WorldWideScience

Sample records for identify important genomic

  1. Genes Important for Schizosaccharomyces pombe Meiosis Identified Through a Functional Genomics Screen

    Science.gov (United States)

    Blyth, Julie; Makrantoni, Vasso; Barton, Rachael E.; Spanos, Christos; Rappsilber, Juri; Marston, Adele L.

    2018-01-01

    Meiosis is a specialized cell division that generates gametes, such as eggs and sperm. Errors in meiosis result in miscarriages and are the leading cause of birth defects; however, the molecular origins of these defects remain unknown. Studies in model organisms are beginning to identify the genes and pathways important for meiosis, but the parts list is still poorly defined. Here we present a comprehensive catalog of genes important for meiosis in the fission yeast, Schizosaccharomyces pombe. Our genome-wide functional screen surveyed all nonessential genes for roles in chromosome segregation and spore formation. Novel genes important at distinct stages of the meiotic chromosome segregation and differentiation program were identified. Preliminary characterization implicated three of these genes in centrosome/spindle pole body, centromere, and cohesion function. Our findings represent a near-complete parts list of genes important for meiosis in fission yeast, providing a valuable resource to advance our molecular understanding of meiosis. PMID:29259000

  2. Identifying selectively important amino acid positions associated with alternative habitat environments in fish mitochondrial genomes.

    Science.gov (United States)

    Xia, Jun Hong; Li, Hong Lian; Zhang, Yong; Meng, Zi Ning; Lin, Hao Ran

    2018-05-01

    Fish species inhabitating seawater (SW) or freshwater (FW) habitats have to develop genetic adaptations to alternative environment factors, especially salinity. Functional consequences of the protein variations associated with habitat environments in fish mitochondrial genomes have not yet received much attention. We analyzed 829 complete fish mitochondrial genomes and compared the amino acid differences of 13 mitochondrial protein families between FW and SW fish groups. We identified 47 specificity determining sites (SDS) that associated with FW or SW environments from 12 mitochondrial protein families. Thirty-two (68%) of the SDS sites are hydrophobic, 13 (28%) are neutral, and the remaining sites are acidic or basic. Seven of those SDS from ND1, ND2 and ND5 were scored as probably damaging to the protein structures. Furthermore, phylogenetic tree based Bayes Empirical Bayes analysis also detected 63 positive sites associated with alternative habitat environments across ten mtDNA proteins. These signatures could be important for studying mitochondrial genetic variation relevant to fish physiology and ecology.

  3. Genome-wide association study identified copy number variants important for appendicular lean mass.

    Science.gov (United States)

    Ran, Shu; Liu, Yong-Jun; Zhang, Lei; Pei, Yufang; Yang, Tie-Lin; Hai, Rong; Han, Ying-Ying; Lin, Yong; Tian, Qing; Deng, Hong-Wen

    2014-01-01

    Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM), is a heritable trait. Copy number variation (CNV) is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2) and 3.34×10(-3), respectively). In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2) and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1), which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL) gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.

  4. Genome-wide association study identified copy number variants important for appendicular lean mass.

    Directory of Open Access Journals (Sweden)

    Shu Ran

    Full Text Available Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM, is a heritable trait. Copy number variation (CNV is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2 and 3.34×10(-3, respectively. In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2 and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1, which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.

  5. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L.) Using SLAF-seq.

    Science.gov (United States)

    Xie, Dongwei; Dai, Zhigang; Yang, Zemao; Sun, Jian; Zhao, Debao; Yang, Xue; Zhang, Liguo; Tang, Qing; Su, Jianguang

    2017-01-01

    Flax ( Linum usitatissimum L.) is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq) was employed to perform a genome-wide association study (GWAS) for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP) loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM) and a mixed linear model (MLM) as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  6. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L. Using SLAF-seq

    Directory of Open Access Journals (Sweden)

    Dongwei Xie

    2018-01-01

    Full Text Available Flax (Linum usitatissimum L. is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq was employed to perform a genome-wide association study (GWAS for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM and a mixed linear model (MLM as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  7. Foxtail millet NF-Y families: genome-wide survey and evolution analyses identified two functional genes important in abiotic stresses

    Directory of Open Access Journals (Sweden)

    Zhi-Juan eFeng

    2015-12-01

    Full Text Available It was reported that Nuclear Factor Y (NF-Y genes were involved in abiotic stress in plants. Foxtail millet (Setaria italica, an elite stress tolerant crop, provided an impetus for the investigation of the NF-Y families in abiotic responses. In the present study, a total of 39 NF-Y genes were identified in foxtail millet. Synteny analyses suggested that foxtail millet NF-Y genes had experienced rapid expansion and strong purifying selection during the process of plant evolution. De novo transcriptome assembly of foxtail millet revealed 11 drought up-regulated NF-Y genes. SiNF-YA1 and SiNF-YB8 were highly activated in leaves and/or roots by drought and salt stresses. Abscisic acid (ABA and H2O2 played positive roles in the induction of SiNF-YA1 and SiNF-YB8 under stress treatments. Transient luciferase (LUC expression assays revealed that SiNF-YA1 and SiNF-YB8 could activate the LUC gene driven by the tobacco (Nicotiana tobacam NtERD10, NtLEA5, NtCAT, NtSOD or NtPOD promoter under normal or stress conditions. Overexpression of SiNF-YA1 enhanced drought and salt tolerance by activating stress-related genes NtERD10 and NtCAT1 and by maintaining relatively stable relative water content (RWC and contents of chlorophyll, superoxide dismutase (SOD, peroxidase (POD, catalase (CAT and malondialdehyde (MDA in transgenic lines under stresses. SiNF-YB8 regulated expression of NtSOD, NtPOD, NtLEA5 and NtERD10 and conferred relatively high RWC and chlorophyll contents and low MDA content, resulting in drought and osmotic tolerance in transgenic lines under stresses. Therefore, SiNF-YA1 and SiNF-YB8 could activate stress-related genes and improve physiological traits, resulting in tolerance to abiotic stresses in plants. All these results will facilitate functional characterization of foxtail millet NF-Ys in future studies.

  8. The compact Selaginella genome identifies changes in gene content associated with the evolution of vascular plants

    Energy Technology Data Exchange (ETDEWEB)

    Grigoriev, Igor V.; Banks, Jo Ann; Nishiyama, Tomoaki; Hasebe, Mitsuyasu; Bowman, John L.; Gribskov, Michael; dePamphilis, Claude; Albert, Victor A.; Aono, Naoki; Aoyama, Tsuyoshi; Ambrose, Barbara A.; Ashton, Neil W.; Axtell, Michael J.; Barker, Elizabeth; Barker, Michael S.; Bennetzen, Jeffrey L.; Bonawitz, Nicholas D.; Chapple, Clint; Cheng, Chaoyang; Correa, Luiz Gustavo Guedes; Dacre, Michael; DeBarry, Jeremy; Dreyer, Ingo; Elias, Marek; Engstrom, Eric M.; Estelle, Mark; Feng, Liang; Finet, Cedric; Floyd, Sandra K.; Frommer, Wolf B.; Fujita, Tomomichi; Gramzow, Lydia; Gutensohn, Michael; Harholt, Jesper; Hattori, Mitsuru; Heyl, Alexander; Hirai, Tadayoshi; Hiwatashi, Yuji; Ishikawa, Masaki; Iwata, Mineko; Karol, Kenneth G.; Koehler, Barbara; Kolukisaoglu, Uener; Kubo, Minoru; Kurata, Tetsuya; Lalonde, Sylvie; Li, Kejie; Li, Ying; Litt, Amy; Lyons, Eric; Manning, Gerard; Maruyama, Takeshi; Michael, Todd P.; Mikami, Koji; Miyazaki, Saori; Morinaga, Shin-ichi; Murata, Takashi; Mueller-Roeber, Bernd; Nelson, David R.; Obara, Mari; Oguri, Yasuko; Olmstead, Richard G.; Onodera, Naoko; Petersen, Bent Larsen; Pils, Birgit; Prigge, Michael; Rensing, Stefan A.; Riano-Pachon, Diego Mauricio; Roberts, Alison W.; Sato, Yoshikatsu; Scheller, Henrik Vibe; Schulz, Burkhard; Schulz, Christian; Shakirov, Eugene V.; Shibagaki, Nakako; Shinohara, Naoki; Shippen, Dorothy E.; Sorensen, Iben; Sotooka, Ryo; Sugimoto, Nagisa; Sugita, Mamoru; Sumikawa, Naomi; Tanurdzic, Milos; Theilsen, Gunter; Ulvskov, Peter; Wakazuki, Sachiko; Weng, Jing-Ke; Willats, William W.G.T.; Wipf, Daniel; Wolf, Paul G.; Yang, Lixing; Zimmer, Andreas D.; Zhu, Qihui; Mitros, Therese; Hellsten, Uffe; Loque, Dominique; Otillar, Robert; Salamov, Asaf; Schmutz, Jeremy; Shapiro, Harris; Lindquist, Erika; Lucas, Susan; Rokhsar, Daniel

    2011-04-28

    We report the genome sequence of the nonseed vascular plant, Selaginella moellendorffii, and by comparative genomics identify genes that likely played important roles in the early evolution of vascular plants and their subsequent evolution

  9. TCGA study identifies genomic features of cervical cancer

    Science.gov (United States)

    Investigators with The Cancer Genome Atlas (TCGA) Research Network have identified novel genomic and molecular characteristics of cervical cancer that will aid in subclassification of the disease and may help target therapies that are most appropriate for each patient.

  10. The Importance of identifiers: IWGSC Meeting 20170720

    OpenAIRE

    Haak, Laurel

    2017-01-01

    Presentation by Laure Haak at the 20 July 2017 meeting of the IWGSC, about use of identifiers in connecting researchers, funding, facilities, and publications. Description of approach and initial results of User Facilities and Publications Working Group, and applications for Scientific Collections.

  11. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  12. Computational approaches to identify functional genetic variants in cancer genomes

    DEFF Research Database (Denmark)

    Gonzalez-Perez, Abel; Mustonen, Ville; Reva, Boris

    2013-01-01

    The International Cancer Genome Consortium (ICGC) aims to catalog genomic abnormalities in tumors from 50 different cancer types. Genome sequencing reveals hundreds to thousands of somatic mutations in each tumor but only a minority of these drive tumor progression. We present the result of discu......The International Cancer Genome Consortium (ICGC) aims to catalog genomic abnormalities in tumors from 50 different cancer types. Genome sequencing reveals hundreds to thousands of somatic mutations in each tumor but only a minority of these drive tumor progression. We present the result...... of discussions within the ICGC on how to address the challenge of identifying mutations that contribute to oncogenesis, tumor maintenance or response to therapy, and recommend computational techniques to annotate somatic variants and predict their impact on cancer phenotype....

  13. Identifying artificial selection signals in the chicken genome.

    Directory of Open Access Journals (Sweden)

    Yunlong Ma

    Full Text Available Identifying the signals of artificial selection can contribute to further shaping economically important traits. Here, a chicken 600k SNP-array was employed to detect the signals of artificial selection using 331 individuals from 9 breeds, including Jingfen (JF, Jinghong (JH, Araucanas (AR, White Leghorn (WL, Pekin-Bantam (PB, Shamo (SH, Gallus-Gallus-Spadiceus (GA, Rheinlander (RH and Vorwerkhuhn (VO. Per the population genetic structure, 9 breeds were combined into 5 breed-pools, and a 'two-step' strategy was used to reveal the signals of artificial selection. GA, which has little artificial selection, was defined as the reference population, and a total of 204, 155, 305 and 323 potential artificial selection signals were identified in AR_VO, PB, RH_WL and JH_JF, respectively. We also found signals derived from standing and de-novo genetic variations have contributed to adaptive evolution during artificial selection. Further enrichment analysis suggests that the genomic regions of artificial selection signals harbour genes, including THSR, PTHLH and PMCH, responsible for economic traits, such as fertility, growth and immunization. Overall, this study found a series of genes that contribute to the improvement of chicken breeds and revealed the genetic mechanisms of adaptive evolution, which can be used as fundamental information in future chicken functional genomics study.

  14. Identifying driver mutations in sequenced cancer genomes

    DEFF Research Database (Denmark)

    Raphael, Benjamin J; Dobson, Jason R; Oesper, Layla

    2014-01-01

    High-throughput DNA sequencing is revolutionizing the study of cancer and enabling the measurement of the somatic mutations that drive cancer development. However, the resulting sequencing datasets are large and complex, obscuring the clinically important mutations in a background of errors, nois...... patterns of mutual exclusivity. These techniques, coupled with advances in high-throughput DNA sequencing, are enabling precision medicine approaches to the diagnosis and treatment of cancer....

  15. Utilization of genomic signatures to identify phenotype-specific drugs.

    Directory of Open Access Journals (Sweden)

    Seiichi Mori

    2009-08-01

    Full Text Available Genetic and genomic studies highlight the substantial complexity and heterogeneity of human cancers and emphasize the general lack of therapeutics that can match this complexity. With the goal of expanding opportunities for drug discovery, we describe an approach that makes use of a phenotype-based screen combined with the use of multiple cancer cell lines. In particular, we have used the NCI-60 cancer cell line panel that includes drug sensitivity measures for over 40,000 compounds assayed on 59 independent cells lines. Targets are cancer-relevant phenotypes represented as gene expression signatures that are used to identify cells within the NCI-60 panel reflecting the signature phenotype and then connect to compounds that are selectively active against those cells. As a proof-of-concept, we show that this strategy effectively identifies compounds with selectivity to the RAS or PI3K pathways. We have then extended this strategy to identify compounds that have activity towards cells exhibiting the basal phenotype of breast cancer, a clinically-important breast cancer characterized as ER-, PR-, and Her2- that lacks viable therapeutic options. One of these compounds, Simvastatin, has previously been shown to inhibit breast cancer cell growth in vitro and importantly, has been associated with a reduction in ER-, PR- breast cancer in a clinical study. We suggest that this approach provides a novel strategy towards identification of therapeutic agents based on clinically relevant phenotypes that can augment the conventional strategies of target-based screens.

  16. Genomic Regions Affecting Cheese Making Properties Identified in Danish Holsteins

    DEFF Research Database (Denmark)

    Gregersen, Vivi Raundahl; Bertelsen, Henriette Pasgaard; Poulsen, Nina Aagaard

    The cheese renneting process is affected by a number of factors associated to milk composition and a number of Danish Holsteins has previously been identified to have poor milk coagulation ability. Therefore, the aim of this study was to identify genomic regions affecting the technological...

  17. Genome resource banking of biomedically important laboratory animals.

    Science.gov (United States)

    Agca, Yuksel

    2012-11-01

    Genome resource banking is the systematic collection, storage, and redistribution of biomaterials in an organized, logistical, and secure manner. Genome cryobanks usually contain biomaterials and associated genomic information essential for progression of biomedicine, human health, and research. In that regard, appropriate genome cryobanks could provide essential biomaterials for both current and future research projects in the form of various cell types and tissues, including sperm, oocytes, embryos, embryonic or adult stem cells, induced pluripotent stem cells, and gonadal tissues. In addition to cryobanked germplasm, cryobanking of DNA, serum, blood products, and tissues from scientifically, economically, and ecologically important species has become a common practice. For revitalization of the whole organism, cryopreserved germplasm in conjunction with assisted reproductive technologies, offer a powerful approach for research model management, as well as assisting in animal production for agriculture, conservation, and human reproductive medicine. Recently, many developed and developing countries have allocated substantial resources to establish genome resources banks which are responsible for safeguarding scientifically, economically, and ecologically important wild type, mutant, and transgenic plants, fish, and local livestock breeds, as well as wildlife species. This review is dedicated to the memory of Dr. John K. Critser, who has made profound contributions to the science of cryobiology and establishment of genome research and resources centers for mice, rats, and swine. Emphasis will be given to application of genome resource banks to species with substantial contributions to the advancement of biomedicine and human health. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. Comparative analyses identified species-specific functional roles in oral microbial genomes

    Science.gov (United States)

    Chen, Tsute; Gajare, Prasad; Olsen, Ingar; Dewhirst, Floyd E.

    2017-01-01

    ABSTRACT The advent of next generation sequencing is producing more genomic sequences for various strains of many human oral microbial species and allows for insightful functional comparisons at both intra- and inter-species levels. This study performed in-silico functional comparisons for currently available genomic sequences of major species associated with periodontitis including Aggregatibacter actinomycetemcomitans (AA), Porphyromonas gingivalis (PG), Treponema denticola (TD), and Tannerella forsythia (TF), as well as several cariogenic and commensal streptococcal species. Complete or draft sequences were annotated with the RAST to infer structured functional subsystems for each genome. The subsystems profiles were clustered to groups of functions with similar patterns. Functional enrichment and depletion were evaluated based on hypergeometric distribution to identify subsystems that are unique or missing between two groups of genomes. Unique or missing metabolic pathways and biological functions were identified in different species. For example, components involved in flagellar motility were found only in the motile species TD, as expected, with few exceptions scattered in several streptococcal species, likely associated with chemotaxis. Transposable elements were only found in the two Bacteroidales species PG and TF, and half of the AA genomes. Genes involved in CRISPR were prevalent in most oral species. Furthermore, prophage related subsystems were also commonly found in most species except for PG and Streptococcus mutans, in which very few genomes contain prophage components. Comparisons between pathogenic (P) and nonpathogenic (NP) genomes also identified genes potentially important for virulence. Two such comparisons were performed between AA (P) and several A. aphrophilus (NP) strains, and between S. mutans + S. sobrinus (P) and other oral streptococcal species (NP). This comparative genomics approach can be readily used to identify functions unique to

  19. Identifying Importance-Performance Matrix Analysis (IPMA) of ...

    African Journals Online (AJOL)

    Identifying Importance-Performance Matrix Analysis (IPMA) of intellectual capital and Islamic work ethics in Malaysian SMES. ... capital and Islamic work ethics significantly influenced business performance. ... AJOL African Journals Online.

  20. Genomic suppression subtractive hybridization as a tool to identify differences in mycorrhizal fungal genomes.

    Science.gov (United States)

    Murat, Claude; Zampieri, Elisa; Vallino, Marta; Daghino, Stefania; Perotto, Silvia; Bonfante, Paola

    2011-05-01

    Characterization of genomic variation among different microbial species, or different strains of the same species, is a field of significant interest with a wide range of potential applications. We have investigated the genomic variation in mycorrhizal fungal genomes through genomic suppressive subtractive hybridization. The comparison was between phylogenetically distant and close truffle species (Tuber spp.), and between isolates of the ericoid mycorrhizal fungus Oidiodendron maius featuring different degrees of metal tolerance. In the interspecies experiment, almost all the sequences that were identified in the Tuber melanosporum genome and absent in Tuber borchii and Tuber indicum corresponded to transposable elements. In the intraspecies comparison, some specific sequences corresponded to regions coding for enzymes, among them a glutathione synthetase known to be involved in metal tolerance. This approach is a quick and rather inexpensive tool to develop molecular markers for mycorrhizal fungi tracking and barcoding, to identify functional genes and to investigate the genome plasticity, adaptation and evolution. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  1. Identifying the important factors in simulation models with many factors

    NARCIS (Netherlands)

    Bettonvil, B.; Kleijnen, J.P.C.

    1994-01-01

    Simulation models may have many parameters and input variables (together called factors), while only a few factors are really important (parsimony principle). For such models this paper presents an effective and efficient screening technique to identify and estimate those important factors. The

  2. Identifying elemental genomic track types and representing them uniformly

    Directory of Open Access Journals (Sweden)

    Gundersen Sveinung

    2011-12-01

    Full Text Available Abstract Background With the recent advances and availability of various high-throughput sequencing technologies, data on many molecular aspects, such as gene regulation, chromatin dynamics, and the three-dimensional organization of DNA, are rapidly being generated in an increasing number of laboratories. The variation in biological context, and the increasingly dispersed mode of data generation, imply a need for precise, interoperable and flexible representations of genomic features through formats that are easy to parse. A host of alternative formats are currently available and in use, complicating analysis and tool development. The issue of whether and how the multitude of formats reflects varying underlying characteristics of data has to our knowledge not previously been systematically treated. Results We here identify intrinsic distinctions between genomic features, and argue that the distinctions imply that a certain variation in the representation of features as genomic tracks is warranted. Four core informational properties of tracks are discussed: gaps, lengths, values and interconnections. From this we delineate fifteen generic track types. Based on the track type distinctions, we characterize major existing representational formats and find that the track types are not adequately supported by any single format. We also find, in contrast to the XML formats, that none of the existing tabular formats are conveniently extendable to support all track types. We thus propose two unified formats for track data, an improved XML format, BioXSD 1.1, and a new tabular format, GTrack 1.0. Conclusions The defined track types are shown to capture relevant distinctions between genomic annotation tracks, resulting in varying representational needs and analysis possibilities. The proposed formats, GTrack 1.0 and BioXSD 1.1, cater to the identified track distinctions and emphasize preciseness, flexibility and parsing convenience.

  3. Exploiting genomic data to identify proteins involved in abalone reproduction.

    Science.gov (United States)

    Mendoza-Porras, Omar; Botwright, Natasha A; McWilliam, Sean M; Cook, Mathew T; Harris, James O; Wijffels, Gene; Colgrave, Michelle L

    2014-08-28

    Aside from their critical role in reproduction, abalone gonads serve as an indicator of sexual maturity and energy balance, two key considerations for effective abalone culture. Temperate abalone farmers face issues with tank restocking with highly marketable abalone owing to inefficient spawning induction methods. The identification of key proteins in sexually mature abalone will serve as the foundation for a greater understanding of reproductive biology. Addressing this knowledge gap is the first step towards improving abalone aquaculture methods. Proteomic profiling of female and male gonads of greenlip abalone, Haliotis laevigata, was undertaken using liquid chromatography-mass spectrometry. Owing to the incomplete nature of abalone protein databases, in addition to searching against two publicly available databases, a custom database comprising genomic data was used. Overall, 162 and 110 proteins were identified in females and males respectively with 40 proteins common to both sexes. For proteins involved in sexual maturation, sperm and egg structure, motility, acrosomal reaction and fertilization, 23 were identified only in females, 18 only in males and 6 were common. Gene ontology analysis revealed clear differences between the female and male protein profiles reflecting a higher rate of protein synthesis in the ovary and higher metabolic activity in the testis. A comprehensive mass spectrometry-based analysis was performed to profile the abalone gonad proteome providing the foundation for future studies of reproduction in abalone. Key proteins involved in both reproduction and energy balance were identified. Genomic resources were utilised to build a database of molluscan proteins yielding >60% more protein identifications than in a standard workflow employing public protein databases. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. The FUN of identifying gene function in bacterial pathogens; insights from Salmonella functional genomics.

    Science.gov (United States)

    Hammarlöf, Disa L; Canals, Rocío; Hinton, Jay C D

    2013-10-01

    The availability of thousands of genome sequences of bacterial pathogens poses a particular challenge because each genome contains hundreds of genes of unknown function (FUN). How can we easily discover which FUN genes encode important virulence factors? One solution is to combine two different functional genomic approaches. First, transcriptomics identifies bacterial FUN genes that show differential expression during the process of mammalian infection. Second, global mutagenesis identifies individual FUN genes that the pathogen requires to cause disease. The intersection of these datasets can reveal a small set of candidate genes most likely to encode novel virulence attributes. We demonstrate this approach with the Salmonella infection model, and propose that a similar strategy could be used for other bacterial pathogens. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Integrated genomic and gene expression profiling identifies two major genomic circuits in urothelial carcinoma.

    Directory of Open Access Journals (Sweden)

    David Lindgren

    Full Text Available Similar to other malignancies, urothelial carcinoma (UC is characterized by specific recurrent chromosomal aberrations and gene mutations. However, the interconnection between specific genomic alterations, and how patterns of chromosomal alterations adhere to different molecular subgroups of UC, is less clear. We applied tiling resolution array CGH to 146 cases of UC and identified a number of regions harboring recurrent focal genomic amplifications and deletions. Several potential oncogenes were included in the amplified regions, including known oncogenes like E2F3, CCND1, and CCNE1, as well as new candidate genes, such as SETDB1 (1q21, and BCL2L1 (20q11. We next combined genome profiling with global gene expression, gene mutation, and protein expression data and identified two major genomic circuits operating in urothelial carcinoma. The first circuit was characterized by FGFR3 alterations, overexpression of CCND1, and 9q and CDKN2A deletions. The second circuit was defined by E3F3 amplifications and RB1 deletions, as well as gains of 5p, deletions at PTEN and 2q36, 16q, 20q, and elevated CDKN2A levels. TP53/MDM2 alterations were common for advanced tumors within the two circuits. Our data also suggest a possible RAS/RAF circuit. The tumors with worst prognosis showed a gene expression profile that indicated a keratinized phenotype. Taken together, our integrative approach revealed at least two separate networks of genomic alterations linked to the molecular diversity seen in UC, and that these circuits may reflect distinct pathways of tumor development.

  6. Positive Selection Driving Cytoplasmic Genome Evolution of the Medicinally Important Ginseng Plant Genus Panax.

    Science.gov (United States)

    Jiang, Peng; Shi, Feng-Xue; Li, Ming-Rui; Liu, Bao; Wen, Jun; Xiao, Hong-Xing; Li, Lin-Feng

    2018-01-01

    Panax L. (the ginseng genus) is a shade-demanding group within the family Araliaceae and all of its species are of crucial significance in traditional Chinese medicine. Phylogenetic and biogeographic analyses demonstrated that two rounds of whole genome duplications accompanying with geographic and ecological isolations promoted the diversification of Panax species. However, contributions of the cytoplasmic genomes to the adaptive evolution of Panax species remained largely uninvestigated. In this study, we sequenced the chloroplast and mitochondrial genomes of 11 accessions belonging to seven Panax species. Our results show that heterogeneity in nucleotide substitution rate is abundant in both of the two cytoplasmic genomes, with the mitochondrial genome possessing more variants at the total level but the chloroplast showing higher sequence polymorphisms at the genic regions. Genome-wide scanning of positive selection identified five and 12 genes from the chloroplast and mitochondrial genomes, respectively. Functional analyses further revealed that these selected genes play important roles in plant development, cellular metabolism and adaptation. We therefore conclude that positive selection might be one of the potential evolutionary forces that shaped nucleotide variation pattern of these Panax species. In particular, the mitochondrial genes evolved under stronger selective pressure compared to the chloroplast genes.

  7. Resequencing 50 accessions of cultivated and wild rice yields markers for identifying agronomically important genes

    DEFF Research Database (Denmark)

    Xu, Xun; Liu, Xin; Ge, Song

    2012-01-01

    Rice is a staple crop that has undergone substantial phenotypic and physiological changes during domestication. Here we resequenced the genomes of 40 cultivated accessions selected from the major groups of rice and 10 accessions of their wild progenitors (Oryza rufipogon and Oryza nivara) to >15 x...... diversity in cultivated but not wild rice, which represent candidate regions selected during domestication. Some of these variants are associated with important biological features, whereas others have yet to be functionally characterized. The molecular markers we have identified should be valuable...... raw data coverage. We investigated genome-wide variation patterns in rice and obtained 6.5 million high-quality single nucleotide polymorphisms (SNPs) after excluding sites with missing data in any accession. Using these population SNP data, we identified thousands of genes with significantly lower...

  8. Genomic analysis identifies masqueraders of full-term cerebral palsy.

    Science.gov (United States)

    Takezawa, Yusuke; Kikuchi, Atsuo; Haginoya, Kazuhiro; Niihori, Tetsuya; Numata-Uematsu, Yurika; Inui, Takehiko; Yamamura-Suzuki, Saeko; Miyabayashi, Takuya; Anzai, Mai; Suzuki-Muromoto, Sato; Okubo, Yukimune; Endo, Wakaba; Togashi, Noriko; Kobayashi, Yasuko; Onuma, Akira; Funayama, Ryo; Shirota, Matsuyuki; Nakayama, Keiko; Aoki, Yoko; Kure, Shigeo

    2018-05-01

    Cerebral palsy is a common, heterogeneous neurodevelopmental disorder that causes movement and postural disabilities. Recent studies have suggested genetic diseases can be misdiagnosed as cerebral palsy. We hypothesized that two simple criteria, that is, full-term births and nonspecific brain MRI findings, are keys to extracting masqueraders among cerebral palsy cases due to the following: (1) preterm infants are susceptible to multiple environmental factors and therefore demonstrate an increased risk of cerebral palsy and (2) brain MRI assessment is essential for excluding environmental causes and other particular disorders. A total of 107 patients-all full-term births-without specific findings on brain MRI were identified among 897 patients diagnosed with cerebral palsy who were followed at our center. DNA samples were available for 17 of the 107 cases for trio whole-exome sequencing and array comparative genomic hybridization. We prioritized variants in genes known to be relevant in neurodevelopmental diseases and evaluated their pathogenicity according to the American College of Medical Genetics guidelines. Pathogenic/likely pathogenic candidate variants were identified in 9 of 17 cases (52.9%) within eight genes: CTNNB1 , CYP2U1 , SPAST , GNAO1 , CACNA1A , AMPD2 , STXBP1 , and SCN2A . Five identified variants had previously been reported. No pathogenic copy number variations were identified. The AMPD2 missense variant and the splice-site variants in CTNNB1 and AMPD2 were validated by in vitro functional experiments. The high rate of detecting causative genetic variants (52.9%) suggests that patients diagnosed with cerebral palsy in full-term births without specific MRI findings may include genetic diseases masquerading as cerebral palsy.

  9. Genomic analyses identify molecular subtypes of pancreatic cancer.

    Science.gov (United States)

    Bailey, Peter; Chang, David K; Nones, Katia; Johns, Amber L; Patch, Ann-Marie; Gingras, Marie-Claude; Miller, David K; Christ, Angelika N; Bruxner, Tim J C; Quinn, Michael C; Nourse, Craig; Murtaugh, L Charles; Harliwong, Ivon; Idrisoglu, Senel; Manning, Suzanne; Nourbakhsh, Ehsan; Wani, Shivangi; Fink, Lynn; Holmes, Oliver; Chin, Venessa; Anderson, Matthew J; Kazakoff, Stephen; Leonard, Conrad; Newell, Felicity; Waddell, Nick; Wood, Scott; Xu, Qinying; Wilson, Peter J; Cloonan, Nicole; Kassahn, Karin S; Taylor, Darrin; Quek, Kelly; Robertson, Alan; Pantano, Lorena; Mincarelli, Laura; Sanchez, Luis N; Evers, Lisa; Wu, Jianmin; Pinese, Mark; Cowley, Mark J; Jones, Marc D; Colvin, Emily K; Nagrial, Adnan M; Humphrey, Emily S; Chantrill, Lorraine A; Mawson, Amanda; Humphris, Jeremy; Chou, Angela; Pajic, Marina; Scarlett, Christopher J; Pinho, Andreia V; Giry-Laterriere, Marc; Rooman, Ilse; Samra, Jaswinder S; Kench, James G; Lovell, Jessica A; Merrett, Neil D; Toon, Christopher W; Epari, Krishna; Nguyen, Nam Q; Barbour, Andrew; Zeps, Nikolajs; Moran-Jones, Kim; Jamieson, Nigel B; Graham, Janet S; Duthie, Fraser; Oien, Karin; Hair, Jane; Grützmann, Robert; Maitra, Anirban; Iacobuzio-Donahue, Christine A; Wolfgang, Christopher L; Morgan, Richard A; Lawlor, Rita T; Corbo, Vincenzo; Bassi, Claudio; Rusev, Borislav; Capelli, Paola; Salvia, Roberto; Tortora, Giampaolo; Mukhopadhyay, Debabrata; Petersen, Gloria M; Munzy, Donna M; Fisher, William E; Karim, Saadia A; Eshleman, James R; Hruban, Ralph H; Pilarsky, Christian; Morton, Jennifer P; Sansom, Owen J; Scarpa, Aldo; Musgrove, Elizabeth A; Bailey, Ulla-Maja Hagbo; Hofmann, Oliver; Sutherland, Robert L; Wheeler, David A; Gill, Anthony J; Gibbs, Richard A; Pearson, John V; Waddell, Nicola; Biankin, Andrew V; Grimmond, Sean M

    2016-03-03

    Integrated genomic analysis of 456 pancreatic ductal adenocarcinomas identified 32 recurrently mutated genes that aggregate into 10 pathways: KRAS, TGF-β, WNT, NOTCH, ROBO/SLIT signalling, G1/S transition, SWI-SNF, chromatin modification, DNA repair and RNA processing. Expression analysis defined 4 subtypes: (1) squamous; (2) pancreatic progenitor; (3) immunogenic; and (4) aberrantly differentiated endocrine exocrine (ADEX) that correlate with histopathological characteristics. Squamous tumours are enriched for TP53 and KDM6A mutations, upregulation of the TP63∆N transcriptional network, hypermethylation of pancreatic endodermal cell-fate determining genes and have a poor prognosis. Pancreatic progenitor tumours preferentially express genes involved in early pancreatic development (FOXA2/3, PDX1 and MNX1). ADEX tumours displayed upregulation of genes that regulate networks involved in KRAS activation, exocrine (NR5A2 and RBPJL), and endocrine differentiation (NEUROD1 and NKX2-2). Immunogenic tumours contained upregulated immune networks including pathways involved in acquired immune suppression. These data infer differences in the molecular evolution of pancreatic cancer subtypes and identify opportunities for therapeutic development.

  10. Use of a draft genome of coffee (Coffea arabica) to identify SNPs associated with caffeine content.

    Science.gov (United States)

    Tran, Hue T M; Ramaraj, Thiruvarangan; Furtado, Agnelo; Lee, Leonard Slade; Henry, Robert J

    2018-03-07

    Arabica coffee (Coffea arabica) has a small gene pool limiting genetic improvement. Selection for caffeine content within this gene pool would be assisted by identification of the genes controlling this important trait. Sequencing of DNA bulks from 18 genotypes with extreme high- or low-caffeine content from a population of 232 genotypes was used to identify linked polymorphisms. To obtain a reference genome, a whole genome assembly of arabica coffee (variety K7) was achieved by sequencing using short read (Illumina) and long-read (PacBio) technology. Assembly was performed using a range of assembly tools resulting in 76 409 scaffolds with a scaffold N50 of 54 544 bp and a total scaffold length of 1448 Mb. Validation of the genome assembly using different tools showed high completeness of the genome. More than 99% of transcriptome sequences mapped to the C. arabica draft genome, and 89% of BUSCOs were present. The assembled genome annotated using AUGUSTUS yielded 99 829 gene models. Using the draft arabica genome as reference in mapping and variant calling allowed the detection of 1444 nonsynonymous single nucleotide polymorphisms (SNPs) associated with caffeine content. Based on Kyoto Encyclopaedia of Genes and Genomes pathway-based analysis, 65 caffeine-associated SNPs were discovered, among which 11 SNPs were associated with genes encoding enzymes involved in the conversion of substrates, which participate in the caffeine biosynthesis pathways. This analysis demonstrated the complex genetic control of this key trait in coffee. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  11. Identifying important nodes by adaptive LeaderRank

    Science.gov (United States)

    Xu, Shuang; Wang, Pei

    2017-03-01

    Spreading process is a common phenomenon in complex networks. Identifying important nodes in complex networks is of great significance in real-world applications. Based on the spreading process on networks, a lot of measures have been proposed to evaluate the importance of nodes. However, most of the existing measures are appropriate to static networks, which are fragile to topological perturbations. Many real-world complex networks are dynamic rather than static, meaning that the nodes and edges of such networks may change with time, which challenge numerous existing centrality measures. Based on a new weighted mechanism and the newly proposed H-index and LeaderRank (LR), this paper introduces a variant of the LR measure, called adaptive LeaderRank (ALR), which is a new member of the LR-family. Simulations on six real-world networks reveal that the new measure can well balance between prediction accuracy and robustness. More interestingly, the new measure can better adapt to the adjustment or local perturbations of network topologies, as compared with the existing measures. By discussing the detailed properties of the measures from the LR-family, we illustrate that the ALR has its competitive advantages over the other measures. The proposed algorithm enriches the measures to understand complex networks, and may have potential applications in social networks and biological systems.

  12. Identifying important motivational factors for professionals in Greek hospitals

    Science.gov (United States)

    Kontodimopoulos, Nick; Paleologou, Victoria; Niakas, Dimitris

    2009-01-01

    Background The purpose of this study was to identify important motivational factors according to the views of health-care professionals in Greek hospitals and particularly to determine if these might differ in the public and private sectors. Methods A previously developed -and validated- instrument addressing four work-related motivators (job attributes, remuneration, co-workers and achievements) was used. Three categories of health care professionals, doctors (N = 354), nurses (N = 581) and office workers (N = 418), working in public and private hospitals, participated and motivation was compared across socio-demographic and occupational variables. Results The range of reported motivational factors was mixed and Maslow's conclusions that lower level motivational factors must be met before ascending to the next level were not confirmed. The highest ranked motivator for the entire sample, and by professional subgroup, was achievements (P motivators were similar, and only one significant difference was observed, namely between doctors and nurses in respect to co-workers (P motivated by all factors significantly more than their public-hospital counterparts. Conclusion The results are in agreement with the literature which focuses attention to management approaches employing both monetary and non-monetary incentives to motivate health care workers. This study showed that intrinsic factors are particularly important and should become a target for effective employee motivation. PMID:19754968

  13. Sequencing of bovine herpesvirus 4 v.test strain reveals important genome features

    Directory of Open Access Journals (Sweden)

    Gillet Laurent

    2011-08-01

    Full Text Available Abstract Background Bovine herpesvirus 4 (BoHV-4 is a useful model for the human pathogenic gammaherpesviruses Epstein-Barr virus and Kaposi's Sarcoma-associated Herpesvirus. Although genome manipulations of this virus have been greatly facilitated by the cloning of the BoHV-4 V.test strain as a Bacterial Artificial Chromosome (BAC, the lack of a complete genome sequence for this strain limits its experimental use. Methods In this study, we have determined the complete sequence of BoHV-4 V.test strain by a pyrosequencing approach. Results The long unique coding region (LUR consists of 108,241 bp encoding at least 79 open reading frames and is flanked by several polyrepetitive DNA units (prDNA. As previously suggested, we showed that the prDNA unit located at the left prDNA-LUR junction (prDNA-G differs from the other prDNA units (prDNA-inner. Namely, the prDNA-G unit lacks the conserved pac-2 cleavage and packaging signal in its right terminal region. Based on the mechanisms of cleavage and packaging of herpesvirus genomes, this feature implies that only genomes bearing left and right end prDNA units are encapsulated into virions. Conclusions In this study, we have determined the complete genome sequence of the BAC-cloned BoHV-4 V.test strain and identified genome organization features that could be important in other herpesviruses.

  14. Genome-wide association study identified CNP12587 region underlying height variation in Chinese females.

    Directory of Open Access Journals (Sweden)

    Yin-Ping Zhang

    Full Text Available Human height is a highly heritable trait considered as an important factor for health. There has been limited success in identifying the genetic factors underlying height variation. We aim to identify sequence variants associated with adult height by a genome-wide association study of copy number variants (CNVs in Chinese.Genome-wide CNV association analyses were conducted in 1,625 unrelated Chinese adults and sex specific subgroup for height variation, respectively. Height was measured with a stadiometer. Affymetrix SNP6.0 genotyping platform was used to identify copy number polymorphisms (CNPs. We constructed a genomic map containing 1,009 CNPs in Chinese individuals and performed a genome-wide association study of CNPs with height.We detected 10 significant association signals for height (p<0.05 in the whole population, 9 and 11 association signals for Chinese female and male population, respectively. A copy number polymorphism (CNP12587, chr18:54081842-54086942, p = 2.41 × 10(-4 was found to be significantly associated with height variation in Chinese females even after strict Bonferroni correction (p = 0.048. Confirmatory real time PCR experiments lent further support for CNV validation. Compared to female subjects with two copies of the CNP, carriers of three copies had an average of 8.1% decrease in height. An important candidate gene, ubiquitin-protein ligase NEDD4-like (NEDD4L, was detected at this region, which plays important roles in bone metabolism by binding to bone formation regulators.Our findings suggest the important genetic variants underlying height variation in Chinese.

  15. Novel genomes and genome constitutions identified by GISH and 5S rDNA and knotted1 genomic sequences in the genus Setaria.

    Science.gov (United States)

    Zhao, Meicheng; Zhi, Hui; Doust, Andrew N; Li, Wei; Wang, Yongfang; Li, Haiquan; Jia, Guanqing; Wang, Yongqiang; Zhang, Ning; Diao, Xianmin

    2013-04-11

    The Setaria genus is increasingly of interest to researchers, as its two species, S. viridis and S. italica, are being developed as models for understanding C4 photosynthesis and plant functional genomics. The genome constitution of Setaria species has been studied in the diploid species S. viridis, S. adhaerans and S. grisebachii, where three genomes A, B and C were identified respectively. Two allotetraploid species, S. verticillata and S. faberi, were found to have AABB genomes, and one autotetraploid species, S. queenslandica, with an AAAA genome, has also been identified. The genomes and genome constitutions of most other species remain unknown, even though it was thought there are approximately 125 species in the genus distributed world-wide. GISH was performed to detect the genome constitutions of Eurasia species of S. glauca, S. plicata, and S. arenaria, with the known A, B and C genomes as probes. No or very poor hybridization signal was detected indicating that their genomes are different from those already described. GISH was also performed reciprocally between S. glauca, S. plicata, and S. arenaria genomes, but no hybridization signals between each other were found. The two sets of chromosomes of S. lachnea both hybridized strong signals with only the known C genome of S. grisebachii. Chromosomes of Qing 9, an accession formerly considered as S. viridis, hybridized strong signal only to B genome of S. adherans. Phylogenetic trees constructed with 5S rDNA and knotted1 markers, clearly classify the samples in this study into six clusters, matching the GISH results, and suggesting that the F genome of S. arenaria is basal in the genus. Three novel genomes in the Setaria genus were identified and designated as genome D (S. glauca), E (S. plicata) and F (S. arenaria) respectively. The genome constitution of tetraploid S. lachnea is putatively CCC'C'. Qing 9 is a B genome species indigenous to China and is hypothesized to be a newly identified species. The

  16. Whole-genome sequencing identifies genomic heterogeneity at a nucleotide and chromosomal level in bladder cancer

    Science.gov (United States)

    Morrison, Carl D.; Liu, Pengyuan; Woloszynska-Read, Anna; Zhang, Jianmin; Luo, Wei; Qin, Maochun; Bshara, Wiam; Conroy, Jeffrey M.; Sabatini, Linda; Vedell, Peter; Xiong, Donghai; Liu, Song; Wang, Jianmin; Shen, He; Li, Yinwei; Omilian, Angela R.; Hill, Annette; Head, Karen; Guru, Khurshid; Kunnev, Dimiter; Leach, Robert; Eng, Kevin H.; Darlak, Christopher; Hoeflich, Christopher; Veeranki, Srividya; Glenn, Sean; You, Ming; Pruitt, Steven C.; Johnson, Candace S.; Trump, Donald L.

    2014-01-01

    Using complete genome analysis, we sequenced five bladder tumors accrued from patients with muscle-invasive transitional cell carcinoma of the urinary bladder (TCC-UB) and identified a spectrum of genomic aberrations. In three tumors, complex genotype changes were noted. All three had tumor protein p53 mutations and a relatively large number of single-nucleotide variants (SNVs; average of 11.2 per megabase), structural variants (SVs; average of 46), or both. This group was best characterized by chromothripsis and the presence of subclonal populations of neoplastic cells or intratumoral mutational heterogeneity. Here, we provide evidence that the process of chromothripsis in TCC-UB is mediated by nonhomologous end-joining using kilobase, rather than megabase, fragments of DNA, which we refer to as “stitchers,” to repair this process. We postulate that a potential unifying theme among tumors with the more complex genotype group is a defective replication–licensing complex. A second group (two bladder tumors) had no chromothripsis, and a simpler genotype, WT tumor protein p53, had relatively few SNVs (average of 5.9 per megabase) and only a single SV. There was no evidence of a subclonal population of neoplastic cells. In this group, we used a preclinical model of bladder carcinoma cell lines to study a unique SV (translocation and amplification) of the gene glutamate receptor ionotropic N-methyl D-aspertate as a potential new therapeutic target in bladder cancer. PMID:24469795

  17. New families of human regulatory RNA structures identified by comparative analysis of vertebrate genomes

    DEFF Research Database (Denmark)

    Parker, Brian John; Moltke, Ida; Roth, Adam

    2011-01-01

    a comparative method, EvoFam, for genome-wide identification of families of regulatory RNA structures, based on primary sequence and secondary structure similarity. We apply EvoFam to a 41-way genomic vertebrate alignment. Genome-wide, we identify 220 human, high-confidence families outside protein...

  18. Genome-wide association study identifies five new schizophrenia loci

    NARCIS (Netherlands)

    Ripke, S.; Sanders, A. R.; Kendler, K. S.; Levinson, D. F.; Sklar, P.; Holmans, P. A.; Lin, D. Y.; Duan, J.; Ophoff, R. A.; Andreassen, O. A.; Scolnick, E.; Cichon, S.; St Clair, D.; Corvin, A.; Gurling, H.; Werge, T.; Rujescu, D.; Blackwood, D. H.; Pato, C. N.; Malhotra, A. K.; Purcell, S.; Dudbridge, F.; Neale, B. M.; Rossin, L.; Visscher, P. M.; Posthuma, D.; Ruderfer, D. M.; Fanous, A.; Stefansson, H.; Steinberg, S.; Mowry, B. J.; Golimbet, V.; de Hert, M.; Jonsson, E. G.; Bitter, I.; Pietilainen, O. P.; Collier, D. A.; Tosato, S.; Agartz, I.; Albus, M.; Alexander, M.; Amdur, R. L.; Amin, F.; Bass, N.; Bergen, S. E.; Black, D. W.; Borglum, A. D.; Brown, M. A.; Bruggeman, R.; Buccola, N. G.; Byerley, W. F.; Cahn, W.; Cantor, R. M.; Carr, V. J.; Catts, S. V.; Choudhury, K.; Cloninger, C. R.; Cormican, P.; Craddock, N.; Danoy, P. A.; Datta, S.; de Haan, L.; Demontis, D.; Dikeos, D.; Djurovic, S.; Donnely, P.; Donohoe, G.; Duong, L.; Dwyer, S.; Fink-Jensen, A.; Freedman, R.; Freimer, N. B.; Friedl, M.; Georgieva, L.; Giegling, I.; Gill, M.; Glenthoj, B.; Godard, S.; Hamshere, M.; Hansen, M.; Hartmann, A. M.; Henskens, F. A.; Hougaard, D. M.; Hultman, C. M.; Ingason, A.; Jablensky, A. V.; Jakobsen, K. D.; Jay, M.; Jurgens, G.; Kahn, R. S.; Keller, M. C.; Kenis, G.; Kenny, E.; Kim, Y.; Kirov, G. K.; Konnerth, H.; Konte, B.; Krabbendam, L.; Krasucki, R.; Lasseter, V. K.; Laurent, C.; Lawrence, J.; Lencz, T.; Lerer, F. B.; Liang, K. Y.; Lichtenstein, P.; Lieberman, J. A.; Linszen, D. H.; Lonnqvist, J.; Loughland, C. M.; Maclean, A. W.; Maher, B. S.; Maier, W.; Mallet, J.; Malloy, P.; Mattheisen, M.; Mattingsdal, M.; McGhee, K. A.; McGrath, J. J.; McIntosh, A.; McLean, D. E.; McQuillin, A.; Melle, I.; Michie, P. T.; Milanova, V.; Morris, D. W.; Mors, O.; Mortensen, P. B.; Moskvina, V.; Muglia, P.; Myin-Germeys, I.; Nertney, D. A.; Nestadt, G.; Nielsen, J.; Nikolov, I.; Nordentoft, M.; Norton, N.; Nothen, M. M.; O'Dushlaine, C. T.; Olincy, A.; Olsen, L.; O'Neill, F. A.; Orntoft, T. F.; Owen, M. J.; Pantelis, C.; Papadimitriou, G.; Pato, M. T.; Peltonen, L.; Petursson, H.; Pickard, B.; Pimm, J.; Pulver, A. E.; Puri, V.; Quested, D.; Quinn, E. M.; Rasmussen, H. B.; Rethelyi, J. M.; Ribble, R.; Rietschel, M.; Riley, B. P.; Ruggeri, M.; Schall, U.; Schulze, T. G.; Schwab, S. G.; Scott, R. J.; Shi, J.; Sigurdsson, E.; Silvermann, J. M.; Spencer, C. C.; Stefansson, K.; Strange, A.; Strengman, E.; Stroup, T. S.; Suvisaari, J.; Terenius, L.; Thirumalai, S.; Thygesen, J. H.; Timm, S.; Toncheva, D.; van den Oord, E.; van Os, J.; van Winkel, R.; Veldink, J.; Walsh, D.; Wang, A. G.; Wiersma, D.; Wildenauer, D. B.; Williams, H. J.; Williams, N. M.; Wormley, B.; Zammit, S.; Sullivan, P. F.; O'Donovan, M. C.; Daly, M. J.; Gejman, P. V.

    2011-01-01

    We examined the role of common genetic variation in schizophrenia in a genome-wide association study of substantial size: a stage 1 discovery sample of 21,856 individuals of European ancestry and a stage 2 replication sample of 29,839 independent subjects. The combined stage 1 and 2 analysis yielded

  19. Genome-wide association study identifies five new schizophrenia loci.

    LENUS (Irish Health Repository)

    Ripke, Stephan

    2011-10-01

    We examined the role of common genetic variation in schizophrenia in a genome-wide association study of substantial size: a stage 1 discovery sample of 21,856 individuals of European ancestry and a stage 2 replication sample of 29,839 independent subjects. The combined stage 1 and 2 analysis yielded genome-wide significant associations with schizophrenia for seven loci, five of which are new (1p21.3, 2q32.3, 8p23.2, 8q21.3 and 10q24.32-q24.33) and two of which have been previously implicated (6p21.32-p22.1 and 18q21.2). The strongest new finding (P = 1.6 × 10(-11)) was with rs1625579 within an intron of a putative primary transcript for MIR137 (microRNA 137), a known regulator of neuronal development. Four other schizophrenia loci achieving genome-wide significance contain predicted targets of MIR137, suggesting MIR137-mediated dysregulation as a previously unknown etiologic mechanism in schizophrenia. In a joint analysis with a bipolar disorder sample (16,374 affected individuals and 14,044 controls), three loci reached genome-wide significance: CACNA1C (rs4765905, P = 7.0 × 10(-9)), ANK3 (rs10994359, P = 2.5 × 10(-8)) and the ITIH3-ITIH4 region (rs2239547, P = 7.8 × 10(-9)).

  20. MVisAGe Identifies Concordant and Discordant Genomic Alterations of Driver Genes in Squamous Tumors.

    Science.gov (United States)

    Walter, Vonn; Du, Ying; Danilova, Ludmila; Hayward, Michele C; Hayes, D Neil

    2018-06-15

    Integrated analyses of multiple genomic datatypes are now common in cancer profiling studies. Such data present opportunities for numerous computational experiments, yet analytic pipelines are limited. Tools such as the cBioPortal and Regulome Explorer, although useful, are not easy to access programmatically or to implement locally. Here, we introduce the MVisAGe R package, which allows users to quantify gene-level associations between two genomic datatypes to investigate the effect of genomic alterations (e.g., DNA copy number changes on gene expression). Visualizing Pearson/Spearman correlation coefficients according to the genomic positions of the underlying genes provides a powerful yet novel tool for conducting exploratory analyses. We demonstrate its utility by analyzing three publicly available cancer datasets. Our approach highlights canonical oncogenes in chr11q13 that displayed the strongest associations between expression and copy number, including CCND1 and CTTN , genes not identified by copy number analysis in the primary reports. We demonstrate highly concordant usage of shared oncogenes on chr3q, yet strikingly diverse oncogene usage on chr11q as a function of HPV infection status. Regions of chr19 that display remarkable associations between methylation and gene expression were identified, as were previously unreported miRNA-gene expression associations that may contribute to the epithelial-to-mesenchymal transition. Significance: This study presents an important bioinformatics tool that will enable integrated analyses of multiple genomic datatypes. Cancer Res; 78(12); 3375-85. ©2018 AACR . ©2018 American Association for Cancer Research.

  1. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae

    Directory of Open Access Journals (Sweden)

    Seong Hwan Park

    2013-01-01

    Full Text Available Identifying species of insects used to estimate postmortem interval (PMI is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science.

  2. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae)

    Science.gov (United States)

    Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon

    2013-01-01

    Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044

  3. Identifying important parameters for a continuous bioscouring process

    NARCIS (Netherlands)

    Lenting, H.B.M.; Lenting, H.B.M.; Zwier, E.; Nierstrasz, Vincent

    2002-01-01

    Compared to a bioscouring process in the batch mode, a continuously operating process requires relatively short processing steps. This study focusses on minimizing the required enzymatic incubation time. It is clear that the presence of a sufficient level of surfactant is of major importance in

  4. My sister's keeper?: genomic research and the identifiability of siblings

    Directory of Open Access Journals (Sweden)

    Kohane Isaac S

    2008-07-01

    Full Text Available Abstract Background Genomic sequencing of SNPs is increasingly prevalent, though the amount of familial information these data contain has not been quantified. Methods We provide a framework for measuring the risk to siblings of a patient's SNP genotype disclosure, and demonstrate that sibling SNP genotypes can be inferred with substantial accuracy. Results Extending this inference technique, we determine that a very low number of matches at commonly varying SNPs is sufficient to confirm sib-ship, demonstrating that published sequence data can reliably be used to derive sibling identities. Using HapMap trio data, at SNPs where one child is homozygotic major, with a minor allele frequency ≤ 0.20, (N = 452684, 65.1% we achieve 91.9% inference accuracy for sibling genotypes. Conclusion These findings demonstrate that substantial discrimination and privacy risks arise from use of inferred familial genomic data.

  5. A Drosophila Genome-Wide Screen Identifies Regulators of Steroid Hormone Production and Developmental Timing

    DEFF Research Database (Denmark)

    Thomas Danielsen, E.; E. Møller, Morten; Yamanaka, Naoki

    2016-01-01

    Steroid hormones control important developmental processes and are linked to many diseases. To systematically identify genes and pathways required for steroid production, we performed a Drosophila genome-wide in vivo RNAi screen and identified 1,906 genes with potential roles in steroidogenesis...... and developmental timing. Here, we use our screen as a resource to identify mechanisms regulating intracellular levels of cholesterol, a substrate for steroidogenesis. We identify a conserved fatty acid elongase that underlies a mechanism that adjusts cholesterol trafficking and steroidogenesis with nutrition...... and developmental programs. In addition, we demonstrate the existence of an autophagosomal cholesterol mobilization mechanism and show that activation of this system rescues Niemann-Pick type C1 deficiency that causes a disorder characterized by cholesterol accumulation. These cholesterol-trafficking mechanisms...

  6. Mining genome sequencing data to identify the genomic features linked to breast cancer histopathology

    Science.gov (United States)

    Ping, Zheng; Siegal, Gene P.; Almeida, Jonas S.; Schnitt, Stuart J.; Shen, Dejun

    2014-01-01

    Background: Genetics and genomics have radically altered our understanding of breast cancer progression. However, the genomic basis of various histopathologic features of breast cancer is not yet well-defined. Materials and Methods: The Cancer Genome Atlas (TCGA) is an international database containing a large collection of human cancer genome sequencing data. cBioPortal is a web tool developed for mining these sequencing data. We performed mining of TCGA sequencing data in an attempt to characterize the genomic features correlated with breast cancer histopathology. We first assessed the quality of the TCGA data using a group of genes with known alterations in various cancers. Both genome-wide gene mutation and copy number changes as well as a group of genes with a high frequency of genetic changes were then correlated with various histopathologic features of invasive breast cancer. Results: Validation of TCGA data using a group of genes with known alterations in breast cancer suggests that the TCGA has accurately documented the genomic abnormalities of multiple malignancies. Further analysis of TCGA breast cancer sequencing data shows that accumulation of specific genomic defects is associated with higher tumor grade, larger tumor size and receptor negativity. Distinct groups of genomic changes were found to be associated with the different grades of invasive ductal carcinoma. The mutator role of the TP53 gene was validated by genomic sequencing data of invasive breast cancer and TP53 mutation was found to play a critical role in defining high tumor grade. Conclusions: Data mining of the TCGA genome sequencing data is an innovative and reliable method to help characterize the genomic abnormalities associated with histopathologic features of invasive breast cancer. PMID:24672738

  7. Mining genome sequencing data to identify the genomic features linked to breast cancer histopathology

    Directory of Open Access Journals (Sweden)

    Zheng Ping

    2014-01-01

    Full Text Available Background: Genetics and genomics have radically altered our understanding of breast cancer progression. However, the genomic basis of various histopathologic features of breast cancer is not yet well-defined. Materials and Methods: The Cancer Genome Atlas (TCGA is an international database containing a large collection of human cancer genome sequencing data. cBioPortal is a web tool developed for mining these sequencing data. We performed mining of TCGA sequencing data in an attempt to characterize the genomic features correlated with breast cancer histopathology. We first assessed the quality of the TCGA data using a group of genes with known alterations in various cancers. Both genome-wide gene mutation and copy number changes as well as a group of genes with a high frequency of genetic changes were then correlated with various histopathologic features of invasive breast cancer. Results: Validation of TCGA data using a group of genes with known alterations in breast cancer suggests that the TCGA has accurately documented the genomic abnormalities of multiple malignancies. Further analysis of TCGA breast cancer sequencing data shows that accumulation of specific genomic defects is associated with higher tumor grade, larger tumor size and receptor negativity. Distinct groups of genomic changes were found to be associated with the different grades of invasive ductal carcinoma. The mutator role of the TP53 gene was validated by genomic sequencing data of invasive breast cancer and TP53 mutation was found to play a critical role in defining high tumor grade. Conclusions: Data mining of the TCGA genome sequencing data is an innovative and reliable method to help characterize the genomic abnormalities associated with histopathologic features of invasive breast cancer.

  8. Genomes2Drugs: identifies target proteins and lead drugs from proteome data.

    LENUS (Irish Health Repository)

    Toomey, David

    2009-01-01

    BACKGROUND: Genome sequencing and bioinformatics have provided the full hypothetical proteome of many pathogenic organisms. Advances in microarray and mass spectrometry have also yielded large output datasets of possible target proteins\\/genes. However, the challenge remains to identify new targets for drug discovery from this wealth of information. Further analysis includes bioinformatics and\\/or molecular biology tools to validate the findings. This is time consuming and expensive, and could fail to yield novel drugs if protein purification and crystallography is impossible. To pre-empt this, a researcher may want to rapidly filter the output datasets for proteins that show good homology to proteins that have already been structurally characterised or proteins that are already targets for known drugs. Critically, those researchers developing novel antibiotics need to select out the proteins that show close homology to any human proteins, as future inhibitors are likely to cross-react with the host protein, causing off-target toxicity effects later in clinical trials. METHODOLOGY\\/PRINCIPAL FINDINGS: To solve many of these issues, we have developed a free online resource called Genomes2Drugs which ranks sequences to identify proteins that are (i) homologous to previously crystallized proteins or (ii) targets of known drugs, but are (iii) not homologous to human proteins. When tested using the Plasmodium falciparum malarial genome the program correctly enriched the ranked list of proteins with known drug target proteins. CONCLUSIONS\\/SIGNIFICANCE: Genomes2Drugs rapidly identifies proteins that are likely to succeed in drug discovery pipelines. This free online resource helps in the identification of potential drug targets. Importantly, the program further highlights proteins that are likely to be inhibited by FDA-approved drugs. These drugs can then be rapidly moved into Phase IV clinical studies under \\'change-of-application\\' patents.

  9. Genomes2Drugs: identifies target proteins and lead drugs from proteome data.

    Directory of Open Access Journals (Sweden)

    David Toomey

    Full Text Available BACKGROUND: Genome sequencing and bioinformatics have provided the full hypothetical proteome of many pathogenic organisms. Advances in microarray and mass spectrometry have also yielded large output datasets of possible target proteins/genes. However, the challenge remains to identify new targets for drug discovery from this wealth of information. Further analysis includes bioinformatics and/or molecular biology tools to validate the findings. This is time consuming and expensive, and could fail to yield novel drugs if protein purification and crystallography is impossible. To pre-empt this, a researcher may want to rapidly filter the output datasets for proteins that show good homology to proteins that have already been structurally characterised or proteins that are already targets for known drugs. Critically, those researchers developing novel antibiotics need to select out the proteins that show close homology to any human proteins, as future inhibitors are likely to cross-react with the host protein, causing off-target toxicity effects later in clinical trials. METHODOLOGY/PRINCIPAL FINDINGS: To solve many of these issues, we have developed a free online resource called Genomes2Drugs which ranks sequences to identify proteins that are (i homologous to previously crystallized proteins or (ii targets of known drugs, but are (iii not homologous to human proteins. When tested using the Plasmodium falciparum malarial genome the program correctly enriched the ranked list of proteins with known drug target proteins. CONCLUSIONS/SIGNIFICANCE: Genomes2Drugs rapidly identifies proteins that are likely to succeed in drug discovery pipelines. This free online resource helps in the identification of potential drug targets. Importantly, the program further highlights proteins that are likely to be inhibited by FDA-approved drugs. These drugs can then be rapidly moved into Phase IV clinical studies under 'change-of-application' patents.

  10. A landscape ecology approach identifies important drivers of urban biodiversity.

    Science.gov (United States)

    Turrini, Tabea; Knop, Eva

    2015-04-01

    Cities are growing rapidly worldwide, yet a mechanistic understanding of the impact of urbanization on biodiversity is lacking. We assessed the impact of urbanization on arthropod diversity (species richness and evenness) and abundance in a study of six cities and nearby intensively managed agricultural areas. Within the urban ecosystem, we disentangled the relative importance of two key landscape factors affecting biodiversity, namely the amount of vegetated area and patch isolation. To do so, we a priori selected sites that independently varied in the amount of vegetated area in the surrounding landscape at the 500-m scale and patch isolation at the 100-m scale, and we hold local patch characteristics constant. As indicator groups, we used bugs, beetles, leafhoppers, and spiders. Compared to intensively managed agricultural ecosystems, urban ecosystems supported a higher abundance of most indicator groups, a higher number of bug species, and a lower evenness of bug and beetle species. Within cities, a high amount of vegetated area increased species richness and abundance of most arthropod groups, whereas evenness showed no clear pattern. Patch isolation played only a limited role in urban ecosystems, which contrasts findings from agro-ecological studies. Our results show that urban areas can harbor a similar arthropod diversity and abundance compared to intensively managed agricultural ecosystems. Further, negative consequences of urbanization on arthropod diversity can be mitigated by providing sufficient vegetated space in the urban area, while patch connectivity is less important in an urban context. This highlights the need for applying a landscape ecological approach to understand the mechanisms shaping urban biodiversity and underlines the potential of appropriate urban planning for mitigating biodiversity loss. © 2015 John Wiley & Sons Ltd.

  11. Identifying Statistical Dependence in Genomic Sequences via Mutual Information Estimates

    Directory of Open Access Journals (Sweden)

    Wojciech Szpankowski

    2007-12-01

    Full Text Available Questions of understanding and quantifying the representation and amount of information in organisms have become a central part of biological research, as they potentially hold the key to fundamental advances. In this paper, we demonstrate the use of information-theoretic tools for the task of identifying segments of biomolecules (DNA or RNA that are statistically correlated. We develop a precise and reliable methodology, based on the notion of mutual information, for finding and extracting statistical as well as structural dependencies. A simple threshold function is defined, and its use in quantifying the level of significance of dependencies between biological segments is explored. These tools are used in two specific applications. First, they are used for the identification of correlations between different parts of the maize zmSRp32 gene. There, we find significant dependencies between the 5′ untranslated region in zmSRp32 and its alternatively spliced exons. This observation may indicate the presence of as-yet unknown alternative splicing mechanisms or structural scaffolds. Second, using data from the FBI's combined DNA index system (CODIS, we demonstrate that our approach is particularly well suited for the problem of discovering short tandem repeats—an application of importance in genetic profiling.

  12. EG-13GENOME-WIDE METHYLATION ANALYSIS IDENTIFIES GENOMIC DNA DEMETHYLATION DURING MALIGNANT PROGRESSION OF GLIOMAS

    Science.gov (United States)

    Saito, Kuniaki; Mukasa, Akitake; Nagae, Genta; Aihara, Koki; Otani, Ryohei; Takayanagi, Shunsaku; Omata, Mayu; Tanaka, Shota; Shibahara, Junji; Takahashi, Miwako; Momose, Toshimitsu; Shimamura, Teppei; Miyano, Satoru; Narita, Yoshitaka; Ueki, Keisuke; Nishikawa, Ryo; Nagane, Motoo; Aburatani, Hiroyuki; Saito, Nobuhito

    2014-01-01

    Low-grade gliomas often undergo malignant progression, and these transformations are a leading cause of death in patients with low-grade gliomas. However, the molecular mechanisms underlying malignant tumor progression are still not well understood. Recent evidence indicates that epigenetic deregulation is an important cause of gliomagenesis; therefore, we examined the impact of epigenetic changes during malignant progression of low-grade gliomas. Specifically, we used the Illumina Infinium Human Methylation 450K BeadChip to perform genome-wide DNA methylation analysis of 120 gliomas and four normal brains. This study sample included 25 matched-pairs of initial low-grade gliomas and recurrent tumors (temporal heterogeneity) and 20 of the 25 recurring tumors recurred as malignant progressions, and one matched-pair of newly emerging malignant lesions and pre-existing lesions (spatial heterogeneity). Analyses of methylation profiles demonstrated that most low-grade gliomas in our sample (43/51; 84%) had a CpG island methylator phenotype (G-CIMP). Remarkably, approximately 50% of secondary glioblastomas that had progressed from low-grade tumors with the G-CIMP status exhibited a characteristic partial demethylation of genomic DNA during malignant progression, but other recurrent gliomas showed no apparent change in DNA methylation pattern. Interestingly, we found that most loci that were demethylated during malignant progression were located outside of CpG islands. The information of histone modifications patterns in normal human astrocytes and embryonal stem cells also showed that the ratio of active marks at the site corresponding to DNA demethylated loci in G-CIMP-demethylated tumors was significantly lower; this finding indicated that most demethylated loci in G-CIMP-demethylated tumors were likely transcriptionally inactive. A small number of the genes that were upregulated and had demethylated CpG islands were associated with cell cycle-related pathway. In

  13. Machine Learning Leveraging Genomes from Metagenomes Identifies Influential Antibiotic Resistance Genes in the Infant Gut Microbiome

    Science.gov (United States)

    Olm, Matthew R.; Morowitz, Michael J.

    2018-01-01

    ABSTRACT Antibiotic resistance in pathogens is extensively studied, and yet little is known about how antibiotic resistance genes of typical gut bacteria influence microbiome dynamics. Here, we leveraged genomes from metagenomes to investigate how genes of the premature infant gut resistome correspond to the ability of bacteria to survive under certain environmental and clinical conditions. We found that formula feeding impacts the resistome. Random forest models corroborated by statistical tests revealed that the gut resistome of formula-fed infants is enriched in class D beta-lactamase genes. Interestingly, Clostridium difficile strains harboring this gene are at higher abundance in formula-fed infants than C. difficile strains lacking this gene. Organisms with genes for major facilitator superfamily drug efflux pumps have higher replication rates under all conditions, even in the absence of antibiotic therapy. Using a machine learning approach, we identified genes that are predictive of an organism’s direction of change in relative abundance after administration of vancomycin and cephalosporin antibiotics. The most accurate results were obtained by reducing annotated genomic data to five principal components classified by boosted decision trees. Among the genes involved in predicting whether an organism increased in relative abundance after treatment are those that encode subclass B2 beta-lactamases and transcriptional regulators of vancomycin resistance. This demonstrates that machine learning applied to genome-resolved metagenomics data can identify key genes for survival after antibiotics treatment and predict how organisms in the gut microbiome will respond to antibiotic administration. IMPORTANCE The process of reconstructing genomes from environmental sequence data (genome-resolved metagenomics) allows unique insight into microbial systems. We apply this technique to investigate how the antibiotic resistance genes of bacteria affect their ability to

  14. Comparison of genome-wide selection strategies to identify furfural tolerance genes in Escherichia coli.

    Science.gov (United States)

    Glebes, Tirzah Y; Sandoval, Nicholas R; Gillis, Jacob H; Gill, Ryan T

    2015-01-01

    Engineering both feedstock and product tolerance is important for transitioning towards next-generation biofuels derived from renewable sources. Tolerance to chemical inhibitors typically results in complex phenotypes, for which multiple genetic changes must often be made to confer tolerance. Here, we performed a genome-wide search for furfural-tolerant alleles using the TRackable Multiplex Recombineering (TRMR) method (Warner et al. (2010), Nature Biotechnology), which uses chromosomally integrated mutations directed towards increased or decreased expression of virtually every gene in Escherichia coli. We employed various growth selection strategies to assess the role of selection design towards growth enrichments. We also compared genes with increased fitness from our TRMR selection to those from a previously reported genome-wide identification study of furfural tolerance genes using a plasmid-based genomic library approach (Glebes et al. (2014) PLOS ONE). In several cases, growth improvements were observed for the chromosomally integrated promoter/RBS mutations but not for the plasmid-based overexpression constructs. Through this assessment, four novel tolerance genes, ahpC, yhjH, rna, and dicA, were identified and confirmed for their effect on improving growth in the presence of furfural. © 2014 Wiley Periodicals, Inc.

  15. 4C-ker: A Method to Reproducibly Identify Genome-Wide Interactions Captured by 4C-Seq Experiments.

    Science.gov (United States)

    Raviram, Ramya; Rocha, Pedro P; Müller, Christian L; Miraldi, Emily R; Badri, Sana; Fu, Yi; Swanzey, Emily; Proudhon, Charlotte; Snetkova, Valentina; Bonneau, Richard; Skok, Jane A

    2016-03-01

    4C-Seq has proven to be a powerful technique to identify genome-wide interactions with a single locus of interest (or "bait") that can be important for gene regulation. However, analysis of 4C-Seq data is complicated by the many biases inherent to the technique. An important consideration when dealing with 4C-Seq data is the differences in resolution of signal across the genome that result from differences in 3D distance separation from the bait. This leads to the highest signal in the region immediately surrounding the bait and increasingly lower signals in far-cis and trans. Another important aspect of 4C-Seq experiments is the resolution, which is greatly influenced by the choice of restriction enzyme and the frequency at which it can cut the genome. Thus, it is important that a 4C-Seq analysis method is flexible enough to analyze data generated using different enzymes and to identify interactions across the entire genome. Current methods for 4C-Seq analysis only identify interactions in regions near the bait or in regions located in far-cis and trans, but no method comprehensively analyzes 4C signals of different length scales. In addition, some methods also fail in experiments where chromatin fragments are generated using frequent cutter restriction enzymes. Here, we describe 4C-ker, a Hidden-Markov Model based pipeline that identifies regions throughout the genome that interact with the 4C bait locus. In addition, we incorporate methods for the identification of differential interactions in multiple 4C-seq datasets collected from different genotypes or experimental conditions. Adaptive window sizes are used to correct for differences in signal coverage in near-bait regions, far-cis and trans chromosomes. Using several datasets, we demonstrate that 4C-ker outperforms all existing 4C-Seq pipelines in its ability to reproducibly identify interaction domains at all genomic ranges with different resolution enzymes.

  16. PCR-RFLP Method to Identify Salmonid Species of Economic Importance

    Directory of Open Access Journals (Sweden)

    Andreea Dudu

    2011-05-01

    Full Text Available The identification of different fish species by molecular methods has become necessary to avoid both the incorrect labelling of individuals involved in repopulation programmes and the commercial frauds on the fish market. Different fish species of great economical importance, like the salmonids, which are very much requested for their meat, can be identified using molecular techniques such as PCR-RFLP. The method is based on the amplification of a target region from the genome by PCR reaction followed by endonucleases digestion to detect the polymorphism of restriction fragments. In our study we analysed the following salmonid species from Romania: Salmo trutta fario, Salmo labrax, Salvelinus fontinalis, Onchorhynchus mykiss, Thymallus thymallus and Hucho hucho. In order to discriminate between the analysed species we amplified a fragment of mitochondrial genome comprising tRNAGlu/ cytochrome b/ tRNAThr/ tRNAPro/ D-loop/ tRNAPhe, followed by digestion with a specific restriction enzyme. The direct digestion of unpurified PCR products generated species-specific restriction patterns and proved to be a simple, reliable, inexpensive and fast method. Thus, it may be successfully utilized in specialized laboratories for the correct identification of the fish species for multiple purposes, including the traceability of fish food products.

  17. In Silico Post Genome-Wide Association Studies Analysis of C-Reactive Protein Loci Suggests an Important Role for Interferons

    NARCIS (Netherlands)

    Vaez, Ahmad; Jansen, Rick; Prins, Bram P.; Hottenga, Jouke-Jan; de Geus, Eco J. C.; Boomsma, Dorret I.; Penninx, Brenda W. J. H.; Nolte, Ilja M.; Snieder, Harold; Alizadeh, Behrooz Z.

    Background Genome-wide association studies (GWASs) have successfully identified several single nucleotide polymorphisms (SNPs) associated with serum levels of C-reactive protein (CRP). An important limitation of GWASs is that the identified variants merely flag the nearby genomic region and do not

  18. In Silico Post Genome-Wide Association Studies Analysis of C-Reactive Protein Loci Suggests an Important Role for Interferons

    NARCIS (Netherlands)

    Vaez, A.; Jansen, R.; Prins, B.P.; Hottenga, J.J.; de Geus, E.J.C.; Boomsma, D.I.; Penninx, B.W.J.H.; Nolte, I.M.; Snieder, H.; Alizadeh, BZ

    2015-01-01

    Background - Genome-wide association studies (GWASs) have successfully identified several single nucleotide polymorphisms (SNPs) associated with serum levels of C-reactive protein (CRP). An important limitation of GWASs is that the identified variants merely flag the nearby genomic region and do not

  19. Harnessing genomics to identify environmental determinants of heritable disease

    Science.gov (United States)

    Yauk, Carole Lyn; Argueso, J. Lucas; Auerbach, Scott S.; Awadalla, Philip; Davis, Sean R.; DeMarini, David M.; Douglas, George R.; Dubrova, Yuri E.; Elespuru, Rosalie K.; Glover, Thomas W.; Hales, Barbara F.; Hurles, Matthew E.; Klein, Catherine B.; Lupski, James R.; Manchester, David K.; Marchetti, Francesco; Montpetit, Alexandre; Mulvihill, John J.; Robaire, Bernard; Robbins, Wendie A.; Rouleau, Guy A.; Shaughnessy, Daniel T.; Somers, Christopher M.; Taylor, James G.; Trasler, Jacquetta; Waters, Michael D.; Wilson, Thomas E.; Witt, Kristine L.; Bishop, Jack B.

    2012-01-01

    Next-generation sequencing technologies can now be used to directly measure heritable de novo DNA sequence mutations in humans. However, these techniques have not been used to examine environmental factors that induce such mutations and their associated diseases. To address this issue, a working group on environmentally induced germline mutation analysis (ENIGMA) met in October 2011 to propose the necessary foundational studies, which include sequencing of parent–offspring trios from highly exposed human populations, and controlled dose–response experiments in animals. These studies will establish background levels of variability in germline mutation rates and identify environmental agents that influence these rates and heritable disease. Guidance for the types of exposures to examine come from rodent studies that have identified agents such as cancer chemotherapeutic drugs, ionizing radiation, cigarette smoke, and air pollution as germ-cell mutagens. Research is urgently needed to establish the health consequences of parental exposures on subsequent generations. PMID:22935230

  20. Evaluation of multiple approaches to identify genome-wide polymorphisms in closely related genotypes of sweet cherry (Prunus avium L.

    Directory of Open Access Journals (Sweden)

    Seanna Hewitt

    Full Text Available Identification of genetic polymorphisms and subsequent development of molecular markers is important for marker assisted breeding of superior cultivars of economically important species. Sweet cherry (Prunus avium L. is an economically important non-climacteric tree fruit crop in the Rosaceae family and has undergone a genetic bottleneck due to breeding, resulting in limited genetic diversity in the germplasm that is utilized for breeding new cultivars. Therefore, it is critical to recognize the best platforms for identifying genome-wide polymorphisms that can help identify, and consequently preserve, the diversity in a genetically constrained species. For the identification of polymorphisms in five closely related genotypes of sweet cherry, a gel-based approach (TRAP, reduced representation sequencing (TRAPseq, a 6k cherry SNParray, and whole genome sequencing (WGS approaches were evaluated in the identification of genome-wide polymorphisms in sweet cherry cultivars. All platforms facilitated detection of polymorphisms among the genotypes with variable efficiency. In assessing multiple SNP detection platforms, this study has demonstrated that a combination of appropriate approaches is necessary for efficient polymorphism identification, especially between closely related cultivars of a species. The information generated in this study provides a valuable resource for future genetic and genomic studies in sweet cherry, and the insights gained from the evaluation of multiple approaches can be utilized for other closely related species with limited genetic diversity in the breeding germplasm. Keywords: Polymorphisms, Prunus avium, Next-generation sequencing, Target region amplification polymorphism (TRAP, Genetic diversity, SNParray, Reduced representation sequencing, Whole genome sequencing (WGS

  1. Comparative genomics of 12 strains of Erwinia amylovora identifies a pan-genome with a large conserved core.

    Directory of Open Access Journals (Sweden)

    Rachel A Mann

    Full Text Available The plant pathogen Erwinia amylovora can be divided into two host-specific groupings; strains infecting a broad range of hosts within the Rosaceae subfamily Spiraeoideae (e.g., Malus, Pyrus, Crataegus, Sorbus and strains infecting Rubus (raspberries and blackberries. Comparative genomic analysis of 12 strains representing distinct populations (e.g., geographic, temporal, host origin of E. amylovora was used to describe the pan-genome of this major pathogen. The pan-genome contains 5751 coding sequences and is highly conserved relative to other phytopathogenic bacteria comprising on average 89% conserved, core genes. The chromosomes of Spiraeoideae-infecting strains were highly homogeneous, while greater genetic diversity was observed between Spiraeoideae- and Rubus-infecting strains (and among individual Rubus-infecting strains, the majority of which was attributed to variable genomic islands. Based on genomic distance scores and phylogenetic analysis, the Rubus-infecting strain ATCC BAA-2158 was genetically more closely related to the Spiraeoideae-infecting strains of E. amylovora than it was to the other Rubus-infecting strains. Analysis of the accessory genomes of Spiraeoideae- and Rubus-infecting strains has identified putative host-specific determinants including variation in the effector protein HopX1(Ea and a putative secondary metabolite pathway only present in Rubus-infecting strains.

  2. Identifying candidate driver genes by integrative ovarian cancer genomics data

    Science.gov (United States)

    Lu, Xinguo; Lu, Jibo

    2017-08-01

    Integrative analysis of molecular mechanics underlying cancer can distinguish interactions that cannot be revealed based on one kind of data for the appropriate diagnosis and treatment of cancer patients. Tumor samples exhibit heterogeneity in omics data, such as somatic mutations, Copy Number Variations CNVs), gene expression profiles and so on. In this paper we combined gene co-expression modules and mutation modulators separately in tumor patients to obtain the candidate driver genes for resistant and sensitive tumor from the heterogeneous data. The final list of modulators identified are well known in biological processes associated with ovarian cancer, such as CCL17, CACTIN, CCL16, CCL22, APOB, KDF1, CCL11, HNF1B, LRG1, MED1 and so on, which can help to facilitate the discovery of biomarkers, molecular diagnostics, and drug discovery.

  3. Genome-wide analysis of regulatory proteases sequences identified through bioinformatics data mining in Taenia solium.

    Science.gov (United States)

    Yan, Hong-Bin; Lou, Zhong-Zi; Li, Li; Brindley, Paul J; Zheng, Yadong; Luo, Xuenong; Hou, Junling; Guo, Aijiang; Jia, Wan-Zhong; Cai, Xuepeng

    2014-06-04

    Cysticercosis remains a major neglected tropical disease of humanity in many regions, especially in sub-Saharan Africa, Central America and elsewhere. Owing to the emerging drug resistance and the inability of current drugs to prevent re-infection, identification of novel vaccines and chemotherapeutic agents against Taenia solium and related helminth pathogens is a public health priority. The T. solium genome and the predicted proteome were reported recently, providing a wealth of information from which new interventional targets might be identified. In order to characterize and classify the entire repertoire of protease-encoding genes of T. solium, which act fundamental biological roles in all life processes, we analyzed the predicted proteins of this cestode through a combination of bioinformatics tools. Functional annotation was performed to yield insights into the signaling processes relevant to the complex developmental cycle of this tapeworm and to highlight a suite of the proteases as potential intervention targets. Within the genome of this helminth parasite, we identified 200 open reading frames encoding proteases from five clans, which correspond to 1.68% of the 11,902 protein-encoding genes predicted to be present in its genome. These proteases include calpains, cytosolic, mitochondrial signal peptidases, ubiquitylation related proteins, and others. Many not only show significant similarity to proteases in the Conserved Domain Database but have conserved active sites and catalytic domains. KEGG Automatic Annotation Server (KAAS) analysis indicated that ~60% of these proteases share strong sequence identities with proteins of the KEGG database, which are involved in human disease, metabolic pathways, genetic information processes, cellular processes, environmental information processes and organismal systems. Also, we identified signal peptides and transmembrane helices through comparative analysis with classes of important regulatory proteases

  4. Analysis of pan-genome to identify the core genes and essential genes of Brucella spp.

    Science.gov (United States)

    Yang, Xiaowen; Li, Yajie; Zang, Juan; Li, Yexia; Bie, Pengfei; Lu, Yanli; Wu, Qingmin

    2016-04-01

    Brucella spp. are facultative intracellular pathogens, that cause a contagious zoonotic disease, that can result in such outcomes as abortion or sterility in susceptible animal hosts and grave, debilitating illness in humans. For deciphering the survival mechanism of Brucella spp. in vivo, 42 Brucella complete genomes from NCBI were analyzed for the pan-genome and core genome by identification of their composition and function of Brucella genomes. The results showed that the total 132,143 protein-coding genes in these genomes were divided into 5369 clusters. Among these, 1710 clusters were associated with the core genome, 1182 clusters with strain-specific genes and 2477 clusters with dispensable genomes. COG analysis indicated that 44 % of the core genes were devoted to metabolism, which were mainly responsible for energy production and conversion (COG category C), and amino acid transport and metabolism (COG category E). Meanwhile, approximately 35 % of the core genes were in positive selection. In addition, 1252 potential essential genes were predicted in the core genome by comparison with a prokaryote database of essential genes. The results suggested that the core genes in Brucella genomes are relatively conservation, and the energy and amino acid metabolism play a more important role in the process of growth and reproduction in Brucella spp. This study might help us to better understand the mechanisms of Brucella persistent infection and provide some clues for further exploring the gene modules of the intracellular survival in Brucella spp.

  5. A barcode of organellar genome polymorphisms identifies the geographic origin of Plasmodium falciparum strains

    KAUST Repository

    Preston, Mark D.; Campino, Susana; Assefa, Samuel A.; Echeverry, Diego F.; Ocholla, Harold; Amambua-Ngwa, Alfred; Stewart, Lindsay B.; Conway, David J.; Borrmann, Steffen; Michon, Pascal; Zongo, Issaka; Oué draogo, Jean-Bosco; Djimde, Abdoulaye A.; Doumbo, Ogobara K.; Nosten, Francois; Pain, Arnab; Bousema, Teun; Drakeley, Chris J.; Fairhurst, Rick M.; Sutherland, Colin J.; Roper, Cally; Clark, Taane G.

    2014-01-01

    Malaria is a major public health problem that is actively being addressed in a global eradication campaign. Increased population mobility through international air travel has elevated the risk of re-introducing parasites to elimination areas and dispersing drug-resistant parasites to new regions. A simple genetic marker that quickly and accurately identifies the geographic origin of infections would be a valuable public health tool for locating the source of imported outbreaks. Here we analyse the mitochondrion and apicoplast genomes of 711 Plasmodium falciparum isolates from 14 countries, and find evidence that they are non-recombining and co-inherited. The high degree of linkage produces a panel of relatively few single-nucleotide polymorphisms (SNPs) that is geographically informative. We design a 23-SNP barcode that is highly predictive (?92%) and easily adapted to aid case management in the field and survey parasite migration worldwide. 2014 Macmillan Publishers Limited. All rights reserved.

  6. A barcode of organellar genome polymorphisms identifies the geographic origin of Plasmodium falciparum strains

    KAUST Repository

    Preston, Mark D.

    2014-06-13

    Malaria is a major public health problem that is actively being addressed in a global eradication campaign. Increased population mobility through international air travel has elevated the risk of re-introducing parasites to elimination areas and dispersing drug-resistant parasites to new regions. A simple genetic marker that quickly and accurately identifies the geographic origin of infections would be a valuable public health tool for locating the source of imported outbreaks. Here we analyse the mitochondrion and apicoplast genomes of 711 Plasmodium falciparum isolates from 14 countries, and find evidence that they are non-recombining and co-inherited. The high degree of linkage produces a panel of relatively few single-nucleotide polymorphisms (SNPs) that is geographically informative. We design a 23-SNP barcode that is highly predictive (?92%) and easily adapted to aid case management in the field and survey parasite migration worldwide. 2014 Macmillan Publishers Limited. All rights reserved.

  7. Genome-wide association study identifies candidate genes for starch content regulation in maize kernels

    Directory of Open Access Journals (Sweden)

    Na Liu

    2016-07-01

    Full Text Available Kernel starch content is an important trait in maize (Zea mays L. as it accounts for 65% to 75% of the dry kernel weight and positively correlates with seed yield. A number of starch synthesis-related genes have been identified in maize in recent years. However, many loci underlying variation in starch content among maize inbred lines still remain to be identified. The current study is a genome-wide association study that used a set of 263 maize inbred lines. In this panel, the average kernel starch content was 66.99%, ranging from 60.60% to 71.58% over the three study years. These inbred lines were genotyped with the SNP50 BeadChip maize array, which is comprised of 56,110 evenly spaced, random SNPs. Population structure was controlled by a mixed linear model (MLM as implemented in the software package TASSEL. After the statistical analyses, four SNPs were identified as significantly associated with starch content (P ≤ 0.0001, among which one each are located on chromosomes 1 and 5 and two are on chromosome 2. Furthermore, 77 candidate genes associated with starch synthesis were found within the 100-kb intervals containing these four QTLs, and four highly associated genes were within 20-kb intervals of the associated SNPs. Among the four genes, Glucose-1-phosphate adenylyltransferase (APS1; Gene ID GRMZM2G163437 is known as an important regulator of kernel starch content. The identified SNPs, QTLs, and candidate genes may not only be readily used for germplasm improvement by marker-assisted selection in breeding, but can also elucidate the genetic basis of starch content. Further studies on these identified candidate genes may help determine the molecular mechanisms regulating kernel starch content in maize and other important cereal crops.

  8. Genome evolution and plasticity of Serratia marcescens, an important multidrug-resistant nosocomial pathogen.

    Science.gov (United States)

    Iguchi, Atsushi; Nagaya, Yutaka; Pradel, Elizabeth; Ooka, Tadasuke; Ogura, Yoshitoshi; Katsura, Keisuke; Kurokawa, Ken; Oshima, Kenshiro; Hattori, Masahira; Parkhill, Julian; Sebaihia, Mohamed; Coulthurst, Sarah J; Gotoh, Naomasa; Thomson, Nicholas R; Ewbank, Jonathan J; Hayashi, Tetsuya

    2014-08-01

    Serratia marcescens is an important nosocomial pathogen that can cause an array of infections, most notably of the urinary tract and bloodstream. Naturally, it is found in many environmental niches, and is capable of infecting plants and animals. The emergence and spread of multidrug-resistant strains producing extended-spectrum or metallo beta-lactamases now pose a threat to public health worldwide. Here we report the complete genome sequences of two carefully selected S. marcescens strains, a multidrug-resistant clinical isolate (strain SM39) and an insect isolate (strain Db11). Our comparative analyses reveal the core genome of S. marcescens and define the potential metabolic capacity, virulence, and multidrug resistance of this species. We show a remarkable intraspecies genetic diversity, both at the sequence level and with regards genome flexibility, which may reflect the diversity of niches inhabited by members of this species. A broader analysis with other Serratia species identifies a set of approximately 3,000 genes that characterize the genus. Within this apparent genetic diversity, we identified many genes implicated in the high virulence potential and antibiotic resistance of SM39, including the metallo beta-lactamase and multiple other drug resistance determinants carried on plasmid pSMC1. We further show that pSMC1 is most closely related to plasmids circulating in Pseudomonas species. Our data will provide a valuable basis for future studies on S. marcescens and new insights into the genetic mechanisms that underlie the emergence of pathogens highly resistant to multiple antimicrobial agents. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  9. RUMINANT NUTRITION SYMPOSIUM: Use of genomics and transcriptomics to identify strategies to lower ruminal methanogenesis.

    Science.gov (United States)

    McAllister, T A; Meale, S J; Valle, E; Guan, L L; Zhou, M; Kelly, W J; Henderson, G; Attwood, G T; Janssen, P H

    2015-04-01

    Globally, methane (CH4) emissions account for 40% to 45% of greenhouse gas emissions from ruminant livestock, with over 90% of these emissions arising from enteric fermentation. Reduction of carbon dioxide to CH4 is critical for efficient ruminal fermentation because it prevents the accumulation of reducing equivalents in the rumen. Methanogens exist in a symbiotic relationship with rumen protozoa and fungi and within biofilms associated with feed and the rumen wall. Genomics and transcriptomics are playing an increasingly important role in defining the ecology of ruminal methanogenesis and identifying avenues for its mitigation. Metagenomic approaches have provided information on changes in abundances as well as the species composition of the methanogen community among ruminants that vary naturally in their CH4 emissions, their feed efficiency, and their response to CH4 mitigators. Sequencing the genomes of rumen methanogens has provided insight into surface proteins that may prove useful in the development of vaccines and has allowed assembly of biochemical pathways for use in chemogenomic approaches to lowering ruminal CH4 emissions. Metagenomics and metatranscriptomic analysis of entire rumen microbial communities are providing new perspectives on how methanogens interact with other members of this ecosystem and how these relationships may be altered to reduce methanogenesis. Identification of community members that produce antimethanogen agents that either inhibit or kill methanogens could lead to the identification of new mitigation approaches. Discovery of a lytic archaeophage that specifically lyses methanogens is 1 such example. Efforts in using genomic data to alter methanogenesis have been hampered by a lack of sequence information that is specific to the microbial community of the rumen. Programs such as Hungate1000 and the Global Rumen Census are increasing the breadth and depth of our understanding of global ruminal microbial communities, steps that

  10. Complex analyses of inverted repeats in mitochondrial genomes revealed their importance and variability.

    Science.gov (United States)

    Cechová, Jana; Lýsek, Jirí; Bartas, Martin; Brázda, Václav

    2018-04-01

    The NCBI database contains mitochondrial DNA (mtDNA) genomes from numerous species. We investigated the presence and locations of inverted repeat sequences (IRs) in these mtDNA sequences, which are known to be important for regulating nuclear genomes. IRs were identified in mtDNA in all species. IR lengths and frequencies correlate with evolutionary age and the greatest variability was detected in subgroups of plants and fungi and the lowest variability in mammals. IR presence is non-random and evolutionary favoured. The frequency of IRs generally decreased with IR length, but not for IRs 24 or 30 bp long, which are 1.5 times more abundant. IRs are enriched in sequences from the replication origin, followed by D-loop, stem-loop and miscellaneous sequences, pointing to the importance of IRs in regulatory regions of mitochondrial DNA. Data were produced using Palindrome analyser, freely available on the web at http://bioinformatics.ibp.cz. vaclav@ibp.cz. Supplementary data are available at Bioinformatics online.

  11. A survey of single nucleotide polymorphisms identified from whole-genome sequencing and their functional effect in the porcine genome.

