WorldWideScience

Sample records for identify important genomic

  1. Genes Important for Schizosaccharomyces pombe Meiosis Identified Through a Functional Genomics Screen

    Science.gov (United States)

    Blyth, Julie; Makrantoni, Vasso; Barton, Rachael E.; Spanos, Christos; Rappsilber, Juri; Marston, Adele L.

    2018-01-01

    Meiosis is a specialized cell division that generates gametes, such as eggs and sperm. Errors in meiosis result in miscarriages and are the leading cause of birth defects; however, the molecular origins of these defects remain unknown. Studies in model organisms are beginning to identify the genes and pathways important for meiosis, but the parts list is still poorly defined. Here we present a comprehensive catalog of genes important for meiosis in the fission yeast, Schizosaccharomyces pombe. Our genome-wide functional screen surveyed all nonessential genes for roles in chromosome segregation and spore formation. Novel genes important at distinct stages of the meiotic chromosome segregation and differentiation program were identified. Preliminary characterization implicated three of these genes in centrosome/spindle pole body, centromere, and cohesion function. Our findings represent a near-complete parts list of genes important for meiosis in fission yeast, providing a valuable resource to advance our molecular understanding of meiosis. PMID:29259000

  2. Identifying selectively important amino acid positions associated with alternative habitat environments in fish mitochondrial genomes.

    Science.gov (United States)

    Xia, Jun Hong; Li, Hong Lian; Zhang, Yong; Meng, Zi Ning; Lin, Hao Ran

    2018-05-01

    Fish species inhabitating seawater (SW) or freshwater (FW) habitats have to develop genetic adaptations to alternative environment factors, especially salinity. Functional consequences of the protein variations associated with habitat environments in fish mitochondrial genomes have not yet received much attention. We analyzed 829 complete fish mitochondrial genomes and compared the amino acid differences of 13 mitochondrial protein families between FW and SW fish groups. We identified 47 specificity determining sites (SDS) that associated with FW or SW environments from 12 mitochondrial protein families. Thirty-two (68%) of the SDS sites are hydrophobic, 13 (28%) are neutral, and the remaining sites are acidic or basic. Seven of those SDS from ND1, ND2 and ND5 were scored as probably damaging to the protein structures. Furthermore, phylogenetic tree based Bayes Empirical Bayes analysis also detected 63 positive sites associated with alternative habitat environments across ten mtDNA proteins. These signatures could be important for studying mitochondrial genetic variation relevant to fish physiology and ecology.

  3. Genome-wide association study identified copy number variants important for appendicular lean mass.

    Science.gov (United States)

    Ran, Shu; Liu, Yong-Jun; Zhang, Lei; Pei, Yufang; Yang, Tie-Lin; Hai, Rong; Han, Ying-Ying; Lin, Yong; Tian, Qing; Deng, Hong-Wen

    2014-01-01

    Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM), is a heritable trait. Copy number variation (CNV) is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2) and 3.34×10(-3), respectively). In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2) and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1), which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL) gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.

  4. Genome-wide association study identified copy number variants important for appendicular lean mass.

    Directory of Open Access Journals (Sweden)

    Shu Ran

    Full Text Available Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM, is a heritable trait. Copy number variation (CNV is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2 and 3.34×10(-3, respectively. In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2 and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1, which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.

  5. Comparative analyses identified species-specific functional roles in oral microbial genomes

    Science.gov (United States)

    Chen, Tsute; Gajare, Prasad; Olsen, Ingar; Dewhirst, Floyd E.

    2017-01-01

    ABSTRACT The advent of next generation sequencing is producing more genomic sequences for various strains of many human oral microbial species and allows for insightful functional comparisons at both intra- and inter-species levels. This study performed in-silico functional comparisons for currently available genomic sequences of major species associated with periodontitis including Aggregatibacter actinomycetemcomitans (AA), Porphyromonas gingivalis (PG), Treponema denticola (TD), and Tannerella forsythia (TF), as well as several cariogenic and commensal streptococcal species. Complete or draft sequences were annotated with the RAST to infer structured functional subsystems for each genome. The subsystems profiles were clustered to groups of functions with similar patterns. Functional enrichment and depletion were evaluated based on hypergeometric distribution to identify subsystems that are unique or missing between two groups of genomes. Unique or missing metabolic pathways and biological functions were identified in different species. For example, components involved in flagellar motility were found only in the motile species TD, as expected, with few exceptions scattered in several streptococcal species, likely associated with chemotaxis. Transposable elements were only found in the two Bacteroidales species PG and TF, and half of the AA genomes. Genes involved in CRISPR were prevalent in most oral species. Furthermore, prophage related subsystems were also commonly found in most species except for PG and Streptococcus mutans, in which very few genomes contain prophage components. Comparisons between pathogenic (P) and nonpathogenic (NP) genomes also identified genes potentially important for virulence. Two such comparisons were performed between AA (P) and several A. aphrophilus (NP) strains, and between S. mutans + S. sobrinus (P) and other oral streptococcal species (NP). This comparative genomics approach can be readily used to identify functions unique to

  6. The compact Selaginella genome identifies changes in gene content associated with the evolution of vascular plants

    Energy Technology Data Exchange (ETDEWEB)

    Grigoriev, Igor V.; Banks, Jo Ann; Nishiyama, Tomoaki; Hasebe, Mitsuyasu; Bowman, John L.; Gribskov, Michael; dePamphilis, Claude; Albert, Victor A.; Aono, Naoki; Aoyama, Tsuyoshi; Ambrose, Barbara A.; Ashton, Neil W.; Axtell, Michael J.; Barker, Elizabeth; Barker, Michael S.; Bennetzen, Jeffrey L.; Bonawitz, Nicholas D.; Chapple, Clint; Cheng, Chaoyang; Correa, Luiz Gustavo Guedes; Dacre, Michael; DeBarry, Jeremy; Dreyer, Ingo; Elias, Marek; Engstrom, Eric M.; Estelle, Mark; Feng, Liang; Finet, Cedric; Floyd, Sandra K.; Frommer, Wolf B.; Fujita, Tomomichi; Gramzow, Lydia; Gutensohn, Michael; Harholt, Jesper; Hattori, Mitsuru; Heyl, Alexander; Hirai, Tadayoshi; Hiwatashi, Yuji; Ishikawa, Masaki; Iwata, Mineko; Karol, Kenneth G.; Koehler, Barbara; Kolukisaoglu, Uener; Kubo, Minoru; Kurata, Tetsuya; Lalonde, Sylvie; Li, Kejie; Li, Ying; Litt, Amy; Lyons, Eric; Manning, Gerard; Maruyama, Takeshi; Michael, Todd P.; Mikami, Koji; Miyazaki, Saori; Morinaga, Shin-ichi; Murata, Takashi; Mueller-Roeber, Bernd; Nelson, David R.; Obara, Mari; Oguri, Yasuko; Olmstead, Richard G.; Onodera, Naoko; Petersen, Bent Larsen; Pils, Birgit; Prigge, Michael; Rensing, Stefan A.; Riano-Pachon, Diego Mauricio; Roberts, Alison W.; Sato, Yoshikatsu; Scheller, Henrik Vibe; Schulz, Burkhard; Schulz, Christian; Shakirov, Eugene V.; Shibagaki, Nakako; Shinohara, Naoki; Shippen, Dorothy E.; Sorensen, Iben; Sotooka, Ryo; Sugimoto, Nagisa; Sugita, Mamoru; Sumikawa, Naomi; Tanurdzic, Milos; Theilsen, Gunter; Ulvskov, Peter; Wakazuki, Sachiko; Weng, Jing-Ke; Willats, William W.G.T.; Wipf, Daniel; Wolf, Paul G.; Yang, Lixing; Zimmer, Andreas D.; Zhu, Qihui; Mitros, Therese; Hellsten, Uffe; Loque, Dominique; Otillar, Robert; Salamov, Asaf; Schmutz, Jeremy; Shapiro, Harris; Lindquist, Erika; Lucas, Susan; Rokhsar, Daniel

    2011-04-28

    We report the genome sequence of the nonseed vascular plant, Selaginella moellendorffii, and by comparative genomics identify genes that likely played important roles in the early evolution of vascular plants and their subsequent evolution

  7. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L.) Using SLAF-seq.

    Science.gov (United States)

    Xie, Dongwei; Dai, Zhigang; Yang, Zemao; Sun, Jian; Zhao, Debao; Yang, Xue; Zhang, Liguo; Tang, Qing; Su, Jianguang

    2017-01-01

    Flax ( Linum usitatissimum L.) is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq) was employed to perform a genome-wide association study (GWAS) for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP) loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM) and a mixed linear model (MLM) as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  8. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L. Using SLAF-seq

    Directory of Open Access Journals (Sweden)

    Dongwei Xie

    2018-01-01

    Full Text Available Flax (Linum usitatissimum L. is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq was employed to perform a genome-wide association study (GWAS for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM and a mixed linear model (MLM as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  9. Genome-wide association study identified CNP12587 region underlying height variation in Chinese females.

    Directory of Open Access Journals (Sweden)

    Yin-Ping Zhang

    Full Text Available Human height is a highly heritable trait considered as an important factor for health. There has been limited success in identifying the genetic factors underlying height variation. We aim to identify sequence variants associated with adult height by a genome-wide association study of copy number variants (CNVs in Chinese.Genome-wide CNV association analyses were conducted in 1,625 unrelated Chinese adults and sex specific subgroup for height variation, respectively. Height was measured with a stadiometer. Affymetrix SNP6.0 genotyping platform was used to identify copy number polymorphisms (CNPs. We constructed a genomic map containing 1,009 CNPs in Chinese individuals and performed a genome-wide association study of CNPs with height.We detected 10 significant association signals for height (p<0.05 in the whole population, 9 and 11 association signals for Chinese female and male population, respectively. A copy number polymorphism (CNP12587, chr18:54081842-54086942, p = 2.41 × 10(-4 was found to be significantly associated with height variation in Chinese females even after strict Bonferroni correction (p = 0.048. Confirmatory real time PCR experiments lent further support for CNV validation. Compared to female subjects with two copies of the CNP, carriers of three copies had an average of 8.1% decrease in height. An important candidate gene, ubiquitin-protein ligase NEDD4-like (NEDD4L, was detected at this region, which plays important roles in bone metabolism by binding to bone formation regulators.Our findings suggest the important genetic variants underlying height variation in Chinese.

  10. TCGA study identifies genomic features of cervical cancer

    Science.gov (United States)

    Investigators with The Cancer Genome Atlas (TCGA) Research Network have identified novel genomic and molecular characteristics of cervical cancer that will aid in subclassification of the disease and may help target therapies that are most appropriate for each patient.

  11. Novel genomes and genome constitutions identified by GISH and 5S rDNA and knotted1 genomic sequences in the genus Setaria.

    Science.gov (United States)

    Zhao, Meicheng; Zhi, Hui; Doust, Andrew N; Li, Wei; Wang, Yongfang; Li, Haiquan; Jia, Guanqing; Wang, Yongqiang; Zhang, Ning; Diao, Xianmin

    2013-04-11

    The Setaria genus is increasingly of interest to researchers, as its two species, S. viridis and S. italica, are being developed as models for understanding C4 photosynthesis and plant functional genomics. The genome constitution of Setaria species has been studied in the diploid species S. viridis, S. adhaerans and S. grisebachii, where three genomes A, B and C were identified respectively. Two allotetraploid species, S. verticillata and S. faberi, were found to have AABB genomes, and one autotetraploid species, S. queenslandica, with an AAAA genome, has also been identified. The genomes and genome constitutions of most other species remain unknown, even though it was thought there are approximately 125 species in the genus distributed world-wide. GISH was performed to detect the genome constitutions of Eurasia species of S. glauca, S. plicata, and S. arenaria, with the known A, B and C genomes as probes. No or very poor hybridization signal was detected indicating that their genomes are different from those already described. GISH was also performed reciprocally between S. glauca, S. plicata, and S. arenaria genomes, but no hybridization signals between each other were found. The two sets of chromosomes of S. lachnea both hybridized strong signals with only the known C genome of S. grisebachii. Chromosomes of Qing 9, an accession formerly considered as S. viridis, hybridized strong signal only to B genome of S. adherans. Phylogenetic trees constructed with 5S rDNA and knotted1 markers, clearly classify the samples in this study into six clusters, matching the GISH results, and suggesting that the F genome of S. arenaria is basal in the genus. Three novel genomes in the Setaria genus were identified and designated as genome D (S. glauca), E (S. plicata) and F (S. arenaria) respectively. The genome constitution of tetraploid S. lachnea is putatively CCC'C'. Qing 9 is a B genome species indigenous to China and is hypothesized to be a newly identified species. The

  12. Genomic suppression subtractive hybridization as a tool to identify differences in mycorrhizal fungal genomes.

    Science.gov (United States)

    Murat, Claude; Zampieri, Elisa; Vallino, Marta; Daghino, Stefania; Perotto, Silvia; Bonfante, Paola

    2011-05-01

    Characterization of genomic variation among different microbial species, or different strains of the same species, is a field of significant interest with a wide range of potential applications. We have investigated the genomic variation in mycorrhizal fungal genomes through genomic suppressive subtractive hybridization. The comparison was between phylogenetically distant and close truffle species (Tuber spp.), and between isolates of the ericoid mycorrhizal fungus Oidiodendron maius featuring different degrees of metal tolerance. In the interspecies experiment, almost all the sequences that were identified in the Tuber melanosporum genome and absent in Tuber borchii and Tuber indicum corresponded to transposable elements. In the intraspecies comparison, some specific sequences corresponded to regions coding for enzymes, among them a glutathione synthetase known to be involved in metal tolerance. This approach is a quick and rather inexpensive tool to develop molecular markers for mycorrhizal fungi tracking and barcoding, to identify functional genes and to investigate the genome plasticity, adaptation and evolution. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  13. The FUN of identifying gene function in bacterial pathogens; insights from Salmonella functional genomics.

    Science.gov (United States)

    Hammarlöf, Disa L; Canals, Rocío; Hinton, Jay C D

    2013-10-01

    The availability of thousands of genome sequences of bacterial pathogens poses a particular challenge because each genome contains hundreds of genes of unknown function (FUN). How can we easily discover which FUN genes encode important virulence factors? One solution is to combine two different functional genomic approaches. First, transcriptomics identifies bacterial FUN genes that show differential expression during the process of mammalian infection. Second, global mutagenesis identifies individual FUN genes that the pathogen requires to cause disease. The intersection of these datasets can reveal a small set of candidate genes most likely to encode novel virulence attributes. We demonstrate this approach with the Salmonella infection model, and propose that a similar strategy could be used for other bacterial pathogens. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Identifying artificial selection signals in the chicken genome.

    Directory of Open Access Journals (Sweden)

    Yunlong Ma

    Full Text Available Identifying the signals of artificial selection can contribute to further shaping economically important traits. Here, a chicken 600k SNP-array was employed to detect the signals of artificial selection using 331 individuals from 9 breeds, including Jingfen (JF, Jinghong (JH, Araucanas (AR, White Leghorn (WL, Pekin-Bantam (PB, Shamo (SH, Gallus-Gallus-Spadiceus (GA, Rheinlander (RH and Vorwerkhuhn (VO. Per the population genetic structure, 9 breeds were combined into 5 breed-pools, and a 'two-step' strategy was used to reveal the signals of artificial selection. GA, which has little artificial selection, was defined as the reference population, and a total of 204, 155, 305 and 323 potential artificial selection signals were identified in AR_VO, PB, RH_WL and JH_JF, respectively. We also found signals derived from standing and de-novo genetic variations have contributed to adaptive evolution during artificial selection. Further enrichment analysis suggests that the genomic regions of artificial selection signals harbour genes, including THSR, PTHLH and PMCH, responsible for economic traits, such as fertility, growth and immunization. Overall, this study found a series of genes that contribute to the improvement of chicken breeds and revealed the genetic mechanisms of adaptive evolution, which can be used as fundamental information in future chicken functional genomics study.

  15. 4C-ker: A Method to Reproducibly Identify Genome-Wide Interactions Captured by 4C-Seq Experiments.

    Science.gov (United States)

    Raviram, Ramya; Rocha, Pedro P; Müller, Christian L; Miraldi, Emily R; Badri, Sana; Fu, Yi; Swanzey, Emily; Proudhon, Charlotte; Snetkova, Valentina; Bonneau, Richard; Skok, Jane A

    2016-03-01

    4C-Seq has proven to be a powerful technique to identify genome-wide interactions with a single locus of interest (or "bait") that can be important for gene regulation. However, analysis of 4C-Seq data is complicated by the many biases inherent to the technique. An important consideration when dealing with 4C-Seq data is the differences in resolution of signal across the genome that result from differences in 3D distance separation from the bait. This leads to the highest signal in the region immediately surrounding the bait and increasingly lower signals in far-cis and trans. Another important aspect of 4C-Seq experiments is the resolution, which is greatly influenced by the choice of restriction enzyme and the frequency at which it can cut the genome. Thus, it is important that a 4C-Seq analysis method is flexible enough to analyze data generated using different enzymes and to identify interactions across the entire genome. Current methods for 4C-Seq analysis only identify interactions in regions near the bait or in regions located in far-cis and trans, but no method comprehensively analyzes 4C signals of different length scales. In addition, some methods also fail in experiments where chromatin fragments are generated using frequent cutter restriction enzymes. Here, we describe 4C-ker, a Hidden-Markov Model based pipeline that identifies regions throughout the genome that interact with the 4C bait locus. In addition, we incorporate methods for the identification of differential interactions in multiple 4C-seq datasets collected from different genotypes or experimental conditions. Adaptive window sizes are used to correct for differences in signal coverage in near-bait regions, far-cis and trans chromosomes. Using several datasets, we demonstrate that 4C-ker outperforms all existing 4C-Seq pipelines in its ability to reproducibly identify interaction domains at all genomic ranges with different resolution enzymes.

  16. 4C-ker: A Method to Reproducibly Identify Genome-Wide Interactions Captured by 4C-Seq Experiments.

    Directory of Open Access Journals (Sweden)

    Ramya Raviram

    2016-03-01

    Full Text Available 4C-Seq has proven to be a powerful technique to identify genome-wide interactions with a single locus of interest (or "bait" that can be important for gene regulation. However, analysis of 4C-Seq data is complicated by the many biases inherent to the technique. An important consideration when dealing with 4C-Seq data is the differences in resolution of signal across the genome that result from differences in 3D distance separation from the bait. This leads to the highest signal in the region immediately surrounding the bait and increasingly lower signals in far-cis and trans. Another important aspect of 4C-Seq experiments is the resolution, which is greatly influenced by the choice of restriction enzyme and the frequency at which it can cut the genome. Thus, it is important that a 4C-Seq analysis method is flexible enough to analyze data generated using different enzymes and to identify interactions across the entire genome. Current methods for 4C-Seq analysis only identify interactions in regions near the bait or in regions located in far-cis and trans, but no method comprehensively analyzes 4C signals of different length scales. In addition, some methods also fail in experiments where chromatin fragments are generated using frequent cutter restriction enzymes. Here, we describe 4C-ker, a Hidden-Markov Model based pipeline that identifies regions throughout the genome that interact with the 4C bait locus. In addition, we incorporate methods for the identification of differential interactions in multiple 4C-seq datasets collected from different genotypes or experimental conditions. Adaptive window sizes are used to correct for differences in signal coverage in near-bait regions, far-cis and trans chromosomes. Using several datasets, we demonstrate that 4C-ker outperforms all existing 4C-Seq pipelines in its ability to reproducibly identify interaction domains at all genomic ranges with different resolution enzymes.

  17. In Silico Post Genome-Wide Association Studies Analysis of C-Reactive Protein Loci Suggests an Important Role for Interferons

    NARCIS (Netherlands)

    Vaez, Ahmad; Jansen, Rick; Prins, Bram P.; Hottenga, Jouke-Jan; de Geus, Eco J. C.; Boomsma, Dorret I.; Penninx, Brenda W. J. H.; Nolte, Ilja M.; Snieder, Harold; Alizadeh, Behrooz Z.

    Background Genome-wide association studies (GWASs) have successfully identified several single nucleotide polymorphisms (SNPs) associated with serum levels of C-reactive protein (CRP). An important limitation of GWASs is that the identified variants merely flag the nearby genomic region and do not

  18. In Silico Post Genome-Wide Association Studies Analysis of C-Reactive Protein Loci Suggests an Important Role for Interferons

    NARCIS (Netherlands)

    Vaez, A.; Jansen, R.; Prins, B.P.; Hottenga, J.J.; de Geus, E.J.C.; Boomsma, D.I.; Penninx, B.W.J.H.; Nolte, I.M.; Snieder, H.; Alizadeh, BZ

    2015-01-01

    Background - Genome-wide association studies (GWASs) have successfully identified several single nucleotide polymorphisms (SNPs) associated with serum levels of C-reactive protein (CRP). An important limitation of GWASs is that the identified variants merely flag the nearby genomic region and do not

  19. Whole genome association study identifies regions of the bovine genome and biological pathways involved in carcass trait performance in Holstein-Friesian cattle.

    Science.gov (United States)

    Doran, Anthony G; Berry, Donagh P; Creevey, Christopher J

    2014-10-01

    Four traits related to carcass performance have been identified as economically important in beef production: carcass weight, carcass fat, carcass conformation of progeny and cull cow carcass weight. Although Holstein-Friesian cattle are primarily utilized for milk production, they are also an important source of meat for beef production and export. Because of this, there is great interest in understanding the underlying genomic structure influencing these traits. Several genome-wide association studies have identified regions of the bovine genome associated with growth or carcass traits, however, little is known about the mechanisms or underlying biological pathways involved. This study aims to detect regions of the bovine genome associated with carcass performance traits (employing a panel of 54,001 SNPs) using measures of genetic merit (as predicted transmitting abilities) for 5,705 Irish Holstein-Friesian animals. Candidate genes and biological pathways were then identified for each trait under investigation. Following adjustment for false discovery (q-value carcass traits using a single SNP regression approach. Using a Bayesian approach, 46 QTL were associated (posterior probability > 0.5) with at least one of the four traits. In total, 557 unique bovine genes, which mapped to 426 human orthologs, were within 500kbs of QTL found associated with a trait using the Bayesian approach. Using this information, 24 significantly over-represented pathways were identified across all traits. The most significantly over-represented biological pathway was the peroxisome proliferator-activated receptor (PPAR) signaling pathway. A large number of genomic regions putatively associated with bovine carcass traits were detected using two different statistical approaches. Notably, several significant associations were detected in close proximity to genes with a known role in animal growth such as glucagon and leptin. Several biological pathways, including PPAR signaling, were

  20. Genome resource banking of biomedically important laboratory animals.

    Science.gov (United States)

    Agca, Yuksel

    2012-11-01

    Genome resource banking is the systematic collection, storage, and redistribution of biomaterials in an organized, logistical, and secure manner. Genome cryobanks usually contain biomaterials and associated genomic information essential for progression of biomedicine, human health, and research. In that regard, appropriate genome cryobanks could provide essential biomaterials for both current and future research projects in the form of various cell types and tissues, including sperm, oocytes, embryos, embryonic or adult stem cells, induced pluripotent stem cells, and gonadal tissues. In addition to cryobanked germplasm, cryobanking of DNA, serum, blood products, and tissues from scientifically, economically, and ecologically important species has become a common practice. For revitalization of the whole organism, cryopreserved germplasm in conjunction with assisted reproductive technologies, offer a powerful approach for research model management, as well as assisting in animal production for agriculture, conservation, and human reproductive medicine. Recently, many developed and developing countries have allocated substantial resources to establish genome resources banks which are responsible for safeguarding scientifically, economically, and ecologically important wild type, mutant, and transgenic plants, fish, and local livestock breeds, as well as wildlife species. This review is dedicated to the memory of Dr. John K. Critser, who has made profound contributions to the science of cryobiology and establishment of genome research and resources centers for mice, rats, and swine. Emphasis will be given to application of genome resource banks to species with substantial contributions to the advancement of biomedicine and human health. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. Genome-wide analysis reveals signatures of selection for important traits in domestic sheep from different ecoregions.

    Science.gov (United States)

    Liu, Zhaohua; Ji, Zhibin; Wang, Guizhi; Chao, Tianle; Hou, Lei; Wang, Jianmin

    2016-11-03

    Throughout a long period of adaptation and selection, sheep have thrived in a diverse range of ecological environments. Mongolian sheep is the common ancestor of the Chinese short fat-tailed sheep. Migration to different ecoregions leads to changes in selection pressures and results in microevolution. Mongolian sheep and its subspecies differ in a number of important traits, especially reproductive traits. Genome-wide intraspecific variation is required to dissect the genetic basis of these traits. This research resequenced 3 short fat-tailed sheep breeds with a 43.2-fold coverage of the sheep genome. We report more than 17 million single nucleotide polymorphisms and 2.9 million indels and identify 143 genomic regions with reduced pooled heterozygosity or increased genetic distance to each other breed that represent likely targets for selection during the migration. These regions harbor genes related to developmental processes, cellular processes, multicellular organismal processes, biological regulation, metabolic processes, reproduction, localization, growth and various components of the stress responses. Furthermore, we examined the haplotype diversity of 3 genomic regions involved in reproduction and found significant differences in TSHR and PRL gene regions among 8 sheep breeds. Our results provide useful genomic information for identifying genes or causal mutations associated with important economic traits in sheep and for understanding the genetic basis of adaptation to different ecological environments.

  2. Computational approaches to identify functional genetic variants in cancer genomes

    DEFF Research Database (Denmark)

    Gonzalez-Perez, Abel; Mustonen, Ville; Reva, Boris

    2013-01-01

    The International Cancer Genome Consortium (ICGC) aims to catalog genomic abnormalities in tumors from 50 different cancer types. Genome sequencing reveals hundreds to thousands of somatic mutations in each tumor but only a minority of these drive tumor progression. We present the result of discu......The International Cancer Genome Consortium (ICGC) aims to catalog genomic abnormalities in tumors from 50 different cancer types. Genome sequencing reveals hundreds to thousands of somatic mutations in each tumor but only a minority of these drive tumor progression. We present the result...... of discussions within the ICGC on how to address the challenge of identifying mutations that contribute to oncogenesis, tumor maintenance or response to therapy, and recommend computational techniques to annotate somatic variants and predict their impact on cancer phenotype....

  3. Positive Selection Driving Cytoplasmic Genome Evolution of the Medicinally Important Ginseng Plant Genus Panax.

    Science.gov (United States)

    Jiang, Peng; Shi, Feng-Xue; Li, Ming-Rui; Liu, Bao; Wen, Jun; Xiao, Hong-Xing; Li, Lin-Feng

    2018-01-01

    Panax L. (the ginseng genus) is a shade-demanding group within the family Araliaceae and all of its species are of crucial significance in traditional Chinese medicine. Phylogenetic and biogeographic analyses demonstrated that two rounds of whole genome duplications accompanying with geographic and ecological isolations promoted the diversification of Panax species. However, contributions of the cytoplasmic genomes to the adaptive evolution of Panax species remained largely uninvestigated. In this study, we sequenced the chloroplast and mitochondrial genomes of 11 accessions belonging to seven Panax species. Our results show that heterogeneity in nucleotide substitution rate is abundant in both of the two cytoplasmic genomes, with the mitochondrial genome possessing more variants at the total level but the chloroplast showing higher sequence polymorphisms at the genic regions. Genome-wide scanning of positive selection identified five and 12 genes from the chloroplast and mitochondrial genomes, respectively. Functional analyses further revealed that these selected genes play important roles in plant development, cellular metabolism and adaptation. We therefore conclude that positive selection might be one of the potential evolutionary forces that shaped nucleotide variation pattern of these Panax species. In particular, the mitochondrial genes evolved under stronger selective pressure compared to the chloroplast genes.

  4. Genomes2Drugs: identifies target proteins and lead drugs from proteome data.

    LENUS (Irish Health Repository)

    Toomey, David

    2009-01-01

    BACKGROUND: Genome sequencing and bioinformatics have provided the full hypothetical proteome of many pathogenic organisms. Advances in microarray and mass spectrometry have also yielded large output datasets of possible target proteins\\/genes. However, the challenge remains to identify new targets for drug discovery from this wealth of information. Further analysis includes bioinformatics and\\/or molecular biology tools to validate the findings. This is time consuming and expensive, and could fail to yield novel drugs if protein purification and crystallography is impossible. To pre-empt this, a researcher may want to rapidly filter the output datasets for proteins that show good homology to proteins that have already been structurally characterised or proteins that are already targets for known drugs. Critically, those researchers developing novel antibiotics need to select out the proteins that show close homology to any human proteins, as future inhibitors are likely to cross-react with the host protein, causing off-target toxicity effects later in clinical trials. METHODOLOGY\\/PRINCIPAL FINDINGS: To solve many of these issues, we have developed a free online resource called Genomes2Drugs which ranks sequences to identify proteins that are (i) homologous to previously crystallized proteins or (ii) targets of known drugs, but are (iii) not homologous to human proteins. When tested using the Plasmodium falciparum malarial genome the program correctly enriched the ranked list of proteins with known drug target proteins. CONCLUSIONS\\/SIGNIFICANCE: Genomes2Drugs rapidly identifies proteins that are likely to succeed in drug discovery pipelines. This free online resource helps in the identification of potential drug targets. Importantly, the program further highlights proteins that are likely to be inhibited by FDA-approved drugs. These drugs can then be rapidly moved into Phase IV clinical studies under \\'change-of-application\\' patents.

  5. Genomes2Drugs: identifies target proteins and lead drugs from proteome data.

    Directory of Open Access Journals (Sweden)

    David Toomey

    Full Text Available BACKGROUND: Genome sequencing and bioinformatics have provided the full hypothetical proteome of many pathogenic organisms. Advances in microarray and mass spectrometry have also yielded large output datasets of possible target proteins/genes. However, the challenge remains to identify new targets for drug discovery from this wealth of information. Further analysis includes bioinformatics and/or molecular biology tools to validate the findings. This is time consuming and expensive, and could fail to yield novel drugs if protein purification and crystallography is impossible. To pre-empt this, a researcher may want to rapidly filter the output datasets for proteins that show good homology to proteins that have already been structurally characterised or proteins that are already targets for known drugs. Critically, those researchers developing novel antibiotics need to select out the proteins that show close homology to any human proteins, as future inhibitors are likely to cross-react with the host protein, causing off-target toxicity effects later in clinical trials. METHODOLOGY/PRINCIPAL FINDINGS: To solve many of these issues, we have developed a free online resource called Genomes2Drugs which ranks sequences to identify proteins that are (i homologous to previously crystallized proteins or (ii targets of known drugs, but are (iii not homologous to human proteins. When tested using the Plasmodium falciparum malarial genome the program correctly enriched the ranked list of proteins with known drug target proteins. CONCLUSIONS/SIGNIFICANCE: Genomes2Drugs rapidly identifies proteins that are likely to succeed in drug discovery pipelines. This free online resource helps in the identification of potential drug targets. Importantly, the program further highlights proteins that are likely to be inhibited by FDA-approved drugs. These drugs can then be rapidly moved into Phase IV clinical studies under 'change-of-application' patents.

  6. Resequencing 50 accessions of cultivated and wild rice yields markers for identifying agronomically important genes

    DEFF Research Database (Denmark)

    Xu, Xun; Liu, Xin; Ge, Song

    2012-01-01

    Rice is a staple crop that has undergone substantial phenotypic and physiological changes during domestication. Here we resequenced the genomes of 40 cultivated accessions selected from the major groups of rice and 10 accessions of their wild progenitors (Oryza rufipogon and Oryza nivara) to >15 x...... diversity in cultivated but not wild rice, which represent candidate regions selected during domestication. Some of these variants are associated with important biological features, whereas others have yet to be functionally characterized. The molecular markers we have identified should be valuable...... raw data coverage. We investigated genome-wide variation patterns in rice and obtained 6.5 million high-quality single nucleotide polymorphisms (SNPs) after excluding sites with missing data in any accession. Using these population SNP data, we identified thousands of genes with significantly lower...

  7. Sequencing of bovine herpesvirus 4 v.test strain reveals important genome features

    Directory of Open Access Journals (Sweden)

    Gillet Laurent

    2011-08-01

    Full Text Available Abstract Background Bovine herpesvirus 4 (BoHV-4 is a useful model for the human pathogenic gammaherpesviruses Epstein-Barr virus and Kaposi's Sarcoma-associated Herpesvirus. Although genome manipulations of this virus have been greatly facilitated by the cloning of the BoHV-4 V.test strain as a Bacterial Artificial Chromosome (BAC, the lack of a complete genome sequence for this strain limits its experimental use. Methods In this study, we have determined the complete sequence of BoHV-4 V.test strain by a pyrosequencing approach. Results The long unique coding region (LUR consists of 108,241 bp encoding at least 79 open reading frames and is flanked by several polyrepetitive DNA units (prDNA. As previously suggested, we showed that the prDNA unit located at the left prDNA-LUR junction (prDNA-G differs from the other prDNA units (prDNA-inner. Namely, the prDNA-G unit lacks the conserved pac-2 cleavage and packaging signal in its right terminal region. Based on the mechanisms of cleavage and packaging of herpesvirus genomes, this feature implies that only genomes bearing left and right end prDNA units are encapsulated into virions. Conclusions In this study, we have determined the complete genome sequence of the BAC-cloned BoHV-4 V.test strain and identified genome organization features that could be important in other herpesviruses.

  8. Integrated genomic and gene expression profiling identifies two major genomic circuits in urothelial carcinoma.

    Directory of Open Access Journals (Sweden)

    David Lindgren

    Full Text Available Similar to other malignancies, urothelial carcinoma (UC is characterized by specific recurrent chromosomal aberrations and gene mutations. However, the interconnection between specific genomic alterations, and how patterns of chromosomal alterations adhere to different molecular subgroups of UC, is less clear. We applied tiling resolution array CGH to 146 cases of UC and identified a number of regions harboring recurrent focal genomic amplifications and deletions. Several potential oncogenes were included in the amplified regions, including known oncogenes like E2F3, CCND1, and CCNE1, as well as new candidate genes, such as SETDB1 (1q21, and BCL2L1 (20q11. We next combined genome profiling with global gene expression, gene mutation, and protein expression data and identified two major genomic circuits operating in urothelial carcinoma. The first circuit was characterized by FGFR3 alterations, overexpression of CCND1, and 9q and CDKN2A deletions. The second circuit was defined by E3F3 amplifications and RB1 deletions, as well as gains of 5p, deletions at PTEN and 2q36, 16q, 20q, and elevated CDKN2A levels. TP53/MDM2 alterations were common for advanced tumors within the two circuits. Our data also suggest a possible RAS/RAF circuit. The tumors with worst prognosis showed a gene expression profile that indicated a keratinized phenotype. Taken together, our integrative approach revealed at least two separate networks of genomic alterations linked to the molecular diversity seen in UC, and that these circuits may reflect distinct pathways of tumor development.

  9. MVisAGe Identifies Concordant and Discordant Genomic Alterations of Driver Genes in Squamous Tumors.

    Science.gov (United States)

    Walter, Vonn; Du, Ying; Danilova, Ludmila; Hayward, Michele C; Hayes, D Neil

    2018-06-15

    Integrated analyses of multiple genomic datatypes are now common in cancer profiling studies. Such data present opportunities for numerous computational experiments, yet analytic pipelines are limited. Tools such as the cBioPortal and Regulome Explorer, although useful, are not easy to access programmatically or to implement locally. Here, we introduce the MVisAGe R package, which allows users to quantify gene-level associations between two genomic datatypes to investigate the effect of genomic alterations (e.g., DNA copy number changes on gene expression). Visualizing Pearson/Spearman correlation coefficients according to the genomic positions of the underlying genes provides a powerful yet novel tool for conducting exploratory analyses. We demonstrate its utility by analyzing three publicly available cancer datasets. Our approach highlights canonical oncogenes in chr11q13 that displayed the strongest associations between expression and copy number, including CCND1 and CTTN , genes not identified by copy number analysis in the primary reports. We demonstrate highly concordant usage of shared oncogenes on chr3q, yet strikingly diverse oncogene usage on chr11q as a function of HPV infection status. Regions of chr19 that display remarkable associations between methylation and gene expression were identified, as were previously unreported miRNA-gene expression associations that may contribute to the epithelial-to-mesenchymal transition. Significance: This study presents an important bioinformatics tool that will enable integrated analyses of multiple genomic datatypes. Cancer Res; 78(12); 3375-85. ©2018 AACR . ©2018 American Association for Cancer Research.

  10. Complex analyses of inverted repeats in mitochondrial genomes revealed their importance and variability.

    Science.gov (United States)

    Cechová, Jana; Lýsek, Jirí; Bartas, Martin; Brázda, Václav

    2018-04-01

    The NCBI database contains mitochondrial DNA (mtDNA) genomes from numerous species. We investigated the presence and locations of inverted repeat sequences (IRs) in these mtDNA sequences, which are known to be important for regulating nuclear genomes. IRs were identified in mtDNA in all species. IR lengths and frequencies correlate with evolutionary age and the greatest variability was detected in subgroups of plants and fungi and the lowest variability in mammals. IR presence is non-random and evolutionary favoured. The frequency of IRs generally decreased with IR length, but not for IRs 24 or 30 bp long, which are 1.5 times more abundant. IRs are enriched in sequences from the replication origin, followed by D-loop, stem-loop and miscellaneous sequences, pointing to the importance of IRs in regulatory regions of mitochondrial DNA. Data were produced using Palindrome analyser, freely available on the web at http://bioinformatics.ibp.cz. vaclav@ibp.cz. Supplementary data are available at Bioinformatics online.

  11. Utilization of genomic signatures to identify phenotype-specific drugs.

    Directory of Open Access Journals (Sweden)

    Seiichi Mori

    2009-08-01

    Full Text Available Genetic and genomic studies highlight the substantial complexity and heterogeneity of human cancers and emphasize the general lack of therapeutics that can match this complexity. With the goal of expanding opportunities for drug discovery, we describe an approach that makes use of a phenotype-based screen combined with the use of multiple cancer cell lines. In particular, we have used the NCI-60 cancer cell line panel that includes drug sensitivity measures for over 40,000 compounds assayed on 59 independent cells lines. Targets are cancer-relevant phenotypes represented as gene expression signatures that are used to identify cells within the NCI-60 panel reflecting the signature phenotype and then connect to compounds that are selectively active against those cells. As a proof-of-concept, we show that this strategy effectively identifies compounds with selectivity to the RAS or PI3K pathways. We have then extended this strategy to identify compounds that have activity towards cells exhibiting the basal phenotype of breast cancer, a clinically-important breast cancer characterized as ER-, PR-, and Her2- that lacks viable therapeutic options. One of these compounds, Simvastatin, has previously been shown to inhibit breast cancer cell growth in vitro and importantly, has been associated with a reduction in ER-, PR- breast cancer in a clinical study. We suggest that this approach provides a novel strategy towards identification of therapeutic agents based on clinically relevant phenotypes that can augment the conventional strategies of target-based screens.

  12. Genomic Regions Affecting Cheese Making Properties Identified in Danish Holsteins

    DEFF Research Database (Denmark)

    Gregersen, Vivi Raundahl; Bertelsen, Henriette Pasgaard; Poulsen, Nina Aagaard

    The cheese renneting process is affected by a number of factors associated to milk composition and a number of Danish Holsteins has previously been identified to have poor milk coagulation ability. Therefore, the aim of this study was to identify genomic regions affecting the technological...

  13. Evaluation of multiple approaches to identify genome-wide polymorphisms in closely related genotypes of sweet cherry (Prunus avium L.

    Directory of Open Access Journals (Sweden)

    Seanna Hewitt

    Full Text Available Identification of genetic polymorphisms and subsequent development of molecular markers is important for marker assisted breeding of superior cultivars of economically important species. Sweet cherry (Prunus avium L. is an economically important non-climacteric tree fruit crop in the Rosaceae family and has undergone a genetic bottleneck due to breeding, resulting in limited genetic diversity in the germplasm that is utilized for breeding new cultivars. Therefore, it is critical to recognize the best platforms for identifying genome-wide polymorphisms that can help identify, and consequently preserve, the diversity in a genetically constrained species. For the identification of polymorphisms in five closely related genotypes of sweet cherry, a gel-based approach (TRAP, reduced representation sequencing (TRAPseq, a 6k cherry SNParray, and whole genome sequencing (WGS approaches were evaluated in the identification of genome-wide polymorphisms in sweet cherry cultivars. All platforms facilitated detection of polymorphisms among the genotypes with variable efficiency. In assessing multiple SNP detection platforms, this study has demonstrated that a combination of appropriate approaches is necessary for efficient polymorphism identification, especially between closely related cultivars of a species. The information generated in this study provides a valuable resource for future genetic and genomic studies in sweet cherry, and the insights gained from the evaluation of multiple approaches can be utilized for other closely related species with limited genetic diversity in the breeding germplasm. Keywords: Polymorphisms, Prunus avium, Next-generation sequencing, Target region amplification polymorphism (TRAP, Genetic diversity, SNParray, Reduced representation sequencing, Whole genome sequencing (WGS

  14. PCR-RFLP Method to Identify Salmonid Species of Economic Importance

    Directory of Open Access Journals (Sweden)

    Andreea Dudu

    2011-05-01

    Full Text Available The identification of different fish species by molecular methods has become necessary to avoid both the incorrect labelling of individuals involved in repopulation programmes and the commercial frauds on the fish market. Different fish species of great economical importance, like the salmonids, which are very much requested for their meat, can be identified using molecular techniques such as PCR-RFLP. The method is based on the amplification of a target region from the genome by PCR reaction followed by endonucleases digestion to detect the polymorphism of restriction fragments. In our study we analysed the following salmonid species from Romania: Salmo trutta fario, Salmo labrax, Salvelinus fontinalis, Onchorhynchus mykiss, Thymallus thymallus and Hucho hucho. In order to discriminate between the analysed species we amplified a fragment of mitochondrial genome comprising tRNAGlu/ cytochrome b/ tRNAThr/ tRNAPro/ D-loop/ tRNAPhe, followed by digestion with a specific restriction enzyme. The direct digestion of unpurified PCR products generated species-specific restriction patterns and proved to be a simple, reliable, inexpensive and fast method. Thus, it may be successfully utilized in specialized laboratories for the correct identification of the fish species for multiple purposes, including the traceability of fish food products.

  15. Complete genome sequence of the cystic fibrosis pathogen Achromobacter xylosoxidans NH44784-1996 complies with important pathogenic phenotypes

    DEFF Research Database (Denmark)

    Jakobsen, Tim Holm; Hansen, Martin Asser; Jensen, Peter Østrup

    2013-01-01

    Achromobacter xylosoxidans is an environmental opportunistic pathogen, which infects an increasing number of immunocompromised patients. In this study we combined genomic analysis of a clinical isolated A. xylosoxidans strain with phenotypic investigations of its important pathogenic features. We...... that render it an opportunistic human pathogen, We found genes involved in anaerobic growth and the pgaABCD operon encoding the biofilm adhesin poly-β-1,6-N-acetyl-D-glucosamin. Furthermore, the genome contains a range of antibiotic resistance genes coding efflux pump systems and antibiotic modifying enzymes....... In vitro studies of A. xylosoxidans NH44784-1996 confirmed the genomic evidence for its ability to form biofilms, anaerobic growth via denitrification, and resistance to a broad range of antibiotics. Our investigation enables further studies of the functionality of important identified genes contributing...

  16. A Drosophila Genome-Wide Screen Identifies Regulators of Steroid Hormone Production and Developmental Timing

    DEFF Research Database (Denmark)

    Thomas Danielsen, E.; E. Møller, Morten; Yamanaka, Naoki

    2016-01-01

    Steroid hormones control important developmental processes and are linked to many diseases. To systematically identify genes and pathways required for steroid production, we performed a Drosophila genome-wide in vivo RNAi screen and identified 1,906 genes with potential roles in steroidogenesis...... and developmental timing. Here, we use our screen as a resource to identify mechanisms regulating intracellular levels of cholesterol, a substrate for steroidogenesis. We identify a conserved fatty acid elongase that underlies a mechanism that adjusts cholesterol trafficking and steroidogenesis with nutrition...... and developmental programs. In addition, we demonstrate the existence of an autophagosomal cholesterol mobilization mechanism and show that activation of this system rescues Niemann-Pick type C1 deficiency that causes a disorder characterized by cholesterol accumulation. These cholesterol-trafficking mechanisms...

  17. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae

    Directory of Open Access Journals (Sweden)

    Seong Hwan Park

    2013-01-01

    Full Text Available Identifying species of insects used to estimate postmortem interval (PMI is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science.

  18. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae)

    Science.gov (United States)

    Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon

    2013-01-01

    Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044

  19. Whole genome DNA copy number changes identified by high density oligonucleotide arrays

    Directory of Open Access Journals (Sweden)

    Huang Jing

    2004-05-01

    Full Text Available Abstract Changes in DNA copy number are one of the hallmarks of the genetic instability common to most human cancers. Previous micro-array-based methods have been used to identify chromosomal gains and losses; however, they are unable to genotype alleles at the level of single nucleotide polymorphisms (SNPs. Here we describe a novel algorithm that uses a recently developed high-density oligonucleotide array-based SNP genotyping method, whole genome sampling analysis (WGSA, to identify genome-wide chromosomal gains and losses at high resolution. WGSA simultaneously genotypes over 10,000 SNPs by allele-specific hybridisation to perfect match (PM and mismatch (MM probes synthesised on a single array. The copy number algorithm jointly uses PM intensity and discrimination ratios between paired PM and MM intensity values to identify and estimate genetic copy number changes. Values from an experimental sample are compared with SNP-specific distributions derived from a reference set containing over 100 normal individuals to gain statistical power. Genomic regions with statistically significant copy number changes can be identified using both single point analysis and contiguous point analysis of SNP intensities. We identified multiple regions of amplification and deletion using a panel of human breast cancer cell lines. We verified these results using an independent method based on quantitative polymerase chain reaction and found that our approach is both sensitive and specific and can tolerate samples which contain a mixture of both tumour and normal DNA. In addition, by using known allele frequencies from the reference set, statistically significant genomic intervals can be identified containing contiguous stretches of homozygous markers, potentially allowing the detection of regions undergoing loss of heterozygosity (LOH without the need for a matched normal control sample. The coupling of LOH analysis, via SNP genotyping, with copy number

  20. New families of human regulatory RNA structures identified by comparative analysis of vertebrate genomes

    DEFF Research Database (Denmark)

    Parker, Brian John; Moltke, Ida; Roth, Adam

    2011-01-01

    a comparative method, EvoFam, for genome-wide identification of families of regulatory RNA structures, based on primary sequence and secondary structure similarity. We apply EvoFam to a 41-way genomic vertebrate alignment. Genome-wide, we identify 220 human, high-confidence families outside protein...

  1. Identifying elemental genomic track types and representing them uniformly

    Directory of Open Access Journals (Sweden)

    Gundersen Sveinung

    2011-12-01

    Full Text Available Abstract Background With the recent advances and availability of various high-throughput sequencing technologies, data on many molecular aspects, such as gene regulation, chromatin dynamics, and the three-dimensional organization of DNA, are rapidly being generated in an increasing number of laboratories. The variation in biological context, and the increasingly dispersed mode of data generation, imply a need for precise, interoperable and flexible representations of genomic features through formats that are easy to parse. A host of alternative formats are currently available and in use, complicating analysis and tool development. The issue of whether and how the multitude of formats reflects varying underlying characteristics of data has to our knowledge not previously been systematically treated. Results We here identify intrinsic distinctions between genomic features, and argue that the distinctions imply that a certain variation in the representation of features as genomic tracks is warranted. Four core informational properties of tracks are discussed: gaps, lengths, values and interconnections. From this we delineate fifteen generic track types. Based on the track type distinctions, we characterize major existing representational formats and find that the track types are not adequately supported by any single format. We also find, in contrast to the XML formats, that none of the existing tabular formats are conveniently extendable to support all track types. We thus propose two unified formats for track data, an improved XML format, BioXSD 1.1, and a new tabular format, GTrack 1.0. Conclusions The defined track types are shown to capture relevant distinctions between genomic annotation tracks, resulting in varying representational needs and analysis possibilities. The proposed formats, GTrack 1.0 and BioXSD 1.1, cater to the identified track distinctions and emphasize preciseness, flexibility and parsing convenience.

  2. Genome-wide association study of PR interval in Hispanics/Latinos identifies novel locus at ID2.

    Science.gov (United States)

    Seyerle, Amanda A; Lin, Henry J; Gogarten, Stephanie M; Stilp, Adrienne; Méndez Giráldez, Raul; Soliman, Elsayed; Baldassari, Antoine; Graff, Mariaelisa; Heckbert, Susan; Kerr, Kathleen F; Kooperberg, Charles; Rodriguez, Carlos; Guo, Xiuqing; Yao, Jie; Sotoodehnia, Nona; Taylor, Kent D; Whitsel, Eric A; Rotter, Jerome I; Laurie, Cathy C; Avery, Christy L

    2017-11-10

    PR interval (PR) is a heritable electrocardiographic measure of atrial and atrioventricular nodal conduction. Changes in PR duration may be associated with atrial fibrillation, heart failure and all-cause mortality. Hispanic/Latino populations have high burdens of cardiovascular morbidity and mortality, are highly admixed and represent exceptional opportunities for novel locus identification. However, they remain chronically understudied. We present the first genome-wide association study (GWAS) of PR in 14 756 participants of Hispanic/Latino ancestry from three studies. Study-specific summary results of the association between 1000 Genomes Phase 1 imputed single-nucleotide polymorphisms (SNPs) and PR assumed an additive genetic model and were adjusted for global ancestry, study centre/region and clinical covariates. Results were combined using fixed-effects, inverse variance weighted meta-analysis. Sequential conditional analyses were used to identify independent signals. Replication of novel loci was performed in populations of Asian, African and European descent. ENCODE and RoadMap data were used to annotate results. We identified a novel genome-wide association (PPR at ID2 (rs6730558), which replicated in Asian and European populations (PPR loci to Hispanics/Latinos. Bioinformatics annotation provided evidence for regulatory function in cardiac tissue. Further, for six loci that generalised, the Hispanic/Latino index SNP was genome-wide significant and identical to (or in high linkage disequilibrium with) the previously identified GWAS lead SNP. Our results suggest that genetic determinants of PR are consistent across race/ethnicity, but extending studies to admixed populations can identify novel associations, underscoring the importance of conducting genetic studies in diverse populations. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise

  3. Comparative Genomics and Disorder Prediction Identify Biologically Relevant SH3 Protein Interactions.

    Directory of Open Access Journals (Sweden)

    2005-08-01

    Full Text Available Protein interaction networks are an important part of the post-genomic effort to integrate a part-list view of the cell into system-level understanding. Using a set of 11 yeast genomes we show that combining comparative genomics and secondary structure information greatly increases consensus-based prediction of SH3 targets. Benchmarking of our method against positive and negative standards gave 83% accuracy with 26% coverage. The concept of an optimal divergence time for effective comparative genomics studies was analyzed, demonstrating that genomes of species that diverged very recently from Saccharomyces cerevisiae(S. mikatae, S. bayanus, and S. paradoxus, or a long time ago (Neurospora crassa and Schizosaccharomyces pombe, contain less information for accurate prediction of SH3 targets than species within the optimal divergence time proposed. We also show here that intrinsically disordered SH3 domain targets are more probable sites of interaction than equivalent sites within ordered regions. Our findings highlight several novel S. cerevisiae SH3 protein interactions, the value of selection of optimal divergence times in comparative genomics studies, and the importance of intrinsic disorder for protein interactions. Based on our results we propose novel roles for the S. cerevisiae proteins Abp1p in endocytosis and Hse1p in endosome protein sorting.

  4. Comparative genomics and disorder prediction identify biologically relevant SH3 protein interactions.

    Directory of Open Access Journals (Sweden)

    Pedro Beltrao

    2005-08-01

    Full Text Available Protein interaction networks are an important part of the post-genomic effort to integrate a part-list view of the cell into system-level understanding. Using a set of 11 yeast genomes we show that combining comparative genomics and secondary structure information greatly increases consensus-based prediction of SH3 targets. Benchmarking of our method against positive and negative standards gave 83% accuracy with 26% coverage. The concept of an optimal divergence time for effective comparative genomics studies was analyzed, demonstrating that genomes of species that diverged very recently from Saccharomyces cerevisiae(S. mikatae, S. bayanus, and S. paradoxus, or a long time ago (Neurospora crassa and Schizosaccharomyces pombe, contain less information for accurate prediction of SH3 targets than species within the optimal divergence time proposed. We also show here that intrinsically disordered SH3 domain targets are more probable sites of interaction than equivalent sites within ordered regions. Our findings highlight several novel S. cerevisiae SH3 protein interactions, the value of selection of optimal divergence times in comparative genomics studies, and the importance of intrinsic disorder for protein interactions. Based on our results we propose novel roles for the S. cerevisiae proteins Abp1p in endocytosis and Hse1p in endosome protein sorting.

  5. Exploring Other Genomes: Bacteria.

    Science.gov (United States)

    Flannery, Maura C.

    2001-01-01

    Points out the importance of genomes other than the human genome project and provides information on the identified bacterial genomes Pseudomonas aeuroginosa, Leprosy, Cholera, Meningitis, Tuberculosis, Bubonic Plague, and plant pathogens. Considers the computer's use in genome studies. (Contains 14 references.) (YDS)

  6. Identification, characterization, and utilization of genome-wide simple sequence repeats to identify a QTL for acidity in apple

    Science.gov (United States)

    2012-01-01

    Background Apple is an economically important fruit crop worldwide. Developing a genetic linkage map is a critical step towards mapping and cloning of genes responsible for important horticultural traits in apple. To facilitate linkage map construction, we surveyed and characterized the distribution and frequency of perfect microsatellites in assembled contig sequences of the apple genome. Results A total of 28,538 SSRs have been identified in the apple genome, with an overall density of 40.8 SSRs per Mb. Di-nucleotide repeats are the most frequent microsatellites in the apple genome, accounting for 71.9% of all microsatellites. AT/TA repeats are the most frequent in genomic regions, accounting for 38.3% of all the G-SSRs, while AG/GA dimers prevail in transcribed sequences, and account for 59.4% of all EST-SSRs. A total set of 310 SSRs is selected to amplify eight apple genotypes. Of these, 245 (79.0%) are found to be polymorphic among cultivars and wild species tested. AG/GA motifs in genomic regions have detected more alleles and higher PIC values than AT/TA or AC/CA motifs. Moreover, AG/GA repeats are more variable than any other dimers in apple, and should be preferentially selected for studies, such as genetic diversity and linkage map construction. A total of 54 newly developed apple SSRs have been genetically mapped. Interestingly, clustering of markers with distorted segregation is observed on linkage groups 1, 2, 10, 15, and 16. A QTL responsible for malic acid content of apple fruits is detected on linkage group 8, and accounts for ~13.5% of the observed phenotypic variation. Conclusions This study demonstrates that di-nucleotide repeats are prevalent in the apple genome and that AT/TA and AG/GA repeats are the most frequent in genomic and transcribed sequences of apple, respectively. All SSR motifs identified in this study as well as those newly mapped SSRs will serve as valuable resources for pursuing apple genetic studies, aiding the apple breeding

  7. Comparative genomics of 12 strains of Erwinia amylovora identifies a pan-genome with a large conserved core.

    Directory of Open Access Journals (Sweden)

    Rachel A Mann

    Full Text Available The plant pathogen Erwinia amylovora can be divided into two host-specific groupings; strains infecting a broad range of hosts within the Rosaceae subfamily Spiraeoideae (e.g., Malus, Pyrus, Crataegus, Sorbus and strains infecting Rubus (raspberries and blackberries. Comparative genomic analysis of 12 strains representing distinct populations (e.g., geographic, temporal, host origin of E. amylovora was used to describe the pan-genome of this major pathogen. The pan-genome contains 5751 coding sequences and is highly conserved relative to other phytopathogenic bacteria comprising on average 89% conserved, core genes. The chromosomes of Spiraeoideae-infecting strains were highly homogeneous, while greater genetic diversity was observed between Spiraeoideae- and Rubus-infecting strains (and among individual Rubus-infecting strains, the majority of which was attributed to variable genomic islands. Based on genomic distance scores and phylogenetic analysis, the Rubus-infecting strain ATCC BAA-2158 was genetically more closely related to the Spiraeoideae-infecting strains of E. amylovora than it was to the other Rubus-infecting strains. Analysis of the accessory genomes of Spiraeoideae- and Rubus-infecting strains has identified putative host-specific determinants including variation in the effector protein HopX1(Ea and a putative secondary metabolite pathway only present in Rubus-infecting strains.

  8. Genome-wide analysis identifies 12 loci influencing human reproductive behavior

    Science.gov (United States)

    Barban, Nicola; Jansen, Rick; de Vlaming, Ronald; Vaez, Ahmad; Mandemakers, Jornt J.; Tropf, Felix C.; Shen, Xia; Wilson, James F.; Chasman, Daniel I.; Nolte, Ilja M.; Tragante, Vinicius; van der Laan, Sander W.; Perry, John R. B.; Kong, Augustine; Ahluwalia, Tarunveer; Albrecht, Eva; Yerges-Armstrong, Laura; Atzmon, Gil; Auro, Kirsi; Ayers, Kristin; Bakshi, Andrew; Ben-Avraham, Danny; Berger, Klaus; Bergman, Aviv; Bertram, Lars; Bielak, Lawrence F.; Bjornsdottir, Gyda; Bonder, Marc Jan; Broer, Linda; Bui, Minh; Barbieri, Caterina; Cavadino, Alana; Chavarro, Jorge E; Turman, Constance; Concas, Maria Pina; Cordell, Heather J.; Davies, Gail; Eibich, Peter; Eriksson, Nicholas; Esko, Tõnu; Eriksson, Joel; Falahi, Fahimeh; Felix, Janine F.; Fontana, Mark Alan; Franke, Lude; Gandin, Ilaria; Gaskins, Audrey J.; Gieger, Christian; Gunderson, Erica P.; Guo, Xiuqing; Hayward, Caroline; He, Chunyan; Hofer, Edith; Huang, Hongyan; Joshi, Peter K.; Kanoni, Stavroula; Karlsson, Robert; Kiechl, Stefan; Kifley, Annette; Kluttig, Alexander; Kraft, Peter; Lagou, Vasiliki; Lecoeur, Cecile; Lahti, Jari; Li-Gao, Ruifang; Lind, Penelope A.; Liu, Tian; Makalic, Enes; Mamasoula, Crysovalanto; Matteson, Lindsay; Mbarek, Hamdi; McArdle, Patrick F.; McMahon, George; Meddens, S. Fleur W.; Mihailov, Evelin; Miller, Mike; Missmer, Stacey A.; Monnereau, Claire; van der Most, Peter J.; Myhre, Ronny; Nalls, Mike A.; Nutile, Teresa; Panagiota, Kalafati Ioanna; Porcu, Eleonora; Prokopenko, Inga; Rajan, Kumar B.; Rich-Edwards, Janet; Rietveld, Cornelius A.; Robino, Antonietta; Rose, Lynda M.; Rueedi, Rico; Ryan, Kathy; Saba, Yasaman; Schmidt, Daniel; Smith, Jennifer A.; Stolk, Lisette; Streeten, Elizabeth; Tonjes, Anke; Thorleifsson, Gudmar; Ulivi, Sheila; Wedenoja, Juho; Wellmann, Juergen; Willeit, Peter; Yao, Jie; Yengo, Loic; Zhao, Jing Hua; Zhao, Wei; Zhernakova, Daria V.; Amin, Najaf; Andrews, Howard; Balkau, Beverley; Barzilai, Nir; Bergmann, Sven; Biino, Ginevra; Bisgaard, Hans; Bønnelykke, Klaus; Boomsma, Dorret I.; Buring, Julie E.; Campbell, Harry; Cappellani, Stefania; Ciullo, Marina; Cox, Simon R.; Cucca, Francesco; Daniela, Toniolo; Davey-Smith, George; Deary, Ian J.; Dedoussis, George; Deloukas, Panos; van Duijn, Cornelia M.; de Geus, Eco JC.; Eriksson, Johan G.; Evans, Denis A.; Faul, Jessica D.; Felicita, Sala Cinzia; Froguel, Philippe; Gasparini, Paolo; Girotto, Giorgia; Grabe, Hans-Jörgen; Greiser, Karin Halina; Groenen, Patrick J.F.; de Haan, Hugoline G.; Haerting, Johannes; Harris, Tamara B.; Heath, Andrew C.; Heikkilä, Kauko; Hofman, Albert; Homuth, Georg; Holliday, Elizabeth G; Hopper, John; Hypponen, Elina; Jacobsson, Bo; Jaddoe, Vincent W. V.; Johannesson, Magnus; Jugessur, Astanand; Kähönen, Mika; Kajantie, Eero; Kardia, Sharon L.R.; Keavney, Bernard; Kolcic, Ivana; Koponen, Päivikki; Kovacs, Peter; Kronenberg, Florian; Kutalik, Zoltan; La Bianca, Martina; Lachance, Genevieve; Iacono, William; Lai, Sandra; Lehtimäki, Terho; Liewald, David C; Lindgren, Cecilia; Liu, Yongmei; Luben, Robert; Lucht, Michael; Luoto, Riitta; Magnus, Per; Magnusson, Patrik K.E.; Martin, Nicholas G.; McGue, Matt; McQuillan, Ruth; Medland, Sarah E.; Meisinger, Christa; Mellström, Dan; Metspalu, Andres; Michela, Traglia; Milani, Lili; Mitchell, Paul; Montgomery, Grant W.; Mook-Kanamori, Dennis; de Mutsert, Renée; Nohr, Ellen A; Ohlsson, Claes; Olsen, Jørn; Ong, Ken K.; Paternoster, Lavinia; Pattie, Alison; Penninx, Brenda WJH; Perola, Markus; Peyser, Patricia A.; Pirastu, Mario; Polasek, Ozren; Power, Chris; Kaprio, Jaakko; Raffel, Leslie J.; Räikkönen, Katri; Raitakari, Olli; Ridker, Paul M.; Ring, Susan M.; Roll, Kathryn; Rudan, Igor; Ruggiero, Daniela; Rujescu, Dan; Salomaa, Veikko; Schlessinger, David; Schmidt, Helena; Schmidt, Reinhold; Schupf, Nicole; Smit, Johannes; Sorice, Rossella; Spector, Tim D.; Starr, John M.; Stöckl, Doris; Strauch, Konstantin; Stumvoll, Michael; Swertz, Morris A.; Thorsteinsdottir, Unnur; Thurik, A. Roy; Timpson, Nicholas J.; Tönjes, Anke; Tung, Joyce Y.; Uitterlinden, André G.; Vaccargiu, Simona; Viikari, Jorma; Vitart, Veronique; Völzke, Henry; Vollenweider, Peter; Vuckovic, Dragana; Waage, Johannes; Wagner, Gert G.; Wang, Jie Jin; Wareham, Nicholas J.; Weir, David R.; Willemsen, Gonneke; Willeit, Johann; Wright, Alan F.; Zondervan, Krina T.; Stefansson, Kari; Krueger, Robert F.; Lee, James J.; Benjamin, Daniel J.; Cesarini, David; Koellinger, Philipp D.; den Hoed, Marcel; Snieder, Harold; Mills, Melinda C.

    2017-01-01

    The genetic architecture of human reproductive behavior – age at first birth (AFB) and number of children ever born (NEB) – has a strong relationship with fitness, human development, infertility and risk of neuropsychiatric disorders. However, very few genetic loci have been identified and the underlying mechanisms of AFB and NEB are poorly understood. We report the largest genome-wide association study to date of both sexes including 251,151 individuals for AFB and 343,072 for NEB. We identified 12 independent loci that are significantly associated with AFB and/or NEB in a SNP-based genome-wide association study, and four additional loci in a gene-based effort. These loci harbor genes that are likely to play a role – either directly or by affecting non-local gene expression – in human reproduction and infertility, thereby increasing our understanding of these complex traits. PMID:27798627

  9. Single nucleotide variants and InDels identified from whole-genome re-sequencing of Guzerat, Gyr, Girolando and Holstein cattle breeds.

    Directory of Open Access Journals (Sweden)

    Nedenia Bonvino Stafuzza

    Full Text Available Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose, Gyr, Girolando and Holstein (dairy production. A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs and 3,828,041 insertions/deletions (InDels were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs.

  10. Genome-wide association study identifies novel locus for neuroticism and shows polygenic association with Major Depressive Disorder

    Science.gov (United States)

    de Moor, Marleen H.M.; van den Berg, Stéphanie M.; Verweij, Karin J.H.; Krueger, Robert F.; Luciano, Michelle; Vasquez, Alejandro Arias; Matteson, Lindsay K.; Derringer, Jaime; Esko, Tõnu; Amin, Najaf; Gordon, Scott D.; Hansell, Narelle K.; Hart, Amy B.; Seppälä, Ilkka; Huffman, Jennifer E.; Konte, Bettina; Lahti, Jari; Lee, Minyoung; Miller, Mike; Nutile, Teresa; Tanaka, Toshiko; Teumer, Alexander; Viktorin, Alexander; Wedenoja, Juho; Abecasis, Goncalo R.; Adkins, Daniel E.; Agrawal, Arpana; Allik, Jüri; Appel, Katja; Bigdeli, Timothy B.; Busonero, Fabio; Campbell, Harry; Costa, Paul T.; Smith, George Davey; Davies, Gail; de Wit, Harriet; Ding, Jun; Engelhardt, Barbara E.; Eriksson, Johan G.; Fedko, Iryna O.; Ferrucci, Luigi; Franke, Barbara; Giegling, Ina; Grucza, Richard; Hartmann, Annette M.; Heath, Andrew C.; Heinonen, Kati; Henders, Anjali K.; Homuth, Georg; Hottenga, Jouke-Jan; Janzing, Joost; Jokela, Markus; Karlsson, Robert; Kemp, John P.; Kirkpatrick, Matthew G.; Latvala, Antti; Lehtimäki, Terho; Liewald, David C.; Madden, Pamela A.F.; Magri, Chiara; Magnusson, Patrik K.E.; Marten, Jonathan; Maschio, Andrea; Medland, Sarah E.; Mihailov, Evelin; Milaneschi, Yuri; Montgomery, Grant W.; Nauck, Matthias; Ouwens, Klaasjan G.; Palotie, Aarno; Pettersson, Erik; Polasek, Ozren; Qian, Yong; Pulkki-Råback, Laura; Raitakari, Olli T.; Realo, Anu; Rose, Richard J.; Ruggiero, Daniela; Schmidt, Carsten O.; Slutske, Wendy S.; Sorice, Rossella; Starr, John M.; Pourcain, Beate St; Sutin, Angelina R.; Timpson, Nicholas J.; Trochet, Holly; Vermeulen, Sita; Vuoksimaa, Eero; Widen, Elisabeth; Wouda, Jasper; Wright, Margaret J.; Zgaga, Lina; Scotland, Generation; Porteous, David; Minelli, Alessandra; Palmer, Abraham A.; Rujescu, Dan; Ciullo, Marina; Hayward, Caroline; Rudan, Igor; Metspalu, Andres; Kaprio, Jaakko; Deary, Ian J.; Räikkönen, Katri; Wilson, James F.; Keltikangas-Järvinen, Liisa; Bierut, Laura J.; Hettema, John M.; Grabe, Hans J.; van Duijn, Cornelia M.; Evans, David M.; Schlessinger, David; Pedersen, Nancy L.; Terracciano, Antonio; McGue, Matt; Penninx, Brenda W.J.H.; Martin, Nicholas G.; Boomsma, Dorret I.

    2015-01-01

    Importance Neuroticism is a personality trait that is briefly defined by emotional instability. It is a robust genetic risk factor for Major Depressive Disorder (MDD) and other psychiatric disorders. Hence, neuroticism is an important phenotype for psychiatric genetics. The Genetics of Personality Consortium (GPC) has created a resource for genome-wide association analyses of personality traits in over 63,000 participants (including MDD cases). Objective To identify genetic variants associated with neuroticism by performing a meta-analysis of genome-wide association (GWA) results based on 1000Genomes imputation, to evaluate if common genetic variants as assessed by Single Nucleotide Polymorphisms (SNPs) explain variation in neuroticism by estimating SNP-based heritability, and to examine whether SNPs that predict neuroticism also predict MDD. Setting 30 cohorts with genome-wide genotype, personality and MDD data from the GPC. Participants The study included 63,661 participants from 29 discovery cohorts and 9,786 participants from a replication cohort. Participants came from Europe, the United States or Australia. Main outcome measure(s) Neuroticism scores harmonized across all cohorts by Item Response Theory (IRT) analysis, and clinically assessed MDD case-control status. Results A genome-wide significant SNP was found in the MAGI1 gene (rs35855737; P=9.26 × 10−9 in the discovery meta-analysis, and P=2.38 × 10−8 in the meta-analysis of all 30 cohorts). Common genetic variants explain 15% of the variance in neuroticism. Polygenic scores based on the meta-analysis of neuroticism in 27 of the discovery cohorts significantly predicted neuroticism in 2 independent cohorts. Importantly, polygenic scores also predicted MDD in these cohorts. Conclusions and relevance This study identifies a novel locus for neuroticism. The variant is located in a known gene that has been associated with bipolar disorder and schizophrenia in previous studies. In addition, the study

  11. Comparison of genome-wide selection strategies to identify furfural tolerance genes in Escherichia coli.

    Science.gov (United States)

    Glebes, Tirzah Y; Sandoval, Nicholas R; Gillis, Jacob H; Gill, Ryan T

    2015-01-01

    Engineering both feedstock and product tolerance is important for transitioning towards next-generation biofuels derived from renewable sources. Tolerance to chemical inhibitors typically results in complex phenotypes, for which multiple genetic changes must often be made to confer tolerance. Here, we performed a genome-wide search for furfural-tolerant alleles using the TRackable Multiplex Recombineering (TRMR) method (Warner et al. (2010), Nature Biotechnology), which uses chromosomally integrated mutations directed towards increased or decreased expression of virtually every gene in Escherichia coli. We employed various growth selection strategies to assess the role of selection design towards growth enrichments. We also compared genes with increased fitness from our TRMR selection to those from a previously reported genome-wide identification study of furfural tolerance genes using a plasmid-based genomic library approach (Glebes et al. (2014) PLOS ONE). In several cases, growth improvements were observed for the chromosomally integrated promoter/RBS mutations but not for the plasmid-based overexpression constructs. Through this assessment, four novel tolerance genes, ahpC, yhjH, rna, and dicA, were identified and confirmed for their effect on improving growth in the presence of furfural. © 2014 Wiley Periodicals, Inc.

  12. Modifiers of notch transcriptional activity identified by genome-wide RNAi

    Directory of Open Access Journals (Sweden)

    Firnhaber Christopher B

    2010-10-01

    Full Text Available Abstract Background The Notch signaling pathway regulates a diverse array of developmental processes, and aberrant Notch signaling can lead to diseases, including cancer. To obtain a more comprehensive understanding of the genetic network that integrates into Notch signaling, we performed a genome-wide RNAi screen in Drosophila cell culture to identify genes that modify Notch-dependent transcription. Results Employing complementary data analyses, we found 399 putative modifiers: 189 promoting and 210 antagonizing Notch activated transcription. These modifiers included several known Notch interactors, validating the robustness of the assay. Many novel modifiers were also identified, covering a range of cellular localizations from the extracellular matrix to the nucleus, as well as a large number of proteins with unknown function. Chromatin-modifying proteins represent a major class of genes identified, including histone deacetylase and demethylase complex components and other chromatin modifying, remodeling and replacement factors. A protein-protein interaction map of the Notch-dependent transcription modifiers revealed that a large number of the identified proteins interact physically with these core chromatin components. Conclusions The genome-wide RNAi screen identified many genes that can modulate Notch transcriptional output. A protein interaction map of the identified genes highlighted a network of chromatin-modifying enzymes and remodelers that regulate Notch transcription. Our results open new avenues to explore the mechanisms of Notch signal regulation and the integration of this pathway into diverse cellular processes.

  13. Genome-wide analysis of regulatory proteases sequences identified through bioinformatics data mining in Taenia solium.

    Science.gov (United States)

    Yan, Hong-Bin; Lou, Zhong-Zi; Li, Li; Brindley, Paul J; Zheng, Yadong; Luo, Xuenong; Hou, Junling; Guo, Aijiang; Jia, Wan-Zhong; Cai, Xuepeng

    2014-06-04

    Cysticercosis remains a major neglected tropical disease of humanity in many regions, especially in sub-Saharan Africa, Central America and elsewhere. Owing to the emerging drug resistance and the inability of current drugs to prevent re-infection, identification of novel vaccines and chemotherapeutic agents against Taenia solium and related helminth pathogens is a public health priority. The T. solium genome and the predicted proteome were reported recently, providing a wealth of information from which new interventional targets might be identified. In order to characterize and classify the entire repertoire of protease-encoding genes of T. solium, which act fundamental biological roles in all life processes, we analyzed the predicted proteins of this cestode through a combination of bioinformatics tools. Functional annotation was performed to yield insights into the signaling processes relevant to the complex developmental cycle of this tapeworm and to highlight a suite of the proteases as potential intervention targets. Within the genome of this helminth parasite, we identified 200 open reading frames encoding proteases from five clans, which correspond to 1.68% of the 11,902 protein-encoding genes predicted to be present in its genome. These proteases include calpains, cytosolic, mitochondrial signal peptidases, ubiquitylation related proteins, and others. Many not only show significant similarity to proteases in the Conserved Domain Database but have conserved active sites and catalytic domains. KEGG Automatic Annotation Server (KAAS) analysis indicated that ~60% of these proteases share strong sequence identities with proteins of the KEGG database, which are involved in human disease, metabolic pathways, genetic information processes, cellular processes, environmental information processes and organismal systems. Also, we identified signal peptides and transmembrane helices through comparative analysis with classes of important regulatory proteases

  14. Genome wide association study identifies KCNMA1 contributing to human obesity

    DEFF Research Database (Denmark)

    Jiao, Hong; Arner, Peter; Hoffstedt, Johan

    2011-01-01

    Recent genome-wide association (GWA) analyses have identified common single nucleotide polymorphisms (SNPs) that are associated with obesity. However, the reported genetic variation in obesity explains only a minor fraction of the total genetic variation expected to be present in the population....... Thus many genetic variants controlling obesity remain to be identified. The aim of this study was to use GWA followed by multiple stepwise validations to identify additional genes associated with obesity....

  15. Genome-wide association study identifies 74 loci associated with educational attainment

    Science.gov (United States)

    Okbay, Aysu; Beauchamp, Jonathan P.; Fontana, Mark A.; Lee, James J.; Pers, Tune H.; Rietveld, Cornelius A.; Turley, Patrick; Chen, Guo-Bo; Emilsson, Valur; Meddens, S. Fleur W.; Oskarsson, Sven; Pickrell, Joseph K.; Thom, Kevin; Timshel, Pascal; de Vlaming, Ronald; Abdellaoui, Abdel; Ahluwalia, Tarunveer S.; Bacelis, Jonas; Baumbach, Clemens; Bjornsdottir, Gyda; Brandsma, Johannes H.; Concas, Maria Pina; Derringer, Jaime; Furlotte, Nicholas A.; Galesloot, Tessel E.; Girotto, Giorgia; Gupta, Richa; Hall, Leanne M.; Harris, Sarah E.; Hofer, Edith; Horikoshi, Momoko; Huffman, Jennifer E.; Kaasik, Kadri; Kalafati, Ioanna P.; Karlsson, Robert; Kong, Augustine; Lahti, Jari; van der Lee, Sven J.; de Leeuw, Christiaan; Lind, Penelope A.; Lindgren, Karl-Oskar; Liu, Tian; Mangino, Massimo; Marten, Jonathan; Mihailov, Evelin; Miller, Michael B.; van der Most, Peter J.; Oldmeadow, Christopher; Payton, Antony; Pervjakova, Natalia; Peyrot, Wouter J.; Qian, Yong; Raitakari, Olli; Rueedi, Rico; Salvi, Erika; Schmidt, Börge; Schraut, Katharina E.; Shi, Jianxin; Smith, Albert V.; Poot, Raymond A.; Pourcain, Beate; Teumer, Alexander; Thorleifsson, Gudmar; Verweij, Niek; Vuckovic, Dragana; Wellmann, Juergen; Westra, Harm-Jan; Yang, Jingyun; Zhao, Wei; Zhu, Zhihong; Alizadeh, Behrooz Z.; Amin, Najaf; Bakshi, Andrew; Baumeister, Sebastian E.; Biino, Ginevra; Bønnelykke, Klaus; Boyle, Patricia A.; Campbell, Harry; Cappuccio, Francesco P.; Davies, Gail; De Neve, Jan-Emmanuel; Deloukas, Panos; Demuth, Ilja; Ding, Jun; Eibich, Peter; Eisele, Lewin; Eklund, Niina; Evans68, David M.; Faul, Jessica D.; Feitosa, Mary F.; Forstner, Andreas J.; Gandin, Ilaria; Gunnarsson, Bjarni; Halldórsson, Bjarni V.; Harris, Tamara B.; Heath, Andrew C.; Hocking, Lynne J.; Holliday, Elizabeth G.; Homuth, Georg; Horan, Michael A.; Hottenga, Jouke-Jan; de Jager, Philip L.; Joshi, Peter K.; Jugessur, Astanand; Kaakinen, Marika A.; Kähönen, Mika; Kanoni, Stavroula; Keltigangas-Järvinen, Liisa; Kiemeney, Lambertus A.L.M.; Kolcic, Ivana; Koskinen, Seppo; Kraja, Aldi T.; Kroh, Martin; Kutalik, Zoltan; Latvala, Antti; Launer, Lenore J.; Lebreton, Maël P.; Levinson, Douglas F.; Lichtenstein, Paul; Lichtner, Peter; Liewald, David C.M.; Loukola, Anu; Madden, Pamela A.; Mägi, Reedik; Mäki-Opas, Tomi; Marioni, Riccardo E.; Marques-Vidal, Pedro; Meddens, Gerardus A.; McMahon, George; Meisinger, Christa; Meitinger, Thomas; Milaneschi, Yusplitri; Milani, Lili; Montgomery, Grant W.; Myhre, Ronny; Nelson, Christopher P.; Nyholt, Dale R.; Ollier, William E.R.; Palotie, Aarno; Paternoster, Lavinia; Pedersen, Nancy L.; Petrovic, Katja E.; Porteous, David J.; Räikkönen, Katri; Ring, Susan M.; Robino, Antonietta; Rostapshova, Olga; Rudan, Igor; Rustichini, Aldo; Salomaa, Veikko; Sanders, Alan R.; Sarin, Antti-Pekka; Schmidt, Helena; Scott, Rodney J.; Smith, Blair H.; Smith, Jennifer A.; Staessen, Jan A.; Steinhagen-Thiessen, Elisabeth; Strauch, Konstantin; Terracciano, Antonio; Tobin, Martin D.; Ulivi, Sheila; Vaccargiu, Simona; Quaye, Lydia; van Rooij, Frank J.A.; Venturini, Cristina; Vinkhuyzen, Anna A.E.; Völker, Uwe; Völzke, Henry; Vonk, Judith M.; Vozzi, Diego; Waage, Johannes; Ware, Erin B.; Willemsen, Gonneke; Attia, John R.; Bennett, David A.; Berger, Klaus; Bertram, Lars; Bisgaard, Hans; Boomsma, Dorret I.; Borecki, Ingrid B.; Bultmann, Ute; Chabris, Christopher F.; Cucca, Francesco; Cusi, Daniele; Deary, Ian J.; Dedoussis, George V.; van Duijn, Cornelia M.; Eriksson, Johan G.; Franke, Barbara; Franke, Lude; Gasparini, Paolo; Gejman, Pablo V.; Gieger, Christian; Grabe, Hans-Jörgen; Gratten, Jacob; Groenen, Patrick J.F.; Gudnason, Vilmundur; van der Harst, Pim; Hayward, Caroline; Hinds, David A.; Hoffmann, Wolfgang; Hyppönen, Elina; Iacono, William G.; Jacobsson, Bo; Järvelin, Marjo-Riitta; Jöckel, Karl-Heinz; Kaprio, Jaakko; Kardia, Sharon L.R.; Lehtimäki, Terho; Lehrer, Steven F.; Magnusson, Patrik K.E.; Martin, Nicholas G.; McGue, Matt; Metspalu, Andres; Pendleton, Neil; Penninx, Brenda W.J.H.; Perola, Markus; Pirastu, Nicola; Pirastu, Mario; Polasek, Ozren; Posthuma, Danielle; Power, Christine; Province, Michael A.; Samani, Nilesh J.; Schlessinger, David; Schmidt, Reinhold; Sørensen, Thorkild I.A.; Spector, Tim D.; Stefansson, Kari; Thorsteinsdottir, Unnur; Thurik, A. Roy; Timpson, Nicholas J.; Tiemeier, Henning; Tung, Joyce Y.; Uitterlinden, André G.; Vitart, Veronique; Vollenweider, Peter; Weir, David R.; Wilson, James F.; Wright, Alan F.; Conley, Dalton C.; Krueger, Robert F.; Smith, George Davey; Hofman, Albert; Laibson, David I.; Medland, Sarah E.; Meyer, Michelle N.; Yang, Jian; Johannesson, Magnus; Visscher, Peter M.; Esko, Tõnu; Koellinger, Philipp D.; Cesarini, David; Benjamin, Daniel J.

    2016-01-01

    Summary Educational attainment (EA) is strongly influenced by social and other environmental factors, but genetic factors are also estimated to account for at least 20% of the variation across individuals1. We report the results of a genome-wide association study (GWAS) for EA that extends our earlier discovery sample1,2 of 101,069 individuals to 293,723 individuals, and a replication in an independent sample of 111,349 individuals from the UK Biobank. We now identify 74 genome-wide significant loci associated with number of years of schooling completed. Single-nucleotide polymorphisms (SNPs) associated with educational attainment are disproportionately found in genomic regions regulating gene expression in the fetal brain. Candidate genes are preferentially expressed in neural tissue, especially during the prenatal period, and enriched for biological pathways involved in neural development. Our findings demonstrate that, even for a behavioral phenotype that is mostly environmentally determined, a well-powered GWAS identifies replicable associated genetic variants that suggest biologically relevant pathways. Because EA is measured in large numbers of individuals, it will continue to be useful as a proxy phenotype in efforts to characterize the genetic influences of related phenotypes, including cognition and neuropsychiatric disease. PMID:27225129

  16. Use of a draft genome of coffee (Coffea arabica) to identify SNPs associated with caffeine content.

    Science.gov (United States)

    Tran, Hue T M; Ramaraj, Thiruvarangan; Furtado, Agnelo; Lee, Leonard Slade; Henry, Robert J

    2018-03-07

    Arabica coffee (Coffea arabica) has a small gene pool limiting genetic improvement. Selection for caffeine content within this gene pool would be assisted by identification of the genes controlling this important trait. Sequencing of DNA bulks from 18 genotypes with extreme high- or low-caffeine content from a population of 232 genotypes was used to identify linked polymorphisms. To obtain a reference genome, a whole genome assembly of arabica coffee (variety K7) was achieved by sequencing using short read (Illumina) and long-read (PacBio) technology. Assembly was performed using a range of assembly tools resulting in 76 409 scaffolds with a scaffold N50 of 54 544 bp and a total scaffold length of 1448 Mb. Validation of the genome assembly using different tools showed high completeness of the genome. More than 99% of transcriptome sequences mapped to the C. arabica draft genome, and 89% of BUSCOs were present. The assembled genome annotated using AUGUSTUS yielded 99 829 gene models. Using the draft arabica genome as reference in mapping and variant calling allowed the detection of 1444 nonsynonymous single nucleotide polymorphisms (SNPs) associated with caffeine content. Based on Kyoto Encyclopaedia of Genes and Genomes pathway-based analysis, 65 caffeine-associated SNPs were discovered, among which 11 SNPs were associated with genes encoding enzymes involved in the conversion of substrates, which participate in the caffeine biosynthesis pathways. This analysis demonstrated the complex genetic control of this key trait in coffee. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  17. Genome evolution and plasticity of Serratia marcescens, an important multidrug-resistant nosocomial pathogen.

    Science.gov (United States)

    Iguchi, Atsushi; Nagaya, Yutaka; Pradel, Elizabeth; Ooka, Tadasuke; Ogura, Yoshitoshi; Katsura, Keisuke; Kurokawa, Ken; Oshima, Kenshiro; Hattori, Masahira; Parkhill, Julian; Sebaihia, Mohamed; Coulthurst, Sarah J; Gotoh, Naomasa; Thomson, Nicholas R; Ewbank, Jonathan J; Hayashi, Tetsuya

    2014-08-01

    Serratia marcescens is an important nosocomial pathogen that can cause an array of infections, most notably of the urinary tract and bloodstream. Naturally, it is found in many environmental niches, and is capable of infecting plants and animals. The emergence and spread of multidrug-resistant strains producing extended-spectrum or metallo beta-lactamases now pose a threat to public health worldwide. Here we report the complete genome sequences of two carefully selected S. marcescens strains, a multidrug-resistant clinical isolate (strain SM39) and an insect isolate (strain Db11). Our comparative analyses reveal the core genome of S. marcescens and define the potential metabolic capacity, virulence, and multidrug resistance of this species. We show a remarkable intraspecies genetic diversity, both at the sequence level and with regards genome flexibility, which may reflect the diversity of niches inhabited by members of this species. A broader analysis with other Serratia species identifies a set of approximately 3,000 genes that characterize the genus. Within this apparent genetic diversity, we identified many genes implicated in the high virulence potential and antibiotic resistance of SM39, including the metallo beta-lactamase and multiple other drug resistance determinants carried on plasmid pSMC1. We further show that pSMC1 is most closely related to plasmids circulating in Pseudomonas species. Our data will provide a valuable basis for future studies on S. marcescens and new insights into the genetic mechanisms that underlie the emergence of pathogens highly resistant to multiple antimicrobial agents. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  18. Genome-wide association study with 1000 genomes imputation identifies signals for nine sex hormone-related phenotypes.

    Science.gov (United States)

    Ruth, Katherine S; Campbell, Purdey J; Chew, Shelby; Lim, Ee Mun; Hadlow, Narelle; Stuckey, Bronwyn G A; Brown, Suzanne J; Feenstra, Bjarke; Joseph, John; Surdulescu, Gabriela L; Zheng, Hou Feng; Richards, J Brent; Murray, Anna; Spector, Tim D; Wilson, Scott G; Perry, John R B

    2016-02-01

    Genetic factors contribute strongly to sex hormone levels, yet knowledge of the regulatory mechanisms remains incomplete. Genome-wide association studies (GWAS) have identified only a small number of loci associated with sex hormone levels, with several reproductive hormones yet to be assessed. The aim of the study was to identify novel genetic variants contributing to the regulation of sex hormones. We performed GWAS using genotypes imputed from the 1000 Genomes reference panel. The study used genotype and phenotype data from a UK twin register. We included 2913 individuals (up to 294 males) from the Twins UK study, excluding individuals receiving hormone treatment. Phenotypes were standardised for age, sex, BMI, stage of menstrual cycle and menopausal status. We tested 7,879,351 autosomal SNPs for association with levels of dehydroepiandrosterone sulphate (DHEAS), oestradiol, free androgen index (FAI), follicle-stimulating hormone (FSH), luteinizing hormone (LH), prolactin, progesterone, sex hormone-binding globulin and testosterone. Eight independent genetic variants reached genome-wide significance (P<5 × 10(-8)), with minor allele frequencies of 1.3-23.9%. Novel signals included variants for progesterone (P=7.68 × 10(-12)), oestradiol (P=1.63 × 10(-8)) and FAI (P=1.50 × 10(-8)). A genetic variant near the FSHB gene was identified which influenced both FSH (P=1.74 × 10(-8)) and LH (P=3.94 × 10(-9)) levels. A separate locus on chromosome 7 was associated with both DHEAS (P=1.82 × 10(-14)) and progesterone (P=6.09 × 10(-14)). This study highlights loci that are relevant to reproductive function and suggests overlap in the genetic basis of hormone regulation.

  19. kmer-SVM: a web server for identifying predictive regulatory sequence features in genomic data sets

    Science.gov (United States)

    Fletez-Brant, Christopher; Lee, Dongwon; McCallion, Andrew S.; Beer, Michael A.

    2013-01-01

    Massively parallel sequencing technologies have made the generation of genomic data sets a routine component of many biological investigations. For example, Chromatin immunoprecipitation followed by sequence assays detect genomic regions bound (directly or indirectly) by specific factors, and DNase-seq identifies regions of open chromatin. A major bottleneck in the interpretation of these data is the identification of the underlying DNA sequence code that defines, and ultimately facilitates prediction of, these transcription factor (TF) bound or open chromatin regions. We have recently developed a novel computational methodology, which uses a support vector machine (SVM) with kmer sequence features (kmer-SVM) to identify predictive combinations of short transcription factor-binding sites, which determine the tissue specificity of these genomic assays (Lee, Karchin and Beer, Discriminative prediction of mammalian enhancers from DNA sequence. Genome Res. 2011; 21:2167–80). This regulatory information can (i) give confidence in genomic experiments by recovering previously known binding sites, and (ii) reveal novel sequence features for subsequent experimental testing of cooperative mechanisms. Here, we describe the development and implementation of a web server to allow the broader research community to independently apply our kmer-SVM to analyze and interpret their genomic datasets. We analyze five recently published data sets and demonstrate how this tool identifies accessory factors and repressive sequence elements. kmer-SVM is available at http://kmersvm.beerlab.org. PMID:23771147

  20. Incidental copy-number variants identified by routine genome testing in a clinical population

    Science.gov (United States)

    Boone, Philip M.; Soens, Zachry T.; Campbell, Ian M.; Stankiewicz, Pawel; Cheung, Sau Wai; Patel, Ankita; Beaudet, Arthur L.; Plon, Sharon E.; Shaw, Chad A.; McGuire, Amy L.; Lupski, James R.

    2013-01-01

    Purpose Mutational load of susceptibility variants has not been studied on a genomic scale in a clinical population, nor has the potential to identify these mutations as incidental findings during clinical testing been systematically ascertained. Methods Array comparative genomic hybridization, a method for genome-wide detection of DNA copy-number variants, was performed clinically on DNA from 9,005 individuals. Copy-number variants encompassing or disrupting single genes were identified and analyzed for their potential to confer predisposition to dominant, adult-onset disease. Multigene copy-number variants affecting dominant, adult-onset cancer syndrome genes were also assessed. Results In our cohort, 83 single-gene copy-number variants affected 40 unique genes associated with dominant, adult-onset disorders and unrelated to the patients’ referring diagnoses (i.e., incidental) were found. Fourteen of these copy-number variants are likely disease-predisposing, 25 are likely benign, and 44 are of unknown clinical consequence. When incidental copy-number variants spanning up to 20 genes were considered, 27 copy-number variants affected 17 unique genes associated with dominant, adult-onset cancer predisposition. Conclusion Copy-number variants potentially conferring susceptibility to adult-onset disease can be identified as incidental findings during routine genome-wide testing. Some of these mutations may be medically actionable, enabling disease surveillance or prevention; however, most incidentally observed single-gene copy-number variants are currently of unclear significance to the patient. PMID:22878507

  1. Machine Learning Leveraging Genomes from Metagenomes Identifies Influential Antibiotic Resistance Genes in the Infant Gut Microbiome

    Science.gov (United States)

    Olm, Matthew R.; Morowitz, Michael J.

    2018-01-01

    ABSTRACT Antibiotic resistance in pathogens is extensively studied, and yet little is known about how antibiotic resistance genes of typical gut bacteria influence microbiome dynamics. Here, we leveraged genomes from metagenomes to investigate how genes of the premature infant gut resistome correspond to the ability of bacteria to survive under certain environmental and clinical conditions. We found that formula feeding impacts the resistome. Random forest models corroborated by statistical tests revealed that the gut resistome of formula-fed infants is enriched in class D beta-lactamase genes. Interestingly, Clostridium difficile strains harboring this gene are at higher abundance in formula-fed infants than C. difficile strains lacking this gene. Organisms with genes for major facilitator superfamily drug efflux pumps have higher replication rates under all conditions, even in the absence of antibiotic therapy. Using a machine learning approach, we identified genes that are predictive of an organism’s direction of change in relative abundance after administration of vancomycin and cephalosporin antibiotics. The most accurate results were obtained by reducing annotated genomic data to five principal components classified by boosted decision trees. Among the genes involved in predicting whether an organism increased in relative abundance after treatment are those that encode subclass B2 beta-lactamases and transcriptional regulators of vancomycin resistance. This demonstrates that machine learning applied to genome-resolved metagenomics data can identify key genes for survival after antibiotics treatment and predict how organisms in the gut microbiome will respond to antibiotic administration. IMPORTANCE The process of reconstructing genomes from environmental sequence data (genome-resolved metagenomics) allows unique insight into microbial systems. We apply this technique to investigate how the antibiotic resistance genes of bacteria affect their ability to

  2. Genome-wide local ancestry approach identifies genes and variants associated with chemotherapeutic susceptibility in African Americans.

    Directory of Open Access Journals (Sweden)

    Heather E Wheeler

    Full Text Available Chemotherapeutic agents are used in the treatment of many cancers, yet variable resistance and toxicities among individuals limit successful outcomes. Several studies have indicated outcome differences associated with ancestry among patients with various cancer types. Using both traditional SNP-based and newly developed gene-based genome-wide approaches, we investigated the genetics of chemotherapeutic susceptibility in lymphoblastoid cell lines derived from 83 African Americans, a population for which there is a disparity in the number of genome-wide studies performed. To account for population structure in this admixed population, we incorporated local ancestry information into our association model. We tested over 2 million SNPs and identified 325, 176, 240, and 190 SNPs that were suggestively associated with cytarabine-, 5'-deoxyfluorouridine (5'-DFUR-, carboplatin-, and cisplatin-induced cytotoxicity, respectively (p≤10(-4. Importantly, some of these variants are found only in populations of African descent. We also show that cisplatin-susceptibility SNPs are enriched for carboplatin-susceptibility SNPs. Using a gene-based genome-wide association approach, we identified 26, 11, 20, and 41 suggestive candidate genes for association with cytarabine-, 5'-DFUR-, carboplatin-, and cisplatin-induced cytotoxicity, respectively (p≤10(-3. Fourteen of these genes showed evidence of association with their respective chemotherapeutic phenotypes in the Yoruba from Ibadan, Nigeria (p<0.05, including TP53I11, COPS5 and GAS8, which are known to be involved in tumorigenesis. Although our results require further study, we have identified variants and genes associated with chemotherapeutic susceptibility in African Americans by using an approach that incorporates local ancestry information.

  3. A genome-wide scan study identifies a single nucleotide substitution in ASIP associated with white versus non-white coat-colour variation in sheep (Ovis aries)

    OpenAIRE

    Li, M-H; Tiirikka, T; Kantanen, J

    2013-01-01

    In sheep, coat colour (and pattern) is one of the important traits of great biological, economic and social importance. However, the genetics of sheep coat colour has not yet been fully clarified. We conducted a genome-wide association study of sheep coat colours by genotyping 47 303 single-nucleotide polymorphisms (SNPs) in the Finnsheep population in Finland. We identified 35 SNPs associated with all the coat colours studied, which cover genomic regions encompassing three kno...

  4. Genome Wide Association Study for Drought, Aflatoxin Resistance, and Important Agronomic Traits of Maize Hybrids in the Sub-Tropics

    Science.gov (United States)

    Farfan, Ivan D. Barrero; De La Fuente, Gerald N.; Murray, Seth C.; Isakeit, Thomas; Huang, Pei-Cheng; Warburton, Marilyn; Williams, Paul; Windham, Gary L.; Kolomiets, Mike

    2015-01-01

    The primary maize (Zea mays L.) production areas are in temperate regions throughout the world and this is where most maize breeding is focused. Important but lower yielding maize growing regions such as the sub-tropics experience unique challenges, the greatest of which are drought stress and aflatoxin contamination. Here we used a diversity panel consisting of 346 maize inbred lines originating in temperate, sub-tropical and tropical areas testcrossed to stiff-stalk line Tx714 to investigate these traits. Testcross hybrids were evaluated under irrigated and non-irrigated trials for yield, plant height, ear height, days to anthesis, days to silking and other agronomic traits. Irrigated trials were also inoculated with Aspergillus flavus and evaluated for aflatoxin content. Diverse maize testcrosses out-yielded commercial checks in most trials, which indicated the potential for genetic diversity to improve sub-tropical breeding programs. To identify genomic regions associated with yield, aflatoxin resistance and other important agronomic traits, a genome wide association analysis was performed. Using 60,000 SNPs, this study found 10 quantitative trait variants for grain yield, plant and ear height, and flowering time after stringent multiple test corrections, and after fitting different models. Three of these variants explained 5–10% of the variation in grain yield under both water conditions. Multiple identified SNPs co-localized with previously reported QTL, which narrows the possible location of causal polymorphisms. Novel significant SNPs were also identified. This study demonstrated the potential to use genome wide association studies to identify major variants of quantitative and complex traits such as yield under drought that are still segregating between elite inbred lines. PMID:25714370

  5. A survey of single nucleotide polymorphisms identified from whole-genome sequencing and their functional effect in the porcine genome.

    Science.gov (United States)

    Keel, B N; Nonneman, D J; Rohrer, G A

    2017-08-01

    Genetic variants detected from sequence have been used to successfully identify causal variants and map complex traits in several organisms. High and moderate impact variants, those expected to alter or disrupt the protein coded by a gene and those that regulate protein production, likely have a more significant effect on phenotypic variation than do other types of genetic variants. Hence, a comprehensive list of these functional variants would be of considerable interest in swine genomic studies, particularly those targeting fertility and production traits. Whole-genome sequence was obtained from 72 of the founders of an intensely phenotyped experimental swine herd at the U.S. Meat Animal Research Center (USMARC). These animals included all 24 of the founding boars (12 Duroc and 12 Landrace) and 48 Yorkshire-Landrace composite sows. Sequence reads were mapped to the Sscrofa10.2 genome build, resulting in a mean of 6.1 fold (×) coverage per genome. A total of 22 342 915 high confidence SNPs were identified from the sequenced genomes. These included 21 million previously reported SNPs and 79% of the 62 163 SNPs on the PorcineSNP60 BeadChip assay. Variation was detected in the coding sequence or untranslated regions (UTRs) of 87.8% of the genes in the porcine genome: loss-of-function variants were predicted in 504 genes, 10 202 genes contained nonsynonymous variants, 10 773 had variation in UTRs and 13 010 genes contained synonymous variants. Approximately 139 000 SNPs were classified as loss-of-function, nonsynonymous or regulatory, which suggests that over 99% of the variation detected in our pigs could potentially be ignored, allowing us to focus on a much smaller number of functional SNPs during future analyses. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

  6. Genome-Wide Search Identifies 1.9 Mb from the Polar Bear Y Chromosome for Evolutionary Analyses

    Science.gov (United States)

    Bidon, Tobias; Schreck, Nancy; Hailer, Frank; Nilsson, Maria A.; Janke, Axel

    2015-01-01

    The male-inherited Y chromosome is the major haploid fraction of the mammalian genome, rendering Y-linked sequences an indispensable resource for evolutionary research. However, despite recent large-scale genome sequencing approaches, only a handful of Y chromosome sequences have been characterized to date, mainly in model organisms. Using polar bear (Ursus maritimus) genomes, we compare two different in silico approaches to identify Y-linked sequences: 1) Similarity to known Y-linked genes and 2) difference in the average read depth of autosomal versus sex chromosomal scaffolds. Specifically, we mapped available genomic sequencing short reads from a male and a female polar bear against the reference genome and identify 112 Y-chromosomal scaffolds with a combined length of 1.9 Mb. We verified the in silico findings for the longer polar bear scaffolds by male-specific in vitro amplification, demonstrating the reliability of the average read depth approach. The obtained Y chromosome sequences contain protein-coding sequences, single nucleotide polymorphisms, microsatellites, and transposable elements that are useful for evolutionary studies. A high-resolution phylogeny of the polar bear patriline shows two highly divergent Y chromosome lineages, obtained from analysis of the identified Y scaffolds in 12 previously published male polar bear genomes. Moreover, we find evidence of gene conversion among ZFX and ZFY sequences in the giant panda lineage and in the ancestor of ursine and tremarctine bears. Thus, the identification of Y-linked scaffold sequences from unordered genome sequences yields valuable data to infer phylogenomic and population-genomic patterns in bears. PMID:26019166

  7. Genome-wide association analysis identifies three new breast cancer susceptibility loci

    DEFF Research Database (Denmark)

    Ghoussaini, Maya; Fletcher, Olivia; Michailidou, Kyriaki

    2012-01-01

    Breast cancer is the most common cancer among women. To date, 22 common breast cancer susceptibility loci have been identified accounting for ∼8% of the heritability of the disease. We attempted to replicate 72 promising associations from two independent genome-wide association studies (GWAS...

  8. Genome-wide methylation analysis identifies genes silenced in non-seminoma cell lines.

    Science.gov (United States)

    Noor, Dzul Azri Mohamed; Jeyapalan, Jennie N; Alhazmi, Safiah; Carr, Matthew; Squibb, Benjamin; Wallace, Claire; Tan, Christopher; Cusack, Martin; Hughes, Jaime; Reader, Tom; Shipley, Janet; Sheer, Denise; Scotting, Paul J

    2016-01-01

    Silencing of genes by DNA methylation is a common phenomenon in many types of cancer. However, the genome-wide effect of DNA methylation on gene expression has been analysed in relatively few cancers. Germ cell tumours (GCTs) are a complex group of malignancies. They are unique in developing from a pluripotent progenitor cell. Previous analyses have suggested that non-seminomas exhibit much higher levels of DNA methylation than seminomas. The genomic targets that are methylated, the extent to which this results in gene silencing and the identity of the silenced genes most likely to play a role in the tumours' biology have not yet been established. In this study, genome-wide methylation and expression analysis of GCT cell lines was combined with gene expression data from primary tumours to address this question. Genome methylation was analysed using the Illumina infinium HumanMethylome450 bead chip system and gene expression was analysed using Affymetrix GeneChip Human Genome U133 Plus 2.0 arrays. Regulation by methylation was confirmed by demethylation using 5-aza-2-deoxycytidine and reverse transcription-quantitative PCR. Large differences in the level of methylation of the CpG islands of individual genes between tumour cell lines correlated well with differential gene expression. Treatment of non-seminoma cells with 5-aza-2-deoxycytidine verified that methylation of all genes tested played a role in their silencing in yolk sac tumour cells and many of these genes were also differentially expressed in primary tumours. Genes silenced by methylation in the various GCT cell lines were identified. Several pluripotency-associated genes were identified as a major functional group of silenced genes.

  9. Importing statistical measures into Artemis enhances gene identification in the Leishmania genome project

    Directory of Open Access Journals (Sweden)

    McDonagh Paul D

    2003-06-01

    Full Text Available Abstract Background Seattle Biomedical Research Institute (SBRI as part of the Leishmania Genome Network (LGN is sequencing chromosomes of the trypanosomatid protozoan species Leishmania major. At SBRI, chromosomal sequence is annotated using a combination of trained and untrained non-consensus gene-prediction algorithms with ARTEMIS, an annotation platform with rich and user-friendly interfaces. Results Here we describe a methodology used to import results from three different protein-coding gene-prediction algorithms (GLIMMER, TESTCODE and GENESCAN into the ARTEMIS sequence viewer and annotation tool. Comparison of these methods, along with the CODONUSAGE algorithm built into ARTEMIS, shows the importance of combining methods to more accurately annotate the L. major genomic sequence. Conclusion An improvised and powerful tool for gene prediction has been developed by importing data from widely-used algorithms into an existing annotation platform. This approach is especially fruitful in the Leishmania genome project where there is large proportion of novel genes requiring manual annotation.

  10. Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes.

    Science.gov (United States)

    Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich

    2012-02-01

    The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.

  11. Evaluating genome-wide association study-identified breast cancer risk variants in African-American women.

    Directory of Open Access Journals (Sweden)

    Jirong Long

    Full Text Available Genome-wide association studies (GWAS, conducted mostly in European or Asian descendants, have identified approximately 67 genetic susceptibility loci for breast cancer. Given the large differences in genetic architecture between the African-ancestry genome and genomes of Asians and Europeans, it is important to investigate these loci in African-ancestry populations. We evaluated index SNPs in all 67 breast cancer susceptibility loci identified to date in our study including up to 3,300 African-American women (1,231 cases and 2,069 controls, recruited in the Southern Community Cohort Study (SCCS and the Nashville Breast Health Study (NBHS. Seven SNPs were statistically significant (P ≤ 0.05 with the risk of overall breast cancer in the same direction as previously reported: rs10069690 (5p15/TERT, rs999737 (14q24/RAD51L1, rs13387042 (2q35/TNP1, rs1219648 (10q26/FGFR2, rs8170 (19p13/BABAM1, rs17817449 (16q12/FTO, and rs13329835 (16q23/DYL2. A marginally significant association (P<0.10 was found for three additional SNPs: rs1045485 (2q33/CASP8, rs4849887 (2q14/INHBB, and rs4808801 (19p13/ELL. Three additional SNPs, including rs1011970 (9p21/CDKN2A/2B, rs941764 (14q32/CCDC88C, and rs17529111 (6q14/FAM46A, showed a significant association in analyses conducted by breast cancer subtype. The risk of breast cancer was elevated with an increasing number of risk variants, as measured by quintile of the genetic risk score, from 1.00 (reference, to 1.75 (1.30-2.37, 1.56 (1.15-2.11, 2.02 (1.50-2.74 and 2.63 (1.96-3.52, respectively, (P = 7.8 × 10(-10. Results from this study highlight the need for large genetic studies in AAs to identify risk variants impacting this population.

  12. ERIC-PCR fingerprinting-based community DNA hybridization to pinpoint genome-specific fragments as molecular markers to identify and track populations common to healthy human guts.

    Science.gov (United States)

    Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping

    2004-10-01

    Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.

  13. Genome-Wide Search Identifies 1.9 Mb from the Polar Bear Y Chromosome for Evolutionary Analyses.

    Science.gov (United States)

    Bidon, Tobias; Schreck, Nancy; Hailer, Frank; Nilsson, Maria A; Janke, Axel

    2015-05-27

    The male-inherited Y chromosome is the major haploid fraction of the mammalian genome, rendering Y-linked sequences an indispensable resource for evolutionary research. However, despite recent large-scale genome sequencing approaches, only a handful of Y chromosome sequences have been characterized to date, mainly in model organisms. Using polar bear (Ursus maritimus) genomes, we compare two different in silico approaches to identify Y-linked sequences: 1) Similarity to known Y-linked genes and 2) difference in the average read depth of autosomal versus sex chromosomal scaffolds. Specifically, we mapped available genomic sequencing short reads from a male and a female polar bear against the reference genome and identify 112 Y-chromosomal scaffolds with a combined length of 1.9 Mb. We verified the in silico findings for the longer polar bear scaffolds by male-specific in vitro amplification, demonstrating the reliability of the average read depth approach. The obtained Y chromosome sequences contain protein-coding sequences, single nucleotide polymorphisms, microsatellites, and transposable elements that are useful for evolutionary studies. A high-resolution phylogeny of the polar bear patriline shows two highly divergent Y chromosome lineages, obtained from analysis of the identified Y scaffolds in 12 previously published male polar bear genomes. Moreover, we find evidence of gene conversion among ZFX and ZFY sequences in the giant panda lineage and in the ancestor of ursine and tremarctine bears. Thus, the identification of Y-linked scaffold sequences from unordered genome sequences yields valuable data to infer phylogenomic and population-genomic patterns in bears. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  14. Comparative genome analysis identifies two large deletions in the genome of highly-passaged attenuated Streptococcus agalactiae strain YM001 compared to the parental pathogenic strain HN016.

    Science.gov (United States)

    Wang, Rui; Li, Liping; Huang, Yan; Luo, Fuguang; Liang, Wanwen; Gan, Xi; Huang, Ting; Lei, Aiying; Chen, Ming; Chen, Lianfu

    2015-11-04

    Streptococcus agalactiae (S. agalactiae), also known as group B Streptococcus (GBS), is an important pathogen for neonatal pneumonia, meningitis, bovine mastitis, and fish meningoencephalitis. The global outbreaks of Streptococcus disease in tilapia cause huge economic losses and threaten human food hygiene safety as well. To investigate the mechanism of S. agalactiae pathogenesis in tilapia and develop attenuated S. agalactiae vaccine, this study sequenced and comparatively analyzed the whole genomes of virulent wild-type S. agalactiae strain HN016 and its highly-passaged attenuated strain YM001 derived from tilapia. We performed Illumina sequencing of DNA prepared from strain HN016 and YM001. Sequencedreads were assembled and nucleotide comparisons, single nucleotide polymorphism (SNP) , indels were analyzed between the draft genomes of HN016 and YM001. Clustered regularly interspaced short palindromic repeats (CRISPRs) and prophage were detected and analyzed in different S. agalactiae strains. The genome of S. agalactiae YM001 was 2,047,957 bp with a GC content of 35.61 %; it contained 2044 genes and 88 RNAs. Meanwhile, the genome of S. agalactiae HN016 was 2,064,722 bp with a GC content of 35.66 %; it had 2063 genes and 101 RNAs. Comparative genome analysis indicated that compared with HN016, YM001 genome had two significant large deletions, at the sizes of 5832 and 11,116 bp respectively, resulting in the deletion of three rRNA and ten tRNA genes, as well as the deletion and functional damage of ten genes related to metabolism, transport, growth, anti-stress, etc. Besides these two large deletions, other ten deletions and 28 single nucleotide variations (SNVs) were also identified, mainly affecting the metabolism- and growth-related genes. The genome of attenuated S. agalactiae YM001 showed significant variations, resulting in the deletion of 10 functional genes, compared to the parental pathogenic strain HN016. The deleted and mutated functional genes all

  15. [Advances in microbial genome reduction and modification].

