WorldWideScience

Sample records for identify important features

  1. Identifying significant environmental features using feature recognition.

    Science.gov (United States)

    2015-10-01

    The Department of Environmental Analysis at the Kentucky Transportation Cabinet has expressed an interest in feature-recognition capability because it may help analysts identify environmentally sensitive features in the landscape, : including those r...

  2. Permutation importance: a corrected feature importance measure.

    Science.gov (United States)

    Altmann, André; Toloşi, Laura; Sander, Oliver; Lengauer, Thomas

    2010-05-15

    In life sciences, interpretability of machine learning models is as important as their prediction accuracy. Linear models are probably the most frequently used methods for assessing feature relevance, despite their relative inflexibility. However, in the past years effective estimators of feature relevance have been derived for highly complex or non-parametric models such as support vector machines and RandomForest (RF) models. Recently, it has been observed that RF models are biased in such a way that categorical variables with a large number of categories are preferred. In this work, we introduce a heuristic for normalizing feature importance measures that can correct the feature importance bias. The method is based on repeated permutations of the outcome vector for estimating the distribution of measured importance for each variable in a non-informative setting. The P-value of the observed importance provides a corrected measure of feature importance. We apply our method to simulated data and demonstrate that (i) non-informative predictors do not receive significant P-values, (ii) informative variables can successfully be recovered among non-informative variables and (iii) P-values computed with permutation importance (PIMP) are very helpful for deciding the significance of variables, and therefore improve model interpretability. Furthermore, PIMP was used to correct RF-based importance measures for two real-world case studies. We propose an improved RF model that uses the significant variables with respect to the PIMP measure and show that its prediction accuracy is superior to that of other existing models. R code for the method presented in this article is available at http://www.mpi-inf.mpg.de/ approximately altmann/download/PIMP.R CONTACT: altmann@mpi-inf.mpg.de, laura.tolosi@mpi-inf.mpg.de Supplementary data are available at Bioinformatics online.

  3. Method of identifying features in indexed data

    Science.gov (United States)

    Jarman, Kristin H [Richland, WA; Daly, Don Simone [Richland, WA; Anderson, Kevin K [Richland, WA; Wahl, Karen L [Richland, WA

    2001-06-26

    The present invention is a method of identifying features in indexed data, especially useful for distinguishing signal from noise in data provided as a plurality of ordered pairs. Each of the plurality of ordered pairs has an index and a response. The method has the steps of: (a) providing an index window having a first window end located on a first index and extending across a plurality of indices to a second window end; (b) selecting responses corresponding to the plurality of indices within the index window and computing a measure of dispersion of the responses; and (c) comparing the measure of dispersion to a dispersion critical value. Advantages of the present invention include minimizing signal to noise ratio, signal drift, varying baseline signal and combinations thereof.

  4. Important Features of Sustainable Aggregate Resource Management

    Directory of Open Access Journals (Sweden)

    Slavko V. Šolar

    2004-06-01

    Full Text Available Every society, whether developed, developing or in a phase of renewal following governmental change, requires stable, adequate and secure supplies of natural resources. In the latter case, there could be significant need for construction materials for rebuilding infrastructure, industrial capacity, and housing. It is essential that these large-volume materials be provided in a rational manner that maximizes their societal contribution and minimizes environmental impacts. We describe an approach to resource management based on the principles of sustainable development. Sustainable Aggregate Resource Management offers a way of addressing the conflicting needs and interests of environmental, economic, and social systems. Sustainability is an ethics based concept that utilizes science and democratic processes to reach acceptable agreements and tradeoffs among interests, while acknowledging the fundamental importance of the environment and social goods. We discuss the features of sustainable aggregate resource management.

  5. Important features of Sustainable Aggregate Resource Management

    Science.gov (United States)

    Solar, Slavko V.; Shields, Deborah J.; Langer, William H.

    2004-01-01

    Every society, whether developed, developing or in a phase of renewal following governmental change, requires stable, adequate and secure supplies of natural resources. In the latter case, there could be significant need for construction materials for rebuilding infrastructure, industrial capacity, and housing. It is essential that these large-volume materials be provided in a rational manner that maximizes their societal contribution and minimizes environmental impacts. We describe an approach to resource management based on the principles of sustainable developed. Sustainable Aggregate Resource Management offers a way of addressing the conflicting needs and interests of environmental, economic, and social systems. Sustainability is an ethics based concept that utilizes science and democratic processes to reach acceptable agreements and tradeoffs among interests, while acknowledging the fundamental importance of the environment and social goods. We discuss the features of sustainable aggregate resource management.

  6. Cyberprints: Identifying Cyber Attackers by Feature Analysis

    Science.gov (United States)

    Blakely, Benjamin A.

    2012-01-01

    The problem of attributing cyber attacks is one of increasing importance. Without a solid method of demonstrating the origin of a cyber attack, any attempts to deter would-be cyber attackers are wasted. Existing methods of attribution make unfounded assumptions about the environment in which they will operate: omniscience (the ability to gather,…

  7. Featured Image: Identifying a Glowing Shell

    Science.gov (United States)

    Kohler, Susanna

    2018-05-01

    New nebulae are being discovered and classified every day and this false-color image reveals one of the more recent objects of interest. This nebula, IPHASX J210204.7+471015, was recently imaged by the Andalucia Faint Object Spectrograph and Camera mounted on the 2.5-m Nordic Optical Telescope in La Palma, Spain. J210204 was initially identified as a possible planetary nebula a remnant left behind at the end of a red giants lifetime. Based on the above imaging, however, a team of authors led by Martn Guerrero (Institute of Astrophysics of Andalusia, Spain) is arguing that this shell of glowing gas was instead expelled around a classical nova. In a classical nova eruption, a white dwarf and its binary companion come very close together, and mass transfers to form a thin atmosphere of hydrogen around the white dwarf. When this hydrogen suddenly ignites in runaway fusion, this outer atmosphere can be expelled, forming a short-lived nova remnant which is what Guerrero and collaborators think were seeing with J210204. If so, this nebula can reveal information about the novathat caused it. To find out more about what the authors learned from this nebula, check out the paper below.CitationMartn A. Guerrero et al 2018 ApJ 857 80. doi:10.3847/1538-4357/aab669

  8. Important conventional island design features: generators

    International Nuclear Information System (INIS)

    Fritsch, Th.

    1985-01-01

    To-day, maximum reactor capacity is setting a provisional limit to the MW race. The latest nuclear generators in manufacturing are rated 1530 MW - 1710 MVA and are doubtless the most powerful ones in the world. The target to be aimed at in designing large turbogenerators may be defined by the following points: 1) meeting the rated load conditions without overpassing maximum admissible temperatures in any part of the machine; 2) keeping losses as small as possible; 3) keeping overall size small enough to allow rail transportation from the works to the site; 4) choosing well experienced solutions in order to set a highly reliable machine with maximum maintenance. In this report the main features of nuclear generators in the 1000-2000 MVA range are described. (Auth.)

  9. The Importance of identifiers: IWGSC Meeting 20170720

    OpenAIRE

    Haak, Laurel

    2017-01-01

    Presentation by Laure Haak at the 20 July 2017 meeting of the IWGSC, about use of identifiers in connecting researchers, funding, facilities, and publications. Description of approach and initial results of User Facilities and Publications Working Group, and applications for Scientific Collections.

  10. Identifying sports videos using replay, text, and camera motion features

    Science.gov (United States)

    Kobla, Vikrant; DeMenthon, Daniel; Doermann, David S.

    1999-12-01

    Automated classification of digital video is emerging as an important piece of the puzzle in the design of content management systems for digital libraries. The ability to classify videos into various classes such as sports, news, movies, or documentaries, increases the efficiency of indexing, browsing, and retrieval of video in large databases. In this paper, we discuss the extraction of features that enable identification of sports videos directly from the compressed domain of MPEG video. These features include detecting the presence of action replays, determining the amount of scene text in vide, and calculating various statistics on camera and/or object motion. The features are derived from the macroblock, motion,and bit-rate information that is readily accessible from MPEG video with very minimal decoding, leading to substantial gains in processing speeds. Full-decoding of selective frames is required only for text analysis. A decision tree classifier built using these features is able to identify sports clips with an accuracy of about 93 percent.

  11. Identifying TF-MiRNA Regulatory Relationships Using Multiple Features.

    Directory of Open Access Journals (Sweden)

    Mingyu Shao

    Full Text Available MicroRNAs are known to play important roles in the transcriptional and post-transcriptional regulation of gene expression. While intensive research has been conducted to identify miRNAs and their target genes in various genomes, there is only limited knowledge about how microRNAs are regulated. In this study, we construct a pipeline that can infer the regulatory relationships between transcription factors and microRNAs from ChIP-Seq data with high confidence. In particular, after identifying candidate peaks from ChIP-Seq data, we formulate the inference as a PU learning (learning from only positive and unlabeled examples problem. Multiple features including the statistical significance of the peaks, the location of the peaks, the transcription factor binding site motifs, and the evolutionary conservation are derived from peaks for training and prediction. To further improve the accuracy of our inference, we also apply a mean reciprocal rank (MRR-based method to the candidate peaks. We apply our pipeline to infer TF-miRNA regulatory relationships in mouse embryonic stem cells. The experimental results show that our approach provides very specific findings of TF-miRNA regulatory relationships.

  12. Feature Importance for Human Epithelial (HEp-2 Cell Image Classification

    Directory of Open Access Journals (Sweden)

    Vibha Gupta

    2018-02-01

    Full Text Available Indirect Immuno-Fluorescence (IIF microscopy imaging of human epithelial (HEp-2 cells is a popular method for diagnosing autoimmune diseases. Considering large data volumes, computer-aided diagnosis (CAD systems, based on image-based classification, can help in terms of time, effort, and reliability of diagnosis. Such approaches are based on extracting some representative features from the images. This work explores the selection of the most distinctive features for HEp-2 cell images using various feature selection (FS methods. Considering that there is no single universally optimal feature selection technique, we also propose hybridization of one class of FS methods (filter methods. Furthermore, the notion of variable importance for ranking features, provided by another type of approaches (embedded methods such as Random forest, Random uniform forest is exploited to select a good subset of features from a large set, such that addition of new features does not increase classification accuracy. In this work, we have also, with great consideration, designed class-specific features to capture morphological visual traits of the cell patterns. We perform various experiments and discussions to demonstrate the effectiveness of FS methods along with proposed and a standard feature set. We achieve state-of-the-art performance even with small number of features, obtained after the feature selection.

  13. The importance of internal facial features in learning new faces.

    Science.gov (United States)

    Longmore, Christopher A; Liu, Chang Hong; Young, Andrew W

    2015-01-01

    For familiar faces, the internal features (eyes, nose, and mouth) are known to be differentially salient for recognition compared to external features such as hairstyle. Two experiments are reported that investigate how this internal feature advantage accrues as a face becomes familiar. In Experiment 1, we tested the contribution of internal and external features to the ability to generalize from a single studied photograph to different views of the same face. A recognition advantage for the internal features over the external features was found after a change of viewpoint, whereas there was no internal feature advantage when the same image was used at study and test. In Experiment 2, we removed the most salient external feature (hairstyle) from studied photographs and looked at how this affected generalization to a novel viewpoint. Removing the hair from images of the face assisted generalization to novel viewpoints, and this was especially the case when photographs showing more than one viewpoint were studied. The results suggest that the internal features play an important role in the generalization between different images of an individual's face by enabling the viewer to detect the common identity-diagnostic elements across non-identical instances of the face.

  14. Identifying DNA Methylation Features that Underlie Prostate Cancer Disparities

    Science.gov (United States)

    2017-10-01

    15.3%) NA 6 (6%) 6 (5.4%) Prostate - specific Antigen (PSA) ng/mL 76.7 (42.9) 78.2 (40.7) pTNM Stage T2 68 (67.3%) 48 (43.2%) T3 29 (28.7%) 58...Profiles Primary Aim #1: Determine if methylation profiles differ by race/ancestry Primary Aim #2: Identify ethnicity- specific markers of prostate ...by ethnicity and to identify ethnicity- specific methylation features of prostate cancer that could contribute the racial disparities that exist in

  15. Attachment insecurity and perceived importance of relational features

    NARCIS (Netherlands)

    Ren, D.; Arriaga, X.B.; Mahan, E.R.

    2017-01-01

    Chronic attachment insecurity can affect the outlook people have on relationships. This research examines how attachment insecurity relates to perceived importance of various features in a romantic relationship (e.g., intimacy, independence). Consistent with predictions, the results from Studies 1–3

  16. Identifying Importance-Performance Matrix Analysis (IPMA) of ...

    African Journals Online (AJOL)

    Identifying Importance-Performance Matrix Analysis (IPMA) of intellectual capital and Islamic work ethics in Malaysian SMES. ... capital and Islamic work ethics significantly influenced business performance. ... AJOL African Journals Online.

  17. Robust modal curvature features for identifying multiple damage in beams

    Science.gov (United States)

    Ostachowicz, Wiesław; Xu, Wei; Bai, Runbo; Radzieński, Maciej; Cao, Maosen

    2014-03-01

    Curvature mode shape is an effective feature for damage detection in beams. However, it is susceptible to measurement noise, easily impairing its advantage of sensitivity to damage. To deal with this deficiency, this study formulates an improved curvature mode shape for multiple damage detection in beams based on integrating a wavelet transform (WT) and a Teager energy operator (TEO). The improved curvature mode shape, termed the WT - TEO curvature mode shape, has inherent capabilities of immunity to noise and sensitivity to damage. The proposed method is experimentally validated by identifying multiple cracks in cantilever steel beams with the mode shapes acquired using a scanning laser vibrometer. The results demonstrate that the improved curvature mode shape can identify multiple damage accurately and reliably, and it is fairly robust to measurement noise.

  18. Key clinical features to identify girls with CDKL5 mutations.

    Science.gov (United States)

    Bahi-Buisson, Nadia; Nectoux, Juliette; Rosas-Vargas, Haydeé; Milh, Mathieu; Boddaert, Nathalie; Girard, Benoit; Cances, Claude; Ville, Dorothée; Afenjar, Alexandra; Rio, Marlène; Héron, Delphine; N'guyen Morel, Marie Ange; Arzimanoglou, Alexis; Philippe, Christophe; Jonveaux, Philippe; Chelly, Jamel; Bienvenu, Thierry

    2008-10-01

    Mutations in the human X-linked cyclin-dependent kinase-like 5 (CDKL5) gene have been shown to cause infantile spasms as well as Rett syndrome (RTT)-like phenotype. To date, less than 25 different mutations have been reported. So far, there are still little data on the key clinical diagnosis criteria and on the natural history of CDKL5-associated encephalopathy. We screened the entire coding region of CDKL5 for mutations in 183 females with encephalopathy with early seizures by denaturing high liquid performance chromatography and direct sequencing, and we identified in 20 unrelated girls, 18 different mutations including 7 novel mutations. These mutations were identified in eight patients with encephalopathy with RTT-like features, five with infantile spasms and seven with encephalopathy with refractory epilepsy. Early epilepsy with normal interictal EEG and severe hypotonia are the key clinical features in identifying patients likely to have CDKL5 mutations. Our study also indicates that these patients clearly exhibit some RTT features such as deceleration of head growth, stereotypies and hand apraxia and that these RTT features become more evident in older and ambulatory patients. However, some RTT signs are clearly absent such as the so called RTT disease profile (period of nearly normal development followed by regression with loss of acquired fine finger skill in early childhood and characteristic intensive eye communication) and the characteristic evolution of the RTT electroencephalogram. Interestingly, in addition to the overall stereotypical symptomatology (age of onset and evolution of the disease) resulting from CDKL5 mutations, atypical forms of CDKL5-related conditions have also been observed. Our data suggest that phenotypic heterogeneity does not correlate with the nature or the position of the mutations or with the pattern of X-chromosome inactivation, but most probably with the functional transcriptional and/or translational consequences of CDKL5

  19. Identifying the important factors in simulation models with many factors

    NARCIS (Netherlands)

    Bettonvil, B.; Kleijnen, J.P.C.

    1994-01-01

    Simulation models may have many parameters and input variables (together called factors), while only a few factors are really important (parsimony principle). For such models this paper presents an effective and efficient screening technique to identify and estimate those important factors. The

  20. Feature Import Vector Machine: A General Classifier with Flexible Feature Selection.

    Science.gov (United States)

    Ghosh, Samiran; Wang, Yazhen

    2015-02-01

    The support vector machine (SVM) and other reproducing kernel Hilbert space (RKHS) based classifier systems are drawing much attention recently due to its robustness and generalization capability. General theme here is to construct classifiers based on the training data in a high dimensional space by using all available dimensions. The SVM achieves huge data compression by selecting only few observations which lie close to the boundary of the classifier function. However when the number of observations are not very large (small n ) but the number of dimensions/features are large (large p ), then it is not necessary that all available features are of equal importance in the classification context. Possible selection of an useful fraction of the available features may result in huge data compression. In this paper we propose an algorithmic approach by means of which such an optimal set of features could be selected. In short, we reverse the traditional sequential observation selection strategy of SVM to that of sequential feature selection. To achieve this we have modified the solution proposed by Zhu and Hastie (2005) in the context of import vector machine (IVM), to select an optimal sub-dimensional model to build the final classifier with sufficient accuracy.

  1. Identifying relevant feature-action associations for grasping unmodelled objects

    DEFF Research Database (Denmark)

    Thomsen, Mikkel Tang; Kraft, Dirk; Krüger, Norbert

    2015-01-01

    content. The method is provided with a large and structured set of visual features, motivated by the visual hierarchy in primates and finds relevant feature action associations automatically. We apply our method in a simulated environment on three different object sets for the case of grasp affordance...... learning. For box objects, we achieve a 0.90 success probability, 0.80 for round objects and up to 0.75 for open objects, when presented with novel objects. In this work, we in particular demonstrate the effect of choosing appropriate feature representations. We demonstrate a significant performance...

  2. An expert botanical feature extraction technique based on phenetic features for identifying plant species.

    Directory of Open Access Journals (Sweden)

    Hoshang Kolivand

    Full Text Available In this paper, we present a new method to recognise the leaf type and identify plant species using phenetic parts of the leaf; lobes, apex and base detection. Most of the research in this area focuses on the popular features such as the shape, colour, vein, and texture, which consumes large amounts of computational processing and are not efficient, especially in the Acer database with a high complexity structure of the leaves. This paper is focused on phenetic parts of the leaf which increases accuracy. Detecting the local maxima and local minima are done based on Centroid Contour Distance for Every Boundary Point, using north and south region to recognise the apex and base. Digital morphology is used to measure the leaf shape and the leaf margin. Centroid Contour Gradient is presented to extract the curvature of leaf apex and base. We analyse 32 leaf images of tropical plants and evaluated with two different datasets, Flavia, and Acer. The best accuracy obtained is 94.76% and 82.6% respectively. Experimental results show the effectiveness of the proposed technique without considering the commonly used features with high computational cost.

  3. An expert botanical feature extraction technique based on phenetic features for identifying plant species

    Science.gov (United States)

    Fern, Bong Mei; Rahim, Mohd Shafry Mohd; Sulong, Ghazali; Baker, Thar; Tully, David

    2018-01-01

    In this paper, we present a new method to recognise the leaf type and identify plant species using phenetic parts of the leaf; lobes, apex and base detection. Most of the research in this area focuses on the popular features such as the shape, colour, vein, and texture, which consumes large amounts of computational processing and are not efficient, especially in the Acer database with a high complexity structure of the leaves. This paper is focused on phenetic parts of the leaf which increases accuracy. Detecting the local maxima and local minima are done based on Centroid Contour Distance for Every Boundary Point, using north and south region to recognise the apex and base. Digital morphology is used to measure the leaf shape and the leaf margin. Centroid Contour Gradient is presented to extract the curvature of leaf apex and base. We analyse 32 leaf images of tropical plants and evaluated with two different datasets, Flavia, and Acer. The best accuracy obtained is 94.76% and 82.6% respectively. Experimental results show the effectiveness of the proposed technique without considering the commonly used features with high computational cost. PMID:29420568

  4. Machine Learning Identifies Stemness Features Associated with Oncogenic Dedifferentiation

    NARCIS (Netherlands)

    Malta, Tathiane M.; Sokolov, Artem; Gentles, Andrew J.; Burzykowski, Tomasz; Poisson, Laila; Weinstein, John N.; Kamińska, Bożena; Huelsken, Joerg; Omberg, Larsson; Gevaert, Olivier; Colaprico, Antonio; Czerwińska, Patrycja; Mazurek, Sylwia; Mishra, Lopa; Heyn, Holger; Krasnitz, Alex; Godwin, Andrew K.; Lazar, Alexander J.; Caesar-Johnson, Samantha J.; Demchok, John A.; Felau, Ina; Kasapi, Melpomeni; Ferguson, Martin L.; Hutter, Carolyn M.; Sofia, Heidi J.; Tarnuzzer, Roy; Wang, Zhining; Yang, Liming; Zenklusen, Jean C.; Zhang, Jiashan (Julia); Chudamani, Sudha; Liu, Jia; Lolla, Laxmi; Naresh, Rashi; Pihl, Todd; Sun, Qiang; Wan, Yunhu; Wu, Ye; Cho, Juok; DeFreitas, Timothy; Frazer, Scott; Gehlenborg, Nils; Getz, Gad; Heiman, David I.; Kim, Jaegil; Lawrence, Michael S.; Lin, Pei; Meier, Sam; Noble, Michael S.; Saksena, Gordon; Voet, Doug; Zhang, Hailei; Bernard, Brady; Chambwe, Nyasha; Dhankani, Varsha; Knijnenburg, Theo; Kramer, Roger; Leinonen, Kalle; Liu, Yuexin; Miller, Michael; Reynolds, Sheila; Shmulevich, Ilya; Thorsson, Vesteinn; Zhang, Wei; Akbani, Rehan; Broom, Bradley M.; Hegde, Apurva M.; Ju, Zhenlin; Kanchi, Rupa S.; Korkut, Anil; Li, Jun; Liang, Han; Ling, Shiyun; Liu, Wenbin; Lu, Yiling; Mills, Gordon B.; Ng, Kwok Shing; Rao, Arvind; Ryan, Michael; Wang, Jing; Weinstein, John N.; Zhang, Jiexin; Abeshouse, Adam; Armenia, Joshua; Chakravarty, Debyani; Chatila, Walid K.; de Bruijn, Ino; Gao, Jianjiong; Gross, Benjamin E.; Heins, Zachary J.; Kundra, Ritika; La, Konnor; Ladanyi, Marc; Luna, Augustin; Nissan, Moriah G.; Ochoa, Angelica; Phillips, Sarah M.; Reznik, Ed; Sanchez-Vega, Francisco; Sander, Chris; Schultz, Nikolaus; Sheridan, Robert; Sumer, S. Onur; Sun, Yichao; Taylor, Barry S.; Wang, Jioajiao; Zhang, Hongxin; Anur, Pavana; Peto, Myron; Spellman, Paul; Benz, Christopher; Stuart, Joshua M.; Wong, Christopher K.; Yau, Christina; Hayes, D. Neil; Parker, Joel S.; Wilkerson, Matthew D.; Ally, Adrian; Balasundaram, Miruna; Bowlby, Reanne; Brooks, Denise; Carlsen, Rebecca; Chuah, Eric; Dhalla, Noreen; Holt, Robert; Jones, Steven J.M.; Kasaian, Katayoon; Lee, Darlene; Ma, Yussanne; Marra, Marco A.; Mayo, Michael; Moore, Richard A.; Mungall, Andrew J.; Mungall, Karen; Robertson, A. Gordon; Sadeghi, Sara; Schein, Jacqueline E.; Sipahimalani, Payal; Tam, Angela; Thiessen, Nina; Tse, Kane; Wong, Tina; Berger, Ashton C.; Beroukhim, Rameen; Cherniack, Andrew D.; Cibulskis, Carrie; Gabriel, Stacey B.; Gao, Galen F.; Ha, Gavin; Meyerson, Matthew; Schumacher, Steven E.; Shih, Juliann; Kucherlapati, Melanie H.; Kucherlapati, Raju S.; Baylin, Stephen; Cope, Leslie; Danilova, Ludmila; Bootwalla, Moiz S.; Lai, Phillip H.; Maglinte, Dennis T.; Van Den Berg, David J.; Weisenberger, Daniel J.; Auman, J. Todd; Balu, Saianand; Bodenheimer, Tom; Fan, Cheng; Hoadley, Katherine A.; Hoyle, Alan P.; Jefferys, Stuart R.; Jones, Corbin D.; Meng, Shaowu; Mieczkowski, Piotr A.; Mose, Lisle E.; Perou, Amy H.; Perou, Charles M.; Roach, Jeffrey; Shi, Yan; Simons, Janae V.; Skelly, Tara; Soloway, Matthew G.; Tan, Donghui; Veluvolu, Umadevi; Fan, Huihui; Hinoue, Toshinori; Laird, Peter W.; Shen, Hui; Zhou, Wanding; Bellair, Michelle; Chang, Kyle; Covington, Kyle; Creighton, Chad J.; Dinh, Huyen; Doddapaneni, Harsha Vardhan; Donehower, Lawrence A.; Drummond, Jennifer; Gibbs, Richard A.; Glenn, Robert; Hale, Walker; Han, Yi; Hu, Jianhong; Korchina, Viktoriya; Lee, Sandra; Lewis, Lora; Li, Wei; Liu, Xiuping; Morgan, Margaret; Morton, Donna; Muzny, Donna; Santibanez, Jireh; Sheth, Margi; Shinbrot, Eve; Wang, Linghua; Wang, Min; Wheeler, David A.; Xi, Liu; Zhao, Fengmei; Hess, Julian; Appelbaum, Elizabeth L.; Bailey, Matthew; Cordes, Matthew G.; Ding, Li; Fronick, Catrina C.; Fulton, Lucinda A.; Fulton, Robert S.; Kandoth, Cyriac; Mardis, Elaine R.; McLellan, Michael D.; Miller, Christopher A.; Schmidt, Heather K.; Wilson, Richard K.; Crain, Daniel; Curley, Erin; Gardner, Johanna; Lau, Kevin; Mallery, David; Morris, Scott; Paulauskis, Joseph; Penny, Robert; Shelton, Candace; Shelton, Troy; Sherman, Mark; Thompson, Eric; Yena, Peggy; Bowen, Jay; Gastier-Foster, Julie M.; Gerken, Mark; Leraas, Kristen M.; Lichtenberg, Tara M.; Ramirez, Nilsa C.; Wise, Lisa; Zmuda, Erik; Corcoran, Niall; Costello, Tony; Hovens, Christopher; Carvalho, Andre L.; de Carvalho, Ana C.; Fregnani, José H.; Longatto-Filho, Adhemar; Reis, Rui M.; Scapulatempo-Neto, Cristovam; Silveira, Henrique C.S.; Vidal, Daniel O.; Burnette, Andrew; Eschbacher, Jennifer; Hermes, Beth; Noss, Ardene; Singh, Rosy; Anderson, Matthew L.; Castro, Patricia D.; Ittmann, Michael; Huntsman, David; Kohl, Bernard; Le, Xuan; Thorp, Richard; Andry, Chris; Duffy, Elizabeth R.; Lyadov, Vladimir; Paklina, Oxana; Setdikova, Galiya; Shabunin, Alexey; Tavobilov, Mikhail; McPherson, Christopher; Warnick, Ronald; Berkowitz, Ross; Cramer, Daniel; Feltmate, Colleen; Horowitz, Neil; Kibel, Adam; Muto, Michael; Raut, Chandrajit P.; Malykh, Andrei; Barnholtz-Sloan, Jill S.; Barrett, Wendi; Devine, Karen; Fulop, Jordonna; Ostrom, Quinn T.; Shimmel, Kristen; Wolinsky, Yingli; Sloan, Andrew E.; De Rose, Agostino; Giuliante, Felice; Goodman, Marc; Karlan, Beth Y.; Hagedorn, Curt H.; Eckman, John; Harr, Jodi; Myers, Jerome; Tucker, Kelinda; Zach, Leigh Anne; Deyarmin, Brenda; Hu, Hai; Kvecher, Leonid; Larson, Caroline; Mural, Richard J.; Somiari, Stella; Vicha, Ales; Zelinka, Tomas; Bennett, Joseph; Iacocca, Mary; Rabeno, Brenda; Swanson, Patricia; Latour, Mathieu; Lacombe, Louis; Têtu, Bernard; Bergeron, Alain; McGraw, Mary; Staugaitis, Susan M.; Chabot, John; Hibshoosh, Hanina; Sepulveda, Antonia; Su, Tao; Wang, Timothy; Potapova, Olga; Voronina, Olga; Desjardins, Laurence; Mariani, Odette; Roman-Roman, Sergio; Sastre, Xavier; Stern, Marc Henri; Cheng, Feixiong; Signoretti, Sabina; Berchuck, Andrew; Bigner, Darell; Lipp, Eric; Marks, Jeffrey; McCall, Shannon; McLendon, Roger; Secord, Angeles; Sharp, Alexis; Behera, Madhusmita; Brat, Daniel J.; Chen, Amy; Delman, Keith; Force, Seth; Khuri, Fadlo; Magliocca, Kelly; Maithel, Shishir; Olson, Jeffrey J.; Owonikoko, Taofeek; Pickens, Alan; Ramalingam, Suresh; Shin, Dong M.; Sica, Gabriel; Van Meir, Erwin G.; Zhang, Hongzheng; Eijckenboom, Wil; Gillis, Ad; Korpershoek, Esther; Looijenga, Leendert; Oosterhuis, Wolter; Stoop, Hans; van Kessel, Kim E.; Zwarthoff, Ellen C.; Calatozzolo, Chiara; Cuppini, Lucia; Cuzzubbo, Stefania; DiMeco, Francesco; Finocchiaro, Gaetano; Mattei, Luca; Perin, Alessandro; Pollo, Bianca; Chen, Chu; Houck, John; Lohavanichbutr, Pawadee; Hartmann, Arndt; Stoehr, Christine; Stoehr, Robert; Taubert, Helge; Wach, Sven; Wullich, Bernd; Kycler, Witold; Murawa, Dawid; Wiznerowicz, Maciej; Chung, Ki; Edenfield, W. Jeffrey; Martin, Julie; Baudin, Eric; Bubley, Glenn; Bueno, Raphael; De Rienzo, Assunta; Richards, William G.; Kalkanis, Steven; Mikkelsen, Tom; Noushmehr, Houtan; Scarpace, Lisa; Girard, Nicolas; Aymerich, Marta; Campo, Elias; Giné, Eva; Guillermo, Armando López; Van Bang, Nguyen; Hanh, Phan Thi; Phu, Bui Duc; Tang, Yufang; Colman, Howard; Evason, Kimberley; Dottino, Peter R.; Martignetti, John A.; Gabra, Hani; Juhl, Hartmut; Akeredolu, Teniola; Stepa, Serghei; Hoon, Dave; Ahn, Keunsoo; Kang, Koo Jeong; Beuschlein, Felix; Breggia, Anne; Birrer, Michael; Bell, Debra; Borad, Mitesh; Bryce, Alan H.; Castle, Erik; Chandan, Vishal; Cheville, John; Copland, John A.; Farnell, Michael; Flotte, Thomas; Giama, Nasra; Ho, Thai; Kendrick, Michael; Kocher, Jean Pierre; Kopp, Karla; Moser, Catherine; Nagorney, David; O'Brien, Daniel; O'Neill, Brian Patrick; Patel, Tushar; Petersen, Gloria; Que, Florencia; Rivera, Michael; Roberts, Lewis; Smallridge, Robert; Smyrk, Thomas; Stanton, Melissa; Thompson, R. Houston; Torbenson, Michael; Yang, Ju Dong; Zhang, Lizhi; Brimo, Fadi; Ajani, Jaffer A.; Gonzalez, Ana Maria Angulo; Behrens, Carmen; Bondaruk, Jolanta; Broaddus, Russell; Czerniak, Bogdan; Esmaeli, Bita; Fujimoto, Junya; Gershenwald, Jeffrey; Guo, Charles; Lazar, Alexander J.; Logothetis, Christopher; Meric-Bernstam, Funda; Moran, Cesar; Ramondetta, Lois; Rice, David; Sood, Anil; Tamboli, Pheroze; Thompson, Timothy; Troncoso, Patricia; Tsao, Anne; Wistuba, Ignacio; Carter, Candace; Haydu, Lauren; Hersey, Peter; Jakrot, Valerie; Kakavand, Hojabr; Kefford, Richard; Lee, Kenneth; Long, Georgina; Mann, Graham; Quinn, Michael; Saw, Robyn; Scolyer, Richard; Shannon, Kerwin; Spillane, Andrew; Stretch, Jonathan; Synott, Maria; Thompson, John; Wilmott, James; Al-Ahmadie, Hikmat; Chan, Timothy A.; Ghossein, Ronald; Gopalan, Anuradha; Levine, Douglas A.; Reuter, Victor; Singer, Samuel; Singh, Bhuvanesh; Tien, Nguyen Viet; Broudy, Thomas; Mirsaidi, Cyrus; Nair, Praveen; Drwiega, Paul; Miller, Judy; Smith, Jennifer; Zaren, Howard; Park, Joong Won; Hung, Nguyen Phi; Kebebew, Electron; Linehan, W. Marston; Metwalli, Adam R.; Pacak, Karel; Pinto, Peter A.; Schiffman, Mark; Schmidt, Laura S.; Vocke, Cathy D.; Wentzensen, Nicolas; Worrell, Robert; Yang, Hannah; Moncrieff, Marc; Goparaju, Chandra; Melamed, Jonathan; Pass, Harvey; Botnariuc, Natalia; Caraman, Irina; Cernat, Mircea; Chemencedji, Inga; Clipca, Adrian; Doruc, Serghei; Gorincioi, Ghenadie; Mura, Sergiu; Pirtac, Maria; Stancul, Irina; Tcaciuc, Diana; Albert, Monique; Alexopoulou, Iakovina; Arnaout, Angel; Bartlett, John; Engel, Jay; Gilbert, Sebastien; Parfitt, Jeremy; Sekhon, Harman; Thomas, George; Rassl, Doris M.; Rintoul, Robert C.; Bifulco, Carlo; Tamakawa, Raina; Urba, Walter; Hayward, Nicholas; Timmers, Henri; Antenucci, Anna; Facciolo, Francesco; Grazi, Gianluca; Marino, Mirella; Merola, Roberta; de Krijger, Ronald; Gimenez-Roqueplo, Anne Paule; Piché, Alain; Chevalier, Simone; McKercher, Ginette; Birsoy, Kivanc; Barnett, Gene; Brewer, Cathy; Farver, Carol; Naska, Theresa; Pennell, Nathan A.; Raymond, Daniel; Schilero, Cathy; Smolenski, Kathy; Williams, Felicia; Morrison, Carl; Borgia, Jeffrey A.; Liptay, Michael J.; Pool, Mark; Seder, Christopher W.; Junker, Kerstin; Omberg, Larsson; Dinkin, Mikhail; Manikhas, George; Alvaro, Domenico; Bragazzi, Maria Consiglia; Cardinale, Vincenzo; Carpino, Guido; Gaudio, Eugenio; Chesla, David; Cottingham, Sandra; Dubina, Michael; Moiseenko, Fedor; Dhanasekaran, Renumathy; Becker, Karl Friedrich; Janssen, Klaus Peter; Slotta-Huspenina, Julia; Abdel-Rahman, Mohamed H.; Aziz, Dina; Bell, Sue; Cebulla, Colleen M.; Davis, Amy; Duell, Rebecca; Elder, J. Bradley; Hilty, Joe; Kumar, Bahavna; Lang, James; Lehman, Norman L.; Mandt, Randy; Nguyen, Phuong; Pilarski, Robert; Rai, Karan; Schoenfield, Lynn; Senecal, Kelly; Wakely, Paul; Hansen, Paul; Lechan, Ronald; Powers, James; Tischler, Arthur; Grizzle, William E.; Sexton, Katherine C.; Kastl, Alison; Henderson, Joel; Porten, Sima; Waldmann, Jens; Fassnacht, Martin; Asa, Sylvia L.; Schadendorf, Dirk; Couce, Marta; Graefen, Markus; Huland, Hartwig; Sauter, Guido; Schlomm, Thorsten; Simon, Ronald; Tennstedt, Pierre; Olabode, Oluwole; Nelson, Mark; Bathe, Oliver; Carroll, Peter R.; Chan, June M.; Disaia, Philip; Glenn, Pat; Kelley, Robin K.; Landen, Charles N.; Phillips, Joanna; Prados, Michael; Simko, Jeffry; Smith-McCune, Karen; VandenBerg, Scott; Roggin, Kevin; Fehrenbach, Ashley; Kendler, Ady; Sifri, Suzanne; Steele, Ruth; Jimeno, Antonio; Carey, Francis; Forgie, Ian; Mannelli, Massimo; Carney, Michael; Hernandez, Brenda; Campos, Benito; Herold-Mende, Christel; Jungk, Christin; Unterberg, Andreas; von Deimling, Andreas; Bossler, Aaron; Galbraith, Joseph; Jacobus, Laura; Knudson, Michael; Knutson, Tina; Ma, Deqin; Milhem, Mohammed; Sigmund, Rita; Godwin, Andrew K.; Madan, Rashna; Rosenthal, Howard G.; Adebamowo, Clement; Adebamowo, Sally N.; Boussioutas, Alex; Beer, David; Giordano, Thomas; Mes-Masson, Anne Marie; Saad, Fred; Bocklage, Therese; Landrum, Lisa; Mannel, Robert; Moore, Kathleen; Moxley, Katherine; Postier, Russel; Walker, Joan; Zuna, Rosemary; Feldman, Michael; Valdivieso, Federico; Dhir, Rajiv; Luketich, James; Pinero, Edna M.Mora; Quintero-Aguilo, Mario; Carlotti, Carlos Gilberto; Dos Santos, Jose Sebastião; Kemp, Rafael; Sankarankuty, Ajith; Tirapelli, Daniela; Catto, James; Agnew, Kathy; Swisher, Elizabeth; Creaney, Jenette; Robinson, Bruce; Shelley, Carl Simon; Godwin, Eryn M.; Kendall, Sara; Shipman, Cassaundra; Bradford, Carol; Carey, Thomas; Haddad, Andrea; Moyer, Jeffey; Peterson, Lisa; Prince, Mark; Rozek, Laura; Wolf, Gregory; Bowman, Rayleen; Fong, Kwun M.; Yang, Ian; Korst, Robert; Rathmell, W. Kimryn; Fantacone-Campbell, J. Leigh; Hooke, Jeffrey A.; Kovatich, Albert J.; Shriver, Craig D.; DiPersio, John; Drake, Bettina; Govindan, Ramaswamy; Heath, Sharon; Ley, Timothy; Van Tine, Brian; Westervelt, Peter; Rubin, Mark A.; Lee, Jung Il; Aredes, Natália D.; Mariamidze, Armaz; Stuart, Joshua M.; Hoadley, Katherine A.; Laird, Peter W.; Noushmehr, Houtan; Wiznerowicz, Maciej

    2018-01-01

    Cancer progression involves the gradual loss of a differentiated phenotype and acquisition of progenitor and stem-cell-like features. Here, we provide novel stemness indices for assessing the degree of oncogenic dedifferentiation. We used an innovative one-class logistic regression (OCLR)

  5. Identifying important nodes by adaptive LeaderRank

    Science.gov (United States)

    Xu, Shuang; Wang, Pei

    2017-03-01

    Spreading process is a common phenomenon in complex networks. Identifying important nodes in complex networks is of great significance in real-world applications. Based on the spreading process on networks, a lot of measures have been proposed to evaluate the importance of nodes. However, most of the existing measures are appropriate to static networks, which are fragile to topological perturbations. Many real-world complex networks are dynamic rather than static, meaning that the nodes and edges of such networks may change with time, which challenge numerous existing centrality measures. Based on a new weighted mechanism and the newly proposed H-index and LeaderRank (LR), this paper introduces a variant of the LR measure, called adaptive LeaderRank (ALR), which is a new member of the LR-family. Simulations on six real-world networks reveal that the new measure can well balance between prediction accuracy and robustness. More interestingly, the new measure can better adapt to the adjustment or local perturbations of network topologies, as compared with the existing measures. By discussing the detailed properties of the measures from the LR-family, we illustrate that the ALR has its competitive advantages over the other measures. The proposed algorithm enriches the measures to understand complex networks, and may have potential applications in social networks and biological systems.

  6. Identifying important motivational factors for professionals in Greek hospitals

    Science.gov (United States)

    Kontodimopoulos, Nick; Paleologou, Victoria; Niakas, Dimitris

    2009-01-01

    Background The purpose of this study was to identify important motivational factors according to the views of health-care professionals in Greek hospitals and particularly to determine if these might differ in the public and private sectors. Methods A previously developed -and validated- instrument addressing four work-related motivators (job attributes, remuneration, co-workers and achievements) was used. Three categories of health care professionals, doctors (N = 354), nurses (N = 581) and office workers (N = 418), working in public and private hospitals, participated and motivation was compared across socio-demographic and occupational variables. Results The range of reported motivational factors was mixed and Maslow's conclusions that lower level motivational factors must be met before ascending to the next level were not confirmed. The highest ranked motivator for the entire sample, and by professional subgroup, was achievements (P motivators were similar, and only one significant difference was observed, namely between doctors and nurses in respect to co-workers (P motivated by all factors significantly more than their public-hospital counterparts. Conclusion The results are in agreement with the literature which focuses attention to management approaches employing both monetary and non-monetary incentives to motivate health care workers. This study showed that intrinsic factors are particularly important and should become a target for effective employee motivation. PMID:19754968

  7. TCGA study identifies genomic features of cervical cancer

    Science.gov (United States)

    Investigators with The Cancer Genome Atlas (TCGA) Research Network have identified novel genomic and molecular characteristics of cervical cancer that will aid in subclassification of the disease and may help target therapies that are most appropriate for each patient.

  8. Identifying features of pocket parks that may be related to health promoting use

    DEFF Research Database (Denmark)

    Peschardt, Karin Kragsig; Stigsdotter, Ulrika K.; Schipperijn, Jasper

    2016-01-01

    . The results show that ‘green features’ do not seem to be of crucial importance for ‘socialising’ whereas, as expected, features promoting gathering should be prioritised. For ‘rest and restitution’, the main results show that ‘green ground cover’ and ‘enclosed green niches’ are important, while ‘disturbing......Urban green spaces have been shown to promote health and well-being and recent research indicates that the two primary potentially health promoting uses of pocket parks are ‘rest and restitution’ and ‘socialising’. The aim of this study is to identify features in pocket parks that may support...... features’ (playground, view outside park) should be avoided. The results add knowledge about the features which support the health promoting use of pocket parks to the existing body of research....

  9. Politeness as a feature: so important and so rare

    Directory of Open Access Journals (Sweden)

    Corbett, Greville G.

    2012-01-01

    Full Text Available Politeness has a major place in many languages, and is remarkably pervasive in some. Yet we rarely find respect as a morphosyntactic feature, alongside gender, person, number and case. I document this imbalance, and then ask why this is what we find.

  10. Identifying important parameters for a continuous bioscouring process

    NARCIS (Netherlands)

    Lenting, H.B.M.; Lenting, H.B.M.; Zwier, E.; Nierstrasz, Vincent

    2002-01-01

    Compared to a bioscouring process in the batch mode, a continuously operating process requires relatively short processing steps. This study focusses on minimizing the required enzymatic incubation time. It is clear that the presence of a sufficient level of surfactant is of major importance in

  11. A landscape ecology approach identifies important drivers of urban biodiversity.

    Science.gov (United States)

    Turrini, Tabea; Knop, Eva

    2015-04-01

    Cities are growing rapidly worldwide, yet a mechanistic understanding of the impact of urbanization on biodiversity is lacking. We assessed the impact of urbanization on arthropod diversity (species richness and evenness) and abundance in a study of six cities and nearby intensively managed agricultural areas. Within the urban ecosystem, we disentangled the relative importance of two key landscape factors affecting biodiversity, namely the amount of vegetated area and patch isolation. To do so, we a priori selected sites that independently varied in the amount of vegetated area in the surrounding landscape at the 500-m scale and patch isolation at the 100-m scale, and we hold local patch characteristics constant. As indicator groups, we used bugs, beetles, leafhoppers, and spiders. Compared to intensively managed agricultural ecosystems, urban ecosystems supported a higher abundance of most indicator groups, a higher number of bug species, and a lower evenness of bug and beetle species. Within cities, a high amount of vegetated area increased species richness and abundance of most arthropod groups, whereas evenness showed no clear pattern. Patch isolation played only a limited role in urban ecosystems, which contrasts findings from agro-ecological studies. Our results show that urban areas can harbor a similar arthropod diversity and abundance compared to intensively managed agricultural ecosystems. Further, negative consequences of urbanization on arthropod diversity can be mitigated by providing sufficient vegetated space in the urban area, while patch connectivity is less important in an urban context. This highlights the need for applying a landscape ecological approach to understand the mechanisms shaping urban biodiversity and underlines the potential of appropriate urban planning for mitigating biodiversity loss. © 2015 John Wiley & Sons Ltd.

  12. Identifying Features of Bodily Expression As Indicators of Emotional Experience during Multimedia Learning

    Directory of Open Access Journals (Sweden)

    Valentin Riemer

    2017-07-01

    Full Text Available The importance of emotions experienced by learners during their interaction with multimedia learning systems, such as serious games, underscores the need to identify sources of information that allow the recognition of learners’ emotional experience without interrupting the learning process. Bodily expression is gaining in attention as one of these sources of information. However, to date, the question of how bodily expression can convey different emotions has largely been addressed in research relying on acted emotion displays. Following a more contextualized approach, the present study aims to identify features of bodily expression (i.e., posture and activity of the upper body and the head that relate to genuine emotional experience during interaction with a serious game. In a multimethod approach, 70 undergraduates played a serious game relating to financial education while their bodily expression was captured using an off-the-shelf depth-image sensor (Microsoft Kinect. In addition, self-reports of experienced enjoyment, boredom, and frustration were collected repeatedly during gameplay, to address the dynamic changes in emotions occurring in educational tasks. Results showed that, firstly, the intensities of all emotions indeed changed significantly over the course of the game. Secondly, by using generalized estimating equations, distinct features of bodily expression could be identified as significant indicators for each emotion under investigation. A participant keeping their head more turned to the right was positively related to frustration being experienced, whereas keeping their head more turned to the left was positively related to enjoyment. Furthermore, having their upper body positioned more closely to the gaming screen was also positively related to frustration. Finally, increased activity of a participant’s head emerged as a significant indicator of boredom being experienced. These results confirm the value of bodily

  13. Resequencing 50 accessions of cultivated and wild rice yields markers for identifying agronomically important genes

    DEFF Research Database (Denmark)

    Xu, Xun; Liu, Xin; Ge, Song

    2012-01-01

    Rice is a staple crop that has undergone substantial phenotypic and physiological changes during domestication. Here we resequenced the genomes of 40 cultivated accessions selected from the major groups of rice and 10 accessions of their wild progenitors (Oryza rufipogon and Oryza nivara) to >15 x...... diversity in cultivated but not wild rice, which represent candidate regions selected during domestication. Some of these variants are associated with important biological features, whereas others have yet to be functionally characterized. The molecular markers we have identified should be valuable...... raw data coverage. We investigated genome-wide variation patterns in rice and obtained 6.5 million high-quality single nucleotide polymorphisms (SNPs) after excluding sites with missing data in any accession. Using these population SNP data, we identified thousands of genes with significantly lower...

  14. Automated local bright feature image analysis of nuclear protein distribution identifies changes in tissue phenotype

    International Nuclear Information System (INIS)

    Knowles, David; Sudar, Damir; Bator, Carol; Bissell, Mina

    2006-01-01

    The organization of nuclear proteins is linked to cell and tissue phenotypes. When cells arrest proliferation, undergo apoptosis, or differentiate, the distribution of nuclear proteins changes. Conversely, forced alteration of the distribution of nuclear proteins modifies cell phenotype. Immunostaining and fluorescence microscopy have been critical for such findings. However, there is an increasing need for quantitative analysis of nuclear protein distribution to decipher epigenetic relationships between nuclear structure and cell phenotype, and to unravel the mechanisms linking nuclear structure and function. We have developed imaging methods to quantify the distribution of fluorescently-stained nuclear protein NuMA in different mammary phenotypes obtained using three-dimensional cell culture. Automated image segmentation of DAPI-stained nuclei was generated to isolate thousands of nuclei from three-dimensional confocal images. Prominent features of fluorescently-stained NuMA were detected using a novel local bright feature analysis technique, and their normalized spatial density calculated as a function of the distance from the nuclear perimeter to its center. The results revealed marked changes in the distribution of the density of NuMA bright features as non-neoplastic cells underwent phenotypically normal acinar morphogenesis. In contrast, we did not detect any reorganization of NuMA during the formation of tumor nodules by malignant cells. Importantly, the analysis also discriminated proliferating non-neoplastic cells from proliferating malignant cells, suggesting that these imaging methods are capable of identifying alterations linked not only to the proliferation status but also to the malignant character of cells. We believe that this quantitative analysis will have additional applications for classifying normal and pathological tissues

  15. Automated local bright feature image analysis of nuclear proteindistribution identifies changes in tissue phenotype

    Energy Technology Data Exchange (ETDEWEB)

    Knowles, David; Sudar, Damir; Bator, Carol; Bissell, Mina

    2006-02-01

    The organization of nuclear proteins is linked to cell and tissue phenotypes. When cells arrest proliferation, undergo apoptosis, or differentiate, the distribution of nuclear proteins changes. Conversely, forced alteration of the distribution of nuclear proteins modifies cell phenotype. Immunostaining and fluorescence microscopy have been critical for such findings. However, there is an increasing need for quantitative analysis of nuclear protein distribution to decipher epigenetic relationships between nuclear structure and cell phenotype, and to unravel the mechanisms linking nuclear structure and function. We have developed imaging methods to quantify the distribution of fluorescently-stained nuclear protein NuMA in different mammary phenotypes obtained using three-dimensional cell culture. Automated image segmentation of DAPI-stained nuclei was generated to isolate thousands of nuclei from three-dimensional confocal images. Prominent features of fluorescently-stained NuMA were detected using a novel local bright feature analysis technique, and their normalized spatial density calculated as a function of the distance from the nuclear perimeter to its center. The results revealed marked changes in the distribution of the density of NuMA bright features as non-neoplastic cells underwent phenotypically normal acinar morphogenesis. In contrast, we did not detect any reorganization of NuMA during the formation of tumor nodules by malignant cells. Importantly, the analysis also discriminated proliferating non-neoplastic cells from proliferating malignant cells, suggesting that these imaging methods are capable of identifying alterations linked not only to the proliferation status but also to the malignant character of cells. We believe that this quantitative analysis will have additional applications for classifying normal and pathological tissues.