    Science.gov (United States)

    Keel, B N; Nonneman, D J; Rohrer, G A

    2017-08-01

    Genetic variants detected from sequence have been used to successfully identify causal variants and map complex traits in several organisms. High and moderate impact variants, those expected to alter or disrupt the protein coded by a gene and those that regulate protein production, likely have a more significant effect on phenotypic variation than do other types of genetic variants. Hence, a comprehensive list of these functional variants would be of considerable interest in swine genomic studies, particularly those targeting fertility and production traits. Whole-genome sequence was obtained from 72 of the founders of an intensely phenotyped experimental swine herd at the U.S. Meat Animal Research Center (USMARC). These animals included all 24 of the founding boars (12 Duroc and 12 Landrace) and 48 Yorkshire-Landrace composite sows. Sequence reads were mapped to the Sscrofa10.2 genome build, resulting in a mean of 6.1 fold (×) coverage per genome. A total of 22 342 915 high confidence SNPs were identified from the sequenced genomes. These included 21 million previously reported SNPs and 79% of the 62 163 SNPs on the PorcineSNP60 BeadChip assay. Variation was detected in the coding sequence or untranslated regions (UTRs) of 87.8% of the genes in the porcine genome: loss-of-function variants were predicted in 504 genes, 10 202 genes contained nonsynonymous variants, 10 773 had variation in UTRs and 13 010 genes contained synonymous variants. Approximately 139 000 SNPs were classified as loss-of-function, nonsynonymous or regulatory, which suggests that over 99% of the variation detected in our pigs could potentially be ignored, allowing us to focus on a much smaller number of functional SNPs during future analyses. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

  12. Identifying signatures of natural selection in Tibetan and Andean populations using dense genome scan data.

    Directory of Open Access Journals (Sweden)

    Abigail Bigham

    2010-09-01

    Full Text Available High-altitude hypoxia (reduced inspired oxygen tension due to decreased barometric pressure exerts severe physiological stress on the human body. Two high-altitude regions where humans have lived for millennia are the Andean Altiplano and the Tibetan Plateau. Populations living in these regions exhibit unique circulatory, respiratory, and hematological adaptations to life at high altitude. Although these responses have been well characterized physiologically, their underlying genetic basis remains unknown. We performed a genome scan to identify genes showing evidence of adaptation to hypoxia. We looked across each chromosome to identify genomic regions with previously unknown function with respect to altitude phenotypes. In addition, groups of genes functioning in oxygen metabolism and sensing were examined to test the hypothesis that particular pathways have been involved in genetic adaptation to altitude. Applying four population genetic statistics commonly used for detecting signatures of natural selection, we identified selection-nominated candidate genes and gene regions in these two populations (Andeans and Tibetans separately. The Tibetan and Andean patterns of genetic adaptation are largely distinct from one another, with both populations showing evidence of positive natural selection in different genes or gene regions. Interestingly, one gene previously known to be important in cellular oxygen sensing, EGLN1 (also known as PHD2, shows evidence of positive selection in both Tibetans and Andeans. However, the pattern of variation for this gene differs between the two populations. Our results indicate that several key HIF-regulatory and targeted genes are responsible for adaptation to high altitude in Andeans and Tibetans, and several different chromosomal regions are implicated in the putative response to selection. These data suggest a genetic role in high-altitude adaption and provide a basis for future genotype/phenotype association

  13. Comparative Genomic Analysis of Meningitis- and Bacteremia-Causing Pneumococci Identifies a Common Core Genome

    Science.gov (United States)

    Cornick, Jennifer E.; Chaguza, Chrispin; Yalcin, Feyruz; Harris, Simon R.; Gray, Katherine J.; Kiran, Anmol M.; Molyneux, Elizabeth; French, Neil; Faragher, Brian E.; Everett, Dean B.; Bentley, Stephen D.

    2015-01-01

    Streptococcus pneumoniae is a nasopharyngeal commensal that occasionally invades normally sterile sites to cause bloodstream infection and meningitis. Although the pneumococcal population structure and evolutionary genetics are well defined, it is not clear whether pneumococci that cause meningitis are genetically distinct from those that do not. Here, we used whole-genome sequencing of 140 isolates of S. pneumoniae recovered from bloodstream infection (n = 70) and meningitis (n = 70) to compare their genetic contents. By fitting a double-exponential decaying-function model, we show that these isolates share a core of 1,427 genes (95% confidence interval [CI], 1,425 to 1,435 genes) and that there is no difference in the core genome or accessory gene content from these disease manifestations. Gene presence/absence alone therefore does not explain the virulence behavior of pneumococci that reach the meninges. Our analysis, however, supports the requirement of a range of previously described virulence factors and vaccine candidates for both meningitis- and bacteremia-causing pneumococci. This high-resolution view suggests that, despite considerable competency for genetic exchange, all pneumococci are under considerable pressure to retain key components advantageous for colonization and transmission and that these components are essential for access to and survival in sterile sites. PMID:26259813

  14. Genome-wide analysis reveals signatures of selection for important traits in domestic sheep from different ecoregions.

    Science.gov (United States)

    Liu, Zhaohua; Ji, Zhibin; Wang, Guizhi; Chao, Tianle; Hou, Lei; Wang, Jianmin

    2016-11-03

    Throughout a long period of adaptation and selection, sheep have thrived in a diverse range of ecological environments. Mongolian sheep is the common ancestor of the Chinese short fat-tailed sheep. Migration to different ecoregions leads to changes in selection pressures and results in microevolution. Mongolian sheep and its subspecies differ in a number of important traits, especially reproductive traits. Genome-wide intraspecific variation is required to dissect the genetic basis of these traits. This research resequenced 3 short fat-tailed sheep breeds with a 43.2-fold coverage of the sheep genome. We report more than 17 million single nucleotide polymorphisms and 2.9 million indels and identify 143 genomic regions with reduced pooled heterozygosity or increased genetic distance to each other breed that represent likely targets for selection during the migration. These regions harbor genes related to developmental processes, cellular processes, multicellular organismal processes, biological regulation, metabolic processes, reproduction, localization, growth and various components of the stress responses. Furthermore, we examined the haplotype diversity of 3 genomic regions involved in reproduction and found significant differences in TSHR and PRL gene regions among 8 sheep breeds. Our results provide useful genomic information for identifying genes or causal mutations associated with important economic traits in sheep and for understanding the genetic basis of adaptation to different ecological environments.

  15. Complete genome sequence of the cystic fibrosis pathogen Achromobacter xylosoxidans NH44784-1996 complies with important pathogenic phenotypes

    DEFF Research Database (Denmark)

    Jakobsen, Tim Holm; Hansen, Martin Asser; Jensen, Peter Østrup

    2013-01-01

    Achromobacter xylosoxidans is an environmental opportunistic pathogen, which infects an increasing number of immunocompromised patients. In this study we combined genomic analysis of a clinical isolated A. xylosoxidans strain with phenotypic investigations of its important pathogenic features. We...... that render it an opportunistic human pathogen, We found genes involved in anaerobic growth and the pgaABCD operon encoding the biofilm adhesin poly-β-1,6-N-acetyl-D-glucosamin. Furthermore, the genome contains a range of antibiotic resistance genes coding efflux pump systems and antibiotic modifying enzymes....... In vitro studies of A. xylosoxidans NH44784-1996 confirmed the genomic evidence for its ability to form biofilms, anaerobic growth via denitrification, and resistance to a broad range of antibiotics. Our investigation enables further studies of the functionality of important identified genes contributing...

  16. kmer-SVM: a web server for identifying predictive regulatory sequence features in genomic data sets

    Science.gov (United States)

    Fletez-Brant, Christopher; Lee, Dongwon; McCallion, Andrew S.; Beer, Michael A.

    2013-01-01

    Massively parallel sequencing technologies have made the generation of genomic data sets a routine component of many biological investigations. For example, Chromatin immunoprecipitation followed by sequence assays detect genomic regions bound (directly or indirectly) by specific factors, and DNase-seq identifies regions of open chromatin. A major bottleneck in the interpretation of these data is the identification of the underlying DNA sequence code that defines, and ultimately facilitates prediction of, these transcription factor (TF) bound or open chromatin regions. We have recently developed a novel computational methodology, which uses a support vector machine (SVM) with kmer sequence features (kmer-SVM) to identify predictive combinations of short transcription factor-binding sites, which determine the tissue specificity of these genomic assays (Lee, Karchin and Beer, Discriminative prediction of mammalian enhancers from DNA sequence. Genome Res. 2011; 21:2167–80). This regulatory information can (i) give confidence in genomic experiments by recovering previously known binding sites, and (ii) reveal novel sequence features for subsequent experimental testing of cooperative mechanisms. Here, we describe the development and implementation of a web server to allow the broader research community to independently apply our kmer-SVM to analyze and interpret their genomic datasets. We analyze five recently published data sets and demonstrate how this tool identifies accessory factors and repressive sequence elements. kmer-SVM is available at http://kmersvm.beerlab.org. PMID:23771147

  17. Genome-wide Association Study Identifies Five Susceptibility Loci for Follicular Lymphoma outside the HLA Region

    NARCIS (Netherlands)

    Skibola, Christine F.; Berndt, Sonja I.; Vijai, Joseph; Conde, Lucia; Wang, Zhaoming; Yeager, Meredith; de Bakker, Paul I. W.; Birmann, Brenda M.; Vajdic, Claire M.; Foo, Jia-Nee; Bracci, Paige M.; Vermeulen, Roel C. H.; Slager, Susan L.; de Sanjose, Silvia; Wang, Sophia S.; Linet, Martha S.; Salles, Gilles; Lan, Qing; Severi, Gianluca; Hjalgrim, Henrik; Lightfoot, Tracy; Melbye, Mads; Gu, Jian; Ghesquieres, Herve; Link, Brian K.; Morton, Lindsay M.; Holly, Elizabeth A.; Smith, Alex; Tinker, Lesley F.; Teras, Lauren R.; Kricker, Anne; Becker, Nikolaus; Purdue, Mark P.; Spinelli, John J.; Zhang, Yawei; Giles, Graham G.; Vineis, Paolo; Monnereau, Alain; Bertrand, Kimberly A.; Albanes, Demetrius; Zeleniuch-Jacquotte, Anne; Gabbas, Attilio; Chung, Charles C.; Burdett, Laurie; Hutchinson, Amy; Lawrence, Charles; Montalvan, Rebecca; Liang, Liming; Huang, Jinyan; Ma, Baoshan; Liu, Jianjun; Adami, Hans-Olov; Glimelius, Bengt; Ye, Yuanqing; Nowakowski, Grzegorz S.; Dogan, Ahmet; Thompson, Carrie A.; Habermann, Thomas M.; Novak, Anne J.; Liebow, Mark; Witzig, Thomas E.; Weiner, George J.; Schenk, Maryjean; Hartge, Patricia; De Roos, Anneclaire J.; Cozen, Wendy; Zhi, Degui; Akers, Nicholas K.; Riby, Jacques; Smith, Martyn T.; Lacher, Mortimer; Villano, Danylo J.; Maria, Ann; Roman, Eve; Kane, Eleanor; Jackson, Rebecca D.; North, Kari E.; Diver, W. Ryan; Turner, Jenny; Armstrong, Bruce K.; Benavente, Yolanda; Boffetta, Paolo; Brennan, Paul; Foretova, Lenka; Maynadie, Marc; Staines, Anthony; McKay, James; Brooks-Wilson, Angela R.; Zheng, Tongzhang; Holford, Theodore R.; Chamosa, Saioa; Kaaks, Rudolph; Kelly, Rachel S.; Ohlsson, Bodil; Travis, Ruth C.; Weiderpass, Elisabete; Clave, Jacqueline; Giovannucci, Edward; Kraft, Peter; Virtamo, Jarmo; Mazza, Patrizio; Cocco, Pierluigi; Ennas, Maria Grazia; Chiu, Brian C. H.; Fraumeni, Joseph R.; Nieters, Alexandra; Offit, Kenneth; Wu, Xifeng; Cerhan, James R.; Smedby, Karin E.; Chanock, Stephen J.; Rothman, Nathaniel

    2014-01-01

    Genome-wide association studies (GWASs) of follicular lymphoma (FL) have previously identified human leukocyte antigen (HLA) gene variants. To identify additional FL susceptibility loci, we conducted a large-scale two-stage GWAS in 4,523 case subjects and 13,344 control subjects of European

  18. Benchmark data for identifying N6-methyladenosine sites in the Saccharomyces cerevisiae genome

    Directory of Open Access Journals (Sweden)

    Wei Chen

    2015-12-01

    Full Text Available This data article contains the benchmark dataset for training and testing iRNA-Methyl, a web-server predictor for identifying N6-methyladenosine sites in RNA (Chen et al., 2015 [15]. It can also be used to develop other predictors for identifying N6-methyladenosine sites in the Saccharomyces cerevisiae genome.

  19. Apophysomyces variabilis: draft genome sequence and comparison of predictive virulence determinants with other medically important Mucorales.

    Science.gov (United States)

    Prakash, Hariprasath; Rudramurthy, Shivaprakash Mandya; Gandham, Prasad S; Ghosh, Anup Kumar; Kumar, Milner M; Badapanda, Chandan; Chakrabarti, Arunaloke

    2017-09-18

    Apophysomyces species are prevalent in tropical countries and A. variabilis is the second most frequent agent causing mucormycosis in India. Among Apophysomyces species, A. elegans, A. trapeziformis and A. variabilis are commonly incriminated in human infections. The genome sequences of A. elegans and A. trapeziformis are available in public database, but not A. variabilis. We, therefore, performed the whole genome sequence of A. variabilis to explore its genomic structure and possible genes determining the virulence of the organism. The whole genome of A. variabilis NCCPF 102052 was sequenced and the genomic structure of A. variabilis was compared with already available genome structures of A. elegans, A. trapeziformis and other medically important Mucorales. The total size of genome assembly of A. variabilis was 39.38 Mb with 12,764 protein-coding genes. The transposable elements (TEs) were low in Apophysomyces genome and the retrotransposon Ty3-gypsy was the common TE. Phylogenetically, Apophysomyces species were grouped closely with Phycomyces blakesleeanus. OrthoMCL analysis revealed 3025 orthologues proteins, which were common in those three pathogenic Apophysomyces species. Expansion of multiple gene families/duplication was observed in Apophysomyces genomes. Approximately 6% of Apophysomyces genes were predicted to be associated with virulence on PHIbase analysis. The virulence determinants included the protein families of CotH proteins (invasins), proteases, iron utilisation pathways, siderophores and signal transduction pathways. Serine proteases were the major group of proteases found in all Apophysomyces genomes. The carbohydrate active enzymes (CAZymes) constitute the majority of the secretory proteins. The present study is the maiden attempt to sequence and analyze the genomic structure of A. variabilis. Together with available genome sequence of A. elegans and A. trapeziformis, the study helped to indicate the possible virulence determinants of

  20. Detection of yellow fever virus genomes from four imported cases in China.

    Science.gov (United States)

    Cui, Shujuan; Pan, Yang; Lyu, Yanning; Liang, Zhichao; Li, Jie; Sun, Yulan; Dou, Xiangfeng; Tian, Lili; Huo, Da; Chen, Lijuan; Li, Xinyu; Wang, Quanyi

    2017-07-01

    Yellow fever virus (YFV), as the first proven human-pathogenic virus, is still a major public health problem with a dramatic upsurge in recent years. This is a report on four imported cases of yellow fever virus into China identified by whole genome sequencing. Phylogenetic analysis was performed and the results showed that these four viruses were highly homologous with Angola 71 strains (AY968064). In addition, effective mutations of amino acids were not observed in the E protein domain of four viruses, thus confirming the effectiveness of the YFV-17D vaccine (X03700). Although there is low risk of local transmission in most part of China, the increasing public health risk of YF caused by international exchange should not be ignored. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  1. Genome-wide CRISPR/Cas9 Screen Identifies Host Factors Essential for Influenza Virus Replication

    Directory of Open Access Journals (Sweden)

    Julianna Han

    2018-04-01

    Full Text Available Summary: The emergence of influenza A viruses (IAVs from zoonotic reservoirs poses a great threat to human health. As seasonal vaccines are ineffective against zoonotic strains, and newly transmitted viruses can quickly acquire drug resistance, there remains a need for host-directed therapeutics against IAVs. Here, we performed a genome-scale CRISPR/Cas9 knockout screen in human lung epithelial cells with a human isolate of an avian H5N1 strain. Several genes involved in sialic acid biosynthesis and related glycosylation pathways were highly enriched post-H5N1 selection, including SLC35A1, a sialic acid transporter essential for IAV receptor expression and thus viral entry. Importantly, we have identified capicua (CIC as a negative regulator of cell-intrinsic immunity, as loss of CIC resulted in heightened antiviral responses and restricted replication of multiple viruses. Therefore, our study demonstrates that the CRISPR/Cas9 system can be utilized for the discovery of host factors critical for the replication of intracellular pathogens. : Using a genome-wide CRISPR/Cas9 screen, Han et al. demonstrate that the major hit, the sialic acid transporter SLC35A1, is an essential host factor for IAV entry. In addition, they identify the DNA-binding transcriptional repressor CIC as a negative regulator of cell-intrinsic immunity. Keywords: CRISPR/Cas9 screen, GeCKO, influenza virus, host factors, sialic acid pathway, SLC35A1, Capicua, CIC, cell-intrinsic immunity, H5N1

  2. Whole-genome and Transcriptome Sequencing of Prostate Cancer Identify New Genetic Alterations Driving Disease Progression

    DEFF Research Database (Denmark)

    Ren, Shancheng; Wei, Gong-Hong; Liu, Dongbing

    2018-01-01

    BACKGROUND: Global disparities in prostate cancer (PCa) incidence highlight the urgent need to identify genomic abnormalities in prostate tumors in different ethnic populations including Asian men. OBJECTIVE: To systematically explore the genomic complexity and define disease-driven genetic......-scale and comprehensive genomic data of prostate cancer from Asian population. Identification of these genetic alterations may help advance prostate cancer diagnosis, prognosis, and treatment....... alterations in PCa. DESIGN, SETTING, AND PARTICIPANTS: The study sequenced whole-genome and transcriptome of tumor-benign paired tissues from 65 treatment-naive Chinese PCa patients. Subsequent targeted deep sequencing of 293 PCa-relevant genes was performed in another cohort of 145 prostate tumors. OUTCOME...

  3. Genome wide association study identifies KCNMA1 contributing to human obesity

    DEFF Research Database (Denmark)

    Jiao, Hong; Arner, Peter; Hoffstedt, Johan

    2011-01-01

    Recent genome-wide association (GWA) analyses have identified common single nucleotide polymorphisms (SNPs) that are associated with obesity. However, the reported genetic variation in obesity explains only a minor fraction of the total genetic variation expected to be present in the population....... Thus many genetic variants controlling obesity remain to be identified. The aim of this study was to use GWA followed by multiple stepwise validations to identify additional genes associated with obesity....

  4. 4C-ker: A Method to Reproducibly Identify Genome-Wide Interactions Captured by 4C-Seq Experiments.

    Directory of Open Access Journals (Sweden)

    Ramya Raviram

    2016-03-01

    Full Text Available 4C-Seq has proven to be a powerful technique to identify genome-wide interactions with a single locus of interest (or "bait" that can be important for gene regulation. However, analysis of 4C-Seq data is complicated by the many biases inherent to the technique. An important consideration when dealing with 4C-Seq data is the differences in resolution of signal across the genome that result from differences in 3D distance separation from the bait. This leads to the highest signal in the region immediately surrounding the bait and increasingly lower signals in far-cis and trans. Another important aspect of 4C-Seq experiments is the resolution, which is greatly influenced by the choice of restriction enzyme and the frequency at which it can cut the genome. Thus, it is important that a 4C-Seq analysis method is flexible enough to analyze data generated using different enzymes and to identify interactions across the entire genome. Current methods for 4C-Seq analysis only identify interactions in regions near the bait or in regions located in far-cis and trans, but no method comprehensively analyzes 4C signals of different length scales. In addition, some methods also fail in experiments where chromatin fragments are generated using frequent cutter restriction enzymes. Here, we describe 4C-ker, a Hidden-Markov Model based pipeline that identifies regions throughout the genome that interact with the 4C bait locus. In addition, we incorporate methods for the identification of differential interactions in multiple 4C-seq datasets collected from different genotypes or experimental conditions. Adaptive window sizes are used to correct for differences in signal coverage in near-bait regions, far-cis and trans chromosomes. Using several datasets, we demonstrate that 4C-ker outperforms all existing 4C-Seq pipelines in its ability to reproducibly identify interaction domains at all genomic ranges with different resolution enzymes.

  5. Comparative Genomics and Disorder Prediction Identify Biologically Relevant SH3 Protein Interactions.

    Directory of Open Access Journals (Sweden)

    2005-08-01

    Full Text Available Protein interaction networks are an important part of the post-genomic effort to integrate a part-list view of the cell into system-level understanding. Using a set of 11 yeast genomes we show that combining comparative genomics and secondary structure information greatly increases consensus-based prediction of SH3 targets. Benchmarking of our method against positive and negative standards gave 83% accuracy with 26% coverage. The concept of an optimal divergence time for effective comparative genomics studies was analyzed, demonstrating that genomes of species that diverged very recently from Saccharomyces cerevisiae(S. mikatae, S. bayanus, and S. paradoxus, or a long time ago (Neurospora crassa and Schizosaccharomyces pombe, contain less information for accurate prediction of SH3 targets than species within the optimal divergence time proposed. We also show here that intrinsically disordered SH3 domain targets are more probable sites of interaction than equivalent sites within ordered regions. Our findings highlight several novel S. cerevisiae SH3 protein interactions, the value of selection of optimal divergence times in comparative genomics studies, and the importance of intrinsic disorder for protein interactions. Based on our results we propose novel roles for the S. cerevisiae proteins Abp1p in endocytosis and Hse1p in endosome protein sorting.

  6. Comparative genomics and disorder prediction identify biologically relevant SH3 protein interactions.

    Directory of Open Access Journals (Sweden)

    Pedro Beltrao

    2005-08-01

    Full Text Available Protein interaction networks are an important part of the post-genomic effort to integrate a part-list view of the cell into system-level understanding. Using a set of 11 yeast genomes we show that combining comparative genomics and secondary structure information greatly increases consensus-based prediction of SH3 targets. Benchmarking of our method against positive and negative standards gave 83% accuracy with 26% coverage. The concept of an optimal divergence time for effective comparative genomics studies was analyzed, demonstrating that genomes of species that diverged very recently from Saccharomyces cerevisiae(S. mikatae, S. bayanus, and S. paradoxus, or a long time ago (Neurospora crassa and Schizosaccharomyces pombe, contain less information for accurate prediction of SH3 targets than species within the optimal divergence time proposed. We also show here that intrinsically disordered SH3 domain targets are more probable sites of interaction than equivalent sites within ordered regions. Our findings highlight several novel S. cerevisiae SH3 protein interactions, the value of selection of optimal divergence times in comparative genomics studies, and the importance of intrinsic disorder for protein interactions. Based on our results we propose novel roles for the S. cerevisiae proteins Abp1p in endocytosis and Hse1p in endosome protein sorting.

  7. A genome-wide scan study identifies a single nucleotide substitution in ASIP associated with white versus non-white coat-colour variation in sheep (Ovis aries)

    OpenAIRE

    Li, M-H; Tiirikka, T; Kantanen, J

    2013-01-01

    In sheep, coat colour (and pattern) is one of the important traits of great biological, economic and social importance. However, the genetics of sheep coat colour has not yet been fully clarified. We conducted a genome-wide association study of sheep coat colours by genotyping 47 303 single-nucleotide polymorphisms (SNPs) in the Finnsheep population in Finland. We identified 35 SNPs associated with all the coat colours studied, which cover genomic regions encompassing three kno...

  8. Integrating Diverse Types of Genomic Data to Identify Genes that Underlie Adverse Pregnancy Phenotypes.

    Directory of Open Access Journals (Sweden)

    Jibril Hirbo

    Full Text Available Progress in understanding complex genetic diseases has been bolstered by synthetic approaches that overlay diverse data types and analyses to identify functionally important genes. Pre-term birth (PTB, a major complication of pregnancy, is a leading cause of infant mortality worldwide. A major obstacle in addressing PTB is that the mechanisms controlling parturition and birth timing remain poorly understood. Integrative approaches that overlay datasets derived from comparative genomics with function-derived ones have potential to advance our understanding of the genetics of birth timing, and thus provide insights into the genes that may contribute to PTB. We intersected data from fast evolving coding and non-coding gene regions in the human and primate lineage with data from genes expressed in the placenta, from genes that show enriched expression only in the placenta, as well as from genes that are differentially expressed in four distinct PTB clinical subtypes. A large fraction of genes that are expressed in placenta, and differentially expressed in PTB clinical subtypes (23-34% are fast evolving, and are associated with functions that include adhesion neurodevelopmental and immune processes. Functional categories of genes that express fast evolution in coding regions differ from those linked to fast evolution in non-coding regions. Finally, there is a surprising lack of overlap between fast evolving genes that are differentially expressed in four PTB clinical subtypes. Integrative approaches, especially those that incorporate evolutionary perspectives, can be successful in identifying potential genetic contributions to complex genetic diseases, such as PTB.

  9. Omics Approaches for Identifying Physiological Adaptations to Genome Instability in Aging.

    Science.gov (United States)

    Edifizi, Diletta; Schumacher, Björn

    2017-11-04

    DNA damage causally contributes to aging and age-related diseases. The declining functioning of tissues and organs during aging can lead to the increased risk of succumbing to aging-associated diseases. Congenital syndromes that are caused by heritable mutations in DNA repair pathways lead to cancer susceptibility and accelerated aging, thus underlining the importance of genome maintenance for withstanding aging. High-throughput mass-spectrometry-based approaches have recently contributed to identifying signalling response networks and gaining a more comprehensive understanding of the physiological adaptations occurring upon unrepaired DNA damage. The insulin-like signalling pathway has been implicated in a DNA damage response (DDR) network that includes epidermal growth factor (EGF)-, AMP-activated protein kinases (AMPK)- and the target of rapamycin (TOR)-like signalling pathways, which are known regulators of growth, metabolism, and stress responses. The same pathways, together with the autophagy-mediated proteostatic response and the decline in energy metabolism have also been found to be similarly regulated during natural aging, suggesting striking parallels in the physiological adaptation upon persistent DNA damage due to DNA repair defects and long-term low-level DNA damage accumulation occurring during natural aging. These insights will be an important starting point to study the interplay between signalling networks involved in progeroid syndromes that are caused by DNA repair deficiencies and to gain new understanding of the consequences of DNA damage in the aging process.

  10. Omics Approaches for Identifying Physiological Adaptations to Genome Instability in Aging

    Directory of Open Access Journals (Sweden)

    Diletta Edifizi

    2017-11-01

    Full Text Available DNA damage causally contributes to aging and age-related diseases. The declining functioning of tissues and organs during aging can lead to the increased risk of succumbing to aging-associated diseases. Congenital syndromes that are caused by heritable mutations in DNA repair pathways lead to cancer susceptibility and accelerated aging, thus underlining the importance of genome maintenance for withstanding aging. High-throughput mass-spectrometry-based approaches have recently contributed to identifying signalling response networks and gaining a more comprehensive understanding of the physiological adaptations occurring upon unrepaired DNA damage. The insulin-like signalling pathway has been implicated in a DNA damage response (DDR network that includes epidermal growth factor (EGF-, AMP-activated protein kinases (AMPK- and the target of rapamycin (TOR-like signalling pathways, which are known regulators of growth, metabolism, and stress responses. The same pathways, together with the autophagy-mediated proteostatic response and the decline in energy metabolism have also been found to be similarly regulated during natural aging, suggesting striking parallels in the physiological adaptation upon persistent DNA damage due to DNA repair defects and long-term low-level DNA damage accumulation occurring during natural aging. These insights will be an important starting point to study the interplay between signalling networks involved in progeroid syndromes that are caused by DNA repair deficiencies and to gain new understanding of the consequences of DNA damage in the aging process.

  11. Evolution of a Pathogen: A Comparative Genomics Analysis Identifies a Genetic Pathway to Pathogenesis in Acinetobacter

    Science.gov (United States)

    Sahl, Jason W.; Gillece, John D.; Schupp, James M.; Waddell, Victor G.; Driebe, Elizabeth M.; Engelthaler, David M.; Keim, Paul

    2013-01-01

    Acinetobacter baumannii is an emergent and global nosocomial pathogen. In addition to A. baumannii, other Acinetobacter species, especially those in the Acinetobacter calcoaceticus-baumannii (Acb) complex, have also been associated with serious human infection. Although mechanisms of attachment, persistence on abiotic surfaces, and pathogenesis in A. baumannii have been identified, the genetic mechanisms that explain the emergence of A. baumannii as the most widespread and virulent Acinetobacter species are not fully understood. Recent whole genome sequencing has provided insight into the phylogenetic structure of the genus Acinetobacter. However, a global comparison of genomic features between Acinetobacter spp. has not been described in the literature. In this study, 136 Acinetobacter genomes, including 67 sequenced in this study, were compared to identify the acquisition and loss of genes in the expansion of the Acinetobacter genus. A whole genome phylogeny confirmed that A. baumannii is a monophyletic clade and that the larger Acb complex is also a well-supported monophyletic group. The whole genome phylogeny provided the framework for a global genomic comparison based on a blast score ratio (BSR) analysis. The BSR analysis demonstrated that specific genes have been both lost and acquired in the evolution of A. baumannii. In addition, several genes associated with A. baumannii pathogenesis were found to be more conserved in the Acb complex, and especially in A. baumannii, than in other Acinetobacter genomes; until recently, a global analysis of the distribution and conservation of virulence factors across the genus was not possible. The results demonstrate that the acquisition of specific virulence factors has likely contributed to the widespread persistence and virulence of A. baumannii. The identification of novel features associated with transcriptional regulation and acquired by clades in the Acb complex presents targets for better understanding the

  12. Complete genome sequence of Clostridium estertheticum DSM 8809, a microbe identified in spoiled vacuum packed beef

    Directory of Open Access Journals (Sweden)

    Zhongyi Yu

    2016-11-01

    Full Text Available Blown pack spoilage (BPS is a major issue for the beef industry. Aetiological agents of BPS involve members of a group of Clostridium species, including Clostridium estertheticum which has the ability to produce gas, mostly carbon dioxide, under anaerobic psychotrophic growth conditions. This spore-forming bacterium grows slowly under laboratory conditions, and it can take up to 3 months to produce a workable culture. These characteristics have limited the study of this commercially challenging bacterium. Consequently information on this bacterium is limited and no effective controls are currently available to confidently detect and manage this production risk. In this study the complete genome of Clostridium estertheticum DSM 8809 was determined by SMRT® sequencing. The genome consists of a circular chromosome of 4.7 Mbp along with a single plasmid carrying a potential tellurite resistance gene tehB and a Tn3-like resolvase-encoding gene tnpR. The genome sequence was searched for central metabolic pathways that would support its biochemical profile and several enzymes contributing to this phenotype were identified. Several putative antibiotic/biocide/metal resistance-encoding genes and virulence factors were also identified in the genome, a feature that requires further research. The availability of the genome sequence will provide a basic blueprint from which to develop valuable biomarkers that could support and improve the detection and control of this bacterium along the beef production chain.

  13. Genome-wide association scan meta-analysis identifies three loci influencing adiposity and fat distribution

    NARCIS (Netherlands)

    C.M. Lindgren (Cecilia); I.M. Heid (Iris); J.C. Randall (Joshua); C. Lamina (Claudia); V. Steinthorsdottir (Valgerdur); L. Qi (Lu); E.K. Speliotes (Elizabeth); G. Thorleifsson (Gudmar); C.J. Willer (Cristen); B.M. Herrera (Blanca); A.U. Jackson (Anne); N. Lim (Noha); P. Scheet (Paul); N. Soranzo (Nicole); N. Amin (Najaf); Y.S. Aulchenko (Yurii); J.C. Chambers (John); A. Drong (Alexander); J. Luan; H.N. Lyon (Helen); F. Rivadeneira Ramirez (Fernando); S. Sanna (Serena); N.J. Timpson (Nicholas); M.C. Zillikens (Carola); H.Z. Jing; P. Almgren (Peter); S. Bandinelli (Stefania); A.J. Bennett (Amanda); R.N. Bergman (Richard); L.L. Bonnycastle (Lori); S. Bumpstead (Suzannah); S.J. Chanock (Stephen); L. Cherkas (Lynn); P.S. Chines (Peter); L. Coin (Lachlan); C. Cooper (Charles); G. Crawford (Gabe); A. Doering (Angela); A. Dominiczak (Anna); A.S.F. Doney (Alex); S. Ebrahim (Shanil); P. Elliott (Paul); M.R. Erdos (Michael); K. Estrada Gil (Karol); L. Ferrucci (Luigi); G. Fischer (Guido); N.G. Forouhi (Nita); C. Gieger (Christian); H. Grallert (Harald); C.J. Groves (Christopher); S.M. Grundy (Scott); C. Guiducci (Candace); D. Hadley (David); A. Hamsten (Anders); A.S. Havulinna (Aki); A. Hofman (Albert); R. Holle (Rolf); J.W. Holloway (John); T. Illig (Thomas); B. Isomaa (Bo); L.C. Jacobs (Leonie); K. Jameson (Karen); P. Jousilahti (Pekka); F. Karpe (Fredrik); J. Kuusisto (Johanna); J. Laitinen (Jaana); G.M. Lathrop (Mark); D.A. Lawlor (Debbie); M. Mangino (Massimo); W.L. McArdle (Wendy); T. Meitinger (Thomas); M.A. Morken (Mario); A.P. Morris (Andrew); P. Munroe (Patricia); N. Narisu (Narisu); A. Nordström (Anna); B.A. Oostra (Ben); C.N.A. Palmer (Colin); F. Payne (Felicity); J. Peden (John); I. Prokopenko (Inga); F. Renström (Frida); A. Ruokonen (Aimo); V. Salomaa (Veikko); M.S. Sandhu (Manjinder); L.J. Scott (Laura); A. Scuteri (Angelo); K. Silander (Kaisa); K. Song (Kijoung); X. Yuan (Xin); H.M. Stringham (Heather); A.J. Swift (Amy); T. Tuomi (Tiinamaija); M. Uda (Manuela); P. Vollenweider (Peter); G. Waeber (Gérard); C. Wallace (Chris); G.B. Walters (Bragi); M.N. Weedon (Michael); J.C.M. Witteman (Jacqueline); C. Zhang (Cuilin); M. Caulfield (Mark); F.S. Collins (Francis); G.D. Smith; I.N.M. Day (Ian); P.W. Franks (Paul); A.T. Hattersley (Andrew); F.B. Hu (Frank); M.-R. Jarvelin (Marjo-Riitta); A. Kong (Augustine); J.S. Kooner (Jaspal); M. Laakso (Markku); E. Lakatta (Edward); V. Mooser (Vincent); L. Peltonen (Leena Johanna); N.J. Samani (Nilesh); T.D. Spector (Timothy); D.P. Strachan (David); T. Tanaka (Toshiko); J. Tuomilehto (Jaakko); A.G. Uitterlinden (André); P. Tikka-Kleemola (Päivi); N.J. Wareham (Nick); H. Watkins (Hugh); D. Waterworth (Dawn); M. Boehnke (Michael); P. Deloukas (Panagiotis); L. Groop (Leif); D.J. Hunter (David); U. Thorsteinsdottir (Unnur); D. Schlessinger (David); H.E. Wichmann (Erich); T.M. Frayling (Timothy); G.R. Abecasis (Gonçalo); J.N. Hirschhorn (Joel); R.J.F. Loos (Ruth); J-A. Zwart (John-Anker); K.L. Mohlke (Karen); I.E. Barroso (Inês); M.I. McCarthy (Mark)

    2009-01-01

    textabstractTo identify genetic loci influencing central obesity and fat distribution, we performed a meta-analysis of 16 genome-wide association studies (GWAS, N = 38,580) informative for adult waist circumference (WC) and waist-hip ratio (WHR). We selected 26 SNPs for follow-up, for which the

  14. Seven prostate cancer susceptibility loci identified by a multi-stage genome-wide association study

    DEFF Research Database (Denmark)

    Kote-Jarai, Zsofia; Olama, Ali Amin Al; Giles, Graham G

    2011-01-01

    Prostate cancer (PrCa) is the most frequently diagnosed male cancer in developed countries. We conducted a multi-stage genome-wide association study for PrCa and previously reported the results of the first two stages, which identified 16 PrCa susceptibility loci. We report here the results of st...

  15. The Human Genome Project and Eugenics: Identifying the Impact on Individuals with Mental Retardation.

    Science.gov (United States)

    Kuna, Jason

    2001-01-01

    This article explores the impact of the mapping work of the Human Genome Project on individuals with mental retardation and the negative effects of genetic testing. The potential to identify disabilities and the concept of eugenics are discussed, along with ethical issues surrounding potential genetic therapies. (Contains references.) (CR)

  16. Genome-wide association analysis identifies three new breast cancer susceptibility loci

    DEFF Research Database (Denmark)

    Ghoussaini, Maya; Fletcher, Olivia; Michailidou, Kyriaki

    2012-01-01

    Breast cancer is the most common cancer among women. To date, 22 common breast cancer susceptibility loci have been identified accounting for ∼8% of the heritability of the disease. We attempted to replicate 72 promising associations from two independent genome-wide association studies (GWAS...

  17. Genome-wide Analyses Identify KIF5A as a Novel ALS Gene

    NARCIS (Netherlands)

    Nicolas, Aude; Kenna, Kevin P.; Renton, Alan E.; Ticozzi, Nicola; Faghri, Faraz; Chia, Ruth; Dominov, Janice A.; Kenna, Brendan J.; Nalls, Mike A.; Keagle, Pamela; Rivera, Alberto M.; van Rheenen, Wouter; Murphy, Natalie A.; van Vugt, Joke J.F.A.; Geiger, Joshua T.; van der Spek, Rick; Pliner, Hannah A.; Smith, Bradley N.; Marangi, Giuseppe; Topp, Simon D.; Abramzon, Yevgeniya; Gkazi, Athina Soragia; Eicher, John D.; Kenna, Aoife; Logullo, Francesco O.; Simone, Isabella L.; Logroscino, Giancarlo; Salvi, Fabrizio; Bartolomei, Ilaria; Borghero, Giuseppe; Murru, Maria Rita; Costantino, Emanuela; Pani, Carla; Puddu, Roberta; Caredda, Carla; Piras, Valeria; Tranquilli, Stefania; Cuccu, Stefania; Corongiu, Daniela; Melis, Maurizio; Milia, Antonio; Marrosu, Francesco; Marrosu, Maria Giovanna; Floris, Gianluca; Cannas, Antonino; Capasso, Margherita; Caponnetto, Claudia; Mancardi, Gianluigi; Origone, Paola; Mandich, Paola; Conforti, Francesca L.; Cavallaro, Sebastiano; Mora, Gabriele; Marinou, Kalliopi; Sideri, Riccardo; Penco, Silvana; Mosca, Lorena; Lunetta, Christian; Pinter, Giuseppe Lauria; Corbo, Massimo; Riva, Nilo; Carrera, Paola; Volanti, Paolo; Mandrioli, Jessica; Fini, Nicola; Fasano, Antonio; Tremolizzo, Lucio; Arosio, Alessandro; Ferrarese, Carlo; Trojsi, Francesca; Tedeschi, Gioacchino; Monsurrò, Maria Rosaria; Piccirillo, Giovanni; Femiano, Cinzia; Ticca, Anna; Ortu, Enzo; La Bella, Vincenzo; Spataro, Rossella; Colletti, Tiziana; Sabatelli, Mario; Zollino, Marcella; Conte, Amelia; Luigetti, Marco; Lattante, Serena; Marangi, Giuseppe; Santarelli, Marialuisa; Petrucci, Antonio; Pugliatti, Maura; Pirisi, Angelo; Parish, Leslie D.; Occhineri, Patrizia; Giannini, Fabio; Battistini, Stefania; Ricci, Claudia; Benigni, Michele; Cau, Tea B.; Loi, Daniela; Calvo, Andrea; Moglia, Cristina; Brunetti, Maura; Barberis, Marco; Restagno, Gabriella; Casale, Federico; Marrali, Giuseppe; Fuda, Giuseppe; Ossola, Irene; Cammarosano, Stefania; Canosa, Antonio; Ilardi, Antonio; Manera, Umberto; Grassano, Maurizio; Tanel, Raffaella; Pisano, Fabrizio; Mora, Gabriele; Calvo, Andrea; Mazzini, Letizia; Riva, Nilo; Mandrioli, Jessica; Caponnetto, Claudia; Battistini, Stefania; Volanti, Paolo; La Bella, Vincenzo; Conforti, Francesca L.; Borghero, Giuseppe; Messina, Sonia; Simone, Isabella L.; Trojsi, Francesca; Salvi, Fabrizio; Logullo, Francesco O.; D'Alfonso, Sandra; Corrado, Lucia; Capasso, Margherita; Ferrucci, Luigi; Harms, Matthew B.; Goldstein, David B.; Shneider, Neil A.; Goutman, Stephen A.; Simmons, Zachary; Miller, Timothy M.; Chandran, Siddharthan; Pal, Suvankar; Manousakis, George; Appel, Stanley H.; Simpson, Ericka; Wang, Leo; Baloh, Robert H.; Gibson, Summer B.; Bedlack, Richard; Lacomis, David; Sareen, Dhruv; Sherman, Alexander; Bruijn, Lucie; Penny, Michelle; Moreno, Cristiane de Araujo Martins; Kamalakaran, Sitharthan; Goldstein, David B.; Allen, Andrew S.; Appel, Stanley; Baloh, Robert H.; Bedlack, Richard S.; Boone, Braden E.; Brown, Robert; Carulli, John P.; Chesi, Alessandra; Chung, Wendy K.; Cirulli, Elizabeth T.; Cooper, Gregory M.; Couthouis, Julien; Day-Williams, Aaron G.; Dion, Patrick A.; Gibson, Summer B.; Gitler, Aaron D.; Glass, Jonathan D.; Goldstein, David B.; Han, Yujun; Harms, Matthew B.; Harris, Tim; Hayes, Sebastian D.; Jones, Angela L.; Keebler, Jonathan; Krueger, Brian J.; Lasseigne, Brittany N.; Levy, Shawn E.; Lu, Yi Fan; Maniatis, Tom; McKenna-Yasek, Diane; Miller, Timothy M.; Myers, Richard M.; Petrovski, Slavé; Pulst, Stefan M.; Raphael, Alya R.; Ravits, John M.; Ren, Zhong; Rouleau, Guy A.; Sapp, Peter C.; Shneider, Neil A.; Simpson, Ericka; Sims, Katherine B.; Staropoli, John F.; Waite, Lindsay L.; Wang, Quanli; Wimbish, Jack R.; Xin, Winnie W.; Gitler, Aaron D.; Harris, Tim; Myers, Richard M.; Phatnani, Hemali; Kwan, Justin; Sareen, Dhruv; Broach, James R.; Simmons, Zachary; Arcila-Londono, Ximena; Lee, Edward B.; Van Deerlin, Vivianna M.; Shneider, Neil A.; Fraenkel, Ernest; Ostrow, Lyle W.; Baas, Frank; Zaitlen, Noah; Berry, James D.; Malaspina, Andrea; Fratta, Pietro; Cox, Gregory A.; Thompson, Leslie M.; Finkbeiner, Steve; Dardiotis, Efthimios; Miller, Timothy M.; Chandran, Siddharthan; Pal, Suvankar; Hornstein, Eran; MacGowan, Daniel J.L.; Heiman-Patterson, Terry D.; Hammell, Molly G.; Patsopoulos, Nikolaos A.; Dubnau, Joshua; Nath, Avindra; Phatnani, Hemali; Musunuri, Rajeeva Lochan; Evani, Uday Shankar; Abhyankar, Avinash; Zody, Michael C.; Kaye, Julia; Finkbeiner, Steven; Wyman, Stacia K.; LeNail, Alexander; Lima, Leandro; Fraenkel, Ernest; Rothstein, Jeffrey D.; Svendsen, Clive N.; Thompson, Leslie M.; Van Eyk, Jenny; Maragakis, Nicholas J.; Berry, James D.; Glass, Jonathan D.; Miller, Timothy M.; Kolb, Stephen J.; Baloh, Robert H.; Cudkowicz, Merit; Baxi, Emily; Kaye, Julia; Finkbeiner, Steven; Wyman, Stacia K.; Finkbeiner, Steven; LeNail, Alex; Lima, Leandro; Fraenkel, Ernest; Fraenkel, Ernest; Svendsen, Clive N.; Svendsen, Clive N.; Thompson, Leslie M.; Thompson, Leslie M.; Van Eyk, Jennifer E.; Berry, James D.; Berry, James D.; Miller, Timothy M.; Kolb, Stephen J.; Cudkowicz, Merit; Cudkowicz, Merit; Baxi, Emily; Benatar, Michael; Taylor, J. Paul; Wu, Gang; Rampersaud, Evadnie; Wuu, Joanne; Rademakers, Rosa; Züchner, Stephan; Schule, Rebecca; McCauley, Jacob; Hussain, Sumaira; Cooley, Anne; Wallace, Marielle; Clayman, Christine; Barohn, Richard; Statland, Jeffrey; Ravits, John M.; Swenson, Andrea; Jackson, Carlayne; Trivedi, Jaya; Khan, Shaida; Katz, Jonathan; Jenkins, Liberty; Burns, Ted; Gwathmey, Kelly; Caress, James; McMillan, Corey; Elman, Lauren; Pioro, Erik P.; Heckmann, Jeannine; So, Yuen; Walk, David; Maiser, Samuel; Zhang, Jinghui; Benatar, Michael; Taylor, J. Paul; Taylor, J. Paul; Rampersaud, Evadnie; Wu, Gang; Wuu, Joanne; Silani, Vincenzo; Ticozzi, Nicola; Gellera, Cinzia; Ratti, Antonia; Taroni, Franco; Lauria, Giuseppe; Verde, Federico; Fogh, Isabella; Tiloca, Cinzia; Comi, Giacomo P.; Sorarù, Gianni; Cereda, Cristina; D'Alfonso, Sandra; Corrado, Lucia; De Marchi, Fabiola; Corti, Stefania; Ceroni, Mauro; Mazzini, Letizia; Siciliano, Gabriele; Filosto, Massimiliano; Inghilleri, Maurizio; Peverelli, Silvia; Colombrita, Claudia; Poletti, Barbara; Maderna, Luca; Del Bo, Roberto; Gagliardi, Stella; Querin, Giorgia; Bertolin, Cinzia; Pensato, Viviana; Castellotti, Barbara; Lauria, Giuseppe; Verde, Federico; Fogh, Isabella; Tiloca, Cinzia; Fogh, Isabella; Comi, Giacomo P.; Sorarù, Gianni; Cereda, Cristina; Camu, William; Mouzat, Kevin; Lumbroso, Serge; Corcia, Philippe; Meininger, Vincent; Besson, Gérard; Lagrange, Emmeline; Clavelou, Pierre; Guy, Nathalie; Couratier, Philippe; Vourch, Patrick; Danel, Véronique; Bernard, Emilien; Lemasson, Gwendal; Corcia, Philippe; Laaksovirta, Hannu; Myllykangas, Liisa; Jansson, Lilja; Valori, Miko; Ealing, John; Hamdalla, Hisham; Rollinson, Sara; Pickering-Brown, Stuart; Orrell, Richard W.; Sidle, Katie C.; Malaspina, Andrea; Hardy, John; Singleton, Andrew B.; Johnson, Janel O.; Arepalli, Sampath; Sapp, Peter C.; McKenna-Yasek, Diane; Polak, Meraida; Asress, Seneshaw; Al-Sarraj, Safa; King, Andrew; Troakes, Claire; Vance, Caroline; de Belleroche, Jacqueline; Baas, Frank; ten Asbroek, Anneloor L.M.A.; Muñoz-Blanco, José Luis; Hernandez, Dena G.; Ding, Jinhui; Gibbs, J. Raphael; Scholz, Sonja W.; Scholz, Sonja W.; Floeter, Mary Kay; Campbell, Roy H.; Landi, Francesco; Bowser, Robert; Pulst, Stefan M.; Ravits, John M.; MacGowan, Daniel J.L.; Kirby, Janine; Pioro, Erik P.; Pamphlett, Roger; Broach, James; Gerhard, Glenn; Dunckley, Travis L.; Brady, Christopher B.; Brady, Christopher B.; Kowall, Neil W.; Troncoso, Juan C.; Le Ber, Isabelle; Mouzat, Kevin; Lumbroso, Serge; Mouzat, Kevin; Lumbroso, Serge; Heiman-Patterson, Terry D.; Heiman-Patterson, Terry D.; Kamel, Freya; Van Den Bosch, Ludo; Van Den Bosch, Ludo; Baloh, Robert H.; Strom, Tim M.; Meitinger, Thomas; Strom, Tim M.; Shatunov, Aleksey; Van Eijk, Kristel R.; de Carvalho, Mamede; de Carvalho, Mamede; Kooyman, Maarten; Middelkoop, Bas; Moisse, Matthieu; McLaughlin, Russell; Van Es, Michael A.; Weber, Markus; Boylan, Kevin B.; Van Blitterswijk, Marka; Rademakers, Rosa; Morrison, Karen; Basak, A. Nazli; Mora, Jesús S.; Drory, Vivian; Shaw, Pamela; Turner, Martin R.; Talbot, Kevin; Hardiman, Orla; Williams, Kelly L.; Fifita, Jennifer A.; Nicholson, Garth A.; Blair, Ian P.; Nicholson, Garth A.; Rouleau, Guy A.; Esteban-Pérez, Jesús; García-Redondo, Alberto; Al-Chalabi, Ammar; Al Kheifat, Ahmad; Al-Chalabi, Ammar; Andersen, Peter M.; Basak, A. Nazli; Blair, Ian P.; Chio, Adriano; Cooper-Knock, Jonathan; Corcia, Philippe; Couratier, Philippe; de Carvalho, Mamede; Dekker, Annelot; Drory, Vivian; Redondo, Alberto Garcia; Gotkine, Marc; Hardiman, Orla; Hide, Winston; Iacoangeli, Alfredo; Glass, Jonathan D.; Kenna, Kevin P.; Kiernan, Matthew; Kooyman, Maarten; Landers, John E.; McLaughlin, Russell; Middelkoop, Bas; Mill, Jonathan; Neto, Miguel Mitne; Moisse, Matthieu; Pardina, Jesus Mora; Morrison, Karen; Newhouse, Stephen; Pinto, Susana; Pulit, Sara; Robberecht, Wim; Shatunov, Aleksey; Shaw, Pamela; Shaw, Chris; Silani, Vincenzo; Sproviero, William; Tazelaar, Gijs; Ticozzi, Nicola; Van Damme, Philip; van den Berg, Leonard; van der Spek, Rick; Van Eijk, Kristel R.; Van Es, Michael A.; van Rheenen, Wouter; van Vugt, Joke J.F.A.; Veldink, Jan H.; Weber, Markus; Williams, Kelly L.; Van Damme, Philip; Robberecht, Wim; Zatz, Mayana; Robberecht, Wim; Bauer, Denis C.; Twine, Natalie A.; Rogaeva, Ekaterina; Zinman, Lorne; Ostrow, Lyle W.; Maragakis, Nicholas J.; Rothstein, Jeffrey D.; Simmons, Zachary; Cooper-Knock, Johnathan; Brice, Alexis; Goutman, Stephen A.; Feldman, Eva L.; Gibson, Summer B.; Taroni, Franco; Ratti, Antonia; Ratti, Antonia; Gellera, Cinzia; Van Damme, Philip; Robberecht, Wim; Fratta, Pietro; Sabatelli, Mario; Lunetta, Christian; Ludolph, Albert C.; Andersen, Peter M.; Weishaupt, Jochen H.; Camu, William; Trojanowski, John Q.; Van Deerlin, Vivianna M.; Brown, Robert H.; van den Berg, Leonard; Veldink, Jan H.; Harms, Matthew B.; Glass, Jonathan D.; Stone, David J.; Tienari, Pentti; Silani, Vincenzo; Silani, Vincenzo; Chiò, Adriano; Shaw, Christopher E.; Chiò, Adriano; Traynor, Bryan J.; Landers, John E.; Traynor, Bryan J.

    2018-01-01

    To identify novel genes associated with ALS, we undertook two lines of investigation. We carried out a genome-wide association study comparing 20,806 ALS cases and 59,804 controls. Independently, we performed a rare variant burden analysis comparing 1,138 index familial ALS cases and 19,494

  18. Genome-wide association analyses identify 18 new loci associated with serum urate concentrations

    NARCIS (Netherlands)

    Kottgen, A.; Albrecht, E.; Teumer, A.; Vitart, V.; Krumsiek, J.; Hundertmark, C.; Pistis, G.; Ruggiero, D.; O'Seaghdha, C.M.; Haller, T.; Yang, Q.; Johnson, A.D.; Kutalik, Z.; Smith, A.V.; Shi, J.L.; Struchalin, M.; Middelberg, R.P.S.; Brown, M.J.; Gaffo, A.L.; Pirastu, N.; Li, G.; Hayward, C.; Zemunik, T.; Huffman, J.; Yengo, L.; Zhao, J.H.; Demirkan, A.; Feitosa, M.F.; Liu, X.; Malerba, G.; Lopez, L.M.; van der Harst, P.; Li, X.Z.; Kleber, M.E.; Hicks, A.A.; Nolte, I.M.; Johansson, A.; Murgia, F.; Wild, S.H.; Bakker, S.J.L.; Peden, J.F.; Dehghan, A.; Steri, M.; Tenesa, A.; Lagou, V.; Salo, P.; Mangino, M.; Rose, L.M.; Lehtimaki, T.; Woodward, O.M.; Okada, Y.; Tin, A.; Muller, C.; Oldmeadow, C.; Putku, M.; Czamara, D.; Kraft, P.; Frogheri, L.; Thun, G.A.; Grotevendt, A.; Gislason, G.K.; Harris, T.B.; Launer, L.J.; McArdle, P.; Shuldiner, A.R.; Boerwinkle, E.; Coresh, J.; Schmidt, H.; Schallert, M.; Martin, N.G.; Montgomery, G.W.; Kubo, M.; Nakamura, Y.; Tanaka, T.; Munroe, P.B.; Samani, N.J.; Jacobs, D.R.; Liu, K.; d'Adamo, P.; Ulivi, S.; Rotter, J.I.; Psaty, B.M.; Vollenweider, P.; Waeber, G.; Campbell, S.; Devuyst, O.; Navarro, P.; Kolcic, I.; Hastie, N.; Balkau, B.; Froguel, P.; Esko, T.; Salumets, A.; Khaw, K.T.; Langenberg, C.; Wareham, N.J.; Isaacs, A.; Kraja, A.; Zhang, Q.Y.; Penninx, B.W.J.H.; Smit, J.H.; Bochud, M.; Gieger, C.

    2013-01-01

    Elevated serum urate concentrations can cause gout, a prevalent and painful inflammatory arthritis. By combining data from >140,000 individuals of European ancestry within the Global Urate Genetics Consortium (GUGC), we identified and replicated 28 genome-wide significant loci in association with

  19. Genome-wide association analyses identify 18 new loci associated with serum urate concentrations

    NARCIS (Netherlands)

    Köttgen, Anna; Albrecht, Eva; Teumer, Alexander; Vitart, Veronique; Krumsiek, Jan; Hundertmark, Claudia; Pistis, Giorgio; Ruggiero, Daniela; O'Seaghdha, Conall M; Haller, Toomas; Yang, Qiong; Tanaka, Toshiko; Johnson, Andrew D; Kutalik, Zoltán; Smith, Albert V; Shi, Julia; Struchalin, Maksim; Middelberg, Rita P S; Brown, Morris J; Gaffo, Angelo L; Pirastu, Nicola; Li, Guo; Hayward, Caroline; Zemunik, Tatijana; Huffman, Jennifer; Yengo, Loic; Zhao, Jing Hua; Demirkan, Ayse; Feitosa, Mary F; Liu, Xuan; Malerba, Giovanni; Lopez, Lorna M; van der Harst, Pim; Li, Xinzhong; Kleber, Marcus E; Hicks, Andrew A; Nolte, Ilja M; Johansson, Asa; Murgia, Federico; Bakker, Stephan J L; Lagou, Vasiliki; Bruinenberg, Marcel; Stolk, Ronald P; Penninx, Brenda W; Mateo Leach, Irene; van Gilst, Wiek H; Hillege, Hans L; Wolffenbuttel, Bruce H R; Snieder, Harold; Navis, Gerjan

    Elevated serum urate concentrations can cause gout, a prevalent and painful inflammatory arthritis. By combining data from >140,000 individuals of European ancestry within the Global Urate Genetics Consortium (GUGC), we identified and replicated 28 genome-wide significant loci in association with

  20. Genome-wide association study identifies multiple susceptibility loci for diffuse large B cell lymphoma

    NARCIS (Netherlands)

    Cerhan, James R.; Berndt, Sonja I.; Vijai, Joseph; Ghesquières, Hervé; McKay, James; Wang, Sophia S.; Wang, Zhaoming; Yeager, Meredith; Conde, Lucia; De Bakker, Paul I W; Nieters, Alexandra; Cox, David; Burdett, Laurie; Monnereau, Alain; Flowers, Christopher R.; De Roos, Anneclaire J.; Brooks-Wilson, Angela R.; Lan, Qing; Severi, Gianluca; Melbye, Mads; Gu, Jian; Jackson, Rebecca D.; Kane, Eleanor; Teras, Lauren R.; Purdue, Mark P.; Vajdic, Claire M.; Spinelli, John J.; Giles, Graham G.; Albanes, Demetrius; Kelly, Rachel S.; Zucca, Mariagrazia; Bertrand, Kimberly A.; Zeleniuch-Jacquotte, Anne; Lawrence, Charles; Hutchinson, Amy; Zhi, Degui; Habermann, Thomas M.; Link, Brian K.; Novak, Anne J.; Dogan, Ahmet; Asmann, Yan W.; Liebow, Mark; Thompson, Carrie A.; Ansell, Stephen M.; Witzig, Thomas E.; Weiner, George J.; Veron, Amelie S.; Zelenika, Diana; Tilly, Hervé; Haioun, Corinne; Molina, Thierry Jo; Hjalgrim, Henrik; Glimelius, Bengt; Adami, Hans Olov; Bracci, Paige M.; Riby, Jacques; Smith, Martyn T.; Holly, Elizabeth A.; Cozen, Wendy; Hartge, Patricia; Morton, Lindsay M.; Severson, Richard K.; Tinker, Lesley F.; North, Kari E.; Becker, Nikolaus; Benavente, Yolanda; Boffetta, Paolo; Brennan, Paul; Foretova, Lenka; Maynadie, Marc; Staines, Anthony; Lightfoot, Tracy; Crouch, Simon; Smith, Alex; Roman, Eve; Diver, W. Ryan; Offit, Kenneth; Zelenetz, Andrew; Klein, Robert J.; Villano, Danylo J.; Zheng, Tongzhang; Zhang, Yawei; Holford, Theodore R.; Kricker, Anne; Turner, Jenny; Southey, Melissa C.; Clavel, Jacqueline; Virtamo, Jarmo; Weinstein, Stephanie; Riboli, Elio; Vineis, Paolo; Kaaks, Rudolph; Trichopoulos, Dimitrios; Vermeulen, Roel C H; Boeing, Heiner; Tjonneland, Anne; Angelucci, Emanuele; Di Lollo, Simonetta; Rais, Marco; Birmann, Brenda M.; Laden, Francine; Giovannucci, Edward; Kraft, Peter; Huang, Jinyan; Ma, Baoshan; Ye, Yuanqing; Chiu, Brian C H; Sampson, Joshua; Liang, Liming; Park, Ju Hyun; Chung, Charles C.; Weisenburger, Dennis D.; Chatterjee, Nilanjan; Fraumeni, Joseph F.; Slager, Susan L.; Wu, Xifeng; De Sanjose, Silvia; Smedby, Karin E.; Salles, Gilles; Skibola, Christine F.; Rothman, Nathaniel; Chanock, Stephen J.

    2014-01-01

    Diffuse large B cell lymphoma (DLBCL) is the most common lymphoma subtype and is clinically aggressive. To identify genetic susceptibility loci for DLBCL, we conducted a meta-analysis of 3 new genome-wide association studies (GWAS) and 1 previous scan, totaling 3,857 cases and 7,666 controls of

  1. Genome-wide association study identifies three novel loci for type 2 diabetes

    DEFF Research Database (Denmark)

    Hara, Kazuo; Fujita, Hayato; Johnson, Todd A

    2014-01-01

    Although over 60 loci for type 2 diabetes (T2D) have been identified, there still remains a large genetic component to be clarified. To explore unidentified loci for T2D, we performed a genome-wide association study (GWAS) of 6 209 637 single-nucleotide polymorphisms (SNPs), which were directly g...

  2. Identification, characterization, and utilization of genome-wide simple sequence repeats to identify a QTL for acidity in apple

    Science.gov (United States)

    2012-01-01

    Background Apple is an economically important fruit crop worldwide. Developing a genetic linkage map is a critical step towards mapping and cloning of genes responsible for important horticultural traits in apple. To facilitate linkage map construction, we surveyed and characterized the distribution and frequency of perfect microsatellites in assembled contig sequences of the apple genome. Results A total of 28,538 SSRs have been identified in the apple genome, with an overall density of 40.8 SSRs per Mb. Di-nucleotide repeats are the most frequent microsatellites in the apple genome, accounting for 71.9% of all microsatellites. AT/TA repeats are the most frequent in genomic regions, accounting for 38.3% of all the G-SSRs, while AG/GA dimers prevail in transcribed sequences, and account for 59.4% of all EST-SSRs. A total set of 310 SSRs is selected to amplify eight apple genotypes. Of these, 245 (79.0%) are found to be polymorphic among cultivars and wild species tested. AG/GA motifs in genomic regions have detected more alleles and higher PIC values than AT/TA or AC/CA motifs. Moreover, AG/GA repeats are more variable than any other dimers in apple, and should be preferentially selected for studies, such as genetic diversity and linkage map construction. A total of 54 newly developed apple SSRs have been genetically mapped. Interestingly, clustering of markers with distorted segregation is observed on linkage groups 1, 2, 10, 15, and 16. A QTL responsible for malic acid content of apple fruits is detected on linkage group 8, and accounts for ~13.5% of the observed phenotypic variation. Conclusions This study demonstrates that di-nucleotide repeats are prevalent in the apple genome and that AT/TA and AG/GA repeats are the most frequent in genomic and transcribed sequences of apple, respectively. All SSR motifs identified in this study as well as those newly mapped SSRs will serve as valuable resources for pursuing apple genetic studies, aiding the apple breeding

  3. The Importance of Bacterial Culture to Food Microbiology in the Age of Genomics.

    Science.gov (United States)

    Gill, Alexander

    2017-01-01

    Culture-based and genomics methods provide different insights into the nature and behavior of bacteria. Maximizing the usefulness of both approaches requires recognizing their limitations and employing them appropriately. Genomic analysis excels at identifying bacteria and establishing the relatedness of isolates. Culture-based methods remain necessary for detection and enumeration, to determine viability, and to validate phenotype predictions made on the bias of genomic analysis. The purpose of this short paper is to discuss the application of culture-based analysis and genomics to the questions food microbiologists routinely need to ask regarding bacteria to ensure the safety of food and its economic production and distribution. To address these issues appropriate tools are required for the detection and enumeration of specific bacterial populations and the characterization of isolates for, identification, phylogenetics, and phenotype prediction.

  4. Whole genome association study identifies regions of the bovine genome and biological pathways involved in carcass trait performance in Holstein-Friesian cattle.

    Science.gov (United States)

    Doran, Anthony G; Berry, Donagh P; Creevey, Christopher J

    2014-10-01

    Four traits related to carcass performance have been identified as economically important in beef production: carcass weight, carcass fat, carcass conformation of progeny and cull cow carcass weight. Although Holstein-Friesian cattle are primarily utilized for milk production, they are also an important source of meat for beef production and export. Because of this, there is great interest in understanding the underlying genomic structure influencing these traits. Several genome-wide association studies have identified regions of the bovine genome associated with growth or carcass traits, however, little is known about the mechanisms or underlying biological pathways involved. This study aims to detect regions of the bovine genome associated with carcass performance traits (employing a panel of 54,001 SNPs) using measures of genetic merit (as predicted transmitting abilities) for 5,705 Irish Holstein-Friesian animals. Candidate genes and biological pathways were then identified for each trait under investigation. Following adjustment for false discovery (q-value carcass traits using a single SNP regression approach. Using a Bayesian approach, 46 QTL were associated (posterior probability > 0.5) with at least one of the four traits. In total, 557 unique bovine genes, which mapped to 426 human orthologs, were within 500kbs of QTL found associated with a trait using the Bayesian approach. Using this information, 24 significantly over-represented pathways were identified across all traits. The most significantly over-represented biological pathway was the peroxisome proliferator-activated receptor (PPAR) signaling pathway. A large number of genomic regions putatively associated with bovine carcass traits were detected using two different statistical approaches. Notably, several significant associations were detected in close proximity to genes with a known role in animal growth such as glucagon and leptin. Several biological pathways, including PPAR signaling, were

  5. Genome-wide association study with 1000 genomes imputation identifies signals for nine sex hormone-related phenotypes.

    Science.gov (United States)

    Ruth, Katherine S; Campbell, Purdey J; Chew, Shelby; Lim, Ee Mun; Hadlow, Narelle; Stuckey, Bronwyn G A; Brown, Suzanne J; Feenstra, Bjarke; Joseph, John; Surdulescu, Gabriela L; Zheng, Hou Feng; Richards, J Brent; Murray, Anna; Spector, Tim D; Wilson, Scott G; Perry, John R B

    2016-02-01

    Genetic factors contribute strongly to sex hormone levels, yet knowledge of the regulatory mechanisms remains incomplete. Genome-wide association studies (GWAS) have identified only a small number of loci associated with sex hormone levels, with several reproductive hormones yet to be assessed. The aim of the study was to identify novel genetic variants contributing to the regulation of sex hormones. We performed GWAS using genotypes imputed from the 1000 Genomes reference panel. The study used genotype and phenotype data from a UK twin register. We included 2913 individuals (up to 294 males) from the Twins UK study, excluding individuals receiving hormone treatment. Phenotypes were standardised for age, sex, BMI, stage of menstrual cycle and menopausal status. We tested 7,879,351 autosomal SNPs for association with levels of dehydroepiandrosterone sulphate (DHEAS), oestradiol, free androgen index (FAI), follicle-stimulating hormone (FSH), luteinizing hormone (LH), prolactin, progesterone, sex hormone-binding globulin and testosterone. Eight independent genetic variants reached genome-wide significance (P<5 × 10(-8)), with minor allele frequencies of 1.3-23.9%. Novel signals included variants for progesterone (P=7.68 × 10(-12)), oestradiol (P=1.63 × 10(-8)) and FAI (P=1.50 × 10(-8)). A genetic variant near the FSHB gene was identified which influenced both FSH (P=1.74 × 10(-8)) and LH (P=3.94 × 10(-9)) levels. A separate locus on chromosome 7 was associated with both DHEAS (P=1.82 × 10(-14)) and progesterone (P=6.09 × 10(-14)). This study highlights loci that are relevant to reproductive function and suggests overlap in the genetic basis of hormone regulation.

  6. Use of microsatellite markers derived from whole genome sequence data for identifying polymorphism in Phytophthora ramorum

    Science.gov (United States)

    Kelly Ivors; Matteo Garbelotto; Ineke De Vries; Peter Bonants

    2006-01-01

    Investigating the population genetics of Phytophthora ramorum, the causal agent of sudden oak death (SOD), is critical to understanding the biology and epidemiology of this important phytopathogen. Raw sequence data (445,000 reads) of P. ramorum was provided by the Joint Genome Institute. Our objective was to develop and utilize...

  7. Meta-analyses of genome-wide association studies identify multiple loci associated with pulmonary function

    NARCIS (Netherlands)

    D.B. Hancock (Dana); M. Eijgelsheim (Mark); J.B. Wilk (Jemma); S.A. Gharib (Sina); L.R. Loehr (Laura); K. Marciante (Kristin); N. Franceschini (Nora); Y.M.T.A. van Durme; T.H. Chen; R.G. Barr (Graham); M.B. Schabath (Matthew); D.J. Couper (David); G.G. Brusselle (Guy); B.M. Psaty (Bruce); P. Tikka-Kleemola (Päivi); J.I. Rotter (Jerome); A.G. Uitterlinden (André); A. Hofman (Albert); N.M. Punjabi (Naresh); F. Rivadeneira Ramirez (Fernando); A.C. Morrison (Alanna); P.L. Enright (Paul); K.E. North (Kari); S.R. Heckbert (Susan); T. Lumley (Thomas); B.H.Ch. Stricker (Bruno); G.T. O'Connor (George); S.J. London (Stephanie)

    2010-01-01

    textabstractSpirometric measures of lung function are heritable traits that reflect respiratory health and predict morbidity and mortality. We meta-analyzed genome-wide association studies for two clinically important lung-function measures: forced expiratory volume in the first second (FEV1) and

  8. Comparative genomic analysis of Helicobacter pylori from Malaysia identifies three distinct lineages suggestive of differential evolution.

    Science.gov (United States)

    Kumar, Narender; Mariappan, Vanitha; Baddam, Ramani; Lankapalli, Aditya K; Shaik, Sabiha; Goh, Khean-Lee; Loke, Mun Fai; Perkins, Tim; Benghezal, Mohammed; Hasnain, Seyed E; Vadivelu, Jamuna; Marshall, Barry J; Ahmed, Niyaz

    2015-01-01

    The discordant prevalence of Helicobacter pylori and its related diseases, for a long time, fostered certain enigmatic situations observed in the countries of the southern world. Variation in H. pylori infection rates and disease outcomes among different populations in multi-ethnic Malaysia provides a unique opportunity to understand dynamics of host-pathogen interaction and genome evolution. In this study, we extensively analyzed and compared genomes of 27 Malaysian H. pylori isolates and identified three major phylogeographic lineages: hspEastAsia, hpEurope and hpSouthIndia. The analysis of the virulence genes within the core genome, however, revealed a comparable pathogenic potential of the strains. In addition, we identified four genes limited to strains of East-Asian lineage. Our analyses identified a few strain-specific genes encoding restriction modification systems and outlined 311 core genes possibly under differential evolutionary constraints, among the strains representing different ethnic groups. The cagA and vacA genes also showed variations in accordance with the host genetic background of the strains. Moreover, restriction modification genes were found to be significantly enriched in East-Asian strains. An understanding of these variations in the genome content would provide significant insights into various adaptive and host modulation strategies harnessed by H. pylori to effectively persist in a host-specific manner. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Incidental copy-number variants identified by routine genome testing in a clinical population

    Science.gov (United States)

    Boone, Philip M.; Soens, Zachry T.; Campbell, Ian M.; Stankiewicz, Pawel; Cheung, Sau Wai; Patel, Ankita; Beaudet, Arthur L.; Plon, Sharon E.; Shaw, Chad A.; McGuire, Amy L.; Lupski, James R.

    2013-01-01

    Purpose Mutational load of susceptibility variants has not been studied on a genomic scale in a clinical population, nor has the potential to identify these mutations as incidental findings during clinical testing been systematically ascertained. Methods Array comparative genomic hybridization, a method for genome-wide detection of DNA copy-number variants, was performed clinically on DNA from 9,005 individuals. Copy-number variants encompassing or disrupting single genes were identified and analyzed for their potential to confer predisposition to dominant, adult-onset disease. Multigene copy-number variants affecting dominant, adult-onset cancer syndrome genes were also assessed. Results In our cohort, 83 single-gene copy-number variants affected 40 unique genes associated with dominant, adult-onset disorders and unrelated to the patients’ referring diagnoses (i.e., incidental) were found. Fourteen of these copy-number variants are likely disease-predisposing, 25 are likely benign, and 44 are of unknown clinical consequence. When incidental copy-number variants spanning up to 20 genes were considered, 27 copy-number variants affected 17 unique genes associated with dominant, adult-onset cancer predisposition. Conclusion Copy-number variants potentially conferring susceptibility to adult-onset disease can be identified as incidental findings during routine genome-wide testing. Some of these mutations may be medically actionable, enabling disease surveillance or prevention; however, most incidentally observed single-gene copy-number variants are currently of unclear significance to the patient. PMID:22878507

  10. Comparative genome analysis identifies two large deletions in the genome of highly-passaged attenuated Streptococcus agalactiae strain YM001 compared to the parental pathogenic strain HN016.

    Science.gov (United States)

    Wang, Rui; Li, Liping; Huang, Yan; Luo, Fuguang; Liang, Wanwen; Gan, Xi; Huang, Ting; Lei, Aiying; Chen, Ming; Chen, Lianfu

    2015-11-04

    Streptococcus agalactiae (S. agalactiae), also known as group B Streptococcus (GBS), is an important pathogen for neonatal pneumonia, meningitis, bovine mastitis, and fish meningoencephalitis. The global outbreaks of Streptococcus disease in tilapia cause huge economic losses and threaten human food hygiene safety as well. To investigate the mechanism of S. agalactiae pathogenesis in tilapia and develop attenuated S. agalactiae vaccine, this study sequenced and comparatively analyzed the whole genomes of virulent wild-type S. agalactiae strain HN016 and its highly-passaged attenuated strain YM001 derived from tilapia. We performed Illumina sequencing of DNA prepared from strain HN016 and YM001. Sequencedreads were assembled and nucleotide comparisons, single nucleotide polymorphism (SNP) , indels were analyzed between the draft genomes of HN016 and YM001. Clustered regularly interspaced short palindromic repeats (CRISPRs) and prophage were detected and analyzed in different S. agalactiae strains. The genome of S. agalactiae YM001 was 2,047,957 bp with a GC content of 35.61 %; it contained 2044 genes and 88 RNAs. Meanwhile, the genome of S. agalactiae HN016 was 2,064,722 bp with a GC content of 35.66 %; it had 2063 genes and 101 RNAs. Comparative genome analysis indicated that compared with HN016, YM001 genome had two significant large deletions, at the sizes of 5832 and 11,116 bp respectively, resulting in the deletion of three rRNA and ten tRNA genes, as well as the deletion and functional damage of ten genes related to metabolism, transport, growth, anti-stress, etc. Besides these two large deletions, other ten deletions and 28 single nucleotide variations (SNVs) were also identified, mainly affecting the metabolism- and growth-related genes. The genome of attenuated S. agalactiae YM001 showed significant variations, resulting in the deletion of 10 functional genes, compared to the parental pathogenic strain HN016. The deleted and mutated functional genes all

  11. Pan-Genome Analysis of Human Gastric Pathogen H. pylori: Comparative Genomics and Pathogenomics Approaches to Identify Regions Associated with Pathogenicity and Prediction of Potential Core Therapeutic Targets

    DEFF Research Database (Denmark)

    Ali, Amjad; Naz, Anam; Soares, Siomar C.

    2015-01-01

    -genome approach; the predicted conserved gene families (1,193) constitute similar to 77% of the average H. pylori genome and 45% of the global gene repertoire of the species. Reverse vaccinology strategies have been adopted to identify and narrow down the potential core-immunogenic candidates. Total of 28 nonhost....... Pan-genome analyses of the global representative H. pylori isolates consisting of 39 complete genomes are presented in this paper. Phylogenetic analyses have revealed close relationships among geographically diverse strains of H. pylori. The conservation among these genomes was further analyzed by pan...

  12. Identifying anti-growth factors for human cancer cell lines through genome-scale metabolic modeling

    DEFF Research Database (Denmark)

    Ghaffari, Pouyan; Mardinoglu, Adil; Asplund, Anna

    2015-01-01

    Human cancer cell lines are used as important model systems to study molecular mechanisms associated with tumor growth, hereunder how genomic and biological heterogeneity found in primary tumors affect cellular phenotypes. We reconstructed Genome scale metabolic models (GEMs) for eleven cell lines...... based on RNA-Seq data and validated the functionality of these models with data from metabolite profiling. We used cell line-specific GEMs to analyze the differences in the metabolism of cancer cell lines, and to explore the heterogeneous expression of the metabolic subsystems. Furthermore, we predicted...... for inhibition of cell growth may provide leads for the development of efficient cancer treatment strategies....

  13. Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder

    Science.gov (United States)

    Yuen, Ryan KC; Merico, Daniele; Bookman, Matt; Howe, Jennifer L; Thiruvahindrapuram, Bhooma; Patel, Rohan V; Whitney, Joe; Deflaux, Nicole; Bingham, Jonathan; Wang, Zhuozhi; Pellecchia, Giovanna; Buchanan, Janet A; Walker, Susan; Marshall, Christian R; Uddin, Mohammed; Zarrei, Mehdi; Deneault, Eric; D’Abate, Lia; Chan, Ada JS; Koyanagi, Stephanie; Paton, Tara; Pereira, Sergio L; Hoang, Ny; Engchuan, Worrawat; Higginbotham, Edward J; Ho, Karen; Lamoureux, Sylvia; Li, Weili; MacDonald, Jeffrey R; Nalpathamkalam, Thomas; Sung, Wilson WL; Tsoi, Fiona J; Wei, John; Xu, Lizhen; Tasse, Anne-Marie; Kirby, Emily; Van Etten, William; Twigger, Simon; Roberts, Wendy; Drmic, Irene; Jilderda, Sanne; Modi, Bonnie MacKinnon; Kellam, Barbara; Szego, Michael; Cytrynbaum, Cheryl; Weksberg, Rosanna; Zwaigenbaum, Lonnie; Woodbury-Smith, Marc; Brian, Jessica; Senman, Lili; Iaboni, Alana; Doyle-Thomas, Krissy; Thompson, Ann; Chrysler, Christina; Leef, Jonathan; Savion-Lemieux, Tal; Smith, Isabel M; Liu, Xudong; Nicolson, Rob; Seifer, Vicki; Fedele, Angie; Cook, Edwin H; Dager, Stephen; Estes, Annette; Gallagher, Louise; Malow, Beth A; Parr, Jeremy R; Spence, Sarah J; Vorstman, Jacob; Frey, Brendan J; Robinson, James T; Strug, Lisa J; Fernandez, Bridget A; Elsabbagh, Mayada; Carter, Melissa T; Hallmayer, Joachim; Knoppers, Bartha M; Anagnostou, Evdokia; Szatmari, Peter; Ring, Robert H; Glazer, David; Pletcher, Mathew T; Scherer, Stephen W

    2017-01-01

    We are performing whole genome sequencing (WGS) of families with Autism Spectrum Disorder (ASD) to build a resource, named MSSNG, to enable the sub-categorization of phenotypes and underlying genetic factors involved. Here, we report WGS of 5,205 samples from families with ASD, accompanied by clinical information, creating a database accessible in a cloud platform, and through an internet portal with controlled access. We found an average of 73.8 de novo single nucleotide variants and 12.6 de novo insertion/deletions (indels) or copy number variations (CNVs) per ASD subject. We identified 18 new candidate ASD-risk genes such as MED13 and PHF3, and found that participants bearing mutations in susceptibility genes had significantly lower adaptive ability (p=6×10−4). In 294/2,620 (11.2%) of ASD cases, a molecular basis could be determined and 7.2% of these carried CNV/chromosomal abnormalities, emphasizing the importance of detecting all forms of genetic variation as diagnostic and therapeutic targets in ASD. PMID:28263302

  14. Integrative genomic analysis identifies isoleucine and CodY as regulators of Listeria monocytogenes virulence.

    Directory of Open Access Journals (Sweden)

    Lior Lobel

    2012-09-01

    Full Text Available Intracellular bacterial pathogens are metabolically adapted to grow within mammalian cells. While these adaptations are fundamental to the ability to cause disease, we know little about the relationship between the pathogen's metabolism and virulence. Here we used an integrative Metabolic Analysis Tool that combines transcriptome data with genome-scale metabolic models to define the metabolic requirements of Listeria monocytogenes during infection. Twelve metabolic pathways were identified as differentially active during L. monocytogenes growth in macrophage cells. Intracellular replication requires de novo synthesis of histidine, arginine, purine, and branch chain amino acids (BCAAs, as well as catabolism of L-rhamnose and glycerol. The importance of each metabolic pathway during infection was confirmed by generation of gene knockout mutants in the respective pathways. Next, we investigated the association of these metabolic requirements in the regulation of L. monocytogenes virulence. Here we show that limiting BCAA concentrations, primarily isoleucine, results in robust induction of the master virulence activator gene, prfA, and the PrfA-regulated genes. This response was specific and required the nutrient responsive regulator CodY, which is known to bind isoleucine. Further analysis demonstrated that CodY is involved in prfA regulation, playing a role in prfA activation under limiting conditions of BCAAs. This study evidences an additional regulatory mechanism underlying L. monocytogenes virulence, placing CodY at the crossroads of metabolism and virulence.

  15. Genome-wide RNAi screen identifies novel host proteins required for alphavirus entry.

    Directory of Open Access Journals (Sweden)

    Yaw Shin Ooi

    Full Text Available The enveloped alphaviruses include important and emerging human pathogens such as Chikungunya virus and Eastern equine encephalitis virus. Alphaviruses enter cells by clathrin-mediated endocytosis, and exit by budding from the plasma membrane. While there has been considerable progress in defining the structure and function of the viral proteins, relatively little is known about the host factors involved in alphavirus infection. We used a genome-wide siRNA screen to identify host factors that promote or inhibit alphavirus infection in human cells. Fuzzy homologue (FUZ, a protein with reported roles in planar cell polarity and cilia biogenesis, was required for the clathrin-dependent internalization of both alphaviruses and the classical endocytic ligand transferrin. The tetraspanin membrane protein TSPAN9 was critical for the efficient fusion of low pH-triggered virus with the endosome membrane. FUZ and TSPAN9 were broadly required for infection by the alphaviruses Sindbis virus, Semliki Forest virus, and Chikungunya virus, but were not required by the structurally-related flavivirus Dengue virus. Our results highlight the unanticipated functions of FUZ and TSPAN9 in distinct steps of alphavirus entry and suggest novel host proteins that may serve as targets for antiviral therapy.

  16. Genome-wide RNAi Screening to Identify Host Factors That Modulate Oncolytic Virus Therapy.

    Science.gov (United States)

    Allan, Kristina J; Mahoney, Douglas J; Baird, Stephen D; Lefebvre, Charles A; Stojdl, David F

    2018-04-03

    High-throughput genome-wide RNAi (RNA interference) screening technology has been widely used for discovering host factors that impact virus replication. Here we present the application of this technology to uncovering host targets that specifically modulate the replication of Maraba virus, an oncolytic rhabdovirus, and vaccinia virus with the goal of enhancing therapy. While the protocol has been tested for use with oncolytic Maraba virus and oncolytic vaccinia virus, this approach is applicable to other oncolytic viruses and can also be utilized for identifying host targets that modulate virus replication in mammalian cells in general. This protocol describes the development and validation of an assay for high-throughput RNAi screening in mammalian cells, the key considerations and preparation steps important for conducting a primary high-throughput RNAi screen, and a step-by-step guide for conducting a primary high-throughput RNAi screen; in addition, it broadly outlines the methods for conducting secondary screen validation and tertiary validation studies. The benefit of high-throughput RNAi screening is that it allows one to catalogue, in an extensive and unbiased fashion, host factors that modulate any aspect of virus replication for which one can develop an in vitro assay such as infectivity, burst size, and cytotoxicity. It has the power to uncover biotherapeutic targets unforeseen based on current knowledge.

  17. Elg1 forms an alternative RFC complex important for DNA replication and genome integrity

    NARCIS (Netherlands)

    Bellaoui, Mohammed; Chang, Michael; Ou, Jiongwen; Xu, Hong; Boone, Charles; Brown, Grant W

    2003-01-01

    Genome-wide synthetic genetic interaction screens with mutants in the mus81 and mms4 replication fork-processing genes identified a novel replication factor C (RFC) homolog, Elg1, which forms an alternative RFC complex with Rfc2-5. This complex is distinct from the DNA replication RFC, the DNA

  18. Genome-wide association study of PR interval in Hispanics/Latinos identifies novel locus at ID2.

    Science.gov (United States)

    Seyerle, Amanda A; Lin, Henry J; Gogarten, Stephanie M; Stilp, Adrienne; Méndez Giráldez, Raul; Soliman, Elsayed; Baldassari, Antoine; Graff, Mariaelisa; Heckbert, Susan; Kerr, Kathleen F; Kooperberg, Charles; Rodriguez, Carlos; Guo, Xiuqing; Yao, Jie; Sotoodehnia, Nona; Taylor, Kent D; Whitsel, Eric A; Rotter, Jerome I; Laurie, Cathy C; Avery, Christy L

    2017-11-10

    PR interval (PR) is a heritable electrocardiographic measure of atrial and atrioventricular nodal conduction. Changes in PR duration may be associated with atrial fibrillation, heart failure and all-cause mortality. Hispanic/Latino populations have high burdens of cardiovascular morbidity and mortality, are highly admixed and represent exceptional opportunities for novel locus identification. However, they remain chronically understudied. We present the first genome-wide association study (GWAS) of PR in 14 756 participants of Hispanic/Latino ancestry from three studies. Study-specific summary results of the association between 1000 Genomes Phase 1 imputed single-nucleotide polymorphisms (SNPs) and PR assumed an additive genetic model and were adjusted for global ancestry, study centre/region and clinical covariates. Results were combined using fixed-effects, inverse variance weighted meta-analysis. Sequential conditional analyses were used to identify independent signals. Replication of novel loci was performed in populations of Asian, African and European descent. ENCODE and RoadMap data were used to annotate results. We identified a novel genome-wide association (PPR at ID2 (rs6730558), which replicated in Asian and European populations (PPR loci to Hispanics/Latinos. Bioinformatics annotation provided evidence for regulatory function in cardiac tissue. Further, for six loci that generalised, the Hispanic/Latino index SNP was genome-wide significant and identical to (or in high linkage disequilibrium with) the previously identified GWAS lead SNP. Our results suggest that genetic determinants of PR are consistent across race/ethnicity, but extending studies to admixed populations can identify novel associations, underscoring the importance of conducting genetic studies in diverse populations. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise

  19. Genome-wide association study identifies multiple risk loci for chronic lymphocytic leukemia

    OpenAIRE

    Berndt, S.I.; Skibola, C.F.; Joseph, V.; Camp, N.J.; Nieters, A.; Wang, Z.; Cozen, W.; Monnereau, A.; Wang, S.S.; Kelly, R.S.; Lan, Q.; Teras, L.R.; Chatterjee, N.; Chung, C.C.; Yeager, M.

    2013-01-01

    Genome-wide association studies (GWAS) have previously identified 13 loci associated with risk of chronic lymphocytic leukemia or small lymphocytic lymphoma (CLL). To identify additional CLL susceptibility loci, we conducted the largest meta-analysis for CLL thus far, including four GWAS with a total of 3,100 individuals with CLL (cases) and 7,667 controls. In the meta-analysis, we identified ten independent associated SNPs in nine new loci at 10q23.31 (ACTA2 or FAS (ACTA2/FAS), P = 1.22 × 10...

  20. New families of human regulatory RNA structures identified by comparative analysis of vertebrate genomes.

    Science.gov (United States)

    Parker, Brian J; Moltke, Ida; Roth, Adam; Washietl, Stefan; Wen, Jiayu; Kellis, Manolis; Breaker, Ronald; Pedersen, Jakob Skou

    2011-11-01

    Regulatory RNA structures are often members of families with multiple paralogous instances across the genome. Family members share functional and structural properties, which allow them to be studied as a whole, facilitating both bioinformatic and experimental characterization. We have developed a comparative method, EvoFam, for genome-wide identification of families of regulatory RNA structures, based on primary sequence and secondary structure similarity. We apply EvoFam to a 41-way genomic vertebrate alignment. Genome-wide, we identify 220 human, high-confidence families outside protein-coding regions comprising 725 individual structures, including 48 families with known structural RNA elements. Known families identified include both noncoding RNAs, e.g., miRNAs and the recently identified MALAT1/MEN β lincRNA family; and cis-regulatory structures, e.g., iron-responsive elements. We also identify tens of new families supported by strong evolutionary evidence and other statistical evidence, such as GO term enrichments. For some of these, detailed analysis has led to the formulation of specific functional hypotheses. Examples include two hypothesized auto-regulatory feedback mechanisms: one involving six long hairpins in the 3'-UTR of MAT2A, a key metabolic gene that produces the primary human methyl donor S-adenosylmethionine; the other involving a tRNA-like structure in the intron of the tRNA maturation gene POP1. We experimentally validate the predicted MAT2A structures. Finally, we identify potential new regulatory networks, including large families of short hairpins enriched in immunity-related genes, e.g., TNF, FOS, and CTLA4, which include known transcript destabilizing elements. Our findings exemplify the diversity of post-transcriptional regulation and provide a resource for further characterization of new regulatory mechanisms and families of noncoding RNAs.

  1. A Genome-Wide Association Study Identifies Five Loci Influencing Facial Morphology in Europeans

    Science.gov (United States)

    Liu, Fan; van der Lijn, Fedde; Schurmann, Claudia; Zhu, Gu; Chakravarty, M. Mallar; Hysi, Pirro G.; Wollstein, Andreas; Lao, Oscar; de Bruijne, Marleen; Ikram, M. Arfan; van der Lugt, Aad; Rivadeneira, Fernando; Uitterlinden, André G.; Hofman, Albert; Niessen, Wiro J.; Homuth, Georg; de Zubicaray, Greig; McMahon, Katie L.; Thompson, Paul M.; Daboul, Amro; Puls, Ralf; Hegenscheid, Katrin; Bevan, Liisa; Pausova, Zdenka; Medland, Sarah E.; Montgomery, Grant W.; Wright, Margaret J.; Wicking, Carol; Boehringer, Stefan; Spector, Timothy D.; Paus, Tomáš; Martin, Nicholas G.; Biffar, Reiner; Kayser, Manfred

    2012-01-01

    Inter-individual variation in facial shape is one of the most noticeable phenotypes in humans, and it is clearly under genetic regulation; however, almost nothing is known about the genetic basis of normal human facial morphology. We therefore conducted a genome-wide association study for facial shape phenotypes in multiple discovery and replication cohorts, considering almost ten thousand individuals of European descent from several countries. Phenotyping of facial shape features was based on landmark data obtained from three-dimensional head magnetic resonance images (MRIs) and two-dimensional portrait images. We identified five independent genetic loci associated with different facial phenotypes, suggesting the involvement of five candidate genes—PRDM16, PAX3, TP63, C5orf50, and COL17A1—in the determination of the human face. Three of them have been implicated previously in vertebrate craniofacial development and disease, and the remaining two genes potentially represent novel players in the molecular networks governing facial development. Our finding at PAX3 influencing the position of the nasion replicates a recent GWAS of facial features. In addition to the reported GWA findings, we established links between common DNA variants previously associated with NSCL/P at 2p21, 8q24, 13q31, and 17q22 and normal facial-shape variations based on a candidate gene approach. Overall our study implies that DNA variants in genes essential for craniofacial development contribute with relatively small effect size to the spectrum of normal variation in human facial morphology. This observation has important consequences for future studies aiming to identify more genes involved in the human facial morphology, as well as for potential applications of DNA prediction of facial shape such as in future forensic applications. PMID:23028347

  2. A genome-wide association study identifies five loci influencing facial morphology in Europeans.

    Directory of Open Access Journals (Sweden)

    Fan Liu

    2012-09-01

    Full Text Available Inter-individual variation in facial shape is one of the most noticeable phenotypes in humans, and it is clearly under genetic regulation; however, almost nothing is known about the genetic basis of normal human facial morphology. We therefore conducted a genome-wide association study for facial shape phenotypes in multiple discovery and replication cohorts, considering almost ten thousand individuals of European descent from several countries. Phenotyping of facial shape features was based on landmark data obtained from three-dimensional head magnetic resonance images (MRIs and two-dimensional portrait images. We identified five independent genetic loci associated with different facial phenotypes, suggesting the involvement of five candidate genes--PRDM16, PAX3, TP63, C5orf50, and COL17A1--in the determination of the human face. Three of them have been implicated previously in vertebrate craniofacial development and disease, and the remaining two genes potentially represent novel players in the molecular networks governing facial development. Our finding at PAX3 influencing the position of the nasion replicates a recent GWAS of facial features. In addition to the reported GWA findings, we established links between common DNA variants previously associated with NSCL/P at 2p21, 8q24, 13q31, and 17q22 and normal facial-shape variations based on a candidate gene approach. Overall our study implies that DNA variants in genes essential for craniofacial development contribute with relatively small effect size to the spectrum of normal variation in human facial morphology. This observation has important consequences for future studies aiming to identify more genes involved in the human facial morphology, as well as for potential applications of DNA prediction of facial shape such as in future forensic applications.