    Science.gov (United States)

    Wang, Jianli; Wang, Xiaoyuan

    2013-08-01

    Microbial genome reduction and modification are important strategies for constructing cellular chassis used for synthetic biology. This article summarized the essential genes and the methods to identify them in microorganisms, compared various strategies for microbial genome reduction, and analyzed the characteristics of some microorganisms with the minimized genome. This review shows the important role of genome reduction in constructing cellular chassis.

  16. The Importance of Bacterial Culture to Food Microbiology in the Age of Genomics.

    Science.gov (United States)

    Gill, Alexander

    2017-01-01

    Culture-based and genomics methods provide different insights into the nature and behavior of bacteria. Maximizing the usefulness of both approaches requires recognizing their limitations and employing them appropriately. Genomic analysis excels at identifying bacteria and establishing the relatedness of isolates. Culture-based methods remain necessary for detection and enumeration, to determine viability, and to validate phenotype predictions made on the bias of genomic analysis. The purpose of this short paper is to discuss the application of culture-based analysis and genomics to the questions food microbiologists routinely need to ask regarding bacteria to ensure the safety of food and its economic production and distribution. To address these issues appropriate tools are required for the detection and enumeration of specific bacterial populations and the characterization of isolates for, identification, phylogenetics, and phenotype prediction.

  17. A high-density genetic map for anchoring genome sequences and identifying QTLs associated with dwarf vine in pumpkin (Cucurbita maxima Duch.).

    Science.gov (United States)

    Zhang, Guoyu; Ren, Yi; Sun, Honghe; Guo, Shaogui; Zhang, Fan; Zhang, Jie; Zhang, Haiying; Jia, Zhangcai; Fei, Zhangjun; Xu, Yong; Li, Haizhen

    2015-12-24

    Pumpkin (Cucurbita maxima Duch.) is an economically important crop belonging to the Cucurbitaceae family. However, very few genomic and genetic resources are available for this species. As part of our ongoing efforts to sequence the pumpkin genome, high-density genetic map is essential for anchoring and orienting the assembled scaffolds. In addition, a saturated genetic map can facilitate quantitative trait locus (QTL) mapping. A set of 186 F2 plants derived from the cross of pumpkin inbred lines Rimu and SQ026 were genotyped using the genotyping-by-sequencing approach. Using the SNPs we identified, a high-density genetic map containing 458 bin-markers was constructed, spanning a total genetic distance of 2,566.8 cM across the 20 linkage groups of C. maxima with a mean marker density of 5.60 cM. Using this map we were able to anchor 58 assembled scaffolds that covered about 194.5 Mb (71.7%) of the 271.4 Mb assembled pumpkin genome, of which 44 (183.0 Mb; 67.4%) were oriented. Furthermore, the high-density genetic map was used to identify genomic regions highly associated with an important agronomic trait, dwarf vine. Three QTLs on linkage groups (LGs) 1, 3 and 4, respectively, were recovered. One QTL, qCmB2, which was located in an interval of 0.42 Mb on LG 3, explained 21.4% phenotypic variations. Within qCmB2, one gene, Cma_004516, encoding the gibberellin (GA) 20-oxidase in the GA biosynthesis pathway, had a 1249-bp deletion in its promoter in bush type lines, and its expression level was significantly increased during the vine growth and higher in vine type lines than bush type lines, supporting Cma_004516 as a possible candidate gene controlling vine growth in pumpkin. A high-density pumpkin genetic map was constructed, which was used to successfully anchor and orient the assembled genome scaffolds, and to identify QTLs highly associated with pumpkin vine length. The map provided a valuable resource for gene cloning and marker assisted breeding in pumpkin and

  18. Detection of yellow fever virus genomes from four imported cases in China.

    Science.gov (United States)

    Cui, Shujuan; Pan, Yang; Lyu, Yanning; Liang, Zhichao; Li, Jie; Sun, Yulan; Dou, Xiangfeng; Tian, Lili; Huo, Da; Chen, Lijuan; Li, Xinyu; Wang, Quanyi

    2017-07-01

    Yellow fever virus (YFV), as the first proven human-pathogenic virus, is still a major public health problem with a dramatic upsurge in recent years. This is a report on four imported cases of yellow fever virus into China identified by whole genome sequencing. Phylogenetic analysis was performed and the results showed that these four viruses were highly homologous with Angola 71 strains (AY968064). In addition, effective mutations of amino acids were not observed in the E protein domain of four viruses, thus confirming the effectiveness of the YFV-17D vaccine (X03700). Although there is low risk of local transmission in most part of China, the increasing public health risk of YF caused by international exchange should not be ignored. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  19. New families of human regulatory RNA structures identified by comparative analysis of vertebrate genomes.

    Science.gov (United States)

    Parker, Brian J; Moltke, Ida; Roth, Adam; Washietl, Stefan; Wen, Jiayu; Kellis, Manolis; Breaker, Ronald; Pedersen, Jakob Skou

    2011-11-01

    Regulatory RNA structures are often members of families with multiple paralogous instances across the genome. Family members share functional and structural properties, which allow them to be studied as a whole, facilitating both bioinformatic and experimental characterization. We have developed a comparative method, EvoFam, for genome-wide identification of families of regulatory RNA structures, based on primary sequence and secondary structure similarity. We apply EvoFam to a 41-way genomic vertebrate alignment. Genome-wide, we identify 220 human, high-confidence families outside protein-coding regions comprising 725 individual structures, including 48 families with known structural RNA elements. Known families identified include both noncoding RNAs, e.g., miRNAs and the recently identified MALAT1/MEN β lincRNA family; and cis-regulatory structures, e.g., iron-responsive elements. We also identify tens of new families supported by strong evolutionary evidence and other statistical evidence, such as GO term enrichments. For some of these, detailed analysis has led to the formulation of specific functional hypotheses. Examples include two hypothesized auto-regulatory feedback mechanisms: one involving six long hairpins in the 3'-UTR of MAT2A, a key metabolic gene that produces the primary human methyl donor S-adenosylmethionine; the other involving a tRNA-like structure in the intron of the tRNA maturation gene POP1. We experimentally validate the predicted MAT2A structures. Finally, we identify potential new regulatory networks, including large families of short hairpins enriched in immunity-related genes, e.g., TNF, FOS, and CTLA4, which include known transcript destabilizing elements. Our findings exemplify the diversity of post-transcriptional regulation and provide a resource for further characterization of new regulatory mechanisms and families of noncoding RNAs.

  20. High throughput sequencing and proteomics to identify immunogenic proteins of a new pathogen: the dirty genome approach.

    Science.gov (United States)

    Greub, Gilbert; Kebbi-Beghdadi, Carole; Bertelli, Claire; Collyn, François; Riederer, Beat M; Yersin, Camille; Croxatto, Antony; Raoult, Didier

    2009-12-23

    With the availability of new generation sequencing technologies, bacterial genome projects have undergone a major boost. Still, chromosome completion needs a costly and time-consuming gap closure, especially when containing highly repetitive elements. However, incomplete genome data may be sufficiently informative to derive the pursued information. For emerging pathogens, i.e. newly identified pathogens, lack of release of genome data during gap closure stage is clearly medically counterproductive. We thus investigated the feasibility of a dirty genome approach, i.e. the release of unfinished genome sequences to develop serological diagnostic tools. We showed that almost the whole genome sequence of the emerging pathogen Parachlamydia acanthamoebae was retrieved even with relatively short reads from Genome Sequencer 20 and Solexa. The bacterial proteome was analyzed to select immunogenic proteins, which were then expressed and used to elaborate the first steps of an ELISA. This work constitutes the proof of principle for a dirty genome approach, i.e. the use of unfinished genome sequences of pathogenic bacteria, coupled with proteomics to rapidly identify new immunogenic proteins useful to develop in the future specific diagnostic tests such as ELISA, immunohistochemistry and direct antigen detection. Although applied here to an emerging pathogen, this combined dirty genome sequencing/proteomic approach may be used for any pathogen for which better diagnostics are needed. These genome sequences may also be very useful to develop DNA based diagnostic tests. All these diagnostic tools will allow further evaluations of the pathogenic potential of this obligate intracellular bacterium.

  1. Genome-wide siRNA-based functional genomics of pigmentation identifies novel genes and pathways that impact melanogenesis in human cells.

    Directory of Open Access Journals (Sweden)

    Anand K Ganesan

    2008-12-01

    Full Text Available Melanin protects the skin and eyes from the harmful effects of UV irradiation, protects neural cells from toxic insults, and is required for sound conduction in the inner ear. Aberrant regulation of melanogenesis underlies skin disorders (melasma and vitiligo, neurologic disorders (Parkinson's disease, auditory disorders (Waardenburg's syndrome, and opthalmologic disorders (age related macular degeneration. Much of the core synthetic machinery driving melanin production has been identified; however, the spectrum of gene products participating in melanogenesis in different physiological niches is poorly understood. Functional genomics based on RNA-mediated interference (RNAi provides the opportunity to derive unbiased comprehensive collections of pharmaceutically tractable single gene targets supporting melanin production. In this study, we have combined a high-throughput, cell-based, one-well/one-gene screening platform with a genome-wide arrayed synthetic library of chemically synthesized, small interfering RNAs to identify novel biological pathways that govern melanin biogenesis in human melanocytes. Ninety-two novel genes that support pigment production were identified with a low false discovery rate. Secondary validation and preliminary mechanistic studies identified a large panel of targets that converge on tyrosinase expression and stability. Small molecule inhibition of a family of gene products in this class was sufficient to impair chronic tyrosinase expression in pigmented melanoma cells and UV-induced tyrosinase expression in primary melanocytes. Isolation of molecular machinery known to support autophagosome biosynthesis from this screen, together with in vitro and in vivo validation, exposed a close functional relationship between melanogenesis and autophagy. In summary, these studies illustrate the power of RNAi-based functional genomics to identify novel genes, pathways, and pharmacologic agents that impact a biological phenotype

  2. Mining genome sequencing data to identify the genomic features linked to breast cancer histopathology

    Science.gov (United States)

    Ping, Zheng; Siegal, Gene P.; Almeida, Jonas S.; Schnitt, Stuart J.; Shen, Dejun

    2014-01-01

    Background: Genetics and genomics have radically altered our understanding of breast cancer progression. However, the genomic basis of various histopathologic features of breast cancer is not yet well-defined. Materials and Methods: The Cancer Genome Atlas (TCGA) is an international database containing a large collection of human cancer genome sequencing data. cBioPortal is a web tool developed for mining these sequencing data. We performed mining of TCGA sequencing data in an attempt to characterize the genomic features correlated with breast cancer histopathology. We first assessed the quality of the TCGA data using a group of genes with known alterations in various cancers. Both genome-wide gene mutation and copy number changes as well as a group of genes with a high frequency of genetic changes were then correlated with various histopathologic features of invasive breast cancer. Results: Validation of TCGA data using a group of genes with known alterations in breast cancer suggests that the TCGA has accurately documented the genomic abnormalities of multiple malignancies. Further analysis of TCGA breast cancer sequencing data shows that accumulation of specific genomic defects is associated with higher tumor grade, larger tumor size and receptor negativity. Distinct groups of genomic changes were found to be associated with the different grades of invasive ductal carcinoma. The mutator role of the TP53 gene was validated by genomic sequencing data of invasive breast cancer and TP53 mutation was found to play a critical role in defining high tumor grade. Conclusions: Data mining of the TCGA genome sequencing data is an innovative and reliable method to help characterize the genomic abnormalities associated with histopathologic features of invasive breast cancer. PMID:24672738

  3. Mining genome sequencing data to identify the genomic features linked to breast cancer histopathology

    Directory of Open Access Journals (Sweden)

    Zheng Ping

    2014-01-01

    Full Text Available Background: Genetics and genomics have radically altered our understanding of breast cancer progression. However, the genomic basis of various histopathologic features of breast cancer is not yet well-defined. Materials and Methods: The Cancer Genome Atlas (TCGA is an international database containing a large collection of human cancer genome sequencing data. cBioPortal is a web tool developed for mining these sequencing data. We performed mining of TCGA sequencing data in an attempt to characterize the genomic features correlated with breast cancer histopathology. We first assessed the quality of the TCGA data using a group of genes with known alterations in various cancers. Both genome-wide gene mutation and copy number changes as well as a group of genes with a high frequency of genetic changes were then correlated with various histopathologic features of invasive breast cancer. Results: Validation of TCGA data using a group of genes with known alterations in breast cancer suggests that the TCGA has accurately documented the genomic abnormalities of multiple malignancies. Further analysis of TCGA breast cancer sequencing data shows that accumulation of specific genomic defects is associated with higher tumor grade, larger tumor size and receptor negativity. Distinct groups of genomic changes were found to be associated with the different grades of invasive ductal carcinoma. The mutator role of the TP53 gene was validated by genomic sequencing data of invasive breast cancer and TP53 mutation was found to play a critical role in defining high tumor grade. Conclusions: Data mining of the TCGA genome sequencing data is an innovative and reliable method to help characterize the genomic abnormalities associated with histopathologic features of invasive breast cancer.

  4. Benchmark data for identifying N6-methyladenosine sites in the Saccharomyces cerevisiae genome

    Directory of Open Access Journals (Sweden)

    Wei Chen

    2015-12-01

    Full Text Available This data article contains the benchmark dataset for training and testing iRNA-Methyl, a web-server predictor for identifying N6-methyladenosine sites in RNA (Chen et al., 2015 [15]. It can also be used to develop other predictors for identifying N6-methyladenosine sites in the Saccharomyces cerevisiae genome.

  5. Gene Discovery and Advances in Finger millet [Eleusine coracana (L. Gaertn.] Genomics - An Important Nutri-cereal of Future

    Directory of Open Access Journals (Sweden)

    Salej Sood

    2016-11-01

    Full Text Available The rapid strides in molecular marker technologies followed by genomics, and next generation sequencing advancements in three major crops (rice, maize and wheat of the world have given opportunities for their use in the orphan, but highly valuable future crops, including finger millet [Eleusine coracana (L. Gaertn.]. Finger millet has many special agronomic and nutritional characteristics, which make it an indispensable crop in arid, semi-arid, hilly and tribal areas of India and Africa. The crop has proven its adaptability in harsh conditions and has shown resilience to climate change. The adaptability traits of finger millet have shown the advantage over major cereal grains under stress conditions, revealing it as a storehouse of important genomic resources for crop improvement. Although new technologies for genomic studies are now available, progress in identifying and tapping these important alleles or genes is lacking. RAPDs were the default choice for genetic diversity studies in the crop until the last decade, but the subsequent development of SSRs and comparative genomics paved the way for the marker assisted selection in finger millet. Resistance gene homologues from NBS-LRR region of finger millet for blast and sequence variants for nutritional traits from other cereals have been developed and used invariably. Population structure analysis studies exhibit 2-4 sub-populations in the finger millet gene pool with separate grouping of Indian and exotic genotypes. Recently, the omics technologies have been efficiently applied to understand the nutritional variation, drought tolerance and gene mining. Progress has also occurred with respect to transgenics development. This review presents the current biotechnological advancements along with research gaps and future perspective of genomic research in finger millet.

  6. Gene Discovery and Advances in Finger Millet [Eleusine coracana (L.) Gaertn.] Genomics-An Important Nutri-Cereal of Future.

    Science.gov (United States)

    Sood, Salej; Kumar, Anil; Babu, B Kalyana; Gaur, Vikram S; Pandey, Dinesh; Kant, Lakshmi; Pattnayak, Arunava

    2016-01-01

    The rapid strides in molecular marker technologies followed by genomics, and next generation sequencing advancements in three major crops (rice, maize and wheat) of the world have given opportunities for their use in the orphan, but highly valuable future crops, including finger millet [ Eleusine coracana (L.) Gaertn.]. Finger millet has many special agronomic and nutritional characteristics, which make it an indispensable crop in arid, semi-arid, hilly and tribal areas of India and Africa. The crop has proven its adaptability in harsh conditions and has shown resilience to climate change. The adaptability traits of finger millet have shown the advantage over major cereal grains under stress conditions, revealing it as a storehouse of important genomic resources for crop improvement. Although new technologies for genomic studies are now available, progress in identifying and tapping these important alleles or genes is lacking. RAPDs were the default choice for genetic diversity studies in the crop until the last decade, but the subsequent development of SSRs and comparative genomics paved the way for the marker assisted selection in finger millet. Resistance gene homologs from NBS-LRR region of finger millet for blast and sequence variants for nutritional traits from other cereals have been developed and used invariably. Population structure analysis studies exhibit 2-4 sub-populations in the finger millet gene pool with separate grouping of Indian and exotic genotypes. Recently, the omics technologies have been efficiently applied to understand the nutritional variation, drought tolerance and gene mining. Progress has also occurred with respect to transgenics development. This review presents the current biotechnological advancements along with research gaps and future perspective of genomic research in finger millet.

  7. Whole-genome and Transcriptome Sequencing of Prostate Cancer Identify New Genetic Alterations Driving Disease Progression

    DEFF Research Database (Denmark)

    Ren, Shancheng; Wei, Gong-Hong; Liu, Dongbing

    2018-01-01

    BACKGROUND: Global disparities in prostate cancer (PCa) incidence highlight the urgent need to identify genomic abnormalities in prostate tumors in different ethnic populations including Asian men. OBJECTIVE: To systematically explore the genomic complexity and define disease-driven genetic......-scale and comprehensive genomic data of prostate cancer from Asian population. Identification of these genetic alterations may help advance prostate cancer diagnosis, prognosis, and treatment....... alterations in PCa. DESIGN, SETTING, AND PARTICIPANTS: The study sequenced whole-genome and transcriptome of tumor-benign paired tissues from 65 treatment-naive Chinese PCa patients. Subsequent targeted deep sequencing of 293 PCa-relevant genes was performed in another cohort of 145 prostate tumors. OUTCOME...

  8. Genome-wide association study identifies multiple risk loci for chronic lymphocytic leukemia

    OpenAIRE

    Berndt, S.I.; Skibola, C.F.; Joseph, V.; Camp, N.J.; Nieters, A.; Wang, Z.; Cozen, W.; Monnereau, A.; Wang, S.S.; Kelly, R.S.; Lan, Q.; Teras, L.R.; Chatterjee, N.; Chung, C.C.; Yeager, M.

    2013-01-01

    Genome-wide association studies (GWAS) have previously identified 13 loci associated with risk of chronic lymphocytic leukemia or small lymphocytic lymphoma (CLL). To identify additional CLL susceptibility loci, we conducted the largest meta-analysis for CLL thus far, including four GWAS with a total of 3,100 individuals with CLL (cases) and 7,667 controls. In the meta-analysis, we identified ten independent associated SNPs in nine new loci at 10q23.31 (ACTA2 or FAS (ACTA2/FAS), P = 1.22 × 10...

  9. Genome U-Plot: a whole genome visualization.

    Science.gov (United States)

    Gaitatzes, Athanasios; Johnson, Sarah H; Smadbeck, James B; Vasmatzis, George

    2018-05-15

    The ability to produce and analyze whole genome sequencing (WGS) data from samples with structural variations (SV) generated the need to visualize such abnormalities in simplified plots. Conventional two-dimensional representations of WGS data frequently use either circular or linear layouts. There are several diverse advantages regarding both these representations, but their major disadvantage is that they do not use the two-dimensional space very efficiently. We propose a layout, termed the Genome U-Plot, which spreads the chromosomes on a two-dimensional surface and essentially quadruples the spatial resolution. We present the Genome U-Plot for producing clear and intuitive graphs that allows researchers to generate novel insights and hypotheses by visualizing SVs such as deletions, amplifications, and chromoanagenesis events. The main features of the Genome U-Plot are its layered layout, its high spatial resolution and its improved aesthetic qualities. We compare conventional visualization schemas with the Genome U-Plot using visualization metrics such as number of line crossings and crossing angle resolution measures. Based on our metrics, we improve the readability of the resulting graph by at least 2-fold, making apparent important features and making it easy to identify important genomic changes. A whole genome visualization tool with high spatial resolution and improved aesthetic qualities. An implementation and documentation of the Genome U-Plot is publicly available at https://github.com/gaitat/GenomeUPlot. vasmatzis.george@mayo.edu. Supplementary data are available at Bioinformatics online.

  10. Genome-wide association study identifies 74 loci associated with educational attainment

    DEFF Research Database (Denmark)

    Okbay, Aysu; P. Beauchamp, Jonathan; Alan Fontana, Mark

    2016-01-01

    -nucleotide polymorphisms associated with educational attainment are disproportionately found in genomic regions regulating gene expression in the fetal brain. Candidate genes are preferentially expressed in neural tissue, especially during the prenatal period, and enriched for biological pathways involved in neural......Educational attainment is strongly influenced by social and other environmental factors, but genetic factors are estimated to account for at least 20% of the variation across individuals1. Here we report the results of a genome-wide association study (GWAS) for educational attainment that extends...... development. Our findings demonstrate that, even for a behavioural phenotype that is mostly environmentally determined, a well-powered GWAS identifies replicable associated genetic variants that suggest biologically relevant pathways. Because educational attainment is measured in large numbers of individuals...

  11. Genome-wide CRISPR/Cas9 Screen Identifies Host Factors Essential for Influenza Virus Replication

    Directory of Open Access Journals (Sweden)

    Julianna Han

    2018-04-01

    Full Text Available Summary: The emergence of influenza A viruses (IAVs from zoonotic reservoirs poses a great threat to human health. As seasonal vaccines are ineffective against zoonotic strains, and newly transmitted viruses can quickly acquire drug resistance, there remains a need for host-directed therapeutics against IAVs. Here, we performed a genome-scale CRISPR/Cas9 knockout screen in human lung epithelial cells with a human isolate of an avian H5N1 strain. Several genes involved in sialic acid biosynthesis and related glycosylation pathways were highly enriched post-H5N1 selection, including SLC35A1, a sialic acid transporter essential for IAV receptor expression and thus viral entry. Importantly, we have identified capicua (CIC as a negative regulator of cell-intrinsic immunity, as loss of CIC resulted in heightened antiviral responses and restricted replication of multiple viruses. Therefore, our study demonstrates that the CRISPR/Cas9 system can be utilized for the discovery of host factors critical for the replication of intracellular pathogens. : Using a genome-wide CRISPR/Cas9 screen, Han et al. demonstrate that the major hit, the sialic acid transporter SLC35A1, is an essential host factor for IAV entry. In addition, they identify the DNA-binding transcriptional repressor CIC as a negative regulator of cell-intrinsic immunity. Keywords: CRISPR/Cas9 screen, GeCKO, influenza virus, host factors, sialic acid pathway, SLC35A1, Capicua, CIC, cell-intrinsic immunity, H5N1

  12. Genome-wide association study identifies candidate genes for starch content regulation in maize kernels

    Directory of Open Access Journals (Sweden)

    Na Liu

    2016-07-01

    Full Text Available Kernel starch content is an important trait in maize (Zea mays L. as it accounts for 65% to 75% of the dry kernel weight and positively correlates with seed yield. A number of starch synthesis-related genes have been identified in maize in recent years. However, many loci underlying variation in starch content among maize inbred lines still remain to be identified. The current study is a genome-wide association study that used a set of 263 maize inbred lines. In this panel, the average kernel starch content was 66.99%, ranging from 60.60% to 71.58% over the three study years. These inbred lines were genotyped with the SNP50 BeadChip maize array, which is comprised of 56,110 evenly spaced, random SNPs. Population structure was controlled by a mixed linear model (MLM as implemented in the software package TASSEL. After the statistical analyses, four SNPs were identified as significantly associated with starch content (P ≤ 0.0001, among which one each are located on chromosomes 1 and 5 and two are on chromosome 2. Furthermore, 77 candidate genes associated with starch synthesis were found within the 100-kb intervals containing these four QTLs, and four highly associated genes were within 20-kb intervals of the associated SNPs. Among the four genes, Glucose-1-phosphate adenylyltransferase (APS1; Gene ID GRMZM2G163437 is known as an important regulator of kernel starch content. The identified SNPs, QTLs, and candidate genes may not only be readily used for germplasm improvement by marker-assisted selection in breeding, but can also elucidate the genetic basis of starch content. Further studies on these identified candidate genes may help determine the molecular mechanisms regulating kernel starch content in maize and other important cereal crops.

  13. High throughput sequencing and proteomics to identify immunogenic proteins of a new pathogen: the dirty genome approach.

    Directory of Open Access Journals (Sweden)

    Gilbert Greub

    Full Text Available BACKGROUND: With the availability of new generation sequencing technologies, bacterial genome projects have undergone a major boost. Still, chromosome completion needs a costly and time-consuming gap closure, especially when containing highly repetitive elements. However, incomplete genome data may be sufficiently informative to derive the pursued information. For emerging pathogens, i.e. newly identified pathogens, lack of release of genome data during gap closure stage is clearly medically counterproductive. METHODS/PRINCIPAL FINDINGS: We thus investigated the feasibility of a dirty genome approach, i.e. the release of unfinished genome sequences to develop serological diagnostic tools. We showed that almost the whole genome sequence of the emerging pathogen Parachlamydia acanthamoebae was retrieved even with relatively short reads from Genome Sequencer 20 and Solexa. The bacterial proteome was analyzed to select immunogenic proteins, which were then expressed and used to elaborate the first steps of an ELISA. CONCLUSIONS/SIGNIFICANCE: This work constitutes the proof of principle for a dirty genome approach, i.e. the use of unfinished genome sequences of pathogenic bacteria, coupled with proteomics to rapidly identify new immunogenic proteins useful to develop in the future specific diagnostic tests such as ELISA, immunohistochemistry and direct antigen detection. Although applied here to an emerging pathogen, this combined dirty genome sequencing/proteomic approach may be used for any pathogen for which better diagnostics are needed. These genome sequences may also be very useful to develop DNA based diagnostic tests. All these diagnostic tools will allow further evaluations of the pathogenic potential of this obligate intracellular bacterium.

  14. Using sheep genomes from diverse U.S. breeds to identify missense variants in genes affecting fecundity

    Science.gov (United States)

    Background: Access to sheep genome sequences significantly improves the chances of identifying genes that may influence the health, welfare, and productivity of these animals. Methods: A public, searchable DNA sequence resource for U.S. sheep was created with whole genome sequence (WGS) of 96 rams. ...

  15. A Web-Based Comparative Genomics Tutorial for Investigating Microbial Genomes

    Directory of Open Access Journals (Sweden)

    Michael Strong

    2009-12-01

    Full Text Available As the number of completely sequenced microbial genomes continues to rise at an impressive rate, it is important to prepare students with the skills necessary to investigate microorganisms at the genomic level. As a part of the core curriculum for first-year graduate students in the biological sciences, we have implemented a web-based tutorial to introduce students to the fields of comparative and functional genomics. The tutorial focuses on recent computational methods for identifying functionally linked genes and proteins on a genome-wide scale and was used to introduce students to the Rosetta Stone, Phylogenetic Profile, conserved Gene Neighbor, and Operon computational methods. Students learned to use a number of publicly available web servers and databases to identify functionally linked genes in the Escherichia coli genome, with emphasis on genome organization and operon structure. The overall effectiveness of the tutorial was assessed based on student evaluations and homework assignments. The tutorial is available to other educators at http://www.doe-mbi.ucla.edu/~strong/m253.php.

  16. Genome-wide Analyses Identify KIF5A as a Novel ALS Gene

    NARCIS (Netherlands)

    Nicolas, Aude; Kenna, Kevin P.; Renton, Alan E.; Ticozzi, Nicola; Faghri, Faraz; Chia, Ruth; Dominov, Janice A.; Kenna, Brendan J.; Nalls, Mike A.; Keagle, Pamela; Rivera, Alberto M.; van Rheenen, Wouter; Murphy, Natalie A.; van Vugt, Joke J.F.A.; Geiger, Joshua T.; van der Spek, Rick; Pliner, Hannah A.; Smith, Bradley N.; Marangi, Giuseppe; Topp, Simon D.; Abramzon, Yevgeniya; Gkazi, Athina Soragia; Eicher, John D.; Kenna, Aoife; Logullo, Francesco O.; Simone, Isabella L.; Logroscino, Giancarlo; Salvi, Fabrizio; Bartolomei, Ilaria; Borghero, Giuseppe; Murru, Maria Rita; Costantino, Emanuela; Pani, Carla; Puddu, Roberta; Caredda, Carla; Piras, Valeria; Tranquilli, Stefania; Cuccu, Stefania; Corongiu, Daniela; Melis, Maurizio; Milia, Antonio; Marrosu, Francesco; Marrosu, Maria Giovanna; Floris, Gianluca; Cannas, Antonino; Capasso, Margherita; Caponnetto, Claudia; Mancardi, Gianluigi; Origone, Paola; Mandich, Paola; Conforti, Francesca L.; Cavallaro, Sebastiano; Mora, Gabriele; Marinou, Kalliopi; Sideri, Riccardo; Penco, Silvana; Mosca, Lorena; Lunetta, Christian; Pinter, Giuseppe Lauria; Corbo, Massimo; Riva, Nilo; Carrera, Paola; Volanti, Paolo; Mandrioli, Jessica; Fini, Nicola; Fasano, Antonio; Tremolizzo, Lucio; Arosio, Alessandro; Ferrarese, Carlo; Trojsi, Francesca; Tedeschi, Gioacchino; Monsurrò, Maria Rosaria; Piccirillo, Giovanni; Femiano, Cinzia; Ticca, Anna; Ortu, Enzo; La Bella, Vincenzo; Spataro, Rossella; Colletti, Tiziana; Sabatelli, Mario; Zollino, Marcella; Conte, Amelia; Luigetti, Marco; Lattante, Serena; Marangi, Giuseppe; Santarelli, Marialuisa; Petrucci, Antonio; Pugliatti, Maura; Pirisi, Angelo; Parish, Leslie D.; Occhineri, Patrizia; Giannini, Fabio; Battistini, Stefania; Ricci, Claudia; Benigni, Michele; Cau, Tea B.; Loi, Daniela; Calvo, Andrea; Moglia, Cristina; Brunetti, Maura; Barberis, Marco; Restagno, Gabriella; Casale, Federico; Marrali, Giuseppe; Fuda, Giuseppe; Ossola, Irene; Cammarosano, Stefania; Canosa, Antonio; Ilardi, Antonio; Manera, Umberto; Grassano, Maurizio; Tanel, Raffaella; Pisano, Fabrizio; Mora, Gabriele; Calvo, Andrea; Mazzini, Letizia; Riva, Nilo; Mandrioli, Jessica; Caponnetto, Claudia; Battistini, Stefania; Volanti, Paolo; La Bella, Vincenzo; Conforti, Francesca L.; Borghero, Giuseppe; Messina, Sonia; Simone, Isabella L.; Trojsi, Francesca; Salvi, Fabrizio; Logullo, Francesco O.; D'Alfonso, Sandra; Corrado, Lucia; Capasso, Margherita; Ferrucci, Luigi; Harms, Matthew B.; Goldstein, David B.; Shneider, Neil A.; Goutman, Stephen A.; Simmons, Zachary; Miller, Timothy M.; Chandran, Siddharthan; Pal, Suvankar; Manousakis, George; Appel, Stanley H.; Simpson, Ericka; Wang, Leo; Baloh, Robert H.; Gibson, Summer B.; Bedlack, Richard; Lacomis, David; Sareen, Dhruv; Sherman, Alexander; Bruijn, Lucie; Penny, Michelle; Moreno, Cristiane de Araujo Martins; Kamalakaran, Sitharthan; Goldstein, David B.; Allen, Andrew S.; Appel, Stanley; Baloh, Robert H.; Bedlack, Richard S.; Boone, Braden E.; Brown, Robert; Carulli, John P.; Chesi, Alessandra; Chung, Wendy K.; Cirulli, Elizabeth T.; Cooper, Gregory M.; Couthouis, Julien; Day-Williams, Aaron G.; Dion, Patrick A.; Gibson, Summer B.; Gitler, Aaron D.; Glass, Jonathan D.; Goldstein, David B.; Han, Yujun; Harms, Matthew B.; Harris, Tim; Hayes, Sebastian D.; Jones, Angela L.; Keebler, Jonathan; Krueger, Brian J.; Lasseigne, Brittany N.; Levy, Shawn E.; Lu, Yi Fan; Maniatis, Tom; McKenna-Yasek, Diane; Miller, Timothy M.; Myers, Richard M.; Petrovski, Slavé; Pulst, Stefan M.; Raphael, Alya R.; Ravits, John M.; Ren, Zhong; Rouleau, Guy A.; Sapp, Peter C.; Shneider, Neil A.; Simpson, Ericka; Sims, Katherine B.; Staropoli, John F.; Waite, Lindsay L.; Wang, Quanli; Wimbish, Jack R.; Xin, Winnie W.; Gitler, Aaron D.; Harris, Tim; Myers, Richard M.; Phatnani, Hemali; Kwan, Justin; Sareen, Dhruv; Broach, James R.; Simmons, Zachary; Arcila-Londono, Ximena; Lee, Edward B.; Van Deerlin, Vivianna M.; Shneider, Neil A.; Fraenkel, Ernest; Ostrow, Lyle W.; Baas, Frank; Zaitlen, Noah; Berry, James D.; Malaspina, Andrea; Fratta, Pietro; Cox, Gregory A.; Thompson, Leslie M.; Finkbeiner, Steve; Dardiotis, Efthimios; Miller, Timothy M.; Chandran, Siddharthan; Pal, Suvankar; Hornstein, Eran; MacGowan, Daniel J.L.; Heiman-Patterson, Terry D.; Hammell, Molly G.; Patsopoulos, Nikolaos A.; Dubnau, Joshua; Nath, Avindra; Phatnani, Hemali; Musunuri, Rajeeva Lochan; Evani, Uday Shankar; Abhyankar, Avinash; Zody, Michael C.; Kaye, Julia; Finkbeiner, Steven; Wyman, Stacia K.; LeNail, Alexander; Lima, Leandro; Fraenkel, Ernest; Rothstein, Jeffrey D.; Svendsen, Clive N.; Thompson, Leslie M.; Van Eyk, Jenny; Maragakis, Nicholas J.; Berry, James D.; Glass, Jonathan D.; Miller, Timothy M.; Kolb, Stephen J.; Baloh, Robert H.; Cudkowicz, Merit; Baxi, Emily; Kaye, Julia; Finkbeiner, Steven; Wyman, Stacia K.; Finkbeiner, Steven; LeNail, Alex; Lima, Leandro; Fraenkel, Ernest; Fraenkel, Ernest; Svendsen, Clive N.; Svendsen, Clive N.; Thompson, Leslie M.; Thompson, Leslie M.; Van Eyk, Jennifer E.; Berry, James D.; Berry, James D.; Miller, Timothy M.; Kolb, Stephen J.; Cudkowicz, Merit; Cudkowicz, Merit; Baxi, Emily; Benatar, Michael; Taylor, J. Paul; Wu, Gang; Rampersaud, Evadnie; Wuu, Joanne; Rademakers, Rosa; Züchner, Stephan; Schule, Rebecca; McCauley, Jacob; Hussain, Sumaira; Cooley, Anne; Wallace, Marielle; Clayman, Christine; Barohn, Richard; Statland, Jeffrey; Ravits, John M.; Swenson, Andrea; Jackson, Carlayne; Trivedi, Jaya; Khan, Shaida; Katz, Jonathan; Jenkins, Liberty; Burns, Ted; Gwathmey, Kelly; Caress, James; McMillan, Corey; Elman, Lauren; Pioro, Erik P.; Heckmann, Jeannine; So, Yuen; Walk, David; Maiser, Samuel; Zhang, Jinghui; Benatar, Michael; Taylor, J. Paul; Taylor, J. Paul; Rampersaud, Evadnie; Wu, Gang; Wuu, Joanne; Silani, Vincenzo; Ticozzi, Nicola; Gellera, Cinzia; Ratti, Antonia; Taroni, Franco; Lauria, Giuseppe; Verde, Federico; Fogh, Isabella; Tiloca, Cinzia; Comi, Giacomo P.; Sorarù, Gianni; Cereda, Cristina; D'Alfonso, Sandra; Corrado, Lucia; De Marchi, Fabiola; Corti, Stefania; Ceroni, Mauro; Mazzini, Letizia; Siciliano, Gabriele; Filosto, Massimiliano; Inghilleri, Maurizio; Peverelli, Silvia; Colombrita, Claudia; Poletti, Barbara; Maderna, Luca; Del Bo, Roberto; Gagliardi, Stella; Querin, Giorgia; Bertolin, Cinzia; Pensato, Viviana; Castellotti, Barbara; Lauria, Giuseppe; Verde, Federico; Fogh, Isabella; Tiloca, Cinzia; Fogh, Isabella; Comi, Giacomo P.; Sorarù, Gianni; Cereda, Cristina; Camu, William; Mouzat, Kevin; Lumbroso, Serge; Corcia, Philippe; Meininger, Vincent; Besson, Gérard; Lagrange, Emmeline; Clavelou, Pierre; Guy, Nathalie; Couratier, Philippe; Vourch, Patrick; Danel, Véronique; Bernard, Emilien; Lemasson, Gwendal; Corcia, Philippe; Laaksovirta, Hannu; Myllykangas, Liisa; Jansson, Lilja; Valori, Miko; Ealing, John; Hamdalla, Hisham; Rollinson, Sara; Pickering-Brown, Stuart; Orrell, Richard W.; Sidle, Katie C.; Malaspina, Andrea; Hardy, John; Singleton, Andrew B.; Johnson, Janel O.; Arepalli, Sampath; Sapp, Peter C.; McKenna-Yasek, Diane; Polak, Meraida; Asress, Seneshaw; Al-Sarraj, Safa; King, Andrew; Troakes, Claire; Vance, Caroline; de Belleroche, Jacqueline; Baas, Frank; ten Asbroek, Anneloor L.M.A.; Muñoz-Blanco, José Luis; Hernandez, Dena G.; Ding, Jinhui; Gibbs, J. Raphael; Scholz, Sonja W.; Scholz, Sonja W.; Floeter, Mary Kay; Campbell, Roy H.; Landi, Francesco; Bowser, Robert; Pulst, Stefan M.; Ravits, John M.; MacGowan, Daniel J.L.; Kirby, Janine; Pioro, Erik P.; Pamphlett, Roger; Broach, James; Gerhard, Glenn; Dunckley, Travis L.; Brady, Christopher B.; Brady, Christopher B.; Kowall, Neil W.; Troncoso, Juan C.; Le Ber, Isabelle; Mouzat, Kevin; Lumbroso, Serge; Mouzat, Kevin; Lumbroso, Serge; Heiman-Patterson, Terry D.; Heiman-Patterson, Terry D.; Kamel, Freya; Van Den Bosch, Ludo; Van Den Bosch, Ludo; Baloh, Robert H.; Strom, Tim M.; Meitinger, Thomas; Strom, Tim M.; Shatunov, Aleksey; Van Eijk, Kristel R.; de Carvalho, Mamede; de Carvalho, Mamede; Kooyman, Maarten; Middelkoop, Bas; Moisse, Matthieu; McLaughlin, Russell; Van Es, Michael A.; Weber, Markus; Boylan, Kevin B.; Van Blitterswijk, Marka; Rademakers, Rosa; Morrison, Karen; Basak, A. Nazli; Mora, Jesús S.; Drory, Vivian; Shaw, Pamela; Turner, Martin R.; Talbot, Kevin; Hardiman, Orla; Williams, Kelly L.; Fifita, Jennifer A.; Nicholson, Garth A.; Blair, Ian P.; Nicholson, Garth A.; Rouleau, Guy A.; Esteban-Pérez, Jesús; García-Redondo, Alberto; Al-Chalabi, Ammar; Al Kheifat, Ahmad; Al-Chalabi, Ammar; Andersen, Peter M.; Basak, A. Nazli; Blair, Ian P.; Chio, Adriano; Cooper-Knock, Jonathan; Corcia, Philippe; Couratier, Philippe; de Carvalho, Mamede; Dekker, Annelot; Drory, Vivian; Redondo, Alberto Garcia; Gotkine, Marc; Hardiman, Orla; Hide, Winston; Iacoangeli, Alfredo; Glass, Jonathan D.; Kenna, Kevin P.; Kiernan, Matthew; Kooyman, Maarten; Landers, John E.; McLaughlin, Russell; Middelkoop, Bas; Mill, Jonathan; Neto, Miguel Mitne; Moisse, Matthieu; Pardina, Jesus Mora; Morrison, Karen; Newhouse, Stephen; Pinto, Susana; Pulit, Sara; Robberecht, Wim; Shatunov, Aleksey; Shaw, Pamela; Shaw, Chris; Silani, Vincenzo; Sproviero, William; Tazelaar, Gijs; Ticozzi, Nicola; Van Damme, Philip; van den Berg, Leonard; van der Spek, Rick; Van Eijk, Kristel R.; Van Es, Michael A.; van Rheenen, Wouter; van Vugt, Joke J.F.A.; Veldink, Jan H.; Weber, Markus; Williams, Kelly L.; Van Damme, Philip; Robberecht, Wim; Zatz, Mayana; Robberecht, Wim; Bauer, Denis C.; Twine, Natalie A.; Rogaeva, Ekaterina; Zinman, Lorne; Ostrow, Lyle W.; Maragakis, Nicholas J.; Rothstein, Jeffrey D.; Simmons, Zachary; Cooper-Knock, Johnathan; Brice, Alexis; Goutman, Stephen A.; Feldman, Eva L.; Gibson, Summer B.; Taroni, Franco; Ratti, Antonia; Ratti, Antonia; Gellera, Cinzia; Van Damme, Philip; Robberecht, Wim; Fratta, Pietro; Sabatelli, Mario; Lunetta, Christian; Ludolph, Albert C.; Andersen, Peter M.; Weishaupt, Jochen H.; Camu, William; Trojanowski, John Q.; Van Deerlin, Vivianna M.; Brown, Robert H.; van den Berg, Leonard; Veldink, Jan H.; Harms, Matthew B.; Glass, Jonathan D.; Stone, David J.; Tienari, Pentti; Silani, Vincenzo; Silani, Vincenzo; Chiò, Adriano; Shaw, Christopher E.; Chiò, Adriano; Traynor, Bryan J.; Landers, John E.; Traynor, Bryan J.

    2018-01-01

    To identify novel genes associated with ALS, we undertook two lines of investigation. We carried out a genome-wide association study comparing 20,806 ALS cases and 59,804 controls. Independently, we performed a rare variant burden analysis comparing 1,138 index familial ALS cases and 19,494

  17. Cross-Genome Comparisons of Newly Identified Domains in Mycoplasma gallisepticum and Domain Architectures with Other Mycoplasma species

    Directory of Open Access Journals (Sweden)

    Chandra Sekhar Reddy Chilamakuri

    2011-01-01

    Full Text Available Accurate functional annotation of protein sequences is hampered by important factors such as the failure of sequence search methods to identify relationships and the inherent diversity in function of proteins related at low sequence similarities. Earlier, we had employed intermediate sequence search approach to establish new domain relationships in the unassigned regions of gene products at the whole genome level by taking Mycoplasma gallisepticum as a specific example and established new domain relationships. In this paper, we report a detailed comparison of the conservation status of the domain and domain architectures of the gene products that bear our newly predicted domains amongst 14 other Mycoplasma genomes and reported the probable implications for the organisms. Some of the domain associations, observed in Mycoplasma that afflict humans and other non-human primates, are involved in regulation of solute transport and DNA binding suggesting specific modes of host-pathogen interactions.

  18. The human genome project

    International Nuclear Information System (INIS)

    Worton, R.

    1996-01-01

    The Human Genome Project is a massive international research project, costing 3 to 5 billion dollars and expected to take 15 years, which will identify the all the genes in the human genome - i.e. the complete sequence of bases in human DNA. The prize will be the ability to identify genes causing or predisposing to disease, and in some cases the development of gene therapy, but this new knowledge will raise important ethical issues

  19. The genome sequence of the most widely cultivated cacao type and its use to identify candidate genes regulating pod color.

    Science.gov (United States)

    Motamayor, Juan C; Mockaitis, Keithanne; Schmutz, Jeremy; Haiminen, Niina; Livingstone, Donald; Cornejo, Omar; Findley, Seth D; Zheng, Ping; Utro, Filippo; Royaert, Stefan; Saski, Christopher; Jenkins, Jerry; Podicheti, Ram; Zhao, Meixia; Scheffler, Brian E; Stack, Joseph C; Feltus, Frank A; Mustiga, Guiliana M; Amores, Freddy; Phillips, Wilbert; Marelli, Jean Philippe; May, Gregory D; Shapiro, Howard; Ma, Jianxin; Bustamante, Carlos D; Schnell, Raymond J; Main, Dorrie; Gilbert, Don; Parida, Laxmi; Kuhn, David N

    2013-06-03

    Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. We describe the sequencing and assembly of the genome of Theobroma cacao L. cultivar Matina 1-6. The genome of the Matina 1-6 cultivar is 445 Mbp, which is significantly larger than a sequenced Criollo cultivar, and more typical of other cultivars. The chromosome-scale assembly, version 1.1, contains 711 scaffolds covering 346.0 Mbp, with a contig N50 of 84.4 kbp, a scaffold N50 of 34.4 Mbp, and an evidence-based gene set of 29,408 loci. Version 1.1 has 10x the scaffold N50 and 4x the contig N50 as Criollo, and includes 111 Mb more anchored sequence. The version 1.1 assembly has 4.4% gap sequence, while Criollo has 10.9%. Through a combination of haplotype, association mapping and gene expression analyses, we leverage this robust reference genome to identify a promising candidate gene responsible for pod color variation. We demonstrate that green/red pod color in cacao is likely regulated by the R2R3 MYB transcription factor TcMYB113, homologs of which determine pigmentation in Rosaceae, Solanaceae, and Brassicaceae. One SNP within the target site for a highly conserved trans-acting siRNA in dicots, found within TcMYB113, seems to affect transcript levels of this gene and therefore pod color variation. We report a high-quality sequence and annotation of Theobroma cacao L. and demonstrate its utility in identifying candidate genes regulating traits.

  20. Pan-Genome Analysis of Human Gastric Pathogen H. pylori: Comparative Genomics and Pathogenomics Approaches to Identify Regions Associated with Pathogenicity and Prediction of Potential Core Therapeutic Targets

    DEFF Research Database (Denmark)

    Ali, Amjad; Naz, Anam; Soares, Siomar C.

    2015-01-01

    -genome approach; the predicted conserved gene families (1,193) constitute similar to 77% of the average H. pylori genome and 45% of the global gene repertoire of the species. Reverse vaccinology strategies have been adopted to identify and narrow down the potential core-immunogenic candidates. Total of 28 nonhost....... Pan-genome analyses of the global representative H. pylori isolates consisting of 39 complete genomes are presented in this paper. Phylogenetic analyses have revealed close relationships among geographically diverse strains of H. pylori. The conservation among these genomes was further analyzed by pan...

  1. Genomic analyses identify molecular subtypes of pancreatic cancer.

    Science.gov (United States)

    Bailey, Peter; Chang, David K; Nones, Katia; Johns, Amber L; Patch, Ann-Marie; Gingras, Marie-Claude; Miller, David K; Christ, Angelika N; Bruxner, Tim J C; Quinn, Michael C; Nourse, Craig; Murtaugh, L Charles; Harliwong, Ivon; Idrisoglu, Senel; Manning, Suzanne; Nourbakhsh, Ehsan; Wani, Shivangi; Fink, Lynn; Holmes, Oliver; Chin, Venessa; Anderson, Matthew J; Kazakoff, Stephen; Leonard, Conrad; Newell, Felicity; Waddell, Nick; Wood, Scott; Xu, Qinying; Wilson, Peter J; Cloonan, Nicole; Kassahn, Karin S; Taylor, Darrin; Quek, Kelly; Robertson, Alan; Pantano, Lorena; Mincarelli, Laura; Sanchez, Luis N; Evers, Lisa; Wu, Jianmin; Pinese, Mark; Cowley, Mark J; Jones, Marc D; Colvin, Emily K; Nagrial, Adnan M; Humphrey, Emily S; Chantrill, Lorraine A; Mawson, Amanda; Humphris, Jeremy; Chou, Angela; Pajic, Marina; Scarlett, Christopher J; Pinho, Andreia V; Giry-Laterriere, Marc; Rooman, Ilse; Samra, Jaswinder S; Kench, James G; Lovell, Jessica A; Merrett, Neil D; Toon, Christopher W; Epari, Krishna; Nguyen, Nam Q; Barbour, Andrew; Zeps, Nikolajs; Moran-Jones, Kim; Jamieson, Nigel B; Graham, Janet S; Duthie, Fraser; Oien, Karin; Hair, Jane; Grützmann, Robert; Maitra, Anirban; Iacobuzio-Donahue, Christine A; Wolfgang, Christopher L; Morgan, Richard A; Lawlor, Rita T; Corbo, Vincenzo; Bassi, Claudio; Rusev, Borislav; Capelli, Paola; Salvia, Roberto; Tortora, Giampaolo; Mukhopadhyay, Debabrata; Petersen, Gloria M; Munzy, Donna M; Fisher, William E; Karim, Saadia A; Eshleman, James R; Hruban, Ralph H; Pilarsky, Christian; Morton, Jennifer P; Sansom, Owen J; Scarpa, Aldo; Musgrove, Elizabeth A; Bailey, Ulla-Maja Hagbo; Hofmann, Oliver; Sutherland, Robert L; Wheeler, David A; Gill, Anthony J; Gibbs, Richard A; Pearson, John V; Waddell, Nicola; Biankin, Andrew V; Grimmond, Sean M

    2016-03-03

    Integrated genomic analysis of 456 pancreatic ductal adenocarcinomas identified 32 recurrently mutated genes that aggregate into 10 pathways: KRAS, TGF-β, WNT, NOTCH, ROBO/SLIT signalling, G1/S transition, SWI-SNF, chromatin modification, DNA repair and RNA processing. Expression analysis defined 4 subtypes: (1) squamous; (2) pancreatic progenitor; (3) immunogenic; and (4) aberrantly differentiated endocrine exocrine (ADEX) that correlate with histopathological characteristics. Squamous tumours are enriched for TP53 and KDM6A mutations, upregulation of the TP63∆N transcriptional network, hypermethylation of pancreatic endodermal cell-fate determining genes and have a poor prognosis. Pancreatic progenitor tumours preferentially express genes involved in early pancreatic development (FOXA2/3, PDX1 and MNX1). ADEX tumours displayed upregulation of genes that regulate networks involved in KRAS activation, exocrine (NR5A2 and RBPJL), and endocrine differentiation (NEUROD1 and NKX2-2). Immunogenic tumours contained upregulated immune networks including pathways involved in acquired immune suppression. These data infer differences in the molecular evolution of pancreatic cancer subtypes and identify opportunities for therapeutic development.

  2. A meta-analysis of genome-wide association studies identifies novel variants associated with osteoarthritis of the hip

    DEFF Research Database (Denmark)

    Evangelou, Evangelos; Kerkhof, Hanneke J; Styrkarsdottir, Unnur

    2014-01-01

    Osteoarthritis (OA) is the most common form of arthritis with a clear genetic component. To identify novel loci associated with hip OA we performed a meta-analysis of genome-wide association studies (GWAS) on European subjects.......Osteoarthritis (OA) is the most common form of arthritis with a clear genetic component. To identify novel loci associated with hip OA we performed a meta-analysis of genome-wide association studies (GWAS) on European subjects....

  3. Leveraging Comparative Genomics to Identify and Functionally Characterize Genes Associated with Sperm Phenotypes in Python bivittatus (Burmese Python

    Directory of Open Access Journals (Sweden)

    Kristopher J. L. Irizarry

    2016-01-01

    Full Text Available Comparative genomics approaches provide a means of leveraging functional genomics information from a highly annotated model organism’s genome (such as the mouse genome in order to make physiological inferences about the role of genes and proteins in a less characterized organism’s genome (such as the Burmese python. We employed a comparative genomics approach to produce the functional annotation of Python bivittatus genes encoding proteins associated with sperm phenotypes. We identify 129 gene-phenotype relationships in the python which are implicated in 10 specific sperm phenotypes. Results obtained through our systematic analysis identified subsets of python genes exhibiting associations with gene ontology annotation terms. Functional annotation data was represented in a semantic scatter plot. Together, these newly annotated Python bivittatus genome resources provide a high resolution framework from which the biology relating to reptile spermatogenesis, fertility, and reproduction can be further investigated. Applications of our research include (1 production of genetic diagnostics for assessing fertility in domestic and wild reptiles; (2 enhanced assisted reproduction technology for endangered and captive reptiles; and (3 novel molecular targets for biotechnology-based approaches aimed at reducing fertility and reproduction of invasive reptiles. Additional enhancements to reptile genomic resources will further enhance their value.

  4. Genome-wide association study identifies three novel loci for type 2 diabetes

    DEFF Research Database (Denmark)

    Hara, Kazuo; Fujita, Hayato; Johnson, Todd A

    2014-01-01

    Although over 60 loci for type 2 diabetes (T2D) have been identified, there still remains a large genetic component to be clarified. To explore unidentified loci for T2D, we performed a genome-wide association study (GWAS) of 6 209 637 single-nucleotide polymorphisms (SNPs), which were directly g...

  5. Genome-wide analysis of the CCCH zinc finger family identifies tissue specific and stress responsive candidates in chickpea (Cicer arietinum L.).

    Science.gov (United States)

    Pradhan, Seema; Kant, Chandra; Verma, Subodh; Bhatia, Sabhyata

    2017-01-01

    The CCCH zinc finger is a group of proteins characterised by a typical motif consisting of three cysteine residues and one histidine residue. These proteins have been reported to play important roles in regulation of plant growth, developmental processes and environmental responses. In the present study, genome wide analysis of the CCCH zinc finger gene family was carried out in the available chickpea genome. Various bioinformatics tools were employed to predict 58 CCCH zinc finger genes in chickpea (designated CarC3H1-58), which were analysed for their physio-chemical properties. Phylogenetic analysis classified the proteins into 12 groups in which members of a particular group had similar structural organization. Further, the numbers as well as the types of CCCH motifs present in the CarC3H proteins were compared with those from Arabidopsis and Medicago truncatula. Synteny analysis revealed valuable information regarding the evolution of this gene family. Tandem and segmental duplication events were identified and their Ka/Ks values revealed that the CarC3H gene family in chickpea had undergone purifying selection. Digital, as well as real time qRT-PCR expression analysis was performed which helped in identification of several CarC3H members that expressed preferentially in specific chickpea tissues as well as during abiotic stresses (desiccation, cold, salinity). Moreover, molecular characterization of an important member CarC3H45 was carried out. This study provides comprehensive genomic information about the important CCCH zinc finger gene family in chickpea. The identified tissue specific and abiotic stress specific CCCH genes could be potential candidates for further characterization to delineate their functional roles in development and stress.

  6. Identifying tagging SNPs for African specific genetic variation from the African Diaspora Genome.

    Science.gov (United States)

    Johnston, Henry Richard; Hu, Yi-Juan; Gao, Jingjing; O'Connor, Timothy D; Abecasis, Gonçalo R; Wojcik, Genevieve L; Gignoux, Christopher R; Gourraud, Pierre-Antoine; Lizee, Antoine; Hansen, Mark; Genuario, Rob; Bullis, Dave; Lawley, Cindy; Kenny, Eimear E; Bustamante, Carlos; Beaty, Terri H; Mathias, Rasika A; Barnes, Kathleen C; Qin, Zhaohui S

    2017-04-21

    A primary goal of The Consortium on Asthma among African-ancestry Populations in the Americas (CAAPA) is to develop an 'African Diaspora Power Chip' (ADPC), a genotyping array consisting of tagging SNPs, useful in comprehensively identifying African specific genetic variation. This array is designed based on the novel variation identified in 642 CAAPA samples of African ancestry with high coverage whole genome sequence data (~30× depth). This novel variation extends the pattern of variation catalogued in the 1000 Genomes and Exome Sequencing Projects to a spectrum of populations representing the wide range of West African genomic diversity. These individuals from CAAPA also comprise a large swath of the African Diaspora population and incorporate historical genetic diversity covering nearly the entire Atlantic coast of the Americas. Here we show the results of designing and producing such a microchip array. This novel array covers African specific variation far better than other commercially available arrays, and will enable better GWAS analyses for researchers with individuals of African descent in their study populations. A recent study cataloging variation in continental African populations suggests this type of African-specific genotyping array is both necessary and valuable for facilitating large-scale GWAS in populations of African ancestry.

  7. Exploiting genomic data to identify proteins involved in abalone reproduction.

    Science.gov (United States)

    Mendoza-Porras, Omar; Botwright, Natasha A; McWilliam, Sean M; Cook, Mathew T; Harris, James O; Wijffels, Gene; Colgrave, Michelle L

    2014-08-28

    Aside from their critical role in reproduction, abalone gonads serve as an indicator of sexual maturity and energy balance, two key considerations for effective abalone culture. Temperate abalone farmers face issues with tank restocking with highly marketable abalone owing to inefficient spawning induction methods. The identification of key proteins in sexually mature abalone will serve as the foundation for a greater understanding of reproductive biology. Addressing this knowledge gap is the first step towards improving abalone aquaculture methods. Proteomic profiling of female and male gonads of greenlip abalone, Haliotis laevigata, was undertaken using liquid chromatography-mass spectrometry. Owing to the incomplete nature of abalone protein databases, in addition to searching against two publicly available databases, a custom database comprising genomic data was used. Overall, 162 and 110 proteins were identified in females and males respectively with 40 proteins common to both sexes. For proteins involved in sexual maturation, sperm and egg structure, motility, acrosomal reaction and fertilization, 23 were identified only in females, 18 only in males and 6 were common. Gene ontology analysis revealed clear differences between the female and male protein profiles reflecting a higher rate of protein synthesis in the ovary and higher metabolic activity in the testis. A comprehensive mass spectrometry-based analysis was performed to profile the abalone gonad proteome providing the foundation for future studies of reproduction in abalone. Key proteins involved in both reproduction and energy balance were identified. Genomic resources were utilised to build a database of molluscan proteins yielding >60% more protein identifications than in a standard workflow employing public protein databases. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Meta-Analysis of Genome-Wide Association Studies Identifies Genetic Risk Factors for Stroke in African Americans.

    Science.gov (United States)

    Carty, Cara L; Keene, Keith L; Cheng, Yu-Ching; Meschia, James F; Chen, Wei-Min; Nalls, Mike; Bis, Joshua C; Kittner, Steven J; Rich, Stephen S; Tajuddin, Salman; Zonderman, Alan B; Evans, Michele K; Langefeld, Carl D; Gottesman, Rebecca; Mosley, Thomas H; Shahar, Eyal; Woo, Daniel; Yaffe, Kristine; Liu, Yongmei; Sale, Michèle M; Dichgans, Martin; Malik, Rainer; Longstreth, W T; Mitchell, Braxton D; Psaty, Bruce M; Kooperberg, Charles; Reiner, Alexander; Worrall, Bradford B; Fornage, Myriam

    2015-08-01

    The majority of genome-wide association studies (GWAS) of stroke have focused on European-ancestry populations; however, none has been conducted in African Americans, despite the disproportionately high burden of stroke in this population. The Consortium of Minority Population Genome-Wide Association Studies of Stroke (COMPASS) was established to identify stroke susceptibility loci in minority populations. Using METAL, we conducted meta-analyses of GWAS in 14 746 African Americans (1365 ischemic and 1592 total stroke cases) from COMPASS, and tested genetic variants with Pstroke genetic studies in European-ancestry populations. We also evaluated stroke loci previously identified in European-ancestry populations. The 15q21.3 locus linked with lipid levels and hypertension was associated with total stroke (rs4471613; P=3.9×10(-8)) in African Americans. Nominal associations (Pstroke were observed for 18 variants in or near genes implicated in cell cycle/mRNA presplicing (PTPRG, CDC5L), platelet function (HPS4), blood-brain barrier permeability (CLDN17), immune response (ELTD1, WDFY4, and IL1F10-IL1RN), and histone modification (HDAC9). Two of these loci achieved nominal significance in METASTROKE: 5q35.2 (P=0.03), and 1p31.1 (P=0.018). Four of 7 previously reported ischemic stroke loci (PITX2, HDAC9, CDKN2A/CDKN2B, and ZFHX3) were nominally associated (Pstroke in COMPASS. We identified a novel genetic variant associated with total stroke in African Americans and found that ischemic stroke loci identified in European-ancestry populations may also be relevant for African Americans. Our findings support investigation of diverse populations to identify and characterize genetic risk factors, and the importance of shared genetic risk across populations. © 2015 American Heart Association, Inc.

  9. Genome-wide association analyses identify 18 new loci associated with serum urate concentrations

    NARCIS (Netherlands)

    Kottgen, A.; Albrecht, E.; Teumer, A.; Vitart, V.; Krumsiek, J.; Hundertmark, C.; Pistis, G.; Ruggiero, D.; O'Seaghdha, C.M.; Haller, T.; Yang, Q.; Johnson, A.D.; Kutalik, Z.; Smith, A.V.; Shi, J.L.; Struchalin, M.; Middelberg, R.P.S.; Brown, M.J.; Gaffo, A.L.; Pirastu, N.; Li, G.; Hayward, C.; Zemunik, T.; Huffman, J.; Yengo, L.; Zhao, J.H.; Demirkan, A.; Feitosa, M.F.; Liu, X.; Malerba, G.; Lopez, L.M.; van der Harst, P.; Li, X.Z.; Kleber, M.E.; Hicks, A.A.; Nolte, I.M.; Johansson, A.; Murgia, F.; Wild, S.H.; Bakker, S.J.L.; Peden, J.F.; Dehghan, A.; Steri, M.; Tenesa, A.; Lagou, V.; Salo, P.; Mangino, M.; Rose, L.M.; Lehtimaki, T.; Woodward, O.M.; Okada, Y.; Tin, A.; Muller, C.; Oldmeadow, C.; Putku, M.; Czamara, D.; Kraft, P.; Frogheri, L.; Thun, G.A.; Grotevendt, A.; Gislason, G.K.; Harris, T.B.; Launer, L.J.; McArdle, P.; Shuldiner, A.R.; Boerwinkle, E.; Coresh, J.; Schmidt, H.; Schallert, M.; Martin, N.G.; Montgomery, G.W.; Kubo, M.; Nakamura, Y.; Tanaka, T.; Munroe, P.B.; Samani, N.J.; Jacobs, D.R.; Liu, K.; d'Adamo, P.; Ulivi, S.; Rotter, J.I.; Psaty, B.M.; Vollenweider, P.; Waeber, G.; Campbell, S.; Devuyst, O.; Navarro, P.; Kolcic, I.; Hastie, N.; Balkau, B.; Froguel, P.; Esko, T.; Salumets, A.; Khaw, K.T.; Langenberg, C.; Wareham, N.J.; Isaacs, A.; Kraja, A.; Zhang, Q.Y.; Penninx, B.W.J.H.; Smit, J.H.; Bochud, M.; Gieger, C.

    2013-01-01

    Elevated serum urate concentrations can cause gout, a prevalent and painful inflammatory arthritis. By combining data from >140,000 individuals of European ancestry within the Global Urate Genetics Consortium (GUGC), we identified and replicated 28 genome-wide significant loci in association with

  10. Genome-wide association analyses identify 18 new loci associated with serum urate concentrations

    NARCIS (Netherlands)

    Köttgen, Anna; Albrecht, Eva; Teumer, Alexander; Vitart, Veronique; Krumsiek, Jan; Hundertmark, Claudia; Pistis, Giorgio; Ruggiero, Daniela; O'Seaghdha, Conall M; Haller, Toomas; Yang, Qiong; Tanaka, Toshiko; Johnson, Andrew D; Kutalik, Zoltán; Smith, Albert V; Shi, Julia; Struchalin, Maksim; Middelberg, Rita P S; Brown, Morris J; Gaffo, Angelo L; Pirastu, Nicola; Li, Guo; Hayward, Caroline; Zemunik, Tatijana; Huffman, Jennifer; Yengo, Loic; Zhao, Jing Hua; Demirkan, Ayse; Feitosa, Mary F; Liu, Xuan; Malerba, Giovanni; Lopez, Lorna M; van der Harst, Pim; Li, Xinzhong; Kleber, Marcus E; Hicks, Andrew A; Nolte, Ilja M; Johansson, Asa; Murgia, Federico; Bakker, Stephan J L; Lagou, Vasiliki; Bruinenberg, Marcel; Stolk, Ronald P; Penninx, Brenda W; Mateo Leach, Irene; van Gilst, Wiek H; Hillege, Hans L; Wolffenbuttel, Bruce H R; Snieder, Harold; Navis, Gerjan

    Elevated serum urate concentrations can cause gout, a prevalent and painful inflammatory arthritis. By combining data from >140,000 individuals of European ancestry within the Global Urate Genetics Consortium (GUGC), we identified and replicated 28 genome-wide significant loci in association with

  11. Genome-wide characterization of centromeric satellites from multiple mammalian genomes.

    Science.gov (United States)

    Alkan, Can; Cardone, Maria Francesca; Catacchio, Claudia Rita; Antonacci, Francesca; O'Brien, Stephen J; Ryder, Oliver A; Purgato, Stefania; Zoli, Monica; Della Valle, Giuliano; Eichler, Evan E; Ventura, Mario

    2011-01-01

    Despite its importance in cell biology and evolution, the centromere has remained the final frontier in genome assembly and annotation due to its complex repeat structure. However, isolation and characterization of the centromeric repeats from newly sequenced species are necessary for a complete understanding of genome evolution and function. In recent years, various genomes have been sequenced, but the characterization of the corresponding centromeric DNA has lagged behind. Here, we present a computational method (RepeatNet) to systematically identify higher-order repeat structures from unassembled whole-genome shotgun sequence and test whether these sequence elements correspond to functional centromeric sequences. We analyzed genome datasets from six species of mammals representing the diversity of the mammalian lineage, namely, horse, dog, elephant, armadillo, opossum, and platypus. We define candidate monomer satellite repeats and demonstrate centromeric localization for five of the six genomes. Our analysis revealed the greatest diversity of centromeric sequences in horse and dog in contrast to elephant and armadillo, which showed high-centromeric sequence homogeneity. We could not isolate centromeric sequences within the platypus genome, suggesting that centromeres in platypus are not enriched in satellite DNA. Our method can be applied to the characterization of thousands of other vertebrate genomes anticipated for sequencing in the near future, providing an important tool for annotation of centromeres.

  12. Genome-wide association study identifies variants associated with autoimmune hepatitis type 1.

    Science.gov (United States)

    de Boer, Ynto S; van Gerven, Nicole M F; Zwiers, Antonie; Verwer, Bart J; van Hoek, Bart; van Erpecum, Karel J; Beuers, Ulrich; van Buuren, Henk R; Drenth, Joost P H; den Ouden, Jannie W; Verdonk, Robert C; Koek, Ger H; Brouwer, Johannes T; Guichelaar, Maureen M J; Vrolijk, Jan M; Kraal, Georg; Mulder, Chris J J; van Nieuwkerk, Carin M J; Fischer, Janett; Berg, Thomas; Stickel, Felix; Sarrazin, Christoph; Schramm, Christoph; Lohse, Ansgar W; Weiler-Normann, Christina; Lerch, Markus M; Nauck, Matthias; Völzke, Henry; Homuth, Georg; Bloemena, Elisabeth; Verspaget, Hein W; Kumar, Vinod; Zhernakova, Alexandra; Wijmenga, Cisca; Franke, Lude; Bouma, Gerd

    2014-08-01

    Autoimmune hepatitis (AIH) is an uncommon autoimmune liver disease of unknown etiology. We used a genome-wide approach to identify genetic variants that predispose individuals to AIH. We performed a genome-wide association study of 649 adults in The Netherlands with AIH type 1 and 13,436 controls. Initial associations were further analyzed in an independent replication panel comprising 451 patients with AIH type 1 in Germany and 4103 controls. We also performed an association analysis in the discovery cohort using imputed genotypes of the major histocompatibility complex region. We associated AIH with a variant in the major histocompatibility complex region at rs2187668 (P = 1.5 × 10(-78)). Analysis of this variant in the discovery cohort identified HLA-DRB1*0301 (P = 5.3 × 10(-49)) as a primary susceptibility genotype and HLA-DRB1*0401 (P = 2.8 × 10(-18)) as a secondary susceptibility genotype. We also associated AIH with variants of SH2B3 (rs3184504, 12q24; P = 7.7 × 10(-8)) and CARD10 (rs6000782, 22q13.1; P = 3.0 × 10(-6)). In addition, strong inflation of association signal was found with single-nucleotide polymorphisms associated with other immune-mediated diseases, including primary sclerosing cholangitis and primary biliary cirrhosis, but not with single-nucleotide polymorphisms associated with other genetic traits. In a genome-wide association study, we associated AIH type 1 with variants in the major histocompatibility complex region, and identified variants of SH2B3and CARD10 as likely risk factors. These findings support a complex genetic basis for AIH pathogenesis and indicate that part of the genetic susceptibility overlaps with that for other immune-mediated liver diseases. Copyright © 2014 AGA Institute. Published by Elsevier Inc. All rights reserved.

  13. Identifying Importance-Performance Matrix Analysis (IPMA) of ...

    African Journals Online (AJOL)

    Identifying Importance-Performance Matrix Analysis (IPMA) of intellectual capital and Islamic work ethics in Malaysian SMES. ... capital and Islamic work ethics significantly influenced business performance. ... AJOL African Journals Online.

  14. Genome-wide meta-analysis of 241,258 adults accounting for smoking behaviour identifies novel loci for obesity traits

    DEFF Research Database (Denmark)

    Justice, Anne E; Winkler, Thomas W; Feitosa, Mary F

    2017-01-01

    Few genome-wide association studies (GWAS) account for environmental exposures, like smoking, potentially impacting the overall trait variance when investigating the genetic contribution to obesity-related traits. Here, we use GWAS data from 51,080 current smokers and 190,178 nonsmokers (87......% European descent) to identify loci influencing BMI and central adiposity, measured as waist circumference and waist-to-hip ratio both adjusted for BMI. We identify 23 novel genetic loci, and 9 loci with convincing evidence of gene-smoking interaction (GxSMK) on obesity-related traits. We show consistent...... direction of effect for all identified loci and significance for 18 novel and for 5 interaction loci in an independent study sample. These loci highlight novel biological functions, including response to oxidative stress, addictive behaviour, and regulatory functions emphasizing the importance of accounting...

  15. Genome-wide Association Study Identifies Five Susceptibility Loci for Follicular Lymphoma outside the HLA Region

    NARCIS (Netherlands)

    Skibola, Christine F.; Berndt, Sonja I.; Vijai, Joseph; Conde, Lucia; Wang, Zhaoming; Yeager, Meredith; de Bakker, Paul I. W.; Birmann, Brenda M.; Vajdic, Claire M.; Foo, Jia-Nee; Bracci, Paige M.; Vermeulen, Roel C. H.; Slager, Susan L.; de Sanjose, Silvia; Wang, Sophia S.; Linet, Martha S.; Salles, Gilles; Lan, Qing; Severi, Gianluca; Hjalgrim, Henrik; Lightfoot, Tracy; Melbye, Mads; Gu, Jian; Ghesquieres, Herve; Link, Brian K.; Morton, Lindsay M.; Holly, Elizabeth A.; Smith, Alex; Tinker, Lesley F.; Teras, Lauren R.; Kricker, Anne; Becker, Nikolaus; Purdue, Mark P.; Spinelli, John J.; Zhang, Yawei; Giles, Graham G.; Vineis, Paolo; Monnereau, Alain; Bertrand, Kimberly A.; Albanes, Demetrius; Zeleniuch-Jacquotte, Anne; Gabbas, Attilio; Chung, Charles C.; Burdett, Laurie; Hutchinson, Amy; Lawrence, Charles; Montalvan, Rebecca; Liang, Liming; Huang, Jinyan; Ma, Baoshan; Liu, Jianjun; Adami, Hans-Olov; Glimelius, Bengt; Ye, Yuanqing; Nowakowski, Grzegorz S.; Dogan, Ahmet; Thompson, Carrie A.; Habermann, Thomas M.; Novak, Anne J.; Liebow, Mark; Witzig, Thomas E.; Weiner, George J.; Schenk, Maryjean; Hartge, Patricia; De Roos, Anneclaire J.; Cozen, Wendy; Zhi, Degui; Akers, Nicholas K.; Riby, Jacques; Smith, Martyn T.; Lacher, Mortimer; Villano, Danylo J.; Maria, Ann; Roman, Eve; Kane, Eleanor; Jackson, Rebecca D.; North, Kari E.; Diver, W. Ryan; Turner, Jenny; Armstrong, Bruce K.; Benavente, Yolanda; Boffetta, Paolo; Brennan, Paul; Foretova, Lenka; Maynadie, Marc; Staines, Anthony; McKay, James; Brooks-Wilson, Angela R.; Zheng, Tongzhang; Holford, Theodore R.; Chamosa, Saioa; Kaaks, Rudolph; Kelly, Rachel S.; Ohlsson, Bodil; Travis, Ruth C.; Weiderpass, Elisabete; Clave, Jacqueline; Giovannucci, Edward; Kraft, Peter; Virtamo, Jarmo; Mazza, Patrizio; Cocco, Pierluigi; Ennas, Maria Grazia; Chiu, Brian C. H.; Fraumeni, Joseph R.; Nieters, Alexandra; Offit, Kenneth; Wu, Xifeng; Cerhan, James R.; Smedby, Karin E.; Chanock, Stephen J.; Rothman, Nathaniel

    2014-01-01

    Genome-wide association studies (GWASs) of follicular lymphoma (FL) have previously identified human leukocyte antigen (HLA) gene variants. To identify additional FL susceptibility loci, we conducted a large-scale two-stage GWAS in 4,523 case subjects and 13,344 control subjects of European

  16. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  17. snpTree - a web-server to identify and construct SNP trees from whole genome sequence data

    DEFF Research Database (Denmark)

    Leekitcharoenphon, Pimlapas; Kaas, Rolf Sommer; Thomsen, Martin Christen Frølund

    2012-01-01

    identify SNPs and construct phylogenetic trees from WGS as well as from assembled genomes or contigs. WGS data in fastq format are aligned to reference genomes by BWA while contigs in fasta format are processed by Nucmer. SNPs are concatenated based on position on reference genome and a tree is constructed...... to differentiate and classify isolates. One of the successfully and broadly used methods is analysis of single nucletide polymorphisms (SNPs). Currently, there are different tools and methods to identify SNPs including various options and cut-off values. Furthermore, all current methods require bioinformatic...... skills. Thus, we lack a standard and simple automatic tool to determine SNPs and construct phylogenetic tree from WGS data. Results Here we introduce snpTree, a server for online-automatic SNPs analysis. This tool is composed of different SNPs analysis suites, perl and python scripts. snpTree can...

  18. A multi-sample based method for identifying common CNVs in normal human genomic structure using high-resolution aCGH data.

    Directory of Open Access Journals (Sweden)

    Chihyun Park

    Full Text Available BACKGROUND: It is difficult to identify copy number variations (CNV in normal human genomic data due to noise and non-linear relationships between different genomic regions and signal intensity. A high-resolution array comparative genomic hybridization (aCGH containing 42 million probes, which is very large compared to previous arrays, was recently published. Most existing CNV detection algorithms do not work well because of noise associated with the large amount of input data and because most of the current methods were not designed to analyze normal human samples. Normal human genome analysis often requires a joint approach across multiple samples. However, the majority of existing methods can only identify CNVs from a single sample. METHODOLOGY AND PRINCIPAL FINDINGS: We developed a multi-sample-based genomic variations detector (MGVD that uses segmentation to identify common breakpoints across multiple samples and a k-means-based clustering strategy. Unlike previous methods, MGVD simultaneously considers multiple samples with different genomic intensities and identifies CNVs and CNV zones (CNVZs; CNVZ is a more precise measure of the location of a genomic variant than the CNV region (CNVR. CONCLUSIONS AND SIGNIFICANCE: We designed a specialized algorithm to detect common CNVs from extremely high-resolution multi-sample aCGH data. MGVD showed high sensitivity and a low false discovery rate for a simulated data set, and outperformed most current methods when real, high-resolution HapMap datasets were analyzed. MGVD also had the fastest runtime compared to the other algorithms evaluated when actual, high-resolution aCGH data were analyzed. The CNVZs identified by MGVD can be used in association studies for revealing relationships between phenotypes and genomic aberrations. Our algorithm was developed with standard C++ and is available in Linux and MS Windows format in the STL library. It is freely available at: http://embio.yonsei.ac.kr/~Park/mgvd.php.

  19. Omics Approaches for Identifying Physiological Adaptations to Genome Instability in Aging.

    Science.gov (United States)

    Edifizi, Diletta; Schumacher, Björn

    2017-11-04

    DNA damage causally contributes to aging and age-related diseases. The declining functioning of tissues and organs during aging can lead to the increased risk of succumbing to aging-associated diseases. Congenital syndromes that are caused by heritable mutations in DNA repair pathways lead to cancer susceptibility and accelerated aging, thus underlining the importance of genome maintenance for withstanding aging. High-throughput mass-spectrometry-based approaches have recently contributed to identifying signalling response networks and gaining a more comprehensive understanding of the physiological adaptations occurring upon unrepaired DNA damage. The insulin-like signalling pathway has been implicated in a DNA damage response (DDR) network that includes epidermal growth factor (EGF)-, AMP-activated protein kinases (AMPK)- and the target of rapamycin (TOR)-like signalling pathways, which are known regulators of growth, metabolism, and stress responses. The same pathways, together with the autophagy-mediated proteostatic response and the decline in energy metabolism have also been found to be similarly regulated during natural aging, suggesting striking parallels in the physiological adaptation upon persistent DNA damage due to DNA repair defects and long-term low-level DNA damage accumulation occurring during natural aging. These insights will be an important starting point to study the interplay between signalling networks involved in progeroid syndromes that are caused by DNA repair deficiencies and to gain new understanding of the consequences of DNA damage in the aging process.

  20. The genome sequence of the most widely cultivated cacao type and its use to identify candidate genes regulating pod color

    Science.gov (United States)

    2013-01-01

    Background Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. Results We describe the sequencing and assembly of the genome of Theobroma cacao L. cultivar Matina 1-6. The genome of the Matina 1-6 cultivar is 445 Mbp, which is significantly larger than a sequenced Criollo cultivar, and more typical of other cultivars. The chromosome-scale assembly, version 1.1, contains 711 scaffolds covering 346.0 Mbp, with a contig N50 of 84.4 kbp, a scaffold N50 of 34.4 Mbp, and an evidence-based gene set of 29,408 loci. Version 1.1 has 10x the scaffold N50 and 4x the contig N50 as Criollo, and includes 111 Mb more anchored sequence. The version 1.1 assembly has 4.4% gap sequence, while Criollo has 10.9%. Through a combination of haplotype, association mapping and gene expression analyses, we leverage this robust reference genome to identify a promising candidate gene responsible for pod color variation. We demonstrate that green/red pod color in cacao is likely regulated by the R2R3 MYB transcription factor TcMYB113, homologs of which determine pigmentation in Rosaceae, Solanaceae, and Brassicaceae. One SNP within the target site for a highly conserved trans-acting siRNA in dicots, found within TcMYB113, seems to affect transcript levels of this gene and therefore pod color variation. Conclusions We report a high-quality sequence and annotation of Theobroma cacao L. and demonstrate its utility in identifying candidate genes regulating traits. PMID:23731509

  1. Comparative genomics identifies distinct lineages of S. Enteritidis from Queensland, Australia.

    Science.gov (United States)

    Graham, Rikki M A; Hiley, Lester; Rathnayake, Irani U; Jennison, Amy V

    2018-01-01

    Salmonella enterica is a major cause of gastroenteritis and foodborne illness in Australia where notification rates in the state of Queensland are the highest in the country. S. Enteritidis is among the five most common serotypes reported in Queensland and it is a priority for epidemiological surveillance due to concerns regarding its emergence in Australia. Using whole genome sequencing, we have analysed the genomic epidemiology of 217 S. Enteritidis isolates from Queensland, and observed that they fall into three distinct clades, which we have differentiated as Clades A, B and C. Phage types and MLST sequence types differed between the clades and comparative genomic analysis has shown that each has a unique profile of prophage and genomic islands. Several of the phage regions present in the S. Enteritidis reference strain P125109 were absent in Clades A and C, and these clades also had difference in the presence of pathogenicity islands, containing complete SPI-6 and SPI-19 regions, while P125109 does not. Antimicrobial resistance markers were found in 39 isolates, all but one of which belonged to Clade B. Phylogenetic analysis of the Queensland isolates in the context of 170 international strains showed that Queensland Clade B isolates group together with the previously identified global clade, while the other two clades are distinct and appear largely restricted to Australia. Locally sourced environmental isolates included in this analysis all belonged to Clades A and C, which is consistent with the theory that these clades are a source of locally acquired infection, while Clade B isolates are mostly travel related.

  2. Comparative genomic analysis of Helicobacter pylori from Malaysia identifies three distinct lineages suggestive of differential evolution.

    Science.gov (United States)

    Kumar, Narender; Mariappan, Vanitha; Baddam, Ramani; Lankapalli, Aditya K; Shaik, Sabiha; Goh, Khean-Lee; Loke, Mun Fai; Perkins, Tim; Benghezal, Mohammed; Hasnain, Seyed E; Vadivelu, Jamuna; Marshall, Barry J; Ahmed, Niyaz

    2015-01-01

    The discordant prevalence of Helicobacter pylori and its related diseases, for a long time, fostered certain enigmatic situations observed in the countries of the southern world. Variation in H. pylori infection rates and disease outcomes among different populations in multi-ethnic Malaysia provides a unique opportunity to understand dynamics of host-pathogen interaction and genome evolution. In this study, we extensively analyzed and compared genomes of 27 Malaysian H. pylori isolates and identified three major phylogeographic lineages: hspEastAsia, hpEurope and hpSouthIndia. The analysis of the virulence genes within the core genome, however, revealed a comparable pathogenic potential of the strains. In addition, we identified four genes limited to strains of East-Asian lineage. Our analyses identified a few strain-specific genes encoding restriction modification systems and outlined 311 core genes possibly under differential evolutionary constraints, among the strains representing different ethnic groups. The cagA and vacA genes also showed variations in accordance with the host genetic background of the strains. Moreover, restriction modification genes were found to be significantly enriched in East-Asian strains. An understanding of these variations in the genome content would provide significant insights into various adaptive and host modulation strategies harnessed by H. pylori to effectively persist in a host-specific manner. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Whole-genome sequencing identifies recurrent mutations in chronic lymphocytic leukaemia

    Science.gov (United States)

    Puente, Xose S.; Pinyol, Magda; Quesada, Víctor; Conde, Laura; Ordóñez, Gonzalo R.; Villamor, Neus; Escaramis, Georgia; Jares, Pedro; Beà, Sílvia; González-Díaz, Marcos; Bassaganyas, Laia; Baumann, Tycho; Juan, Manel; López-Guerra, Mónica; Colomer, Dolors; Tubío, José M. C.; López, Cristina; Navarro, Alba; Tornador, Cristian; Aymerich, Marta; Rozman, María; Hernández, Jesús M.; Puente, Diana A.; Freije, José M. P.; Velasco, Gloria; Gutiérrez-Fernández, Ana; Costa, Dolors; Carrió, Anna; Guijarro, Sara; Enjuanes, Anna; Hernández, Lluís; Yagüe, Jordi; Nicolás, Pilar; Romeo-Casabona, Carlos M.; Himmelbauer, Heinz; Castillo, Ester; Dohm, Juliane C.; de Sanjosé, Silvia; Piris, Miguel A.; de Alava, Enrique; Miguel, Jesús San; Royo, Romina; Gelpí, Josep L.; Torrents, David; Orozco, Modesto; Pisano, David G.; Valencia, Alfonso; Guigó, Roderic; Bayés, Mónica; Heath, Simon; Gut, Marta; Klatt, Peter; Marshall, John; Raine, Keiran; Stebbings, Lucy A.; Futreal, P. Andrew; Stratton, Michael R.; Campbell, Peter J.; Gut, Ivo; López-Guillermo, Armando; Estivill, Xavier; Montserrat, Emili; López-Otín, Carlos; Campo, Elías

    2012-01-01

    Chronic lymphocytic leukaemia (CLL), the most frequent leukaemia in adults in Western countries, is a heterogeneous disease with variable clinical presentation and evolution1,2. Two major molecular subtypes can be distinguished, characterized respectively by a high or low number of somatic hypermutations in the variable region of immunoglobulin genes3,4. The molecular changes leading to the pathogenesis of the disease are still poorly understood. Here we performed whole-genome sequencing of four cases of CLL and identified 46 somatic mutations that potentially affect gene function. Further analysis of these mutations in 363 patients with CLL identified four genes that are recurrently mutated: notch 1 (NOTCH1), exportin 1 (XPO1), myeloid differentiation primary response gene 88 (MYD88) and kelch-like 6 (KLHL6). Mutations in MYD88 and KLHL6 are predominant in cases of CLL with mutated immunoglobulin genes, whereas NOTCH1 and XPO1 mutations are mainly detected in patients with unmutated immunoglobulins. The patterns of somatic mutation, supported by functional and clinical analyses, strongly indicate that the recurrent NOTCH1, MYD88 and XPO1 mutations are oncogenic changes that contribute to the clinical evolution of the disease. To our knowledge, this is the first comprehensive analysis of CLL combining whole-genome sequencing with clinical characteristics and clinical outcomes. It highlights the usefulness of this approach for the identification of clinically relevant mutations in cancer. PMID:21642962

  4. Comparative Genomics Reveals High Genomic Diversity in the Genus Photobacterium

    DEFF Research Database (Denmark)

    Machado, Henrique; Gram, Lone

    2017-01-01

    was widespread and abundant in the genus, suggesting a role in genomic evolution. The high genetic variability and indications of genetic exchange make it difficult to elucidate genome evolutionary paths and raise the awareness of the roles of foreign DNA in the genomic evolution of environmental organisms.......Vibrionaceae is a large marine bacterial family, which can constitute up to 50% of the prokaryotic population in marine waters. Photobacterium is the second largest genus in the family and we used comparative genomics on 35 strains representing 16 of the 28 species described so far, to understand...... the genomic diversity present in the Photobacterium genus. Such understanding is important for ecophysiology studies of the genus. We used whole genome sequences to evaluate phylogenetic relationships using several analyses (16S rRNA, MLSA, fur, amino-acid usage, ANI), which allowed us to identify two...

  5. BLAST screening of chlamydial genomes to identify signature proteins that are unique for the Chlamydiales, Chlamydiaceae, Chlamydophila and Chlamydia groups of species

    Directory of Open Access Journals (Sweden)

    Gupta Radhey S

    2006-01-01

    Full Text Available Abstract Background Chlamydiae species are of much importance from a clinical viewpoint. Their diversity both in terms of their numbers as well as clinical involvement are presently believed to be significantly underestimated. The obligate intracellular nature of chlamydiae has also limited their genetic and biochemical studies. Thus, it is of importance to develop additional means for their identification and characterization. Results We have carried out analyses of available chlamydiae genomes to identify sets of unique proteins that are either specific for all Chlamydiales genomes, or different Chlamydiaceae family members, or members of the Chlamydia and Chlamydophila genera, or those unique to Protochlamydia amoebophila, but which are not found in any other bacteria. In total, 59 Chlamydiales-specific proteins, 79 Chlamydiaceae-specific proteins, 20 proteins each that are specific for both Chlamydia and Chlamydophila and 445 ORFs that are Protochlamydia-specific were identified. Additionally, 33 cases of possible gene loss or lateral gene transfer were also detected. Conclusion The identified chlamydiae-lineage specific proteins, many of which are highly conserved, provide novel biomarkers that should prove of much value in the diagnosis of these bacteria and in exploration of their prevalence and diversity. These conserved protein sequences (CPSs also provide novel therapeutic targets for drugs that are specific for these bacteria. Lastly, functional studies on these chlamydiae or chlamydiae subgroup-specific proteins should lead to important insights into lineage-specific adaptations with regards to development, infectivity and pathogenicity.

  6. Genome-wide profiling of HPV integration in cervical cancer identifies clustered genomic hot spots and a potential microhomology-mediated integration mechanism

    DEFF Research Database (Denmark)

    Hu, Zheng; Zhu, Da; Wang, Wei

    2015-01-01

    Human papillomavirus (HPV) integration is a key genetic event in cervical carcinogenesis1. By conducting whole-genome sequencing and high-throughput viral integration detection, we identified 3,667 HPV integration breakpoints in 26 cervical intraepithelial neoplasias, 104 cervical carcinomas and ...

  7. Large-scale meta-analysis of genome-wide association data identifies six new risk loci for Parkinson's disease

    NARCIS (Netherlands)

    Nalls, Mike A.; Pankratz, Nathan; Lill, Christina M.; Do, Chuong B.; Hernandez, Dena G.; Saad, Mohamad; DeStefano, Anita L.; Kara, Eleanna; Bras, Jose; Sharma, Manu; Schulte, Claudia; Keller, Margaux F.; Arepalli, Sampath; Letson, Christopher; Edsall, Connor; Stefansson, Hreinn; Liu, Xinmin; Pliner, Hannah; Lee, Joseph H.; Cheng, Rong; Ikram, M. Arfan; Ioannidis, John P. A.; Hadjigeorgiou, Georgios M.; Bis, Joshua C.; Martinez, Maria; Perlmutter, Joel S.; Goate, Alison; Marder, Karen; Fiske, Brian; Sutherland, Margaret; Xiromerisiou, Georgia; Myers, Richard H.; Clark, Lorraine N.; Stefansson, Kari; Hardy, John A.; Heutink, Peter; Chen, Honglei; Wood, Nicholas W.; Houlden, Henry; Payami, Haydeh; Brice, Alexis; Scott, William K.; Gasser, Thomas; Bertram, Lars; Eriksson, Nicholas; Foroud, Tatiana; Singleton, Andrew B.; Plagnol, Vincent; Sheerin, Una-Marie; Simón-Sánchez, Javier; Lesage, Suzanne; Sveinbjörnsdóttir, Sigurlaug; Barker, Roger; Ben-Shlomo, Yoav; Berendse, Henk W.; Berg, Daniela; Bhatia, Kailash; de Bie, Rob M. A.; Biffi, Alessandro; Bloem, Bas; Bochdanovits, Zoltan; Bonin, Michael; Bras, Jose M.; Brockmann, Kathrin; Brooks, Janet; Burn, David J.; Charlesworth, Gavin; Chinnery, Patrick F.; Chong, Sean; Clarke, Carl E.; Cookson, Mark R.; Cooper, J. Mark; Corvol, Jean Christophe; Counsell, Carl; Damier, Philippe; Dartigues, Jean-François; Deloukas, Panos; Deuschl, Günther; Dexter, David T.; van Dijk, Karin D.; Dillman, Allissa; Durif, Frank; Dürr, Alexandra; Edkins, Sarah; Evans, Jonathan R.; Foltynie, Thomas; Dong, Jing; Gardner, Michelle; Gibbs, J. Raphael; Gray, Emma; Guerreiro, Rita; Harris, Clare; van Hilten, Jacobus J.; Hofman, Albert; Hollenbeck, Albert; Holton, Janice; Hu, Michele; Huang, Xuemei; Wurster, Isabel; Mätzler, Walter; Hudson, Gavin; Hunt, Sarah E.; Huttenlocher, Johanna; Illig, Thomas; Jónsson, Pálmi V.; Lambert, Jean-Charles; Langford, Cordelia; Lees, Andrew; Lichtner, Peter; Limousin, Patricia; Lopez, Grisel; Lorenz, Delia; McNeill, Alisdair; Moorby, Catriona; Moore, Matthew; Morris, Huw R.; Morrison, Karen E.; Mudanohwo, Ese; O'Sullivan, Sean S.; Pearson, Justin; Pétursson, Hjörvar; Pollak, Pierre; Post, Bart; Potter, Simon; Ravina, Bernard; Revesz, Tamas; Riess, Olaf; Rivadeneira, Fernando; Rizzu, Patrizia; Ryten, Mina; Sawcer, Stephen; Schapira, Anthony; Scheffer, Hans; Shaw, Karen; Shoulson, Ira; Sidransky, Ellen; Smith, Colin; Spencer, Chris C. A.; Stefánsson, Hreinn; Bettella, Francesco; Stockton, Joanna D.; Strange, Amy; Talbot, Kevin; Tanner, Carlie M.; Tashakkori-Ghanbaria, Avazeh; Tison, François; Trabzuni, Daniah; Traynor, Bryan J.; Uitterlinden, André G.; Velseboer, Daan; Vidailhet, Marie; Walker, Robert; van de Warrenburg, Bart; Wickremaratchi, Mirdhu; Williams, Nigel; Williams-Gray, Caroline H.; Winder-Rhodes, Sophie; Stefánsson, Kári; Hardy, John; Factor, S.; Higgins, D.; Evans, S.; Shill, H.; Stacy, M.; Danielson, J.; Marlor, L.; Williamson, K.; Jankovic, J.; Hunter, C.; Simon, D.; Ryan, P.; Scollins, L.; Saunders-Pullman, R.; Boyar, K.; Costan-Toth, C.; Ohmann, E.; Sudarsky, L.; Joubert, C.; Friedman, J.; Chou, K.; Fernandez, H.; Lannon, M.; Galvez-Jimenez, N.; Podichetty, A.; Thompson, K.; Lewitt, P.; Deangelis, M.; O'Brien, C.; Seeberger, L.; Dingmann, C.; Judd, D.; Marder, K.; Fraser, J.; Harris, J.; Bertoni, J.; Peterson, C.; Rezak, M.; Medalle, G.; Chouinard, S.; Panisset, M.; Hall, J.; Poiffaut, H.; Calabrese, V.; Roberge, P.; Wojcieszek, J.; Belden, J.; Jennings, D.; Marek, K.; Mendick, S.; Reich, S.; Dunlop, B.; Jog, M.; Horn, C.; Uitti, R.; Turk, M.; Ajax, T.; Mannetter, J.; Sethi, K.; Carpenter, J.; Dill, B.; Hatch, L.; Ligon, K.; Narayan, S.; Blindauer, K.; Abou-Samra, K.; Petit, J.; Elmer, L.; Aiken, E.; Davis, K.; Schell, C.; Wilson, S.; Velickovic, M.; Koller, W.; Phipps, S.; Feigin, A.; Gordon, M.; Hamann, J.; Licari, E.; Marotta-Kollarus, M.; Shannon, B.; Winnick, R.; Simuni, T.; Videnovic, A.; Kaczmarek, A.; Williams, K.; Wolff, M.; Rao, J.; Cook, M.; Fernandez, M.; Kostyk, S.; Hubble, J.; Campbell, A.; Reider, C.; Seward, A.; Camicioli, R.; Carter, J.; Nutt, J.; Andrews, P.; Morehouse, S.; Stone, C.; Mendis, T.; Grimes, D.; Alcorn-Costa, C.; Gray, P.; Haas, K.; Vendette, J.; Sutton, J.; Hutchinson, B.; Young, J.; Rajput, A.; Klassen, L.; Shirley, T.; Manyam, B.; Simpson, P.; Whetteckey, J.; Wulbrecht, B.; Truong, D.; Pathak, M.; Frei, K.; Luong, N.; Tra, T.; Tran, A.; Vo, J.; Lang, A.; Kleiner- Fisman, G.; Nieves, A.; Johnston, L.; So, J.; Podskalny, G.; Giffin, L.; Atchison, P.; Allen, C.; Martin, W.; Wieler, M.; Suchowersky, O.; Furtado, S.; Klimek, M.; Hermanowicz, N.; Niswonger, S.; Shults, C.; Fontaine, D.; Aminoff, M.; Christine, C.; Diminno, M.; Hevezi, J.; Dalvi, A.; Kang, U.; Richman, J.; Uy, S.; Sahay, A.; Gartner, M.; Schwieterman, D.; Hall, D.; Leehey, M.; Culver, S.; Derian, T.; Demarcaida, T.; Thurlow, S.; Rodnitzky, R.; Dobson, J.; Lyons, K.; Pahwa, R.; Gales, T.; Thomas, S.; Shulman, L.; Weiner, W.; Dustin, K.; Singer, C.; Zelaya, L.; Tuite, P.; Hagen, V.; Rolandelli, S.; Schacherer, R.; Kosowicz, J.; Gordon, P.; Werner, J.; Serrano, C.; Roque, S.; Kurlan, R.; Berry, D.; Gardiner, I.; Hauser, R.; Sanchez-Ramos, J.; Zesiewicz, T.; Delgado, H.; Price, K.; Rodriguez, P.; Wolfrath, S.; Pfeiffer, R.; Davis, L.; Pfeiffer, B.; Dewey, R.; Hayward, B.; Johnson, A.; Meacham, M.; Estes, B.; Walker, F.; Hunt, V.; O'Neill, C.; Racette, B.; Swisher, L.; Dijamco, Cheri; Conley, Emily Drabant; Dorfman, Elizabeth; Tung, Joyce Y.; Hinds, David A.; Mountain, Joanna L.; Wojcicki, Anne; Lew, M.; Klein, C.; Golbe, L.; Growdon, J.; Wooten, G. F.; Watts, R.; Guttman, M.; Goldwurm, S.; Saint-Hilaire, M. H.; Baker, K.; Litvan, I.; Nicholson, G.; Nance, M.; Drasby, E.; Isaacson, S.; Burn, D.; Pramstaller, P.; Al-hinti, J.; Moller, A.; Sherman, S.; Roxburgh, R.; Slevin, J.; Perlmutter, J.; Mark, M. H.; Huggins, N.; Pezzoli, G.; Massood, T.; Itin, I.; Corbett, A.; Chinnery, P.; Ostergaard, K.; Snow, B.; Cambi, F.; Kay, D.; Samii, A.; Agarwal, P.; Roberts, J. W.; Higgins, D. S.; Molho, Eric; Rosen, Ami; Montimurro, J.; Martinez, E.; Griffith, A.; Kusel, V.; Yearout, D.; Zabetian, C.; Clark, L. N.; Liu, X.; Lee, J. H.; Taub, R. Cheng; Louis, E. D.; Cote, L. J.; Waters, C.; Ford, B.; Fahn, S.; Vance, Jeffery M.; Beecham, Gary W.; Martin, Eden R.; Nuytemans, Karen; Pericak-Vance, Margaret A.; Haines, Jonathan L.; DeStefano, Anita; Seshadri, Sudha; Choi, Seung Hoan; Frank, Samuel; Psaty, Bruce M.; Rice, Kenneth; Longstreth, W. T.; Ton, Thanh G. N.; Jain, Samay; van Duijn, Cornelia M.; Verlinden, Vincent J.; Koudstaal, Peter J.; Singleton, Andrew; Cookson, Mark; Hernandez, Dena; Nalls, Michael; Zonderman, Alan; Ferrucci, Luigi; Johnson, Robert; Longo, Dan; O'Brien, Richard; Traynor, Bryan; Troncoso, Juan; van der Brug, Marcel; Zielke, Ronald; Weale, Michael; Ramasamy, Adaikalavan; Dardiotis, Efthimios; Tsimourtou, Vana; Spanaki, Cleanthe; Plaitakis, Andreas; Bozi, Maria; Stefanis, Leonidas; Vassilatis, Dimitris; Koutsis, Georgios; Panas, Marios; Lunnon, Katie; Lupton, Michelle; Powell, John; Parkkinen, Laura; Ansorge, Olaf

    2014-01-01

    We conducted a meta-analysis of Parkinson's disease genome-wide association studies using a common set of 7,893,274 variants across 13,708 cases and 95,282 controls. Twenty-six loci were identified as having genome-wide significant association; these and 6 additional previously reported loci were

  8. Nine Loci for Ocular Axial Length Identified through Genome-wide Association Studies, Including Shared Loci with Refractive Error

    Science.gov (United States)

    Cheng, Ching-Yu; Schache, Maria; Ikram, M. Kamran; Young, Terri L.; Guggenheim, Jeremy A.; Vitart, Veronique; MacGregor, Stuart; Verhoeven, Virginie J.M.; Barathi, Veluchamy A.; Liao, Jiemin; Hysi, Pirro G.; Bailey-Wilson, Joan E.; St. Pourcain, Beate; Kemp, John P.; McMahon, George; Timpson, Nicholas J.; Evans, David M.; Montgomery, Grant W.; Mishra, Aniket; Wang, Ya Xing; Wang, Jie Jin; Rochtchina, Elena; Polasek, Ozren; Wright, Alan F.; Amin, Najaf; van Leeuwen, Elisabeth M.; Wilson, James F.; Pennell, Craig E.; van Duijn, Cornelia M.; de Jong, Paulus T.V.M.; Vingerling, Johannes R.; Zhou, Xin; Chen, Peng; Li, Ruoying; Tay, Wan-Ting; Zheng, Yingfeng; Chew, Merwyn; Rahi, Jugnoo S.; Hysi, Pirro G.; Yoshimura, Nagahisa; Yamashiro, Kenji; Miyake, Masahiro; Delcourt, Cécile; Maubaret, Cecilia; Williams, Cathy; Guggenheim, Jeremy A.; Northstone, Kate; Ring, Susan M.; Davey-Smith, George; Craig, Jamie E.; Burdon, Kathryn P.; Fogarty, Rhys D.; Iyengar, Sudha K.; Igo, Robert P.; Chew, Emily; Janmahasathian, Sarayut; Iyengar, Sudha K.; Igo, Robert P.; Chew, Emily; Janmahasathian, Sarayut; Stambolian, Dwight; Wilson, Joan E. Bailey; MacGregor, Stuart; Lu, Yi; Jonas, Jost B.; Xu, Liang; Saw, Seang-Mei; Baird, Paul N.; Rochtchina, Elena; Mitchell, Paul; Wang, Jie Jin; Jonas, Jost B.; Nangia, Vinay; Hayward, Caroline; Wright, Alan F.; Vitart, Veronique; Polasek, Ozren; Campbell, Harry; Vitart, Veronique; Rudan, Igor; Vatavuk, Zoran; Vitart, Veronique; Paterson, Andrew D.; Hosseini, S. Mohsen; Iyengar, Sudha K.; Igo, Robert P.; Fondran, Jeremy R.; Young, Terri L.; Feng, Sheng; Verhoeven, Virginie J.M.; Klaver, Caroline C.; van Duijn, Cornelia M.; Metspalu, Andres; Haller, Toomas; Mihailov, Evelin; Pärssinen, Olavi; Wedenoja, Juho; Wilson, Joan E. Bailey; Wojciechowski, Robert; Baird, Paul N.; Schache, Maria; Pfeiffer, Norbert; Höhn, René; Pang, Chi Pui; Chen, Peng; Meitinger, Thomas; Oexle, Konrad; Wegner, Aharon; Yoshimura, Nagahisa; Yamashiro, Kenji; Miyake, Masahiro; Pärssinen, Olavi; Yip, Shea Ping; Ho, Daniel W.H.; Pirastu, Mario; Murgia, Federico; Portas, Laura; Biino, Genevra; Wilson, James F.; Fleck, Brian; Vitart, Veronique; Stambolian, Dwight; Wilson, Joan E. Bailey; Hewitt, Alex W.; Ang, Wei; Verhoeven, Virginie J.M.; Klaver, Caroline C.; van Duijn, Cornelia M.; Saw, Seang-Mei; Wong, Tien-Yin; Teo, Yik-Ying; Fan, Qiao; Cheng, Ching-Yu; Zhou, Xin; Ikram, M. Kamran; Saw, Seang-Mei; Teo, Yik-Ying; Fan, Qiao; Cheng, Ching-Yu; Zhou, Xin; Ikram, M. Kamran; Saw, Seang-Mei; Wong, Tien-Yin; Teo, Yik-Ying; Fan, Qiao; Cheng, Ching-Yu; Zhou, Xin; Ikram, M. Kamran; Saw, Seang-Mei; Wong, Tien-Yin; Teo, Yik-Ying; Fan, Qiao; Cheng, Ching-Yu; Zhou, Xin; Ikram, M. Kamran; Saw, Seang-Mei; Tai, E-Shyong; Teo, Yik-Ying; Fan, Qiao; Cheng, Ching-Yu; Zhou, Xin; Ikram, M. Kamran; Saw, Seang-Mei; Teo, Yik-Ying; Fan, Qiao; Cheng, Ching-Yu; Zhou, Xin; Ikram, M. Kamran; Mackey, David A.; MacGregor, Stuart; Hammond, Christopher J.; Hysi, Pirro G.; Deangelis, Margaret M.; Morrison, Margaux; Zhou, Xiangtian; Chen, Wei; Paterson, Andrew D.; Hosseini, S. Mohsen; Mizuki, Nobuhisa; Meguro, Akira; Lehtimäki, Terho; Mäkelä, Kari-Matti; Raitakari, Olli; Kähönen, Mika; Burdon, Kathryn P.; Craig, Jamie E.; Iyengar, Sudha K.; Igo, Robert P.; Lass, Jonathan H.; Reinhart, William; Belin, Michael W.; Schultze, Robert L.; Morason, Todd; Sugar, Alan; Mian, Shahzad; Soong, Hunson Kaz; Colby, Kathryn; Jurkunas, Ula; Yee, Richard; Vital, Mark; Alfonso, Eduardo; Karp, Carol; Lee, Yunhee; Yoo, Sonia; Hammersmith, Kristin; Cohen, Elisabeth; Laibson, Peter; Rapuano, Christopher; Ayres, Brandon; Croasdale, Christopher; Caudill, James; Patel, Sanjay; Baratz, Keith; Bourne, William; Maguire, Leo; Sugar, Joel; Tu, Elmer; Djalilian, Ali; Mootha, Vinod; McCulley, James; Bowman, Wayne; Cavanaugh, H. Dwight; Verity, Steven; Verdier, David; Renucci, Ann; Oliva, Matt; Rotkis, Walter; Hardten, David R.; Fahmy, Ahmad; Brown, Marlene; Reeves, Sherman; Davis, Elizabeth A.; Lindstrom, Richard; Hauswirth, Scott; Hamilton, Stephen; Lee, W. Barry; Price, Francis; Price, Marianne; Kelly, Kathleen; Peters, Faye; Shaughnessy, Michael; Steinemann, Thomas; Dupps, B.J.; Meisler, David M.; Mifflin, Mark; Olson, Randal; Aldave, Anthony; Holland, Gary; Mondino, Bartly J.; Rosenwasser, George; Gorovoy, Mark; Dunn, Steven P.; Heidemann, David G.; Terry, Mark; Shamie, Neda; Rosenfeld, Steven I.; Suedekum, Brandon; Hwang, David; Stone, Donald; Chodosh, James; Galentine, Paul G.; Bardenstein, David; Goddard, Katrina; Chin, Hemin; Mannis, Mark; Varma, Rohit; Borecki, Ingrid; Chew, Emily Y.; Haller, Toomas; Mihailov, Evelin; Metspalu, Andres; Wedenoja, Juho; Simpson, Claire L.; Wojciechowski, Robert; Höhn, René; Mirshahi, Alireza; Zeller, Tanja; Pfeiffer, Norbert; Lackner, Karl J.; Donnelly, Peter; Barroso, Ines; Blackwell, Jenefer M.; Bramon, Elvira; Brown, Matthew A.; Casas, Juan P.; Corvin, Aiden; Deloukas, Panos; Duncanson, Audrey; Jankowski, Janusz; Markus, Hugh S.; Mathew, Christopher G.; Palmer, Colin N.A.; Plomin, Robert; Rautanen, Anna; Sawcer, Stephen J.; Trembath, Richard C.; Viswanathan, Ananth C.; Wood, Nicholas W.; Spencer, Chris C.A.; Band, Gavin; Bellenguez, Céline; Freeman, Colin; Hellenthal, Garrett; Giannoulatou, Eleni; Pirinen, Matti; Pearson, Richard; Strange, Amy; Su, Zhan; Vukcevic, Damjan; Donnelly, Peter; Langford, Cordelia; Hunt, Sarah E.; Edkins, Sarah; Gwilliam, Rhian; Blackburn, Hannah; Bumpstead, Suzannah J.; Dronov, Serge; Gillman, Matthew; Gray, Emma; Hammond, Naomi; Jayakumar, Alagurevathi; McCann, Owen T.; Liddle, Jennifer; Potter, Simon C.; Ravindrarajah, Radhi; Ricketts, Michelle; Waller, Matthew; Weston, Paul; Widaa, Sara; Whittaker, Pamela; Barroso, Ines; Deloukas, Panos; Mathew, Christopher G.; Blackwell, Jenefer M.; Brown, Matthew A.; Corvin, Aiden; Spencer, Chris C.A.; Bettecken, Thomas; Meitinger, Thomas; Oexle, Konrad; Pirastu, Mario; Portas, Laura; Nag, Abhishek; Williams, Katie M.; Yonova-Doing, Ekaterina; Klein, Ronald; Klein, Barbara E.; Hosseini, S. Mohsen; Paterson, Andrew D.; Genuth, S.; Nathan, D.M.; Zinman, B.; Crofford, O.; Crandall, J.; Reid, M.; Brown-Friday, J.; Engel, S.; Sheindlin, J.; Martinez, H.; Shamoon, H.; Engel, H.; Phillips, M.; Gubitosi-Klug, R.; Mayer, L.; Pendegast, S.; Zegarra, H.; Miller, D.; Singerman, L.; Smith-Brewer, S.; Novak, M.; Quin, J.; Dahms, W.; Genuth, Saul; Palmert, M.; Brillon, D.; Lackaye, M.E.; Kiss, S.; Chan, R.; Reppucci, V.; Lee, T.; Heinemann, M.; Whitehouse, F.; Kruger, D.; Jones, J.K.; McLellan, M.; Carey, J.D.; Angus, E.; Thomas, A.; Galprin, A.; Bergenstal, R.; Johnson, M.; Spencer, M.; Morgan, K.; Etzwiler, D.; Kendall, D.; Aiello, Lloyd Paul; Golden, E.; Jacobson, A.; Beaser, R.; Ganda, O.; Hamdy, O.; Wolpert, H.; Sharuk, G.; Arrigg, P.; Schlossman, D.; Rosenzwieg, J.; Rand, L.; Nathan, D.M.; Larkin, M.; Ong, M.; Godine, J.; Cagliero, E.; Lou, P.; Folino, K.; Fritz, S.; Crowell, S.; Hansen, K.; Gauthier-Kelly, C.; Service, J.; Ziegler, G.; Luttrell, L.; Caulder, S.; Lopes-Virella, M.; Colwell, J.; Soule, J.; Fernandes, J.; Hermayer, K.; Kwon, S.; Brabham, M.; Blevins, A.; Parker, J.; Lee, D.; Patel, N.; Pittman, C.; Lindsey, P.; Bracey, M.; Lee, K.; Nutaitis, M.; Farr, A.; Elsing, S.; Thompson, T.; Selby, J.; Lyons, T.; Yacoub-Wasef, S.; Szpiech, M.; Wood, D.; Mayfield, R.; Molitch, M.; Schaefer, B.; Jampol, L.; Lyon, A.; Gill, M.; Strugula, Z.; Kaminski, L.; Mirza, R.; Simjanoski, E.; Ryan, D.; Kolterman, O.; Lorenzi, G.; Goldbaum, M.; Sivitz, W.; Bayless, M.; Counts, D.; Johnsonbaugh, S.; Hebdon, M.; Salemi, P.; Liss, R.; Donner, T.; Gordon, J.; Hemady, R.; Kowarski, A.; Ostrowski, D.; Steidl, S.; Jones, B.; Herman, W.H.; Martin, C.L.; Pop-Busui, R.; Sarma, A.; Albers, J.; Feldman, E.; Kim, K.; Elner, S.; Comer, G.; Gardner, T.; Hackel, R.; Prusak, R.; Goings, L.; Smith, A.; Gothrup, J.; Titus, P.; Lee, J.; Brandle, M.; Prosser, L.; Greene, D.A.; Stevens, M.J.; Vine, A.K.; Bantle, J.; Wimmergren, N.; Cochrane, A.; Olsen, T.; Steuer, E.; Rath, P.; Rogness, B.; Hainsworth, D.; Goldstein, D.; Hitt, S.; Giangiacomo, J.; Schade, D.S.; Canady, J.L.; Chapin, J.E.; Ketai, L.H.; Braunstein, C.S.; Bourne, P.A.; Schwartz, S.; Brucker, A.; Maschak-Carey, B.J.; Baker, L.; Orchard, T.; Silvers, N.; Ryan, C.; Songer, T.; Doft, B.; Olson, S.; Bergren, R.L.; Lobes, L.; Rath, P. Paczan; Becker, D.; Rubinstein, D.; Conrad, P.W.; Yalamanchi, S.; Drash, A.; Morrison, A.; Bernal, M.L.; Vaccaro-Kish, J.; Malone, J.; Pavan, P.R.; Grove, N.; Iyer, M.N.; Burrows, A.F.; Tanaka, E.A.; Gstalder, R.; Dagogo-Jack, S.; Wigley, C.; Ricks, H.; Kitabchi, A.; Murphy, M.B.; Moser, S.; Meyer, D.; Iannacone, A.; Chaum, E.; Yoser, S.; Bryer-Ash, M.; Schussler, S.; Lambeth, H.; Raskin, P.; Strowig, S.; Zinman, B.; Barnie, A.; Devenyi, R.; Mandelcorn, M.; Brent, M.; Rogers, S.; Gordon, A.; Palmer, J.; Catton, S.; Brunzell, J.; Wessells, H.; de Boer, I.H.; Hokanson, J.; Purnell, J.; Ginsberg, J.; Kinyoun, J.; Deeb, S.; Weiss, M.; Meekins, G.; Distad, J.; Van Ottingham, L.; Dupre, J.; Harth, J.; Nicolle, D.; Driscoll, M.; Mahon, J.; Canny, C.; May, M.; Lipps, J.; Agarwal, A.; Adkins, T.; Survant, L.; Pate, R.L.; Munn, G.E.; Lorenz, R.; Feman, S.; White, N.; Levandoski, L.; Boniuk, I.; Grand, G.; Thomas, M.; Joseph, D.D.; Blinder, K.; Shah, G.; Boniuk; Burgess; Santiago, J.; Tamborlane, W.; Gatcomb, P.; Stoessel, K.; Taylor, K.; Goldstein, J.; Novella, S.; Mojibian, H.; Cornfeld, D.; Lima, J.; Bluemke, D.; Turkbey, E.; van der Geest, R.J.; Liu, C.; Malayeri, A.; Jain, A.; Miao, C.; Chahal, H.; Jarboe, R.; Maynard, J.; Gubitosi-Klug, R.; Quin, J.; Gaston, P.; Palmert, M.; Trail, R.; Dahms, W.; Lachin, J.; Cleary, P.; Backlund, J.; Sun, W.; Braffett, B.; Klumpp, K.; Chan, K.; Diminick, L.; Rosenberg, D.; Petty, B.; Determan, A.; Kenny, D.; Rutledge, B.; Younes, Naji; Dews, L.; Hawkins, M.; Cowie, C.; Fradkin, J.; Siebert, C.; Eastman, R.; Danis, R.; Gangaputra, S.; Neill, S.; Davis, M.; Hubbard, L.; Wabers, H.; Burger, M.; Dingledine, J.; Gama, V.; Sussman, R.; Steffes, M.; Bucksa, J.; Nowicki, M.; Chavers, B.; O’Leary, D.; Polak, J.; Harrington, A.; Funk, L.; Crow, R.; Gloeb, B.; Thomas, S.; O’Donnell, C.; Soliman, E.; Zhang, Z.M.; Prineas, R.; Campbell, C.; Ryan, C.; Sandstrom, D.; Williams, T.; Geckle, M.; Cupelli, E.; Thoma, F.; Burzuk, B.; Woodfill, T.; Low, P.; Sommer, C.; Nickander, K.; Budoff, M.; Detrano, R.; Wong, N.; Fox, M.; Kim, L.; Oudiz, R.; Weir, G.; Espeland, M.; Manolio, T.; Rand, L.; Singer, D.; Stern, M.; Boulton, A.E.; Clark, C.; D’Agostino, R.; Lopes-Virella, M.; Garvey, W.T.; Lyons, T.J.; Jenkins, A.; Virella, G.; Jaffa, A.; Carter, Rickey; Lackland, D.; Brabham, M.; McGee, D.; Zheng, D.; Mayfield, R.K.; Boright, A.; Bull, S.; Sun, L.; Scherer, S.; Zinman, B.; Natarajan, R.; Miao, F.; Zhang, L.; Chen;, Z.; Nathan, D.M.; Makela, Kari-Matti; Lehtimaki, Terho; Kahonen, Mika; Raitakari, Olli; Yoshimura, Nagahisa; Matsuda, Fumihiko; Chen, Li Jia; Pang, Chi Pui; Yip, Shea Ping; Yap, Maurice K.H.; Meguro, Akira; Mizuki, Nobuhisa; Inoko, Hidetoshi; Foster, Paul J.; Zhao, Jing Hua; Vithana, Eranga; Tai, E-Shyong; Fan, Qiao; Xu, Liang; Campbell, Harry; Fleck, Brian; Rudan, Igor; Aung, Tin; Hofman, Albert; Uitterlinden, André G.; Bencic, Goran; Khor, Chiea-Chuen; Forward, Hannah; Pärssinen, Olavi; Mitchell, Paul; Rivadeneira, Fernando; Hewitt, Alex W.; Williams, Cathy; Oostra, Ben A.; Teo, Yik-Ying; Hammond, Christopher J.; Stambolian, Dwight; Mackey, David A.; Klaver, Caroline C.W.; Wong, Tien-Yin; Saw, Seang-Mei; Baird, Paul N.