  16. Which features are important for effectiveness of sport- and health-related apps?

    NARCIS (Netherlands)

    Joan Dallinga; Marije Baart de la Faille-Deutekom; Mark Janssen; Steven Vos

    2017-01-01

    In this presentation we presented the results of expert meetings. The aim was to identify which features in sport- and health-related apps contribute to effectiveness of apps. A nominal group technique was used.

  17. Role of Importance and Distinctiveness of Semantic Features in People with Aphasia: A Replication Study

    Science.gov (United States)

    Mason-Baughman, Mary Beth; Wallace, Sarah E.

    2014-01-01

    Previous studies suggest that people with aphasia have incomplete lexical-semantic representations with decreased low-importance distinctive (LID) feature knowledge. In addition, decreased LID feature knowledge correlates with ability to discriminate among semantically related words. The current study seeks to replicate and extend previous…

  18. Sequencing of bovine herpesvirus 4 v.test strain reveals important genome features

    Directory of Open Access Journals (Sweden)

    Gillet Laurent

    2011-08-01

    Full Text Available Abstract Background Bovine herpesvirus 4 (BoHV-4 is a useful model for the human pathogenic gammaherpesviruses Epstein-Barr virus and Kaposi's Sarcoma-associated Herpesvirus. Although genome manipulations of this virus have been greatly facilitated by the cloning of the BoHV-4 V.test strain as a Bacterial Artificial Chromosome (BAC, the lack of a complete genome sequence for this strain limits its experimental use. Methods In this study, we have determined the complete sequence of BoHV-4 V.test strain by a pyrosequencing approach. Results The long unique coding region (LUR consists of 108,241 bp encoding at least 79 open reading frames and is flanked by several polyrepetitive DNA units (prDNA. As previously suggested, we showed that the prDNA unit located at the left prDNA-LUR junction (prDNA-G differs from the other prDNA units (prDNA-inner. Namely, the prDNA-G unit lacks the conserved pac-2 cleavage and packaging signal in its right terminal region. Based on the mechanisms of cleavage and packaging of herpesvirus genomes, this feature implies that only genomes bearing left and right end prDNA units are encapsulated into virions. Conclusions In this study, we have determined the complete genome sequence of the BAC-cloned BoHV-4 V.test strain and identified genome organization features that could be important in other herpesviruses.

  19. Comparative analyses of Legionella species identifies genetic features of strains causing Legionnaires' disease.

    Science.gov (United States)

    Gomez-Valero, Laura; Rusniok, Christophe; Rolando, Monica; Neou, Mario; Dervins-Ravault, Delphine; Demirtas, Jasmin; Rouy, Zoe; Moore, Robert J; Chen, Honglei; Petty, Nicola K; Jarraud, Sophie; Etienne, Jerome; Steinert, Michael; Heuner, Klaus; Gribaldo, Simonetta; Médigue, Claudine; Glöckner, Gernot; Hartland, Elizabeth L; Buchrieser, Carmen

    2014-01-01

    The genus Legionella comprises over 60 species. However, L. pneumophila and L. longbeachae alone cause over 95% of Legionnaires’ disease. To identify the genetic bases underlying the different capacities to cause disease we sequenced and compared the genomes of L. micdadei, L. hackeliae and L. fallonii (LLAP10), which are all rarely isolated from humans. We show that these Legionella species possess different virulence capacities in amoeba and macrophages, correlating with their occurrence in humans. Our comparative analysis of 11 Legionella genomes belonging to five species reveals highly heterogeneous genome content with over 60% representing species-specific genes; these comprise a complete prophage in L. micdadei, the first ever identified in a Legionella genome. Mobile elements are abundant in Legionella genomes; many encode type IV secretion systems for conjugative transfer, pointing to their importance for adaptation of the genus. The Dot/Icm secretion system is conserved, although the core set of substrates is small, as only 24 out of over 300 described Dot/Icm effector genes are present in all Legionella species. We also identified new eukaryotic motifs including thaumatin, synaptobrevin or clathrin/coatomer adaptine like domains. Legionella genomes are highly dynamic due to a large mobilome mainly comprising type IV secretion systems, while a minority of core substrates is shared among the diverse species. Eukaryotic like proteins and motifs remain a hallmark of the genus Legionella. Key factors such as proteins involved in oxygen binding, iron storage, host membrane transport and certain Dot/Icm substrates are specific features of disease-related strains.

  20. Familiarity and Within-Person Facial Variability: The Importance of the Internal and External Features.

    Science.gov (United States)

    Kramer, Robin S S; Manesi, Zoi; Towler, Alice; Reynolds, Michael G; Burton, A Mike

    2018-01-01

    As faces become familiar, we come to rely more on their internal features for recognition and matching tasks. Here, we assess whether this same pattern is also observed for a card sorting task. Participants sorted photos showing either the full face, only the internal features, or only the external features into multiple piles, one pile per identity. In Experiments 1 and 2, we showed the standard advantage for familiar faces-sorting was more accurate and showed very few errors in comparison with unfamiliar faces. However, for both familiar and unfamiliar faces, sorting was less accurate for external features and equivalent for internal and full faces. In Experiment 3, we asked whether external features can ever be used to make an accurate sort. Using familiar faces and instructions on the number of identities present, we nevertheless found worse performance for the external in comparison with the internal features, suggesting that less identity information was available in the former. Taken together, we show that full faces and internal features are similarly informative with regard to identity. In comparison, external features contain less identity information and produce worse card sorting performance. This research extends current thinking on the shift in focus, both in attention and importance, toward the internal features and away from the external features as familiarity with a face increases.

  1. Identifying the relevant features of the National Digital Cadastral Database (NDCDB) for spatial analysis by using the Delphi Technique

    Science.gov (United States)

    Halim, N. Z. A.; Sulaiman, S. A.; Talib, K.; Ng, E. G.

    2018-02-01

    This paper explains the process carried out in identifying the relevant features of the National Digital Cadastral Database (NDCDB) for spatial analysis. The research was initially a part of a larger research exercise to identify the significance of NDCDB from the legal, technical, role and land-based analysis perspectives. The research methodology of applying the Delphi technique is substantially discussed in this paper. A heterogeneous panel of 14 experts was created to determine the importance of NDCDB from the technical relevance standpoint. Three statements describing the relevant features of NDCDB for spatial analysis were established after three rounds of consensus building. It highlighted the NDCDB’s characteristics such as its spatial accuracy, functions, and criteria as a facilitating tool for spatial analysis. By recognising the relevant features of NDCDB for spatial analysis in this study, practical application of NDCDB for various analysis and purpose can be widely implemented.

  2. The value of anthropometric indices for identifying women with features of metabolic syndrome

    Science.gov (United States)

    BMI is a widely used anthropometric measure for identifying CVD and metabolic syndrome (MetS) risk. Two new anthropometric indices are A Body Shape Index (ABSI) and Body Roundness Index (BRI) that may provide better correlations to features of MetS. Methods: Subject data were obtained from 91 over...

  3. PACS administrators' and radiologists' perspective on the importance of features for PACS selection.

    Science.gov (United States)

    Joshi, Vivek; Narra, Vamsi R; Joshi, Kailash; Lee, Kyootai; Melson, David

    2014-08-01

    Picture archiving and communication systems (PACS) play a critical role in radiology. This paper presents the criteria important to PACS administrators for selecting a PACS. A set of criteria are identified and organized into an integrative hierarchical framework. Survey responses from 48 administrators are used to identify the relative weights of these criteria through an analytical hierarchy process. The five main dimensions for PACS selection in order of importance are system continuity and functionality, system performance and architecture, user interface for workflow management, user interface for image manipulation, and display quality. Among the subdimensions, the highest weights were assessed for security, backup, and continuity; tools for continuous performance monitoring; support for multispecialty images; and voice recognition/transcription. PACS administrators' preferences were generally in line with that of previously reported results for radiologists. Both groups assigned the highest priority to ensuring business continuity and preventing loss of data through features such as security, backup, downtime prevention, and tools for continuous PACS performance monitoring. PACS administrators' next high priorities were support for multispecialty images, image retrieval speeds from short-term and long-term storage, real-time monitoring, and architectural issues of compatibility and integration with other products. Thus, next to ensuring business continuity, administrators' focus was on issues that impact their ability to deliver services and support. On the other hand, radiologists gave high priorities to voice recognition, transcription, and reporting; structured reporting; and convenience and responsiveness in manipulation of images. Thus, radiologists' focus appears to be on issues that may impact their productivity, effort, and accuracy.

  4. Determining local and contextual features describing appearance of difficult to identify mitotic figures

    Science.gov (United States)

    Gandomkar, Ziba; Brennan, Patrick C.; Mello-Thoms, Claudia

    2017-03-01

    Mitotic count is helpful in determining the aggressiveness of breast cancer. In previous studies, it was shown that the agreement among pathologists for grading mitotic index is fairly modest, as mitoses have a large variety of appearances and they could be mistaken for other similar objects. In this study, we determined local and contextual features that differ significantly between easily identifiable mitoses and challenging ones. The images were obtained from the Mitosis-Atypia 2014 challenge. In total, the dataset contained 453 mitotic figures. Two pathologists annotated each mitotic figure. In case of disagreement, an opinion from a third pathologist was requested. The mitoses were grouped into three categories, those recognized as "a true mitosis" by both pathologists ,those labelled as "a true mitosis" by only one of the first two readers and also the third pathologist, and those annotated as "probably a mitosis" by all readers or the majority of them. After color unmixing, the mitoses were segmented from H channel. Shape-based features along with intensity-based and textural features were extracted from H-channel, blue ratio channel and five different color spaces. Holistic features describing each image were also considered. The Kruskal-Wallis H test was used to identify significantly different features. Multiple comparisons were done using the rank-based version of Tukey-Kramer test. The results indicated that there are local and global features which differ significantly among different groups. In addition, variations between mitoses in different groups were captured in the features from HSL and LCH color space more than other ones.

  5. The Problem of Informational Object Identification in Case of the Considerable Quantity of Identifying Features

    Directory of Open Access Journals (Sweden)

    S. D. Kulik

    2010-03-01

    Full Text Available The modification of the algorithm of identification of the informational object, used for identification of the hand-written texts performer in an automated workplace of the forensic expert, is presented. As modification, it is offered to use a method of association rules discovery for definition of statistically dependent sets of feature of hand-written capital letters of the Russian language. The algorithm is approved on set of 691 samples of hand-written documents for which about 2000 identifying feature are defined. The modification of the identification algorithm allows to lower level of errors and to raise quality of accepted decisions for information security.

  6. NIMEFI: gene regulatory network inference using multiple ensemble feature importance algorithms.

    Directory of Open Access Journals (Sweden)

    Joeri Ruyssinck

    Full Text Available One of the long-standing open challenges in computational systems biology is the topology inference of gene regulatory networks from high-throughput omics data. Recently, two community-wide efforts, DREAM4 and DREAM5, have been established to benchmark network inference techniques using gene expression measurements. In these challenges the overall top performer was the GENIE3 algorithm. This method decomposes the network inference task into separate regression problems for each gene in the network in which the expression values of a particular target gene are predicted using all other genes as possible predictors. Next, using tree-based ensemble methods, an importance measure for each predictor gene is calculated with respect to the target gene and a high feature importance is considered as putative evidence of a regulatory link existing between both genes. The contribution of this work is twofold. First, we generalize the regression decomposition strategy of GENIE3 to other feature importance methods. We compare the performance of support vector regression, the elastic net, random forest regression, symbolic regression and their ensemble variants in this setting to the original GENIE3 algorithm. To create the ensemble variants, we propose a subsampling approach which allows us to cast any feature selection algorithm that produces a feature ranking into an ensemble feature importance algorithm. We demonstrate that the ensemble setting is key to the network inference task, as only ensemble variants achieve top performance. As second contribution, we explore the effect of using rankwise averaged predictions of multiple ensemble algorithms as opposed to only one. We name this approach NIMEFI (Network Inference using Multiple Ensemble Feature Importance algorithms and show that this approach outperforms all individual methods in general, although on a specific network a single method can perform better. An implementation of NIMEFI has been made

  7. Identifying prognostic features by bottom-up approach and correlating to drug repositioning.

    Directory of Open Access Journals (Sweden)

    Wei Li

    Full Text Available Traditionally top-down method was used to identify prognostic features in cancer research. That is to say, differentially expressed genes usually in cancer versus normal were identified to see if they possess survival prediction power. The problem is that prognostic features identified from one set of patient samples can rarely be transferred to other datasets. We apply bottom-up approach in this study: survival correlated or clinical stage correlated genes were selected first and prioritized by their network topology additionally, then a small set of features can be used as a prognostic signature.Gene expression profiles of a cohort of 221 hepatocellular carcinoma (HCC patients were used as a training set, 'bottom-up' approach was applied to discover gene-expression signatures associated with survival in both tumor and adjacent non-tumor tissues, and compared with 'top-down' approach. The results were validated in a second cohort of 82 patients which was used as a testing set.Two sets of gene signatures separately identified in tumor and adjacent non-tumor tissues by bottom-up approach were developed in the training cohort. These two signatures were associated with overall survival times of HCC patients and the robustness of each was validated in the testing set, and each predictive performance was better than gene expression signatures reported previously. Moreover, genes in these two prognosis signature gave some indications for drug-repositioning on HCC. Some approved drugs targeting these markers have the alternative indications on hepatocellular carcinoma.Using the bottom-up approach, we have developed two prognostic gene signatures with a limited number of genes that associated with overall survival times of patients with HCC. Furthermore, prognostic markers in these two signatures have the potential to be therapeutic targets.

  8. Identifying Trajectories of Borderline Personality Features in Adolescence: Antecedent and Interactive Risk Factors.

    Science.gov (United States)

    Haltigan, John D; Vaillancourt, Tracy

    2016-03-01

    To examine trajectories of adolescent borderline personality (BP) features in a normative-risk cohort (n = 566) of Canadian children assessed at ages 13, 14, 15, and 16 and childhood predictors of trajectory group membership assessed at ages 8, 10, 11, and 12. Data were drawn from the McMaster Teen Study, an on-going study examining relations among bullying, mental health, and academic achievement. Participants and their parents completed a battery of mental health and peer relations questionnaires at each wave of the study. Academic competence was assessed at age 8 (Grade 3). Latent class growth analysis, analysis of variance, and logistic regression were used to analyze the data. Three distinct BP features trajectory groups were identified: elevated or rising, intermediate or stable, and low or stable. Parent- and child-reported mental health symptoms, peer relations risk factors, and intra-individual risk factors were significant predictors of elevated or rising and intermediate or stable trajectory groups. Child-reported attention-deficit hyperactivity disorder (ADHD) and somatization symptoms uniquely predicted elevated or rising trajectory group membership, whereas parent-reported anxiety and child-reported ADHD symptoms uniquely predicted intermediate or stable trajectory group membership. Child-reported somatization symptoms was the only predictor to differentiate the intermediate or stable and elevated or rising trajectory groups (OR 1.15, 95% CI 1.04 to 1.28). Associations between child-reported reactive temperament and elevated BP features trajectory group membership were 10.23 times higher among children who were bullied, supporting a diathesis-stress pathway in the development of BP features for these youth. Findings demonstrate the heterogeneous course of BP features in early adolescence and shed light on the potential prodromal course of later borderline personality disorder. © The Author(s) 2015.

  9. kmer-SVM: a web server for identifying predictive regulatory sequence features in genomic data sets

    Science.gov (United States)

    Fletez-Brant, Christopher; Lee, Dongwon; McCallion, Andrew S.; Beer, Michael A.

    2013-01-01

    Massively parallel sequencing technologies have made the generation of genomic data sets a routine component of many biological investigations. For example, Chromatin immunoprecipitation followed by sequence assays detect genomic regions bound (directly or indirectly) by specific factors, and DNase-seq identifies regions of open chromatin. A major bottleneck in the interpretation of these data is the identification of the underlying DNA sequence code that defines, and ultimately facilitates prediction of, these transcription factor (TF) bound or open chromatin regions. We have recently developed a novel computational methodology, which uses a support vector machine (SVM) with kmer sequence features (kmer-SVM) to identify predictive combinations of short transcription factor-binding sites, which determine the tissue specificity of these genomic assays (Lee, Karchin and Beer, Discriminative prediction of mammalian enhancers from DNA sequence. Genome Res. 2011; 21:2167–80). This regulatory information can (i) give confidence in genomic experiments by recovering previously known binding sites, and (ii) reveal novel sequence features for subsequent experimental testing of cooperative mechanisms. Here, we describe the development and implementation of a web server to allow the broader research community to independently apply our kmer-SVM to analyze and interpret their genomic datasets. We analyze five recently published data sets and demonstrate how this tool identifies accessory factors and repressive sequence elements. kmer-SVM is available at http://kmersvm.beerlab.org. PMID:23771147

  10. Feature genes in metastatic breast cancer identified by MetaDE and SVM classifier methods.

    Science.gov (United States)

    Tuo, Youlin; An, Ning; Zhang, Ming

    2018-03-01

    The aim of the present study was to investigate the feature genes in metastatic breast cancer samples. A total of 5 expression profiles of metastatic breast cancer samples were downloaded from the Gene Expression Omnibus database, which were then analyzed using the MetaQC and MetaDE packages in R language. The feature genes between metastasis and non‑metastasis samples were screened under the threshold of PSVM) classifier training and verification. The accuracy of the SVM classifier was then evaluated using another independent dataset from The Cancer Genome Atlas database. Finally, function and pathway enrichment analyses for genes in the SVM classifier were performed. A total of 541 feature genes were identified between metastatic and non‑metastatic samples. The top 10 genes with the highest betweenness centrality values in the PPI network of feature genes were Nuclear RNA Export Factor 1, cyclin‑dependent kinase 2 (CDK2), myelocytomatosis proto‑oncogene protein (MYC), Cullin 5, SHC Adaptor Protein 1, Clathrin heavy chain, Nucleolin, WD repeat domain 1, proteasome 26S subunit non‑ATPase 2 and telomeric repeat binding factor 2. The cyclin‑dependent kinase inhibitor 1A (CDKN1A), E2F transcription factor 1 (E2F1), and MYC interacted with CDK2. The SVM classifier constructed by the top 30 feature genes was able to distinguish metastatic samples from non‑metastatic samples [correct rate, specificity, positive predictive value and negative predictive value >0.89; sensitivity >0.84; area under the receiver operating characteristic curve (AUROC) >0.96]. The verification of the SVM classifier in an independent dataset (35 metastatic samples and 143 non‑metastatic samples) revealed an accuracy of 94.38% and AUROC of 0.958. Cell cycle associated functions and pathways were the most significant terms of the 30 feature genes. A SVM classifier was constructed to assess the possibility of breast cancer metastasis, which presented high accuracy in several

  11. Methodology for identifying boundaries of systems important to safety in CANDU nuclear power plants

    International Nuclear Information System (INIS)

    Therrien, S.; Komljenovic, D.; Therrien, P.; Ruest, C.; Prevost, P.; Vaillancourt, R.

    2007-01-01

    This paper presents a methodology developed to identify the boundaries of the systems important to safety (SIS) at the Gentilly-2 Nuclear Power Plant (NPP), Hydro-Quebec. The SIS boundaries identification considers nuclear safety only. Components that are not identified as important to safety are systematically identified as related to safety. A global assessment process such as WANO/INPO AP-913 'Equipment Reliability Process' will be needed to implement adequate changes in the management rules of those components. The paper depicts results in applying the methodology to the Shutdown Systems 1 and 2 (SDS 1, 2), and to the Emergency Core Cooling System (ECCS). This validation process enabled fine tuning the methodology, performing a better estimate of the effort required to evaluate a system, and identifying components important to safety of these systems. (author)

  12. SoftSearch: integration of multiple sequence features to identify breakpoints of structural variations.

    Directory of Open Access Journals (Sweden)

    Steven N Hart

    Full Text Available BACKGROUND: Structural variation (SV represents a significant, yet poorly understood contribution to an individual's genetic makeup. Advanced next-generation sequencing technologies are widely used to discover such variations, but there is no single detection tool that is considered a community standard. In an attempt to fulfil this need, we developed an algorithm, SoftSearch, for discovering structural variant breakpoints in Illumina paired-end next-generation sequencing data. SoftSearch combines multiple strategies for detecting SV including split-read, discordant read-pair, and unmated pairs. Co-localized split-reads and discordant read pairs are used to refine the breakpoints. RESULTS: We developed and validated SoftSearch using real and synthetic datasets. SoftSearch's key features are 1 not requiring secondary (or exhaustive primary alignment, 2 portability into established sequencing workflows, and 3 is applicable to any DNA-sequencing experiment (e.g. whole genome, exome, custom capture, etc.. SoftSearch identifies breakpoints from a small number of soft-clipped bases from split reads and a few discordant read-pairs which on their own would not be sufficient to make an SV call. CONCLUSIONS: We show that SoftSearch can identify more true SVs by combining multiple sequence features. SoftSearch was able to call clinically relevant SVs in the BRCA2 gene not reported by other tools while offering significantly improved overall performance.

  13. Modeling vehicle emissions in different types of Chinese cities: Importance of vehicle fleet and local features

    International Nuclear Information System (INIS)

    Huo Hong; Zhang Qiang; He Kebin; Yao Zhiliang; Wang Xintong; Zheng Bo; Streets, David G.; Wang Qidong; Ding Yan

    2011-01-01

    We propose a method to simulate vehicle emissions in Chinese cities of different sizes and development stages. Twenty two cities are examined in this study. The target year is 2007. Among the cities, the vehicle emission factors were remarkably different (the highest is 50-90% higher than the lowest) owing to their distinct local features and vehicle technology levels, and the major contributors to total vehicle emissions were also different. A substantial increase in vehicle emissions is foreseeable unless stronger measures are implemented because the benefit of current policies can be quickly offset by the vehicle growth. Major efforts should be focused on all cities, especially developing cities where the requirements are lenient. This work aims a better understanding of vehicle emissions in all types of Chinese cities. The proposed method could benefit national emission inventory studies in improving accuracy and help in designing national and local policies for vehicle emission control. - Highlights: → We examine vehicle emissions in 22 Chinese cities of different types and locations. → Vehicle emission factors of the cities differ by 50-90% due to distinct local features. → Each vehicle type contributes differently to total emissions among the cities. → A substantial increase in vehicle emissions in most Chinese cities is foreseeable. → City-specific fleet and local features are important in research and policy making. - Vehicle emission characteristics of Chinese cities are remarkably different, and local features need to be taken into account in vehicle emission studies and control strategy.

  14. Genes Important for Schizosaccharomyces pombe Meiosis Identified Through a Functional Genomics Screen

    Science.gov (United States)

    Blyth, Julie; Makrantoni, Vasso; Barton, Rachael E.; Spanos, Christos; Rappsilber, Juri; Marston, Adele L.

    2018-01-01

    Meiosis is a specialized cell division that generates gametes, such as eggs and sperm. Errors in meiosis result in miscarriages and are the leading cause of birth defects; however, the molecular origins of these defects remain unknown. Studies in model organisms are beginning to identify the genes and pathways important for meiosis, but the parts list is still poorly defined. Here we present a comprehensive catalog of genes important for meiosis in the fission yeast, Schizosaccharomyces pombe. Our genome-wide functional screen surveyed all nonessential genes for roles in chromosome segregation and spore formation. Novel genes important at distinct stages of the meiotic chromosome segregation and differentiation program were identified. Preliminary characterization implicated three of these genes in centrosome/spindle pole body, centromere, and cohesion function. Our findings represent a near-complete parts list of genes important for meiosis in fission yeast, providing a valuable resource to advance our molecular understanding of meiosis. PMID:29259000

  15. Identifying predictive features in drug response using machine learning: opportunities and challenges.

    Science.gov (United States)

    Vidyasagar, Mathukumalli

    2015-01-01

    This article reviews several techniques from machine learning that can be used to study the problem of identifying a small number of features, from among tens of thousands of measured features, that can accurately predict a drug response. Prediction problems are divided into two categories: sparse classification and sparse regression. In classification, the clinical parameter to be predicted is binary, whereas in regression, the parameter is a real number. Well-known methods for both classes of problems are briefly discussed. These include the SVM (support vector machine) for classification and various algorithms such as ridge regression, LASSO (least absolute shrinkage and selection operator), and EN (elastic net) for regression. In addition, several well-established methods that do not directly fall into machine learning theory are also reviewed, including neural networks, PAM (pattern analysis for microarrays), SAM (significance analysis for microarrays), GSEA (gene set enrichment analysis), and k-means clustering. Several references indicative of the application of these methods to cancer biology are discussed.

  16. Human body as a set of biometric features identified by means of optoelectronics

    Science.gov (United States)

    Podbielska, Halina; Bauer, Joanna

    2005-09-01

    Human body posses many unique, singular features that are impossible to copy or forge. Nowadays, to establish and to ensure the public security requires specially designed devices and systems. Biometrics is a field of science and technology, exploiting human body characteristics for people recognition. It identifies the most characteristic and unique ones in order to design and construct systems capable to recognize people. In this paper some overview is given, presenting the achievements in biometrics. The verification and identification process is explained, along with the way of evaluation of biometric recognition systems. The most frequently human biometrics used in practice are shortly presented, including fingerprints, facial imaging (including thermal characteristic), hand geometry and iris patterns.

  17. Nonlinear features identified by Volterra series for damage detection in a buckled beam

    Directory of Open Access Journals (Sweden)

    Shiki S. B.

    2014-01-01

    Full Text Available The present paper proposes a new index for damage detection based on nonlinear features extracted from prediction errors computed by multiple convolutions using the discrete-time Volterra series. A reference Volterra model is identified with data in the healthy condition and used for monitoring the system operating with linear or nonlinear behavior. When the system has some structural change, possibly associated with damage, the index metrics computed could give an alert to separate the linear and nonlinear contributions, besides provide a diagnostic about the structural state. To show the applicability of the method, an experimental test is performed using nonlinear vibration signals measured in a clamped buckled beam subject to different levels of force applied and with simulated damages through discontinuities inserted in the beam surface.

  18. Identifying persistent and characteristic features in firearm tool marks on cartridge cases

    Science.gov (United States)

    Ott, Daniel; Soons, Johannes; Thompson, Robert; Song, John

    2017-12-01

    Recent concerns about subjectivity in forensic firearm identification have motivated the development of algorithms to compare firearm tool marks that are imparted on ammunition and to generate quantitative measures of similarity. In this paper, we describe an algorithm that identifies impressed tool marks on a cartridge case that are both consistent between firings and contribute strongly to a surface similarity metric. The result is a representation of the tool mark topography that emphasizes both significant and persistent features across firings. This characteristic surface map is useful for understanding the variability and persistence of the tool marks created by a firearm and can provide improved discrimination between the comparison scores of samples fired from the same firearm and the scores of samples fired from different firearms. The algorithm also provides a convenient method for visualizing areas of similarity that may be useful in providing quantitative support for visual comparisons by trained examiners.

  19. Integrated genomics identifies five medulloblastoma subtypes with distinct genetic profiles, pathway signatures and clinicopathological features.

    Directory of Open Access Journals (Sweden)

    Marcel Kool

    Full Text Available BACKGROUND: Medulloblastoma is the most common malignant brain tumor in children. Despite recent improvements in cure rates, prediction of disease outcome remains a major challenge and survivors suffer from serious therapy-related side-effects. Recent data showed that patients with WNT-activated tumors have a favorable prognosis, suggesting that these patients could be treated less intensively, thereby reducing the side-effects. This illustrates the potential benefits of a robust classification of medulloblastoma patients and a detailed knowledge of associated biological mechanisms. METHODS AND FINDINGS: To get a better insight into the molecular biology of medulloblastoma we established mRNA expression profiles of 62 medulloblastomas and analyzed 52 of them also by comparative genomic hybridization (CGH arrays. Five molecular subtypes were identified, characterized by WNT signaling (A; 9 cases, SHH signaling (B; 15 cases, expression of neuronal differentiation genes (C and D; 16 and 11 cases, respectively or photoreceptor genes (D and E; both 11 cases. Mutations in beta-catenin were identified in all 9 type A tumors, but not in any other tumor. PTCH1 mutations were exclusively identified in type B tumors. CGH analysis identified several fully or partly subtype-specific chromosomal aberrations. Monosomy of chromosome 6 occurred only in type A tumors, loss of 9q mostly occurred in type B tumors, whereas chromosome 17 aberrations, most common in medulloblastoma, were strongly associated with type C or D tumors. Loss of the inactivated X-chromosome was highly specific for female cases of type C, D and E tumors. Gene expression levels faithfully reflected the chromosomal copy number changes. Clinicopathological features significantly different between the 5 subtypes included metastatic disease and age at diagnosis and histology. Metastatic disease at diagnosis was significantly associated with subtypes C and D and most strongly with subtype E

  20. Radiometric monitoring of contaminated scrap metals imported in Italy. Technical and regulatory features

    International Nuclear Information System (INIS)

    Dobici, F.; Piermattei, S.; Susanna, A.

    1996-01-01

    During these last ten years there have been occasional reports of mishaps from trafficking of contaminated scraps or containing radioactive sources. Recently an increase of events indicated that the problem becomes more important as to generate possible consequences, from a radiation protection standpoint, for workers and general public. Following the detection of contaminated metal scraps in some recycling industries and in some consignments entering the Italian borders, the competent Authorities laid down rules to put the matter under control. In this paper technical and regulatory features are discussed. (author)

  1. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C. dubliniensis.

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, P.H.M.

    2003-01-01

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  2. Reducing uncertainty at minimal cost: a method to identify important input parameters and prioritize data collection

    NARCIS (Netherlands)

    Uwizeye, U.A.; Groen, E.A.; Gerber, P.J.; Schulte, Rogier P.O.; Boer, de I.J.M.

    2016-01-01

    The study aims to illustrate a method to identify important input parameters that explain most of the output variance ofenvironmental assessment models. The method is tested for the computation of life-cycle nitrogen (N) use efficiencyindicators among mixed dairy production systems in Rwanda. We

  3. A comparison of random forest and its Gini importance with standard chemometric methods for the feature selection and classification of spectral data

    Directory of Open Access Journals (Sweden)

    Himmelreich Uwe

    2009-07-01

    Full Text Available Abstract Background Regularized regression methods such as principal component or partial least squares regression perform well in learning tasks on high dimensional spectral data, but cannot explicitly eliminate irrelevant features. The random forest classifier with its associated Gini feature importance, on the other hand, allows for an explicit feature elimination, but may not be optimally adapted to spectral data due to the topology of its constituent classification trees which are based on orthogonal splits in feature space. Results We propose to combine the best of both approaches, and evaluated the joint use of a feature selection based on a recursive feature elimination using the Gini importance of random forests' together with regularized classification methods on spectral data sets from medical diagnostics, chemotaxonomy, biomedical analytics, food science, and synthetically modified spectral data. Here, a feature selection using the Gini feature importance with a regularized classification by discriminant partial least squares regression performed as well as or better than a filtering according to different univariate statistical tests, or using regression coefficients in a backward feature elimination. It outperformed the direct application of the random forest classifier, or the direct application of the regularized classifiers on the full set of features. Conclusion The Gini importance of the random forest provided superior means for measuring feature relevance on spectral data, but – on an optimal subset of features – the regularized classifiers might be preferable over the random forest classifier, in spite of their limitation to model linear dependencies only. A feature selection based on Gini importance, however, may precede a regularized linear classification to identify this optimal subset of features, and to earn a double benefit of both dimensionality reduction and the elimination of noise from the classification task.

  4. Estimation of minimum sample size for identification of the most important features: a case study providing a qualitative B2B sales data set

    Directory of Open Access Journals (Sweden)

    Marko Bohanec

    2017-01-01

    Full Text Available An important task in machine learning is to reduce data set dimensionality, which in turn contributes to reducing computational load and data collection costs, while improving human understanding and interpretation of models. We introduce an operational guideline for determining the minimum number of instances sufficient to identify correct ranks of features with the highest impact. We conduct tests based on qualitative B2B sales forecasting data. The results show that a relatively small instance subset is sufficient for identifying the most important features when rank is not important.

  5. Study of a methodology of identifying important research problems by the PIRT process

    International Nuclear Information System (INIS)

    Aoki, Takayuki; Takagi, Toshiyuki; Urayama, Ryoichi; Komura, Ichiro; Furukawa, Takashi; Yusa, Noritaka

    2014-01-01

    In this paper, we propose a new methodology of identifying important research problems to be solved to improve the performance of some specific scientific technologies by the phenomena identification and ranking table (PIRT) process which has been used as a methodology for demonstrating the validity of the best estimate simulation codes in US Nuclear Regulatory Commission (USNRC) licensing of nuclear power plants. The new methodology makes it possible to identify important factors affecting the performance of the technologies from the viewpoint of the figure of merit and problems associated with them while it keeps the fundamental concepts of the original PIRT process. Also in this paper, we demonstrate the effectiveness of the new methodology by applying it to a task of extracting research problems for improving an inspection accuracy of ultrasonic testing or eddy current testing in the inspection of objects having cracks due to fatigue or stress corrosion cracking. (author)

  6. Study of a methodology of identifying important research problems by the PIRT process

    International Nuclear Information System (INIS)

    Aoki, Takayuki; Takagi, Toshiyuki; Urayama, Ryoichi; Komura, Ichiro; Furukawa, Takashi; Yusa, Noritaka

    2013-01-01

    In this paper, we propose a new methodology of identifying important research problems to be solved to improve the performance of some specific scientific technologies by the phenomena identification and ranking table (PIRT) process, which has been used as a methodology for demonstrating the validity of the best estimate simulation codes in USNRC licensing of nuclear power plants. It keeps the fundamental concepts of the original PIRT process but makes it possible to identify important factors affecting the performance of the technologies from the viewpoint of the figure of merit and problems associated with them, which need to be solved to improve the performance. Also in this paper, we demonstrate the effectiveness of the developed method by showing a specific example of the application to physical events or phenomena in objects having fatigue or SCC crack(s) under ultrasonic testing and eddy current testing. (author)

  7. Blood Falls: A novel management approach for a subglacial feature of outstanding scientific importance

    Science.gov (United States)

    Carr, J. R.; Penhale, P. A.; Dahood, A.; Biletnikoff, N.; Harris, C. M.

    2012-04-01

    Blood Falls is a subglacial feature located in the ablation zone of the Taylor Glacier, Taylor Valley, McMurdo Dry Valleys, Antarctica. Blood Falls has a unique physical configuration, microbial ecology and geochemistry and consists of a subglacial brine reservoir and an iron-rich, saline surface discharge at the Taylor Glacier terminus. The feature provides a rare opportunity to sample properties of a subglacial reservoir and its ecosystem without the need for direct contact and is a key site for exobiological studies. The Blood Falls subglacial feature is globally unique and of outstanding scientific importance. As such, it warrants special protection from potential damage by drilling and/or surface activities. Moreover, currently subglacial environments are not represented in the Antarctic protected area network. To address these points, the United States National Science Foundation is working with the scientific community to develop at Blood Falls the first subglacial protected area in Antarctica. The protected area aims to maintain the integrity of the Blood Falls system, whilst allowing continued access for scientific and management purposes. Novel management approaches are being designed to protect the values of the site in three dimensions. Specific guidelines on activities conducted within the area, most notably drilling and coring, are being defined in a management plan. This new approach incorporates uncertainties in the location of the Blood Falls brine reservoir and the connectivity of the subglacial hydrological system of the Taylor Glacier. The management approaches employed at Blood Falls draw on the experience of the subglacial research community and potentially offer an effective framework for the protection of other subglacial environments.

  8. Comparison of Cytotoxic Activity in Leukemic Lineages Reveals Important Features of β-Hairpin Antimicrobial Peptides.

    Science.gov (United States)

    Buri, Marcus V; Torquato, Heron F Vieira; Barros, Carlos Castilho; Ide, Jaime S; Miranda, Antonio; Paredes-Gamero, Edgar J

    2017-07-01

    Several reports described different modes of cell death triggered by antimicrobial peptides (AMPs) due to direct effects on membrane disruption, and more recently by apoptosis and necrosis-like patterns. Cytotoxic curves of four β-hairpin AMPs (gomesin, protegrin, tachyplesin, and polyphemusin) were obtained from several human leukemic lineages and normal monocytes and Two cell lines were then selected based on their cytotoxic sensitivity. One was sensitive to AMPs (K562) and the other resistant (KG-1) and their effect compared between these lineages. Thus, these lineages were chosen to further investigate biological features related with their cytotoxicities to AMPs. Stimulation with AMPs produced cell death, with activation of caspase-3, in K562 lineage. Increase on the fluidity of plasmatic membrane by reducing cholesterol potentiated cytotoxicity of AMPs in both lineages. Quantification of internal and external gomesin binding to the cellular membrane of both K562 and KG-1 cells showed that more peptide is accumulated inside of K562 cells. Additionally, evaluation of multi-drug resistant pumps activity showed that KG-1 has more activity than K562 lineage. A comparison of intrinsic gene patterns showed great differences between K562 and KG-1, but stimulation with gomesin promoted few changes in gene expression patterns. Differences in internalization process through the plasma membrane, multidrug resistance pumps activity, and gene expression pattern are important features to AMPs regulated cell death. J. Cell. Biochem. 118: 1764-1773, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  9. What vehicle features are considered important when buying an automobile? An examination of driver preferences by age and gender.

    Science.gov (United States)

    Vrkljan, Brenda H; Anaby, Dana

    2011-02-01

    Certain vehicle features can help drivers avoid collisions and/or protect occupants in the event of a crash, and therefore, might play an important role when deciding which vehicle to purchase. The objective of this study was to examine the importance attributed to key vehicle features (including safety) that drivers consider when buying a car and its association with age and gender. A sample of 2,002 Canadian drivers aged 18 years and older completed a survey that asked them to rank the importance of eight vehicle features if they were to purchase a vehicle (storage, mileage, safety, price, comfort, performance, design, and reliability). ANOVA tests were performed to: (a) determine if there were differences in the level of importance between features and; (b) examine the effect of age and gender on the importance attributed to these features. Of the features examined, safety and reliability were the most highly rated in terms of importance, whereas design and performance had the lowest rating. Differences in safety and performance across age groups were dependent on gender. This effect was most evident in the youngest and oldest age groups. Safety and reliability were considered the most important features. Age and gender play a significant role in explaining the importance of certain features. Targeted efforts for translating safety-related information to the youngest and oldest consumers should be emphasized due to their high collision, injury, and fatality rates. Copyright © 2011 National Safety Council and Elsevier Ltd. All rights reserved.

  10. Gene expression profiling identifies inflammation and angiogenesis as distinguishing features of canine hemangiosarcoma

    International Nuclear Information System (INIS)

    Tamburini, Beth A; Cutter, Gary R; Wojcieszyn, John W; Bellgrau, Donald; Gemmill, Robert M; Hunter, Lawrence E; Modiano, Jaime F; Phang, Tzu L; Fosmire, Susan P; Scott, Milcah C; Trapp, Susan C; Duckett, Megan M; Robinson, Sally R; Slansky, Jill E; Sharkey, Leslie C

    2010-01-01

    The etiology of hemangiosarcoma remains incompletely understood. Its common occurrence in dogs suggests predisposing factors favor its development in this species. These factors could represent a constellation of heritable characteristics that promote transformation events and/or facilitate the establishment of a microenvironment that is conducive for survival of malignant blood vessel-forming cells. The hypothesis for this study was that characteristic molecular features distinguish hemangiosarcoma from non-malignant endothelial cells, and that such features are informative for the etiology of this disease. We first investigated mutations of VHL and Ras family genes that might drive hemangiosarcoma by sequencing tumor DNA and mRNA (cDNA). Protein expression was examined using immunostaining. Next, we evaluated genome-wide gene expression profiling using the Affymetrix Canine 2.0 platform as a global approach to test the hypothesis. Data were evaluated using routine bioinformatics and validation was done using quantitative real time RT-PCR. Each of 10 tumor and four non-tumor samples analyzed had wild type sequences for these genes. At the genome wide level, hemangiosarcoma cells clustered separately from non-malignant endothelial cells based on a robust signature that included genes involved in inflammation, angiogenesis, adhesion, invasion, metabolism, cell cycle, signaling, and patterning. This signature did not simply reflect a cancer-associated angiogenic phenotype, as it also distinguished hemangiosarcoma from non-endothelial, moderately to highly angiogenic bone marrow-derived tumors (lymphoma, leukemia, osteosarcoma). The data show that inflammation and angiogenesis are important processes in the pathogenesis of vascular tumors, but a definitive ontogeny of the cells that give rise to these tumors remains to be established. The data do not yet distinguish whether functional or ontogenetic plasticity creates this phenotype, although they suggest that cells

  11. Gene expression profiling identifies inflammation and angiogenesis as distinguishing features of canine hemangiosarcoma

    Directory of Open Access Journals (Sweden)

    Slansky Jill E

    2010-11-01

    Full Text Available Abstract Background The etiology of hemangiosarcoma remains incompletely understood. Its common occurrence in dogs suggests predisposing factors favor its development in this species. These factors could represent a constellation of heritable characteristics that promote transformation events and/or facilitate the establishment of a microenvironment that is conducive for survival of malignant blood vessel-forming cells. The hypothesis for this study was that characteristic molecular features distinguish hemangiosarcoma from non-malignant endothelial cells, and that such features are informative for the etiology of this disease. Methods We first investigated mutations of VHL and Ras family genes that might drive hemangiosarcoma by sequencing tumor DNA and mRNA (cDNA. Protein expression was examined using immunostaining. Next, we evaluated genome-wide gene expression profiling using the Affymetrix Canine 2.0 platform as a global approach to test the hypothesis. Data were evaluated using routine bioinformatics and validation was done using quantitative real time RT-PCR. Results Each of 10 tumor and four non-tumor samples analyzed had wild type sequences for these genes. At the genome wide level, hemangiosarcoma cells clustered separately from non-malignant endothelial cells based on a robust signature that included genes involved in inflammation, angiogenesis, adhesion, invasion, metabolism, cell cycle, signaling, and patterning. This signature did not simply reflect a cancer-associated angiogenic phenotype, as it also distinguished hemangiosarcoma from non-endothelial, moderately to highly angiogenic bone marrow-derived tumors (lymphoma, leukemia, osteosarcoma. Conclusions The data show that inflammation and angiogenesis are important processes in the pathogenesis of vascular tumors, but a definitive ontogeny of the cells that give rise to these tumors remains to be established. The data do not yet distinguish whether functional or ontogenetic

  12. On the importance of identifying, characterizing, and predicting fundamental phenomena towards microbial electrochemistry applications.

    Science.gov (United States)

    Torres, César Iván

    2014-06-01

    The development of microbial electrochemistry research toward technological applications has increased significantly in the past years, leading to many process configurations. This short review focuses on the need to identify and characterize the fundamental phenomena that control the performance of microbial electrochemical cells (MXCs). Specifically, it discusses the importance of recent efforts to discover and characterize novel microorganisms for MXC applications, as well as recent developments to understand transport limitations in MXCs. As we increase our understanding of how MXCs operate, it is imperative to continue modeling efforts in order to effectively predict their performance, design efficient MXC technologies, and implement them commercially. Thus, the success of MXC technologies largely depends on the path of identifying, understanding, and predicting fundamental phenomena that determine MXC performance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. The Diagnostic importance of clinical and radiologic features of the Multiple Cemento-osseous dysplasia

    International Nuclear Information System (INIS)

    Han, M. R.; Kim, Y. H.; Kang, B. C.

    1998-01-01

    This case was diagnosed as multiple cementoosseous dysplasia on the basis of clinical and radiological features but was diagnosed as ossifying fibroma on the basis of histopathological feature. The histopathologic features of the multiple cementoosseous dysplasia and cementoossifying fibroma have common features of cementum, fibrous network and bone. Multiple cementoosseous dysplasia is reactive lesion and shows restricted lesion size, occurred on anterior and posterior tooth of the mandible and needs no treatment except periodic follow up. But Cementoossifying fibroma is the true neoplasm and grows continuously and needs surgical removal. The final diagnosis of the multiple cementoosseous dysplasia requires good correlation of the clinical histopathological, and radiological features.

  14. Statistical Analyses of Scatterplots to Identify Important Factors in Large-Scale Simulations

    Energy Technology Data Exchange (ETDEWEB)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-04-01

    The robustness of procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses is investigated. These procedures are based on attempts to detect increasingly complex patterns in the scatterplots under consideration and involve the identification of (1) linear relationships with correlation coefficients, (2) monotonic relationships with rank correlation coefficients, (3) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (4) trends in variability as defined by variances and interquartile ranges, and (5) deviations from randomness as defined by the chi-square statistic. The following two topics related to the robustness of these procedures are considered for a sequence of example analyses with a large model for two-phase fluid flow: the presence of Type I and Type II errors, and the stability of results obtained with independent Latin hypercube samples. Observations from analysis include: (1) Type I errors are unavoidable, (2) Type II errors can occur when inappropriate analysis procedures are used, (3) physical explanations should always be sought for why statistical procedures identify variables as being important, and (4) the identification of important variables tends to be stable for independent Latin hypercube samples.

  15. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae

    Directory of Open Access Journals (Sweden)

    Seong Hwan Park

    2013-01-01

    Full Text Available Identifying species of insects used to estimate postmortem interval (PMI is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science.

  16. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae)

    Science.gov (United States)

    Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon

    2013-01-01

    Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044

  17. Identifying the Minimum Model Features to Replicate Historic Morphodynamics of a Juvenile Delta

    Science.gov (United States)

    Czapiga, M. J.; Parker, G.

    2017-12-01

    We introduce a quasi-2D morphodynamic delta model that improves on past models that require many simplifying assumptions, e.g. a single channel representative of a channel network, fixed channel width, and spatially uniform deposition. Our model is useful for studying long-term progradation rates of any generic micro-tidal delta system with specification of: characteristic grain size, input water and sediment discharges and basin morphology. In particular, we relax the assumption of a single, implicit channel sweeping across the delta topset in favor of an implicit channel network. This network, coupled with recent research on channel-forming Shields number, quantitative assessments of the lateral depositional length of sand (corresponding loosely to levees) and length between bifurcations create a spatial web of deposition within the receiving basin. The depositional web includes spatial boundaries for areas infilling with sands carried as bed material load, as well as those filling via passive deposition of washload mud. Our main goal is to identify the minimum features necessary to accurately model the morphodynamics of channel number, width, depth, and overall delta progradation rate in a juvenile delta. We use the Wax Lake Delta in Louisiana as a test site due to its rapid growth in the last 40 years. Field data including topset/island bathymetry, channel bathymetry, topset/island width, channel width, number of channels, and radial topset length are compiled from US Army Corps of Engineers data for 1989, 1998, and 2006. Additional data is extracted from a DEM from 2015. These data are used as benchmarks for the hindcast model runs. The morphology of Wax Lake Delta is also strongly affected by a pre-delta substrate that acts as a lower "bedrock" boundary. Therefore, we also include closures for a bedrock-alluvial transition and an excess shear rate-law incision model to estimate bedrock incision. The model's framework is generic, but inclusion of individual

  18. An Unrecognized Rash Progressing to Lyme Carditis: Important Features and Recommendations Regarding Lyme Disease.

    Science.gov (United States)

    Lee, Shawn; Singla, Montish

    2016-01-01

    We present a case report of 46-year-old man with no medical history, who complained of extreme fatigue, near-syncope, and palpitations. He initially presented in complete heart block. A transvenous pacemaker was placed in the emergency department, and he was started empirically on Ceftriaxone for Lyme disease. He was admitted and over the course of the next few days, his rhythm regressed to Mobitz type I first-degree atrioventricular block and then to normal sinus rhythm. This case report highlights some important features regarding Lyme carditis, a rare presentation of early disseminated Lyme disease (seen in a few weeks to months after the initial tick bite). In 25%-30% of patients, the characteristic targetoid rash may not be seen, a likely culprit of the disease not being detected early and progressing to disseminated disease. The most common cardiac complaint of Lyme disease is palpitations, occurring in 6.6% of patients, which may not accurately reflect progression into disseminated Lyme disease because it is a nonspecific finding. Conduction abnormality, occurring in 1.8% of patients, is a more specific finding of Borrelia invading cardiac tissue. Finally, this case report highlights a recommendation that patients with confirmed Lyme disease or those presenting with cardiac abnormalities or symptoms who have an atypical profile for a cardiac event should be screened with a 12-lead electrocardiogram, Lyme serology, and be considered for antibiotic therapy with the possibility of temporary pacing.

  19. Familiarity and within-person facial variability: the importance of the internal and external features

    OpenAIRE

    Kramer, R. S. S.; Manesi, Z.; Towler, A.; Reynolds, M. G.; Burton, A. M.

    2018-01-01

    As faces become familiar, we come to rely more on their internal features for recognition and matching tasks. Here, we assess whether this same pattern is also observed for a card sorting task. Participants sorted photos showing either the full face, only the internal features, or only the external features into multiple piles, one pile per identity. In Experiments 1 and 2, we showed the standard advantage for familiar faces—sorting was more accurate and showed very few errors in comparison w...