  3. Genome-wide analysis identifies 12 loci influencing human reproductive behavior

    Science.gov (United States)

    Barban, Nicola; Jansen, Rick; de Vlaming, Ronald; Vaez, Ahmad; Mandemakers, Jornt J.; Tropf, Felix C.; Shen, Xia; Wilson, James F.; Chasman, Daniel I.; Nolte, Ilja M.; Tragante, Vinicius; van der Laan, Sander W.; Perry, John R. B.; Kong, Augustine; Ahluwalia, Tarunveer; Albrecht, Eva; Yerges-Armstrong, Laura; Atzmon, Gil; Auro, Kirsi; Ayers, Kristin; Bakshi, Andrew; Ben-Avraham, Danny; Berger, Klaus; Bergman, Aviv; Bertram, Lars; Bielak, Lawrence F.; Bjornsdottir, Gyda; Bonder, Marc Jan; Broer, Linda; Bui, Minh; Barbieri, Caterina; Cavadino, Alana; Chavarro, Jorge E; Turman, Constance; Concas, Maria Pina; Cordell, Heather J.; Davies, Gail; Eibich, Peter; Eriksson, Nicholas; Esko, Tõnu; Eriksson, Joel; Falahi, Fahimeh; Felix, Janine F.; Fontana, Mark Alan; Franke, Lude; Gandin, Ilaria; Gaskins, Audrey J.; Gieger, Christian; Gunderson, Erica P.; Guo, Xiuqing; Hayward, Caroline; He, Chunyan; Hofer, Edith; Huang, Hongyan; Joshi, Peter K.; Kanoni, Stavroula; Karlsson, Robert; Kiechl, Stefan; Kifley, Annette; Kluttig, Alexander; Kraft, Peter; Lagou, Vasiliki; Lecoeur, Cecile; Lahti, Jari; Li-Gao, Ruifang; Lind, Penelope A.; Liu, Tian; Makalic, Enes; Mamasoula, Crysovalanto; Matteson, Lindsay; Mbarek, Hamdi; McArdle, Patrick F.; McMahon, George; Meddens, S. Fleur W.; Mihailov, Evelin; Miller, Mike; Missmer, Stacey A.; Monnereau, Claire; van der Most, Peter J.; Myhre, Ronny; Nalls, Mike A.; Nutile, Teresa; Panagiota, Kalafati Ioanna; Porcu, Eleonora; Prokopenko, Inga; Rajan, Kumar B.; Rich-Edwards, Janet; Rietveld, Cornelius A.; Robino, Antonietta; Rose, Lynda M.; Rueedi, Rico; Ryan, Kathy; Saba, Yasaman; Schmidt, Daniel; Smith, Jennifer A.; Stolk, Lisette; Streeten, Elizabeth; Tonjes, Anke; Thorleifsson, Gudmar; Ulivi, Sheila; Wedenoja, Juho; Wellmann, Juergen; Willeit, Peter; Yao, Jie; Yengo, Loic; Zhao, Jing Hua; Zhao, Wei; Zhernakova, Daria V.; Amin, Najaf; Andrews, Howard; Balkau, Beverley; Barzilai, Nir; Bergmann, Sven; Biino, Ginevra; Bisgaard, Hans; Bønnelykke, Klaus; Boomsma, Dorret I.; Buring, Julie E.; Campbell, Harry; Cappellani, Stefania; Ciullo, Marina; Cox, Simon R.; Cucca, Francesco; Daniela, Toniolo; Davey-Smith, George; Deary, Ian J.; Dedoussis, George; Deloukas, Panos; van Duijn, Cornelia M.; de Geus, Eco JC.; Eriksson, Johan G.; Evans, Denis A.; Faul, Jessica D.; Felicita, Sala Cinzia; Froguel, Philippe; Gasparini, Paolo; Girotto, Giorgia; Grabe, Hans-Jörgen; Greiser, Karin Halina; Groenen, Patrick J.F.; de Haan, Hugoline G.; Haerting, Johannes; Harris, Tamara B.; Heath, Andrew C.; Heikkilä, Kauko; Hofman, Albert; Homuth, Georg; Holliday, Elizabeth G; Hopper, John; Hypponen, Elina; Jacobsson, Bo; Jaddoe, Vincent W. V.; Johannesson, Magnus; Jugessur, Astanand; Kähönen, Mika; Kajantie, Eero; Kardia, Sharon L.R.; Keavney, Bernard; Kolcic, Ivana; Koponen, Päivikki; Kovacs, Peter; Kronenberg, Florian; Kutalik, Zoltan; La Bianca, Martina; Lachance, Genevieve; Iacono, William; Lai, Sandra; Lehtimäki, Terho; Liewald, David C; Lindgren, Cecilia; Liu, Yongmei; Luben, Robert; Lucht, Michael; Luoto, Riitta; Magnus, Per; Magnusson, Patrik K.E.; Martin, Nicholas G.; McGue, Matt; McQuillan, Ruth; Medland, Sarah E.; Meisinger, Christa; Mellström, Dan; Metspalu, Andres; Michela, Traglia; Milani, Lili; Mitchell, Paul; Montgomery, Grant W.; Mook-Kanamori, Dennis; de Mutsert, Renée; Nohr, Ellen A; Ohlsson, Claes; Olsen, Jørn; Ong, Ken K.; Paternoster, Lavinia; Pattie, Alison; Penninx, Brenda WJH; Perola, Markus; Peyser, Patricia A.; Pirastu, Mario; Polasek, Ozren; Power, Chris; Kaprio, Jaakko; Raffel, Leslie J.; Räikkönen, Katri; Raitakari, Olli; Ridker, Paul M.; Ring, Susan M.; Roll, Kathryn; Rudan, Igor; Ruggiero, Daniela; Rujescu, Dan; Salomaa, Veikko; Schlessinger, David; Schmidt, Helena; Schmidt, Reinhold; Schupf, Nicole; Smit, Johannes; Sorice, Rossella; Spector, Tim D.; Starr, John M.; Stöckl, Doris; Strauch, Konstantin; Stumvoll, Michael; Swertz, Morris A.; Thorsteinsdottir, Unnur; Thurik, A. Roy; Timpson, Nicholas J.; Tönjes, Anke; Tung, Joyce Y.; Uitterlinden, André G.; Vaccargiu, Simona; Viikari, Jorma; Vitart, Veronique; Völzke, Henry; Vollenweider, Peter; Vuckovic, Dragana; Waage, Johannes; Wagner, Gert G.; Wang, Jie Jin; Wareham, Nicholas J.; Weir, David R.; Willemsen, Gonneke; Willeit, Johann; Wright, Alan F.; Zondervan, Krina T.; Stefansson, Kari; Krueger, Robert F.; Lee, James J.; Benjamin, Daniel J.; Cesarini, David; Koellinger, Philipp D.; den Hoed, Marcel; Snieder, Harold; Mills, Melinda C.

    2017-01-01

    The genetic architecture of human reproductive behavior – age at first birth (AFB) and number of children ever born (NEB) – has a strong relationship with fitness, human development, infertility and risk of neuropsychiatric disorders. However, very few genetic loci have been identified and the underlying mechanisms of AFB and NEB are poorly understood. We report the largest genome-wide association study to date of both sexes including 251,151 individuals for AFB and 343,072 for NEB. We identified 12 independent loci that are significantly associated with AFB and/or NEB in a SNP-based genome-wide association study, and four additional loci in a gene-based effort. These loci harbor genes that are likely to play a role – either directly or by affecting non-local gene expression – in human reproduction and infertility, thereby increasing our understanding of these complex traits. PMID:27798627

  4. Cross-Genome Comparisons of Newly Identified Domains in Mycoplasma gallisepticum and Domain Architectures with Other Mycoplasma species

    Directory of Open Access Journals (Sweden)

    Chandra Sekhar Reddy Chilamakuri

    2011-01-01

    Full Text Available Accurate functional annotation of protein sequences is hampered by important factors such as the failure of sequence search methods to identify relationships and the inherent diversity in function of proteins related at low sequence similarities. Earlier, we had employed intermediate sequence search approach to establish new domain relationships in the unassigned regions of gene products at the whole genome level by taking Mycoplasma gallisepticum as a specific example and established new domain relationships. In this paper, we report a detailed comparison of the conservation status of the domain and domain architectures of the gene products that bear our newly predicted domains amongst 14 other Mycoplasma genomes and reported the probable implications for the organisms. Some of the domain associations, observed in Mycoplasma that afflict humans and other non-human primates, are involved in regulation of solute transport and DNA binding suggesting specific modes of host-pathogen interactions.

  5. Genome-wide methylation analysis identifies genes silenced in non-seminoma cell lines.

    Science.gov (United States)

    Noor, Dzul Azri Mohamed; Jeyapalan, Jennie N; Alhazmi, Safiah; Carr, Matthew; Squibb, Benjamin; Wallace, Claire; Tan, Christopher; Cusack, Martin; Hughes, Jaime; Reader, Tom; Shipley, Janet; Sheer, Denise; Scotting, Paul J

    2016-01-01

    Silencing of genes by DNA methylation is a common phenomenon in many types of cancer. However, the genome-wide effect of DNA methylation on gene expression has been analysed in relatively few cancers. Germ cell tumours (GCTs) are a complex group of malignancies. They are unique in developing from a pluripotent progenitor cell. Previous analyses have suggested that non-seminomas exhibit much higher levels of DNA methylation than seminomas. The genomic targets that are methylated, the extent to which this results in gene silencing and the identity of the silenced genes most likely to play a role in the tumours' biology have not yet been established. In this study, genome-wide methylation and expression analysis of GCT cell lines was combined with gene expression data from primary tumours to address this question. Genome methylation was analysed using the Illumina infinium HumanMethylome450 bead chip system and gene expression was analysed using Affymetrix GeneChip Human Genome U133 Plus 2.0 arrays. Regulation by methylation was confirmed by demethylation using 5-aza-2-deoxycytidine and reverse transcription-quantitative PCR. Large differences in the level of methylation of the CpG islands of individual genes between tumour cell lines correlated well with differential gene expression. Treatment of non-seminoma cells with 5-aza-2-deoxycytidine verified that methylation of all genes tested played a role in their silencing in yolk sac tumour cells and many of these genes were also differentially expressed in primary tumours. Genes silenced by methylation in the various GCT cell lines were identified. Several pluripotency-associated genes were identified as a major functional group of silenced genes.

  6. Genome-wide association study identifies 74 loci associated with educational attainment

    OpenAIRE

    Okbay, Aysu; Beauchamp, Jonathan; Fontana, M.A. (Mark Alan); Lee, James J.; Pers, Tune; Rietveld, C.A. (Cornelius A.); Turley, Patrick; Chen, G.-B. (Guo-Bo); Emilsson, Valur; Meddens, S.F.W. (S. Fleur W.); Oskarsson, S. (Sven); Pickrell, J.K. (Joseph K.); Thom, K. (Kevin); Timshel, P. (Pascal); Vlaming, Ronald

    2016-01-01

    textabstractEducational attainment is strongly influenced by social and other environmental factors, but genetic factors are estimated to account for at least 20% of the variation across individuals. Here we report the results of a genome-wide association study (GWAS) for educational attainment that extends our earlier discovery sample of 101,069 individuals to 293,723 individuals, and a replication study in an independent sample of 111,349 individuals from the UK Biobank. We identify 74 geno...

  7. Genome-wide Association Study Identifies New Loci for Resistance to Leptosphaeria maculans in Canola

    Directory of Open Access Journals (Sweden)

    Harsh Raman

    2016-10-01

    Full Text Available Blackleg, caused by Leptosphaeria maculans, is a significant disease which affects the sustainable production of canola. This study reports a genome-wide association study based on 18,804 polymorphic SNPs to identify loci associated with qualitative and quantitative resistance to L. maculans. Genomic regions delimited with 503 significant SNP markers, that are associated with resistance evaluated using 12 single spore isolates and pathotypes from four canola stubble were identified. Several significant associations were detected at known disease resistance loci including in the vicinity of recently cloned Rlm2/LepR3 genes, and at new loci on chromosomes A01/C01, A02/C02, A03/C03, A05/C05, A06, A08, and A09. In addition, we validated statistically significant associations on A01, A07 and A10 in four genetic mapping populations, demonstrating that GWAS marker loci are indeed associated with resistance to L. maculans. One of the novel loci identified for the first time, Rlm12, conveys adult plant resistance and mapped within 13.2 kb from Arabidopsis R gene of TIR-NBS class. We showed that resistance loci are located in the vicinity of R genes of A. thaliana and B. napus on the sequenced genome of B. napus cv. Darmor-bzh. Significantly associated SNP markers provide a valuable tool to enrich germplasm for favorable alleles in order to improve the level of resistance to L. maculans in canola.

  8. A novel data mining method to identify assay-specific signatures in functional genomic studies

    Directory of Open Access Journals (Sweden)

    Guidarelli Jack W

    2006-08-01

    Full Text Available Abstract Background: The highly dimensional data produced by functional genomic (FG studies makes it difficult to visualize relationships between gene products and experimental conditions (i.e., assays. Although dimensionality reduction methods such as principal component analysis (PCA have been very useful, their application to identify assay-specific signatures has been limited by the lack of appropriate methodologies. This article proposes a new and powerful PCA-based method for the identification of assay-specific gene signatures in FG studies. Results: The proposed method (PM is unique for several reasons. First, it is the only one, to our knowledge, that uses gene contribution, a product of the loading and expression level, to obtain assay signatures. The PM develops and exploits two types of assay-specific contribution plots, which are new to the application of PCA in the FG area. The first type plots the assay-specific gene contribution against the given order of the genes and reveals variations in distribution between assay-specific gene signatures as well as outliers within assay groups indicating the degree of importance of the most dominant genes. The second type plots the contribution of each gene in ascending or descending order against a constantly increasing index. This type of plots reveals assay-specific gene signatures defined by the inflection points in the curve. In addition, sharp regions within the signature define the genes that contribute the most to the signature. We proposed and used the curvature as an appropriate metric to characterize these sharp regions, thus identifying the subset of genes contributing the most to the signature. Finally, the PM uses the full dataset to determine the final gene signature, thus eliminating the chance of gene exclusion by poor screening in earlier steps. The strengths of the PM are demonstrated using a simulation study, and two studies of real DNA microarray data – a study of

  9. Whole genome DNA copy number changes identified by high density oligonucleotide arrays

    Directory of Open Access Journals (Sweden)

    Huang Jing

    2004-05-01

    Full Text Available Abstract Changes in DNA copy number are one of the hallmarks of the genetic instability common to most human cancers. Previous micro-array-based methods have been used to identify chromosomal gains and losses; however, they are unable to genotype alleles at the level of single nucleotide polymorphisms (SNPs. Here we describe a novel algorithm that uses a recently developed high-density oligonucleotide array-based SNP genotyping method, whole genome sampling analysis (WGSA, to identify genome-wide chromosomal gains and losses at high resolution. WGSA simultaneously genotypes over 10,000 SNPs by allele-specific hybridisation to perfect match (PM and mismatch (MM probes synthesised on a single array. The copy number algorithm jointly uses PM intensity and discrimination ratios between paired PM and MM intensity values to identify and estimate genetic copy number changes. Values from an experimental sample are compared with SNP-specific distributions derived from a reference set containing over 100 normal individuals to gain statistical power. Genomic regions with statistically significant copy number changes can be identified using both single point analysis and contiguous point analysis of SNP intensities. We identified multiple regions of amplification and deletion using a panel of human breast cancer cell lines. We verified these results using an independent method based on quantitative polymerase chain reaction and found that our approach is both sensitive and specific and can tolerate samples which contain a mixture of both tumour and normal DNA. In addition, by using known allele frequencies from the reference set, statistically significant genomic intervals can be identified containing contiguous stretches of homozygous markers, potentially allowing the detection of regions undergoing loss of heterozygosity (LOH without the need for a matched normal control sample. The coupling of LOH analysis, via SNP genotyping, with copy number

  10. The genome sequence of the most widely cultivated cacao type and its use to identify candidate genes regulating pod color.

    Science.gov (United States)

    Motamayor, Juan C; Mockaitis, Keithanne; Schmutz, Jeremy; Haiminen, Niina; Livingstone, Donald; Cornejo, Omar; Findley, Seth D; Zheng, Ping; Utro, Filippo; Royaert, Stefan; Saski, Christopher; Jenkins, Jerry; Podicheti, Ram; Zhao, Meixia; Scheffler, Brian E; Stack, Joseph C; Feltus, Frank A; Mustiga, Guiliana M; Amores, Freddy; Phillips, Wilbert; Marelli, Jean Philippe; May, Gregory D; Shapiro, Howard; Ma, Jianxin; Bustamante, Carlos D; Schnell, Raymond J; Main, Dorrie; Gilbert, Don; Parida, Laxmi; Kuhn, David N

    2013-06-03

    Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. We describe the sequencing and assembly of the genome of Theobroma cacao L. cultivar Matina 1-6. The genome of the Matina 1-6 cultivar is 445 Mbp, which is significantly larger than a sequenced Criollo cultivar, and more typical of other cultivars. The chromosome-scale assembly, version 1.1, contains 711 scaffolds covering 346.0 Mbp, with a contig N50 of 84.4 kbp, a scaffold N50 of 34.4 Mbp, and an evidence-based gene set of 29,408 loci. Version 1.1 has 10x the scaffold N50 and 4x the contig N50 as Criollo, and includes 111 Mb more anchored sequence. The version 1.1 assembly has 4.4% gap sequence, while Criollo has 10.9%. Through a combination of haplotype, association mapping and gene expression analyses, we leverage this robust reference genome to identify a promising candidate gene responsible for pod color variation. We demonstrate that green/red pod color in cacao is likely regulated by the R2R3 MYB transcription factor TcMYB113, homologs of which determine pigmentation in Rosaceae, Solanaceae, and Brassicaceae. One SNP within the target site for a highly conserved trans-acting siRNA in dicots, found within TcMYB113, seems to affect transcript levels of this gene and therefore pod color variation. We report a high-quality sequence and annotation of Theobroma cacao L. and demonstrate its utility in identifying candidate genes regulating traits.

  11. The genome sequence of the most widely cultivated cacao type and its use to identify candidate genes regulating pod color

    Science.gov (United States)

    2013-01-01

    Background Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. Results We describe the sequencing and assembly of the genome of Theobroma cacao L. cultivar Matina 1-6. The genome of the Matina 1-6 cultivar is 445 Mbp, which is significantly larger than a sequenced Criollo cultivar, and more typical of other cultivars. The chromosome-scale assembly, version 1.1, contains 711 scaffolds covering 346.0 Mbp, with a contig N50 of 84.4 kbp, a scaffold N50 of 34.4 Mbp, and an evidence-based gene set of 29,408 loci. Version 1.1 has 10x the scaffold N50 and 4x the contig N50 as Criollo, and includes 111 Mb more anchored sequence. The version 1.1 assembly has 4.4% gap sequence, while Criollo has 10.9%. Through a combination of haplotype, association mapping and gene expression analyses, we leverage this robust reference genome to identify a promising candidate gene responsible for pod color variation. We demonstrate that green/red pod color in cacao is likely regulated by the R2R3 MYB transcription factor TcMYB113, homologs of which determine pigmentation in Rosaceae, Solanaceae, and Brassicaceae. One SNP within the target site for a highly conserved trans-acting siRNA in dicots, found within TcMYB113, seems to affect transcript levels of this gene and therefore pod color variation. Conclusions We report a high-quality sequence and annotation of Theobroma cacao L. and demonstrate its utility in identifying candidate genes regulating traits. PMID:23731509

  12. Genome-wide association identifies OBFC1 as a locus involved in human leukocyte telomere biology.

    Science.gov (United States)

    Levy, Daniel; Neuhausen, Susan L; Hunt, Steven C; Kimura, Masayuki; Hwang, Shih-Jen; Chen, Wei; Bis, Joshua C; Fitzpatrick, Annette L; Smith, Erin; Johnson, Andrew D; Gardner, Jeffrey P; Srinivasan, Sathanur R; Schork, Nicholas; Rotter, Jerome I; Herbig, Utz; Psaty, Bruce M; Sastrasinh, Malinee; Murray, Sarah S; Vasan, Ramachandran S; Province, Michael A; Glazer, Nicole L; Lu, Xiaobin; Cao, Xiaojian; Kronmal, Richard; Mangino, Massimo; Soranzo, Nicole; Spector, Tim D; Berenson, Gerald S; Aviv, Abraham

    2010-05-18

    Telomeres are engaged in a host of cellular functions, and their length is regulated by multiple genes. Telomere shortening, in the course of somatic cell replication, ultimately leads to replicative senescence. In humans, rare mutations in genes that regulate telomere length have been identified in monogenic diseases such as dyskeratosis congenita and idiopathic pulmonary fibrosis, which are associated with shortened leukocyte telomere length (LTL) and increased risk for aplastic anemia. Shortened LTL is observed in a host of aging-related complex genetic diseases and is associated with diminished survival in the elderly. We report results of a genome-wide association study of LTL in a consortium of four observational studies (n = 3,417 participants with LTL and genome-wide genotyping). SNPs in the regions of the oligonucleotide/oligosaccharide-binding folds containing one gene (OBFC1; rs4387287; P = 3.9 x 10(-9)) and chemokine (C-X-C motif) receptor 4 gene (CXCR4; rs4452212; P = 2.9 x 10(-8)) were associated with LTL at a genome-wide significance level (P a gene associated with LTL (P = 1.1 x 10(-5)). The identification of OBFC1 through genome-wide association as a locus for interindividual variation in LTL in the general population advances the understanding of telomere biology in humans and may provide insights into aging-related disorders linked to altered LTL dynamics.

  13. Modifiers of notch transcriptional activity identified by genome-wide RNAi

    Directory of Open Access Journals (Sweden)

    Firnhaber Christopher B

    2010-10-01

    Full Text Available Abstract Background The Notch signaling pathway regulates a diverse array of developmental processes, and aberrant Notch signaling can lead to diseases, including cancer. To obtain a more comprehensive understanding of the genetic network that integrates into Notch signaling, we performed a genome-wide RNAi screen in Drosophila cell culture to identify genes that modify Notch-dependent transcription. Results Employing complementary data analyses, we found 399 putative modifiers: 189 promoting and 210 antagonizing Notch activated transcription. These modifiers included several known Notch interactors, validating the robustness of the assay. Many novel modifiers were also identified, covering a range of cellular localizations from the extracellular matrix to the nucleus, as well as a large number of proteins with unknown function. Chromatin-modifying proteins represent a major class of genes identified, including histone deacetylase and demethylase complex components and other chromatin modifying, remodeling and replacement factors. A protein-protein interaction map of the Notch-dependent transcription modifiers revealed that a large number of the identified proteins interact physically with these core chromatin components. Conclusions The genome-wide RNAi screen identified many genes that can modulate Notch transcriptional output. A protein interaction map of the identified genes highlighted a network of chromatin-modifying enzymes and remodelers that regulate Notch transcription. Our results open new avenues to explore the mechanisms of Notch signal regulation and the integration of this pathway into diverse cellular processes.

  14. Genome-wide association study identifies four loci associated with eruption of permanent teeth

    DEFF Research Database (Denmark)

    Geller, Frank; Feenstra, Bjarke; Zhang, Hao

    2011-01-01

    The sequence and timing of permanent tooth eruption is thought to be highly heritable and can have important implications for the risk of malocclusion, crowding, and periodontal disease. We conducted a genome-wide association study of number of permanent teeth erupted between age 6 and 14 years......, analyzed as age-adjusted standard deviation score averaged over multiple time points, based on childhood records for 5,104 women from the Danish National Birth Cohort. Four loci showed association at P...

  15. Gene Discovery and Advances in Finger Millet [Eleusine coracana (L.) Gaertn.] Genomics-An Important Nutri-Cereal of Future.

    Science.gov (United States)

    Sood, Salej; Kumar, Anil; Babu, B Kalyana; Gaur, Vikram S; Pandey, Dinesh; Kant, Lakshmi; Pattnayak, Arunava

    2016-01-01

    The rapid strides in molecular marker technologies followed by genomics, and next generation sequencing advancements in three major crops (rice, maize and wheat) of the world have given opportunities for their use in the orphan, but highly valuable future crops, including finger millet [ Eleusine coracana (L.) Gaertn.]. Finger millet has many special agronomic and nutritional characteristics, which make it an indispensable crop in arid, semi-arid, hilly and tribal areas of India and Africa. The crop has proven its adaptability in harsh conditions and has shown resilience to climate change. The adaptability traits of finger millet have shown the advantage over major cereal grains under stress conditions, revealing it as a storehouse of important genomic resources for crop improvement. Although new technologies for genomic studies are now available, progress in identifying and tapping these important alleles or genes is lacking. RAPDs were the default choice for genetic diversity studies in the crop until the last decade, but the subsequent development of SSRs and comparative genomics paved the way for the marker assisted selection in finger millet. Resistance gene homologs from NBS-LRR region of finger millet for blast and sequence variants for nutritional traits from other cereals have been developed and used invariably. Population structure analysis studies exhibit 2-4 sub-populations in the finger millet gene pool with separate grouping of Indian and exotic genotypes. Recently, the omics technologies have been efficiently applied to understand the nutritional variation, drought tolerance and gene mining. Progress has also occurred with respect to transgenics development. This review presents the current biotechnological advancements along with research gaps and future perspective of genomic research in finger millet.

  16. Gene Discovery and Advances in Finger millet [Eleusine coracana (L. Gaertn.] Genomics - An Important Nutri-cereal of Future

    Directory of Open Access Journals (Sweden)

    Salej Sood

    2016-11-01

    Full Text Available The rapid strides in molecular marker technologies followed by genomics, and next generation sequencing advancements in three major crops (rice, maize and wheat of the world have given opportunities for their use in the orphan, but highly valuable future crops, including finger millet [Eleusine coracana (L. Gaertn.]. Finger millet has many special agronomic and nutritional characteristics, which make it an indispensable crop in arid, semi-arid, hilly and tribal areas of India and Africa. The crop has proven its adaptability in harsh conditions and has shown resilience to climate change. The adaptability traits of finger millet have shown the advantage over major cereal grains under stress conditions, revealing it as a storehouse of important genomic resources for crop improvement. Although new technologies for genomic studies are now available, progress in identifying and tapping these important alleles or genes is lacking. RAPDs were the default choice for genetic diversity studies in the crop until the last decade, but the subsequent development of SSRs and comparative genomics paved the way for the marker assisted selection in finger millet. Resistance gene homologues from NBS-LRR region of finger millet for blast and sequence variants for nutritional traits from other cereals have been developed and used invariably. Population structure analysis studies exhibit 2-4 sub-populations in the finger millet gene pool with separate grouping of Indian and exotic genotypes. Recently, the omics technologies have been efficiently applied to understand the nutritional variation, drought tolerance and gene mining. Progress has also occurred with respect to transgenics development. This review presents the current biotechnological advancements along with research gaps and future perspective of genomic research in finger millet.

  17. Screening of whole genome sequences identified high-impact variants for stallion fertility.

    Science.gov (United States)

    Schrimpf, Rahel; Gottschalk, Maren; Metzger, Julia; Martinsson, Gunilla; Sieme, Harald; Distl, Ottmar

    2016-04-14

    Stallion fertility is an economically important trait due to the increase of artificial insemination in horses. The availability of whole genome sequence data facilitates identification of rare high-impact variants contributing to stallion fertility. The aim of our study was to genotype rare high-impact variants retrieved from next-generation sequencing (NGS)-data of 11 horses in order to unravel harmful genetic variants in large samples of stallions. Gene ontology (GO) terms and search results from public databases were used to obtain a comprehensive list of human und mice genes predicted to participate in the regulation of male reproduction. The corresponding equine orthologous genes were searched in whole genome sequence data of seven stallions and four mares and filtered for high-impact genetic variants using SnpEFF, SIFT and Polyphen 2 software. All genetic variants with the missing homozygous mutant genotype were genotyped on 337 fertile stallions of 19 breeds using KASP genotyping assays or PCR-RFLP. Mixed linear model analysis was employed for an association analysis with de-regressed estimated breeding values of the paternal component of the pregnancy rate per estrus (EBV-PAT). We screened next generation sequenced data of whole genomes from 11 horses for equine genetic variants in 1194 human and mice genes involved in male fertility and linked through common gene ontology (GO) with male reproductive processes. Variants were filtered for high-impact on protein structure and validated through SIFT and Polyphen 2. Only those genetic variants were followed up when the homozygote mutant genotype was missing in the detection sample comprising 11 horses. After this filtering process, 17 single nucleotide polymorphism (SNPs) were left. These SNPs were genotyped in 337 fertile stallions of 19 breeds using KASP genotyping assays or PCR-RFLP. An association analysis in 216 Hanoverian stallions revealed a significant association of the splice-site disruption variant

  18. High throughput sequencing and proteomics to identify immunogenic proteins of a new pathogen: the dirty genome approach.

    Science.gov (United States)

    Greub, Gilbert; Kebbi-Beghdadi, Carole; Bertelli, Claire; Collyn, François; Riederer, Beat M; Yersin, Camille; Croxatto, Antony; Raoult, Didier

    2009-12-23

    With the availability of new generation sequencing technologies, bacterial genome projects have undergone a major boost. Still, chromosome completion needs a costly and time-consuming gap closure, especially when containing highly repetitive elements. However, incomplete genome data may be sufficiently informative to derive the pursued information. For emerging pathogens, i.e. newly identified pathogens, lack of release of genome data during gap closure stage is clearly medically counterproductive. We thus investigated the feasibility of a dirty genome approach, i.e. the release of unfinished genome sequences to develop serological diagnostic tools. We showed that almost the whole genome sequence of the emerging pathogen Parachlamydia acanthamoebae was retrieved even with relatively short reads from Genome Sequencer 20 and Solexa. The bacterial proteome was analyzed to select immunogenic proteins, which were then expressed and used to elaborate the first steps of an ELISA. This work constitutes the proof of principle for a dirty genome approach, i.e. the use of unfinished genome sequences of pathogenic bacteria, coupled with proteomics to rapidly identify new immunogenic proteins useful to develop in the future specific diagnostic tests such as ELISA, immunohistochemistry and direct antigen detection. Although applied here to an emerging pathogen, this combined dirty genome sequencing/proteomic approach may be used for any pathogen for which better diagnostics are needed. These genome sequences may also be very useful to develop DNA based diagnostic tests. All these diagnostic tools will allow further evaluations of the pathogenic potential of this obligate intracellular bacterium.

  19. Novel candidate genes and regions for childhood apraxia of speech identified by array comparative genomic hybridization.

    Science.gov (United States)

    Laffin, Jennifer J S; Raca, Gordana; Jackson, Craig A; Strand, Edythe A; Jakielski, Kathy J; Shriberg, Lawrence D

    2012-11-01

    The goal of this study was to identify new candidate genes and genomic copy-number variations associated with a rare, severe, and persistent speech disorder termed childhood apraxia of speech. Childhood apraxia of speech is the speech disorder segregating with a mutation in FOXP2 in a multigenerational London pedigree widely studied for its role in the development of speech-language in humans. A total of 24 participants who were suspected to have childhood apraxia of speech were assessed using a comprehensive protocol that samples speech in challenging contexts. All participants met clinical-research criteria for childhood apraxia of speech. Array comparative genomic hybridization analyses were completed using a customized 385K Nimblegen array (Roche Nimblegen, Madison, WI) with increased coverage of genes and regions previously associated with childhood apraxia of speech. A total of 16 copy-number variations with potential consequences for speech-language development were detected in 12 or half of the 24 participants. The copy-number variations occurred on 10 chromosomes, 3 of which had two to four candidate regions. Several participants were identified with copy-number variations in two to three regions. In addition, one participant had a heterozygous FOXP2 mutation and a copy-number variation on chromosome 2, and one participant had a 16p11.2 microdeletion and copy-number variations on chromosomes 13 and 14. Findings support the likelihood of heterogeneous genomic pathways associated with childhood apraxia of speech.

  20. Genome-wide association study identifies 74 loci associated with educational attainment

    Science.gov (United States)

    Okbay, Aysu; Beauchamp, Jonathan P.; Fontana, Mark A.; Lee, James J.; Pers, Tune H.; Rietveld, Cornelius A.; Turley, Patrick; Chen, Guo-Bo; Emilsson, Valur; Meddens, S. Fleur W.; Oskarsson, Sven; Pickrell, Joseph K.; Thom, Kevin; Timshel, Pascal; de Vlaming, Ronald; Abdellaoui, Abdel; Ahluwalia, Tarunveer S.; Bacelis, Jonas; Baumbach, Clemens; Bjornsdottir, Gyda; Brandsma, Johannes H.; Concas, Maria Pina; Derringer, Jaime; Furlotte, Nicholas A.; Galesloot, Tessel E.; Girotto, Giorgia; Gupta, Richa; Hall, Leanne M.; Harris, Sarah E.; Hofer, Edith; Horikoshi, Momoko; Huffman, Jennifer E.; Kaasik, Kadri; Kalafati, Ioanna P.; Karlsson, Robert; Kong, Augustine; Lahti, Jari; van der Lee, Sven J.; de Leeuw, Christiaan; Lind, Penelope A.; Lindgren, Karl-Oskar; Liu, Tian; Mangino, Massimo; Marten, Jonathan; Mihailov, Evelin; Miller, Michael B.; van der Most, Peter J.; Oldmeadow, Christopher; Payton, Antony; Pervjakova, Natalia; Peyrot, Wouter J.; Qian, Yong; Raitakari, Olli; Rueedi, Rico; Salvi, Erika; Schmidt, Börge; Schraut, Katharina E.; Shi, Jianxin; Smith, Albert V.; Poot, Raymond A.; Pourcain, Beate; Teumer, Alexander; Thorleifsson, Gudmar; Verweij, Niek; Vuckovic, Dragana; Wellmann, Juergen; Westra, Harm-Jan; Yang, Jingyun; Zhao, Wei; Zhu, Zhihong; Alizadeh, Behrooz Z.; Amin, Najaf; Bakshi, Andrew; Baumeister, Sebastian E.; Biino, Ginevra; Bønnelykke, Klaus; Boyle, Patricia A.; Campbell, Harry; Cappuccio, Francesco P.; Davies, Gail; De Neve, Jan-Emmanuel; Deloukas, Panos; Demuth, Ilja; Ding, Jun; Eibich, Peter; Eisele, Lewin; Eklund, Niina; Evans68, David M.; Faul, Jessica D.; Feitosa, Mary F.; Forstner, Andreas J.; Gandin, Ilaria; Gunnarsson, Bjarni; Halldórsson, Bjarni V.; Harris, Tamara B.; Heath, Andrew C.; Hocking, Lynne J.; Holliday, Elizabeth G.; Homuth, Georg; Horan, Michael A.; Hottenga, Jouke-Jan; de Jager, Philip L.; Joshi, Peter K.; Jugessur, Astanand; Kaakinen, Marika A.; Kähönen, Mika; Kanoni, Stavroula; Keltigangas-Järvinen, Liisa; Kiemeney, Lambertus A.L.M.; Kolcic, Ivana; Koskinen, Seppo; Kraja, Aldi T.; Kroh, Martin; Kutalik, Zoltan; Latvala, Antti; Launer, Lenore J.; Lebreton, Maël P.; Levinson, Douglas F.; Lichtenstein, Paul; Lichtner, Peter; Liewald, David C.M.; Loukola, Anu; Madden, Pamela A.; Mägi, Reedik; Mäki-Opas, Tomi; Marioni, Riccardo E.; Marques-Vidal, Pedro; Meddens, Gerardus A.; McMahon, George; Meisinger, Christa; Meitinger, Thomas; Milaneschi, Yusplitri; Milani, Lili; Montgomery, Grant W.; Myhre, Ronny; Nelson, Christopher P.; Nyholt, Dale R.; Ollier, William E.R.; Palotie, Aarno; Paternoster, Lavinia; Pedersen, Nancy L.; Petrovic, Katja E.; Porteous, David J.; Räikkönen, Katri; Ring, Susan M.; Robino, Antonietta; Rostapshova, Olga; Rudan, Igor; Rustichini, Aldo; Salomaa, Veikko; Sanders, Alan R.; Sarin, Antti-Pekka; Schmidt, Helena; Scott, Rodney J.; Smith, Blair H.; Smith, Jennifer A.; Staessen, Jan A.; Steinhagen-Thiessen, Elisabeth; Strauch, Konstantin; Terracciano, Antonio; Tobin, Martin D.; Ulivi, Sheila; Vaccargiu, Simona; Quaye, Lydia; van Rooij, Frank J.A.; Venturini, Cristina; Vinkhuyzen, Anna A.E.; Völker, Uwe; Völzke, Henry; Vonk, Judith M.; Vozzi, Diego; Waage, Johannes; Ware, Erin B.; Willemsen, Gonneke; Attia, John R.; Bennett, David A.; Berger, Klaus; Bertram, Lars; Bisgaard, Hans; Boomsma, Dorret I.; Borecki, Ingrid B.; Bultmann, Ute; Chabris, Christopher F.; Cucca, Francesco; Cusi, Daniele; Deary, Ian J.; Dedoussis, George V.; van Duijn, Cornelia M.; Eriksson, Johan G.; Franke, Barbara; Franke, Lude; Gasparini, Paolo; Gejman, Pablo V.; Gieger, Christian; Grabe, Hans-Jörgen; Gratten, Jacob; Groenen, Patrick J.F.; Gudnason, Vilmundur; van der Harst, Pim; Hayward, Caroline; Hinds, David A.; Hoffmann, Wolfgang; Hyppönen, Elina; Iacono, William G.; Jacobsson, Bo; Järvelin, Marjo-Riitta; Jöckel, Karl-Heinz; Kaprio, Jaakko; Kardia, Sharon L.R.; Lehtimäki, Terho; Lehrer, Steven F.; Magnusson, Patrik K.E.; Martin, Nicholas G.; McGue, Matt; Metspalu, Andres; Pendleton, Neil; Penninx, Brenda W.J.H.; Perola, Markus; Pirastu, Nicola; Pirastu, Mario; Polasek, Ozren; Posthuma, Danielle; Power, Christine; Province, Michael A.; Samani, Nilesh J.; Schlessinger, David; Schmidt, Reinhold; Sørensen, Thorkild I.A.; Spector, Tim D.; Stefansson, Kari; Thorsteinsdottir, Unnur; Thurik, A. Roy; Timpson, Nicholas J.; Tiemeier, Henning; Tung, Joyce Y.; Uitterlinden, André G.; Vitart, Veronique; Vollenweider, Peter; Weir, David R.; Wilson, James F.; Wright, Alan F.; Conley, Dalton C.; Krueger, Robert F.; Smith, George Davey; Hofman, Albert; Laibson, David I.; Medland, Sarah E.; Meyer, Michelle N.; Yang, Jian; Johannesson, Magnus; Visscher, Peter M.; Esko, Tõnu; Koellinger, Philipp D.; Cesarini, David; Benjamin, Daniel J.

    2016-01-01

    Summary Educational attainment (EA) is strongly influenced by social and other environmental factors, but genetic factors are also estimated to account for at least 20% of the variation across individuals1. We report the results of a genome-wide association study (GWAS) for EA that extends our earlier discovery sample1,2 of 101,069 individuals to 293,723 individuals, and a replication in an independent sample of 111,349 individuals from the UK Biobank. We now identify 74 genome-wide significant loci associated with number of years of schooling completed. Single-nucleotide polymorphisms (SNPs) associated with educational attainment are disproportionately found in genomic regions regulating gene expression in the fetal brain. Candidate genes are preferentially expressed in neural tissue, especially during the prenatal period, and enriched for biological pathways involved in neural development. Our findings demonstrate that, even for a behavioral phenotype that is mostly environmentally determined, a well-powered GWAS identifies replicable associated genetic variants that suggest biologically relevant pathways. Because EA is measured in large numbers of individuals, it will continue to be useful as a proxy phenotype in efforts to characterize the genetic influences of related phenotypes, including cognition and neuropsychiatric disease. PMID:27225129

  1. Genome-wide association scan in HIV-1-infected individuals identifying variants influencing disease course.

    Directory of Open Access Journals (Sweden)

    Daniëlle van Manen

    Full Text Available BACKGROUND: AIDS develops typically after 7-11 years of untreated HIV-1 infection, with extremes of very rapid disease progression (15 years. To reveal additional host genetic factors that may impact on the clinical course of HIV-1 infection, we designed a genome-wide association study (GWAS in 404 participants of the Amsterdam Cohort Studies on HIV-1 infection and AIDS. METHODS: The association of SNP genotypes with the clinical course of HIV-1 infection was tested in Cox regression survival analyses using AIDS-diagnosis and AIDS-related death as endpoints. RESULTS: Multiple, not previously identified SNPs, were identified to be strongly associated with disease progression after HIV-1 infection, albeit not genome-wide significant. However, three independent SNPs in the top ten associations between SNP genotypes and time between seroconversion and AIDS-diagnosis, and one from the top ten associations between SNP genotypes and time between seroconversion and AIDS-related death, had P-values smaller than 0.05 in the French Genomics of Resistance to Immunodeficiency Virus cohort on disease progression. CONCLUSIONS: Our study emphasizes that the use of different phenotypes in GWAS may be useful to unravel the full spectrum of host genetic factors that may be associated with the clinical course of HIV-1 infection.

  2. Genome-Wide Association Scan in HIV-1-Infected Individuals Identifying Variants Influencing Disease Course

    Science.gov (United States)

    van Manen, Daniëlle; Delaneau, Olivier; Kootstra, Neeltje A.; Boeser-Nunnink, Brigitte D.; Limou, Sophie; Bol, Sebastiaan M.; Burger, Judith A.; Zwinderman, Aeilko H.; Moerland, Perry D.; van 't Slot, Ruben; Zagury, Jean-François; van 't Wout, Angélique B.; Schuitemaker, Hanneke

    2011-01-01

    Background AIDS develops typically after 7–11 years of untreated HIV-1 infection, with extremes of very rapid disease progression (15 years). To reveal additional host genetic factors that may impact on the clinical course of HIV-1 infection, we designed a genome-wide association study (GWAS) in 404 participants of the Amsterdam Cohort Studies on HIV-1 infection and AIDS. Methods The association of SNP genotypes with the clinical course of HIV-1 infection was tested in Cox regression survival analyses using AIDS-diagnosis and AIDS-related death as endpoints. Results Multiple, not previously identified SNPs, were identified to be strongly associated with disease progression after HIV-1 infection, albeit not genome-wide significant. However, three independent SNPs in the top ten associations between SNP genotypes and time between seroconversion and AIDS-diagnosis, and one from the top ten associations between SNP genotypes and time between seroconversion and AIDS-related death, had P-values smaller than 0.05 in the French Genomics of Resistance to Immunodeficiency Virus cohort on disease progression. Conclusions Our study emphasizes that the use of different phenotypes in GWAS may be useful to unravel the full spectrum of host genetic factors that may be associated with the clinical course of HIV-1 infection. PMID:21811574

  3. Identifying tagging SNPs for African specific genetic variation from the African Diaspora Genome.

    Science.gov (United States)

    Johnston, Henry Richard; Hu, Yi-Juan; Gao, Jingjing; O'Connor, Timothy D; Abecasis, Gonçalo R; Wojcik, Genevieve L; Gignoux, Christopher R; Gourraud, Pierre-Antoine; Lizee, Antoine; Hansen, Mark; Genuario, Rob; Bullis, Dave; Lawley, Cindy; Kenny, Eimear E; Bustamante, Carlos; Beaty, Terri H; Mathias, Rasika A; Barnes, Kathleen C; Qin, Zhaohui S

    2017-04-21

    A primary goal of The Consortium on Asthma among African-ancestry Populations in the Americas (CAAPA) is to develop an 'African Diaspora Power Chip' (ADPC), a genotyping array consisting of tagging SNPs, useful in comprehensively identifying African specific genetic variation. This array is designed based on the novel variation identified in 642 CAAPA samples of African ancestry with high coverage whole genome sequence data (~30× depth). This novel variation extends the pattern of variation catalogued in the 1000 Genomes and Exome Sequencing Projects to a spectrum of populations representing the wide range of West African genomic diversity. These individuals from CAAPA also comprise a large swath of the African Diaspora population and incorporate historical genetic diversity covering nearly the entire Atlantic coast of the Americas. Here we show the results of designing and producing such a microchip array. This novel array covers African specific variation far better than other commercially available arrays, and will enable better GWAS analyses for researchers with individuals of African descent in their study populations. A recent study cataloging variation in continental African populations suggests this type of African-specific genotyping array is both necessary and valuable for facilitating large-scale GWAS in populations of African ancestry.

  4. Whole Genome Analysis of Injectional Anthrax Identifies Two Disease Clusters Spanning More Than 13 Years

    Directory of Open Access Journals (Sweden)

    Paul Keim

    2015-11-01

    Lay Person Interpretation: Injectional anthrax has been plaguing heroin drug users across Europe for more than 10 years. In order to better understand this outbreak, we assessed genomic relationships of all available injectional anthrax strains from four countries spanning a >12 year period. Very few differences were identified using genome-based analysis, but these differentiated the isolates into two distinct clusters. This strongly supports a hypothesis of at least two separate anthrax spore contamination events perhaps during the drug production processes. Identification of two events would not have been possible from standard epidemiological analysis. These comprehensive data will be invaluable for classifying future injectional anthrax isolates and for future geographic attribution.

  5. Genome-wide association study identifies 74 loci associated with educational attainment

    DEFF Research Database (Denmark)

    Okbay, Aysu; P. Beauchamp, Jonathan; Alan Fontana, Mark

    2016-01-01

    -nucleotide polymorphisms associated with educational attainment are disproportionately found in genomic regions regulating gene expression in the fetal brain. Candidate genes are preferentially expressed in neural tissue, especially during the prenatal period, and enriched for biological pathways involved in neural......Educational attainment is strongly influenced by social and other environmental factors, but genetic factors are estimated to account for at least 20% of the variation across individuals1. Here we report the results of a genome-wide association study (GWAS) for educational attainment that extends...... development. Our findings demonstrate that, even for a behavioural phenotype that is mostly environmentally determined, a well-powered GWAS identifies replicable associated genetic variants that suggest biologically relevant pathways. Because educational attainment is measured in large numbers of individuals...

  6. Polygenic analysis of genome-wide SNP data identifies common variants on allergic rhinitis

    DEFF Research Database (Denmark)

    Mohammadnejad, Afsaneh; Brasch-Andersen, Charlotte; Haagerup, Annette

    Background: Allergic Rhinitis (AR) is a complex disorder that affects many people around the world. There is a high genetic contribution to the development of the AR, as twins and family studies have estimated heritability of more than 33%. Due to the complex nature of the disease, single SNP...... analysis has limited power in identifying the genetic variations for AR. We combined genome-wide association analysis (GWAS) with polygenic risk score (PRS) in exploring the genetic basis underlying the disease. Methods: We collected clinical data on 631 Danish subjects with AR cases consisting of 434...... sibling pairs and unrelated individuals and control subjects of 197 unrelated individuals. SNP genotyping was done by Affymetrix Genome-Wide Human SNP Array 5.0. SNP imputation was performed using "IMPUTE2". Using additive effect model, GWAS was conducted in discovery sample, the genotypes...

  7. Genome-wide gene expression dataset used to identify potential therapeutic targets in androgenetic alopecia

    Directory of Open Access Journals (Sweden)

    R. Dey-Rao

    2017-08-01

    Full Text Available The microarray dataset attached to this report is related to the research article with the title: “A genomic approach to susceptibility and pathogenesis leads to identifying potential novel therapeutic targets in androgenetic alopecia” (Dey-Rao and Sinha, 2017 [1]. Male-pattern hair loss that is induced by androgens (testosterone in genetically predisposed individuals is known as androgenetic alopecia (AGA. The raw dataset is being made publicly available to enable critical and/or extended analyses. Our related research paper utilizes the attached raw dataset, for genome-wide gene-expression associated investigations. Combined with several in silico bioinformatics-based analyses we were able to delineate five strategic molecular elements as potential novel targets towards future AGA-therapy.

  8. Genome Wide Association Mapping in Arabidopsis thaliana Identifies Novel Genes Involved in Linking Allyl Glucosinolate to Altered Biomass and Defense.

    Science.gov (United States)

    Francisco, Marta; Joseph, Bindu; Caligagan, Hart; Li, Baohua; Corwin, Jason A; Lin, Catherine; Kerwin, Rachel E; Burow, Meike; Kliebenstein, Daniel J

    2016-01-01

    A key limitation in modern biology is the ability to rapidly identify genes underlying newly identified complex phenotypes. Genome wide association studies (GWAS) have become an increasingly important approach for dissecting natural variation by associating phenotypes with genotypes at a genome wide level. Recent work is showing that the Arabidopsis thaliana defense metabolite, allyl glucosinolate (GSL), may provide direct feedback regulation, linking defense metabolism outputs to the growth, and defense responses of the plant. However, there is still a need to identify genes that underlie this process. To start developing a deeper understanding of the mechanism(s) that modulate the ability of exogenous allyl GSL to alter growth and defense, we measured changes in plant biomass and defense metabolites in a collection of natural 96 A. thaliana accessions fed with 50 μM of allyl GSL. Exogenous allyl GSL was introduced exclusively to the roots and the compound transported to the leaf leading to a wide range of heritable effects upon plant biomass and endogenous GSL accumulation. Using natural variation we conducted GWAS to identify a number of new genes which potentially control allyl responses in various plant processes. This is one of the first instances in which this approach has been successfully utilized to begin dissecting a novel phenotype to the underlying molecular/polygenic basis.

  9. Genome wide association mapping in Arabidopsis thaliana identifies novel genes involved in linking allyl glucosinolate to altered biomass and defense

    Directory of Open Access Journals (Sweden)

    Marta Francisco

    2016-07-01

    Full Text Available A key limitation in modern biology is the ability to rapidly identify genes underlying newly identified complex phenotypes. Genome wide association studies (GWAS have become an increasingly important approach for dissecting natural variation by associating phenotypes with genotypes at a genome wide level. Recent work is showing that the Arabidopsis thaliana defense metabolite, allyl glucosinolate (GSL, may provide direct feedback regulation, linking defense metabolism outputs to the growth and defense responses of the plant. However, there is still a need to identify genes that underlie this process. To start developing a deeper understanding of the mechanism(s that modulate the ability of exogenous allyl GSL to alter growth and defense, we measured changes in plant biomass and defense metabolites in a collection of natural 96 A. thaliana accessions fed with 50 µM of allyl GSL. Exogenous allyl GSL was introduced exclusively to the roots and the compound transported to the leaf leading to a wide range of heritable effects upon plant biomass and endogenous GSL accumulation. Using natural variation we conducted GWAS to identify a number of new genes which potentially control allyl responses in various plant processes. This is one of the first instances in which this approach has been successfully utilized to begin dissecting a novel phenotype to the underlying molecular/polygenic basis.

  10. Genome-wide association study identifies novel locus for neuroticism and shows polygenic association with Major Depressive Disorder

    Science.gov (United States)

    de Moor, Marleen H.M.; van den Berg, Stéphanie M.; Verweij, Karin J.H.; Krueger, Robert F.; Luciano, Michelle; Vasquez, Alejandro Arias; Matteson, Lindsay K.; Derringer, Jaime; Esko, Tõnu; Amin, Najaf; Gordon, Scott D.; Hansell, Narelle K.; Hart, Amy B.; Seppälä, Ilkka; Huffman, Jennifer E.; Konte, Bettina; Lahti, Jari; Lee, Minyoung; Miller, Mike; Nutile, Teresa; Tanaka, Toshiko; Teumer, Alexander; Viktorin, Alexander; Wedenoja, Juho; Abecasis, Goncalo R.; Adkins, Daniel E.; Agrawal, Arpana; Allik, Jüri; Appel, Katja; Bigdeli, Timothy B.; Busonero, Fabio; Campbell, Harry; Costa, Paul T.; Smith, George Davey; Davies, Gail; de Wit, Harriet; Ding, Jun; Engelhardt, Barbara E.; Eriksson, Johan G.; Fedko, Iryna O.; Ferrucci, Luigi; Franke, Barbara; Giegling, Ina; Grucza, Richard; Hartmann, Annette M.; Heath, Andrew C.; Heinonen, Kati; Henders, Anjali K.; Homuth, Georg; Hottenga, Jouke-Jan; Janzing, Joost; Jokela, Markus; Karlsson, Robert; Kemp, John P.; Kirkpatrick, Matthew G.; Latvala, Antti; Lehtimäki, Terho; Liewald, David C.; Madden, Pamela A.F.; Magri, Chiara; Magnusson, Patrik K.E.; Marten, Jonathan; Maschio, Andrea; Medland, Sarah E.; Mihailov, Evelin; Milaneschi, Yuri; Montgomery, Grant W.; Nauck, Matthias; Ouwens, Klaasjan G.; Palotie, Aarno; Pettersson, Erik; Polasek, Ozren; Qian, Yong; Pulkki-Råback, Laura; Raitakari, Olli T.; Realo, Anu; Rose, Richard J.; Ruggiero, Daniela; Schmidt, Carsten O.; Slutske, Wendy S.; Sorice, Rossella; Starr, John M.; Pourcain, Beate St; Sutin, Angelina R.; Timpson, Nicholas J.; Trochet, Holly; Vermeulen, Sita; Vuoksimaa, Eero; Widen, Elisabeth; Wouda, Jasper; Wright, Margaret J.; Zgaga, Lina; Scotland, Generation; Porteous, David; Minelli, Alessandra; Palmer, Abraham A.; Rujescu, Dan; Ciullo, Marina; Hayward, Caroline; Rudan, Igor; Metspalu, Andres; Kaprio, Jaakko; Deary, Ian J.; Räikkönen, Katri; Wilson, James F.; Keltikangas-Järvinen, Liisa; Bierut, Laura J.; Hettema, John M.; Grabe, Hans J.; van Duijn, Cornelia M.; Evans, David M.; Schlessinger, David; Pedersen, Nancy L.; Terracciano, Antonio; McGue, Matt; Penninx, Brenda W.J.H.; Martin, Nicholas G.; Boomsma, Dorret I.

    2015-01-01

    Importance Neuroticism is a personality trait that is briefly defined by emotional instability. It is a robust genetic risk factor for Major Depressive Disorder (MDD) and other psychiatric disorders. Hence, neuroticism is an important phenotype for psychiatric genetics. The Genetics of Personality Consortium (GPC) has created a resource for genome-wide association analyses of personality traits in over 63,000 participants (including MDD cases). Objective To identify genetic variants associated with neuroticism by performing a meta-analysis of genome-wide association (GWA) results based on 1000Genomes imputation, to evaluate if common genetic variants as assessed by Single Nucleotide Polymorphisms (SNPs) explain variation in neuroticism by estimating SNP-based heritability, and to examine whether SNPs that predict neuroticism also predict MDD. Setting 30 cohorts with genome-wide genotype, personality and MDD data from the GPC. Participants The study included 63,661 participants from 29 discovery cohorts and 9,786 participants from a replication cohort. Participants came from Europe, the United States or Australia. Main outcome measure(s) Neuroticism scores harmonized across all cohorts by Item Response Theory (IRT) analysis, and clinically assessed MDD case-control status. Results A genome-wide significant SNP was found in the MAGI1 gene (rs35855737; P=9.26 × 10−9 in the discovery meta-analysis, and P=2.38 × 10−8 in the meta-analysis of all 30 cohorts). Common genetic variants explain 15% of the variance in neuroticism. Polygenic scores based on the meta-analysis of neuroticism in 27 of the discovery cohorts significantly predicted neuroticism in 2 independent cohorts. Importantly, polygenic scores also predicted MDD in these cohorts. Conclusions and relevance This study identifies a novel locus for neuroticism. The variant is located in a known gene that has been associated with bipolar disorder and schizophrenia in previous studies. In addition, the study

  11. Genome Wide Association Study for Drought, Aflatoxin Resistance, and Important Agronomic Traits of Maize Hybrids in the Sub-Tropics

    Science.gov (United States)

    Farfan, Ivan D. Barrero; De La Fuente, Gerald N.; Murray, Seth C.; Isakeit, Thomas; Huang, Pei-Cheng; Warburton, Marilyn; Williams, Paul; Windham, Gary L.; Kolomiets, Mike

    2015-01-01

    The primary maize (Zea mays L.) production areas are in temperate regions throughout the world and this is where most maize breeding is focused. Important but lower yielding maize growing regions such as the sub-tropics experience unique challenges, the greatest of which are drought stress and aflatoxin contamination. Here we used a diversity panel consisting of 346 maize inbred lines originating in temperate, sub-tropical and tropical areas testcrossed to stiff-stalk line Tx714 to investigate these traits. Testcross hybrids were evaluated under irrigated and non-irrigated trials for yield, plant height, ear height, days to anthesis, days to silking and other agronomic traits. Irrigated trials were also inoculated with Aspergillus flavus and evaluated for aflatoxin content. Diverse maize testcrosses out-yielded commercial checks in most trials, which indicated the potential for genetic diversity to improve sub-tropical breeding programs. To identify genomic regions associated with yield, aflatoxin resistance and other important agronomic traits, a genome wide association analysis was performed. Using 60,000 SNPs, this study found 10 quantitative trait variants for grain yield, plant and ear height, and flowering time after stringent multiple test corrections, and after fitting different models. Three of these variants explained 5–10% of the variation in grain yield under both water conditions. Multiple identified SNPs co-localized with previously reported QTL, which narrows the possible location of causal polymorphisms. Novel significant SNPs were also identified. This study demonstrated the potential to use genome wide association studies to identify major variants of quantitative and complex traits such as yield under drought that are still segregating between elite inbred lines. PMID:25714370

  12. Methodology for identifying boundaries of systems important to safety in CANDU nuclear power plants

    International Nuclear Information System (INIS)

    Therrien, S.; Komljenovic, D.; Therrien, P.; Ruest, C.; Prevost, P.; Vaillancourt, R.

    2007-01-01

    This paper presents a methodology developed to identify the boundaries of the systems important to safety (SIS) at the Gentilly-2 Nuclear Power Plant (NPP), Hydro-Quebec. The SIS boundaries identification considers nuclear safety only. Components that are not identified as important to safety are systematically identified as related to safety. A global assessment process such as WANO/INPO AP-913 'Equipment Reliability Process' will be needed to implement adequate changes in the management rules of those components. The paper depicts results in applying the methodology to the Shutdown Systems 1 and 2 (SDS 1, 2), and to the Emergency Core Cooling System (ECCS). This validation process enabled fine tuning the methodology, performing a better estimate of the effort required to evaluate a system, and identifying components important to safety of these systems. (author)

  13. Genome-wide association identifies multiple genomic regions associated with susceptibility to and control of ovine lentivirus.

    Directory of Open Access Journals (Sweden)

    Stephen N White

    Full Text Available BACKGROUND: Like human immunodeficiency virus (HIV, ovine lentivirus (OvLV is macrophage-tropic and causes lifelong infection. OvLV infects one quarter of U.S. sheep and induces pneumonia and body condition wasting. There is no vaccine to prevent OvLV infection and no cost-effective treatment for infected animals. However, breed differences in prevalence and proviral concentration have indicated a genetic basis for susceptibility to OvLV. A recent study identified TMEM154 variants in OvLV susceptibility. The objective here was to identify additional loci associated with odds and/or control of OvLV infection. METHODOLOGY/PRINCIPAL FINDINGS: This genome-wide association study (GWAS included 964 sheep from Rambouillet, Polypay, and Columbia breeds with serological status and proviral concentration phenotypes. Analytic models accounted for breed and age, as well as genotype. This approach identified TMEM154 (nominal P=9.2×10(-7; empirical P=0.13, provided 12 additional genomic regions associated with odds of infection, and provided 13 regions associated with control of infection (all nominal P<1 × 10(-5. Rapid decline of linkage disequilibrium with distance suggested many regions included few genes each. Genes in regions associated with odds of infection included DPPA2/DPPA4 (empirical P=0.006, and SYTL3 (P=0.051. Genes in regions associated with control of infection included a zinc finger cluster (ZNF192, ZSCAN16, ZNF389, and ZNF165; P=0.001, C19orf42/TMEM38A (P=0.047, and DLGAP1 (P=0.092. CONCLUSIONS/SIGNIFICANCE: These associations provide targets for mutation discovery in sheep susceptibility to OvLV. Aside from TMEM154, these genes have not been associated previously with lentiviral infection in any species, to our knowledge. Further, data from other species suggest functional hypotheses for future testing of these genes in OvLV and other lentiviral infections. Specifically, SYTL3 binds and may regulate RAB27A, which is required for enveloped

  14. Genome-wide meta-analysis identifies novel determinants of circulating serum progranulin.

    Science.gov (United States)

    Tönjes, Anke; Scholz, Markus; Krüger, Jacqueline; Krause, Kerstin; Schleinitz, Dorit; Kirsten, Holger; Gebhardt, Claudia; Marzi, Carola; Grallert, Harald; Ladenvall, Claes; Heyne, Henrike; Laurila, Esa; Kriebel, Jennifer; Meisinger, Christa; Rathmann, Wolfgang; Gieger, Christian; Groop, Leif; Prokopenko, Inga; Isomaa, Bo; Beutner, Frank; Kratzsch, Jürgen; Fischer-Rosinsky, Antje; Pfeiffer, Andreas; Krohn, Knut; Spranger, Joachim; Thiery, Joachim; Blüher, Matthias; Stumvoll, Michael; Kovacs, Peter

    2018-02-01

    Progranulin is a secreted protein with important functions in processes including immune and inflammatory response, metabolism and embryonic development. The present study aimed at identification of genetic factors determining progranulin concentrations. We conducted a genome-wide association meta-analysis for serum progranulin in three independent cohorts from Europe: Sorbs (N = 848) and KORA (N = 1628) from Germany and PPP-Botnia (N = 335) from Finland (total N = 2811). Single nucleotide polymorphisms (SNPs) associated with progranulin levels were replicated in two additional German cohorts: LIFE-Heart Study (Leipzig; N = 967) and Metabolic Syndrome Berlin Potsdam (Berlin cohort; N = 833). We measured mRNA expression of genes in peripheral blood mononuclear cells (PBMC) by micro-arrays and performed mRNA expression quantitative trait and expression-progranulin association studies to functionally substantiate identified loci. Finally, we conducted siRNA silencing experiments in vitro to validate potential candidate genes within the associated loci. Heritability of circulating progranulin levels was estimated at 31.8% and 26.1% in the Sorbs and LIFE-Heart cohort, respectively. SNPs at three loci reached study-wide significance (rs660240 in CELSR2-PSRC1-MYBPHL-SORT1, rs4747197 in CDH23-PSAP and rs5848 in GRN) explaining 19.4%/15.0% of the variance and 61%/57% of total heritability in the Sorbs/LIFE-Heart Study. The strongest evidence for association was at rs660240 (P = 5.75 × 10-50), which was also associated with mRNA expression of PSRC1 in PBMC (P = 1.51 × 10-21). Psrc1 knockdown in murine preadipocytes led to a consecutive 30% reduction in progranulin secretion. In conclusion, the present meta-GWAS combined with mRNA expression identified three loci associated with progranulin and supports the role of PSRC1 in the regulation of progranulin secretion. © The Author(s) 2017. Published by Oxford University Press. All rights

  15. Genomics and infectious disease: a call to identify the ethical, legal and social implications for public health and clinical practice.

    Science.gov (United States)

    Geller, Gail; Dvoskin, Rachel; Thio, Chloe L; Duggal, Priya; Lewis, Michelle H; Bailey, Theodore C; Sutherland, Andrea; Salmon, Daniel A; Kahn, Jeffrey P

    2014-01-01

    Advances in genomics are contributing to the development of more effective, personalized approaches to the prevention and treatment of infectious diseases. Genetic sequencing technologies are furthering our understanding of how human and pathogen genomic factors - and their interactions - contribute to individual differences in immunologic responses to vaccines, infections and drug therapies. Such understanding will influence future policies and procedures for infectious disease management. With the potential for tailored interventions for particular individuals, populations or subpopulations, ethical, legal and social implications (ELSIs) may arise for public health and clinical practice. Potential considerations include balancing health-related benefits and harms between individuals and the larger community, minimizing threats to individual privacy and autonomy, and ensuring just distribution of scarce resources. In this Opinion, we consider the potential application of pathogen and host genomic information to particular viral infections that have large-scale public health consequences but differ in ELSI-relevant characteristics such as ease of transmission, chronicity, severity, preventability and treatability. We argue for the importance of anticipating these ELSI issues in advance of new scientific discoveries, and call for the development of strategies for identifying and exploring ethical questions that should be considered as clinical, public health and policy decisions are made.

  16. Efficient genome-wide association in biobanks using topic modeling identifies multiple novel disease loci.

    Science.gov (United States)

    McCoy, Thomas H; Castro, Victor M; Snapper, Leslie A; Hart, Kamber L; Perlis, Roy H

    2017-08-31

    Biobanks and national registries represent a powerful tool for genomic discovery, but rely on diagnostic codes that may be unreliable and fail to capture the relationship between related diagnoses. We developed an efficient means of conducting genome-wide association studies using combinations of diagnostic codes from electronic health records (EHR) for 10845 participants in a biobanking program at two large academic medical centers. Specifically, we applied latent Dirichilet allocation to fit 50 disease topics based on diagnostic codes, then conducted genome-wide common-variant association for each topic. In sensitivity analysis, these results were contrasted with those obtained from traditional single-diagnosis phenome-wide association analysis, as well as those in which only a subset of diagnostic codes are included per topic. In meta-analysis across three biobank cohorts, we identified 23 disease-associated loci with p<1e-15, including previously associated autoimmune disease loci. In all cases, observed significant associations were of greater magnitude than for single phenome-wide diagnostic codes, and incorporation of less strongly-loading diagnostic codes enhanced association. This strategy provides a more efficient means of phenome-wide association in biobanks with coded clinical data.

  17. The Genome of Dendrobium officinale Illuminates the Biology of the Important Traditional Chinese Orchid Herb.

    Science.gov (United States)

    Yan, Liang; Wang, Xiao; Liu, Hui; Tian, Yang; Lian, Jinmin; Yang, Ruijuan; Hao, Shumei; Wang, Xuanjun; Yang, Shengchao; Li, Qiye; Qi, Shuai; Kui, Ling; Okpekum, Moses; Ma, Xiao; Zhang, Jiajin; Ding, Zhaoli; Zhang, Guojie; Wang, Wen; Dong, Yang; Sheng, Jun

    2015-06-01

    Dendrobium officinale Kimura et Migo is a traditional Chinese orchid herb that has both ornamental value and a broad range of therapeutic effects. Here, we report the first de novo assembled 1.35 Gb genome sequences for D. officinale by combining the second-generation Illumina Hiseq 2000 and third-generation PacBio sequencing technologies. We found that orchids have a complete inflorescence gene set and have some specific inflorescence genes. We observed gene expansion in gene families related to fungus symbiosis and drought resistance. We analyzed biosynthesis pathways of medicinal components of D. officinale and found extensive duplication of SPS and SuSy genes, which are related to polysaccharide generation, and that the pathway of D. officinale alkaloid synthesis could be extended to generate 16-epivellosimine. The D. officinale genome assembly demonstrates a new approach to deciphering large complex genomes and, as an important orchid species and a traditional Chinese medicine, the D. officinale genome will facilitate future research on the evolution of orchid plants, as well as the study of medicinal components and potential genetic breeding of the dendrobe. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.

  18. Genome-wide association study identifies variants associated with autoimmune hepatitis type 1.

    Science.gov (United States)

    de Boer, Ynto S; van Gerven, Nicole M F; Zwiers, Antonie; Verwer, Bart J; van Hoek, Bart; van Erpecum, Karel J; Beuers, Ulrich; van Buuren, Henk R; Drenth, Joost P H; den Ouden, Jannie W; Verdonk, Robert C; Koek, Ger H; Brouwer, Johannes T; Guichelaar, Maureen M J; Vrolijk, Jan M; Kraal, Georg; Mulder, Chris J J; van Nieuwkerk, Carin M J; Fischer, Janett; Berg, Thomas; Stickel, Felix; Sarrazin, Christoph; Schramm, Christoph; Lohse, Ansgar W; Weiler-Normann, Christina; Lerch, Markus M; Nauck, Matthias; Völzke, Henry; Homuth, Georg; Bloemena, Elisabeth; Verspaget, Hein W; Kumar, Vinod; Zhernakova, Alexandra; Wijmenga, Cisca; Franke, Lude; Bouma, Gerd

    2014-08-01

    Autoimmune hepatitis (AIH) is an uncommon autoimmune liver disease of unknown etiology. We used a genome-wide approach to identify genetic variants that predispose individuals to AIH. We performed a genome-wide association study of 649 adults in The Netherlands with AIH type 1 and 13,436 controls. Initial associations were further analyzed in an independent replication panel comprising 451 patients with AIH type 1 in Germany and 4103 controls. We also performed an association analysis in the discovery cohort using imputed genotypes of the major histocompatibility complex region. We associated AIH with a variant in the major histocompatibility complex region at rs2187668 (P = 1.5 × 10(-78)). Analysis of this variant in the discovery cohort identified HLA-DRB1*0301 (P = 5.3 × 10(-49)) as a primary susceptibility genotype and HLA-DRB1*0401 (P = 2.8 × 10(-18)) as a secondary susceptibility genotype. We also associated AIH with variants of SH2B3 (rs3184504, 12q24; P = 7.7 × 10(-8)) and CARD10 (rs6000782, 22q13.1; P = 3.0 × 10(-6)). In addition, strong inflation of association signal was found with single-nucleotide polymorphisms associated with other immune-mediated diseases, including primary sclerosing cholangitis and primary biliary cirrhosis, but not with single-nucleotide polymorphisms associated with other genetic traits. In a genome-wide association study, we associated AIH type 1 with variants in the major histocompatibility complex region, and identified variants of SH2B3and CARD10 as likely risk factors. These findings support a complex genetic basis for AIH pathogenesis and indicate that part of the genetic susceptibility overlaps with that for other immune-mediated liver diseases. Copyright © 2014 AGA Institute. Published by Elsevier Inc. All rights reserved.

  19. Importing statistical measures into Artemis enhances gene identification in the Leishmania genome project

    Directory of Open Access Journals (Sweden)

    McDonagh Paul D

    2003-06-01

    Full Text Available Abstract Background Seattle Biomedical Research Institute (SBRI as part of the Leishmania Genome Network (LGN is sequencing chromosomes of the trypanosomatid protozoan species Leishmania major. At SBRI, chromosomal sequence is annotated using a combination of trained and untrained non-consensus gene-prediction algorithms with ARTEMIS, an annotation platform with rich and user-friendly interfaces. Results Here we describe a methodology used to import results from three different protein-coding gene-prediction algorithms (GLIMMER, TESTCODE and GENESCAN into the ARTEMIS sequence viewer and annotation tool. Comparison of these methods, along with the CODONUSAGE algorithm built into ARTEMIS, shows the importance of combining methods to more accurately annotate the L. major genomic sequence. Conclusion An improvised and powerful tool for gene prediction has been developed by importing data from widely-used algorithms into an existing annotation platform. This approach is especially fruitful in the Leishmania genome project where there is large proportion of novel genes requiring manual annotation.

  20. A human genome-wide loss-of-function screen identifies effective chikungunya antiviral drugs.

    Science.gov (United States)

    Karlas, Alexander; Berre, Stefano; Couderc, Thérèse; Varjak, Margus; Braun, Peter; Meyer, Michael; Gangneux, Nicolas; Karo-Astover, Liis; Weege, Friderike; Raftery, Martin; Schönrich, Günther; Klemm, Uwe; Wurzlbauer, Anne; Bracher, Franz; Merits, Andres; Meyer, Thomas F; Lecuit, Marc

    2016-05-12

    Chikungunya virus (CHIKV) is a globally spreading alphavirus against which there is no commercially available vaccine or therapy. Here we use a genome-wide siRNA screen to identify 156 proviral and 41 antiviral host factors affecting CHIKV replication. We analyse the cellular pathways in which human proviral genes are involved and identify druggable targets. Twenty-one small-molecule inhibitors, some of which are FDA approved, targeting six proviral factors or pathways, have high antiviral activity in vitro, with low toxicity. Three identified inhibitors have prophylactic antiviral effects in mouse models of chikungunya infection. Two of them, the calmodulin inhibitor pimozide and the fatty acid synthesis inhibitor TOFA, have a therapeutic effect in vivo when combined. These results demonstrate the value of loss-of-function screening and pathway analysis for the rational identification of small molecules with therapeutic potential and pave the way for the development of new, host-directed, antiviral agents.

  1. Identifying neuropeptide and protein hormone receptors in Drosophila melanogaster by exploiting genomic data

    DEFF Research Database (Denmark)

    Hauser, Frank; Williamson, Michael; Cazzamali, Giuseppe

    2006-01-01

    insect genome, that of the fruitfly Drosophila melanogaster, was sequenced in 2000, and about 200 GPCRs have been annnotated in this model insect. About 50 of these receptors were predicted to have neuropeptides or protein hormones as their ligands. Since 2000, the cDNAs of most of these candidate...... receptors have been cloned and for many receptors the endogenous ligand has been identified. In this review, we will give an update about the current knowledge of all Drosophila neuropeptide and protein hormone receptors, and discuss their phylogenetic relationships. Udgivelsesdato: 2006-Feb...

  2. Systematic Functional Interrogation of Rare Cancer Variants Identifies Oncogenic Alleles | Office of Cancer Genomics

    Science.gov (United States)

    Cancer genome characterization efforts now provide an initial view of the somatic alterations in primary tumors. However, most point mutations occur at low frequency, and the function of these alleles remains undefined. We have developed a scalable systematic approach to interrogate the function of cancer-associated gene variants. We subjected 474 mutant alleles curated from 5,338 tumors to pooled in vivo tumor formation assays and gene expression profiling. We identified 12 transforming alleles, including two in genes (PIK3CB, POT1) that have not been shown to be tumorigenic.

  3. Urban landscape genomics identifies fine-scale gene flow patterns in an avian invasive.

    Science.gov (United States)

    Low, G W; Chattopadhyay, B; Garg, K M; Irestedt, M; Ericson, Pgp; Yap, G; Tang, Q; Wu, S; Rheindt, F E

    2018-01-01

    Invasive species exert a serious impact on native fauna and flora and have been the target of many eradication and management efforts worldwide. However, a lack of data on population structure and history, exacerbated by the recency of many species introductions, limits the efficiency with which such species can be kept at bay. In this study we generated a novel genome of high assembly quality and genotyped 4735 genome-wide single nucleotide polymorphic (SNP) markers from 78 individuals of an invasive population of the Javan Myna Acridotheres javanicus across the island of Singapore. We inferred limited population subdivision at a micro-geographic level, a genetic patch size (~13-14 km) indicative of a pronounced dispersal ability, and barely an increase in effective population size since introduction despite an increase of four to five orders of magnitude in actual population size, suggesting that low population-genetic diversity following a bottleneck has not impeded establishment success. Landscape genomic analyses identified urban features, such as low-rise neighborhoods, that constitute pronounced barriers to gene flow. Based on our data, we consider an approach targeting the complete eradication of Javan Mynas across Singapore to be unfeasible. Instead, a mixed approach of localized mitigation measures taking into account urban geographic features and planning policy may be the most promising avenue to reducing the adverse impacts of this urban pest. Our study demonstrates how genomic methods can directly inform the management and control of invasive species, even in geographically limited datasets with high gene flow rates.

  4. Comparative genomics identifies distinct lineages of S. Enteritidis from Queensland, Australia.

    Science.gov (United States)

    Graham, Rikki M A; Hiley, Lester; Rathnayake, Irani U; Jennison, Amy V

    2018-01-01

    Salmonella enterica is a major cause of gastroenteritis and foodborne illness in Australia where notification rates in the state of Queensland are the highest in the country. S. Enteritidis is among the five most common serotypes reported in Queensland and it is a priority for epidemiological surveillance due to concerns regarding its emergence in Australia. Using whole genome sequencing, we have analysed the genomic epidemiology of 217 S. Enteritidis isolates from Queensland, and observed that they fall into three distinct clades, which we have differentiated as Clades A, B and C. Phage types and MLST sequence types differed between the clades and comparative genomic analysis has shown that each has a unique profile of prophage and genomic islands. Several of the phage regions present in the S. Enteritidis reference strain P125109 were absent in Clades A and C, and these clades also had difference in the presence of pathogenicity islands, containing complete SPI-6 and SPI-19 regions, while P125109 does not. Antimicrobial resistance markers were found in 39 isolates, all but one of which belonged to Clade B. Phylogenetic analysis of the Queensland isolates in the context of 170 international strains showed that Queensland Clade B isolates group together with the previously identified global clade, while the other two clades are distinct and appear largely restricted to Australia. Locally sourced environmental isolates included in this analysis all belonged to Clades A and C, which is consistent with the theory that these clades are a source of locally acquired infection, while Clade B isolates are mostly travel related.

  5. Integration of transcriptome and whole genomic resequencing data to identify key genes affecting swine fat deposition.

    Directory of Open Access Journals (Sweden)

    Kai Xing

    Full Text Available Fat deposition is highly correlated with the growth, meat quality, reproductive performance and immunity of pigs. Fatty acid synthesis takes place mainly in the adipose tissue of pigs; therefore, in this study, a high-throughput massively parallel sequencing approach was used to generate adipose tissue transcriptomes from two groups of Songliao black pigs that had opposite backfat thickness phenotypes. The total number of paired-end reads produced for each sample was in the range of 39.29-49.36 millions. Approximately 188 genes were differentially expressed in adipose tissue and were enriched for metabolic processes, such as fatty acid biosynthesis, lipid synthesis, metabolism of fatty acids, etinol, caffeine and arachidonic acid and immunity. Additionally, many genetic variations were detected between the two groups through pooled whole-genome resequencing. Integration of transcriptome and whole-genome resequencing data revealed important genomic variations among the differentially expressed genes for fat deposition, for example, the lipogenic genes. Further studies are required to investigate the roles of candidate genes in fat deposition to improve pig breeding programs.

  6. Genome-Wide Association Study Identifies Four Loci Associated with Eruption of Permanent Teeth

    Science.gov (United States)

    Zhang, Hao; Shaffer, John R.; Hansen, Thomas; Esserlind, Ann-Louise; Boyd, Heather A.; Nohr, Ellen A.; Timpson, Nicholas J.; Fatemifar, Ghazaleh; Paternoster, Lavinia; Evans, David M.; Weyant, Robert J.; Levy, Steven M.; Lathrop, Mark; Smith, George Davey; Murray, Jeffrey C.; Olesen, Jes; Werge, Thomas; Marazita, Mary L.; Sørensen, Thorkild I. A.; Melbye, Mads

    2011-01-01

    The sequence and timing of permanent tooth eruption is thought to be highly heritable and can have important implications for the risk of malocclusion, crowding, and periodontal disease. We conducted a genome-wide association study of number of permanent teeth erupted between age 6 and 14 years, analyzed as age-adjusted standard deviation score averaged over multiple time points, based on childhood records for 5,104 women from the Danish National Birth Cohort. Four loci showed association at Peruption and were also known to influence height and breast cancer, respectively. The two other loci pointed to genomic regions without any previous significant genome-wide association study results. The intronic SNP rs7924176 in ADK could be linked to gene expression in monocytes. The combined effect of the four genetic variants was most pronounced between age 10 and 12 years, where children with 6 to 8 delayed tooth eruption alleles had on average 3.5 (95% confidence interval: 2.9–4.1) fewer permanent teeth than children with 0 or 1 of these alleles. PMID:21931568

  7. Genome-wide local ancestry approach identifies genes and variants associated with chemotherapeutic susceptibility in African Americans.

    Directory of Open Access Journals (Sweden)

    Heather E Wheeler

    Full Text Available Chemotherapeutic agents are used in the treatment of many cancers, yet variable resistance and toxicities among individuals limit successful outcomes. Several studies have indicated outcome differences associated with ancestry among patients with various cancer types. Using both traditional SNP-based and newly developed gene-based genome-wide approaches, we investigated the genetics of chemotherapeutic susceptibility in lymphoblastoid cell lines derived from 83 African Americans, a population for which there is a disparity in the number of genome-wide studies performed. To account for population structure in this admixed population, we incorporated local ancestry information into our association model. We tested over 2 million SNPs and identified 325, 176, 240, and 190 SNPs that were suggestively associated with cytarabine-, 5'-deoxyfluorouridine (5'-DFUR-, carboplatin-, and cisplatin-induced cytotoxicity, respectively (p≤10(-4. Importantly, some of these variants are found only in populations of African descent. We also show that cisplatin-susceptibility SNPs are enriched for carboplatin-susceptibility SNPs. Using a gene-based genome-wide association approach, we identified 26, 11, 20, and 41 suggestive candidate genes for association with cytarabine-, 5'-DFUR-, carboplatin-, and cisplatin-induced cytotoxicity, respectively (p≤10(-3. Fourteen of these genes showed evidence of association with their respective chemotherapeutic phenotypes in the Yoruba from Ibadan, Nigeria (p<0.05, including TP53I11, COPS5 and GAS8, which are known to be involved in tumorigenesis. Although our results require further study, we have identified variants and genes associated with chemotherapeutic susceptibility in African Americans by using an approach that incorporates local ancestry information.

  8. Using sheep genomes from diverse U.S. breeds to identify missense variants in genes affecting fecundity

    Science.gov (United States)

    Background: Access to sheep genome sequences significantly improves the chances of identifying genes that may influence the health, welfare, and productivity of these animals. Methods: A public, searchable DNA sequence resource for U.S. sheep was created with whole genome sequence (WGS) of 96 rams. ...

  9. Large-scale meta-analysis of genome-wide association data identifies six new risk loci for Parkinson's disease

    NARCIS (Netherlands)

    Nalls, Mike A.; Pankratz, Nathan; Lill, Christina M.; Do, Chuong B.; Hernandez, Dena G.; Saad, Mohamad; DeStefano, Anita L.; Kara, Eleanna; Bras, Jose; Sharma, Manu; Schulte, Claudia; Keller, Margaux F.; Arepalli, Sampath; Letson, Christopher; Edsall, Connor; Stefansson, Hreinn; Liu, Xinmin; Pliner, Hannah; Lee, Joseph H.; Cheng, Rong; Ikram, M. Arfan; Ioannidis, John P. A.; Hadjigeorgiou, Georgios M.; Bis, Joshua C.; Martinez, Maria; Perlmutter, Joel S.; Goate, Alison; Marder, Karen; Fiske, Brian; Sutherland, Margaret; Xiromerisiou, Georgia; Myers, Richard H.; Clark, Lorraine N.; Stefansson, Kari; Hardy, John A.; Heutink, Peter; Chen, Honglei; Wood, Nicholas W.; Houlden, Henry; Payami, Haydeh; Brice, Alexis; Scott, William K.; Gasser, Thomas; Bertram, Lars; Eriksson, Nicholas; Foroud, Tatiana; Singleton, Andrew B.; Plagnol, Vincent; Sheerin, Una-Marie; Simón-Sánchez, Javier; Lesage, Suzanne; Sveinbjörnsdóttir, Sigurlaug; Barker, Roger; Ben-Shlomo, Yoav; Berendse, Henk W.; Berg, Daniela; Bhatia, Kailash; de Bie, Rob M. A.; Biffi, Alessandro; Bloem, Bas; Bochdanovits, Zoltan; Bonin, Michael; Bras, Jose M.; Brockmann, Kathrin; Brooks, Janet; Burn, David J.; Charlesworth, Gavin; Chinnery, Patrick F.; Chong, Sean; Clarke, Carl E.; Cookson, Mark R.; Cooper, J. Mark; Corvol, Jean Christophe; Counsell, Carl; Damier, Philippe; Dartigues, Jean-François; Deloukas, Panos; Deuschl, Günther; Dexter, David T.; van Dijk, Karin D.; Dillman, Allissa; Durif, Frank; Dürr, Alexandra; Edkins, Sarah; Evans, Jonathan R.; Foltynie, Thomas; Dong, Jing; Gardner, Michelle; Gibbs, J. Raphael; Gray, Emma; Guerreiro, Rita; Harris, Clare; van Hilten, Jacobus J.; Hofman, Albert; Hollenbeck, Albert; Holton, Janice; Hu, Michele; Huang, Xuemei; Wurster, Isabel; Mätzler, Walter; Hudson, Gavin; Hunt, Sarah E.; Huttenlocher, Johanna; Illig, Thomas; Jónsson, Pálmi V.; Lambert, Jean-Charles; Langford, Cordelia; Lees, Andrew; Lichtner, Peter; Limousin, Patricia; Lopez, Grisel; Lorenz, Delia; McNeill, Alisdair; Moorby, Catriona; Moore, Matthew; Morris, Huw R.; Morrison, Karen E.; Mudanohwo, Ese; O'Sullivan, Sean S.; Pearson, Justin; Pétursson, Hjörvar; Pollak, Pierre; Post, Bart; Potter, Simon; Ravina, Bernard; Revesz, Tamas; Riess, Olaf; Rivadeneira, Fernando; Rizzu, Patrizia; Ryten, Mina; Sawcer, Stephen; Schapira, Anthony; Scheffer, Hans; Shaw, Karen; Shoulson, Ira; Sidransky, Ellen; Smith, Colin; Spencer, Chris C. A.; Stefánsson, Hreinn; Bettella, Francesco; Stockton, Joanna D.; Strange, Amy; Talbot, Kevin; Tanner, Carlie M.; Tashakkori-Ghanbaria, Avazeh; Tison, François; Trabzuni, Daniah; Traynor, Bryan J.; Uitterlinden, André G.; Velseboer, Daan; Vidailhet, Marie; Walker, Robert; van de Warrenburg, Bart; Wickremaratchi, Mirdhu; Williams, Nigel; Williams-Gray, Caroline H.; Winder-Rhodes, Sophie; Stefánsson, Kári; Hardy, John; Factor, S.; Higgins, D.; Evans, S.; Shill, H.; Stacy, M.; Danielson, J.; Marlor, L.; Williamson, K.; Jankovic, J.; Hunter, C.; Simon, D.; Ryan, P.; Scollins, L.; Saunders-Pullman, R.; Boyar, K.; Costan-Toth, C.; Ohmann, E.; Sudarsky, L.; Joubert, C.; Friedman, J.; Chou, K.; Fernandez, H.; Lannon, M.; Galvez-Jimenez, N.; Podichetty, A.; Thompson, K.; Lewitt, P.; Deangelis, M.; O'Brien, C.; Seeberger, L.; Dingmann, C.; Judd, D.; Marder, K.; Fraser, J.; Harris, J.; Bertoni, J.; Peterson, C.; Rezak, M.; Medalle, G.; Chouinard, S.; Panisset, M.; Hall, J.; Poiffaut, H.; Calabrese, V.; Roberge, P.; Wojcieszek, J.; Belden, J.; Jennings, D.; Marek, K.; Mendick, S.; Reich, S.; Dunlop, B.; Jog, M.; Horn, C.; Uitti, R.; Turk, M.; Ajax, T.; Mannetter, J.; Sethi, K.; Carpenter, J.; Dill, B.; Hatch, L.; Ligon, K.; Narayan, S.; Blindauer, K.; Abou-Samra, K.; Petit, J.; Elmer, L.; Aiken, E.; Davis, K.; Schell, C.; Wilson, S.; Velickovic, M.; Koller, W.; Phipps, S.; Feigin, A.; Gordon, M.; Hamann, J.; Licari, E.; Marotta-Kollarus, M.; Shannon, B.; Winnick, R.; Simuni, T.; Videnovic, A.; Kaczmarek, A.; Williams, K.; Wolff, M.; Rao, J.; Cook, M.; Fernandez, M.; Kostyk, S.; Hubble, J.; Campbell, A.; Reider, C.; Seward, A.; Camicioli, R.; Carter, J.; Nutt, J.; Andrews, P.; Morehouse, S.; Stone, C.; Mendis, T.; Grimes, D.; Alcorn-Costa, C.; Gray, P.; Haas, K.; Vendette, J.; Sutton, J.; Hutchinson, B.; Young, J.; Rajput, A.; Klassen, L.; Shirley, T.; Manyam, B.; Simpson, P.; Whetteckey, J.; Wulbrecht, B.; Truong, D.; Pathak, M.; Frei, K.; Luong, N.; Tra, T.; Tran, A.; Vo, J.; Lang, A.; Kleiner- Fisman, G.; Nieves, A.; Johnston, L.; So, J.; Podskalny, G.; Giffin, L.; Atchison, P.; Allen, C.; Martin, W.; Wieler, M.; Suchowersky, O.; Furtado, S.; Klimek, M.; Hermanowicz, N.; Niswonger, S.; Shults, C.; Fontaine, D.; Aminoff, M.; Christine, C.; Diminno, M.; Hevezi, J.; Dalvi, A.; Kang, U.; Richman, J.; Uy, S.; Sahay, A.; Gartner, M.; Schwieterman, D.; Hall, D.; Leehey, M.; Culver, S.; Derian, T.; Demarcaida, T.; Thurlow, S.; Rodnitzky, R.; Dobson, J.; Lyons, K.; Pahwa, R.; Gales, T.; Thomas, S.; Shulman, L.; Weiner, W.; Dustin, K.; Singer, C.; Zelaya, L.; Tuite, P.; Hagen, V.; Rolandelli, S.; Schacherer, R.; Kosowicz, J.; Gordon, P.; Werner, J.; Serrano, C.; Roque, S.; Kurlan, R.; Berry, D.; Gardiner, I.; Hauser, R.; Sanchez-Ramos, J.; Zesiewicz, T.; Delgado, H.; Price, K.; Rodriguez, P.; Wolfrath, S.; Pfeiffer, R.; Davis, L.; Pfeiffer, B.; Dewey, R.; Hayward, B.; Johnson, A.; Meacham, M.; Estes, B.; Walker, F.; Hunt, V.; O'Neill, C.; Racette, B.; Swisher, L.; Dijamco, Cheri; Conley, Emily Drabant; Dorfman, Elizabeth; Tung, Joyce Y.; Hinds, David A.; Mountain, Joanna L.; Wojcicki, Anne; Lew, M.; Klein, C.; Golbe, L.; Growdon, J.; Wooten, G. F.; Watts, R.; Guttman, M.; Goldwurm, S.; Saint-Hilaire, M. H.; Baker, K.; Litvan, I.; Nicholson, G.; Nance, M.; Drasby, E.; Isaacson, S.; Burn, D.; Pramstaller, P.; Al-hinti, J.; Moller, A.; Sherman, S.; Roxburgh, R.; Slevin, J.; Perlmutter, J.; Mark, M. H.; Huggins, N.; Pezzoli, G.; Massood, T.; Itin, I.; Corbett, A.; Chinnery, P.; Ostergaard, K.; Snow, B.; Cambi, F.; Kay, D.; Samii, A.; Agarwal, P.; Roberts, J. W.; Higgins, D. S.; Molho, Eric; Rosen, Ami; Montimurro, J.; Martinez, E.; Griffith, A.; Kusel, V.; Yearout, D.; Zabetian, C.; Clark, L. N.; Liu, X.; Lee, J. H.; Taub, R. Cheng; Louis, E. D.; Cote, L. J.; Waters, C.; Ford, B.; Fahn, S.; Vance, Jeffery M.; Beecham, Gary W.; Martin, Eden R.; Nuytemans, Karen; Pericak-Vance, Margaret A.; Haines, Jonathan L.; DeStefano, Anita; Seshadri, Sudha; Choi, Seung Hoan; Frank, Samuel; Psaty, Bruce M.; Rice, Kenneth; Longstreth, W. T.; Ton, Thanh G. N.; Jain, Samay; van Duijn, Cornelia M.; Verlinden, Vincent J.; Koudstaal, Peter J.; Singleton, Andrew; Cookson, Mark; Hernandez, Dena; Nalls, Michael; Zonderman, Alan; Ferrucci, Luigi; Johnson, Robert; Longo, Dan; O'Brien, Richard; Traynor, Bryan; Troncoso, Juan; van der Brug, Marcel; Zielke, Ronald; Weale, Michael; Ramasamy, Adaikalavan; Dardiotis, Efthimios; Tsimourtou, Vana; Spanaki, Cleanthe; Plaitakis, Andreas; Bozi, Maria; Stefanis, Leonidas; Vassilatis, Dimitris; Koutsis, Georgios; Panas, Marios; Lunnon, Katie; Lupton, Michelle; Powell, John; Parkkinen, Laura; Ansorge, Olaf

    2014-01-01

    We conducted a meta-analysis of Parkinson's disease genome-wide association studies using a common set of 7,893,274 variants across 13,708 cases and 95,282 controls. Twenty-six loci were identified as having genome-wide significant association; these and 6 additional previously reported loci were

  10. Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes.

    Science.gov (United States)

    Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich

    2012-02-01

    The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.

  11. Genome-wide association study identifies shared risk loci common to two malignancies in golden retrievers.

    Directory of Open Access Journals (Sweden)

    Noriko Tonomura

    2015-02-01

    Full Text Available Dogs, with their breed-determined limited genetic background, are great models of human disease including cancer. Canine B-cell lymphoma and hemangiosarcoma are both malignancies of the hematologic system that are clinically and histologically similar to human B-cell non-Hodgkin lymphoma and angiosarcoma, respectively. Golden retrievers in the US show significantly elevated lifetime risk for both B-cell lymphoma (6% and hemangiosarcoma (20%. We conducted genome-wide association studies for hemangiosarcoma and B-cell lymphoma, identifying two shared predisposing loci. The two associated loci are located on chromosome 5, and together contribute ~20% of the risk of developing these cancers. Genome-wide p-values for the top SNP of each locus are 4.6×10-7 and 2.7×10-6, respectively. Whole genome resequencing of nine cases and controls followed by genotyping and detailed analysis identified three shared and one B-cell lymphoma specific risk haplotypes within the two loci, but no coding changes were associated with the risk haplotypes. Gene expression analysis of B-cell lymphoma tumors revealed that carrying the risk haplotypes at the first locus is associated with down-regulation of several nearby genes including the proximal gene TRPC6, a transient receptor Ca2+-channel involved in T-cell activation, among other functions. The shared risk haplotype in the second locus overlaps the vesicle transport and release gene STX8. Carrying the shared risk haplotype is associated with gene expression changes of 100 genes enriched for pathways involved in immune cell activation. Thus, the predisposing germ-line mutations in B-cell lymphoma and hemangiosarcoma appear to be regulatory, and affect pathways involved in T-cell mediated immune response in the tumor. This suggests that the interaction between the immune system and malignant cells plays a common role in the tumorigenesis of these relatively different cancers.

  12. DESCARTES' RULE OF SIGNS AND THE IDENTIFIABILITY OF POPULATION DEMOGRAPHIC MODELS FROM GENOMIC VARIATION DATA.

    Science.gov (United States)

    Bhaskar, Anand; Song, Yun S

    2014-01-01

    The sample frequency spectrum (SFS) is a widely-used summary statistic of genomic variation in a sample of homologous DNA sequences. It provides a highly efficient dimensional reduction of large-scale population genomic data and its mathematical dependence on the underlying population demography is well understood, thus enabling the development of efficient inference algorithms. However, it has been recently shown that very different population demographies can actually generate the same SFS for arbitrarily large sample sizes. Although in principle this nonidentifiability issue poses a thorny challenge to statistical inference, the population size functions involved in the counterexamples are arguably not so biologically realistic. Here, we revisit this problem and examine the identifiability of demographic models under the restriction that the population sizes are piecewise-defined where each piece belongs to some family of biologically-motivated functions. Under this assumption, we prove that the expected SFS of a sample uniquely determines the underlying demographic model, provided that the sample is sufficiently large. We obtain a general bound on the sample size sufficient for identifiability; the bound depends on the number of pieces in the demographic model and also on the type of population size function in each piece. In the cases of piecewise-constant, piecewise-exponential and piecewise-generalized-exponential models, which are often assumed in population genomic inferences, we provide explicit formulas for the bounds as simple functions of the number of pieces. Lastly, we obtain analogous results for the "folded" SFS, which is often used when there is ambiguity as to which allelic type is ancestral. Our results are proved using a generalization of Descartes' rule of signs for polynomials to the Laplace transform of piecewise continuous functions.