    2013-01-01

    Refractive errors are common eye disorders of public health importance worldwide. Ocular axial length (AL) is the major determinant of refraction and thus of myopia and hyperopia. We conducted a meta-analysis of genome-wide association studies for AL, combining 12,531 Europeans and 8,216 Asians. We identified eight genome-wide significant loci for AL (RSPO1, C3orf26, LAMA2, GJD2, ZNRF3, CD55, MIP, and ALPPL2) and confirmed one previously reported AL locus (ZC3H11B). Of the nine loci, five (LAMA2, GJD2, CD55, ALPPL2, and ZC3H11B) were associated with refraction in 18 independent cohorts (n = 23,591). Differential gene expression was observed for these loci in minus-lens-induced myopia mouse experiments and human ocular tissues. Two of the AL genes, RSPO1 and ZNRF3, are involved in Wnt signaling, a pathway playing a major role in the regulation of eyeball size. This study provides evidence of shared genes between AL and refraction, but importantly also suggests that these traits may have unique pathways. PMID:24144296

  9. Complete genome sequence of Clostridium estertheticum DSM 8809, a microbe identified in spoiled vacuum packed beef

    Directory of Open Access Journals (Sweden)

    Zhongyi Yu

    2016-11-01

    Full Text Available Blown pack spoilage (BPS is a major issue for the beef industry. Aetiological agents of BPS involve members of a group of Clostridium species, including Clostridium estertheticum which has the ability to produce gas, mostly carbon dioxide, under anaerobic psychotrophic growth conditions. This spore-forming bacterium grows slowly under laboratory conditions, and it can take up to 3 months to produce a workable culture. These characteristics have limited the study of this commercially challenging bacterium. Consequently information on this bacterium is limited and no effective controls are currently available to confidently detect and manage this production risk. In this study the complete genome of Clostridium estertheticum DSM 8809 was determined by SMRT® sequencing. The genome consists of a circular chromosome of 4.7 Mbp along with a single plasmid carrying a potential tellurite resistance gene tehB and a Tn3-like resolvase-encoding gene tnpR. The genome sequence was searched for central metabolic pathways that would support its biochemical profile and several enzymes contributing to this phenotype were identified. Several putative antibiotic/biocide/metal resistance-encoding genes and virulence factors were also identified in the genome, a feature that requires further research. The availability of the genome sequence will provide a basic blueprint from which to develop valuable biomarkers that could support and improve the detection and control of this bacterium along the beef production chain.

  10. Patterns of genomic variation in the poplar rust fungus Melampsora larici-populina identify pathogenesis-related factors

    Directory of Open Access Journals (Sweden)

    Antoine ePersoons

    2014-09-01

    Full Text Available Melampsora larici-populina is a fungal pathogen responsible for foliar rust disease on poplar trees, which causes damage to forest plantations worldwide, particularly in Northern Europe. The reference genome of the isolate 98AG31 was previously sequenced using a whole genome shotgun strategy, revealing a large genome of 101 megabases containing 16,399 predicted genes, which included secreted protein genes representing poplar rust candidate effectors. In the present study, the genomes of 15 isolates collected over the past 20 years throughout the French territory, representing distinct virulence profiles, were characterized by massively parallel sequencing to assess genetic variation in the poplar rust fungus. Comparison to the reference genome revealed striking structural variations. Analysis of coverage and sequencing depth identified large missing regions between isolates related to the mating type loci. More than 611,824 single-nucleotide polymorphism (SNP positions were uncovered overall, indicating a remarkable level of polymorphism. Based on the accumulation of non-synonymous substitutions in coding sequences and the relative frequencies of synonymous and non-synonymous polymorphisms (i.e. PN/PS, we identify candidate genes that may be involved in fungal pathogenesis. Correlation between non-synonymous SNPs in genes encoding secreted proteins and pathotypes of the studied isolates revealed candidate genes potentially related to virulences 1, 6 and 8 of the poplar rust fungus.

  11. TSSer: an automated method to identify transcription start sites in prokaryotic genomes from differential RNA sequencing data.

    Science.gov (United States)

    Jorjani, Hadi; Zavolan, Mihaela

    2014-04-01

    Accurate identification of transcription start sites (TSSs) is an essential step in the analysis of transcription regulatory networks. In higher eukaryotes, the capped analysis of gene expression technology enabled comprehensive annotation of TSSs in genomes such as those of mice and humans. In bacteria, an equivalent approach, termed differential RNA sequencing (dRNA-seq), has recently been proposed, but the application of this approach to a large number of genomes is hindered by the paucity of computational analysis methods. With few exceptions, when the method has been used, annotation of TSSs has been largely done manually. In this work, we present a computational method called 'TSSer' that enables the automatic inference of TSSs from dRNA-seq data. The method rests on a probabilistic framework for identifying both genomic positions that are preferentially enriched in the dRNA-seq data as well as preferentially captured relative to neighboring genomic regions. Evaluating our approach for TSS calling on several publicly available datasets, we find that TSSer achieves high consistency with the curated lists of annotated TSSs, but identifies many additional TSSs. Therefore, TSSer can accelerate genome-wide identification of TSSs in bacterial genomes and can aid in further characterization of bacterial transcription regulatory networks. TSSer is freely available under GPL license at http://www.clipz.unibas.ch/TSSer/index.php

  12. Genome-wide Association Study Identifies New Loci for Resistance to Leptosphaeria maculans in Canola

    Directory of Open Access Journals (Sweden)

    Harsh Raman

    2016-10-01

    Full Text Available Blackleg, caused by Leptosphaeria maculans, is a significant disease which affects the sustainable production of canola. This study reports a genome-wide association study based on 18,804 polymorphic SNPs to identify loci associated with qualitative and quantitative resistance to L. maculans. Genomic regions delimited with 503 significant SNP markers, that are associated with resistance evaluated using 12 single spore isolates and pathotypes from four canola stubble were identified. Several significant associations were detected at known disease resistance loci including in the vicinity of recently cloned Rlm2/LepR3 genes, and at new loci on chromosomes A01/C01, A02/C02, A03/C03, A05/C05, A06, A08, and A09. In addition, we validated statistically significant associations on A01, A07 and A10 in four genetic mapping populations, demonstrating that GWAS marker loci are indeed associated with resistance to L. maculans. One of the novel loci identified for the first time, Rlm12, conveys adult plant resistance and mapped within 13.2 kb from Arabidopsis R gene of TIR-NBS class. We showed that resistance loci are located in the vicinity of R genes of A. thaliana and B. napus on the sequenced genome of B. napus cv. Darmor-bzh. Significantly associated SNP markers provide a valuable tool to enrich germplasm for favorable alleles in order to improve the level of resistance to L. maculans in canola.

  13. Comparative analysis of the full genome of Helicobacter pylori isolate Sahul64 identifies genes of high divergence.

    Science.gov (United States)

    Lu, Wei; Wise, Michael J; Tay, Chin Yen; Windsor, Helen M; Marshall, Barry J; Peacock, Christopher; Perkins, Tim

    2014-03-01

    Isolates of Helicobacter pylori can be classified phylogeographically. High genetic diversity and rapid microevolution are a hallmark of H. pylori genomes, a phenomenon that is proposed to play a functional role in persistence and colonization of diverse human populations. To provide further genomic evidence in the lineage of H. pylori and to further characterize diverse strains of this pathogen in different human populations, we report the finished genome sequence of Sahul64, an H. pylori strain isolated from an indigenous Australian. Our analysis identified genes that were highly divergent compared to the 38 publically available genomes, which include genes involved in the biosynthesis and modification of lipopolysaccharide, putative prophage genes, restriction modification components, and hypothetical genes. Furthermore, the virulence-associated vacA locus is a pseudogene and the cag pathogenicity island (cagPAI) is not present. However, the genome does contain a gene cluster associated with pathogenicity, including dupA. Our analysis found that with the addition of Sahul64 to the 38 genomes, the core genome content of H. pylori is reduced by approximately 14% (∼170 genes) and the pan-genome has expanded from 2,070 to 2,238 genes. We have identified three putative horizontally acquired regions, including one that is likely to have been acquired from the closely related Helicobacter cetorum prior to speciation. Our results suggest that Sahul64, with the absence of cagPAI, highly divergent cell envelope proteins, and a predicted nontransportable VacA protein, could be more highly adapted to ancient indigenous Australian people but with lower virulence potential compared to other sequenced and cagPAI-positive H. pylori strains.

  14. Genome-wide association study identifies 74 loci associated with educational attainment

    OpenAIRE

    Okbay, Aysu; Beauchamp, Jonathan; Fontana, M.A. (Mark Alan); Lee, James J.; Pers, Tune; Rietveld, C.A. (Cornelius A.); Turley, Patrick; Chen, G.-B. (Guo-Bo); Emilsson, Valur; Meddens, S.F.W. (S. Fleur W.); Oskarsson, S. (Sven); Pickrell, J.K. (Joseph K.); Thom, K. (Kevin); Timshel, P. (Pascal); Vlaming, Ronald

    2016-01-01

    textabstractEducational attainment is strongly influenced by social and other environmental factors, but genetic factors are estimated to account for at least 20% of the variation across individuals. Here we report the results of a genome-wide association study (GWAS) for educational attainment that extends our earlier discovery sample of 101,069 individuals to 293,723 individuals, and a replication study in an independent sample of 111,349 individuals from the UK Biobank. We identify 74 geno...

  15. Identifying signatures of natural selection in Tibetan and Andean populations using dense genome scan data.

    Directory of Open Access Journals (Sweden)

    Abigail Bigham

    2010-09-01

    Full Text Available High-altitude hypoxia (reduced inspired oxygen tension due to decreased barometric pressure exerts severe physiological stress on the human body. Two high-altitude regions where humans have lived for millennia are the Andean Altiplano and the Tibetan Plateau. Populations living in these regions exhibit unique circulatory, respiratory, and hematological adaptations to life at high altitude. Although these responses have been well characterized physiologically, their underlying genetic basis remains unknown. We performed a genome scan to identify genes showing evidence of adaptation to hypoxia. We looked across each chromosome to identify genomic regions with previously unknown function with respect to altitude phenotypes. In addition, groups of genes functioning in oxygen metabolism and sensing were examined to test the hypothesis that particular pathways have been involved in genetic adaptation to altitude. Applying four population genetic statistics commonly used for detecting signatures of natural selection, we identified selection-nominated candidate genes and gene regions in these two populations (Andeans and Tibetans separately. The Tibetan and Andean patterns of genetic adaptation are largely distinct from one another, with both populations showing evidence of positive natural selection in different genes or gene regions. Interestingly, one gene previously known to be important in cellular oxygen sensing, EGLN1 (also known as PHD2, shows evidence of positive selection in both Tibetans and Andeans. However, the pattern of variation for this gene differs between the two populations. Our results indicate that several key HIF-regulatory and targeted genes are responsible for adaptation to high altitude in Andeans and Tibetans, and several different chromosomal regions are implicated in the putative response to selection. These data suggest a genetic role in high-altitude adaption and provide a basis for future genotype/phenotype association

  16. Genome Wide Association Studies (GWAS Identify QTL on SSC2 and SSC17 Affecting Loin Peak Shear Force in Crossbred Commercial Pigs.

    Directory of Open Access Journals (Sweden)

    Chunyan Zhang

    Full Text Available Of all the meat quality traits, tenderness is considered the most important with regard to eating quality and market value. In this study we have utilised genome wide association studies (GWAS for peak shear force (PSF of loin muscle as a measure of tenderness for 1,976 crossbred commercial pigs, genotyped for 42,721 informative SNPs using the Illumina PorcineSNP60 Beadchip. Four 1 Mb genomic regions, three on SSC2 (at 4 Mb, 5 Mb and 109 Mb and one on SSC17 (at 20 Mb, were detected which collectively explained about 15.30% and 3.07% of the total genetic and phenotypic variance for PSF respectively. Markers ASGA0008566, ASGA0008695, DRGA0003285 and ASGA0075615 in the four regions were strongly associated with the effects. Analysis of the reference genome sequence in the region with the most important SNPs for SSC2_5 identified FRMD8, SLC25A45 and LTBP3 as potential candidate genes for meat tenderness on the basis of functional annotation of these genes. The region SSC2_109 was close to a previously reported candidate gene CAST; however, the very weak LD between DRGA0003285 (the best marker representing region SSC2_109 and CAST indicated the potential for additional genes which are distinct from, or interact with, CAST to affect meat tenderness. Limited information of known genes in regions SSC2_109 and SSC17_20 restricts further analysis. Re-sequencing of these regions for informative animals may help to resolve the molecular architecture and identify new candidate genes and causative mutations affecting this trait. These findings contribute significantly to our knowledge of the genomic regions affecting pork shear force and will potentially lead to new insights into the molecular mechanisms regulating meat tenderness.

  17. Evolution of a Pathogen: A Comparative Genomics Analysis Identifies a Genetic Pathway to Pathogenesis in Acinetobacter

    Science.gov (United States)

    Sahl, Jason W.; Gillece, John D.; Schupp, James M.; Waddell, Victor G.; Driebe, Elizabeth M.; Engelthaler, David M.; Keim, Paul

    2013-01-01

    Acinetobacter baumannii is an emergent and global nosocomial pathogen. In addition to A. baumannii, other Acinetobacter species, especially those in the Acinetobacter calcoaceticus-baumannii (Acb) complex, have also been associated with serious human infection. Although mechanisms of attachment, persistence on abiotic surfaces, and pathogenesis in A. baumannii have been identified, the genetic mechanisms that explain the emergence of A. baumannii as the most widespread and virulent Acinetobacter species are not fully understood. Recent whole genome sequencing has provided insight into the phylogenetic structure of the genus Acinetobacter. However, a global comparison of genomic features between Acinetobacter spp. has not been described in the literature. In this study, 136 Acinetobacter genomes, including 67 sequenced in this study, were compared to identify the acquisition and loss of genes in the expansion of the Acinetobacter genus. A whole genome phylogeny confirmed that A. baumannii is a monophyletic clade and that the larger Acb complex is also a well-supported monophyletic group. The whole genome phylogeny provided the framework for a global genomic comparison based on a blast score ratio (BSR) analysis. The BSR analysis demonstrated that specific genes have been both lost and acquired in the evolution of A. baumannii. In addition, several genes associated with A. baumannii pathogenesis were found to be more conserved in the Acb complex, and especially in A. baumannii, than in other Acinetobacter genomes; until recently, a global analysis of the distribution and conservation of virulence factors across the genus was not possible. The results demonstrate that the acquisition of specific virulence factors has likely contributed to the widespread persistence and virulence of A. baumannii. The identification of novel features associated with transcriptional regulation and acquired by clades in the Acb complex presents targets for better understanding the

  18. Genome-wide screening identifies a KCNIP1 copy number variant as a genetic predictor for atrial fibrillation

    Science.gov (United States)

    Tsai, Chia-Ti; Hsieh, Chia-Shan; Chang, Sheng-Nan; Chuang, Eric Y.; Ueng, Kwo-Chang; Tsai, Chin-Feng; Lin, Tsung-Hsien; Wu, Cho-Kai; Lee, Jen-Kuang; Lin, Lian-Yu; Wang, Yi-Chih; Yu, Chih-Chieh; Lai, Ling-Ping; Tseng, Chuen-Den; Hwang, Juey-Jen; Chiang, Fu-Tien; Lin, Jiunn-Lee

    2016-01-01

    Atrial fibrillation (AF) is the most common sustained cardiac arrhythmia. Previous genome-wide association studies had identified single-nucleotide polymorphisms in several genomic regions to be associated with AF. In human genome, copy number variations (CNVs) are known to contribute to disease susceptibility. Using a genome-wide multistage approach to identify AF susceptibility CNVs, we here show a common 4,470-bp diallelic CNV in the first intron of potassium interacting channel 1 gene (KCNIP1) is strongly associated with AF in Taiwanese populations (odds ratio=2.27 for insertion allele; P=6.23 × 10−24). KCNIP1 insertion is associated with higher KCNIP1 mRNA expression. KCNIP1-encoded protein potassium interacting channel 1 (KCHIP1) is physically associated with potassium Kv channels and modulates atrial transient outward current in cardiac myocytes. Overexpression of KCNIP1 results in inducible AF in zebrafish. In conclusions, a common CNV in KCNIP1 gene is a genetic predictor of AF risk possibly pointing to a functional pathway. PMID:26831368

  19. Genome-wide association scan in HIV-1-infected individuals identifying variants influencing disease course.

    Directory of Open Access Journals (Sweden)

    Daniëlle van Manen

    Full Text Available BACKGROUND: AIDS develops typically after 7-11 years of untreated HIV-1 infection, with extremes of very rapid disease progression (15 years. To reveal additional host genetic factors that may impact on the clinical course of HIV-1 infection, we designed a genome-wide association study (GWAS in 404 participants of the Amsterdam Cohort Studies on HIV-1 infection and AIDS. METHODS: The association of SNP genotypes with the clinical course of HIV-1 infection was tested in Cox regression survival analyses using AIDS-diagnosis and AIDS-related death as endpoints. RESULTS: Multiple, not previously identified SNPs, were identified to be strongly associated with disease progression after HIV-1 infection, albeit not genome-wide significant. However, three independent SNPs in the top ten associations between SNP genotypes and time between seroconversion and AIDS-diagnosis, and one from the top ten associations between SNP genotypes and time between seroconversion and AIDS-related death, had P-values smaller than 0.05 in the French Genomics of Resistance to Immunodeficiency Virus cohort on disease progression. CONCLUSIONS: Our study emphasizes that the use of different phenotypes in GWAS may be useful to unravel the full spectrum of host genetic factors that may be associated with the clinical course of HIV-1 infection.

  20. Genome-Wide Association Scan in HIV-1-Infected Individuals Identifying Variants Influencing Disease Course

    Science.gov (United States)

    van Manen, Daniëlle; Delaneau, Olivier; Kootstra, Neeltje A.; Boeser-Nunnink, Brigitte D.; Limou, Sophie; Bol, Sebastiaan M.; Burger, Judith A.; Zwinderman, Aeilko H.; Moerland, Perry D.; van 't Slot, Ruben; Zagury, Jean-François; van 't Wout, Angélique B.; Schuitemaker, Hanneke

    2011-01-01

    Background AIDS develops typically after 7–11 years of untreated HIV-1 infection, with extremes of very rapid disease progression (15 years). To reveal additional host genetic factors that may impact on the clinical course of HIV-1 infection, we designed a genome-wide association study (GWAS) in 404 participants of the Amsterdam Cohort Studies on HIV-1 infection and AIDS. Methods The association of SNP genotypes with the clinical course of HIV-1 infection was tested in Cox regression survival analyses using AIDS-diagnosis and AIDS-related death as endpoints. Results Multiple, not previously identified SNPs, were identified to be strongly associated with disease progression after HIV-1 infection, albeit not genome-wide significant. However, three independent SNPs in the top ten associations between SNP genotypes and time between seroconversion and AIDS-diagnosis, and one from the top ten associations between SNP genotypes and time between seroconversion and AIDS-related death, had P-values smaller than 0.05 in the French Genomics of Resistance to Immunodeficiency Virus cohort on disease progression. Conclusions Our study emphasizes that the use of different phenotypes in GWAS may be useful to unravel the full spectrum of host genetic factors that may be associated with the clinical course of HIV-1 infection. PMID:21811574

  1. Analysis of pan-genome to identify the core genes and essential genes of Brucella spp.

    Science.gov (United States)

    Yang, Xiaowen; Li, Yajie; Zang, Juan; Li, Yexia; Bie, Pengfei; Lu, Yanli; Wu, Qingmin

    2016-04-01

    Brucella spp. are facultative intracellular pathogens, that cause a contagious zoonotic disease, that can result in such outcomes as abortion or sterility in susceptible animal hosts and grave, debilitating illness in humans. For deciphering the survival mechanism of Brucella spp. in vivo, 42 Brucella complete genomes from NCBI were analyzed for the pan-genome and core genome by identification of their composition and function of Brucella genomes. The results showed that the total 132,143 protein-coding genes in these genomes were divided into 5369 clusters. Among these, 1710 clusters were associated with the core genome, 1182 clusters with strain-specific genes and 2477 clusters with dispensable genomes. COG analysis indicated that 44 % of the core genes were devoted to metabolism, which were mainly responsible for energy production and conversion (COG category C), and amino acid transport and metabolism (COG category E). Meanwhile, approximately 35 % of the core genes were in positive selection. In addition, 1252 potential essential genes were predicted in the core genome by comparison with a prokaryote database of essential genes. The results suggested that the core genes in Brucella genomes are relatively conservation, and the energy and amino acid metabolism play a more important role in the process of growth and reproduction in Brucella spp. This study might help us to better understand the mechanisms of Brucella persistent infection and provide some clues for further exploring the gene modules of the intracellular survival in Brucella spp.

  2. Genome Sequences of Marine Shrimp Exopalaemon carinicauda Holthuis Provide Insights into Genome Size Evolution of Caridea.

    Science.gov (United States)

    Yuan, Jianbo; Gao, Yi; Zhang, Xiaojun; Wei, Jiankai; Liu, Chengzhang; Li, Fuhua; Xiang, Jianhai

    2017-07-05

    Crustacea, particularly Decapoda, contains many economically important species, such as shrimps and crabs. Crustaceans exhibit enormous (nearly 500-fold) variability in genome size. However, limited genome resources are available for investigating these species. Exopalaemon carinicauda Holthuis, an economical caridean shrimp, is a potential ideal experimental animal for research on crustaceans. In this study, we performed low-coverage sequencing and de novo assembly of the E. carinicauda genome. The assembly covers more than 95% of coding regions. E. carinicauda possesses a large complex genome (5.73 Gb), with size twice higher than those of many decapod shrimps. As such, comparative genomic analyses were implied to investigate factors affecting genome size evolution of decapods. However, clues associated with genome duplication were not identified, and few horizontally transferred sequences were detected. Ultimately, the burst of transposable elements, especially retrotransposons, was determined as the major factor influencing genome expansion. A total of 2 Gb repeats were identified, and RTE-BovB, Jockey, Gypsy, and DIRS were the four major retrotransposons that significantly expanded. Both recent (Jockey and Gypsy) and ancestral (DIRS) originated retrotransposons responsible for the genome evolution. The E. carinicauda genome also exhibited potential for the genomic and experimental research of shrimps.

  3. Omics Approaches for Identifying Physiological Adaptations to Genome Instability in Aging

    Directory of Open Access Journals (Sweden)

    Diletta Edifizi

    2017-11-01

    Full Text Available DNA damage causally contributes to aging and age-related diseases. The declining functioning of tissues and organs during aging can lead to the increased risk of succumbing to aging-associated diseases. Congenital syndromes that are caused by heritable mutations in DNA repair pathways lead to cancer susceptibility and accelerated aging, thus underlining the importance of genome maintenance for withstanding aging. High-throughput mass-spectrometry-based approaches have recently contributed to identifying signalling response networks and gaining a more comprehensive understanding of the physiological adaptations occurring upon unrepaired DNA damage. The insulin-like signalling pathway has been implicated in a DNA damage response (DDR network that includes epidermal growth factor (EGF-, AMP-activated protein kinases (AMPK- and the target of rapamycin (TOR-like signalling pathways, which are known regulators of growth, metabolism, and stress responses. The same pathways, together with the autophagy-mediated proteostatic response and the decline in energy metabolism have also been found to be similarly regulated during natural aging, suggesting striking parallels in the physiological adaptation upon persistent DNA damage due to DNA repair defects and long-term low-level DNA damage accumulation occurring during natural aging. These insights will be an important starting point to study the interplay between signalling networks involved in progeroid syndromes that are caused by DNA repair deficiencies and to gain new understanding of the consequences of DNA damage in the aging process.

  4. Genome Wide Association Mapping in Arabidopsis thaliana Identifies Novel Genes Involved in Linking Allyl Glucosinolate to Altered Biomass and Defense.

    Science.gov (United States)

    Francisco, Marta; Joseph, Bindu; Caligagan, Hart; Li, Baohua; Corwin, Jason A; Lin, Catherine; Kerwin, Rachel E; Burow, Meike; Kliebenstein, Daniel J

    2016-01-01

    A key limitation in modern biology is the ability to rapidly identify genes underlying newly identified complex phenotypes. Genome wide association studies (GWAS) have become an increasingly important approach for dissecting natural variation by associating phenotypes with genotypes at a genome wide level. Recent work is showing that the Arabidopsis thaliana defense metabolite, allyl glucosinolate (GSL), may provide direct feedback regulation, linking defense metabolism outputs to the growth, and defense responses of the plant. However, there is still a need to identify genes that underlie this process. To start developing a deeper understanding of the mechanism(s) that modulate the ability of exogenous allyl GSL to alter growth and defense, we measured changes in plant biomass and defense metabolites in a collection of natural 96 A. thaliana accessions fed with 50 μM of allyl GSL. Exogenous allyl GSL was introduced exclusively to the roots and the compound transported to the leaf leading to a wide range of heritable effects upon plant biomass and endogenous GSL accumulation. Using natural variation we conducted GWAS to identify a number of new genes which potentially control allyl responses in various plant processes. This is one of the first instances in which this approach has been successfully utilized to begin dissecting a novel phenotype to the underlying molecular/polygenic basis.

  5. Genome wide association mapping in Arabidopsis thaliana identifies novel genes involved in linking allyl glucosinolate to altered biomass and defense

    Directory of Open Access Journals (Sweden)

    Marta Francisco

    2016-07-01

    Full Text Available A key limitation in modern biology is the ability to rapidly identify genes underlying newly identified complex phenotypes. Genome wide association studies (GWAS have become an increasingly important approach for dissecting natural variation by associating phenotypes with genotypes at a genome wide level. Recent work is showing that the Arabidopsis thaliana defense metabolite, allyl glucosinolate (GSL, may provide direct feedback regulation, linking defense metabolism outputs to the growth and defense responses of the plant. However, there is still a need to identify genes that underlie this process. To start developing a deeper understanding of the mechanism(s that modulate the ability of exogenous allyl GSL to alter growth and defense, we measured changes in plant biomass and defense metabolites in a collection of natural 96 A. thaliana accessions fed with 50 µM of allyl GSL. Exogenous allyl GSL was introduced exclusively to the roots and the compound transported to the leaf leading to a wide range of heritable effects upon plant biomass and endogenous GSL accumulation. Using natural variation we conducted GWAS to identify a number of new genes which potentially control allyl responses in various plant processes. This is one of the first instances in which this approach has been successfully utilized to begin dissecting a novel phenotype to the underlying molecular/polygenic basis.

  6. Large meta-analysis of genome-wide association studies identifies five loci for lean body mass

    DEFF Research Database (Denmark)

    Zillikens, M Carola; Demissie, Serkalem; Hsu, Yi-Hsiang

    2017-01-01

    Lean body mass, consisting mostly of skeletal muscle, is important for healthy aging. We performed a genome-wide association study for whole body (20 cohorts of European ancestry with n = 38,292) and appendicular (arms and legs) lean body mass (n = 28,330) measured using dual energy X-ray absorpt...... a meta-analysis of genome-wide association studies for whole body lean body mass and find five novel genetic loci to be significantly associated.......-ray absorptiometry or bioelectrical impedance analysis, adjusted for sex, age, height, and fat mass. Twenty-one single-nucleotide polymorphisms were significantly associated with lean body mass either genome wide (p 

  7. Genomics technologies to study structural variations in the grapevine genome

    Directory of Open Access Journals (Sweden)

    Cardone Maria Francesca

    2016-01-01

    Full Text Available Grapevine is one of the most important crop plants in the world. Recently there was great expansion of genomics resources about grapevine genome, thus providing increasing efforts for molecular breeding. Current cultivars display a great level of inter-specific differentiation that needs to be investigated to reach a comprehensive understanding of the genetic basis of phenotypic differences, and to find responsible genes selected by cross breeding programs. While there have been significant advances in resolving the pattern and nature of single nucleotide polymorphisms (SNPs on plant genomes, few data are available on copy number variation (CNV. Furthermore association between structural variations and phenotypes has been described in only a few cases. We combined high throughput biotechnologies and bioinformatics tools, to reveal the first inter-varietal atlas of structural variation (SV for the grapevine genome. We sequenced and compared four table grape cultivars with the Pinot noir inbred line PN40024 genome as the reference. We detected roughly 8% of the grapevine genome affected by genomic variations. Taken into account phenotypic differences existing among the studied varieties we performed comparison of SVs among them and the reference and next we performed an in-depth analysis of gene content of polymorphic regions. This allowed us to identify genes showing differences in copy number as putative functional candidates for important traits in grapevine cultivation.

  8. Identifying genomic changes associated with insecticide resistance in the dengue mosquito Aedes aegypti by deep targeted sequencing

    Science.gov (United States)

    Faucon, Frederic; Dusfour, Isabelle; Gaude, Thierry; Navratil, Vincent; Boyer, Frederic; Chandre, Fabrice; Sirisopa, Patcharawan; Thanispong, Kanutcharee; Juntarajumnong, Waraporn; Poupardin, Rodolphe; Chareonviriyaphap, Theeraphap; Girod, Romain; Corbel, Vincent; Reynaud, Stephane; David, Jean-Philippe

    2015-01-01

    The capacity of mosquitoes to resist insecticides threatens the control of diseases such as dengue and malaria. Until alternative control tools are implemented, characterizing resistance mechanisms is crucial for managing resistance in natural populations. Insecticide biodegradation by detoxification enzymes is a common resistance mechanism; however, the genomic changes underlying this mechanism have rarely been identified, precluding individual resistance genotyping. In particular, the role of copy number variations (CNVs) and polymorphisms of detoxification enzymes have never been investigated at the genome level, although they can represent robust markers of metabolic resistance. In this context, we combined target enrichment with high-throughput sequencing for conducting the first comprehensive screening of gene amplifications and polymorphisms associated with insecticide resistance in mosquitoes. More than 760 candidate genes were captured and deep sequenced in several populations of the dengue mosquito Ae. aegypti displaying distinct genetic backgrounds and contrasted resistance levels to the insecticide deltamethrin. CNV analysis identified 41 gene amplifications associated with resistance, most affecting cytochrome P450s overtranscribed in resistant populations. Polymorphism analysis detected more than 30,000 variants and strong selection footprints in specific genomic regions. Combining Bayesian and allele frequency filtering approaches identified 55 nonsynonymous variants strongly associated with resistance. Both CNVs and polymorphisms were conserved within regions but differed across continents, confirming that genomic changes underlying metabolic resistance to insecticides are not universal. By identifying novel DNA markers of insecticide resistance, this study opens the way for tracking down metabolic changes developed by mosquitoes to resist insecticides within and among populations. PMID:26206155

  9. A genome-wide scan study identifies a single nucleotide substitution in ASIP associated with white versus non-white coat-colour variation in sheep (Ovis aries).

    Science.gov (United States)

    Li, M-H; Tiirikka, T; Kantanen, J

    2014-02-01

    In sheep, coat colour (and pattern) is one of the important traits of great biological, economic and social importance. However, the genetics of sheep coat colour has not yet been fully clarified. We conducted a genome-wide association study of sheep coat colours by genotyping 47 303 single-nucleotide polymorphisms (SNPs) in the Finnsheep population in Finland. We identified 35 SNPs associated with all the coat colours studied, which cover genomic regions encompassing three known pigmentation genes (TYRP1, ASIP and MITF) in sheep. Eighteen of these associations were confirmed in further tests between white versus non-white individuals, but none of the 35 associations were significant in the analysis of only non-white colours. Across the tests, the s66432.1 in ASIP showed significant association (P=4.2 × 10(-11) for all the colours; P=2.3 × 10(-11) for white versus non-white colours) with the variation in coat colours and strong linkage disequilibrium with other significant variants surrounding the ASIP gene. The signals detected around the ASIP gene were explained by differences in white versus non-white alleles. Further, a genome scan for selection for white coat pigmentation identified a strong and striking selection signal spanning ASIP. Our study identified the main candidate gene for the coat colour variation between white and non-white as ASIP, an autosomal gene that has been directly implicated in the pathway regulating melanogenesis. Together with ASIP, the two other newly identified genes (TYRP1 and MITF) in the Finnsheep, bordering associated SNPs, represent a new resource for enriching sheep coat-colour genetics and breeding.

  10. Genetic variants associated with subjective well-being, depressive symptoms, and neuroticism identified through genome-wide analyses

    OpenAIRE

    Okbay, Aysu; Baselmans, B.M.L. (Bart M.L.); Neve, Jan-Emmanuel; Turley, Patrick; Nivard, Michel; Fontana, M.A. (Mark Alan); Meddens, S.F.W. (S. Fleur W.); Linnér, R.K. (Richard Karlsson); Rietveld, C.A. (Cornelius A); Derringer, J.; Gratten, Jacob; Lee, James J.; Liu, J.Z. (Jimmy Z); Vlaming, Ronald; SAhluwalia, T. (Tarunveer)

    2016-01-01

    textabstractVery few genetic variants have been associated with depression and neuroticism, likely because of limitations on sample size in previous studies. Subjective well-being, a phenotype that is genetically correlated with both of these traits, has not yet been studied with genome-wide data. We conducted genome-wide association studies of three phenotypes: subjective well-being (n = 298,420), depressive symptoms (n = 161,460), and neuroticism (n = 170,911). We identify 3 variants associ...

  11. Genome-wide association studies in the Japanese population identify seven novel loci for type 2 diabetes

    DEFF Research Database (Denmark)

    Imamura, Minako; Takahashi, Atsushi; Yamauchi, Toshimasa

    2016-01-01

    Genome-wide association studies (GWAS) have identified more than 80 susceptibility loci for type 2 diabetes (T2D), but most of its heritability still remains to be elucidated. In this study, we conducted a meta-analysis of GWAS for T2D in the Japanese population. Combined data from discovery...... and subsequent validation analyses (23,399 T2D cases and 31,722 controls) identify 7 new loci with genome-wide significance (P2, rs7107784 near MIR4686 and rs67839313 near INAFM2....... Of these, the association of 4 loci with T2D is replicated in multi-ethnic populations other than Japanese (up to 65,936 T2Ds and 158,030 controls, P

  12. Mapping genomic features to functional traits through microbial whole genome sequences.

    Science.gov (United States)

    Zhang, Wei; Zeng, Erliang; Liu, Dan; Jones, Stuart E; Emrich, Scott

    2014-01-01

    Recently, the utility of trait-based approaches for microbial communities has been identified. Increasing availability of whole genome sequences provide the opportunity to explore the genetic foundations of a variety of functional traits. We proposed a machine learning framework to quantitatively link the genomic features with functional traits. Genes from bacteria genomes belonging to different functional traits were grouped to Cluster of Orthologs (COGs), and were used as features. Then, TF-IDF technique from the text mining domain was applied to transform the data to accommodate the abundance and importance of each COG. After TF-IDF processing, COGs were ranked using feature selection methods to identify their relevance to the functional trait of interest. Extensive experimental results demonstrated that functional trait related genes can be detected using our method. Further, the method has the potential to provide novel biological insights.

  13. Genome-wide meta-analysis identifies new susceptibility loci for migraine.

    Science.gov (United States)

    Anttila, Verneri; Winsvold, Bendik S; Gormley, Padhraig; Kurth, Tobias; Bettella, Francesco; McMahon, George; Kallela, Mikko; Malik, Rainer; de Vries, Boukje; Terwindt, Gisela; Medland, Sarah E; Todt, Unda; McArdle, Wendy L; Quaye, Lydia; Koiranen, Markku; Ikram, M Arfan; Lehtimäki, Terho; Stam, Anine H; Ligthart, Lannie; Wedenoja, Juho; Dunham, Ian; Neale, Benjamin M; Palta, Priit; Hamalainen, Eija; Schürks, Markus; Rose, Lynda M; Buring, Julie E; Ridker, Paul M; Steinberg, Stacy; Stefansson, Hreinn; Jakobsson, Finnbogi; Lawlor, Debbie A; Evans, David M; Ring, Susan M; Färkkilä, Markus; Artto, Ville; Kaunisto, Mari A; Freilinger, Tobias; Schoenen, Jean; Frants, Rune R; Pelzer, Nadine; Weller, Claudia M; Zielman, Ronald; Heath, Andrew C; Madden, Pamela A F; Montgomery, Grant W; Martin, Nicholas G; Borck, Guntram; Göbel, Hartmut; Heinze, Axel; Heinze-Kuhn, Katja; Williams, Frances M K; Hartikainen, Anna-Liisa; Pouta, Anneli; van den Ende, Joyce; Uitterlinden, Andre G; Hofman, Albert; Amin, Najaf; Hottenga, Jouke-Jan; Vink, Jacqueline M; Heikkilä, Kauko; Alexander, Michael; Muller-Myhsok, Bertram; Schreiber, Stefan; Meitinger, Thomas; Wichmann, Heinz Erich; Aromaa, Arpo; Eriksson, Johan G; Traynor, Bryan; Trabzuni, Daniah; Rossin, Elizabeth; Lage, Kasper; Jacobs, Suzanne B R; Gibbs, J Raphael; Birney, Ewan; Kaprio, Jaakko; Penninx, Brenda W; Boomsma, Dorret I; van Duijn, Cornelia; Raitakari, Olli; Jarvelin, Marjo-Riitta; Zwart, John-Anker; Cherkas, Lynn; Strachan, David P; Kubisch, Christian; Ferrari, Michel D; van den Maagdenberg, Arn M J M; Dichgans, Martin; Wessman, Maija; Smith, George Davey; Stefansson, Kari; Daly, Mark J; Nyholt, Dale R; Chasman, Daniel; Palotie, Aarno

    2013-08-01

    Migraine is the most common brain disorder, affecting approximately 14% of the adult population, but its molecular mechanisms are poorly understood. We report the results of a meta-analysis across 29 genome-wide association studies, including a total of 23,285 individuals with migraine (cases) and 95,425 population-matched controls. We identified 12 loci associated with migraine susceptibility (P<5×10(-8)). Five loci are new: near AJAP1 at 1p36, near TSPAN2 at 1p13, within FHL5 at 6q16, within C7orf10 at 7p14 and near MMP16 at 8q21. Three of these loci were identified in disease subgroup analyses. Brain tissue expression quantitative trait locus analysis suggests potential functional candidate genes at four loci: APOA1BP, TBC1D7, FUT9, STAT6 and ATP5B.

  14. Genome-wide association study identifies genetic loci associated with iron deficiency.

    Directory of Open Access Journals (Sweden)

    Christine E McLaren

    2011-03-01

    Full Text Available The existence of multiple inherited disorders of iron metabolism in man, rodents and other vertebrates suggests genetic contributions to iron deficiency. To identify new genomic locations associated with iron deficiency, a genome-wide association study (GWAS was performed using DNA collected from white men aged≥25 y and women≥50 y in the Hemochromatosis and Iron Overload Screening (HEIRS Study with serum ferritin (SF≤12 µg/L (cases and iron replete controls (SF>100 µg/L in men, SF>50 µg/L in women. Regression analysis was used to examine the association between case-control status (336 cases, 343 controls and quantitative serum iron measures and 331,060 single nucleotide polymorphism (SNP genotypes, with replication analyses performed in a sample of 71 cases and 161 controls from a population of white male and female veterans screened at a US Veterans Affairs (VA medical center. Five SNPs identified in the GWAS met genome-wide statistical significance for association with at least one iron measure, rs2698530 on chr. 2p14; rs3811647 on chr. 3q22, a known SNP in the transferrin (TF gene region; rs1800562 on chr. 6p22, the C282Y mutation in the HFE gene; rs7787204 on chr. 7p21; and rs987710 on chr. 22q11 (GWAS observed P<1.51×10(-7 for all. An association between total iron binding capacity and SNP rs3811647 in the TF gene (GWAS observed P=7.0×10(-9, corrected P=0.012 was replicated within the VA samples (observed P=0.012. Associations with the C282Y mutation in the HFE gene also were replicated. The joint analysis of the HEIRS and VA samples revealed strong associations between rs2698530 on chr. 2p14 and iron status outcomes. These results confirm a previously-described TF polymorphism and implicate one potential new locus as a target for gene identification.

  15. A novel common large genomic deletion and two new missense mutations identified in the Romanian phenylketonuria population.

    Science.gov (United States)

    Gemperle-Britschgi, Corinne; Iorgulescu, Daniela; Mager, Monica Alina; Anton-Paduraru, Dana; Vulturar, Romana; Thöny, Beat

    2016-01-15

    The mutation spectrum for the phenylalanine hydroxylase (PAH) gene was investigated in a cohort of 84 hyperphenylalaninemia (HPA) patients from Romania identified through newborn screening or neurometabolic investigations. Differential diagnosis identified 81 patients with classic PAH deficiency while 3 had tetrahydropterin-cofactor deficiency and/or remained uncertain due to insufficient specimen. PAH-genetic analysis included a combination of Sanger sequencing of exons and exon–intron boundaries, MLPA and NGS with genomic DNA, and cDNA analysis from immortalized lymphoblasts. A diagnostic efficiency of 99.4% was achieved, as for one allele (out of a total of 162 alleles) no mutation could be identified. The most prevalent mutation was p.Arg408Trp which was found in ~ 38% of all PKU alleles. Three novel mutations were identified, including the two missense mutations p.Gln226Lys and p.Tyr268Cys that were both disease causing by prediction algorithms, and the large genomic deletion EX6del7831 (c.509 + 4140_706 + 510del7831) that resulted in skipping of exon 6 based on PAH-cDNA analysis in immortalized lymphocytes. The genomic deletion was present in a heterozygous state in 12 patients, i.e. in ~ 8% of all the analyzed PKU alleles, and might have originated from a Romanian founder.

  16. Genome-wide association scan meta-analysis identifies three loci influencing adiposity and fat distribution

    NARCIS (Netherlands)

    C.M. Lindgren (Cecilia); I.M. Heid (Iris); J.C. Randall (Joshua); C. Lamina (Claudia); V. Steinthorsdottir (Valgerdur); L. Qi (Lu); E.K. Speliotes (Elizabeth); G. Thorleifsson (Gudmar); C.J. Willer (Cristen); B.M. Herrera (Blanca); A.U. Jackson (Anne); N. Lim (Noha); P. Scheet (Paul); N. Soranzo (Nicole); N. Amin (Najaf); Y.S. Aulchenko (Yurii); J.C. Chambers (John); A. Drong (Alexander); J. Luan; H.N. Lyon (Helen); F. Rivadeneira Ramirez (Fernando); S. Sanna (Serena); N.J. Timpson (Nicholas); M.C. Zillikens (Carola); H.Z. Jing; P. Almgren (Peter); S. Bandinelli (Stefania); A.J. Bennett (Amanda); R.N. Bergman (Richard); L.L. Bonnycastle (Lori); S. Bumpstead (Suzannah); S.J. Chanock (Stephen); L. Cherkas (Lynn); P.S. Chines (Peter); L. Coin (Lachlan); C. Cooper (Charles); G. Crawford (Gabe); A. Doering (Angela); A. Dominiczak (Anna); A.S.F. Doney (Alex); S. Ebrahim (Shanil); P. Elliott (Paul); M.R. Erdos (Michael); K. Estrada Gil (Karol); L. Ferrucci (Luigi); G. Fischer (Guido); N.G. Forouhi (Nita); C. Gieger (Christian); H. Grallert (Harald); C.J. Groves (Christopher); S.M. Grundy (Scott); C. Guiducci (Candace); D. Hadley (David); A. Hamsten (Anders); A.S. Havulinna (Aki); A. Hofman (Albert); R. Holle (Rolf); J.W. Holloway (John); T. Illig (Thomas); B. Isomaa (Bo); L.C. Jacobs (Leonie); K. Jameson (Karen); P. Jousilahti (Pekka); F. Karpe (Fredrik); J. Kuusisto (Johanna); J. Laitinen (Jaana); G.M. Lathrop (Mark); D.A. Lawlor (Debbie); M. Mangino (Massimo); W.L. McArdle (Wendy); T. Meitinger (Thomas); M.A. Morken (Mario); A.P. Morris (Andrew); P. Munroe (Patricia); N. Narisu (Narisu); A. Nordström (Anna); B.A. Oostra (Ben); C.N.A. Palmer (Colin); F. Payne (Felicity); J. Peden (John); I. Prokopenko (Inga); F. Renström (Frida); A. Ruokonen (Aimo); V. Salomaa (Veikko); M.S. Sandhu (Manjinder); L.J. Scott (Laura); A. Scuteri (Angelo); K. Silander (Kaisa); K. Song (Kijoung); X. Yuan (Xin); H.M. Stringham (Heather); A.J. Swift (Amy); T. Tuomi (Tiinamaija); M. Uda (Manuela); P. Vollenweider (Peter); G. Waeber (Gérard); C. Wallace (Chris); G.B. Walters (Bragi); M.N. Weedon (Michael); J.C.M. Witteman (Jacqueline); C. Zhang (Cuilin); M. Caulfield (Mark); F.S. Collins (Francis); G.D. Smith; I.N.M. Day (Ian); P.W. Franks (Paul); A.T. Hattersley (Andrew); F.B. Hu (Frank); M.-R. Jarvelin (Marjo-Riitta); A. Kong (Augustine); J.S. Kooner (Jaspal); M. Laakso (Markku); E. Lakatta (Edward); V. Mooser (Vincent); L. Peltonen (Leena Johanna); N.J. Samani (Nilesh); T.D. Spector (Timothy); D.P. Strachan (David); T. Tanaka (Toshiko); J. Tuomilehto (Jaakko); A.G. Uitterlinden (André); P. Tikka-Kleemola (Päivi); N.J. Wareham (Nick); H. Watkins (Hugh); D. Waterworth (Dawn); M. Boehnke (Michael); P. Deloukas (Panagiotis); L. Groop (Leif); D.J. Hunter (David); U. Thorsteinsdottir (Unnur); D. Schlessinger (David); H.E. Wichmann (Erich); T.M. Frayling (Timothy); G.R. Abecasis (Gonçalo); J.N. Hirschhorn (Joel); R.J.F. Loos (Ruth); J-A. Zwart (John-Anker); K.L. Mohlke (Karen); I.E. Barroso (Inês); M.I. McCarthy (Mark)

    2009-01-01

    textabstractTo identify genetic loci influencing central obesity and fat distribution, we performed a meta-analysis of 16 genome-wide association studies (GWAS, N = 38,580) informative for adult waist circumference (WC) and waist-hip ratio (WHR). We selected 26 SNPs for follow-up, for which the

  17. Whole genome re-sequencing reveals genome-wide variations among parental lines of 16 mapping populations in chickpea (Cicer arietinum L.).

    Science.gov (United States)

    Thudi, Mahendar; Khan, Aamir W; Kumar, Vinay; Gaur, Pooran M; Katta, Krishnamohan; Garg, Vanika; Roorkiwal, Manish; Samineni, Srinivasan; Varshney, Rajeev K

    2016-01-27

    Chickpea (Cicer arietinum L.) is the second most important grain legume cultivated by resource poor farmers in South Asia and Sub-Saharan Africa. In order to harness the untapped genetic potential available for chickpea improvement, we re-sequenced 35 chickpea genotypes representing parental lines of 16 mapping populations segregating for abiotic (drought, heat, salinity), biotic stresses (Fusarium wilt, Ascochyta blight, Botrytis grey mould, Helicoverpa armigera) and nutritionally important (protein content) traits using whole genome re-sequencing approach. A total of 192.19 Gb data, generated on 35 genotypes of chickpea, comprising 973.13 million reads, with an average sequencing depth of ~10 X for each line. On an average 92.18 % reads from each genotype were aligned to the chickpea reference genome with 82.17 % coverage. A total of 2,058,566 unique single nucleotide polymorphisms (SNPs) and 292,588 Indels were detected while comparing with the reference chickpea genome. Highest number of SNPs were identified on the Ca4 pseudomolecule. In addition, copy number variations (CNVs) such as gene deletions and duplications were identified across the chickpea parental genotypes, which were minimum in PI 489777 (1 gene deletion) and maximum in JG 74 (1,497). A total of 164,856 line specific variations (144,888 SNPs and 19,968 Indels) with the highest percentage were identified in coding regions in ICC 1496 (21 %) followed by ICCV 97105 (12 %). Of 539 miscellaneous variations, 339, 138 and 62 were inter-chromosomal variations (CTX), intra-chromosomal variations (ITX) and inversions (INV) respectively. Genome-wide SNPs, Indels, CNVs, PAVs, and miscellaneous variations identified in different mapping populations are a valuable resource in genetic research and helpful in locating genes/genomic segments responsible for economically important traits. Further, the genome-wide variations identified in the present study can be used for developing high density SNP arrays for

  18. A genome-wide association study of COPD identifies a susceptibility locus on chromosome 19q13

    DEFF Research Database (Denmark)

    Cho, Michael H; Castaldi, Peter J; Wan, Emily S

    2012-01-01

    The genetic risk factors for chronic obstructive pulmonary disease (COPD) are still largely unknown. To date, genome-wide association studies (GWASs) of limited size have identified several novel risk loci for COPD at CHRNA3/CHRNA5/IREB2, HHIP and FAM13A; additional loci may be identified through...

  19. A barcode of organellar genome polymorphisms identifies the geographic origin of Plasmodium falciparum strains

    KAUST Repository

    Preston, Mark D.

    2014-06-13

    Malaria is a major public health problem that is actively being addressed in a global eradication campaign. Increased population mobility through international air travel has elevated the risk of re-introducing parasites to elimination areas and dispersing drug-resistant parasites to new regions. A simple genetic marker that quickly and accurately identifies the geographic origin of infections would be a valuable public health tool for locating the source of imported outbreaks. Here we analyse the mitochondrion and apicoplast genomes of 711 Plasmodium falciparum isolates from 14 countries, and find evidence that they are non-recombining and co-inherited. The high degree of linkage produces a panel of relatively few single-nucleotide polymorphisms (SNPs) that is geographically informative. We design a 23-SNP barcode that is highly predictive (?92%) and easily adapted to aid case management in the field and survey parasite migration worldwide. 2014 Macmillan Publishers Limited. All rights reserved.

  20. A barcode of organellar genome polymorphisms identifies the geographic origin of Plasmodium falciparum strains

    KAUST Repository

    Preston, Mark D.; Campino, Susana; Assefa, Samuel A.; Echeverry, Diego F.; Ocholla, Harold; Amambua-Ngwa, Alfred; Stewart, Lindsay B.; Conway, David J.; Borrmann, Steffen; Michon, Pascal; Zongo, Issaka; Oué draogo, Jean-Bosco; Djimde, Abdoulaye A.; Doumbo, Ogobara K.; Nosten, Francois; Pain, Arnab; Bousema, Teun; Drakeley, Chris J.; Fairhurst, Rick M.; Sutherland, Colin J.; Roper, Cally; Clark, Taane G.

    2014-01-01

    Malaria is a major public health problem that is actively being addressed in a global eradication campaign. Increased population mobility through international air travel has elevated the risk of re-introducing parasites to elimination areas and dispersing drug-resistant parasites to new regions. A simple genetic marker that quickly and accurately identifies the geographic origin of infections would be a valuable public health tool for locating the source of imported outbreaks. Here we analyse the mitochondrion and apicoplast genomes of 711 Plasmodium falciparum isolates from 14 countries, and find evidence that they are non-recombining and co-inherited. The high degree of linkage produces a panel of relatively few single-nucleotide polymorphisms (SNPs) that is geographically informative. We design a 23-SNP barcode that is highly predictive (?92%) and easily adapted to aid case management in the field and survey parasite migration worldwide. 2014 Macmillan Publishers Limited. All rights reserved.

  1. Relationships Between Health Literacy and Genomics-Related Knowledge, Self-Efficacy, Perceived Importance, and Communication in a Medically Underserved Population.

    Science.gov (United States)

    Kaphingst, Kimberly A; Blanchard, Melvin; Milam, Laurel; Pokharel, Manusheela; Elrick, Ashley; Goodman, Melody S

    2016-01-01

    The increasing importance of genomic information in clinical care heightens the need to examine how individuals understand, value, and communicate about this information. Based on a conceptual framework of genomics-related health literacy, we examined whether health literacy was related to knowledge, self-efficacy, and perceived importance of genetics and family health history (FHH) and communication about FHH in a medically underserved population. The analytic sample was composed of 624 patients at a primary care clinic in a large urban hospital. About half of the participants (47%) had limited health literacy; 55% had no education beyond high school, and 58% were Black. In multivariable models, limited health literacy was associated with lower genetic knowledge (β = -0.55, SE = 0.10, p interval [CI; 0.28, 0.90], p = .020), and greater perceived importance of genetic information (OR = 1.95, 95% CI [1.27, 3.00], p = .0022) but lower perceived importance of FHH information (OR = 0.47, 95% CI [0.26, 0.86], p = .013) and more frequent communication with a doctor about FHH (OR = 2.02, 95% CI [1.27, 3.23], p = .0032). The findings highlight the importance of considering domains of genomics-related health literacy (e.g., knowledge, oral literacy) in developing educational strategies for genomic information. Health literacy research is essential to avoid increasing disparities in information and health outcomes as genomic information reaches more patients.

  2. Complete Genome Sequence of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) from the First Imported MERS-CoV Case in China.

    Science.gov (United States)

    Lu, Roujian; Wang, Yanqun; Wang, Wenling; Nie, Kai; Zhao, Yanjie; Su, Juan; Deng, Yao; Zhou, Weimin; Li, Yang; Wang, Huijuan; Wang, Wen; Ke, Changwen; Ma, Xuejun; Wu, Guizhen; Tan, Wenjie

    2015-08-13

    On 26 May 2015, an imported Middle East respiratory syndrome coronavirus (MERS-CoV) was identified in Guangdong Province, China, and found to be closely related to the MERS-CoV strain prevalent in South Korea. The full genome of the ChinaGD01 strain was sequenced and analyzed to investigate the epidemiology and evolution of MERS-CoV circulating in South Korea and China. Copyright © 2015 Lu et al.

  3. The Human Genome Project and Eugenics: Identifying the Impact on Individuals with Mental Retardation.

    Science.gov (United States)

    Kuna, Jason

    2001-01-01

    This article explores the impact of the mapping work of the Human Genome Project on individuals with mental retardation and the negative effects of genetic testing. The potential to identify disabilities and the concept of eugenics are discussed, along with ethical issues surrounding potential genetic therapies. (Contains references.) (CR)

  4. Genome-wide association study identifies multiple susceptibility loci for diffuse large B cell lymphoma

    NARCIS (Netherlands)

    Cerhan, James R.; Berndt, Sonja I.; Vijai, Joseph; Ghesquières, Hervé; McKay, James; Wang, Sophia S.; Wang, Zhaoming; Yeager, Meredith; Conde, Lucia; De Bakker, Paul I W; Nieters, Alexandra; Cox, David; Burdett, Laurie; Monnereau, Alain; Flowers, Christopher R.; De Roos, Anneclaire J.; Brooks-Wilson, Angela R.; Lan, Qing; Severi, Gianluca; Melbye, Mads; Gu, Jian; Jackson, Rebecca D.; Kane, Eleanor; Teras, Lauren R.; Purdue, Mark P.; Vajdic, Claire M.; Spinelli, John J.; Giles, Graham G.; Albanes, Demetrius; Kelly, Rachel S.; Zucca, Mariagrazia; Bertrand, Kimberly A.; Zeleniuch-Jacquotte, Anne; Lawrence, Charles; Hutchinson, Amy; Zhi, Degui; Habermann, Thomas M.; Link, Brian K.; Novak, Anne J.; Dogan, Ahmet; Asmann, Yan W.; Liebow, Mark; Thompson, Carrie A.; Ansell, Stephen M.; Witzig, Thomas E.; Weiner, George J.; Veron, Amelie S.; Zelenika, Diana; Tilly, Hervé; Haioun, Corinne; Molina, Thierry Jo; Hjalgrim, Henrik; Glimelius, Bengt; Adami, Hans Olov; Bracci, Paige M.; Riby, Jacques; Smith, Martyn T.; Holly, Elizabeth A.; Cozen, Wendy; Hartge, Patricia; Morton, Lindsay M.; Severson, Richard K.; Tinker, Lesley F.; North, Kari E.; Becker, Nikolaus; Benavente, Yolanda; Boffetta, Paolo; Brennan, Paul; Foretova, Lenka; Maynadie, Marc; Staines, Anthony; Lightfoot, Tracy; Crouch, Simon; Smith, Alex; Roman, Eve; Diver, W. Ryan; Offit, Kenneth; Zelenetz, Andrew; Klein, Robert J.; Villano, Danylo J.; Zheng, Tongzhang; Zhang, Yawei; Holford, Theodore R.; Kricker, Anne; Turner, Jenny; Southey, Melissa C.; Clavel, Jacqueline; Virtamo, Jarmo; Weinstein, Stephanie; Riboli, Elio; Vineis, Paolo; Kaaks, Rudolph; Trichopoulos, Dimitrios; Vermeulen, Roel C H; Boeing, Heiner; Tjonneland, Anne; Angelucci, Emanuele; Di Lollo, Simonetta; Rais, Marco; Birmann, Brenda M.; Laden, Francine; Giovannucci, Edward; Kraft, Peter; Huang, Jinyan; Ma, Baoshan; Ye, Yuanqing; Chiu, Brian C H; Sampson, Joshua; Liang, Liming; Park, Ju Hyun; Chung, Charles C.; Weisenburger, Dennis D.; Chatterjee, Nilanjan; Fraumeni, Joseph F.; Slager, Susan L.; Wu, Xifeng; De Sanjose, Silvia; Smedby, Karin E.; Salles, Gilles; Skibola, Christine F.; Rothman, Nathaniel; Chanock, Stephen J.

    2014-01-01

    Diffuse large B cell lymphoma (DLBCL) is the most common lymphoma subtype and is clinically aggressive. To identify genetic susceptibility loci for DLBCL, we conducted a meta-analysis of 3 new genome-wide association studies (GWAS) and 1 previous scan, totaling 3,857 cases and 7,666 controls of

  5. Genome-wide mapping of virulence in brown planthopper identifies loci that break down host plant resistance.

    Science.gov (United States)

    Jing, Shengli; Zhang, Lei; Ma, Yinhua; Liu, Bingfang; Zhao, Yan; Yu, Hangjin; Zhou, Xi; Qin, Rui; Zhu, Lili; He, Guangcun

    2014-01-01

    Insects and plants have coexisted for over 350 million years and their interactions have affected ecosystems and agricultural practices worldwide. Variation in herbivorous insects' virulence to circumvent host resistance has been extensively documented. However, despite decades of investigation, the genetic foundations of virulence are currently unknown. The brown planthopper (Nilaparvata lugens) is the most destructive rice (Oryza sativa) pest in the world. The identification of the resistance gene Bph1 and its introduction in commercial rice varieties prompted the emergence of a new virulent brown planthopper biotype that was able to break the resistance conferred by Bph1. In this study, we aimed to construct a high density linkage map for the brown planthopper and identify the loci responsible for its virulence in order to determine their genetic architecture. Based on genotyping data for hundreds of molecular markers in three mapping populations, we constructed the most comprehensive linkage map available for this species, covering 96.6% of its genome. Fifteen chromosomes were anchored with 124 gene-specific markers. Using genome-wide scanning and interval mapping, the Qhp7 locus that governs preference for Bph1 plants was mapped to a 0.1 cM region of chromosome 7. In addition, two major QTLs that govern the rate of insect growth on resistant rice plants were identified on chromosomes 5 (Qgr5) and 14 (Qgr14). This is the first study to successfully locate virulence in the genome of this important agricultural insect by marker-based genetic mapping. Our results show that the virulence which overcomes the resistance conferred by Bph1 is controlled by a few major genes and that the components of virulence originate from independent genetic characters. The isolation of these loci will enable the elucidation of the molecular mechanisms underpinning the rice-brown planthopper interaction and facilitate the development of durable approaches for controlling this most

  6. Genome-wide mapping of virulence in brown planthopper identifies loci that break down host plant resistance.

    Directory of Open Access Journals (Sweden)

    Shengli Jing

    Full Text Available Insects and plants have coexisted for over 350 million years and their interactions have affected ecosystems and agricultural practices worldwide. Variation in herbivorous insects' virulence to circumvent host resistance has been extensively documented. However, despite decades of investigation, the genetic foundations of virulence are currently unknown. The brown planthopper (Nilaparvata lugens is the most destructive rice (Oryza sativa pest in the world. The identification of the resistance gene Bph1 and its introduction in commercial rice varieties prompted the emergence of a new virulent brown planthopper biotype that was able to break the resistance conferred by Bph1. In this study, we aimed to construct a high density linkage map for the brown planthopper and identify the loci responsible for its virulence in order to determine their genetic architecture. Based on genotyping data for hundreds of molecular markers in three mapping populations, we constructed the most comprehensive linkage map available for this species, covering 96.6% of its genome. Fifteen chromosomes were anchored with 124 gene-specific markers. Using genome-wide scanning and interval mapping, the Qhp7 locus that governs preference for Bph1 plants was mapped to a 0.1 cM region of chromosome 7. In addition, two major QTLs that govern the rate of insect growth on resistant rice plants were identified on chromosomes 5 (Qgr5 and 14 (Qgr14. This is the first study to successfully locate virulence in the genome of this important agricultural insect by marker-based genetic mapping. Our results show that the virulence which overcomes the resistance conferred by Bph1 is controlled by a few major genes and that the components of virulence originate from independent genetic characters. The isolation of these loci will enable the elucidation of the molecular mechanisms underpinning the rice-brown planthopper interaction and facilitate the development of durable approaches for

  7. A Large-Scale Multi-ancestry Genome-wide Study Accounting for Smoking Behavior Identifies Multiple Significant Loci for Blood Pressure

    DEFF Research Database (Denmark)

    Sung, Yun J; Winkler, Thomas W; de Las Fuentes, Lisa

    2018-01-01

    Genome-wide association analysis advanced understanding of blood pressure (BP), a major risk factor for vascular conditions such as coronary heart disease and stroke. Accounting for smoking behavior may help identify BP loci and extend our knowledge of its genetic architecture. We performed genom...

  8. Genome-wide meta-analysis of 241,258 adults accounting for smoking behaviour identifies novel loci for obesity traits.

    Science.gov (United States)

    Justice, Anne E; Winkler, Thomas W; Feitosa, Mary F; Graff, Misa; Fisher, Virginia A; Young, Kristin; Barata, Llilda; Deng, Xuan; Czajkowski, Jacek; Hadley, David; Ngwa, Julius S; Ahluwalia, Tarunveer S; Chu, Audrey Y; Heard-Costa, Nancy L; Lim, Elise; Perez, Jeremiah; Eicher, John D; Kutalik, Zoltán; Xue, Luting; Mahajan, Anubha; Renström, Frida; Wu, Joseph; Qi, Qibin; Ahmad, Shafqat; Alfred, Tamuno; Amin, Najaf; Bielak, Lawrence F; Bonnefond, Amelie; Bragg, Jennifer; Cadby, Gemma; Chittani, Martina; Coggeshall, Scott; Corre, Tanguy; Direk, Nese; Eriksson, Joel; Fischer, Krista; Gorski, Mathias; Neergaard Harder, Marie; Horikoshi, Momoko; Huang, Tao; Huffman, Jennifer E; Jackson, Anne U; Justesen, Johanne Marie; Kanoni, Stavroula; Kinnunen, Leena; Kleber, Marcus E; Komulainen, Pirjo; Kumari, Meena; Lim, Unhee; Luan, Jian'an; Lyytikäinen, Leo-Pekka; Mangino, Massimo; Manichaikul, Ani; Marten, Jonathan; Middelberg, Rita P S; Müller-Nurasyid, Martina; Navarro, Pau; Pérusse, Louis; Pervjakova, Natalia; Sarti, Cinzia; Smith, Albert Vernon; Smith, Jennifer A; Stančáková, Alena; Strawbridge, Rona J; Stringham, Heather M; Sung, Yun Ju; Tanaka, Toshiko; Teumer, Alexander; Trompet, Stella; van der Laan, Sander W; van der Most, Peter J; Van Vliet-Ostaptchouk, Jana V; Vedantam, Sailaja L; Verweij, Niek; Vink, Jacqueline M; Vitart, Veronique; Wu, Ying; Yengo, Loic; Zhang, Weihua; Hua Zhao, Jing; Zimmermann, Martina E; Zubair, Niha; Abecasis, Gonçalo R; Adair, Linda S; Afaq, Saima; Afzal, Uzma; Bakker, Stephan J L; Bartz, Traci M; Beilby, John; Bergman, Richard N; Bergmann, Sven; Biffar, Reiner; Blangero, John; Boerwinkle, Eric; Bonnycastle, Lori L; Bottinger, Erwin; Braga, Daniele; Buckley, Brendan M; Buyske, Steve; Campbell, Harry; Chambers, John C; Collins, Francis S; Curran, Joanne E; de Borst, Gert J; de Craen, Anton J M; de Geus, Eco J C; Dedoussis, George; Delgado, Graciela E; den Ruijter, Hester M; Eiriksdottir, Gudny; Eriksson, Anna L; Esko, Tõnu; Faul, Jessica D; Ford, Ian; Forrester, Terrence; Gertow, Karl; Gigante, Bruna; Glorioso, Nicola; Gong, Jian; Grallert, Harald; Grammer, Tanja B; Grarup, Niels; Haitjema, Saskia; Hallmans, Göran; Hamsten, Anders; Hansen, Torben; Harris, Tamara B; Hartman, Catharina A; Hassinen, Maija; Hastie, Nicholas D; Heath, Andrew C; Hernandez, Dena; Hindorff, Lucia; Hocking, Lynne J; Hollensted, Mette; Holmen, Oddgeir L; Homuth, Georg; Jan Hottenga, Jouke; Huang, Jie; Hung, Joseph; Hutri-Kähönen, Nina; Ingelsson, Erik; James, Alan L; Jansson, John-Olov; Jarvelin, Marjo-Riitta; Jhun, Min A; Jørgensen, Marit E; Juonala, Markus; Kähönen, Mika; Karlsson, Magnus; Koistinen, Heikki A; Kolcic, Ivana; Kolovou, Genovefa; Kooperberg, Charles; Krämer, Bernhard K; Kuusisto, Johanna; Kvaløy, Kirsti; Lakka, Timo A; Langenberg, Claudia; Launer, Lenore J; Leander, Karin; Lee, Nanette R; Lind, Lars; Lindgren, Cecilia M; Linneberg, Allan; Lobbens, Stephane; Loh, Marie; Lorentzon, Mattias; Luben, Robert; Lubke, Gitta; Ludolph-Donislawski, Anja; Lupoli, Sara; Madden, Pamela A F; Männikkö, Reija; Marques-Vidal, Pedro; Martin, Nicholas G; McKenzie, Colin A; McKnight, Barbara; Mellström, Dan; Menni, Cristina; Montgomery, Grant W; Musk, Aw Bill; Narisu, Narisu; Nauck, Matthias; Nolte, Ilja M; Oldehinkel, Albertine J; Olden, Matthias; Ong, Ken K; Padmanabhan, Sandosh; Peyser, Patricia A; Pisinger, Charlotta; Porteous, David J; Raitakari, Olli T; Rankinen, Tuomo; Rao, D C; Rasmussen-Torvik, Laura J; Rawal, Rajesh; Rice, Treva; Ridker, Paul M; Rose, Lynda M; Bien, Stephanie A; Rudan, Igor; Sanna, Serena; Sarzynski, Mark A; Sattar, Naveed; Savonen, Kai; Schlessinger, David; Scholtens, Salome; Schurmann, Claudia; Scott, Robert A; Sennblad, Bengt; Siemelink, Marten A; Silbernagel, Günther; Slagboom, P Eline; Snieder, Harold; Staessen, Jan A; Stott, David J; Swertz, Morris A; Swift, Amy J; Taylor, Kent D; Tayo, Bamidele O; Thorand, Barbara; Thuillier, Dorothee; Tuomilehto, Jaakko; Uitterlinden, Andre G; Vandenput, Liesbeth; Vohl, Marie-Claude; Völzke, Henry; Vonk, Judith M; Waeber, Gérard; Waldenberger, Melanie; Westendorp, R G J; Wild, Sarah; Willemsen, Gonneke; Wolffenbuttel, Bruce H R; Wong, Andrew; Wright, Alan F; Zhao, Wei; Zillikens, M Carola; Baldassarre, Damiano; Balkau, Beverley; Bandinelli, Stefania; Böger, Carsten A; Boomsma, Dorret I; Bouchard, Claude; Bruinenberg, Marcel; Chasman, Daniel I; Chen, Yii-DerIda; Chines, Peter S; Cooper, Richard S; Cucca, Francesco; Cusi, Daniele; Faire, Ulf de; Ferrucci, Luigi; Franks, Paul W; Froguel, Philippe; Gordon-Larsen, Penny; Grabe, Hans-Jörgen; Gudnason, Vilmundur; Haiman, Christopher A; Hayward, Caroline; Hveem, Kristian; Johnson, Andrew D; Wouter Jukema, J; Kardia, Sharon L R; Kivimaki, Mika; Kooner, Jaspal S; Kuh, Diana; Laakso, Markku; Lehtimäki, Terho; Marchand, Loic Le; März, Winfried; McCarthy, Mark I; Metspalu, Andres; Morris, Andrew P; Ohlsson, Claes; Palmer, Lyle J; Pasterkamp, Gerard; Pedersen, Oluf; Peters, Annette; Peters, Ulrike; Polasek, Ozren; Psaty, Bruce M; Qi, Lu; Rauramaa, Rainer; Smith, Blair H; Sørensen, Thorkild I A; Strauch, Konstantin; Tiemeier, Henning; Tremoli, Elena; van der Harst, Pim; Vestergaard, Henrik; Vollenweider, Peter; Wareham, Nicholas J; Weir, David R; Whitfield, John B; Wilson, James F; Tyrrell, Jessica; Frayling, Timothy M; Barroso, Inês; Boehnke, Michael; Deloukas, Panagiotis; Fox, Caroline S; Hirschhorn, Joel N; Hunter, David J; Spector, Tim D; Strachan, David P; van Duijn, Cornelia M; Heid, Iris M; Mohlke, Karen L; Marchini, Jonathan; Loos, Ruth J F; Kilpeläinen, Tuomas O; Liu, Ching-Ti; Borecki, Ingrid B; North, Kari E; Cupples, L Adrienne

    2017-04-26

    Few genome-wide association studies (GWAS) account for environmental exposures, like smoking, potentially impacting the overall trait variance when investigating the genetic contribution to obesity-related traits. Here, we use GWAS data from 51,080 current smokers and 190,178 nonsmokers (87% European descent) to identify loci influencing BMI and central adiposity, measured as waist circumference and waist-to-hip ratio both adjusted for BMI. We identify 23 novel genetic loci, and 9 loci with convincing evidence of gene-smoking interaction (GxSMK) on obesity-related traits. We show consistent direction of effect for all identified loci and significance for 18 novel and for 5 interaction loci in an independent study sample. These loci highlight novel biological functions, including response to oxidative stress, addictive behaviour, and regulatory functions emphasizing the importance of accounting for environment in genetic analyses. Our results suggest that tobacco smoking may alter the genetic susceptibility to overall adiposity and body fat distribution.

  9. A comparative genomics screen identifies a Sinorhizobium meliloti 1021 sodM-like gene strongly expressed within host plant nodules

    Directory of Open Access Journals (Sweden)

    Queiroux Clothilde

    2012-05-01

    Full Text Available Abstract Background We have used the genomic data in the Integrated Microbial Genomes system of the Department of Energy’s Joint Genome Institute to make predictions about rhizobial open reading frames that play a role in nodulation of host plants. The genomic data was screened by searching for ORFs conserved in α-proteobacterial rhizobia, but not conserved in closely-related non-nitrogen-fixing α-proteobacteria. Results Using this approach, we identified many genes known to be involved in nodulation or nitrogen fixation, as well as several new candidate genes. We knocked out selected new genes and assayed for the presence of nodulation phenotypes and/or nodule-specific expression. One of these genes, SMc00911, is strongly expressed by bacterial cells within host plant nodules, but is expressed minimally by free-living bacterial cells. A strain carrying an insertion mutation in SMc00911 is not defective in the symbiosis with host plants, but in contrast to expectations, this mutant strain is able to out-compete the S. meliloti 1021 wild type strain for nodule occupancy in co-inoculation experiments. The SMc00911 ORF is predicted to encode a “SodM-like” (superoxide dismutase-like protein containing a rhodanese sulfurtransferase domain at the N-terminus and a chromate-resistance superfamily domain at the C-terminus. Several other ORFs (SMb20360, SMc01562, SMc01266, SMc03964, and the SMc01424-22 operon identified in the screen are expressed at a moderate level by bacteria within nodules, but not by free-living bacteria. Conclusions Based on the analysis of ORFs identified in this study, we conclude that this comparative genomics approach can identify rhizobial genes involved in the nitrogen-fixing symbiosis with host plants, although none of the newly identified genes were found to be essential for this process.

  10. Use of Whole-Genus Genome Sequence Data To Develop a Multilocus Sequence Typing Tool That Accurately Identifies Yersinia Isolates to the Species and Subspecies Levels

    Science.gov (United States)

    Hall, Miquette; Chattaway, Marie A.; Reuter, Sandra; Savin, Cyril; Strauch, Eckhard; Carniel, Elisabeth; Connor, Thomas; Van Damme, Inge; Rajakaruna, Lakshani; Rajendram, Dunstan; Jenkins, Claire; Thomson, Nicholas R.

    2014-01-01

    The genus Yersinia is a large and diverse bacterial genus consisting of human-pathogenic species, a fish-pathogenic species, and a large number of environmental species. Recently, the phylogenetic and population structure of the entire genus was elucidated through the genome sequence data of 241 strains encompassing every known species in the genus. Here we report the mining of this enormous data set to create a multilocus sequence typing-based scheme that can identify Yersinia strains to the species level to a level of resolution equal to that for whole-genome sequencing. Our assay is designed to be able to accurately subtype the important human-pathogenic species Yersinia enterocolitica to whole-genome resolution levels. We also report the validation of the scheme on 386 strains from reference laboratory collections across Europe. We propose that the scheme is an important molecular typing system to allow accurate and reproducible identification of Yersinia isolates to the species level, a process often inconsistent in nonspecialist laboratories. Additionally, our assay is the most phylogenetically informative typing scheme available for Y. enterocolitica. PMID:25339391

  11. Systems-based analysis of the Sarcocystis neurona genome identifies pathways that contribute to a heteroxenous life cycle.

    Science.gov (United States)

    Blazejewski, Tomasz; Nursimulu, Nirvana; Pszenny, Viviana; Dangoudoubiyam, Sriveny; Namasivayam, Sivaranjani; Chiasson, Melissa A; Chessman, Kyle; Tonkin, Michelle; Swapna, Lakshmipuram S; Hung, Stacy S; Bridgers, Joshua; Ricklefs, Stacy M; Boulanger, Martin J; Dubey, Jitender P; Porcella, Stephen F; Kissinger, Jessica C; Howe, Daniel K; Grigg, Michael E; Parkinson, John

    2015-02-10

    Sarcocystis neurona is a member of the coccidia, a clade of single-celled parasites of medical and veterinary importance including Eimeria, Sarcocystis, Neospora, and Toxoplasma. Unlike Eimeria, a single-host enteric pathogen, Sarcocystis, Neospora, and Toxoplasma are two-host parasites that infect and produce infectious tissue cysts in a wide range of intermediate hosts. As a genus, Sarcocystis is one of the most successful protozoan parasites; all vertebrates, including birds, reptiles, fish, and mammals are hosts to at least one Sarcocystis species. Here we sequenced Sarcocystis neurona, the causal agent of fatal equine protozoal myeloencephalitis. The S. neurona genome is 127 Mbp, more than twice the size of other sequenced coccidian genomes. Comparative analyses identified conservation of the invasion machinery among the coccidia. However, many dense-granule and rhoptry kinase genes, responsible for altering host effector pathways in Toxoplasma and Neospora, are absent from S. neurona. Further, S. neurona has a divergent repertoire of SRS proteins, previously implicated in tissue cyst formation in Toxoplasma. Systems-based analyses identified a series of metabolic innovations, including the ability to exploit alternative sources of energy. Finally, we present an S. neurona model detailing conserved molecular innovations that promote the transition from a purely enteric lifestyle (Eimeria) to a heteroxenous parasite capable of infecting a wide range of intermediate hosts. Sarcocystis neurona is a member of the coccidia, a clade of single-celled apicomplexan parasites responsible for major economic and health care burdens worldwide. A cousin of Plasmodium, Cryptosporidium, Theileria, and Eimeria, Sarcocystis is one of the most successful parasite genera; it is capable of infecting all vertebrates (fish, reptiles, birds, and mammals-including humans). The past decade has witnessed an increasing number of human outbreaks of clinical significance associated with

  12. Genome-wide association analysis of pain severity in dysmenorrhea identifies association at chromosome 1p13.2, near the nerve growth factor locus.

    Science.gov (United States)

    Jones, Amy V; Hockley, James R F; Hyde, Craig; Gorman, Donal; Sredic-Rhodes, Ana; Bilsland, James; McMurray, Gordon; Furlotte, Nicholas A; Hu, Youna; Hinds, David A; Cox, Peter J; Scollen, Serena

    2016-11-01

    Dysmenorrhea is a common chronic pelvic pain syndrome affecting women of childbearing potential. Family studies suggest that genetic background influences the severity of dysmenorrhea, but genetic predisposition and molecular mechanisms underlying dysmenorrhea are not understood. In this study, we conduct the first genome-wide association study to identify genetic factors associated with dysmenorrhea pain severity. A cohort of females of European descent (n = 11,891) aged 18 to 45 years rated their average dysmenorrhea pain severity. We used a linear regression model adjusting for age and body mass index, identifying one genome-wide significant (P dysmenorrhea pain were more likely to report being positive for endometriosis, polycystic ovarian syndrome, depression, and other psychiatric disorders. Our results indicate that dysmenorrhea pain severity is partly genetically determined. NGF already has an established role in chronic pain disorders, and our findings suggest that NGF may be an important mediator for gynaecological/pelvic pain in the viscera.

  13. Seven prostate cancer susceptibility loci identified by a multi-stage genome-wide association study

    DEFF Research Database (Denmark)

    Kote-Jarai, Zsofia; Olama, Ali Amin Al; Giles, Graham G

    2011-01-01

    Prostate cancer (PrCa) is the most frequently diagnosed male cancer in developed countries. We conducted a multi-stage genome-wide association study for PrCa and previously reported the results of the first two stages, which identified 16 PrCa susceptibility loci. We report here the results of st...

  14. The genome of Chenopodium quinoa

    KAUST Repository

    Jarvis, David Erwin; Ho, Yung Shwen; Lightfoot, Damien; Schmö ckel, Sandra M.; Li, Bo; Borm, Theo J. A.; Ohyanagi, Hajime; Mineta, Katsuhiko; Michell, Craig; Saber, Noha; Kharbatia, Najeh M.; Rupper, Ryan R.; Sharp, Aaron R.; Dally, Nadine; Boughton, Berin A.; Woo, Yong; Gao, Ge; Schijlen, Elio G. W. M.; Guo, Xiujie; Momin, Afaque Ahmad Imtiyaz; Negrã o, Só nia; Al-Babili, Salim; Gehring, Christoph A; Roessner, Ute; Jung, Christian; Murphy, Kevin; Arold, Stefan T.; Gojobori, Takashi; Linden, C. Gerard van der; Loo, Eibertus N. van; Jellen, Eric N.; Maughan, Peter J.; Tester, Mark A.

    2017-01-01

    Chenopodium quinoa (quinoa) is a highly nutritious grain identified as an important crop to improve world food security. Unfortunately, few resources are available to facilitate its genetic improvement. Here we report the assembly of a high-quality, chromosome-scale reference genome sequence for quinoa, which was produced using single-molecule real-time sequencing in combination with optical, chromosome-contact and genetic maps. We also report the sequencing of two diploids from the ancestral gene pools of quinoa, which enables the identification of sub-genomes in quinoa, and reduced-coverage genome sequences for 22 other samples of the allotetraploid goosefoot complex. The genome sequence facilitated the identification of the transcription factor likely to control the production of anti-nutritional triterpenoid saponins found in quinoa seeds, including a mutation that appears to cause alternative splicing and a premature stop codon in sweet quinoa strains. These genomic resources are an important first step towards the genetic improvement of quinoa.

  15. The genome of Chenopodium quinoa

    KAUST Repository

    Jarvis, David Erwin

    2017-02-08

    Chenopodium quinoa (quinoa) is a highly nutritious grain identified as an important crop to improve world food security. Unfortunately, few resources are available to facilitate its genetic improvement. Here we report the assembly of a high-quality, chromosome-scale reference genome sequence for quinoa, which was produced using single-molecule real-time sequencing in combination with optical, chromosome-contact and genetic maps. We also report the sequencing of two diploids from the ancestral gene pools of quinoa, which enables the identification of sub-genomes in quinoa, and reduced-coverage genome sequences for 22 other samples of the allotetraploid goosefoot complex. The genome sequence facilitated the identification of the transcription factor likely to control the production of anti-nutritional triterpenoid saponins found in quinoa seeds, including a mutation that appears to cause alternative splicing and a premature stop codon in sweet quinoa strains. These genomic resources are an important first step towards the genetic improvement of quinoa.

  16. The genome of Chenopodium quinoa.

    Science.gov (United States)

    Jarvis, David E; Ho, Yung Shwen; Lightfoot, Damien J; Schmöckel, Sandra M; Li, Bo; Borm, Theo J A; Ohyanagi, Hajime; Mineta, Katsuhiko; Michell, Craig T; Saber, Noha; Kharbatia, Najeh M; Rupper, Ryan R; Sharp, Aaron R; Dally, Nadine; Boughton, Berin A; Woo, Yong H; Gao, Ge; Schijlen, Elio G W M; Guo, Xiujie; Momin, Afaque A; Negrão, Sónia; Al-Babili, Salim; Gehring, Christoph; Roessner, Ute; Jung, Christian; Murphy, Kevin; Arold, Stefan T; Gojobori, Takashi; Linden, C Gerard van der; van Loo, Eibertus N; Jellen, Eric N; Maughan, Peter J; Tester, Mark

    2017-02-16

    Chenopodium quinoa (quinoa) is a highly nutritious grain identified as an important crop to improve world food security. Unfortunately, few resources are available to facilitate its genetic improvement. Here we report the assembly of a high-quality, chromosome-scale reference genome sequence for quinoa, which was produced using single-molecule real-time sequencing in combination with optical, chromosome-contact and genetic maps. We also report the sequencing of two diploids from the ancestral gene pools of quinoa, which enables the identification of sub-genomes in quinoa, and reduced-coverage genome sequences for 22 other samples of the allotetraploid goosefoot complex. The genome sequence facilitated the identification of the transcription factor likely to control the production of anti-nutritional triterpenoid saponins found in quinoa seeds, including a mutation that appears to cause alternative splicing and a premature stop codon in sweet quinoa strains. These genomic resources are an important first step towards the genetic improvement of quinoa.

  17. A genome-wide association analysis of a broad psychosis phenotype identifies three loci for further investigation

    OpenAIRE

    Bramon, Elvira; Pirinen, Matti; Strange, Amy; Lin, Kuang; Freeman, Colin; Bellenguez, Céline; Su, Zhan; Band, Gavin; Pearson, Richard; Vukcevic, Damjan; Langford, Cordelia; Deloukas, Panos; Hunt, Sarah; Gray, Emma; Dronov, Serge

    2014-01-01

    Genome-wide association studies (GWAS) have identified several loci associated with schizophrenia and/or bipolar disorder. We performed a GWAS of psychosis as a broad syndrome rather than within specific diagnostic categories.

  18. Genome-wide gene expression dataset used to identify potential therapeutic targets in androgenetic alopecia

    Directory of Open Access Journals (Sweden)

    R. Dey-Rao

    2017-08-01

    Full Text Available The microarray dataset attached to this report is related to the research article with the title: “A genomic approach to susceptibility and pathogenesis leads to identifying potential novel therapeutic targets in androgenetic alopecia” (Dey-Rao and Sinha, 2017 [1]. Male-pattern hair loss that is induced by androgens (testosterone in genetically predisposed individuals is known as androgenetic alopecia (AGA. The raw dataset is being made publicly available to enable critical and/or extended analyses. Our related research paper utilizes the attached raw dataset, for genome-wide gene-expression associated investigations. Combined with several in silico bioinformatics-based analyses we were able to delineate five strategic molecular elements as potential novel targets towards future AGA-therapy.

  19. Genome-Wide Association Study Identifies Four Loci Associated with Eruption of Permanent Teeth

    Science.gov (United States)

    Zhang, Hao; Shaffer, John R.; Hansen, Thomas; Esserlind, Ann-Louise; Boyd, Heather A.; Nohr, Ellen A.; Timpson, Nicholas J.; Fatemifar, Ghazaleh; Paternoster, Lavinia; Evans, David M.; Weyant, Robert J.; Levy, Steven M.; Lathrop, Mark; Smith, George Davey; Murray, Jeffrey C.; Olesen, Jes; Werge, Thomas; Marazita, Mary L.; Sørensen, Thorkild I. A.; Melbye, Mads

    2011-01-01

    The sequence and timing of permanent tooth eruption is thought to be highly heritable and can have important implications for the risk of malocclusion, crowding, and periodontal disease. We conducted a genome-wide association study of number of permanent teeth erupted between age 6 and 14 years, analyzed as age-adjusted standard deviation score averaged over multiple time points, based on childhood records for 5,104 women from the Danish National Birth Cohort. Four loci showed association at Peruption and were also known to influence height and breast cancer, respectively. The two other loci pointed to genomic regions without any previous significant genome-wide association study results. The intronic SNP rs7924176 in ADK could be linked to gene expression in monocytes. The combined effect of the four genetic variants was most pronounced between age 10 and 12 years, where children with 6 to 8 delayed tooth eruption alleles had on average 3.5 (95% confidence interval: 2.9–4.1) fewer permanent teeth than children with 0 or 1 of these alleles. PMID:21931568

  20. Genome-wide RNAi screen identifies novel host proteins required for alphavirus entry.

    Directory of Open Access Journals (Sweden)

    Yaw Shin Ooi

    Full Text Available The enveloped alphaviruses include important and emerging human pathogens such as Chikungunya virus and Eastern equine encephalitis virus. Alphaviruses enter cells by clathrin-mediated endocytosis, and exit by budding from the plasma membrane. While there has been considerable progress in defining the structure and function of the viral proteins, relatively little is known about the host factors involved in alphavirus infection. We used a genome-wide siRNA screen to identify host factors that promote or inhibit alphavirus infection in human cells. Fuzzy homologue (FUZ, a protein with reported roles in planar cell polarity and cilia biogenesis, was required for the clathrin-dependent internalization of both alphaviruses and the classical endocytic ligand transferrin. The tetraspanin membrane protein TSPAN9 was critical for the efficient fusion of low pH-triggered virus with the endosome membrane. FUZ and TSPAN9 were broadly required for infection by the alphaviruses Sindbis virus, Semliki Forest virus, and Chikungunya virus, but were not required by the structurally-related flavivirus Dengue virus. Our results highlight the unanticipated functions of FUZ and TSPAN9 in distinct steps of alphavirus entry and suggest novel host proteins that may serve as targets for antiviral therapy.

  1. Meta-analyses of genome-wide association studies identify multiple loci associated with pulmonary function

    NARCIS (Netherlands)

    D.B. Hancock (Dana); M. Eijgelsheim (Mark); J.B. Wilk (Jemma); S.A. Gharib (Sina); L.R. Loehr (Laura); K. Marciante (Kristin); N. Franceschini (Nora); Y.M.T.A. van Durme; T.H. Chen; R.G. Barr (Graham); M.B. Schabath (Matthew); D.J. Couper (David); G.G. Brusselle (Guy); B.M. Psaty (Bruce); P. Tikka-Kleemola (Päivi); J.I. Rotter (Jerome); A.G. Uitterlinden (André); A. Hofman (Albert); N.M. Punjabi (Naresh); F. Rivadeneira Ramirez (Fernando); A.C. Morrison (Alanna); P.L. Enright (Paul); K.E. North (Kari); S.R. Heckbert (Susan); T. Lumley (Thomas); B.H.Ch. Stricker (Bruno); G.T. O'Connor (George); S.J. London (Stephanie)

    2010-01-01

    textabstractSpirometric measures of lung function are heritable traits that reflect respiratory health and predict morbidity and mortality. We meta-analyzed genome-wide association studies for two clinically important lung-function measures: forced expiratory volume in the first second (FEV1) and

  2. Genome-wide meta-analyses identify multiple loci associated with smoking behavior.

    LENUS (Irish Health Repository)

    2010-05-01

    Consistent but indirect evidence has implicated genetic factors in smoking behavior. We report meta-analyses of several smoking phenotypes within cohorts of the Tobacco and Genetics Consortium (n = 74,053). We also partnered with the European Network of Genetic and Genomic Epidemiology (ENGAGE) and Oxford-GlaxoSmithKline (Ox-GSK) consortia to follow up the 15 most significant regions (n > 140,000). We identified three loci associated with number of cigarettes smoked per day. The strongest association was a synonymous 15q25 SNP in the nicotinic receptor gene CHRNA3 (rs1051730[A], beta = 1.03, standard error (s.e.) = 0.053, P = 2.8 x 10(-73)). Two 10q25 SNPs (rs1329650[G], beta = 0.367, s.e. = 0.059, P = 5.7 x 10(-10); and rs1028936[A], beta = 0.446, s.e. = 0.074, P = 1.3 x 10(-9)) and one 9q13 SNP in EGLN2 (rs3733829[G], beta = 0.333, s.e. = 0.058, P = 1.0 x 10(-8)) also exceeded genome-wide significance for cigarettes per day. For smoking initiation, eight SNPs exceeded genome-wide significance, with the strongest association at a nonsynonymous SNP in BDNF on chromosome 11 (rs6265[C], odds ratio (OR) = 1.06, 95% confidence interval (Cl) 1.04-1.08, P = 1.8 x 10(-8)). One SNP located near DBH on chromosome 9 (rs3025343[G], OR = 1.12, 95% Cl 1.08-1.18, P = 3.6 x 10(-8)) was significantly associated with smoking cessation.

  3. Complete genome sequence of the fire blight pathogen Erwinia pyrifoliae DSM 12163T and comparative genomic insights into plant pathogenicity

    Directory of Open Access Journals (Sweden)

    Frey Jürg E

    2010-01-01

    Full Text Available Abstract Background Erwinia pyrifoliae is a newly described necrotrophic pathogen, which causes fire blight on Asian (Nashi pear and is geographically restricted to Eastern Asia. Relatively little is known about its genetics compared to the closely related main fire blight pathogen E. amylovora. Results The genome of the type strain of E. pyrifoliae strain DSM 12163T, was sequenced using both 454 and Solexa pyrosequencing and annotated. The genome contains a circular chromosome of 4.026 Mb and four small plasmids. Based on their respective role in virulence in E. amylovora or related organisms, we identified several putative virulence factors, including type III and type VI secretion systems and their effectors, flagellar genes, sorbitol metabolism, iron uptake determinants, and quorum-sensing components. A deletion in the rpoS gene covering the most conserved region of the protein was identified which may contribute to the difference in virulence/host-range compared to E. amylovora. Comparative genomics with the pome fruit epiphyte Erwinia tasmaniensis Et1/99 showed that both species are overall highly similar, although specific differences were identified, for example the presence of some phage gene-containing regions and a high number of putative genomic islands containing transposases in the E. pyrifoliae DSM 12163T genome. Conclusions The E. pyrifoliae genome is an important addition to the published genome of E. tasmaniensis and the unfinished genome of E. amylovora providing a foundation for re-sequencing additional strains that may shed light on the evolution of the host-range and virulence/pathogenicity of this important group of plant-associated bacteria.

  4. RUMINANT NUTRITION SYMPOSIUM: Use of genomics and transcriptomics to identify strategies to lower ruminal methanogenesis.

    Science.gov (United States)

    McAllister, T A; Meale, S J; Valle, E; Guan, L L; Zhou, M; Kelly, W J; Henderson, G; Attwood, G T; Janssen, P H

    2015-04-01

    Globally, methane (CH4) emissions account for 40% to 45% of greenhouse gas emissions from ruminant livestock, with over 90% of these emissions arising from enteric fermentation. Reduction of carbon dioxide to CH4 is critical for efficient ruminal fermentation because it prevents the accumulation of reducing equivalents in the rumen. Methanogens exist in a symbiotic relationship with rumen protozoa and fungi and within biofilms associated with feed and the rumen wall. Genomics and transcriptomics are playing an increasingly important role in defining the ecology of ruminal methanogenesis and identifying avenues for its mitigation. Metagenomic approaches have provided information on changes in abundances as well as the species composition of the methanogen community among ruminants that vary naturally in their CH4 emissions, their feed efficiency, and their response to CH4 mitigators. Sequencing the genomes of rumen methanogens has provided insight into surface proteins that may prove useful in the development of vaccines and has allowed assembly of biochemical pathways for use in chemogenomic approaches to lowering ruminal CH4 emissions. Metagenomics and metatranscriptomic analysis of entire rumen microbial communities are providing new perspectives on how methanogens interact with other members of this ecosystem and how these relationships may be altered to reduce methanogenesis. Identification of community members that produce antimethanogen agents that either inhibit or kill methanogens could lead to the identification of new mitigation approaches. Discovery of a lytic archaeophage that specifically lyses methanogens is 1 such example. Efforts in using genomic data to alter methanogenesis have been hampered by a lack of sequence information that is specific to the microbial community of the rumen. Programs such as Hungate1000 and the Global Rumen Census are increasing the breadth and depth of our understanding of global ruminal microbial communities, steps that

  5. Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder

    Science.gov (United States)

    Yuen, Ryan KC; Merico, Daniele; Bookman, Matt; Howe, Jennifer L; Thiruvahindrapuram, Bhooma; Patel, Rohan V; Whitney, Joe; Deflaux, Nicole; Bingham, Jonathan; Wang, Zhuozhi; Pellecchia, Giovanna; Buchanan, Janet A; Walker, Susan; Marshall, Christian R; Uddin, Mohammed; Zarrei, Mehdi; Deneault, Eric; D’Abate, Lia; Chan, Ada JS; Koyanagi, Stephanie; Paton, Tara; Pereira, Sergio L; Hoang, Ny; Engchuan, Worrawat; Higginbotham, Edward J; Ho, Karen; Lamoureux, Sylvia; Li, Weili; MacDonald, Jeffrey R; Nalpathamkalam, Thomas; Sung, Wilson WL; Tsoi, Fiona J; Wei, John; Xu, Lizhen; Tasse, Anne-Marie; Kirby, Emily; Van Etten, William; Twigger, Simon; Roberts, Wendy; Drmic, Irene; Jilderda, Sanne; Modi, Bonnie MacKinnon; Kellam, Barbara; Szego, Michael; Cytrynbaum, Cheryl; Weksberg, Rosanna; Zwaigenbaum, Lonnie; Woodbury-Smith, Marc; Brian, Jessica; Senman, Lili; Iaboni, Alana; Doyle-Thomas, Krissy; Thompson, Ann; Chrysler, Christina; Leef, Jonathan; Savion-Lemieux, Tal; Smith, Isabel M; Liu, Xudong; Nicolson, Rob; Seifer, Vicki; Fedele, Angie; Cook, Edwin H; Dager, Stephen; Estes, Annette; Gallagher, Louise; Malow, Beth A; Parr, Jeremy R; Spence, Sarah J; Vorstman, Jacob; Frey, Brendan J; Robinson, James T; Strug, Lisa J; Fernandez, Bridget A; Elsabbagh, Mayada; Carter, Melissa T; Hallmayer, Joachim; Knoppers, Bartha M; Anagnostou, Evdokia; Szatmari, Peter; Ring, Robert H; Glazer, David; Pletcher, Mathew T; Scherer, Stephen W

    2017-01-01

    We are performing whole genome sequencing (WGS) of families with Autism Spectrum Disorder (ASD) to build a resource, named MSSNG, to enable the sub-categorization of phenotypes and underlying genetic factors involved. Here, we report WGS of 5,205 samples from families with ASD, accompanied by clinical information, creating a database accessible in a cloud platform, and through an internet portal with controlled access. We found an average of 73.8 de novo single nucleotide variants and 12.6 de novo insertion/deletions (indels) or copy number variations (CNVs) per ASD subject. We identified 18 new candidate ASD-risk genes such as MED13 and PHF3, and found that participants bearing mutations in susceptibility genes had significantly lower adaptive ability (p=6×10−4). In 294/2,620 (11.2%) of ASD cases, a molecular basis could be determined and 7.2% of these carried CNV/chromosomal abnormalities, emphasizing the importance of detecting all forms of genetic variation as diagnostic and therapeutic targets in ASD. PMID:28263302

  6. Elg1 forms an alternative RFC complex important for DNA replication and genome integrity

    NARCIS (Netherlands)

    Bellaoui, Mohammed; Chang, Michael; Ou, Jiongwen; Xu, Hong; Boone, Charles; Brown, Grant W

    2003-01-01

    Genome-wide synthetic genetic interaction screens with mutants in the mus81 and mms4 replication fork-processing genes identified a novel replication factor C (RFC) homolog, Elg1, which forms an alternative RFC complex with Rfc2-5. This complex is distinct from the DNA replication RFC, the DNA

  7. Whole-genome sequencing identifies genomic heterogeneity at a nucleotide and chromosomal level in bladder cancer

    Science.gov (United States)

    Morrison, Carl D.; Liu, Pengyuan; Woloszynska-Read, Anna; Zhang, Jianmin; Luo, Wei; Qin, Maochun; Bshara, Wiam; Conroy, Jeffrey M.; Sabatini, Linda; Vedell, Peter; Xiong, Donghai; Liu, Song; Wang, Jianmin; Shen, He; Li, Yinwei; Omilian, Angela R.; Hill, Annette; Head, Karen; Guru, Khurshid; Kunnev, Dimiter; Leach, Robert; Eng, Kevin H.; Darlak, Christopher; Hoeflich, Christopher; Veeranki, Srividya; Glenn, Sean; You, Ming; Pruitt, Steven C.; Johnson, Candace S.; Trump, Donald L.

    2014-01-01

    Using complete genome analysis, we sequenced five bladder tumors accrued from patients with muscle-invasive transitional cell carcinoma of the urinary bladder (TCC-UB) and identified a spectrum of genomic aberrations. In three tumors, complex genotype changes were noted. All three had tumor protein p53 mutations and a relatively large number of single-nucleotide variants (SNVs; average of 11.2 per megabase), structural variants (SVs; average of 46), or both. This group was best characterized by chromothripsis and the presence of subclonal populations of neoplastic cells or intratumoral mutational heterogeneity. Here, we provide evidence that the process of chromothripsis in TCC-UB is mediated by nonhomologous end-joining using kilobase, rather than megabase, fragments of DNA, which we refer to as “stitchers,” to repair this process. We postulate that a potential unifying theme among tumors with the more complex genotype group is a defective replication–licensing complex. A second group (two bladder tumors) had no chromothripsis, and a simpler genotype, WT tumor protein p53, had relatively few SNVs (average of 5.9 per megabase) and only a single SV. There was no evidence of a subclonal population of neoplastic cells. In this group, we used a preclinical model of bladder carcinoma cell lines to study a unique SV (translocation and amplification) of the gene glutamate receptor ionotropic N-methyl D-aspertate as a potential new therapeutic target in bladder cancer. PMID:24469795

  8. Genomic consequences of selection and genome-wide association mapping in soybean.

    Science.gov (United States)

    Wen, Zixiang; Boyse, John F; Song, Qijian; Cregan, Perry B; Wang, Dechun

    2015-09-03

    Crop improvement always involves selection of specific alleles at genes controlling traits of agronomic importance, likely resulting in detectable signatures of selection within the genome of modern soybean (Glycine max L. Merr.). The identification of these signatures of selection is meaningful from the perspective of evolutionary biology and for uncovering the genetic architecture of agronomic traits. To this end, two populations of soybean, consisting of 342 landraces and 1062 improved lines, were genotyped with the SoySNP50K Illumina BeadChip containing 52,041 single nucleotide polymorphisms (SNPs), and systematically phenotyped for 9 agronomic traits. A cross-population composite likelihood ratio (XP-CLR) method was used to screen the signals of selective sweeps. A total of 125 candidate selection regions were identified, many of which harbored genes potentially involved in crop improvement. To further investigate whether these candidate regions were in fact enriched for genes affected by selection, genome-wide association studies (GWAS) were conducted on 7 selection traits targeted in soybean breeding (grain yield, plant height, lodging, maturity date, seed coat color, seed protein and oil content) and 2 non-selection traits (pubescence and flower color). Major genomic regions associated with selection traits overlapped with candidate selection regions, whereas no overlap of this kind occurred for the non-selection traits, suggesting that the selection sweeps identified are associated with traits of agronomic importance. Multiple novel loci and refined map locations of known loci related to these traits were also identified. These findings illustrate that comparative genomic analyses, especially when combined with GWAS, are a promising approach to dissect the genetic architecture of complex traits.