  20. Identify the Important Decision Factors of Online Shopping Adoption in Indonesia

    Directory of Open Access Journals (Sweden)

    Lailatul HIJRAH

    2017-12-01

    Full Text Available The objective of this study is to identify factors encouraging a consumer to engage in online shopping activities. The expected contribution of this study is for online entrepreneurs, in order to develop the most suitable business strategy, so that it will be clearly identified and sorted out which factors are the most important and the main motivation of Indonesian consumers to shop via online by using responses from respondents who usually shop online and offline in 3 cities in Indonesia, Jakarta, Surabaya and Samarinda. The research instruments were developed by conducting FGDs on relevant groups, either academics, online shopping activists, suppliers and courier businessmen in Jakarta, Surabaya and Samarinda Cities in effort to extract any information that encourages consumers to online shopping. After conducting FGD, the researcher produced 48 items proposed for factor analysis and after extracted to form eleven constructs, some items were removed because they had less loading factors. The eleven constructs or dimensions are trust, risk, consumer factors, website factors, price, service quality, convenience, subjective norm, product guarantee, variety of products and lifestyle. The implications of this study provide valuable insights about consumer decisions to online shopping or not online shopping.

  1. Systematic reviews identify important methodological flaws in stroke rehabilitation therapy primary studies: review of reviews.

    Science.gov (United States)

    Santaguida, Pasqualina; Oremus, Mark; Walker, Kathryn; Wishart, Laurie R; Siegel, Karen Lohmann; Raina, Parminder

    2012-04-01

    A "review of reviews" was undertaken to assess methodological issues in studies evaluating nondrug rehabilitation interventions in stroke patients. MEDLINE, CINAHL, PsycINFO, and the Cochrane Database of Systematic Reviews were searched from January 2000 to January 2008 within the stroke rehabilitation setting. Electronic searches were supplemented by reviews of reference lists and citations identified by experts. Eligible studies were systematic reviews; excluded citations were narrative reviews or reviews of reviews. Review characteristics and criteria for assessing methodological quality of primary studies within them were extracted. The search yielded 949 English-language citations. We included a final set of 38 systematic reviews. Cochrane reviews, which have a standardized methodology, were generally of higher methodological quality than non-Cochrane reviews. Most systematic reviews used standardized quality assessment criteria for primary studies, but not all were comprehensive. Reviews showed that primary studies had problems with randomization, allocation concealment, and blinding. Baseline comparability, adverse events, and co-intervention or contamination were not consistently assessed. Blinding of patients and providers was often not feasible and was not evaluated as a source of bias. The eligible systematic reviews identified important methodological flaws in the evaluated primary studies, suggesting the need for improvement of research methods and reporting. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. Features of the diagnostic methods to identify the sheep subclinical mastitis in according to infectious etiology

    Directory of Open Access Journals (Sweden)

    Eliane Vale Tanaka

    2012-12-01

    Full Text Available Mastitis is an infection of the mammary gland mainly caused by bacteria. In sheep, besides it causes chemical and physical changes in milk with the loss in quality, mastitis changes the glandular tissue which may lead to premature cull-out from the herd. This study aimed to evaluate the diagnostic features of the California Mastitis Test (CMT and somatic cell count (SCC to the identification of subclinical mastitis in sheep according to the micro-organisms isolated. The work is at an early stage and CMT was performed in all ewes. It was considered positive results all degrees of reaction, while the negative reaction was considered when there was not viscosity. Subsequently, samples were collected aseptically from milk and were sent for microbiological analysis. A total of 160 milk samples were analyzed from 85 Santa Inês sheep belonging to the Embrapa Southeast Livestock in São Carlos, São Paulo. Samples were plated on sheep blood agar to 5% and incubated for 24h/72h at 35 ° C. In samples with growth, tests to the identification of the microorganisms were performed, macroscopic characteristics of the colonies and the production or absence of hemolysis, Gram staining, catalase test, coagulase test with rabbit plasma and verification of acetoin production. The sensitivity of the diagnostic tests were determined in accordance to the ratio of the positive tests and the presence of the disease, while the specificities were calculated according to the ratio of the negative results and the absence of disease. The efficiency was based on the percentage of true results that the test was able to provide diagnosis. SCC in milk was determined using the somatic cell count Somacount 300 (Bentley and the presence of the disease was given when isolated coagulase-positive staphylococci (CPS, coagulase-negative staphylococci (CNS, coliforms and other microorganisms (Corinebacteria, strep and association of two bacteria in a same sample. It was used the limit

  3. Identifying Key Features of Student Performance in Educational Video Games and Simulations through Cluster Analysis

    Science.gov (United States)

    Kerr, Deirdre; Chung, Gregory K. W. K.

    2012-01-01

    The assessment cycle of "evidence-centered design" (ECD) provides a framework for treating an educational video game or simulation as an assessment. One of the main steps in the assessment cycle of ECD is the identification of the key features of student performance. While this process is relatively simple for multiple choice tests, when…

  4. An Educational System to Help Students Assess Website Features and Identify High-Risk Websites

    Science.gov (United States)

    Kajiyama, Tomoko; Echizen, Isao

    2015-01-01

    Purpose: The purpose of this paper is to propose an effective educational system to help students assess Web site risk by providing an environment in which students can better understand a Web site's features and determine the risks of accessing the Web site for themselves. Design/methodology/approach: The authors have enhanced a prototype…

  5. A Cross-Sectional Investigation of the Importance of Park Features for Promoting Regular Physical Activity in Parks.

    Science.gov (United States)

    Costigan, Sarah A; Veitch, Jenny; Crawford, David; Carver, Alison; Timperio, Anna

    2017-11-02

    Parks in the US and Australia are generally underutilised, and park visitors typically engage in low levels of physical activity (PA). Better understanding park features that may encourage visitors to be active is important. This study examined the perceived importance of park features for encouraging park-based PA and examined differences by sex, age, parental-status and participation in PA. Cross-sectional surveys were completed by local residents ( n = 2775) living near two parks (2013/2015). Demographic variables, park visitation and leisure-time PA were self-reported, respondents rated the importance of 20 park features for encouraging park-based PA in the next fortnight. Chi-square tests of independence examined differences in importance of park features for PA among sub-groups of local residents (sex, age, parental-status, PA). Park features ranked most important for park-based PA were: well maintained (96.2%), feel safe (95.4%), relaxing atmosphere (91.2%), easy to get to (91.7%), and shady trees (90.3%). All subgroups ranked 'well maintained' as most important. Natural and built environment features of parks are important for promoting adults' park-based PA, and should be considered in park (re)design.

  6. Mining genome sequencing data to identify the genomic features linked to breast cancer histopathology

    Science.gov (United States)

    Ping, Zheng; Siegal, Gene P.; Almeida, Jonas S.; Schnitt, Stuart J.; Shen, Dejun

    2014-01-01

    Background: Genetics and genomics have radically altered our understanding of breast cancer progression. However, the genomic basis of various histopathologic features of breast cancer is not yet well-defined. Materials and Methods: The Cancer Genome Atlas (TCGA) is an international database containing a large collection of human cancer genome sequencing data. cBioPortal is a web tool developed for mining these sequencing data. We performed mining of TCGA sequencing data in an attempt to characterize the genomic features correlated with breast cancer histopathology. We first assessed the quality of the TCGA data using a group of genes with known alterations in various cancers. Both genome-wide gene mutation and copy number changes as well as a group of genes with a high frequency of genetic changes were then correlated with various histopathologic features of invasive breast cancer. Results: Validation of TCGA data using a group of genes with known alterations in breast cancer suggests that the TCGA has accurately documented the genomic abnormalities of multiple malignancies. Further analysis of TCGA breast cancer sequencing data shows that accumulation of specific genomic defects is associated with higher tumor grade, larger tumor size and receptor negativity. Distinct groups of genomic changes were found to be associated with the different grades of invasive ductal carcinoma. The mutator role of the TP53 gene was validated by genomic sequencing data of invasive breast cancer and TP53 mutation was found to play a critical role in defining high tumor grade. Conclusions: Data mining of the TCGA genome sequencing data is an innovative and reliable method to help characterize the genomic abnormalities associated with histopathologic features of invasive breast cancer. PMID:24672738

  7. Mining genome sequencing data to identify the genomic features linked to breast cancer histopathology

    Directory of Open Access Journals (Sweden)

    Zheng Ping

    2014-01-01

    Full Text Available Background: Genetics and genomics have radically altered our understanding of breast cancer progression. However, the genomic basis of various histopathologic features of breast cancer is not yet well-defined. Materials and Methods: The Cancer Genome Atlas (TCGA is an international database containing a large collection of human cancer genome sequencing data. cBioPortal is a web tool developed for mining these sequencing data. We performed mining of TCGA sequencing data in an attempt to characterize the genomic features correlated with breast cancer histopathology. We first assessed the quality of the TCGA data using a group of genes with known alterations in various cancers. Both genome-wide gene mutation and copy number changes as well as a group of genes with a high frequency of genetic changes were then correlated with various histopathologic features of invasive breast cancer. Results: Validation of TCGA data using a group of genes with known alterations in breast cancer suggests that the TCGA has accurately documented the genomic abnormalities of multiple malignancies. Further analysis of TCGA breast cancer sequencing data shows that accumulation of specific genomic defects is associated with higher tumor grade, larger tumor size and receptor negativity. Distinct groups of genomic changes were found to be associated with the different grades of invasive ductal carcinoma. The mutator role of the TP53 gene was validated by genomic sequencing data of invasive breast cancer and TP53 mutation was found to play a critical role in defining high tumor grade. Conclusions: Data mining of the TCGA genome sequencing data is an innovative and reliable method to help characterize the genomic abnormalities associated with histopathologic features of invasive breast cancer.

  8. A Comparison of the Identifying Features of Imitated Handwriting and Elderly Handwriting

    OpenAIRE

    Jing Wang

    2017-01-01

    Imitated handwriting and elderly handwriting are two manifestation patterns of altered handwriting. Several similarities in features can be found in both, such as gentle movement and curved jitter. In practice, it is very easy to confuse the two patterns, leading to wrong decisions and difficulties in document examination. The key to solving these problems is to recognize the similarities and differences between imitated handwriting and elderly handwriting. This paper comprises four parts. Th...

  9. A Novel Technique for Identifying Patients with ICU Needs Using Hemodynamic Features

    Directory of Open Access Journals (Sweden)

    A. Jalali

    2012-01-01

    Full Text Available Identification of patients requiring intensive care is a critical issue in clinical treatment. The objective of this study is to develop a novel methodology using hemodynamic features for distinguishing such patients requiring intensive care from a group of healthy subjects. In this study, based on the hemodynamic features, subjects are divided into three groups: healthy, risky and patient. For each of the healthy and patient subjects, the evaluated features are based on the analysis of existing differences between hemodynamic variables: Blood Pressure and Heart Rate. Further, four criteria from the hemodynamic variables are introduced: circle criterion, estimation error criterion, Poincare plot deviation, and autonomic response delay criterion. For each of these criteria, three fuzzy membership functions are defined to distinguish patients from healthy subjects. Furthermore, based on the evaluated criteria, a scoring method is developed. In this scoring method membership degree of each subject is evaluated for the three classifying groups. Then, for each subject, the cumulative sum of membership degree of all four criteria is calculated. Finally, a given subject is classified with the group which has the largest cumulative sum. In summary, the scoring method results in 86% sensitivity, 94.8% positive predictive accuracy and 82.2% total accuracy.

  10. A Permutation Importance-Based Feature Selection Method for Short-Term Electricity Load Forecasting Using Random Forest

    Directory of Open Access Journals (Sweden)

    Nantian Huang

    2016-09-01

    Full Text Available The prediction accuracy of short-term load forecast (STLF depends on prediction model choice and feature selection result. In this paper, a novel random forest (RF-based feature selection method for STLF is proposed. First, 243 related features were extracted from historical load data and the time information of prediction points to form the original feature set. Subsequently, the original feature set was used to train an RF as the original model. After the training process, the prediction error of the original model on the test set was recorded and the permutation importance (PI value of each feature was obtained. Then, an improved sequential backward search method was used to select the optimal forecasting feature subset based on the PI value of each feature. Finally, the optimal forecasting feature subset was used to train a new RF model as the final prediction model. Experiments showed that the prediction accuracy of RF trained by the optimal forecasting feature subset was higher than that of the original model and comparative models based on support vector regression and artificial neural network.

  11. [Imported malaria and HIV infection in Madrid. Clinical and epidemiological features].

    Science.gov (United States)

    Ramírez-Olivencia, G; Herrero, M D; Subirats, M; de Juanes, J R; Peña, J M; Puente, S

    2012-01-01

    Few data are available in Spain data on human immunodeficiency virus (HIV) patients coinfected with malaria. This study has aimed to determine the epidemiological and clinical characteristics of imported malaria in patients coinfected with HIV. A case-series retrospective study was performed using the patient's medical records. The study population consisted on patients diagnosed with malaria attended in our center from january 1, 2002 to december 31, 2007. A total of 484 episodes of malaria, 398 of which were included in this study, were identified. Co-infection with HIV was described in 32 cases. All of them occurred in individuals presumably with some degree of semi-immunity. In the coinfected group, there were 13 cases (40.6%) asymptomatic, whereas this event occurred in 99 cases of patients not coinfected (37.2%) (P=0.707). The greater presence of anemia in co-infected patients (62.5% vs 32.3% in non-coinfected [P=0.001]) stands out. In present study, the clinical presentation forms were similar, regardless of the presence or absence of HIV infection. Although the study population does not reflect all possible scenarios of malaria and HIV coinfection, our results indicate the reality of patients attended in the Autonomous Community of Madrid. Copyright © 2011 Elsevier España, S.L. All rights reserved.

  12. Perceived Importance of Wellness Features at a Cancer Center: Patient and Staff Perspectives.

    Science.gov (United States)

    Tinner, Michelle; Crovella, Paul; Rosenbaum, Paula F

    2018-01-01

    Determine the relative impact of 11 building wellness features on preference and on the ability to deliver/receive quality care for two groups: patients and caregivers. The impact of building features that promote wellness is of increasing interest to the building owners, designers, and occupants. This study performed a postoccupancy evaluation of two user groups at a healthcare facility with specific wellness features. Seventy-six staff and 62 patients of a cancer center were polled separately to determine their preferences in 11 categories. Results showed that all wellness features were viewed favorably by the two groups, with natural lighting, views of nature, and thermal comfort as top categories for both. The t-test comparisons were performed, and significant differences ( p < .05) between the two groups were found for three of the features (views of nature, art and murals, and indoor plants). Discussion of these differences and the interaction of competing design goals (thermal comfort, views of nature, natural light, and desire for privacy) are included. Designers and owners will want to consider the preferred use of roof gardens, art and murals, and indoor plants for patient spaces, where their relative value is greater. Access to private and quiet spaces is the top need for caregivers. Ease of movement, thermal comfort, and natural light were top needs for patients.

  13. Identifying selectively important amino acid positions associated with alternative habitat environments in fish mitochondrial genomes.

    Science.gov (United States)

    Xia, Jun Hong; Li, Hong Lian; Zhang, Yong; Meng, Zi Ning; Lin, Hao Ran

    2018-05-01

    Fish species inhabitating seawater (SW) or freshwater (FW) habitats have to develop genetic adaptations to alternative environment factors, especially salinity. Functional consequences of the protein variations associated with habitat environments in fish mitochondrial genomes have not yet received much attention. We analyzed 829 complete fish mitochondrial genomes and compared the amino acid differences of 13 mitochondrial protein families between FW and SW fish groups. We identified 47 specificity determining sites (SDS) that associated with FW or SW environments from 12 mitochondrial protein families. Thirty-two (68%) of the SDS sites are hydrophobic, 13 (28%) are neutral, and the remaining sites are acidic or basic. Seven of those SDS from ND1, ND2 and ND5 were scored as probably damaging to the protein structures. Furthermore, phylogenetic tree based Bayes Empirical Bayes analysis also detected 63 positive sites associated with alternative habitat environments across ten mtDNA proteins. These signatures could be important for studying mitochondrial genetic variation relevant to fish physiology and ecology.

  14. PCR-RFLP Method to Identify Salmonid Species of Economic Importance

    Directory of Open Access Journals (Sweden)

    Andreea Dudu

    2011-05-01

    Full Text Available The identification of different fish species by molecular methods has become necessary to avoid both the incorrect labelling of individuals involved in repopulation programmes and the commercial frauds on the fish market. Different fish species of great economical importance, like the salmonids, which are very much requested for their meat, can be identified using molecular techniques such as PCR-RFLP. The method is based on the amplification of a target region from the genome by PCR reaction followed by endonucleases digestion to detect the polymorphism of restriction fragments. In our study we analysed the following salmonid species from Romania: Salmo trutta fario, Salmo labrax, Salvelinus fontinalis, Onchorhynchus mykiss, Thymallus thymallus and Hucho hucho. In order to discriminate between the analysed species we amplified a fragment of mitochondrial genome comprising tRNAGlu/ cytochrome b/ tRNAThr/ tRNAPro/ D-loop/ tRNAPhe, followed by digestion with a specific restriction enzyme. The direct digestion of unpurified PCR products generated species-specific restriction patterns and proved to be a simple, reliable, inexpensive and fast method. Thus, it may be successfully utilized in specialized laboratories for the correct identification of the fish species for multiple purposes, including the traceability of fish food products.

  15. Use of DNA sequences to identify forensically important fly species and their distribution in the coastal region of Central California.

    Science.gov (United States)

    Nakano, Angie; Honda, Jeff

    2015-08-01

    Forensic entomology has gained prominence in recent years, as improvements in DNA technology and molecular methods have allowed insect and other arthropod evidence to become increasingly useful in criminal and civil investigations. However, comprehensive faunal inventories are still needed, including cataloging local DNA sequences for forensically significant Diptera. This multi-year fly-trapping study was built upon and expanded a previous survey of these flies in Santa Clara County, including the addition of genetic barcoding data from collected species of flies. Flies from the families Calliphoridae, Sarcophagidae, and Muscidae were trapped in meat-baited traps set in a variety of locations throughout the county. Flies were identified using morphological features and confirmed by molecular analysis. A total of 16 calliphorid species, 11 sarcophagid species, and four muscid species were collected and differentiated. This study found more species of flies than previous area surveys and established new county records for two calliphorid species: Cynomya cadaverina and Chrysomya rufifacies. Differences were found in fly fauna in different areas of the county, indicating the importance of microclimates in the distribution of these flies. Molecular analysis supported the use of DNA barcoding as an effective method of identifying cryptic fly species. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  16. Combining Methods to Describe Important Marine Habitats for Top Predators: Application to Identify Biological Hotspots in Tropical Waters.

    Science.gov (United States)

    Thiers, Laurie; Louzao, Maite; Ridoux, Vincent; Le Corre, Matthieu; Jaquemet, Sébastien; Weimerskirch, Henri

    2014-01-01

    In tropical waters resources are usually scarce and patchy, and predatory species generally show specific adaptations for foraging. Tropical seabirds often forage in association with sub-surface predators that create feeding opportunities by bringing prey close to the surface, and the birds often aggregate in large multispecific flocks. Here we hypothesize that frigatebirds, a tropical seabird adapted to foraging with low energetic costs, could be a good predictor of the distribution of their associated predatory species, including other seabirds (e.g. boobies, terns) and subsurface predators (e.g., dolphins, tunas). To test this hypothesis, we compared distribution patterns of marine predators in the Mozambique Channel based on a long-term dataset of both vessel- and aerial surveys, as well as tracking data of frigatebirds. By developing species distribution models (SDMs), we identified key marine areas for tropical predators in relation to contemporaneous oceanographic features to investigate multi-species spatial overlap areas and identify predator hotspots in the Mozambique Channel. SDMs reasonably matched observed patterns and both static (e.g. bathymetry) and dynamic (e.g. Chlorophyll a concentration and sea surface temperature) factors were important explaining predator distribution patterns. We found that the distribution of frigatebirds included the distributions of the associated species. The central part of the channel appeared to be the best habitat for the four groups of species considered in this study (frigatebirds, brown terns, boobies and sub-surface predators).

  17. Combining Methods to Describe Important Marine Habitats for Top Predators: Application to Identify Biological Hotspots in Tropical Waters.

    Directory of Open Access Journals (Sweden)

    Laurie Thiers

    Full Text Available In tropical waters resources are usually scarce and patchy, and predatory species generally show specific adaptations for foraging. Tropical seabirds often forage in association with sub-surface predators that create feeding opportunities by bringing prey close to the surface, and the birds often aggregate in large multispecific flocks. Here we hypothesize that frigatebirds, a tropical seabird adapted to foraging with low energetic costs, could be a good predictor of the distribution of their associated predatory species, including other seabirds (e.g. boobies, terns and subsurface predators (e.g., dolphins, tunas. To test this hypothesis, we compared distribution patterns of marine predators in the Mozambique Channel based on a long-term dataset of both vessel- and aerial surveys, as well as tracking data of frigatebirds. By developing species distribution models (SDMs, we identified key marine areas for tropical predators in relation to contemporaneous oceanographic features to investigate multi-species spatial overlap areas and identify predator hotspots in the Mozambique Channel. SDMs reasonably matched observed patterns and both static (e.g. bathymetry and dynamic (e.g. Chlorophyll a concentration and sea surface temperature factors were important explaining predator distribution patterns. We found that the distribution of frigatebirds included the distributions of the associated species. The central part of the channel appeared to be the best habitat for the four groups of species considered in this study (frigatebirds, brown terns, boobies and sub-surface predators.

  18. Microbiological Features of KPC-Producing Enterobacter Isolates Identified in a U.S. Hospital System

    Science.gov (United States)

    Ahn, Chulsoo; Syed, Alveena; Hu, Fupin; O’Hara, Jessica A.; Rivera, Jesabel I.; Doi, Yohei

    2014-01-01

    Microbiological data regarding KPC-producing Enterobacter spp. are scarce. In this study, 11 unique KPC-producing Enterobacter isolates were identified among 44 ertapenem-non-susceptible Enterobacter isolates collected between 2009 and 2013 at a hospital system in Western Pennsylvania. All cases were healthcare-associated and occurred in medically complex patients. While pulsed-field gel electrophoresis (PFGE) showed diverse restriction patterns overall, multilocus sequence typing (MLST) identified Enterobacter cloacae isolates with sequence types (STs) 93 and 171 from two hospitals each. The levels of carbapenem minimum inhibitory concentrations were highly variable. All isolates remained susceptible to colistin, tigecycline, and the majority to amikacin and doxycycline. A blaKPC-carrying IncN plasmid conferring trimethoprim-sulfamethoxazole resistance was identified in three of the isolates. Spread of blaKPC in Enterobacter spp. appears to be due to a combination of plasmid-mediated and clonal processes. PMID:25053203

  19. Identifying Important Atlantic Areas for the conservation of Balearic shearwaters: Spatial overlap with conservation areas

    Science.gov (United States)

    Pérez-Roda, Amparo; Delord, Karine; Boué, Amélie; Arcos, José Manuel; García, David; Micol, Thierry; Weimerskirch, Henri; Pinaud, David; Louzao, Maite

    2017-07-01

    Marine protected areas (MPAs) are considered one of the main tools in both fisheries and conservation management to protect threatened species and their habitats around the globe. However, MPAs are underrepresented in marine environments compared to terrestrial environments. Within this context, we studied the Atlantic non-breeding distribution of the southern population of Balearic shearwaters (Puffinus mauretanicus) breeding in Eivissa during the 2011-2012 period based on global location sensing (GLS) devices. Our objectives were (1) to identify overall Important Atlantic Areas (IAAs) from a southern population, (2) to describe spatio-temporal patterns of oceanographic habitat use, and (3) to assess whether existing conservation areas (Natura 2000 sites and marine Important Bird Areas (IBAs)) cover the main IAAs of Balearic shearwaters. Our results highlighted that the Atlantic staging (from June to October in 2011) dynamic of the southern population was driven by individual segregation at both spatial and temporal scales. Individuals ranged in the North-East Atlantic over four main IAAs (Bay of Biscay: BoB, Western Iberian shelf: WIS, Gulf of Cadiz: GoC, West of Morocco: WoM). While most individuals spent more time on the WIS or in the GoC, a small number of birds visited IAAs at the extremes of their Atlantic distribution range (i.e., BoB and WoM). The chronology of the arrivals to the IAAs showed a latitudinal gradient with northern areas reached earlier during the Atlantic staging. The IAAs coincided with the most productive areas (higher chlorophyll a values) in the NE Atlantic between July and October. The spatial overlap between IAAs and conservation areas was higher for Natura 2000 sites than marine IBAs (areas with and without legal protection, respectively). Concerning the use of these areas, a slightly higher proportion of estimated positions fell within marine IBAs compared to designated Natura 2000 sites, with Spanish and Portuguese conservation

  20. Unique features of a global human ectoparasite identified through sequencing of the bed bug genome.

    Science.gov (United States)

    Benoit, Joshua B; Adelman, Zach N; Reinhardt, Klaus; Dolan, Amanda; Poelchau, Monica; Jennings, Emily C; Szuter, Elise M; Hagan, Richard W; Gujar, Hemant; Shukla, Jayendra Nath; Zhu, Fang; Mohan, M; Nelson, David R; Rosendale, Andrew J; Derst, Christian; Resnik, Valentina; Wernig, Sebastian; Menegazzi, Pamela; Wegener, Christian; Peschel, Nicolai; Hendershot, Jacob M; Blenau, Wolfgang; Predel, Reinhard; Johnston, Paul R; Ioannidis, Panagiotis; Waterhouse, Robert M; Nauen, Ralf; Schorn, Corinna; Ott, Mark-Christoph; Maiwald, Frank; Johnston, J Spencer; Gondhalekar, Ameya D; Scharf, Michael E; Peterson, Brittany F; Raje, Kapil R; Hottel, Benjamin A; Armisén, David; Crumière, Antonin Jean Johan; Refki, Peter Nagui; Santos, Maria Emilia; Sghaier, Essia; Viala, Sèverine; Khila, Abderrahman; Ahn, Seung-Joon; Childers, Christopher; Lee, Chien-Yueh; Lin, Han; Hughes, Daniel S T; Duncan, Elizabeth J; Murali, Shwetha C; Qu, Jiaxin; Dugan, Shannon; Lee, Sandra L; Chao, Hsu; Dinh, Huyen; Han, Yi; Doddapaneni, Harshavardhan; Worley, Kim C; Muzny, Donna M; Wheeler, David; Panfilio, Kristen A; Vargas Jentzsch, Iris M; Vargo, Edward L; Booth, Warren; Friedrich, Markus; Weirauch, Matthew T; Anderson, Michelle A E; Jones, Jeffery W; Mittapalli, Omprakash; Zhao, Chaoyang; Zhou, Jing-Jiang; Evans, Jay D; Attardo, Geoffrey M; Robertson, Hugh M; Zdobnov, Evgeny M; Ribeiro, Jose M C; Gibbs, Richard A; Werren, John H; Palli, Subba R; Schal, Coby; Richards, Stephen

    2016-02-02

    The bed bug, Cimex lectularius, has re-established itself as a ubiquitous human ectoparasite throughout much of the world during the past two decades. This global resurgence is likely linked to increased international travel and commerce in addition to widespread insecticide resistance. Analyses of the C. lectularius sequenced genome (650 Mb) and 14,220 predicted protein-coding genes provide a comprehensive representation of genes that are linked to traumatic insemination, a reduced chemosensory repertoire of genes related to obligate hematophagy, host-symbiont interactions, and several mechanisms of insecticide resistance. In addition, we document the presence of multiple putative lateral gene transfer events. Genome sequencing and annotation establish a solid foundation for future research on mechanisms of insecticide resistance, human-bed bug and symbiont-bed bug associations, and unique features of bed bug biology that contribute to the unprecedented success of C. lectularius as a human ectoparasite.

  1. Unique features of a global human ectoparasite identified through sequencing of the bed bug genome

    Science.gov (United States)

    Benoit, Joshua B.; Adelman, Zach N.; Reinhardt, Klaus; Dolan, Amanda; Poelchau, Monica; Jennings, Emily C.; Szuter, Elise M.; Hagan, Richard W.; Gujar, Hemant; Shukla, Jayendra Nath; Zhu, Fang; Mohan, M.; Nelson, David R.; Rosendale, Andrew J.; Derst, Christian; Resnik, Valentina; Wernig, Sebastian; Menegazzi, Pamela; Wegener, Christian; Peschel, Nicolai; Hendershot, Jacob M.; Blenau, Wolfgang; Predel, Reinhard; Johnston, Paul R.; Ioannidis, Panagiotis; Waterhouse, Robert M.; Nauen, Ralf; Schorn, Corinna; Ott, Mark-Christoph; Maiwald, Frank; Johnston, J. Spencer; Gondhalekar, Ameya D.; Scharf, Michael E.; Peterson, Brittany F.; Raje, Kapil R.; Hottel, Benjamin A.; Armisén, David; Crumière, Antonin Jean Johan; Refki, Peter Nagui; Santos, Maria Emilia; Sghaier, Essia; Viala, Sèverine; Khila, Abderrahman; Ahn, Seung-Joon; Childers, Christopher; Lee, Chien-Yueh; Lin, Han; Hughes, Daniel S. T.; Duncan, Elizabeth J.; Murali, Shwetha C.; Qu, Jiaxin; Dugan, Shannon; Lee, Sandra L.; Chao, Hsu; Dinh, Huyen; Han, Yi; Doddapaneni, Harshavardhan; Worley, Kim C.; Muzny, Donna M.; Wheeler, David; Panfilio, Kristen A.; Vargas Jentzsch, Iris M.; Vargo, Edward L.; Booth, Warren; Friedrich, Markus; Weirauch, Matthew T.; Anderson, Michelle A. E.; Jones, Jeffery W.; Mittapalli, Omprakash; Zhao, Chaoyang; Zhou, Jing-Jiang; Evans, Jay D.; Attardo, Geoffrey M.; Robertson, Hugh M.; Zdobnov, Evgeny M.; Ribeiro, Jose M. C.; Gibbs, Richard A.; Werren, John H.; Palli, Subba R.; Schal, Coby; Richards, Stephen

    2016-01-01

    The bed bug, Cimex lectularius, has re-established itself as a ubiquitous human ectoparasite throughout much of the world during the past two decades. This global resurgence is likely linked to increased international travel and commerce in addition to widespread insecticide resistance. Analyses of the C. lectularius sequenced genome (650 Mb) and 14,220 predicted protein-coding genes provide a comprehensive representation of genes that are linked to traumatic insemination, a reduced chemosensory repertoire of genes related to obligate hematophagy, host–symbiont interactions, and several mechanisms of insecticide resistance. In addition, we document the presence of multiple putative lateral gene transfer events. Genome sequencing and annotation establish a solid foundation for future research on mechanisms of insecticide resistance, human–bed bug and symbiont–bed bug associations, and unique features of bed bug biology that contribute to the unprecedented success of C. lectularius as a human ectoparasite. PMID:26836814

  2. New method for identifying features of an image on a digital video display

    Science.gov (United States)

    Doyle, Michael D.

    1991-04-01

    The MetaMap process extends the concept of direct manipulation human-computer interfaces to new limits. Its specific capabilities include the correlation of discrete image elements to relevant text information and the correlation of these image features to other images as well as to program control mechanisms. The correlation is accomplished through reprogramming of both the color map and the image so that discrete image elements comprise unique sets of color indices. This process allows the correlation to be accomplished with very efficient data storage and program execution times. Image databases adapted to this process become object-oriented as a result. Very sophisticated interrelationships can be set up between images text and program control mechanisms using this process. An application of this interfacing process to the design of an interactive atlas of medical histology as well as other possible applications are described. The MetaMap process is protected by U. S. patent #4

  3. Maternal employment and Mexican school-age children overweight in 2012: the importance of households features.

    Science.gov (United States)

    Espinosa, Alejandro Martínez

    2018-01-01

    International evidence regarding the relationship between maternal employment and school-age children overweight and obesity shows divergent results. In Mexico, this relationship has not been confirmed by national data sets analysis. Consequently, the objective of this article was to evaluate the role of the mothers' participation in labor force related to excess body weight in Mexican school-age children (aged 5-11 years). A cross-sectional study was conducted on a sample of 17,418 individuals from the National Health and Nutrition Survey 2012, applying binomial logistic regression models. After controlling for individual, maternal and contextual features, the mothers' participation in labor force was associated with children body composition. However, when the household features (living arrangements, household ethnicity, size, food security and socioeconomic status) were incorporated, maternal employment was no longer statically significant. Household features are crucial factors for understanding the overweight and obesity prevalence levels in Mexican school-age children, despite the mother having a paid job. Copyright: © 2018 Permanyer.

  4. Identifying Key Features of Effective Active Learning: The Effects of Writing and Peer Discussion

    Science.gov (United States)

    Pangle, Wiline M.; Wyatt, Kevin H.; Powell, Karli N.; Sherwood, Rachel E.

    2014-01-01

    We investigated some of the key features of effective active learning by comparing the outcomes of three different methods of implementing active-learning exercises in a majors introductory biology course. Students completed activities in one of three treatments: discussion, writing, and discussion + writing. Treatments were rotated weekly between three sections taught by three different instructors in a full factorial design. The data set was analyzed by generalized linear mixed-effect models with three independent variables: student aptitude, treatment, and instructor, and three dependent (assessment) variables: change in score on pre- and postactivity clicker questions, and coding scores on in-class writing and exam essays. All independent variables had significant effects on student performance for at least one of the dependent variables. Students with higher aptitude scored higher on all assessments. Student scores were higher on exam essay questions when the activity was implemented with a writing component compared with peer discussion only. There was a significant effect of instructor, with instructors showing different degrees of effectiveness with active-learning techniques. We suggest that individual writing should be implemented as part of active learning whenever possible and that instructors may need training and practice to become effective with active learning. PMID:25185230

  5. Identifying key features of effective active learning: the effects of writing and peer discussion.

    Science.gov (United States)

    Linton, Debra L; Pangle, Wiline M; Wyatt, Kevin H; Powell, Karli N; Sherwood, Rachel E

    2014-01-01

    We investigated some of the key features of effective active learning by comparing the outcomes of three different methods of implementing active-learning exercises in a majors introductory biology course. Students completed activities in one of three treatments: discussion, writing, and discussion + writing. Treatments were rotated weekly between three sections taught by three different instructors in a full factorial design. The data set was analyzed by generalized linear mixed-effect models with three independent variables: student aptitude, treatment, and instructor, and three dependent (assessment) variables: change in score on pre- and postactivity clicker questions, and coding scores on in-class writing and exam essays. All independent variables had significant effects on student performance for at least one of the dependent variables. Students with higher aptitude scored higher on all assessments. Student scores were higher on exam essay questions when the activity was implemented with a writing component compared with peer discussion only. There was a significant effect of instructor, with instructors showing different degrees of effectiveness with active-learning techniques. We suggest that individual writing should be implemented as part of active learning whenever possible and that instructors may need training and practice to become effective with active learning. © 2014 D. L. Linton et al. CBE—Life Sciences Education © 2014 The American Society for Cell Biology. This article is distributed by The American Society for Cell Biology under license from the author(s). It is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  6. Importance of bistatic SAR features from TanDEM-X for forest mapping and monitoring

    NARCIS (Netherlands)

    Schlund, M.; Poncet, von F.; Hoekman, D.H.; Kuntz, S.; Schmullius, C.

    2014-01-01

    Deforestation and forest degradation are one of the important sources for human induced carbon dioxide emissions and their rates are highest in tropical forests. For man-kind, it is of great importance to track land-use conversions like deforestation, e.g. for sustainable forest management and land

  7. Predicting establishment of non-native fishes in Greece: identifying key features

    Directory of Open Access Journals (Sweden)

    Christos Gkenas

    2015-11-01

    Full Text Available Non-native fishes are known to cause economic damage to human society and are considered a major threat to biodiversity loss in freshwater ecosystems. The growing concern about these impacts has driven to an investigation of the biological traits that facilitate the establishment of non-native fish. However, invalid assessment in choosing the appropriate statistical model can lead researchers to ambiguous conclusions. Here, we present a comprehensive comparison of traditional and alternative statistical methods for predicting fish invasions using logistic regression, classification trees, multicorrespondence analysis and random forest analysis to determine characteristics of successful and failed non-native fishes in Hellenic Peninsula through establishment. We defined fifteen categorical predictor variables with biological relevance and measures of human interest. Our study showed that accuracy differed according to the model and the number of factors considered. Among all the models tested, random forest and logistic regression performed best, although all approaches predicted non-native fish establishment with moderate to excellent results. Detailed evaluation among the models corresponded with differences in variables importance, with three biological variables (parental care, distance from nearest native source and maximum size and two variables of human interest (prior invasion success and propagule pressure being important in predicting establishment. The analyzed statistical methods presented have a high predictive power and can be used as a risk assessment tool to prevent future freshwater fish invasions in this region with an imperiled fish fauna.

  8. The overlap syndrome of asthma and COPD: what are its features and how important is it?

    Science.gov (United States)

    Gibson, P G; Simpson, J L

    2009-08-01

    There is a need to re-evaluate the concept of asthma and chronic obstructive pulmonary disease (COPD) as separate conditions, and to consider situations when they may coexist, or when one condition may evolve into the other. Epidemiological studies show that in older people with obstructive airway disease, as many as half or more may have overlapping diagnoses of asthma and COPD (overlap syndrome). These people are typically excluded from current therapy trials, which limit the generalisability of these trials, and this presents a problem for evidence-based guidelines for obstructive airway diseases. Studying overlap syndrome may shed light on the mechanisms of COPD development. Overlap syndrome is recognised by the coexistence of increased variability of airflow in a patient with incompletely reversible airway obstruction. Patients typically have inflammatory features that resemble COPD, with increased airway neutrophilia, as well as features of airway wall remodelling. Overlap syndrome can develop when there is accelerated decline in lung function, or incomplete lung growth, or both. The risk factors for these events are shared, such that increasing age, bronchial hyper-responsiveness, tobacco smoke exposure, asthma and lower respiratory infections/exacerbations are significant risk factors for both incomplete lung growth and accelerated loss of lung function. Studying these events may offer new insights into the mechanisms and treatment of obstructive airway diseases.

  9. Clinically Important Features of Porphyrin and Heme Metabolism and the Porphyrias

    Directory of Open Access Journals (Sweden)

    Siddesh Besur

    2014-11-01

    Full Text Available Heme, like chlorophyll, is a primordial molecule and is one of the fundamental pigments of life. Disorders of normal heme synthesis may cause human diseases, including certain anemias (X-linked sideroblastic anemias and porphyrias. Porphyrias are classified as hepatic and erythropoietic porphyrias based on the organ system in which heme precursors (5-aminolevulinic acid (ALA, porphobilinogen and porphyrins are chiefly overproduced. The hepatic porphyrias are further subdivided into acute porphyrias and chronic hepatic porphyrias. The acute porphyrias include acute intermittent, hereditary copro-, variegate and ALA dehydratase deficiency porphyria. Chronic hepatic porphyrias include porphyria cutanea tarda and hepatoerythropoietic porphyria. The erythropoietic porphyrias include congenital erythropoietic porphyria (Gűnther’s disease and erythropoietic protoporphyria. In this review, we summarize the key features of normal heme synthesis and its differing regulation in liver versus bone marrow. In both organs, principal regulation is exerted at the level of the first and rate-controlling enzyme, but by different molecules (heme in the liver and iron in the bone marrow. We also describe salient clinical, laboratory and genetic features of the eight types of porphyria.

  10. The market features of imported non-indigenous polychaetes in Portugal and consequent ecological concerns

    Directory of Open Access Journals (Sweden)

    Pedro Fidalgo e Costa

    2006-12-01

    Full Text Available The importance of the market for polychaetes dramatically increased after the discovery of their potential as food in aquaculture. In Portugal, the gathering of polychaetes solely from natural populations is not sufficient to meet market demand, both as bait for sea anglers and as a food item in aquaculture. The requests for worms to polychaete dealers by Portuguese and Spanish seafarms have increased during recent years. Due to the lack of intensive culture of these worms in Portugal and the proximity of southern Spanish farms, a large component of imported polychaetes that arrive in Portugal at Lisbon Airport go directly to Spain by road. In 2002 and 2003 a total of 12,728,379 and 16,866,839 polychaetes respectively were imported to Europe via Lisbon Airport from China and the USA. In 2003 the imports from China and the USA realised 716,180 and 291,845 US dollars respectively. Two species were reported to have been imported in these years, namely the Korean blue ragworm Perinereis aibuhitensis and the American bloodworm Glycera dibranchiata. Imports of non-indigenous species, which are traded and sold alive, may increase the risk of accidental introduction into the wild. This is of special concern as Perinereis aibuhitensis has been successfully reared in captivity within the range of environmental conditions existing in the Ria Formosa coastal lagoon. Other risks associated with introduced species are the transport of foreign pathogens and other associated non-native organisms, which may act as carriers of disease.

  11. Modeling vehicle emissions in different types of Chinese cities: importance of vehicle fleet and local features.

    Science.gov (United States)

    Huo, Hong; Zhang, Qiang; He, Kebin; Yao, Zhiliang; Wang, Xintong; Zheng, Bo; Streets, David G; Wang, Qidong; Ding, Yan

    2011-10-01

    We propose a method to simulate vehicle emissions in Chinese cities of different sizes and development stages. Twenty two cities are examined in this study. The target year is 2007. Among the cities, the vehicle emission factors were remarkably different (the highest is 50-90% higher than the lowest) owing to their distinct local features and vehicle technology levels, and the major contributors to total vehicle emissions were also different. A substantial increase in vehicle emissions is foreseeable unless stronger measures are implemented because the benefit of current policies can be quickly offset by the vehicle growth. Major efforts should be focused on all cities, especially developing cities where the requirements are lenient. This work aims a better understanding of vehicle emissions in all types of Chinese cities. The proposed method could benefit national emission inventory studies in improving accuracy and help in designing national and local policies for vehicle emission control. Copyright © 2011 Elsevier Ltd. All rights reserved.

  12. Combining textual and non-textual features for e-mail importance estimation

    NARCIS (Netherlands)

    Sappelli, M.; Verberne, S.; Kraaij, W.

    2013-01-01

    In this work, we present a binary classification problem in which we aim to identify those email messages that the receiver will reply to. The future goal is to develop a tool that informs a knowledge worker which emails are likely to need a reply. The Enron corpus was used to extract training

  13. Estimation of minimum sample size for identification of the most important features: a case study providing a qualitative B2B sales data set

    OpenAIRE

    Marko Bohanec; Mirjana Kljajić Borštnar; Marko Robnik-Šikonja

    2017-01-01

    An important task in machine learning is to reduce data set dimensionality, which in turn contributes to reducing computational load and data collection costs, while improving human understanding and interpretation of models. We introduce an operational guideline for determining the minimum number of instances sufficient to identify correct ranks of features with the highest impact. We conduct tests based on qualitative B2B sales forecasting data. The results show that a relatively small inst...

  14. Competence Description for Personal Recommendations: The Importance of Identifying the Complexity of Learning and Performance Situations

    Science.gov (United States)

    Prins, Frans J.; Nadolski, Rob J.; Berlanga, Adriana J.; Drachsler, Hendrik; Hummel, Hans G. K.; Koper, Rob

    2008-01-01

    For competences development of learners and professionals, target competences and corresponding competence development opportunities have to be identified. Personal Recommender Systems (PRS) provide personal recommendations for learners aimed at finding and selecting learning activities that best match their needs. This article argues that a…

  15. Identifying Important Career Indicators of Undergraduate Geoscience Students Upon Completion of Their Degree

    Science.gov (United States)

    Wilson, C. E.; Keane, C. M.; Houlton, H. R.

    2012-12-01

    The American Geosciences Institute (AGI) decided to create the National Geoscience Student Exit Survey in order to identify the initial pathways into the workforce for these graduating students, as well as assess their preparedness for entering the workforce upon graduation. The creation of this survey stemmed from a combination of experiences with the AGI/AGU Survey of Doctorates and discussions at the following Science Education Research Center (SERC) workshops: "Developing Pathways to Strong Programs for the Future", "Strengthening Your Geoscience Program", and "Assessing Geoscience Programs". These events identified distinct gaps in understanding the experiences and perspectives of geoscience students during one of their most profound professional transitions. Therefore, the idea for the survey arose as a way to evaluate how the discipline is preparing and educating students, as well as identifying the students' desired career paths. The discussions at the workshops solidified the need for this survey and created the initial framework for the first pilot of the survey. The purpose of this assessment tool is to evaluate student preparedness for entering the geosciences workforce; identify student decision points for entering geosciences fields and remaining in the geosciences workforce; identify geosciences fields that students pursue in undergraduate and graduate school; collect information on students' expected career trajectories and geosciences professions; identify geosciences career sectors that are hiring new graduates; collect information about salary projections; overall effectiveness of geosciences departments regionally and nationally; demonstrate the value of geosciences degrees to future students, the institutions, and employers; and establish a benchmark to perform longitudinal studies of geosciences graduates to understand their career pathways and impacts of their educational experiences on these decisions. AGI's Student Exit Survey went through

  16. Accessible surface area of proteins from purely sequence information and the importance of global features

    Science.gov (United States)

    Faraggi, Eshel; Zhou, Yaoqi; Kloczkowski, Andrzej

    2014-03-01

    We present a new approach for predicting the accessible surface area of proteins. The novelty of this approach lies in not using residue mutation profiles generated by multiple sequence alignments as descriptive inputs. Rather, sequential window information and the global monomer and dimer compositions of the chain are used. We find that much of the lost accuracy due to the elimination of evolutionary information is recouped by the use of global features. Furthermore, this new predictor produces similar results for proteins with or without sequence homologs deposited in the Protein Data Bank, and hence shows generalizability. Finally, these predictions are obtained in a small fraction (1/1000) of the time required to run mutation profile based prediction. All these factors indicate the possible usability of this work in de-novo protein structure prediction and in de-novo protein design using iterative searches. Funded in part by the financial support of the National Institutes of Health through Grants R01GM072014 and R01GM073095, and the National Science Foundation through Grant NSF MCB 1071785.

  17. LEADERSHIP IMPORTANCE AND ROLE IN THE PUBLIC SECTOR - FEATURES IN THE CONTEMPORARY CONTEXT

    Directory of Open Access Journals (Sweden)

    MAGDALENA IORDACHE-PLATIS

    2011-04-01

    Full Text Available Nowadays leadership is considered a managerial and organizational process that influences and guides the activities of the companies. As a management process, leadership can systematically influence the relationships that occur between managers and employees as a result of applying the management functions application. This study aims to highlight the main elements that designate the modern and revolutionary concept named”leadership”. The main objectives of the study are: 1. explaining the importance of leadership in the contemporary context; 2. analyzing the similarities and differences between two seemingly similar concepts - “leadership” and “management”; 3. description of the main management styles; 4. analyzing the correlation between leadership and emotional intelligence; 5. explaining leadership role in the public sector in Romania. In every company leadership has a very important role in achieving performance. The leader also plays an important role in a company, because a leader is the person who influences the behavior, actions, positive or negative attitude of others who are determined to act and take decisions voluntarily without fear of being punished if they do not follow the leader. Emotional self-awareness, trust, adaptability, initiative, optimism and team spirit are the ingredients of modern management style which determines the competitiveness of an organization.

  18. Solid state radiation chemistry. Features important in basic research and applications

    International Nuclear Information System (INIS)

    Zagorski, Z.P.

    1998-01-01

    The basic research of chemical radiation effects has been mostly proceeded in aqueous systems. When one turns from aqueous to the 'dry solute' systems, reactions are running in a very different way. The examined compound, previously the solute, becomes then the only constituent of the system, absorbing all ionising energy. Majority of dosimeters and of radiation processed systems is solid: these are crystalline or rigid substances of high viscosity, sometimes of complicated phase-compositions being no longer homogenous like liquids. Main features of the solid (and rigid) state radiation chemistry is to be discussed in five parts: I. Character of absorption process. Absorption of radiation is in all media heterogenous on the molecular level, i.e. with formation of single- and multi-ionisation spurs. The yield of the latters is 15-25% of the total ionisations, depending on the system, even at low LET radiation. In spite of random distribution of initial ionisations, the single-ionisation spurs can turn rapidly into specifically arranged, temporal localisations. The variety of spur reactions is usually more complicated than that in aqueous systems. II. Character of transients. Intermediates in solid state radiation chemistry exhibit very different transport properties: from free electrons moving fast and far, to electrons changing the position by different physicochemical mechanisms, to easy movable H-atoms, and to practically unmovable, only vibrating, new fragments of a lattice or glass. III. Paramagnetic intermediates. Radicals living for microseconds in liquids, when created and trapped in a solid matrix are usually very stable, e.g. they can have a difference of half-life times of 12 orders of magnitude, however their chemical composition remais identical. (author)

  19. Genome-wide association study identified copy number variants important for appendicular lean mass.

    Science.gov (United States)

    Ran, Shu; Liu, Yong-Jun; Zhang, Lei; Pei, Yufang; Yang, Tie-Lin; Hai, Rong; Han, Ying-Ying; Lin, Yong; Tian, Qing; Deng, Hong-Wen

    2014-01-01

    Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM), is a heritable trait. Copy number variation (CNV) is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2) and 3.34×10(-3), respectively). In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2) and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1), which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL) gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.

  20. Genome-wide association study identified copy number variants important for appendicular lean mass.

    Directory of Open Access Journals (Sweden)

    Shu Ran

    Full Text Available Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM, is a heritable trait. Copy number variation (CNV is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2 and 3.34×10(-3, respectively. In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2 and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1, which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.