  13. DESCARTES’ RULE OF SIGNS AND THE IDENTIFIABILITY OF POPULATION DEMOGRAPHIC MODELS FROM GENOMIC VARIATION DATA1

    Science.gov (United States)

    Bhaskar, Anand; Song, Yun S.

    2016-01-01

    The sample frequency spectrum (SFS) is a widely-used summary statistic of genomic variation in a sample of homologous DNA sequences. It provides a highly efficient dimensional reduction of large-scale population genomic data and its mathematical dependence on the underlying population demography is well understood, thus enabling the development of efficient inference algorithms. However, it has been recently shown that very different population demographies can actually generate the same SFS for arbitrarily large sample sizes. Although in principle this nonidentifiability issue poses a thorny challenge to statistical inference, the population size functions involved in the counterexamples are arguably not so biologically realistic. Here, we revisit this problem and examine the identifiability of demographic models under the restriction that the population sizes are piecewise-defined where each piece belongs to some family of biologically-motivated functions. Under this assumption, we prove that the expected SFS of a sample uniquely determines the underlying demographic model, provided that the sample is sufficiently large. We obtain a general bound on the sample size sufficient for identifiability; the bound depends on the number of pieces in the demographic model and also on the type of population size function in each piece. In the cases of piecewise-constant, piecewise-exponential and piecewise-generalized-exponential models, which are often assumed in population genomic inferences, we provide explicit formulas for the bounds as simple functions of the number of pieces. Lastly, we obtain analogous results for the “folded” SFS, which is often used when there is ambiguity as to which allelic type is ancestral. Our results are proved using a generalization of Descartes’ rule of signs for polynomials to the Laplace transform of piecewise continuous functions. PMID:28018011

  14. Epidemiological analysis of Salmonella clusters identified by whole genome sequencing, England and Wales 2014.

    Science.gov (United States)

    Waldram, Alison; Dolan, Gayle; Ashton, Philip M; Jenkins, Claire; Dallman, Timothy J

    2018-05-01

    The unprecedented level of bacterial strain discrimination provided by whole genome sequencing (WGS) presents new challenges with respect to the utility and interpretation of the data. Whole genome sequences from 1445 isolates of Salmonella belonging to the most commonly identified serotypes in England and Wales isolated between April and August 2014 were analysed. Single linkage single nucleotide polymorphism thresholds at the 10, 5 and 0 level were explored for evidence of epidemiological links between clustered cases. Analysis of the WGS data organised 566 of the 1445 isolates into 32 clusters of five or more. A statistically significant epidemiological link was identified for 17 clusters. The clusters were associated with foreign travel (n = 8), consumption of Chinese takeaways (n = 4), chicken eaten at home (n = 2), and one each of the following; eating out, contact with another case in the home and contact with reptiles. In the same time frame, one cluster was detected using traditional outbreak detection methods. WGS can be used for the highly specific and highly sensitive detection of biologically related isolates when epidemiological links are obscured. Improvements in the collection of detailed, standardised exposure information would enhance cluster investigations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Genomic profiling identifies GATA6 as a candidate oncogene amplified in pancreatobiliary cancer.

    Directory of Open Access Journals (Sweden)

    Kevin A Kwei

    2008-05-01

    Full Text Available Pancreatobiliary cancers have among the highest mortality rates of any cancer type. Discovering the full spectrum of molecular genetic alterations may suggest new avenues for therapy. To catalogue genomic alterations, we carried out array-based genomic profiling of 31 exocrine pancreatic cancers and 6 distal bile duct cancers, expanded as xenografts to enrich the tumor cell fraction. We identified numerous focal DNA amplifications and deletions, including in 19% of pancreatobiliary cases gain at cytoband 18q11.2, a locus uncommonly amplified in other tumor types. The smallest shared amplification at 18q11.2 included GATA6, a transcriptional regulator previously linked to normal pancreas development. When amplified, GATA6 was overexpressed at both the mRNA and protein levels, and strong immunostaining was observed in 25 of 54 (46% primary pancreatic cancers compared to 0 of 33 normal pancreas specimens surveyed. GATA6 expression in xenografts was associated with specific microarray gene-expression patterns, enriched for GATA binding sites and mitochondrial oxidative phosphorylation activity. siRNA mediated knockdown of GATA6 in pancreatic cancer cell lines with amplification led to reduced cell proliferation, cell cycle progression, and colony formation. Our findings indicate that GATA6 amplification and overexpression contribute to the oncogenic phenotypes of pancreatic cancer cells, and identify GATA6 as a candidate lineage-specific oncogene in pancreatobiliary cancer, with implications for novel treatment strategies.

  16. Whole-genome sequencing identifies recurrent mutations in chronic lymphocytic leukaemia

    Science.gov (United States)

    Puente, Xose S.; Pinyol, Magda; Quesada, Víctor; Conde, Laura; Ordóñez, Gonzalo R.; Villamor, Neus; Escaramis, Georgia; Jares, Pedro; Beà, Sílvia; González-Díaz, Marcos; Bassaganyas, Laia; Baumann, Tycho; Juan, Manel; López-Guerra, Mónica; Colomer, Dolors; Tubío, José M. C.; López, Cristina; Navarro, Alba; Tornador, Cristian; Aymerich, Marta; Rozman, María; Hernández, Jesús M.; Puente, Diana A.; Freije, José M. P.; Velasco, Gloria; Gutiérrez-Fernández, Ana; Costa, Dolors; Carrió, Anna; Guijarro, Sara; Enjuanes, Anna; Hernández, Lluís; Yagüe, Jordi; Nicolás, Pilar; Romeo-Casabona, Carlos M.; Himmelbauer, Heinz; Castillo, Ester; Dohm, Juliane C.; de Sanjosé, Silvia; Piris, Miguel A.; de Alava, Enrique; Miguel, Jesús San; Royo, Romina; Gelpí, Josep L.; Torrents, David; Orozco, Modesto; Pisano, David G.; Valencia, Alfonso; Guigó, Roderic; Bayés, Mónica; Heath, Simon; Gut, Marta; Klatt, Peter; Marshall, John; Raine, Keiran; Stebbings, Lucy A.; Futreal, P. Andrew; Stratton, Michael R.; Campbell, Peter J.; Gut, Ivo; López-Guillermo, Armando; Estivill, Xavier; Montserrat, Emili; López-Otín, Carlos; Campo, Elías

    2012-01-01

    Chronic lymphocytic leukaemia (CLL), the most frequent leukaemia in adults in Western countries, is a heterogeneous disease with variable clinical presentation and evolution1,2. Two major molecular subtypes can be distinguished, characterized respectively by a high or low number of somatic hypermutations in the variable region of immunoglobulin genes3,4. The molecular changes leading to the pathogenesis of the disease are still poorly understood. Here we performed whole-genome sequencing of four cases of CLL and identified 46 somatic mutations that potentially affect gene function. Further analysis of these mutations in 363 patients with CLL identified four genes that are recurrently mutated: notch 1 (NOTCH1), exportin 1 (XPO1), myeloid differentiation primary response gene 88 (MYD88) and kelch-like 6 (KLHL6). Mutations in MYD88 and KLHL6 are predominant in cases of CLL with mutated immunoglobulin genes, whereas NOTCH1 and XPO1 mutations are mainly detected in patients with unmutated immunoglobulins. The patterns of somatic mutation, supported by functional and clinical analyses, strongly indicate that the recurrent NOTCH1, MYD88 and XPO1 mutations are oncogenic changes that contribute to the clinical evolution of the disease. To our knowledge, this is the first comprehensive analysis of CLL combining whole-genome sequencing with clinical characteristics and clinical outcomes. It highlights the usefulness of this approach for the identification of clinically relevant mutations in cancer. PMID:21642962

  17. PAPA: a flexible tool for identifying pleiotropic pathways using genome-wide association study summaries.

    Science.gov (United States)

    Wen, Yan; Wang, Wenyu; Guo, Xiong; Zhang, Feng

    2016-03-15

    : Pleiotropy is common in the genetic architectures of complex diseases. To the best of our knowledge, no analysis tool has been developed for identifying pleiotropic pathways using multiple genome-wide association study (GWAS) summaries by now. Here, we present PAPA, a flexible tool for pleiotropic pathway analysis utilizing GWAS summary results. The performance of PAPA was validated using publicly available GWAS summaries of body mass index and waist-hip ratio of the GIANT datasets. PAPA identified a set of pleiotropic pathways, which have been demonstrated to be involved in the development of obesity. PAPA program, document and illustrative example are available at http://sourceforge.net/projects/papav1/files/ : fzhxjtu@mail.xjtu.edu.cn Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  18. Genome-wide meta-analysis identifies new susceptibility loci for migraine.

    Science.gov (United States)

    Anttila, Verneri; Winsvold, Bendik S; Gormley, Padhraig; Kurth, Tobias; Bettella, Francesco; McMahon, George; Kallela, Mikko; Malik, Rainer; de Vries, Boukje; Terwindt, Gisela; Medland, Sarah E; Todt, Unda; McArdle, Wendy L; Quaye, Lydia; Koiranen, Markku; Ikram, M Arfan; Lehtimäki, Terho; Stam, Anine H; Ligthart, Lannie; Wedenoja, Juho; Dunham, Ian; Neale, Benjamin M; Palta, Priit; Hamalainen, Eija; Schürks, Markus; Rose, Lynda M; Buring, Julie E; Ridker, Paul M; Steinberg, Stacy; Stefansson, Hreinn; Jakobsson, Finnbogi; Lawlor, Debbie A; Evans, David M; Ring, Susan M; Färkkilä, Markus; Artto, Ville; Kaunisto, Mari A; Freilinger, Tobias; Schoenen, Jean; Frants, Rune R; Pelzer, Nadine; Weller, Claudia M; Zielman, Ronald; Heath, Andrew C; Madden, Pamela A F; Montgomery, Grant W; Martin, Nicholas G; Borck, Guntram; Göbel, Hartmut; Heinze, Axel; Heinze-Kuhn, Katja; Williams, Frances M K; Hartikainen, Anna-Liisa; Pouta, Anneli; van den Ende, Joyce; Uitterlinden, Andre G; Hofman, Albert; Amin, Najaf; Hottenga, Jouke-Jan; Vink, Jacqueline M; Heikkilä, Kauko; Alexander, Michael; Muller-Myhsok, Bertram; Schreiber, Stefan; Meitinger, Thomas; Wichmann, Heinz Erich; Aromaa, Arpo; Eriksson, Johan G; Traynor, Bryan; Trabzuni, Daniah; Rossin, Elizabeth; Lage, Kasper; Jacobs, Suzanne B R; Gibbs, J Raphael; Birney, Ewan; Kaprio, Jaakko; Penninx, Brenda W; Boomsma, Dorret I; van Duijn, Cornelia; Raitakari, Olli; Jarvelin, Marjo-Riitta; Zwart, John-Anker; Cherkas, Lynn; Strachan, David P; Kubisch, Christian; Ferrari, Michel D; van den Maagdenberg, Arn M J M; Dichgans, Martin; Wessman, Maija; Smith, George Davey; Stefansson, Kari; Daly, Mark J; Nyholt, Dale R; Chasman, Daniel; Palotie, Aarno

    2013-08-01

    Migraine is the most common brain disorder, affecting approximately 14% of the adult population, but its molecular mechanisms are poorly understood. We report the results of a meta-analysis across 29 genome-wide association studies, including a total of 23,285 individuals with migraine (cases) and 95,425 population-matched controls. We identified 12 loci associated with migraine susceptibility (P<5×10(-8)). Five loci are new: near AJAP1 at 1p36, near TSPAN2 at 1p13, within FHL5 at 6q16, within C7orf10 at 7p14 and near MMP16 at 8q21. Three of these loci were identified in disease subgroup analyses. Brain tissue expression quantitative trait locus analysis suggests potential functional candidate genes at four loci: APOA1BP, TBC1D7, FUT9, STAT6 and ATP5B.

  19. Genome-wide association study identifies variants in HORMAD2 associated with tonsillectomy

    DEFF Research Database (Denmark)

    Feenstra, Bjarke; Bager, Peter; Liu, Xueping

    2017-01-01

    BACKGROUND: Inflammation of the tonsils is a normal response to infection, but some individuals experience recurrent, severe tonsillitis and massive hypertrophy of the tonsils in which case surgical removal of the tonsils may be considered. OBJECTIVE: To identify common genetic variants associate...... the molecular mechanisms underlying the genetic association involve general lymphoid hyper-reaction throughout the mucosa-associated lymphoid tissue system.......BACKGROUND: Inflammation of the tonsils is a normal response to infection, but some individuals experience recurrent, severe tonsillitis and massive hypertrophy of the tonsils in which case surgical removal of the tonsils may be considered. OBJECTIVE: To identify common genetic variants associated...... with tonsillectomy. METHODS: We used tonsillectomy information from Danish health registers and carried out a genome-wide association study comprising 1464 patients and 12 019 controls of Northwestern European ancestry, with replication in an independent sample set of 1575 patients and 1367 controls. RESULTS...

  20. A genome scale RNAi screen identifies GLI1 as a novel gene regulating vorinostat sensitivity.

    Science.gov (United States)

    Falkenberg, K J; Newbold, A; Gould, C M; Luu, J; Trapani, J A; Matthews, G M; Simpson, K J; Johnstone, R W

    2016-07-01

    Vorinostat is an FDA-approved histone deacetylase inhibitor (HDACi) that has proven clinical success in some patients; however, it remains unclear why certain patients remain unresponsive to this agent and other HDACis. Constitutive STAT (signal transducer and activator of transcription) activation, overexpression of prosurvival Bcl-2 proteins and loss of HR23B have been identified as potential biomarkers of HDACi resistance; however, none have yet been used to aid the clinical utility of HDACi. Herein, we aimed to further elucidate vorinostat-resistance mechanisms through a functional genomics screen to identify novel genes that when knocked down by RNA interference (RNAi) sensitized cells to vorinostat-induced apoptosis. A synthetic lethal functional screen using a whole-genome protein-coding RNAi library was used to identify genes that when knocked down cooperated with vorinostat to induce tumor cell apoptosis in otherwise resistant cells. Through iterative screening, we identified 10 vorinostat-resistance candidate genes that sensitized specifically to vorinostat. One of these vorinostat-resistance genes was GLI1, an oncogene not previously known to regulate the activity of HDACi. Treatment of vorinostat-resistant cells with the GLI1 small-molecule inhibitor, GANT61, phenocopied the effect of GLI1 knockdown. The mechanism by which GLI1 loss of function sensitized tumor cells to vorinostat-induced apoptosis is at least in part through interactions with vorinostat to alter gene expression in a manner that favored apoptosis. Upon GLI1 knockdown and vorinostat treatment, BCL2L1 expression was repressed and overexpression of BCL2L1 inhibited GLI1-knockdown-mediated vorinostat sensitization. Taken together, we present the identification and characterization of GLI1 as a new HDACi resistance gene, providing a strong rationale for development of GLI1 inhibitors for clinical use in combination with HDACi therapy.

  1. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C. dubliniensis.

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, P.H.M.

    2003-01-01

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  2. Reducing uncertainty at minimal cost: a method to identify important input parameters and prioritize data collection

    NARCIS (Netherlands)

    Uwizeye, U.A.; Groen, E.A.; Gerber, P.J.; Schulte, Rogier P.O.; Boer, de I.J.M.

    2016-01-01

    The study aims to illustrate a method to identify important input parameters that explain most of the output variance ofenvironmental assessment models. The method is tested for the computation of life-cycle nitrogen (N) use efficiencyindicators among mixed dairy production systems in Rwanda. We

  3. Structural and functional insights of β-glucosidases identified from the genome of Aspergillus fumigatus

    Science.gov (United States)

    Dodda, Subba Reddy; Aich, Aparajita; Sarkar, Nibedita; Jain, Piyush; Jain, Sneha; Mondal, Sudipa; Aikat, Kaustav; Mukhopadhyay, Sudit S.

    2018-03-01

    Thermostable glucose tolerant β-glucosidase from Aspergillus species has attracted worldwide interest for their potentiality in industrial applications and bioethanol production. A strain of Aspergillus fumigatus (AfNITDGPKA3) identified by our laboratory from straw retting ground showed higher cellulase activity, specifically the β-glucosidase activity, compared to other contemporary strains. Though A. fumigatus has been known for high cellulase activity, detailed identification and characterization of the cellulase genes from their genome is yet to be done. In this work we have been analyzed the cellulase genes from the genome sequence database of Aspergillus fumigatus (Af293). Genome analysis suggests two cellobiohydrolase, eleven endoglucanase and seventeen β-glucosidase genes present. β-Glucosidase genes belong to either Glycohydro1 (GH1 or Bgl1) or Glycohydro3 (GH3 or Bgl3) family. The sequence similarity suggests that Bgl1 and Bgl3 of A. fumagatus are phylogenetically close to those of A. fisheri and A. oryzae. The modelled structure of the Bgl1 predicts the (β/α)8 barrel type structure with deep and narrow active site, whereas, Bgl3 shows the (α/β)8 barrel and (α/β)6 sandwich structure with shallow and open active site. Docking results suggest that amino acids Glu544, Glu466, Trp408,Trp567,Tyr44,Tyr222,Tyr770,Asp844,Asp537,Asn212,Asn217 of Bgl3 and Asp224,Asn242,Glu440, Glu445, Tyr367, Tyr365,Thr994,Trp435,Trp446 of Bgl1 are involved in the hydrolysis. Binding affinity analyses suggest that Bgl3 and Bgl1 enzymes are more active on the substrates like 4-methylumbelliferyl glycoside (MUG) and p-nitrophenyl-β-D-1, 4-glucopyranoside (pNPG) than on cellobiose. Further docking with glucose suggests that Bgl1 is more glucose tolerant than Bgl3. Analysis of the Aspergillus fumigatus genome may help to identify a β-glucosidase enzyme with better property and the structural information may help to develop an engineered recombinant enzyme.

  4. A genome-wide association analysis of a broad psychosis phenotype identifies three loci for further investigation

    OpenAIRE

    Bramon, Elvira; Pirinen, Matti; Strange, Amy; Lin, Kuang; Freeman, Colin; Bellenguez, Céline; Su, Zhan; Band, Gavin; Pearson, Richard; Vukcevic, Damjan; Langford, Cordelia; Deloukas, Panos; Hunt, Sarah; Gray, Emma; Dronov, Serge

    2014-01-01

    Genome-wide association studies (GWAS) have identified several loci associated with schizophrenia and/or bipolar disorder. We performed a GWAS of psychosis as a broad syndrome rather than within specific diagnostic categories.

  5. Meta-Analysis of Genome-Wide Association Studies Identifies Genetic Risk Factors for Stroke in African Americans.

    Science.gov (United States)

    Carty, Cara L; Keene, Keith L; Cheng, Yu-Ching; Meschia, James F; Chen, Wei-Min; Nalls, Mike; Bis, Joshua C; Kittner, Steven J; Rich, Stephen S; Tajuddin, Salman; Zonderman, Alan B; Evans, Michele K; Langefeld, Carl D; Gottesman, Rebecca; Mosley, Thomas H; Shahar, Eyal; Woo, Daniel; Yaffe, Kristine; Liu, Yongmei; Sale, Michèle M; Dichgans, Martin; Malik, Rainer; Longstreth, W T; Mitchell, Braxton D; Psaty, Bruce M; Kooperberg, Charles; Reiner, Alexander; Worrall, Bradford B; Fornage, Myriam

    2015-08-01

    The majority of genome-wide association studies (GWAS) of stroke have focused on European-ancestry populations; however, none has been conducted in African Americans, despite the disproportionately high burden of stroke in this population. The Consortium of Minority Population Genome-Wide Association Studies of Stroke (COMPASS) was established to identify stroke susceptibility loci in minority populations. Using METAL, we conducted meta-analyses of GWAS in 14 746 African Americans (1365 ischemic and 1592 total stroke cases) from COMPASS, and tested genetic variants with Pstroke genetic studies in European-ancestry populations. We also evaluated stroke loci previously identified in European-ancestry populations. The 15q21.3 locus linked with lipid levels and hypertension was associated with total stroke (rs4471613; P=3.9×10(-8)) in African Americans. Nominal associations (Pstroke were observed for 18 variants in or near genes implicated in cell cycle/mRNA presplicing (PTPRG, CDC5L), platelet function (HPS4), blood-brain barrier permeability (CLDN17), immune response (ELTD1, WDFY4, and IL1F10-IL1RN), and histone modification (HDAC9). Two of these loci achieved nominal significance in METASTROKE: 5q35.2 (P=0.03), and 1p31.1 (P=0.018). Four of 7 previously reported ischemic stroke loci (PITX2, HDAC9, CDKN2A/CDKN2B, and ZFHX3) were nominally associated (Pstroke in COMPASS. We identified a novel genetic variant associated with total stroke in African Americans and found that ischemic stroke loci identified in European-ancestry populations may also be relevant for African Americans. Our findings support investigation of diverse populations to identify and characterize genetic risk factors, and the importance of shared genetic risk across populations. © 2015 American Heart Association, Inc.

  6. Pooled-DNA sequencing identifies genomic regions of selection in Nigerian isolates of Plasmodium falciparum.

    Science.gov (United States)

    Oyebola, Kolapo M; Idowu, Emmanuel T; Olukosi, Yetunde A; Awolola, Taiwo S; Amambua-Ngwa, Alfred

    2017-06-29

    The burden of falciparum malaria is especially high in sub-Saharan Africa. Differences in pressure from host immunity and antimalarial drugs lead to adaptive changes responsible for high level of genetic variations within and between the parasite populations. Population-specific genetic studies to survey for genes under positive or balancing selection resulting from drug pressure or host immunity will allow for refinement of interventions. We performed a pooled sequencing (pool-seq) of the genomes of 100 Plasmodium falciparum isolates from Nigeria. We explored allele-frequency based neutrality test (Tajima's D) and integrated haplotype score (iHS) to identify genes under selection. Fourteen shared iHS regions that had at least 2 SNPs with a score > 2.5 were identified. These regions code for genes that were likely to have been under strong directional selection. Two of these genes were the chloroquine resistance transporter (CRT) on chromosome 7 and the multidrug resistance 1 (MDR1) on chromosome 5. There was a weak signature of selection in the dihydrofolate reductase (DHFR) gene on chromosome 4 and MDR5 genes on chromosome 13, with only 2 and 3 SNPs respectively identified within the iHS window. We observed strong selection pressure attributable to continued chloroquine and sulfadoxine-pyrimethamine use despite their official proscription for the treatment of uncomplicated malaria. There was also a major selective sweep on chromosome 6 which had 32 SNPs within the shared iHS region. Tajima's D of circumsporozoite protein (CSP), erythrocyte-binding antigen (EBA-175), merozoite surface proteins - MSP3 and MSP7, merozoite surface protein duffy binding-like (MSPDBL2) and serine repeat antigen (SERA-5) were 1.38, 1.29, 0.73, 0.84 and 0.21, respectively. We have demonstrated the use of pool-seq to understand genomic patterns of selection and variability in P. falciparum from Nigeria, which bears the highest burden of infections. This investigation identified known

  7. Genome-wide mapping of virulence in brown planthopper identifies loci that break down host plant resistance.

    Science.gov (United States)

    Jing, Shengli; Zhang, Lei; Ma, Yinhua; Liu, Bingfang; Zhao, Yan; Yu, Hangjin; Zhou, Xi; Qin, Rui; Zhu, Lili; He, Guangcun

    2014-01-01

    Insects and plants have coexisted for over 350 million years and their interactions have affected ecosystems and agricultural practices worldwide. Variation in herbivorous insects' virulence to circumvent host resistance has been extensively documented. However, despite decades of investigation, the genetic foundations of virulence are currently unknown. The brown planthopper (Nilaparvata lugens) is the most destructive rice (Oryza sativa) pest in the world. The identification of the resistance gene Bph1 and its introduction in commercial rice varieties prompted the emergence of a new virulent brown planthopper biotype that was able to break the resistance conferred by Bph1. In this study, we aimed to construct a high density linkage map for the brown planthopper and identify the loci responsible for its virulence in order to determine their genetic architecture. Based on genotyping data for hundreds of molecular markers in three mapping populations, we constructed the most comprehensive linkage map available for this species, covering 96.6% of its genome. Fifteen chromosomes were anchored with 124 gene-specific markers. Using genome-wide scanning and interval mapping, the Qhp7 locus that governs preference for Bph1 plants was mapped to a 0.1 cM region of chromosome 7. In addition, two major QTLs that govern the rate of insect growth on resistant rice plants were identified on chromosomes 5 (Qgr5) and 14 (Qgr14). This is the first study to successfully locate virulence in the genome of this important agricultural insect by marker-based genetic mapping. Our results show that the virulence which overcomes the resistance conferred by Bph1 is controlled by a few major genes and that the components of virulence originate from independent genetic characters. The isolation of these loci will enable the elucidation of the molecular mechanisms underpinning the rice-brown planthopper interaction and facilitate the development of durable approaches for controlling this most

  8. Genome-wide mapping of virulence in brown planthopper identifies loci that break down host plant resistance.

    Directory of Open Access Journals (Sweden)

    Shengli Jing

    Full Text Available Insects and plants have coexisted for over 350 million years and their interactions have affected ecosystems and agricultural practices worldwide. Variation in herbivorous insects' virulence to circumvent host resistance has been extensively documented. However, despite decades of investigation, the genetic foundations of virulence are currently unknown. The brown planthopper (Nilaparvata lugens is the most destructive rice (Oryza sativa pest in the world. The identification of the resistance gene Bph1 and its introduction in commercial rice varieties prompted the emergence of a new virulent brown planthopper biotype that was able to break the resistance conferred by Bph1. In this study, we aimed to construct a high density linkage map for the brown planthopper and identify the loci responsible for its virulence in order to determine their genetic architecture. Based on genotyping data for hundreds of molecular markers in three mapping populations, we constructed the most comprehensive linkage map available for this species, covering 96.6% of its genome. Fifteen chromosomes were anchored with 124 gene-specific markers. Using genome-wide scanning and interval mapping, the Qhp7 locus that governs preference for Bph1 plants was mapped to a 0.1 cM region of chromosome 7. In addition, two major QTLs that govern the rate of insect growth on resistant rice plants were identified on chromosomes 5 (Qgr5 and 14 (Qgr14. This is the first study to successfully locate virulence in the genome of this important agricultural insect by marker-based genetic mapping. Our results show that the virulence which overcomes the resistance conferred by Bph1 is controlled by a few major genes and that the components of virulence originate from independent genetic characters. The isolation of these loci will enable the elucidation of the molecular mechanisms underpinning the rice-brown planthopper interaction and facilitate the development of durable approaches for

  9. A meta-analysis of genome-wide association studies identifies novel variants associated with osteoarthritis of the hip

    DEFF Research Database (Denmark)

    Evangelou, Evangelos; Kerkhof, Hanneke J; Styrkarsdottir, Unnur

    2014-01-01

    Osteoarthritis (OA) is the most common form of arthritis with a clear genetic component. To identify novel loci associated with hip OA we performed a meta-analysis of genome-wide association studies (GWAS) on European subjects.......Osteoarthritis (OA) is the most common form of arthritis with a clear genetic component. To identify novel loci associated with hip OA we performed a meta-analysis of genome-wide association studies (GWAS) on European subjects....

  10. Nine Loci for Ocular Axial Length Identified through Genome-wide Association Studies, Including Shared Loci with Refractive Error

    Science.gov (United States)

    Cheng, Ching-Yu; Schache, Maria; Ikram, M. Kamran; Young, Terri L.; Guggenheim, Jeremy A.; Vitart, Veronique; MacGregor, Stuart; Verhoeven, Virginie J.M.; Barathi, Veluchamy A.; Liao, Jiemin; Hysi, Pirro G.; Bailey-Wilson, Joan E.; St. Pourcain, Beate; Kemp, John P.; McMahon, George; Timpson, Nicholas J.; Evans, David M.; Montgomery, Grant W.; Mishra, Aniket; Wang, Ya Xing; Wang, Jie Jin; Rochtchina, Elena; Polasek, Ozren; Wright, Alan F.; Amin, Najaf; van Leeuwen, Elisabeth M.; Wilson, James F.; Pennell, Craig E.; van Duijn, Cornelia M.; de Jong, Paulus T.V.M.; Vingerling, Johannes R.; Zhou, Xin; Chen, Peng; Li, Ruoying; Tay, Wan-Ting; Zheng, Yingfeng; Chew, Merwyn; Rahi, Jugnoo S.; Hysi, Pirro G.; Yoshimura, Nagahisa; Yamashiro, Kenji; Miyake, Masahiro; Delcourt, Cécile; Maubaret, Cecilia; Williams, Cathy; Guggenheim, Jeremy A.; Northstone, Kate; Ring, Susan M.; Davey-Smith, George; Craig, Jamie E.; Burdon, Kathryn P.; Fogarty, Rhys D.; Iyengar, Sudha K.; Igo, Robert P.; Chew, Emily; Janmahasathian, Sarayut; Iyengar, Sudha K.; Igo, Robert P.; Chew, Emily; Janmahasathian, Sarayut; Stambolian, Dwight; Wilson, Joan E. Bailey; MacGregor, Stuart; Lu, Yi; Jonas, Jost B.; Xu, Liang; Saw, Seang-Mei; Baird, Paul N.; Rochtchina, Elena; Mitchell, Paul; Wang, Jie Jin; Jonas, Jost B.; Nangia, Vinay; Hayward, Caroline; Wright, Alan F.; Vitart, Veronique; Polasek, Ozren; Campbell, Harry; Vitart, Veronique; Rudan, Igor; Vatavuk, Zoran; Vitart, Veronique; Paterson, Andrew D.; Hosseini, S. Mohsen; Iyengar, Sudha K.; Igo, Robert P.; Fondran, Jeremy R.; Young, Terri L.; Feng, Sheng; Verhoeven, Virginie J.M.; Klaver, Caroline C.; van Duijn, Cornelia M.; Metspalu, Andres; Haller, Toomas; Mihailov, Evelin; Pärssinen, Olavi; Wedenoja, Juho; Wilson, Joan E. Bailey; Wojciechowski, Robert; Baird, Paul N.; Schache, Maria; Pfeiffer, Norbert; Höhn, René; Pang, Chi Pui; Chen, Peng; Meitinger, Thomas; Oexle, Konrad; Wegner, Aharon; Yoshimura, Nagahisa; Yamashiro, Kenji; Miyake, Masahiro; Pärssinen, Olavi; Yip, Shea Ping; Ho, Daniel W.H.; Pirastu, Mario; Murgia, Federico; Portas, Laura; Biino, Genevra; Wilson, James F.; Fleck, Brian; Vitart, Veronique; Stambolian, Dwight; Wilson, Joan E. Bailey; Hewitt, Alex W.; Ang, Wei; Verhoeven, Virginie J.M.; Klaver, Caroline C.; van Duijn, Cornelia M.; Saw, Seang-Mei; Wong, Tien-Yin; Teo, Yik-Ying; Fan, Qiao; Cheng, Ching-Yu; Zhou, Xin; Ikram, M. Kamran; Saw, Seang-Mei; Teo, Yik-Ying; Fan, Qiao; Cheng, Ching-Yu; Zhou, Xin; Ikram, M. Kamran; Saw, Seang-Mei; Wong, Tien-Yin; Teo, Yik-Ying; Fan, Qiao; Cheng, Ching-Yu; Zhou, Xin; Ikram, M. Kamran; Saw, Seang-Mei; Wong, Tien-Yin; Teo, Yik-Ying; Fan, Qiao; Cheng, Ching-Yu; Zhou, Xin; Ikram, M. Kamran; Saw, Seang-Mei; Tai, E-Shyong; Teo, Yik-Ying; Fan, Qiao; Cheng, Ching-Yu; Zhou, Xin; Ikram, M. Kamran; Saw, Seang-Mei; Teo, Yik-Ying; Fan, Qiao; Cheng, Ching-Yu; Zhou, Xin; Ikram, M. Kamran; Mackey, David A.; MacGregor, Stuart; Hammond, Christopher J.; Hysi, Pirro G.; Deangelis, Margaret M.; Morrison, Margaux; Zhou, Xiangtian; Chen, Wei; Paterson, Andrew D.; Hosseini, S. Mohsen; Mizuki, Nobuhisa; Meguro, Akira; Lehtimäki, Terho; Mäkelä, Kari-Matti; Raitakari, Olli; Kähönen, Mika; Burdon, Kathryn P.; Craig, Jamie E.; Iyengar, Sudha K.; Igo, Robert P.; Lass, Jonathan H.; Reinhart, William; Belin, Michael W.; Schultze, Robert L.; Morason, Todd; Sugar, Alan; Mian, Shahzad; Soong, Hunson Kaz; Colby, Kathryn; Jurkunas, Ula; Yee, Richard; Vital, Mark; Alfonso, Eduardo; Karp, Carol; Lee, Yunhee; Yoo, Sonia; Hammersmith, Kristin; Cohen, Elisabeth; Laibson, Peter; Rapuano, Christopher; Ayres, Brandon; Croasdale, Christopher; Caudill, James; Patel, Sanjay; Baratz, Keith; Bourne, William; Maguire, Leo; Sugar, Joel; Tu, Elmer; Djalilian, Ali; Mootha, Vinod; McCulley, James; Bowman, Wayne; Cavanaugh, H. Dwight; Verity, Steven; Verdier, David; Renucci, Ann; Oliva, Matt; Rotkis, Walter; Hardten, David R.; Fahmy, Ahmad; Brown, Marlene; Reeves, Sherman; Davis, Elizabeth A.; Lindstrom, Richard; Hauswirth, Scott; Hamilton, Stephen; Lee, W. Barry; Price, Francis; Price, Marianne; Kelly, Kathleen; Peters, Faye; Shaughnessy, Michael; Steinemann, Thomas; Dupps, B.J.; Meisler, David M.; Mifflin, Mark; Olson, Randal; Aldave, Anthony; Holland, Gary; Mondino, Bartly J.; Rosenwasser, George; Gorovoy, Mark; Dunn, Steven P.; Heidemann, David G.; Terry, Mark; Shamie, Neda; Rosenfeld, Steven I.; Suedekum, Brandon; Hwang, David; Stone, Donald; Chodosh, James; Galentine, Paul G.; Bardenstein, David; Goddard, Katrina; Chin, Hemin; Mannis, Mark; Varma, Rohit; Borecki, Ingrid; Chew, Emily Y.; Haller, Toomas; Mihailov, Evelin; Metspalu, Andres; Wedenoja, Juho; Simpson, Claire L.; Wojciechowski, Robert; Höhn, René; Mirshahi, Alireza; Zeller, Tanja; Pfeiffer, Norbert; Lackner, Karl J.; Donnelly, Peter; Barroso, Ines; Blackwell, Jenefer M.; Bramon, Elvira; Brown, Matthew A.; Casas, Juan P.; Corvin, Aiden; Deloukas, Panos; Duncanson, Audrey; Jankowski, Janusz; Markus, Hugh S.; Mathew, Christopher G.; Palmer, Colin N.A.; Plomin, Robert; Rautanen, Anna; Sawcer, Stephen J.; Trembath, Richard C.; Viswanathan, Ananth C.; Wood, Nicholas W.; Spencer, Chris C.A.; Band, Gavin; Bellenguez, Céline; Freeman, Colin; Hellenthal, Garrett; Giannoulatou, Eleni; Pirinen, Matti; Pearson, Richard; Strange, Amy; Su, Zhan; Vukcevic, Damjan; Donnelly, Peter; Langford, Cordelia; Hunt, Sarah E.; Edkins, Sarah; Gwilliam, Rhian; Blackburn, Hannah; Bumpstead, Suzannah J.; Dronov, Serge; Gillman, Matthew; Gray, Emma; Hammond, Naomi; Jayakumar, Alagurevathi; McCann, Owen T.; Liddle, Jennifer; Potter, Simon C.; Ravindrarajah, Radhi; Ricketts, Michelle; Waller, Matthew; Weston, Paul; Widaa, Sara; Whittaker, Pamela; Barroso, Ines; Deloukas, Panos; Mathew, Christopher G.; Blackwell, Jenefer M.; Brown, Matthew A.; Corvin, Aiden; Spencer, Chris C.A.; Bettecken, Thomas; Meitinger, Thomas; Oexle, Konrad; Pirastu, Mario; Portas, Laura; Nag, Abhishek; Williams, Katie M.; Yonova-Doing, Ekaterina; Klein, Ronald; Klein, Barbara E.; Hosseini, S. Mohsen; Paterson, Andrew D.; Genuth, S.; Nathan, D.M.; Zinman, B.; Crofford, O.; Crandall, J.; Reid, M.; Brown-Friday, J.; Engel, S.; Sheindlin, J.; Martinez, H.; Shamoon, H.; Engel, H.; Phillips, M.; Gubitosi-Klug, R.; Mayer, L.; Pendegast, S.; Zegarra, H.; Miller, D.; Singerman, L.; Smith-Brewer, S.; Novak, M.; Quin, J.; Dahms, W.; Genuth, Saul; Palmert, M.; Brillon, D.; Lackaye, M.E.; Kiss, S.; Chan, R.; Reppucci, V.; Lee, T.; Heinemann, M.; Whitehouse, F.; Kruger, D.; Jones, J.K.; McLellan, M.; Carey, J.D.; Angus, E.; Thomas, A.; Galprin, A.; Bergenstal, R.; Johnson, M.; Spencer, M.; Morgan, K.; Etzwiler, D.; Kendall, D.; Aiello, Lloyd Paul; Golden, E.; Jacobson, A.; Beaser, R.; Ganda, O.; Hamdy, O.; Wolpert, H.; Sharuk, G.; Arrigg, P.; Schlossman, D.; Rosenzwieg, J.; Rand, L.; Nathan, D.M.; Larkin, M.; Ong, M.; Godine, J.; Cagliero, E.; Lou, P.; Folino, K.; Fritz, S.; Crowell, S.; Hansen, K.; Gauthier-Kelly, C.; Service, J.; Ziegler, G.; Luttrell, L.; Caulder, S.; Lopes-Virella, M.; Colwell, J.; Soule, J.; Fernandes, J.; Hermayer, K.; Kwon, S.; Brabham, M.; Blevins, A.; Parker, J.; Lee, D.; Patel, N.; Pittman, C.; Lindsey, P.; Bracey, M.; Lee, K.; Nutaitis, M.; Farr, A.; Elsing, S.; Thompson, T.; Selby, J.; Lyons, T.; Yacoub-Wasef, S.; Szpiech, M.; Wood, D.; Mayfield, R.; Molitch, M.; Schaefer, B.; Jampol, L.; Lyon, A.; Gill, M.; Strugula, Z.; Kaminski, L.; Mirza, R.; Simjanoski, E.; Ryan, D.; Kolterman, O.; Lorenzi, G.; Goldbaum, M.; Sivitz, W.; Bayless, M.; Counts, D.; Johnsonbaugh, S.; Hebdon, M.; Salemi, P.; Liss, R.; Donner, T.; Gordon, J.; Hemady, R.; Kowarski, A.; Ostrowski, D.; Steidl, S.; Jones, B.; Herman, W.H.; Martin, C.L.; Pop-Busui, R.; Sarma, A.; Albers, J.; Feldman, E.; Kim, K.; Elner, S.; Comer, G.; Gardner, T.; Hackel, R.; Prusak, R.; Goings, L.; Smith, A.; Gothrup, J.; Titus, P.; Lee, J.; Brandle, M.; Prosser, L.; Greene, D.A.; Stevens, M.J.; Vine, A.K.; Bantle, J.; Wimmergren, N.; Cochrane, A.; Olsen, T.; Steuer, E.; Rath, P.; Rogness, B.; Hainsworth, D.; Goldstein, D.; Hitt, S.; Giangiacomo, J.; Schade, D.S.; Canady, J.L.; Chapin, J.E.; Ketai, L.H.; Braunstein, C.S.; Bourne, P.A.; Schwartz, S.; Brucker, A.; Maschak-Carey, B.J.; Baker, L.; Orchard, T.; Silvers, N.; Ryan, C.; Songer, T.; Doft, B.; Olson, S.; Bergren, R.L.; Lobes, L.; Rath, P. Paczan; Becker, D.; Rubinstein, D.; Conrad, P.W.; Yalamanchi, S.; Drash, A.; Morrison, A.; Bernal, M.L.; Vaccaro-Kish, J.; Malone, J.; Pavan, P.R.; Grove, N.; Iyer, M.N.; Burrows, A.F.; Tanaka, E.A.; Gstalder, R.; Dagogo-Jack, S.; Wigley, C.; Ricks, H.; Kitabchi, A.; Murphy, M.B.; Moser, S.; Meyer, D.; Iannacone, A.; Chaum, E.; Yoser, S.; Bryer-Ash, M.; Schussler, S.; Lambeth, H.; Raskin, P.; Strowig, S.; Zinman, B.; Barnie, A.; Devenyi, R.; Mandelcorn, M.; Brent, M.; Rogers, S.; Gordon, A.; Palmer, J.; Catton, S.; Brunzell, J.; Wessells, H.; de Boer, I.H.; Hokanson, J.; Purnell, J.; Ginsberg, J.; Kinyoun, J.; Deeb, S.; Weiss, M.; Meekins, G.; Distad, J.; Van Ottingham, L.; Dupre, J.; Harth, J.; Nicolle, D.; Driscoll, M.; Mahon, J.; Canny, C.; May, M.; Lipps, J.; Agarwal, A.; Adkins, T.; Survant, L.; Pate, R.L.; Munn, G.E.; Lorenz, R.; Feman, S.; White, N.; Levandoski, L.; Boniuk, I.; Grand, G.; Thomas, M.; Joseph, D.D.; Blinder, K.; Shah, G.; Boniuk; Burgess; Santiago, J.; Tamborlane, W.; Gatcomb, P.; Stoessel, K.; Taylor, K.; Goldstein, J.; Novella, S.; Mojibian, H.; Cornfeld, D.; Lima, J.; Bluemke, D.; Turkbey, E.; van der Geest, R.J.; Liu, C.; Malayeri, A.; Jain, A.; Miao, C.; Chahal, H.; Jarboe, R.; Maynard, J.; Gubitosi-Klug, R.; Quin, J.; Gaston, P.; Palmert, M.; Trail, R.; Dahms, W.; Lachin, J.; Cleary, P.; Backlund, J.; Sun, W.; Braffett, B.; Klumpp, K.; Chan, K.; Diminick, L.; Rosenberg, D.; Petty, B.; Determan, A.; Kenny, D.; Rutledge, B.; Younes, Naji; Dews, L.; Hawkins, M.; Cowie, C.; Fradkin, J.; Siebert, C.; Eastman, R.; Danis, R.; Gangaputra, S.; Neill, S.; Davis, M.; Hubbard, L.; Wabers, H.; Burger, M.; Dingledine, J.; Gama, V.; Sussman, R.; Steffes, M.; Bucksa, J.; Nowicki, M.; Chavers, B.; O’Leary, D.; Polak, J.; Harrington, A.; Funk, L.; Crow, R.; Gloeb, B.; Thomas, S.; O’Donnell, C.; Soliman, E.; Zhang, Z.M.; Prineas, R.; Campbell, C.; Ryan, C.; Sandstrom, D.; Williams, T.; Geckle, M.; Cupelli, E.; Thoma, F.; Burzuk, B.; Woodfill, T.; Low, P.; Sommer, C.; Nickander, K.; Budoff, M.; Detrano, R.; Wong, N.; Fox, M.; Kim, L.; Oudiz, R.; Weir, G.; Espeland, M.; Manolio, T.; Rand, L.; Singer, D.; Stern, M.; Boulton, A.E.; Clark, C.; D’Agostino, R.; Lopes-Virella, M.; Garvey, W.T.; Lyons, T.J.; Jenkins, A.; Virella, G.; Jaffa, A.; Carter, Rickey; Lackland, D.; Brabham, M.; McGee, D.; Zheng, D.; Mayfield, R.K.; Boright, A.; Bull, S.; Sun, L.; Scherer, S.; Zinman, B.; Natarajan, R.; Miao, F.; Zhang, L.; Chen;, Z.; Nathan, D.M.; Makela, Kari-Matti; Lehtimaki, Terho; Kahonen, Mika; Raitakari, Olli; Yoshimura, Nagahisa; Matsuda, Fumihiko; Chen, Li Jia; Pang, Chi Pui; Yip, Shea Ping; Yap, Maurice K.H.; Meguro, Akira; Mizuki, Nobuhisa; Inoko, Hidetoshi; Foster, Paul J.; Zhao, Jing Hua; Vithana, Eranga; Tai, E-Shyong; Fan, Qiao; Xu, Liang; Campbell, Harry; Fleck, Brian; Rudan, Igor; Aung, Tin; Hofman, Albert; Uitterlinden, André G.; Bencic, Goran; Khor, Chiea-Chuen; Forward, Hannah; Pärssinen, Olavi; Mitchell, Paul; Rivadeneira, Fernando; Hewitt, Alex W.; Williams, Cathy; Oostra, Ben A.; Teo, Yik-Ying; Hammond, Christopher J.; Stambolian, Dwight; Mackey, David A.; Klaver, Caroline C.W.; Wong, Tien-Yin; Saw, Seang-Mei; Baird, Paul N.

    2013-01-01

    Refractive errors are common eye disorders of public health importance worldwide. Ocular axial length (AL) is the major determinant of refraction and thus of myopia and hyperopia. We conducted a meta-analysis of genome-wide association studies for AL, combining 12,531 Europeans and 8,216 Asians. We identified eight genome-wide significant loci for AL (RSPO1, C3orf26, LAMA2, GJD2, ZNRF3, CD55, MIP, and ALPPL2) and confirmed one previously reported AL locus (ZC3H11B). Of the nine loci, five (LAMA2, GJD2, CD55, ALPPL2, and ZC3H11B) were associated with refraction in 18 independent cohorts (n = 23,591). Differential gene expression was observed for these loci in minus-lens-induced myopia mouse experiments and human ocular tissues. Two of the AL genes, RSPO1 and ZNRF3, are involved in Wnt signaling, a pathway playing a major role in the regulation of eyeball size. This study provides evidence of shared genes between AL and refraction, but importantly also suggests that these traits may have unique pathways. PMID:24144296

  11. Genome-wide meta-analyses identify multiple loci associated with smoking behavior.

    LENUS (Irish Health Repository)

    2010-05-01

    Consistent but indirect evidence has implicated genetic factors in smoking behavior. We report meta-analyses of several smoking phenotypes within cohorts of the Tobacco and Genetics Consortium (n = 74,053). We also partnered with the European Network of Genetic and Genomic Epidemiology (ENGAGE) and Oxford-GlaxoSmithKline (Ox-GSK) consortia to follow up the 15 most significant regions (n > 140,000). We identified three loci associated with number of cigarettes smoked per day. The strongest association was a synonymous 15q25 SNP in the nicotinic receptor gene CHRNA3 (rs1051730[A], beta = 1.03, standard error (s.e.) = 0.053, P = 2.8 x 10(-73)). Two 10q25 SNPs (rs1329650[G], beta = 0.367, s.e. = 0.059, P = 5.7 x 10(-10); and rs1028936[A], beta = 0.446, s.e. = 0.074, P = 1.3 x 10(-9)) and one 9q13 SNP in EGLN2 (rs3733829[G], beta = 0.333, s.e. = 0.058, P = 1.0 x 10(-8)) also exceeded genome-wide significance for cigarettes per day. For smoking initiation, eight SNPs exceeded genome-wide significance, with the strongest association at a nonsynonymous SNP in BDNF on chromosome 11 (rs6265[C], odds ratio (OR) = 1.06, 95% confidence interval (Cl) 1.04-1.08, P = 1.8 x 10(-8)). One SNP located near DBH on chromosome 9 (rs3025343[G], OR = 1.12, 95% Cl 1.08-1.18, P = 3.6 x 10(-8)) was significantly associated with smoking cessation.

  12. The importance of the genomic landscape in Waldenström's Macroglobulinemia for targeted therapeutical interventions.

    Science.gov (United States)

    Sacco, Antonio; Fenotti, Adriano; Affò, Loredana; Bazzana, Stefano; Russo, Domenico; Presta, Marco; Malagola, Michele; Anastasia, Antonella; Motta, Marina; Patterson, Christopher J; Rossi, Giuseppe; Imberti, Luisa; Treon, Steven P; Ghobrial, Irene M; Roccaro, Aldo M

    2017-05-23

    The Literature has recently reported on the importance of genomics in the field of hematologic malignancies, including B-cell lymphoproliferative disorders such as Waldenström's Macrolgobulinemia (WM). Particularly, whole exome sequencing has led to the identification of the MYD88L265P and CXCR4C1013G somatic variants in WM, occurring in about 90% and 30% of the patients, respectively. Subsequently, functional studies have demonstrated their functional role in supporting WM pathogenesis and disease progression, both in vitro and in vivo, thus providing the pre-clinical evidences for extremely attractive targets for novel therapeutic interventions in WM. Of note, recent evidences have also approached and defined the transcriptome profiling of WM cells, revealing a signature that mirrors the somatic aberrations demonstrated within the tumor clone. A parallel research field has also reported on microRNAs (miRNAs), highlighting the oncogenic role of miRNA-155 in WM. In the present review, we focus on the latest reports on genomics and miRNAs in WM, providing an overview of the clinical relevance of the latest acquired knowledge about genomics and miRNA aberrations in WM.

  13. Enriched pathways for major depressive disorder identified from a genome-wide association study.

    Science.gov (United States)

    Kao, Chung-Feng; Jia, Peilin; Zhao, Zhongming; Kuo, Po-Hsiu

    2012-11-01

    Major depressive disorder (MDD) has caused a substantial burden of disease worldwide with moderate heritability. Despite efforts through conducting numerous association studies and now, genome-wide association (GWA) studies, the success of identifying susceptibility loci for MDD has been limited, which is partially attributed to the complex nature of depression pathogenesis. A pathway-based analytic strategy to investigate the joint effects of various genes within specific biological pathways has emerged as a powerful tool for complex traits. The present study aimed to identify enriched pathways for depression using a GWA dataset for MDD. For each gene, we estimated its gene-wise p value using combined and minimum p value, separately. Canonical pathways from the Kyoto Encyclopedia of Genes and Genomes (KEGG) and BioCarta were used. We employed four pathway-based analytic approaches (gene set enrichment analysis, hypergeometric test, sum-square statistic, sum-statistic). We adjusted for multiple testing using Benjamini & Hochberg's method to report significant pathways. We found 17 significantly enriched pathways for depression, which presented low-to-intermediate crosstalk. The top four pathways were long-term depression (p⩽1×10-5), calcium signalling (p⩽6×10-5), arrhythmogenic right ventricular cardiomyopathy (p⩽1.6×10-4) and cell adhesion molecules (p⩽2.2×10-4). In conclusion, our comprehensive pathway analyses identified promising pathways for depression that are related to neurotransmitter and neuronal systems, immune system and inflammatory response, which may be involved in the pathophysiological mechanisms underlying depression. We demonstrated that pathway enrichment analysis is promising to facilitate our understanding of complex traits through a deeper interpretation of GWA data. Application of this comprehensive analytic strategy in upcoming GWA data for depression could validate the findings reported in this study.

  14. Compatible Solute Synthesis and Import by the Moderate Halophile Spiribacter salinus: Physiology and Genomics

    Directory of Open Access Journals (Sweden)

    María J. León

    2018-02-01

    Full Text Available Members of the genus Spiribacter are found worldwide and are abundant in ecosystems possessing intermediate salinities between seawater and saturated salt concentrations. Spiribacter salinus M19-40 is the type species of this genus and its first cultivated representative. In the habitats of S. salinus M19-40, high salinity is a key determinant for growth and we therefore focused on the cellular adjustment strategy to this persistent environmental challenge. We coupled these experimental studies to the in silico mining of the genome sequence of this moderate halophile with respect to systems allowing this bacterium to control its potassium and sodium pools, and its ability to import and synthesize compatible solutes. S. salinus M19-40 produces enhanced levels of the compatible solute ectoine, both under optimal and growth-challenging salt concentrations, but the genes encoding the corresponding biosynthetic enzymes are not organized in a canonical ectABC operon. Instead, they are scrambled (ectAC; ectB and are physically separated from each other on the S. salinus M19-40 genome. Genomes of many phylogenetically related bacteria also exhibit a non-canonical organization of the ect genes. S. salinus M19-40 also synthesizes trehalose, but this compatible solute seems to make only a minor contribution to the cytoplasmic solute pool under osmotic stress conditions. However, its cellular levels increase substantially in stationary phase cells grown under optimal salt concentrations. In silico genome mining revealed that S. salinus M19-40 possesses different types of uptake systems for compatible solutes. Among the set of compatible solutes tested in an osmostress protection growth assay, glycine betaine and arsenobetaine were the most effective. Transport studies with radiolabeled glycine betaine showed that S. salinus M19-40 increases the pool size of this osmolyte in a fashion that is sensitively tied to the prevalent salinity of the growth medium

  15. Genome-wide association study identifies six new loci influencing pulse pressure and mean arterial pressure

    Science.gov (United States)

    Wain, Louise V; Verwoert, Germaine C; O’Reilly, Paul F; Shi, Gang; Johnson, Toby; Johnson, Andrew D; Bochud, Murielle; Rice, Kenneth M; Henneman, Peter; Smith, Albert V; Ehret, Georg B; Amin, Najaf; Larson, Martin G; Mooser, Vincent; Hadley, David; Dörr, Marcus; Bis, Joshua C; Aspelund, Thor; Esko, Tõnu; Janssens, A Cecile JW; Zhao, Jing Hua; Heath, Simon; Laan, Maris; Fu, Jingyuan; Pistis, Giorgio; Luan, Jian’an; Arora, Pankaj; Lucas, Gavin; Pirastu, Nicola; Pichler, Irene; Jackson, Anne U; Webster, Rebecca J; Zhang, Feng; Peden, John F; Schmidt, Helena; Tanaka, Toshiko; Campbell, Harry; Igl, Wilmar; Milaneschi, Yuri; Hotteng, Jouke-Jan; Vitart, Veronique; Chasman, Daniel I; Trompet, Stella; Bragg-Gresham, Jennifer L; Alizadeh, Behrooz Z; Chambers, John C; Guo, Xiuqing; Lehtimäki, Terho; Kühnel, Brigitte; Lopez, Lorna M; Polašek, Ozren; Boban, Mladen; Nelson, Christopher P; Morrison, Alanna C; Pihur, Vasyl; Ganesh, Santhi K; Hofman, Albert; Kundu, Suman; Mattace-Raso, Francesco US; Rivadeneira, Fernando; Sijbrands, Eric JG; Uitterlinden, Andre G; Hwang, Shih-Jen; Vasan, Ramachandran S; Wang, Thomas J; Bergmann, Sven; Vollenweider, Peter; Waeber, Gérard; Laitinen, Jaana; Pouta, Anneli; Zitting, Paavo; McArdle, Wendy L; Kroemer, Heyo K; Völker, Uwe; Völzke, Henry; Glazer, Nicole L; Taylor, Kent D; Harris, Tamara B; Alavere, Helene; Haller, Toomas; Keis, Aime; Tammesoo, Mari-Liis; Aulchenko, Yurii; Barroso, Inês; Khaw, Kay-Tee; Galan, Pilar; Hercberg, Serge; Lathrop, Mark; Eyheramendy, Susana; Org, Elin; Sõber, Siim; Lu, Xiaowen; Nolte, Ilja M; Penninx, Brenda W; Corre, Tanguy; Masciullo, Corrado; Sala, Cinzia; Groop, Leif; Voight, Benjamin F; Melander, Olle; O’Donnell, Christopher J; Salomaa, Veikko; d’Adamo, Adamo Pio; Fabretto, Antonella; Faletra, Flavio; Ulivi, Sheila; Del Greco, M Fabiola; Facheris, Maurizio; Collins, Francis S; Bergman, Richard N; Beilby, John P; Hung, Joseph; Musk, A William; Mangino, Massimo; Shin, So-Youn; Soranzo, Nicole; Watkins, Hugh; Goel, Anuj; Hamsten, Anders; Gider, Pierre; Loitfelder, Marisa; Zeginigg, Marion; Hernandez, Dena; Najjar, Samer S; Navarro, Pau; Wild, Sarah H; Corsi, Anna Maria; Singleton, Andrew; de Geus, Eco JC; Willemsen, Gonneke; Parker, Alex N; Rose, Lynda M; Buckley, Brendan; Stott, David; Orru, Marco; Uda, Manuela; van der Klauw, Melanie M; Zhang, Weihua; Li, Xinzhong; Scott, James; Chen, Yii-Der Ida; Burke, Gregory L; Kähönen, Mika; Viikari, Jorma; Döring, Angela; Meitinger, Thomas; Davies, Gail; Starr, John M; Emilsson, Valur; Plump, Andrew; Lindeman, Jan H; ’t Hoen, Peter AC; König, Inke R; Felix, Janine F; Clarke, Robert; Hopewell, Jemma C; Ongen, Halit; Breteler, Monique; Debette, Stéphanie; DeStefano, Anita L; Fornage, Myriam; Mitchell, Gary F; Smith, Nicholas L; Holm, Hilma; Stefansson, Kari; Thorleifsson, Gudmar; Thorsteinsdottir, Unnur; Samani, Nilesh J; Preuss, Michael; Rudan, Igor; Hayward, Caroline; Deary, Ian J; Wichmann, H-Erich; Raitakari, Olli T; Palmas, Walter; Kooner, Jaspal S; Stolk, Ronald P; Jukema, J Wouter; Wright, Alan F; Boomsma, Dorret I; Bandinelli, Stefania; Gyllensten, Ulf B; Wilson, James F; Ferrucci, Luigi; Schmidt, Reinhold; Farrall, Martin; Spector, Tim D; Palmer, Lyle J; Tuomilehto, Jaakko; Pfeufer, Arne; Gasparini, Paolo; Siscovick, David; Altshuler, David; Loos, Ruth JF; Toniolo, Daniela; Snieder, Harold; Gieger, Christian; Meneton, Pierre; Wareham, Nicholas J; Oostra, Ben A; Metspalu, Andres; Launer, Lenore; Rettig, Rainer; Strachan, David P; Beckmann, Jacques S; Witteman, Jacqueline CM; Erdmann, Jeanette; van Dijk, Ko Willems; Boerwinkle, Eric; Boehnke, Michael; Ridker, Paul M; Jarvelin, Marjo-Riitta; Chakravarti, Aravinda; Abecasis, Goncalo R; Gudnason, Vilmundur; Newton-Cheh, Christopher; Levy, Daniel; Munroe, Patricia B; Psaty, Bruce M; Caulfield, Mark J; Rao, Dabeeru C

    2012-01-01

    Numerous genetic loci influence systolic blood pressure (SBP) and diastolic blood pressure (DBP) in Europeans 1-3. We now report genome-wide association studies of pulse pressure (PP) and mean arterial pressure (MAP). In discovery (N=74,064) and follow-up studies (N=48,607), we identified at genome-wide significance (P= 2.7×10-8 to P=2.3×10-13) four novel PP loci (at 4q12 near CHIC2/PDGFRAI, 7q22.3 near PIK3CG, 8q24.12 in NOV, 11q24.3 near ADAMTS-8), two novel MAP loci (3p21.31 in MAP4, 10q25.3 near ADRB1) and one locus associated with both traits (2q24.3 near FIGN) which has recently been associated with SBP in east Asians. For three of the novel PP signals, the estimated effect for SBP was opposite to that for DBP, in contrast to the majority of common SBP- and DBP-associated variants which show concordant effects on both traits. These findings indicate novel genetic mechanisms underlying blood pressure variation, including pathways that may differentially influence SBP and DBP. PMID:21909110

  16. Genome-wide association analysis identifies three new risk loci for gout arthritis in Han Chinese

    Science.gov (United States)

    Li, Changgui; Li, Zhiqiang; Liu, Shiguo; Wang, Can; Han, Lin; Cui, Lingling; Zhou, Jingguo; Zou, Hejian; Liu, Zhen; Chen, Jianhua; Cheng, Xiaoyu; Zhou, Zhaowei; Ding, Chengcheng; Wang, Meng; Chen, Tong; Cui, Ying; He, Hongmei; Zhang, Keke; Yin, Congcong; Wang, Yunlong; Xing, Shichao; Li, Baojie; Ji, Jue; Jia, Zhaotong; Ma, Lidan; Niu, Jiapeng; Xin, Ying; Liu, Tian; Chu, Nan; Yu, Qing; Ren, Wei; Wang, Xuefeng; Zhang, Aiqing; Sun, Yuping; Wang, Haili; Lu, Jie; Li, Yuanyuan; Qing, Yufeng; Chen, Gang; Wang, Yangang; Zhou, Li; Niu, Haitao; Liang, Jun; Dong, Qian; Li, Xinde; Mi, Qing-Sheng; Shi, Yongyong

    2015-01-01

    Gout is one of the most common types of inflammatory arthritis, caused by the deposition of monosodium urate crystals in and around the joints. Previous genome-wide association studies (GWASs) have identified many genetic loci associated with raised serum urate concentrations. However, hyperuricemia alone is not sufficient for the development of gout arthritis. Here we conduct a multistage GWAS in Han Chinese using 4,275 male gout patients and 6,272 normal male controls (1,255 cases and 1,848 controls were genome-wide genotyped), with an additional 1,644 hyperuricemic controls. We discover three new risk loci, 17q23.2 (rs11653176, P=1.36 × 10−13, BCAS3), 9p24.2 (rs12236871, P=1.48 × 10−10, RFX3) and 11p15.5 (rs179785, P=1.28 × 10−8, KCNQ1), which contain inflammatory candidate genes. Our results suggest that these loci are most likely related to the progression from hyperuricemia to inflammatory gout, which will provide new insights into the pathogenesis of gout arthritis. PMID:25967671

  17. Genome-wide association analysis identifies three new risk loci for gout arthritis in Han Chinese.

    Science.gov (United States)

    Li, Changgui; Li, Zhiqiang; Liu, Shiguo; Wang, Can; Han, Lin; Cui, Lingling; Zhou, Jingguo; Zou, Hejian; Liu, Zhen; Chen, Jianhua; Cheng, Xiaoyu; Zhou, Zhaowei; Ding, Chengcheng; Wang, Meng; Chen, Tong; Cui, Ying; He, Hongmei; Zhang, Keke; Yin, Congcong; Wang, Yunlong; Xing, Shichao; Li, Baojie; Ji, Jue; Jia, Zhaotong; Ma, Lidan; Niu, Jiapeng; Xin, Ying; Liu, Tian; Chu, Nan; Yu, Qing; Ren, Wei; Wang, Xuefeng; Zhang, Aiqing; Sun, Yuping; Wang, Haili; Lu, Jie; Li, Yuanyuan; Qing, Yufeng; Chen, Gang; Wang, Yangang; Zhou, Li; Niu, Haitao; Liang, Jun; Dong, Qian; Li, Xinde; Mi, Qing-Sheng; Shi, Yongyong

    2015-05-13

    Gout is one of the most common types of inflammatory arthritis, caused by the deposition of monosodium urate crystals in and around the joints. Previous genome-wide association studies (GWASs) have identified many genetic loci associated with raised serum urate concentrations. However, hyperuricemia alone is not sufficient for the development of gout arthritis. Here we conduct a multistage GWAS in Han Chinese using 4,275 male gout patients and 6,272 normal male controls (1,255 cases and 1,848 controls were genome-wide genotyped), with an additional 1,644 hyperuricemic controls. We discover three new risk loci, 17q23.2 (rs11653176, P=1.36 × 10(-13), BCAS3), 9p24.2 (rs12236871, P=1.48 × 10(-10), RFX3) and 11p15.5 (rs179785, P=1.28 × 10(-8), KCNQ1), which contain inflammatory candidate genes. Our results suggest that these loci are most likely related to the progression from hyperuricemia to inflammatory gout, which will provide new insights into the pathogenesis of gout arthritis.

  18. RNAi-Based Functional Genomics Identifies New Virulence Determinants in Mucormycosis.

    Directory of Open Access Journals (Sweden)

    Trung Anh Trieu

    2017-01-01

    Full Text Available Mucorales are an emerging group of human pathogens that are responsible for the lethal disease mucormycosis. Unfortunately, functional studies on the genetic factors behind the virulence of these organisms are hampered by their limited genetic tractability, since they are reluctant to classical genetic tools like transposable elements or gene mapping. Here, we describe an RNAi-based functional genomic platform that allows the identification of new virulence factors through a forward genetic approach firstly described in Mucorales. This platform contains a whole-genome collection of Mucor circinelloides silenced transformants that presented a broad assortment of phenotypes related to the main physiological processes in fungi, including virulence, hyphae morphology, mycelial and yeast growth, carotenogenesis and asexual sporulation. Selection of transformants with reduced virulence allowed the identification of mcplD, which encodes a Phospholipase D, and mcmyo5, encoding a probably essential cargo transporter of the Myosin V family, as required for a fully virulent phenotype of M. circinelloides. Knock-out mutants for those genes showed reduced virulence in both Galleria mellonella and Mus musculus models, probably due to a delayed germination and polarized growth within macrophages. This study provides a robust approach to study virulence in Mucorales and as a proof of concept identified new virulence determinants in M. circinelloides that could represent promising targets for future antifungal therapies.

  19. High throughput sequencing and proteomics to identify immunogenic proteins of a new pathogen: the dirty genome approach.

    Directory of Open Access Journals (Sweden)

    Gilbert Greub

    Full Text Available BACKGROUND: With the availability of new generation sequencing technologies, bacterial genome projects have undergone a major boost. Still, chromosome completion needs a costly and time-consuming gap closure, especially when containing highly repetitive elements. However, incomplete genome data may be sufficiently informative to derive the pursued information. For emerging pathogens, i.e. newly identified pathogens, lack of release of genome data during gap closure stage is clearly medically counterproductive. METHODS/PRINCIPAL FINDINGS: We thus investigated the feasibility of a dirty genome approach, i.e. the release of unfinished genome sequences to develop serological diagnostic tools. We showed that almost the whole genome sequence of the emerging pathogen Parachlamydia acanthamoebae was retrieved even with relatively short reads from Genome Sequencer 20 and Solexa. The bacterial proteome was analyzed to select immunogenic proteins, which were then expressed and used to elaborate the first steps of an ELISA. CONCLUSIONS/SIGNIFICANCE: This work constitutes the proof of principle for a dirty genome approach, i.e. the use of unfinished genome sequences of pathogenic bacteria, coupled with proteomics to rapidly identify new immunogenic proteins useful to develop in the future specific diagnostic tests such as ELISA, immunohistochemistry and direct antigen detection. Although applied here to an emerging pathogen, this combined dirty genome sequencing/proteomic approach may be used for any pathogen for which better diagnostics are needed. These genome sequences may also be very useful to develop DNA based diagnostic tests. All these diagnostic tools will allow further evaluations of the pathogenic potential of this obligate intracellular bacterium.

  20. Leveraging Comparative Genomics to Identify and Functionally Characterize Genes Associated with Sperm Phenotypes in Python bivittatus (Burmese Python

    Directory of Open Access Journals (Sweden)

    Kristopher J. L. Irizarry

    2016-01-01

    Full Text Available Comparative genomics approaches provide a means of leveraging functional genomics information from a highly annotated model organism’s genome (such as the mouse genome in order to make physiological inferences about the role of genes and proteins in a less characterized organism’s genome (such as the Burmese python. We employed a comparative genomics approach to produce the functional annotation of Python bivittatus genes encoding proteins associated with sperm phenotypes. We identify 129 gene-phenotype relationships in the python which are implicated in 10 specific sperm phenotypes. Results obtained through our systematic analysis identified subsets of python genes exhibiting associations with gene ontology annotation terms. Functional annotation data was represented in a semantic scatter plot. Together, these newly annotated Python bivittatus genome resources provide a high resolution framework from which the biology relating to reptile spermatogenesis, fertility, and reproduction can be further investigated. Applications of our research include (1 production of genetic diagnostics for assessing fertility in domestic and wild reptiles; (2 enhanced assisted reproduction technology for endangered and captive reptiles; and (3 novel molecular targets for biotechnology-based approaches aimed at reducing fertility and reproduction of invasive reptiles. Additional enhancements to reptile genomic resources will further enhance their value.

  1. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  2. Genomic interval engineering of mice identified a novel modulator of triglyceride production

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Y.; Jong, M.C.; Frazer, K.A.; Gong, E.; Krauss, R.M.; Cheng, J.F.; Boffelli, D.; Rubin, E.M.

    1999-10-01

    To accelerate the biological annotation of novel genes discovered in sequenced of mammalian genomes, we are creating large deletions in the mouse genome targeted to include clusters of such genes. Here we describe the targeted deletion of a 450 kb region on mouse chromosome 11 which, based on computational analysis of the deleted murine sequences and human 5q orthologous sequences, codes for nine putative genes. Mice homozygous for the deletion had a variety of abnormalities including severe hypertriglyceridemia, hepatic and cardiac enlargement, growth retardation and premature mortality. Analysis of triglyceride metabolism in these animals demonstrated a several-fold increase in hepatic very-low density lipoprotein (VLDL) triglyceride secretion, the most prevalent mechanism responsible for hypertriglyceridemia in humans. A series of mouse BAC and human YAC transgenes covering different intervals of the 450 kb deleted region were assessed for their ability to complement the deletion induced abnormalities. These studies revealed that OCTN2, a gene recently shown to play a role in carnitine transport, was able to correct the triglyceride abnormalities. The discovery of this previously unappreciated relationship between OCTN2, carnitine and hepatic triglyceride production is of particular importance due to the clinical consequence of hypertriglyceridemia and the paucity of genes known to modulate triglyceride secretion.

  3. A bioinformatics approach for identifying transgene insertion sites using whole genome sequencing data.

    Science.gov (United States)

    Park, Doori; Park, Su-Hyun; Ban, Yong Wook; Kim, Youn Shic; Park, Kyoung-Cheul; Kim, Nam-Soo; Kim, Ju-Kon; Choi, Ik-Young

    2017-08-15

    Genetically modified crops (GM crops) have been developed to improve the agricultural traits of modern crop cultivars. Safety assessments of GM crops are of paramount importance in research at developmental stages and before releasing transgenic plants into the marketplace. Sequencing technology is developing rapidly, with higher output and labor efficiencies, and will eventually replace existing methods for the molecular characterization of genetically modified organisms. To detect the transgenic insertion locations in the three GM rice gnomes, Illumina sequencing reads are mapped and classified to the rice genome and plasmid sequence. The both mapped reads are classified to characterize the junction site between plant and transgene sequence by sequence alignment. Herein, we present a next generation sequencing (NGS)-based molecular characterization method, using transgenic rice plants SNU-Bt9-5, SNU-Bt9-30, and SNU-Bt9-109. Specifically, using bioinformatics tools, we detected the precise insertion locations and copy numbers of transfer DNA, genetic rearrangements, and the absence of backbone sequences, which were equivalent to results obtained from Southern blot analyses. NGS methods have been suggested as an effective means of characterizing and detecting transgenic insertion locations in genomes. Our results demonstrate the use of a combination of NGS technology and bioinformatics approaches that offers cost- and time-effective methods for assessing the safety of transgenic plants.

  4. Study of a methodology of identifying important research problems by the PIRT process

    International Nuclear Information System (INIS)

    Aoki, Takayuki; Takagi, Toshiyuki; Urayama, Ryoichi; Komura, Ichiro; Furukawa, Takashi; Yusa, Noritaka

    2014-01-01

    In this paper, we propose a new methodology of identifying important research problems to be solved to improve the performance of some specific scientific technologies by the phenomena identification and ranking table (PIRT) process which has been used as a methodology for demonstrating the validity of the best estimate simulation codes in US Nuclear Regulatory Commission (USNRC) licensing of nuclear power plants. The new methodology makes it possible to identify important factors affecting the performance of the technologies from the viewpoint of the figure of merit and problems associated with them while it keeps the fundamental concepts of the original PIRT process. Also in this paper, we demonstrate the effectiveness of the new methodology by applying it to a task of extracting research problems for improving an inspection accuracy of ultrasonic testing or eddy current testing in the inspection of objects having cracks due to fatigue or stress corrosion cracking. (author)

  5. Study of a methodology of identifying important research problems by the PIRT process

    International Nuclear Information System (INIS)

    Aoki, Takayuki; Takagi, Toshiyuki; Urayama, Ryoichi; Komura, Ichiro; Furukawa, Takashi; Yusa, Noritaka

    2013-01-01

    In this paper, we propose a new methodology of identifying important research problems to be solved to improve the performance of some specific scientific technologies by the phenomena identification and ranking table (PIRT) process, which has been used as a methodology for demonstrating the validity of the best estimate simulation codes in USNRC licensing of nuclear power plants. It keeps the fundamental concepts of the original PIRT process but makes it possible to identify important factors affecting the performance of the technologies from the viewpoint of the figure of merit and problems associated with them, which need to be solved to improve the performance. Also in this paper, we demonstrate the effectiveness of the developed method by showing a specific example of the application to physical events or phenomena in objects having fatigue or SCC crack(s) under ultrasonic testing and eddy current testing. (author)

  6. Integrative Genomic Analysis of Cholangiocarcinoma Identifies Distinct IDH-Mutant Molecular Profiles

    Directory of Open Access Journals (Sweden)

    Farshad Farshidfar

    2017-03-01

    Full Text Available Cholangiocarcinoma (CCA is an aggressive malignancy of the bile ducts, with poor prognosis and limited treatment options. Here, we describe the integrated analysis of somatic mutations, RNA expression, copy number, and DNA methylation by The Cancer Genome Atlas of a set of predominantly intrahepatic CCA cases and propose a molecular classification scheme. We identified an IDH mutant-enriched subtype with distinct molecular features including low expression of chromatin modifiers, elevated expression of mitochondrial genes, and increased mitochondrial DNA copy number. Leveraging the multi-platform data, we observed that ARID1A exhibited DNA hypermethylation and decreased expression in the IDH mutant subtype. More broadly, we found that IDH mutations are associated with an expanded histological spectrum of liver tumors with molecular features that stratify with CCA. Our studies reveal insights into the molecular pathogenesis and heterogeneity of cholangiocarcinoma and provide classification information of potential therapeutic significance.

  7. Genome-wide association studies identify four ER negative-specific breast cancer risk loci

    DEFF Research Database (Denmark)

    Garcia-Closas, Montserrat; Couch, Fergus J; Lindstrom, Sara

    2013-01-01

    differences in genetic predisposition. To identify susceptibility loci specific to ER-negative disease, we combined in a meta-analysis 3 genome-wide association studies of 4,193 ER-negative breast cancer cases and 35,194 controls with a series of 40 follow-up studies (6,514 cases and 41,455 controls......), genotyped using a custom Illumina array, iCOGS, developed by the Collaborative Oncological Gene-environment Study (COGS). SNPs at four loci, 1q32.1 (MDM4, P = 2.1 × 10(-12) and LGR6, P = 1.4 × 10(-8)), 2p24.1 (P = 4.6 × 10(-8)) and 16q12.2 (FTO, P = 4.0 × 10(-8)), were associated with ER-negative but not ER...

  8. Microfluidic screening and whole-genome sequencing identifies mutations associated with improved protein secretion by yeast

    DEFF Research Database (Denmark)

    Huang, Mingtao; Bai, Yunpeng; Sjostrom, Staffan L.

    2015-01-01

    There is an increasing demand for biotech-based production of recombinant proteins for use as pharmaceuticals in the food and feed industry and in industrial applications. Yeast Saccharomyces cerevisiae is among preferred cell factories for recombinant protein production, and there is increasing...... interest in improving its protein secretion capacity. Due to the complexity of the secretory machinery in eukaryotic cells, it is difficult to apply rational engineering for construction of improved strains. Here we used high-throughput microfluidics for the screening of yeast libraries, generated by UV...... mutagenesis. Several screening and sorting rounds resulted in the selection of eight yeast clones with significantly improved secretion of recombinant a-amylase. Efficient secretion was genetically stable in the selected clones. We performed whole-genome sequencing of the eight clones and identified 330...

  9. Polymorphic microsatellites in the human bloodfluke, Schistosoma japonicum, identified using a genomic resource

    Directory of Open Access Journals (Sweden)

    Spear Robert

    2011-02-01

    Full Text Available Abstract Re-emergence of schistosomiasis in regions of China where control programs have ceased requires development of molecular-genetic tools to track gene flow and assess genetic diversity of Schistosoma populations. We identified many microsatellite loci in the draft genome of Schistosoma japonicum using defined search criteria and selected a subset for further analysis. From an initial panel of 50 loci, 20 new microsatellites were selected for eventual optimization and application to a panel of worms from endemic areas. All but one of the selected microsatellites contain simple tri-nucleotide repeats. Moderate to high levels of polymorphism were detected. Numbers of alleles ranged from 6 to 14 and observed heterozygosity was always >0.6. The loci reported here will facilitate high resolution population-genetic studies on schistosomes in re-emergent foci.

  10. Genome-wide association analysis identifies three new susceptibility loci for childhood body mass index

    Science.gov (United States)

    Felix, Janine F.; Bradfield, Jonathan P.; Monnereau, Claire; van der Valk, Ralf J.P.; Stergiakouli, Evie; Chesi, Alessandra; Gaillard, Romy; Feenstra, Bjarke; Thiering, Elisabeth; Kreiner-Møller, Eskil; Mahajan, Anubha; Pitkänen, Niina; Joro, Raimo; Cavadino, Alana; Huikari, Ville; Franks, Steve; Groen-Blokhuis, Maria M.; Cousminer, Diana L.; Marsh, Julie A.; Lehtimäki, Terho; Curtin, John A.; Vioque, Jesus; Ahluwalia, Tarunveer S.; Myhre, Ronny; Price, Thomas S.; Vilor-Tejedor, Natalia; Yengo, Loïc; Grarup, Niels; Ntalla, Ioanna; Ang, Wei; Atalay, Mustafa; Bisgaard, Hans; Blakemore, Alexandra I.; Bonnefond, Amelie; Carstensen, Lisbeth; Eriksson, Johan; Flexeder, Claudia; Franke, Lude; Geller, Frank; Geserick, Mandy; Hartikainen, Anna-Liisa; Haworth, Claire M.A.; Hirschhorn, Joel N.; Hofman, Albert; Holm, Jens-Christian; Horikoshi, Momoko; Hottenga, Jouke Jan; Huang, Jinyan; Kadarmideen, Haja N.; Kähönen, Mika; Kiess, Wieland; Lakka, Hanna-Maaria; Lakka, Timo A.; Lewin, Alexandra M.; Liang, Liming; Lyytikäinen, Leo-Pekka; Ma, Baoshan; Magnus, Per; McCormack, Shana E.; McMahon, George; Mentch, Frank D.; Middeldorp, Christel M.; Murray, Clare S.; Pahkala, Katja; Pers, Tune H.; Pfäffle, Roland; Postma, Dirkje S.; Power, Christine; Simpson, Angela; Sengpiel, Verena; Tiesler, Carla M. T.; Torrent, Maties; Uitterlinden, André G.; van Meurs, Joyce B.; Vinding, Rebecca; Waage, Johannes; Wardle, Jane; Zeggini, Eleftheria; Zemel, Babette S.; Dedoussis, George V.; Pedersen, Oluf; Froguel, Philippe; Sunyer, Jordi; Plomin, Robert; Jacobsson, Bo; Hansen, Torben; Gonzalez, Juan R.; Custovic, Adnan; Raitakari, Olli T.; Pennell, Craig E.; Widén, Elisabeth; Boomsma, Dorret I.; Koppelman, Gerard H.; Sebert, Sylvain; Järvelin, Marjo-Riitta; Hyppönen, Elina; McCarthy, Mark I.; Lindi, Virpi; Harri, Niinikoski; Körner, Antje; Bønnelykke, Klaus; Heinrich, Joachim; Melbye, Mads; Rivadeneira, Fernando; Hakonarson, Hakon; Ring, Susan M.; Smith, George Davey; Sørensen, Thorkild I.A.; Timpson, Nicholas J.; Grant, Struan F.A.; Jaddoe, Vincent W.V.

    2016-01-01

    A large number of genetic loci are associated with adult body mass index. However, the genetics of childhood body mass index are largely unknown. We performed a meta-analysis of genome-wide association studies of childhood body mass index, using sex- and age-adjusted standard deviation scores. We included 35 668 children from 20 studies in the discovery phase and 11 873 children from 13 studies in the replication phase. In total, 15 loci reached genome-wide significance (P-value < 5 × 10−8) in the joint discovery and replication analysis, of which 12 are previously identified loci in or close to ADCY3, GNPDA2, TMEM18, SEC16B, FAIM2, FTO, TFAP2B, TNNI3K, MC4R, GPR61, LMX1B and OLFM4 associated with adult body mass index or childhood obesity. We identified three novel loci: rs13253111 near ELP3, rs8092503 near RAB27B and rs13387838 near ADAM23. Per additional risk allele, body mass index increased 0.04 Standard Deviation Score (SDS) [Standard Error (SE) 0.007], 0.05 SDS (SE 0.008) and 0.14 SDS (SE 0.025), for rs13253111, rs8092503 and rs13387838, respectively. A genetic risk score combining all 15 SNPs showed that each additional average risk allele was associated with a 0.073 SDS (SE 0.011, P-value = 3.12 × 10−10) increase in childhood body mass index in a population of 1955 children. This risk score explained 2% of the variance in childhood body mass index. This study highlights the shared genetic background between childhood and adult body mass index and adds three novel loci. These loci likely represent age-related differences in strength of the associations with body mass index. PMID:26604143

  11. A genome-wide association study identifies protein quantitative trait loci (pQTLs.

    Directory of Open Access Journals (Sweden)

    David Melzer

    2008-05-01

    Full Text Available There is considerable evidence that human genetic variation influences gene expression. Genome-wide studies have revealed that mRNA levels are associated with genetic variation in or close to the gene coding for those mRNA transcripts - cis effects, and elsewhere in the genome - trans effects. The role of genetic variation in determining protein levels has not been systematically assessed. Using a genome-wide association approach we show that common genetic variation influences levels of clinically relevant proteins in human serum and plasma. We evaluated the role of 496,032 polymorphisms on levels of 42 proteins measured in 1200 fasting individuals from the population based InCHIANTI study. Proteins included insulin, several interleukins, adipokines, chemokines, and liver function markers that are implicated in many common diseases including metabolic, inflammatory, and infectious conditions. We identified eight Cis effects, including variants in or near the IL6R (p = 1.8x10(-57, CCL4L1 (p = 3.9x10(-21, IL18 (p = 6.8x10(-13, LPA (p = 4.4x10(-10, GGT1 (p = 1.5x10(-7, SHBG (p = 3.1x10(-7, CRP (p = 6.4x10(-6 and IL1RN (p = 7.3x10(-6 genes, all associated with their respective protein products with effect sizes ranging from 0.19 to 0.69 standard deviations per allele. Mechanisms implicated include altered rates of cleavage of bound to unbound soluble receptor (IL6R, altered secretion rates of different sized proteins (LPA, variation in gene copy number (CCL4L1 and altered transcription (GGT1. We identified one novel trans effect that was an association between ABO blood group and tumour necrosis factor alpha (TNF-alpha levels (p = 6.8x10(-40, but this finding was not present when TNF-alpha was measured using a different assay , or in a second study, suggesting an assay-specific association. Our results show that protein levels share some of the features of the genetics of gene expression. These include the presence of strong genetic effects in cis

  12. Genome-wide association study identifies genetic loci associated with iron deficiency.

    Directory of Open Access Journals (Sweden)

    Christine E McLaren

    2011-03-01

    Full Text Available The existence of multiple inherited disorders of iron metabolism in man, rodents and other vertebrates suggests genetic contributions to iron deficiency. To identify new genomic locations associated with iron deficiency, a genome-wide association study (GWAS was performed using DNA collected from white men aged≥25 y and women≥50 y in the Hemochromatosis and Iron Overload Screening (HEIRS Study with serum ferritin (SF≤12 µg/L (cases and iron replete controls (SF>100 µg/L in men, SF>50 µg/L in women. Regression analysis was used to examine the association between case-control status (336 cases, 343 controls and quantitative serum iron measures and 331,060 single nucleotide polymorphism (SNP genotypes, with replication analyses performed in a sample of 71 cases and 161 controls from a population of white male and female veterans screened at a US Veterans Affairs (VA medical center. Five SNPs identified in the GWAS met genome-wide statistical significance for association with at least one iron measure, rs2698530 on chr. 2p14; rs3811647 on chr. 3q22, a known SNP in the transferrin (TF gene region; rs1800562 on chr. 6p22, the C282Y mutation in the HFE gene; rs7787204 on chr. 7p21; and rs987710 on chr. 22q11 (GWAS observed P<1.51×10(-7 for all. An association between total iron binding capacity and SNP rs3811647 in the TF gene (GWAS observed P=7.0×10(-9, corrected P=0.012 was replicated within the VA samples (observed P=0.012. Associations with the C282Y mutation in the HFE gene also were replicated. The joint analysis of the HEIRS and VA samples revealed strong associations between rs2698530 on chr. 2p14 and iron status outcomes. These results confirm a previously-described TF polymorphism and implicate one potential new locus as a target for gene identification.

  13. BISQUE: locus- and variant-specific conversion of genomic, transcriptomic and proteomic database identifiers.

    Science.gov (United States)

    Meyer, Michael J; Geske, Philip; Yu, Haiyuan

    2016-05-15

    Biological sequence databases are integral to efforts to characterize and understand biological molecules and share biological data. However, when analyzing these data, scientists are often left holding disparate biological currency-molecular identifiers from different databases. For downstream applications that require converting the identifiers themselves, there are many resources available, but analyzing associated loci and variants can be cumbersome if data is not given in a form amenable to particular analyses. Here we present BISQUE, a web server and customizable command-line tool for converting molecular identifiers and their contained loci and variants between different database conventions. BISQUE uses a graph traversal algorithm to generalize the conversion process for residues in the human genome, genes, transcripts and proteins, allowing for conversion across classes of molecules and in all directions through an intuitive web interface and a URL-based web service. BISQUE is freely available via the web using any major web browser (http://bisque.yulab.org/). Source code is available in a public GitHub repository (https://github.com/hyulab/BISQUE). haiyuan.yu@cornell.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  14. Genome-wide association scan meta-analysis identifies three Loci influencing adiposity and fat distribution.

    Directory of Open Access Journals (Sweden)

    Cecilia M Lindgren

    2009-06-01

    Full Text Available To identify genetic loci influencing central obesity and fat distribution, we performed a meta-analysis of 16 genome-wide association studies (GWAS, N = 38,580 informative for adult waist circumference (WC and waist-hip ratio (WHR. We selected 26 SNPs for follow-up, for which the evidence of association with measures of central adiposity (WC and/or WHR was strong and disproportionate to that for overall adiposity or height. Follow-up studies in a maximum of 70,689 individuals identified two loci strongly associated with measures of central adiposity; these map near TFAP2B (WC, P = 1.9x10(-11 and MSRA (WC, P = 8.9x10(-9. A third locus, near LYPLAL1, was associated with WHR in women only (P = 2.6x10(-8. The variants near TFAP2B appear to influence central adiposity through an effect on overall obesity/fat-mass, whereas LYPLAL1 displays a strong female-only association with fat distribution. By focusing on anthropometric measures of central obesity and fat distribution, we have identified three loci implicated in the regulation of human adiposity.

  15. Systems-based analysis of the Sarcocystis neurona genome identifies pathways that contribute to a heteroxenous life cycle.

    Science.gov (United States)

    Blazejewski, Tomasz; Nursimulu, Nirvana; Pszenny, Viviana; Dangoudoubiyam, Sriveny; Namasivayam, Sivaranjani; Chiasson, Melissa A; Chessman, Kyle; Tonkin, Michelle; Swapna, Lakshmipuram S; Hung, Stacy S; Bridgers, Joshua; Ricklefs, Stacy M; Boulanger, Martin J; Dubey, Jitender P; Porcella, Stephen F; Kissinger, Jessica C; Howe, Daniel K; Grigg, Michael E; Parkinson, John

    2015-02-10

    Sarcocystis neurona is a member of the coccidia, a clade of single-celled parasites of medical and veterinary importance including Eimeria, Sarcocystis, Neospora, and Toxoplasma. Unlike Eimeria, a single-host enteric pathogen, Sarcocystis, Neospora, and Toxoplasma are two-host parasites that infect and produce infectious tissue cysts in a wide range of intermediate hosts. As a genus, Sarcocystis is one of the most successful protozoan parasites; all vertebrates, including birds, reptiles, fish, and mammals are hosts to at least one Sarcocystis species. Here we sequenced Sarcocystis neurona, the causal agent of fatal equine protozoal myeloencephalitis. The S. neurona genome is 127 Mbp, more than twice the size of other sequenced coccidian genomes. Comparative analyses identified conservation of the invasion machinery among the coccidia. However, many dense-granule and rhoptry kinase genes, responsible for altering host effector pathways in Toxoplasma and Neospora, are absent from S. neurona. Further, S. neurona has a divergent repertoire of SRS proteins, previously implicated in tissue cyst formation in Toxoplasma. Systems-based analyses identified a series of metabolic innovations, including the ability to exploit alternative sources of energy. Finally, we present an S. neurona model detailing conserved molecular innovations that promote the transition from a purely enteric lifestyle (Eimeria) to a heteroxenous parasite capable of infecting a wide range of intermediate hosts. Sarcocystis neurona is a member of the coccidia, a clade of single-celled apicomplexan parasites responsible for major economic and health care burdens worldwide. A cousin of Plasmodium, Cryptosporidium, Theileria, and Eimeria, Sarcocystis is one of the most successful parasite genera; it is capable of infecting all vertebrates (fish, reptiles, birds, and mammals-including humans). The past decade has witnessed an increasing number of human outbreaks of clinical significance associated with

  16. Genome wide analysis of inbred mouse lines identifies a locus containing Ppar-gamma as contributing to enhanced malaria survival.

    Directory of Open Access Journals (Sweden)

    Selina E R Bopp

    2010-05-01

    Full Text Available The genetic background of a patient determines in part if a person develops a mild form of malaria and recovers, or develops a severe form and dies. We have used a mouse model to detect genes involved in the resistance or susceptibility to Plasmodium berghei malaria infection. To this end we first characterized 32 different mouse strains infected with P. berghei and identified survival as the best trait to discriminate between the strains. We found a locus on chromosome 6 by linking the survival phenotypes of the mouse strains to their genetic variations using genome wide analyses such as haplotype associated mapping and the efficient mixed-model for association. This new locus involved in malaria resistance contains only two genes and confirms the importance of Ppar-gamma in malaria infection.