  9. Polygenic analysis of genome-wide SNP data identifies common variants on allergic rhinitis

    DEFF Research Database (Denmark)

    Mohammadnejad, Afsaneh; Brasch-Andersen, Charlotte; Haagerup, Annette

    Background: Allergic Rhinitis (AR) is a complex disorder that affects many people around the world. There is a high genetic contribution to the development of the AR, as twins and family studies have estimated heritability of more than 33%. Due to the complex nature of the disease, single SNP...... analysis has limited power in identifying the genetic variations for AR. We combined genome-wide association analysis (GWAS) with polygenic risk score (PRS) in exploring the genetic basis underlying the disease. Methods: We collected clinical data on 631 Danish subjects with AR cases consisting of 434...... sibling pairs and unrelated individuals and control subjects of 197 unrelated individuals. SNP genotyping was done by Affymetrix Genome-Wide Human SNP Array 5.0. SNP imputation was performed using "IMPUTE2". Using additive effect model, GWAS was conducted in discovery sample, the genotypes...

  10. Use of deep whole-genome sequencing data to identify structure risk variants in breast cancer susceptibility genes.

    Science.gov (United States)

    Guo, Xingyi; Shi, Jiajun; Cai, Qiuyin; Shu, Xiao-Ou; He, Jing; Wen, Wanqing; Allen, Jamie; Pharoah, Paul; Dunning, Alison; Hunter, David J; Kraft, Peter; Easton, Douglas F; Zheng, Wei; Long, Jirong

    2018-03-01

    Functional disruptions of susceptibility genes by large genomic structure variant (SV) deletions in germlines are known to be associated with cancer risk. However, few studies have been conducted to systematically search for SV deletions in breast cancer susceptibility genes. We analysed deep (> 30x) whole-genome sequencing (WGS) data generated in blood samples from 128 breast cancer patients of Asian and European descent with either a strong family history of breast cancer or early cancer onset disease. To identify SV deletions in known or suspected breast cancer susceptibility genes, we used multiple SV calling tools including Genome STRiP, Delly, Manta, BreakDancer and Pindel. SV deletions were detected by at least three of these bioinformatics tools in five genes. Specifically, we identified heterozygous deletions covering a fraction of the coding regions of BRCA1 (with approximately 80kb in two patients), and TP53 genes (with ∼1.6 kb in two patients), and of intronic regions (∼1 kb) of the PALB2 (one patient), PTEN (three patients) and RAD51C genes (one patient). We confirmed the presence of these deletions using real-time quantitative PCR (qPCR). Our study identified novel SV deletions in breast cancer susceptibility genes and the identification of such SV deletions may improve clinical testing.

  11. Cytoplasmic male sterility-associated chimeric open reading frames identified by mitochondrial genome sequencing of four Cajanus genotypes.

    Science.gov (United States)

    Tuteja, Reetu; Saxena, Rachit K; Davila, Jaime; Shah, Trushar; Chen, Wenbin; Xiao, Yong-Li; Fan, Guangyi; Saxena, K B; Alverson, Andrew J; Spillane, Charles; Town, Christopher; Varshney, Rajeev K

    2013-10-01

    The hybrid pigeonpea (Cajanus cajan) breeding technology based on cytoplasmic male sterility (CMS) is currently unique among legumes and displays major potential for yield increase. CMS is defined as a condition in which a plant is unable to produce functional pollen grains. The novel chimeric open reading frames (ORFs) produced as a results of mitochondrial genome rearrangements are considered to be the main cause of CMS. To identify these CMS-related ORFs in pigeonpea, we sequenced the mitochondrial genomes of three C. cajan lines (the male-sterile line ICPA 2039, the maintainer line ICPB 2039, and the hybrid line ICPH 2433) and of the wild relative (Cajanus cajanifolius ICPW 29). A single, circular-mapping molecule of length 545.7 kb was assembled and annotated for the ICPA 2039 line. Sequence annotation predicted 51 genes, including 34 protein-coding and 17 RNA genes. Comparison of the mitochondrial genomes from different Cajanus genotypes identified 31 ORFs, which differ between lines within which CMS is present or absent. Among these chimeric ORFs, 13 were identified by comparison of the related male-sterile and maintainer lines. These ORFs display features that are known to trigger CMS in other plant species and to represent the most promising candidates for CMS-related mitochondrial rearrangements in pigeonpea.

  12. Apophysomyces variabilis: draft genome sequence and comparison of predictive virulence determinants with other medically important Mucorales.

    Science.gov (United States)

    Prakash, Hariprasath; Rudramurthy, Shivaprakash Mandya; Gandham, Prasad S; Ghosh, Anup Kumar; Kumar, Milner M; Badapanda, Chandan; Chakrabarti, Arunaloke

    2017-09-18

    Apophysomyces species are prevalent in tropical countries and A. variabilis is the second most frequent agent causing mucormycosis in India. Among Apophysomyces species, A. elegans, A. trapeziformis and A. variabilis are commonly incriminated in human infections. The genome sequences of A. elegans and A. trapeziformis are available in public database, but not A. variabilis. We, therefore, performed the whole genome sequence of A. variabilis to explore its genomic structure and possible genes determining the virulence of the organism. The whole genome of A. variabilis NCCPF 102052 was sequenced and the genomic structure of A. variabilis was compared with already available genome structures of A. elegans, A. trapeziformis and other medically important Mucorales. The total size of genome assembly of A. variabilis was 39.38 Mb with 12,764 protein-coding genes. The transposable elements (TEs) were low in Apophysomyces genome and the retrotransposon Ty3-gypsy was the common TE. Phylogenetically, Apophysomyces species were grouped closely with Phycomyces blakesleeanus. OrthoMCL analysis revealed 3025 orthologues proteins, which were common in those three pathogenic Apophysomyces species. Expansion of multiple gene families/duplication was observed in Apophysomyces genomes. Approximately 6% of Apophysomyces genes were predicted to be associated with virulence on PHIbase analysis. The virulence determinants included the protein families of CotH proteins (invasins), proteases, iron utilisation pathways, siderophores and signal transduction pathways. Serine proteases were the major group of proteases found in all Apophysomyces genomes. The carbohydrate active enzymes (CAZymes) constitute the majority of the secretory proteins. The present study is the maiden attempt to sequence and analyze the genomic structure of A. variabilis. Together with available genome sequence of A. elegans and A. trapeziformis, the study helped to indicate the possible virulence determinants of

  13. Identifying anti-growth factors for human cancer cell lines through genome-scale metabolic modeling

    DEFF Research Database (Denmark)

    Ghaffari, Pouyan; Mardinoglu, Adil; Asplund, Anna

    2015-01-01

    Human cancer cell lines are used as important model systems to study molecular mechanisms associated with tumor growth, hereunder how genomic and biological heterogeneity found in primary tumors affect cellular phenotypes. We reconstructed Genome scale metabolic models (GEMs) for eleven cell lines...... based on RNA-Seq data and validated the functionality of these models with data from metabolite profiling. We used cell line-specific GEMs to analyze the differences in the metabolism of cancer cell lines, and to explore the heterogeneous expression of the metabolic subsystems. Furthermore, we predicted...... for inhibition of cell growth may provide leads for the development of efficient cancer treatment strategies....

  14. Identification of coding and non-coding mutational hotspots in cancer genomes.

    Science.gov (United States)

    Piraino, Scott W; Furney, Simon J

    2017-01-05

    The identification of mutations that play a causal role in tumour development, so called "driver" mutations, is of critical importance for understanding how cancers form and how they might be treated. Several large cancer sequencing projects have identified genes that are recurrently mutated in cancer patients, suggesting a role in tumourigenesis. While the landscape of coding drivers has been extensively studied and many of the most prominent driver genes are well characterised, comparatively less is known about the role of mutations in the non-coding regions of the genome in cancer development. The continuing fall in genome sequencing costs has resulted in a concomitant increase in the number of cancer whole genome sequences being produced, facilitating systematic interrogation of both the coding and non-coding regions of cancer genomes. To examine the mutational landscapes of tumour genomes we have developed a novel method to identify mutational hotspots in tumour genomes using both mutational data and information on evolutionary conservation. We have applied our methodology to over 1300 whole cancer genomes and show that it identifies prominent coding and non-coding regions that are known or highly suspected to play a role in cancer. Importantly, we applied our method to the entire genome, rather than relying on predefined annotations (e.g. promoter regions) and we highlight recurrently mutated regions that may have resulted from increased exposure to mutational processes rather than selection, some of which have been identified previously as targets of selection. Finally, we implicate several pan-cancer and cancer-specific candidate non-coding regions, which could be involved in tumourigenesis. We have developed a framework to identify mutational hotspots in cancer genomes, which is applicable to the entire genome. This framework identifies known and novel coding and non-coding mutional hotspots and can be used to differentiate candidate driver regions from

  15. RNAi-Based Functional Genomics Identifies New Virulence Determinants in Mucormycosis.

    Directory of Open Access Journals (Sweden)

    Trung Anh Trieu

    2017-01-01

    Full Text Available Mucorales are an emerging group of human pathogens that are responsible for the lethal disease mucormycosis. Unfortunately, functional studies on the genetic factors behind the virulence of these organisms are hampered by their limited genetic tractability, since they are reluctant to classical genetic tools like transposable elements or gene mapping. Here, we describe an RNAi-based functional genomic platform that allows the identification of new virulence factors through a forward genetic approach firstly described in Mucorales. This platform contains a whole-genome collection of Mucor circinelloides silenced transformants that presented a broad assortment of phenotypes related to the main physiological processes in fungi, including virulence, hyphae morphology, mycelial and yeast growth, carotenogenesis and asexual sporulation. Selection of transformants with reduced virulence allowed the identification of mcplD, which encodes a Phospholipase D, and mcmyo5, encoding a probably essential cargo transporter of the Myosin V family, as required for a fully virulent phenotype of M. circinelloides. Knock-out mutants for those genes showed reduced virulence in both Galleria mellonella and Mus musculus models, probably due to a delayed germination and polarized growth within macrophages. This study provides a robust approach to study virulence in Mucorales and as a proof of concept identified new virulence determinants in M. circinelloides that could represent promising targets for future antifungal therapies.

  16. De novo assembly of a haplotype-resolved human genome.

    Science.gov (United States)

    Cao, Hongzhi; Wu, Honglong; Luo, Ruibang; Huang, Shujia; Sun, Yuhui; Tong, Xin; Xie, Yinlong; Liu, Binghang; Yang, Hailong; Zheng, Hancheng; Li, Jian; Li, Bo; Wang, Yu; Yang, Fang; Sun, Peng; Liu, Siyang; Gao, Peng; Huang, Haodong; Sun, Jing; Chen, Dan; He, Guangzhu; Huang, Weihua; Huang, Zheng; Li, Yue; Tellier, Laurent C A M; Liu, Xiao; Feng, Qiang; Xu, Xun; Zhang, Xiuqing; Bolund, Lars; Krogh, Anders; Kristiansen, Karsten; Drmanac, Radoje; Drmanac, Snezana; Nielsen, Rasmus; Li, Songgang; Wang, Jian; Yang, Huanming; Li, Yingrui; Wong, Gane Ka-Shu; Wang, Jun

    2015-06-01

    The human genome is diploid, and knowledge of the variants on each chromosome is important for the interpretation of genomic information. Here we report the assembly of a haplotype-resolved diploid genome without using a reference genome. Our pipeline relies on fosmid pooling together with whole-genome shotgun strategies, based solely on next-generation sequencing and hierarchical assembly methods. We applied our sequencing method to the genome of an Asian individual and generated a 5.15-Gb assembled genome with a haplotype N50 of 484 kb. Our analysis identified previously undetected indels and 7.49 Mb of novel coding sequences that could not be aligned to the human reference genome, which include at least six predicted genes. This haplotype-resolved genome represents the most complete de novo human genome assembly to date. Application of our approach to identify individual haplotype differences should aid in translating genotypes to phenotypes for the development of personalized medicine.

  17. Annotating functional RNAs in genomes using Infernal.

    Science.gov (United States)

    Nawrocki, Eric P

    2014-01-01

    Many different types of functional non-coding RNAs participate in a wide range of important cellular functions but the large majority of these RNAs are not routinely annotated in published genomes. Several programs have been developed for identifying RNAs, including specific tools tailored to a particular RNA family as well as more general ones designed to work for any family. Many of these tools utilize covariance models (CMs), statistical models of the conserved sequence, and structure of an RNA family. In this chapter, as an illustrative example, the Infernal software package and CMs from the Rfam database are used to identify RNAs in the genome of the archaeon Methanobrevibacter ruminantium, uncovering some additional RNAs not present in the genome's initial annotation. Analysis of the results and comparison with family-specific methods demonstrate some important strengths and weaknesses of this general approach.

  18. Genome-wide association identifies multiple genomic regions associated with susceptibility to and control of ovine lentivirus.

    Directory of Open Access Journals (Sweden)

    Stephen N White

    Full Text Available BACKGROUND: Like human immunodeficiency virus (HIV, ovine lentivirus (OvLV is macrophage-tropic and causes lifelong infection. OvLV infects one quarter of U.S. sheep and induces pneumonia and body condition wasting. There is no vaccine to prevent OvLV infection and no cost-effective treatment for infected animals. However, breed differences in prevalence and proviral concentration have indicated a genetic basis for susceptibility to OvLV. A recent study identified TMEM154 variants in OvLV susceptibility. The objective here was to identify additional loci associated with odds and/or control of OvLV infection. METHODOLOGY/PRINCIPAL FINDINGS: This genome-wide association study (GWAS included 964 sheep from Rambouillet, Polypay, and Columbia breeds with serological status and proviral concentration phenotypes. Analytic models accounted for breed and age, as well as genotype. This approach identified TMEM154 (nominal P=9.2×10(-7; empirical P=0.13, provided 12 additional genomic regions associated with odds of infection, and provided 13 regions associated with control of infection (all nominal P<1 × 10(-5. Rapid decline of linkage disequilibrium with distance suggested many regions included few genes each. Genes in regions associated with odds of infection included DPPA2/DPPA4 (empirical P=0.006, and SYTL3 (P=0.051. Genes in regions associated with control of infection included a zinc finger cluster (ZNF192, ZSCAN16, ZNF389, and ZNF165; P=0.001, C19orf42/TMEM38A (P=0.047, and DLGAP1 (P=0.092. CONCLUSIONS/SIGNIFICANCE: These associations provide targets for mutation discovery in sheep susceptibility to OvLV. Aside from TMEM154, these genes have not been associated previously with lentiviral infection in any species, to our knowledge. Further, data from other species suggest functional hypotheses for future testing of these genes in OvLV and other lentiviral infections. Specifically, SYTL3 binds and may regulate RAB27A, which is required for enveloped

  19. Identification of novel biomass-degrading enzymes from genomic dark matter: Populating genomic sequence space with functional annotation.

    Science.gov (United States)

    Piao, Hailan; Froula, Jeff; Du, Changbin; Kim, Tae-Wan; Hawley, Erik R; Bauer, Stefan; Wang, Zhong; Ivanova, Nathalia; Clark, Douglas S; Klenk, Hans-Peter; Hess, Matthias

    2014-08-01

    Although recent nucleotide sequencing technologies have significantly enhanced our understanding of microbial genomes, the function of ∼35% of genes identified in a genome currently remains unknown. To improve the understanding of microbial genomes and consequently of microbial processes it will be crucial to assign a function to this "genomic dark matter." Due to the urgent need for additional carbohydrate-active enzymes for improved production of transportation fuels from lignocellulosic biomass, we screened the genomes of more than 5,500 microorganisms for hypothetical proteins that are located in the proximity of already known cellulases. We identified, synthesized and expressed a total of 17 putative cellulase genes with insufficient sequence similarity to currently known cellulases to be identified as such using traditional sequence annotation techniques that rely on significant sequence similarity. The recombinant proteins of the newly identified putative cellulases were subjected to enzymatic activity assays to verify their hydrolytic activity towards cellulose and lignocellulosic biomass. Eleven (65%) of the tested enzymes had significant activity towards at least one of the substrates. This high success rate highlights that a gene context-based approach can be used to assign function to genes that are otherwise categorized as "genomic dark matter" and to identify biomass-degrading enzymes that have little sequence similarity to already known cellulases. The ability to assign function to genes that have no related sequence representatives with functional annotation will be important to enhance our understanding of microbial processes and to identify microbial proteins for a wide range of applications. © 2014 Wiley Periodicals, Inc.

  20. Genomic analysis identifies masqueraders of full-term cerebral palsy.

    Science.gov (United States)

    Takezawa, Yusuke; Kikuchi, Atsuo; Haginoya, Kazuhiro; Niihori, Tetsuya; Numata-Uematsu, Yurika; Inui, Takehiko; Yamamura-Suzuki, Saeko; Miyabayashi, Takuya; Anzai, Mai; Suzuki-Muromoto, Sato; Okubo, Yukimune; Endo, Wakaba; Togashi, Noriko; Kobayashi, Yasuko; Onuma, Akira; Funayama, Ryo; Shirota, Matsuyuki; Nakayama, Keiko; Aoki, Yoko; Kure, Shigeo

    2018-05-01

    Cerebral palsy is a common, heterogeneous neurodevelopmental disorder that causes movement and postural disabilities. Recent studies have suggested genetic diseases can be misdiagnosed as cerebral palsy. We hypothesized that two simple criteria, that is, full-term births and nonspecific brain MRI findings, are keys to extracting masqueraders among cerebral palsy cases due to the following: (1) preterm infants are susceptible to multiple environmental factors and therefore demonstrate an increased risk of cerebral palsy and (2) brain MRI assessment is essential for excluding environmental causes and other particular disorders. A total of 107 patients-all full-term births-without specific findings on brain MRI were identified among 897 patients diagnosed with cerebral palsy who were followed at our center. DNA samples were available for 17 of the 107 cases for trio whole-exome sequencing and array comparative genomic hybridization. We prioritized variants in genes known to be relevant in neurodevelopmental diseases and evaluated their pathogenicity according to the American College of Medical Genetics guidelines. Pathogenic/likely pathogenic candidate variants were identified in 9 of 17 cases (52.9%) within eight genes: CTNNB1 , CYP2U1 , SPAST , GNAO1 , CACNA1A , AMPD2 , STXBP1 , and SCN2A . Five identified variants had previously been reported. No pathogenic copy number variations were identified. The AMPD2 missense variant and the splice-site variants in CTNNB1 and AMPD2 were validated by in vitro functional experiments. The high rate of detecting causative genetic variants (52.9%) suggests that patients diagnosed with cerebral palsy in full-term births without specific MRI findings may include genetic diseases masquerading as cerebral palsy.

  1. Urban landscape genomics identifies fine-scale gene flow patterns in an avian invasive.

    Science.gov (United States)

    Low, G W; Chattopadhyay, B; Garg, K M; Irestedt, M; Ericson, Pgp; Yap, G; Tang, Q; Wu, S; Rheindt, F E

    2018-01-01

    Invasive species exert a serious impact on native fauna and flora and have been the target of many eradication and management efforts worldwide. However, a lack of data on population structure and history, exacerbated by the recency of many species introductions, limits the efficiency with which such species can be kept at bay. In this study we generated a novel genome of high assembly quality and genotyped 4735 genome-wide single nucleotide polymorphic (SNP) markers from 78 individuals of an invasive population of the Javan Myna Acridotheres javanicus across the island of Singapore. We inferred limited population subdivision at a micro-geographic level, a genetic patch size (~13-14 km) indicative of a pronounced dispersal ability, and barely an increase in effective population size since introduction despite an increase of four to five orders of magnitude in actual population size, suggesting that low population-genetic diversity following a bottleneck has not impeded establishment success. Landscape genomic analyses identified urban features, such as low-rise neighborhoods, that constitute pronounced barriers to gene flow. Based on our data, we consider an approach targeting the complete eradication of Javan Mynas across Singapore to be unfeasible. Instead, a mixed approach of localized mitigation measures taking into account urban geographic features and planning policy may be the most promising avenue to reducing the adverse impacts of this urban pest. Our study demonstrates how genomic methods can directly inform the management and control of invasive species, even in geographically limited datasets with high gene flow rates.

  2. Novel immune-modulator identified by a rapid, functional screen of the parapoxvirus ovis (Orf virus genome

    Directory of Open Access Journals (Sweden)

    McGuire Michael J

    2012-01-01

    Full Text Available Abstract Background The success of new sequencing technologies and informatic methods for identifying genes has made establishing gene product function a critical rate limiting step in progressing the molecular sciences. We present a method to functionally mine genomes for useful activities in vivo, using an unusual property of a member of the poxvirus family to demonstrate this screening approach. Results The genome of Parapoxvirus ovis (Orf virus was sequenced, annotated, and then used to PCR-amplify its open-reading-frames. Employing a cloning-independent protocol, a viral expression-library was rapidly built and arrayed into sub-library pools. These were directly delivered into mice as expressible cassettes and assayed for an immune-modulating activity associated with parapoxvirus infection. The product of the B2L gene, a homolog of vaccinia F13L, was identified as the factor eliciting immune cell accumulation at sites of skin inoculation. Administration of purified B2 protein also elicited immune cell accumulation activity, and additionally was found to serve as an adjuvant for antigen-specific responses. Co-delivery of the B2L gene with an influenza gene-vaccine significantly improved protection in mice. Furthermore, delivery of the B2L expression construct, without antigen, non-specifically reduced tumor growth in murine models of cancer. Conclusion A streamlined, functional approach to genome-wide screening of a biological activity in vivo is presented. Its application to screening in mice for an immune activity elicited by the pathogen genome of Parapoxvirus ovis yielded a novel immunomodulator. In this inverted discovery method, it was possible to identify the adjuvant responsible for a function of interest prior to a mechanistic study of the adjuvant. The non-specific immune activity of this modulator, B2, is similar to that associated with administration of inactivated particles to a host or to a live viral infection. Administration

  3. The Pediatric Cancer Genome Project

    Science.gov (United States)

    Downing, James R; Wilson, Richard K; Zhang, Jinghui; Mardis, Elaine R; Pui, Ching-Hon; Ding, Li; Ley, Timothy J; Evans, William E

    2013-01-01

    The St. Jude Children’s Research Hospital–Washington University Pediatric Cancer Genome Project (PCGP) is participating in the international effort to identify somatic mutations that drive cancer. These cancer genome sequencing efforts will not only yield an unparalleled view of the altered signaling pathways in cancer but should also identify new targets against which novel therapeutics can be developed. Although these projects are still deep in the phase of generating primary DNA sequence data, important results are emerging and valuable community resources are being generated that should catalyze future cancer research. We describe here the rationale for conducting the PCGP, present some of the early results of this project and discuss the major lessons learned and how these will affect the application of genomic sequencing in the clinic. PMID:22641210

  4. Integrative analysis of functional genomic annotations and sequencing data to identify rare causal variants via hierarchical modeling

    Directory of Open Access Journals (Sweden)

    Marinela eCapanu

    2015-05-01

    Full Text Available Identifying the small number of rare causal variants contributing to disease has beena major focus of investigation in recent years, but represents a formidable statisticalchallenge due to the rare frequencies with which these variants are observed. In thiscommentary we draw attention to a formal statistical framework, namely hierarchicalmodeling, to combine functional genomic annotations with sequencing data with theobjective of enhancing our ability to identify rare causal variants. Using simulations weshow that in all configurations studied, the hierarchical modeling approach has superiordiscriminatory ability compared to a recently proposed aggregate measure of deleteriousness,the Combined Annotation-Dependent Depletion (CADD score, supportingour premise that aggregate functional genomic measures can more accurately identifycausal variants when used in conjunction with sequencing data through a hierarchicalmodeling approach

  5. A Genome-wide Association Analysis of a Broad Psychosis Phenotype Identifies Three Loci for Further Investigation

    NARCIS (Netherlands)

    Bramon, Elvira; Pirinen, Matti; Strange, Amy; Lin, Kuang; Freeman, Colin; Bellenguez, Celine; Su, Zhan; Band, Gavin; Pearson, Richard; Vukcevic, Damjan; Langford, Cordelia; Deloukas, Panos; Hunt, Sarah; Gray, Emma; Dronov, Serge; Potter, Simon C.; Tashakkori-Ghanbaria, Avazeh; Edkins, Sarah; Bumpstead, Suzannah J.; Arranz, Maria J.; Bakker, Steven; Bender, Stephan; Bruggeman, Richard; Cahn, Wiepke; Chandler, David; Collier, David A.; Crespo-Facorro, Benedicto; Dazzan, Paola; de Haan, Lieuwe; di Forti, Marta; Dragovic, Milan; Giegling, Ina; Hall, Jeremy; Iyegbe, Conrad; Jablensky, Assen; Kahn, Rene S.; Kalaydjieva, Luba; Kravariti, Eugenia; Lawrie, Stephen; Lins-Zen, Don H.; Mata, Ignacio; McDonald, Colm; McIntosh, Andrew; Myin-Germeys, Inez; Ophoff, Roel A.; Pariante, Carmine M.; Paunio, Tiina; Picchioni, Marco; Ripke, Stephan; Wiersma, Durk

    2014-01-01

    Background: Genome-wide association studies (GWAS) have identified several loci associated with schizophrenia and/or bipolar disorder. We performed a GWAS of psychosis as a broad syndrome rather than within specific diagnostic categories. Methods: 1239 cases with schizophrenia, schizoaffective

  6. Genome analysis and comparative genomics of a Giardia intestinalis assemblage E isolate

    Directory of Open Access Journals (Sweden)

    Andersson Jan O

    2010-10-01

    Full Text Available Abstract Background Giardia intestinalis is a protozoan parasite that causes diarrhea in a wide range of mammalian species. To further understand the genetic diversity between the Giardia intestinalis species, we have performed genome sequencing and analysis of a wild-type Giardia intestinalis sample from the assemblage E group, isolated from a pig. Results We identified 5012 protein coding genes, the majority of which are conserved compared to the previously sequenced genomes of the WB and GS strains in terms of microsynteny and sequence identity. Despite this, there is an unexpectedly large number of chromosomal rearrangements and several smaller structural changes that are present in all chromosomes. Novel members of the VSP, NEK Kinase and HCMP gene families were identified, which may reveal possible mechanisms for host specificity and new avenues for antigenic variation. We used comparative genomics of the three diverse Giardia intestinalis isolates P15, GS and WB to define a core proteome for this species complex and to identify lineage-specific genes. Extensive analyses of polymorphisms in the core proteome of Giardia revealed differential rates of divergence among cellular processes. Conclusions Our results indicate that despite a well conserved core of genes there is significant genome variation between Giardia isolates, both in terms of gene content, gene polymorphisms, structural chromosomal variations and surface molecule repertoires. This study improves the annotation of the Giardia genomes and enables the identification of functionally important variation.

  7. Comparative Genomics Reveals High Genomic Diversity in the Genus Photobacterium.

    Science.gov (United States)

    Machado, Henrique; Gram, Lone

    2017-01-01

    Vibrionaceae is a large marine bacterial family, which can constitute up to 50% of the prokaryotic population in marine waters. Photobacterium is the second largest genus in the family and we used comparative genomics on 35 strains representing 16 of the 28 species described so far, to understand the genomic diversity present in the Photobacterium genus. Such understanding is important for ecophysiology studies of the genus. We used whole genome sequences to evaluate phylogenetic relationships using several analyses (16S rRNA, MLSA, fur , amino-acid usage, ANI), which allowed us to identify two misidentified strains. Genome analyses also revealed occurrence of higher and lower GC content clades, correlating with phylogenetic clusters. Pan- and core-genome analysis revealed the conservation of 25% of the genome throughout the genus, with a large and open pan-genome. The major source of genomic diversity could be traced to the smaller chromosome and plasmids. Several of the physiological traits studied in the genus did not correlate with phylogenetic data. Since horizontal gene transfer (HGT) is often suggested as a source of genetic diversity and a potential driver of genomic evolution in bacterial species, we looked into evidence of such in Photobacterium genomes. Genomic islands were the source of genomic differences between strains of the same species. Also, we found transposase genes and CRISPR arrays that suggest multiple encounters with foreign DNA. Presence of genomic exchange traits was widespread and abundant in the genus, suggesting a role in genomic evolution. The high genetic variability and indications of genetic exchange make it difficult to elucidate genome evolutionary paths and raise the awareness of the roles of foreign DNA in the genomic evolution of environmental organisms.

  8. Genomics and infectious disease: a call to identify the ethical, legal and social implications for public health and clinical practice.

    Science.gov (United States)

    Geller, Gail; Dvoskin, Rachel; Thio, Chloe L; Duggal, Priya; Lewis, Michelle H; Bailey, Theodore C; Sutherland, Andrea; Salmon, Daniel A; Kahn, Jeffrey P

    2014-01-01

    Advances in genomics are contributing to the development of more effective, personalized approaches to the prevention and treatment of infectious diseases. Genetic sequencing technologies are furthering our understanding of how human and pathogen genomic factors - and their interactions - contribute to individual differences in immunologic responses to vaccines, infections and drug therapies. Such understanding will influence future policies and procedures for infectious disease management. With the potential for tailored interventions for particular individuals, populations or subpopulations, ethical, legal and social implications (ELSIs) may arise for public health and clinical practice. Potential considerations include balancing health-related benefits and harms between individuals and the larger community, minimizing threats to individual privacy and autonomy, and ensuring just distribution of scarce resources. In this Opinion, we consider the potential application of pathogen and host genomic information to particular viral infections that have large-scale public health consequences but differ in ELSI-relevant characteristics such as ease of transmission, chronicity, severity, preventability and treatability. We argue for the importance of anticipating these ELSI issues in advance of new scientific discoveries, and call for the development of strategies for identifying and exploring ethical questions that should be considered as clinical, public health and policy decisions are made.

  9. Genome-wide association analysis identifies variants associated with nonalcoholic fatty liver disease that have distinct effects on metabolic traits

    DEFF Research Database (Denmark)

    Speliotes, Elizabeth K; Yerges-Armstrong, Laura M; Wu, Jun

    2011-01-01

    steatosis, a non-invasive measure of NAFLD, in large population based samples. Using variance components methods, we show that CT hepatic steatosis is heritable (~26%-27%) in family-based Amish, Family Heart, and Framingham Heart Studies (n¿=¿880 to 3,070). By carrying out a fixed-effects meta......-analysis of genome-wide association (GWA) results between CT hepatic steatosis and ~2.4 million imputed or genotyped SNPs in 7,176 individuals from the Old Order Amish, Age, Gene/Environment Susceptibility-Reykjavik study (AGES), Family Heart, and Framingham Heart Studies, we identify variants associated at genome......Nonalcoholic fatty liver disease (NAFLD) clusters in families, but the only known common genetic variants influencing risk are near PNPLA3. We sought to identify additional genetic variants influencing NAFLD using genome-wide association (GWA) analysis of computed tomography (CT) measured hepatic...

  10. Genome-wide association analysis of more than 120,000 individuals identifies 15 new susceptibility loci for breast cancer

    NARCIS (Netherlands)

    K. Michailidou (Kyriaki); J. Beesley (Jonathan); S. Lindstrom (Stephen); S. Canisius (Sander); J. Dennis (Joe); M. Lush (Michael); M. Maranian (Melanie); M.K. Bolla (Manjeet); Q. Wang (Qing); M. Shah (Mitul); B. Perkins (Barbara); K. Czene (Kamila); M. Eriksson (Mikael); H. Darabi (Hatef); J.S. Brand (Judith S.); S.E. Bojesen (Stig); B.G. Nordestgaard (Børge); H. Flyger (Henrik); S.F. Nielsen (Sune); N. Rahman (Nazneen); C. Turnbull (Clare); O. Fletcher (Olivia); J. Peto (Julian); L.J. Gibson (Lorna); I. dos Santos Silva (Isabel); J. Chang-Claude (Jenny); D. Flesch-Janys (Dieter); A. Rudolph (Anja); U. Eilber (Ursula); T.W. Behrens (Timothy); H. Nevanlinna (Heli); T.A. Muranen (Taru); K. Aittomäki (Kristiina); C. Blomqvist (Carl); S. Khan (Sofia); K. Aaltonen (Kirsimari); H. Ahsan (Habibul); M.G. Kibriya (Muhammad); A.S. Whittemore (Alice S.); E.M. John (Esther M.); K.E. Malone (Kathleen E.); M.D. Gammon (Marilie); R.M. Santella (Regina M.); G. Ursin (Giske); E. Makalic (Enes); D.F. Schmidt (Daniel); G. Casey (Graham); D.J. Hunter (David J.); S.M. Gapstur (Susan M.); M.M. Gaudet (Mia); W.R. Diver (Ryan); C.A. Haiman (Christopher A.); F.R. Schumacher (Fredrick); B.E. Henderson (Brian); L. Le Marchand (Loic); C.D. Berg (Christine); S.J. Chanock (Stephen); J.D. Figueroa (Jonine); R.N. Hoover (Robert N.); D. Lambrechts (Diether); P. Neven (Patrick); H. Wildiers (Hans); E. van Limbergen (Erik); M.K. Schmidt (Marjanka); A. Broeks (Annegien); S. Verhoef; S. Cornelissen (Sten); F.J. Couch (Fergus); J.E. Olson (Janet); B. Hallberg (Boubou); C. Vachon (Celine); Q. Waisfisz (Quinten); E.J. Meijers-Heijboer (Hanne); M.A. Adank (Muriel); R.B. van der Luijt (Rob); J. Li (Jingmei); J. Liu (Jianjun); M.K. Humphreys (Manjeet); D. Kang (Daehee); J.-Y. Choi (Ji-Yeob); S.K. Park (Sue K.); K.Y. Yoo; K. Matsuo (Keitaro); H. Ito (Hidemi); H. Iwata (Hiroji); K. Tajima (Kazuo); P. Guénel (Pascal); T. Truong (Thérèse); C. Mulot (Claire); M. Sanchez (Marie); B. Burwinkel (Barbara); F. Marme (Federick); H. Surowy (Harald); C. Sohn (Christof); A.H. Wu (Anna H); C.-C. Tseng (Chiu-chen); D. Van Den Berg (David); D.O. Stram (Daniel O.); A. González-Neira (Anna); J. Benítez (Javier); M.P. Zamora (Pilar); J.I.A. Perez (Jose Ignacio Arias); X.-O. Shu (Xiao-Ou); W. Lu (Wei); Y. Gao; H. Cai (Hui); A. Cox (Angela); S.S. Cross (Simon); M.W.R. Reed (Malcolm); I.L. Andrulis (Irene); J.A. Knight (Julia); G. Glendon (Gord); A.-M. Mulligan (Anna-Marie); E.J. Sawyer (Elinor); I.P. Tomlinson (Ian); M. Kerin (Michael); N. Miller (Nicola); A. Lindblom (Annika); S. Margolin (Sara); S.H. Teo (Soo Hwang); C.H. Yip (Cheng Har); N.A.M. Taib (Nur Aishah Mohd); G.-H. Tan (Gie-Hooi); M.J. Hooning (Maartje); A. Hollestelle (Antoinette); J.W.M. Martens (John); J.M. Collée (Margriet); W.J. Blot (William); L.B. Signorello (Lisa B.); Q. Cai (Qiuyin); J. Hopper (John); M.C. Southey (Melissa); H. Tsimiklis (Helen); C. Apicella (Carmel); C-Y. Shen (Chen-Yang); C.-N. Hsiung (Chia-Ni); P.-E. Wu (Pei-Ei); M.-F. Hou (Ming-Feng); V. Kristensen (Vessela); S. Nord (Silje); G.G. Alnæs (Grethe); G.G. Giles (Graham G.); R.L. Milne (Roger); C.A. McLean (Catriona Ann); F. Canzian (Federico); D. Trichopoulos (Dimitrios); P.H.M. Peeters; E. Lund (Eiliv); R. Sund (Reijo); K.T. Khaw; M.J. Gunter (Marc J.); D. Palli (Domenico); L.M. Mortensen (Lotte Maxild); L. Dossus (Laure); J.-M. Huerta (Jose-Maria); A. Meindl (Alfons); R.K. Schmutzler (Rita); C. Sutter (Christian); R. Yang (Rongxi); K. Muir (Kenneth); A. Lophatananon (Artitaya); S. Stewart-Brown (Sarah); P. Siriwanarangsan (Pornthep); J.M. Hartman (Joost); X. Miao; K.S. Chia (Kee Seng); C.W. Chan (Ching Wan); P.A. Fasching (Peter); R. Hein (Rebecca); M.W. Beckmann (Matthias); L. Haeberle (Lothar); H. Brenner (Hermann); A.K. Dieffenbach (Aida Karina); V. Arndt (Volker); C. Stegmaier (Christa); A. Ashworth (Alan); N. Orr (Nick); M. Schoemaker (Minouk); A.J. Swerdlow (Anthony ); L.A. Brinton (Louise); M. García-Closas (Montserrat); W. Zheng (Wei); S.L. Halverson (Sandra L.); M. Shrubsole (Martha); J. Long (Jirong); M.S. Goldberg (Mark); F. Labrèche (France); M. Dumont (Martine); R. Winqvist (Robert); K. Pykäs (Katri); A. Jukkola-Vuorinen (Arja); M. Grip (Mervi); H. Brauch (Hiltrud); U. Hamann (Ute); T. Brüning (Thomas); P. Radice (Paolo); P. Peterlongo (Paolo); S. Manoukian (Siranoush); L. Bernard (Loris); N.V. Bogdanova (Natalia); T. Dörk (Thilo); A. Mannermaa (Arto); V. Kataja (Vesa); V-M. Kosma (Veli-Matti); J.M. Hartikainen (J.); P. Devilee (Peter); R.A.E.M. Tollenaar (Rob); C.M. Seynaeve (Caroline); C.J. van Asperen (Christi); A. Jakubowska (Anna); J. Lubinski (Jan); K. Jaworska (Katarzyna); T. Huzarski (Tomasz); S. Sangrajrang (Suleeporn); V. Gaborieau (Valerie); P. Brennan (Paul); J.D. McKay (James); S. Slager (Susan); A.E. Toland (Amanda); C.B. Ambrosone (Christine); D. Yannoukakos (Drakoulis); M. Kabisch (Maria); D. Torres (Diana); S.L. Neuhausen (Susan); H. Anton-Culver (Hoda); C. Luccarini (Craig); C. Baynes (Caroline); S. Ahmed (Shahana); S. Healey (Sue); D.C. Tessier (Daniel C.); D. Vincent (Daniel); F. Bacot (Francois); G. Pita (Guillermo); M.R. Alonso (Rosario); N. Álvarez (Nuria); D. Herrero (Daniel); J. Simard (Jacques); P.P.D.P. Pharoah (Paul P.D.P.); P. Kraft (Peter); A.M. Dunning (Alison); G. Chenevix-Trench (Georgia); P. Hall (Per); D.F. Easton (Douglas)

    2015-01-01

    textabstractGenome-wide association studies (GWAS) and large-scale replication studies have identified common variants in 79 loci associated with breast cancer, explaining ∼14% of the familial risk of the disease. To identify new susceptibility loci, we performed a meta-analysis of 11 GWAS,

  11. A genome-wide association analysis of a broad psychosis phenotype identifies three loci for further investigation

    NARCIS (Netherlands)

    Bramon, Elvira; Pirinen, Matti; Strange, Amy; Lin, Kuang; Freeman, Colin; Bellenguez, Céline; Su, Zhan; Band, Gavin; Pearson, Richard; Vukcevic, Damjan; Langford, Cordelia; Deloukas, Panos; Hunt, Sarah; Gray, Emma; Dronov, Serge; Potter, Simon C.; Tashakkori-Ghanbaria, Avazeh; Edkins, Sarah; Bumpstead, Suzannah J.; Arranz, Maria J.; Bakker, Steven; Bender, Stephan; Bruggeman, Richard; Cahn, Wiepke; Chandler, David; Collier, David A.; Crespo-Facorro, Benedicto; Dazzan, Paola; de Haan, Lieuwe; Di Forti, Marta; Dragović, Milan; Giegling, Ina; Hall, Jeremy; Iyegbe, Conrad; Jablensky, Assen; Kahn, René S.; Kalaydjieva, Luba; Kravariti, Eugenia; Lawrie, Stephen; Linszen, Don H.; Mata, Ignacio; McDonald, Colm; McIntosh, Andrew; Myin-Germeys, Inez; Ophoff, Roel A.; Pariante, Carmine M.; Paunio, Tiina; Picchioni, Marco; Ripke, Stephan; Rujescu, Dan

    2014-01-01

    Genome-wide association studies (GWAS) have identified several loci associated with schizophrenia and/or bipolar disorder. We performed a GWAS of psychosis as a broad syndrome rather than within specific diagnostic categories. 1239 cases with schizophrenia, schizoaffective disorder, or psychotic

  12. Structural and functional insights of β-glucosidases identified from the genome of Aspergillus fumigatus

    Science.gov (United States)

    Dodda, Subba Reddy; Aich, Aparajita; Sarkar, Nibedita; Jain, Piyush; Jain, Sneha; Mondal, Sudipa; Aikat, Kaustav; Mukhopadhyay, Sudit S.

    2018-03-01

    Thermostable glucose tolerant β-glucosidase from Aspergillus species has attracted worldwide interest for their potentiality in industrial applications and bioethanol production. A strain of Aspergillus fumigatus (AfNITDGPKA3) identified by our laboratory from straw retting ground showed higher cellulase activity, specifically the β-glucosidase activity, compared to other contemporary strains. Though A. fumigatus has been known for high cellulase activity, detailed identification and characterization of the cellulase genes from their genome is yet to be done. In this work we have been analyzed the cellulase genes from the genome sequence database of Aspergillus fumigatus (Af293). Genome analysis suggests two cellobiohydrolase, eleven endoglucanase and seventeen β-glucosidase genes present. β-Glucosidase genes belong to either Glycohydro1 (GH1 or Bgl1) or Glycohydro3 (GH3 or Bgl3) family. The sequence similarity suggests that Bgl1 and Bgl3 of A. fumagatus are phylogenetically close to those of A. fisheri and A. oryzae. The modelled structure of the Bgl1 predicts the (β/α)8 barrel type structure with deep and narrow active site, whereas, Bgl3 shows the (α/β)8 barrel and (α/β)6 sandwich structure with shallow and open active site. Docking results suggest that amino acids Glu544, Glu466, Trp408,Trp567,Tyr44,Tyr222,Tyr770,Asp844,Asp537,Asn212,Asn217 of Bgl3 and Asp224,Asn242,Glu440, Glu445, Tyr367, Tyr365,Thr994,Trp435,Trp446 of Bgl1 are involved in the hydrolysis. Binding affinity analyses suggest that Bgl3 and Bgl1 enzymes are more active on the substrates like 4-methylumbelliferyl glycoside (MUG) and p-nitrophenyl-β-D-1, 4-glucopyranoside (pNPG) than on cellobiose. Further docking with glucose suggests that Bgl1 is more glucose tolerant than Bgl3. Analysis of the Aspergillus fumigatus genome may help to identify a β-glucosidase enzyme with better property and the structural information may help to develop an engineered recombinant enzyme.

  13. CRISPRseek: a bioconductor package to identify target-specific guide RNAs for CRISPR-Cas9 genome-editing systems.

    Directory of Open Access Journals (Sweden)

    Lihua J Zhu

    Full Text Available CRISPR-Cas systems are a diverse family of RNA-protein complexes in bacteria that target foreign DNA sequences for cleavage. Derivatives of these complexes have been engineered to cleave specific target sequences depending on the sequence of a CRISPR-derived guide RNA (gRNA and the source of the Cas9 protein. Important considerations for the design of gRNAs are to maximize aimed activity at the desired target site while minimizing off-target cleavage. Because of the rapid advances in the understanding of existing CRISPR-Cas9-derived RNA-guided nucleases and the development of novel RNA-guided nuclease systems, it is critical to have computational tools that can accommodate a wide range of different parameters for the design of target-specific RNA-guided nuclease systems. We have developed CRISPRseek, a highly flexible, open source software package to identify gRNAs that target a given input sequence while minimizing off-target cleavage at other sites within any selected genome. CRISPRseek will identify potential gRNAs that target a sequence of interest for CRISPR-Cas9 systems from different bacterial species and generate a cleavage score for potential off-target sequences utilizing published or user-supplied weight matrices with position-specific mismatch penalty scores. Identified gRNAs may be further filtered to only include those that occur in paired orientations for increased specificity and/or those that overlap restriction enzyme sites. For applications where gRNAs are desired to discriminate between two related sequences, CRISPRseek can rank gRNAs based on the difference between predicted cleavage scores in each input sequence. CRISPRseek is implemented as a Bioconductor package within the R statistical programming environment, allowing it to be incorporated into computational pipelines to automate the design of gRNAs for target sequences identified in a wide variety of genome-wide analyses. CRISPRseek is available under the GNU General

  14. Genomic and Transcriptomic Associations Identify a New Insecticide Resistance Phenotype for the Selective Sweep at the Cyp6g1 Locus of Drosophila melanogaster.

    Science.gov (United States)

    Battlay, Paul; Schmidt, Joshua M; Fournier-Level, Alexandre; Robin, Charles

    2016-08-09

    Scans of the Drosophila melanogaster genome have identified organophosphate resistance loci among those with the most pronounced signature of positive selection. In this study, the molecular basis of resistance to the organophosphate insecticide azinphos-methyl was investigated using the Drosophila Genetic Reference Panel, and genome-wide association. Recently released full transcriptome data were used to extend the utility of the Drosophila Genetic Reference Panel resource beyond traditional genome-wide association studies to allow systems genetics analyses of phenotypes. We found that both genomic and transcriptomic associations independently identified Cyp6g1, a gene involved in resistance to DDT and neonicotinoid insecticides, as the top candidate for azinphos-methyl resistance. This was verified by transgenically overexpressing Cyp6g1 using natural regulatory elements from a resistant allele, resulting in a 6.5-fold increase in resistance. We also identified four novel candidate genes associated with azinphos-methyl resistance, all of which are involved in either regulation of fat storage, or nervous system development. In Cyp6g1, we find a demonstrable resistance locus, a verification that transcriptome data can be used to identify variants associated with insecticide resistance, and an overlap between peaks of a genome-wide association study, and a genome-wide selective sweep analysis. Copyright © 2016 Battlay et al.

  15. Comparative genomics defines the core genome of the growing N4-like phage genus and identifies N4-like Roseophage specific genes

    Directory of Open Access Journals (Sweden)

    Jacqueline Zoe-Munn Chan

    2014-10-01

    Full Text Available Two bacteriophages, RPP1 and RLP1, infecting members of the marine Roseobacter clade were isolated from seawater. Their linear genomes are 74.7 and 74.6 kb and encode 91 and 92 coding DNA sequences, respectively. Around 30% of these are homologous to genes found in Enterobacter phage N4. Comparative genomics of these two new Roseobacter phages and twenty-three other sequenced N4-like phages (three infecting members of the Roseobacter lineage and twenty infecting other Gammaproteobacteria revealed that N4-like phages share a core genome of 14 genes responsible for control of gene expression, replication and virion proteins. Phylogenetic analysis of these genes placed the five N4-like roseophages (RN4 into a distinct subclade. Analysis of the RN4 phage genomes revealed they share a further 19 genes of which nine are found exclusively in RN4 phages and four appear to have been acquired from their bacterial hosts. Proteomic analysis of the RPP1 and RLP1 virions identified a second structural module present in the RN4 phages similar to that found in the Pseudomonas N4-like phage LIT1. Searches of various metagenomic databases, included the GOS database, using CDS sequences from RPP1 suggests these phages are widely distributed in marine environments in particular in the open ocean environment.

  16. Use of the Operon Structure of the C. elegans Genome as a Tool to Identify Functionally Related Proteins

    Directory of Open Access Journals (Sweden)

    Silvia Dossena

    2013-12-01

    Full Text Available One of the most pressing challenges in the post genomic era is the identification and characterization of protein-protein interactions (PPIs, as these are essential in understanding the cellular physiology of health and disease. Experimental techniques suitable for characterizing PPIs (X-ray crystallography or nuclear magnetic resonance spectroscopy, among others are usually laborious, time-consuming and often difficult to apply to membrane proteins, and therefore require accurate prediction of the candidate interacting partners. High-throughput experimental methods (yeast two-hybrid and affinity purification succumb to the same shortcomings, and can also lead to high rates of false positive and negative results. Therefore, reliable tools for predicting PPIs are needed. The use of the operon structure in the eukaryote Caenorhabditis elegans genome is a valuable, though underserved, tool for identifying physically or functionally interacting proteins. Based on the concept that genes organized in the same operon may encode physically or functionally related proteins, this algorithm is easy to be applied and, importantly, gives a limited number of candidate partners of a given protein, allowing for focused experimental verification. Moreover, this approach can be successfully used to predict PPIs in the human system, including those of membrane proteins.

  17. Genome-wide association analysis of more than 120,000 individuals identifies 15 new susceptibility loci for breast cancer

    NARCIS (Netherlands)

    Michailidou, Kyriaki; Beesley, Jonathan; Lindstrom, Sara; Canisius, Sander; Dennis, Joe; Lush, Michael J.; Maranian, Mel J.; Bolla, Manjeet K.; Wang, Qin; Shah, Mitul; Perkins, Barbara J.; Czene, Kamila; Eriksson, Mikael; Darabi, Hatef; Brand, Judith S.; Bojesen, Stig E.; Nordestgaard, Borge G.; Flyger, Henrik; Nielsen, Sune F.; Rahman, Nazneen; Turnbull, Clare; Fletcher, Olivia; Peto, Julian; Gibson, Lorna; dos-Santos-Silva, Isabel; Chang-Claude, Jenny; Flesch-Janys, Dieter; Rudolph, Anja; Eilber, Ursula; Behrens, Sabine; Nevanlinna, Heli; Muranen, Taru A.; Aittomaki, Kristiina; Blomqvist, Carl; Khan, Sofia; Aaltonen, Kirsimari; Ahsan, Habibul; Kibriya, Muhammad G.; Whittemore, Alice S.; John, Esther M.; Malone, Kathleen E.; Gammon, Marilie D.; Santella, Regina M.; Ursin, Giske; Makalic, Enes; Schmidt, Daniel F.; Casey, Graham; Hunter, David J.; Gapstur, Susan M.; Gaudet, Mia M.; Diver, W. Ryan; Haiman, Christopher A.; Schumacher, Fredrick; Henderson, Brian E.; Le Marchand, Loic; Berg, Christine D.; Chanock, Stephen J.; Figueroa, Jonine; Hoover, Robert N.; Lambrechts, Diether; Neven, Patrick; Wildiers, Hans; van Limbergen, Erik; Schmidt, Marjanka K.; Broeks, Annegien; Verhoef, Senno; Cornelissen, Sten; Couch, Fergus J.; Olson, Janet E.; Hallberg, Emily; Vachon, Celine; Waisfisz, Quinten; Meijers-Heijboer, Hanne; Adank, Muriel A.; van der Luijt, Rob B.; Li, Jingmei; Liu, Jianjun; Humphreys, Keith; Kang, Daehee; Choi, Ji-Yeob; Park, Sue K.; Yoo, Keun-Young; Matsuo, Keitaro; Ito, Hidemi; Iwata, Hiroji; Tajima, Kazuo; Guenel, Pascal; Truong, Therese; Mulot, Claire; Sanchez, Marie; Burwinkel, Barbara; Marme, Frederik; Surowy, Harald; Sohn, Christof; Wu, Anna H.; Tseng, Chiu-chen; Van den Berg, David; Stram, Daniel O.; Gonzalez-Neira, Anna; Benitez, Javier; Zamora, M. Pilar; Arias Perez, Jose Ignacio; Shu, Xiao-Ou; Lu, Wei; Gao, Yu-Tang; Cai, Hui; Cox, Angela; Cross, Simon S.; Reed, Malcolm W. R.; Andrulis, Irene L.; Knight, Julia A.; Glendon, Gord; Mulligan, Anna Marie; Sawyer, Elinor J.; Tomlinson, Ian; Kerin, Michael J.; Miller, Nicola; Lindblom, Annika; Margolin, Sara; Teo, Soo Hwang; Yip, Cheng Har; Taib, Nur Aishah Mohd; Tan, Gie-Hooi; Hooning, Maartje J.; Hollestelle, Antoinette; Martens, John W. M.; Collee, J. Margriet; Blot, William; Signorello, Lisa B.; Cai, Qiuyin; Hopper, John L.; Southey, Melissa C.; Tsimiklis, Helen; Apicella, Carmel; Shen, Chen-Yang; Hsiung, Chia-Ni; Wu, Pei-Ei; Hou, Ming-Feng; Kristensen, Vessela N.; Nord, Silje; Alnaes, Grethe I. Grenaker; Giles, Graham G.; Milne, Roger L.; McLean, Catriona; Canzian, Federico; Trichopoulos, Dimitrios; Peeters, Petra; Lund, Eiliv; Sund, Malin; Khaw, Kay-Tee; Gunter, Marc J.; Palli, Domenico; Mortensen, Lotte Maxild; Dossus, Laure; Huerta, Jose-Maria; Meindl, Alfons; Schmutzler, Rita K.; Sutter, Christian; Yang, Rongxi; Muir, Kenneth; Lophatananon, Artitaya; Stewart-Brown, Sarah; Siriwanarangsan, Pornthep; Hartman, Mikael; Miao, Hui; Chia, Kee Seng; Chan, Ching Wan; Fasching, Peter A.; Hein, Alexander; Beckmann, Matthias W.; Haeberle, Lothar; Brenner, Hermann; Dieffenbach, Aida Karina; Arndt, Volker; Stegmaier, Christa; Ashworth, Alan; Orr, Nick; Schoemaker, Minouk J.; Swerdlow, Anthony J.; Brinton, Louise; Garcia-Closas, Montserrat; Zheng, Wei; Halverson, Sandra L.; Shrubsole, Martha; Long, Jirong; Goldberg, Mark S.; Labreche, France; Dumont, Martine; Winqvist, Robert; Pylkas, Katri; Jukkola-Vuorinen, Arja; Grip, Mervi; Brauch, Hiltrud; Hamann, Ute; Bruening, Thomas; Radice, Paolo; Peterlongo, Paolo; Manoukian, Siranoush; Bernard, Loris; Bogdanova, Natalia V.; Doerk, Thilo; Mannermaa, Arto; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M.; Devilee, Peter; Tollenaar, Robert A. E. M.; Seynaeve, Caroline; Van Asperen, Christi J.; Jakubowska, Anna; Lubinski, Jan; Jaworska, Katarzyna; Huzarski, Tomasz; Sangrajrang, Suleeporn; Gaborieau, Valerie; Brennan, Paul; Mckay, James; Slager, Susan; Toland, Amanda E.; Ambrosone, Christine B.; Yannoukakos, Drakoulis; Kabisch, Maria; Torres, Diana; Neuhausen, Susan L.; Anton-Culver, Hoda; Luccarini, Craig; Baynes, Caroline; Ahmed, Shahana; Healey, Catherine S.; Tessier, Daniel C.; Vincent, Daniel; Bacot, Francois; Pita, Guillermo; Rosario Alonso, M.; Alvarez, Nuria; Herrero, Daniel; Simard, Jacques; Pharoah, Paul P. D. P.; Kraft, Peter; Dunning, Alison M.; Chenevix-Trench, Georgia; Hall, Per; Easton, Douglas F.

    Genome-wide association studies (GWAS) and large-scale replication studies have identified common variants in 79 loci associated with breast cancer, explaining similar to 14% of the familial risk of the disease. To identify new susceptibility loci, we performed a meta-analysis of 11 GWAS, comprising

  18. Genome-wide association analysis of more than 120,000 individuals identifies 15 new susceptibility loci for breast cancer

    DEFF Research Database (Denmark)

    Michailidou, Kyriaki; Beesley, Jonathan; Lindstrom, Sara

    2015-01-01

    Genome-wide association studies (GWAS) and large-scale replication studies have identified common variants in 79 loci associated with breast cancer, explaining ∼14% of the familial risk of the disease. To identify new susceptibility loci, we performed a meta-analysis of 11 GWAS, comprising 15,748...

  19. The First Endogenous Herpesvirus, Identified in the Tarsier Genome, and Novel Sequences from Primate Rhadinoviruses and Lymphocryptoviruses

    Science.gov (United States)

    Aswad, Amr; Katzourakis, Aris

    2014-01-01

    Herpesviridae is a diverse family of large and complex pathogens whose genomes are extremely difficult to sequence. This is particularly true for clinical samples, and if the virus, host, or both genomes are being sequenced for the first time. Although herpesviruses are known to occasionally integrate in host genomes, and can also be inherited in a Mendelian fashion, they are notably absent from the genomic fossil record comprised of endogenous viral elements (EVEs). Here, we combine paleovirological and metagenomic approaches to both explore the constituent viral diversity of mammalian genomes and search for endogenous herpesviruses. We describe the first endogenous herpesvirus from the genome of the Philippine tarsier, belonging to the Roseolovirus genus, and characterize its highly defective genome that is integrated and flanked by unambiguous host DNA. From a draft assembly of the aye-aye genome, we use bioinformatic tools to reveal over 100,000 bp of a novel rhadinovirus that is the first lemur gammaherpesvirus, closely related to Kaposi's sarcoma-associated virus. We also identify 58 genes of Pan paniscus lymphocryptovirus 1, the bonobo equivalent of human Epstein-Barr virus. For each of the viruses, we postulate gene function via comparative analysis to known viral relatives. Most notably, the evidence from gene content and phylogenetics suggests that the aye-aye sequences represent the most basal known rhadinovirus, and indicates that tumorigenic herpesviruses have been infecting primates since their emergence in the late Cretaceous. Overall, these data show that a genomic fossil record of herpesviruses exists despite their extremely large genomes, and expands the known diversity of Herpesviridae, which will aid the characterization of pathogenesis. Our analytical approach illustrates the benefit of intersecting evolutionary approaches with metagenomics, genetics and paleovirology. PMID:24945689

  20. Pooled-DNA sequencing identifies genomic regions of selection in Nigerian isolates of Plasmodium falciparum.

    Science.gov (United States)

    Oyebola, Kolapo M; Idowu, Emmanuel T; Olukosi, Yetunde A; Awolola, Taiwo S; Amambua-Ngwa, Alfred

    2017-06-29

    The burden of falciparum malaria is especially high in sub-Saharan Africa. Differences in pressure from host immunity and antimalarial drugs lead to adaptive changes responsible for high level of genetic variations within and between the parasite populations. Population-specific genetic studies to survey for genes under positive or balancing selection resulting from drug pressure or host immunity will allow for refinement of interventions. We performed a pooled sequencing (pool-seq) of the genomes of 100 Plasmodium falciparum isolates from Nigeria. We explored allele-frequency based neutrality test (Tajima's D) and integrated haplotype score (iHS) to identify genes under selection. Fourteen shared iHS regions that had at least 2 SNPs with a score > 2.5 were identified. These regions code for genes that were likely to have been under strong directional selection. Two of these genes were the chloroquine resistance transporter (CRT) on chromosome 7 and the multidrug resistance 1 (MDR1) on chromosome 5. There was a weak signature of selection in the dihydrofolate reductase (DHFR) gene on chromosome 4 and MDR5 genes on chromosome 13, with only 2 and 3 SNPs respectively identified within the iHS window. We observed strong selection pressure attributable to continued chloroquine and sulfadoxine-pyrimethamine use despite their official proscription for the treatment of uncomplicated malaria. There was also a major selective sweep on chromosome 6 which had 32 SNPs within the shared iHS region. Tajima's D of circumsporozoite protein (CSP), erythrocyte-binding antigen (EBA-175), merozoite surface proteins - MSP3 and MSP7, merozoite surface protein duffy binding-like (MSPDBL2) and serine repeat antigen (SERA-5) were 1.38, 1.29, 0.73, 0.84 and 0.21, respectively. We have demonstrated the use of pool-seq to understand genomic patterns of selection and variability in P. falciparum from Nigeria, which bears the highest burden of infections. This investigation identified known

  1. Xylella fastidiosa comparative genomic database is an information resource to explore the annotation, genomic features, and biology of different strains

    Directory of Open Access Journals (Sweden)

    Alessandro M. Varani

    2012-01-01

    Full Text Available The Xylella fastidiosa comparative genomic database is a scientific resource with the aim to provide a user-friendly interface for accessing high-quality manually curated genomic annotation and comparative sequence analysis, as well as for identifying and mapping prophage-like elements, a marked feature of Xylella genomes. Here we describe a database and tools for exploring the biology of this important plant pathogen. The hallmarks of this database are the high quality genomic annotation, the functional and comparative genomic analysis and the identification and mapping of prophage-like elements. It is available from web site http://www.xylella.lncc.br.

  2. Whole Genome Analysis of Injectional Anthrax Identifies Two Disease Clusters Spanning More Than 13 Years

    Directory of Open Access Journals (Sweden)

    Paul Keim

    2015-11-01

    Lay Person Interpretation: Injectional anthrax has been plaguing heroin drug users across Europe for more than 10 years. In order to better understand this outbreak, we assessed genomic relationships of all available injectional anthrax strains from four countries spanning a >12 year period. Very few differences were identified using genome-based analysis, but these differentiated the isolates into two distinct clusters. This strongly supports a hypothesis of at least two separate anthrax spore contamination events perhaps during the drug production processes. Identification of two events would not have been possible from standard epidemiological analysis. These comprehensive data will be invaluable for classifying future injectional anthrax isolates and for future geographic attribution.

  3. Efficient genome-wide association in biobanks using topic modeling identifies multiple novel disease loci.

    Science.gov (United States)

    McCoy, Thomas H; Castro, Victor M; Snapper, Leslie A; Hart, Kamber L; Perlis, Roy H

    2017-08-31

    Biobanks and national registries represent a powerful tool for genomic discovery, but rely on diagnostic codes that may be unreliable and fail to capture the relationship between related diagnoses. We developed an efficient means of conducting genome-wide association studies using combinations of diagnostic codes from electronic health records (EHR) for 10845 participants in a biobanking program at two large academic medical centers. Specifically, we applied latent Dirichilet allocation to fit 50 disease topics based on diagnostic codes, then conducted genome-wide common-variant association for each topic. In sensitivity analysis, these results were contrasted with those obtained from traditional single-diagnosis phenome-wide association analysis, as well as those in which only a subset of diagnostic codes are included per topic. In meta-analysis across three biobank cohorts, we identified 23 disease-associated loci with p<1e-15, including previously associated autoimmune disease loci. In all cases, observed significant associations were of greater magnitude than for single phenome-wide diagnostic codes, and incorporation of less strongly-loading diagnostic codes enhanced association. This strategy provides a more efficient means of phenome-wide association in biobanks with coded clinical data.

  4. Whole-Genome Analyses of Korean Native and Holstein Cattle Breeds by Massively Parallel Sequencing

    Science.gov (United States)

    Stothard, Paul; Chung, Won-Hyong; Jeon, Heoyn-Jeong; Miller, Stephen P.; Choi, So-Young; Lee, Jeong-Koo; Yang, Bokyoung; Lee, Kyung-Tai; Han, Kwang-Jin; Kim, Hyeong-Cheol; Jeong, Dongkee; Oh, Jae-Don; Kim, Namshin; Kim, Tae-Hun; Lee, Hak-Kyo; Lee, Sung-Jin

    2014-01-01

    A main goal of cattle genomics is to identify DNA differences that account for variations in economically important traits. In this study, we performed whole-genome analyses of three important cattle breeds in Korea—Hanwoo, Jeju Heugu, and Korean Holstein—using the Illumina HiSeq 2000 sequencing platform. We achieved 25.5-, 29.6-, and 29.5-fold coverage of the Hanwoo, Jeju Heugu, and Korean Holstein genomes, respectively, and identified a total of 10.4 million single nucleotide polymorphisms (SNPs), of which 54.12% were found to be novel. We also detected 1,063,267 insertions–deletions (InDels) across the genomes (78.92% novel). Annotations of the datasets identified a total of 31,503 nonsynonymous SNPs and 859 frameshift InDels that could affect phenotypic variations in traits of interest. Furthermore, genome-wide copy number variation regions (CNVRs) were detected by comparing the Hanwoo, Jeju Heugu, and previously published Chikso genomes against that of Korean Holstein. A total of 992, 284, and 1881 CNVRs, respectively, were detected throughout the genome. Moreover, 53, 65, 45, and 82 putative regions of homozygosity (ROH) were identified in Hanwoo, Jeju Heugu, Chikso, and Korean Holstein respectively. The results of this study provide a valuable foundation for further investigations to dissect the molecular mechanisms underlying variation in economically important traits in cattle and to develop genetic markers for use in cattle breeding. PMID:24992012

  5. Exploration of genetic diversity among medicinally important genus Epimedium species based on genomic and EST-SSR marker.

    Science.gov (United States)

    Yousaf, Zubaida; Hu, Weiming; Zhang, Yanjun; Zeng, Shaohua; Wang, Ying

    2015-01-01

    Epimedium species has gained prime importance due to their medicinal and economic values. Therefore, in this study, 26 genomic SSR and 10 EST-SSR markers were developed for 13 medicinal species of the Epimedium genus and one out-group species Vancouveria hexandra W. J. Hooker to explore the existing genetic diversity. A total of 100 alleles by genomic SSR and 65 by EST-SSR were detected. The genomic SSR markers were presented between 2-7 alleles per locus. The observed heterozygosity (Ho) and expected heterozygosity (He) ranged from 0.00 to 4.5 and 0.0254 to 2.8108, respectively. Similarly, for EST-SSR, these values were ranged from 3.00 to 4.00 and 1.9650 to 2.7142. The number of alleles for EST-SSR markers ranged from 3 to 10 with an average of 3.51 per loci. It has been concluded that medicinally important species of the genus Epimedium possesses lower intraspecific genetic variation.

  6. Comparative analysis of rosaceous genomes and the reconstruction of a putative ancestral genome for the family.

    Science.gov (United States)

    Illa, Eudald; Sargent, Daniel J; Lopez Girona, Elena; Bushakra, Jill; Cestaro, Alessandro; Crowhurst, Ross; Pindo, Massimo; Cabrera, Antonio; van der Knaap, Esther; Iezzoni, Amy; Gardiner, Susan; Velasco, Riccardo; Arús, Pere; Chagné, David; Troggio, Michela

    2011-01-12

    Comparative genome mapping studies in Rosaceae have been conducted until now by aligning genetic maps within the same genus, or closely related genera and using a limited number of common markers. The growing body of genomics resources and sequence data for both Prunus and Fragaria permits detailed comparisons between these genera and the recently released Malus × domestica genome sequence. We generated a comparative analysis using 806 molecular markers that are anchored genetically to the Prunus and/or Fragaria reference maps, and physically to the Malus genome sequence. Markers in common for Malus and Prunus, and Malus and Fragaria, respectively were 784 and 148. The correspondence between marker positions was high and conserved syntenic blocks were identified among the three genera in the Rosaceae. We reconstructed a proposed ancestral genome for the Rosaceae. A genome containing nine chromosomes is the most likely candidate for the ancestral Rosaceae progenitor. The number of chromosomal translocations observed between the three genera investigated was low. However, the number of inversions identified among Malus and Prunus was much higher than any reported genome comparisons in plants, suggesting that small inversions have played an important role in the evolution of these two genera or of the Rosaceae.

  7. Comparative analysis of rosaceous genomes and the reconstruction of a putative ancestral genome for the family

    Directory of Open Access Journals (Sweden)

    Velasco Riccardo

    2011-01-01

    Full Text Available Abstract Background Comparative genome mapping studies in Rosaceae have been conducted until now by aligning genetic maps within the same genus, or closely related genera and using a limited number of common markers. The growing body of genomics resources and sequence data for both Prunus and Fragaria permits detailed comparisons between these genera and the recently released Malus × domestica genome sequence. Results We generated a comparative analysis using 806 molecular markers that are anchored genetically to the Prunus and/or Fragaria reference maps, and physically to the Malus genome sequence. Markers in common for Malus and Prunus, and Malus and Fragaria, respectively were 784 and 148. The correspondence between marker positions was high and conserved syntenic blocks were identified among the three genera in the Rosaceae. We reconstructed a proposed ancestral genome for the Rosaceae. Conclusions A genome containing nine chromosomes is the most likely candidate for the ancestral Rosaceae progenitor. The number of chromosomal translocations observed between the three genera investigated was low. However, the number of inversions identified among Malus and Prunus was much higher than any reported genome comparisons in plants, suggesting that small inversions have played an important role in the evolution of these two genera or of the Rosaceae.

  8. Integration of mouse and human genome-wide association data identifies KCNIP4 as an asthma gene

    NARCIS (Netherlands)

    Himes, Blanca E.; Sheppard, Keith; Berndt, Annerose; Leme, Adriana S.; Myers, Rachel A.; Gignoux, Christopher R.; Levin, Albert M.; Gauderman, W. James; Yang, James J.; Mathias, Rasika A.; Romieu, Isabelle; Torgerson, Dara G.; Roth, Lindsey A.; Huntsman, Scott; Eng, Celeste; Klanderman, Barbara; Ziniti, John; Senter-Sylvia, Jody; Szefler, Stanley J.; Lemanske, Robert F.; Zeiger, Robert S.; Strunk, Robert C.; Martinez, Fernando D.; Boushey, Homer; Chinchilli, Vernon M.; Israel, Elliot; Mauger, David; Koppelman, Gerard H.; Postma, Dirkje S.; Nieuwenhuis, Maartje A. E.; Vonk, Judith M.; Lima, John J.; Irvin, Charles G.; Peters, Stephen P.; Kubo, Michiaki; Tamari, Mayumi; Nakamura, Yusuke; Litonjua, Augusto A.; Tantisira, Kelan G.; Raby, Benjamin A.; Bleecker, Eugene R.; Meyers, Deborah A.; London, Stephanie J.; Barnes, Kathleen C.; Gilliland, Frank D.; Williams, L. Keoki; Burchard, Esteban G.; Nicolae, Dan L.; Ober, Carole; DeMeo, Dawn L.; Silverman, Edwin K.; Paigen, Beverly; Churchill, Gary; Shapiro, Steve D.; Weiss, Scott

    2013-01-01

    Asthma is a common chronic respiratory disease characterized by airway hyperresponsiveness (AHR). The genetics of asthma have been widely studied in mouse and human, and homologous genomic regions have been associated with mouse AHR and human asthma-related phenotypes. Our goal was to identify

  9. Genomic profiling identifies GATA6 as a candidate oncogene amplified in pancreatobiliary cancer.

    Directory of Open Access Journals (Sweden)

    Kevin A Kwei

    2008-05-01

    Full Text Available Pancreatobiliary cancers have among the highest mortality rates of any cancer type. Discovering the full spectrum of molecular genetic alterations may suggest new avenues for therapy. To catalogue genomic alterations, we carried out array-based genomic profiling of 31 exocrine pancreatic cancers and 6 distal bile duct cancers, expanded as xenografts to enrich the tumor cell fraction. We identified numerous focal DNA amplifications and deletions, including in 19% of pancreatobiliary cases gain at cytoband 18q11.2, a locus uncommonly amplified in other tumor types. The smallest shared amplification at 18q11.2 included GATA6, a transcriptional regulator previously linked to normal pancreas development. When amplified, GATA6 was overexpressed at both the mRNA and protein levels, and strong immunostaining was observed in 25 of 54 (46% primary pancreatic cancers compared to 0 of 33 normal pancreas specimens surveyed. GATA6 expression in xenografts was associated with specific microarray gene-expression patterns, enriched for GATA binding sites and mitochondrial oxidative phosphorylation activity. siRNA mediated knockdown of GATA6 in pancreatic cancer cell lines with amplification led to reduced cell proliferation, cell cycle progression, and colony formation. Our findings indicate that GATA6 amplification and overexpression contribute to the oncogenic phenotypes of pancreatic cancer cells, and identify GATA6 as a candidate lineage-specific oncogene in pancreatobiliary cancer, with implications for novel treatment strategies.

  10. Comparative genomics reveals high biological diversity and specific adaptations in the industrially and medically important fungal genus Aspergillus

    DEFF Research Database (Denmark)

    de Vries, Ronald P.; Riley, Robert; Wiebenga, Ad

    2017-01-01

    Background:  The fungal genus Aspergillus is of critical importance to humankind. Species include those with industrial applications, important pathogens of humans, animals and crops, a source of potent carcinogenic contaminants of food, and an important genetic model. The genome sequences of eig...

  11. Genome-wide association study identifies five new schizophrenia loci.

    LENUS (Irish Health Repository)

    Ripke, Stephan

    2011-10-01

    We examined the role of common genetic variation in schizophrenia in a genome-wide association study of substantial size: a stage 1 discovery sample of 21,856 individuals of European ancestry and a stage 2 replication sample of 29,839 independent subjects. The combined stage 1 and 2 analysis yielded genome-wide significant associations with schizophrenia for seven loci, five of which are new (1p21.3, 2q32.3, 8p23.2, 8q21.3 and 10q24.32-q24.33) and two of which have been previously implicated (6p21.32-p22.1 and 18q21.2). The strongest new finding (P = 1.6 × 10(-11)) was with rs1625579 within an intron of a putative primary transcript for MIR137 (microRNA 137), a known regulator of neuronal development. Four other schizophrenia loci achieving genome-wide significance contain predicted targets of MIR137, suggesting MIR137-mediated dysregulation as a previously unknown etiologic mechanism in schizophrenia. In a joint analysis with a bipolar disorder sample (16,374 affected individuals and 14,044 controls), three loci reached genome-wide significance: CACNA1C (rs4765905, P = 7.0 × 10(-9)), ANK3 (rs10994359, P = 2.5 × 10(-8)) and the ITIH3-ITIH4 region (rs2239547, P = 7.8 × 10(-9)).

  12. A genome-wide association study identifies risk loci for spirometric measures among smokers of European and African ancestry.

    Science.gov (United States)

    Lutz, Sharon M; Cho, Michael H; Young, Kendra; Hersh, Craig P; Castaldi, Peter J; McDonald, Merry-Lynn; Regan, Elizabeth; Mattheisen, Manuel; DeMeo, Dawn L; Parker, Margaret; Foreman, Marilyn; Make, Barry J; Jensen, Robert L; Casaburi, Richard; Lomas, David A; Bhatt, Surya P; Bakke, Per; Gulsvik, Amund; Crapo, James D; Beaty, Terri H; Laird, Nan M; Lange, Christoph; Hokanson, John E; Silverman, Edwin K

    2015-12-03

    Pulmonary function decline is a major contributor to morbidity and mortality among smokers. Post bronchodilator FEV1 and FEV1/FVC ratio are considered the standard assessment of airflow obstruction. We performed a genome-wide association study (GWAS) in 9919 current and former smokers in the COPDGene study (6659 non-Hispanic Whites [NHW] and 3260 African Americans [AA]) to identify associations with spirometric measures (post-bronchodilator FEV1 and FEV1/FVC). We also conducted meta-analysis of FEV1 and FEV1/FVC GWAS in the COPDGene, ECLIPSE, and GenKOLS cohorts (total n = 13,532). Among NHW in the COPDGene cohort, both measures of pulmonary function were significantly associated with SNPs at the 15q25 locus [containing CHRNA3/5, AGPHD1, IREB2, CHRNB4] (lowest p-value = 2.17 × 10(-11)), and FEV1/FVC was associated with a genomic region on chromosome 4 [upstream of HHIP] (lowest p-value = 5.94 × 10(-10)); both regions have been previously associated with COPD. For the meta-analysis, in addition to confirming associations to the regions near CHRNA3/5 and HHIP, genome-wide significant associations were identified for FEV1 on chromosome 1 [TGFB2] (p-value = 8.99 × 10(-9)), 9 [DBH] (p-value = 9.69 × 10(-9)) and 19 [CYP2A6/7] (p-value = 3.49 × 10(-8)) and for FEV1/FVC on chromosome 1 [TGFB2] (p-value = 8.99 × 10(-9)), 4 [FAM13A] (p-value = 3.88 × 10(-12)), 11 [MMP3/12] (p-value = 3.29 × 10(-10)) and 14 [RIN3] (p-value = 5.64 × 10(-9)). In a large genome-wide association study of lung function in smokers, we found genome-wide significant associations at several previously described loci with lung function or COPD. We additionally identified a novel genome-wide significant locus with FEV1 on chromosome 9 [DBH] in a meta-analysis of three study populations.

  13. A haplotype map of genomic variations and genome-wide association studies of agronomic traits in foxtail millet (Setaria italica).

    Science.gov (United States)

    Jia, Guanqing; Huang, Xuehui; Zhi, Hui; Zhao, Yan; Zhao, Qiang; Li, Wenjun; Chai, Yang; Yang, Lifang; Liu, Kunyan; Lu, Hengyun; Zhu, Chuanrang; Lu, Yiqi; Zhou, Congcong; Fan, Danlin; Weng, Qijun; Guo, Yunli; Huang, Tao; Zhang, Lei; Lu, Tingting; Feng, Qi; Hao, Hangfei; Liu, Hongkuan; Lu, Ping; Zhang, Ning; Li, Yuhui; Guo, Erhu; Wang, Shujun; Wang, Suying; Liu, Jinrong; Zhang, Wenfei; Chen, Guoqiu; Zhang, Baojin; Li, Wei; Wang, Yongfang; Li, Haiquan; Zhao, Baohua; Li, Jiayang; Diao, Xianmin; Han, Bin

    2013-08-01

    Foxtail millet (Setaria italica) is an important grain crop that is grown in arid regions. Here we sequenced 916 diverse foxtail millet varieties, identified 2.58 million SNPs and used 0.8 million common SNPs to construct a haplotype map of the foxtail millet genome. We classified the foxtail millet varieties into two divergent groups that are strongly correlated with early and late flowering times. We phenotyped the 916 varieties under five different environments and identified 512 loci associated with 47 agronomic traits by genome-wide association studies. We performed a de novo assembly of deeply sequenced genomes of a Setaria viridis accession (the wild progenitor of S. italica) and an S. italica variety and identified complex interspecies and intraspecies variants. We also identified 36 selective sweeps that seem to have occurred during modern breeding. This study provides fundamental resources for genetics research and genetic improvement in foxtail millet.

  14. Signatures of selection in tilapia revealed by whole genome resequencing.

    Science.gov (United States)

    Xia, Jun Hong; Bai, Zhiyi; Meng, Zining; Zhang, Yong; Wang, Le; Liu, Feng; Jing, Wu; Wan, Zi Yi; Li, Jiale; Lin, Haoran; Yue, Gen Hua

    2015-09-16

    Natural selection and selective breeding for genetic improvement have left detectable signatures within the genome of a species. Identification of selection signatures is important in evolutionary biology and for detecting genes that facilitate to accelerate genetic improvement. However, selection signatures, including artificial selection and natural selection, have only been identified at the whole genome level in several genetically improved fish species. Tilapia is one of the most important genetically improved fish species in the world. Using next-generation sequencing, we sequenced the genomes of 47 tilapia individuals. We identified a total of 1.43 million high-quality SNPs and found that the LD block sizes ranged from 10-100 kb in tilapia. We detected over a hundred putative selective sweep regions in each line of tilapia. Most selection signatures were located in non-coding regions of the tilapia genome. The Wnt signaling, gonadotropin-releasing hormone receptor and integrin signaling pathways were under positive selection in all improved tilapia lines. Our study provides a genome-wide map of genetic variation and selection footprints in tilapia, which could be important for genetic studies and accelerating genetic improvement of tilapia.

  15. Genome-wide association study identifies novel breast cancer susceptibility loci

    Science.gov (United States)

    Easton, Douglas F.; Pooley, Karen A.; Dunning, Alison M.; Pharoah, Paul D. P.; Thompson, Deborah; Ballinger, Dennis G.; Struewing, Jeffery P.; Morrison, Jonathan; Field, Helen; Luben, Robert; Wareham, Nicholas; Ahmed, Shahana; Healey, Catherine S.; Bowman, Richard; Meyer, Kerstin B.; Haiman, Christopher A.; Kolonel, Laurence K.; Henderson, Brian E.; Marchand, Loic Le; Brennan, Paul; Sangrajrang, Suleeporn; Gaborieau, Valerie; Odefrey, Fabrice; Shen, Chen-Yang; Wu, Pei-Ei; Wang, Hui-Chun; Eccles, Diana; Evans, D. Gareth; Peto, Julian; Fletcher, Olivia; Johnson, Nichola; Seal, Sheila; Stratton, Michael R.; Rahman, Nazneen; Chenevix-Trench, Georgia; Bojesen, Stig E.; Nordestgaard, Børge G.; Axelsson, Christen K.; Garcia-Closas, Montserrat; Brinton, Louise; Chanock, Stephen; Lissowska, Jolanta; Peplonska, Beata; Nevanlinna, Heli; Fagerholm, Rainer; Eerola, Hannaleena; Kang, Daehee; Yoo, Keun-Young; Noh, Dong-Young; Ahn, Sei-Hyun; Hunter, David J.; Hankinson, Susan E.; Cox, David G.; Hall, Per; Wedren, Sara; Liu, Jianjun; Low, Yen-Ling; Bogdanova, Natalia; Schürmann, Peter; Dörk, Thilo; Tollenaar, Rob A. E. M.; Jacobi, Catharina E.; Devilee, Peter; Klijn, Jan G. M.; Sigurdson, Alice J.; Doody, Michele M.; Alexander, Bruce H.; Zhang, Jinghui; Cox, Angela; Brock, Ian W.; MacPherson, Gordon; Reed, Malcolm W. R.; Couch, Fergus J.; Goode, Ellen L.; Olson, Janet E.; Meijers-Heijboer, Hanne; van den Ouweland, Ans; Uitterlinden, André; Rivadeneira, Fernando; Milne, Roger L.; Ribas, Gloria; Gonzalez-Neira, Anna; Benitez, Javier; Hopper, John L.; McCredie, Margaret; Southey, Melissa; Giles, Graham G.; Schroen, Chris; Justenhoven, Christina; Brauch, Hiltrud; Hamann, Ute; Ko, Yon-Dschun; Spurdle, Amanda B.; Beesley, Jonathan; Chen, Xiaoqing; Mannermaa, Arto; Kosma, Veli-Matti; Kataja, Vesa; Hartikainen, Jaana; Day, Nicholas E.; Cox, David R.; Ponder, Bruce A. J.; Luccarini, Craig; Conroy, Don; Shah, Mitul; Munday, Hannah; Jordan, Clare; Perkins, Barbara; West, Judy; Redman, Karen; Driver, Kristy; Aghmesheh, Morteza; Amor, David; Andrews, Lesley; Antill, Yoland; Armes, Jane; Armitage, Shane; Arnold, Leanne; Balleine, Rosemary; Begley, Glenn; Beilby, John; Bennett, Ian; Bennett, Barbara; Berry, Geoffrey; Blackburn, Anneke; Brennan, Meagan; Brown, Melissa; Buckley, Michael; Burke, Jo; Butow, Phyllis; Byron, Keith; Callen, David; Campbell, Ian; Chenevix-Trench, Georgia; Clarke, Christine; Colley, Alison; Cotton, Dick; Cui, Jisheng; Culling, Bronwyn; Cummings, Margaret; Dawson, Sarah-Jane; Dixon, Joanne; Dobrovic, Alexander; Dudding, Tracy; Edkins, Ted; Eisenbruch, Maurice; Farshid, Gelareh; Fawcett, Susan; Field, Michael; Firgaira, Frank; Fleming, Jean; Forbes, John; Friedlander, Michael; Gaff, Clara; Gardner, Mac; Gattas, Mike; George, Peter; Giles, Graham; Gill, Grantley; Goldblatt, Jack; Greening, Sian; Grist, Scott; Haan, Eric; Harris, Marion; Hart, Stewart; Hayward, Nick; Hopper, John; Humphrey, Evelyn; Jenkins, Mark; Jones, Alison; Kefford, Rick; Kirk, Judy; Kollias, James; Kovalenko, Sergey; Lakhani, Sunil; Leary, Jennifer; Lim, Jacqueline; Lindeman, Geoff; Lipton, Lara; Lobb, Liz; Maclurcan, Mariette; Mann, Graham; Marsh, Deborah; McCredie, Margaret; McKay, Michael; McLachlan, Sue Anne; Meiser, Bettina; Milne, Roger; Mitchell, Gillian; Newman, Beth; O'Loughlin, Imelda; Osborne, Richard; Peters, Lester; Phillips, Kelly; Price, Melanie; Reeve, Jeanne; Reeve, Tony; Richards, Robert; Rinehart, Gina; Robinson, Bridget; Rudzki, Barney; Salisbury, Elizabeth; Sambrook, Joe; Saunders, Christobel; Scott, Clare; Scott, Elizabeth; Scott, Rodney; Seshadri, Ram; Shelling, Andrew; Southey, Melissa; Spurdle, Amanda; Suthers, Graeme; Taylor, Donna; Tennant, Christopher; Thorne, Heather; Townshend, Sharron; Tucker, Kathy; Tyler, Janet; Venter, Deon; Visvader, Jane; Walpole, Ian; Ward, Robin; Waring, Paul; Warner, Bev; Warren, Graham; Watson, Elizabeth; Williams, Rachael; Wilson, Judy; Winship, Ingrid; Young, Mary Ann; Bowtell, David; Green, Adele; deFazio, Anna; Chenevix-Trench, Georgia; Gertig, Dorota; Webb, Penny

    2009-01-01

    Breast cancer exhibits familial aggregation, consistent with variation in genetic susceptibility to the disease. Known susceptibility genes account for less than 25% of the familial risk of breast cancer, and the residual genetic variance is likely to be due to variants conferring more moderate risks. To identify further susceptibility alleles, we conducted a two-stage genome-wide association study in 4,398 breast cancer cases and 4,316 controls, followed by a third stage in which 30 single nucleotide polymorphisms (SNPs) were tested for confirmation in 21,860 cases and 22,578 controls from 22 studies. We used 227,876 SNPs that were estimated to correlate with 77% of known common SNPs in Europeans at r2>0.5. SNPs in five novel independent loci exhibited strong and consistent evidence of association with breast cancer (P<10−7). Four of these contain plausible causative genes (FGFR2, TNRC9, MAP3K1 and LSP1). At the second stage, 1,792 SNPs were significant at the P<0.05 level compared with an estimated 1,343 that would be expected by chance, indicating that many additional common susceptibility alleles may be identifiable by this approach. PMID:17529967

  16. Identifying and exploiting trait-relevant tissues with multiple functional annotations in genome-wide association studies

    Science.gov (United States)

    Zhang, Shujun

    2018-01-01

    Genome-wide association studies (GWASs) have identified many disease associated loci, the majority of which have unknown biological functions. Understanding the mechanism underlying trait associations requires identifying trait-relevant tissues and investigating associations in a trait-specific fashion. Here, we extend the widely used linear mixed model to incorporate multiple SNP functional annotations from omics studies with GWAS summary statistics to facilitate the identification of trait-relevant tissues, with which to further construct powerful association tests. Specifically, we rely on a generalized estimating equation based algorithm for parameter inference, a mixture modeling framework for trait-tissue relevance classification, and a weighted sequence kernel association test constructed based on the identified trait-relevant tissues for powerful association analysis. We refer to our analytic procedure as the Scalable Multiple Annotation integration for trait-Relevant Tissue identification and usage (SMART). With extensive simulations, we show how our method can make use of multiple complementary annotations to improve the accuracy for identifying trait-relevant tissues. In addition, our procedure allows us to make use of the inferred trait-relevant tissues, for the first time, to construct more powerful SNP set tests. We apply our method for an in-depth analysis of 43 traits from 28 GWASs using tissue-specific annotations in 105 tissues derived from ENCODE and Roadmap. Our results reveal new trait-tissue relevance, pinpoint important annotations that are informative of trait-tissue relationship, and illustrate how we can use the inferred trait-relevant tissues to construct more powerful association tests in the Wellcome trust case control consortium study. PMID:29377896

  17. Identifying and exploiting trait-relevant tissues with multiple functional annotations in genome-wide association studies.

    Directory of Open Access Journals (Sweden)

    Xingjie Hao

    2018-01-01

    Full Text Available Genome-wide association studies (GWASs have identified many disease associated loci, the majority of which have unknown biological functions. Understanding the mechanism underlying trait associations requires identifying trait-relevant tissues and investigating associations in a trait-specific fashion. Here, we extend the widely used linear mixed model to incorporate multiple SNP functional annotations from omics studies with GWAS summary statistics to facilitate the identification of trait-relevant tissues, with which to further construct powerful association tests. Specifically, we rely on a generalized estimating equation based algorithm for parameter inference, a mixture modeling framework for trait-tissue relevance classification, and a weighted sequence kernel association test constructed based on the identified trait-relevant tissues for powerful association analysis. We refer to our analytic procedure as the Scalable Multiple Annotation integration for trait-Relevant Tissue identification and usage (SMART. With extensive simulations, we show how our method can make use of multiple complementary annotations to improve the accuracy for identifying trait-relevant tissues. In addition, our procedure allows us to make use of the inferred trait-relevant tissues, for the first time, to construct more powerful SNP set tests. We apply our method for an in-depth analysis of 43 traits from 28 GWASs using tissue-specific annotations in 105 tissues derived from ENCODE and Roadmap. Our results reveal new trait-tissue relevance, pinpoint important annotations that are informative of trait-tissue relationship, and illustrate how we can use the inferred trait-relevant tissues to construct more powerful association tests in the Wellcome trust case control consortium study.

  18. Compatible Solute Synthesis and Import by the Moderate Halophile Spiribacter salinus: Physiology and Genomics

    Directory of Open Access Journals (Sweden)

    María J. León

    2018-02-01

    Full Text Available Members of the genus Spiribacter are found worldwide and are abundant in ecosystems possessing intermediate salinities between seawater and saturated salt concentrations. Spiribacter salinus M19-40 is the type species of this genus and its first cultivated representative. In the habitats of S. salinus M19-40, high salinity is a key determinant for growth and we therefore focused on the cellular adjustment strategy to this persistent environmental challenge. We coupled these experimental studies to the in silico mining of the genome sequence of this moderate halophile with respect to systems allowing this bacterium to control its potassium and sodium pools, and its ability to import and synthesize compatible solutes. S. salinus M19-40 produces enhanced levels of the compatible solute ectoine, both under optimal and growth-challenging salt concentrations, but the genes encoding the corresponding biosynthetic enzymes are not organized in a canonical ectABC operon. Instead, they are scrambled (ectAC; ectB and are physically separated from each other on the S. salinus M19-40 genome. Genomes of many phylogenetically related bacteria also exhibit a non-canonical organization of the ect genes. S. salinus M19-40 also synthesizes trehalose, but this compatible solute seems to make only a minor contribution to the cytoplasmic solute pool under osmotic stress conditions. However, its cellular levels increase substantially in stationary phase cells grown under optimal salt concentrations. In silico genome mining revealed that S. salinus M19-40 possesses different types of uptake systems for compatible solutes. Among the set of compatible solutes tested in an osmostress protection growth assay, glycine betaine and arsenobetaine were the most effective. Transport studies with radiolabeled glycine betaine showed that S. salinus M19-40 increases the pool size of this osmolyte in a fashion that is sensitively tied to the prevalent salinity of the growth medium

  19. NCC-AUC: an AUC optimization method to identify multi-biomarker panel for cancer prognosis from genomic and clinical data.

    Science.gov (United States)

    Zou, Meng; Liu, Zhaoqi; Zhang, Xiang-Sun; Wang, Yong

    2015-10-15

    In prognosis and survival studies, an important goal is to identify multi-biomarker panels with predictive power using molecular characteristics or clinical observations. Such analysis is often challenged by censored, small-sample-size, but high-dimensional genomic profiles or clinical data. Therefore, sophisticated models and algorithms are in pressing need. In this study, we propose a novel Area Under Curve (AUC) optimization method for multi-biomarker panel identification named Nearest Centroid Classifier for AUC optimization (NCC-AUC). Our method is motived by the connection between AUC score for classification accuracy evaluation and Harrell's concordance index in survival analysis. This connection allows us to convert the survival time regression problem to a binary classification problem. Then an optimization model is formulated to directly maximize AUC and meanwhile minimize the number of selected features to construct a predictor in the nearest centroid classifier framework. NCC-AUC shows its great performance by validating both in genomic data of breast cancer and clinical data of stage IB Non-Small-Cell Lung Cancer (NSCLC). For the genomic data, NCC-AUC outperforms Support Vector Machine (SVM) and Support Vector Machine-based Recursive Feature Elimination (SVM-RFE) in classification accuracy. It tends to select a multi-biomarker panel with low average redundancy and enriched biological meanings. Also NCC-AUC is more significant in separation of low and high risk cohorts than widely used Cox model (Cox proportional-hazards regression model) and L1-Cox model (L1 penalized in Cox model). These performance gains of NCC-AUC are quite robust across 5 subtypes of breast cancer. Further in an independent clinical data, NCC-AUC outperforms SVM and SVM-RFE in predictive accuracy and is consistently better than Cox model and L1-Cox model in grouping patients into high and low risk categories. In summary, NCC-AUC provides a rigorous optimization framework to

  20. Genome-wide association study identifies the SERPINB gene cluster as a susceptibility locus for food allergy.

    Science.gov (United States)

    Marenholz, Ingo; Grosche, Sarah; Kalb, Birgit; Rüschendorf, Franz; Blümchen, Katharina; Schlags, Rupert; Harandi, Neda; Price, Mareike; Hansen, Gesine; Seidenberg, Jürgen; Röblitz, Holger; Yürek, Songül; Tschirner, Sebastian; Hong, Xiumei; Wang, Xiaobin; Homuth, Georg; Schmidt, Carsten O; Nöthen, Markus M; Hübner, Norbert; Niggemann, Bodo; Beyer, Kirsten; Lee, Young-Ae

    2017-10-20

    Genetic factors and mechanisms underlying food allergy are largely unknown. Due to heterogeneity of symptoms a reliable diagnosis is often difficult to make. Here, we report a genome-wide association study on food allergy diagnosed by oral food challenge in 497 cases and 2387 controls. We identify five loci at genome-wide significance, the clade B serpin (SERPINB) gene cluster at 18q21.3, the cytokine gene cluster at 5q31.1, the filaggrin gene, the C11orf30/LRRC32 locus, and the human leukocyte antigen (HLA) region. Stratifying the results for the causative food demonstrates that association of the HLA locus is peanut allergy-specific whereas the other four loci increase the risk for any food allergy. Variants in the SERPINB gene cluster are associated with SERPINB10 expression in leukocytes. Moreover, SERPINB genes are highly expressed in the esophagus. All identified loci are involved in immunological regulation or epithelial barrier function, emphasizing the role of both mechanisms in food allergy.

  1. The Genome of Dendrobium officinale Illuminates the Biology of the Important Traditional Chinese Orchid Herb.

    Science.gov (United States)

    Yan, Liang; Wang, Xiao; Liu, Hui; Tian, Yang; Lian, Jinmin; Yang, Ruijuan; Hao, Shumei; Wang, Xuanjun; Yang, Shengchao; Li, Qiye; Qi, Shuai; Kui, Ling; Okpekum, Moses; Ma, Xiao; Zhang, Jiajin; Ding, Zhaoli; Zhang, Guojie; Wang, Wen; Dong, Yang; Sheng, Jun

    2015-06-01

    Dendrobium officinale Kimura et Migo is a traditional Chinese orchid herb that has both ornamental value and a broad range of therapeutic effects. Here, we report the first de novo assembled 1.35 Gb genome sequences for D. officinale by combining the second-generation Illumina Hiseq 2000 and third-generation PacBio sequencing technologies. We found that orchids have a complete inflorescence gene set and have some specific inflorescence genes. We observed gene expansion in gene families related to fungus symbiosis and drought resistance. We analyzed biosynthesis pathways of medicinal components of D. officinale and found extensive duplication of SPS and SuSy genes, which are related to polysaccharide generation, and that the pathway of D. officinale alkaloid synthesis could be extended to generate 16-epivellosimine. The D. officinale genome assembly demonstrates a new approach to deciphering large complex genomes and, as an important orchid species and a traditional Chinese medicine, the D. officinale genome will facilitate future research on the evolution of orchid plants, as well as the study of medicinal components and potential genetic breeding of the dendrobe. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.

  2. Single-trait and multi-trait genome-wide association analyses identify novel loci for blood pressure in African-ancestry populations.

    Directory of Open Access Journals (Sweden)

    Jingjing Liang

    2017-05-01

    Full Text Available Hypertension is a leading cause of global disease, mortality, and disability. While individuals of African descent suffer a disproportionate burden of hypertension and its complications, they have been underrepresented in genetic studies. To identify novel susceptibility loci for blood pressure and hypertension in people of African ancestry, we performed both single and multiple-trait genome-wide association analyses. We analyzed 21 genome-wide association studies comprised of 31,968 individuals of African ancestry, and validated our results with additional 54,395 individuals from multi-ethnic studies. These analyses identified nine loci with eleven independent variants which reached genome-wide significance (P < 1.25×10-8 for either systolic and diastolic blood pressure, hypertension, or for combined traits. Single-trait analyses identified two loci (TARID/TCF21 and LLPH/TMBIM4 and multiple-trait analyses identified one novel locus (FRMD3 for blood pressure. At these three loci, as well as at GRP20/CDH17, associated variants had alleles common only in African-ancestry populations. Functional annotation showed enrichment for genes expressed in immune and kidney cells, as well as in heart and vascular cells/tissues. Experiments driven by these findings and using angiotensin-II induced hypertension in mice showed altered kidney mRNA expression of six genes, suggesting their potential role in hypertension. Our study provides new evidence for genes related to hypertension susceptibility, and the need to study African-ancestry populations in order to identify biologic factors contributing to hypertension.

  3. Identifying the important factors in simulation models with many factors

    NARCIS (Netherlands)

    Bettonvil, B.; Kleijnen, J.P.C.

    1994-01-01

    Simulation models may have many parameters and input variables (together called factors), while only a few factors are really important (parsimony principle). For such models this paper presents an effective and efficient screening technique to identify and estimate those important factors. The

  4. A genome-wide association study identifies protein quantitative trait loci (pQTLs.

    Directory of Open Access Journals (Sweden)

    David Melzer

    2008-05-01

    Full Text Available There is considerable evidence that human genetic variation influences gene expression. Genome-wide studies have revealed that mRNA levels are associated with genetic variation in or close to the gene coding for those mRNA transcripts - cis effects, and elsewhere in the genome - trans effects. The role of genetic variation in determining protein levels has not been systematically assessed. Using a genome-wide association approach we show that common genetic variation influences levels of clinically relevant proteins in human serum and plasma. We evaluated the role of 496,032 polymorphisms on levels of 42 proteins measured in 1200 fasting individuals from the population based InCHIANTI study. Proteins included insulin, several interleukins, adipokines, chemokines, and liver function markers that are implicated in many common diseases including metabolic, inflammatory, and infectious conditions. We identified eight Cis effects, including variants in or near the IL6R (p = 1.8x10(-57, CCL4L1 (p = 3.9x10(-21, IL18 (p = 6.8x10(-13, LPA (p = 4.4x10(-10, GGT1 (p = 1.5x10(-7, SHBG (p = 3.1x10(-7, CRP (p = 6.4x10(-6 and IL1RN (p = 7.3x10(-6 genes, all associated with their respective protein products with effect sizes ranging from 0.19 to 0.69 standard deviations per allele. Mechanisms implicated include altered rates of cleavage of bound to unbound soluble receptor (IL6R, altered secretion rates of different sized proteins (LPA, variation in gene copy number (CCL4L1 and altered transcription (GGT1. We identified one novel trans effect that was an association between ABO blood group and tumour necrosis factor alpha (TNF-alpha levels (p = 6.8x10(-40, but this finding was not present when TNF-alpha was measured using a different assay , or in a second study, suggesting an assay-specific association. Our results show that protein levels share some of the features of the genetics of gene expression. These include the presence of strong genetic effects in cis

  5. The Arab genome: Health and wealth.

    Science.gov (United States)

    Zayed, Hatem

    2016-11-05

    The 22 Arab nations have a unique genetic structure, which reflects both conserved and diverse gene pools due to the prevalent endogamous and consanguineous marriage culture and the long history of admixture among different ethnic subcultures descended from the Asian, European, and African continents. Human genome sequencing has enabled large-scale genomic studies of different populations and has become a powerful tool for studying disease predictions and diagnosis. Despite the importance of the Arab genome for better understanding the dynamics of the human genome, discovering rare genetic variations, and studying early human migration out of Africa, it is poorly represented in human genome databases, such as HapMap and the 1000 Genomes Project. In this review, I demonstrate the significance of sequencing the Arab genome and setting an Arab genome reference(s) for better understanding the molecular pathogenesis of genetic diseases, discovering novel/rare variants, and identifying a meaningful genotype-phenotype correlation for complex diseases. Copyright © 2016. Published by Elsevier B.V.

  6. Meta-analysis of genome-wide association studies identifies eight new loci for type 2 diabetes in east Asians

    DEFF Research Database (Denmark)

    Cho, Yoon Shin; Chen, Chien-Hsiun; Hu, Cheng

    2012-01-01

    We conducted a three-stage genetic study to identify susceptibility loci for type 2 diabetes (T2D) in east Asian populations. We followed our stage 1 meta-analysis of eight T2D genome-wide association studies (6,952 cases with T2D and 11,865 controls) with a stage 2 in silico replication analysis...... (5,843 cases and 4,574 controls) and a stage 3 de novo replication analysis (12,284 cases and 13,172 controls). The combined analysis identified eight new T2D loci reaching genome-wide significance, which mapped in or near GLIS3, PEPD, FITM2-R3HDML-HNF4A, KCNK16, MAEA, GCC1-PAX4, PSMD6 and ZFAND3...

  7. Comparative genomic analysis identified a mutation related to enhanced heterologous protein production in the filamentous fungus Aspergillus oryzae.

    Science.gov (United States)

    Jin, Feng-Jie; Katayama, Takuya; Maruyama, Jun-Ichi; Kitamoto, Katsuhiko

    2016-11-01

    Genomic mapping of mutations using next-generation sequencing technologies has facilitated the identification of genes contributing to fundamental biological processes, including human diseases. However, few studies have used this approach to identify mutations contributing to heterologous protein production in industrial strains of filamentous fungi, such as Aspergillus oryzae. In a screening of A. oryzae strains that hyper-produce human lysozyme (HLY), we previously isolated an AUT1 mutant that showed higher production of various heterologous proteins; however, the underlying factors contributing to the increased heterologous protein production remained unclear. Here, using a comparative genomic approach performed with whole-genome sequences, we attempted to identify the genes responsible for the high-level production of heterologous proteins in the AUT1 mutant. The comparative sequence analysis led to the detection of a gene (AO090120000003), designated autA, which was predicted to encode an unknown cytoplasmic protein containing an alpha/beta-hydrolase fold domain. Mutation or deletion of autA was associated with higher production levels of HLY. Specifically, the HLY yields of the autA mutant and deletion strains were twofold higher than that of the control strain during the early stages of cultivation. Taken together, these results indicate that combining classical mutagenesis approaches with comparative genomic analysis facilitates the identification of novel genes involved in heterologous protein production in filamentous fungi.

  8. Genome-wide association study identifies a single major locus contributing to survival into old age; the APOE locus revisited

    DEFF Research Database (Denmark)

    Deelen, Joris; Beekman, Marian; Uh, Hae-Won

    2011-01-01

    By studying the loci which contribute to human longevity, we aim to identify mechanisms that contribute to healthy aging. To identify such loci, we performed a genome-wide association study (GWAS) comparing 403 unrelated nonagenarians from long-living families included in the Leiden Longevity Stu...

  9. Investigating Salmonella Eko from Various Sources in Nigeria by Whole Genome Sequencing to Identify the Source of Human Infections

    DEFF Research Database (Denmark)

    Leekitcharoenphon, Pimlapas; Raufu, Ibrahim; Thorup Nielsen, Mette

    2016-01-01

    Twenty-six Salmonella enterica serovar Eko isolated from various sources in Nigeria were investigated by whole genome sequencing to identify the source of human infections. Diversity among the isolates was observed and camel and cattle were identified as the primary reservoirs and the most likely...

  10. Genome-wide association analysis identifies new lung cancer susceptibility loci in never-smoking women in Asia.

    NARCIS (Netherlands)

    Lan, Q.; Hsiung, C.A.; Matsuo, K.; Hong, Y.C.; Seow, A.; Wang, Z.; Hosgood, H.D.; Chen, K.; Wang, J.C.; Chatterjee, N.; Hu, W.; Wong, M.P.; Zheng, W.; Caporaso, N.; Park, J.Y.; Chen, C.J.; Kim, Y.H.; Kim, Y.T.; Landi, M.T.; Shen, H.; Lawrence, C.; Burdett, L.; Yeager, M.; Yuenger, J.; Jacobs, K.B.; Chang, I.S.; Mitsudomi, T.; Kim, H.N.; Chang, G.C.; Bassig, B.A.; Tucker, M.; Wei, F.; Yin, Y.; Wu, C.; An, S.J.; Qian, B.; Lee, V.H.; Lu, D.; Liu, J.; Jeon, H.S.; Hsiao, C.F.; Sung, J.S.; Kim, J.H.; Gao, Y.T.; Tsai, Y.H.; Jung, Y.J.; Guo, H.; Hu, Z.; Hutchinson, A.; Wang, W.C.; Klein, R.; Chung, C.C.; Oh, I.J.; Chen, K.Y.; Berndt, S.I.; He, X.; Wu, W.; Chang, J.; Zhang, X.C.; Huang, M.S.; Zheng, H.; Wang, J.; Zhao, X.|info:eu-repo/dai/nl/413577805; Li, Y.; Choi, J.E.; Su, W.C.; Park, K.H.; Sung, S.W.; Shu, X.O.; Chen, Y.M.; Liu, L.; Kang, C.H.; Hu, L.; Chen, C.H.; Pao, W.; Kim, Y.C.; Yang, T.Y.; Xu, J.; Guan, P.; Tan, W.; Su, J.; Wang, C.L.; Li, H.; Sihoe, A.D.; Zhao, Z.|info:eu-repo/dai/nl/304120995; Chen, Y.; Choi, Y.Y.; Hung, J.Y.; Kim, J.S.; Yoon, H.I.; Cai, Q.; Lin, C.C.; Park, I.K.; Xu, P.; Dong, J.; Kim, C.; He, Q; Perng, R.P.; Kohno, T.; Kweon, S.S.; Chen, C.Y.; Vermeulen, R.|info:eu-repo/dai/nl/216532620; Wu, J.; Lim, W.Y.; Chen, K.C.; Chow, W.H.; Ji, B.T.; Chan, J.K.; Chu, M.; Li, Y.J.; Yokota, J.; Li, J.; Chen, H.; Xiang, Y.B.; Yu, C.J.; Kunitoh, H.; Wu, G.; Jin, L.; Lo, Y.L.; Shiraishi, K.; Chen, Y.H.; Lin, H.C.; Wu, T.; WU, Y.; Yang, P.C.; Zhou, B.; Shin, M.H.; Fraumeni, J.F.; Lin, D.; Chanock, S.J.; Rothman, N.

    2012-01-01

    To identify common genetic variants that contribute to lung cancer susceptibility, we conducted a multistage genome-wide association study of lung cancer in Asian women who never smoked. We scanned 5,510 never-smoking female lung cancer cases and 4,544 controls drawn from 14 studies from mainland

  11. Single-trait and multi-trait genome-wide association analyses identify novel loci for blood pressure in African-ancestry populations

    OpenAIRE

    Liang, Jingjing; Le, Thu H.; Edwards, Digna R. Velez; Tayo, Bamidele O.; Gaulton, Kyle J.; Smith, Jennifer A.; Lu, Yingchang; Jensen, Richard A.; Chen, Guanjie; Yanek, Lisa R.; Schwander, Karen; Tajuddin, Salman M.; Sofer, Tamar; Kim, Wonji; Kayima, James

    2017-01-01

    © 2017 Public Library of Science. All Rights Reserved. Hypertension is a leading cause of global disease, mortality, and disability. While individuals of African descent suffer a disproportionate burden of hypertension and its complications, they have been underrepresented in genetic studies. To identify novel susceptibility loci for blood pressure and hypertension in people of African ancestry, we performed both single and multiple-trait genome-wide association analyses. We analyzed 21 genom...