  1. Identifying faecal impaction is important for ensuring the timely diagnosis of childhood functional constipation

    DEFF Research Database (Denmark)

    Modin, Line; Walsted, Anne-Mette; Jakobsen, Marianne Skytte

    2015-01-01

    AIM: Most research on functional constipation has been carried out at a tertiary level. We focused this study on a secondary-level hospital outpatients' department, assessing the distribution of diagnostic criteria for childhood functional constipation and evaluating the consequences of current...... diagnostic practice based on current guidelines. METHODS: We enrolled 235 children, aged two to 16 years of age, with functional constipation according to the Rome III criteria and assessed them using medical histories and physical examinations, including rectal examinations and ultrasound measurements...... the timely diagnosis of childhood functional constipation at the secondary care level. Ultrasound examination proved a reliable alternative to rectal examination or abdominal radiography when identifying faecal impaction....

  2. Safety issues for LMFBR: important features drawn from the assessments of Superphenix

    International Nuclear Information System (INIS)

    Natta, M.

    2002-01-01

    Superphenix, which is built on the site of Creys-Malville, is still the biggest LMFBR plant that has been in operation. It is a pool type reactor, as Phenix and the RNR 1 500 and EFR projects. After the analysis of the preliminary safety (1974-1975), the construction was authorised by decree of the Prime Minister in 1977, the authorization for fuel loading and star-up to 3% was given by the minister of industry in July 1985 and full power was achieved in December 1986. The plant was operated until the end of December 1996, producing the equivalent of 320 EFPD, corresponding to half of the maximum barn-up of the first core. The plant was definitively stopped on the 20. of April 1998 by a decision of the French government. During this period of 25 years of licensing, construction and operation of Superphenix, others discussions and preliminary licensing procedures were started for new projects, mainly the RNR 1500 French project and the EFR European project. The operation of Superphenix was also marked by several incidents, which led to additional licensing procedures and important modifications. This period was also marked by an important work of research and development in the safety field, mostly related to the issues concerning hypothetical core disruptive accidents (HCDA) and sodium fires; further, this period was marked by the Three Mile Island accident in 1979 and the Chernobyl accident in 1986. The purpose of this paper is to present some items which were discussed during this period of 25 years and which should be of interest for future LMFBRs. In this presentation, we shall discuss the key issues concerning the safety criteria and options taken with respect to severe accidents, i.e. core melt accidents, giving details on some specific which are less known since they were assessed only lately for Superphenix, sometimes in connection with the on-going safety researches. (author)

  3. Resistance to degradation and cellular distribution are important features for the antitumor activity of gomesin.

    Directory of Open Access Journals (Sweden)

    Marcus V Buri

    Full Text Available Many reports have shown that antimicrobial peptides exhibit anticancer abilities. Gomesin (Gm exhibits potent cytotoxic activity against cancer cells by a membrane pore formation induced after well-orchestrated intracellular mechanisms. In this report, the replacements of the Cys by Ser or Thr, and the use D-amino acids in the Gm structure were done to investigate the importance of the resistance to degradation of the molecule with its cytotoxicity. [Thr(2,6,11,15]-Gm, and [Ser(2,6,11,15]-Gm exhibits low cytotoxicity, and low resistance to degradation, and after 24 h are present in localized area near to the membrane. Conversely, the use of D-amino acids in the analogue [D-Thr(2,6,11,15]-D-Gm confers resistance to degradation, increases its potency, and maintained this peptide spread in the cytosol similarly to what happens with Gm. Replacements of Cys by Thr and Gln by L- or D-Pro ([D-Thr(2,6,11,15, Pro(9]-D-Gm, and [Thr(2,6,11,15, D-Pro(9]-Gm, which induced a similar β-hairpin conformation, also increase their resistance to degradation, and cytotoxicity, but after 24 h they are not present spread in the cytosol, exhibiting lower cytotoxicity in comparison to Gm. Additionally, chloroquine, a lysosomal enzyme inhibitor potentiated the effect of the peptides. Furthermore, the binding and internalization of peptides was determined, but a direct correlation among these factors was not observed. However, cholesterol ablation, which increase fluidity of cellular membrane, also increase cytotoxicity and internalization of peptides. β-hairpin spatial conformation, and intracellular localization/target, and the capability of entry are important properties of gomesin cytotoxicity.

  4. Resistance to degradation and cellular distribution are important features for the antitumor activity of gomesin.

    Science.gov (United States)

    Buri, Marcus V; Domingues, Tatiana M; Paredes-Gamero, Edgar J; Casaes-Rodrigues, Rafael L; Rodrigues, Elaine Guadelupe; Miranda, Antonio

    2013-01-01

    Many reports have shown that antimicrobial peptides exhibit anticancer abilities. Gomesin (Gm) exhibits potent cytotoxic activity against cancer cells by a membrane pore formation induced after well-orchestrated intracellular mechanisms. In this report, the replacements of the Cys by Ser or Thr, and the use D-amino acids in the Gm structure were done to investigate the importance of the resistance to degradation of the molecule with its cytotoxicity. [Thr(2,6,11,15)]-Gm, and [Ser(2,6,11,15)]-Gm exhibits low cytotoxicity, and low resistance to degradation, and after 24 h are present in localized area near to the membrane. Conversely, the use of D-amino acids in the analogue [D-Thr(2,6,11,15)]-D-Gm confers resistance to degradation, increases its potency, and maintained this peptide spread in the cytosol similarly to what happens with Gm. Replacements of Cys by Thr and Gln by L- or D-Pro ([D-Thr(2,6,11,15), Pro(9)]-D-Gm, and [Thr(2,6,11,15), D-Pro(9)]-Gm), which induced a similar β-hairpin conformation, also increase their resistance to degradation, and cytotoxicity, but after 24 h they are not present spread in the cytosol, exhibiting lower cytotoxicity in comparison to Gm. Additionally, chloroquine, a lysosomal enzyme inhibitor potentiated the effect of the peptides. Furthermore, the binding and internalization of peptides was determined, but a direct correlation among these factors was not observed. However, cholesterol ablation, which increase fluidity of cellular membrane, also increase cytotoxicity and internalization of peptides. β-hairpin spatial conformation, and intracellular localization/target, and the capability of entry are important properties of gomesin cytotoxicity.

  5. Resistance to Degradation and Cellular Distribution are Important Features for the Antitumor Activity of Gomesin

    Science.gov (United States)

    Buri, Marcus V.; Domingues, Tatiana M.; Paredes-Gamero, Edgar J.; Casaes-Rodrigues, Rafael L.; Rodrigues, Elaine Guadelupe; Miranda, Antonio

    2013-01-01

    Many reports have shown that antimicrobial peptides exhibit anticancer abilities. Gomesin (Gm) exhibits potent cytotoxic activity against cancer cells by a membrane pore formation induced after well-orchestrated intracellular mechanisms. In this report, the replacements of the Cys by Ser or Thr, and the use D-amino acids in the Gm structure were done to investigate the importance of the resistance to degradation of the molecule with its cytotoxicity. [Thr2,6,11,15]-Gm, and [Ser2,6,11,15]-Gm exhibits low cytotoxicity, and low resistance to degradation, and after 24 h are present in localized area near to the membrane. Conversely, the use of D-amino acids in the analogue [D-Thr2,6,11,15]-D-Gm confers resistance to degradation, increases its potency, and maintained this peptide spread in the cytosol similarly to what happens with Gm. Replacements of Cys by Thr and Gln by L- or D-Pro ([D-Thr2,6,11,15, Pro9]-D-Gm, and [Thr2,6,11,15, D-Pro9]-Gm), which induced a similar β-hairpin conformation, also increase their resistance to degradation, and cytotoxicity, but after 24 h they are not present spread in the cytosol, exhibiting lower cytotoxicity in comparison to Gm. Additionally, chloroquine, a lysosomal enzyme inhibitor potentiated the effect of the peptides. Furthermore, the binding and internalization of peptides was determined, but a direct correlation among these factors was not observed. However, cholesterol ablation, which increase fluidity of cellular membrane, also increase cytotoxicity and internalization of peptides. β-hairpin spatial conformation, and intracellular localization/target, and the capability of entry are important properties of gomesin cytotoxicity. PMID:24312251

  6. Biologically important conformational features of DNA as interpreted by quantum mechanics and molecular mechanics computations of its simple fragments.

    Science.gov (United States)

    Poltev, V; Anisimov, V M; Dominguez, V; Gonzalez, E; Deriabina, A; Garcia, D; Rivas, F; Polteva, N A

    2018-02-01

    Deciphering the mechanism of functioning of DNA as the carrier of genetic information requires identifying inherent factors determining its structure and function. Following this path, our previous DFT studies attributed the origin of unique conformational characteristics of right-handed Watson-Crick duplexes (WCDs) to the conformational profile of deoxydinucleoside monophosphates (dDMPs) serving as the minimal repeating units of DNA strand. According to those findings, the directionality of the sugar-phosphate chain and the characteristic ranges of dihedral angles of energy minima combined with the geometric differences between purines and pyrimidines determine the dependence on base sequence of the three-dimensional (3D) structure of WCDs. This work extends our computational study to complementary deoxydinucleotide-monophosphates (cdDMPs) of non-standard conformation, including those of Z-family, Hoogsteen duplexes, parallel-stranded structures, and duplexes with mispaired bases. For most of these systems, except Z-conformation, computations closely reproduce experimental data within the tolerance of characteristic limits of dihedral parameters for each conformation family. Computation of cdDMPs with Z-conformation reveals that their experimental structures do not correspond to the internal energy minimum. This finding establishes the leading role of external factors in formation of the Z-conformation. Energy minima of cdDMPs of non-Watson-Crick duplexes demonstrate different sequence-dependence features than those known for WCDs. The obtained results provide evidence that the biologically important regularities of 3D structure distinguish WCDs from duplexes having non-Watson-Crick nucleotide pairing.

  7. Categorical templates are more useful when features are consistent: Evidence from eye movements during search for societally important vehicles.

    Science.gov (United States)

    Hout, Michael C; Robbins, Arryn; Godwin, Hayward J; Fitzsimmons, Gemma; Scarince, Collin

    2017-08-01

    Unlike in laboratory visual search tasks-wherein participants are typically presented with a pictorial representation of the item they are asked to seek out-in real-world searches, the observer rarely has veridical knowledge of the visual features that define their target. During categorical search, observers look for any instance of a categorically defined target (e.g., helping a family member look for their mobile phone). In these circumstances, people may not have information about noncritical features (e.g., the phone's color), and must instead create a broad mental representation using the features that define (or are typical of) the category of objects they are seeking out (e.g., modern phones are typically rectangular and thin). In the current investigation (Experiment 1), using a categorical visual search task, we add to the body of evidence suggesting that categorical templates are effective enough to conduct efficient visual searches. When color information was available (Experiment 1a), attentional guidance, attention restriction, and object identification were enhanced when participants looked for categories with consistent features (e.g., ambulances) relative to categories with more variable features (e.g., sedans). When color information was removed (Experiment 1b), attention benefits disappeared, but object recognition was still better for feature-consistent target categories. In Experiment 2, we empirically validated the relative homogeneity of our societally important vehicle stimuli. Taken together, our results are in line with a category-consistent view of categorical target templates (Yu, Maxfield, & Zelinsky in, Psychological Science, 2016. doi: 10.1177/0956797616640237 ), and suggest that when features of a category are consistent and predictable, searchers can create mental representations that allow for the efficient guidance and restriction of attention as well as swift object identification.

  8. A case study of identify importance of land use planning in road safety, Benidorm

    Energy Technology Data Exchange (ETDEWEB)

    Casares Blanco, J.; Sanchez Galiano, J.C.; Fernandez Aracil, P.; Ortuño Padilla, A.

    2016-07-01

    This research analyses how urban form, land use and urban density, may influence the incidence of traffic-related crashes injuries and deaths. It begins with a theoretical overview of studies which deal with the study of the relationship between urban patterns and road safety. Next, it details the development of a database of crash incidence and urban form at the district level for the city of Benidorm (Alicante, Spain) in 2010. Subsequently, it is developed a negative binomial approach for intra-city motor vehicle crash analysis. One-year crash data for Benidorm (the fourth largest tourism destination of Spain, after Barcelona, Madrid and San Bartolomé de Tirajana, and exclusively tourist-oriented city) are analyzed using a geographic information system (GIS) to generate relevant inputs for the analysis. In general, the study finds that a strong land use mix results on fewer road accidents, whereas accidents are more common but less severe in areas of high urban density. Finally, pedestrian accidents research showed that rural and low density environment is related to an important road accident numbers unlike tourism-oriented zones, much more safe for them. Based on these findings, the paper discusses the implications for urban design practice. (Author)

  9. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  10. [Importance of the hyperuricaemia, gout and gender nosological features in the activity of general practitioner - family doctor].

    Science.gov (United States)

    Rudichenko, V M

    2012-01-01

    In this article there were analyzed gender data about features of hyperuricaemia and gout: women are much older at the onset of gout arthritis (one of main reasons, probably, makes menopause by itself), have more associated comorbid deseases as hypertension and kidney failure and drinks less alcoholic beverages. It was noticed, that typical localisation of the lesion on the first toe is less often in women, and women are more inclined to use diuretics among medical drugs. Abovementioned clinical features are of some importance for the broad activity of general practitioners - family doctors. Gender features of polyarthicular gout are not uniformed. Scientific researches confirmed possibility of the genetic basis of the uric acid metabolism, which influences some fenotypical features of the organism. Several genes are known for their influence on serum uric acid: PDZK1, GCKR, SLC2A9, ABCG2, LRRC16A, SLC17A3, SLC16A9 and SLC22A12. However, conclusions of the research works confirm the necessity of scientific clarification of the importance of different factors of gender differences.

  11. Promoting wellbeing in young unemployed adults: the importance of identifying meaningful patterns of time use.

    Science.gov (United States)

    Scanlan, Justin Newton; Bundy, Anita C; Matthews, Lynda R

    2011-04-01

    This study set out to explore the differences in time use between 'unemployed', 'unemployed but in education' and part-time and full-time employed 18- to 25-year-old Australians. Unemployed individuals generally experience poor health and this may be related to the way they use their time. Activity-based interventions may be one health-promoting strategy. This knowledge is important for all occupational therapists, as many service users are likely to be unemployed. Time use of unemployed 18- to 25-year-olds (measured using the Modified Occupational Questionnaire) was compared with the time use of part- and full-time employed 18- to 25-year-olds (from the 2006 Australian Time Use Survey). Individuals in the 'unemployed' groups spent significantly less time engaged in work-related activities than their employed peers. This time was reallocated mainly to recreation and leisure and household work (for both men and women) and child care and sleeping (women only). Recreation and leisure activities were generally passive, home-based activities such as watching television or 'doing nothing'. Individuals in the 'unemployed but in education' groups also spent less time in employment-related activities, but the majority of this time was reallocated to education activities. Individuals in the 'unemployed' groups spent large amounts of time engaged in potentially non-directed use of time (e.g. watching television or 'doing nothing'). Such patterns of time use have previously been associated with poor health. To support the health of unemployed individuals more effectively, occupational therapy interventions must focus on enhancing the quality of time use for this population. © 2010 The Authors. Australian Occupational Therapy Journal © 2010 Australian Association of Occupational Therapists.

  12. System and method employing a minimum distance and a load feature database to identify electric load types of different electric loads

    Science.gov (United States)

    Lu, Bin; Yang, Yi; Sharma, Santosh K; Zambare, Prachi; Madane, Mayura A

    2014-12-23

    A method identifies electric load types of a plurality of different electric loads. The method includes providing a load feature database of a plurality of different electric load types, each of the different electric load types including a first load feature vector having at least four different load features; sensing a voltage signal and a current signal for each of the different electric loads; determining a second load feature vector comprising at least four different load features from the sensed voltage signal and the sensed current signal for a corresponding one of the different electric loads; and identifying by a processor one of the different electric load types by determining a minimum distance of the second load feature vector to the first load feature vector of the different electric load types of the load feature database.

  13. Safe storage of pesticides in Sri Lanka - identifying important design features influencing community acceptance and use of safe storage devices

    DEFF Research Database (Denmark)

    Weerasinghe, Manjula; Pieris, Ravi; Eddleston, Michael

    2008-01-01

    BACKGROUND: Self-poisoning with pesticides is the cause of an estimated 300,000 deaths annually in rural Asia. The great majority of these deaths are from impulsive acts of self-harm using pesticides that are readily available in the home. The secure storage of pesticides under lock has been...

  14. In vitro and in vivo studies identify important features of dengue virus pr-E protein interactions.

    Directory of Open Access Journals (Sweden)

    Aihua Zheng

    2010-10-01

    Full Text Available Flaviviruses bud into the endoplasmic reticulum and are transported through the secretory pathway, where the mildly acidic environment triggers particle rearrangement and allows furin processing of the prM protein to pr and M. The peripheral pr peptide remains bound to virus at low pH and inhibits virus-membrane interaction. Upon exocytosis, the release of pr at neutral pH completes virus maturation to an infectious particle. Together this evidence suggests that pr may shield the flavivirus fusion protein E from the low pH environment of the exocytic pathway. Here we developed an in vitro system to reconstitute the interaction of dengue virus (DENV pr with soluble truncated E proteins. At low pH recombinant pr bound to both monomeric and dimeric forms of E and blocked their membrane insertion. Exogenous pr interacted with mature infectious DENV and specifically inhibited virus fusion and infection. Alanine substitution of E H244, a highly conserved histidine residue in the pr-E interface, blocked pr-E interaction and reduced release of DENV virus-like particles. Folding, membrane insertion and trimerization of the H244A mutant E protein were preserved, and particle release could be partially rescued by neutralization of the low pH of the secretory pathway. Thus, pr acts to silence flavivirus fusion activity during virus secretion, and this function can be separated from the chaperone activity of prM. The sequence conservation of key residues involved in the flavivirus pr-E interaction suggests that this protein-protein interface may be a useful target for broad-spectrum inhibitors.

  15. Comprehensive metabolomics identified lipid peroxidation as a prominent feature in human plasma of patients with coronary heart diseases

    Directory of Open Access Journals (Sweden)

    Jianhong Lu

    2017-08-01

    Full Text Available Coronary heart disease (CHD is a complex human disease associated with inflammation and oxidative stress. The underlying mechanisms and diagnostic biomarkers for the different types of CHD remain poorly defined. Metabolomics has been increasingly recognized as an enabling technique with the potential to identify key metabolomic features in an attempt to understand the pathophysiology and differentiate different stages of CHD. We performed comprehensive metabolomic analysis in human plasma from 28 human subjects with stable angina (SA, myocardial infarction (MI, and healthy control (HC. Subsequent analysis demonstrated a uniquely altered metabolic profile in these CHD: a total of 18, 37 and 36 differential metabolites were identified to distinguish SA from HC, MI from SA, and MI from HC groups respectively. Among these metabolites, glycerophospholipid (GPL metabolism emerged as the most significantly disturbed pathway. Next, we used a targeted metabolomic approach to systematically analyze GPL, oxidized phospholipid (oxPL, and downstream metabolites derived from polyunsaturated fatty acids (PUFAs, such as arachidonic acid and linoleic acid. Surprisingly, lipids associated with lipid peroxidation (LPO pathways including oxidized PL and isoprostanes, isomers of prostaglandins, were significantly elevated in plasma of MI patients comparing to HC and SA, consistent with the notion that oxidative stress-induced LPO is a prominent feature in CHD. Our studies using the state-of-the-art metabolomics help to understand the underlying biological mechanisms involved in the pathogenesis of CHD; LPO metabolites may serve as potential biomarkers to differentiation MI from SA and HC. Keywords: Metabolomics, Lipid peroxidation, Lipidomics, Myocardial infarction, Isoprostanes, Coronary heart disease (CHD

  16. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C-dubliniensis

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, PHM

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  17. An evaluation of applicability of seismic refraction method in identifying shallow archaeological features A case study at archaeological site

    Science.gov (United States)

    Jahangardi, Morteza; Hafezi Moghaddas, Naser; Keivan Hosseini, Sayyed; Garazhian, Omran

    2015-04-01

    We applied the seismic refraction method at archaeological site, Tepe Damghani located in Sabzevar, NE of Iran, in order to determine the structures of archaeological interests. This pre-historical site has special conditions with respect to geographical location and geomorphological setting, so it is an urban archaeological site, and in recent years it has been used as an agricultural field. In spring and summer of 2012, the third season of archaeological excavation was carried out. Test trenches of excavations in this site revealed that cultural layers were often disturbed adversely due to human activities such as farming and road construction in recent years. Conditions of archaeological cultural layers in southern and eastern parts of Tepe are slightly better, for instance, in test trench 3×3 m²1S03, third test trench excavated in the southern part of Tepe, an adobe in situ architectural structure was discovered that likely belongs to cultural features of a complex with 5 graves. After conclusion of the third season of archaeological excavation, all of the test trenches were filled with the same soil of excavated test trenches. Seismic refraction method was applied with12 channels of P geophones in three lines with a geophone interval of 0.5 meter and a 1.5 meter distance between profiles on test trench 1S03. The goal of this operation was evaluation of applicability of seismic method in identification of archaeological features, especially adobe wall structures. Processing of seismic data was done with the seismic software, SiesImager. Results were presented in the form of seismic section for every profile, so that identification of adobe wall structures was achieved hardly. This could be due to that adobe wall had been built with the same materials of the natural surrounding earth. Thus, there is a low contrast and it has an inappropriate effect on seismic processing and identifying of archaeological features. Hence the result could be that application of

  18. Accurately Identifying New QoS Violation Driven by High-Distributed Low-Rate Denial of Service Attacks Based on Multiple Observed Features

    Directory of Open Access Journals (Sweden)

    Jian Kang

    2015-01-01

    Full Text Available We propose using multiple observed features of network traffic to identify new high-distributed low-rate quality of services (QoS violation so that detection accuracy may be further improved. For the multiple observed features, we choose F feature in TCP packet header as a microscopic feature and, P feature and D feature of network traffic as macroscopic features. Based on these features, we establish multistream fused hidden Markov model (MF-HMM to detect stealthy low-rate denial of service (LDoS attacks hidden in legitimate network background traffic. In addition, the threshold value is dynamically adjusted by using Kaufman algorithm. Our experiments show that the additive effect of combining multiple features effectively reduces the false-positive rate. The average detection rate of MF-HMM results in a significant 23.39% and 44.64% improvement over typical power spectrum density (PSD algorithm and nonparametric cumulative sum (CUSUM algorithm.

  19. The hierarchy-by-interval approach to identifying important models that need improvement in severe-accident simulation codes

    International Nuclear Information System (INIS)

    Heames, T.J.; Khatib-Rahbar, M.; Kelly, J.E.

    1995-01-01

    The hierarchy-by-interval (HBI) methodology was developed to determine an appropriate phenomena identification and ranking table for an independent peer review of severe-accident computer codes. The methodology is described, and the results of a specific code review are presented. Use of this systematic and structured approach ensures that important code models that need improvement are identified and prioritized, which allows code sponsors to more effectively direct limited resources in future code development. In addition, critical phenomenological areas that need more fundamental work, such as experimentation, are identified

  20. Cosmetics as a Feature of the Extended Human Phenotype: Modulation of the Perception of Biologically Important Facial Signals

    Science.gov (United States)

    Etcoff, Nancy L.; Stock, Shannon; Haley, Lauren E.; Vickery, Sarah A.; House, David M.

    2011-01-01

    Research on the perception of faces has focused on the size, shape, and configuration of inherited features or the biological phenotype, and largely ignored the effects of adornment, or the extended phenotype. Research on the evolution of signaling has shown that animals frequently alter visual features, including color cues, to attract, intimidate or protect themselves from conspecifics. Humans engage in conscious manipulation of visual signals using cultural tools in real time rather than genetic changes over evolutionary time. Here, we investigate one tool, the use of color cosmetics. In two studies, we asked viewers to rate the same female faces with or without color cosmetics, and we varied the style of makeup from minimal (natural), to moderate (professional), to dramatic (glamorous). Each look provided increasing luminance contrast between the facial features and surrounding skin. Faces were shown for 250 ms or for unlimited inspection time, and subjects rated them for attractiveness, competence, likeability and trustworthiness. At 250 ms, cosmetics had significant positive effects on all outcomes. Length of inspection time did not change the effect for competence or attractiveness. However, with longer inspection time, the effect of cosmetics on likability and trust varied by specific makeup looks, indicating that cosmetics could impact automatic and deliberative judgments differently. The results suggest that cosmetics can create supernormal facial stimuli, and that one way they may do so is by exaggerating cues to sexual dimorphism. Our results provide evidence that judgments of facial trustworthiness and attractiveness are at least partially separable, that beauty has a significant positive effect on judgment of competence, a universal dimension of social cognition, but has a more nuanced effect on the other universal dimension of social warmth, and that the extended phenotype significantly influences perception of biologically important signals at first

  1. Cosmetics as a feature of the extended human phenotype: modulation of the perception of biologically important facial signals.

    Directory of Open Access Journals (Sweden)

    Nancy L Etcoff

    Full Text Available Research on the perception of faces has focused on the size, shape, and configuration of inherited features or the biological phenotype, and largely ignored the effects of adornment, or the extended phenotype. Research on the evolution of signaling has shown that animals frequently alter visual features, including color cues, to attract, intimidate or protect themselves from conspecifics. Humans engage in conscious manipulation of visual signals using cultural tools in real time rather than genetic changes over evolutionary time. Here, we investigate one tool, the use of color cosmetics. In two studies, we asked viewers to rate the same female faces with or without color cosmetics, and we varied the style of makeup from minimal (natural, to moderate (professional, to dramatic (glamorous. Each look provided increasing luminance contrast between the facial features and surrounding skin. Faces were shown for 250 ms or for unlimited inspection time, and subjects rated them for attractiveness, competence, likeability and trustworthiness. At 250 ms, cosmetics had significant positive effects on all outcomes. Length of inspection time did not change the effect for competence or attractiveness. However, with longer inspection time, the effect of cosmetics on likability and trust varied by specific makeup looks, indicating that cosmetics could impact automatic and deliberative judgments differently. The results suggest that cosmetics can create supernormal facial stimuli, and that one way they may do so is by exaggerating cues to sexual dimorphism. Our results provide evidence that judgments of facial trustworthiness and attractiveness are at least partially separable, that beauty has a significant positive effect on judgment of competence, a universal dimension of social cognition, but has a more nuanced effect on the other universal dimension of social warmth, and that the extended phenotype significantly influences perception of biologically important

  2. Cosmetics as a feature of the extended human phenotype: modulation of the perception of biologically important facial signals.

    Science.gov (United States)

    Etcoff, Nancy L; Stock, Shannon; Haley, Lauren E; Vickery, Sarah A; House, David M

    2011-01-01

    Research on the perception of faces has focused on the size, shape, and configuration of inherited features or the biological phenotype, and largely ignored the effects of adornment, or the extended phenotype. Research on the evolution of signaling has shown that animals frequently alter visual features, including color cues, to attract, intimidate or protect themselves from conspecifics. Humans engage in conscious manipulation of visual signals using cultural tools in real time rather than genetic changes over evolutionary time. Here, we investigate one tool, the use of color cosmetics. In two studies, we asked viewers to rate the same female faces with or without color cosmetics, and we varied the style of makeup from minimal (natural), to moderate (professional), to dramatic (glamorous). Each look provided increasing luminance contrast between the facial features and surrounding skin. Faces were shown for 250 ms or for unlimited inspection time, and subjects rated them for attractiveness, competence, likeability and trustworthiness. At 250 ms, cosmetics had significant positive effects on all outcomes. Length of inspection time did not change the effect for competence or attractiveness. However, with longer inspection time, the effect of cosmetics on likability and trust varied by specific makeup looks, indicating that cosmetics could impact automatic and deliberative judgments differently. The results suggest that cosmetics can create supernormal facial stimuli, and that one way they may do so is by exaggerating cues to sexual dimorphism. Our results provide evidence that judgments of facial trustworthiness and attractiveness are at least partially separable, that beauty has a significant positive effect on judgment of competence, a universal dimension of social cognition, but has a more nuanced effect on the other universal dimension of social warmth, and that the extended phenotype significantly influences perception of biologically important signals at first

  3. Application of the RES methodology for identifying features, events and processes (FEPs) for near-field analysis of copper-steel canister

    International Nuclear Information System (INIS)

    Vieno, T.; Hautojaervi, A.; Raiko, H.; Ahonen, L.; Salo, J.P.

    1994-12-01

    Rock Engineering Systems (RES) is an approach to discover the important characteristics and interactions of a complex problem. Recently RES has been applied to identify features, events and processes (FEPs) for performance analysis of nuclear waste repositories. The RES methodology was applied to identify FEPs for the near-field analysis of the copper-steel canister for spent fuel disposal. The aims of the exercise were to learn and test the RES methodology and, secondly, to find out how much the results differ when RES is applied by two different groups on the same problem. A similar exercise was previously carried out by a SKB group. A total of 90 potentially significant FEPs were identified. The exercise showed that the RES methodology is a practicable tool to get a comprehensive and transparent picture of a complex problem. The approach is easy to learn and use. It reveals the important characteristics and interactions and organizes them in a format easy to understand. (9 refs., 5 figs., 3 tabs.)

  4. Atmospheric-water absorption features near 2.2 micrometers and their importance in high spectral resolution remote sensing

    Science.gov (United States)

    Kruse, F. A.; Clark, R. N.

    1986-01-01

    Selective absorption of electromagnetic radiation by atmospheric gases and water vapor is an accepted fact in terrestrial remote sensing. Until recently, only a general knowledge of atmospheric effects was required for analysis of remote sensing data; however, with the advent of high spectral resolution imaging devices, detailed knowledge of atmospheric absorption bands has become increasingly important for accurate analysis. Detailed study of high spectral resolution aircraft data at the U.S. Geological Survey has disclosed narrow absorption features centered at approximately 2.17 and 2.20 micrometers not caused by surface mineralogy. Published atmospheric transmission spectra and atmospheric spectra derived using the LOWTRAN-5 computer model indicate that these absorption features are probably water vapor. Spectral modeling indicates that the effects of atmospheric absorption in this region are most pronounced in spectrally flat materials with only weak absorption bands. Without correction and detailed knowledge of the atmospheric effects, accurate mapping of surface mineralogy (particularly at low mineral concentrations) is not possible.

  5. Redd site selection and spawning habitat use by fall chinook salmon: The importance of geomorphic features in large rivers

    International Nuclear Information System (INIS)

    Geist, D.R.; Oregon State Univ., Corvallis, OR; Dauble, D.D.

    1998-01-01

    Knowledge of the three-dimensional connectivity between rivers and groundwater within the hyporheic zone can be used to improve the definition of fall chinook salmon (Oncorhynchus tshawytscha) spawning habitat. Information exists on the microhabitat characteristics that define suitable salmon spawning habitat. However, traditional spawning habitat models that use these characteristics to predict available spawning habitat are restricted because they can not account for the heterogeneous nature of rivers. The authors present a conceptual spawning habitat model for fall chinook salmon that describes how geomorphic features of river channels create hydraulic processes, including hyporheic flows, that influence where salmon spawn in unconstrained reaches of large mainstem alluvial rivers. Two case studies based on empirical data from fall chinook salmon spawning areas in the Hanford Reach of the Columbia River are presented to illustrate important aspects of the conceptual model. The authors suggest that traditional habitat models and the conceptual model be combined to predict the limits of suitable fall chinook salmon spawning habitat. This approach can incorporate quantitative measures of river channel morphology, including general descriptors of geomorphic features at different spatial scales, in order to understand the processes influencing redd site selection and spawning habitat use. This information is needed in order to protect existing salmon spawning habitat in large rivers, as well as to recover habitat already lost

  6. Global sensitivity analysis for identifying important parameters of nitrogen nitrification and denitrification under model uncertainty and scenario uncertainty

    Science.gov (United States)

    Chen, Zhuowei; Shi, Liangsheng; Ye, Ming; Zhu, Yan; Yang, Jinzhong

    2018-06-01

    Nitrogen reactive transport modeling is subject to uncertainty in model parameters, structures, and scenarios. By using a new variance-based global sensitivity analysis method, this paper identifies important parameters for nitrogen reactive transport with simultaneous consideration of these three uncertainties. A combination of three scenarios of soil temperature and two scenarios of soil moisture creates a total of six scenarios. Four alternative models describing the effect of soil temperature and moisture content are used to evaluate the reduction functions used for calculating actual reaction rates. The results show that for nitrogen reactive transport problem, parameter importance varies substantially among different models and scenarios. Denitrification and nitrification process is sensitive to soil moisture content status rather than to the moisture function parameter. Nitrification process becomes more important at low moisture content and low temperature. However, the changing importance of nitrification activity with respect to temperature change highly relies on the selected model. Model-averaging is suggested to assess the nitrification (or denitrification) contribution by reducing the possible model error. Despite the introduction of biochemical heterogeneity or not, fairly consistent parameter importance rank is obtained in this study: optimal denitrification rate (Kden) is the most important parameter; reference temperature (Tr) is more important than temperature coefficient (Q10); empirical constant in moisture response function (m) is the least important one. Vertical distribution of soil moisture but not temperature plays predominant role controlling nitrogen reaction. This study provides insight into the nitrogen reactive transport modeling and demonstrates an effective strategy of selecting the important parameters when future temperature and soil moisture carry uncertainties or when modelers face with multiple ways of establishing nitrogen

  7. Metabolomic approach to human brain spectroscopy identifies associations between clinical features and the frontal lobe metabolome in multiple sclerosis

    Science.gov (United States)

    Vingara, Lisa K.; Yu, Hui Jing; Wagshul, Mark E.; Serafin, Dana; Christodoulou, Christopher; Pelczer, István; Krupp, Lauren B.; Maletić-Savatić, Mirjana

    2013-01-01

    Proton magnetic resonance spectroscopy (1H-MRS) is capable of noninvasively detecting metabolic changes that occur in the brain tissue in vivo. Its clinical utility has been limited so far, however, by analytic methods that focus on independently evaluated metabolites and require prior knowledge about which metabolites to examine. Here, we applied advanced computational methodologies from the field of metabolomics, specifically partial least squares discriminant analysis and orthogonal partial least squares, to in vivo 1H-MRS from frontal lobe white matter of 27 patients with relapsing–remitting multiple sclerosis (RRMS) and 14 healthy controls. We chose RRMS, a chronic demyelinating disorder of the central nervous system, because its complex pathology and variable disease course make the need for reliable biomarkers of disease progression more pressing. We show that in vivo MRS data, when analyzed by multivariate statistical methods, can provide reliable, distinct profiles of MRS-detectable metabolites in different patient populations. Specifically, we find that brain tissue in RRMS patients deviates significantly in its metabolic profile from that of healthy controls, even though it appears normal by standard MRI techniques. We also identify, using statistical means, the metabolic signatures of certain clinical features common in RRMS, such as disability score, cognitive impairments, and response to stress. This approach to human in vivo MRS data should promote understanding of the specific metabolic changes accompanying disease pathogenesis, and could provide biomarkers of disease progression that would be useful in clinical trials. PMID:23751863

  8. Varied Rates of Implementation of Patient-Centered Medical Home Features and Residents' Perceptions of Their Importance Based on Practice Experience.

    Science.gov (United States)

    Eiff, M Patrice; Green, Larry A; Jones, Geoff; Devlaeminck, Alex Verdieck; Waller, Elaine; Dexter, Eve; Marino, Miguel; Carney, Patricia A

    2017-03-01

    Little is known about how the patient-centered medical home (PCMH) is being implemented in residency practices. We describe both the trends in implementation of PCMH features and the influence that working with PCMH features has on resident attitudes toward their importance in 14 family medicine residencies associated with the P4 Project. We assessed 24 residency continuity clinics annually between 2007-2011 on presence or absence of PCMH features. Annual resident surveys (n=690) assessed perceptions of importance of PCMH features using a 4-point scale (not at all important to very important). We used generalized estimating equations logistic regression to assess trends and ordinal-response proportional odds regression models to determine if resident ratings of importance were associated with working with those features during training. Implementation of electronic health record (EHR) features increased significantly from 2007-2011, such as email communication with patients (33% to 67%), preventive services registries (23% to 64%), chronic disease registries (63% to 82%), and population-based quality assurance (46% to 79%). Team-based care was the only process of care feature to change significantly (54% to 93%). Residents with any exposure to EHR-based features had higher odds of rating the features more important compared to those with no exposure. We observed consistently lower odds of the resident rating process of care features as more important with any exposure compared to no exposure. Residencies engaged in educational transformation were more successful in implementing EHR-based PCMH features, and exposure during training appears to positively influence resident ratings of importance, while exposure to process of care features are slower to implement with less influence on importance ratings.

  9. System and method employing a self-organizing map load feature database to identify electric load types of different electric loads

    Science.gov (United States)

    Lu, Bin; Harley, Ronald G.; Du, Liang; Yang, Yi; Sharma, Santosh K.; Zambare, Prachi; Madane, Mayura A.

    2014-06-17

    A method identifies electric load types of a plurality of different electric loads. The method includes providing a self-organizing map load feature database of a plurality of different electric load types and a plurality of neurons, each of the load types corresponding to a number of the neurons; employing a weight vector for each of the neurons; sensing a voltage signal and a current signal for each of the loads; determining a load feature vector including at least four different load features from the sensed voltage signal and the sensed current signal for a corresponding one of the loads; and identifying by a processor one of the load types by relating the load feature vector to the neurons of the database by identifying the weight vector of one of the neurons corresponding to the one of the load types that is a minimal distance to the load feature vector.

  10. Using manipulated photographs to identify features of streetscapes that may encourage older adults to walk for transport.

    Directory of Open Access Journals (Sweden)

    Jelle Van Cauwenberg

    Full Text Available Experimental evidence of environmental features important for physical activity is challenging to procure in real world settings. The current study aimed to investigate the causal effects of environmental modifications on a photographed street's appeal for older adults' walking for transport. Secondly, we examined whether these effects differed according to gender, functional limitations, and current level of walking for transport. Thirdly, we examined whether different environmental modifications interacted with each other. Qualitative responses were also reported to gain deeper insight into the observed quantitative relationships. Two sets of 16 panoramic photographs of a streetscape were created, in which six environmental factors were manipulated (sidewalk evenness, traffic level, general upkeep, vegetation, separation from traffic, and benches. Sixty older adults sorted these photographs on appeal for walking for transport on a 7-point scale and reported qualitative information on the reasons for their rankings. Sidewalk evenness appeared to have the strongest influence on a street's appeal for transport-related walking. The effect of sidewalk evenness was even stronger when the street's overall upkeep was good and when traffic was absent. Absence of traffic, presence of vegetation, and separation from traffic also increased a street's appeal for walking for transport. There were no moderating effects by gender or functional limitations. The presence of benches increased the streetscape's appeal among participants who already walked for transport at least an hour/week. The protocols and methods used in the current study carry the potential to further our understanding of environment-PA relationships. Our findings indicated sidewalk evenness as the most important environmental factor influencing a street's appeal for walking for transport among older adults. However, future research in larger samples and in real-life settings is needed to

  11. Using manipulated photographs to identify features of streetscapes that may encourage older adults to walk for transport.

    Science.gov (United States)

    Van Cauwenberg, Jelle; Van Holle, Veerle; De Bourdeaudhuij, Ilse; Clarys, Peter; Nasar, Jack; Salmon, Jo; Goubert, Liesbet; Deforche, Benedicte

    2014-01-01

    Experimental evidence of environmental features important for physical activity is challenging to procure in real world settings. The current study aimed to investigate the causal effects of environmental modifications on a photographed street's appeal for older adults' walking for transport. Secondly, we examined whether these effects differed according to gender, functional limitations, and current level of walking for transport. Thirdly, we examined whether different environmental modifications interacted with each other. Qualitative responses were also reported to gain deeper insight into the observed quantitative relationships. Two sets of 16 panoramic photographs of a streetscape were created, in which six environmental factors were manipulated (sidewalk evenness, traffic level, general upkeep, vegetation, separation from traffic, and benches). Sixty older adults sorted these photographs on appeal for walking for transport on a 7-point scale and reported qualitative information on the reasons for their rankings. Sidewalk evenness appeared to have the strongest influence on a street's appeal for transport-related walking. The effect of sidewalk evenness was even stronger when the street's overall upkeep was good and when traffic was absent. Absence of traffic, presence of vegetation, and separation from traffic also increased a street's appeal for walking for transport. There were no moderating effects by gender or functional limitations. The presence of benches increased the streetscape's appeal among participants who already walked for transport at least an hour/week. The protocols and methods used in the current study carry the potential to further our understanding of environment-PA relationships. Our findings indicated sidewalk evenness as the most important environmental factor influencing a street's appeal for walking for transport among older adults. However, future research in larger samples and in real-life settings is needed to confirm current

  12. Imaging-Based Screen Identifies Laminin 411 as a Physiologically Relevant Niche Factor with Importance for i-Hep Applications

    Directory of Open Access Journals (Sweden)

    John Ong

    2018-03-01

    Full Text Available Summary: Use of hepatocytes derived from induced pluripotent stem cells (i-Heps is limited by their functional differences in comparison with primary cells. Extracellular niche factors likely play a critical role in bridging this gap. Using image-based characterization (high content analysis; HCA of freshly isolated hepatocytes from 17 human donors, we devised and validated an algorithm (Hepatocyte Likeness Index; HLI for comparing the hepatic properties of cells against a physiological gold standard. The HLI was then applied in a targeted screen of extracellular niche factors to identify substrates driving i-Heps closer to the standard. Laminin 411, the top hit, was validated in two additional induced pluripotent stem cell (iPSC lines, primary tissue, and an in vitro model of α1-antitrypsin deficiency. Cumulatively, these data provide a reference method to control and screen for i-Hep differentiation, identify Laminin 411 as a key niche protein, and underscore the importance of combining substrates, soluble factors, and HCA when developing iPSC applications. : Rashid and colleagues demonstrate the utility of a high-throughput imaging platform for identification of physiologically relevant extracellular niche factors to advance i-Heps closer to their primary tissue counterparts. The extracellular matrix (ECM protein screen identified Laminin 411 as an important niche factor facilitating i-Hep-based disease modeling in vitro. Keywords: iPS hepatocytes, extracellular niche, image-based screening, disease modeling, laminin

  13. NRC Information No. 90-01: Importance of proper response to self-identified violations by licensees

    International Nuclear Information System (INIS)

    Cunningham, R.E.

    1992-01-01

    NRC expects a high standard of compliance by its licensees and requires that licensees provide NRC accurate and complete information and that required records will also be complete and accurate in all material respects. Licensees should be aware of the importance placed by NRC on licensee programs for self detection, correction and reporting of violations or errors related to regulatory requirements. The General Statement of Policy and Procedures for NRC Enforcement Actions in Appendix C to 10 CFR Part 2 underscores the importance of licensees responding promptly and properly to self-identified violations in two ways. It is suggested that when a licensee identifies a violation involving an NRC-required record, the licensee should make a dated notation indicating identification, either on the record itself or other appropriate documentation retrievable for NRC review. The record with the self-identified violation noted should not be altered in any way to mask the correction. The licensee should determine the cause of the violation, correct the root cause of the violation, and document such findings in an appropriate manner. Licensees should also assure that if a report of the violation is required, the report is submitted to NRC in a timely manner. These actions will be considered by NRC in making any enforcement decision, and generally lead to lesser or no civil penalty

  14. Statistical analyses of scatterplots to identify important factors in large-scale simulations, 1: Review and comparison of techniques

    International Nuclear Information System (INIS)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-01-01

    Procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses are described and illustrated. These procedures attempt to detect increasingly complex patterns in scatterplots and involve the identification of (i) linear relationships with correlation coefficients, (ii) monotonic relationships with rank correlation coefficients, (iii) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (iv) trends in variability as defined by variances and interquartile ranges, and (v) deviations from randomness as defined by the chi-square statistic. A sequence of example analyses with a large model for two-phase fluid flow illustrates how the individual procedures can differ in the variables that they identify as having effects on particular model outcomes. The example analyses indicate that the use of a sequence of procedures is a good analysis strategy and provides some assurance that an important effect is not overlooked

  15. ToNER: A tool for identifying nucleotide enrichment signals in feature-enriched RNA-seq data.

    Directory of Open Access Journals (Sweden)

    Yuttachon Promworn

    Full Text Available Biochemical methods are available for enriching 5' ends of RNAs in prokaryotes, which are employed in the differential RNA-seq (dRNA-seq and the more recent Cappable-seq protocols. Computational methods are needed to locate RNA 5' ends from these data by statistical analysis of the enrichment. Although statistical-based analysis methods have been developed for dRNA-seq, they may not be suitable for Cappable-seq data. The more efficient enrichment method employed in Cappable-seq compared with dRNA-seq could affect data distribution and thus algorithm performance.We present Transformation of Nucleotide Enrichment Ratios (ToNER, a tool for statistical modeling of enrichment from RNA-seq data obtained from enriched and unenriched libraries. The tool calculates nucleotide enrichment scores and determines the global transformation for fitting to the normal distribution using the Box-Cox procedure. From the transformed distribution, sites of significant enrichment are identified. To increase power of detection, meta-analysis across experimental replicates is offered. We tested the tool on Cappable-seq and dRNA-seq data for identifying Escherichia coli transcript 5' ends and compared the results with those from the TSSAR tool, which is designed for analyzing dRNA-seq data. When combining results across Cappable-seq replicates, ToNER detects more known transcript 5' ends than TSSAR. In general, the transcript 5' ends detected by ToNER but not TSSAR occur in regions which cannot be locally modeled by TSSAR.ToNER uses a simple yet robust statistical modeling approach, which can be used for detecting RNA 5'ends from Cappable-seq data, in particular when combining information from experimental replicates. The ToNER tool could potentially be applied for analyzing other RNA-seq datasets in which enrichment for other structural features of RNA is employed. The program is freely available for download at ToNER webpage (http://www4a

  16. ToNER: A tool for identifying nucleotide enrichment signals in feature-enriched RNA-seq data.

    Science.gov (United States)

    Promworn, Yuttachon; Kaewprommal, Pavita; Shaw, Philip J; Intarapanich, Apichart; Tongsima, Sissades; Piriyapongsa, Jittima

    2017-01-01

    Biochemical methods are available for enriching 5' ends of RNAs in prokaryotes, which are employed in the differential RNA-seq (dRNA-seq) and the more recent Cappable-seq protocols. Computational methods are needed to locate RNA 5' ends from these data by statistical analysis of the enrichment. Although statistical-based analysis methods have been developed for dRNA-seq, they may not be suitable for Cappable-seq data. The more efficient enrichment method employed in Cappable-seq compared with dRNA-seq could affect data distribution and thus algorithm performance. We present Transformation of Nucleotide Enrichment Ratios (ToNER), a tool for statistical modeling of enrichment from RNA-seq data obtained from enriched and unenriched libraries. The tool calculates nucleotide enrichment scores and determines the global transformation for fitting to the normal distribution using the Box-Cox procedure. From the transformed distribution, sites of significant enrichment are identified. To increase power of detection, meta-analysis across experimental replicates is offered. We tested the tool on Cappable-seq and dRNA-seq data for identifying Escherichia coli transcript 5' ends and compared the results with those from the TSSAR tool, which is designed for analyzing dRNA-seq data. When combining results across Cappable-seq replicates, ToNER detects more known transcript 5' ends than TSSAR. In general, the transcript 5' ends detected by ToNER but not TSSAR occur in regions which cannot be locally modeled by TSSAR. ToNER uses a simple yet robust statistical modeling approach, which can be used for detecting RNA 5'ends from Cappable-seq data, in particular when combining information from experimental replicates. The ToNER tool could potentially be applied for analyzing other RNA-seq datasets in which enrichment for other structural features of RNA is employed. The program is freely available for download at ToNER webpage (http://www4a.biotec.or.th/GI/tools/toner) and Git

  17. Statistical analyses of scatterplots to identify important factors in large-scale simulations, 2: robustness of techniques

    International Nuclear Information System (INIS)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-01-01

    The robustness of procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses is investigated. These procedures are based on attempts to detect increasingly complex patterns in the scatterplots under consideration and involve the identification of (i) linear relationships with correlation coefficients, (ii) monotonic relationships with rank correlation coefficients, (iii) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (iv) trends in variability as defined by variances and interquartile ranges, and (v) deviations from randomness as defined by the chi-square statistic. The following two topics related to the robustness of these procedures are considered for a sequence of example analyses with a large model for two-phase fluid flow: the presence of Type I and Type II errors, and the stability of results obtained with independent Latin hypercube samples. Observations from analysis include: (i) Type I errors are unavoidable, (ii) Type II errors can occur when inappropriate analysis procedures are used, (iii) physical explanations should always be sought for why statistical procedures identify variables as being important, and (iv) the identification of important variables tends to be stable for independent Latin hypercube samples

  18. Crowd-sourced Ontology for Photoleukocoria: Identifying Common Internet Search Terms for a Potentially Important Pediatric Ophthalmic Sign.

    Science.gov (United States)

    Staffieri, Sandra E; Kearns, Lisa S; Sanfilippo, Paul G; Craig, Jamie E; Mackey, David A; Hewitt, Alex W

    2018-02-01

    Leukocoria is the most common presenting sign for pediatric eye disease including retinoblastoma and cataract, with worse outcomes if diagnosis is delayed. We investigated whether individuals could identify leukocoria in photographs (photoleukocoria) and examined their subsequent Internet search behavior. Using a web-based questionnaire, in this cross-sectional study we invited adults aged over 18 years to view two photographs of a child with photoleukocoria, and then search the Internet to determine a possible diagnosis and action plan. The most commonly used search terms and websites accessed were recorded. The questionnaire was completed by 1639 individuals. Facebook advertisement was the most effective recruitment strategy. The mean age of all respondents was 38.95 ± 14.59 years (range, 18-83), 94% were female, and 59.3% had children. An abnormality in the images presented was identified by 1613 (98.4%) participants. The most commonly used search terms were: "white," "pupil," "photo," and "eye" reaching a variety of appropriate websites or links to print or social media articles. Different words or phrases were used to describe the same observation of photoleukocoria leading to a range of websites. Variations in the description of observed signs and search words influenced the sites reached, information obtained, and subsequent help-seeking intentions. Identifying the most commonly used search terms for photoleukocoria is an important step for search engine optimization. Being directed to the most appropriate websites informing of the significance of photoleukocoria and the appropriate actions to take could improve delays in diagnosis of important pediatric eye disease such as retinoblastoma or cataract.