  17. Genome-wide association analyses identify 44 risk variants and refine the genetic architecture of major depression.

    Science.gov (United States)

    Wray, Naomi R; Ripke, Stephan; Mattheisen, Manuel; Trzaskowski, Maciej; Byrne, Enda M; Abdellaoui, Abdel; Adams, Mark J; Agerbo, Esben; Air, Tracy M; Andlauer, Till M F; Bacanu, Silviu-Alin; Bækvad-Hansen, Marie; Beekman, Aartjan F T; Bigdeli, Tim B; Binder, Elisabeth B; Blackwood, Douglas R H; Bryois, Julien; Buttenschøn, Henriette N; Bybjerg-Grauholm, Jonas; Cai, Na; Castelao, Enrique; Christensen, Jane Hvarregaard; Clarke, Toni-Kim; Coleman, Jonathan I R; Colodro-Conde, Lucía; Couvy-Duchesne, Baptiste; Craddock, Nick; Crawford, Gregory E; Crowley, Cheynna A; Dashti, Hassan S; Davies, Gail; Deary, Ian J; Degenhardt, Franziska; Derks, Eske M; Direk, Nese; Dolan, Conor V; Dunn, Erin C; Eley, Thalia C; Eriksson, Nicholas; Escott-Price, Valentina; Kiadeh, Farnush Hassan Farhadi; Finucane, Hilary K; Forstner, Andreas J; Frank, Josef; Gaspar, Héléna A; Gill, Michael; Giusti-Rodríguez, Paola; Goes, Fernando S; Gordon, Scott D; Grove, Jakob; Hall, Lynsey S; Hannon, Eilis; Hansen, Christine Søholm; Hansen, Thomas F; Herms, Stefan; Hickie, Ian B; Hoffmann, Per; Homuth, Georg; Horn, Carsten; Hottenga, Jouke-Jan; Hougaard, David M; Hu, Ming; Hyde, Craig L; Ising, Marcus; Jansen, Rick; Jin, Fulai; Jorgenson, Eric; Knowles, James A; Kohane, Isaac S; Kraft, Julia; Kretzschmar, Warren W; Krogh, Jesper; Kutalik, Zoltán; Lane, Jacqueline M; Li, Yihan; Li, Yun; Lind, Penelope A; Liu, Xiaoxiao; Lu, Leina; MacIntyre, Donald J; MacKinnon, Dean F; Maier, Robert M; Maier, Wolfgang; Marchini, Jonathan; Mbarek, Hamdi; McGrath, Patrick; McGuffin, Peter; Medland, Sarah E; Mehta, Divya; Middeldorp, Christel M; Mihailov, Evelin; Milaneschi, Yuri; Milani, Lili; Mill, Jonathan; Mondimore, Francis M; Montgomery, Grant W; Mostafavi, Sara; Mullins, Niamh; Nauck, Matthias; Ng, Bernard; Nivard, Michel G; Nyholt, Dale R; O'Reilly, Paul F; Oskarsson, Hogni; Owen, Michael J; Painter, Jodie N; Pedersen, Carsten Bøcker; Pedersen, Marianne Giørtz; Peterson, Roseann E; Pettersson, Erik; Peyrot, Wouter J; Pistis, Giorgio; Posthuma, Danielle; Purcell, Shaun M; Quiroz, Jorge A; Qvist, Per; Rice, John P; Riley, Brien P; Rivera, Margarita; Saeed Mirza, Saira; Saxena, Richa; Schoevers, Robert; Schulte, Eva C; Shen, Ling; Shi, Jianxin; Shyn, Stanley I; Sigurdsson, Engilbert; Sinnamon, Grant B C; Smit, Johannes H; Smith, Daniel J; Stefansson, Hreinn; Steinberg, Stacy; Stockmeier, Craig A; Streit, Fabian; Strohmaier, Jana; Tansey, Katherine E; Teismann, Henning; Teumer, Alexander; Thompson, Wesley; Thomson, Pippa A; Thorgeirsson, Thorgeir E; Tian, Chao; Traylor, Matthew; Treutlein, Jens; Trubetskoy, Vassily; Uitterlinden, André G; Umbricht, Daniel; Van der Auwera, Sandra; van Hemert, Albert M; Viktorin, Alexander; Visscher, Peter M; Wang, Yunpeng; Webb, Bradley T; Weinsheimer, Shantel Marie; Wellmann, Jürgen; Willemsen, Gonneke; Witt, Stephanie H; Wu, Yang; Xi, Hualin S; Yang, Jian; Zhang, Futao; Arolt, Volker; Baune, Bernhard T; Berger, Klaus; Boomsma, Dorret I; Cichon, Sven; Dannlowski, Udo; de Geus, E C J; DePaulo, J Raymond; Domenici, Enrico; Domschke, Katharina; Esko, Tõnu; Grabe, Hans J; Hamilton, Steven P; Hayward, Caroline; Heath, Andrew C; Hinds, David A; Kendler, Kenneth S; Kloiber, Stefan; Lewis, Glyn; Li, Qingqin S; Lucae, Susanne; Madden, Pamela F A; Magnusson, Patrik K; Martin, Nicholas G; McIntosh, Andrew M; Metspalu, Andres; Mors, Ole; Mortensen, Preben Bo; Müller-Myhsok, Bertram; Nordentoft, Merete; Nöthen, Markus M; O'Donovan, Michael C; Paciga, Sara A; Pedersen, Nancy L; Penninx, Brenda W J H; Perlis, Roy H; Porteous, David J; Potash, James B; Preisig, Martin; Rietschel, Marcella; Schaefer, Catherine; Schulze, Thomas G; Smoller, Jordan W; Stefansson, Kari; Tiemeier, Henning; Uher, Rudolf; Völzke, Henry; Weissman, Myrna M; Werge, Thomas; Winslow, Ashley R; Lewis, Cathryn M; Levinson, Douglas F; Breen, Gerome; Børglum, Anders D; Sullivan, Patrick F

    2018-05-01

    Major depressive disorder (MDD) is a common illness accompanied by considerable morbidity, mortality, costs, and heightened risk of suicide. We conducted a genome-wide association meta-analysis based in 135,458 cases and 344,901 controls and identified 44 independent and significant loci. The genetic findings were associated with clinical features of major depression and implicated brain regions exhibiting anatomical differences in cases. Targets of antidepressant medications and genes involved in gene splicing were enriched for smaller association signal. We found important relationships of genetic risk for major depression with educational attainment, body mass, and schizophrenia: lower educational attainment and higher body mass were putatively causal, whereas major depression and schizophrenia reflected a partly shared biological etiology. All humans carry lesser or greater numbers of genetic risk factors for major depression. These findings help refine the basis of major depression and imply that a continuous measure of risk underlies the clinical phenotype.

  18. A genome-wide siRNA screen to identify modulators of insulin sensitivity and gluconeogenesis.

    Directory of Open Access Journals (Sweden)

    Ruojing Yang

    Full Text Available BACKGROUND: Hepatic insulin resistance impairs insulin's ability to suppress hepatic glucose production (HGP and contributes to the development of type 2 diabetes (T2D. Although the interests to discover novel genes that modulate insulin sensitivity and HGP are high, it remains challenging to have a human cell based system to identify novel genes. METHODOLOGY/PRINCIPAL FINDINGS: To identify genes that modulate hepatic insulin signaling and HGP, we generated a human cell line stably expressing beta-lactamase under the control of the human glucose-6-phosphatase (G6PC promoter (AH-G6PC cells. Both beta-lactamase activity and endogenous G6PC mRNA were increased in AH-G6PC cells by a combination of dexamethasone and pCPT-cAMP, and reduced by insulin. A 4-gene High-Throughput-Genomics assay was developed to concomitantly measure G6PC and pyruvate-dehydrogenase-kinase-4 (PDK4 mRNA levels. Using this assay, we screened an siRNA library containing pooled siRNA targeting 6650 druggable genes and identified 614 hits that lowered G6PC expression without increasing PDK4 mRNA levels. Pathway analysis indicated that siRNA-mediated knockdown (KD of genes known to positively or negatively affect insulin signaling increased or decreased G6PC mRNA expression, respectively, thus validating our screening platform. A subset of 270 primary screen hits was selected and 149 hits were confirmed by target gene KD by pooled siRNA and 7 single siRNA for each gene to reduce G6PC expression in 4-gene HTG assay. Subsequently, pooled siRNA KD of 113 genes decreased PEPCK and/or PGC1alpha mRNA expression thereby demonstrating their role in regulating key gluconeogenic genes in addition to G6PC. Last, KD of 61 of the above 113 genes potentiated insulin-stimulated Akt phosphorylation, suggesting that they suppress gluconeogenic gene by enhancing insulin signaling. CONCLUSIONS/SIGNIFICANCE: These results support the proposition that the proteins encoded by the genes identified in

  19. Comparative Genomics of the Genus Porphyromonas Identifies Adaptations for Heme Synthesis within the Prevalent Canine Oral Species Porphyromonas cangingivalis.

    Science.gov (United States)

    O'Flynn, Ciaran; Deusch, Oliver; Darling, Aaron E; Eisen, Jonathan A; Wallis, Corrin; Davis, Ian J; Harris, Stephen J

    2015-11-13

    Porphyromonads play an important role in human periodontal disease and recently have been shown to be highly prevalent in canine mouths. Porphyromonas cangingivalis is the most prevalent canine oral bacterial species in both plaque from healthy gingiva and plaque from dogs with early periodontitis. The ability of P. cangingivalis to flourish in the different environmental conditions characterized by these two states suggests a degree of metabolic flexibility. To characterize the genes responsible for this, the genomes of 32 isolates (including 18 newly sequenced and assembled) from 18 Porphyromonad species from dogs, humans, and other mammals were compared. Phylogenetic trees inferred using core genes largely matched previous findings; however, comparative genomic analysis identified several genes and pathways relating to heme synthesis that were present in P. cangingivalis but not in other Porphyromonads. Porphyromonas cangingivalis has a complete protoporphyrin IX synthesis pathway potentially allowing it to synthesize its own heme unlike pathogenic Porphyromonads such as Porphyromonas gingivalis that acquire heme predominantly from blood. Other pathway differences such as the ability to synthesize siroheme and vitamin B12 point to enhanced metabolic flexibility for P. cangingivalis, which may underlie its prevalence in the canine oral cavity. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. Genomic characterization of a new endophytic Streptomyces kebangsaanensis identifies biosynthetic pathway gene clusters for novel phenazine antibiotic production

    Directory of Open Access Journals (Sweden)

    Juwairiah Remali

    2017-11-01

    Full Text Available Background Streptomyces are well known for their capability to produce many bioactive secondary metabolites with medical and industrial importance. Here we report a novel bioactive phenazine compound, 6-((2-hydroxy-4-methoxyphenoxy carbonyl phenazine-1-carboxylic acid (HCPCA extracted from Streptomyces kebangsaanensis, an endophyte isolated from the ethnomedicinal Portulaca oleracea. Methods The HCPCA chemical structure was determined using nuclear magnetic resonance spectroscopy. We conducted whole genome sequencing for the identification of the gene cluster(s believed to be responsible for phenazine biosynthesis in order to map its corresponding pathway, in addition to bioinformatics analysis to assess the potential of S. kebangsaanensis in producing other useful secondary metabolites. Results The S. kebangsaanensis genome comprises an 8,328,719 bp linear chromosome with high GC content (71.35% consisting of 12 rRNA operons, 81 tRNA, and 7,558 protein coding genes. We identified 24 gene clusters involved in polyketide, nonribosomal peptide, terpene, bacteriocin, and siderophore biosynthesis, as well as a gene cluster predicted to be responsible for phenazine biosynthesis. Discussion The HCPCA phenazine structure was hypothesized to derive from the combination of two biosynthetic pathways, phenazine-1,6-dicarboxylic acid and 4-methoxybenzene-1,2-diol, originated from the shikimic acid pathway. The identification of a biosynthesis pathway gene cluster for phenazine antibiotics might facilitate future genetic engineering design of new synthetic phenazine antibiotics. Additionally, these findings confirm the potential of S. kebangsaanensis for producing various antibiotics and secondary metabolites.

  1. Use of the Operon Structure of the C. elegans Genome as a Tool to Identify Functionally Related Proteins

    Directory of Open Access Journals (Sweden)

    Silvia Dossena

    2013-12-01

    Full Text Available One of the most pressing challenges in the post genomic era is the identification and characterization of protein-protein interactions (PPIs, as these are essential in understanding the cellular physiology of health and disease. Experimental techniques suitable for characterizing PPIs (X-ray crystallography or nuclear magnetic resonance spectroscopy, among others are usually laborious, time-consuming and often difficult to apply to membrane proteins, and therefore require accurate prediction of the candidate interacting partners. High-throughput experimental methods (yeast two-hybrid and affinity purification succumb to the same shortcomings, and can also lead to high rates of false positive and negative results. Therefore, reliable tools for predicting PPIs are needed. The use of the operon structure in the eukaryote Caenorhabditis elegans genome is a valuable, though underserved, tool for identifying physically or functionally interacting proteins. Based on the concept that genes organized in the same operon may encode physically or functionally related proteins, this algorithm is easy to be applied and, importantly, gives a limited number of candidate partners of a given protein, allowing for focused experimental verification. Moreover, this approach can be successfully used to predict PPIs in the human system, including those of membrane proteins.

  2. ERIC-PCR fingerprinting-based community DNA hybridization to pinpoint genome-specific fragments as molecular markers to identify and track populations common to healthy human guts.

    Science.gov (United States)

    Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping

    2004-10-01

    Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.

  3. Genome-Wide Association Identifies Multiple Genomic Regions Associated with Susceptibility to and Control of Ovine Lentivirus

    Science.gov (United States)

    2012-10-17

    to varying degrees of dyspnea (respiratory distress), cachexia (body condition wasting), mastitis , arthritis, and/or encephalitis [5,6]. One of the...General Transcription Factor IIH, polypeptide 5), the gene order does not agree with other mammal genomes including cow , human, dog, and mouse, and it may

  4. Genetic variants associated with subjective well-being, depressive symptoms, and neuroticism identified through genome-wide analyses

    OpenAIRE

    Okbay, Aysu; Baselmans, B.M.L. (Bart M.L.); Neve, Jan-Emmanuel; Turley, Patrick; Nivard, Michel; Fontana, M.A. (Mark Alan); Meddens, S.F.W. (S. Fleur W.); Linnér, R.K. (Richard Karlsson); Rietveld, C.A. (Cornelius A); Derringer, J.; Gratten, Jacob; Lee, James J.; Liu, J.Z. (Jimmy Z); Vlaming, Ronald; SAhluwalia, T. (Tarunveer)

    2016-01-01

    textabstractVery few genetic variants have been associated with depression and neuroticism, likely because of limitations on sample size in previous studies. Subjective well-being, a phenotype that is genetically correlated with both of these traits, has not yet been studied with genome-wide data. We conducted genome-wide association studies of three phenotypes: subjective well-being (n = 298,420), depressive symptoms (n = 161,460), and neuroticism (n = 170,911). We identify 3 variants associ...

  5. On the importance of identifying, characterizing, and predicting fundamental phenomena towards microbial electrochemistry applications.

    Science.gov (United States)

    Torres, César Iván

    2014-06-01

    The development of microbial electrochemistry research toward technological applications has increased significantly in the past years, leading to many process configurations. This short review focuses on the need to identify and characterize the fundamental phenomena that control the performance of microbial electrochemical cells (MXCs). Specifically, it discusses the importance of recent efforts to discover and characterize novel microorganisms for MXC applications, as well as recent developments to understand transport limitations in MXCs. As we increase our understanding of how MXCs operate, it is imperative to continue modeling efforts in order to effectively predict their performance, design efficient MXC technologies, and implement them commercially. Thus, the success of MXC technologies largely depends on the path of identifying, understanding, and predicting fundamental phenomena that determine MXC performance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. Exploring Other Genomes: Bacteria.

    Science.gov (United States)

    Flannery, Maura C.

    2001-01-01

    Points out the importance of genomes other than the human genome project and provides information on the identified bacterial genomes Pseudomonas aeuroginosa, Leprosy, Cholera, Meningitis, Tuberculosis, Bubonic Plague, and plant pathogens. Considers the computer's use in genome studies. (Contains 14 references.) (YDS)

  7. Candidate Essential Genes in Burkholderia cenocepacia J2315 Identified by Genome-Wide TraDIS

    KAUST Repository

    Wong, Yee-Chin

    2016-08-22

    Burkholderia cenocepacia infection often leads to fatal cepacia syndrome in cystic fibrosis patients. However, antibiotic therapy rarely results in complete eradication of the pathogen due to its intrinsic resistance to many clinically available antibiotics. Recent attention has turned to the identification of essential genes as the proteins encoded by these genes may serve as potential targets for development of novel antimicrobials. In this study, we utilized TraDIS (Transposon Directed Insertion-site Sequencing) as a genome-wide screening tool to facilitate the identification of B. cenocepacia genes essential for its growth and viability. A transposon mutant pool consisting of approximately 500,000 mutants was successfully constructed, with more than 400,000 unique transposon insertion sites identified by computational analysis of TraDIS datasets. The saturated library allowed for the identification of 383 genes that were predicted to be essential in B. cenocepacia. We extended the application of TraDIS to identify conditionally essential genes required for in vitro growth and revealed an additional repertoire of 439 genes to be crucial for B. cenocepacia growth under nutrient-depleted conditions. The library of B. cenocepacia mutants can subsequently be subjected to various biologically related conditions to facilitate the discovery of genes involved in niche adaptation as well as pathogenicity and virulence.

  8. Genome-wide Analyses Identify KIF5A as a Novel ALS Gene.

    Science.gov (United States)

    Nicolas, Aude; Kenna, Kevin P; Renton, Alan E; Ticozzi, Nicola; Faghri, Faraz; Chia, Ruth; Dominov, Janice A; Kenna, Brendan J; Nalls, Mike A; Keagle, Pamela; Rivera, Alberto M; van Rheenen, Wouter; Murphy, Natalie A; van Vugt, Joke J F A; Geiger, Joshua T; Van der Spek, Rick A; Pliner, Hannah A; Shankaracharya; Smith, Bradley N; Marangi, Giuseppe; Topp, Simon D; Abramzon, Yevgeniya; Gkazi, Athina Soragia; Eicher, John D; Kenna, Aoife; Mora, Gabriele; Calvo, Andrea; Mazzini, Letizia; Riva, Nilo; Mandrioli, Jessica; Caponnetto, Claudia; Battistini, Stefania; Volanti, Paolo; La Bella, Vincenzo; Conforti, Francesca L; Borghero, Giuseppe; Messina, Sonia; Simone, Isabella L; Trojsi, Francesca; Salvi, Fabrizio; Logullo, Francesco O; D'Alfonso, Sandra; Corrado, Lucia; Capasso, Margherita; Ferrucci, Luigi; Moreno, Cristiane de Araujo Martins; Kamalakaran, Sitharthan; Goldstein, David B; Gitler, Aaron D; Harris, Tim; Myers, Richard M; Phatnani, Hemali; Musunuri, Rajeeva Lochan; Evani, Uday Shankar; Abhyankar, Avinash; Zody, Michael C; Kaye, Julia; Finkbeiner, Steven; Wyman, Stacia K; LeNail, Alex; Lima, Leandro; Fraenkel, Ernest; Svendsen, Clive N; Thompson, Leslie M; Van Eyk, Jennifer E; Berry, James D; Miller, Timothy M; Kolb, Stephen J; Cudkowicz, Merit; Baxi, Emily; Benatar, Michael; Taylor, J Paul; Rampersaud, Evadnie; Wu, Gang; Wuu, Joanne; Lauria, Giuseppe; Verde, Federico; Fogh, Isabella; Tiloca, Cinzia; Comi, Giacomo P; Sorarù, Gianni; Cereda, Cristina; Corcia, Philippe; Laaksovirta, Hannu; Myllykangas, Liisa; Jansson, Lilja; Valori, Miko; Ealing, John; Hamdalla, Hisham; Rollinson, Sara; Pickering-Brown, Stuart; Orrell, Richard W; Sidle, Katie C; Malaspina, Andrea; Hardy, John; Singleton, Andrew B; Johnson, Janel O; Arepalli, Sampath; Sapp, Peter C; McKenna-Yasek, Diane; Polak, Meraida; Asress, Seneshaw; Al-Sarraj, Safa; King, Andrew; Troakes, Claire; Vance, Caroline; de Belleroche, Jacqueline; Baas, Frank; Ten Asbroek, Anneloor L M A; Muñoz-Blanco, José Luis; Hernandez, Dena G; Ding, Jinhui; Gibbs, J Raphael; Scholz, Sonja W; Floeter, Mary Kay; Campbell, Roy H; Landi, Francesco; Bowser, Robert; Pulst, Stefan M; Ravits, John M; MacGowan, Daniel J L; Kirby, Janine; Pioro, Erik P; Pamphlett, Roger; Broach, James; Gerhard, Glenn; Dunckley, Travis L; Brady, Christopher B; Kowall, Neil W; Troncoso, Juan C; Le Ber, Isabelle; Mouzat, Kevin; Lumbroso, Serge; Heiman-Patterson, Terry D; Kamel, Freya; Van Den Bosch, Ludo; Baloh, Robert H; Strom, Tim M; Meitinger, Thomas; Shatunov, Aleksey; Van Eijk, Kristel R; de Carvalho, Mamede; Kooyman, Maarten; Middelkoop, Bas; Moisse, Matthieu; McLaughlin, Russell L; Van Es, Michael A; Weber, Markus; Boylan, Kevin B; Van Blitterswijk, Marka; Rademakers, Rosa; Morrison, Karen E; Basak, A Nazli; Mora, Jesús S; Drory, Vivian E; Shaw, Pamela J; Turner, Martin R; Talbot, Kevin; Hardiman, Orla; Williams, Kelly L; Fifita, Jennifer A; Nicholson, Garth A; Blair, Ian P; Rouleau, Guy A; Esteban-Pérez, Jesús; García-Redondo, Alberto; Al-Chalabi, Ammar; Rogaeva, Ekaterina; Zinman, Lorne; Ostrow, Lyle W; Maragakis, Nicholas J; Rothstein, Jeffrey D; Simmons, Zachary; Cooper-Knock, Johnathan; Brice, Alexis; Goutman, Stephen A; Feldman, Eva L; Gibson, Summer B; Taroni, Franco; Ratti, Antonia; Gellera, Cinzia; Van Damme, Philip; Robberecht, Wim; Fratta, Pietro; Sabatelli, Mario; Lunetta, Christian; Ludolph, Albert C; Andersen, Peter M; Weishaupt, Jochen H; Camu, William; Trojanowski, John Q; Van Deerlin, Vivianna M; Brown, Robert H; van den Berg, Leonard H; Veldink, Jan H; Harms, Matthew B; Glass, Jonathan D; Stone, David J; Tienari, Pentti; Silani, Vincenzo; Chiò, Adriano; Shaw, Christopher E; Traynor, Bryan J; Landers, John E

    2018-03-21

    To identify novel genes associated with ALS, we undertook two lines of investigation. We carried out a genome-wide association study comparing 20,806 ALS cases and 59,804 controls. Independently, we performed a rare variant burden analysis comparing 1,138 index familial ALS cases and 19,494 controls. Through both approaches, we identified kinesin family member 5A (KIF5A) as a novel gene associated with ALS. Interestingly, mutations predominantly in the N-terminal motor domain of KIF5A are causative for two neurodegenerative diseases: hereditary spastic paraplegia (SPG10) and Charcot-Marie-Tooth type 2 (CMT2). In contrast, ALS-associated mutations are primarily located at the C-terminal cargo-binding tail domain and patients harboring loss-of-function mutations displayed an extended survival relative to typical ALS cases. Taken together, these results broaden the phenotype spectrum resulting from mutations in KIF5A and strengthen the role of cytoskeletal defects in the pathogenesis of ALS. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. Genome-wide association study identifies novel breast cancer susceptibility loci

    Science.gov (United States)

    Easton, Douglas F.; Pooley, Karen A.; Dunning, Alison M.; Pharoah, Paul D. P.; Thompson, Deborah; Ballinger, Dennis G.; Struewing, Jeffery P.; Morrison, Jonathan; Field, Helen; Luben, Robert; Wareham, Nicholas; Ahmed, Shahana; Healey, Catherine S.; Bowman, Richard; Meyer, Kerstin B.; Haiman, Christopher A.; Kolonel, Laurence K.; Henderson, Brian E.; Marchand, Loic Le; Brennan, Paul; Sangrajrang, Suleeporn; Gaborieau, Valerie; Odefrey, Fabrice; Shen, Chen-Yang; Wu, Pei-Ei; Wang, Hui-Chun; Eccles, Diana; Evans, D. Gareth; Peto, Julian; Fletcher, Olivia; Johnson, Nichola; Seal, Sheila; Stratton, Michael R.; Rahman, Nazneen; Chenevix-Trench, Georgia; Bojesen, Stig E.; Nordestgaard, Børge G.; Axelsson, Christen K.; Garcia-Closas, Montserrat; Brinton, Louise; Chanock, Stephen; Lissowska, Jolanta; Peplonska, Beata; Nevanlinna, Heli; Fagerholm, Rainer; Eerola, Hannaleena; Kang, Daehee; Yoo, Keun-Young; Noh, Dong-Young; Ahn, Sei-Hyun; Hunter, David J.; Hankinson, Susan E.; Cox, David G.; Hall, Per; Wedren, Sara; Liu, Jianjun; Low, Yen-Ling; Bogdanova, Natalia; Schürmann, Peter; Dörk, Thilo; Tollenaar, Rob A. E. M.; Jacobi, Catharina E.; Devilee, Peter; Klijn, Jan G. M.; Sigurdson, Alice J.; Doody, Michele M.; Alexander, Bruce H.; Zhang, Jinghui; Cox, Angela; Brock, Ian W.; MacPherson, Gordon; Reed, Malcolm W. R.; Couch, Fergus J.; Goode, Ellen L.; Olson, Janet E.; Meijers-Heijboer, Hanne; van den Ouweland, Ans; Uitterlinden, André; Rivadeneira, Fernando; Milne, Roger L.; Ribas, Gloria; Gonzalez-Neira, Anna; Benitez, Javier; Hopper, John L.; McCredie, Margaret; Southey, Melissa; Giles, Graham G.; Schroen, Chris; Justenhoven, Christina; Brauch, Hiltrud; Hamann, Ute; Ko, Yon-Dschun; Spurdle, Amanda B.; Beesley, Jonathan; Chen, Xiaoqing; Mannermaa, Arto; Kosma, Veli-Matti; Kataja, Vesa; Hartikainen, Jaana; Day, Nicholas E.; Cox, David R.; Ponder, Bruce A. J.; Luccarini, Craig; Conroy, Don; Shah, Mitul; Munday, Hannah; Jordan, Clare; Perkins, Barbara; West, Judy; Redman, Karen; Driver, Kristy; Aghmesheh, Morteza; Amor, David; Andrews, Lesley; Antill, Yoland; Armes, Jane; Armitage, Shane; Arnold, Leanne; Balleine, Rosemary; Begley, Glenn; Beilby, John; Bennett, Ian; Bennett, Barbara; Berry, Geoffrey; Blackburn, Anneke; Brennan, Meagan; Brown, Melissa; Buckley, Michael; Burke, Jo; Butow, Phyllis; Byron, Keith; Callen, David; Campbell, Ian; Chenevix-Trench, Georgia; Clarke, Christine; Colley, Alison; Cotton, Dick; Cui, Jisheng; Culling, Bronwyn; Cummings, Margaret; Dawson, Sarah-Jane; Dixon, Joanne; Dobrovic, Alexander; Dudding, Tracy; Edkins, Ted; Eisenbruch, Maurice; Farshid, Gelareh; Fawcett, Susan; Field, Michael; Firgaira, Frank; Fleming, Jean; Forbes, John; Friedlander, Michael; Gaff, Clara; Gardner, Mac; Gattas, Mike; George, Peter; Giles, Graham; Gill, Grantley; Goldblatt, Jack; Greening, Sian; Grist, Scott; Haan, Eric; Harris, Marion; Hart, Stewart; Hayward, Nick; Hopper, John; Humphrey, Evelyn; Jenkins, Mark; Jones, Alison; Kefford, Rick; Kirk, Judy; Kollias, James; Kovalenko, Sergey; Lakhani, Sunil; Leary, Jennifer; Lim, Jacqueline; Lindeman, Geoff; Lipton, Lara; Lobb, Liz; Maclurcan, Mariette; Mann, Graham; Marsh, Deborah; McCredie, Margaret; McKay, Michael; McLachlan, Sue Anne; Meiser, Bettina; Milne, Roger; Mitchell, Gillian; Newman, Beth; O'Loughlin, Imelda; Osborne, Richard; Peters, Lester; Phillips, Kelly; Price, Melanie; Reeve, Jeanne; Reeve, Tony; Richards, Robert; Rinehart, Gina; Robinson, Bridget; Rudzki, Barney; Salisbury, Elizabeth; Sambrook, Joe; Saunders, Christobel; Scott, Clare; Scott, Elizabeth; Scott, Rodney; Seshadri, Ram; Shelling, Andrew; Southey, Melissa; Spurdle, Amanda; Suthers, Graeme; Taylor, Donna; Tennant, Christopher; Thorne, Heather; Townshend, Sharron; Tucker, Kathy; Tyler, Janet; Venter, Deon; Visvader, Jane; Walpole, Ian; Ward, Robin; Waring, Paul; Warner, Bev; Warren, Graham; Watson, Elizabeth; Williams, Rachael; Wilson, Judy; Winship, Ingrid; Young, Mary Ann; Bowtell, David; Green, Adele; deFazio, Anna; Chenevix-Trench, Georgia; Gertig, Dorota; Webb, Penny

    2009-01-01

    Breast cancer exhibits familial aggregation, consistent with variation in genetic susceptibility to the disease. Known susceptibility genes account for less than 25% of the familial risk of breast cancer, and the residual genetic variance is likely to be due to variants conferring more moderate risks. To identify further susceptibility alleles, we conducted a two-stage genome-wide association study in 4,398 breast cancer cases and 4,316 controls, followed by a third stage in which 30 single nucleotide polymorphisms (SNPs) were tested for confirmation in 21,860 cases and 22,578 controls from 22 studies. We used 227,876 SNPs that were estimated to correlate with 77% of known common SNPs in Europeans at r2>0.5. SNPs in five novel independent loci exhibited strong and consistent evidence of association with breast cancer (P<10−7). Four of these contain plausible causative genes (FGFR2, TNRC9, MAP3K1 and LSP1). At the second stage, 1,792 SNPs were significant at the P<0.05 level compared with an estimated 1,343 that would be expected by chance, indicating that many additional common susceptibility alleles may be identifiable by this approach. PMID:17529967

  10. A genome-wide RNAi screen identifies regulators of cholesterol-modified hedgehog secretion in Drosophila.

    Directory of Open Access Journals (Sweden)

    Reid Aikin

    Full Text Available Hedgehog (Hh proteins are secreted molecules that function as organizers in animal development. In addition to being palmitoylated, Hh is the only metazoan protein known to possess a covalently-linked cholesterol moiety. The absence of either modification severely disrupts the organization of numerous tissues during development. It is currently not known how lipid-modified Hh is secreted and released from producing cells. We have performed a genome-wide RNAi screen in Drosophila melanogaster cells to identify regulators of Hh secretion. We found that cholesterol-modified Hh secretion is strongly dependent on coat protein complex I (COPI but not COPII vesicles, suggesting that cholesterol modification alters the movement of Hh through the early secretory pathway. We provide evidence that both proteolysis and cholesterol modification are necessary for the efficient trafficking of Hh through the ER and Golgi. Finally, we identified several putative regulators of protein secretion and demonstrate a role for some of these genes in Hh and Wingless (Wg morphogen secretion in vivo. These data open new perspectives for studying how morphogen secretion is regulated, as well as provide insight into regulation of lipid-modified protein secretion.

  11. Candidate Essential Genes in Burkholderia cenocepacia J2315 Identified by Genome-Wide TraDIS

    KAUST Repository

    Wong, Yee-Chin; Abd El Ghany, Moataz; Naeem, Raeece; Lee, Kok-Wei; Tan, Yung-Chie; Pain, Arnab; Nathan, Sheila

    2016-01-01

    Burkholderia cenocepacia infection often leads to fatal cepacia syndrome in cystic fibrosis patients. However, antibiotic therapy rarely results in complete eradication of the pathogen due to its intrinsic resistance to many clinically available antibiotics. Recent attention has turned to the identification of essential genes as the proteins encoded by these genes may serve as potential targets for development of novel antimicrobials. In this study, we utilized TraDIS (Transposon Directed Insertion-site Sequencing) as a genome-wide screening tool to facilitate the identification of B. cenocepacia genes essential for its growth and viability. A transposon mutant pool consisting of approximately 500,000 mutants was successfully constructed, with more than 400,000 unique transposon insertion sites identified by computational analysis of TraDIS datasets. The saturated library allowed for the identification of 383 genes that were predicted to be essential in B. cenocepacia. We extended the application of TraDIS to identify conditionally essential genes required for in vitro growth and revealed an additional repertoire of 439 genes to be crucial for B. cenocepacia growth under nutrient-depleted conditions. The library of B. cenocepacia mutants can subsequently be subjected to various biologically related conditions to facilitate the discovery of genes involved in niche adaptation as well as pathogenicity and virulence.

  12. Whole-genome sequencing identifies recurrent somatic NOTCH2 mutations in splenic marginal zone lymphoma.

    Science.gov (United States)

    Kiel, Mark J; Velusamy, Thirunavukkarasu; Betz, Bryan L; Zhao, Lili; Weigelin, Helmut G; Chiang, Mark Y; Huebner-Chan, David R; Bailey, Nathanael G; Yang, David T; Bhagat, Govind; Miranda, Roberto N; Bahler, David W; Medeiros, L Jeffrey; Lim, Megan S; Elenitoba-Johnson, Kojo S J

    2012-08-27

    Splenic marginal zone lymphoma (SMZL), the most common primary lymphoma of spleen, is poorly understood at the genetic level. In this study, using whole-genome DNA sequencing (WGS) and confirmation by Sanger sequencing, we observed mutations identified in several genes not previously known to be recurrently altered in SMZL. In particular, we identified recurrent somatic gain-of-function mutations in NOTCH2, a gene encoding a protein required for marginal zone B cell development, in 25 of 99 (∼25%) cases of SMZL and in 1 of 19 (∼5%) cases of nonsplenic MZLs. These mutations clustered near the C-terminal proline/glutamate/serine/threonine (PEST)-rich domain, resulting in protein truncation or, rarely, were nonsynonymous substitutions affecting the extracellular heterodimerization domain (HD). NOTCH2 mutations were not present in other B cell lymphomas and leukemias, such as chronic lymphocytic leukemia/small lymphocytic lymphoma (CLL/SLL; n = 15), mantle cell lymphoma (MCL; n = 15), low-grade follicular lymphoma (FL; n = 44), hairy cell leukemia (HCL; n = 15), and reactive lymphoid hyperplasia (n = 14). NOTCH2 mutations were associated with adverse clinical outcomes (relapse, histological transformation, and/or death) among SMZL patients (P = 0.002). These results suggest that NOTCH2 mutations play a role in the pathogenesis and progression of SMZL and are associated with a poor prognosis.

  13. Genome-wide RNAi Screen Identifies Networks Involved in Intestinal Stem Cell Regulation in Drosophila

    Directory of Open Access Journals (Sweden)

    Xiankun Zeng

    2015-02-01

    Full Text Available The intestinal epithelium is the most rapidly self-renewing tissue in adult animals and maintained by intestinal stem cells (ISCs in both Drosophila and mammals. To comprehensively identify genes and pathways that regulate ISC fates, we performed a genome-wide transgenic RNAi screen in adult Drosophila intestine and identified 405 genes that regulate ISC maintenance and lineage-specific differentiation. By integrating these genes into publicly available interaction databases, we further developed functional networks that regulate ISC self-renewal, ISC proliferation, ISC maintenance of diploid status, ISC survival, ISC-to-enterocyte (EC lineage differentiation, and ISC-to-enteroendocrine (EE lineage differentiation. By comparing regulators among ISCs, female germline stem cells, and neural stem cells, we found that factors related to basic stem cell cellular processes are commonly required in all stem cells, and stem-cell-specific, niche-related signals are required only in the unique stem cell type. Our findings provide valuable insights into stem cell maintenance and lineage-specific differentiation.

  14. Candidate essential genes in Burkholderia cenocepacia J2315 identified by genome-wide TraDIS

    Directory of Open Access Journals (Sweden)

    Yee-Chin Wong

    2016-08-01

    Full Text Available Burkholderia cenocepacia infection often leads to fatal cepacia syndrome in cystic fibrosis patients. However, antibiotic therapy rarely results in complete eradication of the pathogen due to its intrinsic resistance to many clinically available antibiotics. Recent attention has turned to the identification of essential genes as the proteins encoded by these genes may serve as potential targets for development of novel antimicrobials. In this study, we utilized TraDIS (Transposon Directed Insertion-site Sequencing as a genome-wide screening tool to facilitate the identification of B. cenocepacia genes essential for its growth and viability. A transposon mutant pool consisting of approximately 500,000 mutants was successfully constructed, with more than 400,000 unique transposon insertion sites identified by computational analysis of TraDIS datasets. The saturated library allowed for the identification of 383 genes that were predicted to be essential in B. cenocepacia. We extended the application of TraDIS to identify conditionally essential genes required for in vitro growth and revealed an additional repertoire of 439 genes to be crucial for B. cenocepacia growth under nutrient-depleted conditions. The library of B. cenocepacia mutants can subsequently be subjected to various biologically related conditions to facilitate the discovery of genes involved in niche adaptation as well as pathogenicity and virulence.

  15. Genome-wide association analysis of more than 120,000 individuals identifies 15 new susceptibility loci for breast cancer

    NARCIS (Netherlands)

    Michailidou, Kyriaki; Beesley, Jonathan; Lindstrom, Sara; Canisius, Sander; Dennis, Joe; Lush, Michael J.; Maranian, Mel J.; Bolla, Manjeet K.; Wang, Qin; Shah, Mitul; Perkins, Barbara J.; Czene, Kamila; Eriksson, Mikael; Darabi, Hatef; Brand, Judith S.; Bojesen, Stig E.; Nordestgaard, Borge G.; Flyger, Henrik; Nielsen, Sune F.; Rahman, Nazneen; Turnbull, Clare; Fletcher, Olivia; Peto, Julian; Gibson, Lorna; dos-Santos-Silva, Isabel; Chang-Claude, Jenny; Flesch-Janys, Dieter; Rudolph, Anja; Eilber, Ursula; Behrens, Sabine; Nevanlinna, Heli; Muranen, Taru A.; Aittomaki, Kristiina; Blomqvist, Carl; Khan, Sofia; Aaltonen, Kirsimari; Ahsan, Habibul; Kibriya, Muhammad G.; Whittemore, Alice S.; John, Esther M.; Malone, Kathleen E.; Gammon, Marilie D.; Santella, Regina M.; Ursin, Giske; Makalic, Enes; Schmidt, Daniel F.; Casey, Graham; Hunter, David J.; Gapstur, Susan M.; Gaudet, Mia M.; Diver, W. Ryan; Haiman, Christopher A.; Schumacher, Fredrick; Henderson, Brian E.; Le Marchand, Loic; Berg, Christine D.; Chanock, Stephen J.; Figueroa, Jonine; Hoover, Robert N.; Lambrechts, Diether; Neven, Patrick; Wildiers, Hans; van Limbergen, Erik; Schmidt, Marjanka K.; Broeks, Annegien; Verhoef, Senno; Cornelissen, Sten; Couch, Fergus J.; Olson, Janet E.; Hallberg, Emily; Vachon, Celine; Waisfisz, Quinten; Meijers-Heijboer, Hanne; Adank, Muriel A.; van der Luijt, Rob B.; Li, Jingmei; Liu, Jianjun; Humphreys, Keith; Kang, Daehee; Choi, Ji-Yeob; Park, Sue K.; Yoo, Keun-Young; Matsuo, Keitaro; Ito, Hidemi; Iwata, Hiroji; Tajima, Kazuo; Guenel, Pascal; Truong, Therese; Mulot, Claire; Sanchez, Marie; Burwinkel, Barbara; Marme, Frederik; Surowy, Harald; Sohn, Christof; Wu, Anna H.; Tseng, Chiu-chen; Van den Berg, David; Stram, Daniel O.; Gonzalez-Neira, Anna; Benitez, Javier; Zamora, M. Pilar; Arias Perez, Jose Ignacio; Shu, Xiao-Ou; Lu, Wei; Gao, Yu-Tang; Cai, Hui; Cox, Angela; Cross, Simon S.; Reed, Malcolm W. R.; Andrulis, Irene L.; Knight, Julia A.; Glendon, Gord; Mulligan, Anna Marie; Sawyer, Elinor J.; Tomlinson, Ian; Kerin, Michael J.; Miller, Nicola; Lindblom, Annika; Margolin, Sara; Teo, Soo Hwang; Yip, Cheng Har; Taib, Nur Aishah Mohd; Tan, Gie-Hooi; Hooning, Maartje J.; Hollestelle, Antoinette; Martens, John W. M.; Collee, J. Margriet; Blot, William; Signorello, Lisa B.; Cai, Qiuyin; Hopper, John L.; Southey, Melissa C.; Tsimiklis, Helen; Apicella, Carmel; Shen, Chen-Yang; Hsiung, Chia-Ni; Wu, Pei-Ei; Hou, Ming-Feng; Kristensen, Vessela N.; Nord, Silje; Alnaes, Grethe I. Grenaker; Giles, Graham G.; Milne, Roger L.; McLean, Catriona; Canzian, Federico; Trichopoulos, Dimitrios; Peeters, Petra; Lund, Eiliv; Sund, Malin; Khaw, Kay-Tee; Gunter, Marc J.; Palli, Domenico; Mortensen, Lotte Maxild; Dossus, Laure; Huerta, Jose-Maria; Meindl, Alfons; Schmutzler, Rita K.; Sutter, Christian; Yang, Rongxi; Muir, Kenneth; Lophatananon, Artitaya; Stewart-Brown, Sarah; Siriwanarangsan, Pornthep; Hartman, Mikael; Miao, Hui; Chia, Kee Seng; Chan, Ching Wan; Fasching, Peter A.; Hein, Alexander; Beckmann, Matthias W.; Haeberle, Lothar; Brenner, Hermann; Dieffenbach, Aida Karina; Arndt, Volker; Stegmaier, Christa; Ashworth, Alan; Orr, Nick; Schoemaker, Minouk J.; Swerdlow, Anthony J.; Brinton, Louise; Garcia-Closas, Montserrat; Zheng, Wei; Halverson, Sandra L.; Shrubsole, Martha; Long, Jirong; Goldberg, Mark S.; Labreche, France; Dumont, Martine; Winqvist, Robert; Pylkas, Katri; Jukkola-Vuorinen, Arja; Grip, Mervi; Brauch, Hiltrud; Hamann, Ute; Bruening, Thomas; Radice, Paolo; Peterlongo, Paolo; Manoukian, Siranoush; Bernard, Loris; Bogdanova, Natalia V.; Doerk, Thilo; Mannermaa, Arto; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M.; Devilee, Peter; Tollenaar, Robert A. E. M.; Seynaeve, Caroline; Van Asperen, Christi J.; Jakubowska, Anna; Lubinski, Jan; Jaworska, Katarzyna; Huzarski, Tomasz; Sangrajrang, Suleeporn; Gaborieau, Valerie; Brennan, Paul; Mckay, James; Slager, Susan; Toland, Amanda E.; Ambrosone, Christine B.; Yannoukakos, Drakoulis; Kabisch, Maria; Torres, Diana; Neuhausen, Susan L.; Anton-Culver, Hoda; Luccarini, Craig; Baynes, Caroline; Ahmed, Shahana; Healey, Catherine S.; Tessier, Daniel C.; Vincent, Daniel; Bacot, Francois; Pita, Guillermo; Rosario Alonso, M.; Alvarez, Nuria; Herrero, Daniel; Simard, Jacques; Pharoah, Paul P. D. P.; Kraft, Peter; Dunning, Alison M.; Chenevix-Trench, Georgia; Hall, Per; Easton, Douglas F.

    Genome-wide association studies (GWAS) and large-scale replication studies have identified common variants in 79 loci associated with breast cancer, explaining similar to 14% of the familial risk of the disease. To identify new susceptibility loci, we performed a meta-analysis of 11 GWAS, comprising

  16. Genome-wide association analysis of more than 120,000 individuals identifies 15 new susceptibility loci for breast cancer

    NARCIS (Netherlands)

    K. Michailidou (Kyriaki); J. Beesley (Jonathan); S. Lindstrom (Stephen); S. Canisius (Sander); J. Dennis (Joe); M. Lush (Michael); M. Maranian (Melanie); M.K. Bolla (Manjeet); Q. Wang (Qing); M. Shah (Mitul); B. Perkins (Barbara); K. Czene (Kamila); M. Eriksson (Mikael); H. Darabi (Hatef); J.S. Brand (Judith S.); S.E. Bojesen (Stig); B.G. Nordestgaard (Børge); H. Flyger (Henrik); S.F. Nielsen (Sune); N. Rahman (Nazneen); C. Turnbull (Clare); O. Fletcher (Olivia); J. Peto (Julian); L.J. Gibson (Lorna); I. dos Santos Silva (Isabel); J. Chang-Claude (Jenny); D. Flesch-Janys (Dieter); A. Rudolph (Anja); U. Eilber (Ursula); T.W. Behrens (Timothy); H. Nevanlinna (Heli); T.A. Muranen (Taru); K. Aittomäki (Kristiina); C. Blomqvist (Carl); S. Khan (Sofia); K. Aaltonen (Kirsimari); H. Ahsan (Habibul); M.G. Kibriya (Muhammad); A.S. Whittemore (Alice S.); E.M. John (Esther M.); K.E. Malone (Kathleen E.); M.D. Gammon (Marilie); R.M. Santella (Regina M.); G. Ursin (Giske); E. Makalic (Enes); D.F. Schmidt (Daniel); G. Casey (Graham); D.J. Hunter (David J.); S.M. Gapstur (Susan M.); M.M. Gaudet (Mia); W.R. Diver (Ryan); C.A. Haiman (Christopher A.); F.R. Schumacher (Fredrick); B.E. Henderson (Brian); L. Le Marchand (Loic); C.D. Berg (Christine); S.J. Chanock (Stephen); J.D. Figueroa (Jonine); R.N. Hoover (Robert N.); D. Lambrechts (Diether); P. Neven (Patrick); H. Wildiers (Hans); E. van Limbergen (Erik); M.K. Schmidt (Marjanka); A. Broeks (Annegien); S. Verhoef; S. Cornelissen (Sten); F.J. Couch (Fergus); J.E. Olson (Janet); B. Hallberg (Boubou); C. Vachon (Celine); Q. Waisfisz (Quinten); E.J. Meijers-Heijboer (Hanne); M.A. Adank (Muriel); R.B. van der Luijt (Rob); J. Li (Jingmei); J. Liu (Jianjun); M.K. Humphreys (Manjeet); D. Kang (Daehee); J.-Y. Choi (Ji-Yeob); S.K. Park (Sue K.); K.Y. Yoo; K. Matsuo (Keitaro); H. Ito (Hidemi); H. Iwata (Hiroji); K. Tajima (Kazuo); P. Guénel (Pascal); T. Truong (Thérèse); C. Mulot (Claire); M. Sanchez (Marie); B. Burwinkel (Barbara); F. Marme (Federick); H. Surowy (Harald); C. Sohn (Christof); A.H. Wu (Anna H); C.-C. Tseng (Chiu-chen); D. Van Den Berg (David); D.O. Stram (Daniel O.); A. González-Neira (Anna); J. Benítez (Javier); M.P. Zamora (Pilar); J.I.A. Perez (Jose Ignacio Arias); X.-O. Shu (Xiao-Ou); W. Lu (Wei); Y. Gao; H. Cai (Hui); A. Cox (Angela); S.S. Cross (Simon); M.W.R. Reed (Malcolm); I.L. Andrulis (Irene); J.A. Knight (Julia); G. Glendon (Gord); A.-M. Mulligan (Anna-Marie); E.J. Sawyer (Elinor); I.P. Tomlinson (Ian); M. Kerin (Michael); N. Miller (Nicola); A. Lindblom (Annika); S. Margolin (Sara); S.H. Teo (Soo Hwang); C.H. Yip (Cheng Har); N.A.M. Taib (Nur Aishah Mohd); G.-H. Tan (Gie-Hooi); M.J. Hooning (Maartje); A. Hollestelle (Antoinette); J.W.M. Martens (John); J.M. Collée (Margriet); W.J. Blot (William); L.B. Signorello (Lisa B.); Q. Cai (Qiuyin); J. Hopper (John); M.C. Southey (Melissa); H. Tsimiklis (Helen); C. Apicella (Carmel); C-Y. Shen (Chen-Yang); C.-N. Hsiung (Chia-Ni); P.-E. Wu (Pei-Ei); M.-F. Hou (Ming-Feng); V. Kristensen (Vessela); S. Nord (Silje); G.G. Alnæs (Grethe); G.G. Giles (Graham G.); R.L. Milne (Roger); C.A. McLean (Catriona Ann); F. Canzian (Federico); D. Trichopoulos (Dimitrios); P.H.M. Peeters; E. Lund (Eiliv); R. Sund (Reijo); K.T. Khaw; M.J. Gunter (Marc J.); D. Palli (Domenico); L.M. Mortensen (Lotte Maxild); L. Dossus (Laure); J.-M. Huerta (Jose-Maria); A. Meindl (Alfons); R.K. Schmutzler (Rita); C. Sutter (Christian); R. Yang (Rongxi); K. Muir (Kenneth); A. Lophatananon (Artitaya); S. Stewart-Brown (Sarah); P. Siriwanarangsan (Pornthep); J.M. Hartman (Joost); X. Miao; K.S. Chia (Kee Seng); C.W. Chan (Ching Wan); P.A. Fasching (Peter); R. Hein (Rebecca); M.W. Beckmann (Matthias); L. Haeberle (Lothar); H. Brenner (Hermann); A.K. Dieffenbach (Aida Karina); V. Arndt (Volker); C. Stegmaier (Christa); A. Ashworth (Alan); N. Orr (Nick); M. Schoemaker (Minouk); A.J. Swerdlow (Anthony ); L.A. Brinton (Louise); M. García-Closas (Montserrat); W. Zheng (Wei); S.L. Halverson (Sandra L.); M. Shrubsole (Martha); J. Long (Jirong); M.S. Goldberg (Mark); F. Labrèche (France); M. Dumont (Martine); R. Winqvist (Robert); K. Pykäs (Katri); A. Jukkola-Vuorinen (Arja); M. Grip (Mervi); H. Brauch (Hiltrud); U. Hamann (Ute); T. Brüning (Thomas); P. Radice (Paolo); P. Peterlongo (Paolo); S. Manoukian (Siranoush); L. Bernard (Loris); N.V. Bogdanova (Natalia); T. Dörk (Thilo); A. Mannermaa (Arto); V. Kataja (Vesa); V-M. Kosma (Veli-Matti); J.M. Hartikainen (J.); P. Devilee (Peter); R.A.E.M. Tollenaar (Rob); C.M. Seynaeve (Caroline); C.J. van Asperen (Christi); A. Jakubowska (Anna); J. Lubinski (Jan); K. Jaworska (Katarzyna); T. Huzarski (Tomasz); S. Sangrajrang (Suleeporn); V. Gaborieau (Valerie); P. Brennan (Paul); J.D. McKay (James); S. Slager (Susan); A.E. Toland (Amanda); C.B. Ambrosone (Christine); D. Yannoukakos (Drakoulis); M. Kabisch (Maria); D. Torres (Diana); S.L. Neuhausen (Susan); H. Anton-Culver (Hoda); C. Luccarini (Craig); C. Baynes (Caroline); S. Ahmed (Shahana); S. Healey (Sue); D.C. Tessier (Daniel C.); D. Vincent (Daniel); F. Bacot (Francois); G. Pita (Guillermo); M.R. Alonso (Rosario); N. Álvarez (Nuria); D. Herrero (Daniel); J. Simard (Jacques); P.P.D.P. Pharoah (Paul P.D.P.); P. Kraft (Peter); A.M. Dunning (Alison); G. Chenevix-Trench (Georgia); P. Hall (Per); D.F. Easton (Douglas)

    2015-01-01

    textabstractGenome-wide association studies (GWAS) and large-scale replication studies have identified common variants in 79 loci associated with breast cancer, explaining ∼14% of the familial risk of the disease. To identify new susceptibility loci, we performed a meta-analysis of 11 GWAS,

  17. Genome-wide association study identifies a single major locus contributing to survival into old age; the APOE locus revisited

    DEFF Research Database (Denmark)

    Deelen, Joris; Beekman, Marian; Uh, Hae-Won

    2011-01-01

    By studying the loci which contribute to human longevity, we aim to identify mechanisms that contribute to healthy aging. To identify such loci, we performed a genome-wide association study (GWAS) comparing 403 unrelated nonagenarians from long-living families included in the Leiden Longevity Stu...

  18. Investigating Salmonella Eko from Various Sources in Nigeria by Whole Genome Sequencing to Identify the Source of Human Infections.

    Directory of Open Access Journals (Sweden)

    Pimlapas Leekitcharoenphon

    Full Text Available Twenty-six Salmonella enterica serovar Eko isolated from various sources in Nigeria were investigated by whole genome sequencing to identify the source of human infections. Diversity among the isolates was observed and camel and cattle were identified as the primary reservoirs and the most likely source of the human infections.

  19. Investigating Salmonella Eko from Various Sources in Nigeria by Whole Genome Sequencing to Identify the Source of Human Infections

    DEFF Research Database (Denmark)

    Leekitcharoenphon, Pimlapas; Raufu, Ibrahim; Thorup Nielsen, Mette

    2016-01-01

    Twenty-six Salmonella enterica serovar Eko isolated from various sources in Nigeria were investigated by whole genome sequencing to identify the source of human infections. Diversity among the isolates was observed and camel and cattle were identified as the primary reservoirs and the most likely...

  20. Genome-wide association analysis of more than 120,000 individuals identifies 15 new susceptibility loci for breast cancer

    DEFF Research Database (Denmark)

    Michailidou, Kyriaki; Beesley, Jonathan; Lindstrom, Sara

    2015-01-01

    Genome-wide association studies (GWAS) and large-scale replication studies have identified common variants in 79 loci associated with breast cancer, explaining ∼14% of the familial risk of the disease. To identify new susceptibility loci, we performed a meta-analysis of 11 GWAS, comprising 15,748...

  1. A genome-wide association study of COPD identifies a susceptibility locus on chromosome 19q13

    DEFF Research Database (Denmark)

    Cho, Michael H; Castaldi, Peter J; Wan, Emily S

    2012-01-01

    The genetic risk factors for chronic obstructive pulmonary disease (COPD) are still largely unknown. To date, genome-wide association studies (GWASs) of limited size have identified several novel risk loci for COPD at CHRNA3/CHRNA5/IREB2, HHIP and FAM13A; additional loci may be identified through...

  2. Evaluating genome-wide association study-identified breast cancer risk variants in African-American women.

    Directory of Open Access Journals (Sweden)

    Jirong Long

    Full Text Available Genome-wide association studies (GWAS, conducted mostly in European or Asian descendants, have identified approximately 67 genetic susceptibility loci for breast cancer. Given the large differences in genetic architecture between the African-ancestry genome and genomes of Asians and Europeans, it is important to investigate these loci in African-ancestry populations. We evaluated index SNPs in all 67 breast cancer susceptibility loci identified to date in our study including up to 3,300 African-American women (1,231 cases and 2,069 controls, recruited in the Southern Community Cohort Study (SCCS and the Nashville Breast Health Study (NBHS. Seven SNPs were statistically significant (P ≤ 0.05 with the risk of overall breast cancer in the same direction as previously reported: rs10069690 (5p15/TERT, rs999737 (14q24/RAD51L1, rs13387042 (2q35/TNP1, rs1219648 (10q26/FGFR2, rs8170 (19p13/BABAM1, rs17817449 (16q12/FTO, and rs13329835 (16q23/DYL2. A marginally significant association (P<0.10 was found for three additional SNPs: rs1045485 (2q33/CASP8, rs4849887 (2q14/INHBB, and rs4808801 (19p13/ELL. Three additional SNPs, including rs1011970 (9p21/CDKN2A/2B, rs941764 (14q32/CCDC88C, and rs17529111 (6q14/FAM46A, showed a significant association in analyses conducted by breast cancer subtype. The risk of breast cancer was elevated with an increasing number of risk variants, as measured by quintile of the genetic risk score, from 1.00 (reference, to 1.75 (1.30-2.37, 1.56 (1.15-2.11, 2.02 (1.50-2.74 and 2.63 (1.96-3.52, respectively, (P = 7.8 × 10(-10. Results from this study highlight the need for large genetic studies in AAs to identify risk variants impacting this population.

  3. The First Endogenous Herpesvirus, Identified in the Tarsier Genome, and Novel Sequences from Primate Rhadinoviruses and Lymphocryptoviruses

    Science.gov (United States)

    Aswad, Amr; Katzourakis, Aris

    2014-01-01

    Herpesviridae is a diverse family of large and complex pathogens whose genomes are extremely difficult to sequence. This is particularly true for clinical samples, and if the virus, host, or both genomes are being sequenced for the first time. Although herpesviruses are known to occasionally integrate in host genomes, and can also be inherited in a Mendelian fashion, they are notably absent from the genomic fossil record comprised of endogenous viral elements (EVEs). Here, we combine paleovirological and metagenomic approaches to both explore the constituent viral diversity of mammalian genomes and search for endogenous herpesviruses. We describe the first endogenous herpesvirus from the genome of the Philippine tarsier, belonging to the Roseolovirus genus, and characterize its highly defective genome that is integrated and flanked by unambiguous host DNA. From a draft assembly of the aye-aye genome, we use bioinformatic tools to reveal over 100,000 bp of a novel rhadinovirus that is the first lemur gammaherpesvirus, closely related to Kaposi's sarcoma-associated virus. We also identify 58 genes of Pan paniscus lymphocryptovirus 1, the bonobo equivalent of human Epstein-Barr virus. For each of the viruses, we postulate gene function via comparative analysis to known viral relatives. Most notably, the evidence from gene content and phylogenetics suggests that the aye-aye sequences represent the most basal known rhadinovirus, and indicates that tumorigenic herpesviruses have been infecting primates since their emergence in the late Cretaceous. Overall, these data show that a genomic fossil record of herpesviruses exists despite their extremely large genomes, and expands the known diversity of Herpesviridae, which will aid the characterization of pathogenesis. Our analytical approach illustrates the benefit of intersecting evolutionary approaches with metagenomics, genetics and paleovirology. PMID:24945689

  4. Genome-wide profiling of HPV integration in cervical cancer identifies clustered genomic hot spots and a potential microhomology-mediated integration mechanism

    DEFF Research Database (Denmark)

    Hu, Zheng; Zhu, Da; Wang, Wei

    2015-01-01

    Human papillomavirus (HPV) integration is a key genetic event in cervical carcinogenesis1. By conducting whole-genome sequencing and high-throughput viral integration detection, we identified 3,667 HPV integration breakpoints in 26 cervical intraepithelial neoplasias, 104 cervical carcinomas and ...

  5. Statistical Analyses of Scatterplots to Identify Important Factors in Large-Scale Simulations

    Energy Technology Data Exchange (ETDEWEB)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-04-01

    The robustness of procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses is investigated. These procedures are based on attempts to detect increasingly complex patterns in the scatterplots under consideration and involve the identification of (1) linear relationships with correlation coefficients, (2) monotonic relationships with rank correlation coefficients, (3) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (4) trends in variability as defined by variances and interquartile ranges, and (5) deviations from randomness as defined by the chi-square statistic. The following two topics related to the robustness of these procedures are considered for a sequence of example analyses with a large model for two-phase fluid flow: the presence of Type I and Type II errors, and the stability of results obtained with independent Latin hypercube samples. Observations from analysis include: (1) Type I errors are unavoidable, (2) Type II errors can occur when inappropriate analysis procedures are used, (3) physical explanations should always be sought for why statistical procedures identify variables as being important, and (4) the identification of important variables tends to be stable for independent Latin hypercube samples.

  6. Genome-Wide Search Identifies 1.9 Mb from the Polar Bear Y Chromosome for Evolutionary Analyses.

    Science.gov (United States)

    Bidon, Tobias; Schreck, Nancy; Hailer, Frank; Nilsson, Maria A; Janke, Axel

    2015-05-27

    The male-inherited Y chromosome is the major haploid fraction of the mammalian genome, rendering Y-linked sequences an indispensable resource for evolutionary research. However, despite recent large-scale genome sequencing approaches, only a handful of Y chromosome sequences have been characterized to date, mainly in model organisms. Using polar bear (Ursus maritimus) genomes, we compare two different in silico approaches to identify Y-linked sequences: 1) Similarity to known Y-linked genes and 2) difference in the average read depth of autosomal versus sex chromosomal scaffolds. Specifically, we mapped available genomic sequencing short reads from a male and a female polar bear against the reference genome and identify 112 Y-chromosomal scaffolds with a combined length of 1.9 Mb. We verified the in silico findings for the longer polar bear scaffolds by male-specific in vitro amplification, demonstrating the reliability of the average read depth approach. The obtained Y chromosome sequences contain protein-coding sequences, single nucleotide polymorphisms, microsatellites, and transposable elements that are useful for evolutionary studies. A high-resolution phylogeny of the polar bear patriline shows two highly divergent Y chromosome lineages, obtained from analysis of the identified Y scaffolds in 12 previously published male polar bear genomes. Moreover, we find evidence of gene conversion among ZFX and ZFY sequences in the giant panda lineage and in the ancestor of ursine and tremarctine bears. Thus, the identification of Y-linked scaffold sequences from unordered genome sequences yields valuable data to infer phylogenomic and population-genomic patterns in bears. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  7. Genome-Wide Search Identifies 1.9 Mb from the Polar Bear Y Chromosome for Evolutionary Analyses

    Science.gov (United States)

    Bidon, Tobias; Schreck, Nancy; Hailer, Frank; Nilsson, Maria A.; Janke, Axel

    2015-01-01

    The male-inherited Y chromosome is the major haploid fraction of the mammalian genome, rendering Y-linked sequences an indispensable resource for evolutionary research. However, despite recent large-scale genome sequencing approaches, only a handful of Y chromosome sequences have been characterized to date, mainly in model organisms. Using polar bear (Ursus maritimus) genomes, we compare two different in silico approaches to identify Y-linked sequences: 1) Similarity to known Y-linked genes and 2) difference in the average read depth of autosomal versus sex chromosomal scaffolds. Specifically, we mapped available genomic sequencing short reads from a male and a female polar bear against the reference genome and identify 112 Y-chromosomal scaffolds with a combined length of 1.9 Mb. We verified the in silico findings for the longer polar bear scaffolds by male-specific in vitro amplification, demonstrating the reliability of the average read depth approach. The obtained Y chromosome sequences contain protein-coding sequences, single nucleotide polymorphisms, microsatellites, and transposable elements that are useful for evolutionary studies. A high-resolution phylogeny of the polar bear patriline shows two highly divergent Y chromosome lineages, obtained from analysis of the identified Y scaffolds in 12 previously published male polar bear genomes. Moreover, we find evidence of gene conversion among ZFX and ZFY sequences in the giant panda lineage and in the ancestor of ursine and tremarctine bears. Thus, the identification of Y-linked scaffold sequences from unordered genome sequences yields valuable data to infer phylogenomic and population-genomic patterns in bears. PMID:26019166

  8. A genome-wide association scan in pig identifies novel regions associated with feed efficiency trait

    DEFF Research Database (Denmark)

    Sahana, Goutam; Kadlecová, Veronika; Hornshøj, Henrik

    2013-01-01

    Feed conversion ratio (FCR) is an economically important trait in pigs and feed accounts for a significant proportion of the costs involved in pig production. In this study we used a high density SNP chip panel, Porcine SNP60 BeadChip, to identify association between FCR and SNP markers and to st...

  9. Genome-wide association study identifies a novel canine glaucoma locus.

    Directory of Open Access Journals (Sweden)

    Saija J Ahonen

    Full Text Available Glaucoma is an optic neuropathy and one of the leading causes of blindness. Its hereditary forms are classified into primary closed-angle (PCAG, primary open-angle (POAG and primary congenital glaucoma (PCG. Although many loci have been mapped in human, only a few genes have been identified that are associated with the development of glaucoma and the genetic basis of the disease remains poorly understood. Glaucoma has also been described in many dog breeds, including Dandie Dinmont Terriers (DDT in which it is a late-onset (>7 years disease. We designed clinical and genetic studies to better define the clinical features of glaucoma in the DDT and to identify the genetic cause. Clinical diagnosis was based on ophthalmic examinations of the affected dogs and 18 additionally investigated unaffected DDTs. We collected DNA from over 400 DTTs and a genome wide association study was performed in a cohort of 23 affected and 23 controls, followed by a fine mapping, a replication study and candidate gene sequencing. The clinical study suggested that ocular abnormalities including abnormal iridocorneal angles and pectinate ligament dysplasia are common (50% and 72%, respectively in the breed and the disease resembles human PCAG. The genetic study identified a novel 9.5 Mb locus on canine chromosome 8 including the 1.6 Mb best associated region (p = 1.63 × 10(-10, OR = 32 for homozygosity. Mutation screening in five candidate genes did not reveal any causative variants. This study indicates that although ocular abnormalities are common in DDTs, the genetic risk for glaucoma is conferred by a novel locus on CFA8. The canine locus shares synteny to a region in human chromosome 14q, which harbors several loci associated with POAG and PCG. Our study reveals a new locus for canine glaucoma and ongoing molecular studies will likely help to understand the genetic etiology of the disease.

  10. Analysis of genomic aberrations and gene expression profiling identifies novel lesions and pathways in myeloproliferative neoplasms

    International Nuclear Information System (INIS)

    Rice, K L; Lin, X; Wolniak, K; Ebert, B L; Berkofsky-Fessler, W; Buzzai, M; Sun, Y; Xi, C; Elkin, P; Levine, R; Golub, T; Gilliland, D G; Crispino, J D; Licht, J D; Zhang, W

    2011-01-01

    Polycythemia vera (PV), essential thrombocythemia and primary myelofibrosis, are myeloproliferative neoplasms (MPNs) with distinct clinical features and are associated with the JAK2V617F mutation. To identify genomic anomalies involved in the pathogenesis of these disorders, we profiled 87 MPN patients using Affymetrix 250K single-nucleotide polymorphism (SNP) arrays. Aberrations affecting chr9 were the most frequently observed and included 9pLOH (n=16), trisomy 9 (n=6) and amplifications of 9p13.3–23.3 (n=1), 9q33.1–34.13 (n=1) and 9q34.13 (n=6). Patients with trisomy 9 were associated with elevated JAK2V617F mutant allele burden, suggesting that gain of chr9 represents an alternative mechanism for increasing JAK2V617F dosage. Gene expression profiling of patients with and without chr9 abnormalities (+9, 9pLOH), identified genes potentially involved in disease pathogenesis including JAK2, STAT5B and MAPK14. We also observed recurrent gains of 1p36.31–36.33 (n=6), 17q21.2–q21.31 (n=5) and 17q25.1–25.3 (n=5) and deletions affecting 18p11.31–11.32 (n=8). Combined SNP and gene expression analysis identified aberrations affecting components of a non-canonical PRC2 complex (EZH1, SUZ12 and JARID2) and genes comprising a ‘HSC signature' (MLLT3, SMARCA2 and PBX1). We show that NFIB, which is amplified in 7/87 MPN patients and upregulated in PV CD34+ cells, protects cells from apoptosis induced by cytokine withdrawal

  11. Comparative Genomics and Transcriptional Analysis of Prophages Identified in the Genomes of Lactobacillus gasseri, Lactobacillus salivarius, and Lactobacillus casei†

    Science.gov (United States)

    Ventura, Marco; Canchaya, Carlos; Bernini, Valentina; Altermann, Eric; Barrangou, Rodolphe; McGrath, Stephen; Claesson, Marcus J.; Li, Yin; Leahy, Sinead; Walker, Carey D.; Zink, Ralf; Neviani, Erasmo; Steele, Jim; Broadbent, Jeff; Klaenhammer, Todd R.; Fitzgerald, Gerald F.; O'Toole, Paul W.; van Sinderen, Douwe

    2006-01-01

    Lactobacillus gasseri ATCC 33323, Lactobacillus salivarius subsp. salivarius UCC 118, and Lactobacillus casei ATCC 334 contain one (LgaI), four (Sal1, Sal2, Sal3, Sal4), and one (Lca1) distinguishable prophage sequences, respectively. Sequence analysis revealed that LgaI, Lca1, Sal1, and Sal2 prophages belong to the group of Sfi11-like pac site and cos site Siphoviridae, respectively. Phylogenetic investigation of these newly described prophage sequences revealed that they have not followed an evolutionary development similar to that of their bacterial hosts and that they show a high degree of diversity, even within a species. The attachment sites were determined for all these prophage elements; LgaI as well as Sal1 integrates in tRNA genes, while prophage Sal2 integrates in a predicted arginino-succinate lyase-encoding gene. In contrast, Lca1 and the Sal3 and Sal4 prophage remnants are integrated in noncoding regions in the L. casei ATCC 334 and L. salivarius UCC 118 genomes. Northern analysis showed that large parts of the prophage genomes are transcriptionally silent and that transcription is limited to genome segments located near the attachment site. Finally, pulsed-field gel electrophoresis followed by Southern blot hybridization with specific prophage probes indicates that these prophage sequences are narrowly distributed within lactobacilli. PMID:16672450

  12. Virulence-Associated Genome Mutations of Murine Rotavirus Identified by Alternating Serial Passages in Mice and Cell Cultures

    Science.gov (United States)

    Tatsumi, Masatoshi; Tsutsumi, Hiroyuki

    2014-01-01

    ABSTRACT Although significant clinical efficacy and safety of rotavirus vaccines were recently revealed in many countries, the mechanism of their attenuation is not well understood. We passaged serially a cell culture-adapted murine rotavirus EB strain in mouse pups or in cell cultures alternately and repeatedly and fully sequenced all 11 genes of 21 virus samples passaged in mice or in cell cultures. Sequence analysis revealed that mouse-passaged viruses that regained virulence almost consistently acquired four kinds of amino acid (aa) substitutions in VP4 and substitution in aa 37 (Val to Ala) in NSP4. In addition, they gained and invariably conserved the 3′ consensus sequence in NSP1. The molecular changes occurred along with the acquisition of virulence during passages in mice and then disappeared following passages in cell cultures. Intraperitoneal injection of recombinant NSP4 proteins confirmed the aa 37 site as important for its diarrheagenic activity in mice. These genome changes are likely to be correlated with rotavirus virulence. IMPORTANCE Serial passage of a virulent wild-type virus in vitro often results in loss of virulence of the virus in an original animal host, while serial passage of a cell culture-adapted avirulent virus in vivo often gains virulence in an animal host. Actually, live attenuated virus vaccines were originally produced by serial passage in cell cultures. Although clinical efficacy and safety of rotavirus vaccines were recently revealed, the mechanism of their attenuation is not well understood. We passaged serially a murine rotavirus by alternating switch of host (mice or cell cultures) repeatedly and sequenced the eleven genes of the passaged viruses to identify mutations associated with the emergence or disappearance of virulence. Sequence analysis revealed that changes in three genes (VP4, NSP1, and NSP4) were associated with virulence in mice. Intraperitoneal injection of recombinant NSP4 proteins confirmed its

  13. TSSer: an automated method to identify transcription start sites in prokaryotic genomes from differential RNA sequencing data.

    Science.gov (United States)

    Jorjani, Hadi; Zavolan, Mihaela

    2014-04-01

    Accurate identification of transcription start sites (TSSs) is an essential step in the analysis of transcription regulatory networks. In higher eukaryotes, the capped analysis of gene expression technology enabled comprehensive annotation of TSSs in genomes such as those of mice and humans. In bacteria, an equivalent approach, termed differential RNA sequencing (dRNA-seq), has recently been proposed, but the application of this approach to a large number of genomes is hindered by the paucity of computational analysis methods. With few exceptions, when the method has been used, annotation of TSSs has been largely done manually. In this work, we present a computational method called 'TSSer' that enables the automatic inference of TSSs from dRNA-seq data. The method rests on a probabilistic framework for identifying both genomic positions that are preferentially enriched in the dRNA-seq data as well as preferentially captured relative to neighboring genomic regions. Evaluating our approach for TSS calling on several publicly available datasets, we find that TSSer achieves high consistency with the curated lists of annotated TSSs, but identifies many additional TSSs. Therefore, TSSer can accelerate genome-wide identification of TSSs in bacterial genomes and can aid in further characterization of bacterial transcription regulatory networks. TSSer is freely available under GPL license at http://www.clipz.unibas.ch/TSSer/index.php

  14. Comparative genomics reveals high biological diversity and specific adaptations in the industrially and medically important fungal genus Aspergillus

    DEFF Research Database (Denmark)

    de Vries, Ronald P.; Riley, Robert; Wiebenga, Ad

    2017-01-01

    Background:  The fungal genus Aspergillus is of critical importance to humankind. Species include those with industrial applications, important pathogens of humans, animals and crops, a source of potent carcinogenic contaminants of food, and an important genetic model. The genome sequences of eig...

  15. Genome-wide association study of classical Hodgkin lymphoma identifies key regulators of disease susceptibility

    DEFF Research Database (Denmark)

    Sud, Amit; Thomsen, Hauke; Law, Philip J.

    2017-01-01

    Several susceptibility loci for classical Hodgkin lymphoma have been reported. However, much of the heritable risk is unknown. Here, we perform a meta-analysis of two existing genome-wide association studies, a new genome-wide association study, and replication totalling 5,314 cases and 16,749 co...

  16. Genome-wide association study of classical Hodgkin lymphoma identifies key regulators of disease susceptibility

    NARCIS (Netherlands)

    Sud, A. (Amit); Thomsen, H. (Hauke); Law, P.J. (Philip J.); A. Försti (Asta); Filho, M.I.D.S. (Miguel Inacio Da Silva); Holroyd, A. (Amy); P. Broderick (Peter); Orlando, G. (Giulia); Lenive, O. (Oleg); Wright, L. (Lauren); R. Cooke (Rosie); D.F. Easton (Douglas); P.D.P. Pharoah (Paul); A.M. Dunning (Alison); J. Peto (Julian); F. Canzian (Federico); Eeles, R. (Rosalind); Z. Kote-Jarai; K.R. Muir (K.); Pashayan, N. (Nora); B.E. Henderson (Brian); C.A. Haiman (Christopher); S. Benlloch (Sara); F.R. Schumacher (Fredrick R); Olama, A.A.A. (Ali Amin Al); S.I. Berndt (Sonja); G. Conti (Giario); F. Wiklund (Fredrik); S.J. Chanock (Stephen); Stevens, V.L. (Victoria L.); C.M. Tangen (Catherine M.); Batra, J. (Jyotsna); Clements, J. (Judith); H. Grönberg (Henrik); Schleutker, J. (Johanna); D. Albanes (Demetrius); Weinstein, S. (Stephanie); K. Wolk (Kerstin); West, C. (Catharine); Mucci, L. (Lorelei); Cancel-Tassin, G. (Géraldine); Koutros, S. (Stella); Sorensen, K.D. (Karina Dalsgaard); L. Maehle; D. Neal (David); S.P.L. Travis (Simon); Hamilton, R.J. (Robert J.); S.A. Ingles (Sue); B.S. Rosenstein (Barry S.); Lu, Y.-J. (Yong-Jie); Giles, G.G. (Graham G.); A. Kibel (Adam); Vega, A. (Ana); M. Kogevinas (Manolis); Penney, K.L. (Kathryn L.); Park, J.Y. (Jong Y.); Stanford, J.L. (Janet L.); C. Cybulski (Cezary); B.G. Nordestgaard (Børge); Brenner, H. (Hermann); Maier, C. (Christiane); Kim, J. (Jeri); E.M. John (Esther); P.J. Teixeira; Neuhausen, S.L. (Susan L.); De Ruyck, K. (Kim); Razack, A. (Azad); Newcomb, L.F. (Lisa F.); Lessel, D. (Davor); Kaneva, R. (Radka); N. Usmani (Nawaid); F. Claessens; Townsend, P.A. (Paul A.); Dominguez, M.G. (Manuela Gago); Roobol, M.J. (Monique J.); F. Menegaux (Florence); P. Hoffmann (Per); M.M. Nöthen (Markus); K.-H. JöCkel (Karl-Heinz); Strandmann, E.P.V. (Elke Pogge Von); Lightfoot, T. (Tracy); Kane, E. (Eleanor); Roman, E. (Eve); Lake, A. (Annette); Montgomery, D. (Dorothy); Jarrett, R.F. (Ruth F.); A.J. Swerdlow (Anthony ); A. Engert (Andreas); N. Orr (Nick); K. Hemminki (Kari); Houlston, R.S. (Richard S.)

    2017-01-01

    textabstractSeveral susceptibility loci for classical Hodgkin lymphoma have been reported. However, much of the heritable risk is unknown. Here, we perform a meta-analysis of two existing genome-wide association studies, a new genome-wide association study, and replication totalling 5,314 cases and

  17. Whole-genome sequencing and comprehensive molecular profiling identify new driver mutations in gastric cancer

    NARCIS (Netherlands)

    Wang, Kai; Yuen, Siu Tsan; Xu, Jiangchun; Lee, Siu Po; Yan, Helen H N; Shi, Stephanie T; Siu, Hoi Cheong; Deng, Shibing; Chu, Kent Man; Law, Simon; Chan, Kok Hoe; Chan, Annie S Y; Tsui, Wai Yin; Ho, Siu Lun; Chan, Anthony K W; Man, Jonathan L K; Foglizzo, Valentina; Ng, Man Kin; Chan, April S; Ching, Yick Pang; Cheng, Grace H W; Xie, Tao; Fernandez, Julio; Li, Vivian S W; Clevers, Hans; Rejto, Paul A; Mao, Mao; Leung, Suet Yi

    Gastric cancer is a heterogeneous disease with diverse molecular and histological subtypes. We performed whole-genome sequencing in 100 tumor-normal pairs, along with DNA copy number, gene expression and methylation profiling, for integrative genomic analysis. We found subtype-specific genetic and

  18. Genome-wide meta-analysis identifies five new susceptibility loci for pancreatic cancer.

    Science.gov (United States)

    Klein, Alison P; Wolpin, Brian M; Risch, Harvey A; Stolzenberg-Solomon, Rachael Z; Mocci, Evelina; Zhang, Mingfeng; Canzian, Federico; Childs, Erica J; Hoskins, Jason W; Jermusyk, Ashley; Zhong, Jun; Chen, Fei; Albanes, Demetrius; Andreotti, Gabriella; Arslan, Alan A; Babic, Ana; Bamlet, William R; Beane-Freeman, Laura; Berndt, Sonja I; Blackford, Amanda; Borges, Michael; Borgida, Ayelet; Bracci, Paige M; Brais, Lauren; Brennan, Paul; Brenner, Hermann; Bueno-de-Mesquita, Bas; Buring, Julie; Campa, Daniele; Capurso, Gabriele; Cavestro, Giulia Martina; Chaffee, Kari G; Chung, Charles C; Cleary, Sean; Cotterchio, Michelle; Dijk, Frederike; Duell, Eric J; Foretova, Lenka; Fuchs, Charles; Funel, Niccola; Gallinger, Steven; M Gaziano, J Michael; Gazouli, Maria; Giles, Graham G; Giovannucci, Edward; Goggins, Michael; Goodman, Gary E; Goodman, Phyllis J; Hackert, Thilo; Haiman, Christopher; Hartge, Patricia; Hasan, Manal; Hegyi, Peter; Helzlsouer, Kathy J; Herman, Joseph; Holcatova, Ivana; Holly, Elizabeth A; Hoover, Robert; Hung, Rayjean J; Jacobs, Eric J; Jamroziak, Krzysztof; Janout, Vladimir; Kaaks, Rudolf; Khaw, Kay-Tee; Klein, Eric A; Kogevinas, Manolis; Kooperberg, Charles; Kulke, Matthew H; Kupcinskas, Juozas; Kurtz, Robert J; Laheru, Daniel; Landi, Stefano; Lawlor, Rita T; Lee, I-Min; LeMarchand, Loic; Lu, Lingeng; Malats, Núria; Mambrini, Andrea; Mannisto, Satu; Milne, Roger L; Mohelníková-Duchoňová, Beatrice; Neale, Rachel E; Neoptolemos, John P; Oberg, Ann L; Olson, Sara H; Orlow, Irene; Pasquali, Claudio; Patel, Alpa V; Peters, Ulrike; Pezzilli, Raffaele; Porta, Miquel; Real, Francisco X; Rothman, Nathaniel; Scelo, Ghislaine; Sesso, Howard D; Severi, Gianluca; Shu, Xiao-Ou; Silverman, Debra; Smith, Jill P; Soucek, Pavel; Sund, Malin; Talar-Wojnarowska, Renata; Tavano, Francesca; Thornquist, Mark D; Tobias, Geoffrey S; Van Den Eeden, Stephen K; Vashist, Yogesh; Visvanathan, Kala; Vodicka, Pavel; Wactawski-Wende, Jean; Wang, Zhaoming; Wentzensen, Nicolas; White, Emily; Yu, Herbert; Yu, Kai; Zeleniuch-Jacquotte, Anne; Zheng, Wei; Kraft, Peter; Li, Donghui; Chanock, Stephen; Obazee, Ofure; Petersen, Gloria M; Amundadottir, Laufey T

    2018-02-08

    In 2020, 146,063 deaths due to pancreatic cancer are estimated to occur in Europe and the United States combined. To identify common susceptibility alleles, we performed the largest pancreatic cancer GWAS to date, including 9040 patients and 12,496 controls of European ancestry from the Pancreatic Cancer Cohort Consortium (PanScan) and the Pancreatic Cancer Case-Control Consortium (PanC4). Here, we find significant evidence of a novel association at rs78417682 (7p12/TNS3, P = 4.35 × 10 -8 ). Replication of 10 promising signals in up to 2737 patients and 4752 controls from the PANcreatic Disease ReseArch (PANDoRA) consortium yields new genome-wide significant loci: rs13303010 at 1p36.33 (NOC2L, P = 8.36 × 10 -14 ), rs2941471 at 8q21.11 (HNF4G, P = 6.60 × 10 -10 ), rs4795218 at 17q12 (HNF1B, P = 1.32 × 10 -8 ), and rs1517037 at 18q21.32 (GRP, P = 3.28 × 10 -8 ). rs78417682 is not statistically significantly associated with pancreatic cancer in PANDoRA. Expression quantitative trait locus analysis in three independent pancreatic data sets provides molecular support of NOC2L as a pancreatic cancer susceptibility gene.

  19. Genome-Wide Analysis to Identify HLA Factors Potentially Associated With Severe Dengue

    Directory of Open Access Journals (Sweden)

    Sudheer Gupta

    2018-04-01

    Full Text Available The pathogenesis of dengue hemorrhagic fever (DHF, following dengue virus (DENV infection, is a complex and poorly understood phenomenon. In view of the clinical need of identifying patients with higher likelihood of developing this severe outcome, we undertook a comparative genome-wide association analysis of epitope variants from sequences available in the ViPR database that have been reported to be differentially related to dengue fever and DHF. Having enumerated the incriminated epitope variants, we determined the corresponding HLA alleles in the context of which DENV infection could potentially precipitate DHF. Our analysis considered the development of DHF in three different perspectives: (a as a consequence of primary DENV infection, (b following secondary DENV infection with a heterologous serotype, (c as a result of DENV infection following infection with related flaviviruses like Zika virus, Japanese Encephalitis virus, West Nile virus, etc. Subject to experimental validation, these viral and host markers would be valuable in triaging DENV-infected patients for closer supervision owing to the relatively higher risk of poor prognostic outcome and also for the judicious allocation of scarce institutional resources during large outbreaks.

  20. Genome-wide association studies identify four ER negative–specific breast cancer risk loci

    Science.gov (United States)

    Garcia-Closas, Montserrat; Couch, Fergus J; Lindstrom, Sara; Michailidou, Kyriaki; Schmidt, Marjanka K; Brook, Mark N; orr, Nick; Rhie, Suhn Kyong; Riboli, Elio; Feigelson, Heather s; Le Marchand, Loic; Buring, Julie E; Eccles, Diana; Miron, Penelope; Fasching, Peter A; Brauch, Hiltrud; Chang-Claude, Jenny; Carpenter, Jane; Godwin, Andrew K; Nevanlinna, Heli; Giles, Graham G; Cox, Angela; Hopper, John L; Bolla, Manjeet K; Wang, Qin; Dennis, Joe; Dicks, Ed; Howat, Will J; Schoof, Nils; Bojesen, Stig E; Lambrechts, Diether; Broeks, Annegien; Andrulis, Irene L; Guénel, Pascal; Burwinkel, Barbara; Sawyer, Elinor J; Hollestelle, Antoinette; Fletcher, Olivia; Winqvist, Robert; Brenner, Hermann; Mannermaa, Arto; Hamann, Ute; Meindl, Alfons; Lindblom, Annika; Zheng, Wei; Devillee, Peter; Goldberg, Mark S; Lubinski, Jan; Kristensen, Vessela; Swerdlow, Anthony; Anton-Culver, Hoda; Dörk, Thilo; Muir, Kenneth; Matsuo, Keitaro; Wu, Anna H; Radice, Paolo; Teo, Soo Hwang; Shu, Xiao-Ou; Blot, William; Kang, Daehee; Hartman, Mikael; Sangrajrang, Suleeporn; Shen, Chen-Yang; Southey, Melissa C; Park, Daniel J; Hammet, Fleur; Stone, Jennifer; Veer, Laura J Van’t; Rutgers, Emiel J; Lophatananon, Artitaya; Stewart-Brown, Sarah; Siriwanarangsan, Pornthep; Peto, Julian; Schrauder, Michael G; Ekici, Arif B; Beckmann, Matthias W; Silva, Isabel dos Santos; Johnson, Nichola; Warren, Helen; Tomlinson, Ian; Kerin, Michael J; Miller, Nicola; Marme, Federick; Schneeweiss, Andreas; Sohn, Christof; Truong, Therese; Laurent-Puig, Pierre; Kerbrat, Pierre; Nordestgaard, Børge G; Nielsen, Sune F; Flyger, Henrik; Milne, Roger L; Perez, Jose Ignacio Arias; Menéndez, Primitiva; Müller, Heiko; Arndt, Volker; Stegmaier, Christa; Lichtner, Peter; Lochmann, Magdalena; Justenhoven, Christina; Ko, Yon-Dschun; Muranen, Taru A; Aittomäki, Kristiina; Blomqvist, Carl; Greco, Dario; Heikkinen, Tuomas; Ito, Hidemi; Iwata, Hiroji; Yatabe, Yasushi; Antonenkova, Natalia N; Margolin, Sara; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M; Balleine, Rosemary; Tseng, Chiu-Chen; Van Den Berg, David; Stram, Daniel O; Neven, Patrick; Dieudonné, Anne-Sophie; Leunen, Karin; Rudolph, Anja; Nickels, Stefan; Flesch-Janys, Dieter; Peterlongo, Paolo; Peissel, Bernard; Bernard, Loris; Olson, Janet E; Wang, Xianshu; Stevens, Kristen; Severi, Gianluca; Baglietto, Laura; Mclean, Catriona; Coetzee, Gerhard A; Feng, Ye; Henderson, Brian E; Schumacher, Fredrick; Bogdanova, Natalia V; Labrèche, France; Dumont, Martine; Yip, Cheng Har; Taib, Nur Aishah Mohd; Cheng, Ching-Yu; Shrubsole, Martha; Long, Jirong; Pylkäs, Katri; Jukkola-Vuorinen, Arja; Kauppila, Saila; knight, Julia A; Glendon, Gord; Mulligan, Anna Marie; Tollenaar, Robertus A E M; Seynaeve, Caroline M; Kriege, Mieke; Hooning, Maartje J; Van den Ouweland, Ans M W; Van Deurzen, Carolien H M; Lu, Wei; Gao, Yu-Tang; Cai, Hui; Balasubramanian, Sabapathy P; Cross, Simon S; Reed, Malcolm W R; Signorello, Lisa; Cai, Qiuyin; Shah, Mitul; Miao, Hui; Chan, Ching Wan; Chia, Kee Seng; Jakubowska, Anna; Jaworska, Katarzyna; Durda, Katarzyna; Hsiung, Chia-Ni; Wu, Pei-Ei; Yu, Jyh-Cherng; Ashworth, Alan; Jones, Michael; Tessier, Daniel C; González-Neira, Anna; Pita, Guillermo; Alonso, M Rosario; Vincent, Daniel; Bacot, Francois; Ambrosone, Christine B; Bandera, Elisa V; John, Esther M; Chen, Gary K; Hu, Jennifer J; Rodriguez-gil, Jorge L; Bernstein, Leslie; Press, Michael F; Ziegler, Regina G; Millikan, Robert M; Deming-Halverson, Sandra L; Nyante, Sarah; Ingles, Sue A; Waisfisz, Quinten; Tsimiklis, Helen; Makalic, Enes; Schmidt, Daniel; Bui, Minh; Gibson, Lorna; Müller-Myhsok, Bertram; Schmutzler, Rita K; Hein, Rebecca; Dahmen, Norbert; Beckmann, Lars; Aaltonen, Kirsimari; Czene, Kamila; Irwanto, Astrid; Liu, Jianjun; Turnbull, Clare; Rahman, Nazneen; Meijers-Heijboer, Hanne; Uitterlinden, Andre G; Rivadeneira, Fernando; Olswold, Curtis; Slager, Susan; Pilarski, Robert; Ademuyiwa, Foluso; Konstantopoulou, Irene; Martin, Nicholas G; Montgomery, Grant W; Slamon, Dennis J; Rauh, Claudia; Lux, Michael P; Jud, Sebastian M; Bruning, Thomas; Weaver, Joellen; Sharma, Priyanka; Pathak, Harsh; Tapper, Will; Gerty, Sue; Durcan, Lorraine; Trichopoulos, Dimitrios; Tumino, Rosario; Peeters, Petra H; Kaaks, Rudolf; Campa, Daniele; Canzian, Federico; Weiderpass, Elisabete; Johansson, Mattias; Khaw, Kay-Tee; Travis, Ruth; Clavel-Chapelon, Françoise; Kolonel, Laurence N; Chen, Constance; Beck, Andy; Hankinson, Susan E; Berg, Christine D; Hoover, Robert N; Lissowska, Jolanta; Figueroa, Jonine D; Chasman, Daniel I; Gaudet, Mia M; Diver, W Ryan; Willett, Walter C; Hunter, David J; Simard, Jacques; Benitez, Javier; Dunning, Alison M; Sherman, Mark E; Chenevix-Trench, Georgia; Chanock, Stephen J; Hall, Per; Pharoah, Paul D P; Vachon, Celine; Easton, Douglas F; Haiman, Christopher A; Kraft, Peter

    2013-01-01

    Estrogen receptor (ER)-negative tumors represent 20–30% of all breast cancers, with a higher proportion occurring in younger women and women of African ancestry1. The etiology2 and clinical behavior3 of ER-negative tumors are different from those of tumors expressing ER (ER positive), including differences in genetic predisposition4. To identify susceptibility loci specific to ER-negative disease, we combined in a meta-analysis 3 genome-wide association studies of 4,193 ER-negative breast cancer cases and 35,194 controls with a series of 40 follow-up studies (6,514 cases and 41,455 controls), genotyped using a custom Illumina array, iCOGS, developed by the Collaborative Oncological Gene-environment Study (COGS). SNPs at four loci, 1q32.1 (MDM4, P = 2.1 × 10−12 and LGR6, P = 1.4 × 10−8), 2p24.1 (P = 4.6 × 10−8) and 16q12.2 (FTO, P = 4.0 × 10−8), were associated with ER-negative but not ER-positive breast cancer (P > 0.05). These findings provide further evidence for distinct etiological pathways associated with invasive ER-positive and ER-negative breast cancers. PMID:23535733

  1. Genome-wide RNAi screening identifies genes inhibiting the migration of glioblastoma cells.

    Directory of Open Access Journals (Sweden)

    Jian Yang

    Full Text Available Glioblastoma Multiforme (GBM cells are highly invasive, infiltrating into the surrounding normal brain tissue, making it impossible to completely eradicate GBM tumors by surgery or radiation. Increasing evidence also shows that these migratory cells are highly resistant to cytotoxic reagents, but decreasing their migratory capability can re-sensitize them to chemotherapy. These evidences suggest that the migratory cell population may serve as a better therapeutic target for more effective treatment of GBM. In order to understand the regulatory mechanism underlying the motile phenotype, we carried out a genome-wide RNAi screen for genes inhibiting the migration of GBM cells. The screening identified a total of twenty-five primary hits; seven of them were confirmed by secondary screening. Further study showed that three of the genes, FLNA, KHSRP and HCFC1, also functioned in vivo, and knocking them down caused multifocal tumor in a mouse model. Interestingly, two genes, KHSRP and HCFC1, were also found to be correlated with the clinical outcome of GBM patients. These two genes have not been previously associated with cell migration.

  2. Nickel-resistance determinants in Acidiphilium sp. PM identified by genome-wide functional screening.

    Directory of Open Access Journals (Sweden)

    Patxi San Martin-Uriz

    Full Text Available Acidiphilium spp. are conspicuous dwellers of acidic, metal-rich environments. Indeed, they are among the most metal-resistant organisms; yet little is known about the mechanisms behind the metal tolerance in this genus. Acidiphilium sp. PM is an environmental isolate from Rio Tinto, an acidic, metal-laden river located in southwestern Spain. The characterization of its metal resistance revealed a remarkable ability to tolerate high Ni concentrations. Here we report the screening of a genomic library of Acidiphilium sp. PM to identify genes involved in Ni resistance. This approach revealed seven different genes conferring Ni resistance to E. coli, two of which form an operon encoding the ATP-dependent protease HslVU (ClpQY. This protease was found to enhance resistance to both Ni and Co in E. coli, a function not previously reported. Other Ni-resistance determinants include genes involved in lipopolysaccharide biosynthesis and the synthesis of branched amino acids. The diversity of molecular functions of the genes recovered in the screening suggests that Ni resistance in Acidiphilium sp. PM probably relies on different molecular mechanisms.

  3. Identifying all moiety conservation laws in genome-scale metabolic networks.

    Science.gov (United States)

    De Martino, Andrea; De Martino, Daniele; Mulet, Roberto; Pagnani, Andrea

    2014-01-01

    The stoichiometry of a metabolic network gives rise to a set of conservation laws for the aggregate level of specific pools of metabolites, which, on one hand, pose dynamical constraints that cross-link the variations of metabolite concentrations and, on the other, provide key insight into a cell's metabolic production capabilities. When the conserved quantity identifies with a chemical moiety, extracting all such conservation laws from the stoichiometry amounts to finding all non-negative integer solutions of a linear system, a programming problem known to be NP-hard. We present an efficient strategy to compute the complete set of integer conservation laws of a genome-scale stoichiometric matrix, also providing a certificate for correctness and maximality of the solution. Our method is deployed for the analysis of moiety conservation relationships in two large-scale reconstructions of the metabolism of the bacterium E. coli, in six tissue-specific human metabolic networks, and, finally, in the human reactome as a whole, revealing that bacterial metabolism could be evolutionarily designed to cover broader production spectra than human metabolism. Convergence to the full set of moiety conservation laws in each case is achieved in extremely reduced computing times. In addition, we uncover a scaling relation that links the size of the independent pool basis to the number of metabolites, for which we present an analytical explanation.

  4. Identifying all moiety conservation laws in genome-scale metabolic networks.

    Directory of Open Access Journals (Sweden)

    Andrea De Martino

    Full Text Available The stoichiometry of a metabolic network gives rise to a set of conservation laws for the aggregate level of specific pools of metabolites, which, on one hand, pose dynamical constraints that cross-link the variations of metabolite concentrations and, on the other, provide key insight into a cell's metabolic production capabilities. When the conserved quantity identifies with a chemical moiety, extracting all such conservation laws from the stoichiometry amounts to finding all non-negative integer solutions of a linear system, a programming problem known to be NP-hard. We present an efficient strategy to compute the complete set of integer conservation laws of a genome-scale stoichiometric matrix, also providing a certificate for correctness and maximality of the solution. Our method is deployed for the analysis of moiety conservation relationships in two large-scale reconstructions of the metabolism of the bacterium E. coli, in six tissue-specific human metabolic networks, and, finally, in the human reactome as a whole, revealing that bacterial metabolism could be evolutionarily designed to cover broader production spectra than human metabolism. Convergence to the full set of moiety conservation laws in each case is achieved in extremely reduced computing times. In addition, we uncover a scaling relation that links the size of the independent pool basis to the number of metabolites, for which we present an analytical explanation.