  12. Genome-wide association identifies OBFC1 as a locus involved in human leukocyte telomere biology.

    Science.gov (United States)

    Levy, Daniel; Neuhausen, Susan L; Hunt, Steven C; Kimura, Masayuki; Hwang, Shih-Jen; Chen, Wei; Bis, Joshua C; Fitzpatrick, Annette L; Smith, Erin; Johnson, Andrew D; Gardner, Jeffrey P; Srinivasan, Sathanur R; Schork, Nicholas; Rotter, Jerome I; Herbig, Utz; Psaty, Bruce M; Sastrasinh, Malinee; Murray, Sarah S; Vasan, Ramachandran S; Province, Michael A; Glazer, Nicole L; Lu, Xiaobin; Cao, Xiaojian; Kronmal, Richard; Mangino, Massimo; Soranzo, Nicole; Spector, Tim D; Berenson, Gerald S; Aviv, Abraham

    2010-05-18

    Telomeres are engaged in a host of cellular functions, and their length is regulated by multiple genes. Telomere shortening, in the course of somatic cell replication, ultimately leads to replicative senescence. In humans, rare mutations in genes that regulate telomere length have been identified in monogenic diseases such as dyskeratosis congenita and idiopathic pulmonary fibrosis, which are associated with shortened leukocyte telomere length (LTL) and increased risk for aplastic anemia. Shortened LTL is observed in a host of aging-related complex genetic diseases and is associated with diminished survival in the elderly. We report results of a genome-wide association study of LTL in a consortium of four observational studies (n = 3,417 participants with LTL and genome-wide genotyping). SNPs in the regions of the oligonucleotide/oligosaccharide-binding folds containing one gene (OBFC1; rs4387287; P = 3.9 x 10(-9)) and chemokine (C-X-C motif) receptor 4 gene (CXCR4; rs4452212; P = 2.9 x 10(-8)) were associated with LTL at a genome-wide significance level (P a gene associated with LTL (P = 1.1 x 10(-5)). The identification of OBFC1 through genome-wide association as a locus for interindividual variation in LTL in the general population advances the understanding of telomere biology in humans and may provide insights into aging-related disorders linked to altered LTL dynamics.

  13. Thirty new loci for age at menarche identified by a meta-analysis of genome-wide association studies

    NARCIS (Netherlands)

    C.E. Elks (Cathy); J.R.B. Perry (John); P. Sulem (Patrick); D.I. Chasman (Daniel); N. Franceschini (Nora); C. He (Chunyan); K.L. Lunetta (Kathryn); J.A. Visser (Jenny); E.M. Byrne (Enda); D.L. Cousminer (Diana); D.F. Gudbjartsson (Daniel); T. Esko (Tõnu); B. Feenstra (Bjarke); J.J. Hottenga (Jouke Jan); D.L. Koller (Daniel); Z. Kutalik (Zoltán); P. Lin (Peng); M. Mangino (Massimo); M. Marongiu (Mara); P.F. McArdle (Patrick); A.V. Smith (Albert Vernon); L. Stolk (Lisette); S. van Wingerden (Sophie); J.H. Zhao (Jing Hua); E. Albrecht (Eva); T. Corre (Tanguy); E. Ingelsson (Erik); C. Hayward (Caroline); P.K. Magnusson (Patrik); S. Ulivi (Shelia); N.M. Warrington (Nicole); L. Zgaga (Lina); H. Alavere (Helene); N. Amin (Najaf); T. Aspelund (Thor); S. Bandinelli (Stefania); I.E. Barroso (Inês); G. Berenson (Gerald); S.M. Bergmann (Sven); H. Blackburn (Hannah); E.A. Boerwinkle (Eric); J.E. Buring (Julie); F. Busonero; H. Campbell (Harry); S.J. Chanock (Stephen); W. Chen (Wei); M. Cornelis (Marilyn); D.J. Couper (David); A.D. Coviello (Andrea); P. d' Adamo (Pio); U. de Faire (Ulf); E.J.C. de Geus (Eco); P. Deloukas (Panagiotis); A. Döring (Angela); D.F. Easton (Douglas); G. Eiriksdottir (Gudny); V. Emilsson (Valur); J.G. Eriksson (Johan); L. Ferrucci (Luigi); A.R. Folsom (Aaron); T. Foroud (Tatiana); M. Garcia (Melissa); P. Gasparini (Paolo); F. Geller (Frank); C. Gieger (Christian); V. Gudnason (Vilmundur); A.S. Hall (Alistair); S.E. Hankinson (Susan); L. Ferreli (Liana); A.C. Heath (Andrew); D.G. Hernandez (Dena); A. Hofman (Albert); F.B. Hu (Frank); T. Illig (Thomas); M.R. Järvelin; A.D. Johnson (Andrew); D. Karasik (David); K-T. Khaw (Kay-Tee); D.P. Kiel (Douglas); T.O. Kilpelänen (Tuomas); I. Kolcic (Ivana); P. Kraft (Peter); L.J. Launer (Lenore); J.S.E. Laven (Joop); S. Li (Shengxu); J. Liu (Jianjun); D. Levy (Daniel); N.G. Martin (Nicholas); M. Melbye (Mads); V. Mooser (Vincent); J.C. Murray (Jeffrey); M.A. Nalls (Michael); P. Navarro (Pau); M. Nelis (Mari); A.R. Ness (Andrew); K. Northstone (Kate); B.A. Oostra (Ben); M. Peacock (Munro); C. Palmer (Cameron); A. Palotie (Aarno); G. Paré (Guillaume); A.N. Parker (Alex); N.L. Pedersen (Nancy); L. Peltonen (Leena Johanna); C.E. Pennell (Craig); P.D.P. Pharoah (Paul); O. Polasek (Ozren); A.S. Plump (Andrew); A. Pouta (Anneli); E. Porcu (Eleonora); T. Rafnar (Thorunn); J.P. Rice (John); S.M. Ring (Susan); F. Rivadeneira Ramirez (Fernando); I. Rudan (Igor); C. Sala (Cinzia); V. Salomaa (Veikko); S. Sanna (Serena); D. Schlessinger; N.J. Schork (Nicholas); A. Scuteri (Angelo); A.V. Segrè (Ayellet); A.R. Shuldiner (Alan); N. Soranzo (Nicole); U. Sovio (Ulla); S.R. Srinivasan (Sathanur); D.P. Strachan (David); M.L. Tammesoo; E. Tikkanen (Emmi); D. Toniolo (Daniela); K. Tsui (Kim); L. Tryggvadottir (Laufey); J.P. Tyrer (Jonathan); M. Uda (Manuela); R.M. van Dam (Rob); J.B.J. van Meurs (Joyce); P. Vollenweider (Peter); G. Waeber (Gérard); N.J. Wareham (Nick); D. Waterworth (Dawn); H.E. Wichmann (Heinz Erich); G.A.H.M. Willemsen (Gonneke); J.F. Wilson (James); A.F. Wright (Alan); L. Young (Lauren); G. Zhai (Guangju); W.V. Zhuang; L.J. Bierut (Laura); D.I. Boomsma (Dorret); H.A. Boyd (Heather); L. Crisponi (Laura); E.W. Demerath (Ellen); P. Tikka-Kleemola (Päivi); M.J. Econs (Michael); T.B. Harris (Tamara); D. Hunter (David); R.J.F. Loos (Ruth); A. Metspalu (Andres); G.W. Montgomery (Grant); P.M. Ridker (Paul); T.D. Spector (Tim); E.A. Streeten (Elizabeth); K. Stefansson (Kari); U. Thorsteinsdottir (Unnur); A.G. Uitterlinden (André); E. Widen (Elisabeth); J. Murabito (Joanne); K. Ong (Ken); M.N. Weedon (Michael)

    2010-01-01

    textabstractTo identify loci for age at menarche, we performed a meta-analysis of 32 genome-wide association studies in 87,802 women of European descent, with replication in up to 14,731 women. In addition to the known loci at LIN28B (P = 5.4 × 10 -60) and 9q31.2 (P = 2.2 × 10 -33), we identified 30

  14. Large meta-analysis of genome-wide association studies identifies five loci for lean body mass

    NARCIS (Netherlands)

    Zillikens, M.C.; Demissie, Serkalem; Hsu, Yi Hsiang; Yerges-Armstrong, Laura M.; Chou, Wen Chi; Stolk, Lisette; Livshits, Gregory; Broer, Linda; Johnson, Toby; Koller, Daniel L.; Kutalik, Zoltán; Luan, J.A.; Malkin, Ida; Ried, Janina S.; Smith, Albert V.; Thorleifsson, Gudmar; Vandenput, Liesbeth; Hua Zhao, Jing; Zhang, Weihua; Aghdassi, Ali; Åkesson, Kristina; Amin, Najaf; Baier, Leslie J.; Barroso, Inês; Bennett, David A.; Bertram, Lars; Biffar, Rainer; Bochud, Murielle; Boehnke, Michael; Borecki, Ingrid B.; Buchman, Aron S.; Byberg, Liisa; Campbell, Harry; Campos Obanda, Natalia; Cauley, Jane A.; Cawthon, Peggy M.; Cederberg, Henna; Chen, Zhao; Cho, Nam H.; Jin Choi, Hyung; Claussnitzer, Melina; Collins, Francis; Cummings, Steven R.; Jager, De Philip L.; Demuth, Ilja; Dhonukshe-Rutten, Rosalie A.M.; DIatchenko, Luda; Eiriksdottir, Gudny; Enneman, Anke W.; Erdos, Mike; Eriksson, Johan G.; Eriksson, Joel; Estrada, Karol; Evans, Daniel S.; Feitosa, Mary F.; Fu, Mao; Garcia, Melissa; Gieger, Christian; Girke, Thomas; Glazer, Nicole L.; Grallert, Harald; Grewal, Jagvir; Han, Bok Ghee; Hanson, Robert L.; Hayward, Caroline; Hofman, Albert; Hoffman, Eric P.; Homuth, Georg; Hsueh, Wen Chi; Hubal, Monica J.; Hubbard, Alan; Huffman, Kim M.; Husted, Lise B.; Illig, Thomas; Ingelsson, Erik; Ittermann, Till; Jansson, John Olov; Jordan, Joanne M.; Jula, Antti; Karlsson, Magnus; Khaw, Kay Tee; Kilpelaïnen, Tuomas O.; Klopp, Norman; Kloth, Jacqueline S.L.; Koistinen, Heikki A.; Kraus, William E.; Kritchevsky, Stephen; Kuulasmaa, Teemu; Kuusisto, Johanna; Laakso, Markku; Lahti, Jari; Lang, Thomas; Langdahl, Bente L.; Launer, Lenore J.; Lee, Jong Young; Lerch, Markus M.; Lewis, Joshua R.; Lind, Lars; Lindgren, Cecilia M.; Liu, Yongmei; Liu, Tian; Liu, Youfang; Ljunggren, Östen; Lorentzon, Mattias; Luben, Robert N.; Maixner, William; McGuigan, Fiona E.; Medina-Gomez, Carolina; Meitinger, Thomas; Melhus, Håkan; Mellström, Dan; Melov, Simon; Michaëlsson, Karl; Mitchell, Braxton D.; Morris, Andrew P.; Mosekilde, Leif; Newman, Anne; Nielson, Carrie M.; O'Connell, Jeffrey R.; Oostra, Ben A.; Orwoll, Eric S.; Palotie, Aarno; Parker, Stephan; Peacock, Munro; Perola, Markus; Peters, Annette; Polasek, Ozren; Prince, Richard L.; Raïkkönen, Katri; Ralston, Stuart H.; Ripatti, Samuli; Robbins, John A.; Rotter, Jerome I.; Rudan, Igor; Salomaa, Veikko; Satterfield, Suzanne; Schadt, Eric E.; Schipf, Sabine; Scott, Laura; Sehmi, Joban; Shen, Jian; Soo Shin, Chan; Sigurdsson, Gunnar; Smith, Shad; Soranzo, Nicole; Stančáková, Alena; Steinhagen-Thiessen, Elisabeth; Streeten, Elizabeth A.; Styrkarsdottir, Unnur; Swart, Karin M.A.; Tan, Sian Tsung; Tarnopolsky, Mark A.; Thompson, Patricia; Thomson, Cynthia A.; Thorsteinsdottir, Unnur; Tikkanen, Emmi; Tranah, Gregory J.; Tuomilehto, Jaakko; Schoor, van Natasja M.; Verma, Arjun; Vollenweider, Peter; Völzke, Henry; Wactawski-Wende, Jean; Walker, Mark; Weedon, Michael N.; Welch, Ryan; Wichman, H.E.; Widen, Elisabeth; Williams, Frances M.K.; Wilson, James F.; Wright, Nicole C.; Xie, Weijia; Yu, Lei; Zhou, Yanhua; Chambers, John C.; Döring, Angela; Duijn, Van Cornelia M.; Econs, Michael J.; Gudnason, Vilmundur; Kooner, Jaspal S.; Psaty, Bruce M.; Spector, Timothy D.; Stefansson, Kari; Rivadeneira, Fernando; Uitterlinden, André G.; Wareham, Nicholas J.; Ossowski, Vicky; Waterworth, Dawn M.; Loos, Ruth J.F.; Karasik, David; Harris, Tamara B.; Ohlsson, Claes; Kiel, Douglas P.

    2017-01-01

    Lean body mass, consisting mostly of skeletal muscle, is important for healthy aging. We performed a genome-wide association study for whole body (20 cohorts of European ancestry with n = 38,292) and appendicular (arms and legs) lean body mass (n = 28,330) measured using dual energy X-ray

  15. Genome-wide association analysis of more than 120,000 individuals identifies 15 new susceptibility loci for breast cancer.

    Science.gov (United States)

    Michailidou, Kyriaki; Beesley, Jonathan; Lindstrom, Sara; Canisius, Sander; Dennis, Joe; Lush, Michael J; Maranian, Mel J; Bolla, Manjeet K; Wang, Qin; Shah, Mitul; Perkins, Barbara J; Czene, Kamila; Eriksson, Mikael; Darabi, Hatef; Brand, Judith S; Bojesen, Stig E; Nordestgaard, Børge G; Flyger, Henrik; Nielsen, Sune F; Rahman, Nazneen; Turnbull, Clare; Fletcher, Olivia; Peto, Julian; Gibson, Lorna; dos-Santos-Silva, Isabel; Chang-Claude, Jenny; Flesch-Janys, Dieter; Rudolph, Anja; Eilber, Ursula; Behrens, Sabine; Nevanlinna, Heli; Muranen, Taru A; Aittomäki, Kristiina; Blomqvist, Carl; Khan, Sofia; Aaltonen, Kirsimari; Ahsan, Habibul; Kibriya, Muhammad G; Whittemore, Alice S; John, Esther M; Malone, Kathleen E; Gammon, Marilie D; Santella, Regina M; Ursin, Giske; Makalic, Enes; Schmidt, Daniel F; Casey, Graham; Hunter, David J; Gapstur, Susan M; Gaudet, Mia M; Diver, W Ryan; Haiman, Christopher A; Schumacher, Fredrick; Henderson, Brian E; Le Marchand, Loic; Berg, Christine D; Chanock, Stephen J; Figueroa, Jonine; Hoover, Robert N; Lambrechts, Diether; Neven, Patrick; Wildiers, Hans; van Limbergen, Erik; Schmidt, Marjanka K; Broeks, Annegien; Verhoef, Senno; Cornelissen, Sten; Couch, Fergus J; Olson, Janet E; Hallberg, Emily; Vachon, Celine; Waisfisz, Quinten; Meijers-Heijboer, Hanne; Adank, Muriel A; van der Luijt, Rob B; Li, Jingmei; Liu, Jianjun; Humphreys, Keith; Kang, Daehee; Choi, Ji-Yeob; Park, Sue K; Yoo, Keun-Young; Matsuo, Keitaro; Ito, Hidemi; Iwata, Hiroji; Tajima, Kazuo; Guénel, Pascal; Truong, Thérèse; Mulot, Claire; Sanchez, Marie; Burwinkel, Barbara; Marme, Frederik; Surowy, Harald; Sohn, Christof; Wu, Anna H; Tseng, Chiu-chen; Van Den Berg, David; Stram, Daniel O; González-Neira, Anna; Benitez, Javier; Zamora, M Pilar; Perez, Jose Ignacio Arias; Shu, Xiao-Ou; Lu, Wei; Gao, Yu-Tang; Cai, Hui; Cox, Angela; Cross, Simon S; Reed, Malcolm W R; Andrulis, Irene L; Knight, Julia A; Glendon, Gord; Mulligan, Anna Marie; Sawyer, Elinor J; Tomlinson, Ian; Kerin, Michael J; Miller, Nicola; Lindblom, Annika; Margolin, Sara; Teo, Soo Hwang; Yip, Cheng Har; Taib, Nur Aishah Mohd; Tan, Gie-Hooi; Hooning, Maartje J; Hollestelle, Antoinette; Martens, John W M; Collée, J Margriet; Blot, William; Signorello, Lisa B; Cai, Qiuyin; Hopper, John L; Southey, Melissa C; Tsimiklis, Helen; Apicella, Carmel; Shen, Chen-Yang; Hsiung, Chia-Ni; Wu, Pei-Ei; Hou, Ming-Feng; Kristensen, Vessela N; Nord, Silje; Alnaes, Grethe I Grenaker; Giles, Graham G; Milne, Roger L; McLean, Catriona; Canzian, Federico; Trichopoulos, Dimitrios; Peeters, Petra; Lund, Eiliv; Sund, Malin; Khaw, Kay-Tee; Gunter, Marc J; Palli, Domenico; Mortensen, Lotte Maxild; Dossus, Laure; Huerta, Jose-Maria; Meindl, Alfons; Schmutzler, Rita K; Sutter, Christian; Yang, Rongxi; Muir, Kenneth; Lophatananon, Artitaya; Stewart-Brown, Sarah; Siriwanarangsan, Pornthep; Hartman, Mikael; Miao, Hui; Chia, Kee Seng; Chan, Ching Wan; Fasching, Peter A; Hein, Alexander; Beckmann, Matthias W; Haeberle, Lothar; Brenner, Hermann; Dieffenbach, Aida Karina; Arndt, Volker; Stegmaier, Christa; Ashworth, Alan; Orr, Nick; Schoemaker, Minouk J; Swerdlow, Anthony J; Brinton, Louise; Garcia-Closas, Montserrat; Zheng, Wei; Halverson, Sandra L; Shrubsole, Martha; Long, Jirong; Goldberg, Mark S; Labrèche, France; Dumont, Martine; Winqvist, Robert; Pylkäs, Katri; Jukkola-Vuorinen, Arja; Grip, Mervi; Brauch, Hiltrud; Hamann, Ute; Brüning, Thomas; Radice, Paolo; Peterlongo, Paolo; Manoukian, Siranoush; Bernard, Loris; Bogdanova, Natalia V; Dörk, Thilo; Mannermaa, Arto; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M; Devilee, Peter; Tollenaar, Robert A E M; Seynaeve, Caroline; Van Asperen, Christi J; Jakubowska, Anna; Lubinski, Jan; Jaworska, Katarzyna; Huzarski, Tomasz; Sangrajrang, Suleeporn; Gaborieau, Valerie; Brennan, Paul; McKay, James; Slager, Susan; Toland, Amanda E; Ambrosone, Christine B; Yannoukakos, Drakoulis; Kabisch, Maria; Torres, Diana; Neuhausen, Susan L; Anton-Culver, Hoda; Luccarini, Craig; Baynes, Caroline; Ahmed, Shahana; Healey, Catherine S; Tessier, Daniel C; Vincent, Daniel; Bacot, Francois; Pita, Guillermo; Alonso, M Rosario; Álvarez, Nuria; Herrero, Daniel; Simard, Jacques; Pharoah, Paul P D P; Kraft, Peter; Dunning, Alison M; Chenevix-Trench, Georgia; Hall, Per; Easton, Douglas F

    2015-04-01

    Genome-wide association studies (GWAS) and large-scale replication studies have identified common variants in 79 loci associated with breast cancer, explaining ∼14% of the familial risk of the disease. To identify new susceptibility loci, we performed a meta-analysis of 11 GWAS, comprising 15,748 breast cancer cases and 18,084 controls together with 46,785 cases and 42,892 controls from 41 studies genotyped on a 211,155-marker custom array (iCOGS). Analyses were restricted to women of European ancestry. We generated genotypes for more than 11 million SNPs by imputation using the 1000 Genomes Project reference panel, and we identified 15 new loci associated with breast cancer at P association analysis with ChIP-seq chromatin binding data in mammary cell lines and ChIA-PET chromatin interaction data from ENCODE, we identified likely target genes in two regions: SETBP1 at 18q12.3 and RNF115 and PDZK1 at 1q21.1. One association appears to be driven by an amino acid substitution encoded in EXO1.

  16. Epidemiological analysis of Salmonella clusters identified by whole genome sequencing, England and Wales 2014.

    Science.gov (United States)

    Waldram, Alison; Dolan, Gayle; Ashton, Philip M; Jenkins, Claire; Dallman, Timothy J

    2018-05-01

    The unprecedented level of bacterial strain discrimination provided by whole genome sequencing (WGS) presents new challenges with respect to the utility and interpretation of the data. Whole genome sequences from 1445 isolates of Salmonella belonging to the most commonly identified serotypes in England and Wales isolated between April and August 2014 were analysed. Single linkage single nucleotide polymorphism thresholds at the 10, 5 and 0 level were explored for evidence of epidemiological links between clustered cases. Analysis of the WGS data organised 566 of the 1445 isolates into 32 clusters of five or more. A statistically significant epidemiological link was identified for 17 clusters. The clusters were associated with foreign travel (n = 8), consumption of Chinese takeaways (n = 4), chicken eaten at home (n = 2), and one each of the following; eating out, contact with another case in the home and contact with reptiles. In the same time frame, one cluster was detected using traditional outbreak detection methods. WGS can be used for the highly specific and highly sensitive detection of biologically related isolates when epidemiological links are obscured. Improvements in the collection of detailed, standardised exposure information would enhance cluster investigations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. QTL-seq approach identified genomic regions and diagnostic markers for rust and late leaf spot resistance in groundnut (Arachis hypogaea L.).

    Science.gov (United States)

    Pandey, Manish K; Khan, Aamir W; Singh, Vikas K; Vishwakarma, Manish K; Shasidhar, Yaduru; Kumar, Vinay; Garg, Vanika; Bhat, Ramesh S; Chitikineni, Annapurna; Janila, Pasupuleti; Guo, Baozhu; Varshney, Rajeev K

    2017-08-01

    Rust and late leaf spot (LLS) are the two major foliar fungal diseases in groundnut, and their co-occurrence leads to significant yield loss in addition to the deterioration of fodder quality. To identify candidate genomic regions controlling resistance to rust and LLS, whole-genome resequencing (WGRS)-based approach referred as 'QTL-seq' was deployed. A total of 231.67 Gb raw and 192.10 Gb of clean sequence data were generated through WGRS of resistant parent and the resistant and susceptible bulks for rust and LLS. Sequence analysis of bulks for rust and LLS with reference-guided resistant parent assembly identified 3136 single-nucleotide polymorphisms (SNPs) for rust and 66 SNPs for LLS with the read depth of ≥7 in the identified genomic region on pseudomolecule A03. Detailed analysis identified 30 nonsynonymous SNPs affecting 25 candidate genes for rust resistance, while 14 intronic and three synonymous SNPs affecting nine candidate genes for LLS resistance. Subsequently, allele-specific diagnostic markers were identified for three SNPs for rust resistance and one SNP for LLS resistance. Genotyping of one RIL population (TAG 24 × GPBD 4) with these four diagnostic markers revealed higher phenotypic variation for these two diseases. These results suggest usefulness of QTL-seq approach in precise and rapid identification of candidate genomic regions and development of diagnostic markers for breeding applications. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  18. The genome of Chenopodium quinoa

    NARCIS (Netherlands)

    Jarvis, D.E.; Shwen Ho, Yung; Lightfoot, Damien J.; Schmöckel, Sandra M.; Li, Bo; Borm, T.J.A.; Ohyanagi, Hajime; Mineta, Katsuhiko; Mitchell, Craig T.; Saber, Noha; Kharbatia, Najeh M.; Rupper, Ryan R.; Sharp, Aaron R.; Dally, Nadine; Boughton, Berin A.; Woo, Yong H.; Gao, Ge; Schijlen, E.G.W.M.; Guo, Xiujie; Momin, Afaque A.; Negräo, Sónia; Al-Babili, Salim; Gehring, Christoph; Roessner, Ute; Jung, Christian; Murphy, Kevin; Arold, Stefan T.; Gojobori, Takashi; Linden, van der C.G.; Loo, van E.N.; Jellen, Eric N.; Maughan, Peter J.; Tester, Mark

    2017-01-01

    Chenopodium quinoa (quinoa) is a highly nutritious grain identified as an important crop to improve world food security. Unfortunately, few resources are available to facilitate its genetic improvement. Here we report the assembly of a high-quality, chromosome-scale reference genome sequence for

  19. Genomes to Proteomes

    Energy Technology Data Exchange (ETDEWEB)

    Panisko, Ellen A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Grigoriev, Igor [USDOE Joint Genome Inst., Walnut Creek, CA (United States); Daly, Don S. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Webb-Robertson, Bobbie-Jo [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Baker, Scott E. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

    2009-03-01

    Biologists are awash with genomic sequence data. In large part, this is due to the rapid acceleration in the generation of DNA sequence that occurred as public and private research institutes raced to sequence the human genome. In parallel with the large human genome effort, mostly smaller genomes of other important model organisms were sequenced. Projects following on these initial efforts have made use of technological advances and the DNA sequencing infrastructure that was built for the human and other organism genome projects. As a result, the genome sequences of many organisms are available in high quality draft form. While in many ways this is good news, there are limitations to the biological insights that can be gleaned from DNA sequences alone; genome sequences offer only a bird's eye view of the biological processes endemic to an organism or community. Fortunately, the genome sequences now being produced at such a high rate can serve as the foundation for other global experimental platforms such as proteomics. Proteomic methods offer a snapshot of the proteins present at a point in time for a given biological sample. Current global proteomics methods combine enzymatic digestion, separations, mass spectrometry and database searching for peptide identification. One key aspect of proteomics is the prediction of peptide sequences from mass spectrometry data. Global proteomic analysis uses computational matching of experimental mass spectra with predicted spectra based on databases of gene models that are often generated computationally. Thus, the quality of gene models predicted from a genome sequence is crucial in the generation of high quality peptide identifications. Once peptides are identified they can be assigned to their parent protein. Proteins identified as expressed in a given experiment are most useful when compared to other expressed proteins in a larger biological context or biochemical pathway. In this chapter we will discuss the automatic

  20. Genome-wide association study of glioma subtypes identifies specific differences in genetic susceptibility to glioblastoma and non-glioblastoma tumors

    DEFF Research Database (Denmark)

    Melin, Beatrice S; Barnholtz-Sloan, Jill S; Wrensch, Margaret R

    2017-01-01

    Genome-wide association studies (GWAS) have transformed our understanding of glioma susceptibility, but individual studies have had limited power to identify risk loci. We performed a meta-analysis of existing GWAS and two new GWAS, which totaled 12,496 cases and 18,190 controls. We identified fi...

  1. Secondary uses and the governance of de-identified data: Lessons from the human genome diversity panel

    Directory of Open Access Journals (Sweden)

    Lee Sandra S-J

    2011-09-01

    Full Text Available Abstract Background Recent changes to regulatory guidance in the US and Europe have complicated oversight of secondary research by rendering most uses of de-identified data exempt from human subjects oversight. To identify the implications of such guidelines for harms to participants and communities, this paper explores the secondary uses of one de-identified DNA sample collection with limited oversight: the Human Genome Diversity Project (HGDP-Centre d'Etude du Polymorphisme Humain, Fondation Jean Dausset (CEPH Human Genome Diversity Panel. Methods Using a combination of keyword and cited reference search, we identified English-language scientific articles published between 2002 and 2009 that reported analysis of HGDP Diversity Panel samples and/or data. We then reviewed each article to identify the specific research use to which the samples and/or data was applied. Secondary uses were categorized according to the type and kind of research supported by the collection. Results A wide variety of secondary uses were identified from 148 peer-reviewed articles. While the vast majority of these uses were consistent with the original intent of the collection, a minority of published reports described research whose primary findings could be regarded as controversial, objectionable, or potentially stigmatizing in their interpretation. Conclusions We conclude that potential risks to participants and communities cannot be wholly eliminated by anonymization of individual data and suggest that explicit review of proposed secondary uses, by a Data Access Committee or similar internal oversight body with suitable stakeholder representation, should be a required component of the trustworthy governance of any repository of data or specimens.

  2. Genome-wide analysis of the WRKY transcription factors in aegilops tauschii.

    Science.gov (United States)

    Ma, Jianhui; Zhang, Daijing; Shao, Yun; Liu, Pei; Jiang, Lina; Li, Chunxi

    2014-01-01

    The WRKY transcription factors (TFs) play important roles in responding to abiotic and biotic stress in plants. However, due to its unfinished genome sequencing, relatively few WRKY TFs with full-length coding sequences (CDSs) have been identified in wheat. Instead, the Aegilops tauschii genome, which is the D-genome progenitor of the hexaploid wheat genome, provides important resources for the discovery of new genes. In this study, we performed a bioinformatics analysis to identify WRKY TFs with full-length CDSs from the A. tauschii genome. A detailed evolutionary analysis for all these TFs was conducted, and quantitative real-time PCR was carried out to investigate the expression patterns of the abiotic stress-related WRKY TFs under different abiotic stress conditions in A. tauschii seedlings. A total of 93 WRKY TFs were identified from A. tauschii, and 79 of them were found to be newly discovered genes compared with wheat. Gene phylogeny, gene structure and chromosome location of the 93 WRKY TFs were fully analyzed. These studies provide a global view of the WRKY TFs from A. tauschii and a firm foundation for further investigations in both A. tauschii and wheat. © 2015 S. Karger AG, Basel.

  3. Genome-wide association study identifies variants in HORMAD2 associated with tonsillectomy

    DEFF Research Database (Denmark)

    Feenstra, Bjarke; Bager, Peter; Liu, Xueping

    2017-01-01

    BACKGROUND: Inflammation of the tonsils is a normal response to infection, but some individuals experience recurrent, severe tonsillitis and massive hypertrophy of the tonsils in which case surgical removal of the tonsils may be considered. OBJECTIVE: To identify common genetic variants associate...... the molecular mechanisms underlying the genetic association involve general lymphoid hyper-reaction throughout the mucosa-associated lymphoid tissue system.......BACKGROUND: Inflammation of the tonsils is a normal response to infection, but some individuals experience recurrent, severe tonsillitis and massive hypertrophy of the tonsils in which case surgical removal of the tonsils may be considered. OBJECTIVE: To identify common genetic variants associated...... with tonsillectomy. METHODS: We used tonsillectomy information from Danish health registers and carried out a genome-wide association study comprising 1464 patients and 12 019 controls of Northwestern European ancestry, with replication in an independent sample set of 1575 patients and 1367 controls. RESULTS...

  4. Five Complete Chloroplast Genome Sequences from Diospyros: Genome Organization and Comparative Analysis.

    Science.gov (United States)

    Fu, Jianmin; Liu, Huimin; Hu, Jingjing; Liang, Yuqin; Liang, Jinjun; Wuyun, Tana; Tan, Xiaofeng

    2016-01-01

    Diospyros is the largest genus in Ebenaceae, comprising more than 500 species with remarkable economic value, especially Diospyros kaki Thunb., which has traditionally been an important food resource in China, Korea, and Japan. Complete chloroplast (cp) genomes from D. kaki, D. lotus L., D. oleifera Cheng., D. glaucifolia Metc., and Diospyros 'Jinzaoshi' were sequenced using Illumina sequencing technology. This is the first cp genome reported in Ebenaceae. The cp genome sequences of Diospyros ranged from 157,300 to 157,784 bp in length, presenting a typical quadripartite structure with two inverted repeats each separated by one large and one small single-copy region. For each cp genome, 134 genes were annotated, including 80 protein-coding, 31 tRNA, and 4 rRNA unique genes. In all, 179 repeats and 283 single sequence repeats were identified. Four hypervariable regions, namely, intergenic region of trnQ_rps16, trnV_ndhC, and psbD_trnT, and intron of ndhA, were identified in the Diospyros genomes. Phylogenetic analyses based on the whole cp genome, protein-coding, and intergenic and intron sequences indicated that D. oleifera is closely related to D. kaki and could be used as a model plant for future research on D. kaki; to our knowledge, this is proposed for the first time. Further, these analyses together with two large deletions (301 and 140 bp) in the cp genome of D. 'Jinzaoshi', support its placement as a new species in Diospyros. Both maximum parsimony and likelihood analyses for 19 taxa indicated the basal position of Ericales in asterids and suggested that Ebenaceae is monophyletic in Ericales.

  5. Five Complete Chloroplast Genome Sequences from Diospyros: Genome Organization and Comparative Analysis.

    Directory of Open Access Journals (Sweden)

    Jianmin Fu

    Full Text Available Diospyros is the largest genus in Ebenaceae, comprising more than 500 species with remarkable economic value, especially Diospyros kaki Thunb., which has traditionally been an important food resource in China, Korea, and Japan. Complete chloroplast (cp genomes from D. kaki, D. lotus L., D. oleifera Cheng., D. glaucifolia Metc., and Diospyros 'Jinzaoshi' were sequenced using Illumina sequencing technology. This is the first cp genome reported in Ebenaceae. The cp genome sequences of Diospyros ranged from 157,300 to 157,784 bp in length, presenting a typical quadripartite structure with two inverted repeats each separated by one large and one small single-copy region. For each cp genome, 134 genes were annotated, including 80 protein-coding, 31 tRNA, and 4 rRNA unique genes. In all, 179 repeats and 283 single sequence repeats were identified. Four hypervariable regions, namely, intergenic region of trnQ_rps16, trnV_ndhC, and psbD_trnT, and intron of ndhA, were identified in the Diospyros genomes. Phylogenetic analyses based on the whole cp genome, protein-coding, and intergenic and intron sequences indicated that D. oleifera is closely related to D. kaki and could be used as a model plant for future research on D. kaki; to our knowledge, this is proposed for the first time. Further, these analyses together with two large deletions (301 and 140 bp in the cp genome of D. 'Jinzaoshi', support its placement as a new species in Diospyros. Both maximum parsimony and likelihood analyses for 19 taxa indicated the basal position of Ericales in asterids and suggested that Ebenaceae is monophyletic in Ericales.

  6. An initial comparative map of copy number variations in the goat (Capra hircus genome

    Directory of Open Access Journals (Sweden)

    Casadio Rita

    2010-11-01

    Full Text Available Abstract Background The goat (Capra hircus represents one of the most important farm animal species. It is reared in all continents with an estimated world population of about 800 million of animals. Despite its importance, studies on the goat genome are still in their infancy compared to those in other farm animal species. Comparative mapping between cattle and goat showed only a few rearrangements in agreement with the similarity of chromosome banding. We carried out a cross species cattle-goat array comparative genome hybridization (aCGH experiment in order to identify copy number variations (CNVs in the goat genome analysing animals of different breeds (Saanen, Camosciata delle Alpi, Girgentana, and Murciano-Granadina using a tiling oligonucleotide array with ~385,000 probes designed on the bovine genome. Results We identified a total of 161 CNVs (an average of 17.9 CNVs per goat, with the largest number in the Saanen breed and the lowest in the Camosciata delle Alpi goat. By aggregating overlapping CNVs identified in different animals we determined CNV regions (CNVRs: on the whole, we identified 127 CNVRs covering about 11.47 Mb of the virtual goat genome referred to the bovine genome (0.435% of the latter genome. These 127 CNVRs included 86 loss and 41 gain and ranged from about 24 kb to about 1.07 Mb with a mean and median equal to 90,292 bp and 49,530 bp, respectively. To evaluate whether the identified goat CNVRs overlap with those reported in the cattle genome, we compared our results with those obtained in four independent cattle experiments. Overlapping between goat and cattle CNVRs was highly significant (P Conclusions We describe a first map of goat CNVRs. This provides information on a comparative basis with the cattle genome by identifying putative recurrent interspecies CNVs between these two ruminant species. Several goat CNVs affect genes with important biological functions. Further studies are needed to evaluate the

  7. Genome-wide association studies in the Japanese population identify seven novel loci for type 2 diabetes

    DEFF Research Database (Denmark)

    Imamura, Minako; Takahashi, Atsushi; Yamauchi, Toshimasa

    2016-01-01

    Genome-wide association studies (GWAS) have identified more than 80 susceptibility loci for type 2 diabetes (T2D), but most of its heritability still remains to be elucidated. In this study, we conducted a meta-analysis of GWAS for T2D in the Japanese population. Combined data from discovery and ...

  8. Full-length genome sequences of porcine epidemic diarrhoea virus strain CV777; Use of NGS to analyse genomic and sub-genomic RNAs

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Boniotti, Maria Beatrice; Papetti, Alice

    2018-01-01

    Porcine epidemic diarrhoea virus, strain CV777, was initially characterized in 1978 as the causative agent of a disease first identified in the UK in 1971. This coronavirus has been widely distributed among laboratories and has been passaged both within pigs and in cell culture. To determine...... the variability between different stocks of the PEDV strain CV777, sequencing of the full-length genome (ca. 28kb) has been performed in 6 different laboratories, using different protocols. Not surprisingly, each of the different full genome sequences were distinct from each other and from the reference sequence...... the analysis of sub-genomic mRNAs from infected cells. It is clearly important to know the features of the specific sample of CV777 being used for experimental studies....

  9. The draft genome of watermelon (Citrullus lanatus) and resequencing of 20 diverse accessions.

    Science.gov (United States)

    Guo, Shaogui; Zhang, Jianguo; Sun, Honghe; Salse, Jerome; Lucas, William J; Zhang, Haiying; Zheng, Yi; Mao, Linyong; Ren, Yi; Wang, Zhiwen; Min, Jiumeng; Guo, Xiaosen; Murat, Florent; Ham, Byung-Kook; Zhang, Zhaoliang; Gao, Shan; Huang, Mingyun; Xu, Yimin; Zhong, Silin; Bombarely, Aureliano; Mueller, Lukas A; Zhao, Hong; He, Hongju; Zhang, Yan; Zhang, Zhonghua; Huang, Sanwen; Tan, Tao; Pang, Erli; Lin, Kui; Hu, Qun; Kuang, Hanhui; Ni, Peixiang; Wang, Bo; Liu, Jingan; Kou, Qinghe; Hou, Wenju; Zou, Xiaohua; Jiang, Jiao; Gong, Guoyi; Klee, Kathrin; Schoof, Heiko; Huang, Ying; Hu, Xuesong; Dong, Shanshan; Liang, Dequan; Wang, Juan; Wu, Kui; Xia, Yang; Zhao, Xiang; Zheng, Zequn; Xing, Miao; Liang, Xinming; Huang, Bangqing; Lv, Tian; Wang, Junyi; Yin, Ye; Yi, Hongping; Li, Ruiqiang; Wu, Mingzhu; Levi, Amnon; Zhang, Xingping; Giovannoni, James J; Wang, Jun; Li, Yunfu; Fei, Zhangjun; Xu, Yong

    2013-01-01

    Watermelon, Citrullus lanatus, is an important cucurbit crop grown throughout the world. Here we report a high-quality draft genome sequence of the east Asia watermelon cultivar 97103 (2n = 2× = 22) containing 23,440 predicted protein-coding genes. Comparative genomics analysis provided an evolutionary scenario for the origin of the 11 watermelon chromosomes derived from a 7-chromosome paleohexaploid eudicot ancestor. Resequencing of 20 watermelon accessions representing three different C. lanatus subspecies produced numerous haplotypes and identified the extent of genetic diversity and population structure of watermelon germplasm. Genomic regions that were preferentially selected during domestication were identified. Many disease-resistance genes were also found to be lost during domestication. In addition, integrative genomic and transcriptomic analyses yielded important insights into aspects of phloem-based vascular signaling in common between watermelon and cucumber and identified genes crucial to valuable fruit-quality traits, including sugar accumulation and citrulline metabolism.

  10. Genome-wide association study identifies four loci associated with eruption of permanent teeth

    DEFF Research Database (Denmark)

    Geller, Frank; Feenstra, Bjarke; Zhang, Hao

    2011-01-01

    The sequence and timing of permanent tooth eruption is thought to be highly heritable and can have important implications for the risk of malocclusion, crowding, and periodontal disease. We conducted a genome-wide association study of number of permanent teeth erupted between age 6 and 14 years......, analyzed as age-adjusted standard deviation score averaged over multiple time points, based on childhood records for 5,104 women from the Danish National Birth Cohort. Four loci showed association at P...

  11. Identifying neuropeptide and protein hormone receptors in Drosophila melanogaster by exploiting genomic data

    DEFF Research Database (Denmark)

    Hauser, Frank; Williamson, Michael; Cazzamali, Giuseppe

    2006-01-01

    insect genome, that of the fruitfly Drosophila melanogaster, was sequenced in 2000, and about 200 GPCRs have been annnotated in this model insect. About 50 of these receptors were predicted to have neuropeptides or protein hormones as their ligands. Since 2000, the cDNAs of most of these candidate...... receptors have been cloned and for many receptors the endogenous ligand has been identified. In this review, we will give an update about the current knowledge of all Drosophila neuropeptide and protein hormone receptors, and discuss their phylogenetic relationships. Udgivelsesdato: 2006-Feb...

  12. A human genome-wide loss-of-function screen identifies effective chikungunya antiviral drugs.

    Science.gov (United States)

    Karlas, Alexander; Berre, Stefano; Couderc, Thérèse; Varjak, Margus; Braun, Peter; Meyer, Michael; Gangneux, Nicolas; Karo-Astover, Liis; Weege, Friderike; Raftery, Martin; Schönrich, Günther; Klemm, Uwe; Wurzlbauer, Anne; Bracher, Franz; Merits, Andres; Meyer, Thomas F; Lecuit, Marc

    2016-05-12

    Chikungunya virus (CHIKV) is a globally spreading alphavirus against which there is no commercially available vaccine or therapy. Here we use a genome-wide siRNA screen to identify 156 proviral and 41 antiviral host factors affecting CHIKV replication. We analyse the cellular pathways in which human proviral genes are involved and identify druggable targets. Twenty-one small-molecule inhibitors, some of which are FDA approved, targeting six proviral factors or pathways, have high antiviral activity in vitro, with low toxicity. Three identified inhibitors have prophylactic antiviral effects in mouse models of chikungunya infection. Two of them, the calmodulin inhibitor pimozide and the fatty acid synthesis inhibitor TOFA, have a therapeutic effect in vivo when combined. These results demonstrate the value of loss-of-function screening and pathway analysis for the rational identification of small molecules with therapeutic potential and pave the way for the development of new, host-directed, antiviral agents.

  13. The Whole Genome Assembly and Comparative Genomic Research of Thellungiella parvula (Extremophile Crucifer Mitochondrion

    Directory of Open Access Journals (Sweden)

    Xuelin Wang

    2016-01-01

    Full Text Available The complete nucleotide sequences of the mitochondrial (mt genome of an extremophile species Thellungiella parvula (T. parvula have been determined with the lengths of 255,773 bp. T. parvula mt genome is a circular sequence and contains 32 protein-coding genes, 19 tRNA genes, and three ribosomal RNA genes with a 11.5% coding sequence. The base composition of 27.5% A, 27.5% T, 22.7% C, and 22.3% G in descending order shows a slight bias of 55% AT. Fifty-three repeats were identified in the mitochondrial genome of T. parvula, including 24 direct repeats, 28 tandem repeats (TRs, and one palindromic repeat. Furthermore, a total of 199 perfect microsatellites have been mined with a high A/T content (83.1% through simple sequence repeat (SSR analysis and they were distributed unevenly within this mitochondrial genome. We also analyzed other plant mitochondrial genomes’ evolution in general, providing clues for the understanding of the evolution of organelles genomes in plants. Comparing with other Brassicaceae species, T. parvula is related to Arabidopsis thaliana whose characters of low temperature resistance have been well documented. This study will provide important genetic tools for other Brassicaceae species research and improve yields of economically important plants.

  14. Enriched pathways for major depressive disorder identified from a genome-wide association study.

    Science.gov (United States)

    Kao, Chung-Feng; Jia, Peilin; Zhao, Zhongming; Kuo, Po-Hsiu

    2012-11-01

    Major depressive disorder (MDD) has caused a substantial burden of disease worldwide with moderate heritability. Despite efforts through conducting numerous association studies and now, genome-wide association (GWA) studies, the success of identifying susceptibility loci for MDD has been limited, which is partially attributed to the complex nature of depression pathogenesis. A pathway-based analytic strategy to investigate the joint effects of various genes within specific biological pathways has emerged as a powerful tool for complex traits. The present study aimed to identify enriched pathways for depression using a GWA dataset for MDD. For each gene, we estimated its gene-wise p value using combined and minimum p value, separately. Canonical pathways from the Kyoto Encyclopedia of Genes and Genomes (KEGG) and BioCarta were used. We employed four pathway-based analytic approaches (gene set enrichment analysis, hypergeometric test, sum-square statistic, sum-statistic). We adjusted for multiple testing using Benjamini & Hochberg's method to report significant pathways. We found 17 significantly enriched pathways for depression, which presented low-to-intermediate crosstalk. The top four pathways were long-term depression (p⩽1×10-5), calcium signalling (p⩽6×10-5), arrhythmogenic right ventricular cardiomyopathy (p⩽1.6×10-4) and cell adhesion molecules (p⩽2.2×10-4). In conclusion, our comprehensive pathway analyses identified promising pathways for depression that are related to neurotransmitter and neuronal systems, immune system and inflammatory response, which may be involved in the pathophysiological mechanisms underlying depression. We demonstrated that pathway enrichment analysis is promising to facilitate our understanding of complex traits through a deeper interpretation of GWA data. Application of this comprehensive analytic strategy in upcoming GWA data for depression could validate the findings reported in this study.

  15. A database of phylogenetically atypical genes in archaeal and bacterial genomes, identified using the DarkHorse algorithm

    Directory of Open Access Journals (Sweden)

    Allen Eric E

    2008-10-01

    Full Text Available Abstract Background The process of horizontal gene transfer (HGT is believed to be widespread in Bacteria and Archaea, but little comparative data is available addressing its occurrence in complete microbial genomes. Collection of high-quality, automated HGT prediction data based on phylogenetic evidence has previously been impractical for large numbers of genomes at once, due to prohibitive computational demands. DarkHorse, a recently described statistical method for discovering phylogenetically atypical genes on a genome-wide basis, provides a means to solve this problem through lineage probability index (LPI ranking scores. LPI scores inversely reflect phylogenetic distance between a test amino acid sequence and its closest available database matches. Proteins with low LPI scores are good horizontal gene transfer candidates; those with high scores are not. Description The DarkHorse algorithm has been applied to 955 microbial genome sequences, and the results organized into a web-searchable relational database, called the DarkHorse HGT Candidate Resource http://darkhorse.ucsd.edu. Users can select individual genomes or groups of genomes to screen by LPI score, search for protein functions by descriptive annotation or amino acid sequence similarity, or select proteins with unusual G+C composition in their underlying coding sequences. The search engine reports LPI scores for match partners as well as query sequences, providing the opportunity to explore whether potential HGT donor sequences are phylogenetically typical or atypical within their own genomes. This information can be used to predict whether or not sufficient information is available to build a well-supported phylogenetic tree using the potential donor sequence. Conclusion The DarkHorse HGT Candidate database provides a powerful, flexible set of tools for identifying phylogenetically atypical proteins, allowing researchers to explore both individual HGT events in single genomes, and

  16. Genome-wide methylation analysis identifies a core set of hypermethylated genes in CIMP-H colorectal cancer.

    Science.gov (United States)

    McInnes, Tyler; Zou, Donghui; Rao, Dasari S; Munro, Francesca M; Phillips, Vicky L; McCall, John L; Black, Michael A; Reeve, Anthony E; Guilford, Parry J

    2017-03-28

    Aberrant DNA methylation profiles are a characteristic of all known cancer types, epitomized by the CpG island methylator phenotype (CIMP) in colorectal cancer (CRC). Hypermethylation has been observed at CpG islands throughout the genome, but it is unclear which factors determine whether an individual island becomes methylated in cancer. DNA methylation in CRC was analysed using the Illumina HumanMethylation450K array. Differentially methylated loci were identified using Significance Analysis of Microarrays (SAM) and the Wilcoxon Signed Rank (WSR) test. Unsupervised hierarchical clustering was used to identify methylation subtypes in CRC. In this study we characterized the DNA methylation profiles of 94 CRC tissues and their matched normal counterparts. Consistent with previous studies, unsupervized hierarchical clustering of genome-wide methylation data identified three subtypes within the tumour samples, designated CIMP-H, CIMP-L and CIMP-N, that showed high, low and very low methylation levels, respectively. Differential methylation between normal and tumour samples was analysed at the individual CpG level, and at the gene level. The distribution of hypermethylation in CIMP-N tumours showed high inter-tumour variability and appeared to be highly stochastic in nature, whereas CIMP-H tumours exhibited consistent hypermethylation at a subset of genes, in addition to a highly variable background of hypermethylated genes. EYA4, TFPI2 and TLX1 were hypermethylated in more than 90% of all tumours examined. One-hundred thirty-two genes were hypermethylated in 100% of CIMP-H tumours studied and these were highly enriched for functions relating to skeletal system development (Bonferroni adjusted p value =2.88E-15), segment specification (adjusted p value =9.62E-11), embryonic development (adjusted p value =1.52E-04), mesoderm development (adjusted p value =1.14E-20), and ectoderm development (adjusted p value =7.94E-16). Our genome-wide characterization of DNA

  17. FR-like EBNA1 binding repeats in the human genome

    International Nuclear Information System (INIS)

    D'Herouel, Aymeric Fouquier; Birgersdotter, Anna; Werner, Maria

    2010-01-01

    Epstein-Barr virus (EBV) is widely spread in the human population. EBV nuclear antigen 1 (EBNA1) is a transcription factor that activates viral genes and is necessary for viral replication and partitioning, which binds the EBV genome cooperatively. We identify similar EBNA1 repeat binding sites in the human genome using a nearest-neighbor positional weight matrix. Previously experimentally verified EBNA1 sites in the human genome are successfully recovered by our approach. Most importantly, 40 novel regions are identified in the human genome, constituted of tandemly repeated binding sites for EBNA1. Genes located in the vicinity of these regions are presented as possible targets for EBNA1-mediated regulation. Among these, four are discussed in more detail: IQCB1, IMPG1, IRF2BP2 and TPO. Incorporating the cooperative actions of EBNA1 is essential when identifying regulatory regions in the human genome and we believe the findings presented here are highly valuable for the understanding of EBV-induced phenotypic changes.

  18. Genome-wide association analyses identify 44 risk variants and refine the genetic architecture of major depression.

    Science.gov (United States)

    Wray, Naomi R; Ripke, Stephan; Mattheisen, Manuel; Trzaskowski, Maciej; Byrne, Enda M; Abdellaoui, Abdel; Adams, Mark J; Agerbo, Esben; Air, Tracy M; Andlauer, Till M F; Bacanu, Silviu-Alin; Bækvad-Hansen, Marie; Beekman, Aartjan F T; Bigdeli, Tim B; Binder, Elisabeth B; Blackwood, Douglas R H; Bryois, Julien; Buttenschøn, Henriette N; Bybjerg-Grauholm, Jonas; Cai, Na; Castelao, Enrique; Christensen, Jane Hvarregaard; Clarke, Toni-Kim; Coleman, Jonathan I R; Colodro-Conde, Lucía; Couvy-Duchesne, Baptiste; Craddock, Nick; Crawford, Gregory E; Crowley, Cheynna A; Dashti, Hassan S; Davies, Gail; Deary, Ian J; Degenhardt, Franziska; Derks, Eske M; Direk, Nese; Dolan, Conor V; Dunn, Erin C; Eley, Thalia C; Eriksson, Nicholas; Escott-Price, Valentina; Kiadeh, Farnush Hassan Farhadi; Finucane, Hilary K; Forstner, Andreas J; Frank, Josef; Gaspar, Héléna A; Gill, Michael; Giusti-Rodríguez, Paola; Goes, Fernando S; Gordon, Scott D; Grove, Jakob; Hall, Lynsey S; Hannon, Eilis; Hansen, Christine Søholm; Hansen, Thomas F; Herms, Stefan; Hickie, Ian B; Hoffmann, Per; Homuth, Georg; Horn, Carsten; Hottenga, Jouke-Jan; Hougaard, David M; Hu, Ming; Hyde, Craig L; Ising, Marcus; Jansen, Rick; Jin, Fulai; Jorgenson, Eric; Knowles, James A; Kohane, Isaac S; Kraft, Julia; Kretzschmar, Warren W; Krogh, Jesper; Kutalik, Zoltán; Lane, Jacqueline M; Li, Yihan; Li, Yun; Lind, Penelope A; Liu, Xiaoxiao; Lu, Leina; MacIntyre, Donald J; MacKinnon, Dean F; Maier, Robert M; Maier, Wolfgang; Marchini, Jonathan; Mbarek, Hamdi; McGrath, Patrick; McGuffin, Peter; Medland, Sarah E; Mehta, Divya; Middeldorp, Christel M; Mihailov, Evelin; Milaneschi, Yuri; Milani, Lili; Mill, Jonathan; Mondimore, Francis M; Montgomery, Grant W; Mostafavi, Sara; Mullins, Niamh; Nauck, Matthias; Ng, Bernard; Nivard, Michel G; Nyholt, Dale R; O'Reilly, Paul F; Oskarsson, Hogni; Owen, Michael J; Painter, Jodie N; Pedersen, Carsten Bøcker; Pedersen, Marianne Giørtz; Peterson, Roseann E; Pettersson, Erik; Peyrot, Wouter J; Pistis, Giorgio; Posthuma, Danielle; Purcell, Shaun M; Quiroz, Jorge A; Qvist, Per; Rice, John P; Riley, Brien P; Rivera, Margarita; Saeed Mirza, Saira; Saxena, Richa; Schoevers, Robert; Schulte, Eva C; Shen, Ling; Shi, Jianxin; Shyn, Stanley I; Sigurdsson, Engilbert; Sinnamon, Grant B C; Smit, Johannes H; Smith, Daniel J; Stefansson, Hreinn; Steinberg, Stacy; Stockmeier, Craig A; Streit, Fabian; Strohmaier, Jana; Tansey, Katherine E; Teismann, Henning; Teumer, Alexander; Thompson, Wesley; Thomson, Pippa A; Thorgeirsson, Thorgeir E; Tian, Chao; Traylor, Matthew; Treutlein, Jens; Trubetskoy, Vassily; Uitterlinden, André G; Umbricht, Daniel; Van der Auwera, Sandra; van Hemert, Albert M; Viktorin, Alexander; Visscher, Peter M; Wang, Yunpeng; Webb, Bradley T; Weinsheimer, Shantel Marie; Wellmann, Jürgen; Willemsen, Gonneke; Witt, Stephanie H; Wu, Yang; Xi, Hualin S; Yang, Jian; Zhang, Futao; Arolt, Volker; Baune, Bernhard T; Berger, Klaus; Boomsma, Dorret I; Cichon, Sven; Dannlowski, Udo; de Geus, E C J; DePaulo, J Raymond; Domenici, Enrico; Domschke, Katharina; Esko, Tõnu; Grabe, Hans J; Hamilton, Steven P; Hayward, Caroline; Heath, Andrew C; Hinds, David A; Kendler, Kenneth S; Kloiber, Stefan; Lewis, Glyn; Li, Qingqin S; Lucae, Susanne; Madden, Pamela F A; Magnusson, Patrik K; Martin, Nicholas G; McIntosh, Andrew M; Metspalu, Andres; Mors, Ole; Mortensen, Preben Bo; Müller-Myhsok, Bertram; Nordentoft, Merete; Nöthen, Markus M; O'Donovan, Michael C; Paciga, Sara A; Pedersen, Nancy L; Penninx, Brenda W J H; Perlis, Roy H; Porteous, David J; Potash, James B; Preisig, Martin; Rietschel, Marcella; Schaefer, Catherine; Schulze, Thomas G; Smoller, Jordan W; Stefansson, Kari; Tiemeier, Henning; Uher, Rudolf; Völzke, Henry; Weissman, Myrna M; Werge, Thomas; Winslow, Ashley R; Lewis, Cathryn M; Levinson, Douglas F; Breen, Gerome; Børglum, Anders D; Sullivan, Patrick F

    2018-05-01

    Major depressive disorder (MDD) is a common illness accompanied by considerable morbidity, mortality, costs, and heightened risk of suicide. We conducted a genome-wide association meta-analysis based in 135,458 cases and 344,901 controls and identified 44 independent and significant loci. The genetic findings were associated with clinical features of major depression and implicated brain regions exhibiting anatomical differences in cases. Targets of antidepressant medications and genes involved in gene splicing were enriched for smaller association signal. We found important relationships of genetic risk for major depression with educational attainment, body mass, and schizophrenia: lower educational attainment and higher body mass were putatively causal, whereas major depression and schizophrenia reflected a partly shared biological etiology. All humans carry lesser or greater numbers of genetic risk factors for major depression. These findings help refine the basis of major depression and imply that a continuous measure of risk underlies the clinical phenotype.

  19. Novel candidate genes and regions for childhood apraxia of speech identified by array comparative genomic hybridization.

    Science.gov (United States)

    Laffin, Jennifer J S; Raca, Gordana; Jackson, Craig A; Strand, Edythe A; Jakielski, Kathy J; Shriberg, Lawrence D

    2012-11-01

    The goal of this study was to identify new candidate genes and genomic copy-number variations associated with a rare, severe, and persistent speech disorder termed childhood apraxia of speech. Childhood apraxia of speech is the speech disorder segregating with a mutation in FOXP2 in a multigenerational London pedigree widely studied for its role in the development of speech-language in humans. A total of 24 participants who were suspected to have childhood apraxia of speech were assessed using a comprehensive protocol that samples speech in challenging contexts. All participants met clinical-research criteria for childhood apraxia of speech. Array comparative genomic hybridization analyses were completed using a customized 385K Nimblegen array (Roche Nimblegen, Madison, WI) with increased coverage of genes and regions previously associated with childhood apraxia of speech. A total of 16 copy-number variations with potential consequences for speech-language development were detected in 12 or half of the 24 participants. The copy-number variations occurred on 10 chromosomes, 3 of which had two to four candidate regions. Several participants were identified with copy-number variations in two to three regions. In addition, one participant had a heterozygous FOXP2 mutation and a copy-number variation on chromosome 2, and one participant had a 16p11.2 microdeletion and copy-number variations on chromosomes 13 and 14. Findings support the likelihood of heterogeneous genomic pathways associated with childhood apraxia of speech.

  20. Coevolution analysis of Hepatitis C virus genome to identify the structural and functional dependency network of viral proteins

    Science.gov (United States)

    Champeimont, Raphaël; Laine, Elodie; Hu, Shuang-Wei; Penin, Francois; Carbone, Alessandra

    2016-05-01

    A novel computational approach of coevolution analysis allowed us to reconstruct the protein-protein interaction network of the Hepatitis C Virus (HCV) at the residue resolution. For the first time, coevolution analysis of an entire viral genome was realized, based on a limited set of protein sequences with high sequence identity within genotypes. The identified coevolving residues constitute highly relevant predictions of protein-protein interactions for further experimental identification of HCV protein complexes. The method can be used to analyse other viral genomes and to predict the associated protein interaction networks.

  1. Utility of sequenced genomes for microsatellite marker development in non-model organisms: a case study of functionally important genes in nine-spined sticklebacks (Pungitius pungitius

    Directory of Open Access Journals (Sweden)

    Shimada Yukinori

    2010-05-01

    Full Text Available Abstract Background Identification of genes involved in adaptation and speciation by targeting specific genes of interest has become a plausible strategy also for non-model organisms. We investigated the potential utility of available sequenced fish genomes to develop microsatellite (cf. simple sequence repeat, SSR markers for functionally important genes in nine-spined sticklebacks (Pungitius pungitius, as well as cross-species transferability of SSR primers from three-spined (Gasterosteus aculeatus to nine-spined sticklebacks. In addition, we examined the patterns and degree of SSR conservation between these species using their aligned sequences. Results Cross-species amplification success was lower for SSR markers located in or around functionally important genes (27 out of 158 than for those randomly derived from genomic (35 out of 101 and cDNA (35 out of 87 libraries. Polymorphism was observed at a large proportion (65% of the cross-amplified loci independently of SSR type. To develop SSR markers for functionally important genes in nine-spined sticklebacks, SSR locations were surveyed in or around 67 target genes based on the three-spined stickleback genome and these regions were sequenced with primers designed from conserved sequences in sequenced fish genomes. Out of the 81 SSRs identified in the sequenced regions (44,084 bp, 57 exhibited the same motifs at the same locations as in the three-spined stickleback. Di- and trinucleotide SSRs appeared to be highly conserved whereas mononucleotide SSRs were less so. Species-specific primers were designed to amplify 58 SSRs using the sequences of nine-spined sticklebacks. Conclusions Our results demonstrated that a large proportion of SSRs are conserved in the species that have diverged more than 10 million years ago. Therefore, the three-spined stickleback genome can be used to predict SSR locations in the nine-spined stickleback genome. While cross-species utility of SSR primers is limited due

  2. Genome-wide meta-analysis identifies novel determinants of circulating serum progranulin.

    Science.gov (United States)

    Tönjes, Anke; Scholz, Markus; Krüger, Jacqueline; Krause, Kerstin; Schleinitz, Dorit; Kirsten, Holger; Gebhardt, Claudia; Marzi, Carola; Grallert, Harald; Ladenvall, Claes; Heyne, Henrike; Laurila, Esa; Kriebel, Jennifer; Meisinger, Christa; Rathmann, Wolfgang; Gieger, Christian; Groop, Leif; Prokopenko, Inga; Isomaa, Bo; Beutner, Frank; Kratzsch, Jürgen; Fischer-Rosinsky, Antje; Pfeiffer, Andreas; Krohn, Knut; Spranger, Joachim; Thiery, Joachim; Blüher, Matthias; Stumvoll, Michael; Kovacs, Peter

    2018-02-01

    Progranulin is a secreted protein with important functions in processes including immune and inflammatory response, metabolism and embryonic development. The present study aimed at identification of genetic factors determining progranulin concentrations. We conducted a genome-wide association meta-analysis for serum progranulin in three independent cohorts from Europe: Sorbs (N = 848) and KORA (N = 1628) from Germany and PPP-Botnia (N = 335) from Finland (total N = 2811). Single nucleotide polymorphisms (SNPs) associated with progranulin levels were replicated in two additional German cohorts: LIFE-Heart Study (Leipzig; N = 967) and Metabolic Syndrome Berlin Potsdam (Berlin cohort; N = 833). We measured mRNA expression of genes in peripheral blood mononuclear cells (PBMC) by micro-arrays and performed mRNA expression quantitative trait and expression-progranulin association studies to functionally substantiate identified loci. Finally, we conducted siRNA silencing experiments in vitro to validate potential candidate genes within the associated loci. Heritability of circulating progranulin levels was estimated at 31.8% and 26.1% in the Sorbs and LIFE-Heart cohort, respectively. SNPs at three loci reached study-wide significance (rs660240 in CELSR2-PSRC1-MYBPHL-SORT1, rs4747197 in CDH23-PSAP and rs5848 in GRN) explaining 19.4%/15.0% of the variance and 61%/57% of total heritability in the Sorbs/LIFE-Heart Study. The strongest evidence for association was at rs660240 (P = 5.75 × 10-50), which was also associated with mRNA expression of PSRC1 in PBMC (P = 1.51 × 10-21). Psrc1 knockdown in murine preadipocytes led to a consecutive 30% reduction in progranulin secretion. In conclusion, the present meta-GWAS combined with mRNA expression identified three loci associated with progranulin and supports the role of PSRC1 in the regulation of progranulin secretion. © The Author(s) 2017. Published by Oxford University Press. All rights

  3. RNA-Seq analysis and annotation of a draft blueberry genome assembly identifies candidate genes involved in fruit ripening, biosynthesis of bioactive compounds, and stage-specific alternative splicing.

    Science.gov (United States)

    Gupta, Vikas; Estrada, April D; Blakley, Ivory; Reid, Rob; Patel, Ketan; Meyer, Mason D; Andersen, Stig Uggerhøj; Brown, Allan F; Lila, Mary Ann; Loraine, Ann E

    2015-01-01

    Blueberries are a rich source of antioxidants and other beneficial compounds that can protect against disease. Identifying genes involved in synthesis of bioactive compounds could enable the breeding of berry varieties with enhanced health benefits. Toward this end, we annotated a previously sequenced draft blueberry genome assembly using RNA-Seq data from five stages of berry fruit development and ripening. Genome-guided assembly of RNA-Seq read alignments combined with output from ab initio gene finders produced around 60,000 gene models, of which more than half were similar to proteins from other species, typically the grape Vitis vinifera. Comparison of gene models to the PlantCyc database of metabolic pathway enzymes identified candidate genes involved in synthesis of bioactive compounds, including bixin, an apocarotenoid with potential disease-fighting properties, and defense-related cyanogenic glycosides, which are toxic. Cyanogenic glycoside (CG) biosynthetic enzymes were highly expressed in green fruit, and a candidate CG detoxification enzyme was up-regulated during fruit ripening. Candidate genes for ethylene, anthocyanin, and 400 other biosynthetic pathways were also identified. Homology-based annotation using Blast2GO and InterPro assigned Gene Ontology terms to around 15,000 genes. RNA-Seq expression profiling showed that blueberry growth, maturation, and ripening involve dynamic gene expression changes, including coordinated up- and down-regulation of metabolic pathway enzymes and transcriptional regulators. Analysis of RNA-seq alignments identified developmentally regulated alternative splicing, promoter use, and 3' end formation. We report genome sequence, gene models, functional annotations, and RNA-Seq expression data that provide an important new resource enabling high throughput studies in blueberry.

  4. A highly redundant BAC library of Atlantic salmon (Salmo salar: an important tool for salmon projects

    Directory of Open Access Journals (Sweden)

    Koop Ben F

    2005-04-01

    Full Text Available Abstract Background As farming of Atlantic salmon is growing as an aquaculture enterprise, the need to identify the genomic mechanisms for specific traits is becoming more important in breeding and management of the animal. Traits of importance might be related to growth, disease resistance, food conversion efficiency, color or taste. To identify genomic regions responsible for specific traits, genomic large insert libraries have previously proven to be of crucial importance. These large insert libraries can be screened using gene or genetic markers in order to identify and map regions of interest. Furthermore, large-scale mapping can utilize highly redundant libraries in genome projects, and hence provide valuable data on the genome structure. Results Here we report the construction and characterization of a highly redundant bacterial artificial chromosome (BAC library constructed from a Norwegian aquaculture strain male of Atlantic salmon (Salmo salar. The library consists of a total number of 305 557 clones, in which approximately 299 000 are recombinants. The average insert size of the library is 188 kbp, representing 18-fold genome coverage. High-density filters each consisting of 18 432 clones spotted in duplicates have been produced for hybridization screening, and are publicly available 1. To characterize the library, 15 expressed sequence tags (ESTs derived overgos and 12 oligo sequences derived from microsatellite markers were used in hybridization screening of the complete BAC library. Secondary hybridizations with individual probes were performed for the clones detected. The BACs positive for the EST probes were fingerprinted and mapped into contigs, yielding an average of 3 contigs for each probe. Clones identified using genomic probes were PCR verified using microsatellite specific primers. Conclusion Identification of genes and genomic regions of interest is greatly aided by the availability of the CHORI-214 Atlantic salmon BAC

  5. Genome sequencing and comparative genomics reveal a repertoire of putative pathogenicity genes in chilli anthracnose fungus Colletotrichum truncatum.

    Science.gov (United States)

    Rao, Soumya; Nandineni, Madhusudan R

    2017-01-01

    Colletotrichum truncatum, a major fungal phytopathogen, causes the anthracnose disease on an economically important spice crop chilli (Capsicum annuum), resulting in huge economic losses in tropical and sub-tropical countries. It follows a subcuticular intramural infection strategy on chilli with a short, asymptomatic, endophytic phase, which contrasts with the intracellular hemibiotrophic lifestyle adopted by most of the Colletotrichum species. However, little is known about the molecular determinants and the mechanism of pathogenicity in this fungus. A high quality whole genome sequence and gene annotation based on transcriptome data of an Indian isolate of C. truncatum from chilli has been obtained. Analysis of the genome sequence revealed a rich repertoire of pathogenicity genes in C. truncatum encoding secreted proteins, effectors, plant cell wall degrading enzymes, secondary metabolism associated proteins, with potential roles in the host-specific infection strategy, placing it next only to the Fusarium species. The size of genome assembly, number of predicted genes and some of the functional categories were similar to other sequenced Colletotrichum species. The comparative genomic analyses with other species and related fungi identified some unique genes and certain highly expanded gene families of CAZymes, proteases and secondary metabolism associated genes in the genome of C. truncatum. The draft genome assembly and functional annotation of potential pathogenicity genes of C. truncatum provide an important genomic resource for understanding the biology and lifestyle of this important phytopathogen and will pave the way for designing efficient disease control regimens.

  6. Genome-wide association study identifies a maternal copy-number deletion in PSG11 enriched among preeclampsia patients

    Directory of Open Access Journals (Sweden)

    Zhao Linlu

    2012-06-01

    Full Text Available Abstract Background Specific genetic contributions for preeclampsia (PE are currently unknown. This genome-wide association study (GWAS aims to identify maternal single nucleotide polymorphisms (SNPs and copy-number variants (CNVs involved in the etiology of PE. Methods A genome-wide scan was performed on 177 PE cases (diagnosed according to National Heart, Lung and Blood Institute guidelines and 116 normotensive controls. White female study subjects from Iowa were genotyped on Affymetrix SNP 6.0 microarrays. CNV calls made using a combination of four detection algorithms (Birdseye, Canary, PennCNV, and QuantiSNP were merged using CNVision and screened with stringent prioritization criteria. Due to limited DNA quantities and the deleterious nature of copy-number deletions, it was decided a priori that only deletions would be selected for assay on the entire case-control dataset using quantitative real-time PCR. Results The top four SNP candidates had an allelic or genotypic p-value between 10-5 and 10-6, however, none surpassed the Bonferroni-corrected significance threshold. Three recurrent rare deletions meeting prioritization criteria detected in multiple cases were selected for targeted genotyping. A locus of particular interest was found showing an enrichment of case deletions in 19q13.31 (5/169 cases and 1/114 controls, which encompasses the PSG11 gene contiguous to a highly plastic genomic region. All algorithm calls for these regions were assay confirmed. Conclusions CNVs may confer risk for PE and represent interesting regions that warrant further investigation. Top SNP candidates identified from the GWAS, although not genome-wide significant, may be useful to inform future studies in PE genetics.

  7. DESCARTES' RULE OF SIGNS AND THE IDENTIFIABILITY OF POPULATION DEMOGRAPHIC MODELS FROM GENOMIC VARIATION DATA.

    Science.gov (United States)

    Bhaskar, Anand; Song, Yun S

    2014-01-01

    The sample frequency spectrum (SFS) is a widely-used summary statistic of genomic variation in a sample of homologous DNA sequences. It provides a highly efficient dimensional reduction of large-scale population genomic data and its mathematical dependence on the underlying population demography is well understood, thus enabling the development of efficient inference algorithms. However, it has been recently shown that very different population demographies can actually generate the same SFS for arbitrarily large sample sizes. Although in principle this nonidentifiability issue poses a thorny challenge to statistical inference, the population size functions involved in the counterexamples are arguably not so biologically realistic. Here, we revisit this problem and examine the identifiability of demographic models under the restriction that the population sizes are piecewise-defined where each piece belongs to some family of biologically-motivated functions. Under this assumption, we prove that the expected SFS of a sample uniquely determines the underlying demographic model, provided that the sample is sufficiently large. We obtain a general bound on the sample size sufficient for identifiability; the bound depends on the number of pieces in the demographic model and also on the type of population size function in each piece. In the cases of piecewise-constant, piecewise-exponential and piecewise-generalized-exponential models, which are often assumed in population genomic inferences, we provide explicit formulas for the bounds as simple functions of the number of pieces. Lastly, we obtain analogous results for the "folded" SFS, which is often used when there is ambiguity as to which allelic type is ancestral. Our results are proved using a generalization of Descartes' rule of signs for polynomials to the Laplace transform of piecewise continuous functions.

  8. Investigating Salmonella Eko from Various Sources in Nigeria by Whole Genome Sequencing to Identify the Source of Human Infections.

    Directory of Open Access Journals (Sweden)

    Pimlapas Leekitcharoenphon

    Full Text Available Twenty-six Salmonella enterica serovar Eko isolated from various sources in Nigeria were investigated by whole genome sequencing to identify the source of human infections. Diversity among the isolates was observed and camel and cattle were identified as the primary reservoirs and the most likely source of the human infections.

  9. Distinct high resolution genome profiles of early onset and late onset colorectal cancer integrated with gene expression data identify candidate susceptibility loci

    Directory of Open Access Journals (Sweden)

    Merok Marianne A

    2010-05-01

    Full Text Available Abstract Background Estimates suggest that up to 30% of colorectal cancers (CRC may develop due to an increased genetic risk. The mean age at diagnosis for CRC is about 70 years. Time of disease onset 20 years younger than the mean age is assumed to be indicative of genetic susceptibility. We have compared high resolution tumor genome copy number variation (CNV (Roche NimbleGen, 385 000 oligo CGH array in microsatellite stable (MSS tumors from two age groups, including 23 young at onset patients without known hereditary syndromes and with a median age of 44 years (range: 28-53 and 17 elderly patients with median age 79 years (range: 69-87. Our aim was to identify differences in the tumor genomes between these groups and pinpoint potential susceptibility loci. Integration analysis of CNV and genome wide mRNA expression data, available for the same tumors, was performed to identify a restricted candidate gene list. Results The total fraction of the genome with aberrant copy number, the overall genomic profile and the TP53 mutation spectrum were similar between the two age groups. However, both the number of chromosomal aberrations and the number of breakpoints differed significantly between the groups. Gains of 2q35, 10q21.3-22.1, 10q22.3 and 19q13.2-13.31 and losses from 1p31.3, 1q21.1, 2q21.2, 4p16.1-q28.3, 10p11.1 and 19p12, positions that in total contain more than 500 genes, were found significantly more often in the early onset group as compared to the late onset group. Integration analysis revealed a covariation of DNA copy number at these sites and mRNA expression for 107 of the genes. Seven of these genes, CLC, EIF4E, LTBP4, PLA2G12A, PPAT, RG9MTD2, and ZNF574, had significantly different mRNA expression comparing median expression levels across the transcriptome between the two groups. Conclusions Ten genomic loci, containing more than 500 protein coding genes, are identified as more often altered in tumors from early onset versus late

  10. Genome-wide divergence and linkage disequilibrium analyses for Capsicum baccatum revealed by genome-anchored single nucleotide polymorphisms

    Science.gov (United States)

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...

  11. Genome-wide meta-analysis identifies 11 new loci for anthropometric traits and provides insights into genetic architecture

    NARCIS (Netherlands)

    S.I. Berndt (Sonja); S. Gustafsson (Stefan); R. Mägi (Reedik); A. Ganna (Andrea); E. Wheeler (Eleanor); M.F. Feitosa (Mary Furlan); A.E. Justice (Anne); K.L. Monda (Keri); D.C. Croteau-Chonka (Damien); F.R. Day (Felix); T. Esko (Tõnu); M. Fall (Magnus); T. Ferreira (Teresa); D. Gentilini (Davide); A.U. Jackson (Anne); J. Luan; J.C. Randall (Joshua); S. Vedantam (Sailaja); C.J. Willer (Cristen); T.W. Winkler (Thomas); A.R. Wood (Andrew); T. Workalemahu (Tsegaselassie); Y.-J. Hu (Yi-Juan); S.H. Lee (Sang Hong); L. Liang (Liming); D.Y. Lin (Dan); J. Min (Josine); B.M. Neale (Benjamin); G. Thorleifsson (Gudmar); J. Yang (Jian); E. Albrecht (Eva); N. Amin (Najaf); J.L. Bragg-Gresham (Jennifer L.); G. Cadby (Gemma); M. den Heijer (Martin); N. Eklund (Niina); K. Fischer (Krista); A. Goel (Anuj); J.J. Hottenga (Jouke Jan); J.E. Huffman (Jennifer); I. Jarick (Ivonne); A. Johansson (Åsa); T. Johnson (Toby); S. Kanoni (Stavroula); M.E. Kleber (Marcus); I.R. König (Inke); K. Kristiansson (Kati); Z. Kutalik (Zoltán); C. Lamina (Claudia); C. Lecoeur (Cécile); G. Li (Guo); M. Mangino (Massimo); W.L. McArdle (Wendy); M.C. Medina-Gomez (Carolina); M. Müller-Nurasyid (Martina); J.S. Ngwa; I.M. Nolte (Ilja); L. Paternoster (Lavinia); S. Pechlivanis (Sonali); M. Perola (Markus); M.J. Peters (Marjolein); M. Preuss (Michael); L.M. Rose (Lynda); J. Shi (Jianxin); D. Shungin (Dmitry); G.D. Smith; R.J. Strawbridge (Rona); I. Surakka (Ida); A. Teumer (Alexander); M.D. Trip (Mieke); J.P. Tyrer (Jonathan); J.V. van Vliet-Ostaptchouk (Jana); L. Vandenput (Liesbeth); L. Waite (Lindsay); J.H. Zhao (Jing Hua); D. Absher (Devin); F.W. Asselbergs (Folkert); M. Atalay (Mustafa); A.P. Attwood (Antony); A.J. Balmforth (Anthony); D.C.G. Basart (Dick); J.P. Beilby (John); L.L. Bonnycastle (Lori); P. Brambilla (Paolo); M. Bruinenberg (M.); H. Campbell (Harry); D.I. Chasman (Daniel); P.S. Chines (Peter); F.S. Collins (Francis); J. Connell (John); W. O Cookson (William); U. de Faire (Ulf); F. de Vegt (Femmie); M. Dei (Mariano); M. Dimitriou (Maria); T. Edkins (Ted); K. Estrada Gil (Karol); D.M. Evans (David); M. Farrall (Martin); F. Ferrario (Franco); J. Ferrières (Jean); L. Franke (Lude); F. Frau (Francesca); P.V. Gejman (Pablo); H. Grallert (Harald); H. Grönberg (Henrik); V. Gudnason (Vilmundur); A. Hall (Anne); A.S. Hall (Alistair); A.L. Hartikainen; C. Hayward (Caroline); N.L. Heard-Costa (Nancy); A.C. Heath (Andrew); J. Hebebrand (Johannes); G. Homuth (Georg); F.B. Hu (Frank); S.E. Hunt (Sarah); E. Hyppönen (Elina); C. Iribarren (Carlos); K.B. Jacobs (Kevin); J.-O. Jansson (John-Olov); A. Jula (Antti); M. Kähönen (Mika); S. Kathiresan (Sekar); F. Kee (F.); K-T. Khaw (Kay-Tee); M. Kivimaki (Mika); W. Koenig (Wolfgang); A. Kraja (Aldi); M. Kumari (Meena); K. Kuulasmaa (Kari); J. Kuusisto (Johanna); J. Laitinen (Jaana); T.A. Lakka (Timo); C. Langenberg (Claudia); L.J. Launer (Lenore); L. Lind (Lars); J. Lindstrom (Jaana); J. Liu (Jianjun); A. Liuzzi (Antonio); M.L. Lokki; M. Lorentzon (Mattias); P.A. Madden (Pamela); P.K. Magnusson (Patrik); P. Manunta (Paolo); D. Marek (Diana); W. März (Winfried); I.M. Leach (Irene Mateo); B. McKnight (Barbara); S.E. Medland (Sarah Elizabeth); E. Mihailov (Evelin); L. Milani (Lili); G.W. Montgomery (Grant); V. Mooser (Vincent); T.W. Mühleisen (Thomas); P. Munroe (Patricia); A.W. Musk (Arthur); N. Narisu (Narisu); G. Navis (Gerjan); G. Nicholson (Ggeorge); C. Nohr (Christian); K. Ong (Ken); B.A. Oostra (Ben); C.N.A. Palmer (Colin); A. Palotie (Aarno); J. Peden (John); N. Pedersen; A. Peters (Annette); O. Polasek (Ozren); A. Pouta (Anneli); P.P. Pramstaller (Peter Paul); I. Prokopenko (Inga); C. Pütter (Carolin); A. Radhakrishnan (Aparna); O. Raitakari (Olli); A. Rendon (Augusto); F. Rivadeneira Ramirez (Fernando); I. Rudan (Igor); T. Saaristo (Timo); J.G. Sambrook (Jennifer); A.R. Sanders (Alan); S. Sanna (Serena); J. Saramies (Jouko); S. Schipf (Sabine); S. Schreiber (Stefan); H. Schunkert (Heribert); S.-Y. Shin; S. Signorini (Stefano); J. Sinisalo (Juha); B. Skrobek (Boris); N. Soranzo (Nicole); A. Stancáková (Alena); K. Stark (Klaus); J. Stephens (Jonathan); K. Stirrups (Kathy); R.P. Stolk (Ronald); M. Stumvoll (Michael); A.J. Swift (Amy); E.V. Theodoraki (Eirini); B. Thorand (Barbara); D.-A. Tregouet (David-Alexandre); E. Tremoli (Elena); M.M. van der Klauw (Melanie); J.B.J. van Meurs (Joyce); S.H.H.M. Vermeulen (Sita); J. Viikari (Jorma); J. Virtamo (Jarmo); V. Vitart (Veronique); G. Waeber (Gérard); Z. Wang (Zhaoming); E. Widen (Elisabeth); S.H. Wild (Sarah); G.A.H.M. Willemsen (Gonneke); B. Winkelmann; J.C.M. Witteman (Jacqueline); B.H.R. Wolffenbuttel (Bruce); A. Wong (Andrew); A.F. Wright (Alan); M.C. Zillikens (Carola); P. Amouyel (Philippe); B.O. Boehm (Bernhard); E.A. Boerwinkle (Eric); D.I. Boomsma (Dorret); M. Caulfield (Mark); S.J. Chanock (Stephen); L.A. Cupples (Adrienne); D. Cusi (Daniele); G.V. Dedoussis (George); J. Erdmann (Jeanette); J.G. Eriksson (Johan); P.W. Franks (Paul); P. Froguel (Philippe); C. Gieger (Christian); U. Gyllensten (Ulf); A. Hamsten (Anders); T.B. Harris (Tamara); C. Hengstenberg (Christian); A.A. Hicks (Andrew); A. Hingorani (Aroon); A. Hinney (Anke); A. Hofman (Albert); G.K. Hovingh (Kees); K. Hveem (Kristian); T. Illig (Thomas); M.-R. Jarvelin (Marjo-Riitta); K.-H. Jöckel (Karl-Heinz); S. Keinanen-Kiukaanniemi (Sirkka); L.A.L.M. Kiemeney (Bart); D. Kuh (Diana); M. Laakso (Markku); T. Lehtimäki (Terho); D.F. Levinson (Douglas); N.G. Martin (Nicholas); A. Metspalu (Andres); A.D. Morris (Andrew); M.S. Nieminen (Markku); I. Njølstad (Inger); C. Ohlsson (Claes); A.J. Oldehinkel (Albertine); W.H. Ouwehand (Willem); C. Palmer (Cameron); B.W.J.H. Penninx (Brenda); C. Power (Christopher); M.A. Province (Mike); B.M. Psaty (Bruce); L. Qi (Lu); R. Rauramaa (Rainer); P.M. Ridker (Paul); S. Ripatti (Samuli); V. Salomaa (Veikko); N.J. Samani (Nilesh); H. Snieder (Harold); H.G. Sorensen; T.D. Spector (Timothy); J-A. Zwart (John-Anker); A. Tönjes (Anke); J. Tuomilehto (Jaakko); A.G. Uitterlinden (André); M. Uusitupa (Matti); P. van der Harst (Pim); P. Vollenweider (Peter); H. Wallaschofski (Henri); N.J. Wareham (Nick); H. Watkins (Hugh); H.E. Wichmann (Heinz Erich); J.F. Wilson (James F); G.R. Abecasis (Gonçalo); T.L. Assimes (Themistocles); I.E. Barroso (Inês); M. Boehnke (Michael); I.B. Borecki (Ingrid); P. Deloukas (Panagiotis); C. Fox (Craig); T.M. Frayling (Timothy); L. Groop (Leif); T. Haritunian (Talin); I.M. Heid (Iris); D. Hunter (David); R.C. Kaplan (Robert); F. Karpe (Fredrik); M.F. Moffatt (Miriam); K.L. Mohlke (Karen); J.R. O´Connell; Y. Pawitan (Yudi); E.E. Schadt (Eric); D. Schlessinger (David); V. Steinthorsdottir (Valgerdur); D.P. Strachan (David); U. Thorsteinsdottir (Unnur); C.M. van Duijn (Cornelia); P.M. Visscher (Peter); A.M. Di Blasio (Anna Maria); J.N. Hirschhorn (Joel); C.M. Lindgren (Cecilia); A.D. Morris (Andrew); D. Meyre (David); A. Scherag (Andre); M.I. McCarthy (Mark); E.K. Speliotes (Elizabeth); K.E. North (Kari); R.J.F. Loos (Ruth); E. Ingelsson (Erik)

    2013-01-01

    textabstractApproaches exploiting trait distribution extremes may be used to identify loci associated with common traits, but it is unknown whether these loci are generalizable to the broader population. In a genome-wide search for loci associated with the upper versus the lower 5th percentiles of

  12. Copy number variation in the bovine genome

    DEFF Research Database (Denmark)

    Fadista, João; Thomsen, Bo; Holm, Lars-Erik

    2010-01-01

    to genetic variation in cattle. Results We designed and used a set of NimbleGen CGH arrays that tile across the assayable portion of the cattle genome with approximately 6.3 million probes, at a median probe spacing of 301 bp. This study reports the highest resolution map of copy number variation...... in the cattle genome, with 304 CNV regions (CNVRs) being identified among the genomes of 20 bovine samples from 4 dairy and beef breeds. The CNVRs identified covered 0.68% (22 Mb) of the genome, and ranged in size from 1.7 to 2,031 kb (median size 16.7 kb). About 20% of the CNVs co-localized with segmental...... duplications, while 30% encompass genes, of which the majority is involved in environmental response. About 10% of the human orthologous of these genes are associated with human disease susceptibility and, hence, may have important phenotypic consequences. Conclusions Together, this analysis provides a useful...

  13. The whole genome sequences and experimentally phased haplotypes of over 100 personal genomes.

    Science.gov (United States)

    Mao, Qing; Ciotlos, Serban; Zhang, Rebecca Yu; Ball, Madeleine P; Chin, Robert; Carnevali, Paolo; Barua, Nina; Nguyen, Staci; Agarwal, Misha R; Clegg, Tom; Connelly, Abram; Vandewege, Ward; Zaranek, Alexander Wait; Estep, Preston W; Church, George M; Drmanac, Radoje; Peters, Brock A

    2016-10-11

    Since the completion of the Human Genome Project in 2003, it is estimated that more than 200,000 individual whole human genomes have been sequenced. A stunning accomplishment in such a short period of time. However, most of these were sequenced without experimental haplotype data and are therefore missing an important aspect of genome biology. In addition, much of the genomic data is not available to the public and lacks phenotypic information. As part of the Personal Genome Project, blood samples from 184 participants were collected and processed using Complete Genomics' Long Fragment Read technology. Here, we present the experimental whole genome haplotyping and sequencing of these samples to an average read coverage depth of 100X. This is approximately three-fold higher than the read coverage applied to most whole human genome assemblies and ensures the highest quality results. Currently, 114 genomes from this dataset are freely available in the GigaDB repository and are associated with rich phenotypic data; the remaining 70 should be added in the near future as they are approved through the PGP data release process. For reproducibility analyses, 20 genomes were sequenced at least twice using independent LFR barcoded libraries. Seven genomes were also sequenced using Complete Genomics' standard non-barcoded library process. In addition, we report 2.6 million high-quality, rare variants not previously identified in the Single Nucleotide Polymorphisms database or the 1000 Genomes Project Phase 3 data. These genomes represent a unique source of haplotype and phenotype data for the scientific community and should help to expand our understanding of human genome evolution and function.

  14. Genomic Prediction from Whole Genome Sequence in Livestock: The 1000 Bull Genomes Project

    DEFF Research Database (Denmark)

    Hayes, Benjamin J; MacLeod, Iona M; Daetwyler, Hans D

    Advantages of using whole genome sequence data to predict genomic estimated breeding values (GEBV) include better persistence of accuracy of GEBV across generations and more accurate GEBV across breeds. The 1000 Bull Genomes Project provides a database of whole genome sequenced key ancestor bulls....... In a dairy data set, predictions using BayesRC and imputed sequence data from 1000 Bull Genomes were 2% more accurate than with 800k data. We could demonstrate the method identified causal mutations in some cases. Further improvements will come from more accurate imputation of sequence variant genotypes...

  15. Omics and Environmental Science Genomic Approaches With Natural Fish Populations From Polluted Environments

    Science.gov (United States)

    Bozinovic, Goran; Oleksiak, Marjorie F.

    2010-01-01

    Transcriptomics and population genomics are two complementary genomic approaches that can be used to gain insight into pollutant effects in natural populations. Transcriptomics identify altered gene expression pathways while population genomics approaches more directly target the causative genomic polymorphisms. Neither approach is restricted to a pre-determined set of genes or loci. Instead, both approaches allow a broad overview of genomic processes. Transcriptomics and population genomic approaches have been used to explore genomic responses in populations of fish from polluted environments and have identified sets of candidate genes and loci that appear biologically important in response to pollution. Often differences in gene expression or loci between polluted and reference populations are not conserved among polluted populations suggesting a biological complexity that we do not yet fully understand. As genomic approaches become less expensive with the advent of new sequencing and genotyping technologies, they will be more widely used in complimentary studies. However, while these genomic approaches are immensely powerful for identifying candidate gene and loci, the challenge of determining biological mechanisms that link genotypes and phenotypes remains. PMID:21072843

  16. The importance of identity-by-state information for the accuracy of genomic selection

    Directory of Open Access Journals (Sweden)

    Luan Tu

    2012-08-01

    Full Text Available Abstract Background It is commonly assumed that prediction of genome-wide breeding values in genomic selection is achieved by capitalizing on linkage disequilibrium between markers and QTL but also on genetic relationships. Here, we investigated the reliability of predicting genome-wide breeding values based on population-wide linkage disequilibrium information, based on identity-by-descent relationships within the known pedigree, and to what extent linkage disequilibrium information improves predictions based on identity-by-descent genomic relationship information. Methods The study was performed on milk, fat, and protein yield, using genotype data on 35 706 SNP and deregressed proofs of 1086 Italian Brown Swiss bulls. Genome-wide breeding values were predicted using a genomic identity-by-state relationship matrix and a genomic identity-by-descent relationship matrix (averaged over all marker loci. The identity-by-descent matrix was calculated by linkage analysis using one to five generations of pedigree data. Results We showed that genome-wide breeding values prediction based only on identity-by-descent genomic relationships within the known pedigree was as or more reliable than that based on identity-by-state, which implicitly also accounts for genomic relationships that occurred before the known pedigree. Furthermore, combining the two matrices did not improve the prediction compared to using identity-by-descent alone. Including different numbers of generations in the pedigree showed that most of the information in genome-wide breeding values prediction comes from animals with known common ancestors less than four generations back in the pedigree. Conclusions Our results show that, in pedigreed breeding populations, the accuracy of genome-wide breeding values obtained by identity-by-descent relationships was not improved by identity-by-state information. Although, in principle, genomic selection based on identity-by-state does not require

  17. Genome-wide meta-analysis identifies 11 new loci for anthropometric traits and provides insights into genetic architecture

    NARCIS (Netherlands)

    Berndt, Sonja I; Gustafsson, Stefan; Mägi, Reedik; Ganna, Andrea; Wheeler, Eleanor; Feitosa, Mary F; Justice, Anne E; Monda, Keri L; Croteau-Chonka, Damien C; Day, Felix R; Esko, Tõnu; Fall, Tove; Ferreira, Teresa; Gentilini, Davide; Jackson, Anne U; Luan, Jian'an; Randall, Joshua C; Vedantam, Sailaja; Willer, Cristen J; Winkler, Thomas W; Wood, Andrew R; Workalemahu, Tsegaselassie; Hu, Yi-Juan; Lee, Sang Hong; Liang, Liming; Lin, Dan-Yu; Min, Josine L; Neale, Benjamin M; Thorleifsson, Gudmar; Yang, Jian; Albrecht, Eva; Amin, Najaf; Bragg-Gresham, Jennifer L; Cadby, Gemma; den Heijer, Martin; Eklund, Niina; Fischer, Krista; Goel, Anuj; Hottenga, Jouke-Jan; Huffman, Jennifer E; Jarick, Ivonne; Johansson, Åsa; Johnson, Toby; Kanoni, Stavroula; Kleber, Marcus E; König, Inke R; Kristiansson, Kati; Kutalik, Zoltán; Lamina, Claudia; Lecoeur, Cecile; Li, Guo; Mangino, Massimo; McArdle, Wendy L; Medina-Gomez, Carolina; Müller-Nurasyid, Martina; Ngwa, Julius S; Nolte, Ilja M; Paternoster, Lavinia; Pechlivanis, Sonali; Perola, Markus; Peters, Marjolein J; Preuss, Michael; Rose, Lynda M; Shi, Jianxin; Shungin, Dmitry; Smith, Albert Vernon; Strawbridge, Rona J; Surakka, Ida; Teumer, Alexander; Trip, Mieke D; Tyrer, Jonathan; Van Vliet-Ostaptchouk, Jana V; Vandenput, Liesbeth; Waite, Lindsay L; Zhao, Jing Hua; Absher, Devin; Asselbergs, Folkert W; Atalay, Mustafa; Attwood, Antony P; Balmforth, Anthony J; Basart, Hanneke; Beilby, John; Bonnycastle, Lori L; Brambilla, Paolo; Bruinenberg, Marcel; Campbell, Harry; Chasman, Daniel I; Chines, Peter S; Collins, Francis S; Connell, John M; Cookson, William O; de Faire, Ulf; de Vegt, Femmie; Dei, Mariano; Dimitriou, Maria; Edkins, Sarah; Estrada, Karol; Evans, David M; Farrall, Martin; Ferrario, Marco M; Ferrières, Jean; Franke, Lude; Frau, Francesca; Gejman, Pablo V; Grallert, Harald; Grönberg, Henrik; Gudnason, Vilmundur; Hall, Alistair S; Hall, Per; Hartikainen, Anna-Liisa; Hayward, Caroline; Heard-Costa, Nancy L; Heath, Andrew C; Hebebrand, Johannes; Homuth, Georg; Hu, Frank B; Hunt, Sarah E; Hyppönen, Elina; Iribarren, Carlos; Jacobs, Kevin B; Jansson, John-Olov; Jula, Antti; Kähönen, Mika; Kathiresan, Sekar; Kee, Frank; Khaw, Kay-Tee; Kivimäki, Mika; Koenig, Wolfgang; Kraja, Aldi T; Kumari, Meena; Kuulasmaa, Kari; Kuusisto, Johanna; Laitinen, Jaana H; Lakka, Timo A; Langenberg, Claudia; Launer, Lenore J; Lind, Lars; Lindström, Jaana; Liu, Jianjun; Liuzzi, Antonio; Lokki, Marja-Liisa; Lorentzon, Mattias; Madden, Pamela A; Magnusson, Patrik K; Manunta, Paolo; Marek, Diana; März, Winfried; Mateo Leach, Irene; McKnight, Barbara; Medland, Sarah E; Mihailov, Evelin; Milani, Lili; Montgomery, Grant W; Mooser, Vincent; Mühleisen, Thomas W; Munroe, Patricia B; Musk, Arthur W; Narisu, Narisu; Navis, Gerjan; Nicholson, George; Nohr, Ellen A; Ong, Ken K; Oostra, Ben A; Palmer, Colin N A; Palotie, Aarno; Peden, John F; Pedersen, Nancy; Peters, Annette; Polasek, Ozren; Pouta, Anneli; Pramstaller, Peter P; Prokopenko, Inga; Pütter, Carolin; Radhakrishnan, Aparna; Raitakari, Olli; Rendon, Augusto; Rivadeneira, Fernando; Rudan, Igor; Saaristo, Timo E; Sambrook, Jennifer G; Sanders, Alan R; Sanna, Serena; Saramies, Jouko; Schipf, Sabine; Schreiber, Stefan; Schunkert, Heribert; Shin, So-Youn; Signorini, Stefano; Sinisalo, Juha; Skrobek, Boris; Soranzo, Nicole; Stančáková, Alena; Stark, Klaus; Stephens, Jonathan C; Stirrups, Kathleen; Stolk, Ronald P; Stumvoll, Michael; Swift, Amy J; Theodoraki, Eirini V; Thorand, Barbara; Tregouet, David-Alexandre; Tremoli, Elena; Van der Klauw, Melanie M; van Meurs, Joyce B J; Vermeulen, Sita H; Viikari, Jorma; Virtamo, Jarmo; Vitart, Veronique; Waeber, Gérard; Wang, Zhaoming; Widén, Elisabeth; Wild, Sarah H; Willemsen, Gonneke; Winkelmann, Bernhard R; Witteman, Jacqueline C M; Wolffenbuttel, Bruce H R; Wong, Andrew; Wright, Alan F; Zillikens, M Carola; Amouyel, Philippe; Boehm, Bernhard O; Boerwinkle, Eric; Boomsma, Dorret I; Caulfield, Mark J; Chanock, Stephen J; Cupples, L Adrienne; Cusi, Daniele; Dedoussis, George V; Erdmann, Jeanette; Eriksson, Johan G; Franks, Paul W; Froguel, Philippe; Gieger, Christian; Gyllensten, Ulf; Hamsten, Anders; Harris, Tamara B; Hengstenberg, Christian; Hicks, Andrew A; Hingorani, Aroon; Hinney, Anke; Hofman, Albert; Hovingh, Kees G; Hveem, Kristian; Illig, Thomas; Jarvelin, Marjo-Riitta; Jöckel, Karl-Heinz; Keinanen-Kiukaanniemi, Sirkka M; Kiemeney, Lambertus A; Kuh, Diana; Laakso, Markku; Lehtimäki, Terho; Levinson, Douglas F; Martin, Nicholas G; Metspalu, Andres; Morris, Andrew D; Nieminen, Markku S; Njølstad, Inger; Ohlsson, Claes; Oldehinkel, Albertine J; Ouwehand, Willem H; Palmer, Lyle J; Penninx, Brenda; Power, Chris; Province, Michael A; Psaty, Bruce M; Qi, Lu; Rauramaa, Rainer; Ridker, Paul M; Ripatti, Samuli; Salomaa, Veikko; Samani, Nilesh J; Snieder, Harold; Sørensen, Thorkild I A; Spector, Timothy D; Stefansson, Kari; Tönjes, Anke; Tuomilehto, Jaakko; Uitterlinden, André G; Uusitupa, Matti; van der Harst, Pim; Vollenweider, Peter; Wallaschofski, Henri; Wareham, Nicholas J; Watkins, Hugh; Wichmann, H-Erich; Wilson, James F; Abecasis, Goncalo R; Assimes, Themistocles L; Barroso, Inês; Boehnke, Michael; Borecki, Ingrid B; Deloukas, Panos; Fox, Caroline S; Frayling, Timothy; Groop, Leif C; Haritunian, Talin; Heid, Iris M; Hunter, David; Kaplan, Robert C; Karpe, Fredrik; Moffatt, Miriam F; Mohlke, Karen L; O'Connell, Jeffrey R; Pawitan, Yudi; Schadt, Eric E; Schlessinger, David; Steinthorsdottir, Valgerdur; Strachan, David P; Thorsteinsdottir, Unnur; van Duijn, Cornelia M; Visscher, Peter M; Di Blasio, Anna Maria; Hirschhorn, Joel N; Lindgren, Cecilia M; Morris, Andrew P; Meyre, David; Scherag, André; McCarthy, Mark I; Speliotes, Elizabeth K; North, Kari E; Loos, Ruth J F; Ingelsson, Erik

    Approaches exploiting trait distribution extremes may be used to identify loci associated with common traits, but it is unknown whether these loci are generalizable to the broader population. In a genome-wide search for loci associated with the upper versus the lower 5th percentiles of body mass

  18. Genome-wide meta-analysis identifies 11 new loci for anthropometric traits and provides insights into genetic architecture

    NARCIS (Netherlands)

    Berndt, Sonja I.; Gustafsson, Stefan; Mägi, Reedik; Ganna, Andrea; Wheeler, Eleanor; Feitosa, Mary F.; Justice, Anne E.; Monda, Keri L.; Croteau-Chonka, Damien C.; Day, Felix R.; Esko, Tõnu; Fall, Tove; Ferreira, Teresa; Gentilini, Davide; Jackson, Anne U.; Luan, Jian'an; Randall, Joshua C.; Vedantam, Sailaja; Willer, Cristen J.; Winkler, Thomas W.; Wood, Andrew R.; Workalemahu, Tsegaselassie; Hu, Yi-Juan; Lee, Sang Hong; Liang, Liming; Lin, Dan-Yu; Min, Josine L.; Neale, Benjamin M.; Thorleifsson, Gudmar; Yang, Jian; Albrecht, Eva; Amin, Najaf; Bragg-Gresham, Jennifer L.; Cadby, Gemma; den Heijer, Martin; Eklund, Niina; Fischer, Krista; Goel, Anuj; Hottenga, Jouke-Jan; Huffman, Jennifer E.; Jarick, Ivonne; Johansson, Asa; Johnson, Toby; Kanoni, Stavroula; Kleber, Marcus E.; König, Inke R.; Kristiansson, Kati; Kutalik, Zoltán; Lamina, Claudia; Lecoeur, Cecile; Li, Guo; Mangino, Massimo; McArdle, Wendy L.; Medina-Gomez, Carolina; Müller-Nurasyid, Martina; Ngwa, Julius S.; Nolte, Ilja M.; Paternoster, Lavinia; Pechlivanis, Sonali; Perola, Markus; Peters, Marjolein J.; Preuss, Michael; Rose, Lynda M.; Shi, Jianxin; Shungin, Dmitry; Smith, Albert Vernon; Strawbridge, Rona J.; Surakka, Ida; Teumer, Alexander; Trip, Mieke D.; Tyrer, Jonathan; van Vliet-Ostaptchouk, Jana V.; Vandenput, Liesbeth; Waite, Lindsay L.; Zhao, Jing Hua; Absher, Devin; Asselbergs, Folkert W.; Atalay, Mustafa; Attwood, Antony P.; Balmforth, Anthony J.; Basart, Hanneke; Beilby, John; Bonnycastle, Lori L.; Brambilla, Paolo; Bruinenberg, Marcel; Campbell, Harry; Chasman, Daniel I.; Chines, Peter S.; Collins, Francis S.; Connell, John M.; Cookson, William O.; de Faire, Ulf; de Vegt, Femmie; dei, Mariano; Dimitriou, Maria; Edkins, Sarah; Estrada, Karol; Evans, David M.; Farrall, Martin; Ferrario, Marco M.; Ferrières, Jean; Franke, Lude; Frau, Francesca; Gejman, Pablo V.; Grallert, Harald; Grönberg, Henrik; Gudnason, Vilmundur; Hall, Alistair S.; Hall, Per; Hartikainen, Anna-Liisa; Hayward, Caroline; Heard-Costa, Nancy L.; Heath, Andrew C.; Hebebrand, Johannes; Homuth, Georg; Hu, Frank B.; Hunt, Sarah E.; Hyppönen, Elina; Iribarren, Carlos; Jacobs, Kevin B.; Jansson, John-Olov; Jula, Antti; Kähönen, Mika; Kathiresan, Sekar; Kee, Frank; Khaw, Kay-Tee; Kivimäki, Mika; Koenig, Wolfgang; Kraja, Aldi T.; Kumari, Meena; Kuulasmaa, Kari; Kuusisto, Johanna; Laitinen, Jaana H.; Lakka, Timo A.; Langenberg, Claudia; Launer, Lenore J.; Lind, Lars; Lindström, Jaana; Liu, Jianjun; Liuzzi, Antonio; Lokki, Marja-Liisa; Lorentzon, Mattias; Madden, Pamela A.; Magnusson, Patrik K.; Manunta, Paolo; Marek, Diana; März, Winfried; Mateo Leach, Irene; McKnight, Barbara; Medland, Sarah E.; Mihailov, Evelin; Milani, Lili; Montgomery, Grant W.; Mooser, Vincent; Mühleisen, Thomas W.; Munroe, Patricia B.; Musk, Arthur W.; Narisu, Narisu; Navis, Gerjan; Nicholson, George; Nohr, Ellen A.; Ong, Ken K.; Oostra, Ben A.; Palmer, Colin N. A.; Palotie, Aarno; Peden, John F.; Pedersen, Nancy; Peters, Annette; Polasek, Ozren; Pouta, Anneli; Pramstaller, Peter P.; Prokopenko, Inga; Pütter, Carolin; Radhakrishnan, Aparna; Raitakari, Olli; Rendon, Augusto; Rivadeneira, Fernando; Rudan, Igor; Saaristo, Timo E.; Sambrook, Jennifer G.; Sanders, Alan R.; Sanna, Serena; Saramies, Jouko; Schipf, Sabine; Schreiber, Stefan; Schunkert, Heribert; Shin, So-Youn; Signorini, Stefano; Sinisalo, Juha; Skrobek, Boris; Soranzo, Nicole; Stančáková, Alena; Stark, Klaus; Stephens, Jonathan C.; Stirrups, Kathleen; Stolk, Ronald P.; Stumvoll, Michael; Swift, Amy J.; Theodoraki, Eirini V.; Thorand, Barbara; Tregouet, David-Alexandre; Tremoli, Elena; van der Klauw, Melanie M.; van Meurs, Joyce B. J.; Vermeulen, Sita H.; Viikari, Jorma; Virtamo, Jarmo; Vitart, Veronique; Waeber, Gérard; Wang, Zhaoming; Widén, Elisabeth; Wild, Sarah H.; Willemsen, Gonneke; Winkelmann, Bernhard R.; Witteman, Jacqueline C. M.; Wolffenbuttel, Bruce H. R.; Wong, Andrew; Wright, Alan F.; Zillikens, M. Carola; Amouyel, Philippe; Boehm, Bernhard O.; Boerwinkle, Eric; Boomsma, Dorret I.; Caulfield, Mark J.; Chanock, Stephen J.; Cupples, L. Adrienne; Cusi, Daniele; Dedoussis, George V.; Erdmann, Jeanette; Eriksson, Johan G.; Franks, Paul W.; Froguel, Philippe; Gieger, Christian; Gyllensten, Ulf; Hamsten, Anders; Harris, Tamara B.; Hengstenberg, Christian; Hicks, Andrew A.; Hingorani, Aroon; Hinney, Anke; Hofman, Albert; Hovingh, Kees G.; Hveem, Kristian; Illig, Thomas; Jarvelin, Marjo-Riitta; Jöckel, Karl-Heinz; Keinanen-Kiukaanniemi, Sirkka M.; Kiemeney, Lambertus A.; Kuh, Diana; Laakso, Markku; Lehtimäki, Terho; Levinson, Douglas F.; Martin, Nicholas G.; Metspalu, Andres; Morris, Andrew D.; Nieminen, Markku S.; Njølstad, Inger; Ohlsson, Claes; Oldehinkel, Albertine J.; Ouwehand, Willem H.; Palmer, Lyle J.; Penninx, Brenda; Power, Chris; Province, Michael A.; Psaty, Bruce M.; Qi, Lu; Rauramaa, Rainer; Ridker, Paul M.; Ripatti, Samuli; Salomaa, Veikko; Samani, Nilesh J.; Snieder, Harold; Sørensen, Thorkild I. A.; Spector, Timothy D.; Stefansson, Kari; Tönjes, Anke; Tuomilehto, Jaakko; Uitterlinden, André G.; Uusitupa, Matti; van der Harst, Pim; Vollenweider, Peter; Wallaschofski, Henri; Wareham, Nicholas J.; Watkins, Hugh; Wichmann, H.-Erich; Wilson, James F.; Abecasis, Goncalo R.; Assimes, Themistocles L.; Barroso, Inês; Boehnke, Michael; Borecki, Ingrid B.; Deloukas, Panos; Fox, Caroline S.; Frayling, Timothy; Groop, Leif C.; Haritunian, Talin; Heid, Iris M.; Hunter, David; Kaplan, Robert C.; Karpe, Fredrik; Moffatt, Miriam F.; Mohlke, Karen L.; O'Connell, Jeffrey R.; Pawitan, Yudi; Schadt, Eric E.; Schlessinger, David; Steinthorsdottir, Valgerdur; Strachan, David P.; Thorsteinsdottir, Unnur; van Duijn, Cornelia M.; Visscher, Peter M.; Di Blasio, Anna Maria; Hirschhorn, Joel N.; Lindgren, Cecilia M.; Morris, Andrew P.; Meyre, David; Scherag, André; McCarthy, Mark I.; Speliotes, Elizabeth K.; North, Kari E.; Loos, Ruth J. F.; Ingelsson, Erik

    2013-01-01

    Approaches exploiting trait distribution extremes may be used to identify loci associated with common traits, but it is unknown whether these loci are generalizable to the broader population. In a genome-wide search for loci associated with the upper versus the lower 5th percentiles of body mass

  19. Genome-wide meta-analysis identifies 11 new loci for anthropometric traits and provides insights into genetic architecture

    DEFF Research Database (Denmark)

    Berndt, Sonja I; Gustafsson, Stefan; Mägi, Reedik

    2013-01-01

    Approaches exploiting trait distribution extremes may be used to identify loci associated with common traits, but it is unknown whether these loci are generalizable to the broader population. In a genome-wide search for loci associated with the upper versus the lower 5th percentiles of body mass ...