  19. Geomfinder: a multi-feature identifier of similar three-dimensional protein patterns: a ligand-independent approach.

    Science.gov (United States)

    Núñez-Vivanco, Gabriel; Valdés-Jiménez, Alejandro; Besoaín, Felipe; Reyes-Parada, Miguel

    2016-01-01

    Since the structure of proteins is more conserved than the sequence, the identification of conserved three-dimensional (3D) patterns among a set of proteins, can be important for protein function prediction, protein clustering, drug discovery and the establishment of evolutionary relationships. Thus, several computational applications to identify, describe and compare 3D patterns (or motifs) have been developed. Often, these tools consider a 3D pattern as that described by the residues surrounding co-crystallized/docked ligands available from X-ray crystal structures or homology models. Nevertheless, many of the protein structures stored in public databases do not provide information about the location and characteristics of ligand binding sites and/or other important 3D patterns such as allosteric sites, enzyme-cofactor interaction motifs, etc. This makes necessary the development of new ligand-independent methods to search and compare 3D patterns in all available protein structures. Here we introduce Geomfinder, an intuitive, flexible, alignment-free and ligand-independent web server for detailed estimation of similarities between all pairs of 3D patterns detected in any two given protein structures. We used around 1100 protein structures to form pairs of proteins which were assessed with Geomfinder. In these analyses each protein was considered in only one pair (e.g. in a subset of 100 different proteins, 50 pairs of proteins can be defined). Thus: (a) Geomfinder detected identical pairs of 3D patterns in a series of monoamine oxidase-B structures, which corresponded to the effectively similar ligand binding sites at these proteins; (b) we identified structural similarities among pairs of protein structures which are targets of compounds such as acarbose, benzamidine, adenosine triphosphate and pyridoxal phosphate; these similar 3D patterns are not detected using sequence-based methods; (c) the detailed evaluation of three specific cases showed the versatility

  20. Critical features of acute stress-induced cross-sensitization identified through the hypothalamic-pituitary-adrenal axis output.

    Science.gov (United States)

    Belda, Xavier; Nadal, Roser; Armario, Antonio

    2016-08-11

    Stress-induced sensitization represents a process whereby prior exposure to severe stressors leaves animals or humans in a hyper-responsive state to further stressors. Indeed, this phenomenon is assumed to be the basis of certain stress-associated pathologies, including post-traumatic stress disorder and psychosis. One biological system particularly prone to sensitization is the hypothalamic-pituitary-adrenal (HPA) axis, the prototypic stress system. It is well established that under certain conditions, prior exposure of animals to acute and chronic (triggering) stressors enhances HPA responses to novel (heterotypic) stressors on subsequent days (e.g. raised plasma ACTH and corticosterone levels). However, such changes remain somewhat controversial and thus, the present study aimed to identify the critical characteristics of the triggering and challenging stressors that affect acute stress-induced HPA cross-sensitization in adult rats. We found that HPA cross-sensitization is markedly influenced by the intensity of the triggering stressor, whereas the length of exposure mainly affects its persistence. Importantly, HPA sensitization is more evident with mild than strong challenging stressors, and it may remain unnoticed if exposure to the challenging stressor is prolonged beyond 15 min. We speculate that heterotypic HPA sensitization might have developed to optimize biologically adaptive responses to further brief stressors.

  1. Features of Two New Proteins with OmpA-Like Domains Identified in the Genome Sequences of Leptospira interrogans

    Science.gov (United States)

    Teixeira, Aline F.; de Morais, Zenaide M.; Kirchgatter, Karin; Romero, Eliete C.; Vasconcellos, Silvio A.; Nascimento, Ana Lucia T. O.

    2015-01-01

    Leptospirosis is an acute febrile disease caused by pathogenic spirochetes of the genus Leptospira. It is considered an important re-emerging infectious disease that affects humans worldwide. The knowledge about the mechanisms by which pathogenic leptospires invade and colonize the host remains limited since very few virulence factors contributing to the pathogenesis of the disease have been identified. Here, we report the identification and characterization of two new leptospiral proteins with OmpA-like domains. The recombinant proteins, which exhibit extracellular matrix-binding properties, are called Lsa46 - LIC13479 and Lsa77 - LIC10050 (Leptospiral surface adhesins of 46 and 77 kDa, respectively). Attachment of Lsa46 and Lsa77 to laminin was specific, dose dependent and saturable, with KD values of 24.3 ± 17.0 and 53.0 ± 17.5 nM, respectively. Lsa46 and Lsa77 also bind plasma fibronectin, and both adhesins are plasminogen (PLG)-interacting proteins, capable of generating plasmin (PLA) and as such, increase the proteolytic ability of leptospires. The proteins corresponding to Lsa46 and Lsa77 are present in virulent L. interrogans L1-130 and in saprophyte L. biflexa Patoc 1 strains, as detected by immunofluorescence. The adhesins are recognized by human leptospirosis serum samples at the onset and convalescent phases of the disease, suggesting that they are expressed during infection. Taken together, our data could offer valuable information to the understanding of leptospiral pathogenesis. PMID:25849456

  2. Features of two new proteins with OmpA-like domains identified in the genome sequences of Leptospira interrogans.

    Directory of Open Access Journals (Sweden)

    Aline F Teixeira

    Full Text Available Leptospirosis is an acute febrile disease caused by pathogenic spirochetes of the genus Leptospira. It is considered an important re-emerging infectious disease that affects humans worldwide. The knowledge about the mechanisms by which pathogenic leptospires invade and colonize the host remains limited since very few virulence factors contributing to the pathogenesis of the disease have been identified. Here, we report the identification and characterization of two new leptospiral proteins with OmpA-like domains. The recombinant proteins, which exhibit extracellular matrix-binding properties, are called Lsa46 - LIC13479 and Lsa77 - LIC10050 (Leptospiral surface adhesins of 46 and 77 kDa, respectively. Attachment of Lsa46 and Lsa77 to laminin was specific, dose dependent and saturable, with KD values of 24.3 ± 17.0 and 53.0 ± 17.5 nM, respectively. Lsa46 and Lsa77 also bind plasma fibronectin, and both adhesins are plasminogen (PLG-interacting proteins, capable of generating plasmin (PLA and as such, increase the proteolytic ability of leptospires. The proteins corresponding to Lsa46 and Lsa77 are present in virulent L. interrogans L1-130 and in saprophyte L. biflexa Patoc 1 strains, as detected by immunofluorescence. The adhesins are recognized by human leptospirosis serum samples at the onset and convalescent phases of the disease, suggesting that they are expressed during infection. Taken together, our data could offer valuable information to the understanding of leptospiral pathogenesis.

  3. A delphi exercise to identify characteristic features of gout - opinions from patients and physicians, the first stage in developing new classification criteria.

    Science.gov (United States)

    Prowse, Rebecca L; Dalbeth, Nicola; Kavanaugh, Arthur; Adebajo, Adewale O; Gaffo, Angelo L; Terkeltaub, Robert; Mandell, Brian F; Suryana, Bagus P P; Goldenstein-Schainberg, Claudia; Diaz-Torne, Cèsar; Khanna, Dinesh; Lioté, Frederic; Mccarthy, Geraldine; Kerr, Gail S; Yamanaka, Hisashi; Janssens, Hein; Baraf, Herbert F; Chen, Jiunn-Horng; Vazquez-Mellado, Janitzia; Harrold, Leslie R; Stamp, Lisa K; Van De Laar, Mart A; Janssen, Matthijs; Doherty, Michael; Boers, Maarten; Edwards, N Lawrence; Gow, Peter; Chapman, Peter; Khanna, Puja; Helliwell, Philip S; Grainger, Rebecca; Schumacher, H Ralph; Neogi, Tuhina; Jansen, Tim L; Louthrenoo, Worawit; Sivera, Francisca; Taylor, William J; Alten, Rieke

    2013-04-01

    To identify a comprehensive list of features that might discriminate between gout and other rheumatic musculoskeletal conditions, to be used subsequently for a case-control study to develop and test new classification criteria for gout. Two Delphi exercises were conducted using Web-based questionnaires: one with physicians from several countries who had an interest in gout and one with patients from New Zealand who had gout. Physicians rated a list of potentially discriminating features that were identified by literature review and expert opinion, and patients rated a list of features that they generated themselves. Agreement was defined by the RAND/UCLA disagreement index. Forty-four experienced physicians and 9 patients responded to all iterations. For physicians, 71 items were identified by literature review and 15 more were suggested by physicians. The physician survey showed agreement for 26 discriminatory features and 15 as not discriminatory. The patients identified 46 features of gout, for which there was agreement on 25 items as being discriminatory and 7 items as not discriminatory. Patients and physicians agreed upon several key features of gout. Physicians emphasized objective findings, imaging, and patterns of symptoms, whereas patients emphasized severity, functional results, and idiographic perception of symptoms.

  4. Identifying and Characterizing Important Trembling Aspen Competitors with Juvenile Lodgepole Pine in Three South-Central British Columbia Ecosystems

    Directory of Open Access Journals (Sweden)

    Teresa A. Newsome

    2012-01-01

    Full Text Available Critical height ratios for predicting competition between trembling aspen and lodgepole pine were identified in six juvenile stands in three south-central British Columbia ecosystems. We used a series of regression analyses predicting pine stem diameter from the density of neighbouring aspen in successively shorter relative height classes to identify the aspen-pine height ratio that maximized R2. Critical height ratios varied widely among sites when stands were 8–12 years old but, by age 14–19, had converged at 1.25–1.5. Maximum R2 values at age 14–19 ranged from 13.4% to 69.8%, demonstrating that the importance of aspen competition varied widely across a relatively small geographic range. Logistic regression also indicated that the risk of poor pine vigour in the presence of aspen varied between sites. Generally, the degree of competition, risk to pine vigour, and size of individual aspen contributing to the models declined along a gradient of decreasing ecosystem productivity.

  5. Computation and Evaluation of Features of Surface Electromyogram to Identify the Force of Muscle Contraction and Muscle Fatigue

    Directory of Open Access Journals (Sweden)

    Sridhar P. Arjunan

    2014-01-01

    Full Text Available The relationship between force of muscle contraction and muscle fatigue with six different features of surface electromyogram (sEMG was determined by conducting experiments on thirty-five volunteers. The participants performed isometric contractions at 50%, 75%, and 100% of their maximum voluntary contraction (MVC. Six features were considered in this study: normalised spectral index (NSM5, median frequency, root mean square, waveform length, normalised root mean square (NRMS, and increase in synchronization (IIS index. Analysis of variance (ANOVA and linear regression analysis were performed to determine the significance of the feature with respect to the three factors: muscle force, muscle fatigue, and subject. The results show that IIS index of sEMG had the highest correlation with muscle fatigue and the relationship was statistically significant (P0.05.

  6. Computation and evaluation of features of surface electromyogram to identify the force of muscle contraction and muscle fatigue.

    Science.gov (United States)

    Arjunan, Sridhar P; Kumar, Dinesh K; Naik, Ganesh

    2014-01-01

    The relationship between force of muscle contraction and muscle fatigue with six different features of surface electromyogram (sEMG) was determined by conducting experiments on thirty-five volunteers. The participants performed isometric contractions at 50%, 75%, and 100% of their maximum voluntary contraction (MVC). Six features were considered in this study: normalised spectral index (NSM5), median frequency, root mean square, waveform length, normalised root mean square (NRMS), and increase in synchronization (IIS) index. Analysis of variance (ANOVA) and linear regression analysis were performed to determine the significance of the feature with respect to the three factors: muscle force, muscle fatigue, and subject. The results show that IIS index of sEMG had the highest correlation with muscle fatigue and the relationship was statistically significant (P 0.05).

  7. Data-Wave-Based Features Extraction and Its Application in Symbol Identifier Recognition and Positioning Suitable for Multi-Robot Systems

    Directory of Open Access Journals (Sweden)

    Xilong Liu

    2012-12-01

    Full Text Available In this paper, feature extraction based on data-wave is proposed. The concept of data-wave is introduced to describe the rising and falling trends of the data over the long-term which are detected based on ripple and wave filters. Supported by data-wave, a novel symbol identifier with significant structure features is designed and these features are extracted by constructing pixel chains. On this basis, the corresponding recognition and positioning approach is presented. The effectiveness of the proposed approach is verified by experiments.

  8. Molecular characterization of NRXN1 deletions from 19,263 clinical microarray cases identifies exons important for neurodevelopmental disease expression

    Science.gov (United States)

    Lowther, Chelsea; Speevak, Marsha; Armour, Christine M.; Goh, Elaine S.; Graham, Gail E.; Li, Chumei; Zeesman, Susan; Nowaczyk, Malgorzata J.M.; Schultz, Lee-Anne; Morra, Antonella; Nicolson, Rob; Bikangaga, Peter; Samdup, Dawa; Zaazou, Mostafa; Boyd, Kerry; Jung, Jack H.; Siu, Victoria; Rajguru, Manjulata; Goobie, Sharan; Tarnopolsky, Mark A.; Prasad, Chitra; Dick, Paul T.; Hussain, Asmaa S.; Walinga, Margreet; Reijenga, Renske G.; Gazzellone, Matthew; Lionel, Anath C.; Marshall, Christian R.; Scherer, Stephen W.; Stavropoulos, Dimitri J.; McCready, Elizabeth; Bassett, Anne S.

    2016-01-01

    Purpose The purpose of the current study was to assess the penetrance of NRXN1 deletions. Methods We compared the prevalence and genomic extent of NRXN1 deletions identified among 19,263 clinically referred cases to that of 15,264 controls. The burden of additional clinically relevant CNVs was used as a proxy to estimate the relative penetrance of NRXN1 deletions. Results We identified 41 (0.21%) previously unreported exonic NRXN1 deletions ascertained for developmental delay/intellectual disability, significantly greater than in controls [OR=8.14 (95% CI 2.91–22.72), p< 0.0001)]. Ten (22.7%) of these had a second clinically relevant CNV. Subjects with a deletion near the 3′ end of NRXN1 were significantly more likely to have a second rare CNV than subjects with a 5′ NRXN1 deletion [OR=7.47 (95% CI 2.36–23.61), p=0.0006]. The prevalence of intronic NRXN1 deletions was not statistically different between cases and controls (p=0.618). The majority (63.2%) of intronic NRXN1 deletion cases had a second rare CNV, a two-fold greater prevalence than for exonic NRXN1 deletion cases (p=0.0035). Conclusions The results support the importance of exons near the 5′ end of NRXN1 in the expression of neurodevelopmental disorders. Intronic NRXN1 deletions do not appear to substantially increase the risk for clinical phenotypes. PMID:27195815

  9. Gene Expression Profiling Identifies Important Genes Affected by R2 Compound Disrupting FAK and P53 Complex

    International Nuclear Information System (INIS)

    Golubovskaya, Vita M.; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G.

    2014-01-01

    Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53 +/+ and p53 −/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53 +/+ cells but not in p53 −/− cells. Among up-regulated genes in HCT p53 +/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53 +/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach

  10. DNA-SIP identifies sulfate-reducing Clostridia as important toluene degraders in tar-oil-contaminated aquifer sediment

    Energy Technology Data Exchange (ETDEWEB)

    Winderl, C.; Penning, H.; von Netzer, F.; Meckenstock, R.U.; Lueders, T. [Helmholtz Zentrum Munchen, Neuherberg (Germany)

    2010-10-15

    Global groundwater resources are constantly challenged by a multitude of contaminants such as aromatic hydrocarbons. Especially in anaerobic habitats, a large diversity of unrecognized microbial populations may be responsible for their degradation. Still, our present understanding of the respective microbiota and their ecophysiology is almost exclusively based on a small number of cultured organisms, mostly within the Proteobacteria. Here, by DNA-based stable isotope probing (SIP), we directly identified the most active sulfate-reducing toluene degraders in a diverse sedimentary microbial community originating from a tar-oil-contaminated aquifer at a former coal gasification plant. On incubation of fresh sediments with {sup 13}C{sub 7}-toluene, the production of both sulfide and (CS{sub 2}){sup 13}CO{sub 2} was clearly coupled to the {sup 13}Clabeling of DNA of microbes related to Desulfosporosinus spp. within the Peptococcaceae (Clostridia). The screening of labeled DNA fractions also suggested a novel benzylsuccinate synthase alpha-subunit (bssA) sequence type previously only detected in the environment to be tentatively affiliated with these degraders. However, carbon flow from the contaminant into degrader DNA was only similar to 50%, pointing toward high ratios of heterotrophic CS{sub 2}-fixation during assimilation of acetyl-CoA originating from the contaminant by these degraders. These findings demonstrate that the importance of non-proteobacterial populations in anaerobic aromatics degradation, as well as their specific ecophysiology in the subsurface may still be largely ungrasped.

  11. Evaluation of bentonite alteration due to interactions with iron. Sensitivity analyses to identify the important factors for the bentonite alteration

    International Nuclear Information System (INIS)

    Sasamoto, Hiroshi; Wilson, James; Sato, Tsutomu

    2013-01-01

    Performance assessment of geological disposal systems for high-level radioactive waste requires a consideration of long-term systems behaviour. It is possible that the alteration of swelling clay present in bentonite buffers might have an impact on buffer functions. In the present study, iron (as a candidate overpack material)-bentonite (I-B) interactions were evaluated as the main buffer alteration scenario. Existing knowledge on alteration of bentonite during I-B interactions was first reviewed, then the evaluation methodology was developed considering modeling techniques previously used overseas. A conceptual model for smectite alteration during I-B interactions was produced. The following reactions and processes were selected: 1) release of Fe 2+ due to overpack corrosion; 2) diffusion of Fe 2+ in compacted bentonite; 3) sorption of Fe 2+ on smectite edge and ion exchange in interlayers; 4) dissolution of primary phases and formation of alteration products. Sensitivity analyses were performed to identify the most important factors for the alteration of bentonite by I-B interactions. (author)

  12. Identifying important and feasible policies and actions for health at community sports clubs: a consensus-generating approach.

    Science.gov (United States)

    Kelly, Bridget; King, Lesley; Bauman, Adrian E; Baur, Louise A; Macniven, Rona; Chapman, Kathy; Smith, Ben J

    2014-01-01

    Children's high participation in organised sport in Australia makes sport an ideal setting for health promotion. This study aimed to generate consensus on priority health promotion objectives for community sports clubs, based on informed expert judgements. Delphi survey using three structured questionnaires. Forty-six health promotion, nutrition, physical activity and sport management/delivery professionals were approached to participate in the survey. Questionnaires used an iterative process to determine aspects of sports clubs deemed necessary for developing healthy sporting environments for children. Initially, participants were provided with a list of potential standards for a range of health promotion areas and asked to rate standards based on their importance and feasibility, and any barriers to implementation. Subsequently, participants were provided with information that summarised ratings for each standard to indicate convergence of the group, and asked to review and potentially revise their responses where they diverged. In a third round, participants ranked confirmed standards by priority. 26 professionals completed round 1, 21 completed round 2, and 18 completed round 3. The highest ranked standards related to responsible alcohol practices, availability of healthy food and drinks at sports canteens, smoke-free club facilities, restricting the sale and consumption of alcohol during junior sporting activities, and restricting unhealthy food and beverage company sponsorship. Identifying and prioritising health promotion areas that are relevant to children's sports clubs assists in focusing public health efforts and may guide future engagement of sports clubs. Approaches for providing informational and financial support to clubs to operationalise these standards are proposed. Copyright © 2013 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  13. Identifying organisational principles and management practices important to the quality of health care services for chronic conditions.

    Science.gov (United States)

    Frølich, Anne

    2012-02-01

    effect of financial incentives and public performance reporting on the behaviour of professionals and quality of care. Using secondary data, KP and the Danish health care system were compared in terms of six central dimensions: population, health care professionals, health care organisations, utilization patterns, quality measurements, and costs. Differences existed between the two systems on all dimensions, complicating the interpretation of findings. For instance, observed differences might be due to similar tendencies in the two health care systems that were observed at different times, rather than true structural differences. The expenses in the two health care systems were corrected for differences in the populations served and the purchasing power of currencies. However, no validated methods existed to correct for observed differences in case-mixes of chronic conditions. Data from a population of about half a million patients with diabetes in a large U.S. integrated health care delivery system affiliated with 41 medical centers employing 15 different CCM management practices was the basis for identifying effective management practices. Through the use of statistical modelling, the management practice of provider alerts was identified as most effective for promoting screening for hemoglobin A1c and lipid profile. The CCM was used as a framework for implementing four rehabilitation programs. The model promoted continuity of care and quality of health care services. New management practices were developed in the study, and known practices were further developed. However, the observational nature of the study limited the generalisability of the findings. In a structured literature survey focusing on the effect of financial incentives and public performance reporting on the quality of health care services, few studies documenting an effect were identified. The results varied, and important program aspects or contextual variables were often omitted. A model describing

  14. Functional measurements based on feature tracking of cine magnetic resonance images identify left ventricular segments with myocardial scar

    Directory of Open Access Journals (Sweden)

    Nylander Eva

    2009-11-01

    Full Text Available Abstract Background The aim of the study was to perform a feature tracking analysis on cine magnetic resonance (MR images to elucidate if functional measurements of the motion of the left ventricular wall may detect scar defined with gadolinium enhanced MR. Myocardial contraction can be measured in terms of the velocity, displacement and local deformation (strain of a particular myocardial segment. Contraction of the myocardial wall will be reduced in the presence of scar and as a consequence of reduced myocardial blood flow. Methods Thirty patients (3 women and 27 men were selected based on the presence or absence of extensive scar in the anteroseptal area of the left ventricle. The patients were investigated in stable clinical condition, 4-8 weeks post ST-elevation myocardial infarction treated with percutaneous coronary intervention. Seventeen had a scar area >75% in at least one anteroseptal segment (scar and thirteen had scar area Results In the scar patients, segments with scar showed lower functional measurements than remote segments. Radial measurements of velocity, displacement and strain performed better in terms of receiver-operator-characteristic curves (ROC than the corresponding longitudinal measurements. The best area-under-curve was for radial strain, 0.89, where a cut-off value of 38.8% had 80% sensitivity and 86% specificity for the detection of a segment with scar area >50%. As a percentage of the mean, intraobserver variability was 16-14-26% for radial measurements of displacement-velocity-strain and corresponding interobserver variability was 13-12-18%. Conclusion Feature tracking analysis of cine-MR displays velocity, displacement and strain in the radial and longitudinal direction and may be used for the detection of transmural scar. The accuracy and repeatability of the radial functional measurements is satisfactory and global measures agree.

  15. Identifying Important Gaps in Randomized Controlled Trials of Adult Cardiac Arrest Treatments: A Systematic Review of the Published Literature

    Science.gov (United States)

    Sinha, Shashank S.; Sukul, Devraj; Lazarus, John J.; Polavarapu, Vivek; Chan, Paul S.; Neumar, Robert W.; Nallamothu, Brahmajee K.

    2016-01-01

    Background Cardiac arrests are a major public health concern worldwide. The extent and types of randomized controlled trials (RCTs) – our most reliable source of clinical evidence – conducted in these high-risk patients over recent years are largely unknown. Methods and Results We performed a systematic review, identifying all RCTs published in PubMed, EMBASE, Scopus, Web of Science, and the Cochrane Library from 1995 to 2014 that focused on acute treatment of non-traumatic cardiac arrest in adults. We then extracted data on the setting of study populations, types and timing of interventions studied, risk of bias, outcomes reported and how these factors have changed over time. Over this twenty-year period, 92 RCTs were published containing 64,309 patients (median, 225.5 per trial). Of these, 81 RCTs (88.0%) involved out-of-hospital cardiac arrest whereas 4 (4.3%) involved in-hospital cardiac arrest and 7 (7.6%) included both. Eighteen RCTs (19.6%) were performed in the U.S., 68 (73.9%) were performed outside the U.S., and 6 (6.5%) were performed in both settings. Thirty-eight RCTs (41.3%) evaluated drug therapy, 39 (42.4%) evaluated device therapy, and 15 (16.3%) evaluated protocol improvements. Seventy-four RCTs (80.4%) examined interventions during the cardiac arrest, 15 (16.3%) examined post-cardiac arrest treatment, and 3 (3.3%) studied both. Overall, reporting of risk of bias was limited. The most common outcome reported was ROSC: 86 (93.5%) with only 22 (23.9%) reporting survival beyond 6 months. Fifty-three RCTs (57.6%) reported global ordinal outcomes whereas 15 (16.3%) reported quality-of-life. RCTs in the last 5 years were more likely to be focused on protocol improvement and post-cardiac arrest care. Conclusions Important gaps in RCTs of cardiac arrest treatments exist, especially those examining in-hospital cardiac arrest, protocol improvement, post-cardiac arrest care, and long-term or quality-of-life outcomes. PMID:27756794

  16. A genome-scale RNA-interference screen identifies RRAS signaling as a pathologic feature of Huntington's disease.

    Directory of Open Access Journals (Sweden)

    John P Miller

    Full Text Available A genome-scale RNAi screen was performed in a mammalian cell-based assay to identify modifiers of mutant huntingtin toxicity. Ontology analysis of suppressor data identified processes previously implicated in Huntington's disease, including proteolysis, glutamate excitotoxicity, and mitochondrial dysfunction. In addition to established mechanisms, the screen identified multiple components of the RRAS signaling pathway as loss-of-function suppressors of mutant huntingtin toxicity in human and mouse cell models. Loss-of-function in orthologous RRAS pathway members also suppressed motor dysfunction in a Drosophila model of Huntington's disease. Abnormal activation of RRAS and a down-stream effector, RAF1, was observed in cellular models and a mouse model of Huntington's disease. We also observe co-localization of RRAS and mutant huntingtin in cells and in mouse striatum, suggesting that activation of R-Ras may occur through protein interaction. These data indicate that mutant huntingtin exerts a pathogenic effect on this pathway that can be corrected at multiple intervention points including RRAS, FNTA/B, PIN1, and PLK1. Consistent with these results, chemical inhibition of farnesyltransferase can also suppress mutant huntingtin toxicity. These data suggest that pharmacological inhibition of RRAS signaling may confer therapeutic benefit in Huntington's disease.

  17. A method to identify important dynamical states in Boolean models of regulatory networks: application to regulation of stomata closure by ABA in A. thaliana.

    Science.gov (United States)

    Bugs, Cristhian A; Librelotto, Giovani R; Mombach, José C M

    2011-12-22

    We introduce a method to analyze the states of regulatory Boolean models that identifies important network states and their biological influence on the global network dynamics. It consists in (1) finding the states of the network that are most frequently visited and (2) the identification of variable and frozen nodes of the network. The method, along with a simulation that includes random features, is applied to the study of stomata closure by abscisic acid (ABA) in A. thaliana proposed by Albert and coworkers. We find that for the case of study, that the dynamics of wild and mutant networks have just two states that are highly visited in their space of states and about a third of all nodes of the wild network are variable while the rest remain frozen in True or False states. This high number of frozen elements explains the low cardinality of the space of states of the wild network. Similar results are observed in the mutant networks. The application of the method allowed us to explain how wild and mutants behave dynamically in the SS and determined an essential feature of the activation of the closure node (representing stomata closure), i.e. its synchronization with the AnionEm node (representing anion efflux at the plasma membrane). The dynamics of this synchronization explains the efficiency reached by the wild and each of the mutant networks. For the biological problem analyzed, our method allows determining how wild and mutant networks differ 'phenotypically'. It shows that the different efficiencies of stomata closure reached among the simulated wild and mutant networks follow from a dynamical behavior of two nodes that are always synchronized. Additionally, we predict that the involvement of the anion efflux at the plasma membrane is crucial for the plant response to ABA. The algorithm used in the simulations is available upon request.

  18. Identifying landscape features associated with Rift Valley fever virus transmission, Ferlo region, Senegal, using very high spatial resolution satellite imagery.

    Science.gov (United States)

    Soti, Valérie; Chevalier, Véronique; Maura, Jonathan; Bégué, Agnès; Lelong, Camille; Lancelot, Renaud; Thiongane, Yaya; Tran, Annelise

    2013-03-01

    Dynamics of most of vector-borne diseases are strongly linked to global and local environmental changes. Landscape changes are indicators of human activities or natural processes that are likely to modify the ecology of the diseases. Here, a landscape approach developed at a local scale is proposed for extracting mosquito favourable biotopes, and for testing ecological parameters when identifying risk areas of Rift Valley fever (RVF) transmission. The study was carried out around Barkedji village, Ferlo region, Senegal. In order to test whether pond characteristics may influence the density and the dispersal behaviour of RVF vectors, and thus the spatial variation in RVFV transmission, we used a very high spatial resolution remote sensing image (2.4 m resolution) provided by the Quickbird sensor to produce a detailed land-cover map of the study area. Based on knowledge of vector and disease ecology, seven landscape attributes were defined at the pond level and computed from the land-cover map. Then, the relationships between landscape attributes and RVF serologic incidence rates in small ruminants were analyzed through a beta-binomial regression. Finally, the best statistical model according to the Akaike Information Criterion corrected for small samples (AICC), was used to map areas at risk for RVF. Among the derived landscape variables, the vegetation density index (VDI) computed within a 500 m buffer around ponds was positively correlated with serologic incidence (premote sensing data for identifying environmental risk factors and mapping RVF risk areas at a local scale.

  19. [A representative case of joint contracture as a main feature of AL amyloid deposits identified in the skeletal muscles].

    Science.gov (United States)

    Matsumura, Erika; Yamaguchi, Tetsuto; Tomidokoro, Yasushi; Ishii, Akiko; Tamaoka, Akira

    2014-01-01

    A 68-year-old man, with a history of type 2 diabetes mellitus and chronic kidney impairment, had been suffering from progressive knee joint contracture and dysesthesia of the lower extremities for 4 years. When he walked, his knees remained bent owing to contracture of the knee joints. There was no evidence of muscle pseudohypertrophy, intramuscular nodules, or muscle weakness. Clinical examination revealed IgA λ M-protein, reticular high-signal intensity lesions demonstrated by magnetic resonance T2-short TI IR(STIR) imaging of the lower extremity muscles, and a mixture of neurogenic and myogenic changes demonstrated by needle electromyography. A biopsy specimen from the vastus lateralis muscle identified Aλ amyloid deposits around the vessels, establishing a diagnosis of amyloid myopathy based on systemic AL amyloidosis. This case demonstrated that joint contracture and reticular lesions shown by magnetic resonance STIR imaging of the muscles can alert the physician to consider muscle biopsy to investigate deposition of amyloid in the skeletal muscles even in the absence of muscle pseudohypertrophy or weakness, both of which are characteristic of amyloid myopathy.

  20. Unsupervised consensus cluster analysis of [18F]-fluoroethyl-L-tyrosine positron emission tomography identified textural features for the diagnosis of pseudoprogression in high-grade glioma.

    Science.gov (United States)

    Kebir, Sied; Khurshid, Zain; Gaertner, Florian C; Essler, Markus; Hattingen, Elke; Fimmers, Rolf; Scheffler, Björn; Herrlinger, Ulrich; Bundschuh, Ralph A; Glas, Martin

    2017-01-31

    Timely detection of pseudoprogression (PSP) is crucial for the management of patients with high-grade glioma (HGG) but remains difficult. Textural features of O-(2-[18F]fluoroethyl)-L-tyrosine positron emission tomography (FET-PET) mirror tumor uptake heterogeneity; some of them may be associated with tumor progression. Fourteen patients with HGG and suspected of PSP underwent FET-PET imaging. A set of 19 conventional and textural FET-PET features were evaluated and subjected to unsupervised consensus clustering. The final diagnosis of true progression vs. PSP was based on follow-up MRI using RANO criteria. Three robust clusters have been identified based on 10 predominantly textural FET-PET features. None of the patients with PSP fell into cluster 2, which was associated with high values for textural FET-PET markers of uptake heterogeneity. Three out of 4 patients with PSP were assigned to cluster 3 that was largely associated with low values of textural FET-PET features. By comparison, tumor-to-normal brain ratio (TNRmax) at the optimal cutoff 2.1 was less predictive of PSP (negative predictive value 57% for detecting true progression, p=0.07 vs. 75% with cluster 3, p=0.04). Clustering based on textural O-(2-[18F]fluoroethyl)-L-tyrosine PET features may provide valuable information in assessing the elusive phenomenon of pseudoprogression.

  1. Identifying organisational principles and management practices important to the quality of health care services for chronic conditions

    DEFF Research Database (Denmark)

    Frølich, Anne

    2012-01-01

    are limited, it is necessary to identify efficient methods to improve the quality of care. Comparing health care systems is a well-known method for identifying new knowledge regarding, for instance, organisational methods and principles. Kaiser Permanente (KP), an integrated health care delivery system...... in the U.S., is recognized as providing high-quality chronic care; to some extent, this is due to KP's implementation of the chronic care model (CCM). This model recommends a range of evidence-based management practices that support the implementation of evidence-based medicine. However, it is not clear...... which management practices in the CCM are most efficient and in what combinations. In addition, financial incentives and public reporting of performance are often considered effective at improving the quality of health care services, but this has not yet been definitively proved....

  2. Spent coffee-based activated carbon: specific surface features and their importance for H2S separation process.

    Science.gov (United States)

    Kante, Karifala; Nieto-Delgado, Cesar; Rangel-Mendez, J Rene; Bandosz, Teresa J

    2012-01-30

    Activated carbons were prepared from spent ground coffee. Zinc chloride was used as an activation agent. The obtained materials were used as a media for separation of hydrogen sulfide from air at ambient conditions. The materials were characterized using adsorption of nitrogen, elemental analysis, SEM, FTIR, and thermal analysis. Surface features of the carbons depend on the amount of an activation agent used. Even though the residual inorganic matter takes part in the H(2)S retention via salt formation, the porous surface of carbons governs the separation process. The chemical activation method chosen resulted in formation of large volume of pores with sizes between 10 and 30Å, optimal for water and hydrogen sulfide adsorption. Even though the activation process can be optimized/changed, the presence of nitrogen in the precursor (caffeine) is a significant asset of that specific organic waste. Nitrogen functional groups play a catalytic role in hydrogen sulfide oxidation. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. Morphological and anatomical features of cypsela of some crepis taxa (asteraceae) from turkey and their taxonomic importance

    International Nuclear Information System (INIS)

    Ru, J.; Cheng, X.Y.; Wang, C.

    2015-01-01

    Fruit morphology and anatomy have taxonomic importance in Asteraceae. The fruits structures of Crepis from Turkey, which include five species (C. alpina, C. smyrnaea, C. pulchra, C. zacintha, C. sancta) and two subspecies (C. foetida subsp. foetida and C. foetida subsp. rhoeadifolia) were studied for fruit morphological and anatomical characters with one-way analysis of variance, cluster analysis and principal component analysis. Fruit size, shape, color, and the presence of beak were observed with stereomicroscopy. Whereas the surface patterns of fruit and pappus were examined using scanning electron microscopy (SEM). Furthermore, pericarp structure, thicknesses of testa and endosperm, and number of rib, cotyledon width in cypsela were studied anatomically. Results indicated that cypsela sizes, the presence or absence of beak on the cypsela, fruit and pappus surfaces, pericarp. Thickness of testa and endosperm, and number of ribs are of major importance to illustrate interspecific relations among the examined taxa. Also, this investigation is a preliminary study, which was performed to use fruit morphological and anatomical characters for their practicality on the classification of taxa within the genus. (author)

  4. Quantitative Analysis of the Association Angle between T-cell Receptor Vα/Vβ Domains Reveals Important Features for Epitope Recognition.

    Directory of Open Access Journals (Sweden)

    Thomas Hoffmann

    2015-07-01

    Full Text Available T-cell receptors (TCR play an important role in the adaptive immune system as they recognize pathogen- or cancer-based epitopes and thus initiate the cell-mediated immune response. Therefore there exists a growing interest in the optimization of TCRs for medical purposes like adoptive T-cell therapy. However, the molecular mechanisms behind T-cell signaling are still predominantly unknown. For small sets of TCRs it was observed that the angle between their Vα- and Vβ-domains, which bind the epitope, can vary and might be important for epitope recognition. Here we present a comprehensive, quantitative study of the variation in the Vα/Vβ interdomain-angle and its influence on epitope recognition, performing a systematic bioinformatics analysis based on a representative set of experimental TCR structures. For this purpose we developed a new, cuboid-based superpositioning method, which allows a unique, quantitative analysis of the Vα/Vβ-angles. Angle-based clustering led to six significantly different clusters. Analysis of these clusters revealed the unexpected result that the angle is predominantly influenced by the TCR-clonotype, whereas the bound epitope has only a minor influence. Furthermore we could identify a previously unknown center of rotation (CoR, which is shared by all TCRs. All TCR geometries can be obtained by rotation around this center, rendering it a new, common TCR feature with the potential of improving the accuracy of TCR structure prediction considerably. The importance of Vα/Vβ rotation for signaling was confirmed as we observed larger variances in the Vα/Vβ-angles in unbound TCRs compared to epitope-bound TCRs. Our results strongly support a two-step mechanism for TCR-epitope: First, preformation of a flexible TCR geometry in the unbound state and second, locking of the Vα/Vβ-angle in a TCR-type specific geometry upon epitope-MHC association, the latter being driven by rotation around the unique center of rotation.

  5. Individual differences in using geometric and featural cues to maintain spatial orientation: cue quantity and cue ambiguity are more important than cue type.

    Science.gov (United States)

    Kelly, Jonathan W; McNamara, Timothy P; Bodenheimer, Bobby; Carr, Thomas H; Rieser, John J

    2009-02-01

    Two experiments explored the role of environmental cues in maintaining spatial orientation (sense of self-location and direction) during locomotion. Of particular interest was the importance of geometric cues (provided by environmental surfaces) and featural cues (nongeometric properties provided by striped walls) in maintaining spatial orientation. Participants performed a spatial updating task within virtual environments containing geometric or featural cues that were ambiguous or unambiguous indicators of self-location and direction. Cue type (geometric or featural) did not affect performance, but the number and ambiguity of environmental cues did. Gender differences, interpreted as a proxy for individual differences in spatial ability and/or experience, highlight the interaction between cue quantity and ambiguity. When environmental cues were ambiguous, men stayed oriented with either one or two cues, whereas women stayed oriented only with two. When environmental cues were unambiguous, women stayed oriented with one cue.

  6. Identifying diabetes-related important protein targets with few interacting partners with the PageRank algorithm.

    Science.gov (United States)

    Grolmusz, Vince I

    2015-04-01

    Diabetes is a growing concern for the developed nations worldwide. New genomic, metagenomic and gene-technologic approaches may yield considerable results in the next several years in its early diagnosis, or in advances in therapy and management. In this work, we highlight some human proteins that may serve as new targets in the early diagnosis and therapy. With the help of a very successful mathematical tool for network analysis that formed the basis of the early successes of Google(TM), Inc., we analyse the human protein-protein interaction network gained from the IntAct database with a mathematical algorithm. The novelty of our approach is that the new protein targets suggested do not have many interacting partners (so, they are not hubs or super-hubs), so their inhibition or promotion probably will not have serious side effects. We have identified numerous possible protein targets for diabetes therapy and/or management; some of these have been well known for a long time (these validate our method), some of them appeared in the literature in the last 12 months (these show the cutting edge of the algorithm), and the remainder are still unknown to be connected with diabetes, witnessing completely new hits of the method.

  7. Gene expression profiling and candidate gene resequencing identifies pathways and mutations important for malignant transformation caused by leukemogenic fusion genes.

    Science.gov (United States)

    Novak, Rachel L; Harper, David P; Caudell, David; Slape, Christopher; Beachy, Sarah H; Aplan, Peter D

    2012-12-01

    NUP98-HOXD13 (NHD13) and CALM-AF10 (CA10) are oncogenic fusion proteins produced by recurrent chromosomal translocations in patients with acute myeloid leukemia (AML). Transgenic mice that express these fusions develop AML with a long latency and incomplete penetrance, suggesting that collaborating genetic events are required for leukemic transformation. We employed genetic techniques to identify both preleukemic abnormalities in healthy transgenic mice as well as collaborating events leading to leukemic transformation. Candidate gene resequencing revealed that 6 of 27 (22%) CA10 AMLs spontaneously acquired a Ras pathway mutation and 8 of 27 (30%) acquired an Flt3 mutation. Two CA10 AMLs acquired an Flt3 internal-tandem duplication, demonstrating that these mutations can be acquired in murine as well as human AML. Gene expression profiles revealed a marked upregulation of Hox genes, particularly Hoxa5, Hoxa9, and Hoxa10 in both NHD13 and CA10 mice. Furthermore, mir196b, which is embedded within the Hoxa locus, was overexpressed in both CA10 and NHD13 samples. In contrast, the Hox cofactors Meis1 and Pbx3 were differentially expressed; Meis1 was increased in CA10 AMLs but not NHD13 AMLs, whereas Pbx3 was consistently increased in NHD13 but not CA10 AMLs. Silencing of Pbx3 in NHD13 cells led to decreased proliferation, increased apoptosis, and decreased colony formation in vitro, suggesting a previously unexpected role for Pbx3 in leukemic transformation. Published by Elsevier Inc.

  8. Serotonin-immunoreactivity in the ventral nerve cord of Pycnogonida--support for individually identifiable neurons as ancestral feature of the arthropod nervous system.

    Science.gov (United States)

    Brenneis, Georg; Scholtz, Gerhard

    2015-07-10

    The arthropod ventral nerve cord features a comparably low number of serotonin-immunoreactive neurons, occurring in segmentally repeated arrays. In different crustaceans and hexapods, these neurons have been individually identified and even inter-specifically homologized, based on their soma positions and neurite morphologies. Stereotypic sets of serotonin-immunoreactive neurons are also present in myriapods, whereas in the investigated chelicerates segmental neuron clusters with higher and variable cell numbers have been reported. This led to the suggestion that individually identifiable serotonin-immunoreactive neurons are an apomorphic feature of the Mandibulata. To test the validity of this neurophylogenetic hypothesis, we studied serotonin-immunoreactivity in three species of Pycnogonida (sea spiders). This group of marine arthropods is nowadays most plausibly resolved as sister group to all other extant chelicerates, rendering its investigation crucial for a reliable reconstruction of arthropod nervous system evolution. In all three investigated pycnogonids, the ventral walking leg ganglia contain different types of serotonin-immunoreactive neurons, the somata of which occurring mostly singly or in pairs within the ganglionic cortex. Several of these neurons are readily and consistently identifiable due to their stereotypic soma position and characteristic neurite morphology. They can be clearly homologized across different ganglia and different specimens as well as across the three species. Based on these homologous neurons, we reconstruct for their last common ancestor (presumably the pycnogonid stem species) a minimal repertoire of at least seven identified serotonin-immunoreactive neurons per hemiganglion. Beyond that, each studied species features specific pattern variations, which include also some neurons that were not reliably labeled in all specimens. Our results unequivocally demonstrate the presence of individually identifiable serotonin

  9. TBX1 mutation identified by exome sequencing in a Japanese family with 22q11.2 deletion syndrome-like craniofacial features and hypocalcemia.

    Directory of Open Access Journals (Sweden)

    Tsutomu Ogata

    Full Text Available BACKGROUND: Although TBX1 mutations have been identified in patients with 22q11.2 deletion syndrome (22q11.2DS-like phenotypes including characteristic craniofacial features, cardiovascular anomalies, hypoparathyroidism, and thymic hypoplasia, the frequency of TBX1 mutations remains rare in deletion-negative patients. Thus, it would be reasonable to perform a comprehensive genetic analysis in deletion-negative patients with 22q11.2DS-like phenotypes. METHODOLOGY/PRINCIPAL FINDINGS: We studied three subjects with craniofacial features and hypocalcemia (group 1, two subjects with craniofacial features alone (group 2, and three subjects with normal phenotype within a single Japanese family. Fluorescence in situ hybridization analysis excluded chromosome 22q11.2 deletion, and genomewide array comparative genomic hybridization analysis revealed no copy number change specific to group 1 or groups 1+2. However, exome sequencing identified a heterozygous TBX1 frameshift mutation (c.1253delA, p.Y418fsX459 specific to groups 1+2, as well as six missense variants and two in-frame microdeletions specific to groups 1+2 and two missense variants specific to group 1. The TBX1 mutation resided at exon 9C and was predicted to produce a non-functional truncated protein missing the nuclear localization signal and most of the transactivation domain. CONCLUSIONS/SIGNIFICANCE: Clinical features in groups 1+2 are well explained by the TBX1 mutation, while the clinical effects of the remaining variants are largely unknown. Thus, the results exemplify the usefulness of exome sequencing in the identification of disease-causing mutations in familial disorders. Furthermore, the results, in conjunction with the previous data, imply that TBX1 isoform C is the biologically essential variant and that TBX1 mutations are associated with a wide phenotypic spectrum, including most of 22q11.2DS phenotypes.

  10. Using the apparent diffusion coefficient to identifying MGMT promoter methylation status early in glioblastoma: importance of analytical method

    Energy Technology Data Exchange (ETDEWEB)

    Rundle-Thiele, Dayle [Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia); Day, Bryan; Stringer, Brett [Brain Cancer Research Unit, Queensland Institute of Medical Research, Brisbane, Queensland (Australia); Fay, Michael [Department of Radiation Oncology, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Martin, Jennifer [Discipline of Clinical Pharmacology, School of Medicine and Public Health, University of Newcastle, Newcastle, New South Wales (Australia); Jeffree, Rosalind L [Department of Neurosurgery, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Thomas, Paul [Queensland PET Service, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Bell, Christopher [Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia); Salvado, Olivier [CSIRO Digital Productivity Flagship, CSIRO, Herston, Queensland (Australia); Gal, Yaniv [Centre for Medical Diagnostic Technologies in Queensland, University of Queensland, Brisbane, Queensland (Australia); Coulthard, Alan [Discipline of Medical Imaging, University of Queensland, St Lucia, Queensland (Australia); Department of Medical Imaging, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Crozier, Stuart [Centre for Medical Diagnostic Technologies in Queensland, University of Queensland, Brisbane, Queensland (Australia); Rose, Stephen, E-mail: stephen.rose@csiro.au [CSIRO Digital Productivity Flagship, CSIRO, Herston, Queensland (Australia); Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia)

    2015-06-15

    Accurate knowledge of O{sup 6}-methylguanine methyltransferase (MGMT) gene promoter subtype in patients with glioblastoma (GBM) is important for treatment. However, this test is not always available. Pre-operative diffusion MRI (dMRI) can be used to probe tumour biology using the apparent diffusion coefficient (ADC); however, its ability to act as a surrogate to predict MGMT status has shown mixed results. We investigated whether this was due to variations in the method used to analyse ADC. We undertook a retrospective study of 32 patients with GBM who had MGMT status measured. Matching pre-operative MRI data were used to calculate the ADC within contrast enhancing regions of tumour. The relationship between ADC and MGMT was examined using two published ADC methods. A strong trend between a measure of ‘minimum ADC’ and methylation status was seen. An elevated minimum ADC was more likely in the methylated compared to the unmethylated MGMT group (U = 56, P = 0.0561). In contrast, utilising a two-mixture model histogram approach, a significant reduction in mean measure of the ‘low ADC’ component within the histogram was associated with an MGMT promoter methylation subtype (P < 0.0246). This study shows that within the same patient cohort, the method selected to analyse ADC measures has a significant bearing on the use of that metric as a surrogate marker of MGMT status. Thus for dMRI data to be clinically useful, consistent methods of data analysis need to be established prior to establishing any relationship with genetic or epigenetic profiling.

  11. Using the apparent diffusion coefficient to identifying MGMT promoter methylation status early in glioblastoma: importance of analytical method

    International Nuclear Information System (INIS)

    Rundle-Thiele, Dayle; Day, Bryan; Stringer, Brett; Fay, Michael; Martin, Jennifer; Jeffree, Rosalind L; Thomas, Paul; Bell, Christopher; Salvado, Olivier; Gal, Yaniv; Coulthard, Alan; Crozier, Stuart; Rose, Stephen

    2015-01-01

    Accurate knowledge of O 6 -methylguanine methyltransferase (MGMT) gene promoter subtype in patients with glioblastoma (GBM) is important for treatment. However, this test is not always available. Pre-operative diffusion MRI (dMRI) can be used to probe tumour biology using the apparent diffusion coefficient (ADC); however, its ability to act as a surrogate to predict MGMT status has shown mixed results. We investigated whether this was due to variations in the method used to analyse ADC. We undertook a retrospective study of 32 patients with GBM who had MGMT status measured. Matching pre-operative MRI data were used to calculate the ADC within contrast enhancing regions of tumour. The relationship between ADC and MGMT was examined using two published ADC methods. A strong trend between a measure of ‘minimum ADC’ and methylation status was seen. An elevated minimum ADC was more likely in the methylated compared to the unmethylated MGMT group (U = 56, P = 0.0561). In contrast, utilising a two-mixture model histogram approach, a significant reduction in mean measure of the ‘low ADC’ component within the histogram was associated with an MGMT promoter methylation subtype (P < 0.0246). This study shows that within the same patient cohort, the method selected to analyse ADC measures has a significant bearing on the use of that metric as a surrogate marker of MGMT status. Thus for dMRI data to be clinically useful, consistent methods of data analysis need to be established prior to establishing any relationship with genetic or epigenetic profiling

  12. The large-scale ENSO event, the El Niño and other important regional features

    Directory of Open Access Journals (Sweden)

    1993-01-01

    anomalously heavy subtropical Chilean rainfall. The high index (anti-ENSO phase of the SO relates on the west side of the «see-saw» to anomalously heavy rainfall over eastern and northern Australia, anomalously heavy east monsoon rainfall over Indonesia, above normal summer monsoon rainfall over India, and an abnormally large supply of water entering the Nile River system as a result of abnormally heavy summer monsoon rainfall over the highlands of Ethiopia. In contrast, on the east side of the «see-saw» it relates to cool anti-El Niño conditions over the northwestern South American coastal region with its cool upwelling waters, an equatorial Pacific dry zone extending far to the west as a result of the underlying cool upwelling sea water caused by strong easterly winds, and anomalously low subtropical Chilean rainfall. Although each individual large-scale ENSO and anti-ENSO phase pattern will display its own unique characteristics, the above-stated generalities will frequently occur, particularly when the events are in the strong and very strong intensity categories. At times the initial onset of these large-scale developments can be noted earlier on the western side of the «see-saw» than they can on the eastern side. There is no better example of this than the very strong 1982-1983 ENSO development. An ultimate goal of all research on the large-scale ENSO, the El Niño, and other associated regional climatic features is to eventually develop the capability to provide reasonably reliable long-range outlooks as to the time of onset, areal extent, duration, and intensity of these recurring SO-related ocean-atmosphere climatic fluctuations. Here some of the background information, data, and records obtained over the historical past are presented and discussed.