  5. Novel genetic loci underlying human intracranial volume identified through genome-wide association

    Science.gov (United States)

    Adams, Hieab HH; Hibar, Derrek P; Chouraki, Vincent; Stein, Jason L; Nyquist, Paul A; Rentería, Miguel E; Trompet, Stella; Arias-Vasquez, Alejandro; Seshadri, Sudha; Desrivières, Sylvane; Beecham, Ashley H; Jahanshad, Neda; Wittfeld, Katharina; Van der Lee, Sven J; Abramovic, Lucija; Alhusaini, Saud; Amin, Najaf; Andersson, Micael; Arfanakis, Konstantinos; Aribisala, Benjamin S; Armstrong, Nicola J; Athanasiu, Lavinia; Axelsson, Tomas; Beiser, Alexa; Bernard, Manon; Bis, Joshua C; Blanken, Laura ME; Blanton, Susan H; Bohlken, Marc M; Boks, Marco P; Bralten, Janita; Brickman, Adam M; Carmichael, Owen; Chakravarty, M Mallar; Chauhan, Ganesh; Chen, Qiang; Ching, Christopher RK; Cuellar-Partida, Gabriel; Den Braber, Anouk; Doan, Nhat Trung; Ehrlich, Stefan; Filippi, Irina; Ge, Tian; Giddaluru, Sudheer; Goldman, Aaron L; Gottesman, Rebecca F; Greven, Corina U; Grimm, Oliver; Griswold, Michael E; Guadalupe, Tulio; Hass, Johanna; Haukvik, Unn K; Hilal, Saima; Hofer, Edith; Hoehn, David; Holmes, Avram J; Hoogman, Martine; Janowitz, Deborah; Jia, Tianye; Kasperaviciute, Dalia; Kim, Sungeun; Klein, Marieke; Kraemer, Bernd; Lee, Phil H; Liao, Jiemin; Liewald, David CM; Lopez, Lorna M; Luciano, Michelle; Macare, Christine; Marquand, Andre; Matarin, Mar; Mather, Karen A; Mattheisen, Manuel; Mazoyer, Bernard; McKay, David R; McWhirter, Rebekah; Milaneschi, Yuri; Mirza-Schreiber, Nazanin; Muetzel, Ryan L; Maniega, Susana Muñoz; Nho, Kwangsik; Nugent, Allison C; Olde Loohuis, Loes M; Oosterlaan, Jaap; Papmeyer, Martina; Pappa, Irene; Pirpamer, Lukas; Pudas, Sara; Pütz, Benno; Rajan, Kumar B; Ramasamy, Adaikalavan; Richards, Jennifer S; Risacher, Shannon L; Roiz-Santiañez, Roberto; Rommelse, Nanda; Rose, Emma J; Royle, Natalie A; Rundek, Tatjana; Sämann, Philipp G; Satizabal, Claudia L; Schmaal, Lianne; Schork, Andrew J; Shen, Li; Shin, Jean; Shumskaya, Elena; Smith, Albert V; Sprooten, Emma; Strike, Lachlan T; Teumer, Alexander; Thomson, Russell; Tordesillas-Gutierrez, Diana; Toro, Roberto; Trabzuni, Daniah; Vaidya, Dhananjay; Van der Grond, Jeroen; Van der Meer, Dennis; Van Donkelaar, Marjolein MJ; Van Eijk, Kristel R; Van Erp, Theo GM; Van Rooij, Daan; Walton, Esther; Westlye, Lars T; Whelan, Christopher D; Windham, Beverly G; Winkler, Anderson M; Woldehawariat, Girma; Wolf, Christiane; Wolfers, Thomas; Xu, Bing; Yanek, Lisa R; Yang, Jingyun; Zijdenbos, Alex; Zwiers, Marcel P; Agartz, Ingrid; Aggarwal, Neelum T; Almasy, Laura; Ames, David; Amouyel, Philippe; Andreassen, Ole A; Arepalli, Sampath; Assareh, Amelia A; Barral, Sandra; Bastin, Mark E; Becker, Diane M; Becker, James T; Bennett, David A; Blangero, John; van Bokhoven, Hans; Boomsma, Dorret I; Brodaty, Henry; Brouwer, Rachel M; Brunner, Han G; Buckner, Randy L; Buitelaar, Jan K; Bulayeva, Kazima B; Cahn, Wiepke; Calhoun, Vince D; Cannon, Dara M; Cavalleri, Gianpiero L; Chen, Christopher; Cheng, Ching-Yu; Cichon, Sven; Cookson, Mark R; Corvin, Aiden; Crespo-Facorro, Benedicto; Curran, Joanne E; Czisch, Michael; Dale, Anders M; Davies, Gareth E; De Geus, Eco JC; De Jager, Philip L; de Zubicaray, Greig I; Delanty, Norman; Depondt, Chantal; DeStefano, Anita L; Dillman, Allissa; Djurovic, Srdjan; Donohoe, Gary; Drevets, Wayne C; Duggirala, Ravi; Dyer, Thomas D; Erk, Susanne; Espeseth, Thomas; Evans, Denis A; Fedko, Iryna O; Fernández, Guillén; Ferrucci, Luigi; Fisher, Simon E; Fleischman, Debra A; Ford, Ian; Foroud, Tatiana M; Fox, Peter T; Francks, Clyde; Fukunaga, Masaki; Gibbs, J Raphael; Glahn, David C; Gollub, Randy L; Göring, Harald HH; Grabe, Hans J; Green, Robert C; Gruber, Oliver; Gudnason, Vilmundur; Guelfi, Sebastian; Hansell, Narelle K; Hardy, John; Hartman, Catharina A; Hashimoto, Ryota; Hegenscheid, Katrin; Heinz, Andreas; Le Hellard, Stephanie; Hernandez, Dena G; Heslenfeld, Dirk J; Ho, Beng-Choon; Hoekstra, Pieter J; Hoffmann, Wolfgang; Hofman, Albert; Holsboer, Florian; Homuth, Georg; Hosten, Norbert; Hottenga, Jouke-Jan; Hulshoff Pol, Hilleke E; Ikeda, Masashi; Ikram, M Kamran; Jack, Clifford R; Jenkinson, Mark; Johnson, Robert; Jönsson, Erik G; Jukema, J Wouter; Kahn, René S; Kanai, Ryota; Kloszewska, Iwona; Knopman, David S; Kochunov, Peter; Kwok, John B; Lawrie, Stephen M; Lemaître, Hervé; Liu, Xinmin; Longo, Dan L; Longstreth, WT; Lopez, Oscar L; Lovestone, Simon; Martinez, Oliver; Martinot, Jean-Luc; Mattay, Venkata S; McDonald, Colm; McIntosh, Andrew M; McMahon, Katie L; McMahon, Francis J; Mecocci, Patrizia; Melle, Ingrid; Meyer-Lindenberg, Andreas; Mohnke, Sebastian; Montgomery, Grant W; Morris, Derek W; Mosley, Thomas H; Mühleisen, Thomas W; Müller-Myhsok, Bertram; Nalls, Michael A; Nauck, Matthias; Nichols, Thomas E; Niessen, Wiro J; Nöthen, Markus M; Nyberg, Lars; Ohi, Kazutaka; Olvera, Rene L; Ophoff, Roel A; Pandolfo, Massimo; Paus, Tomas; Pausova, Zdenka; Penninx, Brenda WJH; Pike, G Bruce; Potkin, Steven G; Psaty, Bruce M; Reppermund, Simone; Rietschel, Marcella; Roffman, Joshua L; Romanczuk-Seiferth, Nina; Rotter, Jerome I; Ryten, Mina; Sacco, Ralph L; Sachdev, Perminder S; Saykin, Andrew J; Schmidt, Reinhold; Schofield, Peter R; Sigurdsson, Sigurdur; Simmons, Andy; Singleton, Andrew; Sisodiya, Sanjay M; Smith, Colin; Smoller, Jordan W; Soininen, Hilkka; Srikanth, Velandai; Steen, Vidar M; Stott, David J; Sussmann, Jessika E; Thalamuthu, Anbupalam; Tiemeier, Henning; Toga, Arthur W; Traynor, Bryan J; Troncoso, Juan; Turner, Jessica A; Tzourio, Christophe; Uitterlinden, Andre G; Valdés Hernández, Maria C; Van der Brug, Marcel; Van der Lugt, Aad; Van der Wee, Nic JA; Van Duijn, Cornelia M; Van Haren, Neeltje EM; Van 't Ent, Dennis; Van Tol, Marie-Jose; Vardarajan, Badri N; Veltman, Dick J; Vernooij, Meike W; Völzke, Henry; Walter, Henrik; Wardlaw, Joanna M; Wassink, Thomas H; Weale, Michael E; Weinberger, Daniel R; Weiner, Michael W; Wen, Wei; Westman, Eric; White, Tonya; Wong, Tien Y; Wright, Clinton B; Zielke, H Ronald; Zonderman, Alan B; Deary, Ian J; DeCarli, Charles; Schmidt, Helena; Martin, Nicholas G; De Craen, Anton JM; Wright, Margaret J; Launer, Lenore J; Schumann, Gunter; Fornage, Myriam; Franke, Barbara; Debette, Stéphanie; Medland, Sarah E; Ikram, M Arfan; Thompson, Paul M

    2016-01-01

    Intracranial volume reflects the maximally attained brain size during development, and remains stable with loss of tissue in late life. It is highly heritable, but the underlying genes remain largely undetermined. In a genome-wide association study of 32,438 adults, we discovered five novel loci for intracranial volume and confirmed two known signals. Four of the loci are also associated with adult human stature, but these remained associated with intracranial volume after adjusting for height. We found a high genetic correlation with child head circumference (ρgenetic=0.748), which indicated a similar genetic background and allowed for the identification of four additional loci through meta-analysis (Ncombined = 37,345). Variants for intracranial volume were also related to childhood and adult cognitive function, Parkinson’s disease, and enriched near genes involved in growth pathways including PI3K–AKT signaling. These findings identify biological underpinnings of intracranial volume and provide genetic support for theories on brain reserve and brain overgrowth. PMID:27694991

  6. Genome-wide screen of Pseudomonas aeruginosa In Saccharomyces cerevisiae identifies new virulence factors

    Directory of Open Access Journals (Sweden)

    Rafat eZrieq

    2015-11-01

    Full Text Available Pseudomonas aeruginosa is a human opportunistic pathogen that causes mortality in cystic fibrosis and immunocompromised patients. While many virulence factors of this pathogen have already been identified, several remain to be discovered. In this respect we set an unprecedented genome-wide screen of a P. aeruginosa expression library based on a yeast growth phenotype. 51 candidates were selected in a three-round screening process. The robustness of the screen was validated by the selection of three well known secreted proteins including one demonstrated virulence factor, the protease LepA. Further in silico sorting of the 51 candidates highlighted three potential new Pseudomonas effector candidates (Pec. By testing the cytotoxicity of wild type P. aeruginosa vs pec mutants towards macrophages and the virulence in the Caenorhabditis elegans model, we demonstrated that the three selected Pecs are novel virulence factors of P. aeruginosa. Additional cellular localization experiments in the host revealed specific localization for Pec1 and Pec2 that could inform about their respective functions.

  7. Genome-wide association studies identify four ER negative-specific breast cancer risk loci.

    Science.gov (United States)

    Garcia-Closas, Montserrat; Couch, Fergus J; Lindstrom, Sara; Michailidou, Kyriaki; Schmidt, Marjanka K; Brook, Mark N; Orr, Nick; Rhie, Suhn Kyong; Riboli, Elio; Feigelson, Heather S; Le Marchand, Loic; Buring, Julie E; Eccles, Diana; Miron, Penelope; Fasching, Peter A; Brauch, Hiltrud; Chang-Claude, Jenny; Carpenter, Jane; Godwin, Andrew K; Nevanlinna, Heli; Giles, Graham G; Cox, Angela; Hopper, John L; Bolla, Manjeet K; Wang, Qin; Dennis, Joe; Dicks, Ed; Howat, Will J; Schoof, Nils; Bojesen, Stig E; Lambrechts, Diether; Broeks, Annegien; Andrulis, Irene L; Guénel, Pascal; Burwinkel, Barbara; Sawyer, Elinor J; Hollestelle, Antoinette; Fletcher, Olivia; Winqvist, Robert; Brenner, Hermann; Mannermaa, Arto; Hamann, Ute; Meindl, Alfons; Lindblom, Annika; Zheng, Wei; Devillee, Peter; Goldberg, Mark S; Lubinski, Jan; Kristensen, Vessela; Swerdlow, Anthony; Anton-Culver, Hoda; Dörk, Thilo; Muir, Kenneth; Matsuo, Keitaro; Wu, Anna H; Radice, Paolo; Teo, Soo Hwang; Shu, Xiao-Ou; Blot, William; Kang, Daehee; Hartman, Mikael; Sangrajrang, Suleeporn; Shen, Chen-Yang; Southey, Melissa C; Park, Daniel J; Hammet, Fleur; Stone, Jennifer; Veer, Laura J Van't; Rutgers, Emiel J; Lophatananon, Artitaya; Stewart-Brown, Sarah; Siriwanarangsan, Pornthep; Peto, Julian; Schrauder, Michael G; Ekici, Arif B; Beckmann, Matthias W; Dos Santos Silva, Isabel; Johnson, Nichola; Warren, Helen; Tomlinson, Ian; Kerin, Michael J; Miller, Nicola; Marme, Federick; Schneeweiss, Andreas; Sohn, Christof; Truong, Therese; Laurent-Puig, Pierre; Kerbrat, Pierre; Nordestgaard, Børge G; Nielsen, Sune F; Flyger, Henrik; Milne, Roger L; Perez, Jose Ignacio Arias; Menéndez, Primitiva; Müller, Heiko; Arndt, Volker; Stegmaier, Christa; Lichtner, Peter; Lochmann, Magdalena; Justenhoven, Christina; Ko, Yon-Dschun; Muranen, Taru A; Aittomäki, Kristiina; Blomqvist, Carl; Greco, Dario; Heikkinen, Tuomas; Ito, Hidemi; Iwata, Hiroji; Yatabe, Yasushi; Antonenkova, Natalia N; Margolin, Sara; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M; Balleine, Rosemary; Tseng, Chiu-Chen; Berg, David Van Den; Stram, Daniel O; Neven, Patrick; Dieudonné, Anne-Sophie; Leunen, Karin; Rudolph, Anja; Nickels, Stefan; Flesch-Janys, Dieter; Peterlongo, Paolo; Peissel, Bernard; Bernard, Loris; Olson, Janet E; Wang, Xianshu; Stevens, Kristen; Severi, Gianluca; Baglietto, Laura; McLean, Catriona; Coetzee, Gerhard A; Feng, Ye; Henderson, Brian E; Schumacher, Fredrick; Bogdanova, Natalia V; Labrèche, France; Dumont, Martine; Yip, Cheng Har; Taib, Nur Aishah Mohd; Cheng, Ching-Yu; Shrubsole, Martha; Long, Jirong; Pylkäs, Katri; Jukkola-Vuorinen, Arja; Kauppila, Saila; Knight, Julia A; Glendon, Gord; Mulligan, Anna Marie; Tollenaar, Robertus A E M; Seynaeve, Caroline M; Kriege, Mieke; Hooning, Maartje J; van den Ouweland, Ans M W; van Deurzen, Carolien H M; Lu, Wei; Gao, Yu-Tang; Cai, Hui; Balasubramanian, Sabapathy P; Cross, Simon S; Reed, Malcolm W R; Signorello, Lisa; Cai, Qiuyin; Shah, Mitul; Miao, Hui; Chan, Ching Wan; Chia, Kee Seng; Jakubowska, Anna; Jaworska, Katarzyna; Durda, Katarzyna; Hsiung, Chia-Ni; Wu, Pei-Ei; Yu, Jyh-Cherng; Ashworth, Alan; Jones, Michael; Tessier, Daniel C; González-Neira, Anna; Pita, Guillermo; Alonso, M Rosario; Vincent, Daniel; Bacot, Francois; Ambrosone, Christine B; Bandera, Elisa V; John, Esther M; Chen, Gary K; Hu, Jennifer J; Rodriguez-Gil, Jorge L; Bernstein, Leslie; Press, Michael F; Ziegler, Regina G; Millikan, Robert M; Deming-Halverson, Sandra L; Nyante, Sarah; Ingles, Sue A; Waisfisz, Quinten; Tsimiklis, Helen; Makalic, Enes; Schmidt, Daniel; Bui, Minh; Gibson, Lorna; Müller-Myhsok, Bertram; Schmutzler, Rita K; Hein, Rebecca; Dahmen, Norbert; Beckmann, Lars; Aaltonen, Kirsimari; Czene, Kamila; Irwanto, Astrid; Liu, Jianjun; Turnbull, Clare; Rahman, Nazneen; Meijers-Heijboer, Hanne; Uitterlinden, Andre G; Rivadeneira, Fernando; Olswold, Curtis; Slager, Susan; Pilarski, Robert; Ademuyiwa, Foluso; Konstantopoulou, Irene; Martin, Nicholas G; Montgomery, Grant W; Slamon, Dennis J; Rauh, Claudia; Lux, Michael P; Jud, Sebastian M; Bruning, Thomas; Weaver, Joellen; Sharma, Priyanka; Pathak, Harsh; Tapper, Will; Gerty, Sue; Durcan, Lorraine; Trichopoulos, Dimitrios; Tumino, Rosario; Peeters, Petra H; Kaaks, Rudolf; Campa, Daniele; Canzian, Federico; Weiderpass, Elisabete; Johansson, Mattias; Khaw, Kay-Tee; Travis, Ruth; Clavel-Chapelon, Françoise; Kolonel, Laurence N; Chen, Constance; Beck, Andy; Hankinson, Susan E; Berg, Christine D; Hoover, Robert N; Lissowska, Jolanta; Figueroa, Jonine D; Chasman, Daniel I; Gaudet, Mia M; Diver, W Ryan; Willett, Walter C; Hunter, David J; Simard, Jacques; Benitez, Javier; Dunning, Alison M; Sherman, Mark E; Chenevix-Trench, Georgia; Chanock, Stephen J; Hall, Per; Pharoah, Paul D P; Vachon, Celine; Easton, Douglas F; Haiman, Christopher A; Kraft, Peter

    2013-04-01

    Estrogen receptor (ER)-negative tumors represent 20-30% of all breast cancers, with a higher proportion occurring in younger women and women of African ancestry. The etiology and clinical behavior of ER-negative tumors are different from those of tumors expressing ER (ER positive), including differences in genetic predisposition. To identify susceptibility loci specific to ER-negative disease, we combined in a meta-analysis 3 genome-wide association studies of 4,193 ER-negative breast cancer cases and 35,194 controls with a series of 40 follow-up studies (6,514 cases and 41,455 controls), genotyped using a custom Illumina array, iCOGS, developed by the Collaborative Oncological Gene-environment Study (COGS). SNPs at four loci, 1q32.1 (MDM4, P = 2.1 × 10(-12) and LGR6, P = 1.4 × 10(-8)), 2p24.1 (P = 4.6 × 10(-8)) and 16q12.2 (FTO, P = 4.0 × 10(-8)), were associated with ER-negative but not ER-positive breast cancer (P > 0.05). These findings provide further evidence for distinct etiological pathways associated with invasive ER-positive and ER-negative breast cancers.

  8. Genome-Wide Expression Profiling of Five Mouse Models Identifies Similarities and Differences with Human Psoriasis

    Science.gov (United States)

    Swindell, William R.; Johnston, Andrew; Carbajal, Steve; Han, Gangwen; Wohn, Christian; Lu, Jun; Xing, Xianying; Nair, Rajan P.; Voorhees, John J.; Elder, James T.; Wang, Xiao-Jing; Sano, Shigetoshi; Prens, Errol P.; DiGiovanni, John; Pittelkow, Mark R.; Ward, Nicole L.; Gudjonsson, Johann E.

    2011-01-01

    Development of a suitable mouse model would facilitate the investigation of pathomechanisms underlying human psoriasis and would also assist in development of therapeutic treatments. However, while many psoriasis mouse models have been proposed, no single model recapitulates all features of the human disease, and standardized validation criteria for psoriasis mouse models have not been widely applied. In this study, whole-genome transcriptional profiling is used to compare gene expression patterns manifested by human psoriatic skin lesions with those that occur in five psoriasis mouse models (K5-Tie2, imiquimod, K14-AREG, K5-Stat3C and K5-TGFbeta1). While the cutaneous gene expression profiles associated with each mouse phenotype exhibited statistically significant similarity to the expression profile of psoriasis in humans, each model displayed distinctive sets of similarities and differences in comparison to human psoriasis. For all five models, correspondence to the human disease was strong with respect to genes involved in epidermal development and keratinization. Immune and inflammation-associated gene expression, in contrast, was more variable between models as compared to the human disease. These findings support the value of all five models as research tools, each with identifiable areas of convergence to and divergence from the human disease. Additionally, the approach used in this paper provides an objective and quantitative method for evaluation of proposed mouse models of psoriasis, which can be strategically applied in future studies to score strengths of mouse phenotypes relative to specific aspects of human psoriasis. PMID:21483750

  9. Comparative analysis of the full genome of Helicobacter pylori isolate Sahul64 identifies genes of high divergence.

    Science.gov (United States)

    Lu, Wei; Wise, Michael J; Tay, Chin Yen; Windsor, Helen M; Marshall, Barry J; Peacock, Christopher; Perkins, Tim

    2014-03-01

    Isolates of Helicobacter pylori can be classified phylogeographically. High genetic diversity and rapid microevolution are a hallmark of H. pylori genomes, a phenomenon that is proposed to play a functional role in persistence and colonization of diverse human populations. To provide further genomic evidence in the lineage of H. pylori and to further characterize diverse strains of this pathogen in different human populations, we report the finished genome sequence of Sahul64, an H. pylori strain isolated from an indigenous Australian. Our analysis identified genes that were highly divergent compared to the 38 publically available genomes, which include genes involved in the biosynthesis and modification of lipopolysaccharide, putative prophage genes, restriction modification components, and hypothetical genes. Furthermore, the virulence-associated vacA locus is a pseudogene and the cag pathogenicity island (cagPAI) is not present. However, the genome does contain a gene cluster associated with pathogenicity, including dupA. Our analysis found that with the addition of Sahul64 to the 38 genomes, the core genome content of H. pylori is reduced by approximately 14% (∼170 genes) and the pan-genome has expanded from 2,070 to 2,238 genes. We have identified three putative horizontally acquired regions, including one that is likely to have been acquired from the closely related Helicobacter cetorum prior to speciation. Our results suggest that Sahul64, with the absence of cagPAI, highly divergent cell envelope proteins, and a predicted nontransportable VacA protein, could be more highly adapted to ancient indigenous Australian people but with lower virulence potential compared to other sequenced and cagPAI-positive H. pylori strains.

  10. Genome-wide association study identifies novel loci associated with circulating phospho- and sphingolipid concentrations.

    Directory of Open Access Journals (Sweden)

    Ayşe Demirkan

    Full Text Available Phospho- and sphingolipids are crucial cellular and intracellular compounds. These lipids are required for active transport, a number of enzymatic processes, membrane formation, and cell signalling. Disruption of their metabolism leads to several diseases, with diverse neurological, psychiatric, and metabolic consequences. A large number of phospholipid and sphingolipid species can be detected and measured in human plasma. We conducted a meta-analysis of five European family-based genome-wide association studies (N = 4034 on plasma levels of 24 sphingomyelins (SPM, 9 ceramides (CER, 57 phosphatidylcholines (PC, 20 lysophosphatidylcholines (LPC, 27 phosphatidylethanolamines (PE, and 16 PE-based plasmalogens (PLPE, as well as their proportions in each major class. This effort yielded 25 genome-wide significant loci for phospholipids (smallest P-value = 9.88×10(-204 and 10 loci for sphingolipids (smallest P-value = 3.10×10(-57. After a correction for multiple comparisons (P-value<2.2×10(-9, we observed four novel loci significantly associated with phospholipids (PAQR9, AGPAT1, PKD2L1, PDXDC1 and two with sphingolipids (PLD2 and APOE explaining up to 3.1% of the variance. Further analysis of the top findings with respect to within class molar proportions uncovered three additional loci for phospholipids (PNLIPRP2, PCDH20, and ABDH3 suggesting their involvement in either fatty acid elongation/saturation processes or fatty acid specific turnover mechanisms. Among those, 14 loci (KCNH7, AGPAT1, PNLIPRP2, SYT9, FADS1-2-3, DLG2, APOA1, ELOVL2, CDK17, LIPC, PDXDC1, PLD2, LASS4, and APOE mapped into the glycerophospholipid and 12 loci (ILKAP, ITGA9, AGPAT1, FADS1-2-3, APOA1, PCDH20, LIPC, PDXDC1, SGPP1, APOE, LASS4, and PLD2 to the sphingolipid pathways. In large meta-analyses, associations between FADS1-2-3 and carotid intima media thickness, AGPAT1 and type 2 diabetes, and APOA1 and coronary artery disease were observed. In conclusion, our

  11. Identify the Important Decision Factors of Online Shopping Adoption in Indonesia

    Directory of Open Access Journals (Sweden)

    Lailatul HIJRAH

    2017-12-01

    Full Text Available The objective of this study is to identify factors encouraging a consumer to engage in online shopping activities. The expected contribution of this study is for online entrepreneurs, in order to develop the most suitable business strategy, so that it will be clearly identified and sorted out which factors are the most important and the main motivation of Indonesian consumers to shop via online by using responses from respondents who usually shop online and offline in 3 cities in Indonesia, Jakarta, Surabaya and Samarinda. The research instruments were developed by conducting FGDs on relevant groups, either academics, online shopping activists, suppliers and courier businessmen in Jakarta, Surabaya and Samarinda Cities in effort to extract any information that encourages consumers to online shopping. After conducting FGD, the researcher produced 48 items proposed for factor analysis and after extracted to form eleven constructs, some items were removed because they had less loading factors. The eleven constructs or dimensions are trust, risk, consumer factors, website factors, price, service quality, convenience, subjective norm, product guarantee, variety of products and lifestyle. The implications of this study provide valuable insights about consumer decisions to online shopping or not online shopping.

  12. Systematic reviews identify important methodological flaws in stroke rehabilitation therapy primary studies: review of reviews.

    Science.gov (United States)

    Santaguida, Pasqualina; Oremus, Mark; Walker, Kathryn; Wishart, Laurie R; Siegel, Karen Lohmann; Raina, Parminder

    2012-04-01

    A "review of reviews" was undertaken to assess methodological issues in studies evaluating nondrug rehabilitation interventions in stroke patients. MEDLINE, CINAHL, PsycINFO, and the Cochrane Database of Systematic Reviews were searched from January 2000 to January 2008 within the stroke rehabilitation setting. Electronic searches were supplemented by reviews of reference lists and citations identified by experts. Eligible studies were systematic reviews; excluded citations were narrative reviews or reviews of reviews. Review characteristics and criteria for assessing methodological quality of primary studies within them were extracted. The search yielded 949 English-language citations. We included a final set of 38 systematic reviews. Cochrane reviews, which have a standardized methodology, were generally of higher methodological quality than non-Cochrane reviews. Most systematic reviews used standardized quality assessment criteria for primary studies, but not all were comprehensive. Reviews showed that primary studies had problems with randomization, allocation concealment, and blinding. Baseline comparability, adverse events, and co-intervention or contamination were not consistently assessed. Blinding of patients and providers was often not feasible and was not evaluated as a source of bias. The eligible systematic reviews identified important methodological flaws in the evaluated primary studies, suggesting the need for improvement of research methods and reporting. Copyright © 2012 Elsevier Inc. All rights reserved.

  13. Integrated genomics identifies five medulloblastoma subtypes with distinct genetic profiles, pathway signatures and clinicopathological features.

    Directory of Open Access Journals (Sweden)

    Marcel Kool

    Full Text Available BACKGROUND: Medulloblastoma is the most common malignant brain tumor in children. Despite recent improvements in cure rates, prediction of disease outcome remains a major challenge and survivors suffer from serious therapy-related side-effects. Recent data showed that patients with WNT-activated tumors have a favorable prognosis, suggesting that these patients could be treated less intensively, thereby reducing the side-effects. This illustrates the potential benefits of a robust classification of medulloblastoma patients and a detailed knowledge of associated biological mechanisms. METHODS AND FINDINGS: To get a better insight into the molecular biology of medulloblastoma we established mRNA expression profiles of 62 medulloblastomas and analyzed 52 of them also by comparative genomic hybridization (CGH arrays. Five molecular subtypes were identified, characterized by WNT signaling (A; 9 cases, SHH signaling (B; 15 cases, expression of neuronal differentiation genes (C and D; 16 and 11 cases, respectively or photoreceptor genes (D and E; both 11 cases. Mutations in beta-catenin were identified in all 9 type A tumors, but not in any other tumor. PTCH1 mutations were exclusively identified in type B tumors. CGH analysis identified several fully or partly subtype-specific chromosomal aberrations. Monosomy of chromosome 6 occurred only in type A tumors, loss of 9q mostly occurred in type B tumors, whereas chromosome 17 aberrations, most common in medulloblastoma, were strongly associated with type C or D tumors. Loss of the inactivated X-chromosome was highly specific for female cases of type C, D and E tumors. Gene expression levels faithfully reflected the chromosomal copy number changes. Clinicopathological features significantly different between the 5 subtypes included metastatic disease and age at diagnosis and histology. Metastatic disease at diagnosis was significantly associated with subtypes C and D and most strongly with subtype E

  14. Functional genomics identifies specific vulnerabilities in PTEN-deficient breast cancer.

    Science.gov (United States)

    Tang, Yew Chung; Ho, Szu-Chi; Tan, Elisabeth; Ng, Alvin Wei Tian; McPherson, John R; Goh, Germaine Yen Lin; Teh, Bin Tean; Bard, Frederic; Rozen, Steven G

    2018-03-22

    Phosphatase and tensin homolog (PTEN) is one of the most frequently inactivated tumor suppressors in breast cancer. While PTEN itself is not considered a druggable target, PTEN synthetic-sick or synthetic-lethal (PTEN-SSL) genes are potential drug targets in PTEN-deficient breast cancers. Therefore, with the aim of identifying potential targets for precision breast cancer therapy, we sought to discover PTEN-SSL genes present in a broad spectrum of breast cancers. To discover broad-spectrum PTEN-SSL genes in breast cancer, we used a multi-step approach that started with (1) a genome-wide short interfering RNA (siRNA) screen of ~ 21,000 genes in a pair of isogenic human mammary epithelial cell lines, followed by (2) a short hairpin RNA (shRNA) screen of ~ 1200 genes focused on hits from the first screen in a panel of 11 breast cancer cell lines; we then determined reproducibility of hits by (3) identification of overlaps between our results and reanalyzed data from 3 independent gene-essentiality screens, and finally, for selected candidate PTEN-SSL genes we (4) confirmed PTEN-SSL activity using either drug sensitivity experiments in a panel of 19 cell lines or mutual exclusivity analysis of publicly available pan-cancer somatic mutation data. The screens (steps 1 and 2) and the reproducibility analysis (step 3) identified six candidate broad-spectrum PTEN-SSL genes (PIK3CB, ADAMTS20, AP1M2, HMMR, STK11, and NUAK1). PIK3CB was previously identified as PTEN-SSL, while the other five genes represent novel PTEN-SSL candidates. Confirmation studies (step 4) provided additional evidence that NUAK1 and STK11 have PTEN-SSL patterns of activity. Consistent with PTEN-SSL status, inhibition of the NUAK1 protein kinase by the small molecule drug HTH-01-015 selectively impaired viability in multiple PTEN-deficient breast cancer cell lines, while mutations affecting STK11 and PTEN were largely mutually exclusive across large pan-cancer data sets. Six genes showed PTEN

  15. Integrated Genomic Analysis Identifies Clinically Relevant Subtypes of Glioblastoma Characterized by Abnormalities in PDGFRA, IDH1, EGFR, and NF1

    Energy Technology Data Exchange (ETDEWEB)

    Verhaak, Roel GW; Hoadley, Katherine A; Purdom, Elizabeth; Wang, Victoria; Qi, Yuan; Wilkerson, Matthew D; Miller, C Ryan; Ding, Li; Golub, Todd; Mesirov, Jill P; Alexe, Gabriele; Lawrence, Michael; O' Kelly, Michael; Tamayo, Pablo; Weir, Barbara A; Gabriel, Stacey; Winckler, Wendy; Gupta, Supriya; Jakkula, Lakshmi; Feiler, Heidi S; Hodgson, J Graeme; James, C David; Sarkaria, Jann N; Brennan, Cameron; Kahn, Ari; Spellman, Paul T; Wilson, Richard K; Speed, Terence P; Gray, Joe W; Meyerson, Matthew; Getz, Gad; Perou, Charles M; Hayes, D Neil; Network, The Cancer Genome Atlas Research

    2009-09-03

    The Cancer Genome Atlas Network recently cataloged recurrent genomic abnormalities in glioblastoma multiforme (GBM). We describe a robust gene expression-based molecular classification of GBM into Proneural, Neural, Classical, and Mesenchymal subtypes and integrate multidimensional genomic data to establish patterns of somatic mutations and DNA copy number. Aberrations and gene expression of EGFR, NF1, and PDGFRA/IDH1 each define the Classical, Mesenchymal, and Proneural subtypes, respectively. Gene signatures of normal brain cell types show a strong relationship between subtypes and different neural lineages. Additionally, response to aggressive therapy differs by subtype, with the greatest benefit in the Classical subtype and no benefit in the Proneural subtype. We provide a framework that unifies transcriptomic and genomic dimensions for GBM molecular stratification with important implications for future studies.

  16. MicroRNA repertoire for functional genome research in tilapia identified by deep sequencing.

    Science.gov (United States)

    Yan, Biao; Wang, Zhen-Hua; Zhu, Chang-Dong; Guo, Jin-Tao; Zhao, Jin-Liang

    2014-08-01

    The Nile tilapia (Oreochromis niloticus; Cichlidae) is an economically important species in aquaculture and occupies a prominent position in the aquaculture industry. MicroRNAs (miRNAs) are a class of noncoding RNAs that post-transcriptionally regulate gene expression involved in diverse biological and metabolic processes. To increase the repertoire of miRNAs characterized in tilapia, we used the Illumina/Solexa sequencing technology to sequence a small RNA library using pooled RNA sample isolated from the different developmental stages of tilapia. Bioinformatic analyses suggest that 197 conserved and 27 novel miRNAs are expressed in tilapia. Sequence alignments indicate that all tested miRNAs and miRNAs* are highly conserved across many species. In addition, we characterized the tissue expression patterns of five miRNAs using real-time quantitative PCR. We found that miR-1/206, miR-7/9, and miR-122 is abundantly expressed in muscle, brain, and liver, respectively, implying a potential role in the regulation of tissue differentiation or the maintenance of tissue identity. Overall, our results expand the number of tilapia miRNAs, and the discovery of miRNAs in tilapia genome contributes to a better understanding the role of miRNAs in regulating diverse biological processes.

  17. Molecular characterization of NRXN1 deletions from 19,263 clinical microarray cases identifies exons important for neurodevelopmental disease expression

    Science.gov (United States)

    Lowther, Chelsea; Speevak, Marsha; Armour, Christine M.; Goh, Elaine S.; Graham, Gail E.; Li, Chumei; Zeesman, Susan; Nowaczyk, Malgorzata J.M.; Schultz, Lee-Anne; Morra, Antonella; Nicolson, Rob; Bikangaga, Peter; Samdup, Dawa; Zaazou, Mostafa; Boyd, Kerry; Jung, Jack H.; Siu, Victoria; Rajguru, Manjulata; Goobie, Sharan; Tarnopolsky, Mark A.; Prasad, Chitra; Dick, Paul T.; Hussain, Asmaa S.; Walinga, Margreet; Reijenga, Renske G.; Gazzellone, Matthew; Lionel, Anath C.; Marshall, Christian R.; Scherer, Stephen W.; Stavropoulos, Dimitri J.; McCready, Elizabeth; Bassett, Anne S.

    2016-01-01

    Purpose The purpose of the current study was to assess the penetrance of NRXN1 deletions. Methods We compared the prevalence and genomic extent of NRXN1 deletions identified among 19,263 clinically referred cases to that of 15,264 controls. The burden of additional clinically relevant CNVs was used as a proxy to estimate the relative penetrance of NRXN1 deletions. Results We identified 41 (0.21%) previously unreported exonic NRXN1 deletions ascertained for developmental delay/intellectual disability, significantly greater than in controls [OR=8.14 (95% CI 2.91–22.72), p< 0.0001)]. Ten (22.7%) of these had a second clinically relevant CNV. Subjects with a deletion near the 3′ end of NRXN1 were significantly more likely to have a second rare CNV than subjects with a 5′ NRXN1 deletion [OR=7.47 (95% CI 2.36–23.61), p=0.0006]. The prevalence of intronic NRXN1 deletions was not statistically different between cases and controls (p=0.618). The majority (63.2%) of intronic NRXN1 deletion cases had a second rare CNV, a two-fold greater prevalence than for exonic NRXN1 deletion cases (p=0.0035). Conclusions The results support the importance of exons near the 5′ end of NRXN1 in the expression of neurodevelopmental disorders. Intronic NRXN1 deletions do not appear to substantially increase the risk for clinical phenotypes. PMID:27195815

  18. CRISPRseek: a bioconductor package to identify target-specific guide RNAs for CRISPR-Cas9 genome-editing systems.

    Directory of Open Access Journals (Sweden)

    Lihua J Zhu

    Full Text Available CRISPR-Cas systems are a diverse family of RNA-protein complexes in bacteria that target foreign DNA sequences for cleavage. Derivatives of these complexes have been engineered to cleave specific target sequences depending on the sequence of a CRISPR-derived guide RNA (gRNA and the source of the Cas9 protein. Important considerations for the design of gRNAs are to maximize aimed activity at the desired target site while minimizing off-target cleavage. Because of the rapid advances in the understanding of existing CRISPR-Cas9-derived RNA-guided nucleases and the development of novel RNA-guided nuclease systems, it is critical to have computational tools that can accommodate a wide range of different parameters for the design of target-specific RNA-guided nuclease systems. We have developed CRISPRseek, a highly flexible, open source software package to identify gRNAs that target a given input sequence while minimizing off-target cleavage at other sites within any selected genome. CRISPRseek will identify potential gRNAs that target a sequence of interest for CRISPR-Cas9 systems from different bacterial species and generate a cleavage score for potential off-target sequences utilizing published or user-supplied weight matrices with position-specific mismatch penalty scores. Identified gRNAs may be further filtered to only include those that occur in paired orientations for increased specificity and/or those that overlap restriction enzyme sites. For applications where gRNAs are desired to discriminate between two related sequences, CRISPRseek can rank gRNAs based on the difference between predicted cleavage scores in each input sequence. CRISPRseek is implemented as a Bioconductor package within the R statistical programming environment, allowing it to be incorporated into computational pipelines to automate the design of gRNAs for target sequences identified in a wide variety of genome-wide analyses. CRISPRseek is available under the GNU General

  19. snpTree - a web-server to identify and construct SNP trees from whole genome sequence data

    DEFF Research Database (Denmark)

    Leekitcharoenphon, Pimlapas; Kaas, Rolf Sommer; Thomsen, Martin Christen Frølund

    2012-01-01

    identify SNPs and construct phylogenetic trees from WGS as well as from assembled genomes or contigs. WGS data in fastq format are aligned to reference genomes by BWA while contigs in fasta format are processed by Nucmer. SNPs are concatenated based on position on reference genome and a tree is constructed...... to differentiate and classify isolates. One of the successfully and broadly used methods is analysis of single nucletide polymorphisms (SNPs). Currently, there are different tools and methods to identify SNPs including various options and cut-off values. Furthermore, all current methods require bioinformatic...... skills. Thus, we lack a standard and simple automatic tool to determine SNPs and construct phylogenetic tree from WGS data. Results Here we introduce snpTree, a server for online-automatic SNPs analysis. This tool is composed of different SNPs analysis suites, perl and python scripts. snpTree can...

  20. Genome-wide association analysis identifies variants associated with nonalcoholic fatty liver disease that have distinct effects on metabolic traits

    DEFF Research Database (Denmark)

    Speliotes, Elizabeth K; Yerges-Armstrong, Laura M; Wu, Jun

    2011-01-01

    steatosis, a non-invasive measure of NAFLD, in large population based samples. Using variance components methods, we show that CT hepatic steatosis is heritable (~26%-27%) in family-based Amish, Family Heart, and Framingham Heart Studies (n¿=¿880 to 3,070). By carrying out a fixed-effects meta......-analysis of genome-wide association (GWA) results between CT hepatic steatosis and ~2.4 million imputed or genotyped SNPs in 7,176 individuals from the Old Order Amish, Age, Gene/Environment Susceptibility-Reykjavik study (AGES), Family Heart, and Framingham Heart Studies, we identify variants associated at genome......Nonalcoholic fatty liver disease (NAFLD) clusters in families, but the only known common genetic variants influencing risk are near PNPLA3. We sought to identify additional genetic variants influencing NAFLD using genome-wide association (GWA) analysis of computed tomography (CT) measured hepatic...

  1. Genome-wide association study of blood pressure extremes identifies variant near UMOD associated with hypertension.

    Directory of Open Access Journals (Sweden)

    Sandosh Padmanabhan

    2010-10-01

    Full Text Available Hypertension is a heritable and major contributor to the global burden of disease. The sum of rare and common genetic variants robustly identified so far explain only 1%-2% of the population variation in BP and hypertension. This suggests the existence of more undiscovered common variants. We conducted a genome-wide association study in 1,621 hypertensive cases and 1,699 controls and follow-up validation analyses in 19,845 cases and 16,541 controls using an extreme case-control design. We identified a locus on chromosome 16 in the 5' region of Uromodulin (UMOD; rs13333226, combined P value of 3.6 × 10⁻¹¹. The minor G allele is associated with a lower risk of hypertension (OR [95%CI]: 0.87 [0.84-0.91], reduced urinary uromodulin excretion, better renal function; and each copy of the G allele is associated with a 7.7% reduction in risk of CVD events after adjusting for age, sex, BMI, and smoking status (H.R. = 0.923, 95% CI 0.860-0.991; p = 0.027. In a subset of 13,446 individuals with estimated glomerular filtration rate (eGFR measurements, we show that rs13333226 is independently associated with hypertension (unadjusted for eGFR: 0.89 [0.83-0.96], p = 0.004; after eGFR adjustment: 0.89 [0.83-0.96], p = 0.003. In clinical functional studies, we also consistently show the minor G allele is associated with lower urinary uromodulin excretion. The exclusive expression of uromodulin in the thick portion of the ascending limb of Henle suggests a putative role of this variant in hypertension through an effect on sodium homeostasis. The newly discovered UMOD locus for hypertension has the potential to give new insights into the role of uromodulin in BP regulation and to identify novel drugable targets for reducing cardiovascular risk.

  2. Whole genome population genetics analysis of Sudanese goats identifies regions harboring genes associated with major traits.

    Science.gov (United States)

    Rahmatalla, Siham A; Arends, Danny; Reissmann, Monika; Said Ahmed, Ammar; Wimmers, Klaus; Reyer, Henry; Brockmann, Gudrun A

    2017-10-23

    Sudan is endowed with a variety of indigenous goat breeds which are used for meat and milk production and which are well adapted to the local environment. The aim of the present study was to determine the genetic diversity and relationship within and between the four main Sudanese breeds of Nubian, Desert, Taggar and Nilotic goats. Using the 50 K SNP chip, 24 animals of each breed were genotyped. More than 96% of high quality SNPs were polymorphic with an average minor allele frequency of 0.3. In all breeds, no significant difference between observed (0.4) and expected (0.4) heterozygosity was found and the inbreeding coefficients (F IS ) did not differ from zero. F st coefficients for the genetic distance between breeds also did not significantly deviate from zero. In addition, the analysis of molecular variance revealed that 93% of the total variance in the examined population can be explained by differences among individuals, while only 7% result from differences between the breeds. These findings provide evidence for high genetic diversity and little inbreeding within breeds on one hand, and low diversity between breeds on the other hand. Further examinations using Nei's genetic distance and STRUCTURE analysis clustered Taggar goats distinct from the other breeds. In a principal component (PC) analysis, PC1 could separate Taggar, Nilotic and a mix of Nubian and Desert goats into three groups. The SNPs that contributed strongly to PC1 showed high F st values in Taggar goat versus the other goat breeds. PCA allowed us to identify target genomic regions which contain genes known to influence growth, development, bone formation and the immune system. The information on the genetic variability and diversity in this study confirmed that Taggar goat is genetically different from the other goat breeds in Sudan. The SNPs identified by the first principal components show high F st values in Taggar goat and allowed to identify candidate genes which can be used in the

  3. Complete Genome Sequence of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) from the First Imported MERS-CoV Case in China.

    Science.gov (United States)

    Lu, Roujian; Wang, Yanqun; Wang, Wenling; Nie, Kai; Zhao, Yanjie; Su, Juan; Deng, Yao; Zhou, Weimin; Li, Yang; Wang, Huijuan; Wang, Wen; Ke, Changwen; Ma, Xuejun; Wu, Guizhen; Tan, Wenjie

    2015-08-13

    On 26 May 2015, an imported Middle East respiratory syndrome coronavirus (MERS-CoV) was identified in Guangdong Province, China, and found to be closely related to the MERS-CoV strain prevalent in South Korea. The full genome of the ChinaGD01 strain was sequenced and analyzed to investigate the epidemiology and evolution of MERS-CoV circulating in South Korea and China. Copyright © 2015 Lu et al.

  4. Editor's Highlight: High-Throughput Functional Genomics Identifies Modulators of TCE Metabolite Genotoxicity and Candidate Susceptibility Genes.

    Science.gov (United States)

    De La Rosa, Vanessa Y; Asfaha, Jonathan; Fasullo, Michael; Loguinov, Alex; Li, Peng; Moore, Lee E; Rothman, Nathaniel; Nakamura, Jun; Swenberg, James A; Scelo, Ghislaine; Zhang, Luoping; Smith, Martyn T; Vulpe, Chris D

    2017-11-01

    Trichloroethylene (TCE), an industrial chemical and environmental contaminant, is a human carcinogen. Reactive metabolites are implicated in renal carcinogenesis associated with TCE exposure, yet the toxicity mechanisms of these metabolites and their contribution to cancer and other adverse effects remain unclear. We employed an integrated functional genomics approach that combined functional profiling studies in yeast and avian DT40 cell models to provide new insights into the specific mechanisms contributing to toxicity associated with TCE metabolites. Genome-wide profiling studies in yeast identified the error-prone translesion synthesis (TLS) pathway as an import mechanism in response to TCE metabolites. The role of TLS DNA repair was further confirmed by functional profiling in DT40 avian cell lines, but also revealed that TLS and homologous recombination DNA repair likely play competing roles in cellular susceptibility to TCE metabolites in higher eukaryotes. These DNA repair pathways are highly conserved between yeast, DT40, and humans. We propose that in humans, mutagenic TLS is favored over homologous recombination repair in response to TCE metabolites. The results of these studies contribute to the body of evidence supporting a mutagenic mode of action for TCE-induced renal carcinogenesis mediated by reactive metabolites in humans. Our approach illustrates the potential for high-throughput in vitro functional profiling in yeast to elucidate toxicity pathways (molecular initiating events, key events) and candidate susceptibility genes for focused study. © The Author 2017. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  5. Virulence-associated genome mutations of murine rotavirus identified by alternating serial passages in mice and cell cultures.

    Science.gov (United States)

    Tsugawa, Takeshi; Tatsumi, Masatoshi; Tsutsumi, Hiroyuki

    2014-05-01

    Although significant clinical efficacy and safety of rotavirus vaccines were recently revealed in many countries, the mechanism of their attenuation is not well understood. We passaged serially a cell culture-adapted murine rotavirus EB strain in mouse pups or in cell cultures alternately and repeatedly and fully sequenced all 11 genes of 21 virus samples passaged in mice or in cell cultures. Sequence analysis revealed that mouse-passaged viruses that regained virulence almost consistently acquired four kinds of amino acid (aa) substitutions in VP4 and substitution in aa 37 (Val to Ala) in NSP4. In addition, they gained and invariably conserved the 3' consensus sequence in NSP1. The molecular changes occurred along with the acquisition of virulence during passages in mice and then disappeared following passages in cell cultures. Intraperitoneal injection of recombinant NSP4 proteins confirmed the aa 37 site as important for its diarrheagenic activity in mice. These genome changes are likely to be correlated with rotavirus virulence. Serial passage of a virulent wild-type virus in vitro often results in loss of virulence of the virus in an original animal host, while serial passage of a cell culture-adapted avirulent virus in vivo often gains virulence in an animal host. Actually, live attenuated virus vaccines were originally produced by serial passage in cell cultures. Although clinical efficacy and safety of rotavirus vaccines were recently revealed, the mechanism of their attenuation is not well understood. We passaged serially a murine rotavirus by alternating switch of host (mice or cell cultures) repeatedly and sequenced the eleven genes of the passaged viruses to identify mutations associated with the emergence or disappearance of virulence. Sequence analysis revealed that changes in three genes (VP4, NSP1, and NSP4) were associated with virulence in mice. Intraperitoneal injection of recombinant NSP4 proteins confirmed its diarrheagenic activity in mice

  6. Replication protein A, the laxative that keeps DNA regular: The importance of RPA phosphorylation in maintaining genome stability.

    Science.gov (United States)

    Byrne, Brendan M; Oakley, Gregory G

    2018-04-20

    The eukaryotic ssDNA-binding protein, Replication protein A (RPA), was first discovered almost three decades ago. Since then, much progress has been made to elucidate the critical roles for RPA in DNA metabolic pathways that help promote genomic stability. The canonical RPA heterotrimer (RPA1-3) is an essential coordinator of DNA metabolism that interacts with ssDNA and numerous protein partners to coordinate its roles in DNA replication, repair, recombination and telomere maintenance. An alternative form of RPA, termed aRPA, is formed by a complex of RPA4 with RPA1 and RPA3. aRPA is expressed differentially in cells compared to canonical RPA and has been shown to inhibit canonical RPA function while allowing for regular maintenance of cell viability. Interestingly, while aRPA is defective in DNA replication and cell cycle progression, it was shown to play a supporting role in nucleotide excision repair and recombination. The binding domains of canonical RPA interact with a growing number of partners involved in numerous genome maintenance processes. The protein interactions of the RPA-ssDNA complex are not only governed by competition between the binding proteins but also by post-translation modifications such as phosphorylation. Phosphorylation of RPA2 is an important post-translational modification of the RPA complex, and is essential for directing context-specific functions of the RPA complex in the DNA damage response. Due to the importance of RPA in cellular metabolism, it was identified as an appealing target for chemotherapeutic drug development that could be used in future cancer treatment regimens. Copyright © 2018 Elsevier Ltd. All rights reserved.

  7. Identifying and exploiting trait-relevant tissues with multiple functional annotations in genome-wide association studies

    Science.gov (United States)

    Zhang, Shujun

    2018-01-01

    Genome-wide association studies (GWASs) have identified many disease associated loci, the majority of which have unknown biological functions. Understanding the mechanism underlying trait associations requires identifying trait-relevant tissues and investigating associations in a trait-specific fashion. Here, we extend the widely used linear mixed model to incorporate multiple SNP functional annotations from omics studies with GWAS summary statistics to facilitate the identification of trait-relevant tissues, with which to further construct powerful association tests. Specifically, we rely on a generalized estimating equation based algorithm for parameter inference, a mixture modeling framework for trait-tissue relevance classification, and a weighted sequence kernel association test constructed based on the identified trait-relevant tissues for powerful association analysis. We refer to our analytic procedure as the Scalable Multiple Annotation integration for trait-Relevant Tissue identification and usage (SMART). With extensive simulations, we show how our method can make use of multiple complementary annotations to improve the accuracy for identifying trait-relevant tissues. In addition, our procedure allows us to make use of the inferred trait-relevant tissues, for the first time, to construct more powerful SNP set tests. We apply our method for an in-depth analysis of 43 traits from 28 GWASs using tissue-specific annotations in 105 tissues derived from ENCODE and Roadmap. Our results reveal new trait-tissue relevance, pinpoint important annotations that are informative of trait-tissue relationship, and illustrate how we can use the inferred trait-relevant tissues to construct more powerful association tests in the Wellcome trust case control consortium study. PMID:29377896

  8. Identifying and exploiting trait-relevant tissues with multiple functional annotations in genome-wide association studies.

    Directory of Open Access Journals (Sweden)

    Xingjie Hao

    2018-01-01

    Full Text Available Genome-wide association studies (GWASs have identified many disease associated loci, the majority of which have unknown biological functions. Understanding the mechanism underlying trait associations requires identifying trait-relevant tissues and investigating associations in a trait-specific fashion. Here, we extend the widely used linear mixed model to incorporate multiple SNP functional annotations from omics studies with GWAS summary statistics to facilitate the identification of trait-relevant tissues, with which to further construct powerful association tests. Specifically, we rely on a generalized estimating equation based algorithm for parameter inference, a mixture modeling framework for trait-tissue relevance classification, and a weighted sequence kernel association test constructed based on the identified trait-relevant tissues for powerful association analysis. We refer to our analytic procedure as the Scalable Multiple Annotation integration for trait-Relevant Tissue identification and usage (SMART. With extensive simulations, we show how our method can make use of multiple complementary annotations to improve the accuracy for identifying trait-relevant tissues. In addition, our procedure allows us to make use of the inferred trait-relevant tissues, for the first time, to construct more powerful SNP set tests. We apply our method for an in-depth analysis of 43 traits from 28 GWASs using tissue-specific annotations in 105 tissues derived from ENCODE and Roadmap. Our results reveal new trait-tissue relevance, pinpoint important annotations that are informative of trait-tissue relationship, and illustrate how we can use the inferred trait-relevant tissues to construct more powerful association tests in the Wellcome trust case control consortium study.

  9. Patterns of genomic variation in the poplar rust fungus Melampsora larici-populina identify pathogenesis-related factors

    Directory of Open Access Journals (Sweden)

    Antoine ePersoons

    2014-09-01

    Full Text Available Melampsora larici-populina is a fungal pathogen responsible for foliar rust disease on poplar trees, which causes damage to forest plantations worldwide, particularly in Northern Europe. The reference genome of the isolate 98AG31 was previously sequenced using a whole genome shotgun strategy, revealing a large genome of 101 megabases containing 16,399 predicted genes, which included secreted protein genes representing poplar rust candidate effectors. In the present study, the genomes of 15 isolates collected over the past 20 years throughout the French territory, representing distinct virulence profiles, were characterized by massively parallel sequencing to assess genetic variation in the poplar rust fungus. Comparison to the reference genome revealed striking structural variations. Analysis of coverage and sequencing depth identified large missing regions between isolates related to the mating type loci. More than 611,824 single-nucleotide polymorphism (SNP positions were uncovered overall, indicating a remarkable level of polymorphism. Based on the accumulation of non-synonymous substitutions in coding sequences and the relative frequencies of synonymous and non-synonymous polymorphisms (i.e. PN/PS, we identify candidate genes that may be involved in fungal pathogenesis. Correlation between non-synonymous SNPs in genes encoding secreted proteins and pathotypes of the studied isolates revealed candidate genes potentially related to virulences 1, 6 and 8 of the poplar rust fungus.

  10. Meta-analysis of five genome-wide association studies identifies multiple new loci associated with testicular germ cell tumor

    DEFF Research Database (Denmark)

    Wang, Zhaoming; McGlynn, Katherine A.; Rajpert-De Meyts, Ewa

    2017-01-01

    The international Testicular Cancer Consortium (TECAC) combined five published genome-wide association studies of testicular germ cell tumor (TGCT; 3,558 cases and 13,970 controls) to identify new susceptibility loci. We conducted a fixed-effects meta-analysis, including, to our knowledge, the fi...

  11. Integration of mouse and human genome-wide association data identifies KCNIP4 as an asthma gene

    NARCIS (Netherlands)

    Himes, Blanca E.; Sheppard, Keith; Berndt, Annerose; Leme, Adriana S.; Myers, Rachel A.; Gignoux, Christopher R.; Levin, Albert M.; Gauderman, W. James; Yang, James J.; Mathias, Rasika A.; Romieu, Isabelle; Torgerson, Dara G.; Roth, Lindsey A.; Huntsman, Scott; Eng, Celeste; Klanderman, Barbara; Ziniti, John; Senter-Sylvia, Jody; Szefler, Stanley J.; Lemanske, Robert F.; Zeiger, Robert S.; Strunk, Robert C.; Martinez, Fernando D.; Boushey, Homer; Chinchilli, Vernon M.; Israel, Elliot; Mauger, David; Koppelman, Gerard H.; Postma, Dirkje S.; Nieuwenhuis, Maartje A. E.; Vonk, Judith M.; Lima, John J.; Irvin, Charles G.; Peters, Stephen P.; Kubo, Michiaki; Tamari, Mayumi; Nakamura, Yusuke; Litonjua, Augusto A.; Tantisira, Kelan G.; Raby, Benjamin A.; Bleecker, Eugene R.; Meyers, Deborah A.; London, Stephanie J.; Barnes, Kathleen C.; Gilliland, Frank D.; Williams, L. Keoki; Burchard, Esteban G.; Nicolae, Dan L.; Ober, Carole; DeMeo, Dawn L.; Silverman, Edwin K.; Paigen, Beverly; Churchill, Gary; Shapiro, Steve D.; Weiss, Scott

    2013-01-01

    Asthma is a common chronic respiratory disease characterized by airway hyperresponsiveness (AHR). The genetics of asthma have been widely studied in mouse and human, and homologous genomic regions have been associated with mouse AHR and human asthma-related phenotypes. Our goal was to identify

  12. A genome-wide association study identifies susceptibility loci for ovarian cancer at 2q31 and 8q24

    DEFF Research Database (Denmark)

    Goode, Ellen L; Chenevix-Trench, Georgia; Song, Honglin

    2010-01-01

    Ovarian cancer accounts for more deaths than all other gynecological cancers combined. To identify common low-penetrance ovarian cancer susceptibility genes, we conducted a genome-wide association study of 507,094 SNPs in 1,768 individuals with ovarian cancer (cases) and 2,354 controls, with foll...

  13. Genome-wide association studies of autoimmune vitiligo identify 23 new risk loci and highlight key pathways and regulatory variants

    NARCIS (Netherlands)

    Jin, Ying; Andersen, Genevieve; Yorgov, Daniel; Ferrara, Tracey M.; Ben, Songtao; Brownson, Kelly M.; Holland, Paulene J.; Birlea, Stanca A.; Siebert, Janet; Hartmann, Anke; Lienert, Anne; van Geel, Nanja; Lambert, Jo; Luiten, Rosalie M.; Wolkerstorfer, Albert; Wietze van der Veen, J. P.; Bennett, Dorothy C.; Taïeb, Alain; Ezzedine, Khaled; Kemp, E. Helen; Gawkrodger, David J.; Weetman, Anthony P.; Kõks, Sulev; Prans, Ele; Kingo, Külli; Karelson, Maire; Wallace, Margaret R.; McCormack, Wayne T.; Overbeck, Andreas; Moretti, Silvia; Colucci, Roberta; Picardo, Mauro; Silverberg, Nanette B.; Olsson, Mats; Valle, Yan; Korobko, Igor; Böhm, Markus; Lim, Henry W.; Hamzavi, Iltefat; Zhou, Li; Mi, Qing-Sheng; Fain, Pamela R.; Santorico, Stephanie A.; Spritz, Richard A.

    2016-01-01

    Vitiligo is an autoimmune disease in which depigmented skin results from the destruction of melanocytes, with epidemiological association with other autoimmune diseases. In previous linkage and genome-wide association studies (GWAS1 and GWAS2), we identified 27 vitiligo susceptibility loci in

  14. Genome-wide association analysis identifies new lung cancer susceptibility loci in never-smoking women in Asia.

    NARCIS (Netherlands)

    Lan, Q.; Hsiung, C.A.; Matsuo, K.; Hong, Y.C.; Seow, A.; Wang, Z.; Hosgood, H.D.; Chen, K.; Wang, J.C.; Chatterjee, N.; Hu, W.; Wong, M.P.; Zheng, W.; Caporaso, N.; Park, J.Y.; Chen, C.J.; Kim, Y.H.; Kim, Y.T.; Landi, M.T.; Shen, H.; Lawrence, C.; Burdett, L.; Yeager, M.; Yuenger, J.; Jacobs, K.B.; Chang, I.S.; Mitsudomi, T.; Kim, H.N.; Chang, G.C.; Bassig, B.A.; Tucker, M.; Wei, F.; Yin, Y.; Wu, C.; An, S.J.; Qian, B.; Lee, V.H.; Lu, D.; Liu, J.; Jeon, H.S.; Hsiao, C.F.; Sung, J.S.; Kim, J.H.; Gao, Y.T.; Tsai, Y.H.; Jung, Y.J.; Guo, H.; Hu, Z.; Hutchinson, A.; Wang, W.C.; Klein, R.; Chung, C.C.; Oh, I.J.; Chen, K.Y.; Berndt, S.I.; He, X.; Wu, W.; Chang, J.; Zhang, X.C.; Huang, M.S.; Zheng, H.; Wang, J.; Zhao, X.|info:eu-repo/dai/nl/413577805; Li, Y.; Choi, J.E.; Su, W.C.; Park, K.H.; Sung, S.W.; Shu, X.O.; Chen, Y.M.; Liu, L.; Kang, C.H.; Hu, L.; Chen, C.H.; Pao, W.; Kim, Y.C.; Yang, T.Y.; Xu, J.; Guan, P.; Tan, W.; Su, J.; Wang, C.L.; Li, H.; Sihoe, A.D.; Zhao, Z.|info:eu-repo/dai/nl/304120995; Chen, Y.; Choi, Y.Y.; Hung, J.Y.; Kim, J.S.; Yoon, H.I.; Cai, Q.; Lin, C.C.; Park, I.K.; Xu, P.; Dong, J.; Kim, C.; He, Q; Perng, R.P.; Kohno, T.; Kweon, S.S.; Chen, C.Y.; Vermeulen, R.|info:eu-repo/dai/nl/216532620; Wu, J.; Lim, W.Y.; Chen, K.C.; Chow, W.H.; Ji, B.T.; Chan, J.K.; Chu, M.; Li, Y.J.; Yokota, J.; Li, J.; Chen, H.; Xiang, Y.B.; Yu, C.J.; Kunitoh, H.; Wu, G.; Jin, L.; Lo, Y.L.; Shiraishi, K.; Chen, Y.H.; Lin, H.C.; Wu, T.; WU, Y.; Yang, P.C.; Zhou, B.; Shin, M.H.; Fraumeni, J.F.; Lin, D.; Chanock, S.J.; Rothman, N.

    2012-01-01

    To identify common genetic variants that contribute to lung cancer susceptibility, we conducted a multistage genome-wide association study of lung cancer in Asian women who never smoked. We scanned 5,510 never-smoking female lung cancer cases and 4,544 controls drawn from 14 studies from mainland

  15. Genome-wide meta-analysis identifies 11 new loci for anthropometric traits and provides insights into genetic architecture

    NARCIS (Netherlands)

    S.I. Berndt (Sonja); S. Gustafsson (Stefan); R. Mägi (Reedik); A. Ganna (Andrea); E. Wheeler (Eleanor); M.F. Feitosa (Mary Furlan); A.E. Justice (Anne); K.L. Monda (Keri); D.C. Croteau-Chonka (Damien); F.R. Day (Felix); T. Esko (Tõnu); M. Fall (Magnus); T. Ferreira (Teresa); D. Gentilini (Davide); A.U. Jackson (Anne); J. Luan; J.C. Randall (Joshua); S. Vedantam (Sailaja); C.J. Willer (Cristen); T.W. Winkler (Thomas); A.R. Wood (Andrew); T. Workalemahu (Tsegaselassie); Y.-J. Hu (Yi-Juan); S.H. Lee (Sang Hong); L. Liang (Liming); D.Y. Lin (Dan); J. Min (Josine); B.M. Neale (Benjamin); G. Thorleifsson (Gudmar); J. Yang (Jian); E. Albrecht (Eva); N. Amin (Najaf); J.L. Bragg-Gresham (Jennifer L.); G. Cadby (Gemma); M. den Heijer (Martin); N. Eklund (Niina); K. Fischer (Krista); A. Goel (Anuj); J.J. Hottenga (Jouke Jan); J.E. Huffman (Jennifer); I. Jarick (Ivonne); A. Johansson (Åsa); T. Johnson (Toby); S. Kanoni (Stavroula); M.E. Kleber (Marcus); I.R. König (Inke); K. Kristiansson (Kati); Z. Kutalik (Zoltán); C. Lamina (Claudia); C. Lecoeur (Cécile); G. Li (Guo); M. Mangino (Massimo); W.L. McArdle (Wendy); M.C. Medina-Gomez (Carolina); M. Müller-Nurasyid (Martina); J.S. Ngwa; I.M. Nolte (Ilja); L. Paternoster (Lavinia); S. Pechlivanis (Sonali); M. Perola (Markus); M.J. Peters (Marjolein); M. Preuss (Michael); L.M. Rose (Lynda); J. Shi (Jianxin); D. Shungin (Dmitry); G.D. Smith; R.J. Strawbridge (Rona); I. Surakka (Ida); A. Teumer (Alexander); M.D. Trip (Mieke); J.P. Tyrer (Jonathan); J.V. van Vliet-Ostaptchouk (Jana); L. Vandenput (Liesbeth); L. Waite (Lindsay); J.H. Zhao (Jing Hua); D. Absher (Devin); F.W. Asselbergs (Folkert); M. Atalay (Mustafa); A.P. Attwood (Antony); A.J. Balmforth (Anthony); D.C.G. Basart (Dick); J.P. Beilby (John); L.L. Bonnycastle (Lori); P. Brambilla (Paolo); M. Bruinenberg (M.); H. Campbell (Harry); D.I. Chasman (Daniel); P.S. Chines (Peter); F.S. Collins (Francis); J. Connell (John); W. O Cookson (William); U. de Faire (Ulf); F. de Vegt (Femmie); M. Dei (Mariano); M. Dimitriou (Maria); T. Edkins (Ted); K. Estrada Gil (Karol); D.M. Evans (David); M. Farrall (Martin); F. Ferrario (Franco); J. Ferrières (Jean); L. Franke (Lude); F. Frau (Francesca); P.V. Gejman (Pablo); H. Grallert (Harald); H. Grönberg (Henrik); V. Gudnason (Vilmundur); A. Hall (Anne); A.S. Hall (Alistair); A.L. Hartikainen; C. Hayward (Caroline); N.L. Heard-Costa (Nancy); A.C. Heath (Andrew); J. Hebebrand (Johannes); G. Homuth (Georg); F.B. Hu (Frank); S.E. Hunt (Sarah); E. Hyppönen (Elina); C. Iribarren (Carlos); K.B. Jacobs (Kevin); J.-O. Jansson (John-Olov); A. Jula (Antti); M. Kähönen (Mika); S. Kathiresan (Sekar); F. Kee (F.); K-T. Khaw (Kay-Tee); M. Kivimaki (Mika); W. Koenig (Wolfgang); A. Kraja (Aldi); M. Kumari (Meena); K. Kuulasmaa (Kari); J. Kuusisto (Johanna); J. Laitinen (Jaana); T.A. Lakka (Timo); C. Langenberg (Claudia); L.J. Launer (Lenore); L. Lind (Lars); J. Lindstrom (Jaana); J. Liu (Jianjun); A. Liuzzi (Antonio); M.L. Lokki; M. Lorentzon (Mattias); P.A. Madden (Pamela); P.K. Magnusson (Patrik); P. Manunta (Paolo); D. Marek (Diana); W. März (Winfried); I.M. Leach (Irene Mateo); B. McKnight (Barbara); S.E. Medland (Sarah Elizabeth); E. Mihailov (Evelin); L. Milani (Lili); G.W. Montgomery (Grant); V. Mooser (Vincent); T.W. Mühleisen (Thomas); P. Munroe (Patricia); A.W. Musk (Arthur); N. Narisu (Narisu); G. Navis (Gerjan); G. Nicholson (Ggeorge); C. Nohr (Christian); K. Ong (Ken); B.A. Oostra (Ben); C.N.A. Palmer (Colin); A. Palotie (Aarno); J. Peden (John); N. Pedersen; A. Peters (Annette); O. Polasek (Ozren); A. Pouta (Anneli); P.P. Pramstaller (Peter Paul); I. Prokopenko (Inga); C. Pütter (Carolin); A. Radhakrishnan (Aparna); O. Raitakari (Olli); A. Rendon (Augusto); F. Rivadeneira Ramirez (Fernando); I. Rudan (Igor); T. Saaristo (Timo); J.G. Sambrook (Jennifer); A.R. Sanders (Alan); S. Sanna (Serena); J. Saramies (Jouko); S. Schipf (Sabine); S. Schreiber (Stefan); H. Schunkert (Heribert); S.-Y. Shin; S. Signorini (Stefano); J. Sinisalo (Juha); B. Skrobek (Boris); N. Soranzo (Nicole); A. Stancáková (Alena); K. Stark (Klaus); J. Stephens (Jonathan); K. Stirrups (Kathy); R.P. Stolk (Ronald); M. Stumvoll (Michael); A.J. Swift (Amy); E.V. Theodoraki (Eirini); B. Thorand (Barbara); D.-A. Tregouet (David-Alexandre); E. Tremoli (Elena); M.M. van der Klauw (Melanie); J.B.J. van Meurs (Joyce); S.H.H.M. Vermeulen (Sita); J. Viikari (Jorma); J. Virtamo (Jarmo); V. Vitart (Veronique); G. Waeber (Gérard); Z. Wang (Zhaoming); E. Widen (Elisabeth); S.H. Wild (Sarah); G.A.H.M. Willemsen (Gonneke); B. Winkelmann; J.C.M. Witteman (Jacqueline); B.H.R. Wolffenbuttel (Bruce); A. Wong (Andrew); A.F. Wright (Alan); M.C. Zillikens (Carola); P. Amouyel (Philippe); B.O. Boehm (Bernhard); E.A. Boerwinkle (Eric); D.I. Boomsma (Dorret); M. Caulfield (Mark); S.J. Chanock (Stephen); L.A. Cupples (Adrienne); D. Cusi (Daniele); G.V. Dedoussis (George); J. Erdmann (Jeanette); J.G. Eriksson (Johan); P.W. Franks (Paul); P. Froguel (Philippe); C. Gieger (Christian); U. Gyllensten (Ulf); A. Hamsten (Anders); T.B. Harris (Tamara); C. Hengstenberg (Christian); A.A. Hicks (Andrew); A. Hingorani (Aroon); A. Hinney (Anke); A. Hofman (Albert); G.K. Hovingh (Kees); K. Hveem (Kristian); T. Illig (Thomas); M.-R. Jarvelin (Marjo-Riitta); K.-H. Jöckel (Karl-Heinz); S. Keinanen-Kiukaanniemi (Sirkka); L.A.L.M. Kiemeney (Bart); D. Kuh (Diana); M. Laakso (Markku); T. Lehtimäki (Terho); D.F. Levinson (Douglas); N.G. Martin (Nicholas); A. Metspalu (Andres); A.D. Morris (Andrew); M.S. Nieminen (Markku); I. Njølstad (Inger); C. Ohlsson (Claes); A.J. Oldehinkel (Albertine); W.H. Ouwehand (Willem); C. Palmer (Cameron); B.W.J.H. Penninx (Brenda); C. Power (Christopher); M.A. Province (Mike); B.M. Psaty (Bruce); L. Qi (Lu); R. Rauramaa (Rainer); P.M. Ridker (Paul); S. Ripatti (Samuli); V. Salomaa (Veikko); N.J. Samani (Nilesh); H. Snieder (Harold); H.G. Sorensen; T.D. Spector (Timothy); J-A. Zwart (John-Anker); A. Tönjes (Anke); J. Tuomilehto (Jaakko); A.G. Uitterlinden (André); M. Uusitupa (Matti); P. van der Harst (Pim); P. Vollenweider (Peter); H. Wallaschofski (Henri); N.J. Wareham (Nick); H. Watkins (Hugh); H.E. Wichmann (Heinz Erich); J.F. Wilson (James F); G.R. Abecasis (Gonçalo); T.L. Assimes (Themistocles); I.E. Barroso (Inês); M. Boehnke (Michael); I.B. Borecki (Ingrid); P. Deloukas (Panagiotis); C. Fox (Craig); T.M. Frayling (Timothy); L. Groop (Leif); T. Haritunian (Talin); I.M. Heid (Iris); D. Hunter (David); R.C. Kaplan (Robert); F. Karpe (Fredrik); M.F. Moffatt (Miriam); K.L. Mohlke (Karen); J.R. O´Connell; Y. Pawitan (Yudi); E.E. Schadt (Eric); D. Schlessinger (David); V. Steinthorsdottir (Valgerdur); D.P. Strachan (David); U. Thorsteinsdottir (Unnur); C.M. van Duijn (Cornelia); P.M. Visscher (Peter); A.M. Di Blasio (Anna Maria); J.N. Hirschhorn (Joel); C.M. Lindgren (Cecilia); A.D. Morris (Andrew); D. Meyre (David); A. Scherag (Andre); M.I. McCarthy (Mark); E.K. Speliotes (Elizabeth); K.E. North (Kari); R.J.F. Loos (Ruth); E. Ingelsson (Erik)

    2013-01-01

    textabstractApproaches exploiting trait distribution extremes may be used to identify loci associated with common traits, but it is unknown whether these loci are generalizable to the broader population. In a genome-wide search for loci associated with the upper versus the lower 5th percentiles of

  16. Genome-wide meta-analysis identifies 11 new loci for anthropometric traits and provides insights into genetic architecture

    NARCIS (Netherlands)

    Berndt, Sonja I; Gustafsson, Stefan; Mägi, Reedik; Ganna, Andrea; Wheeler, Eleanor; Feitosa, Mary F; Justice, Anne E; Monda, Keri L; Croteau-Chonka, Damien C; Day, Felix R; Esko, Tõnu; Fall, Tove; Ferreira, Teresa; Gentilini, Davide; Jackson, Anne U; Luan, Jian'an; Randall, Joshua C; Vedantam, Sailaja; Willer, Cristen J; Winkler, Thomas W; Wood, Andrew R; Workalemahu, Tsegaselassie; Hu, Yi-Juan; Lee, Sang Hong; Liang, Liming; Lin, Dan-Yu; Min, Josine L; Neale, Benjamin M; Thorleifsson, Gudmar; Yang, Jian; Albrecht, Eva; Amin, Najaf; Bragg-Gresham, Jennifer L; Cadby, Gemma; den Heijer, Martin; Eklund, Niina; Fischer, Krista; Goel, Anuj; Hottenga, Jouke-Jan; Huffman, Jennifer E; Jarick, Ivonne; Johansson, Åsa; Johnson, Toby; Kanoni, Stavroula; Kleber, Marcus E; König, Inke R; Kristiansson, Kati; Kutalik, Zoltán; Lamina, Claudia; Lecoeur, Cecile; Li, Guo; Mangino, Massimo; McArdle, Wendy L; Medina-Gomez, Carolina; Müller-Nurasyid, Martina; Ngwa, Julius S; Nolte, Ilja M; Paternoster, Lavinia; Pechlivanis, Sonali; Perola, Markus; Peters, Marjolein J; Preuss, Michael; Rose, Lynda M; Shi, Jianxin; Shungin, Dmitry; Smith, Albert Vernon; Strawbridge, Rona J; Surakka, Ida; Teumer, Alexander; Trip, Mieke D; Tyrer, Jonathan; Van Vliet-Ostaptchouk, Jana V; Vandenput, Liesbeth; Waite, Lindsay L; Zhao, Jing Hua; Absher, Devin; Asselbergs, Folkert W; Atalay, Mustafa; Attwood, Antony P; Balmforth, Anthony J; Basart, Hanneke; Beilby, John; Bonnycastle, Lori L; Brambilla, Paolo; Bruinenberg, Marcel; Campbell, Harry; Chasman, Daniel I; Chines, Peter S; Collins, Francis S; Connell, John M; Cookson, William O; de Faire, Ulf; de Vegt, Femmie; Dei, Mariano; Dimitriou, Maria; Edkins, Sarah; Estrada, Karol; Evans, David M; Farrall, Martin; Ferrario, Marco M; Ferrières, Jean; Franke, Lude; Frau, Francesca; Gejman, Pablo V; Grallert, Harald; Grönberg, Henrik; Gudnason, Vilmundur; Hall, Alistair S; Hall, Per; Hartikainen, Anna-Liisa; Hayward, Caroline; Heard-Costa, Nancy L; Heath, Andrew C; Hebebrand, Johannes; Homuth, Georg; Hu, Frank B; Hunt, Sarah E; Hyppönen, Elina; Iribarren, Carlos; Jacobs, Kevin B; Jansson, John-Olov; Jula, Antti; Kähönen, Mika; Kathiresan, Sekar; Kee, Frank; Khaw, Kay-Tee; Kivimäki, Mika; Koenig, Wolfgang; Kraja, Aldi T; Kumari, Meena; Kuulasmaa, Kari; Kuusisto, Johanna; Laitinen, Jaana H; Lakka, Timo A; Langenberg, Claudia; Launer, Lenore J; Lind, Lars; Lindström, Jaana; Liu, Jianjun; Liuzzi, Antonio; Lokki, Marja-Liisa; Lorentzon, Mattias; Madden, Pamela A; Magnusson, Patrik K; Manunta, Paolo; Marek, Diana; März, Winfried; Mateo Leach, Irene; McKnight, Barbara; Medland, Sarah E; Mihailov, Evelin; Milani, Lili; Montgomery, Grant W; Mooser, Vincent; Mühleisen, Thomas W; Munroe, Patricia B; Musk, Arthur W; Narisu, Narisu; Navis, Gerjan; Nicholson, George; Nohr, Ellen A; Ong, Ken K; Oostra, Ben A; Palmer, Colin N A; Palotie, Aarno; Peden, John F; Pedersen, Nancy; Peters, Annette; Polasek, Ozren; Pouta, Anneli; Pramstaller, Peter P; Prokopenko, Inga; Pütter, Carolin; Radhakrishnan, Aparna; Raitakari, Olli; Rendon, Augusto; Rivadeneira, Fernando; Rudan, Igor; Saaristo, Timo E; Sambrook, Jennifer G; Sanders, Alan R; Sanna, Serena; Saramies, Jouko; Schipf, Sabine; Schreiber, Stefan; Schunkert, Heribert; Shin, So-Youn; Signorini, Stefano; Sinisalo, Juha; Skrobek, Boris; Soranzo, Nicole; Stančáková, Alena; Stark, Klaus; Stephens, Jonathan C; Stirrups, Kathleen; Stolk, Ronald P; Stumvoll, Michael; Swift, Amy J; Theodoraki, Eirini V; Thorand, Barbara; Tregouet, David-Alexandre; Tremoli, Elena; Van der Klauw, Melanie M; van Meurs, Joyce B J; Vermeulen, Sita H; Viikari, Jorma; Virtamo, Jarmo; Vitart, Veronique; Waeber, Gérard; Wang, Zhaoming; Widén, Elisabeth; Wild, Sarah H; Willemsen, Gonneke; Winkelmann, Bernhard R; Witteman, Jacqueline C M; Wolffenbuttel, Bruce H R; Wong, Andrew; Wright, Alan F; Zillikens, M Carola; Amouyel, Philippe; Boehm, Bernhard O; Boerwinkle, Eric; Boomsma, Dorret I; Caulfield, Mark J; Chanock, Stephen J; Cupples, L Adrienne; Cusi, Daniele; Dedoussis, George V; Erdmann, Jeanette; Eriksson, Johan G; Franks, Paul W; Froguel, Philippe; Gieger, Christian; Gyllensten, Ulf; Hamsten, Anders; Harris, Tamara B; Hengstenberg, Christian; Hicks, Andrew A; Hingorani, Aroon; Hinney, Anke; Hofman, Albert; Hovingh, Kees G; Hveem, Kristian; Illig, Thomas; Jarvelin, Marjo-Riitta; Jöckel, Karl-Heinz; Keinanen-Kiukaanniemi, Sirkka M; Kiemeney, Lambertus A; Kuh, Diana; Laakso, Markku; Lehtimäki, Terho; Levinson, Douglas F; Martin, Nicholas G; Metspalu, Andres; Morris, Andrew D; Nieminen, Markku S; Njølstad, Inger; Ohlsson, Claes; Oldehinkel, Albertine J; Ouwehand, Willem H; Palmer, Lyle J; Penninx, Brenda; Power, Chris; Province, Michael A; Psaty, Bruce M; Qi, Lu; Rauramaa, Rainer; Ridker, Paul M; Ripatti, Samuli; Salomaa, Veikko; Samani, Nilesh J; Snieder, Harold; Sørensen, Thorkild I A; Spector, Timothy D; Stefansson, Kari; Tönjes, Anke; Tuomilehto, Jaakko; Uitterlinden, André G; Uusitupa, Matti; van der Harst, Pim; Vollenweider, Peter; Wallaschofski, Henri; Wareham, Nicholas J; Watkins, Hugh; Wichmann, H-Erich; Wilson, James F; Abecasis, Goncalo R; Assimes, Themistocles L; Barroso, Inês; Boehnke, Michael; Borecki, Ingrid B; Deloukas, Panos; Fox, Caroline S; Frayling, Timothy; Groop, Leif C; Haritunian, Talin; Heid, Iris M; Hunter, David; Kaplan, Robert C; Karpe, Fredrik; Moffatt, Miriam F; Mohlke, Karen L; O'Connell, Jeffrey R; Pawitan, Yudi; Schadt, Eric E; Schlessinger, David; Steinthorsdottir, Valgerdur; Strachan, David P; Thorsteinsdottir, Unnur; van Duijn, Cornelia M; Visscher, Peter M; Di Blasio, Anna Maria; Hirschhorn, Joel N; Lindgren, Cecilia M; Morris, Andrew P; Meyre, David; Scherag, André; McCarthy, Mark I; Speliotes, Elizabeth K; North, Kari E; Loos, Ruth J F; Ingelsson, Erik

    Approaches exploiting trait distribution extremes may be used to identify loci associated with common traits, but it is unknown whether these loci are generalizable to the broader population. In a genome-wide search for loci associated with the upper versus the lower 5th percentiles of body mass

  17. Genome-wide meta-analysis identifies 11 new loci for anthropometric traits and provides insights into genetic architecture

    NARCIS (Netherlands)

    Berndt, Sonja I.; Gustafsson, Stefan; Mägi, Reedik; Ganna, Andrea; Wheeler, Eleanor; Feitosa, Mary F.; Justice, Anne E.; Monda, Keri L.; Croteau-Chonka, Damien C.; Day, Felix R.; Esko, Tõnu; Fall, Tove; Ferreira, Teresa; Gentilini, Davide; Jackson, Anne U.; Luan, Jian'an; Randall, Joshua C.; Vedantam, Sailaja; Willer, Cristen J.; Winkler, Thomas W.; Wood, Andrew R.; Workalemahu, Tsegaselassie; Hu, Yi-Juan; Lee, Sang Hong; Liang, Liming; Lin, Dan-Yu; Min, Josine L.; Neale, Benjamin M.; Thorleifsson, Gudmar; Yang, Jian; Albrecht, Eva; Amin, Najaf; Bragg-Gresham, Jennifer L.; Cadby, Gemma; den Heijer, Martin; Eklund, Niina; Fischer, Krista; Goel, Anuj; Hottenga, Jouke-Jan; Huffman, Jennifer E.; Jarick, Ivonne; Johansson, Asa; Johnson, Toby; Kanoni, Stavroula; Kleber, Marcus E.; König, Inke R.; Kristiansson, Kati; Kutalik, Zoltán; Lamina, Claudia; Lecoeur, Cecile; Li, Guo; Mangino, Massimo; McArdle, Wendy L.; Medina-Gomez, Carolina; Müller-Nurasyid, Martina; Ngwa, Julius S.; Nolte, Ilja M.; Paternoster, Lavinia; Pechlivanis, Sonali; Perola, Markus; Peters, Marjolein J.; Preuss, Michael; Rose, Lynda M.; Shi, Jianxin; Shungin, Dmitry; Smith, Albert Vernon; Strawbridge, Rona J.; Surakka, Ida; Teumer, Alexander; Trip, Mieke D.; Tyrer, Jonathan; van Vliet-Ostaptchouk, Jana V.; Vandenput, Liesbeth; Waite, Lindsay L.; Zhao, Jing Hua; Absher, Devin; Asselbergs, Folkert W.; Atalay, Mustafa; Attwood, Antony P.; Balmforth, Anthony J.; Basart, Hanneke; Beilby, John; Bonnycastle, Lori L.; Brambilla, Paolo; Bruinenberg, Marcel; Campbell, Harry; Chasman, Daniel I.; Chines, Peter S.; Collins, Francis S.; Connell, John M.; Cookson, William O.; de Faire, Ulf; de Vegt, Femmie; dei, Mariano; Dimitriou, Maria; Edkins, Sarah; Estrada, Karol; Evans, David M.; Farrall, Martin; Ferrario, Marco M.; Ferrières, Jean; Franke, Lude; Frau, Francesca; Gejman, Pablo V.; Grallert, Harald; Grönberg, Henrik; Gudnason, Vilmundur; Hall, Alistair S.; Hall, Per; Hartikainen, Anna-Liisa; Hayward, Caroline; Heard-Costa, Nancy L.; Heath, Andrew C.; Hebebrand, Johannes; Homuth, Georg; Hu, Frank B.; Hunt, Sarah E.; Hyppönen, Elina; Iribarren, Carlos; Jacobs, Kevin B.; Jansson, John-Olov; Jula, Antti; Kähönen, Mika; Kathiresan, Sekar; Kee, Frank; Khaw, Kay-Tee; Kivimäki, Mika; Koenig, Wolfgang; Kraja, Aldi T.; Kumari, Meena; Kuulasmaa, Kari; Kuusisto, Johanna; Laitinen, Jaana H.; Lakka, Timo A.; Langenberg, Claudia; Launer, Lenore J.; Lind, Lars; Lindström, Jaana; Liu, Jianjun; Liuzzi, Antonio; Lokki, Marja-Liisa; Lorentzon, Mattias; Madden, Pamela A.; Magnusson, Patrik K.; Manunta, Paolo; Marek, Diana; März, Winfried; Mateo Leach, Irene; McKnight, Barbara; Medland, Sarah E.; Mihailov, Evelin; Milani, Lili; Montgomery, Grant W.; Mooser, Vincent; Mühleisen, Thomas W.; Munroe, Patricia B.; Musk, Arthur W.; Narisu, Narisu; Navis, Gerjan; Nicholson, George; Nohr, Ellen A.; Ong, Ken K.; Oostra, Ben A.; Palmer, Colin N. A.; Palotie, Aarno; Peden, John F.; Pedersen, Nancy; Peters, Annette; Polasek, Ozren; Pouta, Anneli; Pramstaller, Peter P.; Prokopenko, Inga; Pütter, Carolin; Radhakrishnan, Aparna; Raitakari, Olli; Rendon, Augusto; Rivadeneira, Fernando; Rudan, Igor; Saaristo, Timo E.; Sambrook, Jennifer G.; Sanders, Alan R.; Sanna, Serena; Saramies, Jouko; Schipf, Sabine; Schreiber, Stefan; Schunkert, Heribert; Shin, So-Youn; Signorini, Stefano; Sinisalo, Juha; Skrobek, Boris; Soranzo, Nicole; Stančáková, Alena; Stark, Klaus; Stephens, Jonathan C.; Stirrups, Kathleen; Stolk, Ronald P.; Stumvoll, Michael; Swift, Amy J.; Theodoraki, Eirini V.; Thorand, Barbara; Tregouet, David-Alexandre; Tremoli, Elena; van der Klauw, Melanie M.; van Meurs, Joyce B. J.; Vermeulen, Sita H.; Viikari, Jorma; Virtamo, Jarmo; Vitart, Veronique; Waeber, Gérard; Wang, Zhaoming; Widén, Elisabeth; Wild, Sarah H.; Willemsen, Gonneke; Winkelmann, Bernhard R.; Witteman, Jacqueline C. M.; Wolffenbuttel, Bruce H. R.; Wong, Andrew; Wright, Alan F.; Zillikens, M. Carola; Amouyel, Philippe; Boehm, Bernhard O.; Boerwinkle, Eric; Boomsma, Dorret I.; Caulfield, Mark J.; Chanock, Stephen J.; Cupples, L. Adrienne; Cusi, Daniele; Dedoussis, George V.; Erdmann, Jeanette; Eriksson, Johan G.; Franks, Paul W.; Froguel, Philippe; Gieger, Christian; Gyllensten, Ulf; Hamsten, Anders; Harris, Tamara B.; Hengstenberg, Christian; Hicks, Andrew A.; Hingorani, Aroon; Hinney, Anke; Hofman, Albert; Hovingh, Kees G.; Hveem, Kristian; Illig, Thomas; Jarvelin, Marjo-Riitta; Jöckel, Karl-Heinz; Keinanen-Kiukaanniemi, Sirkka M.; Kiemeney, Lambertus A.; Kuh, Diana; Laakso, Markku; Lehtimäki, Terho; Levinson, Douglas F.; Martin, Nicholas G.; Metspalu, Andres; Morris, Andrew D.; Nieminen, Markku S.; Njølstad, Inger; Ohlsson, Claes; Oldehinkel, Albertine J.; Ouwehand, Willem H.; Palmer, Lyle J.; Penninx, Brenda; Power, Chris; Province, Michael A.; Psaty, Bruce M.; Qi, Lu; Rauramaa, Rainer; Ridker, Paul M.; Ripatti, Samuli; Salomaa, Veikko; Samani, Nilesh J.; Snieder, Harold; Sørensen, Thorkild I. A.; Spector, Timothy D.; Stefansson, Kari; Tönjes, Anke; Tuomilehto, Jaakko; Uitterlinden, André G.; Uusitupa, Matti; van der Harst, Pim; Vollenweider, Peter; Wallaschofski, Henri; Wareham, Nicholas J.; Watkins, Hugh; Wichmann, H.-Erich; Wilson, James F.; Abecasis, Goncalo R.; Assimes, Themistocles L.; Barroso, Inês; Boehnke, Michael; Borecki, Ingrid B.; Deloukas, Panos; Fox, Caroline S.; Frayling, Timothy; Groop, Leif C.; Haritunian, Talin; Heid, Iris M.; Hunter, David; Kaplan, Robert C.; Karpe, Fredrik; Moffatt, Miriam F.; Mohlke, Karen L.; O'Connell, Jeffrey R.; Pawitan, Yudi; Schadt, Eric E.; Schlessinger, David; Steinthorsdottir, Valgerdur; Strachan, David P.; Thorsteinsdottir, Unnur; van Duijn, Cornelia M.; Visscher, Peter M.; Di Blasio, Anna Maria; Hirschhorn, Joel N.; Lindgren, Cecilia M.; Morris, Andrew P.; Meyre, David; Scherag, André; McCarthy, Mark I.; Speliotes, Elizabeth K.; North, Kari E.; Loos, Ruth J. F.; Ingelsson, Erik

    2013-01-01

    Approaches exploiting trait distribution extremes may be used to identify loci associated with common traits, but it is unknown whether these loci are generalizable to the broader population. In a genome-wide search for loci associated with the upper versus the lower 5th percentiles of body mass

  18. Identifying genomic changes associated with insecticide resistance in the dengue mosquito Aedes aegypti by deep targeted sequencing

    Science.gov (United States)

    Faucon, Frederic; Dusfour, Isabelle; Gaude, Thierry; Navratil, Vincent; Boyer, Frederic; Chandre, Fabrice; Sirisopa, Patcharawan; Thanispong, Kanutcharee; Juntarajumnong, Waraporn; Poupardin, Rodolphe; Chareonviriyaphap, Theeraphap; Girod, Romain; Corbel, Vincent; Reynaud, Stephane; David, Jean-Philippe

    2015-01-01

    The capacity of mosquitoes to resist insecticides threatens the control of diseases such as dengue and malaria. Until alternative control tools are implemented, characterizing resistance mechanisms is crucial for managing resistance in natural populations. Insecticide biodegradation by detoxification enzymes is a common resistance mechanism; however, the genomic changes underlying this mechanism have rarely been identified, precluding individual resistance genotyping. In particular, the role of copy number variations (CNVs) and polymorphisms of detoxification enzymes have never been investigated at the genome level, although they can represent robust markers of metabolic resistance. In this context, we combined target enrichment with high-throughput sequencing for conducting the first comprehensive screening of gene amplifications and polymorphisms associated with insecticide resistance in mosquitoes. More than 760 candidate genes were captured and deep sequenced in several populations of the dengue mosquito Ae. aegypti displaying distinct genetic backgrounds and contrasted resistance levels to the insecticide deltamethrin. CNV analysis identified 41 gene amplifications associated with resistance, most affecting cytochrome P450s overtranscribed in resistant populations. Polymorphism analysis detected more than 30,000 variants and strong selection footprints in specific genomic regions. Combining Bayesian and allele frequency filtering approaches identified 55 nonsynonymous variants strongly associated with resistance. Both CNVs and polymorphisms were conserved within regions but differed across continents, confirming that genomic changes underlying metabolic resistance to insecticides are not universal. By identifying novel DNA markers of insecticide resistance, this study opens the way for tracking down metabolic changes developed by mosquitoes to resist insecticides within and among populations. PMID:26206155

  19. A genome-wide association analysis of a broad psychosis phenotype identifies three loci for further investigation

    NARCIS (Netherlands)

    Bramon, Elvira; Pirinen, Matti; Strange, Amy; Lin, Kuang; Freeman, Colin; Bellenguez, Céline; Su, Zhan; Band, Gavin; Pearson, Richard; Vukcevic, Damjan; Langford, Cordelia; Deloukas, Panos; Hunt, Sarah; Gray, Emma; Dronov, Serge; Potter, Simon C.; Tashakkori-Ghanbaria, Avazeh; Edkins, Sarah; Bumpstead, Suzannah J.; Arranz, Maria J.; Bakker, Steven; Bender, Stephan; Bruggeman, Richard; Cahn, Wiepke; Chandler, David; Collier, David A.; Crespo-Facorro, Benedicto; Dazzan, Paola; de Haan, Lieuwe; Di Forti, Marta; Dragović, Milan; Giegling, Ina; Hall, Jeremy; Iyegbe, Conrad; Jablensky, Assen; Kahn, René S.; Kalaydjieva, Luba; Kravariti, Eugenia; Lawrie, Stephen; Linszen, Don H.; Mata, Ignacio; McDonald, Colm; McIntosh, Andrew; Myin-Germeys, Inez; Ophoff, Roel A.; Pariante, Carmine M.; Paunio, Tiina; Picchioni, Marco; Ripke, Stephan; Rujescu, Dan

    2014-01-01

    Genome-wide association studies (GWAS) have identified several loci associated with schizophrenia and/or bipolar disorder. We performed a GWAS of psychosis as a broad syndrome rather than within specific diagnostic categories. 1239 cases with schizophrenia, schizoaffective disorder, or psychotic

  20. A Genome-wide Association Analysis of a Broad Psychosis Phenotype Identifies Three Loci for Further Investigation

    NARCIS (Netherlands)

    Bramon, Elvira; Pirinen, Matti; Strange, Amy; Lin, Kuang; Freeman, Colin; Bellenguez, Celine; Su, Zhan; Band, Gavin; Pearson, Richard; Vukcevic, Damjan; Langford, Cordelia; Deloukas, Panos; Hunt, Sarah; Gray, Emma; Dronov, Serge; Potter, Simon C.; Tashakkori-Ghanbaria, Avazeh; Edkins, Sarah; Bumpstead, Suzannah J.; Arranz, Maria J.; Bakker, Steven; Bender, Stephan; Bruggeman, Richard; Cahn, Wiepke; Chandler, David; Collier, David A.; Crespo-Facorro, Benedicto; Dazzan, Paola; de Haan, Lieuwe; di Forti, Marta; Dragovic, Milan; Giegling, Ina; Hall, Jeremy; Iyegbe, Conrad; Jablensky, Assen; Kahn, Rene S.; Kalaydjieva, Luba; Kravariti, Eugenia; Lawrie, Stephen; Lins-Zen, Don H.; Mata, Ignacio; McDonald, Colm; McIntosh, Andrew; Myin-Germeys, Inez; Ophoff, Roel A.; Pariante, Carmine M.; Paunio, Tiina; Picchioni, Marco; Ripke, Stephan; Wiersma, Durk

    2014-01-01

    Background: Genome-wide association studies (GWAS) have identified several loci associated with schizophrenia and/or bipolar disorder. We performed a GWAS of psychosis as a broad syndrome rather than within specific diagnostic categories. Methods: 1239 cases with schizophrenia, schizoaffective

  1. Genome-wide association studies in the Japanese population identify seven novel loci for type 2 diabetes

    DEFF Research Database (Denmark)

    Imamura, Minako; Takahashi, Atsushi; Yamauchi, Toshimasa

    2016-01-01

    Genome-wide association studies (GWAS) have identified more than 80 susceptibility loci for type 2 diabetes (T2D), but most of its heritability still remains to be elucidated. In this study, we conducted a meta-analysis of GWAS for T2D in the Japanese population. Combined data from discovery and ...