  20. Genome Evolution of Plant-Parasitic Nematodes.

    Science.gov (United States)

    Kikuchi, Taisei; Eves-van den Akker, Sebastian; Jones, John T

    2017-08-04

    Plant parasitism has evolved independently on at least four separate occasions in the phylum Nematoda. The application of next-generation sequencing (NGS) to plant-parasitic nematodes has allowed a wide range of genome- or transcriptome-level comparisons, and these have identified genome adaptations that enable parasitism of plants. Current genome data suggest that horizontal gene transfer, gene family expansions, evolution of new genes that mediate interactions with the host, and parasitism-specific gene regulation are important adaptations that allow nematodes to parasitize plants. Sequencing of a larger number of nematode genomes, including plant parasites that show different modes of parasitism or that have evolved in currently unsampled clades, and using free-living taxa as comparators would allow more detailed analysis and a better understanding of the organization of key genes within the genomes. This would facilitate a more complete understanding of the way in which parasitism has shaped the genomes of plant-parasitic nematodes.

  1. Analysis of the Complete Mitochondrial Genome Sequence of the Diploid Cotton Gossypium raimondii by Comparative Genomics Approaches

    Directory of Open Access Journals (Sweden)

    Changwei Bi

    2016-01-01

    Full Text Available Cotton is one of the most important economic crops and the primary source of natural fiber and is an important protein source for animal feed. The complete nuclear and chloroplast (cp genome sequences of G. raimondii are already available but not mitochondria. Here, we assembled the complete mitochondrial (mt DNA sequence of G. raimondii into a circular genome of length of 676,078 bp and performed comparative analyses with other higher plants. The genome contains 39 protein-coding genes, 6 rRNA genes, and 25 tRNA genes. We also identified four larger repeats (63.9 kb, 10.6 kb, 9.1 kb, and 2.5 kb in this mt genome, which may be active in intramolecular recombination in the evolution of cotton. Strikingly, nearly all of the G. raimondii mt genome has been transferred to nucleus on Chr1, and the transfer event must be very recent. Phylogenetic analysis reveals that G. raimondii, as a member of Malvaceae, is much closer to another cotton (G. barbadense than other rosids, and the clade formed by two Gossypium species is sister to Brassicales. The G. raimondii mt genome may provide a crucial foundation for evolutionary analysis, molecular biology, and cytoplasmic male sterility in cotton and other higher plants.

  2. Genome-Wide Association Study Identifies NBS-LRR-Encoding Genes Related with Anthracnose and Common Bacterial Blight in the Common Bean.

    Science.gov (United States)

    Wu, Jing; Zhu, Jifeng; Wang, Lanfen; Wang, Shumin

    2017-01-01

    Nucleotide-binding site and leucine-rich repeat (NBS-LRR) genes represent the largest and most important disease resistance genes in plants. The genome sequence of the common bean ( Phaseolus vulgaris L.) provides valuable data for determining the genomic organization of NBS-LRR genes. However, data on the NBS-LRR genes in the common bean are limited. In total, 178 NBS-LRR-type genes and 145 partial genes (with or without a NBS) located on 11 common bean chromosomes were identified from genome sequences database. Furthermore, 30 NBS-LRR genes were classified into Toll/interleukin-1 receptor (TIR)-NBS-LRR (TNL) types, and 148 NBS-LRR genes were classified into coiled-coil (CC)-NBS-LRR (CNL) types. Moreover, the phylogenetic tree supported the division of these PvNBS genes into two obvious groups, TNL types and CNL types. We also built expression profiles of NBS genes in response to anthracnose and common bacterial blight using qRT-PCR. Finally, we detected nine disease resistance loci for anthracnose (ANT) and seven for common bacterial blight (CBB) using the developed NBS-SSR markers. Among these loci, NSSR24, NSSR73, and NSSR265 may be located at new regions for ANT resistance, while NSSR65 and NSSR260 may be located at new regions for CBB resistance. Furthermore, we validated NSSR24, NSSR65, NSSR73, NSSR260, and NSSR265 using a new natural population. Our results provide useful information regarding the function of the NBS-LRR proteins and will accelerate the functional genomics and evolutionary studies of NBS-LRR genes in food legumes. NBS-SSR markers represent a wide-reaching resource for molecular breeding in the common bean and other food legumes. Collectively, our results should be of broad interest to bean scientists and breeders.

  3. Editor's Highlight: High-Throughput Functional Genomics Identifies Modulators of TCE Metabolite Genotoxicity and Candidate Susceptibility Genes.

    Science.gov (United States)

    De La Rosa, Vanessa Y; Asfaha, Jonathan; Fasullo, Michael; Loguinov, Alex; Li, Peng; Moore, Lee E; Rothman, Nathaniel; Nakamura, Jun; Swenberg, James A; Scelo, Ghislaine; Zhang, Luoping; Smith, Martyn T; Vulpe, Chris D

    2017-11-01

    Trichloroethylene (TCE), an industrial chemical and environmental contaminant, is a human carcinogen. Reactive metabolites are implicated in renal carcinogenesis associated with TCE exposure, yet the toxicity mechanisms of these metabolites and their contribution to cancer and other adverse effects remain unclear. We employed an integrated functional genomics approach that combined functional profiling studies in yeast and avian DT40 cell models to provide new insights into the specific mechanisms contributing to toxicity associated with TCE metabolites. Genome-wide profiling studies in yeast identified the error-prone translesion synthesis (TLS) pathway as an import mechanism in response to TCE metabolites. The role of TLS DNA repair was further confirmed by functional profiling in DT40 avian cell lines, but also revealed that TLS and homologous recombination DNA repair likely play competing roles in cellular susceptibility to TCE metabolites in higher eukaryotes. These DNA repair pathways are highly conserved between yeast, DT40, and humans. We propose that in humans, mutagenic TLS is favored over homologous recombination repair in response to TCE metabolites. The results of these studies contribute to the body of evidence supporting a mutagenic mode of action for TCE-induced renal carcinogenesis mediated by reactive metabolites in humans. Our approach illustrates the potential for high-throughput in vitro functional profiling in yeast to elucidate toxicity pathways (molecular initiating events, key events) and candidate susceptibility genes for focused study. © The Author 2017. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  4. GREAM: A Web Server to Short-List Potentially Important Genomic Repeat Elements Based on Over-/Under-Representation in Specific Chromosomal Locations, Such as the Gene Neighborhoods, within or across 17 Mammalian Species.

    Directory of Open Access Journals (Sweden)

    Darshan Shimoga Chandrashekar

    Full Text Available Genome-wide repeat sequences, such as LINEs, SINEs and LTRs share a considerable part of the mammalian nuclear genomes. These repeat elements seem to be important for multiple functions including the regulation of transcription initiation, alternative splicing and DNA methylation. But it is not possible to study all repeats and, hence, it would help to short-list before exploring their potential functional significance via experimental studies and/or detailed in silico analyses.We developed the 'Genomic Repeat Element Analyzer for Mammals' (GREAM for analysis, screening and selection of potentially important mammalian genomic repeats. This web-server offers many novel utilities. For example, this is the only tool that can reveal a categorized list of specific types of transposons, retro-transposons and other genome-wide repetitive elements that are statistically over-/under-represented in regions around a set of genes, such as those expressed differentially in a disease condition. The output displays the position and frequency of identified elements within the specified regions. In addition, GREAM offers two other types of analyses of genomic repeat sequences: a enrichment within chromosomal region(s of interest, and b comparative distribution across the neighborhood of orthologous genes. GREAM successfully short-listed a repeat element (MER20 known to contain functional motifs. In other case studies, we could use GREAM to short-list repetitive elements in the azoospermia factor a (AZFa region of the human Y chromosome and those around the genes associated with rat liver injury. GREAM could also identify five over-represented repeats around some of the human and mouse transcription factor coding genes that had conserved expression patterns across the two species.GREAM has been developed to provide an impetus to research on the role of repetitive sequences in mammalian genomes by offering easy selection of more interesting repeats in various

  5. Genome-wide patterns of copy number variation in the diversified chicken genomes using next-generation sequencing.

    Science.gov (United States)

    Yi, Guoqiang; Qu, Lujiang; Liu, Jianfeng; Yan, Yiyuan; Xu, Guiyun; Yang, Ning

    2014-11-07

    Copy number variation (CNV) is important and widespread in the genome, and is a major cause of disease and phenotypic diversity. Herein, we performed a genome-wide CNV analysis in 12 diversified chicken genomes based on whole genome sequencing. A total of 8,840 CNV regions (CNVRs) covering 98.2 Mb and representing 9.4% of the chicken genome were identified, ranging in size from 1.1 to 268.8 kb with an average of 11.1 kb. Sequencing-based predictions were confirmed at a high validation rate by two independent approaches, including array comparative genomic hybridization (aCGH) and quantitative PCR (qPCR). The Pearson's correlation coefficients between sequencing and aCGH results ranged from 0.435 to 0.755, and qPCR experiments revealed a positive validation rate of 91.71% and a false negative rate of 22.43%. In total, 2,214 (25.0%) predicted CNVRs span 2,216 (36.4%) RefSeq genes associated with specific biological functions. Besides two previously reported copy number variable genes EDN3 and PRLR, we also found some promising genes with potential in phenotypic variation. Two genes, FZD6 and LIMS1, related to disease susceptibility/resistance are covered by CNVRs. The highly duplicated SOCS2 may lead to higher bone mineral density. Entire or partial duplication of some genes like POPDC3 may have great economic importance in poultry breeding. Our results based on extensive genetic diversity provide a more refined chicken CNV map and genome-wide gene copy number estimates, and warrant future CNV association studies for important traits in chickens.

  6. Genome-wide association studies of autoimmune vitiligo identify 23 new risk loci and highlight key pathways and regulatory variants

    Science.gov (United States)

    Jin, Ying; Andersen, Genevieve; Yorgov, Daniel; Ferrara, Tracey M; Ben, Songtao; Brownson, Kelly M; Holland, Paulene J; Birlea, Stanca A; Siebert, Janet; Hartmann, Anke; Lienert, Anne; van Geel, Nanja; Lambert, Jo; Luiten, Rosalie M; Wolkerstorfer, Albert; van der Veen, JP Wietze; Bennett, Dorothy C; Taïeb, Alain; Ezzedine, Khaled; Kemp, E Helen; Gawkrodger, David J; Weetman, Anthony P; Kõks, Sulev; Prans, Ele; Kingo, Külli; Karelson, Maire; Wallace, Margaret R; McCormack, Wayne T; Overbeck, Andreas; Moretti, Silvia; Colucci, Roberta; Picardo, Mauro; Silverberg, Nanette B; Olsson, Mats; Valle, Yan; Korobko, Igor; Böhm, Markus; Lim, Henry W.; Hamzavi, Iltefat; Zhou, Li; Mi, Qing-Sheng; Fain, Pamela R.; Santorico, Stephanie A; Spritz, Richard A

    2016-01-01

    Vitiligo is an autoimmune disease in which depigmented skin results from destruction of melanocytes1, with epidemiologic association with other autoimmune diseases2. In previous linkage and genome-wide association studies (GWAS1, GWAS2), we identified 27 vitiligo susceptibility loci in patients of European (EUR) ancestry. We carried out a third GWAS (GWAS3) in EUR subjects, with augmented GWAS1 and GWAS2 controls, genome-wide imputation, and meta-analysis of all three GWAS, followed by an independent replication. The combined analyses, with 4,680 cases and 39,586 controls, identified 23 new loci and 7 suggestive loci, most encoding immune and apoptotic regulators, some also associated with other autoimmune diseases, as well as several melanocyte regulators. Bioinformatic analyses indicate a predominance of causal regulatory variation, some corresponding to eQTL at these loci. Together, the identified genes provide a framework for vitiligo genetic architecture and pathobiology, highlight relationships to other autoimmune diseases and melanoma, and offer potential targets for treatment. PMID:27723757

  7. Genome-wide Association Analysis of Kernel Weight in Hard Winter Wheat

    Science.gov (United States)

    Wheat kernel weight is an important and heritable component of wheat grain yield and a key predictor of flour extraction. Genome-wide association analysis was conducted to identify genomic regions associated with kernel weight and kernel weight environmental response in 8 trials of 299 hard winter ...

  8. Comparative genomics and transcriptomics of trait-gene association

    Directory of Open Access Journals (Sweden)

    Pierlé Sebastián

    2012-11-01

    Full Text Available Abstract Background The Order Rickettsiales includes important tick-borne pathogens, from Rickettsia rickettsii, which causes Rocky Mountain spotted fever, to Anaplasma marginale, the most prevalent vector-borne pathogen of cattle. Although most pathogens in this Order are transmitted by arthropod vectors, little is known about the microbial determinants of transmission. A. marginale provides unique tools for studying the determinants of transmission, with multiple strain sequences available that display distinct and reproducible transmission phenotypes. The closed core A. marginale genome suggests that any phenotypic differences are due to single nucleotide polymorphisms (SNPs. We combined DNA/RNA comparative genomic approaches using strains with different tick transmission phenotypes and identified genes that segregate with transmissibility. Results Comparison of seven strains with different transmission phenotypes generated a list of SNPs affecting 18 genes and nine promoters. Transcriptional analysis found two candidate genes downstream from promoter SNPs that were differentially transcribed. To corroborate the comparative genomics approach we used three RNA-seq platforms to analyze the transcriptomes from two A. marginale strains with different transmission phenotypes. RNA-seq analysis confirmed the comparative genomics data and found 10 additional genes whose transcription between strains with distinct transmission efficiencies was significantly different. Six regions of the genome that contained no annotation were found to be transcriptionally active, and two of these newly identified transcripts were differentially transcribed. Conclusions This approach identified 30 genes and two novel transcripts potentially involved in tick transmission. We describe the transcriptome of an obligate intracellular bacterium in depth, while employing massive parallel sequencing to dissect an important trait in bacterial pathogenesis.

  9. Comparative Genomics of the Genus Porphyromonas Identifies Adaptations for Heme Synthesis within the Prevalent Canine Oral Species Porphyromonas cangingivalis.

    Science.gov (United States)

    O'Flynn, Ciaran; Deusch, Oliver; Darling, Aaron E; Eisen, Jonathan A; Wallis, Corrin; Davis, Ian J; Harris, Stephen J

    2015-11-13

    Porphyromonads play an important role in human periodontal disease and recently have been shown to be highly prevalent in canine mouths. Porphyromonas cangingivalis is the most prevalent canine oral bacterial species in both plaque from healthy gingiva and plaque from dogs with early periodontitis. The ability of P. cangingivalis to flourish in the different environmental conditions characterized by these two states suggests a degree of metabolic flexibility. To characterize the genes responsible for this, the genomes of 32 isolates (including 18 newly sequenced and assembled) from 18 Porphyromonad species from dogs, humans, and other mammals were compared. Phylogenetic trees inferred using core genes largely matched previous findings; however, comparative genomic analysis identified several genes and pathways relating to heme synthesis that were present in P. cangingivalis but not in other Porphyromonads. Porphyromonas cangingivalis has a complete protoporphyrin IX synthesis pathway potentially allowing it to synthesize its own heme unlike pathogenic Porphyromonads such as Porphyromonas gingivalis that acquire heme predominantly from blood. Other pathway differences such as the ability to synthesize siroheme and vitamin B12 point to enhanced metabolic flexibility for P. cangingivalis, which may underlie its prevalence in the canine oral cavity. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  10. Deep whole-genome sequencing of 90 Han Chinese genomes.

    Science.gov (United States)

    Lan, Tianming; Lin, Haoxiang; Zhu, Wenjuan; Laurent, Tellier Christian Asker Melchior; Yang, Mengcheng; Liu, Xin; Wang, Jun; Wang, Jian; Yang, Huanming; Xu, Xun; Guo, Xiaosen

    2017-09-01

    Next-generation sequencing provides a high-resolution insight into human genetic information. However, the focus of previous studies has primarily been on low-coverage data due to the high cost of sequencing. Although the 1000 Genomes Project and the Haplotype Reference Consortium have both provided powerful reference panels for imputation, low-frequency and novel variants remain difficult to discover and call with accuracy on the basis of low-coverage data. Deep sequencing provides an optimal solution for the problem of these low-frequency and novel variants. Although whole-exome sequencing is also a viable choice for exome regions, it cannot account for noncoding regions, sometimes resulting in the absence of important, causal variants. For Han Chinese populations, the majority of variants have been discovered based upon low-coverage data from the 1000 Genomes Project. However, high-coverage, whole-genome sequencing data are limited for any population, and a large amount of low-frequency, population-specific variants remain uncharacterized. We have performed whole-genome sequencing at a high depth (∼×80) of 90 unrelated individuals of Chinese ancestry, collected from the 1000 Genomes Project samples, including 45 Northern Han Chinese and 45 Southern Han Chinese samples. Eighty-three of these 90 have been sequenced by the 1000 Genomes Project. We have identified 12 568 804 single nucleotide polymorphisms, 2 074 210 short InDels, and 26 142 structural variations from these 90 samples. Compared to the Han Chinese data from the 1000 Genomes Project, we have found 7 000 629 novel variants with low frequency (defined as minor allele frequency genome. Compared to the 1000 Genomes Project, these Han Chinese deep sequencing data enhance the characterization of a large number of low-frequency, novel variants. This will be a valuable resource for promoting Chinese genetics research and medical development. Additionally, it will provide a valuable supplement to the 1000

  11. Meta-analysis of genome-wide association studies identifies novel loci that influence cupping and the glaucomatous process

    NARCIS (Netherlands)

    Springelkamp, Henriët; Höhn, René; Mishra, Aniket; Hysi, Pirro G; Khor, Chiea-Chuen; Loomis, Stephanie J; Bailey, Jessica N Cooke; Gibson, Jane; Thorleifsson, Gudmar; Janssen, Sarah F; Luo, Xiaoyan; Ramdas, Wishal D; Vithana, Eranga; Nongpiur, Monisha E; Montgomery, Grant W; Xu, Liang; Mountain, Jenny E; Gharahkhani, Puya; Lu, Yi; Amin, Najaf; Karssen, Lennart C; Sim, Kar-Seng; van Leeuwen, Elisabeth M; Iglesias, Adriana I; Verhoeven, Virginie J M; Hauser, Michael A; Loon, Seng-Chee; Despriet, Dominiek D G; Nag, Abhishek; Venturini, Cristina; Sanfilippo, Paul G; Schillert, Arne; Kang, Jae H; Landers, John; Jonasson, Fridbert; Cree, Angela J; van Koolwijk, Leonieke M E; Rivadeneira, Fernando; Souzeau, Emmanuelle; Jonsson, Vesteinn; Menon, Geeta; Weinreb, Robert N; de Jong, Paulus T V M; Oostra, Ben A; Uitterlinden, André G; Hofman, Albert; Ennis, Sarah; Thorsteinsdottir, Unnur; Burdon, Kathryn P; Spector, Timothy D; Mirshahi, Alireza; Saw, Seang-Mei; Vingerling, Johannes R; Teo, Yik-Ying; Haines, Jonathan L; Wolfs, Roger C W; Lemij, Hans G; Tai, E-Shyong; Jansonius, Nomdo M; Jonas, Jost B; Cheng, Ching-Yu; Aung, Tin; Viswanathan, Ananth C; Klaver, Caroline C W; Craig, Jamie E; Macgregor, Stuart; Mackey, David A; Lotery, Andrew J; Stefansson, Kari; Bergen, Arthur A B; Young, Terri L; Wiggs, Janey L; Pfeiffer, Norbert; Wong, Tien-Yin; Pasquale, Louis R; Hewitt, Alex W; van Duijn, Cornelia M; Hammond, Christopher J

    2014-01-01

    Glaucoma is characterized by irreversible optic nerve degeneration and is the most frequent cause of irreversible blindness worldwide. Here, the International Glaucoma Genetics Consortium conducts a meta-analysis of genome-wide association studies of vertical cup-disc ratio (VCDR), an important

  12. Gene interactions in the DNA damage-response pathway identified by genome-wide RNA-interference analysis of synthetic lethality

    NARCIS (Netherlands)

    van Haaften, Gijs; Vastenhouw, Nadine L; Nollen, Ellen A A; Plasterk, Ronald H A; Tijsterman, Marcel

    2004-01-01

    Here, we describe a systematic search for synthetic gene interactions in a multicellular organism, the nematode Caenorhabditis elegans. We established a high-throughput method to determine synthetic gene interactions by genome-wide RNA interference and identified genes that are required to protect

  13. Comparative inference of duplicated genes produced by polyploidization in soybean genome.

    Science.gov (United States)

    Yang, Yanmei; Wang, Jinpeng; Di, Jianyong

    2013-01-01

    Soybean (Glycine max) is one of the most important crop plants for providing protein and oil. It is important to investigate soybean genome for its economic and scientific value. Polyploidy is a widespread and recursive phenomenon during plant evolution, and it could generate massive duplicated genes which is an important resource for genetic innovation. Improved sequence alignment criteria and statistical analysis are used to identify and characterize duplicated genes produced by polyploidization in soybean. Based on the collinearity method, duplicated genes by whole genome duplication account for 70.3% in soybean. From the statistical analysis of the molecular distances between duplicated genes, our study indicates that the whole genome duplication event occurred more than once in the genome evolution of soybean, which is often distributed near the ends of chromosomes.

  14. Identifying Rare Variation in Cases of Schizophrenia in the Isolated Population of the Faroe Islands using Whole-genome Sequencing

    DEFF Research Database (Denmark)

    Als, Thomas Damm; Lescai, Francesco; Dahl, Hans

    to map risk variants involved in complex traits. We aim at utilizing samples of cases and controls of the isolated population of the Faroe Islands to conduct whole-genome-sequence analysis in order to identify rare genetic variants associated with schizophrenia. We will search for rare genetic variants...... of developing SZ. However, these studies are designed to examining only “the common variant” proportion of the genomic landscape of SZ. Due to increased genetic drift during founding and potential bottlenecks, followed by population expansion, isolated populations may be particularly useful in identifying rare...... disease variants, that may appear at higher frequencies and/or within a more clearly distinct haplotype structure compared to outbred populations. Small isolated populations also typically show reduced phenotypic, genetic and environmental heterogeneity, thus making them advantageous in studies aiming...

  15. Genome Maps, a new generation genome browser.

    Science.gov (United States)

    Medina, Ignacio; Salavert, Francisco; Sanchez, Rubén; de Maria, Alejandro; Alonso, Roberto; Escobar, Pablo; Bleda, Marta; Dopazo, Joaquín

    2013-07-01

    Genome browsers have gained importance as more genomes and related genomic information become available. However, the increase of information brought about by new generation sequencing technologies is, at the same time, causing a subtle but continuous decrease in the efficiency of conventional genome browsers. Here, we present Genome Maps, a genome browser that implements an innovative model of data transfer and management. The program uses highly efficient technologies from the new HTML5 standard, such as scalable vector graphics, that optimize workloads at both server and client sides and ensure future scalability. Thus, data management and representation are entirely carried out by the browser, without the need of any Java Applet, Flash or other plug-in technology installation. Relevant biological data on genes, transcripts, exons, regulatory features, single-nucleotide polymorphisms, karyotype and so forth, are imported from web services and are available as tracks. In addition, several DAS servers are already included in Genome Maps. As a novelty, this web-based genome browser allows the local upload of huge genomic data files (e.g. VCF or BAM) that can be dynamically visualized in real time at the client side, thus facilitating the management of medical data affected by privacy restrictions. Finally, Genome Maps can easily be integrated in any web application by including only a few lines of code. Genome Maps is an open source collaborative initiative available in the GitHub repository (https://github.com/compbio-bigdata-viz/genome-maps). Genome Maps is available at: http://www.genomemaps.org.

  16. Genome-wide association study identifies shared risk loci common to two malignancies in golden retrievers.

    Directory of Open Access Journals (Sweden)

    Noriko Tonomura

    2015-02-01

    Full Text Available Dogs, with their breed-determined limited genetic background, are great models of human disease including cancer. Canine B-cell lymphoma and hemangiosarcoma are both malignancies of the hematologic system that are clinically and histologically similar to human B-cell non-Hodgkin lymphoma and angiosarcoma, respectively. Golden retrievers in the US show significantly elevated lifetime risk for both B-cell lymphoma (6% and hemangiosarcoma (20%. We conducted genome-wide association studies for hemangiosarcoma and B-cell lymphoma, identifying two shared predisposing loci. The two associated loci are located on chromosome 5, and together contribute ~20% of the risk of developing these cancers. Genome-wide p-values for the top SNP of each locus are 4.6×10-7 and 2.7×10-6, respectively. Whole genome resequencing of nine cases and controls followed by genotyping and detailed analysis identified three shared and one B-cell lymphoma specific risk haplotypes within the two loci, but no coding changes were associated with the risk haplotypes. Gene expression analysis of B-cell lymphoma tumors revealed that carrying the risk haplotypes at the first locus is associated with down-regulation of several nearby genes including the proximal gene TRPC6, a transient receptor Ca2+-channel involved in T-cell activation, among other functions. The shared risk haplotype in the second locus overlaps the vesicle transport and release gene STX8. Carrying the shared risk haplotype is associated with gene expression changes of 100 genes enriched for pathways involved in immune cell activation. Thus, the predisposing germ-line mutations in B-cell lymphoma and hemangiosarcoma appear to be regulatory, and affect pathways involved in T-cell mediated immune response in the tumor. This suggests that the interaction between the immune system and malignant cells plays a common role in the tumorigenesis of these relatively different cancers.

  17. High-Resolution Genome-Wide Linkage Mapping Identifies Susceptibility Loci for BMI in the Chinese Population

    DEFF Research Database (Denmark)

    Zhang, Dong Feng; Pang, Zengchang; Li, Shuxia

    2012-01-01

    The genetic loci affecting the commonly used BMI have been intensively investigated using linkage approaches in multiple populations. This study aims at performing the first genome-wide linkage scan on BMI in the Chinese population in mainland China with hypothesis that heterogeneity in genetic...... linkage could exist in different ethnic populations. BMI was measured from 126 dizygotic twins in Qingdao municipality who were genotyped using high-resolution Affymetrix Genome-Wide Human SNP arrays containing about 1 million single-nucleotide polymorphisms (SNPs). Nonparametric linkage analysis...... in western countries. Multiple loci showing suggestive linkage were found on chromosome 1 (lod score 2.38 at 242 cM), chromosome 8 (2.48 at 95 cM), and chromosome 14 (2.2 at 89.4 cM). The strong linkage identified in the Chinese subjects that is consistent with that found in populations of European origin...

  18. Use of microsatellite markers derived from whole genome sequence data for identifying polymorphism in Phytophthora ramorum

    Science.gov (United States)

    Kelly Ivors; Matteo Garbelotto; Ineke De Vries; Peter Bonants

    2006-01-01

    Investigating the population genetics of Phytophthora ramorum, the causal agent of sudden oak death (SOD), is critical to understanding the biology and epidemiology of this important phytopathogen. Raw sequence data (445,000 reads) of P. ramorum was provided by the Joint Genome Institute. Our objective was to develop and utilize...

  19. Genome wide analysis of inbred mouse lines identifies a locus containing Ppar-gamma as contributing to enhanced malaria survival.

    Directory of Open Access Journals (Sweden)

    Selina E R Bopp

    2010-05-01

    Full Text Available The genetic background of a patient determines in part if a person develops a mild form of malaria and recovers, or develops a severe form and dies. We have used a mouse model to detect genes involved in the resistance or susceptibility to Plasmodium berghei malaria infection. To this end we first characterized 32 different mouse strains infected with P. berghei and identified survival as the best trait to discriminate between the strains. We found a locus on chromosome 6 by linking the survival phenotypes of the mouse strains to their genetic variations using genome wide analyses such as haplotype associated mapping and the efficient mixed-model for association. This new locus involved in malaria resistance contains only two genes and confirms the importance of Ppar-gamma in malaria infection.

  20. Cancer associated epigenetic transitions identified by genome-wide histone methylation binding profiles in human colorectal cancer samples and paired normal mucosa

    International Nuclear Information System (INIS)

    Enroth, Stefan; Rada-Iglesisas, Alvaro; Andersson, Robin; Wallerman, Ola; Wanders, Alkwin; Påhlman, Lars; Komorowski, Jan; Wadelius, Claes

    2011-01-01

    Despite their well-established functional roles, histone modifications have received less attention than DNA methylation in the cancer field. In order to evaluate their importance in colorectal cancer (CRC), we generated the first genome-wide histone modification profiles in paired normal colon mucosa and tumor samples. Chromatin immunoprecipitation and microarray hybridization (ChIP-chip) was used to identify promoters enriched for histone H3 trimethylated on lysine 4 (H3K4me3) and lysine 27 (H3K27me3) in paired normal colon mucosa and tumor samples from two CRC patients and for the CRC cell line HT29. By comparing histone modification patterns in normal mucosa and tumors, we found that alterations predicted to have major functional consequences were quite rare. Furthermore, when normal or tumor tissue samples were compared to HT29, high similarities were observed for H3K4me3. However, the differences found for H3K27me3, which is important in determining cellular identity, indicates that cell lines do not represent optimal tissue models. Finally, using public expression data, we uncovered previously unknown changes in CRC expression patterns. Genes positive for H3K4me3 in normal and/or tumor samples, which are typically already active in normal mucosa, became hyperactivated in tumors, while genes with H3K27me3 in normal and/or tumor samples and which are expressed at low levels in normal mucosa, became hypersilenced in tumors. Genome wide histone modification profiles can be used to find epigenetic aberrations in genes associated with cancer. This strategy gives further insights into the epigenetic contribution to the oncogenic process and may identify new biomarkers

  1. Evolution of endogenous non-retroviral genes integrated into plant genomes

    Directory of Open Access Journals (Sweden)

    Hyosub Chu

    2014-08-01

    Full Text Available Numerous comparative genome analyses have revealed the wide extent of horizontal gene transfer (HGT in living organisms, which contributes to their evolution and genetic diversity. Viruses play important roles in HGT. Endogenous viral elements (EVEs are defined as viral DNA sequences present within the genomes of non-viral organisms. In eukaryotic cells, the majority of EVEs are derived from RNA viruses using reverse transcription. In contrast, endogenous non-retroviral elements (ENREs are poorly studied. However, the increasing availability of genomic data and the rapid development of bioinformatics tools have enabled the identification of several ENREs in various eukaryotic organisms. To date, a small number of ENREs integrated into plant genomes have been identified. Of the known non-retroviruses, most identified ENREs are derived from double-strand (ds RNA viruses, followed by single-strand (ss DNA and ssRNA viruses. At least eight virus families have been identified. Of these, viruses in the family Partitiviridae are dominant, followed by viruses of the families Chrysoviridae and Geminiviridae. The identified ENREs have been primarily identified in eudicots, followed by monocots. In this review, we briefly discuss the current view on non-retroviral sequences integrated into plant genomes that are associated with plant-virus evolution and their possible roles in antiviral resistance.

  2. Replication protein A, the laxative that keeps DNA regular: The importance of RPA phosphorylation in maintaining genome stability.

    Science.gov (United States)

    Byrne, Brendan M; Oakley, Gregory G

    2018-04-20

    The eukaryotic ssDNA-binding protein, Replication protein A (RPA), was first discovered almost three decades ago. Since then, much progress has been made to elucidate the critical roles for RPA in DNA metabolic pathways that help promote genomic stability. The canonical RPA heterotrimer (RPA1-3) is an essential coordinator of DNA metabolism that interacts with ssDNA and numerous protein partners to coordinate its roles in DNA replication, repair, recombination and telomere maintenance. An alternative form of RPA, termed aRPA, is formed by a complex of RPA4 with RPA1 and RPA3. aRPA is expressed differentially in cells compared to canonical RPA and has been shown to inhibit canonical RPA function while allowing for regular maintenance of cell viability. Interestingly, while aRPA is defective in DNA replication and cell cycle progression, it was shown to play a supporting role in nucleotide excision repair and recombination. The binding domains of canonical RPA interact with a growing number of partners involved in numerous genome maintenance processes. The protein interactions of the RPA-ssDNA complex are not only governed by competition between the binding proteins but also by post-translation modifications such as phosphorylation. Phosphorylation of RPA2 is an important post-translational modification of the RPA complex, and is essential for directing context-specific functions of the RPA complex in the DNA damage response. Due to the importance of RPA in cellular metabolism, it was identified as an appealing target for chemotherapeutic drug development that could be used in future cancer treatment regimens. Copyright © 2018 Elsevier Ltd. All rights reserved.

  3. Evidence-based gene models for structural and functional annotations of the oil palm genome.

    Science.gov (United States)

    Chan, Kuang-Lim; Tatarinova, Tatiana V; Rosli, Rozana; Amiruddin, Nadzirah; Azizi, Norazah; Halim, Mohd Amin Ab; Sanusi, Nik Shazana Nik Mohd; Jayanthi, Nagappan; Ponomarenko, Petr; Triska, Martin; Solovyev, Victor; Firdaus-Raih, Mohd; Sambanthamurthi, Ravigadevi; Murphy, Denis; Low, Eng-Ti Leslie

    2017-09-08

    Oil palm is an important source of edible oil. The importance of the crop, as well as its long breeding cycle (10-12 years) has led to the sequencing of its genome in 2013 to pave the way for genomics-guided breeding. Nevertheless, the first set of gene predictions, although useful, had many fragmented genes. Classification and characterization of genes associated with traits of interest, such as those for fatty acid biosynthesis and disease resistance, were also limited. Lipid-, especially fatty acid (FA)-related genes are of particular interest for the oil palm as they specify oil yields and quality. This paper presents the characterization of the oil palm genome using different gene prediction methods and comparative genomics analysis, identification of FA biosynthesis and disease resistance genes, and the development of an annotation database and bioinformatics tools. Using two independent gene-prediction pipelines, Fgenesh++ and Seqping, 26,059 oil palm genes with transcriptome and RefSeq support were identified from the oil palm genome. These coding regions of the genome have a characteristic broad distribution of GC 3 (fraction of cytosine and guanine in the third position of a codon) with over half the GC 3 -rich genes (GC 3  ≥ 0.75286) being intronless. In comparison, only one-seventh of the oil palm genes identified are intronless. Using comparative genomics analysis, characterization of conserved domains and active sites, and expression analysis, 42 key genes involved in FA biosynthesis in oil palm were identified. For three of them, namely EgFABF, EgFABH and EgFAD3, segmental duplication events were detected. Our analysis also identified 210 candidate resistance genes in six classes, grouped by their protein domain structures. We present an accurate and comprehensive annotation of the oil palm genome, focusing on analysis of important categories of genes (GC 3 -rich and intronless), as well as those associated with important functions, such as FA

  4. Genomic interval engineering of mice identified a novel modulator of triglyceride production

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Y.; Jong, M.C.; Frazer, K.A.; Gong, E.; Krauss, R.M.; Cheng, J.F.; Boffelli, D.; Rubin, E.M.

    1999-10-01

    To accelerate the biological annotation of novel genes discovered in sequenced of mammalian genomes, we are creating large deletions in the mouse genome targeted to include clusters of such genes. Here we describe the targeted deletion of a 450 kb region on mouse chromosome 11 which, based on computational analysis of the deleted murine sequences and human 5q orthologous sequences, codes for nine putative genes. Mice homozygous for the deletion had a variety of abnormalities including severe hypertriglyceridemia, hepatic and cardiac enlargement, growth retardation and premature mortality. Analysis of triglyceride metabolism in these animals demonstrated a several-fold increase in hepatic very-low density lipoprotein (VLDL) triglyceride secretion, the most prevalent mechanism responsible for hypertriglyceridemia in humans. A series of mouse BAC and human YAC transgenes covering different intervals of the 450 kb deleted region were assessed for their ability to complement the deletion induced abnormalities. These studies revealed that OCTN2, a gene recently shown to play a role in carnitine transport, was able to correct the triglyceride abnormalities. The discovery of this previously unappreciated relationship between OCTN2, carnitine and hepatic triglyceride production is of particular importance due to the clinical consequence of hypertriglyceridemia and the paucity of genes known to modulate triglyceride secretion.

  5. Integrating Diverse Types of Genomic Data to Identify Genes that Underlie Adverse Pregnancy Phenotypes.

    Directory of Open Access Journals (Sweden)

    Jibril Hirbo

    Full Text Available Progress in understanding complex genetic diseases has been bolstered by synthetic approaches that overlay diverse data types and analyses to identify functionally important genes. Pre-term birth (PTB, a major complication of pregnancy, is a leading cause of infant mortality worldwide. A major obstacle in addressing PTB is that the mechanisms controlling parturition and birth timing remain poorly understood. Integrative approaches that overlay datasets derived from comparative genomics with function-derived ones have potential to advance our understanding of the genetics of birth timing, and thus provide insights into the genes that may contribute to PTB. We intersected data from fast evolving coding and non-coding gene regions in the human and primate lineage with data from genes expressed in the placenta, from genes that show enriched expression only in the placenta, as well as from genes that are differentially expressed in four distinct PTB clinical subtypes. A large fraction of genes that are expressed in placenta, and differentially expressed in PTB clinical subtypes (23-34% are fast evolving, and are associated with functions that include adhesion neurodevelopmental and immune processes. Functional categories of genes that express fast evolution in coding regions differ from those linked to fast evolution in non-coding regions. Finally, there is a surprising lack of overlap between fast evolving genes that are differentially expressed in four PTB clinical subtypes. Integrative approaches, especially those that incorporate evolutionary perspectives, can be successful in identifying potential genetic contributions to complex genetic diseases, such as PTB.

  6. Genomics of Preterm Birth

    Science.gov (United States)

    Swaggart, Kayleigh A.; Pavlicev, Mihaela; Muglia, Louis J.

    2015-01-01

    The molecular mechanisms controlling human birth timing at term, or resulting in preterm birth, have been the focus of considerable investigation, but limited insights have been gained over the past 50 years. In part, these processes have remained elusive because of divergence in reproductive strategies and physiology shown by model organisms, making extrapolation to humans uncertain. Here, we summarize the evolution of progesterone signaling and variation in pregnancy maintenance and termination. We use this comparative physiology to support the hypothesis that selective pressure on genomic loci involved in the timing of parturition have shaped human birth timing, and that these loci can be identified with comparative genomic strategies. Previous limitations imposed by divergence of mechanisms provide an important new opportunity to elucidate fundamental pathways of parturition control through increasing availability of sequenced genomes and associated reproductive physiology characteristics across diverse organisms. PMID:25646385

  7. Genome-wide association study identifies multiple loci associated with both mammographic density and breast cancer risk

    Science.gov (United States)

    Lindström, Sara; Thompson, Deborah J.; Paterson, Andrew D.; Li, Jingmei; Gierach, Gretchen L.; Scott, Christopher; Stone, Jennifer; Douglas, Julie A.; dos-Santos-Silva, Isabel; Fernandez-Navarro, Pablo; Verghase, Jajini; Smith, Paula; Brown, Judith; Luben, Robert; Wareham, Nicholas J.; Loos, Ruth J.F.; Heit, John A.; Pankratz, V. Shane; Norman, Aaron; Goode, Ellen L.; Cunningham, Julie M.; deAndrade, Mariza; Vierkant, Robert A.; Czene, Kamila; Fasching, Peter A.; Baglietto, Laura; Southey, Melissa C.; Giles, Graham G.; Shah, Kaanan P.; Chan, Heang-Ping; Helvie, Mark A.; Beck, Andrew H.; Knoblauch, Nicholas W.; Hazra, Aditi; Hunter, David J.; Kraft, Peter; Pollan, Marina; Figueroa, Jonine D.; Couch, Fergus J.; Hopper, John L.; Hall, Per; Easton, Douglas F.; Boyd, Norman F.; Vachon, Celine M.; Tamimi, Rulla M.

    2015-01-01

    Mammographic density reflects the amount of stromal and epithelial tissues in relation to adipose tissue in the breast and is a strong risk factor for breast cancer. Here we report the results from meta-analysis of genome-wide association studies (GWAS) of three mammographic density phenotypes: dense area, non-dense area and percent density in up to 7,916 women in stage 1 and an additional 10,379 women in stage 2. We identify genome-wide significant (P<5×10−8) loci for dense area (AREG, ESR1, ZNF365, LSP1/TNNT3, IGF1, TMEM184B, SGSM3/MKL1), non-dense area (8p11.23) and percent density (PRDM6, 8p11.23, TMEM184B). Four of these regions are known breast cancer susceptibility loci, and four additional regions were found to be associated with breast cancer (P<0.05) in a large meta-analysis. These results provide further evidence of a shared genetic basis between mammographic density and breast cancer and illustrate the power of studying intermediate quantitative phenotypes to identify putative disease susceptibility loci. PMID:25342443

  8. Genome-wide analysis of multi-ancestry cohorts identifies new loci influencing intraocular pressure and susceptibility to glaucoma

    NARCIS (Netherlands)

    Hysi, Pirro G.; Cheng, Ching-Yu; Springelkamp, Henriet; Macgregor, Stuart; Bailey, Jessica N. Cooke; Wojciechowski, Robert; Vitart, Veronique; Nag, Abhishek; Hewitt, Alex W.; Hohn, Rene; Venturini, Cristina; Mirshahi, Alireza; Ramdas, Wishal D.; Thorleifsson, Gudmar; Vithana, Eranga; Khor, Chiea-Chuen; Stefansson, Arni B.; Liao, Jiemin; Haines, Jonathan L.; Amin, Najaf; Wang, Ya Xing; Wild, Philipp S.; Ozel, Ayse B.; Li, Jun Z.; Fleck, Brian W.; Zeller, Tanja; Staffieri, Sandra E.; Teo, Yik-Ying; Cuellar-Partida, Gabriel; Luo, Xiaoyan; Allingham, R. Rand; Richards, Julia E.; Senft, Andrea; Karssen, Lennart C.; Zheng, Yingfeng; Bellenguez, Celine; Xu, Liang; Iglesias, Adriana I.; Wilson, James F.; Kang, Jae H.; van Leeuwen, Elisabeth M.; Jonsson, Vesteinn; Thorsteinsdottir, Unnur; Despriet, Dominiek D. G.; Ennis, Sarah; Moroi, Sayoko E.; Martin, Nicholas G.; Jansonius, Nomdo M.; Yazar, Seyhan; Tai, E-Shyong

    2014-01-01

    Elevated intraocular pressure (IOP) is an important risk factor in developing glaucoma, and variability in IOP might herald glaucomatous development or progression. We report the results of a genome-wide association study meta-analysis of 18 population cohorts from the International Glaucoma

  9. Meta-analysis of five genome-wide association studies identifies multiple new loci associated with testicular germ cell tumor

    DEFF Research Database (Denmark)

    Wang, Zhaoming; McGlynn, Katherine A.; Rajpert-De Meyts, Ewa

    2017-01-01

    The international Testicular Cancer Consortium (TECAC) combined five published genome-wide association studies of testicular germ cell tumor (TGCT; 3,558 cases and 13,970 controls) to identify new susceptibility loci. We conducted a fixed-effects meta-analysis, including, to our knowledge, the fi...

  10. Stakeholder engagement in policy development: challenges and opportunities for human genomics

    OpenAIRE

    Lemke, Amy A.; Harris-Wai, Julie N.

    2015-01-01

    Along with rapid advances in human genomics, policies governing genomic data and clinical technologies have proliferated. Stakeholder engagement is widely lauded as an important methodology for improving clinical, scientific, and public health policy decision making. The purpose of this paper is to examine how stakeholder engagement is used to develop policies in genomics research and public health areas, as well as to identify future priorities for conducting evidence-based stakeholder engag...

  11. Preliminary Genomic Characterization of Ten Hardwood Tree Species from Multiplexed Low Coverage Whole Genome Sequencing.

    Directory of Open Access Journals (Sweden)

    Margaret Staton

    Full Text Available Forest health issues are on the rise in the United States, resulting from introduction of alien pests and diseases, coupled with abiotic stresses related to climate change. Increasingly, forest scientists are finding genetic/genomic resources valuable in addressing forest health issues. For a set of ten ecologically and economically important native hardwood tree species representing a broad phylogenetic spectrum, we used low coverage whole genome sequencing from multiplex Illumina paired ends to economically profile their genomic content. For six species, the genome content was further analyzed by flow cytometry in order to determine the nuclear genome size. Sequencing yielded a depth of 0.8X to 7.5X, from which in silico analysis yielded preliminary estimates of gene and repetitive sequence content in the genome for each species. Thousands of genomic SSRs were identified, with a clear predisposition toward dinucleotide repeats and AT-rich repeat motifs. Flanking primers were designed for SSR loci for all ten species, ranging from 891 loci in sugar maple to 18,167 in redbay. In summary, we have demonstrated that useful preliminary genome information including repeat content, gene content and useful SSR markers can be obtained at low cost and time input from a single lane of Illumina multiplex sequence.

  12. A Genome-Wide Association Study Identifies Risk Loci to Equine Recurrent Uveitis in German Warmblood Horses

    Science.gov (United States)

    Kulbrock, Maike; Lehner, Stefanie; Metzger, Julia; Ohnesorge, Bernhard; Distl, Ottmar

    2013-01-01

    Equine recurrent uveitis (ERU) is a common eye disease affecting up to 3–15% of the horse population. A genome-wide association study (GWAS) using the Illumina equine SNP50 bead chip was performed to identify loci conferring risk to ERU. The sample included a total of 144 German warmblood horses. A GWAS showed a significant single nucleotide polymorphism (SNP) on horse chromosome (ECA) 20 at 49.3 Mb, with IL-17A and IL-17F being the closest genes. This locus explained a fraction of 23% of the phenotypic variance for ERU. A GWAS taking into account the severity of ERU, revealed a SNP on ECA18 nearby to the crystalline gene cluster CRYGA-CRYGF. For both genomic regions on ECA18 and 20, significantly associated haplotypes containing the genome-wide significant SNPs could be demonstrated. In conclusion, our results are indicative for a genetic component regulating the possible critical role of IL-17A and IL-17F in the pathogenesis of ERU. The associated SNP on ECA18 may be indicative for cataract formation in the course of ERU. PMID:23977091

  13. Genome-wide RNAi Screening to Identify Host Factors That Modulate Oncolytic Virus Therapy.

    Science.gov (United States)

    Allan, Kristina J; Mahoney, Douglas J; Baird, Stephen D; Lefebvre, Charles A; Stojdl, David F

    2018-04-03

    High-throughput genome-wide RNAi (RNA interference) screening technology has been widely used for discovering host factors that impact virus replication. Here we present the application of this technology to uncovering host targets that specifically modulate the replication of Maraba virus, an oncolytic rhabdovirus, and vaccinia virus with the goal of enhancing therapy. While the protocol has been tested for use with oncolytic Maraba virus and oncolytic vaccinia virus, this approach is applicable to other oncolytic viruses and can also be utilized for identifying host targets that modulate virus replication in mammalian cells in general. This protocol describes the development and validation of an assay for high-throughput RNAi screening in mammalian cells, the key considerations and preparation steps important for conducting a primary high-throughput RNAi screen, and a step-by-step guide for conducting a primary high-throughput RNAi screen; in addition, it broadly outlines the methods for conducting secondary screen validation and tertiary validation studies. The benefit of high-throughput RNAi screening is that it allows one to catalogue, in an extensive and unbiased fashion, host factors that modulate any aspect of virus replication for which one can develop an in vitro assay such as infectivity, burst size, and cytotoxicity. It has the power to uncover biotherapeutic targets unforeseen based on current knowledge.

  14. The Complete Chloroplast Genome Sequence of Tree of Heaven (Ailanthus altissima (Mill. (Sapindales: Simaroubaceae, an Important Pantropical Tree

    Directory of Open Access Journals (Sweden)

    Josphat K. Saina

    2018-03-01

    Full Text Available Ailanthus altissima (Mill. Swingle (Simaroubaceae is a deciduous tree widely distributed throughout temperate regions in China, hence suitable for genetic diversity and evolutionary studies. Previous studies in A. altissima have mainly focused on its biological activities, genetic diversity and genetic structure. However, until now there is no published report regarding genome of this plant species or Simaroubaceae family. Therefore, in this paper, we first characterized A. altissima complete chloroplast genome sequence. The tree of heaven chloroplast genome was found to be a circular molecule 160,815 base pairs (bp in size and possess a quadripartite structure. The A. altissima chloroplast genome contains 113 unique genes of which 79 and 30 are protein coding and transfer RNA (tRNA genes respectively and also 4 ribosomal RNA genes (rRNA with overall GC content of 37.6%. Microsatellite marker detection identified A/T mononucleotides as majority SSRs in all the seven analyzed genomes. Repeat analyses of seven Sapindales revealed a total of 49 repeats in A. altissima, Rhus chinensis, Dodonaea viscosa, Leitneria floridana, while Azadirachta indica, Boswellia sacra, and Citrus aurantiifolia had a total of 48 repeats. The phylogenetic analysis using protein coding genes revealed that A. altissima is a sister to Leitneria floridana and also suggested that Simaroubaceae is a sister to Rutaceae family. The genome information reported here could be further applied for evolution and invasion, population genetics, and molecular studies in this plant species and family.

  15. Genomic Resource and Genome Guided Comparison of Twenty Type Strains of the Genus Methylobacterium

    Directory of Open Access Journals (Sweden)

    Vasvi Chaudhry

    2017-12-01

    Full Text Available Bacteria of the genus Methylobacterium are widespread in diverse habitats ranging from soil, water and plant (phyllosphere, rhizosphere and endosphere. In the present study, we in house generated genomic data resource of six type strains along with fourteen database genomes of the Methylobacterium genus to carry out phylogenomic, taxonomic, comparative and ecological studies of this genus. Overall, the genus shows high diversity and genetic variation primarily due to its ability to acquire genetic material from diverse sources through horizontal gene transfer. As majority of species identified in this study are plant associated with their genomes equipped with methylotrophy and photosynthesis related gene along with genes for plant probiotic traits. Most of the species genomes are equipped with genes for adaptation and defense for UV radiation, oxidative stress and desiccation. The genus has an open pan-genome and we predicted the role of gain/loss of prophages and CRISPR elements in diversity and evolution. Our genomic resource with annotation and analysis provides a platform for interspecies genomic comparisons in the genus Methylobacterium, and to unravel their natural genome diversity and to study how natural selection shapes their genome with the adaptive mechanisms which allow them to acquire diverse habitat lifestyles. This type strains genomic data display power of Next Generation Sequencing in rapidly creating resource paving the way for studies on phylogeny and taxonomy as well as for basic and applied research for this important genus.

  16. A meta-analysis of genome-wide association studies to identify prostate cancer susceptibility loci associated with aggressive and non-aggressive disease

    DEFF Research Database (Denmark)

    Amin Al Olama, Ali; Kote-Jarai, Zsofia; Schumacher, Fredrick R

    2013-01-01

    Genome-wide association studies (GWAS) have identified multiple common genetic variants associated with an increased risk of prostate cancer (PrCa), but these explain less than one-third of the heritability. To identify further susceptibility alleles, we conducted a meta-analysis of four GWAS inc...

  17. Whole Genome Sequencing for Genomics-Guided Investigations of Escherichia coli O157:H7 Outbreaks.

    Science.gov (United States)

    Rusconi, Brigida; Sanjar, Fatemeh; Koenig, Sara S K; Mammel, Mark K; Tarr, Phillip I; Eppinger, Mark

    2016-01-01

    Multi isolate whole genome sequencing (WGS) and typing for outbreak investigations has become a reality in the post-genomics era. We applied this technology to strains from Escherichia coli O157:H7 outbreaks. These include isolates from seven North America outbreaks, as well as multiple isolates from the same patient and from different infected individuals in the same household. Customized high-resolution bioinformatics sequence typing strategies were developed to assess the core genome and mobilome plasticity. Sequence typing was performed using an in-house single nucleotide polymorphism (SNP) discovery and validation pipeline. Discriminatory power becomes of particular importance for the investigation of isolates from outbreaks in which macrogenomic techniques such as pulse-field gel electrophoresis or multiple locus variable number tandem repeat analysis do not differentiate closely related organisms. We also characterized differences in the phage inventory, allowing us to identify plasticity among outbreak strains that is not detectable at the core genome level. Our comprehensive analysis of the mobilome identified multiple plasmids that have not previously been associated with this lineage. Applied phylogenomics approaches provide strong molecular evidence for exceptionally little heterogeneity of strains within outbreaks and demonstrate the value of intra-cluster comparisons, rather than basing the analysis on archetypal reference strains. Next generation sequencing and whole genome typing strategies provide the technological foundation for genomic epidemiology outbreak investigation utilizing its significantly higher sample throughput, cost efficiency, and phylogenetic relatedness accuracy. These phylogenomics approaches have major public health relevance in translating information from the sequence-based survey to support timely and informed countermeasures. Polymorphisms identified in this work offer robust phylogenetic signals that index both short- and

  18. Integration of transcriptome and whole genomic resequencing data to identify key genes affecting swine fat deposition.

    Directory of Open Access Journals (Sweden)

    Kai Xing

    Full Text Available Fat deposition is highly correlated with the growth, meat quality, reproductive performance and immunity of pigs. Fatty acid synthesis takes place mainly in the adipose tissue of pigs; therefore, in this study, a high-throughput massively parallel sequencing approach was used to generate adipose tissue transcriptomes from two groups of Songliao black pigs that had opposite backfat thickness phenotypes. The total number of paired-end reads produced for each sample was in the range of 39.29-49.36 millions. Approximately 188 genes were differentially expressed in adipose tissue and were enriched for metabolic processes, such as fatty acid biosynthesis, lipid synthesis, metabolism of fatty acids, etinol, caffeine and arachidonic acid and immunity. Additionally, many genetic variations were detected between the two groups through pooled whole-genome resequencing. Integration of transcriptome and whole-genome resequencing data revealed important genomic variations among the differentially expressed genes for fat deposition, for example, the lipogenic genes. Further studies are required to investigate the roles of candidate genes in fat deposition to improve pig breeding programs.

  19. A genome scale RNAi screen identifies GLI1 as a novel gene regulating vorinostat sensitivity.

    Science.gov (United States)

    Falkenberg, K J; Newbold, A; Gould, C M; Luu, J; Trapani, J A; Matthews, G M; Simpson, K J; Johnstone, R W

    2016-07-01

    Vorinostat is an FDA-approved histone deacetylase inhibitor (HDACi) that has proven clinical success in some patients; however, it remains unclear why certain patients remain unresponsive to this agent and other HDACis. Constitutive STAT (signal transducer and activator of transcription) activation, overexpression of prosurvival Bcl-2 proteins and loss of HR23B have been identified as potential biomarkers of HDACi resistance; however, none have yet been used to aid the clinical utility of HDACi. Herein, we aimed to further elucidate vorinostat-resistance mechanisms through a functional genomics screen to identify novel genes that when knocked down by RNA interference (RNAi) sensitized cells to vorinostat-induced apoptosis. A synthetic lethal functional screen using a whole-genome protein-coding RNAi library was used to identify genes that when knocked down cooperated with vorinostat to induce tumor cell apoptosis in otherwise resistant cells. Through iterative screening, we identified 10 vorinostat-resistance candidate genes that sensitized specifically to vorinostat. One of these vorinostat-resistance genes was GLI1, an oncogene not previously known to regulate the activity of HDACi. Treatment of vorinostat-resistant cells with the GLI1 small-molecule inhibitor, GANT61, phenocopied the effect of GLI1 knockdown. The mechanism by which GLI1 loss of function sensitized tumor cells to vorinostat-induced apoptosis is at least in part through interactions with vorinostat to alter gene expression in a manner that favored apoptosis. Upon GLI1 knockdown and vorinostat treatment, BCL2L1 expression was repressed and overexpression of BCL2L1 inhibited GLI1-knockdown-mediated vorinostat sensitization. Taken together, we present the identification and characterization of GLI1 as a new HDACi resistance gene, providing a strong rationale for development of GLI1 inhibitors for clinical use in combination with HDACi therapy.

  20. Systematic Functional Interrogation of Rare Cancer Variants Identifies Oncogenic Alleles | Office of Cancer Genomics

    Science.gov (United States)

    Cancer genome characterization efforts now provide an initial view of the somatic alterations in primary tumors. However, most point mutations occur at low frequency, and the function of these alleles remains undefined. We have developed a scalable systematic approach to interrogate the function of cancer-associated gene variants. We subjected 474 mutant alleles curated from 5,338 tumors to pooled in vivo tumor formation assays and gene expression profiling. We identified 12 transforming alleles, including two in genes (PIK3CB, POT1) that have not been shown to be tumorigenic.

  1. Genome-wide Analyses Identify KIF5A as a Novel ALS Gene.

    Science.gov (United States)

    Nicolas, Aude; Kenna, Kevin P; Renton, Alan E; Ticozzi, Nicola; Faghri, Faraz; Chia, Ruth; Dominov, Janice A; Kenna, Brendan J; Nalls, Mike A; Keagle, Pamela; Rivera, Alberto M; van Rheenen, Wouter; Murphy, Natalie A; van Vugt, Joke J F A; Geiger, Joshua T; Van der Spek, Rick A; Pliner, Hannah A; Shankaracharya; Smith, Bradley N; Marangi, Giuseppe; Topp, Simon D; Abramzon, Yevgeniya; Gkazi, Athina Soragia; Eicher, John D; Kenna, Aoife; Mora, Gabriele; Calvo, Andrea; Mazzini, Letizia; Riva, Nilo; Mandrioli, Jessica; Caponnetto, Claudia; Battistini, Stefania; Volanti, Paolo; La Bella, Vincenzo; Conforti, Francesca L; Borghero, Giuseppe; Messina, Sonia; Simone, Isabella L; Trojsi, Francesca; Salvi, Fabrizio; Logullo, Francesco O; D'Alfonso, Sandra; Corrado, Lucia; Capasso, Margherita; Ferrucci, Luigi; Moreno, Cristiane de Araujo Martins; Kamalakaran, Sitharthan; Goldstein, David B; Gitler, Aaron D; Harris, Tim; Myers, Richard M; Phatnani, Hemali; Musunuri, Rajeeva Lochan; Evani, Uday Shankar; Abhyankar, Avinash; Zody, Michael C; Kaye, Julia; Finkbeiner, Steven; Wyman, Stacia K; LeNail, Alex; Lima, Leandro; Fraenkel, Ernest; Svendsen, Clive N; Thompson, Leslie M; Van Eyk, Jennifer E; Berry, James D; Miller, Timothy M; Kolb, Stephen J; Cudkowicz, Merit; Baxi, Emily; Benatar, Michael; Taylor, J Paul; Rampersaud, Evadnie; Wu, Gang; Wuu, Joanne; Lauria, Giuseppe; Verde, Federico; Fogh, Isabella; Tiloca, Cinzia; Comi, Giacomo P; Sorarù, Gianni; Cereda, Cristina; Corcia, Philippe; Laaksovirta, Hannu; Myllykangas, Liisa; Jansson, Lilja; Valori, Miko; Ealing, John; Hamdalla, Hisham; Rollinson, Sara; Pickering-Brown, Stuart; Orrell, Richard W; Sidle, Katie C; Malaspina, Andrea; Hardy, John; Singleton, Andrew B; Johnson, Janel O; Arepalli, Sampath; Sapp, Peter C; McKenna-Yasek, Diane; Polak, Meraida; Asress, Seneshaw; Al-Sarraj, Safa; King, Andrew; Troakes, Claire; Vance, Caroline; de Belleroche, Jacqueline; Baas, Frank; Ten Asbroek, Anneloor L M A; Muñoz-Blanco, José Luis; Hernandez, Dena G; Ding, Jinhui; Gibbs, J Raphael; Scholz, Sonja W; Floeter, Mary Kay; Campbell, Roy H; Landi, Francesco; Bowser, Robert; Pulst, Stefan M; Ravits, John M; MacGowan, Daniel J L; Kirby, Janine; Pioro, Erik P; Pamphlett, Roger; Broach, James; Gerhard, Glenn; Dunckley, Travis L; Brady, Christopher B; Kowall, Neil W; Troncoso, Juan C; Le Ber, Isabelle; Mouzat, Kevin; Lumbroso, Serge; Heiman-Patterson, Terry D; Kamel, Freya; Van Den Bosch, Ludo; Baloh, Robert H; Strom, Tim M; Meitinger, Thomas; Shatunov, Aleksey; Van Eijk, Kristel R; de Carvalho, Mamede; Kooyman, Maarten; Middelkoop, Bas; Moisse, Matthieu; McLaughlin, Russell L; Van Es, Michael A; Weber, Markus; Boylan, Kevin B; Van Blitterswijk, Marka; Rademakers, Rosa; Morrison, Karen E; Basak, A Nazli; Mora, Jesús S; Drory, Vivian E; Shaw, Pamela J; Turner, Martin R; Talbot, Kevin; Hardiman, Orla; Williams, Kelly L; Fifita, Jennifer A; Nicholson, Garth A; Blair, Ian P; Rouleau, Guy A; Esteban-Pérez, Jesús; García-Redondo, Alberto; Al-Chalabi, Ammar; Rogaeva, Ekaterina; Zinman, Lorne; Ostrow, Lyle W; Maragakis, Nicholas J; Rothstein, Jeffrey D; Simmons, Zachary; Cooper-Knock, Johnathan; Brice, Alexis; Goutman, Stephen A; Feldman, Eva L; Gibson, Summer B; Taroni, Franco; Ratti, Antonia; Gellera, Cinzia; Van Damme, Philip; Robberecht, Wim; Fratta, Pietro; Sabatelli, Mario; Lunetta, Christian; Ludolph, Albert C; Andersen, Peter M; Weishaupt, Jochen H; Camu, William; Trojanowski, John Q; Van Deerlin, Vivianna M; Brown, Robert H; van den Berg, Leonard H; Veldink, Jan H; Harms, Matthew B; Glass, Jonathan D; Stone, David J; Tienari, Pentti; Silani, Vincenzo; Chiò, Adriano; Shaw, Christopher E; Traynor, Bryan J; Landers, John E

    2018-03-21

    To identify novel genes associated with ALS, we undertook two lines of investigation. We carried out a genome-wide association study comparing 20,806 ALS cases and 59,804 controls. Independently, we performed a rare variant burden analysis comparing 1,138 index familial ALS cases and 19,494 controls. Through both approaches, we identified kinesin family member 5A (KIF5A) as a novel gene associated with ALS. Interestingly, mutations predominantly in the N-terminal motor domain of KIF5A are causative for two neurodegenerative diseases: hereditary spastic paraplegia (SPG10) and Charcot-Marie-Tooth type 2 (CMT2). In contrast, ALS-associated mutations are primarily located at the C-terminal cargo-binding tail domain and patients harboring loss-of-function mutations displayed an extended survival relative to typical ALS cases. Taken together, these results broaden the phenotype spectrum resulting from mutations in KIF5A and strengthen the role of cytoskeletal defects in the pathogenesis of ALS. Copyright © 2018 Elsevier Inc. All rights reserved.

  2. A trans-ethnic genome-wide association study identifies gender-specific loci influencing pediatric aBMD and BMC at the distal radius.

    Science.gov (United States)

    Chesi, Alessandra; Mitchell, Jonathan A; Kalkwarf, Heidi J; Bradfield, Jonathan P; Lappe, Joan M; McCormack, Shana E; Gilsanz, Vicente; Oberfield, Sharon E; Hakonarson, Hakon; Shepherd, John A; Kelly, Andrea; Zemel, Babette S; Grant, Struan F A

    2015-09-01

    Childhood fractures are common, with the forearm being the most common site. Genome-wide association studies (GWAS) have identified more than 60 loci associated with bone mineral density (BMD) in adults but less is known about genetic influences specific to bone in childhood. To identify novel genetic factors that influence pediatric bone strength at a common site for childhood fractures, we performed a sex-stratified trans-ethnic genome-wide association study of areal BMD (aBMD) and bone mineral content (BMC) Z-scores measured by dual energy X-ray absorptiometry at the one-third distal radius, in a cohort of 1399 children without clinical abnormalities in bone health. We tested signals with P BMC-Z). Signals at the CPED1-WNT16-FAM3C locus have been previously associated with BMD at other skeletal sites in adults and children. Our result at the distal radius underscores the importance of this locus at multiple skeletal sites. The 9p21.3 locus is within a gene desert, with the nearest gene flanking each side being MIR31HG and MTAP, neither of which has been implicated in BMD or BMC previously. These findings suggest that genetic determinants of childhood bone accretion at the radius, a skeletal site that is primarily cortical bone, exist and also differ by sex. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  3. Complete sequence and analysis of plastid genomes of two economically important red algae: Pyropia haitanensis and Pyropia yezoensis.

    Directory of Open Access Journals (Sweden)

    Li Wang

    Full Text Available Pyropia haitanensis and P. yezoensis are two economically important marine crops that are also considered to be research models to study the physiological ecology of intertidal seaweed communities, evolutionary biology of plastids, and the origins of sexual reproduction. This plastid genome information will facilitate study of breeding, population genetics and phylogenetics.We have fully sequenced using next-generation sequencing the circular plastid genomes of P. hatanensis (195,597 bp and P. yezoensis (191,975 bp, the largest of all the plastid genomes of the red lineage sequenced to date. Organization and gene contents of the two plastids were similar, with 211-213 protein-coding genes (including 29-31 unknown-function ORFs, 37 tRNA genes, and 6 ribosomal RNA genes, suggesting a largest coding capacity in the red lineage. In each genome, 14 protein genes overlapped and no interrupted genes were found, indicating a high degree of genomic condensation. Pyropia maintain an ancient gene content and conserved gene clusters in their plastid genomes, containing nearly complete repertoires of the plastid genes known in photosynthetic eukaryotes. Similarity analysis based on the whole plastid genome sequences showed the distance between P. haitanensis and P. yezoensis (0.146 was much smaller than that of Porphyra purpurea and P. haitanensis (0.250, and P. yezoensis (0.251; this supports re-grouping the two species in a resurrected genus Pyropia while maintaining P. purpurea in genus Porphyra. Phylogenetic analysis supports a sister relationship between Bangiophyceae and Florideophyceae, though precise phylogenetic relationships between multicellular red alage and chromists were not fully resolved.These results indicate that Pyropia have compact plastid genomes. Large coding capacity and long intergenic regions contribute to the size of the largest plastid genomes reported for the red lineage. Possessing the largest coding capacity and ancient gene

  4. Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4.

    LENUS (Irish Health Repository)

    Sklar, Pamela

    2011-10-01

    We conducted a combined genome-wide association study (GWAS) of 7,481 individuals with bipolar disorder (cases) and 9,250 controls as part of the Psychiatric GWAS Consortium. Our replication study tested 34 SNPs in 4,496 independent cases with bipolar disorder and 42,422 independent controls and found that 18 of 34 SNPs had P < 0.05, with 31 of 34 SNPs having signals with the same direction of effect (P = 3.8 × 10(-7)). An analysis of all 11,974 bipolar disorder cases and 51,792 controls confirmed genome-wide significant evidence of association for CACNA1C and identified a new intronic variant in ODZ4. We identified a pathway comprised of subunits of calcium channels enriched in bipolar disorder association intervals. Finally, a combined GWAS analysis of schizophrenia and bipolar disorder yielded strong association evidence for SNPs in CACNA1C and in the region of NEK4-ITIH1-ITIH3-ITIH4. Our replication results imply that increasing sample sizes in bipolar disorder will confirm many additional loci.

  5. The importance of the genomic landscape in Waldenström's Macroglobulinemia for targeted therapeutical interventions.

    Science.gov (United States)

    Sacco, Antonio; Fenotti, Adriano; Affò, Loredana; Bazzana, Stefano; Russo, Domenico; Presta, Marco; Malagola, Michele; Anastasia, Antonella; Motta, Marina; Patterson, Christopher J; Rossi, Giuseppe; Imberti, Luisa; Treon, Steven P; Ghobrial, Irene M; Roccaro, Aldo M

    2017-05-23

    The Literature has recently reported on the importance of genomics in the field of hematologic malignancies, including B-cell lymphoproliferative disorders such as Waldenström's Macrolgobulinemia (WM). Particularly, whole exome sequencing has led to the identification of the MYD88L265P and CXCR4C1013G somatic variants in WM, occurring in about 90% and 30% of the patients, respectively. Subsequently, functional studies have demonstrated their functional role in supporting WM pathogenesis and disease progression, both in vitro and in vivo, thus providing the pre-clinical evidences for extremely attractive targets for novel therapeutic interventions in WM. Of note, recent evidences have also approached and defined the transcriptome profiling of WM cells, revealing a signature that mirrors the somatic aberrations demonstrated within the tumor clone. A parallel research field has also reported on microRNAs (miRNAs), highlighting the oncogenic role of miRNA-155 in WM. In the present review, we focus on the latest reports on genomics and miRNAs in WM, providing an overview of the clinical relevance of the latest acquired knowledge about genomics and miRNA aberrations in WM.

  6. A universal genomic coordinate translator for comparative genomics.

    Science.gov (United States)

    Zamani, Neda; Sundström, Görel; Meadows, Jennifer R S; Höppner, Marc P; Dainat, Jacques; Lantz, Henrik; Haas, Brian J; Grabherr, Manfred G

    2014-06-30

    Genomic duplications constitute major events in the evolution of species, allowing paralogous copies of genes to take on fine-tuned biological roles. Unambiguously identifying the orthology relationship between copies across multiple genomes can be resolved by synteny, i.e. the conserved order of genomic sequences. However, a comprehensive analysis of duplication events and their contributions to evolution would require all-to-all genome alignments, which increases at N2 with the number of available genomes, N. Here, we introduce Kraken, software that omits the all-to-all requirement by recursively traversing a graph of pairwise alignments and dynamically re-computing orthology. Kraken scales linearly with the number of targeted genomes, N, which allows for including large numbers of genomes in analyses. We first evaluated the method on the set of 12 Drosophila genomes, finding that orthologous correspondence computed indirectly through a graph of multiple synteny maps comes at minimal cost in terms of sensitivity, but reduces overall computational runtime by an order of magnitude. We then used the method on three well-annotated mammalian genomes, human, mouse, and rat, and show that up to 93% of protein coding transcripts have unambiguous pairwise orthologous relationships across the genomes. On a nucleotide level, 70 to 83% of exons match exactly at both splice junctions, and up to 97% on at least one junction. We last applied Kraken to an RNA-sequencing dataset from multiple vertebrates and diverse tissues, where we confirmed that brain-specific gene family members, i.e. one-to-many or many-to-many homologs, are more highly correlated across species than single-copy (i.e. one-to-one homologous) genes. Not limited to protein coding genes, Kraken also identifies thousands of newly identified transcribed loci, likely non-coding RNAs that are consistently transcribed in human, chimpanzee and gorilla, and maintain significant correlation of expression levels across

  7. Integrated Genomic Analysis Identifies Clinically Relevant Subtypes of Glioblastoma Characterized by Abnormalities in PDGFRA, IDH1, EGFR, and NF1

    Energy Technology Data Exchange (ETDEWEB)

    Verhaak, Roel GW; Hoadley, Katherine A; Purdom, Elizabeth; Wang, Victoria; Qi, Yuan; Wilkerson, Matthew D; Miller, C Ryan; Ding, Li; Golub, Todd; Mesirov, Jill P; Alexe, Gabriele; Lawrence, Michael; O' Kelly, Michael; Tamayo, Pablo; Weir, Barbara A; Gabriel, Stacey; Winckler, Wendy; Gupta, Supriya; Jakkula, Lakshmi; Feiler, Heidi S; Hodgson, J Graeme; James, C David; Sarkaria, Jann N; Brennan, Cameron; Kahn, Ari; Spellman, Paul T; Wilson, Richard K; Speed, Terence P; Gray, Joe W; Meyerson, Matthew; Getz, Gad; Perou, Charles M; Hayes, D Neil; Network, The Cancer Genome Atlas Research

    2009-09-03

    The Cancer Genome Atlas Network recently cataloged recurrent genomic abnormalities in glioblastoma multiforme (GBM). We describe a robust gene expression-based molecular classification of GBM into Proneural, Neural, Classical, and Mesenchymal subtypes and integrate multidimensional genomic data to establish patterns of somatic mutations and DNA copy number. Aberrations and gene expression of EGFR, NF1, and PDGFRA/IDH1 each define the Classical, Mesenchymal, and Proneural subtypes, respectively. Gene signatures of normal brain cell types show a strong relationship between subtypes and different neural lineages. Additionally, response to aggressive therapy differs by subtype, with the greatest benefit in the Classical subtype and no benefit in the Proneural subtype. We provide a framework that unifies transcriptomic and genomic dimensions for GBM molecular stratification with important implications for future studies.

  8. Screening of whole genome sequences identified high-impact variants for stallion fertility.

    Science.gov (United States)

    Schrimpf, Rahel; Gottschalk, Maren; Metzger, Julia; Martinsson, Gunilla; Sieme, Harald; Distl, Ottmar

    2016-04-14

    Stallion fertility is an economically important trait due to the increase of artificial insemination in horses. The availability of whole genome sequence data facilitates identification of rare high-impact variants contributing to stallion fertility. The aim of our study was to genotype rare high-impact variants retrieved from next-generation sequencing (NGS)-data of 11 horses in order to unravel harmful genetic variants in large samples of stallions. Gene ontology (GO) terms and search results from public databases were used to obtain a comprehensive list of human und mice genes predicted to participate in the regulation of male reproduction. The corresponding equine orthologous genes were searched in whole genome sequence data of seven stallions and four mares and filtered for high-impact genetic variants using SnpEFF, SIFT and Polyphen 2 software. All genetic variants with the missing homozygous mutant genotype were genotyped on 337 fertile stallions of 19 breeds using KASP genotyping assays or PCR-RFLP. Mixed linear model analysis was employed for an association analysis with de-regressed estimated breeding values of the paternal component of the pregnancy rate per estrus (EBV-PAT). We screened next generation sequenced data of whole genomes from 11 horses for equine genetic variants in 1194 human and mice genes involved in male fertility and linked through common gene ontology (GO) with male reproductive processes. Variants were filtered for high-impact on protein structure and validated through SIFT and Polyphen 2. Only those genetic variants were followed up when the homozygote mutant genotype was missing in the detection sample comprising 11 horses. After this filtering process, 17 single nucleotide polymorphism (SNPs) were left. These SNPs were genotyped in 337 fertile stallions of 19 breeds using KASP genotyping assays or PCR-RFLP. An association analysis in 216 Hanoverian stallions revealed a significant association of the splice-site disruption variant

  9. A genome-wide screen identifies conserved protein hubs required for cadherin-mediated cell–cell adhesion

    Science.gov (United States)

    Toret, Christopher P.; D’Ambrosio, Michael V.; Vale, Ronald D.; Simon, Michael A.

    2014-01-01

    Cadherins and associated catenins provide an important structural interface between neighboring cells, the actin cytoskeleton, and intracellular signaling pathways in a variety of cell types throughout the Metazoa. However, the full inventory of the proteins and pathways required for cadherin-mediated adhesion has not been established. To this end, we completed a genome-wide (∼14,000 genes) ribonucleic acid interference (RNAi) screen that targeted Ca2+-dependent adhesion in DE-cadherin–expressing Drosophila melanogaster S2 cells in suspension culture. This novel screen eliminated Ca2+-independent cell–cell adhesion, integrin-based adhesion, cell spreading, and cell migration. We identified 17 interconnected regulatory hubs, based on protein functions and protein–protein interactions that regulate the levels of the core cadherin–catenin complex and coordinate cadherin-mediated cell–cell adhesion. Representative proteins from these hubs were analyzed further in Drosophila oogenesis, using targeted germline RNAi, and adhesion was analyzed in Madin–Darby canine kidney mammalian epithelial cell–cell adhesion. These experiments reveal roles for a diversity of cellular pathways that are required for cadherin function in Metazoa, including cytoskeleton organization, cell–substrate interactions, and nuclear and cytoplasmic signaling. PMID:24446484

  10. A genome-wide association study identifies five loci influencing facial morphology in Europeans.

    Directory of Open Access Journals (Sweden)

    Fan Liu

    2012-09-01

    Full Text Available Inter-individual variation in facial shape is one of the most noticeable phenotypes in humans, and it is clearly under genetic regulation; however, almost nothing is known about the genetic basis of normal human facial morphology. We therefore conducted a genome-wide association study for facial shape phenotypes in multiple discovery and replication cohorts, considering almost ten thousand individuals of European descent from several countries. Phenotyping of facial shape features was based on landmark data obtained from three-dimensional head magnetic resonance images (MRIs and two-dimensional portrait images. We identified five independent genetic loci associated with different facial phenotypes, suggesting the involvement of five candidate genes--PRDM16, PAX3, TP63, C5orf50, and COL17A1--in the determination of the human face. Three of them have been implicated previously in vertebrate craniofacial development and disease, and the remaining two genes potentially represent novel players in the molecular networks governing facial development. Our finding at PAX3 influencing the position of the nasion replicates a recent GWAS of facial features. In addition to the reported GWA findings, we established links between common DNA variants previously associated with NSCL/P at 2p21, 8q24, 13q31, and 17q22 and normal facial-shape variations based on a candidate gene approach. Overall our study implies that DNA variants in genes essential for craniofacial development contribute with relatively small effect size to the spectrum of normal variation in human facial morphology. This observation has important consequences for future studies aiming to identify more genes involved in the human facial morphology, as well as for potential applications of DNA prediction of facial shape such as in future forensic applications.

  11. A Genome-Wide Association Study Identifies Five Loci Influencing Facial Morphology in Europeans

    Science.gov (United States)

    Liu, Fan; van der Lijn, Fedde; Schurmann, Claudia; Zhu, Gu; Chakravarty, M. Mallar; Hysi, Pirro G.; Wollstein, Andreas; Lao, Oscar; de Bruijne, Marleen; Ikram, M. Arfan; van der Lugt, Aad; Rivadeneira, Fernando; Uitterlinden, André G.; Hofman, Albert; Niessen, Wiro J.; Homuth, Georg; de Zubicaray, Greig; McMahon, Katie L.; Thompson, Paul M.; Daboul, Amro; Puls, Ralf; Hegenscheid, Katrin; Bevan, Liisa; Pausova, Zdenka; Medland, Sarah E.; Montgomery, Grant W.; Wright, Margaret J.; Wicking, Carol; Boehringer, Stefan; Spector, Timothy D.; Paus, Tomáš; Martin, Nicholas G.; Biffar, Reiner; Kayser, Manfred

    2012-01-01

    Inter-individual variation in facial shape is one of the most noticeable phenotypes in humans, and it is clearly under genetic regulation; however, almost nothing is known about the genetic basis of normal human facial morphology. We therefore conducted a genome-wide association study for facial shape phenotypes in multiple discovery and replication cohorts, considering almost ten thousand individuals of European descent from several countries. Phenotyping of facial shape features was based on landmark data obtained from three-dimensional head magnetic resonance images (MRIs) and two-dimensional portrait images. We identified five independent genetic loci associated with different facial phenotypes, suggesting the involvement of five candidate genes—PRDM16, PAX3, TP63, C5orf50, and COL17A1—in the determination of the human face. Three of them have been implicated previously in vertebrate craniofacial development and disease, and the remaining two genes potentially represent novel players in the molecular networks governing facial development. Our finding at PAX3 influencing the position of the nasion replicates a recent GWAS of facial features. In addition to the reported GWA findings, we established links between common DNA variants previously associated with NSCL/P at 2p21, 8q24, 13q31, and 17q22 and normal facial-shape variations based on a candidate gene approach. Overall our study implies that DNA variants in genes essential for craniofacial development contribute with relatively small effect size to the spectrum of normal variation in human facial morphology. This observation has important consequences for future studies aiming to identify more genes involved in the human facial morphology, as well as for potential applications of DNA prediction of facial shape such as in future forensic applications. PMID:23028347

  12. Recurrence time statistics: versatile tools for genomic DNA sequence analysis.

    Science.gov (United States)

    Cao, Yinhe; Tung, Wen-Wen; Gao, J B

    2004-01-01

    With the completion of the human and a few model organisms' genomes, and the genomes of many other organisms waiting to be sequenced, it has become increasingly important to develop faster computational tools which are capable of easily identifying the structures and extracting features from DNA sequences. One of the more important structures in a DNA sequence is repeat-related. Often they have to be masked before protein coding regions along a DNA sequence are to be identified or redundant expressed sequence tags (ESTs) are to be sequenced. Here we report a novel recurrence time based method for sequence analysis. The method can conveniently study all kinds of periodicity and exhaustively find all repeat-related features from a genomic DNA sequence. An efficient codon index is also derived from the recurrence time statistics, which has the salient features of being largely species-independent and working well on very short sequences. Efficient codon indices are key elements of successful gene finding algorithms, and are particularly useful for determining whether a suspected EST belongs to a coding or non-coding region. We illustrate the power of the method by studying the genomes of E. coli, the yeast S. cervisivae, the nematode worm C. elegans, and the human, Homo sapiens. Computationally, our method is very efficient. It allows us to carry out analysis of genomes on the whole genomic scale by a PC.

  13. Genome-wide association studies of autoimmune vitiligo identify 23 new risk loci and highlight key pathways and regulatory variants.

    Science.gov (United States)

    Jin, Ying; Andersen, Genevieve; Yorgov, Daniel; Ferrara, Tracey M; Ben, Songtao; Brownson, Kelly M; Holland, Paulene J; Birlea, Stanca A; Siebert, Janet; Hartmann, Anke; Lienert, Anne; van Geel, Nanja; Lambert, Jo; Luiten, Rosalie M; Wolkerstorfer, Albert; Wietze van der Veen, J P; Bennett, Dorothy C; Taïeb, Alain; Ezzedine, Khaled; Kemp, E Helen; Gawkrodger, David J; Weetman, Anthony P; Kõks, Sulev; Prans, Ele; Kingo, Külli; Karelson, Maire; Wallace, Margaret R; McCormack, Wayne T; Overbeck, Andreas; Moretti, Silvia; Colucci, Roberta; Picardo, Mauro; Silverberg, Nanette B; Olsson, Mats; Valle, Yan; Korobko, Igor; Böhm, Markus; Lim, Henry W; Hamzavi, Iltefat; Zhou, Li; Mi, Qing-Sheng; Fain, Pamela R; Santorico, Stephanie A; Spritz, Richard A

    2016-11-01

    Vitiligo is an autoimmune disease in which depigmented skin results from the destruction of melanocytes, with epidemiological association with other autoimmune diseases. In previous linkage and genome-wide association studies (GWAS1 and GWAS2), we identified 27 vitiligo susceptibility loci in patients of European ancestry. We carried out a third GWAS (GWAS3) in European-ancestry subjects, with augmented GWAS1 and GWAS2 controls, genome-wide imputation, and meta-analysis of all three GWAS, followed by an independent replication. The combined analyses, with 4,680 cases and 39,586 controls, identified 23 new significantly associated loci and 7 suggestive loci. Most encode immune and apoptotic regulators, with some also associated with other autoimmune diseases, as well as several melanocyte regulators. Bioinformatic analyses indicate a predominance of causal regulatory variation, some of which corresponds to expression quantitative trait loci (eQTLs) at these loci. Together, the identified genes provide a framework for the genetic architecture and pathobiology of vitiligo, highlight relationships with other autoimmune diseases and melanoma, and offer potential targets for treatment.

  14. Integrative Genomic Analysis of Cholangiocarcinoma Identifies Distinct IDH-Mutant Molecular Profiles

    Directory of Open Access Journals (Sweden)

    Farshad Farshidfar

    2017-03-01

    Full Text Available Cholangiocarcinoma (CCA is an aggressive malignancy of the bile ducts, with poor prognosis and limited treatment options. Here, we describe the integrated analysis of somatic mutations, RNA expression, copy number, and DNA methylation by The Cancer Genome Atlas of a set of predominantly intrahepatic CCA cases and propose a molecular classification scheme. We identified an IDH mutant-enriched subtype with distinct molecular features including low expression of chromatin modifiers, elevated expression of mitochondrial genes, and increased mitochondrial DNA copy number. Leveraging the multi-platform data, we observed that ARID1A exhibited DNA hypermethylation and decreased expression in the IDH mutant subtype. More broadly, we found that IDH mutations are associated with an expanded histological spectrum of liver tumors with molecular features that stratify with CCA. Our studies reveal insights into the molecular pathogenesis and heterogeneity of cholangiocarcinoma and provide classification information of potential therapeutic significance.

  15. Stomatal vs. genome size in angiosperms: the somatic tail wagging the genomic dog?

    Science.gov (United States)

    Hodgson, J G; Sharafi, M; Jalili, A; Díaz, S; Montserrat-Martí, G; Palmer, C; Cerabolini, B; Pierce, S; Hamzehee, B; Asri, Y; Jamzad, Z; Wilson, P; Raven, J A; Band, S R; Basconcelo, S; Bogard, A; Carter, G; Charles, M; Castro-Díez, P; Cornelissen, J H C; Funes, G; Jones, G; Khoshnevis, M; Pérez-Harguindeguy, N; Pérez-Rontomé, M C; Shirvany, F A; Vendramini, F; Yazdani, S; Abbas-Azimi, R; Boustani, S; Dehghan, M; Guerrero-Campo, J; Hynd, A; Kowsary, E; Kazemi-Saeed, F; Siavash, B; Villar-Salvador, P; Craigie, R; Naqinezhad, A; Romo-Díez, A; de Torres Espuny, L; Simmons, E

    2010-04-01

    Genome size is a function, and the product, of cell volume. As such it is contingent on ecological circumstance. The nature of 'this ecological circumstance' is, however, hotly debated. Here, we investigate for angiosperms whether stomatal size may be this 'missing link': the primary determinant of genome size. Stomata are crucial for photosynthesis and their size affects functional efficiency. Stomatal and leaf characteristics were measured for 1442 species from Argentina, Iran, Spain and the UK and, using PCA, some emergent ecological and taxonomic patterns identified. Subsequently, an assessment of the relationship between genome-size values obtained from the Plant DNA C-values database and measurements of stomatal size was carried out. Stomatal size is an ecologically important attribute. It varies with life-history (woody species < herbaceous species < vernal geophytes) and contributes to ecologically and physiologically important axes of leaf specialization. Moreover, it is positively correlated with genome size across a wide range of major taxa. Stomatal size predicts genome size within angiosperms. Correlation is not, however, proof of causality and here our interpretation is hampered by unexpected deficiencies in the scientific literature. Firstly, there are discrepancies between our own observations and established ideas about the ecological significance of stomatal size; very large stomata, theoretically facilitating photosynthesis in deep shade, were, in this study (and in other studies), primarily associated with vernal geophytes of unshaded habitats. Secondly, the lower size limit at which stomata can function efficiently, and the ecological circumstances under which these minute stomata might occur, have not been satisfactorally resolved. Thus, our hypothesis, that the optimization of stomatal size for functional efficiency is a major ecological determinant of genome size, remains unproven.

  16. Genomic insight into the common carp (Cyprinus carpio genome by sequencing analysis of BAC-end sequences

    Directory of Open Access Journals (Sweden)

    Wang Jintu

    2011-04-01

    Full Text Available Abstract Background Common carp is one of the most important aquaculture teleost fish in the world. Common carp and other closely related Cyprinidae species provide over 30% aquaculture production in the world. However, common carp genomic resources are still relatively underdeveloped. BAC end sequences (BES are important resources for genome research on BAC-anchored genetic marker development, linkage map and physical map integration, and whole genome sequence assembling and scaffolding. Result To develop such valuable resources in common carp (Cyprinus carpio, a total of 40,224 BAC clones were sequenced on both ends, generating 65,720 clean BES with an average read length of 647 bp after sequence processing, representing 42,522,168 bp or 2.5% of common carp genome. The first survey of common carp genome was conducted with various bioinformatics tools. The common carp genome contains over 17.3% of repetitive elements with GC content of 36.8% and 518 transposon ORFs. To identify and develop BAC-anchored microsatellite markers, a total of 13,581 microsatellites were detected from 10,355 BES. The coding region of 7,127 genes were recognized from 9,443 BES on 7,453 BACs, with 1,990 BACs have genes on both ends. To evaluate the similarity to the genome of closely related zebrafish, BES of common carp were aligned against zebrafish genome. A total of 39,335 BES of common carp have conserved homologs on zebrafish genome which demonstrated the high similarity between zebrafish and common carp genomes, indicating the feasibility of comparative mapping between zebrafish and common carp once we have physical map of common carp. Conclusion BAC end sequences are great resources for the first genome wide survey of common carp. The repetitive DNA was estimated to be approximate 28% of common carp genome, indicating the higher complexity of the genome. Comparative analysis had mapped around 40,000 BES to zebrafish genome and established over 3

  17. Genomic insight into the common carp (Cyprinus carpio) genome by sequencing analysis of BAC-end sequences

    Science.gov (United States)

    2011-01-01

    Background Common carp is one of the most important aquaculture teleost fish in the world. Common carp and other closely related Cyprinidae species provide over 30% aquaculture production in the world. However, common carp genomic resources are still relatively underdeveloped. BAC end sequences (BES) are important resources for genome research on BAC-anchored genetic marker development, linkage map and physical map integration, and whole genome sequence assembling and scaffolding. Result To develop such valuable resources in common carp (Cyprinus carpio), a total of 40,224 BAC clones were sequenced on both ends, generating 65,720 clean BES with an average read length of 647 bp after sequence processing, representing 42,522,168 bp or 2.5% of common carp genome. The first survey of common carp genome was conducted with various bioinformatics tools. The common carp genome contains over 17.3% of repetitive elements with GC content of 36.8% and 518 transposon ORFs. To identify and develop BAC-anchored microsatellite markers, a total of 13,581 microsatellites were detected from 10,355 BES. The coding region of 7,127 genes were recognized from 9,443 BES on 7,453 BACs, with 1,990 BACs have genes on both ends. To evaluate the similarity to the genome of closely related zebrafish, BES of common carp were aligned against zebrafish genome. A total of 39,335 BES of common carp have conserved homologs on zebrafish genome which demonstrated the high similarity between zebrafish and common carp genomes, indicating the feasibility of comparative mapping between zebrafish and common carp once we have physical map of common carp. Conclusion BAC end sequences are great resources for the first genome wide survey of common carp. The repetitive DNA was estimated to be approximate 28% of common carp genome, indicating the higher complexity of the genome. Comparative analysis had mapped around 40,000 BES to zebrafish genome and established over 3,100 microsyntenies, covering over 50% of

  18. Discovering regulatory motifs in the Plasmodium genome using comparative genomics

    OpenAIRE

    Wu, Jie; Sieglaff, Douglas H.; Gervin, Joshua; Xie, Xiaohui S.

    2008-01-01

    Motivation: Understanding gene regulation in Plasmodium, the causative agent of malaria, is an important step in deciphering its complex life cycle as well as leading to possible new targets for therapeutic applications. Very little is known about gene regulation in Plasmodium, and in particular, few regulatory elements have been identified. Such discovery has been significantly hampered by the high A-T content of some of the genomes of Plasmodium species, as well as the challenge in associat...

  19. Large meta-analysis of genome-wide association studies identifies five loci for lean body mass.

    Science.gov (United States)

    Zillikens, M Carola; Demissie, Serkalem; Hsu, Yi-Hsiang; Yerges-Armstrong, Laura M; Chou, Wen-Chi; Stolk, Lisette; Livshits, Gregory; Broer, Linda; Johnson, Toby; Koller, Daniel L; Kutalik, Zoltán; Luan, Jian'an; Malkin, Ida; Ried, Janina S; Smith, Albert V; Thorleifsson, Gudmar; Vandenput, Liesbeth; Hua Zhao, Jing; Zhang, Weihua; Aghdassi, Ali; Åkesson, Kristina; Amin, Najaf; Baier, Leslie J; Barroso, Inês; Bennett, David A; Bertram, Lars; Biffar, Rainer; Bochud, Murielle; Boehnke, Michael; Borecki, Ingrid B; Buchman, Aron S; Byberg, Liisa; Campbell, Harry; Campos Obanda, Natalia; Cauley, Jane A; Cawthon, Peggy M; Cederberg, Henna; Chen, Zhao; Cho, Nam H; Jin Choi, Hyung; Claussnitzer, Melina; Collins, Francis; Cummings, Steven R; De Jager, Philip L; Demuth, Ilja; Dhonukshe-Rutten, Rosalie A M; Diatchenko, Luda; Eiriksdottir, Gudny; Enneman, Anke W; Erdos, Mike; Eriksson, Johan G; Eriksson, Joel; Estrada, Karol; Evans, Daniel S; Feitosa, Mary F; Fu, Mao; Garcia, Melissa; Gieger, Christian; Girke, Thomas; Glazer, Nicole L; Grallert, Harald; Grewal, Jagvir; Han, Bok-Ghee; Hanson, Robert L; Hayward, Caroline; Hofman, Albert; Hoffman, Eric P; Homuth, Georg; Hsueh, Wen-Chi; Hubal, Monica J; Hubbard, Alan; Huffman, Kim M; Husted, Lise B; Illig, Thomas; Ingelsson, Erik; Ittermann, Till; Jansson, John-Olov; Jordan, Joanne M; Jula, Antti; Karlsson, Magnus; Khaw, Kay-Tee; Kilpeläinen, Tuomas O; Klopp, Norman; Kloth, Jacqueline S L; Koistinen, Heikki A; Kraus, William E; Kritchevsky, Stephen; Kuulasmaa, Teemu; Kuusisto, Johanna; Laakso, Markku; Lahti, Jari; Lang, Thomas; Langdahl, Bente L; Launer, Lenore J; Lee, Jong-Young; Lerch, Markus M; Lewis, Joshua R; Lind, Lars; Lindgren, Cecilia; Liu, Yongmei; Liu, Tian; Liu, Youfang; Ljunggren, Östen; Lorentzon, Mattias; Luben, Robert N; Maixner, William; McGuigan, Fiona E; Medina-Gomez, Carolina; Meitinger, Thomas; Melhus, Håkan; Mellström, Dan; Melov, Simon; Michaëlsson, Karl; Mitchell, Braxton D; Morris, Andrew P; Mosekilde, Leif; Newman, Anne; Nielson, Carrie M; O'Connell, Jeffrey R; Oostra, Ben A; Orwoll, Eric S; Palotie, Aarno; Parker, Stephen C J; Peacock, Munro; Perola, Markus; Peters, Annette; Polasek, Ozren; Prince, Richard L; Räikkönen, Katri; Ralston, Stuart H; Ripatti, Samuli; Robbins, John A; Rotter, Jerome I; Rudan, Igor; Salomaa, Veikko; Satterfield, Suzanne; Schadt, Eric E; Schipf, Sabine; Scott, Laura; Sehmi, Joban; Shen, Jian; Soo Shin, Chan; Sigurdsson, Gunnar; Smith, Shad; Soranzo, Nicole; Stančáková, Alena; Steinhagen-Thiessen, Elisabeth; Streeten, Elizabeth A; Styrkarsdottir, Unnur; Swart, Karin M A; Tan, Sian-Tsung; Tarnopolsky, Mark A; Thompson, Patricia; Thomson, Cynthia A; Thorsteinsdottir, Unnur; Tikkanen, Emmi; Tranah, Gregory J; Tuomilehto, Jaakko; van Schoor, Natasja M; Verma, Arjun; Vollenweider, Peter; Völzke, Henry; Wactawski-Wende, Jean; Walker, Mark; Weedon, Michael N; Welch, Ryan; Wichmann, H-Erich; Widen, Elisabeth; Williams, Frances M K; Wilson, James F; Wright, Nicole C; Xie, Weijia; Yu, Lei; Zhou, Yanhua; Chambers, John C; Döring, Angela; van Duijn, Cornelia M; Econs, Michael J; Gudnason, Vilmundur; Kooner, Jaspal S; Psaty, Bruce M; Spector, Timothy D; Stefansson, Kari; Rivadeneira, Fernando; Uitterlinden, André G; Wareham, Nicholas J; Ossowski, Vicky; Waterworth, Dawn; Loos, Ruth J F; Karasik, David; Harris, Tamara B; Ohlsson, Claes; Kiel, Douglas P

    2017-07-19

    Lean body mass, consisting mostly of skeletal muscle, is important for healthy aging. We performed a genome-wide association study for whole body (20 cohorts of European ancestry with n = 38,292) and appendicular (arms and legs) lean body mass (n = 28,330) measured using dual energy X-ray absorptiometry or bioelectrical impedance analysis, adjusted for sex, age, height, and fat mass. Twenty-one single-nucleotide polymorphisms were significantly associated with lean body mass either genome wide (p lean body mass and in 45,090 (42,360 of European ancestry) subjects from 25 cohorts for appendicular lean body mass was successful for five single-nucleotide polymorphisms in/near HSD17B11, VCAN, ADAMTSL3, IRS1, and FTO for total lean body mass and for three single-nucleotide polymorphisms in/near VCAN, ADAMTSL3, and IRS1 for appendicular lean body mass. Our findings provide new insight into the genetics of lean body mass.Lean body mass is a highly heritable trait and is associated with various health conditions. Here, Kiel and colleagues perform a meta-analysis of genome-wide association studies for whole body lean body mass and find five novel genetic loci to be significantly associated.

  20. A genome-wide association analysis of a broad psychosis phenotype identifies three loci for further investigation

    OpenAIRE

    Psychosis Endophenotypes International Consortium; Wellcome Trust Case-Control Consortium; Bramon, E.; Pirinen, M.; Strange, A.; Lin, K.; Freeman, C.; Bellenguez, C.; Su, Z.; Band, G.; Pearson, R.; Vukcevic, D.; Langford, C.; Deloukas, P.; Hunt, S.

    2014-01-01

    BACKGROUND: Genome-wide association studies (GWAS) have identified several loci associated with schizophrenia and/or bipolar disorder. We performed a GWAS of psychosis as a broad syndrome rather than within specific diagnostic categories. METHODS: 1239 cases with schizophrenia, schizoaffective disorder, or psychotic bipolar disorder; 857 of their unaffected relatives, and 2739 healthy controls were genotyped with the Affymetrix 6.0 single nucleotide polymorphism (SNP) array. Analyses of 69...

  1. A Genome-wide Association Analysis of a Broad Psychosis Phenotype Identifies Three Loci for Further Investigation

    OpenAIRE

    Tosato, Sarah; Myin-germeys, Inez; Barroso, Ines; Bender, Stephan; Giegling, Ina; Arranz, Maria J.; Donnelly, Peter; Bellenguez, Celine; Brown, Matthew A.; Lawrie, Stephen; Kalaydjieva, Luba; Vukcevic, Damjan; Kahn, Rene S.; Dronov, Serge; Walshe, Muriel

    2014-01-01

    Background: Genome-wide association studies (GWAS) have identified several loci associated with schizophrenia and/or bipolar disorder. We performed a GWAS of psychosis as a broad syndrome rather than within specific diagnostic categories.Methods: 1239 cases with schizophrenia, schizoaffective disorder, or psychotic bipolar disorder; 857 of their unaffected relatives, and 2739 healthy controls were genotyped with the Affymetrix 6.0 single nucleotide polymorphism (SNP) array. Analyses of 695,19...

  2. Discovering human germ cell mutagens with whole genome sequencing: Insights from power calculations reveal the importance of controlling for between-family variability.

    Science.gov (United States)

    Webster, R J; Williams, A; Marchetti, F; Yauk, C L

    2018-07-01

    Mutations in germ cells pose potential genetic risks to offspring. However, de novo mutations are rare events that are spread across the genome and are difficult to detect. Thus, studies in this area have generally been under-powered, and no human germ cell mutagen has been identified. Whole Genome Sequencing (WGS) of human pedigrees has been proposed as an approach to overcome these technical and statistical challenges. WGS enables analysis of a much wider breadth of the genome than traditional approaches. Here, we performed power analyses to determine the feasibility of using WGS in human families to identify germ cell mutagens. Different statistical models were compared in the power analyses (ANOVA and multiple regression for one-child families, and mixed effect model sampling between two to four siblings per family). Assumptions were made based on parameters from the existing literature, such as the mutation-by-paternal age effect. We explored two scenarios: a constant effect due to an exposure that occurred in the past, and an accumulating effect where the exposure is continuing. Our analysis revealed the importance of modeling inter-family variability of the mutation-by-paternal age effect. Statistical power was improved by models accounting for the family-to-family variability. Our power analyses suggest that sufficient statistical power can be attained with 4-28 four-sibling families per treatment group, when the increase in mutations ranges from 40 to 10% respectively. Modeling family variability using mixed effect models provided a reduction in sample size compared to a multiple regression approach. Much larger sample sizes were required to detect an interaction effect between environmental exposures and paternal age. These findings inform study design and statistical modeling approaches to improve power and reduce sequencing costs for future studies in this area. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

  3. Genome projects and the functional-genomic era.

    Science.gov (United States)

    Sauer, Sascha; Konthur, Zoltán; Lehrach, Hans

    2005-12-01

    The problems we face today in public health as a result of the -- fortunately -- increasing age of people and the requirements of developing countries create an urgent need for new and innovative approaches in medicine and in agronomics. Genomic and functional genomic approaches have a great potential to at least partially solve these problems in the future. Important progress has been made by procedures to decode genomic information of humans, but also of other key organisms. The basic comprehension of genomic information (and its transfer) should now give us the possibility to pursue the next important step in life science eventually leading to a basic understanding of biological information flow; the elucidation of the function of all genes and correlative products encoded in the genome, as well as the discovery of their interactions in a molecular context and the response to environmental factors. As a result of the sequencing projects, we are now able to ask important questions about sequence variation and can start to comprehensively study the function of expressed genes on different levels such as RNA, protein or the cell in a systematic context including underlying networks. In this article we review and comment on current trends in large-scale systematic biological research. A particular emphasis is put on technology developments that can provide means to accomplish the tasks of future lines of functional genomics.

  4. Comparative genome analysis of Bacillus cereus group genomes withBacillus subtilis

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, Iain; Sorokin, Alexei; Kapatral, Vinayak; Reznik, Gary; Bhattacharya, Anamitra; Mikhailova, Natalia; Burd, Henry; Joukov, Victor; Kaznadzey, Denis; Walunas, Theresa; D' Souza, Mark; Larsen, Niels; Pusch,Gordon; Liolios, Konstantinos; Grechkin, Yuri; Lapidus, Alla; Goltsman,Eugene; Chu, Lien; Fonstein, Michael; Ehrlich, S. Dusko; Overbeek, Ross; Kyrpides, Nikos; Ivanova, Natalia

    2005-09-14

    Genome features of the Bacillus cereus group genomes (representative strains of Bacillus cereus, Bacillus anthracis and Bacillus thuringiensis sub spp israelensis) were analyzed and compared with the Bacillus subtilis genome. A core set of 1,381 protein families among the four Bacillus genomes, with an additional set of 933 families common to the B. cereus group, was identified. Differences in signal transduction pathways, membrane transporters, cell surface structures, cell wall, and S-layer proteins suggesting differences in their phenotype were identified. The B. cereus group has signal transduction systems including a tyrosine kinase related to two-component system histidine kinases from B. subtilis. A model for regulation of the stress responsive sigma factor sigmaB in the B. cereus group different from the well studied regulation in B. subtilis has been proposed. Despite a high degree of chromosomal synteny among these genomes, significant differences in cell wall and spore coat proteins that contribute to the survival and adaptation in specific hosts has been identified.

  5. Genome-Wide Association Study to Identify Single Nucleotide Polymorphisms (SNPs) Associated With the Development of Erectile Dysfunction in African-American Men After Radiotherapy for Prostate Cancer

    International Nuclear Information System (INIS)

    Kerns, Sarah L.; Ostrer, Harry; Stock, Richard; Li, William; Moore, Julian; Pearlman, Alexander; Campbell, Christopher; Shao Yongzhao; Stone, Nelson; Kusnetz, Lynda; Rosenstein, Barry S.

    2010-01-01

    Purpose: To identify single nucleotide polymorphisms (SNPs) associated with erectile dysfunction (ED) among African-American prostate cancer patients treated with external beam radiation therapy. Methods and Materials: A cohort of African-American prostate cancer patients treated with external beam radiation therapy was observed for the development of ED by use of the five-item Sexual Health Inventory for Men (SHIM) questionnaire. Final analysis included 27 cases (post-treatment SHIM score ≤7) and 52 control subjects (post-treatment SHIM score ≥16). A genome-wide association study was performed using approximately 909,000 SNPs genotyped on Affymetrix 6.0 arrays (Affymetrix, Santa Clara, CA). Results: We identified SNP rs2268363, located in the follicle-stimulating hormone receptor (FSHR) gene, as significantly associated with ED after correcting for multiple comparisons (unadjusted p = 5.46 x 10 -8 , Bonferroni p = 0.028). We identified four additional SNPs that tended toward a significant association with an unadjusted p value -6 . Inference of population substructure showed that cases had a higher proportion of African ancestry than control subjects (77% vs. 60%, p = 0.005). A multivariate logistic regression model that incorporated estimated ancestry and four of the top-ranked SNPs was a more accurate classifier of ED than a model that included only clinical variables. Conclusions: To our knowledge, this is the first genome-wide association study to identify SNPs associated with adverse effects resulting from radiotherapy. It is important to note that the SNP that proved to be significantly associated with ED is located within a gene whose encoded product plays a role in male gonad development and function. Another key finding of this project is that the four SNPs most strongly associated with ED were specific to persons of African ancestry and would therefore not have been identified had a cohort of European ancestry been screened. This study demonstrates

  6. EG-13GENOME-WIDE METHYLATION ANALYSIS IDENTIFIES GENOMIC DNA DEMETHYLATION DURING MALIGNANT PROGRESSION OF GLIOMAS

    Science.gov (United States)

    Saito, Kuniaki; Mukasa, Akitake; Nagae, Genta; Aihara, Koki; Otani, Ryohei; Takayanagi, Shunsaku; Omata, Mayu; Tanaka, Shota; Shibahara, Junji; Takahashi, Miwako; Momose, Toshimitsu; Shimamura, Teppei; Miyano, Satoru; Narita, Yoshitaka; Ueki, Keisuke; Nishikawa, Ryo; Nagane, Motoo; Aburatani, Hiroyuki; Saito, Nobuhito

    2014-01-01

    Low-grade gliomas often undergo malignant progression, and these transformations are a leading cause of death in patients with low-grade gliomas. However, the molecular mechanisms underlying malignant tumor progression are still not well understood. Recent evidence indicates that epigenetic deregulation is an important cause of gliomagenesis; therefore, we examined the impact of epigenetic changes during malignant progression of low-grade gliomas. Specifically, we used the Illumina Infinium Human Methylation 450K BeadChip to perform genome-wide DNA methylation analysis of 120 gliomas and four normal brains. This study sample included 25 matched-pairs of initial low-grade gliomas and recurrent tumors (temporal heterogeneity) and 20 of the 25 recurring tumors recurred as malignant progressions, and one matched-pair of newly emerging malignant lesions and pre-existing lesions (spatial heterogeneity). Analyses of methylation profiles demonstrated that most low-grade gliomas in our sample (43/51; 84%) had a CpG island methylator phenotype (G-CIMP). Remarkably, approximately 50% of secondary glioblastomas that had progressed from low-grade tumors with the G-CIMP status exhibited a characteristic partial demethylation of genomic DNA during malignant progression, but other recurrent gliomas showed no apparent change in DNA methylation pattern. Interestingly, we found that most loci that were demethylated during malignant progression were located outside of CpG islands. The information of histone modifications patterns in normal human astrocytes and embryonal stem cells also showed that the ratio of active marks at the site corresponding to DNA demethylated loci in G-CIMP-demethylated tumors was significantly lower; this finding indicated that most demethylated loci in G-CIMP-demethylated tumors were likely transcriptionally inactive. A small number of the genes that were upregulated and had demethylated CpG islands were associated with cell cycle-related pathway. In

  7. Genomic characterization of a new endophytic Streptomyces kebangsaanensis identifies biosynthetic pathway gene clusters for novel phenazine antibiotic production

    Directory of Open Access Journals (Sweden)

    Juwairiah Remali

    2017-11-01

    Full Text Available Background Streptomyces are well known for their capability to produce many bioactive secondary metabolites with medical and industrial importance. Here we report a novel bioactive phenazine compound, 6-((2-hydroxy-4-methoxyphenoxy carbonyl phenazine-1-carboxylic acid (HCPCA extracted from Streptomyces kebangsaanensis, an endophyte isolated from the ethnomedicinal Portulaca oleracea. Methods The HCPCA chemical structure was determined using nuclear magnetic resonance spectroscopy. We conducted whole genome sequencing for the identification of the gene cluster(s believed to be responsible for phenazine biosynthesis in order to map its corresponding pathway, in addition to bioinformatics analysis to assess the potential of S. kebangsaanensis in producing other useful secondary metabolites. Results The S. kebangsaanensis genome comprises an 8,328,719 bp linear chromosome with high GC content (71.35% consisting of 12 rRNA operons, 81 tRNA, and 7,558 protein coding genes. We identified 24 gene clusters involved in polyketide, nonribosomal peptide, terpene, bacteriocin, and siderophore biosynthesis, as well as a gene cluster predicted to be responsible for phenazine biosynthesis. Discussion The HCPCA phenazine structure was hypothesized to derive from the combination of two biosynthetic pathways, phenazine-1,6-dicarboxylic acid and 4-methoxybenzene-1,2-diol, originated from the shikimic acid pathway. The identification of a biosynthesis pathway gene cluster for phenazine antibiotics might facilitate future genetic engineering design of new synthetic phenazine antibiotics. Additionally, these findings confirm the potential of S. kebangsaanensis for producing various antibiotics and secondary metabolites.