  13. The importance of service-users' perspectives: A systematic review of qualitative evidence reveals overlooked critical features of weight management programmes.

    Science.gov (United States)

    Sutcliffe, Katy; Melendez-Torres, G J; Burchett, Helen E D; Richardson, Michelle; Rees, Rebecca; Thomas, James

    2018-03-14

    Extensive research effort shows that weight management programmes (WMPs) targeting both diet and exercise are broadly effective. However, the critical features of WMPs remain unclear. To develop a deeper understanding of WMPs critical features, we undertook a systematic review of qualitative evidence. We sought to understand from a service-user perspective how programmes are experienced, and may be effective, on the ground. We identified qualitative studies from existing reviews and updated the searches of one review. We included UK studies capturing the views of adult WMP users. Thematic analysis was used inductively to code and synthesize the evidence. Service users were emphatic that supportive relationships, with service providers or WMP peers, are the most critical aspect of WMPs. Supportive relationships were described as providing an extrinsic motivator or "hook" which helped to overcome barriers such as scepticism about dietary advice or a lack confidence to engage in physical activity. The evidence revealed that service-users' understandings of the critical features of WMPs differ from the focus of health promotion guidance or descriptions of evaluated programmes which largely emphasize educational or goal setting aspects of WMPs. Existing programme guidance may not therefore fully address the needs of service users. The study illustrates that the perspectives of service users can reveal unanticipated intervention mechanisms or underemphasized critical features and underscores the value of a holistic understanding about "what happens" in complex psychosocial interventions such as WMPs. © 2017 The Authors Health Expectations published by John Wiley & Sons Ltd.

  14. Tensor decomposition-based unsupervised feature extraction identifies candidate genes that induce post-traumatic stress disorder-mediated heart diseases.

    Science.gov (United States)

    Taguchi, Y-H

    2017-12-21

    Although post-traumatic stress disorder (PTSD) is primarily a mental disorder, it can cause additional symptoms that do not seem to be directly related to the central nervous system, which PTSD is assumed to directly affect. PTSD-mediated heart diseases are some of such secondary disorders. In spite of the significant correlations between PTSD and heart diseases, spatial separation between the heart and brain (where PTSD is primarily active) prevents researchers from elucidating the mechanisms that bridge the two disorders. Our purpose was to identify genes linking PTSD and heart diseases. In this study, gene expression profiles of various murine tissues observed under various types of stress or without stress were analyzed in an integrated manner using tensor decomposition (TD). Based upon the obtained features, ∼ 400 genes were identified as candidate genes that may mediate heart diseases associated with PTSD. Various gene enrichment analyses supported biological reliability of the identified genes. Ten genes encoding protein-, DNA-, or mRNA-interacting proteins-ILF2, ILF3, ESR1, ESR2, RAD21, HTT, ATF2, NR3C1, TP53, and TP63-were found to be likely to regulate expression of most of these ∼ 400 genes and therefore are candidate primary genes that cause PTSD-mediated heart diseases. Approximately 400 genes in the heart were also found to be strongly affected by various drugs whose known adverse effects are related to heart diseases and/or fear memory conditioning; these data support the reliability of our findings. TD-based unsupervised feature extraction turned out to be a useful method for gene selection and successfully identified possible genes causing PTSD-mediated heart diseases.

  15. Genomic, Epigenomic, and Transcriptomic Profiling towards Identifying Omics Features and Specific Biomarkers That Distinguish Uterine Leiomyosarcoma and Leiomyoma at Molecular Levels

    Directory of Open Access Journals (Sweden)

    Tomoko Miyata

    2015-01-01

    Full Text Available Uterine leiomyosarcoma (LMS is the worst malignancy among the gynecologic cancers. Uterine leiomyoma (LM, a benign tumor of myometrial origin, is the most common among women of childbearing age. Because of their similar symptoms, it is difficult to preoperatively distinguish the two conditions only by ultrasound and pelvic MRI. While histopathological diagnosis is currently the main approach used to distinguish them postoperatively, unusual histologic variants of LM tend to be misdiagnosed as LMS. Therefore, development of molecular diagnosis as an alternative or confirmatory means will help to diagnose LMS more accurately. We adopted omics-based technologies to identify genome-wide features to distinguish LMS from LM and revealed that copy number, gene expression, and DNA methylation profiles successfully distinguished these tumors. LMS was found to possess features typically observed in malignant solid tumors, such as extensive chromosomal abnormalities, overexpression of cell cycle-related genes, hypomethylation spreading through large genomic regions, and frequent hypermethylation at the polycomb group target genes and protocadherin genes. We also identified candidate expression and DNA methylation markers, which will facilitate establishing postoperative molecular diagnostic tests based on conventional quantitative assays. Our results demonstrate the feasibility of establishing such tests and the possibility of developing preoperative and noninvasive methods.

  16. Triangulating Principal Effectiveness: How Perspectives of Parents, Teachers, and Assistant Principals Identify the Central Importance of Managerial Skills. Working Paper 35

    Science.gov (United States)

    Grissom, Jason A.; Loeb, Susanna

    2009-01-01

    While the importance of effective principals is undisputed, few studies have addressed what specific skills principals need to promote school success. This study draws on unique data combining survey responses from principals, assistant principals, teachers and parents with rich administrative data to identify which principal skills matter most…

  17. Sparse feature selection identifies H2A.Z as a novel, pattern-specific biomarker for asymmetrically self-renewing distributed stem cells

    Directory of Open Access Journals (Sweden)

    Yang Hoon Huh

    2015-03-01

    Full Text Available There is a long-standing unmet clinical need for biomarkers with high specificity for distributed stem cells (DSCs in tissues, or for use in diagnostic and therapeutic cell preparations (e.g., bone marrow. Although DSCs are essential for tissue maintenance and repair, accurate determination of their numbers for medical applications has been problematic. Previous searches for biomarkers expressed specifically in DSCs were hampered by difficulty obtaining pure DSCs and by the challenges in mining complex molecular expression data. To identify such useful and specific DSC biomarkers, we combined a novel sparse feature selection method with combinatorial molecular expression data focused on asymmetric self-renewal, a conspicuous property of DSCs. The analysis identified reduced expression of the histone H2A variant H2A.Z as a superior molecular discriminator for DSC asymmetric self-renewal. Subsequent molecular expression studies showed H2A.Z to be a novel “pattern-specific biomarker” for asymmetrically self-renewing cells, with sufficient specificity to count asymmetrically self-renewing DSCs in vitro and potentially in situ.

  18. Standard Pathologic Features Can Be Used to Identify a Subset of Estrogen Receptor-Positive, HER2 Negative Patients Likely to Benefit from Neoadjuvant Chemotherapy.

    Science.gov (United States)

    Petruolo, Oriana A; Pilewskie, Melissa; Patil, Sujata; Barrio, Andrea V; Stempel, Michelle; Wen, Hannah Y; Morrow, Monica

    2017-09-01

    The benefit of neoadjuvant chemotherapy (NAC) in patients with estrogen receptor-positive (ER+)/human epidermal growth factor receptor 2-negative (HER2-) breast cancers and in invasive lobular carcinoma (ILC) is uncertain due to the low rates of pathologic complete response (pCR). The aim of this study was to determine if pathologic features can identify subsets likely to benefit from NAC. Patients with stage I-III ER+, HER2- breast cancer receiving NAC were retrospectively reviewed. Endpoints were downstaging to breast-conserving surgery (BCS) and nodal pCR after NAC. Patients were grouped by progesterone receptor (PR) status and grade/differentiation (high grade or poor [HP] vs. non-HP). From 2007 to 2016, 402 ER+/HER2- cancers in patients receiving NAC were identified. Median age was 50 years, 98% were clinical stage II-III, and 75% were cN+. Overall pCR rate was 5%; breast pCR in 7% and nodal pCR in 15% of cN+ patients (p benefit from NAC are those with PR- and HP tumors. Patients with ILC are unlikely to downstage in the breast or axilla compared with IDC. The use of these criteria can assist in defining the initial treatment approach.

  19. Bipolar disorder: The importance of clinical assessment in identifying prognostic factors - An Audit. Part 1: An analysis of potential prognostic factors.

    Science.gov (United States)

    Verdolini, Norma; Dean, Jonathon; Elisei, Sandro; Quartesan, Roberto; Zaman, Rashid; Agius, Mark

    2014-11-01

    Prognostic factors of bipolar disorder must be identified to assist in staging and treatment, and this may be done primarily during the initial psychiatric assessment. In fact, most of the prognostic factors, which determine disease outcome, could be detected from simple but often-unrecorded questions asked during the psychiatric clinic visit. We collected data from the clinical notes of 70 bipolar outpatients seen at the initial psychiatric assessment clinic about socio-demographic and clinical factors to determine whether various factors had relevance to prevalence, prognosis, or outcome. The sample comprised 16 bipolar I (22.9%) and 54 bipolar II (77.1%) outpatients; a psychiatric comorbidity was noted in 26 patients (37.1%). 60.9% (42 patients) reported anxiety features and 12 patients (17.6%) were noted to have obsessive-compulsive characteristics. Percentages reported in our results are of the sample for which the data was available. Anhedonia is a depressive feature that was present in most of the population where this data was available (92.2%, 59 patients) and 81.8% (54 patients) reported suicidal thoughts during a depressive episode. 74.6% (47 patients) had a family history of bipolar disorder, depression, suicide or psychosis. 27 patients (39.7%) reported current alcohol use and 14 patients (22.6%) current illicit drug use. A comparison between 10 prognostic factors found that only the correlations between current illicit drug use/previous illicit drug use (χ(2)=11.471, Palcohol use/previous alcohol use (χ(2)=31.510, Palcohol use (χ(2)=5.071, P=0.023) and previous alcohol use/family history (χ(2)=4.309, P=0.037) were almost statistically significant. 17 patients (24.3%) of the 70 bipolar patients were assigned to a care coordinator; we have evaluated the possible differences between the patients with or without a care coordinator on the basis of the presence of 10 possible prognostic factors and found no statistically significant differences between

  20. The Relative Importance of Family History, Gender, Mode of Onset, and Age at Onsetin Predicting Clinical Features of First-Episode Psychotic Disorders.

    Science.gov (United States)

    Compton, Michael T; Berez, Chantal; Walker, Elaine F

    Family history of psychosis, gender, mode of onset, and age at onset are considered prognostic factors important to clinicians evaluating first-episode psychosis; yet, clinicians have little guidance as to how these four factors differentially predict early-course substance abuse, symptomatology, and functioning. We conducted a "head-to-head comparison" of these four factors regarding their associations with key clinical features at initial hospitalization. We also assessed potential interactions between gender and family history with regard to age at onset of psychosis and symptom severity. Consecutively admitted first-episode patients (n=334) were evaluated in two studies that rigorously assessed a number of early-course variables. Associations among variables of interest were examined using Pearson correlations, χ 2 tests, Student's t-tests, and 2×2 factorial analyses of variance. Substance (nicotine, alcohol, and cannabis) abuse and positive symptom severity were predicted only by male gender. Negative symptom severity and global functioning impairments were predicted by earlier age at onset of psychosis. General psychopathology symptom severity was predicted by both mode of onset and age at onset. Interaction effects were not observed with regard to gender and family history in predicting age at onset or symptom severity. The four prognostic features have differential associations with substance abuse, domains of symptom severity, and global functioning. Gender and age at onset of psychosis appear to be more predictive of clinical features at the time of initial evaluation (and thus presumably longer term outcomes) than the presence of a family history of psychosis and a more gradual mode of onset.

  1. SHBG is an important factor in stemness induction of cells by DHT in vitro and associated with poor clinical features of prostate carcinomas.

    Science.gov (United States)

    Ma, Yuanyuan; Liang, Dongming; Liu, Jian; Wen, Jian-Guo; Servoll, Einar; Waaler, Gudmund; Sæter, Thorstein; Axcrona, Karol; Vlatkovic, Ljiljana; Axcrona, Ulrika; Paus, Elisabeth; Yang, Yue; Zhang, Zhiqian; Kvalheim, Gunnar; Nesland, Jahn M; Suo, Zhenhe

    2013-01-01

    Androgen plays a vital role in prostate cancer development. However, it is not clear whether androgens influence stem-like properties of prostate cancer, a feature important for prostate cancer progression. In this study, we show that upon DHT treatment in vitro, prostate cancer cell lines LNCaP and PC-3 were revealed with higher clonogenic potential and higher expression levels of stemness related factors CD44, CD90, Oct3/4 and Nanog. Moreover, sex hormone binding globulin (SHBG) was also simultaneously upregulated in these cells. When the SHBG gene was blocked by SHBG siRNA knock-down, the induction of Oct3/4, Nanog, CD44 and CD90 by DHT was also correspondingly blocked in these cells. Immunohistochemical evaluation of clinical samples disclosed weakly positive, and areas negative for SHBG expression in the benign prostate tissues, while most of the prostate carcinomas were strongly positive for SHBG. In addition, higher levels of SHBG expression were significantly associated with higher Gleason score, more seminal vesicle invasions and lymph node metastases. Collectively, our results show a role of SHBG in upregulating stemness of prostate cancer cells upon DHT exposure in vitro, and SHBG expression in prostate cancer samples is significantly associated with poor clinicopathological features, indicating a role of SHBG in prostate cancer progression.

  2. SHBG is an important factor in stemness induction of cells by DHT in vitro and associated with poor clinical features of prostate carcinomas.

    Directory of Open Access Journals (Sweden)

    Yuanyuan Ma

    Full Text Available Androgen plays a vital role in prostate cancer development. However, it is not clear whether androgens influence stem-like properties of prostate cancer, a feature important for prostate cancer progression. In this study, we show that upon DHT treatment in vitro, prostate cancer cell lines LNCaP and PC-3 were revealed with higher clonogenic potential and higher expression levels of stemness related factors CD44, CD90, Oct3/4 and Nanog. Moreover, sex hormone binding globulin (SHBG was also simultaneously upregulated in these cells. When the SHBG gene was blocked by SHBG siRNA knock-down, the induction of Oct3/4, Nanog, CD44 and CD90 by DHT was also correspondingly blocked in these cells. Immunohistochemical evaluation of clinical samples disclosed weakly positive, and areas negative for SHBG expression in the benign prostate tissues, while most of the prostate carcinomas were strongly positive for SHBG. In addition, higher levels of SHBG expression were significantly associated with higher Gleason score, more seminal vesicle invasions and lymph node metastases. Collectively, our results show a role of SHBG in upregulating stemness of prostate cancer cells upon DHT exposure in vitro, and SHBG expression in prostate cancer samples is significantly associated with poor clinicopathological features, indicating a role of SHBG in prostate cancer progression.

  3. SHBG Is an Important Factor in Stemness Induction of Cells by DHT In Vitro and Associated with Poor Clinical Features of Prostate Carcinomas

    Science.gov (United States)

    Ma, Yuanyuan; Liang, Dongming; Liu, Jian; Wen, Jian-Guo; Servoll, Einar; Waaler, Gudmund; Sæter, Thorstein; Axcrona, Karol; Vlatkovic, Ljiljana; Axcrona, Ulrika; Paus, Elisabeth; Yang, Yue; Zhang, Zhiqian; Kvalheim, Gunnar; Nesland, Jahn M.; Suo, Zhenhe

    2013-01-01

    Androgen plays a vital role in prostate cancer development. However, it is not clear whether androgens influence stem-like properties of prostate cancer, a feature important for prostate cancer progression. In this study, we show that upon DHT treatment in vitro, prostate cancer cell lines LNCaP and PC-3 were revealed with higher clonogenic potential and higher expression levels of stemness related factors CD44, CD90, Oct3/4 and Nanog. Moreover, sex hormone binding globulin (SHBG) was also simultaneously upregulated in these cells. When the SHBG gene was blocked by SHBG siRNA knock-down, the induction of Oct3/4, Nanog, CD44 and CD90 by DHT was also correspondingly blocked in these cells. Immunohistochemical evaluation of clinical samples disclosed weakly positive, and areas negative for SHBG expression in the benign prostate tissues, while most of the prostate carcinomas were strongly positive for SHBG. In addition, higher levels of SHBG expression were significantly associated with higher Gleason score, more seminal vesicle invasions and lymph node metastases. Collectively, our results show a role of SHBG in upregulating stemness of prostate cancer cells upon DHT exposure in vitro, and SHBG expression in prostate cancer samples is significantly associated with poor clinicopathological features, indicating a role of SHBG in prostate cancer progression. PMID:23936228

  4. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L.) Using SLAF-seq.

    Science.gov (United States)

    Xie, Dongwei; Dai, Zhigang; Yang, Zemao; Sun, Jian; Zhao, Debao; Yang, Xue; Zhang, Liguo; Tang, Qing; Su, Jianguang

    2017-01-01

    Flax ( Linum usitatissimum L.) is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq) was employed to perform a genome-wide association study (GWAS) for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP) loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM) and a mixed linear model (MLM) as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  5. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L. Using SLAF-seq

    Directory of Open Access Journals (Sweden)

    Dongwei Xie

    2018-01-01

    Full Text Available Flax (Linum usitatissimum L. is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq was employed to perform a genome-wide association study (GWAS for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM and a mixed linear model (MLM as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  6. The strategic importance of identifying knowledge-based and intangible assets for generating value, competitiveness and innovation in sub-Saharan Africa

    Directory of Open Access Journals (Sweden)

    Nicoline Ondari-Okemwa

    2011-01-01

    Full Text Available This article discusses the strategic importance of identifying intangible assets for creating value and enhancing competitiveness and innovation in science and technology in a knowledge economy with particular reference to the sub- Saharan Africa region. It has always been difficult to gather the prerequisite information to manage such assets and create value from them. The paper discusses the nature of intangible assets, the characteristics of a knowledge economy and the role of knowledge workers in a knowledge economy. The paper also discusses the importance of identifying intangible assets in relation to capturing the value of such assets, the transfer of intangible assets to other owners and the challenges of managing organizational intangible assets. Objectives of the article include: underscoring the strategic importance of identifying intangible assets in sub-Saharan Africa; examining the performance of intangible assets in a knowledge economy; how intangible assets may generate competitiveness, economic growth and innovation; and assess how knowledge workers are becoming a dominant factor in the knowledge economy. An extensive literature review was employed to collect data for this article. It is concluded in the article that organizations and governments in sub-Saharan Africa should look at knowledge-based assets as strategic resources, even though the traditional accounting systems may still be having problems in determining the exact book value of such assets. It is recommended that organizations and government departments in sub-Saharan Africa should implement a system of the reporting of the value of intangible organizational assets just like the reporting of the value of tangible assets; and that organizations in sub-Saharan Africa should use knowledge to produce “smart products and services” which command premium prices.

  7. Identifying the distinct features of geometric structures for hole trapping to generate radicals on rutile TiO₂(110) in photooxidation using density functional theory calculations with hybrid functional.

    Science.gov (United States)

    Wang, Dong; Wang, Haifeng; Hu, P

    2015-01-21

    Using density functional theory calculations with HSE 06 functional, we obtained the structures of spin-polarized radicals on rutile TiO2(110), which is crucial to understand the photooxidation at the atomic level, and further calculate the thermodynamic stabilities of these radicals. By analyzing the results, we identify the structural features for hole trapping in the system, and reveal the mutual effects among the geometric structures, the energy levels of trapped hole states and their hole trapping capacities. Furthermore, the results from HSE 06 functional are compared to those from DFT + U and the stability trend of radicals against the number of slabs is tested. The effect of trapped holes on two important steps of the oxygen evolution reaction, i.e. water dissociation and the oxygen removal, is investigated and discussed.

  8. Identifying obstacles and ranking common biological control research priorities for Europe to manage most economically important pests in arable, vegetable and perennial crops.

    Science.gov (United States)

    Lamichhane, Jay Ram; Bischoff-Schaefer, Monika; Bluemel, Sylvia; Dachbrodt-Saaydeh, Silke; Dreux, Laure; Jansen, Jean-Pierre; Kiss, Jozsef; Köhl, Jürgen; Kudsk, Per; Malausa, Thibaut; Messéan, Antoine; Nicot, Philippe C; Ricci, Pierre; Thibierge, Jérôme; Villeneuve, François

    2017-01-01

    EU agriculture is currently in transition from conventional crop protection to integrated pest management (IPM). Because biocontrol is a key component of IPM, many European countries recently have intensified their national efforts on biocontrol research and innovation (R&I), although such initiatives are often fragmented. The operational outputs of national efforts would benefit from closer collaboration among stakeholders via transnationally coordinated approaches, as most economically important pests are similar across Europe. This paper proposes a common European framework on biocontrol R&I. It identifies generic R&I bottlenecks and needs as well as priorities for three crop types (arable, vegetable and perennial crops). The existing gap between the market offers of biocontrol solutions and the demand of growers, the lengthy and expensive registration process for biocontrol solutions and their varying effectiveness due to variable climatic conditions and site-specific factors across Europe are key obstacles hindering the development and adoption of biocontrol solutions in Europe. Considering arable, vegetable and perennial crops, a dozen common target pests are identified for each type of crop and ranked by order of importance at European level. Such a ranked list indicates numerous topics on which future joint transnational efforts would be justified. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  9. Linking the Salt Transcriptome with Physiological Responses of a Salt-Resistant Populus Species as a Strategy to Identify Genes Important for Stress Acclimation1[W][OA

    Science.gov (United States)

    Brinker, Monika; Brosché, Mikael; Vinocur, Basia; Abo-Ogiala, Atef; Fayyaz, Payam; Janz, Dennis; Ottow, Eric A.; Cullmann, Andreas D.; Saborowski, Joachim; Kangasjärvi, Jaakko; Altman, Arie; Polle, Andrea

    2010-01-01

    To investigate early salt acclimation mechanisms in a salt-tolerant poplar species (Populus euphratica), the kinetics of molecular, metabolic, and physiological changes during a 24-h salt exposure were measured. Three distinct phases of salt stress were identified by analyses of the osmotic pressure and the shoot water potential: dehydration, salt accumulation, and osmotic restoration associated with ionic stress. The duration and intensity of these phases differed between leaves and roots. Transcriptome analysis using P. euphratica-specific microarrays revealed clusters of coexpressed genes in these phases, with only 3% overlapping salt-responsive genes in leaves and roots. Acclimation of cellular metabolism to high salt concentrations involved remodeling of amino acid and protein biosynthesis and increased expression of molecular chaperones (dehydrins, osmotin). Leaves suffered initially from dehydration, which resulted in changes in transcript levels of mitochondrial and photosynthetic genes, indicating adjustment of energy metabolism. Initially, decreases in stress-related genes were found, whereas increases occurred only when leaves had restored the osmotic balance by salt accumulation. Comparative in silico analysis of the poplar stress regulon with Arabidopsis (Arabidopsis thaliana) orthologs was used as a strategy to reduce the number of candidate genes for functional analysis. Analysis of Arabidopsis knockout lines identified a lipocalin-like gene (AtTIL) and a gene encoding a protein with previously unknown functions (AtSIS) to play roles in salt tolerance. In conclusion, by dissecting the stress transcriptome of tolerant species, novel genes important for salt endurance can be identified. PMID:20959419

  10. Linking the salt transcriptome with physiological responses of a salt-resistant Populus species as a strategy to identify genes important for stress acclimation.

    Science.gov (United States)

    Brinker, Monika; Brosché, Mikael; Vinocur, Basia; Abo-Ogiala, Atef; Fayyaz, Payam; Janz, Dennis; Ottow, Eric A; Cullmann, Andreas D; Saborowski, Joachim; Kangasjärvi, Jaakko; Altman, Arie; Polle, Andrea

    2010-12-01

    To investigate early salt acclimation mechanisms in a salt-tolerant poplar species (Populus euphratica), the kinetics of molecular, metabolic, and physiological changes during a 24-h salt exposure were measured. Three distinct phases of salt stress were identified by analyses of the osmotic pressure and the shoot water potential: dehydration, salt accumulation, and osmotic restoration associated with ionic stress. The duration and intensity of these phases differed between leaves and roots. Transcriptome analysis using P. euphratica-specific microarrays revealed clusters of coexpressed genes in these phases, with only 3% overlapping salt-responsive genes in leaves and roots. Acclimation of cellular metabolism to high salt concentrations involved remodeling of amino acid and protein biosynthesis and increased expression of molecular chaperones (dehydrins, osmotin). Leaves suffered initially from dehydration, which resulted in changes in transcript levels of mitochondrial and photosynthetic genes, indicating adjustment of energy metabolism. Initially, decreases in stress-related genes were found, whereas increases occurred only when leaves had restored the osmotic balance by salt accumulation. Comparative in silico analysis of the poplar stress regulon with Arabidopsis (Arabidopsis thaliana) orthologs was used as a strategy to reduce the number of candidate genes for functional analysis. Analysis of Arabidopsis knockout lines identified a lipocalin-like gene (AtTIL) and a gene encoding a protein with previously unknown functions (AtSIS) to play roles in salt tolerance. In conclusion, by dissecting the stress transcriptome of tolerant species, novel genes important for salt endurance can be identified.

  11. Cultured bovine granulosa cells rapidly lose important features of their identity and functionality but partially recover under long-term culture conditions.

    Science.gov (United States)

    Yenuganti, Vengala Rao; Vanselow, Jens

    2017-05-01

    Cell culture models are essential for the detailed study of molecular processes. We analyze the dynamics of changes in a culture model of bovine granulosa cells. The cells were cultured for up to 8 days and analyzed for steroid production and gene expression. According to the expression of the marker genes CDH1, CDH2 and VIM, the cells maintained their mesenchymal character throughout the time of culture. In contrast, the levels of functionally important transcripts and of estradiol and progesterone production were rapidly down-regulated but showed a substantial up-regulation from day 4. FOXL2, a marker for granulosa cell identity, was also rapidly down-regulated after plating but completely recovered towards the end of culture. In contrast, expression of the Sertoli cell marker SOX9 and the lesion/inflammation marker PTGS2 increased during the first 2 days after plating but gradually decreased later on. We conclude that only long-term culture conditions (>4 days) allow the cells to recover from plating stress and to re-acquire characteristic granulosa cell features.

  12. Experimental assessment of the importance of amino acid positions identified by an entropy-based correlation analysis of multiple-sequence alignments.

    Science.gov (United States)

    Dietrich, Susanne; Borst, Nadine; Schlee, Sandra; Schneider, Daniel; Janda, Jan-Oliver; Sterner, Reinhard; Merkl, Rainer

    2012-07-17

    The analysis of a multiple-sequence alignment (MSA) with correlation methods identifies pairs of residue positions whose occupation with amino acids changes in a concerted manner. It is plausible to assume that positions that are part of many such correlation pairs are important for protein function or stability. We have used the algorithm H2r to identify positions k in the MSAs of the enzymes anthranilate phosphoribosyl transferase (AnPRT) and indole-3-glycerol phosphate synthase (IGPS) that show a high conn(k) value, i.e., a large number of significant correlations in which k is involved. The importance of the identified residues was experimentally validated by performing mutagenesis studies with sAnPRT and sIGPS from the archaeon Sulfolobus solfataricus. For sAnPRT, five H2r mutant proteins were generated by replacing nonconserved residues with alanine or the prevalent residue of the MSA. As a control, five residues with conn(k) values of zero were chosen randomly and replaced with alanine. The catalytic activities and conformational stabilities of the H2r and control mutant proteins were analyzed by steady-state enzyme kinetics and thermal unfolding studies. Compared to wild-type sAnPRT, the catalytic efficiencies (k(cat)/K(M)) were largely unaltered. In contrast, the apparent thermal unfolding temperature (T(M)(app)) was lowered in most proteins. Remarkably, the strongest observed destabilization (ΔT(M)(app) = 14 °C) was caused by the V284A exchange, which pertains to the position with the highest correlation signal [conn(k) = 11]. For sIGPS, six H2r mutant and four control proteins with alanine exchanges were generated and characterized. The k(cat)/K(M) values of four H2r mutant proteins were reduced between 13- and 120-fold, and their T(M)(app) values were decreased by up to 5 °C. For the sIGPS control proteins, the observed activity and stability decreases were much less severe. Our findings demonstrate that positions with high conn(k) values have an

  13. IDENTIFYING PLANETARY BIOSIGNATURE IMPOSTORS: SPECTRAL FEATURES OF CO AND O{sub 4} RESULTING FROM ABIOTIC O{sub 2}/O{sub 3} PRODUCTION

    Energy Technology Data Exchange (ETDEWEB)

    Schwieterman, Edward W.; Meadows, Victoria S.; Arney, Giada N.; Luger, Rodrigo; Misra, Amit; Barnes, Rory [Astronomy Department, University of Washington, Box 351580, Seattle, WA 98195 (United States); Domagal-Goldman, Shawn D.; Deming, Drake; Harman, Chester E., E-mail: eschwiet@uw.edu [NASA Astrobiology Institute’s Virtual Planetary Laboratory, Seattle, WA 981195 (United States)

    2016-03-01

    O{sub 2} and O{sub 3} have been long considered the most robust individual biosignature gases in a planetary atmosphere, yet multiple mechanisms that may produce them in the absence of life have been described. However, these abiotic planetary mechanisms modify the environment in potentially identifiable ways. Here we briefly discuss two of the most detectable spectral discriminants for abiotic O{sub 2}/O{sub 3}: CO and O{sub 4}. We produce the first explicit self-consistent simulations of these spectral discriminants as they may be seen by James Webb Space Telescope (JWST). If JWST-NIRISS and/or NIRSpec observe CO (2.35, 4.6 μm) in conjunction with CO{sub 2} (1.6, 2.0, 4.3 μm) in the transmission spectrum of a terrestrial planet it could indicate robust CO{sub 2} photolysis and suggest that a future detection of O{sub 2} or O{sub 3} might not be biogenic. Strong O{sub 4} bands seen in transmission at 1.06 and 1.27 μm could be diagnostic of a post-runaway O{sub 2}-dominated atmosphere from massive H-escape. We find that for these false positive scenarios, CO at 2.35 μm, CO{sub 2} at 2.0 and 4.3 μm, and O{sub 4} at 1.27 μm are all stronger features in transmission than O{sub 2}/O{sub 3} and could be detected with S/Ns ≳ 3 for an Earth-size planet orbiting a nearby M dwarf star with as few as 10 transits, assuming photon-limited noise. O{sub 4} bands could also be sought in UV/VIS/NIR reflected light (at 0.345, 0.36, 0.38, 0.445, 0.475, 0.53, 0.57, 0.63, 1.06, and 1.27 μm) by a next generation direct-imaging telescope such as LUVOIR/HDST or HabEx and would indicate an oxygen atmosphere too massive to be biologically produced.

  14. GAPO syndrome : a new case of this rare syndrome and a review of the relative importance of different phenotypic features in diagnosis

    NARCIS (Netherlands)

    Bacon, W; Hall, RK; Roset, JP; Boukari, A; Tenenbaum, H; Walter, B

    1999-01-01

    The case of GAPO syndrome reported here is the 24th recorded case, 23 cases having been published previously. The 29-year-old male under discussion presents all the typical features of the syndrome, having short stature, dysmorphic craniofacial features. total alopecia and pseudoanodontia. Orally,

  15. High throughput phenotypic selection of Mycobacterium tuberculosis mutants with impaired resistance to reactive oxygen species identifies genes important for intracellular growth.

    Directory of Open Access Journals (Sweden)

    Olga Mestre

    Full Text Available Mycobacterium tuberculosis has the remarkable capacity to survive within the hostile environment of the macrophage, and to resist potent antibacterial molecules such as reactive oxygen species (ROS. Thus, understanding mycobacterial resistance mechanisms against ROS may contribute to the development of new anti-tuberculosis therapies. Here we identified genes involved in such mechanisms by screening a high-density transposon mutant library, and we show that several of them are involved in the intracellular lifestyle of the pathogen. Many of these genes were found to play a part in cell envelope functions, further strengthening the important role of the mycobacterial cell envelope in protection against aggressions such as the ones caused by ROS inside host cells.

  16. PROBLEMATIC FEATURES OF THE POLITICAL DECISION MAKERS

    OpenAIRE

    Aleksey Sergeevih Voynov

    2014-01-01

    Purpose: identify the most important features in the process of making political decisions that affect the effectiveness of problem-solving situationsScientific novelty: as a result of the analysis identified the problematic features of major importance for the efficiency of the development and adoption of the most rational solution to a problem situation.Results: the analysis of the most significant features affecting the quality of decisions among them the interest of the person making deci...

  17. Identifying Key Features, Cutting Edge Cloud Resources, and Artificial Intelligence Tools to Achieve User-Friendly Water Science in the Cloud

    Science.gov (United States)

    Pierce, S. A.

    2017-12-01

    Decision making for groundwater systems is becoming increasingly important, as shifting water demands increasingly impact aquifers. As buffer systems, aquifers provide room for resilient responses and augment the actual timeframe for hydrological response. Yet the pace impacts, climate shifts, and degradation of water resources is accelerating. To meet these new drivers, groundwater science is transitioning toward the emerging field of Integrated Water Resources Management, or IWRM. IWRM incorporates a broad array of dimensions, methods, and tools to address problems that tend to be complex. Computational tools and accessible cyberinfrastructure (CI) are needed to cross the chasm between science and society. Fortunately cloud computing environments, such as the new Jetstream system, are evolving rapidly. While still targeting scientific user groups systems such as, Jetstream, offer configurable cyberinfrastructure to enable interactive computing and data analysis resources on demand. The web-based interfaces allow researchers to rapidly customize virtual machines, modify computing architecture and increase the usability and access for broader audiences to advanced compute environments. The result enables dexterous configurations and opening up opportunities for IWRM modelers to expand the reach of analyses, number of case studies, and quality of engagement with stakeholders and decision makers. The acute need to identify improved IWRM solutions paired with advanced computational resources refocuses the attention of IWRM researchers on applications, workflows, and intelligent systems that are capable of accelerating progress. IWRM must address key drivers of community concern, implement transdisciplinary methodologies, adapt and apply decision support tools in order to effectively support decisions about groundwater resource management. This presentation will provide an overview of advanced computing services in the cloud using integrated groundwater management case

  18. Systemic analysis of different colorectal cancer cell lines and TCGA datasets identified IGF-1R/EGFR-PPAR-CASPASE axis as important indicator for radiotherapy sensitivity.

    Science.gov (United States)

    Chen, Lin; Zhu, Zhe; Gao, Wei; Jiang, Qixin; Yu, Jiangming; Fu, Chuangang

    2017-09-05

    Insulin-like growth factor 1 receptor (IGF-1R) is proved to contribute the development of many types of cancers. But, little is known about its roles in radio-resistance of colorectal cancer (CRC). Here, we demonstrated that low IGF-1R expression value was associated with the better radiotherapy sensitivity of CRC. Besides, through Quantitative Real-time PCR (qRT-PCR), the elevated expression value of epidermal growth factor receptor (EGFR) was observed in CRC cell lines (HT29, RKO) with high radio-sensitivity compared with those with low sensitivity (SW480, LOVO). The irradiation induced apoptosis rates of wild type and EGFR agonist (EGF) or IGF-1R inhibitor (NVP-ADW742) treated HT29 and SW480 cells were quantified by flow cytometry. As a result, the apoptosis rate of EGF and NVP-ADW742 treated HT29 cells was significantly higher than that of those wild type ones, which indicated that high EGFR and low IGF-1R expression level in CRC was associated with the high sensitivity to radiotherapy. We next conducted systemic bioinformatics analysis of genome-wide expression profiles of CRC samples from the Cancer Genome Atlas (TCGA). Differential expression analysis between IGF-1R and EGFR abnormal CRC samples, i.e. CRC samples with higher IGF-1R and lower EGFR expression levels based on their median expression values, and the rest of CRC samples identified potential genes contribute to radiotherapy sensitivity. Functional enrichment of analysis of those differential expression genes (DEGs) in the Database for Annotation, Visualization and Integrated Discovery (DAVID) indicated PPAR signaling pathway as an important pathway for the radio-resistance of CRC. Our study identified the potential biomarkers for the rational selection of radiotherapy for CRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Whole-exome sequencing of muscle-invasive bladder cancer identifies recurrent mutations of UNC5C and prognostic importance of DNA repair gene mutations on survival.

    Science.gov (United States)

    Yap, Kai Lee; Kiyotani, Kazuma; Tamura, Kenji; Antic, Tatjana; Jang, Miran; Montoya, Magdeline; Campanile, Alexa; Yew, Poh Yin; Ganshert, Cory; Fujioka, Tomoaki; Steinberg, Gary D; O'Donnell, Peter H; Nakamura, Yusuke

    2014-12-15

    Because of suboptimal outcomes in muscle-invasive bladder cancer even with multimodality therapy, determination of potential genetic drivers offers the possibility of improving therapeutic approaches and discovering novel prognostic indicators. Using pTN staging, we case-matched 81 patients with resected ≥pT2 bladder cancers for whom perioperative chemotherapy use and disease recurrence status were known. Whole-exome sequencing was conducted in 43 cases to identify recurrent somatic mutations and targeted sequencing of 10 genes selected from the initial screening in an additional 38 cases was completed. Mutational profiles along with clinicopathologic information were correlated with recurrence-free survival (RFS) in the patients. We identified recurrent novel somatic mutations in the gene UNC5C (9.9%), in addition to TP53 (40.7%), KDM6A (21.0%), and TSC1 (12.3%). Patients who were carriers of somatic mutations in DNA repair genes (one or more of ATM, ERCC2, FANCD2, PALB2, BRCA1, or BRCA2) had a higher overall number of somatic mutations (P = 0.011). Importantly, after a median follow-up of 40.4 months, carriers of somatic mutations (n = 25) in any of these six DNA repair genes had significantly enhanced RFS compared with noncarriers [median, 32.4 vs. 14.8 months; hazard ratio of 0.46, 95% confidence interval (CI), 0.22-0.98; P = 0.0435], after adjustment for pathologic pTN staging and independent of adjuvant chemotherapy usage. Better prognostic outcomes of individuals carrying somatic mutations in DNA repair genes suggest these mutations as favorable prognostic events in muscle-invasive bladder cancer. Additional mechanistic investigation into the previously undiscovered role of UNC5C in bladder cancer is warranted. ©2014 American Association for Cancer Research.

  20. Integrated physiological, biochemical and molecular analysis identifies important traits and mechanisms associated with differential response of rice genotypes to elevated temperature

    Directory of Open Access Journals (Sweden)

    Boghireddy eSailaja

    2015-11-01

    Full Text Available In changing climate, heat stress caused by high temperature poses a serious threat to rice cultivation. A multiple organizational analysis at physiological, biochemical and molecular level is required to fully understand the impact of elevated temperature in rice. This study was aimed at deciphering the elevated temperature response in eleven popular and mega rice cultivars widely grown in India. Physiological and biochemical traits specifically membrane thermostability (MTS, antioxidants, and photosynthesis were studied at vegetative and reproductive phases which were used to establish a correlation with grain yield under stress. Several useful traits in different genotypes were identified which will be important resource to develop high temperature tolerant rice cultivars. Interestingly, Nagina22 emerged as best performer in terms of yield as well as expression of physiological and biochemical traits at elevated temperature. It showed lesser relative injury, lesser reduction in chlorophyll content, increased super oxide dismutase, catalase and peroxidase activity, lesser reduction in net photosynthetic rate (PN, high transpiration rate (E and other photosynthetic/ fluorescence parameters contributing to least reduction in spikelet fertility and grain yield at elevated temperature. Further, expression of 14 genes including heat shock transcription factors and heat shock proteins was analyzed in Nagina22 (tolerant and Vandana (susceptible at flowering phase, strengthening the fact that N22 performs better at molecular level also during elevated temperature. This study shows that elevated temperature response is complex and involves multiple biological processes which are needed to be characterized to address the challenges of future climate extreme conditions.

  1. Machine Learning Analysis Identifies Drosophila Grunge/Atrophin as an Important Learning and Memory Gene Required for Memory Retention and Social Learning.

    Science.gov (United States)

    Kacsoh, Balint Z; Greene, Casey S; Bosco, Giovanni

    2017-11-06

    High-throughput experiments are becoming increasingly common, and scientists must balance hypothesis-driven experiments with genome-wide data acquisition. We sought to predict novel genes involved in Drosophila learning and long-term memory from existing public high-throughput data. We performed an analysis using PILGRM, which analyzes public gene expression compendia using machine learning. We evaluated the top prediction alongside genes involved in learning and memory in IMP, an interface for functional relationship networks. We identified Grunge/Atrophin ( Gug/Atro ), a transcriptional repressor, histone deacetylase, as our top candidate. We find, through multiple, distinct assays, that Gug has an active role as a modulator of memory retention in the fly and its function is required in the adult mushroom body. Depletion of Gug specifically in neurons of the adult mushroom body, after cell division and neuronal development is complete, suggests that Gug function is important for memory retention through regulation of neuronal activity, and not by altering neurodevelopment. Our study provides a previously uncharacterized role for Gug as a possible regulator of neuronal plasticity at the interface of memory retention and memory extinction. Copyright © 2017 Kacsoh et al.

  2. Expressions of Social Conventions and Language Features in Arabic, German, Japanese and Korean and Their Importance in a Proficiency Oriented Classroom.

    Science.gov (United States)

    Armstrong, Marianne; And Others

    Teachers of Arabic, German, Japanese, and Korean at the Defense Language Institute describe classroom activities that have proven effective in preparing their adult, military language students for contact with another culture. Cultural awareness and understanding of the culture's sociolinguistic features are emphasized because of their importance…

  3. Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses

    Directory of Open Access Journals (Sweden)

    Su Zhen

    2011-07-01

    Full Text Available Abstract Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants.

  4. Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses

    Science.gov (United States)

    2011-01-01

    Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants. PMID:21718548

  5. The importance of Foxp3 antibody and fixation/permeabilization buffer combinations in identifying CD4+CD25+Foxp3+ regulatory T cells.

    Science.gov (United States)

    Law, Jacqueline P; Hirschkorn, Dale F; Owen, Rachel E; Biswas, Hope H; Norris, Philip J; Lanteri, Marion C

    2009-12-01

    Foxp3 is a key marker for CD4(+) regulatory T cells (T(regs)) and was used in developing a multiparameter flow cytometric panel to identify T(regs). Achieving reproducible staining and analysis first required optimization of Foxp3 staining. We present a comparative study of PCH101, 236A/E7, 3G3, 206D, 150D, and 259D/C7 clones of anti-human-Foxp3 antibodies used in combination with five different fixation/permeabilization buffers. Staining for CD25, CD152, and CD127 was also compared between fixation/permeabilization treatments. Promising antibody/buffer combinations were tested in a panel of peripheral blood mononuclear cells from 10 individuals, and then on fresh versus frozen cells from four individuals. Finally, different fluorochromes coupled to two representative antibodies were compared to optimize separation of Foxp3(+) from Foxp3(-) events. Foxp3 gates were set using two gating strategies based on CD127(+)CD25(-) "non-T(regs)" or based on isotype controls. For Foxp3 staining, the best conditions for fixation/permeabilization were obtained using the eBioscience Foxp3, Imgenex, BioLegend, and BD Foxp3 buffers. Comparing results from 10 subjects, 259D/C7, PCH101, 236A/E7, and 206D antibodies yielded statistically higher levels of Foxp3 cells than those by 150D and 3G3 antibodies (mean = 6.9, 5.1, 4.7, and 3.7% compared with 1.7, and 0.3% of CD25(+)Foxp3(+) events within CD4(+) cells, respectively). Importantly, the "nonspecificity" of some antibodies observed with a Foxp3 gate based on isotype controls could be eliminated by setting the Foxp3 gate on "non-T(regs)". Better separation of Foxp3(+) and Foxp3(-) populations was observed using the PCH101 clone coupled to Alexa647 compared with FITC or the 259D/C7 clone coupled to PE compared with Alexa488 fluorochrome. Foxp3 staining can be highly variable and depends on the choice of antibody/buffer pair and the fluorochrome used. Selecting the correct population for setting the Foxp3 gate is critical to avoid

  6. Textural features for radar image analysis

    Science.gov (United States)

    Shanmugan, K. S.; Narayanan, V.; Frost, V. S.; Stiles, J. A.; Holtzman, J. C.

    1981-01-01

    Texture is seen as an important spatial feature useful for identifying objects or regions of interest in an image. While textural features have been widely used in analyzing a variety of photographic images, they have not been used in processing radar images. A procedure for extracting a set of textural features for characterizing small areas in radar images is presented, and it is shown that these features can be used in classifying segments of radar images corresponding to different geological formations.

  7. Bipolar disorder: The importance of clinical assessment in identifying prognostic factors - An Audit. Part 3: A comparison between Italian and English mental health services and a survey of bipolar disorder.

    Science.gov (United States)

    Verdolini, Norma; Dean, Jonathon; Massucci, Giampaolo; Elisei, Sandro; Quartesan, Roberto; Zaman, Rashid; Agius, Mark

    2014-11-01

    Most of the prognostic factors of bipolar disorder, which determine disease course and outcome, could be detected from simple but often-unrecorded questions asked during the psychiatric clinic assessments. In previous parts of this research, we analysed various prognostic factors and focused on mixed states and rapid cycling subsets. We now compare our sample in England with a small sample from Italy to demonstrate the utility of focused prognostic questioning and of international comparison. We collected data from the clinical notes of 70 English bipolar and 8 Italian bipolar outpatients seen at the initial psychiatric assessment clinic about socio-demographic and clinical factors to determine whether various factors had relevance to prevalence, prognosis, or outcome. The sample comprised 16 bipolar I (22.9%) and 54 bipolar II (77.1%) English outpatients and 7 bipolar I (87.5%) and 1 bipolar II (12.5%) Italian outpatients. Differences between the groups are seen mainly in terms of age of onset, duration of both depressive and hypomanic episodes, presence of psychiatric family history, incidence of mixed state features and rapid cycling, presence of elated mood in response to past antidepressant treatment, and misuse of illicit drugs and alcohol. In order to promote improved mental health primary care, mental health systems in all countries should develop standardized epidemiological tools that are shared between countries. We recommend the use of a questionnaire that reminds clinicians of potentially prognostic information and suggest that this might identify important components of a potential standardized diagnostic and prognostic tool.

  8. Geomorphological features in the southern Canary Island Volcanic Province: The importance of volcanic processes and massive slope instabilities associated with seamounts

    Science.gov (United States)

    Palomino, Desirée; Vázquez, Juan-Tomás; Somoza, Luis; León, Ricardo; López-González, Nieves; Medialdea, Teresa; Fernández-Salas, Luis-Miguel; González, Francisco-Javier; Rengel, Juan Antonio

    2016-02-01

    The margin of the continental slope of the Volcanic Province of Canary Islands is characterised by seamounts, submarine hills and large landslides. The seabed morphology including detailed morphology of the seamounts and hills was analysed using multibeam bathymetry and backscatter data, and very high resolution seismic profiles. Some of the elevation data are reported here for the first time. The shape and distribution of characteristics features such as volcanic cones, ridges, slides scars, gullies and channels indicate evolutionary differences. Special attention was paid to recent geological processes that influenced the seamounts. We defined various morpho-sedimentary units, which are mainly due to massive slope instability that disrupt the pelagic sedimentary cover. We also studied other processes such as the role of deep bottom currents in determining sediment distribution. The sediments are interpreted as the result of a complex mixture of material derived from a) slope failures on seamounts and submarine hills; and b) slides and slumps on the continental slope.

  9. A novel screening method for cell wall mutants in Aspergillus niger identifies UDP-galactopyranose mutase as an important protein in fungal cell wall biosynthesis

    NARCIS (Netherlands)

    Damveld, R.A.; Franken, A.; Arentshorst, M.; Punt, P.J.; Klis, F.M.; van den Hondel, C.A.M.J.J.; Ram, A.F.J.

    2008-01-01

    To identify cell wall biosynthetic genes in filamentous fungi and thus potential targets for the discovery of new antifungals, we developed a novel screening method for cell wall mutants. It is based on our earlier observation that the Aspergillus niger agsA gene, which encodes a putative

  10. Gene expression profiling identifies FYN as an important molecule in tamoxifen resistance and a predictor of early recurrence in patients treated with endocrine therapy

    DEFF Research Database (Denmark)

    Elias, D; (Hansen) Vever, Henriette; Lænkholm, A-V

    2015-01-01

    To elucidate the molecular mechanisms of tamoxifen resistance in breast cancer, we performed gene array analyses and identified 366 genes with altered expression in four unique tamoxifen-resistant (TamR) cell lines vs the parental tamoxifen-sensitive MCF-7/S0.5 cell line. Most of these genes were...

  11. A novel screening method for cell wall mutants in Aspergillus niger identifies UDP-galactopyranose mutase as an important protein in fungal cell wall biosynthesis

    NARCIS (Netherlands)

    Damveld, R.A.; Franken, A.; Arentshorst, M.; Punt, P.J.; Klis, F.M.; Hondel, C.A.M.J.J. van den; Ram, A.F.J.

    2008-01-01

    To identify cell wall biosynthetic genes in filamentous fungi and thus potential targets for the discovery of new antifungals, we developed a novel screening method for cell wall mutants. It is based on our earlier observation that the Aspergillus niger agsA gene, which encodes a putative a-glucan

  12. Prevalence and Clinical Import of Thoracic Injury Identified by Chest Computed Tomography but Not Chest Radiography in Blunt Trauma: Multicenter Prospective Cohort Study.