  2. Genome-wide meta-analysis identifies 11 new loci for anthropometric traits and provides insights into genetic architecture

    DEFF Research Database (Denmark)

    Berndt, Sonja I; Gustafsson, Stefan; Mägi, Reedik

    2013-01-01

    Approaches exploiting trait distribution extremes may be used to identify loci associated with common traits, but it is unknown whether these loci are generalizable to the broader population. In a genome-wide search for loci associated with the upper versus the lower 5th percentiles of body mass ...

  3. Genome-wide association analysis of pain severity in dysmenorrhea identifies association at chromosome 1p13.2, near the nerve growth factor locus.

    Science.gov (United States)

    Jones, Amy V; Hockley, James R F; Hyde, Craig; Gorman, Donal; Sredic-Rhodes, Ana; Bilsland, James; McMurray, Gordon; Furlotte, Nicholas A; Hu, Youna; Hinds, David A; Cox, Peter J; Scollen, Serena

    2016-11-01

    Dysmenorrhea is a common chronic pelvic pain syndrome affecting women of childbearing potential. Family studies suggest that genetic background influences the severity of dysmenorrhea, but genetic predisposition and molecular mechanisms underlying dysmenorrhea are not understood. In this study, we conduct the first genome-wide association study to identify genetic factors associated with dysmenorrhea pain severity. A cohort of females of European descent (n = 11,891) aged 18 to 45 years rated their average dysmenorrhea pain severity. We used a linear regression model adjusting for age and body mass index, identifying one genome-wide significant (P dysmenorrhea pain were more likely to report being positive for endometriosis, polycystic ovarian syndrome, depression, and other psychiatric disorders. Our results indicate that dysmenorrhea pain severity is partly genetically determined. NGF already has an established role in chronic pain disorders, and our findings suggest that NGF may be an important mediator for gynaecological/pelvic pain in the viscera.

  4. The importance of identity-by-state information for the accuracy of genomic selection

    Directory of Open Access Journals (Sweden)

    Luan Tu

    2012-08-01

    Full Text Available Abstract Background It is commonly assumed that prediction of genome-wide breeding values in genomic selection is achieved by capitalizing on linkage disequilibrium between markers and QTL but also on genetic relationships. Here, we investigated the reliability of predicting genome-wide breeding values based on population-wide linkage disequilibrium information, based on identity-by-descent relationships within the known pedigree, and to what extent linkage disequilibrium information improves predictions based on identity-by-descent genomic relationship information. Methods The study was performed on milk, fat, and protein yield, using genotype data on 35 706 SNP and deregressed proofs of 1086 Italian Brown Swiss bulls. Genome-wide breeding values were predicted using a genomic identity-by-state relationship matrix and a genomic identity-by-descent relationship matrix (averaged over all marker loci. The identity-by-descent matrix was calculated by linkage analysis using one to five generations of pedigree data. Results We showed that genome-wide breeding values prediction based only on identity-by-descent genomic relationships within the known pedigree was as or more reliable than that based on identity-by-state, which implicitly also accounts for genomic relationships that occurred before the known pedigree. Furthermore, combining the two matrices did not improve the prediction compared to using identity-by-descent alone. Including different numbers of generations in the pedigree showed that most of the information in genome-wide breeding values prediction comes from animals with known common ancestors less than four generations back in the pedigree. Conclusions Our results show that, in pedigreed breeding populations, the accuracy of genome-wide breeding values obtained by identity-by-descent relationships was not improved by identity-by-state information. Although, in principle, genomic selection based on identity-by-state does not require

  5. Brucella abortus Strain 2308 Wisconsin Genome: Importance of the Definition of Reference Strains

    Science.gov (United States)

    Suárez-Esquivel, Marcela; Ruiz-Villalobos, Nazareth; Castillo-Zeledón, Amanda; Jiménez-Rojas, César; Roop II, R. Martin; Comerci, Diego J.; Barquero-Calvo, Elías; Chacón-Díaz, Carlos; Caswell, Clayton C.; Baker, Kate S.; Chaves-Olarte, Esteban; Thomson, Nicholas R.; Moreno, Edgardo; Letesson, Jean J.; De Bolle, Xavier; Guzmán-Verri, Caterina

    2016-01-01

    Brucellosis is a bacterial infectious disease affecting a wide range of mammals and a neglected zoonosis caused by species of the genetically homogenous genus Brucella. As in most studies on bacterial diseases, research in brucellosis is carried out by using reference strains as canonical models to understand the mechanisms underlying host pathogen interactions. We performed whole genome sequencing analysis of the reference strain B. abortus 2308 routinely used in our laboratory, including manual curated annotation accessible as an editable version through a link at https://en.wikipedia.org/wiki/Brucella#Genomics. Comparison of this genome with two publically available 2308 genomes showed significant differences, particularly indels related to insertional elements, suggesting variability related to the transposition of these elements within the same strain. Considering the outcome of high resolution genomic techniques in the bacteriology field, the conventional concept of strain definition needs to be revised. PMID:27746773

  6. Thirty new loci for age at menarche identified by a meta-analysis of genome-wide association studies

    NARCIS (Netherlands)

    C.E. Elks (Cathy); J.R.B. Perry (John); P. Sulem (Patrick); D.I. Chasman (Daniel); N. Franceschini (Nora); C. He (Chunyan); K.L. Lunetta (Kathryn); J.A. Visser (Jenny); E.M. Byrne (Enda); D.L. Cousminer (Diana); D.F. Gudbjartsson (Daniel); T. Esko (Tõnu); B. Feenstra (Bjarke); J.J. Hottenga (Jouke Jan); D.L. Koller (Daniel); Z. Kutalik (Zoltán); P. Lin (Peng); M. Mangino (Massimo); M. Marongiu (Mara); P.F. McArdle (Patrick); A.V. Smith (Albert Vernon); L. Stolk (Lisette); S. van Wingerden (Sophie); J.H. Zhao (Jing Hua); E. Albrecht (Eva); T. Corre (Tanguy); E. Ingelsson (Erik); C. Hayward (Caroline); P.K. Magnusson (Patrik); S. Ulivi (Shelia); N.M. Warrington (Nicole); L. Zgaga (Lina); H. Alavere (Helene); N. Amin (Najaf); T. Aspelund (Thor); S. Bandinelli (Stefania); I.E. Barroso (Inês); G. Berenson (Gerald); S.M. Bergmann (Sven); H. Blackburn (Hannah); E.A. Boerwinkle (Eric); J.E. Buring (Julie); F. Busonero; H. Campbell (Harry); S.J. Chanock (Stephen); W. Chen (Wei); M. Cornelis (Marilyn); D.J. Couper (David); A.D. Coviello (Andrea); P. d' Adamo (Pio); U. de Faire (Ulf); E.J.C. de Geus (Eco); P. Deloukas (Panagiotis); A. Döring (Angela); D.F. Easton (Douglas); G. Eiriksdottir (Gudny); V. Emilsson (Valur); J.G. Eriksson (Johan); L. Ferrucci (Luigi); A.R. Folsom (Aaron); T. Foroud (Tatiana); M. Garcia (Melissa); P. Gasparini (Paolo); F. Geller (Frank); C. Gieger (Christian); V. Gudnason (Vilmundur); A.S. Hall (Alistair); S.E. Hankinson (Susan); L. Ferreli (Liana); A.C. Heath (Andrew); D.G. Hernandez (Dena); A. Hofman (Albert); F.B. Hu (Frank); T. Illig (Thomas); M.R. Järvelin; A.D. Johnson (Andrew); D. Karasik (David); K-T. Khaw (Kay-Tee); D.P. Kiel (Douglas); T.O. Kilpelänen (Tuomas); I. Kolcic (Ivana); P. Kraft (Peter); L.J. Launer (Lenore); J.S.E. Laven (Joop); S. Li (Shengxu); J. Liu (Jianjun); D. Levy (Daniel); N.G. Martin (Nicholas); M. Melbye (Mads); V. Mooser (Vincent); J.C. Murray (Jeffrey); M.A. Nalls (Michael); P. Navarro (Pau); M. Nelis (Mari); A.R. Ness (Andrew); K. Northstone (Kate); B.A. Oostra (Ben); M. Peacock (Munro); C. Palmer (Cameron); A. Palotie (Aarno); G. Paré (Guillaume); A.N. Parker (Alex); N.L. Pedersen (Nancy); L. Peltonen (Leena Johanna); C.E. Pennell (Craig); P.D.P. Pharoah (Paul); O. Polasek (Ozren); A.S. Plump (Andrew); A. Pouta (Anneli); E. Porcu (Eleonora); T. Rafnar (Thorunn); J.P. Rice (John); S.M. Ring (Susan); F. Rivadeneira Ramirez (Fernando); I. Rudan (Igor); C. Sala (Cinzia); V. Salomaa (Veikko); S. Sanna (Serena); D. Schlessinger; N.J. Schork (Nicholas); A. Scuteri (Angelo); A.V. Segrè (Ayellet); A.R. Shuldiner (Alan); N. Soranzo (Nicole); U. Sovio (Ulla); S.R. Srinivasan (Sathanur); D.P. Strachan (David); M.L. Tammesoo; E. Tikkanen (Emmi); D. Toniolo (Daniela); K. Tsui (Kim); L. Tryggvadottir (Laufey); J.P. Tyrer (Jonathan); M. Uda (Manuela); R.M. van Dam (Rob); J.B.J. van Meurs (Joyce); P. Vollenweider (Peter); G. Waeber (Gérard); N.J. Wareham (Nick); D. Waterworth (Dawn); H.E. Wichmann (Heinz Erich); G.A.H.M. Willemsen (Gonneke); J.F. Wilson (James); A.F. Wright (Alan); L. Young (Lauren); G. Zhai (Guangju); W.V. Zhuang; L.J. Bierut (Laura); D.I. Boomsma (Dorret); H.A. Boyd (Heather); L. Crisponi (Laura); E.W. Demerath (Ellen); P. Tikka-Kleemola (Päivi); M.J. Econs (Michael); T.B. Harris (Tamara); D. Hunter (David); R.J.F. Loos (Ruth); A. Metspalu (Andres); G.W. Montgomery (Grant); P.M. Ridker (Paul); T.D. Spector (Tim); E.A. Streeten (Elizabeth); K. Stefansson (Kari); U. Thorsteinsdottir (Unnur); A.G. Uitterlinden (André); E. Widen (Elisabeth); J. Murabito (Joanne); K. Ong (Ken); M.N. Weedon (Michael)

    2010-01-01

    textabstractTo identify loci for age at menarche, we performed a meta-analysis of 32 genome-wide association studies in 87,802 women of European descent, with replication in up to 14,731 women. In addition to the known loci at LIN28B (P = 5.4 × 10 -60) and 9q31.2 (P = 2.2 × 10 -33), we identified 30

  7. Complete sequence and analysis of plastid genomes of two economically important red algae: Pyropia haitanensis and Pyropia yezoensis.

    Directory of Open Access Journals (Sweden)

    Li Wang

    Full Text Available Pyropia haitanensis and P. yezoensis are two economically important marine crops that are also considered to be research models to study the physiological ecology of intertidal seaweed communities, evolutionary biology of plastids, and the origins of sexual reproduction. This plastid genome information will facilitate study of breeding, population genetics and phylogenetics.We have fully sequenced using next-generation sequencing the circular plastid genomes of P. hatanensis (195,597 bp and P. yezoensis (191,975 bp, the largest of all the plastid genomes of the red lineage sequenced to date. Organization and gene contents of the two plastids were similar, with 211-213 protein-coding genes (including 29-31 unknown-function ORFs, 37 tRNA genes, and 6 ribosomal RNA genes, suggesting a largest coding capacity in the red lineage. In each genome, 14 protein genes overlapped and no interrupted genes were found, indicating a high degree of genomic condensation. Pyropia maintain an ancient gene content and conserved gene clusters in their plastid genomes, containing nearly complete repertoires of the plastid genes known in photosynthetic eukaryotes. Similarity analysis based on the whole plastid genome sequences showed the distance between P. haitanensis and P. yezoensis (0.146 was much smaller than that of Porphyra purpurea and P. haitanensis (0.250, and P. yezoensis (0.251; this supports re-grouping the two species in a resurrected genus Pyropia while maintaining P. purpurea in genus Porphyra. Phylogenetic analysis supports a sister relationship between Bangiophyceae and Florideophyceae, though precise phylogenetic relationships between multicellular red alage and chromists were not fully resolved.These results indicate that Pyropia have compact plastid genomes. Large coding capacity and long intergenic regions contribute to the size of the largest plastid genomes reported for the red lineage. Possessing the largest coding capacity and ancient gene

  8. A comparative genomics screen identifies a Sinorhizobium meliloti 1021 sodM-like gene strongly expressed within host plant nodules

    Directory of Open Access Journals (Sweden)

    Queiroux Clothilde

    2012-05-01

    Full Text Available Abstract Background We have used the genomic data in the Integrated Microbial Genomes system of the Department of Energy’s Joint Genome Institute to make predictions about rhizobial open reading frames that play a role in nodulation of host plants. The genomic data was screened by searching for ORFs conserved in α-proteobacterial rhizobia, but not conserved in closely-related non-nitrogen-fixing α-proteobacteria. Results Using this approach, we identified many genes known to be involved in nodulation or nitrogen fixation, as well as several new candidate genes. We knocked out selected new genes and assayed for the presence of nodulation phenotypes and/or nodule-specific expression. One of these genes, SMc00911, is strongly expressed by bacterial cells within host plant nodules, but is expressed minimally by free-living bacterial cells. A strain carrying an insertion mutation in SMc00911 is not defective in the symbiosis with host plants, but in contrast to expectations, this mutant strain is able to out-compete the S. meliloti 1021 wild type strain for nodule occupancy in co-inoculation experiments. The SMc00911 ORF is predicted to encode a “SodM-like” (superoxide dismutase-like protein containing a rhodanese sulfurtransferase domain at the N-terminus and a chromate-resistance superfamily domain at the C-terminus. Several other ORFs (SMb20360, SMc01562, SMc01266, SMc03964, and the SMc01424-22 operon identified in the screen are expressed at a moderate level by bacteria within nodules, but not by free-living bacteria. Conclusions Based on the analysis of ORFs identified in this study, we conclude that this comparative genomics approach can identify rhizobial genes involved in the nitrogen-fixing symbiosis with host plants, although none of the newly identified genes were found to be essential for this process.

  9. Coevolution analysis of Hepatitis C virus genome to identify the structural and functional dependency network of viral proteins

    Science.gov (United States)

    Champeimont, Raphaël; Laine, Elodie; Hu, Shuang-Wei; Penin, Francois; Carbone, Alessandra

    2016-05-01

    A novel computational approach of coevolution analysis allowed us to reconstruct the protein-protein interaction network of the Hepatitis C Virus (HCV) at the residue resolution. For the first time, coevolution analysis of an entire viral genome was realized, based on a limited set of protein sequences with high sequence identity within genotypes. The identified coevolving residues constitute highly relevant predictions of protein-protein interactions for further experimental identification of HCV protein complexes. The method can be used to analyse other viral genomes and to predict the associated protein interaction networks.

  10. [The increasing importance of tumor and tissue banks in the light of genomic and proteomic research].

    Science.gov (United States)

    Tschulik, A; Zatloukal, K

    2001-09-01

    Recent technological advances in genome and proteome research offer new perspectives for diagnosis and therapy. The DNA chip technology as well as high-resolution two-dimensional gel electrophoresis in combination with mass spectrometry is able to provide comprehensive information on gene and protein expression patterns, which allow insights into the dynamic and functional aspects of diseases. The application of these techniques depends on the availability of unfixed fresh or cryopreserved tissue with short ischaemia time. For this reason tissue banks are of increasing importance. The pathologist with his expertise and responsibility for histopathological diagnosis, plays a central role in the collection of the human tissues, in accordance with medical, legal and ethical standards, not only for diagnostic purposes, but also for research. The scientific value of a tissue bank is markedly increased if tissue samples are accompanied by detailed patient data as well as blood samples. Informed consent given by the patient is an essential requirement for the use of human tissue banks in biomedical research. The informed consent should not be restricted to scientific investigations but also include the potential commercial use of the data generated.

  11. Nine Loci for Ocular Axial Length Identified through Genome-wide Association Studies, Including Shared Loci with Refractive Error

    NARCIS (Netherlands)

    Cheng, Ching-Yu; Schache, Maria; Ikram, M. Kamran; Young, Terri L.; Guggenheim, Jeremy A.; Vitart, Veronique; Macgregor, Stuart; Verhoeven, Virginie J. M.; Barathi, Veluchamy A.; Liao, Jiemin; Hysi, Pirro G.; Bailey-Wilson, Joan E.; St Pourcain, Beate; Kemp, John P.; McMahon, George; Timpson, Nicholas J.; Evans, David M.; Montgomery, Grant W.; Mishra, Aniket; Wang, Ya Xing; Wang, Jie Jin; Rochtchina, Elena; Polasek, Ozren; Wright, Alan F.; Amin, Najaf; van Leeuwen, Elisabeth M.; Wilson, James F.; Pennell, Craig E.; van Duijn, Cornelia M.; de Jong, Paulus T. V. M.; Vingerling, Johannes R.; Zhou, Xin; Chen, Peng; Li, Ruoying; Tay, Wan-Ting; Zheng, Yingfeng; Chew, Merwyn; Burdon, Kathryn P.; Craig, Jamie E.; Iyengar, Sudha K.; Igo, Robert P.; Lass, Jonathan H.; Chew, Emily Y.; Haller, Toomas; Mihailov, Evelin; Metspalu, Andres; Wedenoja, Juho; Simpson, Claire L.; Wojciechowski, Robert; Chen, Wei

    2013-01-01

    Refractive errors are common eye disorders of public health importance worldwide. Ocular axial length (AL) is the major determinant of refraction and thus of myopia and hyperopia. We conducted a meta-analysis of genome-wide association studies for AL, combining 12,531 Europeans and 8,216 Asians. We

  12. Large meta-analysis of genome-wide association studies identifies five loci for lean body mass

    NARCIS (Netherlands)

    Zillikens, M.C.; Demissie, Serkalem; Hsu, Yi Hsiang; Yerges-Armstrong, Laura M.; Chou, Wen Chi; Stolk, Lisette; Livshits, Gregory; Broer, Linda; Johnson, Toby; Koller, Daniel L.; Kutalik, Zoltán; Luan, J.A.; Malkin, Ida; Ried, Janina S.; Smith, Albert V.; Thorleifsson, Gudmar; Vandenput, Liesbeth; Hua Zhao, Jing; Zhang, Weihua; Aghdassi, Ali; Åkesson, Kristina; Amin, Najaf; Baier, Leslie J.; Barroso, Inês; Bennett, David A.; Bertram, Lars; Biffar, Rainer; Bochud, Murielle; Boehnke, Michael; Borecki, Ingrid B.; Buchman, Aron S.; Byberg, Liisa; Campbell, Harry; Campos Obanda, Natalia; Cauley, Jane A.; Cawthon, Peggy M.; Cederberg, Henna; Chen, Zhao; Cho, Nam H.; Jin Choi, Hyung; Claussnitzer, Melina; Collins, Francis; Cummings, Steven R.; Jager, De Philip L.; Demuth, Ilja; Dhonukshe-Rutten, Rosalie A.M.; DIatchenko, Luda; Eiriksdottir, Gudny; Enneman, Anke W.; Erdos, Mike; Eriksson, Johan G.; Eriksson, Joel; Estrada, Karol; Evans, Daniel S.; Feitosa, Mary F.; Fu, Mao; Garcia, Melissa; Gieger, Christian; Girke, Thomas; Glazer, Nicole L.; Grallert, Harald; Grewal, Jagvir; Han, Bok Ghee; Hanson, Robert L.; Hayward, Caroline; Hofman, Albert; Hoffman, Eric P.; Homuth, Georg; Hsueh, Wen Chi; Hubal, Monica J.; Hubbard, Alan; Huffman, Kim M.; Husted, Lise B.; Illig, Thomas; Ingelsson, Erik; Ittermann, Till; Jansson, John Olov; Jordan, Joanne M.; Jula, Antti; Karlsson, Magnus; Khaw, Kay Tee; Kilpelaïnen, Tuomas O.; Klopp, Norman; Kloth, Jacqueline S.L.; Koistinen, Heikki A.; Kraus, William E.; Kritchevsky, Stephen; Kuulasmaa, Teemu; Kuusisto, Johanna; Laakso, Markku; Lahti, Jari; Lang, Thomas; Langdahl, Bente L.; Launer, Lenore J.; Lee, Jong Young; Lerch, Markus M.; Lewis, Joshua R.; Lind, Lars; Lindgren, Cecilia M.; Liu, Yongmei; Liu, Tian; Liu, Youfang; Ljunggren, Östen; Lorentzon, Mattias; Luben, Robert N.; Maixner, William; McGuigan, Fiona E.; Medina-Gomez, Carolina; Meitinger, Thomas; Melhus, Håkan; Mellström, Dan; Melov, Simon; Michaëlsson, Karl; Mitchell, Braxton D.; Morris, Andrew P.; Mosekilde, Leif; Newman, Anne; Nielson, Carrie M.; O'Connell, Jeffrey R.; Oostra, Ben A.; Orwoll, Eric S.; Palotie, Aarno; Parker, Stephan; Peacock, Munro; Perola, Markus; Peters, Annette; Polasek, Ozren; Prince, Richard L.; Raïkkönen, Katri; Ralston, Stuart H.; Ripatti, Samuli; Robbins, John A.; Rotter, Jerome I.; Rudan, Igor; Salomaa, Veikko; Satterfield, Suzanne; Schadt, Eric E.; Schipf, Sabine; Scott, Laura; Sehmi, Joban; Shen, Jian; Soo Shin, Chan; Sigurdsson, Gunnar; Smith, Shad; Soranzo, Nicole; Stančáková, Alena; Steinhagen-Thiessen, Elisabeth; Streeten, Elizabeth A.; Styrkarsdottir, Unnur; Swart, Karin M.A.; Tan, Sian Tsung; Tarnopolsky, Mark A.; Thompson, Patricia; Thomson, Cynthia A.; Thorsteinsdottir, Unnur; Tikkanen, Emmi; Tranah, Gregory J.; Tuomilehto, Jaakko; Schoor, van Natasja M.; Verma, Arjun; Vollenweider, Peter; Völzke, Henry; Wactawski-Wende, Jean; Walker, Mark; Weedon, Michael N.; Welch, Ryan; Wichman, H.E.; Widen, Elisabeth; Williams, Frances M.K.; Wilson, James F.; Wright, Nicole C.; Xie, Weijia; Yu, Lei; Zhou, Yanhua; Chambers, John C.; Döring, Angela; Duijn, Van Cornelia M.; Econs, Michael J.; Gudnason, Vilmundur; Kooner, Jaspal S.; Psaty, Bruce M.; Spector, Timothy D.; Stefansson, Kari; Rivadeneira, Fernando; Uitterlinden, André G.; Wareham, Nicholas J.; Ossowski, Vicky; Waterworth, Dawn M.; Loos, Ruth J.F.; Karasik, David; Harris, Tamara B.; Ohlsson, Claes; Kiel, Douglas P.

    2017-01-01

    Lean body mass, consisting mostly of skeletal muscle, is important for healthy aging. We performed a genome-wide association study for whole body (20 cohorts of European ancestry with n = 38,292) and appendicular (arms and legs) lean body mass (n = 28,330) measured using dual energy X-ray

  13. Genome-wide analysis of multi-ancestry cohorts identifies new loci influencing intraocular pressure and susceptibility to glaucoma

    NARCIS (Netherlands)

    Hysi, Pirro G.; Cheng, Ching-Yu; Springelkamp, Henriet; Macgregor, Stuart; Bailey, Jessica N. Cooke; Wojciechowski, Robert; Vitart, Veronique; Nag, Abhishek; Hewitt, Alex W.; Hohn, Rene; Venturini, Cristina; Mirshahi, Alireza; Ramdas, Wishal D.; Thorleifsson, Gudmar; Vithana, Eranga; Khor, Chiea-Chuen; Stefansson, Arni B.; Liao, Jiemin; Haines, Jonathan L.; Amin, Najaf; Wang, Ya Xing; Wild, Philipp S.; Ozel, Ayse B.; Li, Jun Z.; Fleck, Brian W.; Zeller, Tanja; Staffieri, Sandra E.; Teo, Yik-Ying; Cuellar-Partida, Gabriel; Luo, Xiaoyan; Allingham, R. Rand; Richards, Julia E.; Senft, Andrea; Karssen, Lennart C.; Zheng, Yingfeng; Bellenguez, Celine; Xu, Liang; Iglesias, Adriana I.; Wilson, James F.; Kang, Jae H.; van Leeuwen, Elisabeth M.; Jonsson, Vesteinn; Thorsteinsdottir, Unnur; Despriet, Dominiek D. G.; Ennis, Sarah; Moroi, Sayoko E.; Martin, Nicholas G.; Jansonius, Nomdo M.; Yazar, Seyhan; Tai, E-Shyong

    2014-01-01

    Elevated intraocular pressure (IOP) is an important risk factor in developing glaucoma, and variability in IOP might herald glaucomatous development or progression. We report the results of a genome-wide association study meta-analysis of 18 population cohorts from the International Glaucoma

  14. Meta-analysis of genome-wide association studies identifies novel loci that influence cupping and the glaucomatous process

    NARCIS (Netherlands)

    Springelkamp, Henriët; Höhn, René; Mishra, Aniket; Hysi, Pirro G; Khor, Chiea-Chuen; Loomis, Stephanie J; Bailey, Jessica N Cooke; Gibson, Jane; Thorleifsson, Gudmar; Janssen, Sarah F; Luo, Xiaoyan; Ramdas, Wishal D; Vithana, Eranga; Nongpiur, Monisha E; Montgomery, Grant W; Xu, Liang; Mountain, Jenny E; Gharahkhani, Puya; Lu, Yi; Amin, Najaf; Karssen, Lennart C; Sim, Kar-Seng; van Leeuwen, Elisabeth M; Iglesias, Adriana I; Verhoeven, Virginie J M; Hauser, Michael A; Loon, Seng-Chee; Despriet, Dominiek D G; Nag, Abhishek; Venturini, Cristina; Sanfilippo, Paul G; Schillert, Arne; Kang, Jae H; Landers, John; Jonasson, Fridbert; Cree, Angela J; van Koolwijk, Leonieke M E; Rivadeneira, Fernando; Souzeau, Emmanuelle; Jonsson, Vesteinn; Menon, Geeta; Weinreb, Robert N; de Jong, Paulus T V M; Oostra, Ben A; Uitterlinden, André G; Hofman, Albert; Ennis, Sarah; Thorsteinsdottir, Unnur; Burdon, Kathryn P; Spector, Timothy D; Mirshahi, Alireza; Saw, Seang-Mei; Vingerling, Johannes R; Teo, Yik-Ying; Haines, Jonathan L; Wolfs, Roger C W; Lemij, Hans G; Tai, E-Shyong; Jansonius, Nomdo M; Jonas, Jost B; Cheng, Ching-Yu; Aung, Tin; Viswanathan, Ananth C; Klaver, Caroline C W; Craig, Jamie E; Macgregor, Stuart; Mackey, David A; Lotery, Andrew J; Stefansson, Kari; Bergen, Arthur A B; Young, Terri L; Wiggs, Janey L; Pfeiffer, Norbert; Wong, Tien-Yin; Pasquale, Louis R; Hewitt, Alex W; van Duijn, Cornelia M; Hammond, Christopher J

    2014-01-01

    Glaucoma is characterized by irreversible optic nerve degeneration and is the most frequent cause of irreversible blindness worldwide. Here, the International Glaucoma Genetics Consortium conducts a meta-analysis of genome-wide association studies of vertical cup-disc ratio (VCDR), an important

  15. Identifying Important Atlantic Areas for the conservation of Balearic shearwaters: Spatial overlap with conservation areas

    Science.gov (United States)

    Pérez-Roda, Amparo; Delord, Karine; Boué, Amélie; Arcos, José Manuel; García, David; Micol, Thierry; Weimerskirch, Henri; Pinaud, David; Louzao, Maite

    2017-07-01

    Marine protected areas (MPAs) are considered one of the main tools in both fisheries and conservation management to protect threatened species and their habitats around the globe. However, MPAs are underrepresented in marine environments compared to terrestrial environments. Within this context, we studied the Atlantic non-breeding distribution of the southern population of Balearic shearwaters (Puffinus mauretanicus) breeding in Eivissa during the 2011-2012 period based on global location sensing (GLS) devices. Our objectives were (1) to identify overall Important Atlantic Areas (IAAs) from a southern population, (2) to describe spatio-temporal patterns of oceanographic habitat use, and (3) to assess whether existing conservation areas (Natura 2000 sites and marine Important Bird Areas (IBAs)) cover the main IAAs of Balearic shearwaters. Our results highlighted that the Atlantic staging (from June to October in 2011) dynamic of the southern population was driven by individual segregation at both spatial and temporal scales. Individuals ranged in the North-East Atlantic over four main IAAs (Bay of Biscay: BoB, Western Iberian shelf: WIS, Gulf of Cadiz: GoC, West of Morocco: WoM). While most individuals spent more time on the WIS or in the GoC, a small number of birds visited IAAs at the extremes of their Atlantic distribution range (i.e., BoB and WoM). The chronology of the arrivals to the IAAs showed a latitudinal gradient with northern areas reached earlier during the Atlantic staging. The IAAs coincided with the most productive areas (higher chlorophyll a values) in the NE Atlantic between July and October. The spatial overlap between IAAs and conservation areas was higher for Natura 2000 sites than marine IBAs (areas with and without legal protection, respectively). Concerning the use of these areas, a slightly higher proportion of estimated positions fell within marine IBAs compared to designated Natura 2000 sites, with Spanish and Portuguese conservation

  16. Comparative genomics defines the core genome of the growing N4-like phage genus and identifies N4-like Roseophage specific genes

    Directory of Open Access Journals (Sweden)

    Jacqueline Zoe-Munn Chan

    2014-10-01

    Full Text Available Two bacteriophages, RPP1 and RLP1, infecting members of the marine Roseobacter clade were isolated from seawater. Their linear genomes are 74.7 and 74.6 kb and encode 91 and 92 coding DNA sequences, respectively. Around 30% of these are homologous to genes found in Enterobacter phage N4. Comparative genomics of these two new Roseobacter phages and twenty-three other sequenced N4-like phages (three infecting members of the Roseobacter lineage and twenty infecting other Gammaproteobacteria revealed that N4-like phages share a core genome of 14 genes responsible for control of gene expression, replication and virion proteins. Phylogenetic analysis of these genes placed the five N4-like roseophages (RN4 into a distinct subclade. Analysis of the RN4 phage genomes revealed they share a further 19 genes of which nine are found exclusively in RN4 phages and four appear to have been acquired from their bacterial hosts. Proteomic analysis of the RPP1 and RLP1 virions identified a second structural module present in the RN4 phages similar to that found in the Pseudomonas N4-like phage LIT1. Searches of various metagenomic databases, included the GOS database, using CDS sequences from RPP1 suggests these phages are widely distributed in marine environments in particular in the open ocean environment.

  17. The genome sequence of the emerging common midwife toad virus identifies an evolutionary intermediate within ranaviruses.

    Science.gov (United States)

    Mavian, Carla; López-Bueno, Alberto; Balseiro, Ana; Casais, Rosa; Alcamí, Antonio; Alejo, Alí

    2012-04-01

    Worldwide amphibian population declines have been ascribed to global warming, increasing pollution levels, and other factors directly related to human activities. These factors may additionally be favoring the emergence of novel pathogens. In this report, we have determined the complete genome sequence of the emerging common midwife toad ranavirus (CMTV), which has caused fatal disease in several amphibian species across Europe. Phylogenetic and gene content analyses of the first complete genomic sequence from a ranavirus isolated in Europe show that CMTV is an amphibian-like ranavirus (ALRV). However, the CMTV genome structure is novel and represents an intermediate evolutionary stage between the two previously described ALRV groups. We find that CMTV clusters with several other ranaviruses isolated from different hosts and locations which might also be included in this novel ranavirus group. This work sheds light on the phylogenetic relationships within this complex group of emerging, disease-causing viruses.

  18. The Complete Chloroplast Genome Sequence of Tree of Heaven (Ailanthus altissima (Mill. (Sapindales: Simaroubaceae, an Important Pantropical Tree

    Directory of Open Access Journals (Sweden)

    Josphat K. Saina

    2018-03-01

    Full Text Available Ailanthus altissima (Mill. Swingle (Simaroubaceae is a deciduous tree widely distributed throughout temperate regions in China, hence suitable for genetic diversity and evolutionary studies. Previous studies in A. altissima have mainly focused on its biological activities, genetic diversity and genetic structure. However, until now there is no published report regarding genome of this plant species or Simaroubaceae family. Therefore, in this paper, we first characterized A. altissima complete chloroplast genome sequence. The tree of heaven chloroplast genome was found to be a circular molecule 160,815 base pairs (bp in size and possess a quadripartite structure. The A. altissima chloroplast genome contains 113 unique genes of which 79 and 30 are protein coding and transfer RNA (tRNA genes respectively and also 4 ribosomal RNA genes (rRNA with overall GC content of 37.6%. Microsatellite marker detection identified A/T mononucleotides as majority SSRs in all the seven analyzed genomes. Repeat analyses of seven Sapindales revealed a total of 49 repeats in A. altissima, Rhus chinensis, Dodonaea viscosa, Leitneria floridana, while Azadirachta indica, Boswellia sacra, and Citrus aurantiifolia had a total of 48 repeats. The phylogenetic analysis using protein coding genes revealed that A. altissima is a sister to Leitneria floridana and also suggested that Simaroubaceae is a sister to Rutaceae family. The genome information reported here could be further applied for evolution and invasion, population genetics, and molecular studies in this plant species and family.

  19. A target based approach identifies genomic predictors of breast cancer patient response to chemotherapy

    Directory of Open Access Journals (Sweden)

    Hallett Robin M

    2012-05-01

    Full Text Available Abstract Background The efficacy of chemotherapy regimens in breast cancer patients is variable and unpredictable. Whether individual patients either achieve long-term remission or suffer recurrence after therapy may be dictated by intrinsic properties of their breast tumors including genetic lesions and consequent aberrant transcriptional programs. Global gene expression profiling provides a powerful tool to identify such tumor-intrinsic transcriptional programs, whose analyses provide insight into the underlying biology of individual patient tumors. For example, multi-gene expression signatures have been identified that can predict the likelihood of disease reccurrence, and thus guide patient prognosis. Whereas such prognostic signatures are being introduced in the clinical setting, similar signatures that predict sensitivity or resistance to chemotherapy are not currently clinically available. Methods We used gene expression profiling to identify genes that were co-expressed with genes whose transcripts encode the protein targets of commonly used chemotherapeutic agents. Results Here, we present target based expression indices that predict breast tumor response to anthracycline and taxane based chemotherapy. Indeed, these signatures were independently predictive of chemotherapy response after adjusting for standard clinic-pathological variables such as age, grade, and estrogen receptor status in a cohort of 488 breast cancer patients treated with adriamycin and taxotere/taxol. Conclusions Importantly, our findings suggest the practicality of developing target based indices that predict response to therapeutics, as well as highlight the possibility of using gene signatures to guide the use of chemotherapy during treatment of breast cancer patients.

  20. Recently Identified Mutations in the Ebola Virus-Makona Genome Do Not Alter Pathogenicity in Animal Models

    Directory of Open Access Journals (Sweden)

    Andrea Marzi

    2018-05-01

    Full Text Available Summary: Ebola virus (EBOV, isolate Makona, the causative agent of the West African EBOV epidemic, has been the subject of numerous investigations to determine the genetic diversity and its potential implication for virus biology, pathogenicity, and transmissibility. Despite various mutations that have emerged over time through multiple human-to-human transmission chains, their biological relevance remains questionable. Recently, mutations in the glycoprotein GP and polymerase L, which emerged and stabilized early during the outbreak, have been associated with improved viral fitness in cell culture. Here, we infected mice and rhesus macaques with EBOV-Makona isolates carrying or lacking those mutations. Surprisingly, all isolates behaved very similarly independent of the genotype, causing severe or lethal disease in mice and macaques, respectively. Likewise, we could not detect any evidence for differences in virus shedding. Thus, no specific biological phenotype could be associated with these EBOV-Makona mutations in two animal models. : Marzi et al. demonstrate that recently identified mutations in the EBOV-Makona genome, which appeared during the West African epidemic, do not significantly alter pathogenicity in IFNAR−/− mice and rhesus macaques. Other factors may have been more important for increased case numbers, case fatalities, and human-to-human transmission during this unprecedented epidemic. Keywords: Ebola virus, Ebola Makona, glycoprotein GP, polymerase L, GP mutation A82V, L mutation D759G, West African epidemic, pathogenicity

  1. A genome-wide screen identifies conserved protein hubs required for cadherin-mediated cell–cell adhesion

    Science.gov (United States)

    Toret, Christopher P.; D’Ambrosio, Michael V.; Vale, Ronald D.; Simon, Michael A.

    2014-01-01

    Cadherins and associated catenins provide an important structural interface between neighboring cells, the actin cytoskeleton, and intracellular signaling pathways in a variety of cell types throughout the Metazoa. However, the full inventory of the proteins and pathways required for cadherin-mediated adhesion has not been established. To this end, we completed a genome-wide (∼14,000 genes) ribonucleic acid interference (RNAi) screen that targeted Ca2+-dependent adhesion in DE-cadherin–expressing Drosophila melanogaster S2 cells in suspension culture. This novel screen eliminated Ca2+-independent cell–cell adhesion, integrin-based adhesion, cell spreading, and cell migration. We identified 17 interconnected regulatory hubs, based on protein functions and protein–protein interactions that regulate the levels of the core cadherin–catenin complex and coordinate cadherin-mediated cell–cell adhesion. Representative proteins from these hubs were analyzed further in Drosophila oogenesis, using targeted germline RNAi, and adhesion was analyzed in Madin–Darby canine kidney mammalian epithelial cell–cell adhesion. These experiments reveal roles for a diversity of cellular pathways that are required for cadherin function in Metazoa, including cytoskeleton organization, cell–substrate interactions, and nuclear and cytoplasmic signaling. PMID:24446484

  2. Brucella abortus strain 2308 Wisconsin genome: importance of the definition of reference strains

    Directory of Open Access Journals (Sweden)

    Marcela Suárez-Esquivel

    2016-09-01

    Full Text Available Brucellosis is a bacterial infectious disease affecting a wide range of mammals and a neglected zoonosis caused by species of the genetically homogenous genus Brucella. As in most studies on bacterial diseases, research in brucellosis is carried out by using reference strains as canonical models to understand the mechanisms underlying host pathogen interactions. We performed whole genome sequencing (WGS analysis of the reference strain Brucella abortus 2308 routinely used in our laboratory, including manual curated annotation accessible as an editable version at www.wikipedia.Comparison of this genome with two publically available 2308 genomes showed significant differences, particularly indels related to insertional elements, suggesting variability related to the transposition of these elements within the same strain. Considering the outcome of high resolution genomic techniques in the bacteriology field, the conventional concept of strain definition needs to be revised.

  3. Large meta-analysis of genome-wide association studies identifies five loci for lean body mass

    DEFF Research Database (Denmark)

    Zillikens, M Carola; Demissie, Serkalem; Hsu, Yi-Hsiang

    2017-01-01

    Lean body mass, consisting mostly of skeletal muscle, is important for healthy aging. We performed a genome-wide association study for whole body (20 cohorts of European ancestry with n = 38,292) and appendicular (arms and legs) lean body mass (n = 28,330) measured using dual energy X-ray absorpt...... a meta-analysis of genome-wide association studies for whole body lean body mass and find five novel genetic loci to be significantly associated.......-ray absorptiometry or bioelectrical impedance analysis, adjusted for sex, age, height, and fat mass. Twenty-one single-nucleotide polymorphisms were significantly associated with lean body mass either genome wide (p 

  4. Single nucleotide variants and InDels identified from whole-genome re-sequencing of Guzerat, Gyr, Girolando and Holstein cattle breeds.

    Directory of Open Access Journals (Sweden)

    Nedenia Bonvino Stafuzza

    Full Text Available Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose, Gyr, Girolando and Holstein (dairy production. A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs and 3,828,041 insertions/deletions (InDels were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs.

  5. Genome-wide meta-analyses identify multiple loci associated with smoking behavior

    NARCIS (Netherlands)

    H. Furberg (Helena); Y. Kim (Yunjung); J. Dackor (Jennifer); E.A. Boerwinkle (Eric); N. Franceschini (Nora); D. Ardissino (Diego); L. Bernardinelli (Luisa); P.M. Mannucci (Pier); F. Mauri (Francesco); P.A. Merlini (Piera); D. Absher (Devin); T.L. Assimes (Themistocles); S.P. Fortmann (Stephen); C. Iribarren (Carlos); J.W. Knowles (Joshua); T. Quertermous (Thomas); L. Ferrucci (Luigi); T. Tanaka (Toshiko); J.C. Bis (Joshua); T. Haritunians (Talin); B. McKnight (Barbara); B.M. Psaty (Bruce); K.D. Taylor (Kent); E.L. Thacker (Evan); P. Almgren (Peter); L. Groop (Leif); C. Ladenvall (Claes); M. Boehnke (Michael); A.U. Jackson (Anne); K.L. Mohlke (Karen); H.M. Stringham (Heather); J. Tuomilehto (Jaakko); E.J. Benjamin (Emelia); S.J. Hwang; D. Levy (Daniel); S.R. Preis; R.S. Vasan (Ramachandran Srini); J. Duan (Jubao); P.V. Gejman (Pablo); D.F. Levinson (Douglas); A.R. Sanders (Alan); J. Shi (Jianxin); E.H. Lips (Esther); J.D. McKay (James); A. Agudo (Antonio); L. Barzan (Luigi); V. Bencko (Vladimir); S. Benhamou (Simone); X. Castellsagué (Xavier); C. Canova (Cristina); D.I. Conway (David); E. Fabianova (Eleonora); L. Foretova (Lenka); V. Janout (Vladimir); C.M. Healy (Claire); I. Holcátová (Ivana); K. Kjaerheim (Kristina); P. Lagiou; J. Lissowska (Jolanta); R. Lowry (Ray); T.V. MacFarlane (Tatiana); D. Mates (Dana); L. Richiardi (Lorenzo); P. Rudnai (Peter); N. Szeszenia-Dabrowska (Neonilia); D. Zaridze; A. Znaor (Ariana); M. Lathrop (Mark); P. Brennan (Paul); S. Bandinelli (Stefania); T.M. Frayling (Timothy); J.M. Guralnik (Jack); Y. Milaneschi (Yuri); J.R.B. Perry (John); D. Altshuler (David); R. Elosua (Roberto); S. Kathiresan (Sekar); G. Lucas (Gavin); O. Melander (Olle); V. Salomaa (Veikko); S.M. Schwartz (Stephen); B.F. Voight (Benjamin); B.W.J.H. Penninx (Brenda); J.H. Smit (Johannes); N. Vogelzangs (Nicole); D.I. Boomsma (Dorret); E.J.C. de Geus (Eco); J.M. Vink (Jacqueline); G.A.H.M. Willemsen (Gonneke); S.J. Chanock (Stephen); F. Gu (Fangyi); S.E. Hankinson (Susan); D. Hunter (David); A. Hofman (Albert); H.W. Tiemeier (Henning); A.G. Uitterlinden (André); P. Tikka-Kleemola (Päivi); S. Walter (Stefan); D.I. Chasman (Daniel); B.M. Everett (Brendan); G. Pare (Guillaume); P.M. Ridker (Paul); M.D. Li (Ming); H.H. Maes (Hermine); J. Audrain-Mcgovern (Janet); D. Posthuma (Danielle); L.M. Thornton (Laura); C. Lerman (Caryn); J. Kaprio (Jaakko); J.E. Rose (Jed); J.P.A. Ioannidis (John); P. Kraft (Peter); D.Y. Lin (Dan); P.F. Sullivan (Patrick); C.J. O'Donnell (Christopher)

    2010-01-01

    textabstractConsistent but indirect evidence has implicated genetic factors in smoking behavior. We report meta-analyses of several smoking phenotypes within cohorts of the Tobacco and Genetics Consortium (n = 74,053). We also partnered with the European Network of Genetic and Genomic Epidemiology

  6. Genome-wide meta-analysis identifies new susceptibility loci for migraine

    DEFF Research Database (Denmark)

    Anttila, Verneri; Winsvold, Bendik S; Gormley, Padhraig

    2013-01-01

    Migraine is the most common brain disorder, affecting approximately 14% of the adult population, but its molecular mechanisms are poorly understood. We report the results of a meta-analysis across 29 genome-wide association studies, including a total of 23,285 individuals with migraine (cases) an...

  7. Meta-analysis of genome-wide association studies identifies ten loci influencing allergic sensitization

    DEFF Research Database (Denmark)

    Bønnelykke, Klaus; Matheson, Melanie C; Pers, Tune Hannes

    2013-01-01

    Allergen-specific immunoglobulin E (present in allergic sensitization) has a central role in the pathogenesis of allergic disease. We performed the first large-scale genome-wide association study (GWAS) of allergic sensitization in 5,789 affected individuals and 10,056 controls and followed up th...

  8. Genome-wide meta-analysis identifies six novel loci associated with habitual coffee consumption

    NARCIS (Netherlands)

    Cornelis, M. C.; Byrne, E. M.; Esko, T.; Nalls, M. A.; Ganna, A.; Paynter, N.; Monda, K. L.; Amin, N.; Fischer, K.; Renstrom, F.; Ngwa, J. S.; Huikari, V.; Cavadino, A.; Nolte, I. M.; Teumer, A.; Yu, K.; Marques-Vidal, P.; Rawal, R.; Manichaikul, A.; Wojczynski, M. K.; Vink, J. M.; Zhao, J. H.; Burlutsky, G.; Lahti, J.; Mikkilä, V.; Lemaitre, R. N.; Eriksson, J.; Musani, S. K.; Tanaka, T.; Geller, F.; Luan, J.; Hui, J.; Mägi, R.; Dimitriou, M.; Garcia, M. E.; Ho, W.-K.; Wright, M. J.; Rose, L. M.; Magnusson, P. K. E.; Pedersen, N. L.; Couper, D.; Oostra, B. A.; Hofman, A.; Ikram, M. A.; Tiemeier, H. W.; Uitterlinden, A. G.; van Rooij, F. J. A.; Barroso, I.; Johansson, I.; Xue, L.; Kaakinen, M.; Milani, L.; Power, C.; Snieder, H.; Stolk, R. P.; Baumeister, S. E.; Biffar, R.; Gu, F.; Bastardot, F.; Kutalik, Z.; Jacobs, D. R.; Forouhi, N. G.; Mihailov, E.; Lind, L.; Lindgren, C.; Michaëlsson, K.; Morris, A.; Jensen, M.; Khaw, K.-T.; Luben, R. N.; Wang, J. J.; Männistö, S.; Perälä, M.-M.; Kähönen, M.; Lehtimäki, T.; Viikari, J.; Mozaffarian, D.; Mukamal, K.; Psaty, B. M.; Döring, A.; Heath, A. C.; Montgomery, G. W.; Dahmen, N.; Carithers, T.; Tucker, K. L.; Ferrucci, L.; Boyd, H. A.; Melbye, M.; Treur, J. L.; Mellström, D.; Hottenga, J. J.; Prokopenko, I.; Tönjes, A.; Deloukas, P.; Kanoni, S.; Lorentzon, M.; Houston, D. K.; Liu, Y.; Danesh, J.; Rasheed, A.; Mason, M. A.; Zonderman, A. B.; Franke, L.; Kristal, B. S.; Karjalainen, J.; Reed, D. R.; Westra, H.-J.; Evans, M. K.; Saleheen, D.; Harris, T. B.; Dedoussis, G.; Curhan, G.; Stumvoll, M.; Beilby, J.; Pasquale, L. R.; Feenstra, B.; Bandinelli, S.; Ordovas, J. M.; Chan, A. T.; Peters, U.; Ohlsson, C.; Gieger, C.; Martin, N. G.; Waldenberger, M.; Siscovick, D. S.; Raitakari, O.; Eriksson, J. G.; Mitchell, P.; Hunter, D. J.; Kraft, P.; Rimm, E. B.; Boomsma, D. I.; Borecki, I. B.; Loos, R. J. F.; Wareham, N. J.; Vollenweider, P.; Caporaso, N.; Grabe, H. J.; Neuhouser, M. L.; Wolffenbuttel, B. H. R.; Hu, F. B.; Hyppönen, E.; Järvelin, M.-R.; Cupples, L. A.; Franks, P. W.; Ridker, P. M.; van Duijn, C. M.; Heiss, G.; Metspalu, A.; North, K. E.; Ingelsson, E.; Nettleton, J. A.; van Dam, R. M.; Chasman, D. I.; Nalls, Michael A.; Plagnol, Vincent; Hernandez, Dena G.; Sharma, Manu; Sheerin, Una-Marie; Saad, Mohamad; Simón-Sánchez, Javier; Schulte, Claudia; Lesage, Suzanne; Sveinbjörnsdóttir, Sigurlaug; Arepalli, Sampath; Barker, Roger; Ben-Shlomo, Yoav; Berendse, Henk W.; Berg, Daniela; Bhatia, Kailash; de Bie, Rob M. A.; Biffi, Alessandro; Bloem, Bas; Bochdanovits, Zoltan; Bonin, Michael; Bras, M.; Brockmann, Kathrin; Brooks, Janet; Burn, David J.; Charlesworth, Gavin; Chen, Honglei; Chinnery, Patrick F.; Chong, Sean; Clarke, Carl E.; Cookson, Mark R.; Cooper, J. Mark; Corvol, Jean Christophe; Counsell, Carl; Damier, Philippe; Dartigues, Jean-François; Deloukas, Panos; Deuschl, Günther; Dexter, David T.; van Dijk, Karin D.; Dillman, Allissa; Durif, Frank; Dürr, Alexandra; Edkins, Sarah; Evans, Jonathan R.; Foltynie, Thomas; Dong, Jing; Gardner, Michelle; Gibbs, J. Raphael; Goate, Alison; Gray, Emma; Guerreiro, Rita; Harris, Clare; van Hilten, Jacobus J.; Hofman, Albert; Hollenbeck, Albert; Holton, Janice; Hu, Michele; Huang, Xuemei; Hershey, Milton S.; Wurster, Isabel; Mätzler, Walter; Hudson, Gavin; Hunt, Sarah E.; Huttenlocher, Johanna; Illig, Thomas; München, Helmholtz Zentrum; Jónsson, Pálmi V.; Lambert, Jean-Charles; Langford, Cordelia; Lees, Andrew; Lichtner, Peter; Limousin, Patricia; Lopez, Grisel; Lorenz, Delia; McNeill, Alisdair; Moorby, Catriona; Moore, Matthew; Morris, Huw R.; Morrison, Karen E.; O' Sullivan, Sean S.; Pearson, Justin; Perlmutter, Joel S.; Pétursson, Hjörvar; Pollak, Pierre; Potter, Simon; Ravina, Bernard; Revesz, Tamas; Riess, Olaf; Rivadeneira, Fernando; Rizzu, Patrizia; Ryten, Mina; Sawcer, Stephen; Schapira, Anthony; Scheffer, Hans; Shaw, Karen; Sidransky, Ellen; Smith, Colin; Spencer, Chris C. A.; Stefánsson, Hreinn; Bettella, Francesco; Stockton, Joanna D.; Strange, Amy; Talbot, Kevin; Tanner, M.; Tashakkori-Ghanbaria, Avazeh; Tison, François; Trabzuni, Daniah; Traynor, Bryan J.; Uitterlinden, André G.; Velseboer, Daan; Vidailhet, Marie; Walker, Robert; van de Warrenburg, Bart; Wickremaratchi, Mirdhu; Williams, Nigel; Williams-Gray, Caroline H.; Winder-Rhodes, Sophie; Stefánsson, Kári; Martinez, Maria; Sabatier, Paul; Wood, Nicholas W.; Hardy, John; Heutink, Peter; Brice, Alexis; Gasser, Thomas; Singleton, Andrew B.; Singleton, Andrew; Cookson, Mark; Hernandez, Dena; Nalls, Michael; Zonderman, Alan; Ferrucci, Luigi; Johnson, Robert; Longo, Dan; O'Brien, Richard; Traynor, Bryan; Troncoso, Juan; van der Brug, Marcel; Zielke, Ronald; Weale, Michael; Ramasamy, Adaikalavan; Box, P. O.

    2015-01-01

    Coffee, a major dietary source of caffeine, is among the most widely consumed beverages in the world and has received considerable attention regarding health risks and benefits. We conducted a genome-wide (GW) meta-analysis of predominately regular-type coffee consumption (cups per day) among up to

  9. Novel genetic loci underlying human intracranial volume identified through genome-wide association

    NARCIS (Netherlands)

    Adams, Hieab H H; Hibar, Derrek P; Chouraki, Vincent; Stein, Jason L; Nyquist, Paul A; Rentería, Miguel E; Trompet, Stella; Arias-Vasquez, Alejandro; Seshadri, Sudha; Desrivières, Sylvane; Beecham, Ashley H; Jahanshad, Neda; Wittfeld, Katharina; Van der Lee, Sven J; Abramovic, Lucija; Alhusaini, Saud; Amin, Najaf; Andersson, Micael; Arfanakis, Konstantinos; Aribisala, Benjamin S; Armstrong, Nicola J; Athanasiu, Lavinia; Axelsson, Tomas; Beiser, Alexa; Bernard, Manon; Bis, Joshua C; Blanken, Laura M E; Blanton, Susan H; Bohlken, Marc M; Boks, Marco P; Bralten, Janita; Brickman, Adam M; Carmichael, Owen; Chakravarty, M Mallar; Chauhan, Ganesh; Chen, Qiang; Ching, Christopher R K; Cuellar-Partida, Gabriel; Braber, Anouk Den; Doan, Nhat Trung; Ehrlich, Stefan; Filippi, Irina; Ge, Tian; Giddaluru, Sudheer; Goldman, Aaron L; Gottesman, Rebecca F; Greven, Corina U; Grimm, Oliver; Griswold, Michael E; Guadalupe, Tulio; Hass, Johanna; Haukvik, Unn K; Hilal, Saima; Hofer, Edith; Hoehn, David; Holmes, Avram J; Hoogman, Martine; Janowitz, Deborah; Jia, Tianye; Kasperaviciute, Dalia; Kim, Sungeun; Klein, Marieke; Kraemer, Bernd; Lee, Phil H; Liao, Jiemin; Liewald, David C M; Lopez, Lorna M; Luciano, Michelle; Macare, Christine; Marquand, Andre; Matarin, Mar; Mather, Karen A; Mattheisen, Manuel; Mazoyer, Bernard; McKay, David R; McWhirter, Rebekah; Milaneschi, Yuri; Mirza-Schreiber, Nazanin; Muetzel, Ryan L; Maniega, Susana Muñoz; Nho, Kwangsik; Nugent, Allison C; Loohuis, Loes M Olde; Oosterlaan, Jaap; Papmeyer, Martina; Pappa, Irene; Pirpamer, Lukas; Pudas, Sara; Pütz, Benno; Rajan, Kumar B; Ramasamy, Adaikalavan; Richards, Jennifer S; Risacher, Shannon L; Roiz-Santiañez, Roberto; Rommelse, Nanda; Rose, Emma J; Royle, Natalie A; Rundek, Tatjana; Sämann, Philipp G; Satizabal, Claudia L; Schmaal, Lianne; Schork, Andrew J; Shen, Li; Shin, Jean; Shumskaya, Elena; Smith, Albert V; Sprooten, Emma; Strike, Lachlan T; Teumer, Alexander; Thomson, Russell; Tordesillas-Gutierrez, Diana; Toro, Roberto; Trabzuni, Daniah; Vaidya, Dhananjay; Van der Grond, Jeroen; Van der Meer, Dennis; Van Donkelaar, Marjolein M J; Van Eijk, Kristel R; Van Erp, Theo G M; Van Rooij, Daan; Walton, Esther; Westlye, Lars T; Whelan, Christopher D; Windham, Beverly G; Winkler, Anderson M; Woldehawariat, Girma; Wolf, Christiane; Wolfers, Thomas; Xu, Bing; Yanek, Lisa R; Yang, Jingyun; Zijdenbos, Alex; Zwiers, Marcel P; Agartz, Ingrid; Aggarwal, Neelum T; Almasy, Laura; Ames, David; Amouyel, Philippe; Andreassen, Ole A; Arepalli, Sampath; Assareh, Amelia A; Barral, Sandra; Bastin, Mark E; Becker, Diane M; Becker, James T; Bennett, David A; Blangero, John; van Bokhoven, Hans; Boomsma, Dorret I; Brodaty, Henry; Brouwer, Rachel M; Brunner, Han G; Buckner, Randy L; Buitelaar, Jan K; Bulayeva, Kazima B; Cahn, Wiepke; Calhoun, Vince D; Cannon, Dara M; Cavalleri, Gianpiero L; Chen, Christopher; Cheng, Ching-Yu; Cichon, Sven; Cookson, Mark R; Corvin, Aiden; Crespo-Facorro, Benedicto; Curran, Joanne E; Czisch, Michael; Dale, Anders M; Davies, Gareth E; De Geus, Eco J C; De Jager, Philip L; de Zubicaray, Greig I; Delanty, Norman; Depondt, Chantal; DeStefano, Anita L; Dillman, Allissa; Djurovic, Srdjan; Donohoe, Gary; Drevets, Wayne C; Duggirala, Ravi; Dyer, Thomas D; Erk, Susanne; Espeseth, Thomas; Evans, Denis A; Fedko, Iryna O; Fernández, Guillén; Ferrucci, Luigi; Fisher, Simon E; Fleischman, Debra A; Ford, Ian; Foroud, Tatiana M; Fox, Peter T; Francks, Clyde; Fukunaga, Masaki; Gibbs, J Raphael; Glahn, David C; Gollub, Randy L; Göring, Harald H H; Grabe, Hans J; Green, Robert C; Gruber, Oliver; Gudnason, Vilmundur; Guelfi, Sebastian; Hansell, Narelle K; Hardy, John; Hartman, Catharina A; Hashimoto, Ryota; Hegenscheid, Katrin; Heinz, Andreas; Le Hellard, Stephanie; Hernandez, Dena G; Heslenfeld, Dirk J; Ho, Beng-Choon; Hoekstra, Pieter J; Hoffmann, Wolfgang; Hofman, Albert; Holsboer, Florian; Homuth, Georg; Hosten, Norbert; Hottenga, Jouke-Jan; Pol, Hilleke E Hulshoff; Ikeda, Masashi; Ikram, M Kamran; Jack, Clifford R; Jenkinson, Mark; Johnson, Robert; Jönsson, Erik G; Jukema, J Wouter; Kahn, René S; Kanai, Ryota; Kloszewska, Iwona; Knopman, David S; Kochunov, Peter; Kwok, John B; Lawrie, Stephen M; Lemaître, Hervé; Liu, Xinmin; Longo, Dan L; Longstreth, W T; Lopez, Oscar L; Lovestone, Simon; Martinez, Oliver; Martinot, Jean-Luc; Mattay, Venkata S; McDonald, Colm; McIntosh, Andrew M; McMahon, Katie L; McMahon, Francis J; Mecocci, Patrizia; Melle, Ingrid; Meyer-Lindenberg, Andreas; Mohnke, Sebastian; Montgomery, Grant W; Morris, Derek W; Mosley, Thomas H; Mühleisen, Thomas W; Müller-Myhsok, Bertram; Nalls, Michael A; Nauck, Matthias; Nichols, Thomas E; Niessen, Wiro J; Nöthen, Markus M; Nyberg, Lars; Ohi, Kazutaka; Olvera, Rene L; Ophoff, Roel A; Pandolfo, Massimo; Paus, Tomas; Pausova, Zdenka; Penninx, Brenda W J H; Pike, G Bruce; Potkin, Steven G; Psaty, Bruce M; Reppermund, Simone; Rietschel, Marcella; Roffman, Joshua L; Romanczuk-Seiferth, Nina; Rotter, Jerome I; Ryten, Mina; Sacco, Ralph L; Sachdev, Perminder S; Saykin, Andrew J; Schmidt, Reinhold; Schofield, Peter R; Sigurdsson, Sigurdur; Simmons, Andy; Singleton, Andrew; Sisodiya, Sanjay M; Smith, Colin; Smoller, Jordan W; Soininen, Hilkka; Srikanth, Velandai; Steen, Vidar M; Stott, David J; Sussmann, Jessika E; Thalamuthu, Anbupalam; Tiemeier, Henning; Toga, Arthur W; Traynor, Bryan J; Troncoso, Juan; Turner, Jessica A; Tzourio, Christophe; Uitterlinden, Andre G; Hernández, Maria C Valdés; Van der Brug, Marcel; Van der Lugt, Aad; Van der Wee, Nic J A; Van Duijn, Cornelia M; Van Haren, Neeltje E M; Van T Ent, Dennis; Van Tol, Marie-Jose; Vardarajan, Badri N; Veltman, Dick J; Vernooij, Meike W; Völzke, Henry; Walter, Henrik; Wardlaw, Joanna M; Wassink, Thomas H; Weale, Michael E; Weinberger, Daniel R; Weiner, Michael W; Wen, Wei; Westman, Eric; White, Tonya; Wong, Tien Y; Wright, Clinton B; Zielke, H Ronald; Zonderman, Alan B; Deary, Ian J; DeCarli, Charles; Schmidt, Helena; Martin, Nicholas G; De Craen, Anton J M; Wright, Margaret J; Launer, Lenore J; Schumann, Gunter; Fornage, Myriam; Franke, Barbara; Debette, Stéphanie; Medland, Sarah E; Ikram, M Arfan; Thompson, Paul M

    2016-01-01

    Intracranial volume reflects the maximally attained brain size during development, and remains stable with loss of tissue in late life. It is highly heritable, but the underlying genes remain largely undetermined. In a genome-wide association study of 32,438 adults, we discovered five previously

  10. Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder

    NARCIS (Netherlands)

    Yuen, Ryan K C; Merico, Daniele; Bookman, Matt; Howe, Jennifer L.; Thiruvahindrapuram, Bhooma; Patel, Rohan V.; Whitney, Joe; Deflaux, Nicole; Bingham, Jonathan; Wang, Zhuozhi; Pellecchia, Giovanna; Buchanan, Janet A.; Walker, Susan; Marshall, Christian R.; Uddin, Mohammed; Zarrei, Mehdi; Deneault, Eric; D'Abate, Lia; Chan, Ada J S; Koyanagi, Stephanie; Paton, Tara; Pereira, Sergio L.; Hoang, Ny; Engchuan, Worrawat; Higginbotham, Edward J.; Ho, Karen; Lamoureux, Sylvia; Li, Weili; MacDonald, Jeffrey R.; Nalpathamkalam, Thomas; Sung, Wilson W L; Tsoi, Fiona J.; Wei, John; Xu, Lizhen; Tasse, Anne Marie; Kirby, Emily; Van Etten, William; Twigger, Simon; Roberts, Wendy; Drmic, Irene; Jilderda, Sanne; Modi, Bonnie Mackinnon; Kellam, Barbara; Szego, Michael; Cytrynbaum, Cheryl; Weksberg, Rosanna; Zwaigenbaum, Lonnie; Woodbury-Smith, Marc; Brian, Jessica; Senman, Lili; Iaboni, Alana; Doyle-Thomas, Krissy; Thompson, Ann; Chrysler, Christina; Leef, Jonathan; Savion-Lemieux, Tal; Smith, Isabel M.; Liu, Xudong; Nicolson, Rob; Seifer, Vicki; Fedele, Angie; Cook, Edwin H.; Dager, Stephen; Estes, Annette; Gallagher, Louise; Malow, Beth A.; Parr, Jeremy R.; Spence, Sarah J.; Vorstman, Jacob; Frey, Brendan J.; Robinson, James T.; Strug, Lisa J.; Fernandez, Bridget A.; Elsabbagh, Mayada; Carter, Melissa T.; Hallmayer, Joachim; Knoppers, Bartha M.; Anagnostou, Evdokia; Szatmari, Peter; Ring, Robert H.; Glazer, David; Pletcher, Mathew T.; Scherer, Stephen W.

    2017-01-01

    We are performing whole-genome sequencing of families with autism spectrum disorder (ASD) to build a resource (MSSNG) for subcategorizing the phenotypes and underlying genetic factors involved. Here we report sequencing of 5,205 samples from families with ASD, accompanied by clinical information,

  11. Integrative genome analyses identify key somatic driver mutations of small-cell lung cancer

    NARCIS (Netherlands)

    Peifer, Martin; Fernandez-Cuesta, Lynnette; Sos, Martin L.; George, Julie; Seidel, Danila; Kasper, Lawryn H.; Plenker, Dennis; Leenders, Frauke; Sun, Ruping; Zander, Thomas; Menon, Roopika; Koker, Mirjam; Dahmen, Ilona; Mueller, Christian; Di Cerbo, Vincenzo; Schildhaus, Hans-Ulrich; Altmueller, Janine; Baessmann, Ingelore; Becker, Christian; de Wilde, Bram; Vandesompele, Jo; Boehm, Diana; Ansen, Sascha; Gabler, Franziska; Wilkening, Ines; Heynck, Stefanie; Heuckmann, Johannes M.; Lu, Xin; Carter, Scott L.; Cibulskis, Kristian; Banerji, Shantanu; Getz, Gad; Park, Kwon-Sik; Rauh, Daniel; Gruetter, Christian; Fischer, Matthias; Pasqualucci, Laura; Wright, Gavin; Wainer, Zoe; Russell, Prudence; Petersen, Iver; Chen, Yuan; Stoelben, Erich; Ludwig, Corinna; Schnabel, Philipp; Hoffmann, Hans; Muley, Thomas; Brockmann, Michael; Engel-Riedel, Walburga; Muscarella, Lucia A.; Fazio, Vito M.; Groen, Harry; Timens, Wim; Sietsma, Hannie; Thunnissen, Erik; Smit, Egbert; Heideman, Danielle A. M.; Snijders, Peter J. F.; Cappuzzo, Federico; Ligorio, Claudia; Damiani, Stefania; Field, John; Solberg, Steinar; Brustugun, Odd Terje; Lund-Iversen, Marius; Saenger, Joerg; Clement, Joachim H.; Soltermann, Alex; Moch, Holger; Weder, Walter; Solomon, Benjamin; Soria, Jean-Charles; Validire, Pierre; Besse, Benjamin; Brambilla, Elisabeth; Brambilla, Christian; Lantuejoul, Sylvie; Lorimier, Philippe; Schneider, Peter M.; Hallek, Michael; Pao, William; Meyerson, Matthew; Sage, Julien; Shendure, Jay; Schneider, Robert; Buettner, Reinhard; Wolf, Juergen; Nuernberg, Peter; Perner, Sven; Heukamp, Lukas C.; Brindle, Paul K.; Haas, Stefan; Thomas, Roman K.

    2012-01-01

    Small-cell lung cancer (SCLC) is an aggressive lung tumor subtype with poor prognosis(1-3). We sequenced 29 SCLC exomes, 2 genomes and 15 transcriptomes and found an extremely high mutation rate of 7.4 +/- 1 protein-changing mutations per million base pairs. Therefore, we conducted integrated

  12. Genome-wide association study identifies multiple susceptibility loci for multiple myeloma

    DEFF Research Database (Denmark)

    Mitchell, Jonathan S; Li, Ni; Weinhold, Niels

    2016-01-01

    Multiple myeloma (MM) is a plasma cell malignancy with a significant heritable basis. Genome-wide association studies have transformed our understanding of MM predisposition, but individual studies have had limited power to discover risk loci. Here we perform a meta-analysis of these GWAS, add a ...

  13. Genome-wide meta-analysis identifies six novel loci associated with habitual coffee consumption

    NARCIS (Netherlands)

    Cornelis, M. C.; Byrne, E. M.; Esko, T.; Nalls, M. A.; Ganna, A.; Paynter, N.; Monda, K. L.; Amin, N.; Fischer, K.; Renstrom, F.; Ngwa, J. S.; Huikari, V.; Cavadino, A.; Nolte, I. M.; Teumer, A.; Yu, K.; Marques-Vidal, P.; Rawal, R.; Manichaikul, A.; Wojczynski, M. K.; Vink, J. M.; Zhao, J. H.; Burlutsky, G.; Lahti, J.; Mikkila, V.; Lemaitre, R. N.; Eriksson, J.; Musani, S. K.; Tanaka, T.; Geller, F.; Luan, J.; Hui, J.; Maegi, R.; Dimitriou, M.; Garcia, M. E.; Ho, W-K; Wright, M. J.; Rose, L. M.; Magnusson, P. K. E.; Pedersen, N. L.; Couper, D.; Oostra, B. A.; Hofman, A.; Ikram, M. A.; Tiemeier, H. W.; Uitterlinden, A. G.; van Rooij, F. J. A.; Barroso, I.; Johansson, I.; Xue, L.; Kaakinen, M.; Milani, L.; Power, C.; Snieder, H.; Stolk, R. P.; Baumeister, S. E.; Biffar, R.; Gu, F.; Bastardot, F.; Kutalik, Z.; Jacobs, D. R.; Forouhi, N. G.; Mihailov, E.; Lind, L.; Lindgren, C.; Michaelsson, K.; Morris, A.; Jensen, M.; Khaw, K-T; Luben, R. N.; Wang, J. J.; Mannisto, S.; Perala, M-M; Kahonen, M.; Lehtimaki, T.; Viikari, J.; Mozaffarian, D.; Mukamal, K.; Psaty, B. M.; Doering, A.; Heath, A. C.; Montgomery, G. W.; Dahmen, N.; Carithers, T.; Tucker, K. L.; Ferrucci, L.; Boyd, H. A.; Melbye, M.; Treur, J. L.; Mellstrom, D.; Hottenga, J. J.; Prokopenko, I.; Toenjes, A.; Deloukas, P.; Kanoni, S.; Lorentzon, M.; Houston, D. K.; Liu, Y.; Danesh, J.; Rasheed, A.; Mason, M. A.; Zonderman, A. B.; Franke, L.; Kristal, B. S.; Karjalainen, J.; Reed, D. R.; Westra, H-J; Evans, M. K.; Saleheen, D.; Harris, T. B.; Dedoussis, G.; Curhan, G.; Stumvoll, M.; Beilby, J.; Pasquale, L. R.; Feenstra, B.; Bandinelli, S.; Ordovas, J. M.; Chan, A. T.; Peters, U.; Ohlsson, C.; Gieger, C.; Martin, N. G.; Waldenberger, M.; Siscovick, D. S.; Raitakari, O.; Eriksson, J. G.; Mitchell, P.; Hunter, D. J.; Kraft, P.; Rimm, E. B.; Boomsma, D. I.; Borecki, I. B.; Loos, R. J. F.; Wareham, N. J.; Vollenweider, P.; Caporaso, N.; Grabe, H. J.; Neuhouser, M. L.; Wolffenbuttel, B. H. R.; Hu, F. B.; Hyppoenen, E.; Jarvelin, M-R; Cupples, L. A.; Franks, P. W.; Ridker, P. M.; van Duijn, C. M.; Heiss, G.; Metspalu, A.; North, K. E.; Ingelsson, E.; Nettleton, J. A.; van Dam, R. M.; Chasman, D. I.

    Coffee, a major dietary source of caffeine, is among the most widely consumed beverages in the world and has received considerable attention regarding health risks and benefits. We conducted a genome-wide (GW) meta-analysis of predominately regular-type coffee consumption (cups per day) among up to

  14. Integrative Genomic Analysis of Cholangiocarcinoma Identifies Distinct IDH-Mutant Molecular Profiles

    DEFF Research Database (Denmark)

    Farshidfar, Farshad; Zheng, Siyuan; Gingras, Marie-Claude

    2017-01-01

    Cholangiocarcinoma (CCA) is an aggressive malignancy of the bile ducts, with poor prognosis and limited treatment options. Here, we describe the integrated analysis of somatic mutations, RNA expression, copy number, and DNA methylation by The Cancer Genome Atlas of a set of predominantly intrahep...

  15. Genome-wide meta-analysis identifies new susceptibility loci for migraine

    NARCIS (Netherlands)

    Anttila, Verneri; Winsvold, Bendik S.; Gormley, Padhraig; Kurth, Tobias; Bettella, Francesco; McMahon, George; Kallela, Mikko; Malik, Rainer; de Vries, Boukje; Terwindt, Gisela; Medland, Sarah E.; Todt, Unda; McArdle, Wendy L.; Quaye, Lydia; Koiranen, Markku; Ikram, M. Arfan; Lehtimaki, Terho; Stam, Anine H.; Ligthart, Lannie; Wedenoja, Juho; Dunham, Ian; Neale, Benjamin M.; Palta, Priit; Hamalainen, Eija; Schuerks, Markus; Rose, Lynda M.; Buring, Julie E.; Ridker, Paul M.; Steinberg, Stacy; Stefansson, Hreinn; Jakobsson, Finnbogi; Lawlor, Debbie A.; Evans, David M.; Ring, Susan M.; Farkkila, Markus; Artto, Ville; Kaunisto, Mari A.; Freilinger, Tobias; Schoenen, Jean; Frants, Rune R.; Pelzer, Nadine; Weller, Claudia M.; Zielman, Ronald; Heath, Andrew C.; Madden, Pamela A. F.; Montgomery, Grant W.; Martin, Nicholas G.; Borck, Guntram; Goebel, Hartmut; Heinze, Axel

    Migraine is the most common brain disorder, affecting approximately 14% of the adult population, but its molecular mechanisms are poorly understood. We report the results of a meta-analysis across 29 genome-wide association studies, including a total of 23,285 individuals with migraine (cases) and

  16. Genome-wide meta-analysis identifies new susceptibility loci for migraine

    NARCIS (Netherlands)

    Anttila, V.; Winsvold, B.S.; Gormley, P.; Kurth, T.; Bettella, F.; McMahon, G.; Kallela, M.; Malik, R.; de Vries, B.; Terwindt, G.; Medland, S.E.; Todt, U.; McArdle, W.L.; Quaye, L.; Koiranen, M.; Ikram, M.A.; Lehtimäki, T.; Stam, A.H.; Ligthart, R.S.L.; Wedenoja, J.; Dunham, I.; Neale, B. M.; Palta, P.; Hamalainen, E.; Schürks, M.; Rose, L.M.; Buring, J.E.; Ridker, P.M.; Steinberg, S.; Stefansson, H.; Jakobsson, F.; Lawlor, D.A.; Evans, D.M.; Ring, S.M.; Färkkilä, M.; Artto, V.; Kaunisto, M.A.; Freilinger, T.; Schoenen, J.; Frants, R.R.; Pelzer, N.; Weller, C.M.; Zielman, R.; Heath, A.C.; Madden, P.A.F.; Montgomery, G.W.; Martin, N.G.; Borck, G.; Göbel, H.; Heinze, A.; Heinze-Kuhn, K.; Williams, F.M.; Hartikainen, A.-L.; Pouta, A.; van den Ende, J..; Uitterlinden, A.G.; Hofman, A.; Amin, N.; Hottenga, J.J.; Vink, J.M.; Heikkilä, K.; Alexander, M.; Muller-Myhsok, B.; Schreiber, S; Meitinger, T.; Wichmann, H. E.; Aromaa, A.; Eriksson, J.G.; Traynor, B.J.; Trabzuni, D.; Rossin, E.; Lage, K.; Jacobs, S.B.; Gibbs, J.R.; Birney, E.; Kaprio, J.; Penninx, B.W.J.H.; Boomsma, D.I.; van Duijn, C.M.; Raitakari, O.; Jarvelin, M.-R.; Zwart, J.A.; Cherkas, L.; Strachan, D.P.; Kubisch, C.; Ferrari, M.D.; van den Maagdenberg, A.M.J.M.; Dichgans, M.; Wessman, M.; Smith, G.D.; Stefansson, K.; Daly, M.J.; Nyholt, DR; Chasman, D.I.; Palotie, A.

    2013-01-01

    Migraine is the most common brain disorder, affecting approximately 14% of the adult population, but its molecular mechanisms are poorly understood. We report the results of a meta-analysis across 29 genome-wide association studies, including a total of 23,285 individuals with migraine (cases) and

  17. Genome-wide association analysis identifies 13 new risk loci for schizophrenia

    NARCIS (Netherlands)

    Ripke, Stephan; O'Dushlaine, Colm; Chambert, Kimberly; Moran, Jennifer L.; Kähler, Anna K.; Akterin, Susanne; Bergen, Sarah E.; Collins, Ann L.; Crowley, James J.; Fromer, Menachem; Kim, Yunjung; Lee, Sang Hong; Magnusson, Patrik K. E.; Sanchez, Nick; Stahl, Eli A.; Williams, Stephanie; Wray, Naomi R.; Xia, Kai; Bettella, Francesco; Borglum, Anders D.; Bulik-Sullivan, Brendan K.; Cormican, Paul; Craddock, Nick; de Leeuw, Christiaan; Durmishi, Naser; Gill, Michael; Golimbet, Vera; Hamshere, Marian L.; Holmans, Peter; Hougaard, David M.; Kendler, Kenneth S.; Lin, Kuang; Morris, Derek W.; Mors, Ole; Mortensen, Preben B.; Neale, Benjamin M.; O'Neill, Francis A.; Owen, Michael J.; Milovancevic, Milica Pejovic; Posthuma, Danielle; Powell, John; Richards, Alexander L.; Riley, Brien P.; Ruderfer, Douglas; Rujescu, Dan; Sigurdsson, Engilbert; Silagadze, Teimuraz; Smit, August B.; Stefansson, Hreinn; Steinberg, Stacy; Suvisaari, Jaana; Tosato, Sarah; Verhage, Matthijs; Walters, James T.; Levinson, Douglas F.; Gejman, Pablo V.; Laurent, Claudine; Mowry, Bryan J.; O'Donovan, Michael C.; Pulver, Ann E.; Schwab, Sibylle G.; Wildenauer, Dieter B.; Dudbridge, Frank; Shi, Jianxin; Albus, Margot; Alexander, Madeline; Campion, Dominique; Cohen, David; Dikeos, Dimitris; Duan, Jubao; Eichhammer, Peter; Godard, Stephanie; Hansen, Mark; Lerer, F. Bernard; Liang, Kung-Yee; Maier, Wolfgang; Mallet, Jacques; Nertney, Deborah A.; Nestadt, Gerald; Norton, Nadine; Papadimitriou, George N.; Ribble, Robert; Sanders, Alan R.; Silverman, Jeremy M.; Walsh, Dermot; Williams, Nigel M.; Wormley, Brandon; Arranz, Maria J.; Bakker, Steven; Bender, Stephan; Bramon, Elvira; Collier, David; Crespo-Facorro, Benedicto; Hall, Jeremy; Iyegbe, Conrad; Jablensky, Assen; Kahn, Rene S.; Kalaydjieva, Luba; Lawrie, Stephen; Lewis, Cathryn M.; Linszen, Don H.; Mata, Ignacio; McIntosh, Andrew; Murray, Robin M.; Ophoff, Roel A.; van Os, Jim; Walshe, Muriel; Weisbrod, Matthias; Wiersma, Durk; Donnelly, Peter; Barroso, Ines; Blackwell, Jenefer M.; Brown, Matthew A.; Casas, Juan P.; Corvin, Aiden P.; Deloukas, Panos; Duncanson, Audrey; Jankowski, Janusz; Markus, Hugh S.; Mathew, Christopher G.; Palmer, Colin N. A.; Plomin, Robert; Rautanen, Anna; Sawcer, Stephen J.; Trembath, Richard C.; Viswanathan, Ananth C.; Wood, Nicholas W.; Spencer, Chris C. A.; Band, Gavin; Bellenguez, Céline; Freeman, Colin; Hellenthal, Garrett; Giannoulatou, Eleni; Pirinen, Matti; Pearson, Richard D.; Strange, Amy; Su, Zhan; Vukcevic, Damjan; Langford, Cordelia; Hunt, Sarah E.; Edkins, Sarah; Gwilliam, Rhian; Blackburn, Hannah; Bumpstead, Suzannah J.; Dronov, Serge; Gillman, Matthew; Gray, Emma; Hammond, Naomi; Jayakumar, Alagurevathi; McCann, Owen T.; Liddle, Jennifer; Potter, Simon C.; Ravindrarajah, Radhi; Ricketts, Michelle; Tashakkori-Ghanbaria, Avazeh; Waller, Matthew J.; Weston, Paul; Widaa, Sara; Whittaker, Pamela; McCarthy, Mark I.; Stefansson, Kari; Scolnick, Edward; Purcell, Shaun; McCarroll, Steven A.; Sklar, Pamela; Hultman, Christina M.; Sullivan, Patrick F.

    2013-01-01

    Schizophrenia is an idiopathic mental disorder with a heritable component and a substantial public health impact. We conducted a multi-stage genome-wide association study (GWAS) for schizophrenia beginning with a Swedish national sample (5,001 cases and 6,243 controls) followed by meta-analysis with

  18. Genome-wide association study identifies novel loci associated with circulating phospho- and sphingolipid concentrations

    DEFF Research Database (Denmark)

    Demirkan, Ayşe; van Duijn, Cornelia M; Ugocsai, Peter

    2012-01-01

    , and metabolic consequences. A large number of phospholipid and sphingolipid species can be detected and measured in human plasma. We conducted a meta-analysis of five European family-based genome-wide association studies (N = 4034) on plasma levels of 24 sphingomyelins (SPM), 9 ceramides (CER), 57...

  19. Genome-wide association study identifies FCGR2A as a susceptibility locus for Kawasaki disease

    NARCIS (Netherlands)

    Khor, Chiea Chuen; Davila, Sonia; Breunis, Willemijn B.; Lee, Yi-Ching; Shimizu, Chisato; Wright, Victoria J.; Yeung, Rae S. M.; Tan, Dennis E. K.; Sim, Kar Seng; Wang, Jie Jin; Wong, Tien Yin; Pang, Junxiong; Mitchell, Paul; Cimaz, Rolando; Dahdah, Nagib; Cheung, Yiu-Fai; Huang, Guo-Ying; Yang, Wanling; Park, In-Sook; Lee, Jong-Keuk; Wu, Jer-Yuarn; Levin, Michael; Burns, Jane C.; Burgner, David; Kuijpers, Taco W.; Hibberd, Martin L.; Lau, Yu-Lung; Zhang, Jing; Ma, Xiao-Jing; Liu, Fang; Wu, Lin; Yoo, Jeong-Jin; Hong, Soo-Jong; Kim, Kwi-Joo; Kim, Jae-Jung; Park, Young-Mi; Mi Hong, Young; Sohn, Sejung; Young Jang, Gi; Ha, Kee-Soo; Nam, Hyo-Kyoung; Byeon, Jung-Hye; Weon Yun, Sin; Ki Han, Myung; Lee, Kyung-Yil; Hwang, Ja-Young; Kuipers, Irene M.; Ottenkamp, Jaap J.; Biezeveld, Maarten; Tacke, Carline

    2011-01-01

    Kawasaki disease is a systemic vasculitis of unknown etiology, with clinical observations suggesting a substantial genetic contribution to disease susceptibility. We conducted a genome-wide association study and replication analysis in 2,173 individuals with Kawasaki disease and 9,383 controls from

  20. Genome-wide meta-analysis identifies multiple novel associations and ethnic heterogeneity of psoriasis susceptibility

    NARCIS (Netherlands)

    Yin, Xianyong; Low, Hui Qi; Wang, Ling; Li, Yonghong; Ellinghaus, Eva; Han, Jiali; Estivill, Xavier; Sun, Liangdan; Zuo, Xianbo; Shen, Changbing; Zhu, Caihong; Zhang, Anping; Sanchez, Fabio; Padyukov, Leonid; Catanese, Joseph J; Krueger, Gerald G; Duffin, Kristina Callis; Mucha, Sören; Weichenthal, Michael; Weidinger, Stephan; Lieb, Wolfgang; Foo, Jia Nee; Li, Yi; Sim, Karseng; Liany, Herty; Irwan, Ishak; Teo, Yikying; Theng, Colin T S; Gupta, Rashmi; Bowcock, Anne; De Jager, Philip L; Qureshi, Abrar A; de Bakker, Paul I W; Seielstad, Mark; Liao, Wilson; Ståhle, Mona; Franke, Andre; Zhang, Xuejun; Liu, Jianjun

    2015-01-01

    Psoriasis is a common inflammatory skin disease with complex genetics and different degrees of prevalence across ethnic populations. Here we present the largest trans-ethnic genome-wide meta-analysis (GWMA) of psoriasis in 15,369 cases and 19,517 controls of Caucasian and Chinese ancestries. We

  1. Using an online genome resource to identify myostatin variation in U.S. sheep

    Science.gov (United States)

    We created a public, searchable DNA sequence resource for sheep that contained approximately 14x whole genome sequence of 96 rams. The animals represent 10 popular U.S. breeds and share minimal pedigree relationships, making the resource suitable for viewing gene variants in the user-friendly Integ...

  2. Genome-wide association study identifies six new loci influencing pulse pressure and mean arterial pressure

    NARCIS (Netherlands)

    L.V. Wain (Louise); G.C. Verwoert (Germaine); P.F. O'Reilly (Paul); G. Shi (Gang); T. Johnson (Toby); M. Bochud (Murielle); K. Rice (Kenneth); P. Henneman (Peter); A.V. Smith (Albert Vernon); G.B. Ehret (Georg); N. Amin (Najaf); M.G. Larson (Martin); V. Mooser (Vincent); D. Hadley (David); M. Dörr (Marcus); J.C. Bis (Joshua); T. Aspelund (Thor); T. Esko (Tõnu); A.C.J.W. Janssens (Cécile); J.H. Zhao (Jing Hua); S.C. Heath (Simon); M. Laan (Maris); J. Fu (Jingyuan); G. Pistis (Giorgio); J. Luan; G. Lucas (Gavin); N. Pirastu (Nicola); I. Pichler (Irene); A.U. Jackson (Anne); R.J. Webster (Rebecca J.); F.F. Zhang; J. Peden (John); R. Schmidt (Reinhold); T. Tanaka (Toshiko); H. Campbell (Harry); W. Igl (Wilmar); Y. Milaneschi (Yuri); J.J. Hottenga (Jouke Jan); V. Vitart (Veronique); D.I. Chasman (Daniel); S. Trompet (Stella); J.L. Bragg-Gresham (Jennifer L.); B.Z. Alizadeh (Behrooz); J.C. Chambers (John); X. Guo (Xiuqing); T. Lehtimäki (Terho); B. Kuhnel (Brigitte); L.M. Lopez; O. Polasek (Ozren); M. Boban (Mladen); C.P. Nelson (Christopher P.); A.C. Morrison (Alanna); V. Pihur (Vasyl); S.K. Ganesh (Santhi); A. Hofman (Albert); S. Kundu (Suman); F.U.S. Mattace Raso (Francesco); F. Rivadeneira Ramirez (Fernando); E.J.G. Sijbrands (Eric); A.G. Uitterlinden (André); S.J. Hwang; R.S. Vasan (Ramachandran Srini); Y.A. Wang (Ying); S.M. Bergmann (Sven); P. Vollenweider (Peter); G. Waeber (Gérard); J. Laitinen (Jaana); A. Pouta (Anneli); P. Zitting (Paavo); W.L. McArdle (Wendy); H.K. Kroemer (Heyo); U. Völker (Uwe); H. Völzke (Henry); N.L. Glazer (Nicole); K.D. Taylor (Kent); T.B. Harris (Tamara); H. Alavere (Helene); T. Haller (Toomas); A. Keis (Aime); M.L. Tammesoo; Y.S. Aulchenko (Yurii); K-T. Khaw (Kay-Tee); P. Galan (Pilar); S. Hercberg (Serge); G.M. Lathrop (Mark); S. Eyheramendy (Susana); E. Org (Elin); S. Sõber (Siim); X. Lu (Xiaowen); I.M. Nolte (Ilja); B.W.J.H. Penninx (Brenda); T. Corre (Tanguy); C. Masciullo (Corrado); C. Sala (Cinzia); L. Groop (Leif); B.F. Voight (Benjamin); O. Melander (Olle); C.J. O'Donnell (Christopher); V. Salomaa (Veikko); P. d' Adamo (Pio); A. Fabretto (Antonella); F. Faletra (Flavio); S. Ulivi (Shelia); F. Del Greco M (Fabiola); M.F. Facheris (Maurizio); F.S. Collins (Francis); R.N. Bergman (Richard); J.P. Beilby (John); J. Hung (Judy); A.W. Musk (Arthur); M. Mangino (Massimo); S.Y. Shin (So Youn); N. Soranzo (Nicole); H. Watkins (Hugh); A. Goel (Anuj); A. Hamsten (Anders); P. Gider (Pierre); M. Loitfelder (Marisa); M. Zeginigg (Marion); D.G. Hernandez (Dena); S.S. Najjar (Samer); P. Navarro (Pau); S.H. Wild (Sarah); A.M. Corsi (Anna Maria); A. Singleton (Andrew); E.J.C. de Geus (Eco); G.A.H.M. Willemsen (Gonneke); A.N. Parker (Alex); L.M. Rose (Lynda); B.M. Buckley (Brendan M.); D.J. Stott (David. J.); M. Orrù (Marco); M. Uda (Manuela); M.M. van der Klauw (Melanie); X. Li (Xiaohui); J. Scott (James); Y.D.I. Chen (Yii-Der Ida); G.L. Burke (Greg); M. Kähönen (Mika); J. Viikari (Jorma); A. Döring (Angela); T. Meitinger (Thomas); G.S. Davis; J.M. Starr (John); V. Emilsson (Valur); A.S. Plump (Andrew); J.H. Lindeman (Jan H.); P.A.C. 't Hoen (Peter); I.R. König (Inke); J.F. Felix (Janine); R. Clarke; J. Hopewell; H. Ongen (Halit); M.M.B. Breteler (Monique); S. Debette (Stéphanie); A.L. DeStefano (Anita); M. Fornage (Myriam); G.F. Mitchell (Gary); H. Holm (Hilma); K. Stefansson (Kari); G. Thorleifsson (Gudmar); U. Thorsteinsdottir (Unnur); N.J. Samani (Nilesh); M. Preuss (Michael); I. Rudan (Igor); C. Hayward (Caroline); I.J. Deary (Ian); H.E. Wichmann (Heinz Erich); O. Raitakari (Olli); W. Palmas (Walter); J.S. Kooner (Jaspal); R.P. Stolk (Ronald); J.W. Jukema (Jan Wouter); A.F. Wright (Alan); D.I. Boomsma (Dorret); S. Bandinelli (Stefania); U. Gyllensten (Ulf); J.F. Wilson (James); L. Ferrucci (Luigi); M. Farrall (Martin); T.D. Spector (Timothy); L.J. Palmer; J. Tuomilehto (Jaakko); A. Pfeufer (Arne); P. Gasparini (Paolo); D.S. Siscovick (David); D. Altshuler (David); R.J.F. Loos (Ruth); D. Toniolo (Daniela); H. Snieder (Harold); C. Gieger (Christian); P. Meneton (Pierre); N.J. Wareham (Nick); B.A. Oostra (Ben); A. Metspalu (Andres); L.J. Launer (Lenore); R. Rettig (Rainer); D.P. Strachan (David); J.S. Beckmann (Jacques); J.C.M. Witteman (Jacqueline); J.A.P. Willems van Dijk (Ko); E.A. Boerwinkle (Eric); M. Boehnke (Michael); P.M. Ridker (Paul); M.R. Järvelin; A. Chakravarti (Aravinda); J. Erdmann (Jeanette); V. Gudnason (Vilmundur); C. Newton-Cheh (Christopher); D. Levy (Daniel); P. Arora (Pankaj); P. Munroe (Patricia); B.M. Psaty (Bruce); M. Caulfield (Mark); D.C. Rao (Dabeeru C.); P. Elliott (Paul); P. Tikka-Kleemola (Päivi); G.R. Abecasis (Gonçalo); I.E. Barroso (Inês)

    2011-01-01

    textabstractNumerous genetic loci have been associated with systolic blood pressure (SBP) and diastolic blood pressure (DBP) in Europeans. We now report genome-wide association studies of pulse pressure (PP) and mean arterial pressure (MAP). In discovery (N = 74,064) and follow-up studies (N =

  3. Genome-wide association analyses identify variants in developmental genes associated with hypospadias

    DEFF Research Database (Denmark)

    Geller, Frank; Feenstra, Bjarke; Carstensen, Lisbeth

    2014-01-01

    Hypospadias is a common congenital condition in boys in which the urethra opens on the underside of the penis. We performed a genome-wide association study on 1,006 surgery-confirmed hypospadias cases and 5,486 controls from Denmark. After replication genotyping of an additional 1,972 cases and 1...