  8. Genome-wide association studies of autoimmune vitiligo identify 23 new risk loci and highlight key pathways and regulatory variants

    NARCIS (Netherlands)

    Jin, Ying; Andersen, Genevieve; Yorgov, Daniel; Ferrara, Tracey M.; Ben, Songtao; Brownson, Kelly M.; Holland, Paulene J.; Birlea, Stanca A.; Siebert, Janet; Hartmann, Anke; Lienert, Anne; van Geel, Nanja; Lambert, Jo; Luiten, Rosalie M.; Wolkerstorfer, Albert; Wietze van der Veen, J. P.; Bennett, Dorothy C.; Taïeb, Alain; Ezzedine, Khaled; Kemp, E. Helen; Gawkrodger, David J.; Weetman, Anthony P.; Kõks, Sulev; Prans, Ele; Kingo, Külli; Karelson, Maire; Wallace, Margaret R.; McCormack, Wayne T.; Overbeck, Andreas; Moretti, Silvia; Colucci, Roberta; Picardo, Mauro; Silverberg, Nanette B.; Olsson, Mats; Valle, Yan; Korobko, Igor; Böhm, Markus; Lim, Henry W.; Hamzavi, Iltefat; Zhou, Li; Mi, Qing-Sheng; Fain, Pamela R.; Santorico, Stephanie A.; Spritz, Richard A.

    2016-01-01

    Vitiligo is an autoimmune disease in which depigmented skin results from the destruction of melanocytes, with epidemiological association with other autoimmune diseases. In previous linkage and genome-wide association studies (GWAS1 and GWAS2), we identified 27 vitiligo susceptibility loci in

  9. A Large-Scale Multi-ancestry Genome-wide Study Accounting for Smoking Behavior Identifies Multiple Significant Loci for Blood Pressure

    NARCIS (Netherlands)

    Sung, Yun J.; Winkler, Thomas W.; de las Fuentes, Lisa; Bentley, Amy R.; Brown, Michael R.; Kraja, Aldi T.; Schwander, Karen; Ntalla, Ioanna; Guo, Xiuqing; Franceschini, Nora; Lu, Yingchang; Cheng, Ching-Yu; Sim, Xueling; Vojinovic, Dina; Marten, Jonathan; Musani, Solomon K.; Li, Changwei; Feitosa, Mary F.; Kilpelainen, Tuomas O.; Richard, Melissa A.; Noordam, Raymond; Aslibekyan, Stella; Aschard, Hugues; Bartz, Traci M.; Dorajoo, Rajkumar; Liu, Yongmei; Manning, Alisa K.; Rankinen, Tuomo; Smith, Albert Vernon; Tajuddin, Salman M.; Tayo, Bamidele O.; Warren, Helen R.; Zhao, Wei; Zhou, Yanhua; Matoba, Nana; Sofer, Tamar; Alver, Maris; Amini, Marzyeh; Boissel, Mathilde; Chai, Jin Fang; Chen, Xu; Divers, Jasmin; Gandin, Ilaria; Gao, Chuan; Giulianini, Franco; Goel, Anuj; Harris, Sarah E.; Hartwig, Fernando Pires; Horimoto, Andrea R. V. R.; Hsu, Fang-Chi; Jackson, Anne U.; Kahonen, Mika; Kasturiratne, Anuradhani; Kuhnel, Brigitte; Leander, Karin; Lee, Wen-Jane; Lin, Keng-Hung; Luan, Jian' an; McKenzie, Colin A.; He Meian,; Nelson, Christopher P.; Rauramaa, Rainer; Schupf, Nicole; Scott, Robert A.; Sheu, Wayne H. H.; Stancakova, Alena; Takeuchi, Fumihiko; van der Most, Peter J.; Varga, Tibor V.; Wang, Heming; Wang, Yajuan; Ware, Erin B.; Weiss, Stefan; Wen, Wanqing; Yanek, Lisa R.; Zhang, Weihua; Zhao, Jing Hua; Afaq, Saima; Alfred, Tamuno; Amin, Najaf; Arking, Dan; Aung, Tin; Barr, R. Graham; Bielak, Lawrence F.; Boerwinkle, Eric; Bottinger, Erwin P.; Braund, Peter S.; Brody, Jennifer A.; Broeckel, Ulrich; Cabrera, Claudia P.; Cade, Brian; Yu Caizheng,; Campbell, Archie; Canouil, Mickael; Chakravarti, Aravinda; Chauhan, Ganesh; Christensen, Kaare; Cocca, Massimiliano; Collins, Francis S.; Connell, John M.; de Mutsert, Renee; de Silva, H. Janaka; Debette, Stephanie; Dorr, Marcus; Duan, Qing; Eaton, Charles B.; Ehret, Georg; Evangelou, Evangelos; Faul, Jessica D.; Fisher, Virginia A.; Forouhi, Nita G.; Franco, Oscar H.; Friedlander, Yechiel; Gao, He; Gigante, Bruna; Graff, Misa; Gu, C. Charles; Gu, Dongfeng; Gupta, Preeti; Hagenaars, Saskia P.; Harris, Tamara B.; He, Jiang; Heikkinen, Sami; Heng, Chew-Kiat; Hirata, Makoto; Hofman, Albert; Howard, Barbara V.; Hunt, Steven; Irvin, Marguerite R.; Jia, Yucheng; Joehanes, Roby; Justice, Anne E.; Katsuya, Tomohiro; Kaufman, Joel; Kerrison, Nicola D.; Khor, Chiea Chuen; Koh, Woon-Puay; Koistinen, Heikki A.; Komulainen, Pirjo; Kooperberg, Charles; Krieger, Jose E.; Kubo, Michiaki; Kuusisto, Johanna; Langefeld, Carl D.; Langenberg, Claudia; Launer, Lenore J.; Lehne, Benjamin; Lewis, Cora E.; Li, Yize; Lim, Sing Hui; Lin, Shiow; Liu, Ching-Ti; Liu, Jianjun; Liu, Jingmin; Liu, Kiang; Liu, Yeheng; Loh, Marie; Lohman, Kurt K.; Long, Jirong; Louie, Tin; Magi, Reedik; Mahajan, Anubha; Meitinger, Thomas; Metspalu, Andres; Milani, Lili; Momozawa, Yukihide; Morris, Andrew P.; Mosley, Thomas H.; Munson, Peter; Murray, Alison D.; Nalls, Mike A.; Nasri, Ubaydah; Norris, Jill M.; North, Kari; Ogunniyi, Adesola; Padmanabhan, Sandosh; Palmas, Walter R.; Palmer, Nicholette D.; Pankow, James S.; Pedersen, Nancy L.; Peters, Annette; Peyser, Patricia A.; Polasek, Ozren; Raitakari, Olli T.; Renstrom, Frida; Rice, Treva K.; Ridker, Paul M.; Robino, Antonietta; Robinson, Jennifer G.; Rose, Lynda M.; Rudan, Igor; Sabanayagam, Charumathi; Salako, Babatunde L.; Sandow, Kevin; Schmidt, Carsten O.; Schreiner, Pamela J.; Scott, William R.; Seshadri, Sudha; Sever, Peter; Sitlani, Colleen M.; Smith, Jennifer A.; Snieder, Harold; Starr, John M.; Strauch, Konstantin; Tang, Hua; Taylor, Kent D.; Teo, Yik Ying; Tham, Yih Chung; Ultterlinden, Andre G.; Waldenberger, Melanie; Wang, Lihua; Wang, Ya X.; Bin Wei, Wen; Williams, Christine; Wilson, Gregory; Wojczynski, Mary K.; Yao, Jie; Yuan, Jian-Min; Zonderman, Alan B.; Becker, Diane M.; Boehnke, Michael; Bowden, Donald W.; Chambers, John C.; Chen, Yii-Der Ida; de Faire, Ulf; Deary, Ian J.; Esko, Tonu; Farrall, Martin; Forrester, Terrence; Franks, Paul W.; Freedman, Barry I.; Froguel, Philippe; Gasparini, Paolo; Gieger, Christian; Horta, Bernardo Lessa; Hung, Yi-Jen; Jonas, Jost B.; Kato, Norihiro; Kooner, Jaspal S.; Laakso, Markku; Lehtimaki, Terho; Liang, Kae-Woei; Magnusson, Patrik K. E.; Newman, Anne B.; Oldehinkel, Albertine J.; Pereira, Alexandre C.; Redline, Susan; Rettig, Rainer; Samani, Nilesh J.; Scott, James; Shu, Xiao-Ou; van der Harst, Pim; Wagenknecht, Lynne E.; Wareham, Nicholas J.; Watkins, Hugh; Weir, David R.; Wickremasinghe, Ananda R.; Wu, Tangchun; Zheng, Wei; Kamatani, Yoichiro; Laurie, Cathy C.; Bouchard, Claude; Cooper, Richard S.; Evans, Michele K.; Gudnason, Vilmundur; Kardia, Sharon L. R.; Kritchevsky, Stephen B.; Levy, Daniel; O'Connell, Jeff R.; Psaty, Bruce M.; van Dam, Rob M.; Sims, Mario; Arnett, Donna K.; Mook-Kanamori, Dennis O.; Kelly, Tanika N.; Fox, Ervin R.; Hayward, Caroline; Fornage, Myriam; Rotimi, Charles N.; Province, Michael A.; van Duijn, Cornelia M.; Tai, E. Shyong; Wong, Tien Yin; Loos, Ruth J. F.; Reiner, Alex P.; Rotter, Jerome I.; Zhu, Xiaofeng; Bierut, Laura J.; Gauderman, W. James; Caulfield, Mark J.; Elliott, Paul; Rice, Kenneth; Munroe, Patricia B.; Morrison, Alanna C.; Cupples, L. Adrienne; Rao, Dabeeru C.; Chasman, Daniel I.; Study, Lifelines Cohort

    2018-01-01

    Genome-wide association analysis advanced understanding of blood pressure (BP), a major risk factor for vascular conditions such as coronary heart disease and stroke. Accounting for smoking behavior may help identify BP loci and extend our knowledge of its genetic architecture. We performed

  10. Identifying cis-mediators for trans-eQTLs across many human tissues using genomic mediation analysis.

    Science.gov (United States)

    Yang, Fan; Wang, Jiebiao; Pierce, Brandon L; Chen, Lin S

    2017-11-01

    The impact of inherited genetic variation on gene expression in humans is well-established. The majority of known expression quantitative trait loci (eQTLs) impact expression of local genes ( cis -eQTLs). More research is needed to identify effects of genetic variation on distant genes ( trans -eQTLs) and understand their biological mechanisms. One common trans -eQTLs mechanism is "mediation" by a local ( cis ) transcript. Thus, mediation analysis can be applied to genome-wide SNP and expression data in order to identify transcripts that are " cis -mediators" of trans -eQTLs, including those " cis -hubs" involved in regulation of many trans -genes. Identifying such mediators helps us understand regulatory networks and suggests biological mechanisms underlying trans -eQTLs, both of which are relevant for understanding susceptibility to complex diseases. The multitissue expression data from the Genotype-Tissue Expression (GTEx) program provides a unique opportunity to study cis -mediation across human tissue types. However, the presence of complex hidden confounding effects in biological systems can make mediation analyses challenging and prone to confounding bias, particularly when conducted among diverse samples. To address this problem, we propose a new method: Genomic Mediation analysis with Adaptive Confounding adjustment (GMAC). It enables the search of a very large pool of variables, and adaptively selects potential confounding variables for each mediation test. Analyses of simulated data and GTEx data demonstrate that the adaptive selection of confounders by GMAC improves the power and precision of mediation analysis. Application of GMAC to GTEx data provides new insights into the observed patterns of cis -hubs and trans -eQTL regulation across tissue types. © 2017 Yang et al.; Published by Cold Spring Harbor Laboratory Press.

  11. Genomic organization, annotation, and ligand-receptor inferences of chicken chemokines and chemokine receptor genes based on comparative genomics

    Directory of Open Access Journals (Sweden)

    Sze Sing-Hoi

    2005-03-01

    Full Text Available Abstract Background Chemokines and their receptors play important roles in host defense, organogenesis, hematopoiesis, and neuronal communication. Forty-two chemokines and 19 cognate receptors have been found in the human genome. Prior to this report, only 11 chicken chemokines and 7 receptors had been reported. The objectives of this study were to systematically identify chicken chemokines and their cognate receptor genes in the chicken genome and to annotate these genes and ligand-receptor binding by a comparative genomics approach. Results Twenty-three chemokine and 14 chemokine receptor genes were identified in the chicken genome. All of the chicken chemokines contained a conserved CC, CXC, CX3C, or XC motif, whereas all the chemokine receptors had seven conserved transmembrane helices, four extracellular domains with a conserved cysteine, and a conserved DRYLAIV sequence in the second intracellular domain. The number of coding exons in these genes and the syntenies are highly conserved between human, mouse, and chicken although the amino acid sequence homologies are generally low between mammalian and chicken chemokines. Chicken genes were named with the systematic nomenclature used in humans and mice based on phylogeny, synteny, and sequence homology. Conclusion The independent nomenclature of chicken chemokines and chemokine receptors suggests that the chicken may have ligand-receptor pairings similar to mammals. All identified chicken chemokines and their cognate receptors were identified in the chicken genome except CCR9, whose ligand was not identified in this study. The organization of these genes suggests that there were a substantial number of these genes present before divergence between aves and mammals and more gene duplications of CC, CXC, CCR, and CXCR subfamilies in mammals than in aves after the divergence.

  12. GenoSets: visual analytic methods for comparative genomics.

    Directory of Open Access Journals (Sweden)

    Aurora A Cain

    Full Text Available Many important questions in biology are, fundamentally, comparative, and this extends to our analysis of a growing number of sequenced genomes. Existing genomic analysis tools are often organized around literal views of genomes as linear strings. Even when information is highly condensed, these views grow cumbersome as larger numbers of genomes are added. Data aggregation and summarization methods from the field of visual analytics can provide abstracted comparative views, suitable for sifting large multi-genome datasets to identify critical similarities and differences. We introduce a software system for visual analysis of comparative genomics data. The system automates the process of data integration, and provides the analysis platform to identify and explore features of interest within these large datasets. GenoSets borrows techniques from business intelligence and visual analytics to provide a rich interface of interactive visualizations supported by a multi-dimensional data warehouse. In GenoSets, visual analytic approaches are used to enable querying based on orthology, functional assignment, and taxonomic or user-defined groupings of genomes. GenoSets links this information together with coordinated, interactive visualizations for both detailed and high-level categorical analysis of summarized data. GenoSets has been designed to simplify the exploration of multiple genome datasets and to facilitate reasoning about genomic comparisons. Case examples are included showing the use of this system in the analysis of 12 Brucella genomes. GenoSets software and the case study dataset are freely available at http://genosets.uncc.edu. We demonstrate that the integration of genomic data using a coordinated multiple view approach can simplify the exploration of large comparative genomic data sets, and facilitate reasoning about comparisons and features of interest.

  13. PAPA: a flexible tool for identifying pleiotropic pathways using genome-wide association study summaries.

    Science.gov (United States)

    Wen, Yan; Wang, Wenyu; Guo, Xiong; Zhang, Feng

    2016-03-15

    : Pleiotropy is common in the genetic architectures of complex diseases. To the best of our knowledge, no analysis tool has been developed for identifying pleiotropic pathways using multiple genome-wide association study (GWAS) summaries by now. Here, we present PAPA, a flexible tool for pleiotropic pathway analysis utilizing GWAS summary results. The performance of PAPA was validated using publicly available GWAS summaries of body mass index and waist-hip ratio of the GIANT datasets. PAPA identified a set of pleiotropic pathways, which have been demonstrated to be involved in the development of obesity. PAPA program, document and illustrative example are available at http://sourceforge.net/projects/papav1/files/ : fzhxjtu@mail.xjtu.edu.cn Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  14. Genetic variants associated with subjective well-being, depressive symptoms and neuroticism identified through genome-wide analyses

    Science.gov (United States)

    Derringer, Jaime; Gratten, Jacob; Lee, James J; Liu, Jimmy Z; de Vlaming, Ronald; Ahluwalia, Tarunveer S; Buchwald, Jadwiga; Cavadino, Alana; Frazier-Wood, Alexis C; Davies, Gail; Furlotte, Nicholas A; Garfield, Victoria; Geisel, Marie Henrike; Gonzalez, Juan R; Haitjema, Saskia; Karlsson, Robert; van der Laan, Sander W; Ladwig, Karl-Heinz; Lahti, Jari; van der Lee, Sven J; Miller, Michael B; Lind, Penelope A; Liu, Tian; Matteson, Lindsay; Mihailov, Evelin; Minica, Camelia C; Nolte, Ilja M; Mook-Kanamori, Dennis O; van der Most, Peter J; Oldmeadow, Christopher; Qian, Yong; Raitakari, Olli; Rawal, Rajesh; Realo, Anu; Rueedi, Rico; Schmidt, Börge; Smith, Albert V; Stergiakouli, Evie; Tanaka, Toshiko; Taylor, Kent; Thorleifsson, Gudmar; Wedenoja, Juho; Wellmann, Juergen; Westra, Harm-Jan; Willems, Sara M; Zhao, Wei; Amin, Najaf; Bakshi, Andrew; Bergmann, Sven; Bjornsdottir, Gyda; Boyle, Patricia A; Cherney, Samantha; Cox, Simon R; Davis, Oliver S P; Ding, Jun; Direk, Nese; Eibich, Peter; Emeny, Rebecca T; Fatemifar, Ghazaleh; Faul, Jessica D; Ferrucci, Luigi; Forstner, Andreas J; Gieger, Christian; Gupta, Richa; Harris, Tamara B; Harris, Juliette M; Holliday, Elizabeth G; Hottenga, Jouke-Jan; De Jager, Philip L; Kaakinen, Marika A; Kajantie, Eero; Karhunen, Ville; Kolcic, Ivana; Kumari, Meena; Launer, Lenore J; Franke, Lude; Li-Gao, Ruifang; Liewald, David C; Koini, Marisa; Loukola, Anu; Marques-Vidal, Pedro; Montgomery, Grant W; Mosing, Miriam A; Paternoster, Lavinia; Pattie, Alison; Petrovic, Katja E; Pulkki-Råback, Laura; Quaye, Lydia; Räikkönen, Katri; Rudan, Igor; Scott, Rodney J; Smith, Jennifer A; Sutin, Angelina R; Trzaskowski, Maciej; Vinkhuyzen, Anna E; Yu, Lei; Zabaneh, Delilah; Attia, John R; Bennett, David A; Berger, Klaus; Bertram, Lars; Boomsma, Dorret I; Snieder, Harold; Chang, Shun-Chiao; Cucca, Francesco; Deary, Ian J; van Duijn, Cornelia M; Eriksson, Johan G; Bültmann, Ute; de Geus, Eco J C; Groenen, Patrick J F; Gudnason, Vilmundur; Hansen, Torben; Hartman, Catharine A; Haworth, Claire M A; Hayward, Caroline; Heath, Andrew C; Hinds, David A; Hyppönen, Elina; Iacono, William G; Järvelin, Marjo-Riitta; Jöckel, Karl-Heinz; Kaprio, Jaakko; Kardia, Sharon L R; Keltikangas-Järvinen, Liisa; Kraft, Peter; Kubzansky, Laura D; Lehtimäki, Terho; Magnusson, Patrik K E; Martin, Nicholas G; McGue, Matt; Metspalu, Andres; Mills, Melinda; de Mutsert, Renée; Oldehinkel, Albertine J; Pasterkamp, Gerard; Pedersen, Nancy L; Plomin, Robert; Polasek, Ozren; Power, Christine; Rich, Stephen S; Rosendaal, Frits R; den Ruijter, Hester M; Schlessinger, David; Schmidt, Helena; Svento, Rauli; Schmidt, Reinhold; Alizadeh, Behrooz Z; Sørensen, Thorkild I A; Spector, Tim D; Starr, John M; Stefansson, Kari; Steptoe, Andrew; Terracciano, Antonio; Thorsteinsdottir, Unnur; Thurik, A Roy; Timpson, Nicholas J; Tiemeier, Henning; Uitterlinden, André G; Vollenweider, Peter; Wagner, Gert G; Weir, David R; Yang, Jian; Conley, Dalton C; Smith, George Davey; Hofman, Albert; Johannesson, Magnus; Laibson, David I; Medland, Sarah E; Meyer, Michelle N; Pickrell, Joseph K; Esko, Tõnu; Krueger, Robert F; Beauchamp, Jonathan P; Koellinger, Philipp D; Benjamin, Daniel J; Bartels, Meike; Cesarini, David

    2016-01-01

    We conducted genome-wide association studies of three phenotypes: subjective well-being (N = 298,420), depressive symptoms (N = 161,460), and neuroticism (N = 170,910). We identified three variants associated with subjective well-being, two with depressive symptoms, and eleven with neuroticism, including two inversion polymorphisms. The two depressive symptoms loci replicate in an independent depression sample. Joint analyses that exploit the high genetic correlations between the phenotypes (|ρ^| ≈ 0.8) strengthen the overall credibility of the findings, and allow us to identify additional variants. Across our phenotypes, loci regulating expression in central nervous system and adrenal/pancreas tissues are strongly enriched for association. PMID:27089181

  15. Phylogenetic Conflict in Bears Identified by Automated Discovery of Transposable Element Insertions in Low-Coverage Genomes

    Science.gov (United States)

    Gallus, Susanne; Janke, Axel

    2017-01-01

    Abstract Phylogenetic reconstruction from transposable elements (TEs) offers an additional perspective to study evolutionary processes. However, detecting phylogenetically informative TE insertions requires tedious experimental work, limiting the power of phylogenetic inference. Here, we analyzed the genomes of seven bear species using high-throughput sequencing data to detect thousands of TE insertions. The newly developed pipeline for TE detection called TeddyPi (TE detection and discovery for Phylogenetic Inference) identified 150,513 high-quality TE insertions in the genomes of ursine and tremarctine bears. By integrating different TE insertion callers and using a stringent filtering approach, the TeddyPi pipeline produced highly reliable TE insertion calls, which were confirmed by extensive in vitro validation experiments. Analysis of single nucleotide substitutions in the flanking regions of the TEs shows that these substitutions correlate with the phylogenetic signal from the TE insertions. Our phylogenomic analyses show that TEs are a major driver of genomic variation in bears and enabled phylogenetic reconstruction of a well-resolved species tree, despite strong signals for incomplete lineage sorting and introgression. The analyses show that the Asiatic black, sun, and sloth bear form a monophyletic clade, in which phylogenetic incongruence originates from incomplete lineage sorting. TeddyPi is open source and can be adapted to various TE and structural variation callers. The pipeline makes it possible to confidently extract thousands of TE insertions even from low-coverage genomes (∼10×) of nonmodel organisms. This opens new possibilities for biologists to study phylogenies and evolutionary processes as well as rates and patterns of (retro-)transposition and structural variation. PMID:28985298

  16. PineElm_SSRdb: a microsatellite marker database identified from genomic, chloroplast, mitochondrial and EST sequences of pineapple (Ananas comosus (L.) Merrill).

    Science.gov (United States)

    Chaudhary, Sakshi; Mishra, Bharat Kumar; Vivek, Thiruvettai; Magadum, Santoshkumar; Yasin, Jeshima Khan

    2016-01-01

    Simple Sequence Repeats or microsatellites are resourceful molecular genetic markers. There are only few reports of SSR identification and development in pineapple. Complete genome sequence of pineapple available in the public domain can be used to develop numerous novel SSRs. Therefore, an attempt was made to identify SSRs from genomic, chloroplast, mitochondrial and EST sequences of pineapple which will help in deciphering genetic makeup of its germplasm resources. A total of 359511 SSRs were identified in pineapple (356385 from genome sequence, 45 from chloroplast sequence, 249 in mitochondrial sequence and 2832 from EST sequences). The list of EST-SSR markers and their details are available in the database. PineElm_SSRdb is an open source database available for non-commercial academic purpose at http://app.bioelm.com/ with a mapping tool which can develop circular maps of selected marker set. This database will be of immense use to breeders, researchers and graduates working on Ananas spp. and to others working on cross-species transferability of markers, investigating diversity, mapping and DNA fingerprinting.

  17. Genome-wide association analysis of more than 120,000 individuals identifies 15 new susceptibility loci for breast cancer.

    OpenAIRE

    Michailidou, Kyriaki; Beesley, Jonathan; Lindstrom, Sara; Canisius, Sander; Dennis, Joe; Lush, Michael J; Maranian, Mel J; Bolla, Manjeet K; Wang, Qin; Shah, Mitulkumar Nandlal; Perkins, Barbara J; Czene, Kamila; Eriksson, Mikael; Darabi, Hatef; Brand, Judith S

    2015-01-01

    Genome-wide association studies (GWAS) and large-scale replication studies have identified common variants in 79 loci associated with breast cancer, explaining ~14% of the familial risk of the disease. To identify new susceptibility loci, we performed a meta-analysis of 11 GWAS, comprising 15,748 breast cancer cases and 18,084 controls together with 46,785 cases and 42,892 controls from 41 studies genotyped on a 211,155-marker custom array (iCOGS). Analyses were restricted to women of Europea...

  18. Genome-wide association analysis of more than 120,000 individuals identifies 15 new susceptibility loci for breast cancer

    OpenAIRE

    Michailidou, Kyriaki; Beesley, Jonathan; Lindstrom, Stephen; Canisius, Sander; Dennis, Joe; Lush, Michael; Maranian, Melanie; Bolla, Manjeet; Wang, Qing; Shah, Mitul; Perkins, Barbara; Czene, Kamila; Eriksson, Mikael; Darabi, Hatef; Brand, Judith S.

    2015-01-01

    textabstractGenome-wide association studies (GWAS) and large-scale replication studies have identified common variants in 79 loci associated with breast cancer, explaining ∼14% of the familial risk of the disease. To identify new susceptibility loci, we performed a meta-analysis of 11 GWAS, comprising 15,748 breast cancer cases and 18,084 controls together with 46,785 cases and 42,892 controls from 41 studies genotyped on a 211,155-marker custom array (iCOGS). Analyses were restricted to wome...

  19. Integrative Annotation of Variants from 1092 Humans: Application to Cancer Genomics

    DEFF Research Database (Denmark)

    Khurana, Ekta; Fu, Yao; Colonna, Vincenza

    2013-01-01

    Identifying Important Identifiers Each of us has millions of sequence variations in our genomes. Signatures of purifying or negative selection should help identify which of those variations is functionally important. Khurana et al. (1235587) used sequence polymorphisms from 1092 humans across 14...... sites tended to occur in network hub promoters. Many recurrent somatic cancer variants occurred in noncoding regulatory regions and thus might indicate mutations that drive cancer....

  20. Comparative Genomic Hybridization Analysis of Yersinia enterocolitica and Yersinia pseudotuberculosis Identifies Genetic Traits to Elucidate Their Different Ecologies

    Directory of Open Access Journals (Sweden)

    Kaisa Jaakkola

    2015-01-01

    Full Text Available Enteropathogenic Yersinia enterocolitica and Yersinia pseudotuberculosis are both etiological agents for intestinal infection known as yersiniosis, but their epidemiology and ecology bear many differences. Swine are the only known reservoir for Y. enterocolitica 4/O:3 strains, which are the most common cause of human disease, while Y. pseudotuberculosis has been isolated from a variety of sources, including vegetables and wild animals. Infections caused by Y. enterocolitica mainly originate from swine, but fresh produce has been the source for widespread Y. pseudotuberculosis outbreaks within recent decades. A comparative genomic hybridization analysis with a DNA microarray based on three Yersinia enterocolitica and four Yersinia pseudotuberculosis genomes was conducted to shed light on the genomic differences between enteropathogenic Yersinia. The hybridization results identified Y. pseudotuberculosis strains to carry operons linked with the uptake and utilization of substances not found in living animal tissues but present in soil, plants, and rotting flesh. Y. pseudotuberculosis also harbors a selection of type VI secretion systems targeting other bacteria and eukaryotic cells. These genetic traits are not found in Y. enterocolitica, and it appears that while Y. pseudotuberculosis has many tools beneficial for survival in varied environments, the Y. enterocolitica genome is more streamlined and adapted to their preferred animal reservoir.

  1. DESCARTES’ RULE OF SIGNS AND THE IDENTIFIABILITY OF POPULATION DEMOGRAPHIC MODELS FROM GENOMIC VARIATION DATA1

    Science.gov (United States)

    Bhaskar, Anand; Song, Yun S.

    2016-01-01

    The sample frequency spectrum (SFS) is a widely-used summary statistic of genomic variation in a sample of homologous DNA sequences. It provides a highly efficient dimensional reduction of large-scale population genomic data and its mathematical dependence on the underlying population demography is well understood, thus enabling the development of efficient inference algorithms. However, it has been recently shown that very different population demographies can actually generate the same SFS for arbitrarily large sample sizes. Although in principle this nonidentifiability issue poses a thorny challenge to statistical inference, the population size functions involved in the counterexamples are arguably not so biologically realistic. Here, we revisit this problem and examine the identifiability of demographic models under the restriction that the population sizes are piecewise-defined where each piece belongs to some family of biologically-motivated functions. Under this assumption, we prove that the expected SFS of a sample uniquely determines the underlying demographic model, provided that the sample is sufficiently large. We obtain a general bound on the sample size sufficient for identifiability; the bound depends on the number of pieces in the demographic model and also on the type of population size function in each piece. In the cases of piecewise-constant, piecewise-exponential and piecewise-generalized-exponential models, which are often assumed in population genomic inferences, we provide explicit formulas for the bounds as simple functions of the number of pieces. Lastly, we obtain analogous results for the “folded” SFS, which is often used when there is ambiguity as to which allelic type is ancestral. Our results are proved using a generalization of Descartes’ rule of signs for polynomials to the Laplace transform of piecewise continuous functions. PMID:28018011

  2. Exploring relationships between host genome and microbiome: new insights from genome-wide association studies.

    Directory of Open Access Journals (Sweden)

    Muslihudeen Abdul-Razaq Abdul-Aziz

    2016-10-01

    Full Text Available As our understanding of the human microbiome expands, impacts on health and disease continue to be revealed. Alterations in the microbiome can result in dysbiosis, which has now been linked to subsequent autoimmune and metabolic diseases, highlighting the need to identify factors that shape the microbiome. Research has identified that the composition and functions of the human microbiome can be influenced by diet, age, gender, and environment. More recently, studies have explored how human genetic variation may also influence the microbiome. Here, we review several recent analytical advances in this new research area, including those that use genome-wide association studies to examine host genome-microbiome interactions, while controlling for the influence of other factors. We find that current research is limited by small sample sizes, lack of cohort replication, and insufficient confirmatory mechanistic studies. In addition, we discuss the importance of understanding long-term interactions between the host genome and microbiome, as well as the potential impacts of disrupting this relationship, and explore new research avenues that may provide information about the co-evolutionary history of humans and their microorganisms.

  3. Genomic dark matter: the reliability of short read mapping illustrated by the genome mappability score.

    Science.gov (United States)

    Lee, Hayan; Schatz, Michael C

    2012-08-15

    Genome resequencing and short read mapping are two of the primary tools of genomics and are used for many important applications. The current state-of-the-art in mapping uses the quality values and mapping quality scores to evaluate the reliability of the mapping. These attributes, however, are assigned to individual reads and do not directly measure the problematic repeats across the genome. Here, we present the Genome Mappability Score (GMS) as a novel measure of the complexity of resequencing a genome. The GMS is a weighted probability that any read could be unambiguously mapped to a given position and thus measures the overall composition of the genome itself. We have developed the Genome Mappability Analyzer to compute the GMS of every position in a genome. It leverages the parallelism of cloud computing to analyze large genomes, and enabled us to identify the 5-14% of the human, mouse, fly and yeast genomes that are difficult to analyze with short reads. We examined the accuracy of the widely used BWA/SAMtools polymorphism discovery pipeline in the context of the GMS, and found discovery errors are dominated by false negatives, especially in regions with poor GMS. These errors are fundamental to the mapping process and cannot be overcome by increasing coverage. As such, the GMS should be considered in every resequencing project to pinpoint the 'dark matter' of the genome, including of known clinically relevant variations in these regions. The source code and profiles of several model organisms are available at http://gma-bio.sourceforge.net

  4. Virulence-Associated Genome Mutations of Murine Rotavirus Identified by Alternating Serial Passages in Mice and Cell Cultures

    Science.gov (United States)

    Tatsumi, Masatoshi; Tsutsumi, Hiroyuki

    2014-01-01

    ABSTRACT Although significant clinical efficacy and safety of rotavirus vaccines were recently revealed in many countries, the mechanism of their attenuation is not well understood. We passaged serially a cell culture-adapted murine rotavirus EB strain in mouse pups or in cell cultures alternately and repeatedly and fully sequenced all 11 genes of 21 virus samples passaged in mice or in cell cultures. Sequence analysis revealed that mouse-passaged viruses that regained virulence almost consistently acquired four kinds of amino acid (aa) substitutions in VP4 and substitution in aa 37 (Val to Ala) in NSP4. In addition, they gained and invariably conserved the 3′ consensus sequence in NSP1. The molecular changes occurred along with the acquisition of virulence during passages in mice and then disappeared following passages in cell cultures. Intraperitoneal injection of recombinant NSP4 proteins confirmed the aa 37 site as important for its diarrheagenic activity in mice. These genome changes are likely to be correlated with rotavirus virulence. IMPORTANCE Serial passage of a virulent wild-type virus in vitro often results in loss of virulence of the virus in an original animal host, while serial passage of a cell culture-adapted avirulent virus in vivo often gains virulence in an animal host. Actually, live attenuated virus vaccines were originally produced by serial passage in cell cultures. Although clinical efficacy and safety of rotavirus vaccines were recently revealed, the mechanism of their attenuation is not well understood. We passaged serially a murine rotavirus by alternating switch of host (mice or cell cultures) repeatedly and sequenced the eleven genes of the passaged viruses to identify mutations associated with the emergence or disappearance of virulence. Sequence analysis revealed that changes in three genes (VP4, NSP1, and NSP4) were associated with virulence in mice. Intraperitoneal injection of recombinant NSP4 proteins confirmed its

  5. Draft genome sequence of an elite Dura palm and whole-genome patterns of DNA variation in oil palm.

    Science.gov (United States)

    Jin, Jingjing; Lee, May; Bai, Bin; Sun, Yanwei; Qu, Jing; Rahmadsyah; Alfiko, Yuzer; Lim, Chin Huat; Suwanto, Antonius; Sugiharti, Maria; Wong, Limsoon; Ye, Jian; Chua, Nam-Hai; Yue, Gen Hua

    2016-12-01

    Oil palm is the world's leading source of vegetable oil and fat. Dura, Pisifera and Tenera are three forms of oil palm. The genome sequence of Pisifera is available whereas the Dura form has not been sequenced yet. We sequenced the genome of one elite Dura palm, and re-sequenced 17 palm genomes. The assemble genome sequence of the elite Dura tree contained 10,971 scaffolds and was 1.701 Gb in length, covering 94.49% of the oil palm genome. 36,105 genes were predicted. Re-sequencing of 17 additional palm trees identified 18.1 million SNPs. We found high genetic variation among palms from different geographical regions, but lower variation among Southeast Asian Dura and Pisifera palms. We mapped 10,000 SNPs on the linkage map of oil palm. In addition, high linkage disequilibrium (LD) was detected in the oil palms used in breeding populations of Southeast Asia, suggesting that LD mapping is likely to be practical in this important oil crop. Our data provide a valuable resource for accelerating genetic improvement and studying the mechanism underlying phenotypic variations of important oil palm traits. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  6. Genome Editing with Engineered Nucleases in Economically Important Animals and Plants: State of the Art in the Research Pipeline.

    Science.gov (United States)

    Sovová, Tereza; Kerins, Gerard; Demnerová, Kateřina; Ovesná, Jaroslava

    2017-01-01

    After induced mutagenesis and transgenesis, genome editing is the next step in the development of breeding techniques. Genome editing using site-directed nucleases - including meganucleases, zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the CRISPR/Cas9 system - is based on the mechanism of double strand breaks. The nuclease is directed to cleave the DNA at a specific place of the genome which is then repaired by natural repair mechanisms. Changes are introduced during the repair that are either accidental or can be targeted if a DNA template with the desirable sequence is provided. These techniques allow making virtually any change to the genome including specific DNA sequence changes, gene insertion, replacements or deletions with unprecedented precision and specificity while being less laborious and more straightforward compared to traditional breeding techniques or transgenesis. Therefore, the research in this field is developing quickly and, apart from model species, multiple studies have focused on economically important species and agronomically important traits that were the key subjects of this review. In plants, studies have been undertaken on disease resistance, herbicide tolerance, nutrient metabolism and nutritional value. In animals, the studies have mainly focused on disease resistance, meat production and allergenicity of milk. However, none of the promising studies has led to commercialization despite several patent applications. The uncertain legal status of genome-editing methods is one of the reasons for poor commercial development, as it is not clear whether the products would fall under the GMO regulation. We believe this issue should be clarified soon in order to allow promising methods to reach their full potential.

  7. Advances in Genomics of Entomopathogenic Fungi.

    Science.gov (United States)

    Wang, J B; St Leger, R J; Wang, C

    2016-01-01

    Fungi are the commonest pathogens of insects and crucial regulators of insect populations. The rapid advance of genome technologies has revolutionized our understanding of entomopathogenic fungi with multiple Metarhizium spp. sequenced, as well as Beauveria bassiana, Cordyceps militaris, and Ophiocordyceps sinensis among others. Phylogenomic analysis suggests that the ancestors of many of these fungi were plant endophytes or pathogens, with entomopathogenicity being an acquired characteristic. These fungi now occupy a wide range of habitats and hosts, and their genomes have provided a wealth of information on the evolution of virulence-related characteristics, as well as the protein families and genomic structure associated with ecological and econutritional heterogeneity, genome evolution, and host range diversification. In particular, their evolutionary transition from plant pathogens or endophytes to insect pathogens provides a novel perspective on how new functional mechanisms important for host switching and virulence are acquired. Importantly, genomic resources have helped make entomopathogenic fungi ideal model systems for answering basic questions in parasitology, entomology, and speciation. At the same time, identifying the selective forces that act upon entomopathogen fitness traits could underpin both the development of new mycoinsecticides and further our understanding of the natural roles of these fungi in nature. These roles frequently include mutualistic relationships with plants. Genomics has also facilitated the rapid identification of genes encoding biologically useful molecules, with implications for the development of pharmaceuticals and the use of these fungi as bioreactors. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Genome-Wide Linkage and Association Analysis Identifies Major Gene Loci for Guttural Pouch Tympany in Arabian and German Warmblood Horses

    Science.gov (United States)

    Metzger, Julia; Ohnesorge, Bernhard; Distl, Ottmar

    2012-01-01

    Equine guttural pouch tympany (GPT) is a hereditary condition affecting foals in their first months of life. Complex segregation analyses in Arabian and German warmblood horses showed the involvement of a major gene as very likely. Genome-wide linkage and association analyses including a high density marker set of single nucleotide polymorphisms (SNPs) were performed to map the genomic region harbouring the potential major gene for GPT. A total of 85 Arabian and 373 German warmblood horses were genotyped on the Illumina equine SNP50 beadchip. Non-parametric multipoint linkage analyses showed genome-wide significance on horse chromosomes (ECA) 3 for German warmblood at 16–26 Mb and 34–55 Mb and for Arabian on ECA15 at 64–65 Mb. Genome-wide association analyses confirmed the linked regions for both breeds. In Arabian, genome-wide association was detected at 64 Mb within the region with the highest linkage peak on ECA15. For German warmblood, signals for genome-wide association were close to the peak region of linkage at 52 Mb on ECA3. The odds ratio for the SNP with the highest genome-wide association was 0.12 for the Arabian. In conclusion, the refinement of the regions with the Illumina equine SNP50 beadchip is an important step to unravel the responsible mutations for GPT. PMID:22848553

  9. Extensive Mobilome-Driven Genome Diversification in Mouse Gut-Associated Bacteroides vulgatus mpk.

    Science.gov (United States)

    Lange, Anna; Beier, Sina; Steimle, Alex; Autenrieth, Ingo B; Huson, Daniel H; Frick, Julia-Stefanie

    2016-04-25

    Like many other Bacteroides species, Bacteroides vulgatus strain mpk, a mouse fecal isolate which was shown to promote intestinal homeostasis, utilizes a variety of mobile elements for genome evolution. Based on sequences collected by Pacific Biosciences SMRT sequencing technology, we discuss the challenges of assembling and studying a bacterial genome of high plasticity. Additionally, we conducted comparative genomics comparing this commensal strain with the B. vulgatus type strain ATCC 8482 as well as multiple other Bacteroides and Parabacteroides strains to reveal the most important differences and identify the unique features of B. vulgatus mpk. The genome of B. vulgatus mpk harbors a large and diverse set of mobile element proteins compared with other sequenced Bacteroides strains. We found evidence of a number of different horizontal gene transfer events and a genome landscape that has been extensively altered by different mobilization events. A CRISPR/Cas system could be identified that provides a possible mechanism for preventing the integration of invading external DNA. We propose that the high genome plasticity and the introduced genome instabilities of B. vulgatus mpk arising from the various mobilization events might play an important role not only in its adaptation to the challenging intestinal environment in general, but also in its ability to interact with the gut microbiota. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  10. Identifying Likely Transmission Pathways within a 10-Year Community Outbreak of Tuberculosis by High-Depth Whole Genome Sequencing.

    Directory of Open Access Journals (Sweden)

    Alexander C Outhred

    Full Text Available Improved tuberculosis control and the need to contain the spread of drug-resistant strains provide a strong rationale for exploring tuberculosis transmission dynamics at the population level. Whole-genome sequencing provides optimal strain resolution, facilitating detailed mapping of potential transmission pathways.We sequenced 22 isolates from a Mycobacterium tuberculosis cluster in New South Wales, Australia, identified during routine 24-locus mycobacterial interspersed repetitive unit typing. Following high-depth paired-end sequencing using the Illumina HiSeq 2000 platform, two independent pipelines were employed for analysis, both employing read mapping onto reference genomes as well as de novo assembly, to control biases in variant detection. In addition to single-nucleotide polymorphisms, the analyses also sought to identify insertions, deletions and structural variants.Isolates were highly similar, with a distance of 13 variants between the most distant members of the cluster. The most sensitive analysis classified the 22 isolates into 18 groups. Four of the isolates did not appear to share a recent common ancestor with the largest clade; another four isolates had an uncertain ancestral relationship with the largest clade.Whole genome sequencing, with analysis of single-nucleotide polymorphisms, insertions, deletions, structural variants and subpopulations, enabled the highest possible level of discrimination between cluster members, clarifying likely transmission pathways and exposing the complexity of strain origin. The analysis provides a basis for targeted public health intervention and enhanced classification of future isolates linked to the cluster.

  11. Genome-wide association study to identify common variants associated with brachial circumference: a meta-analysis of 14 cohorts.

    Directory of Open Access Journals (Sweden)

    Vesna Boraska

    Full Text Available Brachial circumference (BC, also known as upper arm or mid arm circumference, can be used as an indicator of muscle mass and fat tissue, which are distributed differently in men and women. Analysis of anthropometric measures of peripheral fat distribution such as BC could help in understanding the complex pathophysiology behind overweight and obesity. The purpose of this study is to identify genetic variants associated with BC through a large-scale genome-wide association scan (GWAS meta-analysis. We used fixed-effects meta-analysis to synthesise summary results across 14 GWAS discovery and 4 replication cohorts comprising overall 22,376 individuals (12,031 women and 10,345 men of European ancestry. Individual analyses were carried out for men, women, and combined across sexes using linear regression and an additive genetic model: adjusted for age and adjusted for age and BMI. We prioritised signals for follow-up in two-stages. We did not detect any signals reaching genome-wide significance. The FTO rs9939609 SNP showed nominal evidence for association (p<0.05 in the age-adjusted strata for men and across both sexes. In this first GWAS meta-analysis for BC to date, we have not identified any genome-wide significant signals and do not observe robust association of previously established obesity loci with BC. Large-scale collaborations will be necessary to achieve higher power to detect loci underlying BC.

  12. Whole genome sequencing reveals genomic heterogeneity and antibiotic purification in Mycobacterium tuberculosis isolates

    KAUST Repository

    Black, PA

    2015-10-24

    Background Whole genome sequencing has revolutionised the interrogation of mycobacterial genomes. Recent studies have reported conflicting findings on the genomic stability of Mycobacterium tuberculosis during the evolution of drug resistance. In an age where whole genome sequencing is increasingly relied upon for defining the structure of bacterial genomes, it is important to investigate the reliability of next generation sequencing to identify clonal variants present in a minor percentage of the population. This study aimed to define a reliable cut-off for identification of low frequency sequence variants and to subsequently investigate genetic heterogeneity and the evolution of drug resistance in M. tuberculosis. Methods Genomic DNA was isolated from single colonies from 14 rifampicin mono-resistant M. tuberculosis isolates, as well as the primary cultures and follow up MDR cultures from two of these patients. The whole genomes of the M. tuberculosis isolates were sequenced using either the Illumina MiSeq or Illumina HiSeq platforms. Sequences were analysed with an in-house pipeline. Results Using next-generation sequencing in combination with Sanger sequencing and statistical analysis we defined a read frequency cut-off of 30 % to identify low frequency M. tuberculosis variants with high confidence. Using this cut-off we demonstrated a high rate of genetic diversity between single colonies isolated from one population, showing that by using the current sequencing technology, single colonies are not a true reflection of the genetic diversity within a whole population and vice versa. We further showed that numerous heterogeneous variants emerge and then disappear during the evolution of isoniazid resistance within individual patients. Our findings allowed us to formulate a model for the selective bottleneck which occurs during the course of infection, acting as a genomic purification event. Conclusions Our study demonstrated true levels of genetic diversity

  13. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms

    Science.gov (United States)

    Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

    2015-01-01

    Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450

  14. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

    Directory of Open Access Journals (Sweden)

    Francesca Bertolini

    Full Text Available Few studies investigated the donkey (Equus asinus at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca. The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing and Ion Torrent (RRL runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

  15. Functional profiling of cyanobacterial genomes and its role in ecological adaptations

    Directory of Open Access Journals (Sweden)

    Ratna Prabha

    2016-09-01

    Full Text Available With the availability of complete genome sequences of many cyanobacterial species, it is becoming feasible to study the broad prospective of the environmental adaptation and the overall changes at transcriptional and translational level in these organisms. In the evolutionary phase, niche-specific competitive forces have resulted in specific features of the cyanobacterial genomes. In this study, functional composition of the 84 different cyanobacterial genomes and their adaptations to different environments was examined by identifying the genomic composition for specific cellular processes, which reflect their genomic functional profile and ecological adaptation. It was identified that among cyanobacterial genomes, metabolic genes have major share over other categories and differentiation of genomic functional profile was observed for the species inhabiting different habitats. The cyanobacteria of freshwater and other habitats accumulate large number of poorly characterized genes. Strain specific functions were also reported in many cyanobacterial members, of which an important feature was the occurrence of phage-related sequences. From this study, it can be speculated that habitat is one of the major factors in giving the shape of functional composition of cyanobacterial genomes towards their ecological adaptations.

  16. The yak genome and adaptation to life at high altitude

    DEFF Research Database (Denmark)

    Qiu, Qiang; Zhang, Guojie; Ma, Tao

    2012-01-01

    . Here, we present the draft genome sequence of a female domestic yak generated using Illumina-based technology at 65-fold coverage. Genomic comparisons between yak and cattle identify an expansion in yak of gene families related to sensory perception and energy metabolism, as well as an enrichment...... important implications for understanding adaptation to high altitude in other animal species and for hypoxia-related diseases in humans....

  17. Identifying important nodes by adaptive LeaderRank

    Science.gov (United States)

    Xu, Shuang; Wang, Pei

    2017-03-01

    Spreading process is a common phenomenon in complex networks. Identifying important nodes in complex networks is of great significance in real-world applications. Based on the spreading process on networks, a lot of measures have been proposed to evaluate the importance of nodes. However, most of the existing measures are appropriate to static networks, which are fragile to topological perturbations. Many real-world complex networks are dynamic rather than static, meaning that the nodes and edges of such networks may change with time, which challenge numerous existing centrality measures. Based on a new weighted mechanism and the newly proposed H-index and LeaderRank (LR), this paper introduces a variant of the LR measure, called adaptive LeaderRank (ALR), which is a new member of the LR-family. Simulations on six real-world networks reveal that the new measure can well balance between prediction accuracy and robustness. More interestingly, the new measure can better adapt to the adjustment or local perturbations of network topologies, as compared with the existing measures. By discussing the detailed properties of the measures from the LR-family, we illustrate that the ALR has its competitive advantages over the other measures. The proposed algorithm enriches the measures to understand complex networks, and may have potential applications in social networks and biological systems.

  18. A genome-wide siRNA screen to identify modulators of insulin sensitivity and gluconeogenesis.

    Directory of Open Access Journals (Sweden)

    Ruojing Yang

    Full Text Available BACKGROUND: Hepatic insulin resistance impairs insulin's ability to suppress hepatic glucose production (HGP and contributes to the development of type 2 diabetes (T2D. Although the interests to discover novel genes that modulate insulin sensitivity and HGP are high, it remains challenging to have a human cell based system to identify novel genes. METHODOLOGY/PRINCIPAL FINDINGS: To identify genes that modulate hepatic insulin signaling and HGP, we generated a human cell line stably expressing beta-lactamase under the control of the human glucose-6-phosphatase (G6PC promoter (AH-G6PC cells. Both beta-lactamase activity and endogenous G6PC mRNA were increased in AH-G6PC cells by a combination of dexamethasone and pCPT-cAMP, and reduced by insulin. A 4-gene High-Throughput-Genomics assay was developed to concomitantly measure G6PC and pyruvate-dehydrogenase-kinase-4 (PDK4 mRNA levels. Using this assay, we screened an siRNA library containing pooled siRNA targeting 6650 druggable genes and identified 614 hits that lowered G6PC expression without increasing PDK4 mRNA levels. Pathway analysis indicated that siRNA-mediated knockdown (KD of genes known to positively or negatively affect insulin signaling increased or decreased G6PC mRNA expression, respectively, thus validating our screening platform. A subset of 270 primary screen hits was selected and 149 hits were confirmed by target gene KD by pooled siRNA and 7 single siRNA for each gene to reduce G6PC expression in 4-gene HTG assay. Subsequently, pooled siRNA KD of 113 genes decreased PEPCK and/or PGC1alpha mRNA expression thereby demonstrating their role in regulating key gluconeogenic genes in addition to G6PC. Last, KD of 61 of the above 113 genes potentiated insulin-stimulated Akt phosphorylation, suggesting that they suppress gluconeogenic gene by enhancing insulin signaling. CONCLUSIONS/SIGNIFICANCE: These results support the proposition that the proteins encoded by the genes identified in

  19. A genome-wide association study identifies susceptibility loci for ovarian cancer at 2q31 and 8q24

    DEFF Research Database (Denmark)

    Goode, Ellen L; Chenevix-Trench, Georgia; Song, Honglin

    2010-01-01

    Ovarian cancer accounts for more deaths than all other gynecological cancers combined. To identify common low-penetrance ovarian cancer susceptibility genes, we conducted a genome-wide association study of 507,094 SNPs in 1,768 individuals with ovarian cancer (cases) and 2,354 controls, with foll...

  20. Investigating Drought Tolerance in Chickpea Using Genome-Wide Association Mapping and Genomic Selection Based on Whole-Genome Resequencing Data.

    Science.gov (United States)

    Li, Yongle; Ruperao, Pradeep; Batley, Jacqueline; Edwards, David; Khan, Tanveer; Colmer, Timothy D; Pang, Jiayin; Siddique, Kadambot H M; Sutton, Tim

    2018-01-01

    Drought tolerance is a complex trait that involves numerous genes. Identifying key causal genes or linked molecular markers can facilitate the fast development of drought tolerant varieties. Using a whole-genome resequencing approach, we sequenced 132 chickpea varieties and advanced breeding lines and found more than 144,000 single nucleotide polymorphisms (SNPs). We measured 13 yield and yield-related traits in three drought-prone environments of Western Australia. The genotypic effects were significant for all traits, and many traits showed highly significant correlations, ranging from 0.83 between grain yield and biomass to -0.67 between seed weight and seed emergence rate. To identify candidate genes, the SNP and trait data were incorporated into the SUPER genome-wide association study (GWAS) model, a modified version of the linear mixed model. We found that several SNPs from auxin-related genes, including auxin efflux carrier protein (PIN3), p-glycoprotein, and nodulin MtN21/EamA-like transporter, were significantly associated with yield and yield-related traits under drought-prone environments. We identified four genetic regions containing SNPs significantly associated with several different traits, which was an indication of pleiotropic effects. We also investigated the possibility of incorporating the GWAS results into a genomic selection (GS) model, which is another approach to deal with complex traits. Compared to using all SNPs, application of the GS model using subsets of SNPs significantly associated with the traits under investigation increased the prediction accuracies of three yield and yield-related traits by more than twofold. This has important implication for implementing GS in plant breeding programs.

  1. Genome-wide association studies in dogs and humans identify ADAMTS20 as a risk variant for cleft lip and palate.

    Science.gov (United States)

    Wolf, Zena T; Brand, Harrison A; Shaffer, John R; Leslie, Elizabeth J; Arzi, Boaz; Willet, Cali E; Cox, Timothy C; McHenry, Toby; Narayan, Nicole; Feingold, Eleanor; Wang, Xioajing; Sliskovic, Saundra; Karmi, Nili; Safra, Noa; Sanchez, Carla; Deleyiannis, Frederic W B; Murray, Jeffrey C; Wade, Claire M; Marazita, Mary L; Bannasch, Danika L

    2015-03-01

    Cleft lip with or without cleft palate (CL/P) is the most commonly occurring craniofacial birth defect. We provide insight into the genetic etiology of this birth defect by performing genome-wide association studies in two species: dogs and humans. In the dog, a genome-wide association study of 7 CL/P cases and 112 controls from the Nova Scotia Duck Tolling Retriever (NSDTR) breed identified a significantly associated region on canine chromosome 27 (unadjusted p=1.1 x 10(-13); adjusted p= 2.2 x 10(-3)). Further analysis in NSDTR families and additional full sibling cases identified a 1.44 Mb homozygous haplotype (chromosome 27: 9.29 - 10.73 Mb) segregating with a more complex phenotype of cleft lip, cleft palate, and syndactyly (CLPS) in 13 cases. Whole-genome sequencing of 3 CLPS cases and 4 controls at 15X coverage led to the discovery of a frameshift mutation within ADAMTS20 (c.1360_1361delAA (p.Lys453Ilefs*3)), which segregated concordant with the phenotype. In a parallel study in humans, a family-based association analysis (DFAM) of 125 CL/P cases, 420 unaffected relatives, and 392 controls from a Guatemalan cohort, identified a suggestive association (rs10785430; p =2.67 x 10-6) with the same gene, ADAMTS20. Sequencing of cases from the Guatemalan cohort was unable to identify a causative mutation within the coding region of ADAMTS20, but four coding variants were found in additional cases of CL/P. In summary, this study provides genetic evidence for a role of ADAMTS20 in CL/P development in dogs and as a candidate gene for CL/P development in humans.

  2. Genome-wide association analysis identifies three new risk loci for gout arthritis in Han Chinese

    Science.gov (United States)

    Li, Changgui; Li, Zhiqiang; Liu, Shiguo; Wang, Can; Han, Lin; Cui, Lingling; Zhou, Jingguo; Zou, Hejian; Liu, Zhen; Chen, Jianhua; Cheng, Xiaoyu; Zhou, Zhaowei; Ding, Chengcheng; Wang, Meng; Chen, Tong; Cui, Ying; He, Hongmei; Zhang, Keke; Yin, Congcong; Wang, Yunlong; Xing, Shichao; Li, Baojie; Ji, Jue; Jia, Zhaotong; Ma, Lidan; Niu, Jiapeng; Xin, Ying; Liu, Tian; Chu, Nan; Yu, Qing; Ren, Wei; Wang, Xuefeng; Zhang, Aiqing; Sun, Yuping; Wang, Haili; Lu, Jie; Li, Yuanyuan; Qing, Yufeng; Chen, Gang; Wang, Yangang; Zhou, Li; Niu, Haitao; Liang, Jun; Dong, Qian; Li, Xinde; Mi, Qing-Sheng; Shi, Yongyong

    2015-01-01

    Gout is one of the most common types of inflammatory arthritis, caused by the deposition of monosodium urate crystals in and around the joints. Previous genome-wide association studies (GWASs) have identified many genetic loci associated with raised serum urate concentrations. However, hyperuricemia alone is not sufficient for the development of gout arthritis. Here we conduct a multistage GWAS in Han Chinese using 4,275 male gout patients and 6,272 normal male controls (1,255 cases and 1,848 controls were genome-wide genotyped), with an additional 1,644 hyperuricemic controls. We discover three new risk loci, 17q23.2 (rs11653176, P=1.36 × 10−13, BCAS3), 9p24.2 (rs12236871, P=1.48 × 10−10, RFX3) and 11p15.5 (rs179785, P=1.28 × 10−8, KCNQ1), which contain inflammatory candidate genes. Our results suggest that these loci are most likely related to the progression from hyperuricemia to inflammatory gout, which will provide new insights into the pathogenesis of gout arthritis. PMID:25967671

  3. Genome-wide association analysis identifies three new risk loci for gout arthritis in Han Chinese.

    Science.gov (United States)

    Li, Changgui; Li, Zhiqiang; Liu, Shiguo; Wang, Can; Han, Lin; Cui, Lingling; Zhou, Jingguo; Zou, Hejian; Liu, Zhen; Chen, Jianhua; Cheng, Xiaoyu; Zhou, Zhaowei; Ding, Chengcheng; Wang, Meng; Chen, Tong; Cui, Ying; He, Hongmei; Zhang, Keke; Yin, Congcong; Wang, Yunlong; Xing, Shichao; Li, Baojie; Ji, Jue; Jia, Zhaotong; Ma, Lidan; Niu, Jiapeng; Xin, Ying; Liu, Tian; Chu, Nan; Yu, Qing; Ren, Wei; Wang, Xuefeng; Zhang, Aiqing; Sun, Yuping; Wang, Haili; Lu, Jie; Li, Yuanyuan; Qing, Yufeng; Chen, Gang; Wang, Yangang; Zhou, Li; Niu, Haitao; Liang, Jun; Dong, Qian; Li, Xinde; Mi, Qing-Sheng; Shi, Yongyong

    2015-05-13

    Gout is one of the most common types of inflammatory arthritis, caused by the deposition of monosodium urate crystals in and around the joints. Previous genome-wide association studies (GWASs) have identified many genetic loci associated with raised serum urate concentrations. However, hyperuricemia alone is not sufficient for the development of gout arthritis. Here we conduct a multistage GWAS in Han Chinese using 4,275 male gout patients and 6,272 normal male controls (1,255 cases and 1,848 controls were genome-wide genotyped), with an additional 1,644 hyperuricemic controls. We discover three new risk loci, 17q23.2 (rs11653176, P=1.36 × 10(-13), BCAS3), 9p24.2 (rs12236871, P=1.48 × 10(-10), RFX3) and 11p15.5 (rs179785, P=1.28 × 10(-8), KCNQ1), which contain inflammatory candidate genes. Our results suggest that these loci are most likely related to the progression from hyperuricemia to inflammatory gout, which will provide new insights into the pathogenesis of gout arthritis.

  4. In silico analysis of the fucosylation-associated genome of the human blood fluke Schistosoma mansoni: cloning and characterization of the enzymes involved in GDP-L-fucose synthesis and Golgi import.

    Science.gov (United States)

    Peterson, Nathan A; Anderson, Tavis K; Wu, Xiao-Jun; Yoshino, Timothy P

    2013-07-09

    Carbohydrate structures of surface-expressed and secreted/excreted glycoconjugates of the human blood fluke Schistosoma mansoni are key determinants that mediate host-parasite interactions in both snail and mammalian hosts. Fucose is a major constituent of these immunologically important glycans, and recent studies have sought to characterize fucosylation-associated enzymes, including the Golgi-localized fucosyltransferases that catalyze the transfer of L-fucose from a GDP-L-fucose donor to an oligosaccharide acceptor. Importantly, GDP-L-fucose is the only nucleotide-sugar donor used by fucosyltransferases and its availability represents a bottleneck in fucosyl-glycotope expression. A homology-based genome-wide bioinformatics approach was used to identify and molecularly characterize the enzymes that contribute to GDP-L-fucose synthesis and Golgi import in S. mansoni. Putative functions were further investigated through molecular phylogenetic and immunocytochemical analyses. We identified homologs of GDP-D-mannose-4,6-dehydratase (GMD) and GDP-4-keto-6-deoxy-D-mannose-3,5-epimerase-4-reductase (GMER), which constitute a de novo pathway for GDP-L-fucose synthesis, in addition to a GDP-L-fucose transporter (GFT) that putatively imports cytosolic GDP-L-fucose into the Golgi. In silico primary sequence analyses identified characteristic Rossman loop and short-chain dehydrogenase/reductase motifs in GMD and GMER as well as 10 transmembrane domains in GFT. All genes are alternatively spliced, generating variants of unknown function. Observed quantitative differences in steady-state transcript levels between miracidia and primary sporocysts may contribute to differential glycotope expression in early larval development. Additionally, analyses of protein expression suggest the occurrence of cytosolic GMD and GMER in the ciliated epidermal plates and tegument of miracidia and primary sporocysts, respectively, which is consistent with previous localization of highly

  5. Brucella abortus Strain 2308 Wisconsin Genome: Importance of the Definition of Reference Strains

    Science.gov (United States)

    Suárez-Esquivel, Marcela; Ruiz-Villalobos, Nazareth; Castillo-Zeledón, Amanda; Jiménez-Rojas, César; Roop II, R. Martin; Comerci, Diego J.; Barquero-Calvo, Elías; Chacón-Díaz, Carlos; Caswell, Clayton C.; Baker, Kate S.; Chaves-Olarte, Esteban; Thomson, Nicholas R.; Moreno, Edgardo; Letesson, Jean J.; De Bolle, Xavier; Guzmán-Verri, Caterina

    2016-01-01

    Brucellosis is a bacterial infectious disease affecting a wide range of mammals and a neglected zoonosis caused by species of the genetically homogenous genus Brucella. As in most studies on bacterial diseases, research in brucellosis is carried out by using reference strains as canonical models to understand the mechanisms underlying host pathogen interactions. We performed whole genome sequencing analysis of the reference strain B. abortus 2308 routinely used in our laboratory, including manual curated annotation accessible as an editable version through a link at https://en.wikipedia.org/wiki/Brucella#Genomics. Comparison of this genome with two publically available 2308 genomes showed significant differences, particularly indels related to insertional elements, suggesting variability related to the transposition of these elements within the same strain. Considering the outcome of high resolution genomic techniques in the bacteriology field, the conventional concept of strain definition needs to be revised. PMID:27746773

  6. Genomics Research: World Survey of Public Funding

    Directory of Open Access Journals (Sweden)

    Cook-Deegan Robert M

    2008-10-01

    Full Text Available Abstract Background Over the past two decades, genomics has evolved as a scientific research discipline. Genomics research was fueled initially by government and nonprofit funding sources, later augmented by private research and development (R&D funding. Citizens and taxpayers of many countries have funded much of the research, and have expectations about access to the resulting information and knowledge. While access to knowledge gained from all publicly funded research is desired, access is especially important for fields that have broad social impact and stimulate public dialogue. Genomics is one such field, where public concerns are raised for reasons such as health care and insurance implications, as well as personal and ancestral identification. Thus, genomics has grown rapidly as a field, and attracts considerable interest. Results One way to study the growth of a field of research is to examine its funding. This study focuses on public funding of genomics research, identifying and collecting data from major government and nonprofit organizations around the world, and updating previous estimates of world genomics research funding, including information about geographical origins. We initially identified 89 publicly funded organizations; we requested information about each organization's funding of genomics research. Of these organizations, 48 responded and 34 reported genomics research expenditures (of those that responded but did not supply information, some did not fund such research, others could not quantify it. The figures reported here include all the largest funders and we estimate that we have accounted for most of the genomics research funding from government and nonprofit sources. Conclusion Aggregate spending on genomics research from 34 funding sources averaged around $2.9 billion in 2003 – 2006. The United States spent more than any other country on genomics research, corresponding to 35% of the overall worldwide public

  7. SNP-associations and phenotype predictions from hundreds of microbial genomes without genome alignments.

    Science.gov (United States)

    Hall, Barry G

    2014-01-01

    SNP-association studies are a starting point for identifying genes that may be responsible for specific phenotypes, such as disease traits. The vast bulk of tools for SNP-association studies are directed toward SNPs in the human genome, and I am unaware of any tools designed specifically for such studies in bacterial or viral genomes. The PPFS (Predict Phenotypes From SNPs) package described here is an add-on to kSNP , a program that can identify SNPs in a data set of hundreds of microbial genomes. PPFS identifies those SNPs that are non-randomly associated with a phenotype based on the χ² probability, then uses those diagnostic SNPs for two distinct, but related, purposes: (1) to predict the phenotypes of strains whose phenotypes are unknown, and (2) to identify those diagnostic SNPs that are most likely to be causally related to the phenotype. In the example illustrated here, from a set of 68 E. coli genomes, for 67 of which the pathogenicity phenotype was known, there were 418,500 SNPs. Using the phenotypes of 36 of those strains, PPFS identified 207 diagnostic SNPs. The diagnostic SNPs predicted the phenotypes of all of the genomes with 97% accuracy. It then identified 97 SNPs whose probability of being causally related to the pathogenic phenotype was >0.999. In a second example, from a set of 116 E. coli genome sequences, using the phenotypes of 65 strains PPFS identified 101 SNPs that predicted the source host (human or non-human) with 90% accuracy.

  8. Meta-analysis of Genome-Wide Association Studies Identifies Novel Loci Associated With Optic Disc Morphology

    OpenAIRE

    Springelkamp, Henriët; Mishra, Aniket; Hysi, Pirro G.; Gharahkhani, Puya; Höhn, René; Khor, Chiea-Chuen; Cooke Bailey, Jessica N.; Luo, Xiaoyan; Ramdas, Wishal D.; Vithana, Eranga; Koh, Victor; Yazar, Seyhan; Xu, Liang; Forward, Hannah; Kearns, Lisa S.

    2015-01-01

    Primary open-angle glaucoma is the most common optic neuropathy and an important cause of irreversible blindness worldwide. The optic nerve head or optic disc is divided in two parts: a central cup (without nerve fibers) surrounded by the neuroretinal rim (containing axons of the retinal ganglion cells). The International Glaucoma Genetics Consortium conducted a meta-analysis of genome-wide association studies consisting of 17,248 individuals of European ancestry and 6,841 individuals of Asia...

  9. Cross-comparison of the genome sequences from human, chimpanzee, Neanderthal and a Denisovan hominin identifies novel potentially compensated mutations

    Directory of Open Access Journals (Sweden)

    Zhang Guojie

    2011-07-01

    Full Text Available Abstract The recent publication of the draft genome sequences of the Neanderthal and a ~50,000-year-old archaic hominin from Denisova Cave in southern Siberia has ushered in a new age in molecular archaeology. We previously cross-compared the human, chimpanzee and Neanderthal genome sequences with respect to a set of disease-causing/disease-associated missense and regulatory mutations (Human Gene Mutation Database and succeeded in identifying genetic variants which, although apparently pathogenic in humans, may represent a 'compensated' wild-type state in at least one of the other two species. Here, in an attempt to identify further 'potentially compensated mutations' (PCMs of interest, we have compared our dataset of disease-causing/disease-associated mutations with their corresponding nucleotide positions in the Denisovan hominin, Neanderthal and chimpanzee genomes. Of the 15 human putatively disease-causing mutations that were found to be compensated in chimpanzee, Denisovan or Neanderthal, only a solitary F5 variant (Val1736Met was specific to the Denisovan. In humans, this missense mutation is associated with activated protein C resistance and an increased risk of thromboembolism and recurrent miscarriage. It is unclear at this juncture whether this variant was indeed a PCM in the Denisovan or whether it could instead have been associated with disease in this ancient hominin.

  10. Integrative genomic analysis identifies isoleucine and CodY as regulators of Listeria monocytogenes virulence.

    Directory of Open Access Journals (Sweden)

    Lior Lobel

    2012-09-01

    Full Text Available Intracellular bacterial pathogens are metabolically adapted to grow within mammalian cells. While these adaptations are fundamental to the ability to cause disease, we know little about the relationship between the pathogen's metabolism and virulence. Here we used an integrative Metabolic Analysis Tool that combines transcriptome data with genome-scale metabolic models to define the metabolic requirements of Listeria monocytogenes during infection. Twelve metabolic pathways were identified as differentially active during L. monocytogenes growth in macrophage cells. Intracellular replication requires de novo synthesis of histidine, arginine, purine, and branch chain amino acids (BCAAs, as well as catabolism of L-rhamnose and glycerol. The importance of each metabolic pathway during infection was confirmed by generation of gene knockout mutants in the respective pathways. Next, we investigated the association of these metabolic requirements in the regulation of L. monocytogenes virulence. Here we show that limiting BCAA concentrations, primarily isoleucine, results in robust induction of the master virulence activator gene, prfA, and the PrfA-regulated genes. This response was specific and required the nutrient responsive regulator CodY, which is known to bind isoleucine. Further analysis demonstrated that CodY is involved in prfA regulation, playing a role in prfA activation under limiting conditions of BCAAs. This study evidences an additional regulatory mechanism underlying L. monocytogenes virulence, placing CodY at the crossroads of metabolism and virulence.

  11. Phylogeny and comparative genome analysis of a Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert W.; Salamov, Asaf; Grigoriev, Igor; Hibbett, David

    2011-03-14

    Fungi of the phylum Basidiomycota, make up some 37percent of the described fungi, and are important from the perspectives of forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, plant pathogenic rusts and smuts, and some human pathogens. To better understand these important fungi, we have undertaken a comparative genomic analysis of the Basidiomycetes with available sequenced genomes. We report a phylogeny that sheds light on previously unclear evolutionary relationships among the Basidiomycetes. We also define a `core proteome? based on protein families conserved in all Basidiomycetes. We identify key expansions and contractions in protein families that may be responsible for the degradation of plant biomass such as cellulose, hemicellulose, and lignin. Finally, we speculate as to the genomic changes that drove such expansions and contractions.

  12. The Whole-Genome and Transcriptome of the Manila Clam (Ruditapes philippinarum).

    Science.gov (United States)

    Mun, Seyoung; Kim, Yun-Ji; Markkandan, Kesavan; Shin, Wonseok; Oh, Sumin; Woo, Jiyoung; Yoo, Jongsu; An, Hyesuck; Han, Kyudong

    2017-06-01

    The manila clam, Ruditapes philippinarum, is an important bivalve species in worldwide aquaculture including Korea. The aquaculture production of R. philippinarum is under threat from diverse environmental factors including viruses, microorganisms, parasites, and water conditions with subsequently declining production. In spite of its importance as a marine resource, the reference genome of R. philippinarum for comprehensive genetic studies is largely unexplored. Here, we report the de novo whole-genome and transcriptome assembly of R. philippinarum across three different tissues (foot, gill, and adductor muscle), and provide the basic data for advanced studies in selective breeding and disease control in order to obtain successful aquaculture systems. An approximately 2.56 Gb high quality whole-genome was assembled with various library construction methods. A total of 108,034 protein coding gene models were predicted and repetitive elements including simple sequence repeats and noncoding RNAs were identified to further understanding of the genetic background of R. philippinarum for genomics-assisted breeding. Comparative analysis with the bivalve marine invertebrates uncover that the gene family related to complement C1q was enriched. Furthermore, we performed transcriptome analysis with three different tissues in order to support genome annotation and then identified 41,275 transcripts which were annotated. The R. philippinarum genome resource will markedly advance a wide range of potential genetic studies, a reference genome for comparative analysis of bivalve species and unraveling mechanisms of biological processes in molluscs. We believe that the R. philippinarum genome will serve as an initial platform for breeding better-quality clams using a genomic approach. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  13. Phylogenetic Conflict in Bears Identified by Automated Discovery of Transposable Element Insertions in Low-Coverage Genomes.

    Science.gov (United States)

    Lammers, Fritjof; Gallus, Susanne; Janke, Axel; Nilsson, Maria A

    2017-10-01

    Phylogenetic reconstruction from transposable elements (TEs) offers an additional perspective to study evolutionary processes. However, detecting phylogenetically informative TE insertions requires tedious experimental work, limiting the power of phylogenetic inference. Here, we analyzed the genomes of seven bear species using high-throughput sequencing data to detect thousands of TE insertions. The newly developed pipeline for TE detection called TeddyPi (TE detection and discovery for Phylogenetic Inference) identified 150,513 high-quality TE insertions in the genomes of ursine and tremarctine bears. By integrating different TE insertion callers and using a stringent filtering approach, the TeddyPi pipeline produced highly reliable TE insertion calls, which were confirmed by extensive in vitro validation experiments. Analysis of single nucleotide substitutions in the flanking regions of the TEs shows that these substitutions correlate with the phylogenetic signal from the TE insertions. Our phylogenomic analyses show that TEs are a major driver of genomic variation in bears and enabled phylogenetic reconstruction of a well-resolved species tree, despite strong signals for incomplete lineage sorting and introgression. The analyses show that the Asiatic black, sun, and sloth bear form a monophyletic clade, in which phylogenetic incongruence originates from incomplete lineage sorting. TeddyPi is open source and can be adapted to various TE and structural variation callers. The pipeline makes it possible to confidently extract thousands of TE insertions even from low-coverage genomes (∼10×) of nonmodel organisms. This opens new possibilities for biologists to study phylogenies and evolutionary processes as well as rates and patterns of (retro-)transposition and structural variation. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  14. The cacao Criollo genome v2.0: an improved version of the genome for genetic and functional genomic studies.

    Science.gov (United States)

    Argout, X; Martin, G; Droc, G; Fouet, O; Labadie, K; Rivals, E; Aury, J M; Lanaud, C

    2017-09-15

    Theobroma cacao L., native to the Amazonian basin of South America, is an economically important fruit tree crop for tropical countries as a source of chocolate. The first draft genome of the species, from a Criollo cultivar, was published in 2011. Although a useful resource, some improvements are possible, including identifying misassemblies, reducing the number of scaffolds and gaps, and anchoring un-anchored sequences to the 10 chromosomes. We used a NGS-based approach to significantly improve the assembly of the Belizian Criollo B97-61/B2 genome. We combined four Illumina large insert size mate paired libraries with 52x of Pacific Biosciences long reads to correct misassembled regions and reduced the number of scaffolds. We then used genotyping by sequencing (GBS) methods to increase the proportion of the assembly anchored to chromosomes. The scaffold number decreased from 4,792 in assembly V1 to 554 in V2 while the scaffold N50 size has increased from 0.47 Mb in V1 to 6.5 Mb in V2. A total of 96.7% of the assembly was anchored to the 10 chromosomes compared to 66.8% in the previous version. Unknown sites (Ns) were reduced from 10.8% to 5.7%. In addition, we updated the functional annotations and performed a new RefSeq structural annotation based on RNAseq evidence. Theobroma cacao Criollo genome version 2 will be a valuable resource for the investigation of complex traits at the genomic level and for future comparative genomics and genetics studies in cacao tree. New functional tools and annotations are available on the Cocoa Genome Hub ( http://cocoa-genome-hub.southgreen.fr ).

  15. Personal utility in genomic testing: a systematic literature review.

    Science.gov (United States)

    Kohler, Jennefer N; Turbitt, Erin; Biesecker, Barbara B

    2017-06-01

    Researchers and clinicians refer to outcomes of genomic testing that extend beyond clinical utility as 'personal utility'. No systematic delineation of personal utility exists, making it challenging to appreciate its scope. Identifying empirical elements of personal utility reported in the literature offers an inventory that can be subsequently ranked for its relative value by those who have undergone genomic testing. A systematic review was conducted of the peer-reviewed literature reporting non-health-related outcomes of genomic testing from 1 January 2003 to 5 August 2016. Inclusion criteria specified English language, date of publication, and presence of empirical evidence. Identified outcomes were iteratively coded into unique domains. The search returned 551 abstracts from which 31 studies met the inclusion criteria. Study populations and type of genomic testing varied. Coding resulted in 15 distinct elements of personal utility, organized into three domains related to personal outcomes: affective, cognitive, and behavioral; and one domain related to social outcomes. The domains of personal utility may inform pre-test counseling by helping patients anticipate potential value of test results beyond clinical utility. Identified elements may also inform investigations into the prevalence and importance of personal utility to future test users.

  16. The Chlamydia psittaci genome: a comparative analysis of intracellular pathogens.

    Directory of Open Access Journals (Sweden)

    Anja Voigt

    Full Text Available Chlamydiaceae are a family of obligate intracellular pathogens causing a wide range of diseases in animals and humans, and facing unique evolutionary constraints not encountered by free-living prokaryotes. To investigate genomic aspects of infection, virulence and host preference we have sequenced Chlamydia psittaci, the pathogenic agent of ornithosis.A comparison of the genome of the avian Chlamydia psittaci isolate 6BC with the genomes of other chlamydial species, C. trachomatis, C. muridarum, C. pneumoniae, C. abortus, C. felis and C. caviae, revealed a high level of sequence conservation and synteny across taxa, with the major exception of the human pathogen C. trachomatis. Important differences manifest in the polymorphic membrane protein family specific for the Chlamydiae and in the highly variable chlamydial plasticity zone. We identified a number of psittaci-specific polymorphic membrane proteins of the G family that may be related to differences in host-range and/or virulence as compared to closely related Chlamydiaceae. We calculated non-synonymous to synonymous substitution rate ratios for pairs of orthologous genes to identify putative targets of adaptive evolution and predicted type III secreted effector proteins.This study is the first detailed analysis of the Chlamydia psittaci genome sequence. It provides insights in the genome architecture of C. psittaci and proposes a number of novel candidate genes mostly of yet unknown function that may be important for pathogen-host interactions.

  17. The Chlamydia psittaci genome: a comparative analysis of intracellular pathogens.

    Science.gov (United States)

    Voigt, Anja; Schöfl, Gerhard; Saluz, Hans Peter

    2012-01-01

    Chlamydiaceae are a family of obligate intracellular pathogens causing a wide range of diseases in animals and humans, and facing unique evolutionary constraints not encountered by free-living prokaryotes. To investigate genomic aspects of infection, virulence and host preference we have sequenced Chlamydia psittaci, the pathogenic agent of ornithosis. A comparison of the genome of the avian Chlamydia psittaci isolate 6BC with the genomes of other chlamydial species, C. trachomatis, C. muridarum, C. pneumoniae, C. abortus, C. felis and C. caviae, revealed a high level of sequence conservation and synteny across taxa, with the major exception of the human pathogen C. trachomatis. Important differences manifest in the polymorphic membrane protein family specific for the Chlamydiae and in the highly variable chlamydial plasticity zone. We identified a number of psittaci-specific polymorphic membrane proteins of the G family that may be related to differences in host-range and/or virulence as compared to closely related Chlamydiaceae. We calculated non-synonymous to synonymous substitution rate ratios for pairs of orthologous genes to identify putative targets of adaptive evolution and predicted type III secreted effector proteins. This study is the first detailed analysis of the Chlamydia psittaci genome sequence. It provides insights in the genome architecture of C. psittaci and proposes a number of novel candidate genes mostly of yet unknown function that may be important for pathogen-host interactions.

  18. Genome-wide association study identifies five new schizophrenia loci

    NARCIS (Netherlands)

    Ripke, S.; Sanders, A. R.; Kendler, K. S.; Levinson, D. F.; Sklar, P.; Holmans, P. A.; Lin, D. Y.; Duan, J.; Ophoff, R. A.; Andreassen, O. A.; Scolnick, E.; Cichon, S.; St Clair, D.; Corvin, A.; Gurling, H.; Werge, T.; Rujescu, D.; Blackwood, D. H.; Pato, C. N.; Malhotra, A. K.; Purcell, S.; Dudbridge, F.; Neale, B. M.; Rossin, L.; Visscher, P. M.; Posthuma, D.; Ruderfer, D. M.; Fanous, A.; Stefansson, H.; Steinberg, S.; Mowry, B. J.; Golimbet, V.; de Hert, M.; Jonsson, E. G.; Bitter, I.; Pietilainen, O. P.; Collier, D. A.; Tosato, S.; Agartz, I.; Albus, M.; Alexander, M.; Amdur, R. L.; Amin, F.; Bass, N.; Bergen, S. E.; Black, D. W.; Borglum, A. D.; Brown, M. A.; Bruggeman, R.; Buccola, N. G.; Byerley, W. F.; Cahn, W.; Cantor, R. M.; Carr, V. J.; Catts, S. V.; Choudhury, K.; Cloninger, C. R.; Cormican, P.; Craddock, N.; Danoy, P. A.; Datta, S.; de Haan, L.; Demontis, D.; Dikeos, D.; Djurovic, S.; Donnely, P.; Donohoe, G.; Duong, L.; Dwyer, S.; Fink-Jensen, A.; Freedman, R.; Freimer, N. B.; Friedl, M.; Georgieva, L.; Giegling, I.; Gill, M.; Glenthoj, B.; Godard, S.; Hamshere, M.; Hansen, M.; Hartmann, A. M.; Henskens, F. A.; Hougaard, D. M.; Hultman, C. M.; Ingason, A.; Jablensky, A. V.; Jakobsen, K. D.; Jay, M.; Jurgens, G.; Kahn, R. S.; Keller, M. C.; Kenis, G.; Kenny, E.; Kim, Y.; Kirov, G. K.; Konnerth, H.; Konte, B.; Krabbendam, L.; Krasucki, R.; Lasseter, V. K.; Laurent, C.; Lawrence, J.; Lencz, T.; Lerer, F. B.; Liang, K. Y.; Lichtenstein, P.; Lieberman, J. A.; Linszen, D. H.; Lonnqvist, J.; Loughland, C. M.; Maclean, A. W.; Maher, B. S.; Maier, W.; Mallet, J.; Malloy, P.; Mattheisen, M.; Mattingsdal, M.; McGhee, K. A.; McGrath, J. J.; McIntosh, A.; McLean, D. E.; McQuillin, A.; Melle, I.; Michie, P. T.; Milanova, V.; Morris, D. W.; Mors, O.; Mortensen, P. B.; Moskvina, V.; Muglia, P.; Myin-Germeys, I.; Nertney, D. A.; Nestadt, G.; Nielsen, J.; Nikolov, I.; Nordentoft, M.; Norton, N.; Nothen, M. M.; O'Dushlaine, C. T.; Olincy, A.; Olsen, L.; O'Neill, F. A.; Orntoft, T. F.; Owen, M. J.; Pantelis, C.; Papadimitriou, G.; Pato, M. T.; Peltonen, L.; Petursson, H.; Pickard, B.; Pimm, J.; Pulver, A. E.; Puri, V.; Quested, D.; Quinn, E. M.; Rasmussen, H. B.; Rethelyi, J. M.; Ribble, R.; Rietschel, M.; Riley, B. P.; Ruggeri, M.; Schall, U.; Schulze, T. G.; Schwab, S. G.; Scott, R. J.; Shi, J.; Sigurdsson, E.; Silvermann, J. M.; Spencer, C. C.; Stefansson, K.; Strange, A.; Strengman, E.; Stroup, T. S.; Suvisaari, J.; Terenius, L.; Thirumalai, S.; Thygesen, J. H.; Timm, S.; Toncheva, D.; van den Oord, E.; van Os, J.; van Winkel, R.; Veldink, J.; Walsh, D.; Wang, A. G.; Wiersma, D.; Wildenauer, D. B.; Williams, H. J.; Williams, N. M.; Wormley, B.; Zammit, S.; Sullivan, P. F.; O'Donovan, M. C.; Daly, M. J.; Gejman, P. V.

    2011-01-01

    We examined the role of common genetic variation in schizophrenia in a genome-wide association study of substantial size: a stage 1 discovery sample of 21,856 individuals of European ancestry and a stage 2 replication sample of 29,839 independent subjects. The combined stage 1 and 2 analysis yielded

  19. Genomic locus modulating corneal thickness in the mouse identifies POU6F2 as a potential risk of developing glaucoma.

    Directory of Open Access Journals (Sweden)

    Rebecca King

    2018-01-01

    Full Text Available Central corneal thickness (CCT is one of the most heritable ocular traits and it is also a phenotypic risk factor for primary open angle glaucoma (POAG. The present study uses the BXD Recombinant Inbred (RI strains to identify novel quantitative trait loci (QTLs modulating CCT in the mouse with the potential of identifying a molecular link between CCT and risk of developing POAG. The BXD RI strain set was used to define mammalian genomic loci modulating CCT, with a total of 818 corneas measured from 61 BXD RI strains (between 60-100 days of age. The mice were anesthetized and the eyes were positioned in front of the lens of the Phoenix Micron IV Image-Guided OCT system or the Bioptigen OCT system. CCT data for each strain was averaged and used to QTLs modulating this phenotype using the bioinformatics tools on GeneNetwork (www.genenetwork.org. The candidate genes and genomic loci identified in the mouse were then directly compared with the summary data from a human POAG genome wide association study (NEIGHBORHOOD to determine if any genomic elements modulating mouse CCT are also risk factors for POAG.This analysis revealed one significant QTL on Chr 13 and a suggestive QTL on Chr 7. The significant locus on Chr 13 (13 to 19 Mb was examined further to define candidate genes modulating this eye phenotype. For the Chr 13 QTL in the mouse, only one gene in the region (Pou6f2 contained nonsynonymous SNPs. Of these five nonsynonymous SNPs in Pou6f2, two resulted in changes in the amino acid proline which could result in altered secondary structure affecting protein function. The 7 Mb region under the mouse Chr 13 peak distributes over 2 chromosomes in the human: Chr 1 and Chr 7. These genomic loci were examined in the NEIGHBORHOOD database to determine if they are potential risk factors for human glaucoma identified using meta-data from human GWAS. The top 50 hits all resided within one gene (POU6F2, with the highest significance level of p = 10-6 for

  20. BISQUE: locus- and variant-specific conversion of genomic, transcriptomic and proteomic database identifiers.

    Science.gov (United States)

    Meyer, Michael J; Geske, Philip; Yu, Haiyuan

    2016-05-15

    Biological sequence databases are integral to efforts to characterize and understand biological molecules and share biological data. However, when analyzing these data, scientists are often left holding disparate biological currency-molecular identifiers from different databases. For downstream applications that require converting the identifiers themselves, there are many resources available, but analyzing associated loci and variants can be cumbersome if data is not given in a form amenable to particular analyses. Here we present BISQUE, a web server and customizable command-line tool for converting molecular identifiers and their contained loci and variants between different database conventions. BISQUE uses a graph traversal algorithm to generalize the conversion process for residues in the human genome, genes, transcripts and proteins, allowing for conversion across classes of molecules and in all directions through an intuitive web interface and a URL-based web service. BISQUE is freely available via the web using any major web browser (http://bisque.yulab.org/). Source code is available in a public GitHub repository (https://github.com/hyulab/BISQUE). haiyuan.yu@cornell.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  1. Genome-wide association studies identify four ER negative-specific breast cancer risk loci

    DEFF Research Database (Denmark)

    Garcia-Closas, Montserrat; Couch, Fergus J; Lindstrom, Sara

    2013-01-01

    differences in genetic predisposition. To identify susceptibility loci specific to ER-negative disease, we combined in a meta-analysis 3 genome-wide association studies of 4,193 ER-negative breast cancer cases and 35,194 controls with a series of 40 follow-up studies (6,514 cases and 41,455 controls......), genotyped using a custom Illumina array, iCOGS, developed by the Collaborative Oncological Gene-environment Study (COGS). SNPs at four loci, 1q32.1 (MDM4, P = 2.1 × 10(-12) and LGR6, P = 1.4 × 10(-8)), 2p24.1 (P = 4.6 × 10(-8)) and 16q12.2 (FTO, P = 4.0 × 10(-8)), were associated with ER-negative but not ER...

  2. Convergent functional genomics of psychiatric disorders.

    Science.gov (United States)

    Niculescu, Alexander B

    2013-10-01

    Genetic and gene expression studies, in humans and animal models of psychiatric and other medical disorders, are becoming increasingly integrated. Particularly for genomics, the convergence and integration of data across species, experimental modalities and technical platforms is providing a fit-to-disease way of extracting reproducible and biologically important signal, in contrast to the fit-to-cohort effect and limited reproducibility of human genetic analyses alone. With the advent of whole-genome sequencing and the realization that a major portion of the non-coding genome may contain regulatory variants, Convergent Functional Genomics (CFG) approaches are going to be essential to identify disease-relevant signal from the tremendous polymorphic variation present in the general population. Such work in psychiatry can provide an example of how to address other genetically complex disorders, and in turn will benefit by incorporating concepts from other areas, such as cancer, cardiovascular diseases, and diabetes. © 2013 Wiley Periodicals, Inc.

  3. A genome-wide shRNA screen identifies GAS1 as a novel melanoma metastasis suppressor gene.

    Science.gov (United States)

    Gobeil, Stephane; Zhu, Xiaochun; Doillon, Charles J; Green, Michael R

    2008-11-01

    Metastasis suppressor genes inhibit one or more steps required for metastasis without affecting primary tumor formation. Due to the complexity of the metastatic process, the development of experimental approaches for identifying genes involved in metastasis prevention has been challenging. Here we describe a genome-wide RNAi screening strategy to identify candidate metastasis suppressor genes. Following expression in weakly metastatic B16-F0 mouse melanoma cells, shRNAs were selected based upon enhanced satellite colony formation in a three-dimensional cell culture system and confirmed in a mouse experimental metastasis assay. Using this approach we discovered 22 genes whose knockdown increased metastasis without affecting primary tumor growth. We focused on one of these genes, Gas1 (Growth arrest-specific 1), because we found that it was substantially down-regulated in highly metastatic B16-F10 melanoma cells, which contributed to the high metastatic potential of this mouse cell line. We further demonstrated that Gas1 has all the expected properties of a melanoma tumor suppressor including: suppression of metastasis in a spontaneous metastasis assay, promotion of apoptosis following dissemination of cells to secondary sites, and frequent down-regulation in human melanoma metastasis-derived cell lines and metastatic tumor samples. Thus, we developed a genome-wide shRNA screening strategy that enables the discovery of new metastasis suppressor genes.

  4. Genomics and the human genome project: implications for psychiatry

    OpenAIRE

    Kelsoe, J R

    2004-01-01

    In the past decade the Human Genome Project has made extraordinary strides in understanding of fundamental human genetics. The complete human genetic sequence has been determined, and the chromosomal location of almost all human genes identified. Presently, a large international consortium, the HapMap Project, is working to identify a large portion of genetic variation in different human populations and the structure and relationship of these variants to each other. The Human Genome Project h...

  5. Parent-of-origin effects in autism identified through genome-wide linkage analysis of 16,000 SNPs.

    Directory of Open Access Journals (Sweden)

    Delphine Fradin

    2010-09-01

    Full Text Available Autism is a common heritable neurodevelopmental disorder with complex etiology. Several genome-wide linkage and association scans have been carried out to identify regions harboring genes related to autism or autism spectrum disorders, with mixed results. Given the overlap in autism features with genetic abnormalities known to be associated with imprinting, one possible reason for lack of consistency would be the influence of parent-of-origin effects that may mask the ability to detect linkage and association.We have performed a genome-wide linkage scan that accounts for potential parent-of-origin effects using 16,311 SNPs among families from the Autism Genetic Resource Exchange (AGRE and the National Institute of Mental Health (NIMH autism repository. We report parametric (GH, Genehunter and allele-sharing linkage (Aspex results using a broad spectrum disorder case definition. Paternal-origin genome-wide statistically significant linkage was observed on chromosomes 4 (LOD(GH = 3.79, empirical p<0.005 and LOD(Aspex = 2.96, p = 0.008, 15 (LOD(GH = 3.09, empirical p<0.005 and LOD(Aspex = 3.62, empirical p = 0.003 and 20 (LOD(GH = 3.36, empirical p<0.005 and LOD(Aspex = 3.38, empirical p = 0.006.These regions may harbor imprinted sites associated with the development of autism and offer fruitful domains for molecular investigation into the role of epigenetic mechanisms in autism.

  6. The African Genome Variation Project shapes medical genetics in Africa

    Science.gov (United States)

    Gurdasani, Deepti; Carstensen, Tommy; Tekola-Ayele, Fasil; Pagani, Luca; Tachmazidou, Ioanna; Hatzikotoulas, Konstantinos; Karthikeyan, Savita; Iles, Louise; Pollard, Martin O.; Choudhury, Ananyo; Ritchie, Graham R. S.; Xue, Yali; Asimit, Jennifer; Nsubuga, Rebecca N.; Young, Elizabeth H.; Pomilla, Cristina; Kivinen, Katja; Rockett, Kirk; Kamali, Anatoli; Doumatey, Ayo P.; Asiki, Gershim; Seeley, Janet; Sisay-Joof, Fatoumatta; Jallow, Muminatou; Tollman, Stephen; Mekonnen, Ephrem; Ekong, Rosemary; Oljira, Tamiru; Bradman, Neil; Bojang, Kalifa; Ramsay, Michele; Adeyemo, Adebowale; Bekele, Endashaw; Motala, Ayesha; Norris, Shane A.; Pirie, Fraser; Kaleebu, Pontiano; Kwiatkowski, Dominic; Tyler-Smith, Chris; Rotimi, Charles; Zeggini, Eleftheria; Sandhu, Manjinder S.

    2015-01-01

    Given the importance of Africa to studies of human origins and disease susceptibility, detailed characterization of African genetic diversity is needed. The African Genome Variation Project provides a resource with which to design, implement and interpret genomic studies in sub-Saharan Africa and worldwide. The African Genome Variation Project represents dense genotypes from 1,481 individuals and whole-genome sequences from 320 individuals across sub-Saharan Africa. Using this resource, we find novel evidence of complex, regionally distinct hunter-gatherer and Eurasian admixture across sub-Saharan Africa. We identify new loci under selection, including loci related to malaria susceptibility and hypertension. We show that modern imputation panels (sets of reference genotypes from which unobserved or missing genotypes in study sets can be inferred) can identify association signals at highly differentiated loci across populations in sub-Saharan Africa. Using whole-genome sequencing, we demonstrate further improvements in imputation accuracy, strengthening the case for large-scale sequencing efforts of diverse African haplotypes. Finally, we present an efficient genotype array design capturing common genetic variation in Africa.

  7. The African Genome Variation Project shapes medical genetics in Africa.

    Science.gov (United States)

    Gurdasani, Deepti; Carstensen, Tommy; Tekola-Ayele, Fasil; Pagani, Luca; Tachmazidou, Ioanna; Hatzikotoulas, Konstantinos; Karthikeyan, Savita; Iles, Louise; Pollard, Martin O; Choudhury, Ananyo; Ritchie, Graham R S; Xue, Yali; Asimit, Jennifer; Nsubuga, Rebecca N; Young, Elizabeth H; Pomilla, Cristina; Kivinen, Katja; Rockett, Kirk; Kamali, Anatoli; Doumatey, Ayo P; Asiki, Gershim; Seeley, Janet; Sisay-Joof, Fatoumatta; Jallow, Muminatou; Tollman, Stephen; Mekonnen, Ephrem; Ekong, Rosemary; Oljira, Tamiru; Bradman, Neil; Bojang, Kalifa; Ramsay, Michele; Adeyemo, Adebowale; Bekele, Endashaw; Motala, Ayesha; Norris, Shane A; Pirie, Fraser; Kaleebu, Pontiano; Kwiatkowski, Dominic; Tyler-Smith, Chris; Rotimi, Charles; Zeggini, Eleftheria; Sandhu, Manjinder S

    2015-01-15

    Given the importance of Africa to studies of human origins and disease susceptibility, detailed characterization of African genetic diversity is needed. The African Genome Variation Project provides a resource with which to design, implement and interpret genomic studies in sub-Saharan Africa and worldwide. The African Genome Variation Project represents dense genotypes from 1,481 individuals and whole-genome sequences from 320 individuals across sub-Saharan Africa. Using this resource, we find novel evidence of complex, regionally distinct hunter-gatherer and Eurasian admixture across sub-Saharan Africa. We identify new loci under selection, including loci related to malaria susceptibility and hypertension. We show that modern imputation panels (sets of reference genotypes from which unobserved or missing genotypes in study sets can be inferred) can identify association signals at highly differentiated loci across populations in sub-Saharan Africa. Using whole-genome sequencing, we demonstrate further improvements in imputation accuracy, strengthening the case for large-scale sequencing efforts of diverse African haplotypes. Finally, we present an efficient genotype array design capturing common genetic variation in Africa.

  8. Challenges and strategies for implementing genomic services in diverse settings: experiences from the Implementing GeNomics In pracTicE (IGNITE) network.

    Science.gov (United States)

    Sperber, Nina R; Carpenter, Janet S; Cavallari, Larisa H; J Damschroder, Laura; Cooper-DeHoff, Rhonda M; Denny, Joshua C; Ginsburg, Geoffrey S; Guan, Yue; Horowitz, Carol R; Levy, Kenneth D; Levy, Mia A; Madden, Ebony B; Matheny, Michael E; Pollin, Toni I; Pratt, Victoria M; Rosenman, Marc; Voils, Corrine I; W Weitzel, Kristen; Wilke, Russell A; Ryanne Wu, R; Orlando, Lori A

    2017-05-22

    To realize potential public health benefits from genetic and genomic innovations, understanding how best to implement the innovations into clinical care is important. The objective of this study was to synthesize data on challenges identified by six diverse projects that are part of a National Human Genome Research Institute (NHGRI)-funded network focused on implementing genomics into practice and strategies to overcome these challenges. We used a multiple-case study approach with each project considered as a case and qualitative methods to elicit and describe themes related to implementation challenges and strategies. We describe challenges and strategies in an implementation framework and typology to enable consistent definitions and cross-case comparisons. Strategies were linked to challenges based on expert review and shared themes. Three challenges were identified by all six projects, and strategies to address these challenges varied across the projects. One common challenge was to increase the relative priority of integrating genomics within the health system electronic health record (EHR). Four projects used data warehousing techniques to accomplish the integration. The second common challenge was to strengthen clinicians' knowledge and beliefs about genomic medicine. To overcome this challenge, all projects developed educational materials and conducted meetings and outreach focused on genomic education for clinicians. The third challenge was engaging patients in the genomic medicine projects. Strategies to overcome this challenge included use of mass media to spread the word, actively involving patients in implementation (e.g., a patient advisory board), and preparing patients to be active participants in their healthcare decisions. This is the first collaborative evaluation focusing on the description of genomic medicine innovations implemented in multiple real-world clinical settings. Findings suggest that strategies to facilitate integration of genomic

  9. Nine Loci for Ocular Axial Length Identified through Genome-wide Association Studies, Including Shared Loci with Refractive Error

    NARCIS (Netherlands)

    Cheng, Ching-Yu; Schache, Maria; Ikram, M. Kamran; Young, Terri L.; Guggenheim, Jeremy A.; Vitart, Veronique; Macgregor, Stuart; Verhoeven, Virginie J. M.; Barathi, Veluchamy A.; Liao, Jiemin; Hysi, Pirro G.; Bailey-Wilson, Joan E.; St Pourcain, Beate; Kemp, John P.; McMahon, George; Timpson, Nicholas J.; Evans, David M.; Montgomery, Grant W.; Mishra, Aniket; Wang, Ya Xing; Wang, Jie Jin; Rochtchina, Elena; Polasek, Ozren; Wright, Alan F.; Amin, Najaf; van Leeuwen, Elisabeth M.; Wilson, James F.; Pennell, Craig E.; van Duijn, Cornelia M.; de Jong, Paulus T. V. M.; Vingerling, Johannes R.; Zhou, Xin; Chen, Peng; Li, Ruoying; Tay, Wan-Ting; Zheng, Yingfeng; Chew, Merwyn; Burdon, Kathryn P.; Craig, Jamie E.; Iyengar, Sudha K.; Igo, Robert P.; Lass, Jonathan H.; Chew, Emily Y.; Haller, Toomas; Mihailov, Evelin; Metspalu, Andres; Wedenoja, Juho; Simpson, Claire L.; Wojciechowski, Robert; Chen, Wei

    2013-01-01

    Refractive errors are common eye disorders of public health importance worldwide. Ocular axial length (AL) is the major determinant of refraction and thus of myopia and hyperopia. We conducted a meta-analysis of genome-wide association studies for AL, combining 12,531 Europeans and 8,216 Asians. We

  10. Genome-wide gene-environment study identifies glutamate receptor gene GRIN2A as a Parkinson's disease modifier gene via interaction with coffee.

    OpenAIRE

    Taye H Hamza; Honglei Chen; Erin M Hill-Burns; Shannon L Rhodes; Jennifer Montimurro; Denise M Kay; Albert Tenesa; Victoria I Kusel; Patricia Sheehan; Muthukrishnan Eaaswarkhanth; Dora Yearout; Ali Samii; John W Roberts; Pinky Agarwal; Yvette Bordelon

    2011-01-01

    Our aim was to identify genes that influence the inverse association of coffee with the risk of developing Parkinson's disease (PD). We used genome-wide genotype data and lifetime caffeinated-coffee-consumption data on 1,458 persons with PD and 931 without PD from the NeuroGenetics Research Consortium (NGRC), and we performed a genome-wide association and interaction study (GWAIS), testing each SNP's main-effect plus its interaction with coffee, adjusting for sex, age, and two principal compo...

  11. Identification and classification of conserved RNA secondary structures in the human genome

    DEFF Research Database (Denmark)

    Pedersen, Jakob Skou; Bejerano, Gill; Siepel, Adam

    2006-01-01

    The discoveries of microRNAs and riboswitches, among others, have shown functional RNAs to be biologically more important and genomically more prevalent than previously anticipated. We have developed a general comparative genomics method based on phylogenetic stochastic context-free grammars...... for identifying functional RNAs encoded in the human genome and used it to survey an eight-way genome-wide alignment of the human, chimpanzee, mouse, rat, dog, chicken, zebra-fish, and puffer-fish genomes for deeply conserved functional RNAs. At a loose threshold for acceptance, this search resulted in a set......, the results nevertheless provide evidence for many new human functional RNAs and present specific predictions to facilitate their further characterization....

  12. Genome-wide association study identifies a novel canine glaucoma locus.

    Directory of Open Access Journals (Sweden)

    Saija J Ahonen

    Full Text Available Glaucoma is an optic neuropathy and one of the leading causes of blindness. Its hereditary forms are classified into primary closed-angle (PCAG, primary open-angle (POAG and primary congenital glaucoma (PCG. Although many loci have been mapped in human, only a few genes have been identified that are associated with the development of glaucoma and the genetic basis of the disease remains poorly understood. Glaucoma has also been described in many dog breeds, including Dandie Dinmont Terriers (DDT in which it is a late-onset (>7 years disease. We designed clinical and genetic studies to better define the clinical features of glaucoma in the DDT and to identify the genetic cause. Clinical diagnosis was based on ophthalmic examinations of the affected dogs and 18 additionally investigated unaffected DDTs. We collected DNA from over 400 DTTs and a genome wide association study was performed in a cohort of 23 affected and 23 controls, followed by a fine mapping, a replication study and candidate gene sequencing. The clinical study suggested that ocular abnormalities including abnormal iridocorneal angles and pectinate ligament dysplasia are common (50% and 72%, respectively in the breed and the disease resembles human PCAG. The genetic study identified a novel 9.5 Mb locus on canine chromosome 8 including the 1.6 Mb best associated region (p = 1.63 × 10(-10, OR = 32 for homozygosity. Mutation screening in five candidate genes did not reveal any causative variants. This study indicates that although ocular abnormalities are common in DDTs, the genetic risk for glaucoma is conferred by a novel locus on CFA8. The canine locus shares synteny to a region in human chromosome 14q, which harbors several loci associated with POAG and PCG. Our study reveals a new locus for canine glaucoma and ongoing molecular studies will likely help to understand the genetic etiology of the disease.

  13. Soybean (Glycine max) SWEET gene family: insights through comparative genomics, transcriptome profiling and whole genome re-sequence analysis.

    Science.gov (United States)

    Patil, Gunvant; Valliyodan, Babu; Deshmukh, Rupesh; Prince, Silvas; Nicander, Bjorn; Zhao, Mingzhe; Sonah, Humira; Song, Li; Lin, Li; Chaudhary, Juhi; Liu, Yang; Joshi, Trupti; Xu, Dong; Nguyen, Henry T

    2015-07-11

    SWEET (MtN3_saliva) domain proteins, a recently identified group of efflux transporters, play an indispensable role in sugar efflux, phloem loading, plant-pathogen interaction and reproductive tissue development. The SWEET gene family is predominantly studied in Arabidopsis and members of the family are being investigated in rice. To date, no transcriptome or genomics analysis of soybean SWEET genes has been reported. In the present investigation, we explored the evolutionary aspect of the SWEET gene family in diverse plant species including primitive single cell algae to angiosperms with a major emphasis on Glycine max. Evolutionary features showed expansion and duplication of the SWEET gene family in land plants. Homology searches with BLAST tools and Hidden Markov Model-directed sequence alignments identified 52 SWEET genes that were mapped to 15 chromosomes in the soybean genome as tandem duplication events. Soybean SWEET (GmSWEET) genes showed a wide range of expression profiles in different tissues and developmental stages. Analysis of public transcriptome data and expression profiling using quantitative real time PCR (qRT-PCR) showed that a majority of the GmSWEET genes were confined to reproductive tissue development. Several natural genetic variants (non-synonymous SNPs, premature stop codons and haplotype) were identified in the GmSWEET genes using whole genome re-sequencing data analysis of 106 soybean genotypes. A significant association was observed between SNP-haplogroup and seed sucrose content in three gene clusters on chromosome 6. Present investigation utilized comparative genomics, transcriptome profiling and whole genome re-sequencing approaches and provided a systematic description of soybean SWEET genes and identified putative candidates with probable roles in the reproductive tissue development. Gene expression profiling at different developmental stages and genomic variation data will aid as an important resource for the soybean research

  14. Identification of Ohnolog Genes Originating from Whole Genome Duplication in Early Vertebrates, Based on Synteny Comparison across Multiple Genomes.

    Science.gov (United States)

    Singh, Param Priya; Arora, Jatin; Isambert, Hervé

    2015-07-01

    Whole genome duplications (WGD) have now been firmly established in all major eukaryotic kingdoms. In particular, all vertebrates descend from two rounds of WGDs, that occurred in their jawless ancestor some 500 MY ago. Paralogs retained from WGD, also coined 'ohnologs' after Susumu Ohno, have been shown to be typically associated with development, signaling and gene regulation. Ohnologs, which amount to about 20 to 35% of genes in the human genome, have also been shown to be prone to dominant deleterious mutations and frequently implicated in cancer and genetic diseases. Hence, identifying ohnologs is central to better understand the evolution of vertebrates and their susceptibility to genetic diseases. Early computational analyses to identify vertebrate ohnologs relied on content-based synteny comparisons between the human genome and a single invertebrate outgroup genome or within the human genome itself. These approaches are thus limited by lineage specific rearrangements in individual genomes. We report, in this study, the identification of vertebrate ohnologs based on the quantitative assessment and integration of synteny conservation between six amniote vertebrates and six invertebrate outgroups. Such a synteny comparison across multiple genomes is shown to enhance the statistical power of ohnolog identification in vertebrates compared to earlier approaches, by overcoming lineage specific genome rearrangements. Ohnolog gene families can be browsed and downloaded for three statistical confidence levels or recompiled for specific, user-defined, significance criteria at http://ohnologs.curie.fr/. In the light of the importance of WGD on the genetic makeup of vertebrates, our analysis provides a useful resource for researchers interested in gaining further insights on vertebrate evolution and genetic diseases.

  15. Methodology for identifying boundaries of systems important to safety in CANDU nuclear power plants

    International Nuclear Information System (INIS)

    Therrien, S.; Komljenovic, D.; Therrien, P.; Ruest, C.; Prevost, P.; Vaillancourt, R.

    2007-01-01

    This paper presents a methodology developed to identify the boundaries of the systems important to safety (SIS) at the Gentilly-2 Nuclear Power Plant (NPP), Hydro-Quebec. The SIS boundaries identification considers nuclear safety only. Components that are not identified as important to safety are systematically identified as related to safety. A global assessment process such as WANO/INPO AP-913 'Equipment Reliability Process' will be needed to implement adequate changes in the management rules of those components. The paper depicts results in applying the methodology to the Shutdown Systems 1 and 2 (SDS 1, 2), and to the Emergency Core Cooling System (ECCS). This validation process enabled fine tuning the methodology, performing a better estimate of the effort required to evaluate a system, and identifying components important to safety of these systems. (author)

  16. Genome-wide association studies in dogs and humans identify ADAMTS20 as a risk variant for cleft lip and palate.

    Directory of Open Access Journals (Sweden)

    Zena T Wolf

    2015-03-01

    Full Text Available Cleft lip with or without cleft palate (CL/P is the most commonly occurring craniofacial birth defect. We provide insight into the genetic etiology of this birth defect by performing genome-wide association studies in two species: dogs and humans. In the dog, a genome-wide association study of 7 CL/P cases and 112 controls from the Nova Scotia Duck Tolling Retriever (NSDTR breed identified a significantly associated region on canine chromosome 27 (unadjusted p=1.1 x 10(-13; adjusted p= 2.2 x 10(-3. Further analysis in NSDTR families and additional full sibling cases identified a 1.44 Mb homozygous haplotype (chromosome 27: 9.29 - 10.73 Mb segregating with a more complex phenotype of cleft lip, cleft palate, and syndactyly (CLPS in 13 cases. Whole-genome sequencing of 3 CLPS cases and 4 controls at 15X coverage led to the discovery of a frameshift mutation within ADAMTS20 (c.1360_1361delAA (p.Lys453Ilefs*3, which segregated concordant with the phenotype. In a parallel study in humans, a family-based association analysis (DFAM of 125 CL/P cases, 420 unaffected relatives, and 392 controls from a Guatemalan cohort, identified a suggestive association (rs10785430; p =2.67 x 10-6 with the same gene, ADAMTS20. Sequencing of cases from the Guatemalan cohort was unable to identify a causative mutation within the coding region of ADAMTS20, but four coding variants were found in additional cases of CL/P. In summary, this study provides genetic evidence for a role of ADAMTS20 in CL/P development in dogs and as a candidate gene for CL/P development in humans.