    Science.gov (United States)

    Langdorf, Mark I; Medak, Anthony J; Hendey, Gregory W; Nishijima, Daniel K; Mower, William R; Raja, Ali S; Baumann, Brigitte M; Anglin, Deirdre R; Anderson, Craig L; Lotfipour, Shahram; Reed, Karin E; Zuabi, Nadia; Khan, Nooreen A; Bithell, Chelsey A; Rowther, Armaan A; Villar, Julian; Rodriguez, Robert M

    2015-12-01

    Chest computed tomography (CT) diagnoses more injuries than chest radiography, so-called occult injuries. Wide availability of chest CT has driven substantial increase in emergency department use, although the incidence and clinical significance of chest CT findings have not been fully described. We determine the frequency, severity, and clinical import of occult injury, as determined by changes in management. These data will better inform clinical decisions, need for chest CT, and odds of intervention. Our sample included prospective data (2009 to 2013) on 5,912 patients at 10 Level I trauma center EDs with both chest radiography and chest CT at physician discretion. These patients were 40.6% of 14,553 enrolled in the parent study who had either chest radiography or chest CT. Occult injuries were pneumothorax, hemothorax, sternal or greater than 2 rib fractures, pulmonary contusion, thoracic spine or scapula fracture, and diaphragm or great vessel injury found on chest CT but not on preceding chest radiography. A priori, we categorized thoracic injuries as major (having invasive procedures), minor (observation or inpatient pain control >24 hours), or of no clinical significance. Primary outcome was prevalence and proportion of occult injury with major interventions of chest tube, mechanical ventilation, or surgery. Secondary outcome was minor interventions of admission rate or observation hours because of occult injury. Two thousand forty-eight patients (34.6%) had chest injury on chest radiography or chest CT, whereas 1,454 of these patients (71.0%, 24.6% of all patients) had occult injury. Of these, in 954 patients (46.6% of injured, 16.1% of total), chest CT found injuries not observed on immediately preceding chest radiography. In 500 more patients (24.4% of injured patients, 8.5% of all patients), chest radiography found some injury, but chest CT found occult injury. Chest radiography found all injuries in only 29.0% of injured patients. Two hundred and two

  13. What Does It Take to Change an Editor's Mind? Identifying Minimally Important Difference Thresholds for Peer Reviewer Rating Scores of Scientific Articles.

    Science.gov (United States)

    Callaham, Michael; John, Leslie K

    2018-01-05

    We define a minimally important difference for the Likert-type scores frequently used in scientific peer review (similar to existing minimally important differences for scores in clinical medicine). The magnitude of score change required to change editorial decisions has not been studied, to our knowledge. Experienced editors at a journal in the top 6% by impact factor were asked how large a change of rating in "overall desirability for publication" was required to trigger a change in their initial decision on an article. Minimally important differences were assessed twice for each editor: once assessing the rating change required to shift the editor away from an initial decision to accept, and the other assessing the magnitude required to shift away from an initial rejection decision. Forty-one editors completed the survey (89% response rate). In the acceptance frame, the median minimally important difference was 0.4 points on a scale of 1 to 5. Editors required a greater rating change to shift from an initial rejection decision; in the rejection frame, the median minimally important difference was 1.2 points. Within each frame, there was considerable heterogeneity: in the acceptance frame, 38% of editors did not change their decision within the maximum available range; in the rejection frame, 51% did not. To our knowledge, this is the first study to determine the minimally important difference for Likert-type ratings of research article quality, or in fact any nonclinical scientific assessment variable. Our findings may be useful for future research assessing whether changes to the peer review process produce clinically meaningful differences in editorial decisionmaking. Copyright © 2017 American College of Emergency Physicians. Published by Elsevier Inc. All rights reserved.

  14. Comparison of Spot Urine Protein to Creatinine Ratio to 24-Hour Proteinuria to Identify Important Change Over Time in Proteinuria in Lupus.

    Science.gov (United States)

    Medina-Rosas, Jorge; Su, Jiandong; Cook, Richard J; Sabapathy, Arthy; Touma, Zahi

    2017-09-01

    The aim of this study was to determine whether spot urine protein-to-creatinine ratio (PCR) accurately measures the change in proteinuria compared with 24-hour proteinuria (24H-P). This was a retrospective analysis on patients' paired visits and paired urine samples for PCR and 24H-P. Patients with both abnormal 24H-P (>0.5 g/d) and PCR (>0.05 g/mmol) or both normal 24H-P (≤0.5 g/d) and PCR (≤0.05 g/mmol) at baseline visit were identified.The first follow-up visit with partial recovery (50% decrease in proteinuria) or complete recovery (≤0.5 g/d) was identified for those with abnormal baseline 24H-P, and new proteinuria (>0.5 g/d) was identified for those with normal 24H-P. Twenty-four-hour urine collection and PCR end-point frequencies were compared. Twenty-four-hour urine collection results were converted to 24H-PCR. Twenty-four-hour PCR and PCR were utilized to measure the magnitude of change (by standardized response mean [SRM]) in patients who achieved the end points. Of 230 patients, at baseline, 95 patients had abnormal and 109 had normal 24H-P and PCR. On follow-up, 57 achieved partial recovery, and 53 achieved complete recovery by 24H-P. Standardized response mean was -1.03 and -1.10 for 24H-PCR and PCR, respectively. By PCR, 53 patients had partial recovery, and 27 had complete recovery. Standardized response mean was -1.25 and -0.86 by 24H-PCR and PCR, respectively.For new proteinuria, 28 patients were identified by 24H-P and 21 by PCR. Twenty-four-hour PCR SRM was 0.80, and PCR SRM was 0.68. Protein-to-creatinine ratio does not have sufficient accuracy compared with 24H-P for improvement and worsening to be used in lieu of 24H-P.

  15. Identifying most important skills for PhD students in Food Science and Technology: a comparison between industry and academic stakeholders

    Directory of Open Access Journals (Sweden)

    Chelo González-Martínez

    2015-10-01

    Full Text Available Nowadays, there is an increasing need of new skills for PhD students to face the future labour market prospects. PhD graduates must have qualities attractive not only in academia but also outside, in both manufacture and service-oriented enterprises, in small innovative companies, and in the civil services and public administration, among others. To know what the needs of these future employees are, is of great importance to be able to improve their personal and academic formation. The aim of this work was, in the framework of the EC-funded ISEKI_Food 4 network, to evaluate the most desirable specific and soft skills that PhD students should acquire by the end of their doctoral studies. To this aim, several surveys were conducted and sent to the different stakeholders (academia and food industry partners in order to collect the information needed. Results showed that competences related to research skills and techniques, research management, personal effectiveness and communication skills were considered to be the most valuable skills to be acquired by our PhD students to meet the future needs of the labour market.  The importance of these skills was appreciated differently, depending on the stakeholder. To sum up, some recommendations to integrate such valuable skills into the curricula of the PhD student are given.

  16. Post-hoc principal component analysis on a largely illiterate elderly population from North-west India to identify important elements of mini-mental state examination

    Directory of Open Access Journals (Sweden)

    Sunil Kumar Raina

    2016-01-01

    Full Text Available Background: Mini-mental state examination (MMSE scale measures cognition using specific elements that can be isolated, defined, and subsequently measured. This study was conducted with the aim to analyze the factorial structure of MMSE in a largely, illiterate, elderly population in India and to reduce the number of variables to a few meaningful and interpretable combinations. Methodology: Principal component analysis (PCA was performed post-hoc on the data generated by a research project conducted to estimate the prevalence of dementia in four geographically defined habitations in Himachal Pradesh state of India. Results: Questions on orientation and registration account for high percentage of cumulative variance in comparison to other questions. Discussion: The PCA conducted on the data derived from a largely, illiterate population reveals that the most important components to consider for the estimation of cognitive impairment in illiterate Indian population are temporal orientation, spatial orientation, and immediate memory.

  17. Post-hoc principal component analysis on a largely illiterate elderly population from North-west India to identify important elements of mini-mental state examination.

    Science.gov (United States)

    Raina, Sunil Kumar; Chander, Vishav; Raina, Sujeet; Grover, Ashoo

    2016-01-01

    Mini-mental state examination (MMSE) scale measures cognition using specific elements that can be isolated, defined, and subsequently measured. This study was conducted with the aim to analyze the factorial structure of MMSE in a largely, illiterate, elderly population in India and to reduce the number of variables to a few meaningful and interpretable combinations. Principal component analysis (PCA) was performed post-hoc on the data generated by a research project conducted to estimate the prevalence of dementia in four geographically defined habitations in Himachal Pradesh state of India. Questions on orientation and registration account for high percentage of cumulative variance in comparison to other questions. The PCA conducted on the data derived from a largely, illiterate population reveals that the most important components to consider for the estimation of cognitive impairment in illiterate Indian population are temporal orientation, spatial orientation, and immediate memory.

  18. Improving a full-text search engine: the importance of negation detection and family history context to identify cases in a biomedical data warehouse.

    Science.gov (United States)

    Garcelon, Nicolas; Neuraz, Antoine; Benoit, Vincent; Salomon, Rémi; Burgun, Anita

    2017-05-01

    The repurposing of electronic health records (EHRs) can improve clinical and genetic research for rare diseases. However, significant information in rare disease EHRs is embedded in the narrative reports, which contain many negated clinical signs and family medical history. This paper presents a method to detect family history and negation in narrative reports and evaluates its impact on selecting populations from a clinical data warehouse (CDW). We developed a pipeline to process 1.6 million reports from multiple sources. This pipeline is part of the load process of the Necker Hospital CDW. We identified patients with "Lupus and diarrhea," "Crohn's and diabetes," and "NPHP1" from the CDW. The overall precision, recall, specificity, and F-measure were 0.85, 0.98, 0.93, and 0.91, respectively. The proposed method generates a highly accurate identification of cases from a CDW of rare disease EHRs. © The Author 2016. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  19. Identifying Image Manipulation Software from Image Features

    Science.gov (United States)

    2015-03-26

    scales”. Educational and Psychological Measurement, 20(1):37, 1960. 7. Committee, Technical Standardization. Exchangeable image file format for digital...Digital Forensics. Springer, 2005. 23. Photography, Technical Committee. Photography and graphic technology - Ex- tended colour encodings for digital image

  20. Proteome analysis identifies the Dpr protein of Streptococcus mutans as an important factor in the presence of early streptococcal colonizers of tooth surfaces.

    Directory of Open Access Journals (Sweden)

    Akihiro Yoshida

    Full Text Available Oral streptococci are primary colonizers of tooth surfaces and Streptococcus mutans is the principal causative agent of dental caries in humans. A number of proteins are involved in the formation of monospecies biofilms by S. mutans. This study analyzed the protein expression profiles of S. mutans biofilms formed in the presence or absence of S. gordonii, a pioneer colonizer of the tooth surface, by two-dimensional gel electrophoresis (2-DE. After identifying S. mutans proteins by Mass spectrometric analysis, their expression in the presence of S. gordonii was analyzed. S. mutans was inoculated with or without S. gordonii DL1. The two species were compartmentalized using 0.2-μl Anopore membranes. The biofilms on polystyrene plates were harvested, and the solubilized proteins were separated by 2-DE. When S. mutans biofilms were formed in the presence of S. gordonii, the peroxide resistance protein Dpr of the former showed 4.3-fold increased expression compared to biofilms that developed in the absence of the pioneer colonizer. In addition, we performed a competition assay using S. mutans antioxidant protein mutants together with S. gordonii and other initial colonizers. Growth of the dpr-knockout S. mutans mutant was significantly inhibited by S. gordonii, as well as by S. sanguinis. Furthermore, a cell viability assay revealed that the viability of the dpr-defective mutant was significantly attenuated compared to the wild-type strain when co-cultured with S. gordonii. Therefore, these results suggest that Dpr might be one of the essential proteins for S. mutans survival on teeth in the presence of early colonizing oral streptococci.

  1. Proteome Analysis Identifies the Dpr Protein of Streptococcus mutans as an Important Factor in the Presence of Early Streptococcal Colonizers of Tooth Surfaces

    Science.gov (United States)

    Yoshida, Akihiro; Niki, Mamiko; Yamamoto, Yuji; Yasunaga, Ai; Ansai, Toshihiro

    2015-01-01

    Oral streptococci are primary colonizers of tooth surfaces and Streptococcus mutans is the principal causative agent of dental caries in humans. A number of proteins are involved in the formation of monospecies biofilms by S. mutans. This study analyzed the protein expression profiles of S. mutans biofilms formed in the presence or absence of S. gordonii, a pioneer colonizer of the tooth surface, by two-dimensional gel electrophoresis (2-DE). After identifying S. mutans proteins by Mass spectrometric analysis, their expression in the presence of S. gordonii was analyzed. S. mutans was inoculated with or without S. gordonii DL1. The two species were compartmentalized using 0.2-μl Anopore membranes. The biofilms on polystyrene plates were harvested, and the solubilized proteins were separated by 2-DE. When S. mutans biofilms were formed in the presence of S. gordonii, the peroxide resistance protein Dpr of the former showed 4.3-fold increased expression compared to biofilms that developed in the absence of the pioneer colonizer. In addition, we performed a competition assay using S. mutans antioxidant protein mutants together with S. gordonii and other initial colonizers. Growth of the dpr-knockout S. mutans mutant was significantly inhibited by S. gordonii, as well as by S. sanguinis. Furthermore, a cell viability assay revealed that the viability of the dpr-defective mutant was significantly attenuated compared to the wild-type strain when co-cultured with S. gordonii. Therefore, these results suggest that Dpr might be one of the essential proteins for S. mutans survival on teeth in the presence of early colonizing oral streptococci. PMID:25816242

  2. Foxtail millet NF-Y families: genome-wide survey and evolution analyses identified two functional genes important in abiotic stresses

    Directory of Open Access Journals (Sweden)

    Zhi-Juan eFeng

    2015-12-01

    Full Text Available It was reported that Nuclear Factor Y (NF-Y genes were involved in abiotic stress in plants. Foxtail millet (Setaria italica, an elite stress tolerant crop, provided an impetus for the investigation of the NF-Y families in abiotic responses. In the present study, a total of 39 NF-Y genes were identified in foxtail millet. Synteny analyses suggested that foxtail millet NF-Y genes had experienced rapid expansion and strong purifying selection during the process of plant evolution. De novo transcriptome assembly of foxtail millet revealed 11 drought up-regulated NF-Y genes. SiNF-YA1 and SiNF-YB8 were highly activated in leaves and/or roots by drought and salt stresses. Abscisic acid (ABA and H2O2 played positive roles in the induction of SiNF-YA1 and SiNF-YB8 under stress treatments. Transient luciferase (LUC expression assays revealed that SiNF-YA1 and SiNF-YB8 could activate the LUC gene driven by the tobacco (Nicotiana tobacam NtERD10, NtLEA5, NtCAT, NtSOD or NtPOD promoter under normal or stress conditions. Overexpression of SiNF-YA1 enhanced drought and salt tolerance by activating stress-related genes NtERD10 and NtCAT1 and by maintaining relatively stable relative water content (RWC and contents of chlorophyll, superoxide dismutase (SOD, peroxidase (POD, catalase (CAT and malondialdehyde (MDA in transgenic lines under stresses. SiNF-YB8 regulated expression of NtSOD, NtPOD, NtLEA5 and NtERD10 and conferred relatively high RWC and chlorophyll contents and low MDA content, resulting in drought and osmotic tolerance in transgenic lines under stresses. Therefore, SiNF-YA1 and SiNF-YB8 could activate stress-related genes and improve physiological traits, resulting in tolerance to abiotic stresses in plants. All these results will facilitate functional characterization of foxtail millet NF-Ys in future studies.

  3. Understanding Legacy Features with Featureous

    DEFF Research Database (Denmark)

    Olszak, Andrzej; Jørgensen, Bo Nørregaard

    2011-01-01

    Java programs called Featureous that addresses this issue. Featureous allows a programmer to easily establish feature-code traceability links and to analyze their characteristics using a number of visualizations. Featureous is an extension to the NetBeans IDE, and can itself be extended by third...

  4. Physician Rating Websites: What Aspects Are Important to Identify a Good Doctor, and Are Patients Capable of Assessing Them? A Mixed-Methods Approach Including Physicians' and Health Care Consumers' Perspectives.

    Science.gov (United States)

    Rothenfluh, Fabia; Schulz, Peter J

    2017-05-01

    Physician rating websites (PRWs) offer health care consumers the opportunity to evaluate their doctor anonymously. However, physicians' professional training and experience create a vast knowledge gap in medical matters between physicians and patients. This raises ethical concerns about the relevance and significance of health care consumers' evaluation of physicians' performance. To identify the aspects physician rating websites should offer for evaluation, this study investigated the aspects of physicians and their practice relevant for identifying a good doctor, and whether health care consumers are capable of evaluating these aspects. In a first step, a Delphi study with physicians from 4 specializations was conducted, testing various indicators to identify a good physician. These indicators were theoretically derived from Donabedian, who classifies quality in health care into pillars of structure, process, and outcome. In a second step, a cross-sectional survey with health care consumers in Switzerland (N=211) was launched based on the indicators developed in the Delphi study. Participants were asked to rate the importance of these indicators to identify a good physician and whether they would feel capable to evaluate those aspects after the first visit to a physician. All indicators were ordered into a 4×4 grid based on evaluation and importance, as judged by the physicians and health care consumers. Agreement between the physicians and health care consumers was calculated applying Holsti's method. In the majority of aspects, physicians and health care consumers agreed on what facets of care were important and not important to identify a good physician and whether patients were able to evaluate them, yielding a level of agreement of 74.3%. The two parties agreed that the infrastructure, staff, organization, and interpersonal skills are both important for a good physician and can be evaluated by health care consumers. Technical skills of a doctor and outcomes

  5. Feature Article

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education. Feature Article. Articles in Resonance – Journal of Science Education. Volume 1 Issue 1 January 1996 pp 80-85 Feature Article. What's New in Computers Windows 95 · Vijnan Shastri · More Details Fulltext PDF. Volume 1 Issue 1 January 1996 pp 86-89 Feature ...

  6. Individual discriminative face recognition models based on subsets of features

    DEFF Research Database (Denmark)

    Clemmensen, Line Katrine Harder; Gomez, David Delgado; Ersbøll, Bjarne Kjær

    2007-01-01

    The accuracy of data classification methods depends considerably on the data representation and on the selected features. In this work, the elastic net model selection is used to identify meaningful and important features in face recognition. Modelling the characteristics which distinguish one...... person from another using only subsets of features will both decrease the computational cost and increase the generalization capacity of the face recognition algorithm. Moreover, identifying which are the features that better discriminate between persons will also provide a deeper understanding...... of the face recognition problem. The elastic net model is able to select a subset of features with low computational effort compared to other state-of-the-art feature selection methods. Furthermore, the fact that the number of features usually is larger than the number of images in the data base makes feature...

  7. Principal component analysis of normalized full spectrum mass spectrometry data in multiMS-toolbox: An effective tool to identify important factors for classification of different metabolic patterns and bacterial strains.

    Science.gov (United States)

    Cejnar, Pavel; Kuckova, Stepanka; Prochazka, Ales; Karamonova, Ludmila; Svobodova, Barbora

    2018-06-15

    Explorative statistical analysis of mass spectrometry data is still a time-consuming step. We analyzed critical factors for application of principal component analysis (PCA) in mass spectrometry and focused on two whole spectrum based normalization techniques and their application in the analysis of registered peak data and, in comparison, in full spectrum data analysis. We used this technique to identify different metabolic patterns in the bacterial culture of Cronobacter sakazakii, an important foodborne pathogen. Two software utilities, the ms-alone, a python-based utility for mass spectrometry data preprocessing and peak extraction, and the multiMS-toolbox, an R software tool for advanced peak registration and detailed explorative statistical analysis, were implemented. The bacterial culture of Cronobacter sakazakii was cultivated on Enterobacter sakazakii Isolation Agar, Blood Agar Base and Tryptone Soya Agar for 24 h and 48 h and applied by the smear method on an Autoflex speed MALDI-TOF mass spectrometer. For three tested cultivation media only two different metabolic patterns of Cronobacter sakazakii were identified using PCA applied on data normalized by two different normalization techniques. Results from matched peak data and subsequent detailed full spectrum analysis identified only two different metabolic patterns - a cultivation on Enterobacter sakazakii Isolation Agar showed significant differences to the cultivation on the other two tested media. The metabolic patterns for all tested cultivation media also proved the dependence on cultivation time. Both whole spectrum based normalization techniques together with the full spectrum PCA allow identification of important discriminative factors in experiments with several variable condition factors avoiding any problems with improper identification of peaks or emphasis on bellow threshold peak data. The amounts of processed data remain still manageable. Both implemented software utilities are available

  8. Formal consensus to identify clinically important changes in management resulting from the use of cardiovascular magnetic resonance (CMR) in patients who activate the primary percutaneous coronary intervention (PPCI) pathway.

    Science.gov (United States)

    Pufulete, Maria; Brierley, Rachel C; Bucciarelli-Ducci, Chiara; Greenwood, John P; Dorman, Stephen; Anderson, Richard A; Harris, Jessica; McAlindon, Elisa; Rogers, Chris A; Reeves, Barnaby C

    2017-06-22

    To define important changes in management arising from the use of cardiovascular magnetic resonance (CMR) in patients who activate the primary percutaneous coronary intervention (PPCI) pathway. Formal consensus study using literature review and cardiologist expert opinion to formulate consensus statements and setting up a consensus panel to review the statements (by completing a web-based survey, attending a face-to-face meeting to discuss survey results and modify the survey to reflect group discussion and completing the modified survey to determine which statements were in consensus). Formulation of consensus statements: four cardiologists (two CMR and two interventional) and six non-clinical researchers. Formal consensus: seven cardiologists (two CMR and three interventional, one echocardiography and one heart failure). Forty-nine additional cardiologists completed the modified survey. Thirty-seven draft statements describing changes in management following CMR were generated; these were condensed into 12 statements and reviewed through the formal consensus process. Three of 12 statements were classified in consensus in the first survey; these related to the role of CMR in identifying the cause of out-of-hospital cardiac arrest, providing a definitive diagnosis in patients found to have unobstructed arteries on angiography and identifying patients with left ventricular thrombus. Two additional statements were in consensus in the modified survey, relating to the ability of CMR to identify patients who have a poor prognosis after PPCI and assess ischaemia and viability in patients with multivessel disease. There was consensus that CMR leads to clinically important changes in management in five subgroups of patients who activate the PPCI pathway. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  9. MicroRNAs regulate T-cell production of interleukin-9 and identify hypoxia-inducible factor-2α as an important regulator of T helper 9 and regulatory T-cell differentiation.

    Science.gov (United States)

    Singh, Yogesh; Garden, Oliver A; Lang, Florian; Cobb, Bradley S

    2016-09-01

    MicroRNAs (miRNAs) regulate many aspects of helper T cell (Th) development and function. Here we found that they are required for the suppression of interleukin-9 (IL-9) expression in Th9 cells and other Th subsets. Two highly related miRNAs (miR-15b and miR-16) that we previously found to play an important role in regulatory T (Treg) cell differentiation were capable of suppressing IL-9 expression when they were over-expressed in Th9 cells. We used these miRNAs as tools to identify novel regulators of IL-9 expression and found that they could regulate the expression of Epas1, which encodes hypoxia-inducible factor (HIF)-2α. HIF proteins regulate metabolic pathway usage that is important in determining appropriate Th differentiation. The related protein, HIF-1α enhances Th17 differentiation and inhibits Treg cell differentiation. Here we found that HIF-2α was required for IL-9 expression in Th9 cells, but its expression was not sufficient in other Th subsets. Furthermore, HIF-2α suppressed Treg cell differentiation like HIF-1α, demonstrating both similar and distinct roles of the HIF proteins in Th differentiation and adding a further dimension to their function. Ironically, even though miR-15b and miR-16 suppressed HIF-2α expression in Treg cells, inhibiting their function in Treg cells did not lead to an increase in IL-9 expression. Therefore, the physiologically relevant miRNAs that regulate IL-9 expression in Treg cells and other subsets remain unknown. Nevertheless, the analysis of miR-15b and miR-16 function led to the discovery of the importance of HIF-2α so this work demonstrated the utility of studying miRNA function to identify novel regulatory pathways in helper T-cell development. © 2016 John Wiley & Sons Ltd.

  10. Feature Extraction

    CERN Document Server

    CERN. Geneva

    2015-01-01

    Feature selection and reduction are key to robust multivariate analyses. In this talk I will focus on pros and cons of various variable selection methods and focus on those that are most relevant in the context of HEP.

  11. Solar Features

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Collection includes a variety of solar feature datasets contributed by a number of national and private solar observatories located worldwide.

  12. Site Features

    Data.gov (United States)

    U.S. Environmental Protection Agency — This dataset consists of various site features from multiple Superfund sites in U.S. EPA Region 8. These data were acquired from multiple sources at different times...

  13. Designing attractive gamification features for collaborative storytelling websites.

    Science.gov (United States)

    Hsu, Shang Hwa; Chang, Jen-Wei; Lee, Chun-Chia

    2013-06-01

    Gamification design is considered as the predictor of collaborative storytelling websites' success. Although aforementioned studies have mentioned a broad range of factors that may influence gamification, they neither depicted the actual design features nor relative attractiveness among them. This study aims to identify attractive gamification features for collaborative storytelling websites. We first constructed a hierarchical system structure of gamification design of collaborative storytelling websites and conducted a focus group interview with eighteen frequent users to identify 35gamification features. After that, this study determined the relative attractiveness of these gamification features by administrating an online survey to 6333 collaborative storytelling websites users. The results indicated that the top 10 most attractive gamification features could account for more than 50% of attractiveness among these 35 gamification features. The feature of unpredictable time pressure is important to website users, yet not revealed in previous relevant studies. Implications of the findings were discussed.

  14. Importance measures

    International Nuclear Information System (INIS)

    Gomez Cobo, A.

    1997-01-01

    The presentation discusses the following: general concepts of importance measures; example fault tree, used to illustrate importance measures; Birnbaum's structural importance; criticality importance; Fussel-Vesely importance; upgrading function; risk achievement worth; risk reduction worth

  15. A putative biomarker signature for clinically effective AKT inhibition: correlation of in vitro, in vivo and clinical data identifies the importance of modulation of the mTORC1 pathway.

    Science.gov (United States)

    Cheraghchi-Bashi, Azadeh; Parker, Christine A; Curry, Ed; Salazar, Jean-Frederic; Gungor, Hatice; Saleem, Azeem; Cunnea, Paula; Rama, Nona; Salinas, Cristian; Mills, Gordon B; Morris, Shannon R; Kumar, Rakesh; Gabra, Hani; Stronach, Euan A

    2015-12-08

    Our identification of dysregulation of the AKT pathway in ovarian cancer as a platinum resistance specific event led to a comprehensive analysis of in vitro, in vivo and clinical behaviour of the AKT inhibitor GSK2141795. Proteomic biomarker signatures correlating with effects of GSK2141795 were developed using in vitro and in vivo models, well characterised for related molecular, phenotypic and imaging endpoints. Signatures were validated in temporally paired biopsies from patients treated with GSK2141795 in a clinical study. GSK2141795 caused growth-arrest as single agent in vitro, enhanced cisplatin-induced apoptosis in vitro and reduced tumour volume in combination with platinum in vivo. GSK2141795 treatment in vitro and in vivo resulted in ~50-90% decrease in phospho-PRAS40 and 20-80% decrease in fluoro-deoxyglucose (FDG) uptake. Proteomic analysis of GSK2141795 in vitro and in vivo identified a signature of pathway inhibition including changes in AKT and p38 phosphorylation and total Bim, IGF1R, AR and YB1 levels. In patient biopsies, prior to treatment with GSK2141795 in a phase 1 clinical trial, this signature was predictive of post-treatment changes in the response marker CA125. Development of this signature represents an opportunity to demonstrate the clinical importance of AKT inhibition for re-sensitisation of platinum resistant ovarian cancer to platinum.

  16. Implementation and importance of fluorescence in situ hybridization (fish) in paraffin tissues for categorization of B-cell lymphoma unclassifiable, with features intermediate between Burkitt lymphoma and diffuse large B-cell lymphoma

    International Nuclear Information System (INIS)

    Carvajal Cuenca, Alejandra

    2011-01-01

    The diagnostic criteria have been defined based on the tools that the country has acquired and international guidelines for pure entities: the LB, LDCGB, and the new entity of B lymphoma unclassifiable with features intermediate LDCGB and LB. The fluorescence in situ hybridization for the translocation (8;14) has been implemented in paraffin tissues for proper categorization. A total of 21 cases have been studied: the characteristics of patients, morphology, immunohistochemistry and the presence or absence of the translocation (8;14). Twelve of the cases have been classified as B-cell lymphoma unclassifiable with features intermediate between LDCGB and LB. Furthermore, nine of the cases were classified in LB. Fluorescence in situ hybridization (FISH) has been negative in 5 of the 21 cases. The diagnosis of lymphoma with features bordering between the LB and the LDCGB has been imperative for the survival of the patient and the corresponding treatment [es

  17. Presence of multiple spondyloarthritis (SpA) features is important but not sufficient for a diagnosis of axial spondyloarthritis: data from the SPondyloArthritis Caught Early (SPACE) cohort

    NARCIS (Netherlands)

    Ez-Zaitouni, Z.; Bakker, P. A. C.; van Lunteren, M.; Berg, I. J.; Landewe, R.; van Oosterhout, M.; Lorenzin, M.; van der Heijde, D.; van Gaalen, F. A.

    2017-01-01

    Objectives Concerns have been raised about overdiagnosis of axial spondyloarthritis (axSpA). We investigated whether patients with chronic back pain (CBP) of short duration and multiple SpA features are always diagnosed with axSpA by the rheumatologist, and to what extent fulfilment of the

  18. Featuring animacy

    Directory of Open Access Journals (Sweden)

    Elizabeth Ritter

    2015-01-01

    Full Text Available Algonquian languages are famous for their animacy-based grammatical properties—an animacy based noun classification system and direct/inverse system which gives rise to animacy hierarchy effects in the determination of verb agreement. In this paper I provide new evidence for the proposal that the distinctive properties of these languages is due to the use of participant-based features, rather than spatio-temporal ones, for both nominal and verbal functional categories (Ritter & Wiltschko 2009, 2014. Building on Wiltschko (2012, I develop a formal treatment of the Blackfoot aspectual system that assumes a category Inner Aspect (cf. MacDonald 2008, Travis 1991, 2010. Focusing on lexical aspect in Blackfoot, I demonstrate that the classification of both nouns (Seinsarten and verbs (Aktionsarten is based on animacy, rather than boundedness, resulting in a strikingly different aspectual system for both categories. 

  19. Cherubism: Clinicoradiographic Features and Treatment

    Directory of Open Access Journals (Sweden)

    Luiz Antonio Guimarães Cabral

    2010-04-01

    Full Text Available Objectives: Cherubism is a congenital childhood disease of autosomal dominant inheritance. This disease is characterized by painless bilateral enlargement of the jaws, in which bone is replaced with fibrous tissue. The condition has sui generis clinical, radiographic and histological features, of which the clinician should be aware for a better differential diagnosis in the presence of a fibro-osseous lesion affecting the bones of the maxillomandibular complex. The purpose of present paper was to review the literature and to report the most important aspects of cherubism in order to facilitate the study of this disease.Material and Methods: Literature was reviewed about cherubism, emphasizing the relevant clinicoradiographic features and treatment. Literature was selected through a search of PubMed and Scielo electronic databases. The keywords used for search were adolescent, cherubism, cherubism/physiopathology, cherubism/treatment, cherubism/radiography. A manual search of the reference lists of the identified articles and the authors’ article files and recent reviews was conducted to identify additional publications. Those studies that described new features about cherubism were included in this review.Results: In total 44 literature sources were obtained and reviewed. Studies that described new features about cherubism physiopathology, diagnostics and treatment were reviewed.Conclusions: Despite the exceptions, cherubism is a clinically well-characterized disease. In cases of a suspicion of cherubism, radiographic examination is essential since the clinical presentation, the location and distribution of the lesions may define the diagnosis. Histopathological examination is complementary. Nowadays, genetic tests should be used for final diagnosis of cherubism.

  20. Mammographic feature enhancement by multiscale analysis

    International Nuclear Information System (INIS)

    Laine, A.F.; Schuler, S.; Fan, J.; Huda, W.

    1994-01-01

    This paper introduces a novel approach for accomplishing mammographic feature analysis by overcomplete multiresolution representations. The authors show that efficient representations may be identified within a continuum of scale-space and used to enhance features of importance to mammography. Methods of contrast enhancement are described based on three overcomplete multiscale representations: (1) the dyadic wavelet transform (separable), (2) the var-phi-transform (nonseparable, nonorthogonal), and (3) the hexagonal wavelet transform (nonseparable). Multiscale edges identified within distinct levels of transform space provide local support for image enhancement. Mammograms are reconstructed from wavelet coefficients modified at one or more levels by local and global nonlinear operators. In each case, edges and gain parameters are identified adaptively by a measure of energy within each level of scale-space. The authors show quantitatively that transform coefficients, modified by adaptive nonlinear operators, can make more obvious unseen or barely seen features of mammography without requiring additional radiation. The results are compared with traditional image enhancement techniques by measuring the local contrast of known mammographic features. The authors demonstrate that features extracted from multiresolution representations can provide an adaptive mechanism for accomplishing local contrast enhancement. By improving the visualization of breast pathology, they can improve chances of early detection while requiring less time to evaluate mammograms for most patients

  1. Crowding with conjunctions of simple features.

    Science.gov (United States)

    Põder, Endel; Wagemans, Johan

    2007-11-20

    Several recent studies have related crowding with the feature integration stage in visual processing. In order to understand the mechanisms involved in this stage, it is important to use stimuli that have several features to integrate, and these features should be clearly defined and measurable. In this study, Gabor patches were used as target and distractor stimuli. The stimuli differed in three dimensions: spatial frequency, orientation, and color. A group of 3, 5, or 7 objects was presented briefly at 4 deg eccentricity of the visual field. The observers' task was to identify the object located in the center of the group. A strong effect of the number of distractors was observed, consistent with various spatial pooling models. The analysis of incorrect responses revealed that these were a mix of feature errors and mislocalizations of the target object. Feature errors were not purely random, but biased by the features of distractors. We propose a simple feature integration model that predicts most of the observed regularities.

  2. Dependency Parsing with Transformed Feature

    Directory of Open Access Journals (Sweden)

    Fuxiang Wu

    2017-01-01

    Full Text Available Dependency parsing is an important subtask of natural language processing. In this paper, we propose an embedding feature transforming method for graph-based parsing, transform-based parsing, which directly utilizes the inner similarity of the features to extract information from all feature strings including the un-indexed strings and alleviate the feature sparse problem. The model transforms the extracted features to transformed features via applying a feature weight matrix, which consists of similarities between the feature strings. Since the matrix is usually rank-deficient because of similar feature strings, it would influence the strength of constraints. However, it is proven that the duplicate transformed features do not degrade the optimization algorithm: the margin infused relaxed algorithm. Moreover, this problem can be alleviated by reducing the number of the nearest transformed features of a feature. In addition, to further improve the parsing accuracy, a fusion parser is introduced to integrate transformed and original features. Our experiments verify that both transform-based and fusion parser improve the parsing accuracy compared to the corresponding feature-based parser.

  3. Mechanisms of Disease and Clinical Features of Mutations of the Gene for Mitofusin 2: An Important Cause of Hereditary Peripheral Neuropathy with Striking Clinical Variability in Children and Adults

    Science.gov (United States)

    Ouvrier, Robert; Grew, Simon

    2010-01-01

    Mitofusin 2, a large transmembrane GTPase located in the outer mitochondrial membrane, promotes membrane fusion and is involved in the maintenance of the morphology of axonal mitochondria. Mutations of the gene encoding mitofusin 2 ("MFN2") have recently been identified as the cause of approximately one-third of dominantly inherited cases of the…

  4. A pair of seamount chains in the Central Indian Basin, identified from multibeam mapping

    Digital Repository Service at National Institute of Oceanography (India)

    Kodagali, V.N.

    Seamounts are major physiographic features on the ocean floor. Their study is important to the understanding of the tectonic history of the seafloor. Over 150 seamounts were identified during the multibeam (Hydrosweep system) mapping of the Central...

  5. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  6. Personality Features of Motorists

    Directory of Open Access Journals (Sweden)

    Andrej Justinek

    1997-12-01

    Full Text Available Justinek tries to answer the question whether or not motorists have specific personality features which predispose them for safe and well-mannered driving. A good driver should have sensory abilities which enable psycho-motor coordiation of a vehicle, intellectual and cognitive features that are important for solving problems in new, unknown situations, and emotional and motivational trails defining a driver's maturity. Justmek advocates the belief that in training future drivers greater attention should be paid to developing these features which are vital for safe driving and appropriate behaviour of drivers in traffic. He also suggests certain learning methods leading to development of the above­ mentioned personality traits. Justinek introduces the notion of the 'philosophy of driving' as an essential educational category in training future drivers.

  7. Histological image classification using biologically interpretable shape-based features

    International Nuclear Information System (INIS)

    Kothari, Sonal; Phan, John H; Young, Andrew N; Wang, May D

    2013-01-01

    Automatic cancer diagnostic systems based on histological image classification are important for improving therapeutic decisions. Previous studies propose textural and morphological features for such systems. These features capture patterns in histological images that are useful for both cancer grading and subtyping. However, because many of these features lack a clear biological interpretation, pathologists may be reluctant to adopt these features for clinical diagnosis. We examine the utility of biologically interpretable shape-based features for classification of histological renal tumor images. Using Fourier shape descriptors, we extract shape-based features that capture the distribution of stain-enhanced cellular and tissue structures in each image and evaluate these features using a multi-class prediction model. We compare the predictive performance of the shape-based diagnostic model to that of traditional models, i.e., using textural, morphological and topological features. The shape-based model, with an average accuracy of 77%, outperforms or complements traditional models. We identify the most informative shapes for each renal tumor subtype from the top-selected features. Results suggest that these shapes are not only accurate diagnostic features, but also correlate with known biological characteristics of renal tumors. Shape-based analysis of histological renal tumor images accurately classifies disease subtypes and reveals biologically insightful discriminatory features. This method for shape-based analysis can be extended to other histological datasets to aid pathologists in diagnostic and therapeutic decisions

  8. IMPORTANT NOTIFICATION

    CERN Multimedia

    HR Department

    2009-01-01

    Green plates, removals and importation of personal effects Please note that, as from 1 April 2009, formalities relating to K and CD special series French vehicle plates (green plates), removals and importation of personal effects into France and Switzerland will be dealt with by GS Department (Building 73/3-014, tel. 73683/74407). Importation and purchase of tax-free vehicles in Switzerland, as well as diplomatic privileges, will continue to be dealt with by the Installation Service of HR Department (Building 33/1-011, tel. 73962). HR and GS Departments

  9. Measures of risk importance and their applications

    International Nuclear Information System (INIS)

    Vesely, W.E.; Davis, T.C.; Denning, R.S.; Saltos, N.

    1983-07-01

    This work is part of a project being conducted for the Division of Risk Analysis (DRA) of the Nuclear Regulatory Commission (NRC). The objectives of the project are to evaluate the importances of containment, the different safety functions, and other various contributers as assessed in probabilistic risk analyses and to identify generic conclusions regarding the importances. Effective display of the importances is an important part of these objectives. To address these objectives, measures of risk importance need to be first identified and then they need to be evaluated for the different risk analyses which have been performed. This report describes the risk importance measures that were defined and were applied to the risk analyses which were performed as part of the Reactor Safety Study Methodology Applications Program (RSSMAP). The risk importance measures defined in this report measure the importance of features not only with regard to risk reduction but also with regard to reliability assurance, or risk maintenance. The goal of this report is not to identify new mathematical formulas for risk importance but to show how importance measures can be interpreted and can be applied

  10. Using Matrix-Assisted Laser Desorption Ionization-Time of Flight (MALDI-TOF) Complemented with Selected 16S rRNA and gyrB Genes Sequencing to Practically Identify Clinical Important Viridans Group Streptococci (VGS).

    Science.gov (United States)

    Zhou, Menglan; Yang, Qiwen; Kudinha, Timothy; Zhang, Li; Xiao, Meng; Kong, Fanrong; Zhao, Yupei; Xu, Ying-Chun

    2016-01-01

    There are challenges in viridans group streptococci (VGS) identification especially for the mitis group. Few studies have investigated the performance of MALDI-TOF MS system in VGS identification. Using 16S rRNA gene and gyrB gene sequencing as a gold standard, the performance of two MALDI-TOF MS instruments in the identification of 181 VGS clinical isolates was studied. The Bruker Biotyper and Vitek MS IVD systems correctly identified 88.4% and 98.9% of the 181 isolates, respectively. The Vitek MS RUO system was the least reliable, only correctly identifying 38.7% of the isolates to species level with several misidentifications and invalid results. The Bruker Biotyper system was very unreliable in the identification of species within the mitis group. Among 22 non-pneumococci isolates (S. mitis/S. oralis/S. pseudopneumoniae), Biotyper misidentified 21 of them as S. pneumoniae leading to a low sensitivity and low positive predictive value in these species. In contrast, the Vitek MS IVD demonstrated a better resolution for pneumococci and non-pneumococci despite the inability to distinguish between S. mitis/S. oralis. For more accurate species-level identification, further improvements in the VGS spectra databases are needed. Based on MALDI-TOF analysis and selected 16S rRNA gene plus gyrB genes sequencing, we designed a practical VGS identification algorithm.

  11. Acoustic features of objects matched by an echolocating bottlenose dolphin.

    Science.gov (United States)

    Delong, Caroline M; Au, Whitlow W L; Lemonds, David W; Harley, Heidi E; Roitblat, Herbert L

    2006-03-01

    The focus of this study was to investigate how dolphins use acoustic features in returning echolocation signals to discriminate among objects. An echolocating dolphin performed a match-to-sample task with objects that varied in size, shape, material, and texture. After the task was completed, the features of the object echoes were measured (e.g., target strength, peak frequency). The dolphin's error patterns were examined in conjunction with the between-object variation in acoustic features to identify the acoustic features that the dolphin used to discriminate among the objects. The present study explored two hypotheses regarding the way dolphins use acoustic information in echoes: (1) use of a single feature, or (2) use of a linear combination of multiple features. The results suggested that dolphins do not use a single feature across all object sets or a linear combination of six echo features. Five features appeared to be important to the dolphin on four or more sets: the echo spectrum shape, the pattern of changes in target strength and number of highlights as a function of object orientation, and peak and center frequency. These data suggest that dolphins use multiple features and integrate information across echoes from a range of object orientations.

  12. Importance classification

    International Nuclear Information System (INIS)

    Mizumachi, Wataru; Kobayashi, Masahide

    2008-01-01

    Conventionally, the design of a nuclear reactor has been performed from a viewpoint of a safety function and the importance on earthquake-proof on the basis of not giving off the mainly included radioactivity outside. In this Niigataken-Chuetsuoki earthquake, there is almost no damage to the system, components and structure on safe also in the earthquake beyond assumption, and the validity of the design was checked. But, the situation peculiar to a big earthquake was also generated. The emergency plan room which should serve as a connection center with the exterior was not able to open a door and use at the beginning. Fire-extinguishing system piping fractured and self-defense fire fighting was not made. And so on. Discussion from the following three viewpoints was performed. 1st: The importance from a viewpoint which should maintain a function also with the disaster in case of an earthquake like an emergency plan room etc. 2nd: In the earthquake, since the safe system and un-safe system was influenced, the importance from a viewpoint which may have influence safely inquired when the un-safe system broke down. 3rd: Although it was not directly related safely, discussion from a viewpoint which influences fear of insecurity, such as taking out smoke, for example, was performed (author)

  13. ICF reactor economics: identifying the high leverage design features

    International Nuclear Information System (INIS)

    Meier, W.R.; Hogan, W.J.

    1985-01-01

    Parametric studies were carried out for a heavy ion beam (HIB) fusion electric power plant to investigate the effects on the cost of electricity (COE) of variations in several design parameters. In particular, we examined the effects of maximum achievable chamber pulse rate, driver cost, target gain, electric conversion efficiency, and net electric power. We find that with a combination of improvements over our base case, HIB fusion can be economically competitive with other future power sources

  14. Automatically identifying characteristic features of non-native English accents

    NARCIS (Netherlands)

    Bloem, Jelke; Wieling, Martijn; Nerbonne, John; Côté, Marie-Hélène; Knooihuizen, Remco; Nerbonne, John

    2016-01-01

    In this work, we demonstrate the application of statistical measures from dialectometry to the study of accented English speech. This new methodology enables a more quantitative approach to the study of accents. Studies on spoken dialect data have shown that a combination of representativeness (the

  15. Identifying Universal Linguistic Features Associated with Veracity and Deception

    Science.gov (United States)

    2015-01-02

    declared no potential conflicts of interests with respect to the authorship and/or publication of this article. FINANCIAL DISCLOSURE/FUNDING: This...Unique Sensory Detail and Spatial Detail Posthoc analyses: Gender differences According to Suckle-Nelson et al. (2010), women who responded...did not use SA, it was possible that, regardless of language, gender matters. Thus, gender was tested in the current study by conducting an overall

  16. A challenge of a Brownfield Redevelopment: Identifying Real Estate Features

    NARCIS (Netherlands)

    Glumac, B.; Smeets, J.J.A.M.; Schaefer, W.F.; Otter, den A.F.H.J.

    2009-01-01

    One of the biggest challenges in urban areas is the redevelopment of brownfields. Most of the brownfield sites are currently not fully in use or even totally vacant, derelict or contaminated. They are not available for intended use without a drastic intervention. During the decision making process

  17. Key Clinical Features to Identify Girls with "CDKL5" Mutations

    Science.gov (United States)

    Bahi-Buisson, Nadia; Nectoux, Juliette; Rosas-Vargas, Haydee; Milh, Mathieu; Boddaert, Nathalie; Girard, Benoit; Cances, Claude; Ville, Dorothee; Afenjar, Alexandra; Rio, Marlene; Heron, Delphine; Morel, Marie Ange N'Guyen; Arzimanoglou, Alexis; Philippe, Christophe; Jonveaux, Philippe; Chelly, Jamel; Bienvenu, Thierry

    2008-01-01

    Mutations in the human X-linked cyclin-dependent kinase-like 5 ("CDKL5") gene have been shown to cause infantile spasms as well as Rett syndrome (RTT)-like phenotype. To date, less than 25 different mutations have been reported. So far, there are still little data on the key clinical diagnosis criteria and on the natural history of…

  18. Connectivity features for identifying cognitive impairment in presymptomatic carotid stenosis.

    Directory of Open Access Journals (Sweden)

    Chun-Jen Lin

    Full Text Available Severe asymptomatic stenosis of the internal carotid artery (ICA leads to increased incidence of mild cognitive impairment (MCI likely through silent embolic infarcts and/or chronic hypoperfusion, but the brain dysfunction is poorly understood and difficult to diagnose. Thirty cognitively intact subjects with asymptomatic, severe (≥ 70%, unilateral stenosis of the ICA were compared with 30 healthy controls, matched for age, sex, cardiovascular risk factors and education level, on a battery of neuropsychiatric tests, voxel-based morphometry of magnetic resonance imaging (MRI, diffusion tensor imaging and brain-wise, seed-based analysis of resting-state functional MRI. Multivariate regression models and multivariate pattern classification (support vector machines were computed to assess the relationship between connectivity measures and neurocognitive performance. The patients had worse dizziness scores and poorer verbal memory, executive function and complex visuo-spatial performance than controls. Twelve out of the 30 patients (40% were considered to have MCI. Nonetheless, the leukoaraiosis Sheltens scores, hippocampal and brain volumes were not different between groups. Their whole-brain mean fractional anisotropy (FA was significantly reduced and regional functional connectivity (Fc was significantly impaired in the dorsal attention network (DAN, frontoparietal network, sensorimotor network and default mode network. In particular, the Fc strength at the insula of the DAN and the mean FA were linearly related with attention performance and dizziness severity, respectively. The multivariate pattern classification gave over 90% predictive accuracy of individuals with MCI or severe dizziness. Cognitive decline in stroke-free individuals with severe carotid stenosis may arise from nonselective widespread disconnections of long-range, predominantly interhemispheric non-hippocampal pathways. Connectivity measures may serve as both predictors for cases at risk and therapeutic targets for mitigating vascular cognitive impairment.

  19. Identifying developmental features in students' clinical reasoning to inform teaching.

    Science.gov (United States)

    Pinnock, Ralph; Anakin, Megan; Lawrence, Julie; Chignell, Helen; Wilkinson, Tim

    2018-04-27

    There is increasing evidence that students at different levels of training may benefit from different methods of learning clinical reasoning. Two of the common methods of teaching are the "whole - case" format and the "serial cue" approach. There is little empirical evidence to guide teachers as to which method to use and when to introduce them. We observed 23 students from different stages of training to examine how they were taking a history and how they were thinking whilst doing this. Each student interviewed a simulated patient who presented with a straightforward and a complex presentation. We inferred how students were reasoning from how they took a history and how they described their thinking while doing this. Early in their training students can only take a generic history. Only later in training are they able to take a focused history, remember the information they have gathered, use it to seek further specific information, compare and contrast possibilities and analyze their data as they are collecting it. Early in their training students are unable to analyze data during history taking. When they have started developing illness scripts, they are able to benefit from the "serial cue" approach of teaching clinical reasoning.