  4. Genome-wide association study identifies new prostate cancer susceptibility loci

    DEFF Research Database (Denmark)

    Schumacher, Fredrick R.; Berndt, Sonja I.; Siddiq, Afshan

    2011-01-01

    Prostate cancer (PrCa) is the most common non-skin cancer diagnosed among males in developed countries and the second leading cause of cancer mortality, yet little is known regarding its etiology and factors that influence clinical outcome. Genome-wide association studies (GWAS) of PrCa have iden...

  5. Genome-wide association study identifies 74 loci associated with educational attainment

    NARCIS (Netherlands)

    A. Okbay (Aysu); J.P. Beauchamp (Jonathan); Fontana, M.A. (Mark Alan); J.J. Lee (James J.); T.H. Pers (Tune); Rietveld, C.A. (Cornelius A.); P. Turley (Patrick); Chen, G.-B. (Guo-Bo); V. Emilsson (Valur); Meddens, S.F.W. (S. Fleur W.); Oskarsson, S. (Sven); Pickrell, J.K. (Joseph K.); Thom, K. (Kevin); Timshel, P. (Pascal); R. de Vlaming (Ronald); A. Abdellaoui (Abdel); T.S. Ahluwalia (Tarunveer Singh); J. Bacelis (Jonas); C. Baumbach (Clemens); Bjornsdottir, G. (Gyda); J.H. Brandsma (Johan); Pina Concas, M. (Maria); J. Derringer; Furlotte, N.A. (Nicholas A.); T.E. Galesloot (Tessel); S. Girotto; Gupta, R. (Richa); L.M. Hall (Leanne M.); S.E. Harris (Sarah); E. Hofer; Horikoshi, M. (Momoko); J.E. Huffman (Jennifer E.); Kaasik, K. (Kadri); I.-P. Kalafati (Ioanna-Panagiota); R. Karlsson (Robert); A. Kong (Augustine); J. Lahti (Jari); S.J. van der Lee (Sven); Deleeuw, C. (Christiaan); P.A. Lind (Penelope); Lindgren, K.-O. (Karl-Oskar); Liu, T. (Tian); M. Mangino (Massimo); J. Marten (Jonathan); E. Mihailov (Evelin); M. Miller (Mike); P.J. van der Most (Peter); C. Oldmeadow (Christopher); A. Payton (Antony); N. Pervjakova (Natalia); W.J. Peyrot (Wouter ); Qian, Y. (Yong); O. Raitakari (Olli); Rueedi, R. (Rico); Salvi, E. (Erika); Schmidt, B. (Börge); Schraut, K.E. (Katharina E.); Shi, J. (Jianxin); A.V. Smith (Albert Vernon); R.A. Poot (Raymond); B. St Pourcain (Beate); A. Teumer (Alexander); G. Thorleifsson (Gudmar); N. Verweij (Niek); D. Vuckovic (Dragana); Wellmann, J. (Juergen); H.J. Westra (Harm-Jan); Yang, J. (Jingyun); Zhao, W. (Wei); Zhu, Z. (Zhihong); B.Z. Alizadeh (Behrooz); N. Amin (Najaf); Bakshi, A. (Andrew); S.E. Baumeister (Sebastian); G. Biino (Ginevra); K. Bønnelykke (Klaus); P.A. Boyle (Patricia); H. Campbell (Harry); Cappuccio, F.P. (Francesco P.); G. Davies (Gail); J.E. de Neve (Jan-Emmanuel); P. Deloukas (Panagiotis); I. Demuth (Ilja); Ding, J. (Jun); Eibich, P. (Peter); Eisele, L. (Lewin); N. Eklund (Niina); D.M. Evans (David); J.D. Faul (Jessica D.); M.F. Feitosa (Mary Furlan); A.J. Forstner (Andreas); I. Gandin (Ilaria); Gunnarsson, B. (Bjarni); B.V. Halldorsson (Bjarni); T.B. Harris (Tamara); E.G. Holliday (Elizabeth); A.C. Heath (Andrew C.); L.J. Hocking; G. Homuth (Georg); M. Horan (Mike); J.J. Hottenga (Jouke Jan); P.L. de Jager (Philip); P.K. Joshi (Peter); A. Juqessur (Astanand); M. Kaakinen (Marika); M. Kähönen (Mika); S. Kanoni (Stavroula); Keltigangas-Järvinen, L. (Liisa); L.A.L.M. Kiemeney (Bart); I. Kolcic (Ivana); Koskinen, S. (Seppo); A. Kraja (Aldi); Kroh, M. (Martin); Z. Kutalik (Zoltán); A. Latvala (Antti); L.J. Launer (Lenore); Lebreton, M.P. (Maël P.); D.F. Levinson (Douglas F.); P. Lichtenstein (Paul); P. Lichtner (Peter); D.C. Liewald (David C.); A. Loukola (Anu); P.A. Madden (Pamela); R. Mägi (Reedik); Mäki-Opas, T. (Tomi); R.E. Marioni (Riccardo); P. Marques-Vidal; Meddens, G.A. (Gerardus A.); G. Mcmahon (George); C. Meisinger (Christa); T. Meitinger (Thomas); Milaneschi, Y. (Yusplitri); L. Milani (Lili); G.W. Montgomery (Grant); R. Myhre (Ronny); C.P. Nelson (Christopher P.); D.R. Nyholt (Dale); W.E.R. Ollier (William); A. Palotie (Aarno); L. Paternoster (Lavinia); N.L. Pedersen (Nancy); K. Petrovic (Katja); D.J. Porteous (David J.); K. Räikkönen (Katri); Ring, S.M. (Susan M.); A. Robino (Antonietta); O. Rostapshova (Olga); I. Rudan (Igor); A. Rustichini (Aldo); V. Salomaa (Veikko); Sanders, A.R. (Alan R.); A.-P. Sarin; R. Schmidt (Reinhold); R.J. Scott (Rodney); B.H. Smith (Blair); J.A. Smith (Jennifer A); J.A. Staessen (Jan); E. Steinhagen-Thiessen (Elisabeth); K. Strauch (Konstantin); A. Terracciano; M.D. Tobin (Martin); S. Ulivi (Shelia); S. Vaccargiu (Simona); L. Quaye (Lydia); F.J.A. van Rooij (Frank); C. Venturini (Cristina); A.A.E. Vinkhuyzen (Anna A.); U. Völker (Uwe); Völzke, H. (Henry); J.M. Vonk (Judith); D. Vozzi (Diego); J. Waage (Johannes); E.B. Ware (Erin B.); G.A.H.M. Willemsen (Gonneke); J. Attia (John); D.A. Bennett (David A.); Berger, K. (Klaus); L. Bertram (Lars); H. Bisgaard (Hans); D.I. Boomsma (Dorret); I.B. Borecki (Ingrid); U. Bültmann (Ute); C.F. Chabris (Christopher F.); F. Cucca (Francesco); D. Cusi (Daniele); I.J. Deary (Ian J.); G.V. Dedoussis (George); C.M. van Duijn (Cornelia); K. Hagen (Knut); B. Franke (Barbara); L. Franke (Lude); P. Gasparini (Paolo); P.V. Gejman (Pablo); C. Gieger (Christian); H.J. Grabe (Hans Jörgen); J. Gratten (Jacob); P.J.F. Groenen (Patrick); V. Gudnason (Vilmundur); P. van der Harst (Pim); C. Hayward (Caroline); D.A. Hinds (David A.); W. Hoffmann (Wolfgang); E. Hypponen (Elina); W.G. Iacono (William); B. Jacobsson (Bo); M.-R. Jarvelin (Marjo-Riitta); K.-H. JöCkel (Karl-Heinz); J. Kaprio (Jaakko); S.L.R. Kardia (Sharon); T. Lehtimäki (Terho); Lehrer, S.F. (Steven F.); P.K. Magnusson (Patrik); N.G. Martin (Nicholas); M. McGue (Matt); A. Metspalu (Andres); N. Pendleton (Neil); B.W.J.H. Penninx (Brenda); M. Perola (Markus); N. Pirastu (Nicola); M. Pirastu (Mario); O. Polasek (Ozren); D. Posthuma (Danielle); C. Power (Christopher); M.A. Province (Mike); N.J. Samani (Nilesh); Schlessinger, D. (David); R. Schmidt (Reinhold); T.I.A. Sørensen (Thorkild); T.D. Spector (Timothy); J-A. Zwart (John-Anker); U. Thorsteinsdottir (Unnur); A.R. Thurik (Roy); Timpson, N.J. (Nicholas J.); H.W. Tiemeier (Henning); J.Y. Tung (Joyce Y.); A.G. Uitterlinden (André); Vitart, V. (Veronique); P. Vollenweider (Peter); D.R. Weir (David); J.F. Wilson (James F.); A.F. Wright (Alan); Conley, D.C. (Dalton C.); R.F. Krueger; G.D. Smith; Hofman, A. (Albert); D. Laibson (David); S.E. Medland (Sarah Elizabeth); M.N. Meyer (Michelle N.); J. Yang (Joanna); M. Johannesson (Magnus); P.M. Visscher (Peter); T. Esko (Tõnu); Ph.D. Koellinger (Philipp); D. Cesarini (David); D.J. Benjamin (Daniel J.)

    2016-01-01

    textabstractEducational attainment is strongly influenced by social and other environmental factors, but genetic factors are estimated to account for at least 20% of the variation across individuals. Here we report the results of a genome-wide association study (GWAS) for educational attainment that

  6. Using rice genome-wide association studies to identify DNA markers for marker-assisted selection

    Science.gov (United States)

    Rice association mapping panels are collections of rice (Oryza sativa L.) accessions developed for genome-wide association (GWA) studies. One of these panels, the Rice Diversity Panel 1 (RDP1) was phenotyped by various research groups for several traits of interest, and more recently, genotyped with...

  7. Genome-wide association analysis identifies 13 new risk loci for schizophrenia

    NARCIS (Netherlands)

    Ripke, S.; O'Dushlaine, C.; Chambert, K.; Moran, J.L.; Kähler, A.K.; Akterin, S.; Bergen, S.E.; Collins, A.L.; Crowley, J.J.; Fromer, M.; Kim, Y.; Lee, S.H.; Magnusson, P.K.; Sanchez, N.; Stahl, E.A.; Williams, S.; Wray, N.R.; Xia, K.; Bettella, F.; Borglum, A. D.; Bulik-Sullivan, B.K.; Cormican, P.; Craddock, N.; de Leeuw, C.A.; Durmishi, N.; Gill, M.; Golimbet, V.; Hamshere, M.L.; Holmans, P.; Hougaard, D. M.; Kendler, K.S.; Lin, K.; Morris, D. W.; Mors, O.; Mortensen, P.B.; Neale, B. M.; O'Neill, F. A.; Owen, M.J.; Milovancevic, M.P.; Posthuma, D.; Powell, J.; Richards, A.L.; Riley, B.P.; Ruderfer, D.; Rujescu, D.; Sigurdsson, E.; Silagadze, T.; Smit, A.B.; Stefansson, H.; Steinberg, S.; Suvisaari, J.; Tosato, S.; Verhage, M.; Walters, T.J.; Levinson, D.F.; Gejman, P.V.; Laurent, C.; Mowry, B. J.; O'Donovan, M.C.; Pulver, A. E.; Schwab, S.G.; Wildenauer, D. B.; Dudbridge, F.; Shi, J.; Albus, M.; Alexander, M.; Campion, D.; Cohen, D.; Dikeos, D.; Duan, J.; Eichhammer, P.; Godard, S.; Hansen, M.; Lerer, F.B.; Liang, K.Y.; Maier, W.; Mallet, J.; Nertney, D. A.; Nestadt, G.; Norton, N.; O'Neill, F.A.; Papadimitriou, G.N.; Ribble, R.; Sanders, A.R.; Silverman, J.M.; Wormley, B.; Arranz, M.J.; Bakker, S.; Bender, S.; Bramon, E.; Collier, D.; Crespo-Facorro, B.; Hall, J.; Iyegbe, C.; Jablensky, A.; Kahn, R.S.; Kalaydjieva, L.; Lawrie, S.M.; Lewis, C.M.; Linszen, D.H.; Mata, I.; McIntosh, A.; Murray, R.M.; Ophoff, R.A.; van Os, J.; Walshe, M.; Weisbrod, M.; Wiersma, D.; Donnely, P.; Barasso, I.; Blackwell, J.M.; Brown, M.A.; Casas, J.P.; Corvin, A.P.; Deloukas, P.; Duncanson, A.; Jankowski, J.; Markus, H.S.; Mathew, C.G.; Palmer, C.N.; Plomin, R.; Rautanen, A.; Sawcer, S.J.; Trembath, R.C.; Viswanathan, A.C.; Wood, N.W.; Spencer, C. C.; Band, G.; Bellenguez, C.; Freeman, C.; Hellenthal, G.; Giannoulatou, E.; Pirinen, M.; Pearson, R.D.; Strange, A.; Su, Z.; Vukcevic, D.; Langford, C.; Hunt, S.E.; Edkins, S.; Gwilliam, R.; Blackburn, H.; Bumpstead, S.; Dronov, S.; Gillman, M.; Gray, E.; Hammond, N.; Jayakumar, A.; McCann, O.T.; Liddle, J.; Potter, S.C.; Ravindrarajah, R.; Ricketts, M.; Tashakkori-Ghanbaria, A.; Waller, M.J.; Weston, P.; Widaa, S.; Whittaker, P.; Barrroso, I.; McCarthy, M.I.; Spencer, C.C.; Stefansson, K.; Scolnick, E.; Purcell, S.; McCarroll, S.A.; Sklar, P.; Hultman, C. M.; Sullivan, P.F.

    2013-01-01

    Schizophrenia is an idiopathic mental disorder with a heritable component and a substantial public health impact. We conducted a multi-stage genome-wide association study (GWAS) for schizophrenia beginning with a Swedish national sample (5,001 cases and 6,243 controls) followed by meta-Analysis with

  8. Genome-wide meta-analysis identifies six novel loci associated with habitual coffee consumption

    NARCIS (Netherlands)

    M. Cornelis (Marilyn); E.M. Byrne; T. Esko (Tõnu); M.A. Nalls (Michael); A. Ganna (Andrea); N.P. Paynter (Nina); K.L. Monda (Keri); N. Amin (Najaf); K. Fischer (Krista); F. Renström (Frida); J.S. Ngwa; V. Huikari (Ville); A. Cavadino (Alana); I.M. Nolte (Ilja M.); A. Teumer (Alexander); K. Yu; P. Marques-Vidal; R. Rawal; A. Manichaikul (Ani); M.K. Wojczynski (Mary ); J.M. Vink; J.H. Zhao (Jing Hua); G. Burlutsky (George); J. Lahti (Jari); V. Mikkilä (Vera); R.N. Lemaitre (Rozenn ); J. Eriksson; S. Musani (Solomon); T. Tanaka; F. Geller (Frank); J. Luan; J. Hui; R. Mägi (Reedik); M. Dimitriou (Maria); M. Garcia (Melissa); W.-K. Ho; M.J. Wright (Margaret); L.M. Rose (Lynda M.); P.K.E. Magnusson (Patrik K. E.); N.L. Pedersen (Nancy L.); D.J. Couper (David); B.A. Oostra (Ben); A. Hofman (Albert); M.A. Ikram (Arfan); H.W. Tiemeier (Henning); A.G. Uitterlinden (André); F.J.A. van Rooij (Frank); I. Barroso; I. Johansson (Ingegerd); L. Xue (Luting); M. Kaakinen (Marika); L. Milani (Lili); C. Power (Christine); H. Snieder (Harold); R.P. Stolk; S.E. Baumeister (Sebastian); R. Biffar; F. Gu; F. Bastardot (Francois); Z. Kutalik; D.R. Jacobs (David); N.G. Forouhi (Nita G.); E. Mihailov (Evelin); L. Lind (Lars); C. Lindgren; K. Michaëlsson; A.P. Morris (Andrew); M.K. Jensen (Majken K.); K.T. Khaw; R.N. Luben (Robert); J.J. Wang; S. Männistö (Satu); M.-M. Perälä; M. Kähönen (Mika); T. Lehtimäki (Terho); J. Viikari (Jorma); D. Mozaffarian; K. Mukamal (Kenneth); B.M. Psaty (Bruce); A. Döring; A.C. Heath (Andrew C.); G.W. Montgomery (Grant W.); N. Dahmen (N.); T. Carithers; K.L. Tucker; L. Ferrucci (Luigi); H.A. Boyd; M. Melbye (Mads); J.L. Treur; D. Mellström (Dan); J.J. Hottenga (Jouke Jan); I. Prokopenko (Inga); A. Tönjes (Anke); P. Deloukas (Panagiotis); S. Kanoni (Stavroula); M. Lorentzon (Mattias); D.K. Houston; Y. Liu; J. Danesh (John); A. Rasheed; M.A. Mason; A.B. Zonderman; L. Franke (Lude); B.S. Kristal; J. Karjalainen (Juha); D.R. Reed; H.-J. Westra; M.K. Evans; D. Saleheen; T.B. Harris (Tamara); G.V. Dedoussis (George V.); G.C. Curhan (Gary); M. Stumvoll (Michael); J. Beilby (John); L.R. Pasquale; B. Feenstra; S. Bandinelli; J.M. Ordovas; A.T. Chan; U. Peters (Ulrike); C. Ohlsson (Claes); C. Gieger (Christian); N.G. Martin (Nicholas); M. Waldenberger (Melanie); D.S. Siscovick (David); O. Raitakari (Olli); J.G. Eriksson (Johan G.); P. Mitchell (Paul); D. Hunter (David); P. Kraft (Peter); E.B. Rimm (Eric B.); D.I. Boomsma (Dorret); I.B. Borecki (Ingrid); R.J.F. Loos (Ruth); N.J. Wareham (Nick); P.K. Vollenweider (Peter K.); N. Caporaso; H.J. Grabe (Hans Jörgen); M.L. Neuhouser (Marian L.); B.H.R. Wolffenbuttel (Bruce H. R.); F.B. Hu (Frank); E. Hypponen (Elina); M.-R. Jarvelin (Marjo-Riitta); L.A. Cupples (Adrienne); P.W. Franks; P.M. Ridker (Paul); C.M. van Duijn (Cornelia); G. Heiss (Gerardo); A. Metspalu (Andres); K.E. North (Kari); E. Ingelsson (Erik); J.A. Nettleton; R.M. van Dam (Rob); D.I. Chasman (Daniel)

    2015-01-01

    textabstractCoffee, a major dietary source of caffeine, is among the most widely consumed beverages in the world and has received considerable attention regarding health risks and benefits. We conducted a genome-wide (GW) meta-analysis of predominately regular-type coffee consumption (cups per day)

  9. Genome-wide association analysis identifies three new susceptibility loci for childhood body mass index

    NARCIS (Netherlands)

    J.F. Felix (Janine); J.P. Bradfield (Jonathan); C. Monnereau; R.J.P. van der Valk (Ralf); E. Stergiakouli (Evie); A. Chesi (Alessandra); R. Gaillard (Romy); B. Feenstra (Bjarke); E. Thiering (Elisabeth); E. Kreiner-Møller (Eskil); A. Mahajan (Anubha); Niina Pitkänen; R. Joro (Raimo); A. Cavadino (Alana); V. Huikari (Ville); S. Franks (Steve); M. Groen-Blokhuis (Maria); D.L. Cousminer (Diana); J.A. Marsh (Julie); T. Lehtimäki (Terho); J.A. Curtin (John); J. Vioque (Jesus); T.S. Ahluwalia (Tarunveer Singh); R. Myhre (Ronny); T.S. Price (Thomas); Natalia Vilor-Tejedor; L. Yengo (Loic); N. Grarup (Niels); I. Ntalla (Ioanna); W.Q. Ang (Wei); M. Atalay (Mustafa); H. Bisgaard (Hans); A.I.F. Blakemore (Alexandra); A. Bonnefond (Amélie); L. Carstensen (Lisbeth); J.G. Eriksson (Johan G.); C. Flexeder (Claudia); L. Franke (Lude); F. Geller (Frank); M. Geserick (Mandy); A.L. Hartikainen; C.M.A. Haworth (Claire M.); J.N. Hirschhorn (Joel N.); A. Hofman (Albert); J.-C. Holm (Jens-Christian); M. Horikoshi (Momoko); J.J. Hottenga (Jouke Jan); J. Huang (Jian); H.N. Kadarmideen (Haja N.); M. Kähönen (Mika); W. Kiess (Wieland); T.A. Lakka (Timo); T.A. Lakka (Timo); A. Lewin (Alex); L. Liang (Liming); L.-P. Lyytikäinen (Leo-Pekka); B. Ma (Baoshan); P. Magnus (Per); S.E. McCormack (Shana E.); G. Mcmahon (George); F.D. Mentch (Frank); C.M. Middeldorp (Christel); C.S. Murray (Clare S.); K. Pahkala (Katja); T.H. Pers (Tune); R. Pfäffle (Roland); D.S. Postma (Dirkje); C. Power (Christine); A. Simpson (Angela); V. Sengpiel (Verena); C. Tiesler (Carla); M. Torrent (Maties); A.G. Uitterlinden (André); J.B.J. van Meurs (Joyce); R. Vinding (Rebecca); J. Waage (Johannes); J. Wardle (Jane); E. Zeggini (Eleftheria); B.S. Zemel (Babette S.); G.V. Dedoussis (George); O. Pedersen (Oluf); P. Froguel (Philippe); J. Sunyer (Jordi); R. Plomin (Robert); B. Jacobsson (Bo); T. Hansen (Torben); J.R. Gonzalez (Juan R.); A. Custovic; O.T. Raitakari (Olli T.); C.E. Pennell (Craig); Elisabeth Widén; D.I. Boomsma (Dorret); G.H. Koppelman (Gerard); S. Sebert (Sylvain); M.-R. Jarvelin (Marjo-Riitta); E. Hypponen (Elina); M.I. McCarthy (Mark); V. Lindi (Virpi); N. Harri (Niinikoski); A. Körner (Antje); K. Bønnelykke (Klaus); J. Heinrich (Joachim); M. Melbye (Mads); F. Rivadeneira Ramirez (Fernando); H. Hakonarson (Hakon); S.M. Ring (Susan); G.D. Smith; T.I.A. Sørensen (Thorkild I.A.); N.J. Timpson (Nicholas); S.F.A. Grant (Struan); V.W.V. Jaddoe (Vincent); H.J. Kalkwarf (Heidi J.); J.M. Lappe (Joan M.); V. Gilsanz (Vicente); S.E. Oberfield (Sharon E.); J.A. Shepherd (John A.); A. Kelly (Andrea)

    2016-01-01

    textabstractA large number of genetic loci are associated with adult body mass index. However, the genetics of childhood body mass index are largely unknown.We performed a meta-analysis of genome-wide association studies of childhood body mass index, using sex- and age-adjusted standard deviation

  10. Genome-wide association study identifies 74 loci associated with educational attainment

    NARCIS (Netherlands)

    Okbay, A.; Beauchamp, J.; Fontana, M.A.; Lee, J.J.; Pers, T.H.; Rietveld, C.A.; Turley, P.; Chen, G.B.; Emilsson, V.; Meddens, S.F.W.; de Vlaming, R.; Abdellaoui, A.; Peyrot, W.; Vinkhuyzen, A.A.E.; Hottenga, J.J.; Willemsen, G.; Boomsma, D.I.; Penninx, B.W.J.H.; Laibson, D.; Medland, S.E.; Meyer, M.N.; Yang, J.; Johannesson, M.; Visscher, P.M.; Esko, T.; Koellinger, P.D.; Cesarini, D.; Benjamin, D.J.

    2016-01-01

    Educational attainment is strongly influenced by social and other environmental factors, but genetic factors are estimated to account for at least 20% of the variation across individuals. Here we report the results of a genome-wide association study (GWAS) for educational attainment that extends our

  11. Genome-wide association study identifies 74 loci associated with educational attainment

    NARCIS (Netherlands)

    Okbay, Aysu; Beauchamp, Jonathan P.; Fontana, Mark Alan; Lee, James J.; Pers, Tune H.; Rietveld, Cornelius A.; Turley, Patrick; Chen, Guo-Bo; Emilsson, Valur; Meddens, S. Fleur W.; Oskarsson, Sven; Pickrell, Joseph K.; Thom, Kevin; Timshel, Pascal; de Vlaming, Ronald; Abdellaoui, Abdel; Ahluwalia, Tarunveer S.; Bacelis, Jonas; Baumbach, Clemens; Bjornsdottir, Gyda; Brandsma, Johannes H.; Concas, Maria Pina; Derringer, Jaime; Furlotte, Nicholas A.; Galesloot, Tessel E.; Girotto, Giorgia; Gupta, Richa; Hall, Leanne M.; Harris, Sarah E.; Hofer, Edith; Horikoshi, Momoko; Huffman, Jennifer E.; Kaasik, Kadri; Kalafati, Ioanna P.; Karlsson, Robert; Kong, Augustine; Lahti, Jari; van der Lee, Sven J.; de Leeuw, Christiaan; Lind, Penelope A.; Lindgren, Karl-Oskar; Liu, Tian; van der Most, Peter J.; Verweij, Niek; Alizadeh, Behrooz Z.; Vonk, Judith M.; Bultmann, Ute; Franke, Lude; van der Harst, Pim; Penninx, Brenda W. J. H.

    2016-01-01

    Educational attainment is strongly influenced by social and other environmental factors, but genetic factors are estimated to account for at least 20% of the variation across individuals(1). Here we report the results of a genome-wide association study (GWAS) for educational attainment that extends

  12. Genome-wide siRNA-based functional genomics of pigmentation identifies novel genes and pathways that impact melanogenesis in human cells.

    Directory of Open Access Journals (Sweden)

    Anand K Ganesan

    2008-12-01

    Full Text Available Melanin protects the skin and eyes from the harmful effects of UV irradiation, protects neural cells from toxic insults, and is required for sound conduction in the inner ear. Aberrant regulation of melanogenesis underlies skin disorders (melasma and vitiligo, neurologic disorders (Parkinson's disease, auditory disorders (Waardenburg's syndrome, and opthalmologic disorders (age related macular degeneration. Much of the core synthetic machinery driving melanin production has been identified; however, the spectrum of gene products participating in melanogenesis in different physiological niches is poorly understood. Functional genomics based on RNA-mediated interference (RNAi provides the opportunity to derive unbiased comprehensive collections of pharmaceutically tractable single gene targets supporting melanin production. In this study, we have combined a high-throughput, cell-based, one-well/one-gene screening platform with a genome-wide arrayed synthetic library of chemically synthesized, small interfering RNAs to identify novel biological pathways that govern melanin biogenesis in human melanocytes. Ninety-two novel genes that support pigment production were identified with a low false discovery rate. Secondary validation and preliminary mechanistic studies identified a large panel of targets that converge on tyrosinase expression and stability. Small molecule inhibition of a family of gene products in this class was sufficient to impair chronic tyrosinase expression in pigmented melanoma cells and UV-induced tyrosinase expression in primary melanocytes. Isolation of molecular machinery known to support autophagosome biosynthesis from this screen, together with in vitro and in vivo validation, exposed a close functional relationship between melanogenesis and autophagy. In summary, these studies illustrate the power of RNAi-based functional genomics to identify novel genes, pathways, and pharmacologic agents that impact a biological phenotype

  13. Genome-wide association study identified genetic variations and candidate genes for plant architecture component traits in Chinese upland cotton.

    Science.gov (United States)

    Su, Junji; Li, Libei; Zhang, Chi; Wang, Caixiang; Gu, Lijiao; Wang, Hantao; Wei, Hengling; Liu, Qibao; Huang, Long; Yu, Shuxun

    2018-06-01

    Thirty significant associations between 22 SNPs and five plant architecture component traits in Chinese upland cotton were identified via GWAS. Four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits. A candidate gene, Gh_D03G0922, might be responsible for plant height in upland cotton. A compact plant architecture is increasingly required for mechanized harvesting processes in China. Therefore, cotton plant architecture is an important trait, and its components, such as plant height, fruit branch length and fruit branch angle, affect the suitability of a cultivar for mechanized harvesting. To determine the genetic basis of cotton plant architecture, a genome-wide association study (GWAS) was performed using a panel composed of 355 accessions and 93,250 single nucleotide polymorphisms (SNPs) identified using the specific-locus amplified fragment sequencing method. Thirty significant associations between 22 SNPs and five plant architecture component traits were identified via GWAS. Most importantly, four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits, and these SNPs were harbored in one linkage disequilibrium block. Furthermore, 21 candidate genes for plant architecture were predicted in a 0.95-Mb region including the four peak SNPs. One of these genes (Gh_D03G0922) was near the significant SNP D03_31584163 (8.40 kb), and its Arabidopsis homologs contain MADS-box domains that might be involved in plant growth and development. qRT-PCR showed that the expression of Gh_D03G0922 was upregulated in the apical buds and young leaves of the short and compact cotton varieties, and virus-induced gene silencing (VIGS) proved that the silenced plants exhibited increased PH. These results indicate that Gh_D03G0922 is likely the candidate gene for PH in cotton. The genetic variations and candidate genes identified in this study lay a foundation

  14. Genome-wide screening identifies a KCNIP1 copy number variant as a genetic predictor for atrial fibrillation

    Science.gov (United States)

    Tsai, Chia-Ti; Hsieh, Chia-Shan; Chang, Sheng-Nan; Chuang, Eric Y.; Ueng, Kwo-Chang; Tsai, Chin-Feng; Lin, Tsung-Hsien; Wu, Cho-Kai; Lee, Jen-Kuang; Lin, Lian-Yu; Wang, Yi-Chih; Yu, Chih-Chieh; Lai, Ling-Ping; Tseng, Chuen-Den; Hwang, Juey-Jen; Chiang, Fu-Tien; Lin, Jiunn-Lee

    2016-01-01

    Atrial fibrillation (AF) is the most common sustained cardiac arrhythmia. Previous genome-wide association studies had identified single-nucleotide polymorphisms in several genomic regions to be associated with AF. In human genome, copy number variations (CNVs) are known to contribute to disease susceptibility. Using a genome-wide multistage approach to identify AF susceptibility CNVs, we here show a common 4,470-bp diallelic CNV in the first intron of potassium interacting channel 1 gene (KCNIP1) is strongly associated with AF in Taiwanese populations (odds ratio=2.27 for insertion allele; P=6.23 × 10−24). KCNIP1 insertion is associated with higher KCNIP1 mRNA expression. KCNIP1-encoded protein potassium interacting channel 1 (KCHIP1) is physically associated with potassium Kv channels and modulates atrial transient outward current in cardiac myocytes. Overexpression of KCNIP1 results in inducible AF in zebrafish. In conclusions, a common CNV in KCNIP1 gene is a genetic predictor of AF risk possibly pointing to a functional pathway. PMID:26831368

  15. Comparative genomic analysis identified a mutation related to enhanced heterologous protein production in the filamentous fungus Aspergillus oryzae.

    Science.gov (United States)

    Jin, Feng-Jie; Katayama, Takuya; Maruyama, Jun-Ichi; Kitamoto, Katsuhiko

    2016-11-01

    Genomic mapping of mutations using next-generation sequencing technologies has facilitated the identification of genes contributing to fundamental biological processes, including human diseases. However, few studies have used this approach to identify mutations contributing to heterologous protein production in industrial strains of filamentous fungi, such as Aspergillus oryzae. In a screening of A. oryzae strains that hyper-produce human lysozyme (HLY), we previously isolated an AUT1 mutant that showed higher production of various heterologous proteins; however, the underlying factors contributing to the increased heterologous protein production remained unclear. Here, using a comparative genomic approach performed with whole-genome sequences, we attempted to identify the genes responsible for the high-level production of heterologous proteins in the AUT1 mutant. The comparative sequence analysis led to the detection of a gene (AO090120000003), designated autA, which was predicted to encode an unknown cytoplasmic protein containing an alpha/beta-hydrolase fold domain. Mutation or deletion of autA was associated with higher production levels of HLY. Specifically, the HLY yields of the autA mutant and deletion strains were twofold higher than that of the control strain during the early stages of cultivation. Taken together, these results indicate that combining classical mutagenesis approaches with comparative genomic analysis facilitates the identification of novel genes involved in heterologous protein production in filamentous fungi.

  16. A genome-wide association study of psoriasis and psoriatic arthritis identifies new disease loci.

    Directory of Open Access Journals (Sweden)

    Ying Liu

    2008-03-01

    Full Text Available A genome-wide association study was performed to identify genetic factors involved in susceptibility to psoriasis (PS and psoriatic arthritis (PSA, inflammatory diseases of the skin and joints in humans. 223 PS cases (including 91 with PSA were genotyped with 311,398 single nucleotide polymorphisms (SNPs, and results were compared with those from 519 Northern European controls. Replications were performed with an independent cohort of 577 PS cases and 737 controls from the U.S., and 576 PSA patients and 480 controls from the U.K.. Strongest associations were with the class I region of the major histocompatibility complex (MHC. The most highly associated SNP was rs10484554, which lies 34.7 kb upstream from HLA-C (P = 7.8x10(-11, GWA scan; P = 1.8x10(-30, replication; P = 1.8x10(-39, combined; U.K. PSA: P = 6.9x10(-11. However, rs2395029 encoding the G2V polymorphism within the class I gene HCP5 (combined P = 2.13x10(-26 in U.S. cases yielded the highest ORs with both PS and PSA (4.1 and 3.2 respectively. This variant is associated with low viral set point following HIV infection and its effect is independent of rs10484554. We replicated the previously reported association with interleukin 23 receptor and interleukin 12B (IL12B polymorphisms in PS and PSA cohorts (IL23R: rs11209026, U.S. PS, P = 1.4x10(-4; U.K. PSA: P = 8.0x10(-4; IL12B:rs6887695, U.S. PS, P = 5x10(-5 and U.K. PSA, P = 1.3x10(-3 and detected an independent association in the IL23R region with a SNP 4 kb upstream from IL12RB2 (P = 0.001. Novel associations replicated in the U.S. PS cohort included the region harboring lipoma HMGIC fusion partner (LHFP and conserved oligomeric golgi complex component 6 (COG6 genes on chromosome 13q13 (combined P = 2x10(-6 for rs7993214; OR = 0.71, the late cornified envelope gene cluster (LCE from the Epidermal Differentiation Complex (PSORS4 (combined P = 6.2x10(-5 for rs6701216; OR 1.45 and a region of LD at 15q21 (combined P = 2.9x10(-5 for rs

  17. A database of phylogenetically atypical genes in archaeal and bacterial genomes, identified using the DarkHorse algorithm

    Directory of Open Access Journals (Sweden)

    Allen Eric E

    2008-10-01

    Full Text Available Abstract Background The process of horizontal gene transfer (HGT is believed to be widespread in Bacteria and Archaea, but little comparative data is available addressing its occurrence in complete microbial genomes. Collection of high-quality, automated HGT prediction data based on phylogenetic evidence has previously been impractical for large numbers of genomes at once, due to prohibitive computational demands. DarkHorse, a recently described statistical method for discovering phylogenetically atypical genes on a genome-wide basis, provides a means to solve this problem through lineage probability index (LPI ranking scores. LPI scores inversely reflect phylogenetic distance between a test amino acid sequence and its closest available database matches. Proteins with low LPI scores are good horizontal gene transfer candidates; those with high scores are not. Description The DarkHorse algorithm has been applied to 955 microbial genome sequences, and the results organized into a web-searchable relational database, called the DarkHorse HGT Candidate Resource http://darkhorse.ucsd.edu. Users can select individual genomes or groups of genomes to screen by LPI score, search for protein functions by descriptive annotation or amino acid sequence similarity, or select proteins with unusual G+C composition in their underlying coding sequences. The search engine reports LPI scores for match partners as well as query sequences, providing the opportunity to explore whether potential HGT donor sequences are phylogenetically typical or atypical within their own genomes. This information can be used to predict whether or not sufficient information is available to build a well-supported phylogenetic tree using the potential donor sequence. Conclusion The DarkHorse HGT Candidate database provides a powerful, flexible set of tools for identifying phylogenetically atypical proteins, allowing researchers to explore both individual HGT events in single genomes, and

  18. A novel common large genomic deletion and two new missense mutations identified in the Romanian phenylketonuria population.

    Science.gov (United States)

    Gemperle-Britschgi, Corinne; Iorgulescu, Daniela; Mager, Monica Alina; Anton-Paduraru, Dana; Vulturar, Romana; Thöny, Beat

    2016-01-15

    The mutation spectrum for the phenylalanine hydroxylase (PAH) gene was investigated in a cohort of 84 hyperphenylalaninemia (HPA) patients from Romania identified through newborn screening or neurometabolic investigations. Differential diagnosis identified 81 patients with classic PAH deficiency while 3 had tetrahydropterin-cofactor deficiency and/or remained uncertain due to insufficient specimen. PAH-genetic analysis included a combination of Sanger sequencing of exons and exon–intron boundaries, MLPA and NGS with genomic DNA, and cDNA analysis from immortalized lymphoblasts. A diagnostic efficiency of 99.4% was achieved, as for one allele (out of a total of 162 alleles) no mutation could be identified. The most prevalent mutation was p.Arg408Trp which was found in ~ 38% of all PKU alleles. Three novel mutations were identified, including the two missense mutations p.Gln226Lys and p.Tyr268Cys that were both disease causing by prediction algorithms, and the large genomic deletion EX6del7831 (c.509 + 4140_706 + 510del7831) that resulted in skipping of exon 6 based on PAH-cDNA analysis in immortalized lymphocytes. The genomic deletion was present in a heterozygous state in 12 patients, i.e. in ~ 8% of all the analyzed PKU alleles, and might have originated from a Romanian founder.

  19. Quantitative trait loci (QTL study identifies novel genomic regions associated to Chiari-like malformation in Griffon Bruxellois dogs.

    Directory of Open Access Journals (Sweden)

    Philippe Lemay

    Full Text Available Chiari-like malformation (CM is a developmental abnormality of the craniocervical junction that is common in the Griffon Bruxellois (GB breed with an estimated prevalence of 65%. This disease is characterized by overcrowding of the neural parenchyma at the craniocervical junction and disturbance of cerebrospinal fluid (CSF flow. The most common clinical sign is pain either as a direct consequence of CM or neuropathic pain as a consequence of secondary syringomyelia. The etiology of CM remains unknown but genetic factors play an important role. To investigate the genetic complexity of the disease, a quantitative trait locus (QTL approach was adopted. A total of 14 quantitative skull and atlas measurements were taken and were tested for association to CM. Six traits were found to be associated to CM and were subjected to a whole-genome association study using the Illumina canine high density bead chip in 74 GB dogs (50 affected and 24 controls. Linear and mixed regression analyses identified associated single nucleotide polymorphisms (SNPs on 5 Canis Familiaris Autosomes (CFAs: CFA2, CFA9, CFA12, CFA14 and CFA24. A reconstructed haplotype of 0.53 Mb on CFA2 strongly associated to the height of the cranial fossa (diameter F and an haplotype of 2.5 Mb on CFA14 associated to both the height of the rostral part of the caudal cranial fossa (AE and the height of the brain (FG were significantly associated to CM after 10 000 permutations strengthening their candidacy for this disease (P = 0.0421, P = 0.0094 respectively. The CFA2 QTL harbours the Sall-1 gene which is an excellent candidate since its orthologue in humans is mutated in Townes-Brocks syndrome which has previously been associated to Chiari malformation I. Our study demonstrates the implication of multiple traits in the etiology of CM and has successfully identified two new QTL associated to CM and a potential candidate gene.

  20. BLAST screening of chlamydial genomes to identify signature proteins that are unique for the Chlamydiales, Chlamydiaceae, Chlamydophila and Chlamydia groups of species

    Directory of Open Access Journals (Sweden)

    Gupta Radhey S

    2006-01-01

    Full Text Available Abstract Background Chlamydiae species are of much importance from a clinical viewpoint. Their diversity both in terms of their numbers as well as clinical involvement are presently believed to be significantly underestimated. The obligate intracellular nature of chlamydiae has also limited their genetic and biochemical studies. Thus, it is of importance to develop additional means for their identification and characterization. Results We have carried out analyses of available chlamydiae genomes to identify sets of unique proteins that are either specific for all Chlamydiales genomes, or different Chlamydiaceae family members, or members of the Chlamydia and Chlamydophila genera, or those unique to Protochlamydia amoebophila, but which are not found in any other bacteria. In total, 59 Chlamydiales-specific proteins, 79 Chlamydiaceae-specific proteins, 20 proteins each that are specific for both Chlamydia and Chlamydophila and 445 ORFs that are Protochlamydia-specific were identified. Additionally, 33 cases of possible gene loss or lateral gene transfer were also detected. Conclusion The identified chlamydiae-lineage specific proteins, many of which are highly conserved, provide novel biomarkers that should prove of much value in the diagnosis of these bacteria and in exploration of their prevalence and diversity. These conserved protein sequences (CPSs also provide novel therapeutic targets for drugs that are specific for these bacteria. Lastly, functional studies on these chlamydiae or chlamydiae subgroup-specific proteins should lead to important insights into lineage-specific adaptations with regards to development, infectivity and pathogenicity.

  1. Genome-wide association studies in the Japanese population identify seven novel loci for type 2 diabetes

    DEFF Research Database (Denmark)

    Imamura, Minako; Takahashi, Atsushi; Yamauchi, Toshimasa

    2016-01-01

    Genome-wide association studies (GWAS) have identified more than 80 susceptibility loci for type 2 diabetes (T2D), but most of its heritability still remains to be elucidated. In this study, we conducted a meta-analysis of GWAS for T2D in the Japanese population. Combined data from discovery...... and subsequent validation analyses (23,399 T2D cases and 31,722 controls) identify 7 new loci with genome-wide significance (P2, rs7107784 near MIR4686 and rs67839313 near INAFM2....... Of these, the association of 4 loci with T2D is replicated in multi-ethnic populations other than Japanese (up to 65,936 T2Ds and 158,030 controls, P

  2. Meta-analysis of genome-wide association studies identifies eight new loci for type 2 diabetes in east Asians

    DEFF Research Database (Denmark)

    Cho, Yoon Shin; Chen, Chien-Hsiun; Hu, Cheng

    2012-01-01

    We conducted a three-stage genetic study to identify susceptibility loci for type 2 diabetes (T2D) in east Asian populations. We followed our stage 1 meta-analysis of eight T2D genome-wide association studies (6,952 cases with T2D and 11,865 controls) with a stage 2 in silico replication analysis...... (5,843 cases and 4,574 controls) and a stage 3 de novo replication analysis (12,284 cases and 13,172 controls). The combined analysis identified eight new T2D loci reaching genome-wide significance, which mapped in or near GLIS3, PEPD, FITM2-R3HDML-HNF4A, KCNK16, MAEA, GCC1-PAX4, PSMD6 and ZFAND3...

  3. Identifying Rare Variation in Cases of Schizophrenia in the Isolated Population of the Faroe Islands using Whole-genome Sequencing

    DEFF Research Database (Denmark)

    Als, Thomas Damm; Lescai, Francesco; Dahl, Hans

    to map risk variants involved in complex traits. We aim at utilizing samples of cases and controls of the isolated population of the Faroe Islands to conduct whole-genome-sequence analysis in order to identify rare genetic variants associated with schizophrenia. We will search for rare genetic variants...... of developing SZ. However, these studies are designed to examining only “the common variant” proportion of the genomic landscape of SZ. Due to increased genetic drift during founding and potential bottlenecks, followed by population expansion, isolated populations may be particularly useful in identifying rare...... disease variants, that may appear at higher frequencies and/or within a more clearly distinct haplotype structure compared to outbred populations. Small isolated populations also typically show reduced phenotypic, genetic and environmental heterogeneity, thus making them advantageous in studies aiming...

  4. Integrative analysis of functional genomic annotations and sequencing data to identify rare causal variants via hierarchical modeling

    Directory of Open Access Journals (Sweden)

    Marinela eCapanu

    2015-05-01

    Full Text Available Identifying the small number of rare causal variants contributing to disease has beena major focus of investigation in recent years, but represents a formidable statisticalchallenge due to the rare frequencies with which these variants are observed. In thiscommentary we draw attention to a formal statistical framework, namely hierarchicalmodeling, to combine functional genomic annotations with sequencing data with theobjective of enhancing our ability to identify rare causal variants. Using simulations weshow that in all configurations studied, the hierarchical modeling approach has superiordiscriminatory ability compared to a recently proposed aggregate measure of deleteriousness,the Combined Annotation-Dependent Depletion (CADD score, supportingour premise that aggregate functional genomic measures can more accurately identifycausal variants when used in conjunction with sequencing data through a hierarchicalmodeling approach

  5. Unique features of a global human ectoparasite identified through sequencing of the bed bug genome.

    Science.gov (United States)

    Benoit, Joshua B; Adelman, Zach N; Reinhardt, Klaus; Dolan, Amanda; Poelchau, Monica; Jennings, Emily C; Szuter, Elise M; Hagan, Richard W; Gujar, Hemant; Shukla, Jayendra Nath; Zhu, Fang; Mohan, M; Nelson, David R; Rosendale, Andrew J; Derst, Christian; Resnik, Valentina; Wernig, Sebastian; Menegazzi, Pamela; Wegener, Christian; Peschel, Nicolai; Hendershot, Jacob M; Blenau, Wolfgang; Predel, Reinhard; Johnston, Paul R; Ioannidis, Panagiotis; Waterhouse, Robert M; Nauen, Ralf; Schorn, Corinna; Ott, Mark-Christoph; Maiwald, Frank; Johnston, J Spencer; Gondhalekar, Ameya D; Scharf, Michael E; Peterson, Brittany F; Raje, Kapil R; Hottel, Benjamin A; Armisén, David; Crumière, Antonin Jean Johan; Refki, Peter Nagui; Santos, Maria Emilia; Sghaier, Essia; Viala, Sèverine; Khila, Abderrahman; Ahn, Seung-Joon; Childers, Christopher; Lee, Chien-Yueh; Lin, Han; Hughes, Daniel S T; Duncan, Elizabeth J; Murali, Shwetha C; Qu, Jiaxin; Dugan, Shannon; Lee, Sandra L; Chao, Hsu; Dinh, Huyen; Han, Yi; Doddapaneni, Harshavardhan; Worley, Kim C; Muzny, Donna M; Wheeler, David; Panfilio, Kristen A; Vargas Jentzsch, Iris M; Vargo, Edward L; Booth, Warren; Friedrich, Markus; Weirauch, Matthew T; Anderson, Michelle A E; Jones, Jeffery W; Mittapalli, Omprakash; Zhao, Chaoyang; Zhou, Jing-Jiang; Evans, Jay D; Attardo, Geoffrey M; Robertson, Hugh M; Zdobnov, Evgeny M; Ribeiro, Jose M C; Gibbs, Richard A; Werren, John H; Palli, Subba R; Schal, Coby; Richards, Stephen

    2016-02-02

    The bed bug, Cimex lectularius, has re-established itself as a ubiquitous human ectoparasite throughout much of the world during the past two decades. This global resurgence is likely linked to increased international travel and commerce in addition to widespread insecticide resistance. Analyses of the C. lectularius sequenced genome (650 Mb) and 14,220 predicted protein-coding genes provide a comprehensive representation of genes that are linked to traumatic insemination, a reduced chemosensory repertoire of genes related to obligate hematophagy, host-symbiont interactions, and several mechanisms of insecticide resistance. In addition, we document the presence of multiple putative lateral gene transfer events. Genome sequencing and annotation establish a solid foundation for future research on mechanisms of insecticide resistance, human-bed bug and symbiont-bed bug associations, and unique features of bed bug biology that contribute to the unprecedented success of C. lectularius as a human ectoparasite.

  6. Unique features of a global human ectoparasite identified through sequencing of the bed bug genome

    Science.gov (United States)

    Benoit, Joshua B.; Adelman, Zach N.; Reinhardt, Klaus; Dolan, Amanda; Poelchau, Monica; Jennings, Emily C.; Szuter, Elise M.; Hagan, Richard W.; Gujar, Hemant; Shukla, Jayendra Nath; Zhu, Fang; Mohan, M.; Nelson, David R.; Rosendale, Andrew J.; Derst, Christian; Resnik, Valentina; Wernig, Sebastian; Menegazzi, Pamela; Wegener, Christian; Peschel, Nicolai; Hendershot, Jacob M.; Blenau, Wolfgang; Predel, Reinhard; Johnston, Paul R.; Ioannidis, Panagiotis; Waterhouse, Robert M.; Nauen, Ralf; Schorn, Corinna; Ott, Mark-Christoph; Maiwald, Frank; Johnston, J. Spencer; Gondhalekar, Ameya D.; Scharf, Michael E.; Peterson, Brittany F.; Raje, Kapil R.; Hottel, Benjamin A.; Armisén, David; Crumière, Antonin Jean Johan; Refki, Peter Nagui; Santos, Maria Emilia; Sghaier, Essia; Viala, Sèverine; Khila, Abderrahman; Ahn, Seung-Joon; Childers, Christopher; Lee, Chien-Yueh; Lin, Han; Hughes, Daniel S. T.; Duncan, Elizabeth J.; Murali, Shwetha C.; Qu, Jiaxin; Dugan, Shannon; Lee, Sandra L.; Chao, Hsu; Dinh, Huyen; Han, Yi; Doddapaneni, Harshavardhan; Worley, Kim C.; Muzny, Donna M.; Wheeler, David; Panfilio, Kristen A.; Vargas Jentzsch, Iris M.; Vargo, Edward L.; Booth, Warren; Friedrich, Markus; Weirauch, Matthew T.; Anderson, Michelle A. E.; Jones, Jeffery W.; Mittapalli, Omprakash; Zhao, Chaoyang; Zhou, Jing-Jiang; Evans, Jay D.; Attardo, Geoffrey M.; Robertson, Hugh M.; Zdobnov, Evgeny M.; Ribeiro, Jose M. C.; Gibbs, Richard A.; Werren, John H.; Palli, Subba R.; Schal, Coby; Richards, Stephen

    2016-01-01

    The bed bug, Cimex lectularius, has re-established itself as a ubiquitous human ectoparasite throughout much of the world during the past two decades. This global resurgence is likely linked to increased international travel and commerce in addition to widespread insecticide resistance. Analyses of the C. lectularius sequenced genome (650 Mb) and 14,220 predicted protein-coding genes provide a comprehensive representation of genes that are linked to traumatic insemination, a reduced chemosensory repertoire of genes related to obligate hematophagy, host–symbiont interactions, and several mechanisms of insecticide resistance. In addition, we document the presence of multiple putative lateral gene transfer events. Genome sequencing and annotation establish a solid foundation for future research on mechanisms of insecticide resistance, human–bed bug and symbiont–bed bug associations, and unique features of bed bug biology that contribute to the unprecedented success of C. lectularius as a human ectoparasite. PMID:26836814

  7. Population genomics identifies the origin and signatures of selection of Korean weedy rice

    OpenAIRE

    He, Qiang; Kim, Kyu?Won; Park, Yong?Jin

    2016-01-01

    Summary Weedy rice is the same biological species as cultivated rice (Oryza sativa); it is also a noxious weed infesting rice fields worldwide. Its formation and population?selective or ?adaptive signatures are poorly understood. In this study, we investigated the phylogenetics, population structure and signatures of selection of Korean weedy rice by determining the whole genomes of 30 weedy rice, 30 landrace rice and ten wild rice samples. The phylogenetic tree and results of ancestry infere...

  8. Novel genetic loci underlying human intracranial volume identified through genome-wide association

    OpenAIRE

    Adams, Hieab HH; Hibar, Derrek P; Chouraki, Vincent; Stein, Jason L; Nyquist, Paul A; Renter��a, Miguel E; Trompet, Stella; Arias-Vasquez, Alejandro; Seshadri, Sudha; Desrivi��res, Sylvane; Beecham, Ashley H; Jahanshad, Neda; Wittfeld, Katharina; Van der Lee, Sven J; Abramovic, Lucija

    2016-01-01

    Intracranial volume reflects the maximally attained brain size during development, and remains stable with loss of tissue in late life. It is highly heritable, but the underlying genes remain largely undetermined. In a genome-wide association study of 32,438 adults, we discovered five previously unknown loci for intracranial volume and confirmed two known signals. Four of the loci were also associated with adult human stature, but these remained associated with intracranial volume after adjus...

  9. Genome size as a marker for identifying the invasive alien taxa in Fallopia section Reynoutria

    Czech Academy of Sciences Publication Activity Database

    Suda, Jan; Trávníček, P.; Mandák, Bohumil; Berchová-Bímová, Kateřina

    2010-01-01

    Roč. 82, č. 1 (2010), s. 97-106 ISSN 0032-7786 R&D Projects: GA AV ČR KJB6005301; GA AV ČR IAA600050711; GA AV ČR IAA600050707 Institutional research plan: CEZ:AV0Z60050516 Keywords : cytometry * ploidy * genome size Subject RIV: EF - Botanics Impact factor: 2.792, year: 2010

  10. Genome Analysis of a Limnobacter sp. Identified in an Anaerobic Methane-Consuming Cell Consortium

    OpenAIRE

    Chen, Ying; Feng, Xiaoyuan; He, Ying; Wang, Fengping

    2016-01-01

    Species of Limnobacter genus are widespread in a variety of environments, yet knowledges upon their metabolic potentials and mechanisms of environmental adaptation are limited. In this study, a cell aggregate containing Limnobacter and anaerobic methanotrophic archaea (ANME) was captured from an enriched anaerobic methane oxidizing (AOM) microbial community. A genomic bin of Limnobacter was obtained and analyzed, which provides the first metabolic insights into Limnobacter from an AOM environ...

  11. Genome analysis of a Limnobacter sp. identified in an anaerobic methane-consuming cell consortium

    OpenAIRE

    Ying Chen; Ying Chen; Ying Chen; Xiaoyuan Feng; Xiaoyuan Feng; Ying He; Ying He; Fengping Wang; Fengping Wang

    2016-01-01

    Species of Limnobacter genus are widespread in a variety of environments, yet knowledges upon their metabolic potentials and mechanisms of environmental adaptation are limited. In this study, a cell aggregate containing Limnobacter and anaerobic methanotrophic archaea (ANME) was captured from an enriched anaerobic methane oxidizing (AOM) microbial community. A genomic bin of Limnobacter was obtained and analyzed, which provides the first metabolic insights into Limnobacter from an AOM environ...

  12. Unbiased Combinatorial Genomic Approaches to Identify Alternative Therapeutic Targets within the TSC Signaling Network

    Science.gov (United States)

    2015-09-01

    endonuclease. Nat Biotechnol. 2013;31(3):230-2. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, et al. Multiplex genome engineering using CRISPR/Cas systems...Res 42, e89 (2014)10.1093/nar/gku289). 13. L. Cong, F. A. Ran, D. Cox, S. Lin, R. Barretto, N. Habib , P. D. Hsu, X. Wu, W. Jiang, L. A. Marraffini

  13. Application of representational difference analysis to identify genomic differences between Bradyrhizobium elkanii and B. Japonicum species.

    Science.gov (United States)

    Soares, René Arderius; Passaglia, Luciane Maria Pereira

    2010-10-01

    Bradyrhizobium elkanii is successfully used in the formulation of commercial inoculants and, together with B. japonicum, it fully supplies the plant nitrogen demands. Despite the similarity between B. japonicum and B. elkanii species, several works demonstrated genetic and physiological differences between them. In this work Representational Difference Analysis (RDA) was used for genomic comparison between B. elkanii SEMIA 587, a crop inoculant strain, and B. japonicum USDA 110, a reference strain. Two hundred sequences were obtained. From these, 46 sequences belonged exclusively to the genome of B. elkanii strain, and 154 showed similarity to sequences from B. japonicum genome. From the 46 sequences with no similarity to sequences from B. japonicum, 39 showed no similarity to sequences in public databases and seven showed similarity to sequences of genes coding for known proteins. These seven sequences were divided in three groups: similar to sequences from other Bradyrhizobium strains, similar to sequences from other nitrogen-fixing bacteria, and similar to sequences from non nitrogen-fixing bacteria. These new sequences could be used as DNA markers in order to investigate the rates of genetic material gain and loss in natural Bradyrhizobium strains.

  14. DeepBipolar: Identifying genomic mutations for bipolar disorder via deep learning.

    Science.gov (United States)

    Laksshman, Sundaram; Bhat, Rajendra Rana; Viswanath, Vivek; Li, Xiaolin

    2017-09-01

    Bipolar disorder, also known as manic depression, is a brain disorder that affects the brain structure of a patient. It results in extreme mood swings, severe states of depression, and overexcitement simultaneously. It is estimated that roughly 3% of the population of the United States (about 5.3 million adults) suffers from bipolar disorder. Recent research efforts like the Twin studies have demonstrated a high heritability factor for the disorder, making genomics a viable alternative for detecting and treating bipolar disorder, in addition to the conventional lengthy and costly postsymptom clinical diagnosis. Motivated by this study, leveraging several emerging deep learning algorithms, we design an end-to-end deep learning architecture (called DeepBipolar) to predict bipolar disorder based on limited genomic data. DeepBipolar adopts the Deep Convolutional Neural Network (DCNN) architecture that automatically extracts features from genotype information to predict the bipolar phenotype. We participated in the Critical Assessment of Genome Interpretation (CAGI) bipolar disorder challenge and DeepBipolar was considered the most successful by the independent assessor. In this work, we thoroughly evaluate the performance of DeepBipolar and analyze the type of signals we believe could have affected the classifier in distinguishing the case samples from the control set. © 2017 Wiley Periodicals, Inc.

  15. Optical Whole-Genome Restriction Mapping as a Tool for Rapidly Distinguishing and Identifying Bacterial Contaminants in Clinical Samples

    Science.gov (United States)

    2015-08-01

    Article 3. DATES COVERED (From – To) Oct 2011 – Aug 2012 4. TITLE AND SUBTITLE Optical Whole-Genome Restriction Mapping as a Tool for Rapidly...multiple bacteria could be uniquely identified within mixtures. In the first set of experiments, three unique organisms ( Bacillus subtilis subsp. globigii...be useful in monitoring nosocomial outbreaks in neonatal and intensive care wards, or even as an initial screen for antibiotic resistant strains

  16. A genome-wide association analysis of a broad psychosis phenotype identifies three loci for further investigation

    OpenAIRE

    Psychosis Endophenotypes International Consortium; Wellcome Trust Case-Control Consortium; Bramon, E.; Pirinen, M.; Strange, A.; Lin, K.; Freeman, C.; Bellenguez, C.; Su, Z.; Band, G.; Pearson, R.; Vukcevic, D.; Langford, C.; Deloukas, P.; Hunt, S.

    2014-01-01

    BACKGROUND: Genome-wide association studies (GWAS) have identified several loci associated with schizophrenia and/or bipolar disorder. We performed a GWAS of psychosis as a broad syndrome rather than within specific diagnostic categories. METHODS: 1239 cases with schizophrenia, schizoaffective disorder, or psychotic bipolar disorder; 857 of their unaffected relatives, and 2739 healthy controls were genotyped with the Affymetrix 6.0 single nucleotide polymorphism (SNP) array. Analyses of 69...

  17. A Genome-wide Association Analysis of a Broad Psychosis Phenotype Identifies Three Loci for Further Investigation

    OpenAIRE

    Tosato, Sarah; Myin-germeys, Inez; Barroso, Ines; Bender, Stephan; Giegling, Ina; Arranz, Maria J.; Donnelly, Peter; Bellenguez, Celine; Brown, Matthew A.; Lawrie, Stephen; Kalaydjieva, Luba; Vukcevic, Damjan; Kahn, Rene S.; Dronov, Serge; Walshe, Muriel

    2014-01-01

    Background: Genome-wide association studies (GWAS) have identified several loci associated with schizophrenia and/or bipolar disorder. We performed a GWAS of psychosis as a broad syndrome rather than within specific diagnostic categories.Methods: 1239 cases with schizophrenia, schizoaffective disorder, or psychotic bipolar disorder; 857 of their unaffected relatives, and 2739 healthy controls were genotyped with the Affymetrix 6.0 single nucleotide polymorphism (SNP) array. Analyses of 695,19...

  18. Complete mitochondrial genomes and nuclear ribosomal RNA operons of two species of Diplostomum (Platyhelminthes: Trematoda): a molecular resource for taxonomy and molecular epidemiology of important fish pathogens.

    Science.gov (United States)

    Brabec, Jan; Kostadinova, Aneta; Scholz, Tomáš; Littlewood, D Timothy J

    2015-06-19

    The genus Diplostomum (Platyhelminthes: Trematoda: Diplostomidae) is a diverse group of freshwater parasites with complex life-cycles and global distribution. The larval stages are important pathogens causing eye fluke disease implicated in substantial impacts on natural fish populations and losses in aquaculture. However, the problematic species delimitation and difficulties in the identification of larval stages hamper the assessment of the distributional and host ranges of Diplostomum spp. and their transmission ecology. Total genomic DNA was isolated from adult worms and shotgun sequenced using Illumina MiSeq technology. Mitochondrial (mt) genomes and nuclear ribosomal RNA (rRNA) operons were assembled using established bioinformatic tools and fully annotated. Mt protein-coding genes and nuclear rRNA genes were subjected to phylogenetic analysis by maximum likelihood and the resulting topologies compared. We characterised novel complete mt genomes and nuclear rRNA operons of two closely related species, Diplostomum spathaceum and D. pseudospathaceum. Comparative mt genome assessment revealed that the cox1 gene and its 'barcode' region used for molecular identification are the most conserved regions; instead, nad4 and nad5 genes were identified as most promising molecular diagnostic markers. Using the novel data, we provide the first genome wide estimation of the phylogenetic relationships of the order Diplostomida, one of the two fundamental lineages of the Digenea. Analyses of the mitogenomic data invariably recovered the Diplostomidae as a sister lineage of the order Plagiorchiida rather than as a basal lineage of the Diplostomida as inferred in rDNA phylogenies; this was concordant with the mt gene order of Diplostomum spp. exhibiting closer match to the conserved gene order of the Plagiorchiida. Complete sequences of the mt genome and rRNA operon of two species of Diplostomum provide a valuable resource for novel genetic markers for species delineation and

  19. Genome Wide Association Studies (GWAS Identify QTL on SSC2 and SSC17 Affecting Loin Peak Shear Force in Crossbred Commercial Pigs.

    Directory of Open Access Journals (Sweden)

    Chunyan Zhang

    Full Text Available Of all the meat quality traits, tenderness is considered the most important with regard to eating quality and market value. In this study we have utilised genome wide association studies (GWAS for peak shear force (PSF of loin muscle as a measure of tenderness for 1,976 crossbred commercial pigs, genotyped for 42,721 informative SNPs using the Illumina PorcineSNP60 Beadchip. Four 1 Mb genomic regions, three on SSC2 (at 4 Mb, 5 Mb and 109 Mb and one on SSC17 (at 20 Mb, were detected which collectively explained about 15.30% and 3.07% of the total genetic and phenotypic variance for PSF respectively. Markers ASGA0008566, ASGA0008695, DRGA0003285 and ASGA0075615 in the four regions were strongly associated with the effects. Analysis of the reference genome sequence in the region with the most important SNPs for SSC2_5 identified FRMD8, SLC25A45 and LTBP3 as potential candidate genes for meat tenderness on the basis of functional annotation of these genes. The region SSC2_109 was close to a previously reported candidate gene CAST; however, the very weak LD between DRGA0003285 (the best marker representing region SSC2_109 and CAST indicated the potential for additional genes which are distinct from, or interact with, CAST to affect meat tenderness. Limited information of known genes in regions SSC2_109 and SSC17_20 restricts further analysis. Re-sequencing of these regions for informative animals may help to resolve the molecular architecture and identify new candidate genes and causative mutations affecting this trait. These findings contribute significantly to our knowledge of the genomic regions affecting pork shear force and will potentially lead to new insights into the molecular mechanisms regulating meat tenderness.

  20. Use of deep whole-genome sequencing data to identify structure risk variants in breast cancer susceptibility genes.

    Science.gov (United States)

    Guo, Xingyi; Shi, Jiajun; Cai, Qiuyin; Shu, Xiao-Ou; He, Jing; Wen, Wanqing; Allen, Jamie; Pharoah, Paul; Dunning, Alison; Hunter, David J; Kraft, Peter; Easton, Douglas F; Zheng, Wei; Long, Jirong

    2018-03-01

    Functional disruptions of susceptibility genes by large genomic structure variant (SV) deletions in germlines are known to be associated with cancer risk. However, few studies have been conducted to systematically search for SV deletions in breast cancer susceptibility genes. We analysed deep (> 30x) whole-genome sequencing (WGS) data generated in blood samples from 128 breast cancer patients of Asian and European descent with either a strong family history of breast cancer or early cancer onset disease. To identify SV deletions in known or suspected breast cancer susceptibility genes, we used multiple SV calling tools including Genome STRiP, Delly, Manta, BreakDancer and Pindel. SV deletions were detected by at least three of these bioinformatics tools in five genes. Specifically, we identified heterozygous deletions covering a fraction of the coding regions of BRCA1 (with approximately 80kb in two patients), and TP53 genes (with ∼1.6 kb in two patients), and of intronic regions (∼1 kb) of the PALB2 (one patient), PTEN (three patients) and RAD51C genes (one patient). We confirmed the presence of these deletions using real-time quantitative PCR (qPCR). Our study identified novel SV deletions in breast cancer susceptibility genes and the identification of such SV deletions may improve clinical testing.

  1. Cytoplasmic male sterility-associated chimeric open reading frames identified by mitochondrial genome sequencing of four Cajanus genotypes.

    Science.gov (United States)

    Tuteja, Reetu; Saxena, Rachit K; Davila, Jaime; Shah, Trushar; Chen, Wenbin; Xiao, Yong-Li; Fan, Guangyi; Saxena, K B; Alverson, Andrew J; Spillane, Charles; Town, Christopher; Varshney, Rajeev K

    2013-10-01

    The hybrid pigeonpea (Cajanus cajan) breeding technology based on cytoplasmic male sterility (CMS) is currently unique among legumes and displays major potential for yield increase. CMS is defined as a condition in which a plant is unable to produce functional pollen grains. The novel chimeric open reading frames (ORFs) produced as a results of mitochondrial genome rearrangements are considered to be the main cause of CMS. To identify these CMS-related ORFs in pigeonpea, we sequenced the mitochondrial genomes of three C. cajan lines (the male-sterile line ICPA 2039, the maintainer line ICPB 2039, and the hybrid line ICPH 2433) and of the wild relative (Cajanus cajanifolius ICPW 29). A single, circular-mapping molecule of length 545.7 kb was assembled and annotated for the ICPA 2039 line. Sequence annotation predicted 51 genes, including 34 protein-coding and 17 RNA genes. Comparison of the mitochondrial genomes from different Cajanus genotypes identified 31 ORFs, which differ between lines within which CMS is present or absent. Among these chimeric ORFs, 13 were identified by comparison of the related male-sterile and maintainer lines. These ORFs display features that are known to trigger CMS in other plant species and to represent the most promising candidates for CMS-related mitochondrial rearrangements in pigeonpea.

  2. Competence Description for Personal Recommendations: The Importance of Identifying the Complexity of Learning and Performance Situations

    Science.gov (United States)

    Prins, Frans J.; Nadolski, Rob J.; Berlanga, Adriana J.; Drachsler, Hendrik; Hummel, Hans G. K.; Koper, Rob

    2008-01-01

    For competences development of learners and professionals, target competences and corresponding competence development opportunities have to be identified. Personal Recommender Systems (PRS) provide personal recommendations for learners aimed at finding and selecting learning activities that best match their needs. This article argues that a…

  3. Whole genome analysis of selected human and animal rotaviruses identified in Uganda from 2012 to 2014 reveals complex genome reassortment events between human, bovine, caprine and porcine strains.

    Science.gov (United States)

    Bwogi, Josephine; Jere, Khuzwayo C; Karamagi, Charles; Byarugaba, Denis K; Namuwulya, Prossy; Baliraine, Frederick N; Desselberger, Ulrich; Iturriza-Gomara, Miren

    2017-01-01

    Rotaviruses of species A (RVA) are a common cause of diarrhoea in children and the young of various other mammals and birds worldwide. To investigate possible interspecies transmission of RVAs, whole genomes of 18 human and 6 domestic animal RVA strains identified in Uganda between 2012 and 2014 were sequenced using the Illumina HiSeq platform. The backbone of the human RVA strains had either a Wa- or a DS-1-like genetic constellation. One human strain was a Wa-like mono-reassortant containing a DS-1-like VP2 gene of possible animal origin. All eleven genes of one bovine RVA strain were closely related to those of human RVAs. One caprine strain had a mixed genotype backbone, suggesting that it emerged from multiple reassortment events involving different host species. The porcine RVA strains had mixed genotype backbones with possible multiple reassortant events with strains of human and bovine origin.Overall, whole genome characterisation of rotaviruses found in domestic animals in Uganda strongly suggested the presence of human-to animal RVA transmission, with concomitant circulation of multi-reassortant strains potentially derived from complex interspecies transmission events. However, whole genome data from the human RVA strains causing moderate and severe diarrhoea in under-fives in Uganda indicated that they were primarily transmitted from person-to-person.

  4. Comparative Genomic Hybridization Analysis of Yersinia enterocolitica and Yersinia pseudotuberculosis Identifies Genetic Traits to Elucidate Their Different Ecologies

    Directory of Open Access Journals (Sweden)

    Kaisa Jaakkola

    2015-01-01

    Full Text Available Enteropathogenic Yersinia enterocolitica and Yersinia pseudotuberculosis are both etiological agents for intestinal infection known as yersiniosis, but their epidemiology and ecology bear many differences. Swine are the only known reservoir for Y. enterocolitica 4/O:3 strains, which are the most common cause of human disease, while Y. pseudotuberculosis has been isolated from a variety of sources, including vegetables and wild animals. Infections caused by Y. enterocolitica mainly originate from swine, but fresh produce has been the source for widespread Y. pseudotuberculosis outbreaks within recent decades. A comparative genomic hybridization analysis with a DNA microarray based on three Yersinia enterocolitica and four Yersinia pseudotuberculosis genomes was conducted to shed light on the genomic differences between enteropathogenic Yersinia. The hybridization results identified Y. pseudotuberculosis strains to carry operons linked with the uptake and utilization of substances not found in living animal tissues but present in soil, plants, and rotting flesh. Y. pseudotuberculosis also harbors a selection of type VI secretion systems targeting other bacteria and eukaryotic cells. These genetic traits are not found in Y. enterocolitica, and it appears that while Y. pseudotuberculosis has many tools beneficial for survival in varied environments, the Y. enterocolitica genome is more streamlined and adapted to their preferred animal reservoir.

  5. Identifying Important Career Indicators of Undergraduate Geoscience Students Upon Completion of Their Degree

    Science.gov (United States)

    Wilson, C. E.; Keane, C. M.; Houlton, H. R.

    2012-12-01

    The American Geosciences Institute (AGI) decided to create the National Geoscience Student Exit Survey in order to identify the initial pathways into the workforce for these graduating students, as well as assess their preparedness for entering the workforce upon graduation. The creation of this survey stemmed from a combination of experiences with the AGI/AGU Survey of Doctorates and discussions at the following Science Education Research Center (SERC) workshops: "Developing Pathways to Strong Programs for the Future", "Strengthening Your Geoscience Program", and "Assessing Geoscience Programs". These events identified distinct gaps in understanding the experiences and perspectives of geoscience students during one of their most profound professional transitions. Therefore, the idea for the survey arose as a way to evaluate how the discipline is preparing and educating students, as well as identifying the students' desired career paths. The discussions at the workshops solidified the need for this survey and created the initial framework for the first pilot of the survey. The purpose of this assessment tool is to evaluate student preparedness for entering the geosciences workforce; identify student decision points for entering geosciences fields and remaining in the geosciences workforce; identify geosciences fields that students pursue in undergraduate and graduate school; collect information on students' expected career trajectories and geosciences professions; identify geosciences career sectors that are hiring new graduates; collect information about salary projections; overall effectiveness of geosciences departments regionally and nationally; demonstrate the value of geosciences degrees to future students, the institutions, and employers; and establish a benchmark to perform longitudinal studies of geosciences graduates to understand their career pathways and impacts of their educational experiences on these decisions. AGI's Student Exit Survey went through

  6. A high-density genetic map for anchoring genome sequences and identifying QTLs associated with dwarf vine in pumpkin (Cucurbita maxima Duch.).

    Science.gov (United States)

    Zhang, Guoyu; Ren, Yi; Sun, Honghe; Guo, Shaogui; Zhang, Fan; Zhang, Jie; Zhang, Haiying; Jia, Zhangcai; Fei, Zhangjun; Xu, Yong; Li, Haizhen

    2015-12-24

    Pumpkin (Cucurbita maxima Duch.) is an economically important crop belonging to the Cucurbitaceae family. However, very few genomic and genetic resources are available for this species. As part of our ongoing efforts to sequence the pumpkin genome, high-density genetic map is essential for anchoring and orienting the assembled scaffolds. In addition, a saturated genetic map can facilitate quantitative trait locus (QTL) mapping. A set of 186 F2 plants derived from the cross of pumpkin inbred lines Rimu and SQ026 were genotyped using the genotyping-by-sequencing approach. Using the SNPs we identified, a high-density genetic map containing 458 bin-markers was constructed, spanning a total genetic distance of 2,566.8 cM across the 20 linkage groups of C. maxima with a mean marker density of 5.60 cM. Using this map we were able to anchor 58 assembled scaffolds that covered about 194.5 Mb (71.7%) of the 271.4 Mb assembled pumpkin genome, of which 44 (183.0 Mb; 67.4%) were oriented. Furthermore, the high-density genetic map was used to identify genomic regions highly associated with an important agronomic trait, dwarf vine. Three QTLs on linkage groups (LGs) 1, 3 and 4, respectively, were recovered. One QTL, qCmB2, which was located in an interval of 0.42 Mb on LG 3, explained 21.4% phenotypic variations. Within qCmB2, one gene, Cma_004516, encoding the gibberellin (GA) 20-oxidase in the GA biosynthesis pathway, had a 1249-bp deletion in its promoter in bush type lines, and its expression level was significantly increased during the vine growth and higher in vine type lines than bush type lines, supporting Cma_004516 as a possible candidate gene controlling vine growth in pumpkin. A high-density pumpkin genetic map was constructed, which was used to successfully anchor and orient the assembled genome scaffolds, and to identify QTLs highly associated with pumpkin vine length. The map provided a valuable resource for gene cloning and marker assisted breeding in pumpkin and

  7. A genome-wide scan study identifies a single nucleotide substitution in ASIP associated with white versus non-white coat-colour variation in sheep (Ovis aries).

    Science.gov (United States)

    Li, M-H; Tiirikka, T; Kantanen, J

    2014-02-01

    In sheep, coat colour (and pattern) is one of the important traits of great biological, economic and social importance. However, the genetics of sheep coat colour has not yet been fully clarified. We conducted a genome-wide association study of sheep coat colours by genotyping 47 303 single-nucleotide polymorphisms (SNPs) in the Finnsheep population in Finland. We identified 35 SNPs associated with all the coat colours studied, which cover genomic regions encompassing three known pigmentation genes (TYRP1, ASIP and MITF) in sheep. Eighteen of these associations were confirmed in further tests between white versus non-white individuals, but none of the 35 associations were significant in the analysis of only non-white colours. Across the tests, the s66432.1 in ASIP showed significant association (P=4.2 × 10(-11) for all the colours; P=2.3 × 10(-11) for white versus non-white colours) with the variation in coat colours and strong linkage disequilibrium with other significant variants surrounding the ASIP gene. The signals detected around the ASIP gene were explained by differences in white versus non-white alleles. Further, a genome scan for selection for white coat pigmentation identified a strong and striking selection signal spanning ASIP. Our study identified the main candidate gene for the coat colour variation between white and non-white as ASIP, an autosomal gene that has been directly implicated in the pathway regulating melanogenesis. Together with ASIP, the two other newly identified genes (TYRP1 and MITF) in the Finnsheep, bordering associated SNPs, represent a new resource for enriching sheep coat-colour genetics and breeding.

  8. Improvement of industrially important microbial strains by genome shuffling: Current status and future prospects.

    Science.gov (United States)

    Magocha, Tinashe Archbold; Zabed, H; Yang, Miaomiao; Yun, Junhua; Zhang, Huanhuan; Qi, Xianghui

    2018-06-01

    The growing demand for biotechnological products against limited metabolic capacity of industrially used microorganisms has led to an increased interest on strain-improvement over the last several decades, which aimed to enhance metabolite yield, substrate uptake and tolerance of the strains. Among a few techniques of strain-improvement, genome shuffling is the most recent and promising approach used for rapid strain-improvement that can yield a new strain by combining whole genomes of multi-parental microorganisms using the principles of protoplast fusion. Genome shuffling has brought a major breakthrough in the strain-improvement concept as it is found to be effective and reliable for expressing complex phenotypes. This review will discuss the technical aspects and applications of genome shuffling for various industrial strains to present its current status and recent progress. In the concluding remarks, a summary will be presented focusing on the major challenges and future outlooks of this technology. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. Draft Genome Sequence of Pontibacter sp. nov. BAB1700, a Halotolerant, Industrially Important Bacterium

    Science.gov (United States)

    Joshi, M. N.; Sharma, A. C.; Pandya, R. V.; Patel, R. P.; Saiyed, Z. M.; Saxena, A. K.

    2012-01-01

    Pontibacter sp. nov. BAB1700 is a halotolerant, Gram-negative, rod-shaped, pink-pigmented, menaquinone-7-producing bacterium isolated from sediments of a drilling well. The draft genome sequence of the strain, consisting of one chromosome of 4.5 Mb, revealed vital gene clusters involved in vitamin biosynthesis and resistance against various metals and antibiotics. PMID:23105068

  10. Grand challenges in evolutionary and population genetics: The importance of integrating epigenetics, genomics, modeling, and experimentation

    Science.gov (United States)

    Samuel A. Cushman

    2014-01-01

    This is a time of explosive growth in the fields of evolutionary and population genetics, with whole genome sequencing and bioinformatics driving a transformative paradigm shift (Morozova and Marra, 2008). At the same time, advances in epigenetics are thoroughly transforming our understanding of evolutionary processes and their implications for populations, species and...

  11. Meta-analysis of Genome-Wide Association Studies Identifies Novel Loci Associated With Optic Disc Morphology

    OpenAIRE

    Springelkamp, Henriët; Mishra, Aniket; Hysi, Pirro G.; Gharahkhani, Puya; Höhn, René; Khor, Chiea-Chuen; Cooke Bailey, Jessica N.; Luo, Xiaoyan; Ramdas, Wishal D.; Vithana, Eranga; Koh, Victor; Yazar, Seyhan; Xu, Liang; Forward, Hannah; Kearns, Lisa S.

    2015-01-01

    Primary open-angle glaucoma is the most common optic neuropathy and an important cause of irreversible blindness worldwide. The optic nerve head or optic disc is divided in two parts: a central cup (without nerve fibers) surrounded by the neuroretinal rim (containing axons of the retinal ganglion cells). The International Glaucoma Genetics Consortium conducted a meta-analysis of genome-wide association studies consisting of 17,248 individuals of European ancestry and 6,841 individuals of Asia...

  12. A genome-wide association study identifies risk loci for spirometric measures among smokers of European and African ancestry.

    Science.gov (United States)

    Lutz, Sharon M; Cho, Michael H; Young, Kendra; Hersh, Craig P; Castaldi, Peter J; McDonald, Merry-Lynn; Regan, Elizabeth; Mattheisen, Manuel; DeMeo, Dawn L; Parker, Margaret; Foreman, Marilyn; Make, Barry J; Jensen, Robert L; Casaburi, Richard; Lomas, David A; Bhatt, Surya P; Bakke, Per; Gulsvik, Amund; Crapo, James D; Beaty, Terri H; Laird, Nan M; Lange, Christoph; Hokanson, John E; Silverman, Edwin K

    2015-12-03

    Pulmonary function decline is a major contributor to morbidity and mortality among smokers. Post bronchodilator FEV1 and FEV1/FVC ratio are considered the standard assessment of airflow obstruction. We performed a genome-wide association study (GWAS) in 9919 current and former smokers in the COPDGene study (6659 non-Hispanic Whites [NHW] and 3260 African Americans [AA]) to identify associations with spirometric measures (post-bronchodilator FEV1 and FEV1/FVC). We also conducted meta-analysis of FEV1 and FEV1/FVC GWAS in the COPDGene, ECLIPSE, and GenKOLS cohorts (total n = 13,532). Among NHW in the COPDGene cohort, both measures of pulmonary function were significantly associated with SNPs at the 15q25 locus [containing CHRNA3/5, AGPHD1, IREB2, CHRNB4] (lowest p-value = 2.17 × 10(-11)), and FEV1/FVC was associated with a genomic region on chromosome 4 [upstream of HHIP] (lowest p-value = 5.94 × 10(-10)); both regions have been previously associated with COPD. For the meta-analysis, in addition to confirming associations to the regions near CHRNA3/5 and HHIP, genome-wide significant associations were identified for FEV1 on chromosome 1 [TGFB2] (p-value = 8.99 × 10(-9)), 9 [DBH] (p-value = 9.69 × 10(-9)) and 19 [CYP2A6/7] (p-value = 3.49 × 10(-8)) and for FEV1/FVC on chromosome 1 [TGFB2] (p-value = 8.99 × 10(-9)), 4 [FAM13A] (p-value = 3.88 × 10(-12)), 11 [MMP3/12] (p-value = 3.29 × 10(-10)) and 14 [RIN3] (p-value = 5.64 × 10(-9)). In a large genome-wide association study of lung function in smokers, we found genome-wide significant associations at several previously described loci with lung function or COPD. We additionally identified a novel genome-wide significant locus with FEV1 on chromosome 9 [DBH] in a meta-analysis of three study populations.

  13. Utility of sequenced genomes for microsatellite marker development in non-model organisms: a case study of functionally important genes in nine-spined sticklebacks (Pungitius pungitius

    Directory of Open Access Journals (Sweden)

    Shimada Yukinori

    2010-05-01

    Full Text Available Abstract Background Identification of genes involved in adaptation and speciation by targeting specific genes of interest has become a plausible strategy also for non-model organisms. We investigated the potential utility of available sequenced fish genomes to develop microsatellite (cf. simple sequence repeat, SSR markers for functionally important genes in nine-spined sticklebacks (Pungitius pungitius, as well as cross-species transferability of SSR primers from three-spined (Gasterosteus aculeatus to nine-spined sticklebacks. In addition, we examined the patterns and degree of SSR conservation between these species using their aligned sequences. Results Cross-species amplification success was lower for SSR markers located in or around functionally important genes (27 out of 158 than for those randomly derived from genomic (35 out of 101 and cDNA (35 out of 87 libraries. Polymorphism was observed at a large proportion (65% of the cross-amplified loci independently of SSR type. To develop SSR markers for functionally important genes in nine-spined sticklebacks, SSR locations were surveyed in or around 67 target genes based on the three-spined stickleback genome and these regions were sequenced with primers designed from conserved sequences in sequenced fish genomes. Out of the 81 SSRs identified in the sequenced regions (44,084 bp, 57 exhibited the same motifs at the same locations as in the three-spined stickleback. Di- and trinucleotide SSRs appeared to be highly conserved whereas mononucleotide SSRs were less so. Species-specific primers were designed to amplify 58 SSRs using the sequences of nine-spined sticklebacks. Conclusions Our results demonstrated that a large proportion of SSRs are conserved in the species that have diverged more than 10 million years ago. Therefore, the three-spined stickleback genome can be used to predict SSR locations in the nine-spined stickleback genome. While cross-species utility of SSR primers is limited due

  14. Use of Whole-Genus Genome Sequence Data To Develop a Multilocus Sequence Typing Tool That Accurately Identifies Yersinia Isolates to the Species and Subspecies Levels

    Science.gov (United States)

    Hall, Miquette; Chattaway, Marie A.; Reuter, Sandra; Savin, Cyril; Strauch, Eckhard; Carniel, Elisabeth; Connor, Thomas; Van Damme, Inge; Rajakaruna, Lakshani; Rajendram, Dunstan; Jenkins, Claire; Thomson, Nicholas R.

    2014-01-01

    The genus Yersinia is a large and diverse bacterial genus consisting of human-pathogenic species, a fish-pathogenic species, and a large number of environmental species. Recently, the phylogenetic and population structure of the entire genus was elucidated through the genome sequence data of 241 strains encompassing every known species in the genus. Here we report the mining of this enormous data set to create a multilocus sequence typing-based scheme that can identify Yersinia strains to the species level to a level of resolution equal to that for whole-genome sequencing. Our assay is designed to be able to accurately subtype the important human-pathogenic species Yersinia enterocolitica to whole-genome resolution levels. We also report the validation of the scheme on 386 strains from reference laboratory collections across Europe. We propose that the scheme is an important molecular typing system to allow accurate and reproducible identification of Yersinia isolates to the species level, a process often inconsistent in nonspecialist laboratories. Additionally, our assay is the most phylogenetically informative typing scheme available for Y. enterocolitica. PMID:25339391

  15. Genome-wide association analysis of more than 120,000 individuals identifies 15 new susceptibility loci for breast cancer.

    OpenAIRE

    Michailidou, Kyriaki; Beesley, Jonathan; Lindstrom, Sara; Canisius, Sander; Dennis, Joe; Lush, Michael J; Maranian, Mel J; Bolla, Manjeet K; Wang, Qin; Shah, Mitulkumar Nandlal; Perkins, Barbara J; Czene, Kamila; Eriksson, Mikael; Darabi, Hatef; Brand, Judith S

    2015-01-01

    Genome-wide association studies (GWAS) and large-scale replication studies have identified common variants in 79 loci associated with breast cancer, explaining ~14% of the familial risk of the disease. To identify new susceptibility loci, we performed a meta-analysis of 11 GWAS, comprising 15,748 breast cancer cases and 18,084 controls together with 46,785 cases and 42,892 controls from 41 studies genotyped on a 211,155-marker custom array (iCOGS). Analyses were restricted to women of Europea...

  16. Genome-wide association analysis of more than 120,000 individuals identifies 15 new susceptibility loci for breast cancer

    OpenAIRE

    Michailidou, Kyriaki; Beesley, Jonathan; Lindstrom, Stephen; Canisius, Sander; Dennis, Joe; Lush, Michael; Maranian, Melanie; Bolla, Manjeet; Wang, Qing; Shah, Mitul; Perkins, Barbara; Czene, Kamila; Eriksson, Mikael; Darabi, Hatef; Brand, Judith S.

    2015-01-01

    textabstractGenome-wide association studies (GWAS) and large-scale replication studies have identified common variants in 79 loci associated with breast cancer, explaining ∼14% of the familial risk of the disease. To identify new susceptibility loci, we performed a meta-analysis of 11 GWAS, comprising 15,748 breast cancer cases and 18,084 controls together with 46,785 cases and 42,892 controls from 41 studies genotyped on a 211,155-marker custom array (iCOGS). Analyses were restricted to wome...

  17. Genome characterization of Long Island tick rhabdovirus, a new virus identified in Amblyomma americanum ticks.

    Science.gov (United States)

    Tokarz, Rafal; Sameroff, Stephen; Leon, Maria Sanchez; Jain, Komal; Lipkin, W Ian

    2014-02-11

    Ticks are implicated as hosts to a wide range of animal and human pathogens. The full range of microbes harbored by ticks has not yet been fully explored. As part of a viral surveillance and discovery project in arthropods, we used unbiased high-throughput sequencing to examine viromes of ticks collected on Long Island, New York in 2013. We detected and sequenced the complete genome of a novel rhabdovirus originating from a pool of Amblyomma americanum ticks. This virus, which we provisionally name Long Island tick rhabdovirus, is distantly related to Moussa virus from Africa. The Long Island tick rhabdovirus may represent a novel species within family Rhabdoviridae.

  18. The complete genomic sequence of a tentative new polerovirus identified in barley in South Korea.

    Science.gov (United States)

    Zhao, Fumei; Lim, Seungmo; Yoo, Ran Hee; Igori, Davaajargal; Kim, Sang-Min; Kwak, Do Yeon; Kim, Sun Lim; Lee, Bong Choon; Moon, Jae Sun

    2016-07-01

    The complete nucleotide sequence of a new barley polerovirus, tentatively named barley virus G (BVG), which was isolated in Gimje, South Korea, has been determined using an RNA sequencing technique combined with polymerase chain reaction methods. The viral genomic RNA of BVG is 5,620 nucleotides long and contains six typical open reading frames commonly observed in other poleroviruses. Sequence comparisons revealed that BVG is most closely related to maize yellow dwarf virus-RMV, with the highest amino acid identities being less than 90 % for all of the corresponding proteins. These results suggested that BVG is a member of a new species in the genus Polerovirus.

  19. Identifying faecal impaction is important for ensuring the timely diagnosis of childhood functional constipation

    DEFF Research Database (Denmark)

    Modin, Line; Walsted, Anne-Mette; Jakobsen, Marianne Skytte

    2015-01-01

    AIM: Most research on functional constipation has been carried out at a tertiary level. We focused this study on a secondary-level hospital outpatients' department, assessing the distribution of diagnostic criteria for childhood functional constipation and evaluating the consequences of current...... diagnostic practice based on current guidelines. METHODS: We enrolled 235 children, aged two to 16 years of age, with functional constipation according to the Rome III criteria and assessed them using medical histories and physical examinations, including rectal examinations and ultrasound measurements...... the timely diagnosis of childhood functional constipation at the secondary care level. Ultrasound examination proved a reliable alternative to rectal examination or abdominal radiography when identifying faecal impaction....

  20. Use of a bovine genome array to identify new biological pathways for beef marbling in Hanwoo (Korean Cattle

    Directory of Open Access Journals (Sweden)

    Lim Da-jeong

    2010-11-01

    Full Text Available Abstract Background Marbling (intramuscular fat is a valuable trait that impacts on meat quality and an important factor determining price of beef in the Korean beef market. Animals that are destined for this high marbling market are fed a high concentrate ration for approximately 30 months in the Korean finishing farms. However, this feeding strategy leads to inefficiencies and excessive fat production. This study aimed to identify candidate genes and pathways associated with intramuscular fat deposition on highly divergent marbling phenotypes in adult Hanwoo cattle. Results Bovine genome array analysis was conducted to detect differentially expressed genes (DEGs in m. longissimus with divergent marbling phenotype (marbling score 2 to 7. Three data-processing methods (MAS5.0, GCRMA and RMA were used to test for differential expression (DE. Statistical analysis identified 21 significant transcripts from at least two data-processing methods (P . All 21 differentially expr