  17. Genome-wide RNAi Screen Identifies Networks Involved in Intestinal Stem Cell Regulation in Drosophila

    Directory of Open Access Journals (Sweden)

    Xiankun Zeng

    2015-02-01

    Full Text Available The intestinal epithelium is the most rapidly self-renewing tissue in adult animals and maintained by intestinal stem cells (ISCs in both Drosophila and mammals. To comprehensively identify genes and pathways that regulate ISC fates, we performed a genome-wide transgenic RNAi screen in adult Drosophila intestine and identified 405 genes that regulate ISC maintenance and lineage-specific differentiation. By integrating these genes into publicly available interaction databases, we further developed functional networks that regulate ISC self-renewal, ISC proliferation, ISC maintenance of diploid status, ISC survival, ISC-to-enterocyte (EC lineage differentiation, and ISC-to-enteroendocrine (EE lineage differentiation. By comparing regulators among ISCs, female germline stem cells, and neural stem cells, we found that factors related to basic stem cell cellular processes are commonly required in all stem cells, and stem-cell-specific, niche-related signals are required only in the unique stem cell type. Our findings provide valuable insights into stem cell maintenance and lineage-specific differentiation.

  18. Genome-Wide Analysis of the Expression of WRKY Family Genes in Different Developmental Stages of Wild Strawberry (Fragaria vesca Fruit.

    Directory of Open Access Journals (Sweden)

    Heying Zhou

    Full Text Available WRKY proteins play important regulatory roles in plant developmental processes such as senescence, trichome initiation and embryo morphogenesis. In strawberry, only FaWRKY1 (Fragaria × ananassa has been characterized, leaving numerous WRKY genes to be identified and their function characterized. The publication of the draft genome sequence of the strawberry genome allowed us to conduct a genome-wide search for WRKY proteins in Fragaria vesca, and to compare the identified proteins with their homologs in model plants. Fifty-nine FvWRKY genes were identified and annotated from the F. vesca genome. Detailed analysis, including gene classification, annotation, phylogenetic evaluation, conserved motif determination and expression profiling, based on RNA-seq data, were performed on all members of the family. Additionally, the expression patterns of the WRKY genes in different fruit developmental stages were further investigated using qRT-PCR, to provide a foundation for further comparative genomics and functional studies of this important class of transcriptional regulators in strawberry.

  19. Genome Sequencing Identifies Two Nearly Unchanged Strains of Persistent Listeria monocytogenes Isolated at Two Different Fish Processing Plants Sampled 6 Years Apart

    DEFF Research Database (Denmark)

    Holch, Anne; Webb, Kristen; Lukjancenko, Oksana

    2013-01-01

    Listeria monocytogenes is a food-borne human-pathogenic bacterium that can cause infections with a high mortality rate. It has a remarkable ability to persist in food processing facilities. Here we report the genome sequences for two L. monocytogenes strains (N53-1 and La111) that were isolated 6...... that has been isolated as a persistent subtype in several European countries. The purpose of this study was to use genome analyses to identify genes or proteins that could contribute to persistence. In a genome comparison, the two persistent strains were extremely similar and collectively differed from...... are required to determine if the absence of these genes promotes persistence. While the genome comparison did not point to a clear physiological explanation of the persistent phenotype, the remarkable similarity between the two strains indicates that subtypes with specific traits are selected for in the food...

  20. Genome-wide association scan meta-analysis identifies three Loci influencing adiposity and fat distribution.

    Directory of Open Access Journals (Sweden)

    Cecilia M Lindgren

    2009-06-01

    Full Text Available To identify genetic loci influencing central obesity and fat distribution, we performed a meta-analysis of 16 genome-wide association studies (GWAS, N = 38,580 informative for adult waist circumference (WC and waist-hip ratio (WHR. We selected 26 SNPs for follow-up, for which the evidence of association with measures of central adiposity (WC and/or WHR was strong and disproportionate to that for overall adiposity or height. Follow-up studies in a maximum of 70,689 individuals identified two loci strongly associated with measures of central adiposity; these map near TFAP2B (WC, P = 1.9x10(-11 and MSRA (WC, P = 8.9x10(-9. A third locus, near LYPLAL1, was associated with WHR in women only (P = 2.6x10(-8. The variants near TFAP2B appear to influence central adiposity through an effect on overall obesity/fat-mass, whereas LYPLAL1 displays a strong female-only association with fat distribution. By focusing on anthropometric measures of central obesity and fat distribution, we have identified three loci implicated in the regulation of human adiposity.

  1. Characterization of canine osteosarcoma by array comparative genomic hybridization and RT-qPCR: signatures of genomic imbalance in canine osteosarcoma parallel the human counterpart.

    Science.gov (United States)

    Angstadt, Andrea Y; Motsinger-Reif, Alison; Thomas, Rachael; Kisseberth, William C; Guillermo Couto, C; Duval, Dawn L; Nielsen, Dahlia M; Modiano, Jaime F; Breen, Matthew

    2011-11-01

    Osteosarcoma (OS) is the most commonly diagnosed malignant bone tumor in humans and dogs, characterized in both species by extremely complex karyotypes exhibiting high frequencies of genomic imbalance. Evaluation of genomic signatures in human OS using array comparative genomic hybridization (aCGH) has assisted in uncovering genetic mechanisms that result in disease phenotype. Previous low-resolution (10-20 Mb) aCGH analysis of canine OS identified a wide range of recurrent DNA copy number aberrations, indicating extensive genomic instability. In this study, we profiled 123 canine OS tumors by 1 Mb-resolution aCGH to generate a dataset for direct comparison with current data for human OS, concluding that several high frequency aberrations in canine and human OS are orthologous. To ensure complete coverage of gene annotation, we identified the human refseq genes that map to these orthologous aberrant dog regions and found several candidate genes warranting evaluation for OS involvement. Specifically, subsequenct FISH and qRT-PCR analysis of RUNX2, TUSC3, and PTEN indicated that expression levels correlated with genomic copy number status, showcasing RUNX2 as an OS associated gene and TUSC3 as a possible tumor suppressor candidate. Together these data demonstrate the ability of genomic comparative oncology to identify genetic abberations which may be important for OS progression. Large scale screening of genomic imbalance in canine OS further validates the use of the dog as a suitable model for human cancers, supporting the idea that dysregulation discovered in canine cancers will provide an avenue for complementary study in human counterparts. Copyright © 2011 Wiley-Liss, Inc.

  2. Integration of genome-wide association studies with biological knowledge identifies six novel genes related to kidney function.

    Science.gov (United States)

    Chasman, Daniel I; Fuchsberger, Christian; Pattaro, Cristian; Teumer, Alexander; Böger, Carsten A; Endlich, Karlhans; Olden, Matthias; Chen, Ming-Huei; Tin, Adrienne; Taliun, Daniel; Li, Man; Gao, Xiaoyi; Gorski, Mathias; Yang, Qiong; Hundertmark, Claudia; Foster, Meredith C; O'Seaghdha, Conall M; Glazer, Nicole; Isaacs, Aaron; Liu, Ching-Ti; Smith, Albert V; O'Connell, Jeffrey R; Struchalin, Maksim; Tanaka, Toshiko; Li, Guo; Johnson, Andrew D; Gierman, Hinco J; Feitosa, Mary F; Hwang, Shih-Jen; Atkinson, Elizabeth J; Lohman, Kurt; Cornelis, Marilyn C; Johansson, Asa; Tönjes, Anke; Dehghan, Abbas; Lambert, Jean-Charles; Holliday, Elizabeth G; Sorice, Rossella; Kutalik, Zoltan; Lehtimäki, Terho; Esko, Tõnu; Deshmukh, Harshal; Ulivi, Sheila; Chu, Audrey Y; Murgia, Federico; Trompet, Stella; Imboden, Medea; Coassin, Stefan; Pistis, Giorgio; Harris, Tamara B; Launer, Lenore J; Aspelund, Thor; Eiriksdottir, Gudny; Mitchell, Braxton D; Boerwinkle, Eric; Schmidt, Helena; Cavalieri, Margherita; Rao, Madhumathi; Hu, Frank; Demirkan, Ayse; Oostra, Ben A; de Andrade, Mariza; Turner, Stephen T; Ding, Jingzhong; Andrews, Jeanette S; Freedman, Barry I; Giulianini, Franco; Koenig, Wolfgang; Illig, Thomas; Meisinger, Christa; Gieger, Christian; Zgaga, Lina; Zemunik, Tatijana; Boban, Mladen; Minelli, Cosetta; Wheeler, Heather E; Igl, Wilmar; Zaboli, Ghazal; Wild, Sarah H; Wright, Alan F; Campbell, Harry; Ellinghaus, David; Nöthlings, Ute; Jacobs, Gunnar; Biffar, Reiner; Ernst, Florian; Homuth, Georg; Kroemer, Heyo K; Nauck, Matthias; Stracke, Sylvia; Völker, Uwe; Völzke, Henry; Kovacs, Peter; Stumvoll, Michael; Mägi, Reedik; Hofman, Albert; Uitterlinden, Andre G; Rivadeneira, Fernando; Aulchenko, Yurii S; Polasek, Ozren; Hastie, Nick; Vitart, Veronique; Helmer, Catherine; Wang, Jie Jin; Stengel, Bénédicte; Ruggiero, Daniela; Bergmann, Sven; Kähönen, Mika; Viikari, Jorma; Nikopensius, Tiit; Province, Michael; Ketkar, Shamika; Colhoun, Helen; Doney, Alex; Robino, Antonietta; Krämer, Bernhard K; Portas, Laura; Ford, Ian; Buckley, Brendan M; Adam, Martin; Thun, Gian-Andri; Paulweber, Bernhard; Haun, Margot; Sala, Cinzia; Mitchell, Paul; Ciullo, Marina; Kim, Stuart K; Vollenweider, Peter; Raitakari, Olli; Metspalu, Andres; Palmer, Colin; Gasparini, Paolo; Pirastu, Mario; Jukema, J Wouter; Probst-Hensch, Nicole M; Kronenberg, Florian; Toniolo, Daniela; Gudnason, Vilmundur; Shuldiner, Alan R; Coresh, Josef; Schmidt, Reinhold; Ferrucci, Luigi; Siscovick, David S; van Duijn, Cornelia M; Borecki, Ingrid B; Kardia, Sharon L R; Liu, Yongmei; Curhan, Gary C; Rudan, Igor; Gyllensten, Ulf; Wilson, James F; Franke, Andre; Pramstaller, Peter P; Rettig, Rainer; Prokopenko, Inga; Witteman, Jacqueline; Hayward, Caroline; Ridker, Paul M; Parsa, Afshin; Bochud, Murielle; Heid, Iris M; Kao, W H Linda; Fox, Caroline S; Köttgen, Anna

    2012-12-15

    In conducting genome-wide association studies (GWAS), analytical approaches leveraging biological information may further understanding of the pathophysiology of clinical traits. To discover novel associations with estimated glomerular filtration rate (eGFR), a measure of kidney function, we developed a strategy for integrating prior biological knowledge into the existing GWAS data for eGFR from the CKDGen Consortium. Our strategy focuses on single nucleotide polymorphism (SNPs) in genes that are connected by functional evidence, determined by literature mining and gene ontology (GO) hierarchies, to genes near previously validated eGFR associations. It then requires association thresholds consistent with multiple testing, and finally evaluates novel candidates by independent replication. Among the samples of European ancestry, we identified a genome-wide significant SNP in FBXL20 (P = 5.6 × 10(-9)) in meta-analysis of all available data, and additional SNPs at the INHBC, LRP2, PLEKHA1, SLC3A2 and SLC7A6 genes meeting multiple-testing corrected significance for replication and overall P-values of 4.5 × 10(-4)-2.2 × 10(-7). Neither the novel PLEKHA1 nor FBXL20 associations, both further supported by association with eGFR among African Americans and with transcript abundance, would have been implicated by eGFR candidate gene approaches. LRP2, encoding the megalin receptor, was identified through connection with the previously known eGFR gene DAB2 and extends understanding of the megalin system in kidney function. These findings highlight integration of existing genome-wide association data with independent biological knowledge to uncover novel candidate eGFR associations, including candidates lacking known connections to kidney-specific pathways. The strategy may also be applicable to other clinical phenotypes, although more testing will be needed to assess its potential for discovery in general.

  3. Investigating Drought Tolerance in Chickpea Using Genome-Wide Association Mapping and Genomic Selection Based on Whole-Genome Resequencing Data

    Directory of Open Access Journals (Sweden)

    Yongle Li

    2018-02-01

    Full Text Available Drought tolerance is a complex trait that involves numerous genes. Identifying key causal genes or linked molecular markers can facilitate the fast development of drought tolerant varieties. Using a whole-genome resequencing approach, we sequenced 132 chickpea varieties and advanced breeding lines and found more than 144,000 single nucleotide polymorphisms (SNPs. We measured 13 yield and yield-related traits in three drought-prone environments of Western Australia. The genotypic effects were significant for all traits, and many traits showed highly significant correlations, ranging from 0.83 between grain yield and biomass to -0.67 between seed weight and seed emergence rate. To identify candidate genes, the SNP and trait data were incorporated into the SUPER genome-wide association study (GWAS model, a modified version of the linear mixed model. We found that several SNPs from auxin-related genes, including auxin efflux carrier protein (PIN3, p-glycoprotein, and nodulin MtN21/EamA-like transporter, were significantly associated with yield and yield-related traits under drought-prone environments. We identified four genetic regions containing SNPs significantly associated with several different traits, which was an indication of pleiotropic effects. We also investigated the possibility of incorporating the GWAS results into a genomic selection (GS model, which is another approach to deal with complex traits. Compared to using all SNPs, application of the GS model using subsets of SNPs significantly associated with the traits under investigation increased the prediction accuracies of three yield and yield-related traits by more than twofold. This has important implication for implementing GS in plant breeding programs.

  4. Viral dark matter and virus–host interactions resolved from publicly available microbial genomes

    Science.gov (United States)

    Roux, Simon; Hallam, Steven J; Woyke, Tanja; Sullivan, Matthew B

    2015-01-01

    The ecological importance of viruses is now widely recognized, yet our limited knowledge of viral sequence space and virus–host interactions precludes accurate prediction of their roles and impacts. In this study, we mined publicly available bacterial and archaeal genomic data sets to identify 12,498 high-confidence viral genomes linked to their microbial hosts. These data augment public data sets 10-fold, provide first viral sequences for 13 new bacterial phyla including ecologically abundant phyla, and help taxonomically identify 7–38% of ‘unknown’ sequence space in viromes. Genome- and network-based classification was largely consistent with accepted viral taxonomy and suggested that (i) 264 new viral genera were identified (doubling known genera) and (ii) cross-taxon genomic recombination is limited. Further analyses provided empirical data on extrachromosomal prophages and coinfection prevalences, as well as evaluation of in silico virus–host linkage predictions. Together these findings illustrate the value of mining viral signal from microbial genomes. DOI: http://dx.doi.org/10.7554/eLife.08490.001 PMID:26200428

  5. Genome-wide association analysis identifies three new susceptibility loci for childhood body mass index

    Science.gov (United States)

    Felix, Janine F.; Bradfield, Jonathan P.; Monnereau, Claire; van der Valk, Ralf J.P.; Stergiakouli, Evie; Chesi, Alessandra; Gaillard, Romy; Feenstra, Bjarke; Thiering, Elisabeth; Kreiner-Møller, Eskil; Mahajan, Anubha; Pitkänen, Niina; Joro, Raimo; Cavadino, Alana; Huikari, Ville; Franks, Steve; Groen-Blokhuis, Maria M.; Cousminer, Diana L.; Marsh, Julie A.; Lehtimäki, Terho; Curtin, John A.; Vioque, Jesus; Ahluwalia, Tarunveer S.; Myhre, Ronny; Price, Thomas S.; Vilor-Tejedor, Natalia; Yengo, Loïc; Grarup, Niels; Ntalla, Ioanna; Ang, Wei; Atalay, Mustafa; Bisgaard, Hans; Blakemore, Alexandra I.; Bonnefond, Amelie; Carstensen, Lisbeth; Eriksson, Johan; Flexeder, Claudia; Franke, Lude; Geller, Frank; Geserick, Mandy; Hartikainen, Anna-Liisa; Haworth, Claire M.A.; Hirschhorn, Joel N.; Hofman, Albert; Holm, Jens-Christian; Horikoshi, Momoko; Hottenga, Jouke Jan; Huang, Jinyan; Kadarmideen, Haja N.; Kähönen, Mika; Kiess, Wieland; Lakka, Hanna-Maaria; Lakka, Timo A.; Lewin, Alexandra M.; Liang, Liming; Lyytikäinen, Leo-Pekka; Ma, Baoshan; Magnus, Per; McCormack, Shana E.; McMahon, George; Mentch, Frank D.; Middeldorp, Christel M.; Murray, Clare S.; Pahkala, Katja; Pers, Tune H.; Pfäffle, Roland; Postma, Dirkje S.; Power, Christine; Simpson, Angela; Sengpiel, Verena; Tiesler, Carla M. T.; Torrent, Maties; Uitterlinden, André G.; van Meurs, Joyce B.; Vinding, Rebecca; Waage, Johannes; Wardle, Jane; Zeggini, Eleftheria; Zemel, Babette S.; Dedoussis, George V.; Pedersen, Oluf; Froguel, Philippe; Sunyer, Jordi; Plomin, Robert; Jacobsson, Bo; Hansen, Torben; Gonzalez, Juan R.; Custovic, Adnan; Raitakari, Olli T.; Pennell, Craig E.; Widén, Elisabeth; Boomsma, Dorret I.; Koppelman, Gerard H.; Sebert, Sylvain; Järvelin, Marjo-Riitta; Hyppönen, Elina; McCarthy, Mark I.; Lindi, Virpi; Harri, Niinikoski; Körner, Antje; Bønnelykke, Klaus; Heinrich, Joachim; Melbye, Mads; Rivadeneira, Fernando; Hakonarson, Hakon; Ring, Susan M.; Smith, George Davey; Sørensen, Thorkild I.A.; Timpson, Nicholas J.; Grant, Struan F.A.; Jaddoe, Vincent W.V.

    2016-01-01

    A large number of genetic loci are associated with adult body mass index. However, the genetics of childhood body mass index are largely unknown. We performed a meta-analysis of genome-wide association studies of childhood body mass index, using sex- and age-adjusted standard deviation scores. We included 35 668 children from 20 studies in the discovery phase and 11 873 children from 13 studies in the replication phase. In total, 15 loci reached genome-wide significance (P-value < 5 × 10−8) in the joint discovery and replication analysis, of which 12 are previously identified loci in or close to ADCY3, GNPDA2, TMEM18, SEC16B, FAIM2, FTO, TFAP2B, TNNI3K, MC4R, GPR61, LMX1B and OLFM4 associated with adult body mass index or childhood obesity. We identified three novel loci: rs13253111 near ELP3, rs8092503 near RAB27B and rs13387838 near ADAM23. Per additional risk allele, body mass index increased 0.04 Standard Deviation Score (SDS) [Standard Error (SE) 0.007], 0.05 SDS (SE 0.008) and 0.14 SDS (SE 0.025), for rs13253111, rs8092503 and rs13387838, respectively. A genetic risk score combining all 15 SNPs showed that each additional average risk allele was associated with a 0.073 SDS (SE 0.011, P-value = 3.12 × 10−10) increase in childhood body mass index in a population of 1955 children. This risk score explained 2% of the variance in childhood body mass index. This study highlights the shared genetic background between childhood and adult body mass index and adds three novel loci. These loci likely represent age-related differences in strength of the associations with body mass index. PMID:26604143

  6. A bioinformatics approach for identifying transgene insertion sites using whole genome sequencing data.

    Science.gov (United States)

    Park, Doori; Park, Su-Hyun; Ban, Yong Wook; Kim, Youn Shic; Park, Kyoung-Cheul; Kim, Nam-Soo; Kim, Ju-Kon; Choi, Ik-Young

    2017-08-15

    Genetically modified crops (GM crops) have been developed to improve the agricultural traits of modern crop cultivars. Safety assessments of GM crops are of paramount importance in research at developmental stages and before releasing transgenic plants into the marketplace. Sequencing technology is developing rapidly, with higher output and labor efficiencies, and will eventually replace existing methods for the molecular characterization of genetically modified organisms. To detect the transgenic insertion locations in the three GM rice gnomes, Illumina sequencing reads are mapped and classified to the rice genome and plasmid sequence. The both mapped reads are classified to characterize the junction site between plant and transgene sequence by sequence alignment. Herein, we present a next generation sequencing (NGS)-based molecular characterization method, using transgenic rice plants SNU-Bt9-5, SNU-Bt9-30, and SNU-Bt9-109. Specifically, using bioinformatics tools, we detected the precise insertion locations and copy numbers of transfer DNA, genetic rearrangements, and the absence of backbone sequences, which were equivalent to results obtained from Southern blot analyses. NGS methods have been suggested as an effective means of characterizing and detecting transgenic insertion locations in genomes. Our results demonstrate the use of a combination of NGS technology and bioinformatics approaches that offers cost- and time-effective methods for assessing the safety of transgenic plants.

  7. Cellular Factors Shape 3D Genome Landscape

    Science.gov (United States)

    Researchers, using novel large-scale imaging technology, have mapped the spatial location of individual genes in the nucleus of human cells and identified 50 cellular factors required for the proper 3D positioning of genes. These spatial locations play important roles in gene expression, DNA repair, genome stability, and other cellular activities.

  8. Genome-wide association study identifies six new loci influencing pulse pressure and mean arterial pressure

    Science.gov (United States)

    Wain, Louise V; Verwoert, Germaine C; O’Reilly, Paul F; Shi, Gang; Johnson, Toby; Johnson, Andrew D; Bochud, Murielle; Rice, Kenneth M; Henneman, Peter; Smith, Albert V; Ehret, Georg B; Amin, Najaf; Larson, Martin G; Mooser, Vincent; Hadley, David; Dörr, Marcus; Bis, Joshua C; Aspelund, Thor; Esko, Tõnu; Janssens, A Cecile JW; Zhao, Jing Hua; Heath, Simon; Laan, Maris; Fu, Jingyuan; Pistis, Giorgio; Luan, Jian’an; Arora, Pankaj; Lucas, Gavin; Pirastu, Nicola; Pichler, Irene; Jackson, Anne U; Webster, Rebecca J; Zhang, Feng; Peden, John F; Schmidt, Helena; Tanaka, Toshiko; Campbell, Harry; Igl, Wilmar; Milaneschi, Yuri; Hotteng, Jouke-Jan; Vitart, Veronique; Chasman, Daniel I; Trompet, Stella; Bragg-Gresham, Jennifer L; Alizadeh, Behrooz Z; Chambers, John C; Guo, Xiuqing; Lehtimäki, Terho; Kühnel, Brigitte; Lopez, Lorna M; Polašek, Ozren; Boban, Mladen; Nelson, Christopher P; Morrison, Alanna C; Pihur, Vasyl; Ganesh, Santhi K; Hofman, Albert; Kundu, Suman; Mattace-Raso, Francesco US; Rivadeneira, Fernando; Sijbrands, Eric JG; Uitterlinden, Andre G; Hwang, Shih-Jen; Vasan, Ramachandran S; Wang, Thomas J; Bergmann, Sven; Vollenweider, Peter; Waeber, Gérard; Laitinen, Jaana; Pouta, Anneli; Zitting, Paavo; McArdle, Wendy L; Kroemer, Heyo K; Völker, Uwe; Völzke, Henry; Glazer, Nicole L; Taylor, Kent D; Harris, Tamara B; Alavere, Helene; Haller, Toomas; Keis, Aime; Tammesoo, Mari-Liis; Aulchenko, Yurii; Barroso, Inês; Khaw, Kay-Tee; Galan, Pilar; Hercberg, Serge; Lathrop, Mark; Eyheramendy, Susana; Org, Elin; Sõber, Siim; Lu, Xiaowen; Nolte, Ilja M; Penninx, Brenda W; Corre, Tanguy; Masciullo, Corrado; Sala, Cinzia; Groop, Leif; Voight, Benjamin F; Melander, Olle; O’Donnell, Christopher J; Salomaa, Veikko; d’Adamo, Adamo Pio; Fabretto, Antonella; Faletra, Flavio; Ulivi, Sheila; Del Greco, M Fabiola; Facheris, Maurizio; Collins, Francis S; Bergman, Richard N; Beilby, John P; Hung, Joseph; Musk, A William; Mangino, Massimo; Shin, So-Youn; Soranzo, Nicole; Watkins, Hugh; Goel, Anuj; Hamsten, Anders; Gider, Pierre; Loitfelder, Marisa; Zeginigg, Marion; Hernandez, Dena; Najjar, Samer S; Navarro, Pau; Wild, Sarah H; Corsi, Anna Maria; Singleton, Andrew; de Geus, Eco JC; Willemsen, Gonneke; Parker, Alex N; Rose, Lynda M; Buckley, Brendan; Stott, David; Orru, Marco; Uda, Manuela; van der Klauw, Melanie M; Zhang, Weihua; Li, Xinzhong; Scott, James; Chen, Yii-Der Ida; Burke, Gregory L; Kähönen, Mika; Viikari, Jorma; Döring, Angela; Meitinger, Thomas; Davies, Gail; Starr, John M; Emilsson, Valur; Plump, Andrew; Lindeman, Jan H; ’t Hoen, Peter AC; König, Inke R; Felix, Janine F; Clarke, Robert; Hopewell, Jemma C; Ongen, Halit; Breteler, Monique; Debette, Stéphanie; DeStefano, Anita L; Fornage, Myriam; Mitchell, Gary F; Smith, Nicholas L; Holm, Hilma; Stefansson, Kari; Thorleifsson, Gudmar; Thorsteinsdottir, Unnur; Samani, Nilesh J; Preuss, Michael; Rudan, Igor; Hayward, Caroline; Deary, Ian J; Wichmann, H-Erich; Raitakari, Olli T; Palmas, Walter; Kooner, Jaspal S; Stolk, Ronald P; Jukema, J Wouter; Wright, Alan F; Boomsma, Dorret I; Bandinelli, Stefania; Gyllensten, Ulf B; Wilson, James F; Ferrucci, Luigi; Schmidt, Reinhold; Farrall, Martin; Spector, Tim D; Palmer, Lyle J; Tuomilehto, Jaakko; Pfeufer, Arne; Gasparini, Paolo; Siscovick, David; Altshuler, David; Loos, Ruth JF; Toniolo, Daniela; Snieder, Harold; Gieger, Christian; Meneton, Pierre; Wareham, Nicholas J; Oostra, Ben A; Metspalu, Andres; Launer, Lenore; Rettig, Rainer; Strachan, David P; Beckmann, Jacques S; Witteman, Jacqueline CM; Erdmann, Jeanette; van Dijk, Ko Willems; Boerwinkle, Eric; Boehnke, Michael; Ridker, Paul M; Jarvelin, Marjo-Riitta; Chakravarti, Aravinda; Abecasis, Goncalo R; Gudnason, Vilmundur; Newton-Cheh, Christopher; Levy, Daniel; Munroe, Patricia B; Psaty, Bruce M; Caulfield, Mark J; Rao, Dabeeru C

    2012-01-01

    Numerous genetic loci influence systolic blood pressure (SBP) and diastolic blood pressure (DBP) in Europeans 1-3. We now report genome-wide association studies of pulse pressure (PP) and mean arterial pressure (MAP). In discovery (N=74,064) and follow-up studies (N=48,607), we identified at genome-wide significance (P= 2.7×10-8 to P=2.3×10-13) four novel PP loci (at 4q12 near CHIC2/PDGFRAI, 7q22.3 near PIK3CG, 8q24.12 in NOV, 11q24.3 near ADAMTS-8), two novel MAP loci (3p21.31 in MAP4, 10q25.3 near ADRB1) and one locus associated with both traits (2q24.3 near FIGN) which has recently been associated with SBP in east Asians. For three of the novel PP signals, the estimated effect for SBP was opposite to that for DBP, in contrast to the majority of common SBP- and DBP-associated variants which show concordant effects on both traits. These findings indicate novel genetic mechanisms underlying blood pressure variation, including pathways that may differentially influence SBP and DBP. PMID:21909110

  9. Polymorphic microsatellites in the human bloodfluke, Schistosoma japonicum, identified using a genomic resource

    Directory of Open Access Journals (Sweden)

    Spear Robert

    2011-02-01

    Full Text Available Abstract Re-emergence of schistosomiasis in regions of China where control programs have ceased requires development of molecular-genetic tools to track gene flow and assess genetic diversity of Schistosoma populations. We identified many microsatellite loci in the draft genome of Schistosoma japonicum using defined search criteria and selected a subset for further analysis. From an initial panel of 50 loci, 20 new microsatellites were selected for eventual optimization and application to a panel of worms from endemic areas. All but one of the selected microsatellites contain simple tri-nucleotide repeats. Moderate to high levels of polymorphism were detected. Numbers of alleles ranged from 6 to 14 and observed heterozygosity was always >0.6. The loci reported here will facilitate high resolution population-genetic studies on schistosomes in re-emergent foci.

  10. Chloroplast Genome Sequence of pigeonpea (Cajanus cajan (L. Millspaugh and Cajanus scarabaeoides: Genome organization and Comparison with other legumes

    Directory of Open Access Journals (Sweden)

    Tanvi Kaila

    2016-12-01

    Full Text Available Pigeonpea (Cajanus cajan (L. Millspaugh, a diploid (2n = 22 legume crop with a genome size of 852 Mbp, serves as an important source of human dietary protein especially in South East Asian and African regions. In this study, the draft chloroplast genomes of Cajanus cajan and Cajanus scarabaeoides were sequenced. Cajanus scarabaeoides is an important species of the Cajanus gene pool and has also been used for developing promising CMS system by different groups. A male sterile genotype harbouring the Cajanus scarabaeoides cytoplasm was used for sequencing the plastid genome. The cp genome of Cajanus cajan is 152,242bp long, having a quadripartite structure with LSC of 83,455 bp and SSC of 17,871 bp separated by IRs of 25,398 bp. Similarly, the cp genome of Cajanus scarabaeoides is 152,201bp long, having a quadripartite structure in which IRs of 25,402 bp length separates 83,423 bp of LSC and 17,854 bp of SSC. The pigeonpea cp genome contains 116 unique genes, including 30 tRNA, 4 rRNA, 78 predicted protein coding genes and 5 pseudogenes. A 50kb inversion was observed in the LSC region of pigeonpea cp genome, consistent with other legumes. Comparison of cp genome with other legumes revealed the contraction of IR boundaries due to the absence of rps19 gene in the IR region. Chloroplast SSRs were mined and a total of 280 and 292 cpSSRs were identified in Cajanus scarabaeoides and Cajanus cajan respectively. RNA editing was observed at 37 sites in both Cajanus scarabaeoides and Cajanus cajan, with maximum occurrence in the ndh genes. The pigeonpea cp genome sequence would be beneficial in providing informative molecular markers which can be utilized for genetic diversity analysis and aid in understanding the plant systematics studies among major grain legumes.

  11. Genome Wide Association Study of SNP-, Gene-, and Pathway-based Approaches to Identify Genes Influencing Susceptibility to Staphylococcus aureus Infections

    Directory of Open Access Journals (Sweden)

    Zhan eYe

    2014-05-01

    Full Text Available Background: We conducted a genome-wide association study (GWAS to identify specific genetic variants that underlie susceptibility to disease caused by Staphylococcus aureus in humans. Methods: Cases (n=309 and controls (n=2,925 were genotyped at 508,921 single nucleotide polymorphisms (SNPs. Cases had at least one laboratory and clinician confirmed disease caused by S. aureus whereas controls did not. R-package (for SNP association, EIGENSOFT (to estimate and adjust for population stratification and gene- (VEGAS and pathway-based (DAVID, PANTHER, and Ingenuity Pathway Analysis analyses were performed.Results: No SNP reached genome-wide significance. Four SNPs exceeded the pConclusion: We identified potential susceptibility genes for S. aureus diseases in this preliminary study but confirmation by other studies is needed. The observed associations could be relevant given the complexity of S. aureus as a pathogen and its ability to exploit multiple biological pathways to cause infections in humans.

  12. My sister's keeper?: genomic research and the identifiability of siblings

    Directory of Open Access Journals (Sweden)

    Kohane Isaac S

    2008-07-01

    Full Text Available Abstract Background Genomic sequencing of SNPs is increasingly prevalent, though the amount of familial information these data contain has not been quantified. Methods We provide a framework for measuring the risk to siblings of a patient's SNP genotype disclosure, and demonstrate that sibling SNP genotypes can be inferred with substantial accuracy. Results Extending this inference technique, we determine that a very low number of matches at commonly varying SNPs is sufficient to confirm sib-ship, demonstrating that published sequence data can reliably be used to derive sibling identities. Using HapMap trio data, at SNPs where one child is homozygotic major, with a minor allele frequency ≤ 0.20, (N = 452684, 65.1% we achieve 91.9% inference accuracy for sibling genotypes. Conclusion These findings demonstrate that substantial discrimination and privacy risks arise from use of inferred familial genomic data.

  13. Brucella abortus strain 2308 Wisconsin genome: importance of the definition of reference strains

    Directory of Open Access Journals (Sweden)

    Marcela Suárez-Esquivel

    2016-09-01

    Full Text Available Brucellosis is a bacterial infectious disease affecting a wide range of mammals and a neglected zoonosis caused by species of the genetically homogenous genus Brucella. As in most studies on bacterial diseases, research in brucellosis is carried out by using reference strains as canonical models to understand the mechanisms underlying host pathogen interactions. We performed whole genome sequencing (WGS analysis of the reference strain Brucella abortus 2308 routinely used in our laboratory, including manual curated annotation accessible as an editable version at www.wikipedia.Comparison of this genome with two publically available 2308 genomes showed significant differences, particularly indels related to insertional elements, suggesting variability related to the transposition of these elements within the same strain. Considering the outcome of high resolution genomic techniques in the bacteriology field, the conventional concept of strain definition needs to be revised.

  14. Signatures of selection in the Iberian honey bee: a genome wide approach using single nucleotide polymorphisms (SNPs)

    OpenAIRE

    Chavez-Galarza, Julio; Johnston, J. Spencer; Azevedo, João; Muñoz, Irene; De la Rúa, Pilar; Patton, John C.; Pinto, M. Alice

    2011-01-01

    Dissecting genome-wide (expansions, contractions, admixture) from genome-specific effects (selection) is a goal of central importance in evolutionary biology because it leads to more robust inferences of demographic history and to identification of adaptive divergence. The publication of the honey bee genome and the development of high-density SNPs genotyping, provide us with powerful tools, allowing us to identify signatures of selection in the honey bee genome. These signatur...

  15. High depth, whole-genome sequencing of cholera isolates from Haiti and the Dominican Republic.

    Science.gov (United States)

    Sealfon, Rachel; Gire, Stephen; Ellis, Crystal; Calderwood, Stephen; Qadri, Firdausi; Hensley, Lisa; Kellis, Manolis; Ryan, Edward T; LaRocque, Regina C; Harris, Jason B; Sabeti, Pardis C

    2012-09-11

    Whole-genome sequencing is an important tool for understanding microbial evolution and identifying the emergence of functionally important variants over the course of epidemics. In October 2010, a severe cholera epidemic began in Haiti, with additional cases identified in the neighboring Dominican Republic. We used whole-genome approaches to sequence four Vibrio cholerae isolates from Haiti and the Dominican Republic and three additional V. cholerae isolates to a high depth of coverage (>2000x); four of the seven isolates were previously sequenced. Using these sequence data, we examined the effect of depth of coverage and sequencing platform on genome assembly and identification of sequence variants. We found that 50x coverage is sufficient to construct a whole-genome assembly and to accurately call most variants from 100 base pair paired-end sequencing reads. Phylogenetic analysis between the newly sequenced and thirty-three previously sequenced V. cholerae isolates indicates that the Haitian and Dominican Republic isolates are closest to strains from South Asia. The Haitian and Dominican Republic isolates form a tight cluster, with only four variants unique to individual isolates. These variants are located in the CTX region, the SXT region, and the core genome. Of the 126 mutations identified that separate the Haiti-Dominican Republic cluster from the V. cholerae reference strain (N16961), 73 are non-synonymous changes, and a number of these changes cluster in specific genes and pathways. Sequence variant analyses of V. cholerae isolates, including multiple isolates from the Haitian outbreak, identify coverage-specific and technology-specific effects on variant detection, and provide insight into genomic change and functional evolution during an epidemic.

  16. High depth, whole-genome sequencing of cholera isolates from Haiti and the Dominican Republic

    Directory of Open Access Journals (Sweden)

    Sealfon Rachel

    2012-09-01

    Full Text Available Abstract Background Whole-genome sequencing is an important tool for understanding microbial evolution and identifying the emergence of functionally important variants over the course of epidemics. In October 2010, a severe cholera epidemic began in Haiti, with additional cases identified in the neighboring Dominican Republic. We used whole-genome approaches to sequence four Vibrio cholerae isolates from Haiti and the Dominican Republic and three additional V. cholerae isolates to a high depth of coverage (>2000x; four of the seven isolates were previously sequenced. Results Using these sequence data, we examined the effect of depth of coverage and sequencing platform on genome assembly and identification of sequence variants. We found that 50x coverage is sufficient to construct a whole-genome assembly and to accurately call most variants from 100 base pair paired-end sequencing reads. Phylogenetic analysis between the newly sequenced and thirty-three previously sequenced V. cholerae isolates indicates that the Haitian and Dominican Republic isolates are closest to strains from South Asia. The Haitian and Dominican Republic isolates form a tight cluster, with only four variants unique to individual isolates. These variants are located in the CTX region, the SXT region, and the core genome. Of the 126 mutations identified that separate the Haiti-Dominican Republic cluster from the V. cholerae reference strain (N16961, 73 are non-synonymous changes, and a number of these changes cluster in specific genes and pathways. Conclusions Sequence variant analyses of V. cholerae isolates, including multiple isolates from the Haitian outbreak, identify coverage-specific and technology-specific effects on variant detection, and provide insight into genomic change and functional evolution during an epidemic.

  17. Functional genomics identifies specific vulnerabilities in PTEN-deficient breast cancer.

    Science.gov (United States)

    Tang, Yew Chung; Ho, Szu-Chi; Tan, Elisabeth; Ng, Alvin Wei Tian; McPherson, John R; Goh, Germaine Yen Lin; Teh, Bin Tean; Bard, Frederic; Rozen, Steven G

    2018-03-22

    Phosphatase and tensin homolog (PTEN) is one of the most frequently inactivated tumor suppressors in breast cancer. While PTEN itself is not considered a druggable target, PTEN synthetic-sick or synthetic-lethal (PTEN-SSL) genes are potential drug targets in PTEN-deficient breast cancers. Therefore, with the aim of identifying potential targets for precision breast cancer therapy, we sought to discover PTEN-SSL genes present in a broad spectrum of breast cancers. To discover broad-spectrum PTEN-SSL genes in breast cancer, we used a multi-step approach that started with (1) a genome-wide short interfering RNA (siRNA) screen of ~ 21,000 genes in a pair of isogenic human mammary epithelial cell lines, followed by (2) a short hairpin RNA (shRNA) screen of ~ 1200 genes focused on hits from the first screen in a panel of 11 breast cancer cell lines; we then determined reproducibility of hits by (3) identification of overlaps between our results and reanalyzed data from 3 independent gene-essentiality screens, and finally, for selected candidate PTEN-SSL genes we (4) confirmed PTEN-SSL activity using either drug sensitivity experiments in a panel of 19 cell lines or mutual exclusivity analysis of publicly available pan-cancer somatic mutation data. The screens (steps 1 and 2) and the reproducibility analysis (step 3) identified six candidate broad-spectrum PTEN-SSL genes (PIK3CB, ADAMTS20, AP1M2, HMMR, STK11, and NUAK1). PIK3CB was previously identified as PTEN-SSL, while the other five genes represent novel PTEN-SSL candidates. Confirmation studies (step 4) provided additional evidence that NUAK1 and STK11 have PTEN-SSL patterns of activity. Consistent with PTEN-SSL status, inhibition of the NUAK1 protein kinase by the small molecule drug HTH-01-015 selectively impaired viability in multiple PTEN-deficient breast cancer cell lines, while mutations affecting STK11 and PTEN were largely mutually exclusive across large pan-cancer data sets. Six genes showed PTEN

  18. Proteogenomic Analysis Identifies a Novel Human SHANK3 Isoform

    Directory of Open Access Journals (Sweden)

    Fahad Benthani

    2015-05-01

    Full Text Available Mutations of the SHANK3 gene have been associated with autism spectrum disorder. Individuals harboring different SHANK3 mutations display considerable heterogeneity in their cognitive impairment, likely due to the high SHANK3 transcriptional diversity. In this study, we report a novel interaction between the Mutated in colorectal cancer (MCC protein and a newly identified SHANK3 protein isoform in human colon cancer cells and mouse brain tissue. Hence, our proteogenomic analysis identifies a new human long isoform of the key synaptic protein SHANK3 that was not predicted by the human reference genome. Taken together, our findings describe a potential new role for MCC in neurons, a new human SHANK3 long isoform and, importantly, highlight the use of proteomic data towards the re-annotation of GC-rich genomic regions.

  19. Sequencing of mitochondrial genomes of nine Aspergillus and Penicillium species identifies mobile introns and accessory genes as main sources of genome size variability.

    Science.gov (United States)

    Joardar, Vinita; Abrams, Natalie F; Hostetler, Jessica; Paukstelis, Paul J; Pakala, Suchitra; Pakala, Suman B; Zafar, Nikhat; Abolude, Olukemi O; Payne, Gary; Andrianopoulos, Alex; Denning, David W; Nierman, William C

    2012-12-12

    The genera Aspergillus and Penicillium include some of the most beneficial as well as the most harmful fungal species such as the penicillin-producer Penicillium chrysogenum and the human pathogen Aspergillus fumigatus, respectively. Their mitochondrial genomic sequences may hold vital clues into the mechanisms of their evolution, population genetics, and biology, yet only a handful of these genomes have been fully sequenced and annotated. Here we report the complete sequence and annotation of the mitochondrial genomes of six Aspergillus and three Penicillium species: A. fumigatus, A. clavatus, A. oryzae, A. flavus, Neosartorya fischeri (A. fischerianus), A. terreus, P. chrysogenum, P. marneffei, and Talaromyces stipitatus (P. stipitatum). The accompanying comparative analysis of these and related publicly available mitochondrial genomes reveals wide variation in size (25-36 Kb) among these closely related fungi. The sources of genome expansion include group I introns and accessory genes encoding putative homing endonucleases, DNA and RNA polymerases (presumed to be of plasmid origin) and hypothetical proteins. The two smallest sequenced genomes (A. terreus and P. chrysogenum) do not contain introns in protein-coding genes, whereas the largest genome (T. stipitatus), contains a total of eleven introns. All of the sequenced genomes have a group I intron in the large ribosomal subunit RNA gene, suggesting that this intron is fixed in these species. Subsequent analysis of several A. fumigatus strains showed low intraspecies variation. This study also includes a phylogenetic analysis based on 14 concatenated core mitochondrial proteins. The phylogenetic tree has a different topology from published multilocus trees, highlighting the challenges still facing the Aspergillus systematics. The study expands the genomic resources available to fungal biologists by providing mitochondrial genomes with consistent annotations for future genetic, evolutionary and population

  20. Comparative Genomic Analysis of Meningitis- and Bacteremia-Causing Pneumococci Identifies a Common Core Genome

    Science.gov (United States)

    Cornick, Jennifer E.; Chaguza, Chrispin; Yalcin, Feyruz; Harris, Simon R.; Gray, Katherine J.; Kiran, Anmol M.; Molyneux, Elizabeth; French, Neil; Faragher, Brian E.; Everett, Dean B.; Bentley, Stephen D.

    2015-01-01

    Streptococcus pneumoniae is a nasopharyngeal commensal that occasionally invades normally sterile sites to cause bloodstream infection and meningitis. Although the pneumococcal population structure and evolutionary genetics are well defined, it is not clear whether pneumococci that cause meningitis are genetically distinct from those that do not. Here, we used whole-genome sequencing of 140 isolates of S. pneumoniae recovered from bloodstream infection (n = 70) and meningitis (n = 70) to compare their genetic contents. By fitting a double-exponential decaying-function model, we show that these isolates share a core of 1,427 genes (95% confidence interval [CI], 1,425 to 1,435 genes) and that there is no difference in the core genome or accessory gene content from these disease manifestations. Gene presence/absence alone therefore does not explain the virulence behavior of pneumococci that reach the meninges. Our analysis, however, supports the requirement of a range of previously described virulence factors and vaccine candidates for both meningitis- and bacteremia-causing pneumococci. This high-resolution view suggests that, despite considerable competency for genetic exchange, all pneumococci are under considerable pressure to retain key components advantageous for colonization and transmission and that these components are essential for access to and survival in sterile sites. PMID:26259813

  1. Novel genetic loci underlying human intracranial volume identified through genome-wide association

    Science.gov (United States)

    Adams, Hieab HH; Hibar, Derrek P; Chouraki, Vincent; Stein, Jason L; Nyquist, Paul A; Rentería, Miguel E; Trompet, Stella; Arias-Vasquez, Alejandro; Seshadri, Sudha; Desrivières, Sylvane; Beecham, Ashley H; Jahanshad, Neda; Wittfeld, Katharina; Van der Lee, Sven J; Abramovic, Lucija; Alhusaini, Saud; Amin, Najaf; Andersson, Micael; Arfanakis, Konstantinos; Aribisala, Benjamin S; Armstrong, Nicola J; Athanasiu, Lavinia; Axelsson, Tomas; Beiser, Alexa; Bernard, Manon; Bis, Joshua C; Blanken, Laura ME; Blanton, Susan H; Bohlken, Marc M; Boks, Marco P; Bralten, Janita; Brickman, Adam M; Carmichael, Owen; Chakravarty, M Mallar; Chauhan, Ganesh; Chen, Qiang; Ching, Christopher RK; Cuellar-Partida, Gabriel; Den Braber, Anouk; Doan, Nhat Trung; Ehrlich, Stefan; Filippi, Irina; Ge, Tian; Giddaluru, Sudheer; Goldman, Aaron L; Gottesman, Rebecca F; Greven, Corina U; Grimm, Oliver; Griswold, Michael E; Guadalupe, Tulio; Hass, Johanna; Haukvik, Unn K; Hilal, Saima; Hofer, Edith; Hoehn, David; Holmes, Avram J; Hoogman, Martine; Janowitz, Deborah; Jia, Tianye; Kasperaviciute, Dalia; Kim, Sungeun; Klein, Marieke; Kraemer, Bernd; Lee, Phil H; Liao, Jiemin; Liewald, David CM; Lopez, Lorna M; Luciano, Michelle; Macare, Christine; Marquand, Andre; Matarin, Mar; Mather, Karen A; Mattheisen, Manuel; Mazoyer, Bernard; McKay, David R; McWhirter, Rebekah; Milaneschi, Yuri; Mirza-Schreiber, Nazanin; Muetzel, Ryan L; Maniega, Susana Muñoz; Nho, Kwangsik; Nugent, Allison C; Olde Loohuis, Loes M; Oosterlaan, Jaap; Papmeyer, Martina; Pappa, Irene; Pirpamer, Lukas; Pudas, Sara; Pütz, Benno; Rajan, Kumar B; Ramasamy, Adaikalavan; Richards, Jennifer S; Risacher, Shannon L; Roiz-Santiañez, Roberto; Rommelse, Nanda; Rose, Emma J; Royle, Natalie A; Rundek, Tatjana; Sämann, Philipp G; Satizabal, Claudia L; Schmaal, Lianne; Schork, Andrew J; Shen, Li; Shin, Jean; Shumskaya, Elena; Smith, Albert V; Sprooten, Emma; Strike, Lachlan T; Teumer, Alexander; Thomson, Russell; Tordesillas-Gutierrez, Diana; Toro, Roberto; Trabzuni, Daniah; Vaidya, Dhananjay; Van der Grond, Jeroen; Van der Meer, Dennis; Van Donkelaar, Marjolein MJ; Van Eijk, Kristel R; Van Erp, Theo GM; Van Rooij, Daan; Walton, Esther; Westlye, Lars T; Whelan, Christopher D; Windham, Beverly G; Winkler, Anderson M; Woldehawariat, Girma; Wolf, Christiane; Wolfers, Thomas; Xu, Bing; Yanek, Lisa R; Yang, Jingyun; Zijdenbos, Alex; Zwiers, Marcel P; Agartz, Ingrid; Aggarwal, Neelum T; Almasy, Laura; Ames, David; Amouyel, Philippe; Andreassen, Ole A; Arepalli, Sampath; Assareh, Amelia A; Barral, Sandra; Bastin, Mark E; Becker, Diane M; Becker, James T; Bennett, David A; Blangero, John; van Bokhoven, Hans; Boomsma, Dorret I; Brodaty, Henry; Brouwer, Rachel M; Brunner, Han G; Buckner, Randy L; Buitelaar, Jan K; Bulayeva, Kazima B; Cahn, Wiepke; Calhoun, Vince D; Cannon, Dara M; Cavalleri, Gianpiero L; Chen, Christopher; Cheng, Ching-Yu; Cichon, Sven; Cookson, Mark R; Corvin, Aiden; Crespo-Facorro, Benedicto; Curran, Joanne E; Czisch, Michael; Dale, Anders M; Davies, Gareth E; De Geus, Eco JC; De Jager, Philip L; de Zubicaray, Greig I; Delanty, Norman; Depondt, Chantal; DeStefano, Anita L; Dillman, Allissa; Djurovic, Srdjan; Donohoe, Gary; Drevets, Wayne C; Duggirala, Ravi; Dyer, Thomas D; Erk, Susanne; Espeseth, Thomas; Evans, Denis A; Fedko, Iryna O; Fernández, Guillén; Ferrucci, Luigi; Fisher, Simon E; Fleischman, Debra A; Ford, Ian; Foroud, Tatiana M; Fox, Peter T; Francks, Clyde; Fukunaga, Masaki; Gibbs, J Raphael; Glahn, David C; Gollub, Randy L; Göring, Harald HH; Grabe, Hans J; Green, Robert C; Gruber, Oliver; Gudnason, Vilmundur; Guelfi, Sebastian; Hansell, Narelle K; Hardy, John; Hartman, Catharina A; Hashimoto, Ryota; Hegenscheid, Katrin; Heinz, Andreas; Le Hellard, Stephanie; Hernandez, Dena G; Heslenfeld, Dirk J; Ho, Beng-Choon; Hoekstra, Pieter J; Hoffmann, Wolfgang; Hofman, Albert; Holsboer, Florian; Homuth, Georg; Hosten, Norbert; Hottenga, Jouke-Jan; Hulshoff Pol, Hilleke E; Ikeda, Masashi; Ikram, M Kamran; Jack, Clifford R; Jenkinson, Mark; Johnson, Robert; Jönsson, Erik G; Jukema, J Wouter; Kahn, René S; Kanai, Ryota; Kloszewska, Iwona; Knopman, David S; Kochunov, Peter; Kwok, John B; Lawrie, Stephen M; Lemaître, Hervé; Liu, Xinmin; Longo, Dan L; Longstreth, WT; Lopez, Oscar L; Lovestone, Simon; Martinez, Oliver; Martinot, Jean-Luc; Mattay, Venkata S; McDonald, Colm; McIntosh, Andrew M; McMahon, Katie L; McMahon, Francis J; Mecocci, Patrizia; Melle, Ingrid; Meyer-Lindenberg, Andreas; Mohnke, Sebastian; Montgomery, Grant W; Morris, Derek W; Mosley, Thomas H; Mühleisen, Thomas W; Müller-Myhsok, Bertram; Nalls, Michael A; Nauck, Matthias; Nichols, Thomas E; Niessen, Wiro J; Nöthen, Markus M; Nyberg, Lars; Ohi, Kazutaka; Olvera, Rene L; Ophoff, Roel A; Pandolfo, Massimo; Paus, Tomas; Pausova, Zdenka; Penninx, Brenda WJH; Pike, G Bruce; Potkin, Steven G; Psaty, Bruce M; Reppermund, Simone; Rietschel, Marcella; Roffman, Joshua L; Romanczuk-Seiferth, Nina; Rotter, Jerome I; Ryten, Mina; Sacco, Ralph L; Sachdev, Perminder S; Saykin, Andrew J; Schmidt, Reinhold; Schofield, Peter R; Sigurdsson, Sigurdur; Simmons, Andy; Singleton, Andrew; Sisodiya, Sanjay M; Smith, Colin; Smoller, Jordan W; Soininen, Hilkka; Srikanth, Velandai; Steen, Vidar M; Stott, David J; Sussmann, Jessika E; Thalamuthu, Anbupalam; Tiemeier, Henning; Toga, Arthur W; Traynor, Bryan J; Troncoso, Juan; Turner, Jessica A; Tzourio, Christophe; Uitterlinden, Andre G; Valdés Hernández, Maria C; Van der Brug, Marcel; Van der Lugt, Aad; Van der Wee, Nic JA; Van Duijn, Cornelia M; Van Haren, Neeltje EM; Van 't Ent, Dennis; Van Tol, Marie-Jose; Vardarajan, Badri N; Veltman, Dick J; Vernooij, Meike W; Völzke, Henry; Walter, Henrik; Wardlaw, Joanna M; Wassink, Thomas H; Weale, Michael E; Weinberger, Daniel R; Weiner, Michael W; Wen, Wei; Westman, Eric; White, Tonya; Wong, Tien Y; Wright, Clinton B; Zielke, H Ronald; Zonderman, Alan B; Deary, Ian J; DeCarli, Charles; Schmidt, Helena; Martin, Nicholas G; De Craen, Anton JM; Wright, Margaret J; Launer, Lenore J; Schumann, Gunter; Fornage, Myriam; Franke, Barbara; Debette, Stéphanie; Medland, Sarah E; Ikram, M Arfan; Thompson, Paul M

    2016-01-01

    Intracranial volume reflects the maximally attained brain size during development, and remains stable with loss of tissue in late life. It is highly heritable, but the underlying genes remain largely undetermined. In a genome-wide association study of 32,438 adults, we discovered five novel loci for intracranial volume and confirmed two known signals. Four of the loci are also associated with adult human stature, but these remained associated with intracranial volume after adjusting for height. We found a high genetic correlation with child head circumference (ρgenetic=0.748), which indicated a similar genetic background and allowed for the identification of four additional loci through meta-analysis (Ncombined = 37,345). Variants for intracranial volume were also related to childhood and adult cognitive function, Parkinson’s disease, and enriched near genes involved in growth pathways including PI3K–AKT signaling. These findings identify biological underpinnings of intracranial volume and provide genetic support for theories on brain reserve and brain overgrowth. PMID:27694991

  2. Genome-wide association study identified genetic variations and candidate genes for plant architecture component traits in Chinese upland cotton.

    Science.gov (United States)

    Su, Junji; Li, Libei; Zhang, Chi; Wang, Caixiang; Gu, Lijiao; Wang, Hantao; Wei, Hengling; Liu, Qibao; Huang, Long; Yu, Shuxun

    2018-06-01

    Thirty significant associations between 22 SNPs and five plant architecture component traits in Chinese upland cotton were identified via GWAS. Four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits. A candidate gene, Gh_D03G0922, might be responsible for plant height in upland cotton. A compact plant architecture is increasingly required for mechanized harvesting processes in China. Therefore, cotton plant architecture is an important trait, and its components, such as plant height, fruit branch length and fruit branch angle, affect the suitability of a cultivar for mechanized harvesting. To determine the genetic basis of cotton plant architecture, a genome-wide association study (GWAS) was performed using a panel composed of 355 accessions and 93,250 single nucleotide polymorphisms (SNPs) identified using the specific-locus amplified fragment sequencing method. Thirty significant associations between 22 SNPs and five plant architecture component traits were identified via GWAS. Most importantly, four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits, and these SNPs were harbored in one linkage disequilibrium block. Furthermore, 21 candidate genes for plant architecture were predicted in a 0.95-Mb region including the four peak SNPs. One of these genes (Gh_D03G0922) was near the significant SNP D03_31584163 (8.40 kb), and its Arabidopsis homologs contain MADS-box domains that might be involved in plant growth and development. qRT-PCR showed that the expression of Gh_D03G0922 was upregulated in the apical buds and young leaves of the short and compact cotton varieties, and virus-induced gene silencing (VIGS) proved that the silenced plants exhibited increased PH. These results indicate that Gh_D03G0922 is likely the candidate gene for PH in cotton. The genetic variations and candidate genes identified in this study lay a foundation

  3. Decoding the genome with an integrative analysis tool: combinatorial CRM Decoder.

    Science.gov (United States)

    Kang, Keunsoo; Kim, Joomyeong; Chung, Jae Hoon; Lee, Daeyoup

    2011-09-01

    The identification of genome-wide cis-regulatory modules (CRMs) and characterization of their associated epigenetic features are fundamental steps toward the understanding of gene regulatory networks. Although integrative analysis of available genome-wide information can provide new biological insights, the lack of novel methodologies has become a major bottleneck. Here, we present a comprehensive analysis tool called combinatorial CRM decoder (CCD), which utilizes the publicly available information to identify and characterize genome-wide CRMs in a species of interest. CCD first defines a set of the epigenetic features which is significantly associated with a set of known CRMs as a code called 'trace code', and subsequently uses the trace code to pinpoint putative CRMs throughout the genome. Using 61 genome-wide data sets obtained from 17 independent mouse studies, CCD successfully catalogued ∼12 600 CRMs (five distinct classes) including polycomb repressive complex 2 target sites as well as imprinting control regions. Interestingly, we discovered that ∼4% of the identified CRMs belong to at least two different classes named 'multi-functional CRM', suggesting their functional importance for regulating spatiotemporal gene expression. From these examples, we show that CCD can be applied to any potential genome-wide datasets and therefore will shed light on unveiling genome-wide CRMs in various species.

  4. Meta-analysis of genome-wide association data and large-scale replication identifies additional susceptibility loci for type 2 diabetes

    DEFF Research Database (Denmark)

    Zeggini, Eleftheria; Scott, Laura J; Saxena, Richa

    2008-01-01

    analyses had limited power to identify variants with modest effects, we carried out meta-analysis of three T2D GWA scans comprising 10,128 individuals of European descent and approximately 2.2 million SNPs (directly genotyped and imputed), followed by replication testing in an independent sample......Genome-wide association (GWA) studies have identified multiple loci at which common variants modestly but reproducibly influence risk of type 2 diabetes (T2D). Established associations to common and rare variants explain only a small proportion of the heritability of T2D. As previously published...

  5. A novel data mining method to identify assay-specific signatures in functional genomic studies

    Directory of Open Access Journals (Sweden)

    Guidarelli Jack W

    2006-08-01

    Full Text Available Abstract Background: The highly dimensional data produced by functional genomic (FG studies makes it difficult to visualize relationships between gene products and experimental conditions (i.e., assays. Although dimensionality reduction methods such as principal component analysis (PCA have been very useful, their application to identify assay-specific signatures has been limited by the lack of appropriate methodologies. This article proposes a new and powerful PCA-based method for the identification of assay-specific gene signatures in FG studies. Results: The proposed method (PM is unique for several reasons. First, it is the only one, to our knowledge, that uses gene contribution, a product of the loading and expression level, to obtain assay signatures. The PM develops and exploits two types of assay-specific contribution plots, which are new to the application of PCA in the FG area. The first type plots the assay-specific gene contribution against the given order of the genes and reveals variations in distribution between assay-specific gene signatures as well as outliers within assay groups indicating the degree of importance of the most dominant genes. The second type plots the contribution of each gene in ascending or descending order against a constantly increasing index. This type of plots reveals assay-specific gene signatures defined by the inflection points in the curve. In addition, sharp regions within the signature define the genes that contribute the most to the signature. We proposed and used the curvature as an appropriate metric to characterize these sharp regions, thus identifying the subset of genes contributing the most to the signature. Finally, the PM uses the full dataset to determine the final gene signature, thus eliminating the chance of gene exclusion by poor screening in earlier steps. The strengths of the PM are demonstrated using a simulation study, and two studies of real DNA microarray data – a study of

  6. Genome sequence and genetic diversity of the common carp, Cyprinus carpio.

    Science.gov (United States)

    Xu, Peng; Zhang, Xiaofeng; Wang, Xumin; Li, Jiongtang; Liu, Guiming; Kuang, Youyi; Xu, Jian; Zheng, Xianhu; Ren, Lufeng; Wang, Guoliang; Zhang, Yan; Huo, Linhe; Zhao, Zixia; Cao, Dingchen; Lu, Cuiyun; Li, Chao; Zhou, Yi; Liu, Zhanjiang; Fan, Zhonghua; Shan, Guangle; Li, Xingang; Wu, Shuangxiu; Song, Lipu; Hou, Guangyuan; Jiang, Yanliang; Jeney, Zsigmond; Yu, Dan; Wang, Li; Shao, Changjun; Song, Lai; Sun, Jing; Ji, Peifeng; Wang, Jian; Li, Qiang; Xu, Liming; Sun, Fanyue; Feng, Jianxin; Wang, Chenghui; Wang, Shaolin; Wang, Baosen; Li, Yan; Zhu, Yaping; Xue, Wei; Zhao, Lan; Wang, Jintu; Gu, Ying; Lv, Weihua; Wu, Kejing; Xiao, Jingfa; Wu, Jiayan; Zhang, Zhang; Yu, Jun; Sun, Xiaowen

    2014-11-01

    The common carp, Cyprinus carpio, is one of the most important cyprinid species and globally accounts for 10% of freshwater aquaculture production. Here we present a draft genome of domesticated C. carpio (strain Songpu), whose current assembly contains 52,610 protein-coding genes and approximately 92.3% coverage of its paleotetraploidized genome (2n = 100). The latest round of whole-genome duplication has been estimated to have occurred approximately 8.2 million years ago. Genome resequencing of 33 representative individuals from worldwide populations demonstrates a single origin for C. carpio in 2 subspecies (C. carpio Haematopterus and C. carpio carpio). Integrative genomic and transcriptomic analyses were used to identify loci potentially associated with traits including scaling patterns and skin color. In combination with the high-resolution genetic map, the draft genome paves the way for better molecular studies and improved genome-assisted breeding of C. carpio and other closely related species.

  7. Whole genome sequencing and bioinformatics analysis of two Egyptian genomes.

    Science.gov (United States)

    ElHefnawi, Mahmoud; Jeon, Sungwon; Bhak, Youngjune; ElFiky, Asmaa; Horaiz, Ahmed; Jun, JeHoon; Kim, Hyunho; Bhak, Jong

    2018-05-15

    We report two Egyptian male genomes (EGP1 and EGP2) sequenced at ~ 30× sequencing depths. EGP1 had 4.7 million variants, where 198,877 were novel variants while EGP2 had 209,109 novel variants out of 4.8 million variants. The mitochondrial haplogroup of the two individuals were identified to be H7b1 and L2a1c, respectively. We also identified the Y haplogroup of EGP1 (R1b) and EGP2 (J1a2a1a2 > P58 > FGC11). EGP1 had a mutation in the NADH gene of the mitochondrial genome ND4 (m.11778 G > A) that causes Leber's hereditary optic neuropathy. Some SNPs shared by the two genomes were associated with an increased level of cholesterol and triglycerides, probably related with Egyptians obesity. Comparison of these genomes with African and Western-Asian genomes can provide insights on Egyptian ancestry and genetic history. This resource can be used to further understand genomic diversity and functional classification of variants as well as human migration and evolution across Africa and Western-Asia. Copyright © 2017. Published by Elsevier B.V.

  8. Optical Whole-Genome Restriction Mapping as a Tool for Rapidly Distinguishing and Identifying Bacterial Contaminants in Clinical Samples

    Science.gov (United States)

    2015-08-01

    Article 3. DATES COVERED (From – To) Oct 2011 – Aug 2012 4. TITLE AND SUBTITLE Optical Whole-Genome Restriction Mapping as a Tool for Rapidly...multiple bacteria could be uniquely identified within mixtures. In the first set of experiments, three unique organisms ( Bacillus subtilis subsp. globigii...be useful in monitoring nosocomial outbreaks in neonatal and intensive care wards, or even as an initial screen for antibiotic resistant strains

  9. Comparative genome analysis to identify SNPs associated with high oleic acid and elevated protein content in soybean.

    Science.gov (United States)

    Kulkarni, Krishnanand P; Patil, Gunvant; Valliyodan, Babu; Vuong, Tri D; Shannon, J Grover; Nguyen, Henry T; Lee, Jeong-Dong

    2018-03-01

    The objective of this study was to determine the genetic relationship between the oleic acid and protein content. The genotypes having high oleic acid and elevated protein (HOEP) content were crossed with five elite lines having normal oleic acid and average protein (NOAP) content. The selected accessions were grown at six environments in three different locations and phenotyped for protein, oil, and fatty acid components. The mean protein content of parents, HOEP, and NOAP lines was 34.6%, 38%, and 34.9%, respectively. The oleic acid concentration of parents, HOEP, and NOAP lines was 21.7%, 80.5%, and 20.8%, respectively. The HOEP plants carried both FAD2-1A (S117N) and FAD2-1B (P137R) mutant alleles contributing to the high oleic acid phenotype. Comparative genome analysis using whole-genome resequencing data identified six genes having single nucleotide polymorphism (SNP) significantly associated with the traits analyzed. A single SNP in the putative gene Glyma.10G275800 was associated with the elevated protein content, and palmitic, oleic, and linoleic acids. The genes from the marker intervals of previously identified QTL did not carry SNPs associated with protein content and fatty acid composition in the lines used in this study, indicating that all the genes except Glyma.10G278000 may be the new genes associated with the respective traits.

  10. Genome-Enhanced Detection and Identification (GEDI of plant pathogens

    Directory of Open Access Journals (Sweden)

    Nicolas Feau

    2018-02-01

    Full Text Available Plant diseases caused by fungi and Oomycetes represent worldwide threats to crops and forest ecosystems. Effective prevention and appropriate management of emerging diseases rely on rapid detection and identification of the causal pathogens. The increase in genomic resources makes it possible to generate novel genome-enhanced DNA detection assays that can exploit whole genomes to discover candidate genes for pathogen detection. A pipeline was developed to identify genome regions that discriminate taxa or groups of taxa and can be converted into PCR assays. The modular pipeline is comprised of four components: (1 selection and genome sequencing of phylogenetically related taxa, (2 identification of clusters of orthologous genes, (3 elimination of false positives by filtering, and (4 assay design. This pipeline was applied to some of the most important plant pathogens across three broad taxonomic groups: Phytophthoras (Stramenopiles, Oomycota, Dothideomycetes (Fungi, Ascomycota and Pucciniales (Fungi, Basidiomycota. Comparison of 73 fungal and Oomycete genomes led the discovery of 5,939 gene clusters that were unique to the targeted taxa and an additional 535 that were common at higher taxonomic levels. Approximately 28% of the 299 tested were converted into qPCR assays that met our set of specificity criteria. This work demonstrates that a genome-wide approach can efficiently identify multiple taxon-specific genome regions that can be converted into highly specific PCR assays. The possibility to easily obtain multiple alternative regions to design highly specific qPCR assays should be of great help in tackling challenging cases for which higher taxon-resolution is needed.

  11. Genome-wide association identifies genetic variants associated with lentiform nucleus volume in N = 1345 young and elderly subjects.

    Science.gov (United States)

    Hibar, Derrek P; Stein, Jason L; Ryles, April B; Kohannim, Omid; Jahanshad, Neda; Medland, Sarah E; Hansell, Narelle K; McMahon, Katie L; de Zubicaray, Greig I; Montgomery, Grant W; Martin, Nicholas G; Wright, Margaret J; Saykin, Andrew J; Jack, Clifford R; Weiner, Michael W; Toga, Arthur W; Thompson, Paul M

    2013-06-01

    Deficits in lentiform nucleus volume and morphometry are implicated in a number of genetically influenced disorders, including Parkinson's disease, schizophrenia, and ADHD. Here we performed genome-wide searches to discover common genetic variants associated with differences in lentiform nucleus volume in human populations. We assessed structural MRI scans of the brain in two large genotyped samples: the Alzheimer's Disease Neuroimaging Initiative (ADNI; N = 706) and the Queensland Twin Imaging Study (QTIM; N = 639). Statistics of association from each cohort were combined meta-analytically using a fixed-effects model to boost power and to reduce the prevalence of false positive findings. We identified a number of associations in and around the flavin-containing monooxygenase (FMO) gene cluster. The most highly associated SNP, rs1795240, was located in the FMO3 gene; after meta-analysis, it showed genome-wide significant evidence of association with lentiform nucleus volume (P MA  = 4.79 × 10(-8)). This commonly-carried genetic variant accounted for 2.68 % and 0.84 % of the trait variability in the ADNI and QTIM samples, respectively, even though the QTIM sample was on average 50 years younger. Pathway enrichment analysis revealed significant contributions of this gene to the cytochrome P450 pathway, which is involved in metabolizing numerous therapeutic drugs for pain, seizures, mania, depression, anxiety, and psychosis. The genetic variants we identified provide replicated, genome-wide significant evidence for the FMO gene cluster's involvement in lentiform nucleus volume differences in human populations.

  12. Insights into bilaterian evolution from three spiralian genomes

    Energy Technology Data Exchange (ETDEWEB)

    Simakov, Oleg; Marletaz, Ferdinand; Cho, Sung-Jin; Edsinger-Gonzales, Eric; Havlak, Paul; Hellsten, Uffe; Kuo, Dian-Han; Larsson, Tomas; Lv, Jie; Arendt, Detlev; Savage, Robert; Osoegawa, Kazutoyo; de Jong, Pieter; Grimwood, Jane; Chapman, Jarrod A.; Shapiro, Harris; Otillar, Robert P.; Terry, Astrid Y.; Boore, Jeffrey L.; Grigoriev, Igor V.; Lindberg, David R.; Seaver, Elaine C.; Weisblat, David A.; Putnam, Nicholas H.; Rokhsar, Daniel S.; Aerts, Andrea

    2012-01-07

    Current genomic perspectives on animal diversity neglect two prominent phyla, the molluscs and annelids, that together account for nearly one-third of known marine species and are important both ecologically and as experimental systems in classical embryology1, 2, 3. Here we describe the draft genomes of the owl limpet (Lottia gigantea), a marine polychaete (Capitella teleta) and a freshwater leech (Helobdella robusta), and compare them with other animal genomes to investigate the origin and diversification of bilaterians from a genomic perspective. We find that the genome organization, gene structure and functional content of these species are more similar to those of some invertebrate deuterostome genomes (for example, amphioxus and sea urchin) than those of other protostomes that have been sequenced to date (flies, nematodes and flatworms). The conservation of these genomic features enables us to expand the inventory of genes present in the last common bilaterian ancestor, establish the tripartite diversification of bilaterians using multiple genomic characteristics and identify ancient conserved long- and short-range genetic linkages across metazoans. Superimposed on this broadly conserved pan-bilaterian background we find examples of lineage-specific genome evolution, including varying rates of rearrangement, intron gain and loss, expansions and contractions of gene families, and the evolution of clade-specific genes that produce the unique content of each genome.

  13. The First Complete Chloroplast Genome Sequences in Actinidiaceae: Genome Structure and Comparative Analysis.

    Science.gov (United States)

    Yao, Xiaohong; Tang, Ping; Li, Zuozhou; Li, Dawei; Liu, Yifei; Huang, Hongwen

    2015-01-01

    Actinidia chinensis is an important economic plant belonging to the basal lineage of the asterids. Availability of a complete Actinidia chloroplast genome sequence is crucial to understanding phylogenetic relationships among major lineages of angiosperms and facilitates kiwifruit genetic improvement. We report here the complete nucleotide sequences of the chloroplast genomes for Actinidia chinensis and A. chinensis var deliciosa obtained through de novo assembly of Illumina paired-end reads produced by total DNA sequencing. The total genome size ranges from 155,446 to 157,557 bp, with an inverted repeat (IR) of 24,013 to 24,391 bp, a large single copy region (LSC) of 87,984 to 88,337 bp and a small single copy region (SSC) of 20,332 to 20,336 bp. The genome encodes 113 different genes, including 79 unique protein-coding genes, 30 tRNA genes and 4 ribosomal RNA genes, with 16 duplicated in the inverted repeats, and a tRNA gene (trnfM-CAU) duplicated once in the LSC region. Comparisons of IR boundaries among four asterid species showed that IR/LSC borders were extended into the 5' portion of the psbA gene and IR contraction occurred in Actinidia. The clap gene has been lost from the chloroplast genome in Actinidia, and may have been transferred to the nucleus during chloroplast evolution. Twenty-seven polymorphic simple sequence repeat (SSR) loci were identified in the Actinidia chloroplast genome. Maximum parsimony analyses of a 72-gene, 16 taxa angiosperm dataset strongly support the placement of Actinidiaceae in Ericales within the basal asterids.

  14. Musa sebagai Model Genom

    Directory of Open Access Journals (Sweden)

    RITA MEGIA

    2005-12-01

    Full Text Available During the meeting in Arlington, USA in 2001, the scientists grouped in PROMUSA agreed with the launching of the Global Musa Genomics Consortium. The Consortium aims to apply genomics technologies to the improvement of this important crop. These genome projects put banana as the third model species after Arabidopsis and rice that will be analyzed and sequenced. Comparing to Arabidopsis and rice, banana genome provides a unique and powerful insight into structural and in functional genomics that could not be found in those two species. This paper discussed these subjects-including the importance of banana as the fourth main food in the world, the evolution and biodiversity of this genetic resource and its parasite.

  15. Supplementary Material for: Whole genome sequencing reveals genomic heterogeneity and antibiotic purification in Mycobacterium tuberculosis isolates

    KAUST Repository

    Black, PA

    2015-01-01

    Abstract Background Whole genome sequencing has revolutionised the interrogation of mycobacterial genomes. Recent studies have reported conflicting findings on the genomic stability of Mycobacterium tuberculosis during the evolution of drug resistance. In an age where whole genome sequencing is increasingly relied upon for defining the structure of bacterial genomes, it is important to investigate the reliability of next generation sequencing to identify clonal variants present in a minor percentage of the population. This study aimed to define a reliable cut-off for identification of low frequency sequence variants and to subsequently investigate genetic heterogeneity and the evolution of drug resistance in M. tuberculosis. Methods Genomic DNA was isolated from single colonies from 14 rifampicin mono-resistant M. tuberculosis isolates, as well as the primary cultures and follow up MDR cultures from two of these patients. The whole genomes of the M. tuberculosis isolates were sequenced using either the Illumina MiSeq or Illumina HiSeq platforms. Sequences were analysed with an in-house pipeline. Results Using next-generation sequencing in combination with Sanger sequencing and statistical analysis we defined a read frequency cut-off of 30 % to identify low frequency M. tuberculosis variants with high confidence. Using this cut-off we demonstrated a high rate of genetic diversity between single colonies isolated from one population, showing that by using the current sequencing technology, single colonies are not a true reflection of the genetic diversity within a whole population and vice versa. We further showed that numerous heterogeneous variants emerge and then disappear during the evolution of isoniazid resistance within individual patients. Our findings allowed us to formulate a model for the selective bottleneck which occurs during the course of infection, acting as a genomic purification event. Conclusions Our study demonstrated true levels of genetic

  16. Limitations of variable number of tandem repeat typing identified through whole genome sequencing of Mycobacterium avium subsp. paratuberculosis on a national and herd level.

    Science.gov (United States)

    Ahlstrom, Christina; Barkema, Herman W; Stevenson, Karen; Zadoks, Ruth N; Biek, Roman; Kao, Rowland; Trewby, Hannah; Haupstein, Deb; Kelton, David F; Fecteau, Gilles; Labrecque, Olivia; Keefe, Greg P; McKenna, Shawn L B; De Buck, Jeroen

    2015-03-08

    Mycobacterium avium subsp. paratuberculosis (MAP), the causative bacterium of Johne's disease in dairy cattle, is widespread in the Canadian dairy industry and has significant economic and animal welfare implications. An understanding of the population dynamics of MAP can be used to identify introduction events, improve control efforts and target transmission pathways, although this requires an adequate understanding of MAP diversity and distribution between herds and across the country. Whole genome sequencing (WGS) offers a detailed assessment of the SNP-level diversity and genetic relationship of isolates, whereas several molecular typing techniques used to investigate the molecular epidemiology of MAP, such as variable number of tandem repeat (VNTR) typing, target relatively unstable repetitive elements in the genome that may be too unpredictable to draw accurate conclusions. The objective of this study was to evaluate the diversity of bovine MAP isolates in Canadian dairy herds using WGS and then determine if VNTR typing can distinguish truly related and unrelated isolates. Phylogenetic analysis based on 3,039 SNPs identified through WGS of 124 MAP isolates identified eight genetically distinct subtypes in dairy herds from seven Canadian provinces, with the dominant type including over 80% of MAP isolates. VNTR typing of 527 MAP isolates identified 12 types, including "bison type" isolates, from seven different herds. At a national level, MAP isolates differed from each other by 1-2 to 239-240 SNPs, regardless of whether they belonged to the same or different VNTR types. A herd-level analysis of MAP isolates demonstrated that VNTR typing may both over-estimate and under-estimate the relatedness of MAP isolates found within a single herd. The presence of multiple MAP subtypes in Canada suggests multiple introductions into the country including what has now become one dominant type, an important finding for Johne's disease control. VNTR typing often failed to

  17. Genome wide characterization of simple sequence repeats in watermelon genome and their application in comparative mapping and genetic diversity analysis.

    Science.gov (United States)

    Zhu, Huayu; Song, Pengyao; Koo, Dal-Hoe; Guo, Luqin; Li, Yanman; Sun, Shouru; Weng, Yiqun; Yang, Luming

    2016-08-05

    Microsatellite markers are one of the most informative and versatile DNA-based markers used in plant genetic research, but their development has traditionally been difficult and costly. The whole genome sequencing with next-generation sequencing (NGS) technologies provides large amounts of sequence data to develop numerous microsatellite markers at whole genome scale. SSR markers have great advantage in cross-species comparisons and allow investigation of karyotype and genome evolution through highly efficient computation approaches such as in silico PCR. Here we described genome wide development and characterization of SSR markers in the watermelon (Citrullus lanatus) genome, which were then use in comparative analysis with two other important crop species in the Cucurbitaceae family: cucumber (Cucumis sativus L.) and melon (Cucumis melo L.). We further applied these markers in evaluating the genetic diversity and population structure in watermelon germplasm collections. A total of 39,523 microsatellite loci were identified from the watermelon draft genome with an overall density of 111 SSRs/Mbp, and 32,869 SSR primers were designed with suitable flanking sequences. The dinucleotide SSRs were the most common type representing 34.09 % of the total SSR loci and the AT-rich motifs were the most abundant in all nucleotide repeat types. In silico PCR analysis identified 832 and 925 SSR markers with each having a single amplicon in the cucumber and melon draft genome, respectively. Comparative analysis with these cross-species SSR markers revealed complicated mosaic patterns of syntenic blocks among the genomes of three species. In addition, genetic diversity analysis of 134 watermelon accessions with 32 highly informative SSR loci placed these lines into two groups with all accessions of C.lanatus var. citorides and three accessions of C. colocynthis clustered in one group and all accessions of C. lanatus var. lanatus and the remaining accessions of C. colocynthis

  18. Genome-wide meta-analysis identifies new susceptibility loci for migraine

    NARCIS (Netherlands)

    Anttila, Verneri; Winsvold, Bendik S.; Gormley, Padhraig; Kurth, Tobias; Bettella, Francesco; McMahon, George; Kallela, Mikko; Malik, Rainer; de Vries, Boukje; Terwindt, Gisela; Medland, Sarah E.; Todt, Unda; McArdle, Wendy L.; Quaye, Lydia; Koiranen, Markku; Ikram, M. Arfan; Lehtimaki, Terho; Stam, Anine H.; Ligthart, Lannie; Wedenoja, Juho; Dunham, Ian; Neale, Benjamin M.; Palta, Priit; Hamalainen, Eija; Schuerks, Markus; Rose, Lynda M.; Buring, Julie E.; Ridker, Paul M.; Steinberg, Stacy; Stefansson, Hreinn; Jakobsson, Finnbogi; Lawlor, Debbie A.; Evans, David M.; Ring, Susan M.; Farkkila, Markus; Artto, Ville; Kaunisto, Mari A.; Freilinger, Tobias; Schoenen, Jean; Frants, Rune R.; Pelzer, Nadine; Weller, Claudia M.; Zielman, Ronald; Heath, Andrew C.; Madden, Pamela A. F.; Montgomery, Grant W.; Martin, Nicholas G.; Borck, Guntram; Goebel, Hartmut; Heinze, Axel

    Migraine is the most common brain disorder, affecting approximately 14% of the adult population, but its molecular mechanisms are poorly understood. We report the results of a meta-analysis across 29 genome-wide association studies, including a total of 23,285 individuals with migraine (cases) and

  19. Genome-wide meta-analysis identifies new susceptibility loci for migraine

    NARCIS (Netherlands)

    Anttila, V.; Winsvold, B.S.; Gormley, P.; Kurth, T.; Bettella, F.; McMahon, G.; Kallela, M.; Malik, R.; de Vries, B.; Terwindt, G.; Medland, S.E.; Todt, U.; McArdle, W.L.; Quaye, L.; Koiranen, M.; Ikram, M.A.; Lehtimäki, T.; Stam, A.H.; Ligthart, R.S.L.; Wedenoja, J.; Dunham, I.; Neale, B. M.; Palta, P.; Hamalainen, E.; Schürks, M.; Rose, L.M.; Buring, J.E.; Ridker, P.M.; Steinberg, S.; Stefansson, H.; Jakobsson, F.; Lawlor, D.A.; Evans, D.M.; Ring, S.M.; Färkkilä, M.; Artto, V.; Kaunisto, M.A.; Freilinger, T.; Schoenen, J.; Frants, R.R.; Pelzer, N.; Weller, C.M.; Zielman, R.; Heath, A.C.; Madden, P.A.F.; Montgomery, G.W.; Martin, N.G.; Borck, G.; Göbel, H.; Heinze, A.; Heinze-Kuhn, K.; Williams, F.M.; Hartikainen, A.-L.; Pouta, A.; van den Ende, J..; Uitterlinden, A.G.; Hofman, A.; Amin, N.; Hottenga, J.J.; Vink, J.M.; Heikkilä, K.; Alexander, M.; Muller-Myhsok, B.; Schreiber, S; Meitinger, T.; Wichmann, H. E.; Aromaa, A.; Eriksson, J.G.; Traynor, B.J.; Trabzuni, D.; Rossin, E.; Lage, K.; Jacobs, S.B.; Gibbs, J.R.; Birney, E.; Kaprio, J.; Penninx, B.W.J.H.; Boomsma, D.I.; van Duijn, C.M.; Raitakari, O.; Jarvelin, M.-R.; Zwart, J.A.; Cherkas, L.; Strachan, D.P.; Kubisch, C.; Ferrari, M.D.; van den Maagdenberg, A.M.J.M.; Dichgans, M.; Wessman, M.; Smith, G.D.; Stefansson, K.; Daly, M.J.; Nyholt, DR; Chasman, D.I.; Palotie, A.

    2013-01-01

    Migraine is the most common brain disorder, affecting approximately 14% of the adult population, but its molecular mechanisms are poorly understood. We report the results of a meta-analysis across 29 genome-wide association studies, including a total of 23,285 individuals with migraine (cases) and

  20. Genome-wide meta-analysis identifies new susceptibility loci for migraine

    DEFF Research Database (Denmark)

    Anttila, Verneri; Winsvold, Bendik S; Gormley, Padhraig

    2013-01-01

    Migraine is the most common brain disorder, affecting approximately 14% of the adult population, but its molecular mechanisms are poorly understood. We report the results of a meta-analysis across 29 genome-wide association studies, including a total of 23,285 individuals with migraine (cases) an...

  1. DeepBipolar: Identifying genomic mutations for bipolar disorder via deep learning.

    Science.gov (United States)

    Laksshman, Sundaram; Bhat, Rajendra Rana; Viswanath, Vivek; Li, Xiaolin

    2017-09-01

    Bipolar disorder, also known as manic depression, is a brain disorder that affects the brain structure of a patient. It results in extreme mood swings, severe states of depression, and overexcitement simultaneously. It is estimated that roughly 3% of the population of the United States (about 5.3 million adults) suffers from bipolar disorder. Recent research efforts like the Twin studies have demonstrated a high heritability factor for the disorder, making genomics a viable alternative for detecting and treating bipolar disorder, in addition to the conventional lengthy and costly postsymptom clinical diagnosis. Motivated by this study, leveraging several emerging deep learning algorithms, we design an end-to-end deep learning architecture (called DeepBipolar) to predict bipolar disorder based on limited genomic data. DeepBipolar adopts the Deep Convolutional Neural Network (DCNN) architecture that automatically extracts features from genotype information to predict the bipolar phenotype. We participated in the Critical Assessment of Genome Interpretation (CAGI) bipolar disorder challenge and DeepBipolar was considered the most successful by the independent assessor. In this work, we thoroughly evaluate the performance of DeepBipolar and analyze the type of signals we believe could have affected the classifier in distinguishing the case samples from the control set. © 2017 Wiley Periodicals, Inc.

  2. The complete genome sequence and comparative genome analysis of the high pathogenicity Yersinia enterocolitica strain 8081.

    Directory of Open Access Journals (Sweden)

    Nicholas R Thomson

    2006-12-01

    Full Text Available The human enteropathogen, Yersinia enterocolitica, is a significant link in the range of Yersinia pathologies extending from mild gastroenteritis to bubonic plague. Comparison at the genomic level is a key step in our understanding of the genetic basis for this pathogenicity spectrum. Here we report the genome of Y. enterocolitica strain 8081 (serotype 0:8; biotype 1B and extensive microarray data relating to the genetic diversity of the Y. enterocolitica species. Our analysis reveals that the genome of Y. enterocolitica strain 8081 is a patchwork of horizontally acquired genetic loci, including a plasticity zone of 199 kb containing an extraordinarily high density of virulence genes. Microarray analysis has provided insights into species-specific Y. enterocolitica gene functions and the intraspecies differences between the high, low, and nonpathogenic Y. enterocolitica biotypes. Through comparative genome sequence analysis we provide new information on the evolution of the Yersinia. We identify numerous loci that represent ancestral clusters of genes potentially important in enteric survival and pathogenesis, which have been lost or are in the process of being lost, in the other sequenced Yersinia lineages. Our analysis also highlights large metabolic operons in Y. enterocolitica that are absent in the related enteropathogen, Yersinia pseudotuberculosis, indicating major differences in niche and nutrients used within the mammalian gut. These include clusters directing, the production of hydrogenases, tetrathionate respiration, cobalamin synthesis, and propanediol utilisation. Along with ancestral gene clusters, the genome of Y. enterocolitica has revealed species-specific and enteropathogen-specific loci. This has provided important insights into the pathology of this bacterium and, more broadly, into the evolution of the genus. Moreover, wider investigations looking at the patterns of gene loss and gain in the Yersinia have highlighted common

  3. Draft genome sequence of pectic polysaccharide-degrading moderate thermophilic bacterium Geobacillus thermodenitrificans DSM 101594

    Directory of Open Access Journals (Sweden)

    Raimonda Petkauskaite

    Full Text Available Abstract Geobacillus thermodenitrificans DSM 101594 was isolated as a producer of extracellular thermostable pectic polysaccharide degrading enzymes. The completely sequenced genome was 3.6 Mb in length with GC content of 48.86%. A number of genes encoding enzymatic active against the high molecular weight polysaccharides of potential biotechnological importance were identified in the genome.

  4. Genomic and Genetic Diversity within the Pseudomonas fluorescens Complex.

    Directory of Open Access Journals (Sweden)

    Daniel Garrido-Sanz

    Full Text Available The Pseudomonas fluorescens complex includes Pseudomonas strains that have been taxonomically assigned to more than fifty different species, many of which have been described as plant growth-promoting rhizobacteria (PGPR with potential applications in biocontrol and biofertilization. So far the phylogeny of this complex has been analyzed according to phenotypic traits, 16S rDNA, MLSA and inferred by whole-genome analysis. However, since most of the type strains have not been fully sequenced and new species are frequently described, correlation between taxonomy and phylogenomic analysis is missing. In recent years, the genomes of a large number of strains have been sequenced, showing important genomic heterogeneity and providing information suitable for genomic studies that are important to understand the genomic and genetic diversity shown by strains of this complex. Based on MLSA and several whole-genome sequence-based analyses of 93 sequenced strains, we have divided the P. fluorescens complex into eight phylogenomic groups that agree with previous works based on type strains. Digital DDH (dDDH identified 69 species and 75 subspecies within the 93 genomes. The eight groups corresponded to clustering with a threshold of 31.8% dDDH, in full agreement with our MLSA. The Average Nucleotide Identity (ANI approach showed inconsistencies regarding the assignment to species and to the eight groups. The small core genome of 1,334 CDSs and the large pan-genome of 30,848 CDSs, show the large diversity and genetic heterogeneity of the P. fluorescens complex. However, a low number of strains were enough to explain most of the CDSs diversity at core and strain-specific genomic fractions. Finally, the identification and analysis of group-specific genome and the screening for distinctive characters revealed a phylogenomic distribution of traits among the groups that provided insights into biocontrol and bioremediation applications as well as their role as

  5. Genome-wide association study identifies new prostate cancer susceptibility loci

    DEFF Research Database (Denmark)

    Schumacher, Fredrick R.; Berndt, Sonja I.; Siddiq, Afshan

    2011-01-01

    Prostate cancer (PrCa) is the most common non-skin cancer diagnosed among males in developed countries and the second leading cause of cancer mortality, yet little is known regarding its etiology and factors that influence clinical outcome. Genome-wide association studies (GWAS) of PrCa have iden...

  6. OrthoVenn: a web server for genome wide comparison and annotation of orthologous clusters across multiple species

    Science.gov (United States)

    Genome wide analysis of orthologous clusters is an important component of comparative genomics studies. Identifying the overlap among orthologous clusters can enable us to elucidate the function and evolution of proteins across multiple species. Here, we report a web platform named OrthoVenn that i...

  7. Genome-Wide Association Identifies Multiple Genomic Regions Associated with Susceptibility to and Control of Ovine Lentivirus

    Science.gov (United States)

    2012-10-17

    to varying degrees of dyspnea (respiratory distress), cachexia (body condition wasting), mastitis , arthritis, and/or encephalitis [5,6]. One of the...General Transcription Factor IIH, polypeptide 5), the gene order does not agree with other mammal genomes including cow , human, dog, and mouse, and it may

  8. Unleashing the genome of Brassica rapa

    Directory of Open Access Journals (Sweden)

    Haibao eTang

    2012-07-01

    Full Text Available The completion and release of the Brassica rapa genome is of great benefit to researchers of the Brassicas, Arabidopsis, and genome evolution. While its lineage is closely related to the model organism Arabidopsis thaliana, the Brassicas experienced a whole genome triplication subsequent to their divergence. This event contemporaneously created three copies of its ancestral genome, which had diploidized through the process of homeologous gene loss known as fractionation. By the fractionation of homeologous gene content and genetic regulatory binding sites, Brassica’s genome is well placed to use comparative genomic techniques to identify syntenic regions, homeologous gene duplications, and putative regulatory sequences. Here, we use the comparative genomics platform CoGe to perform several different genomic analyses with which to study structural changes of its genome and dynamics of various genetic elements. Starting with whole genome comparisons, the Brassica paleohexaploidy is characterized, syntenic regions with Arabidopsis thaliana are identified, and the TOC1 gene in the circadian rhythm pathway from Arabidopsis thaliana is used to find duplicated orthologs in Brassica rapa. These TOC1 genes are further analyzed to identify conserved noncoding sequences that contain cis-acting regulatory elements and promoter sequences previously implicated in circadian rhythmicity. Each 'cookbook style' analysis includes a step-by-step walkthrough with links to CoGe to quickly reproduce each step of the analytical process.

  9. Ensembl Genomes 2013: scaling up access to genome-wide data.

    Science.gov (United States)

    Kersey, Paul Julian; Allen, James E; Christensen, Mikkel; Davis, Paul; Falin, Lee J; Grabmueller, Christoph; Hughes, Daniel Seth Toney; Humphrey, Jay; Kerhornou, Arnaud; Khobova, Julia; Langridge, Nicholas; McDowall, Mark D; Maheswari, Uma; Maslen, Gareth; Nuhn, Michael; Ong, Chuang Kee; Paulini, Michael; Pedro, Helder; Toneva, Iliana; Tuli, Mary Ann; Walts, Brandon; Williams, Gareth; Wilson, Derek; Youens-Clark, Ken; Monaco, Marcela K; Stein, Joshua; Wei, Xuehong; Ware, Doreen; Bolser, Daniel M; Howe, Kevin Lee; Kulesha, Eugene; Lawson, Daniel; Staines, Daniel Michael

    2014-01-01

    Ensembl Genomes (http://www.ensemblgenomes.org) is an integrating resource for genome-scale data from non-vertebrate species. The project exploits and extends technologies for genome annotation, analysis and dissemination, developed in the context of the vertebrate-focused Ensembl project, and provides a complementary set of resources for non-vertebrate species through a consistent set of programmatic and interactive interfaces. These provide access to data including reference sequence, gene models, transcriptional data, polymorphisms and comparative analysis. This article provides an update to the previous publications about the resource, with a focus on recent developments. These include the addition of important new genomes (and related data sets) including crop plants, vectors of human disease and eukaryotic pathogens. In addition, the resource has scaled up its representation of bacterial genomes, and now includes the genomes of over 9000 bacteria. Specific extensions to the web and programmatic interfaces have been developed to support users in navigating these large data sets. Looking forward, analytic tools to allow targeted selection of data for visualization and download are likely to become increasingly important in future as the number of available genomes increases within all domains of life, and some of the challenges faced in representing bacterial data are likely to become commonplace for eukaryotes in future.

  10. Application of Genomic Technologies to the Breeding of Trees.

    Science.gov (United States)

    Badenes, Maria L; Fernández I Martí, Angel; Ríos, Gabino; Rubio-Cabetas, María J

    2016-01-01

    The recent introduction of next generation sequencing (NGS) technologies represents a major revolution in providing new tools for identifying the genes and/or genomic intervals controlling important traits for selection in breeding programs. In perennial fruit trees with long generation times and large sizes of adult plants, the impact of these techniques is even more important. High-throughput DNA sequencing technologies have provided complete annotated sequences in many important tree species. Most of the high-throughput genotyping platforms described are being used for studies of genetic diversity and population structure. Dissection of complex traits became possible through the availability of genome sequences along with phenotypic variation data, which allow to elucidate the causative genetic differences that give rise to observed phenotypic variation. Association mapping facilitates the association between genetic markers and phenotype in unstructured and complex populations, identifying molecular markers for assisted selection and breeding. Also, genomic data provide in silico identification and characterization of genes and gene families related to important traits, enabling new tools for molecular marker assisted selection in tree breeding. Deep sequencing of transcriptomes is also a powerful tool for the analysis of precise expression levels of each gene in a sample. It consists in quantifying short cDNA reads, obtained by NGS technologies, in order to compare the entire transcriptomes between genotypes and environmental conditions. The miRNAs are non-coding short RNAs involved in the regulation of different physiological processes, which can be identified by high-throughput sequencing of RNA libraries obtained by reverse transcription of purified short RNAs, and by in silico comparison with known miRNAs from other species. All together, NGS techniques and their applications have increased the resources for plant breeding in tree species, closing the

  11. Identifying genetic relatives without compromising privacy.

    Science.gov (United States)

    He, Dan; Furlotte, Nicholas A; Hormozdiari, Farhad; Joo, Jong Wha J; Wadia, Akshay; Ostrovsky, Rafail; Sahai, Amit; Eskin, Eleazar

    2014-04-01

    The development of high-throughput genomic technologies has impacted many areas of genetic research. While many applications of these technologies focus on the discovery of genes involved in disease from population samples, applications of genomic technologies to an individual's genome or personal genomics have recently gained much interest. One such application is the identification of relatives from genetic data. In this application, genetic information from a set of individuals is collected in a database, and each pair of individuals is compared in order to identify genetic relatives. An inherent issue that arises in the identification of relatives is privacy. In this article, we propose a method for identifying genetic relatives without compromising privacy by taking advantage of novel cryptographic techniques customized for secure and private comparison of genetic information. We demonstrate the utility of these techniques by allowing a pair of individuals to discover whether or not they are related without compromising their genetic information or revealing it to a third party. The idea is that individuals only share enough special-purpose cryptographically protected information with each other to identify whether or not they are relatives, but not enough to expose any information about their genomes. We show in HapMap and 1000 Genomes data that our method can recover first- and second-order genetic relationships and, through simulations, show that our method can identify relationships as distant as third cousins while preserving privacy.

  12. Emerging Genomic Tools for Legume Breeding: Current Status and Future Prospects

    Science.gov (United States)

    Pandey, Manish K.; Roorkiwal, Manish; Singh, Vikas K.; Ramalingam, Abirami; Kudapa, Himabindu; Thudi, Mahendar; Chitikineni, Anu; Rathore, Abhishek; Varshney, Rajeev K.

    2016-01-01

    Legumes play a vital role in ensuring global nutritional food security and improving soil quality through nitrogen fixation. Accelerated higher genetic gains is required to meet the demand of ever increasing global population. In recent years, speedy developments have been witnessed in legume genomics due to advancements in next-generation sequencing (NGS) and high-throughput genotyping technologies. Reference genome sequences for many legume crops have been reported in the last 5 years. The availability of the draft genome sequences and re-sequencing of elite genotypes for several important legume crops have made it possible to identify structural variations at large scale. Availability of large-scale genomic resources and low-cost and high-throughput genotyping technologies are enhancing the efficiency and resolution of genetic mapping and marker-trait association studies. Most importantly, deployment of molecular breeding approaches has resulted in development of improved lines in some legume crops such as chickpea and groundnut. In order to support genomics-driven crop improvement at a fast pace, the deployment of breeder-friendly genomics and decision support tools seems appear to be critical in breeding programs in developing countries. This review provides an overview of emerging genomics and informatics tools/approaches that will be the key driving force for accelerating genomics-assisted breeding and ultimately ensuring nutritional and food security in developing countries. PMID:27199998

  13. Identifying all moiety conservation laws in genome-scale metabolic networks.

    Science.gov (United States)

    De Martino, Andrea; De Martino, Daniele; Mulet, Roberto; Pagnani, Andrea

    2014-01-01

    The stoichiometry of a metabolic network gives rise to a set of conservation laws for the aggregate level of specific pools of metabolites, which, on one hand, pose dynamical constraints that cross-link the variations of metabolite concentrations and, on the other, provide key insight into a cell's metabolic production capabilities. When the conserved quantity identifies with a chemical moiety, extracting all such conservation laws from the stoichiometry amounts to finding all non-negative integer solutions of a linear system, a programming problem known to be NP-hard. We present an efficient strategy to compute the complete set of integer conservation laws of a genome-scale stoichiometric matrix, also providing a certificate for correctness and maximality of the solution. Our method is deployed for the analysis of moiety conservation relationships in two large-scale reconstructions of the metabolism of the bacterium E. coli, in six tissue-specific human metabolic networks, and, finally, in the human reactome as a whole, revealing that bacterial metabolism could be evolutionarily designed to cover broader production spectra than human metabolism. Convergence to the full set of moiety conservation laws in each case is achieved in extremely reduced computing times. In addition, we uncover a scaling relation that links the size of the independent pool basis to the number of metabolites, for which we present an analytical explanation.

  14. Identifying all moiety conservation laws in genome-scale metabolic networks.

    Directory of Open Access Journals (Sweden)

    Andrea De Martino

    Full Text Available The stoichiometry of a metabolic network gives rise to a set of conservation laws for the aggregate level of specific pools of metabolites, which, on one hand, pose dynamical constraints that cross-link the variations of metabolite concentrations and, on the other, provide key insight into a cell's metabolic production capabilities. When the conserved quantity identifies with a chemical moiety, extracting all such conservation laws from the stoichiometry amounts to finding all non-negative integer solutions of a linear system, a programming problem known to be NP-hard. We present an efficient strategy to compute the complete set of integer conservation laws of a genome-scale stoichiometric matrix, also providing a certificate for correctness and maximality of the solution. Our method is deployed for the analysis of moiety conservation relationships in two large-scale reconstructions of the metabolism of the bacterium E. coli, in six tissue-specific human metabolic networks, and, finally, in the human reactome as a whole, revealing that bacterial metabolism could be evolutionarily designed to cover broader production spectra than human metabolism. Convergence to the full set of moiety conservation laws in each case is achieved in extremely reduced computing times. In addition, we uncover a scaling relation that links the size of the independent pool basis to the number of metabolites, for which we present an analytical explanation.

  15. Delineating slowly and rapidly evolving fractions of the Drosophila genome.

    Science.gov (United States)

    Keith, Jonathan M; Adams, Peter; Stephen, Stuart; Mattick, John S

    2008-05-01

    Evolutionary conservation is an important indicator of function and a major component of bioinformatic methods to identify non-protein-coding genes. We present a new Bayesian method for segmenting pairwise alignments of eukaryotic genomes while simultaneously classifying segments into slowly and rapidly evolving fractions. We also describe an information criterion similar to the Akaike Information Criterion (AIC) for determining the number of classes. Working with pairwise alignments enables detection of differences in conservation patterns among closely related species. We analyzed three whole-genome and three partial-genome pairwise alignments among eight Drosophila species. Three distinct classes of conservation level were detected. Sequences comprising the most slowly evolving component were consistent across a range of species pairs, and constituted approximately 62-66% of the D. melanogaster genome. Almost all (>90%) of the aligned protein-coding sequence is in this fraction, suggesting much of it (comprising the majority of the Drosophila genome, including approximately 56% of non-protein-coding sequences) is functional. The size and content of the most rapidly evolving component was species dependent, and varied from 1.6% to 4.8%. This fraction is also enriched for protein-coding sequence (while containing significant amounts of non-protein-coding sequence), suggesting it is under positive selection. We also classified segments according to conservation and GC content simultaneously. This analysis identified numerous sub-classes of those identified on the basis of conservation alone, but was nevertheless consistent with that classification. Software, data, and results available at www.maths.qut.edu.au/-keithj/. Genomic segments comprising the conservation classes available in BED format.

  16. Phytozome Comparative Plant Genomics Portal

    Energy Technology Data Exchange (ETDEWEB)

    Goodstein, David; Batra, Sajeev; Carlson, Joseph; Hayes, Richard; Phillips, Jeremy; Shu, Shengqiang; Schmutz, Jeremy; Rokhsar, Daniel

    2014-09-09

    The Dept. of Energy Joint Genome Institute is a genomics user facility supporting DOE mission science in the areas of Bioenergy, Carbon Cycling, and Biogeochemistry. The Plant Program at the JGI applies genomic, analytical, computational and informatics platforms and methods to: 1. Understand and accelerate the improvement (domestication) of bioenergy crops 2. Characterize and moderate plant response to climate change 3. Use comparative genomics to identify constrained elements and infer gene function 4. Build high quality genomic resource platforms of JGI Plant Flagship genomes for functional and experimental work 5. Expand functional genomic resources for Plant Flagship genomes

  17. Cre/lox-recombinase-mediated cassette exchange for reversible site-specific genomic targeting of the disease vector, Aedes aegypti

    Science.gov (United States)

    Site-specific genome modification is an important tool for mosquito functional genomics studies that help to uncover gene functions, identify gene regulatory elements, and perform comparative gene expression studies, all of which contribute to a better understanding of mosquito biology and are thus ...

  18. Short and long-term genome stability analysis of prokaryotic genomes.

    Science.gov (United States)

    Brilli, Matteo; Liò, Pietro; Lacroix, Vincent; Sagot, Marie-France

    2013-05-08

    Gene organization dynamics is actively studied because it provides useful evolutionary information, makes functional annotation easier and often enables to characterize pathogens. There is therefore a strong interest in understanding the variability of this trait and the possible correlations with life-style. Two kinds of events affect genome organization: on one hand translocations and recombinations change the relative position of genes shared by two genomes (i.e. the backbone gene order); on the other, insertions and deletions leave the backbone gene order unchanged but they alter the gene neighborhoods by breaking the syntenic regions. A complete picture about genome organization evolution therefore requires to account for both kinds of events. We developed an approach where we model chromosomes as graphs on which we compute different stability estimators; we consider genome rearrangements as well as the effect of gene insertions and deletions. In a first part of the paper, we fit a measure of backbone gene order conservation (hereinafter called backbone stability) against phylogenetic distance for over 3000 genome comparisons, improving existing models for the divergence in time of backbone stability. Intra- and inter-specific comparisons were treated separately to focus on different time-scales. The use of multiple genomes of a same species allowed to identify genomes with diverging gene order with respect to their conspecific. The inter-species analysis indicates that pathogens are more often unstable with respect to non-pathogens. In a second part of the text, we show that in pathogens, gene content dynamics (insertions and deletions) have a much more dramatic effect on genome organization stability than backbone rearrangements. In this work, we studied genome organization divergence taking into account the contribution of both genome order rearrangements and genome content dynamics. By studying species with multiple sequenced genomes available, we were

  19. The perennial ryegrass GenomeZipper: targeted use of genome resources for comparative grass genomics.

    Science.gov (United States)

    Pfeifer, Matthias; Martis, Mihaela; Asp, Torben; Mayer, Klaus F X; Lübberstedt, Thomas; Byrne, Stephen; Frei, Ursula; Studer, Bruno

    2013-02-01

    Whole-genome sequences established for model and major crop species constitute a key resource for advanced genomic research. For outbreeding forage and turf grass species like ryegrasses (Lolium spp.), such resources have yet to be developed. Here, we present a model of the perennial ryegrass (Lolium perenne) genome on the basis of conserved synteny to barley (Hordeum vulgare) and the model grass genome Brachypodium (Brachypodium distachyon) as well as rice (Oryza sativa) and sorghum (Sorghum bicolor). A transcriptome-based genetic linkage map of perennial ryegrass served as a scaffold to establish the chromosomal arrangement of syntenic genes from model grass species. This scaffold revealed a high degree of synteny and macrocollinearity and was then utilized to anchor a collection of perennial ryegrass genes in silico to their predicted genome positions. This resulted in the unambiguous assignment of 3,315 out of 8,876 previously unmapped genes to the respective chromosomes. In total, the GenomeZipper incorporates 4,035 conserved grass gene loci, which were used for the first genome-wide sequence divergence analysis between perennial ryegrass, barley, Brachypodium, rice, and sorghum. The perennial ryegrass GenomeZipper is an ordered, information-rich genome scaffold, facilitating map-based cloning and genome assembly in perennial ryegrass and closely related Poaceae species. It also represents a milestone in describing synteny between perennial ryegrass and fully sequenced model grass genomes, thereby increasing our understanding of genome organization and evolution in the most important temperate forage and turf grass species.

  20. ICSNPathway: identify candidate causal SNPs and pathways from genome-wide association study by one analytical framework.

    Science.gov (United States)

    Zhang, Kunlin; Chang, Suhua; Cui, Sijia; Guo, Liyuan; Zhang, Liuyan; Wang, Jing

    2011-07-01

    Genome-wide association study (GWAS) is widely utilized to identify genes involved in human complex disease or some other trait. One key challenge for GWAS data interpretation is to identify causal SNPs and provide profound evidence on how they affect the trait. Currently, researches are focusing on identification of candidate causal variants from the most significant SNPs of GWAS, while there is lack of support on biological mechanisms as represented by pathways. Although pathway-based analysis (PBA) has been designed to identify disease-related pathways by analyzing the full list of SNPs from GWAS, it does not emphasize on interpreting causal SNPs. To our knowledge, so far there is no web server available to solve the challenge for GWAS data interpretation within one analytical framework. ICSNPathway is developed to identify candidate causal SNPs and their corresponding candidate causal pathways from GWAS by integrating linkage disequilibrium (LD) analysis, functional SNP annotation and PBA. ICSNPathway provides a feasible solution to bridge the gap between GWAS and disease mechanism study by generating hypothesis of SNP → gene → pathway(s). The ICSNPathway server is freely available at http://icsnpathway.psych.ac.cn/.