  20. MRI features of chondroblastoma

    International Nuclear Information System (INIS)

    Cheng Xiaoguang; Liu Xia; Cheng Kebin; Liu Wei

    2009-01-01

    Objective: To evaluate the MR imaging features of chondroblastoma. Methods: MRI examinations of 20 patients with histological proven chondmblastoma were reviewed retrospectively. The MRI findings of chondroblastoma including the signal intensity, the shape, the growth patterns, and the surrounding bone marrow edema and the adjacent soft tissue edema, the periosteal reaction, the adjacent joint effusion were analyzed. Results: All 20 cases demonstrated heterogeneous MR signal intensity on T 1 WI and T 2 WI images and showed lobular margins. Sixteen cases demonstrated expansive growth patterns. Surrounding bone marrow edema was found in 18 cases and adjacent soft tissue edema in 14 cases. Periosteal reaction was identified in 6 cases. In 7 cases the tumor extended to adjacent soft tissue. Adjacent joint effusion was visible on MRI in 6 cases. Conclusion: Heterogeneous signal intensity, lobular margins and expansive growth pattern, adjacent bone marrow and soft tissue edema were the common features of chondroblastoma on MRI. (authors)

  1. The Role of Attention for Context-Context Binding of Intrinsic and Extrinsic Features

    Science.gov (United States)

    Boywitt, C. Dennis; Meiser, Thorsten

    2012-01-01

    There is converging evidence that the feeling of conscious recollection is usually accompanied by the bound retrieval of context features of the encoding episode (e.g., Meiser, Sattler, & Weiber, 2008). Recently, however, important limiting conditions have been identified for the binding between context features in memory. For example, focusing on…

  2. Discovery and analysis of topographic features using learning algorithms: A seamount case study

    NARCIS (Netherlands)

    Valentine, A.P.; Kalnins, L.M.; Trampert, J.

    2013-01-01

    Identifying and cataloging occurrences of particular topographic features are important but time-consuming tasks. Typically, automation is challenging, as simple models do not fully describe the complexities of natural features. We propose a new approach, where a particular class of neural network

  3. Thoughts on identifiers

    CERN Multimedia

    CERN. Geneva

    2005-01-01

    As business processes and information transactions have become an inextricably intertwined with the Web, the importance of assignment, registration, discovery, and maintenance of identifiers has increased. In spite of this, integrated frameworks for managing identifiers have been slow to emerge. Instead, identification systems arise (quite naturally) from immediate business needs without consideration for how they fit into larger information architectures. In addition, many legacy identifier systems further complicate the landscape, making it difficult for content managers to select and deploy identifier systems that meet both the business case and long term information management objectives. This presentation will outline a model for evaluating identifier applications and the functional requirements of the systems necessary to support them. The model is based on a layered analysis of the characteristics of identifier systems, including: * Functional characteristics * Technology * Policy * Business * Social T...

  4. Online feature selection with streaming features.

    Science.gov (United States)

    Wu, Xindong; Yu, Kui; Ding, Wei; Wang, Hao; Zhu, Xingquan

    2013-05-01

    We propose a new online feature selection framework for applications with streaming features where the knowledge of the full feature space is unknown in advance. We define streaming features as features that flow in one by one over time whereas the number of training examples remains fixed. This is in contrast with traditional online learning methods that only deal with sequentially added observations, with little attention being paid to streaming features. The critical challenges for Online Streaming Feature Selection (OSFS) include 1) the continuous growth of feature volumes over time, 2) a large feature space, possibly of unknown or infinite size, and 3) the unavailability of the entire feature set before learning starts. In the paper, we present a novel Online Streaming Feature Selection method to select strongly relevant and nonredundant features on the fly. An efficient Fast-OSFS algorithm is proposed to improve feature selection performance. The proposed algorithms are evaluated extensively on high-dimensional datasets and also with a real-world case study on impact crater detection. Experimental results demonstrate that the algorithms achieve better compactness and higher prediction accuracy than existing streaming feature selection algorithms.

  5. Writer identification using curvature-free features

    NARCIS (Netherlands)

    He, Sheng; Schomaker, Lambertus

    2017-01-01

    Feature engineering takes a very important role in writer identification which has been widely studied in the literature. Previous works have shown that the joint feature distribution of two properties can improve the performance. The joint feature distribution makes feature relationships explicit

  6. Feature Selection for Audio Surveillance in Urban Environment

    Directory of Open Access Journals (Sweden)

    KIKTOVA Eva

    2014-05-01

    Full Text Available This paper presents the work leading to the acoustic event detection system, which is designed to recognize two types of acoustic events (shot and breaking glass in urban environment. For this purpose, a huge front-end processing was performed for the effective parametric representation of an input sound. MFCC features and features computed during their extraction (MELSPEC and FBANK, then MPEG-7 audio descriptors and other temporal and spectral characteristics were extracted. High dimensional feature sets were created and in the next phase reduced by the mutual information based selection algorithms. Hidden Markov Model based classifier was applied and evaluated by the Viterbi decoding algorithm. Thus very effective feature sets were identified and also the less important features were found.

  7. PROBLEMATIC FEATURES OF THE POLITICAL DECISION MAKERS

    Directory of Open Access Journals (Sweden)

    Aleksey Sergeevih Voynov

    2014-11-01

    Full Text Available Purpose: identify the most important features in the process of making political decisions that affect the effectiveness of problem-solving situationsScientific novelty: as a result of the analysis identified the problematic features of major importance for the efficiency of the development and adoption of the most rational solution to a problem situation.Results: the analysis of the most significant features affecting the quality of decisions among them the interest of the person making decisions in the search for causes of the problem situation; decisions from the influence of the immediate environment; populism in decision making, creating a visibility problem-solving; decision making based on personal emotional factor face decision-makers; the perception of the population face decision-makers in relation to the current problem situation and possible ways of its resolution.Defined facts influencing the process of political decision-making such as: corruption, the struggle for influence on the process of political decision-making, lack of qualified specialists, staff shortage, including arose as the result of substitution of notions of "succession" to "nepotism".

  8. Unconventional imports

    International Nuclear Information System (INIS)

    Yamaguchi, N.D.

    2001-01-01

    This article focuses on bitumens and bitumen products from Canadian oil sands and explores how they will affect the Canadian oil industry and the US refining industry. The falling production of crude, the growing demand for it, and the stagnating refining capacity in the US are reported, and Canadian and Mexican exports to the US, the definition of bitumens and bitumen quality, and the position of Canada as world leader in bitumen resources are considered. Bitumen production techniques, sales of bitumens and synthetic crude, the production outlook, and the quality and refining of bitumen and synthetic crude are examined. Plots illustrating North American crude refining capacity, production and demand for 1980-2000; US crude imports from Canada and Mexico (1981-2000), world proven oil reserves (2001), world bitumen resources, and Canadian oil production (1998-2000) are provided. Details of the composition of crudes and bitumens, and recent synthetic crude production are tabulated

  9. [Important epidemiological features of the treatment of type 2 diabetes].

    Science.gov (United States)

    Seguí Díaz, M

    2014-07-01

    According to the various clinical practice guidelines, the recommendations for the treatment of type 2 diabetes are well-established, thus leading to homogenization of clinical practice and avoiding variability. However, it is well known that, depending on factors such as effectiveness, physiopathology, cost, adverse effects, preferences, and comorbidities, each patient will, in the long-term, receive different treatment of type 2 diabetes. The consensus document published last year and approved by the American Diabetes Association and the European Association for the Study of Diabetes recommends distinct targets for each patient with type 2 diabetes and argues for the individualization of the management and treatment of this disease. In other words, the document advocates a patient-centered approach, in which the various therapeutic alternatives are related mainly to distinct physiopathological factors, adverse effects, and the patient's comorbidities, as well as the patient's preferences. Copyright © 2014 Elsevier España, S.L.U. y Sociedad Española de Medicina Rural y Generalista (SEMERGEN). All rights reserved.

  10. Evaluations and utilizations of risk importances

    International Nuclear Information System (INIS)

    Vesely, W.E.; Davis, T.C.

    1985-08-01

    This report presents approaches for utilizing Probabilistic Risk Analyses (PRA's) to determine risk importances. Risk importances are determined for design features, plant operations, and other factors that can affect risk. PRA's can be used to identify the importances of risk contributors or proposed changes to designs or operations. The objective of this report is to serve as a handbook and guide in evaluating and applying risk importances. The utilization of both qualitative risk importances and quantitative risk importances is described in this report. Qualitative risk importances are based on the logic models in the PRA, while quantitative risk importances are based on the quantitative results of the PRA. Both types of importances are among the most robust and meaningful information a PRA can provide. A wide variety of risk importance evaluations are described including evaluations of the importances of design changes, testing, maintenance, degrading environments, and aging. Specific utilizations are described in inspection and in reliability assurance programs, however the general approaches have widespread applicability. The role of personal computers and decision support programs in applying risk importance evaluations is also described

  11. Identifying Knowledge and Communication

    Directory of Open Access Journals (Sweden)

    Eduardo Coutinho Lourenço de Lima

    2006-12-01

    Full Text Available In this paper, I discuss how the principle of identifying knowledge which Strawson advances in ‘Singular Terms and Predication’ (1961, and in ‘Identifying Reference and Truth-Values’ (1964 turns out to constrain communication. The principle states that a speaker’s use of a referring expression should invoke identifying knowledge on the part of the hearer, if the hearer is to understand what the speaker is saying, and also that, in so referring, speakers are attentive to hearers’ epistemic states. In contrasting it with Russell’s Principle (Evans 1982, as well as with the principle of identifying descriptions (Donnellan 1970, I try to show that the principle of identifying knowledge, ultimately a condition for understanding, makes sense only in a situation of conversation. This allows me to conclude that the cooperative feature of communication (Grice 1975 and reference (Clark andWilkes-Gibbs 1986 holds also at the understanding level. Finally, I discuss where Strawson’s views seem to be unsatisfactory, and suggest how they might be improved.

  12. Efficient Multi-Label Feature Selection Using Entropy-Based Label Selection

    Directory of Open Access Journals (Sweden)

    Jaesung Lee

    2016-11-01

    Full Text Available Multi-label feature selection is designed to select a subset of features according to their importance to multiple labels. This task can be achieved by ranking the dependencies of features and selecting the features with the highest rankings. In a multi-label feature selection problem, the algorithm may be faced with a dataset containing a large number of labels. Because the computational cost of multi-label feature selection increases according to the number of labels, the algorithm may suffer from a degradation in performance when processing very large datasets. In this study, we propose an efficient multi-label feature selection method based on an information-theoretic label selection strategy. By identifying a subset of labels that significantly influence the importance of features, the proposed method efficiently outputs a feature subset. Experimental results demonstrate that the proposed method can identify a feature subset much faster than conventional multi-label feature selection methods for large multi-label datasets.

  13. Language Features and Culture Features on Short Message

    Institute of Scientific and Technical Information of China (English)

    王佳

    2013-01-01

    Mobile phone is regarded as“the fifth media”after newspaper,radio,TV and the Internet.The mobile phone short message further highlights the importance of written signs in communication.“The thumb revolution”is eagerly anticipating one kind of trend by the hand replace of mouth,sound substitute for the quiet around us. My paper will analyze the language features and the culture features of mobile phone short messages which are written in Chinese and English.

  14. MRI features associated with acute appendicitis

    NARCIS (Netherlands)

    Leeuwenburgh, Marjolein M. N.; Jensch, Sebastiaan; Gratama, Jan W. C.; Spilt, Aart; Wiarda, Bart M.; van Es, H. Wouter; Cobben, Lodewijk P. J.; Bossuyt, Patrick M. M.; Boermeester, Marja A.; Stoker, Jaap; Bouma, Wim H.; Houdijk, Alexander P. J.; Richir, Milan C.; Stockmann, Hein B. A. C.; Wiezer, Marinus J.; Verhagen, Thijs

    2014-01-01

    To identify MRI features associated with appendicitis. Features expected to be associated with appendicitis were recorded in consensus by two expert radiologists on 223 abdominal MRIs in patients with suspected appendicitis. Nine MRI features were studied: appendix diameter >7 mm, appendicolith,

  15. Hypothesis testing for differentially correlated features.

    Science.gov (United States)

    Sheng, Elisa; Witten, Daniela; Zhou, Xiao-Hua

    2016-10-01

    In a multivariate setting, we consider the task of identifying features whose correlations with the other features differ across conditions. Such correlation shifts may occur independently of mean shifts, or differences in the means of the individual features across conditions. Previous approaches for detecting correlation shifts consider features simultaneously, by computing a correlation-based test statistic for each feature. However, since correlations involve two features, such approaches do not lend themselves to identifying which feature is the culprit. In this article, we instead consider a serial testing approach, by comparing columns of the sample correlation matrix across two conditions, and removing one feature at a time. Our method provides a novel perspective and favorable empirical results compared with competing approaches. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  16. Search features of digital libraries

    Directory of Open Access Journals (Sweden)

    Alastair G. Smith

    2000-01-01

    Full Text Available Traditional on-line search services such as Dialog, DataStar and Lexis provide a wide range of search features (boolean and proximity operators, truncation, etc. This paper discusses the use of these features for effective searching, and argues that these features are required, regardless of advances in search engine technology. The literature on on-line searching is reviewed, identifying features that searchers find desirable for effective searching. A selective survey of current digital libraries available on the Web was undertaken, identifying which search features are present. The survey indicates that current digital libraries do not implement a wide range of search features. For instance: under half of the examples included controlled vocabulary, under half had proximity searching, only one enabled browsing of term indexes, and none of the digital libraries enable searchers to refine an initial search. Suggestions are made for enhancing the search effectiveness of digital libraries, for instance by: providing a full range of search operators, enabling browsing of search terms, enhancement of records with controlled vocabulary, enabling the refining of initial searches, etc.

  17. Mobius syndrome: MRI features

    International Nuclear Information System (INIS)

    Markarian, Maria F.; Villarroel, Gonzalo M.; Nagel, Jorge R.

    2003-01-01

    Purpose: Mobius Syndrome or congenital facial diplegia is associated with paralysis of the lateral gaze movements. This syndrome may include other cranial nerve palsies and be associated to musculoskeletal anomalies. Our objective is to show the MRI findings in Mobius Syndrome. Material and methods: MRI study was performed in 3 patients with clinic diagnosis of Mobius Syndrome. RMI (1.5T); exams included axial FSE (T1 and T2), FLAIR, SE/EPI, GRE/20, sagittal FSE T2 , coronal T1, diffusion, angio MRI and Spectroscopy sequences. Results: The common features of this syndrome found in MRI were: depression or straightening of the floor of the fourth ventricle, brainstem anteroposterior diameter diminution, morphologic alteration of the pons and medulla oblongata and of the hypoglossal nuclei as well as severe micrognathia. Conclusion: The morphologic alterations of Mobius Syndrome can be clearly identified by MRI; this method has proved to be a useful diagnostic examination. (author)

  18. Print advertisements for Alzheimer's disease drugs: informational and transformational features.

    Science.gov (United States)

    Gooblar, Jonathan; Carpenter, Brian D

    2013-06-01

    We examined print advertisements for Alzheimer's disease drugs published in journals and magazines between January 2008 and February 2012, using an informational versus transformational theoretical framework to identify objective and persuasive features. In 29 unique advertisements, we used qualitative methods to code and interpret identifying information, charts, benefit and side effect language, and persuasive appeals embedded in graphics and narratives. Most elements contained a mixture of informational and transformational features. Charts were used infrequently, but when they did appear the accompanying text often exaggerated the data. Benefit statements covered an array of symptoms, drug properties, and caregiver issues. Side effect statements often used positive persuasive appeals. Graphics and narrative features emphasized positive emotions and outcomes. We found subtle and sophisticated attempts both to educate and to persuade readers. It is important for consumers and prescribing physicians to read print advertisements critically so that they can make informed treatment choices.

  19. Adaptive Colour Feature Identification in Image for Object Tracking

    Directory of Open Access Journals (Sweden)

    Feng Su

    2012-01-01

    Full Text Available Identification and tracking of a moving object using computer vision techniques is important in robotic surveillance. In this paper, an adaptive colour filtering method is introduced for identifying and tracking a moving object appearing in image sequences. This filter is capable of automatically identifying the most salient colour feature of the moving object in the image and using this for a robot to track the object. The method enables the selected colour feature to adapt to surrounding condition when it is changed. A method of determining the region of interest of the moving target is also developed for the adaptive colour filter to extract colour information. Experimental results show that by using a camera mounted on a robot, the proposed methods can perform robustly in tracking a randomly moving object using adaptively selected colour features in a crowded environment.

  20. Spatial features register: toward standardization of spatial features

    Science.gov (United States)

    Cascio, Janette

    1994-01-01

    As the need to share spatial data increases, more than agreement on a common format is needed to ensure that the data is meaningful to both the importer and the exporter. Effective data transfer also requires common definitions of spatial features. To achieve this, part 2 of the Spatial Data Transfer Standard (SDTS) provides a model for a spatial features data content specification and a glossary of features and attributes that fit this model. The model provides a foundation for standardizing spatial features. The glossary now contains only a limited subset of hydrographic and topographic features. For it to be useful, terms and definitions must be included for other categories, such as base cartographic, bathymetric, cadastral, cultural and demographic, geodetic, geologic, ground transportation, international boundaries, soils, vegetation, water, and wetlands, and the set of hydrographic and topographic features must be expanded. This paper will review the philosophy of the SDTS part 2 and the current plans for creating a national spatial features register as one mechanism for maintaining part 2.

  1. Unsupervised Feature Subset Selection

    DEFF Research Database (Denmark)

    Søndberg-Madsen, Nicolaj; Thomsen, C.; Pena, Jose

    2003-01-01

    This paper studies filter and hybrid filter-wrapper feature subset selection for unsupervised learning (data clustering). We constrain the search for the best feature subset by scoring the dependence of every feature on the rest of the features, conjecturing that these scores discriminate some ir...... irrelevant features. We report experimental results on artificial and real data for unsupervised learning of naive Bayes models. Both the filter and hybrid approaches perform satisfactorily....

  2. European Nuclear Features

    International Nuclear Information System (INIS)

    Barre, B.; Gonzalez, E.; Diaz Diaz, J.L.; Jimenez, J.L.; Velarde, G.; Navarro, J.M.; Hittner, D.; Dominguez, M.T.; Bollini, G.; Martin, A.; Suarez, J.; Traini, E.; Lang-Lenton, J.

    2004-01-01

    ''European Nuclear Features - ENF'' is a joint publication of the three specialized technical journals, Nuclear Espana (Spain), Revue General Nucleaire (France), and atw - International Journal of Nuclear Power (Germany). The ENF support the international Europeen exchange of information and news about energy and nuclear power. News items, comments, and scientific and technical contributions will cover important aspects of the field. The second issue of ENF contains contributions about theses topics, among others: Institutional and Political Changes in the EU. - CIEMAT Department of Nuclear Fission: A General Overview. - Inertial Fusion Energy at DENIM. - High Temperature Reactors. European Research Programme. - On Site Assistance to Khmelnitsky NPP 1 and 2 (Ukraine). - Dismantling and Decommissioning of Vandellos I. (orig.)

  3. Stylistic Features of Comment in Arabic Blogosphere

    Directory of Open Access Journals (Sweden)

    Gabdulzyamil G. Zaynullin

    2017-11-01

    Full Text Available One of the most important issues in the study of the functioning of the Internet language is the definition of the features of each Internet genre presented in online communication, taking into account the linguocultural features of the language in question. This paper studies the genre of the Internet comments of the Arabic-speaking blogosphere and reveals its stylistic features. The most common goal of the comment is gratitude, followed by praise. We created a corpus of comments from blogs of various subjects, and then conducted the tagging, having identified the group to which we attributed a comment, depending on the subject and the communicative goal. With the help of the Lexico 3 software, the most frequent lexical units were identified, the lexical features of the comments were described, the main one being the widespread use of religionyms, and the relationship between the blog subject and the stylistic characteristics of communication was revealed. The article traces the correlation between the literary and colloquial functional style in the comments, and also draws a conclusion that the comments are of a conversational, informal character. The main devices of expressiveness that are characteristic for both network and pre-network communication were revealed, and the tendency of the analysts to observe in the comments a stable three-part composition (greeting, message, final formula. The influence of traditional Arabic rhetoric, as well as the epistolary genre, was preserved. The results of the paper can be used when studying other genres of Internet communication in Arabic and in comparative studies to create the linguistic software.

  4. Rhabdomyolysis featuring muscular dystrophies.

    Science.gov (United States)

    Lahoria, Rajat; Milone, Margherita

    2016-02-15

    Rhabdomyolysis is a potentially life threatening condition of various etiology. The association between rhabdomyolysis and muscular dystrophies is under-recognized in clinical practice. To identify muscular dystrophies presenting with rhabdomyolysis at onset or as predominant feature. We retrospectively reviewed clinical and laboratory data of patients with a genetically confirmed muscular dystrophy in whom rhabdomyolysis was the presenting or main clinical manifestation. Thirteen unrelated patients (males=6; females=7) were identified. Median age at time of rhabdomyolysis was 18 years (range, 2-47) and median duration between the first episode of rhabdomyolysis and molecular diagnosis was 2 years. Fukutin-related protein (FKRP) muscular dystrophy (n=6) was the most common diagnosis, followed by anoctaminopathy-5 (n=3), calpainopathy-3 (n=2) and dystrophinopathy (n=2). Four patients experienced recurrent rhabdomyolysis. Eight patients were asymptomatic and 3 reported myalgia and exercise intolerance prior to the rhabdomyolysis. Exercise (n=6) and fever (n=4) were common triggers; rhabdomyolysis was unprovoked in 3 patients. Twelve patients required hospitalization. Baseline CK levels were elevated in all patients (median 1200 IU/L; range, 600-3600). Muscular dystrophies can present with rhabdomyolysis; FKRP mutations are particularly frequent in causing such complication. A persistently elevated CK level in patients with rhabdomyolysis warrants consideration for underlying muscular dystrophy. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Quantitative imaging features: extension of the oncology medical image database

    Science.gov (United States)

    Patel, M. N.; Looney, P. T.; Young, K. C.; Halling-Brown, M. D.

    2015-03-01

    Radiological imaging is fundamental within the healthcare industry and has become routinely adopted for diagnosis, disease monitoring and treatment planning. With the advent of digital imaging modalities and the rapid growth in both diagnostic and therapeutic imaging, the ability to be able to harness this large influx of data is of paramount importance. The Oncology Medical Image Database (OMI-DB) was created to provide a centralized, fully annotated dataset for research. The database contains both processed and unprocessed images, associated data, and annotations and where applicable expert determined ground truths describing features of interest. Medical imaging provides the ability to detect and localize many changes that are important to determine whether a disease is present or a therapy is effective by depicting alterations in anatomic, physiologic, biochemical or molecular processes. Quantitative imaging features are sensitive, specific, accurate and reproducible imaging measures of these changes. Here, we describe an extension to the OMI-DB whereby a range of imaging features and descriptors are pre-calculated using a high throughput approach. The ability to calculate multiple imaging features and data from the acquired images would be valuable and facilitate further research applications investigating detection, prognosis, and classification. The resultant data store contains more than 10 million quantitative features as well as features derived from CAD predictions. Theses data can be used to build predictive models to aid image classification, treatment response assessment as well as to identify prognostic imaging biomarkers.

  6. Effective Feature Preprocessing for Time Series Forecasting

    DEFF Research Database (Denmark)

    Zhao, Junhua; Dong, Zhaoyang; Xu, Zhao

    2006-01-01

    Time series forecasting is an important area in data mining research. Feature preprocessing techniques have significant influence on forecasting accuracy, therefore are essential in a forecasting model. Although several feature preprocessing techniques have been applied in time series forecasting...... performance in time series forecasting. It is demonstrated in our experiment that, effective feature preprocessing can significantly enhance forecasting accuracy. This research can be a useful guidance for researchers on effectively selecting feature preprocessing techniques and integrating them with time...... series forecasting models....

  7. A comparative analysis of DNA barcode microarray feature size

    Directory of Open Access Journals (Sweden)

    Smith Andrew M

    2009-10-01

    Full Text Available Abstract Background Microarrays are an invaluable tool in many modern genomic studies. It is generally perceived that decreasing the size of microarray features leads to arrays with higher resolution (due to greater feature density, but this increase in resolution can compromise sensitivity. Results We demonstrate that barcode microarrays with smaller features are equally capable of detecting variation in DNA barcode intensity when compared to larger feature sizes within a specific microarray platform. The barcodes used in this study are the well-characterized set derived from the Yeast KnockOut (YKO collection used for screens of pooled yeast (Saccharomyces cerevisiae deletion mutants. We treated these pools with the glycosylation inhibitor tunicamycin as a test compound. Three generations of barcode microarrays at 30, 8 and 5 μm features sizes independently identified the primary target of tunicamycin to be ALG7. Conclusion We show that the data obtained with 5 μm feature size is of comparable quality to the 30 μm size and propose that further shrinking of features could yield barcode microarrays with equal or greater resolving power and, more importantly, higher density.

  8. Features Related to Faunal Activity

    NARCIS (Netherlands)

    Kooistra, M.J.; Pulleman, M.M.

    2010-01-01

    Soil fauna plays an important role in transporting and altering various soil components, in particular the decomposition of organic matter and the development of soil structure. Fauna-induced features are found in all types of soils and can be so abundant that they determine the nature and intensity

  9. Feature Selection by Reordering

    Czech Academy of Sciences Publication Activity Database

    Jiřina, Marcel; Jiřina jr., M.

    2005-01-01

    Roč. 2, č. 1 (2005), s. 155-161 ISSN 1738-6438 Institutional research plan: CEZ:AV0Z10300504 Keywords : feature selection * data reduction * ordering of features Subject RIV: BA - General Mathematics

  10. Screening for Plant Features

    NARCIS (Netherlands)

    Heijden, van der G.W.A.M.; Polder, G.

    2015-01-01

    In this chapter, an overview of different plant features is given, from (sub)cellular to canopy level. A myriad of methods is available to measure these features using image analysis, and often, multiple methods can be used to measure the same feature. Several criteria are listed for choosing a

  11. Prediction of interface residue based on the features of residue interaction network.

    Science.gov (United States)

    Jiao, Xiong; Ranganathan, Shoba

    2017-11-07

    Protein-protein interaction plays a crucial role in the cellular biological processes. Interface prediction can improve our understanding of the molecular mechanisms of the related processes and functions. In this work, we propose a classification method to recognize the interface residue based on the features of a weighted residue interaction network. The random forest algorithm is used for the prediction and 16 network parameters and the B-factor are acting as the element of the input feature vector. Compared with other similar work, the method is feasible and effective. The relative importance of these features also be analyzed to identify the key feature for the prediction. Some biological meaning of the important feature is explained. The results of this work can be used for the related work about the structure-function relationship analysis via a residue interaction network model. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. RETAIL BANKING BUSINESS: CURRENT STATE ANDSPECIFIC FEATURES

    Directory of Open Access Journals (Sweden)

    Гузель Рефкадовна Фаизова

    2013-04-01

    Full Text Available The role and importance of the retail banking business in the banking sector continueto grow. The current state of the retail banking business is considered and specific features of this area in the face of growing demand for banking products and services by the public and interest from lending institutions are identified by the article.Purpose: Research of current state of retail banking business and detection specific features of this area.Methodology: In the process of analysis and researchof the question the methods of economical and statistical analysis, methods of comparison and generalizationwereused.Results: The conclusion is that interest in the retail banking business continues to grow.There were revealed the role and the importance of standardized service processes and standardized products and services delivering as one of the main line of development in the segment of retail business.DOI: http://dx.doi.org/10.12731/2218-7405-2013-3-2

  13. Learning about the internal structure of categories through classification and feature inference.

    Science.gov (United States)

    Jee, Benjamin D; Wiley, Jennifer

    2014-01-01

    Previous research on category learning has found that classification tasks produce representations that are skewed toward diagnostic feature dimensions, whereas feature inference tasks lead to richer representations of within-category structure. Yet, prior studies often measure category knowledge through tasks that involve identifying only the typical features of a category. This neglects an important aspect of a category's internal structure: how typical and atypical features are distributed within a category. The present experiments tested the hypothesis that inference learning results in richer knowledge of internal category structure than classification learning. We introduced several new measures to probe learners' representations of within-category structure. Experiment 1 found that participants in the inference condition learned and used a wider range of feature dimensions than classification learners. Classification learners, however, were more sensitive to the presence of atypical features within categories. Experiment 2 provided converging evidence that classification learners were more likely to incorporate atypical features into their representations. Inference learners were less likely to encode atypical category features, even in a "partial inference" condition that focused learners' attention on the feature dimensions relevant to classification. Overall, these results are contrary to the hypothesis that inference learning produces superior knowledge of within-category structure. Although inference learning promoted representations that included a broad range of category-typical features, classification learning promoted greater sensitivity to the distribution of typical and atypical features within categories.

  14. Selecting protein families for environmental features based on manifold regularization.

    Science.gov (United States)

    Jiang, Xingpeng; Xu, Weiwei; Park, E K; Li, Guangrong

    2014-06-01

    Recently, statistics and machine learning have been developed to identify functional or taxonomic features of environmental features or physiological status. Important proteins (or other functional and taxonomic entities) to environmental features can be potentially used as biosensors. A major challenge is how the distribution of protein and gene functions embodies the adaption of microbial communities across environments and host habitats. In this paper, we propose a novel regularization method for linear regression to adapt the challenge. The approach is inspired by local linear embedding (LLE) and we call it a manifold-constrained regularization for linear regression (McRe). The novel regularization procedure also has potential to be used in solving other linear systems. We demonstrate the efficiency and the performance of the approach in both simulation and real data.

  15. Radiographic features of periapical cysts and granulomas

    OpenAIRE

    Zain, R. B.; Roswati, N.; Ismail, K.

    1989-01-01

    Many studies have been reported on radiographic lesion sizes of periapical lesions. However no studies have been reported on prevalences of subjective radiographic features in these lesions except for the early assumption that a periapical cyst usually exhibit a radiopaque cortex. This study is conducted to evaluate the prevalences of several subjective radiographic features of periapical cysts and granulomas in the hope to identify features that maybe suggestive of either diagnosis. The resu...

  16. Ability of Slovakian Pupils to Identify Birds

    Science.gov (United States)

    Prokop, Pavol; Rodak, Rastislav

    2009-01-01

    A pupil's ability to identify common organisms is necessary for acquiring further knowledge of biology. We investigated how pupils were able to identify 25 bird species following their song, growth habits, or both features presented simultaneously. Just about 19% of birds were successfully identified by song, about 39% by growth habit, and 45% of…

  17. Identifi cation of Sectarianism

    Directory of Open Access Journals (Sweden)

    Martinovich Vladimir

    2016-03-01

    Full Text Available «New religious movements and society» is traditionally one of the most sophisticated topics in the area of new religions studies. Its problem field is so huge that up to now by far not all important research themes where even touched by scientists from all over the world. The problem of the process of the identification of sectarianism by diff erent societal institutions is one of such untouched themes that is taken as the main subject of this article. This process by itself is an inseparable part of the every societal deliberate reaction to the very existence of unconventional religiosity, its unstructured and mainly structured types. The focal point of the article is step-by-step analysis of the general structure elements of the process of the identification of sectarianism without any reference to the specific time and place of its flow. Special attention is paid to the analysis of the subjects of the identification of sectarianism, to the criteria for religious groups to be qualified as new religious movements, and to the specific features of the process of documents filtration. The causes of selective perception of sectarianism are disclosed. Some main consequences and unpredictable outcomes of the process of the identification of sectarianism are described.

  18. Patterns of Dysmorphic Features in Schizophrenia

    Science.gov (United States)

    Scutt, L.E.; Chow, E.W.C.; Weksberg, R.; Honer, W.G.; Bassett, Anne S.

    2011-01-01

    Congenital dysmorphic features are prevalent in schizophrenia and may reflect underlying neurodevelopmental abnormalities. A cluster analysis approach delineating patterns of dysmorphic features has been used in genetics to classify individuals into more etiologically homogeneous subgroups. In the present study, this approach was applied to schizophrenia, using a sample with a suspected genetic syndrome as a testable model. Subjects (n = 159) with schizophrenia or schizoaffective disorder were ascertained from chronic patient populations (random, n=123) or referred with possible 22q11 deletion syndrome (referred, n = 36). All subjects were evaluated for presence or absence of 70 reliably assessed dysmorphic features, which were used in a three-step cluster analysis. The analysis produced four major clusters with different patterns of dysmorphic features. Significant between-cluster differences were found for rates of 37 dysmorphic features (P dysmorphic features (P = 0.0001), and validating features not used in the cluster analysis: mild mental retardation (P = 0.001) and congenital heart defects (P = 0.002). Two clusters (1 and 4) appeared to represent more developmental subgroups of schizophrenia with elevated rates of dysmorphic features and validating features. Cluster 1 (n = 27) comprised mostly referred subjects. Cluster 4 (n= 18) had a different pattern of dysmorphic features; one subject had a mosaic Turner syndrome variant. Two other clusters had lower rates and patterns of features consistent with those found in previous studies of schizophrenia. Delineating patterns of dysmorphic features may help identify subgroups that could represent neurodevelopmental forms of schizophrenia with more homogeneous origins. PMID:11803519

  19. Assessment of severe accident prevention and mitigation features: PWR, large dry containment design

    International Nuclear Information System (INIS)

    Perkins, K.R.; Hsu, C.J.; Lehner, J.R.; Luckas, W.J.; Cho, N.; Fitzpatrick, R.G.; Pratt, W.T.; Eltawila, F.; Maly, J.A.

    1988-07-01

    Plant features and operator actions which have been found to be important in either preventing or mitigating severe accidents in PWRs with large dry containments have been identified. These features and actions were developed from insights derived from reviews of risk assessments performed specifically for the Zion plant and from assessments of other relevant studies. Accident sequences that dominate the core-damage frequency and those accident sequences that are of potentially high consequence were identified. Vulnerabilities of the large dry containment to severe accident containment loads were also identified. In addition, those features of a PWR with a large dry containment, which are important for preventing core damage and are available for mitigating fission-product release to the environment were identified. The report is issued to provide focus to the analyst examining an individual plant. The report calls attention to plant features and operator actions and provides a list of deterministic tributes for assessing those features and actions found to be helpful in reducing the overall risk for Zion and other PWRs with large dry containments. Thus, the guidance is offered as a resource in examining the subject plant to determine if the same, or similar, plant features and operator actions will be of value in reducing overall plant risk. This report is intended to serve solely as guidance

  20. Assessment of severe accident prevention and mitigation features: PWR, ice-condenser containment design

    International Nuclear Information System (INIS)

    Hsu, C.J.; Perkins, K.R.; Luckas, W.J.; Fitzpatrick, R.G.; Cho, N.; Lehner, J.R.; Pratt, W.T.; Eltawila, F.; Maly, J.A.

    1988-07-01

    Plant features and operator actions which have been found to be important in either preventing and mitigating severe accidents in PWRs with ice-condenser containments have been identified. Thus features and actions were developed from insights derived from reviews of risk assessments performed specifically for the Sequoyah plant and from assessments of other relevant studies. Accident sequences that dominate the core-damage frequency and those accident sequences that are of potentially high consequence were identified. Vulnerabilities of the ice-condenser containment to sever accident containment loads were also identified. In addition, those features of a PWR with an ice-condenser containment, which are important for preventing core damage and are available for mitigating fission-product release to the environment were identified. This report is issued to provide focus to an analyst examining an individual plant. The report calls attention to plant features and operator actions and provides a list of deterministic attributes for assessing those features and actions found to be helpful in reducing the overall risk for Sequoyah and other PWRs with ice-condenser containments. Thus, the guidance is offered as a resource in examining the subject plant to determine if the same, or similar, plant features and operator actions will be of value in reducing overall plant risk. This report is intended to serve solely as guidance. 14 tabs

  1. Controllable edge feature sharpening for dental applications.

    Science.gov (United States)

    Fan, Ran; Jin, Xiaogang

    2014-01-01

    This paper presents a new approach to sharpen blurred edge features in scanned tooth preparation surfaces generated by structured-light scanners. It aims to efficiently enhance the edge features so that the embedded feature lines can be easily identified in dental CAD systems, and to avoid unnatural oversharpening geometry. We first separate the feature regions using graph-cut segmentation, which does not require a user-defined threshold. Then, we filter the face normal vectors to propagate the geometry from the smooth region to the feature region. In order to control the degree of the sharpness, we propose a feature distance measure which is based on normal tensor voting. Finally, the vertex positions are updated according to the modified face normal vectors. We have applied the approach to scanned tooth preparation models. The results show that the blurred edge features are enhanced without unnatural oversharpening geometry.

  2. Controllable Edge Feature Sharpening for Dental Applications

    Directory of Open Access Journals (Sweden)

    Ran Fan

    2014-01-01

    Full Text Available This paper presents a new approach to sharpen blurred edge features in scanned tooth preparation surfaces generated by structured-light scanners. It aims to efficiently enhance the edge features so that the embedded feature lines can be easily identified in dental CAD systems, and to avoid unnatural oversharpening geometry. We first separate the feature regions using graph-cut segmentation, which does not require a user-defined threshold. Then, we filter the face normal vectors to propagate the geometry from the smooth region to the feature region. In order to control the degree of the sharpness, we propose a feature distance measure which is based on normal tensor voting. Finally, the vertex positions are updated according to the modified face normal vectors. We have applied the approach to scanned tooth preparation models. The results show that the blurred edge features are enhanced without unnatural oversharpening geometry.

  3. Features partnership in auditing

    Directory of Open Access Journals (Sweden)

    V.P. Bondar

    2015-06-01

    Full Text Available The notion of «institution partnerships in the audit» and its importance in Ukraine. Done overview of international experience in the Institute of partnerships in the audit business. Determined the nature of the audit, rights, duties and powers of the partnership during the audit. Done distribution of functions between the partner and the engagement partner in the synthesis of these blocks: taking on a new customer service or continued cooperation with existing customers (clients; familiarization with activities of customer audits, including an understanding of its internal control system; identification and assessment of risks of material misstatement of accounting; audit process and the audit and the formation of the final judgment. On the basis of the distribution of functions between the partner and the engagement partner, defined the overall structure of management system auditing firm. These conditions for implementation of partnerships in the audit business, and identified a number of advantages and disadvantages of partnerships for auditing.

  4. Volcanic features of Io

    International Nuclear Information System (INIS)

    Carr, M.H.; Masursky, H.; Strom, R.G.; Terrile, R.J.

    1979-01-01

    The volcanic features of Io as detected during the Voyager mission are discussed. The volcanic activity is apparently higher than on any other body in the Solar System. Its volcanic landforms are compared with features on Earth to indicate the type of volcanism present on Io. (U.K.)

  5. Learning Transferable Features with Deep Adaptation Networks

    OpenAIRE

    Long, Mingsheng; Cao, Yue; Wang, Jianmin; Jordan, Michael I.

    2015-01-01

    Recent studies reveal that a deep neural network can learn transferable features which generalize well to novel tasks for domain adaptation. However, as deep features eventually transition from general to specific along the network, the feature transferability drops significantly in higher layers with increasing domain discrepancy. Hence, it is important to formally reduce the dataset bias and enhance the transferability in task-specific layers. In this paper, we propose a new Deep Adaptation...

  6. JCE Feature Columns

    Science.gov (United States)

    Holmes, Jon L.

    1999-05-01

    The Features area of JCE Online is now readily accessible through a single click from our home page. In the Features area each column is linked to its own home page. These column home pages also have links to them from the online Journal Table of Contents pages or from any article published as part of that feature column. Using these links you can easily find abstracts of additional articles that are related by topic. Of course, JCE Online+ subscribers are then just one click away from the entire article. Finding related articles is easy because each feature column "site" contains links to the online abstracts of all the articles that have appeared in the column. In addition, you can find the mission statement for the column and the email link to the column editor that I mentioned above. At the discretion of its editor, a feature column site may contain additional resources. As an example, the Chemical Information Instructor column edited by Arleen Somerville will have a periodically updated bibliography of resources for teaching and using chemical information. Due to the increase in the number of these resources available on the WWW, it only makes sense to publish this information online so that you can get to these resources with a simple click of the mouse. We expect that there will soon be additional information and resources at several other feature column sites. Following in the footsteps of the Chemical Information Instructor, up-to-date bibliographies and links to related online resources can be made available. We hope to extend the online component of our feature columns with moderated online discussion forums. If you have a suggestion for an online resource you would like to see included, let the feature editor or JCE Online (jceonline@chem.wisc.edu) know about it. JCE Internet Features JCE Internet also has several feature columns: Chemical Education Resource Shelf, Conceptual Questions and Challenge Problems, Equipment Buyers Guide, Hal's Picks, Mathcad

  7. Critical feature analysis of a radiotherapy machine

    International Nuclear Information System (INIS)

    Rae, Andrew; Jackson, Daniel; Ramanan, Prasad; Flanz, Jay; Leyman, Didier

    2005-01-01

    The software implementation of the emergency shutdown feature in a major radiotherapy system was analyzed, using a directed form of code review based on module dependences. Dependences between modules are labelled by particular assumptions; this allows one to trace through the code, and identify those fragments responsible for critical features. An 'assumption tree' is constructed in parallel, showing the assumptions which each module makes about others. The root of the assumption tree is the critical feature of interest, and its leaves represent assumptions which, if not valid, might cause the critical feature to fail. The analysis revealed some unexpected assumptions that motivated improvements to the code

  8. Imaging features of kaposiform lymphangiomatosis

    International Nuclear Information System (INIS)

    Goyal, Pradeep; Alomari, Ahmad I.; Shaikh, Raja; Chaudry, Gulraiz; Kozakewich, Harry P.; Perez-Atayde, Antonio R.; Trenor, Cameron C.; Fishman, Steven J.; Greene, Arin K.

    2016-01-01

    Kaposiform lymphangiomatosis is a rare, aggressive lymphatic disorder. The imaging and presenting features of kaposiform lymphangiomatosis can overlap with those of central conducting lymphatic anomaly and generalized lymphatic anomaly. To analyze the imaging findings of kaposiform lymphangiomatosis disorder and highlight features most suggestive of this diagnosis. We retrospectively identified and characterized 20 children and young adults with histopathological diagnosis of kaposiform lymphangiomatosis and radiologic imaging referred to the vascular anomalies center between 1995 and 2015. The median age at onset was 6.5 years (range 3 months to 27 years). The most common presenting features were respiratory compromise (dyspnea, cough, chest pain; 55.5%), swelling/mass (25%), bleeding (15%) and fracture (5%). The thoracic cavity was involved in all patients; all patients had mediastinal involvement followed by lung parenchymal disease (90%) and pleural (85%) and pericardial (50%) effusions. The most common extra-thoracic sites of disease were the retroperitoneum (80%), bone (60%), abdominal viscera (55%) and muscles (45%). There was characteristic enhancing and infiltrative soft-tissue thickening in the mediastinum and retroperitoneum extending along the lymphatic distribution. Kaposiform lymphangiomatosis has overlapping imaging features with central conducting lymphatic anomaly and generalized lymphatic anomaly. Presence of mediastinal or retroperitoneal enhancing and infiltrative soft-tissue disease along the lymphatic distribution, hemorrhagic effusions and moderate thrombocytopenia (50-100,000/μl) should favor diagnosis of kaposiform lymphangiomatosis. (orig.)

  9. Classification of radiolarian images with hand-crafted and deep features

    Science.gov (United States)

    Keçeli, Ali Seydi; Kaya, Aydın; Keçeli, Seda Uzunçimen

    2017-12-01

    Radiolarians are planktonic protozoa and are important biostratigraphic and paleoenvironmental indicators for paleogeographic reconstructions. Radiolarian paleontology still remains as a low cost and the one of the most convenient way to obtain dating of deep ocean sediments. Traditional methods for identifying radiolarians are time-consuming and cannot scale to the granularity or scope necessary for large-scale studies. Automated image classification will allow making these analyses promptly. In this study, a method for automatic radiolarian image classification is proposed on Scanning Electron Microscope (SEM) images of radiolarians to ease species identification of fossilized radiolarians. The proposed method uses both hand-crafted features like invariant moments, wavelet moments, Gabor features, basic morphological features and deep features obtained from a pre-trained Convolutional Neural Network (CNN). Feature selection is applied over deep features to reduce high dimensionality. Classification outcomes are analyzed to compare hand-crafted features, deep features, and their combinations. Results show that the deep features obtained from a pre-trained CNN are more discriminative comparing to hand-crafted ones. Additionally, feature selection utilizes to the computational cost of classification algorithms and have no negative effect on classification accuracy.

  10. New features in MEDM

    International Nuclear Information System (INIS)

    Evans, K. Jr.

    1999-01-01

    MEDM, which is derived from Motif Editor and Display Manager, is the primary graphical interface to the EPICS control system. This paper describes new features that have been added to MEDM in the last two years. These features include new editing capabilities, a PV Info dialog box, a means of specifying limits and precision, a new implementation of the Cartesian Plot, new features for several objects, new capability for the Related Display, help, a user-configurable Execute Menu, reconfigured start-up options, and availability for Windows 95/98/NT. Over one hundred bugs have been fixed, and the program is quite stable and in extensive use

  11. Facial and Ocular Features of Marfan Syndrome

    Directory of Open Access Journals (Sweden)

    Juan C. Leoni

    2014-10-01

    Full Text Available Marfan syndrome is the most common inherited disorder of connective tissue affecting multiple organ systems. Identification of the facial, ocular and skeletal features should prompt referral for aortic imaging since sudden death by aortic dissection and rupture remains a major cause of death in patients with unrecognized Marfan syndrome. Echocardiography is recommended as the initial imaging test, and once a dilated aortic root is identified magnetic resonance or computed tomography should be done to assess the entire aorta. Prophylactic aortic root replacement is safe and has been demonstrated to improve life expectancy in patients with Marfan syndrome. Medical therapy for Marfan syndrome includes the use of beta blockers in older children and adults with an enlarged aorta. Addition of angiotensin receptor antagonists has been shown to slow the progression of aortic root dilation compared to beta blockers alone. Lifelong and regular follow up in a center for specialized care is important for patients with Marfan syndrome. We present a case of a patient with clinical features of Marfan syndrome and discuss possible therapeutic interventions for her dilated aorta.

  12. Abdominal cocoon: sonographic features.

    Science.gov (United States)

    Vijayaraghavan, S Boopathy; Palanivelu, Chinnusamy; Sendhilkumar, Karuppusamy; Parthasarathi, Ramakrishnan

    2003-07-01

    An abdominal cocoon is a rare condition in which the small bowel is encased in a membrane. The diagnosis is usually established at surgery. Here we describe the sonographic features of this condition.

  13. Mesoblastic nephroma: Pathological features

    African Journals Online (AJOL)

    N.M. El-Badawy

    determined mainly by its histologic type, we found it worthwhile to elaborate more on the gross and microscopic features of ... behavior of mesoblastic nephroma is determined mainly by its his- .... However, it exhibits a nodular growth pattern at.

  14. Assessment of severe accident prevention and mitigation features: BWR, Mark II containment design

    International Nuclear Information System (INIS)

    Lehner, J.R.; Hsu, C.J.; Eltawila, F.; Perkins, K.R.; Luckas, W.J.; Fitzpatrick, R.G.; Pratt, W.T.

    1988-07-01

    Plant features and operator actions, which have been found to be important in either preventing or mitigating severe accidents in BWRs with Mark II containments (BWR Mark II's) have been identified. These features and actions were developed from insights derived from reviews of in-depth risk assessments performed specifically for the Limerick and Shoreham plants and from other relevant studies. Accident sequences that dominate the core-damage frequency and those accident sequences that are of potentially high consequence were identified. Vulnerabilities of the BWR Mark II to severe-accident containment loads were also noted. In addition, those features of a BWR Mark II, which are important for preventing core damage and are available for mitigating fission-product release to the environment were also identified. This report is issued to provide focus to an analyst examining an individual plant. This report calls attention to plant features and operator actions and provides a list of deterministic attributes for assessing those features and actions found to be helpful in reducing the overall risk for Mark II plants. Thus, the guidance is offered as a resource in examining the subject plant to determine if the same, or similar, plant features and operator actions will be of value in reducing overall plant risk. This report is intended to serve solely as guidance

  15. Feature Binding in Zebrafish

    Directory of Open Access Journals (Sweden)

    P Neri

    2012-07-01

    Full Text Available Binding operations are primarily ascribed to cortex or similarly complex avian structures. My experiments show that the zebrafish, a lower vertebrate lacking cortex, supports visual feature binding of form and motion for the purpose of social behavior. These results challenge the notion that feature binding may require highly evolved neural structures and demonstrate that the nervous system of lower vertebrates can afford unexpectedly complex computations.

  16. Spectral features in the cosmic ray fluxes

    Science.gov (United States)

    Lipari, Paolo

    2018-01-01

    The cosmic ray energy distributions contain spectral features, that is narrow energy regions where the slope of the spectrum changes rapidly. The identification and study of these features is of great importance to understand the astrophysical mechanisms of acceleration and propagation that form the spectra. In first approximation a spectral feature is often described as a discontinuous change in slope, however very valuable information is also contained in its width, that is the length of the energy interval where the change in spectral index develops. In this work we discuss the best way to define and parameterize the width a spectral feature, and for illustration discuss some of the most prominent known structures.

  17. Predicting protein amidation sites by orchestrating amino acid sequence features

    Science.gov (United States)

    Zhao, Shuqiu; Yu, Hua; Gong, Xiujun

    2017-08-01

    Amidation is the fourth major category of post-translational modifications, which plays an important role in physiological and pathological processes. Identifying amidation sites can help us understanding the amidation and recognizing the original reason of many kinds of diseases. But the traditional experimental methods for predicting amidation sites are often time-consuming and expensive. In this study, we propose a computational method for predicting amidation sites by orchestrating amino acid sequence features. Three kinds of feature extraction methods are used to build a feature vector enabling to capture not only the physicochemical properties but also position related information of the amino acids. An extremely randomized trees algorithm is applied to choose the optimal features to remove redundancy and dependence among components of the feature vector by a supervised fashion. Finally the support vector machine classifier is used to label the amidation sites. When tested on an independent data set, it shows that the proposed method performs better than all the previous ones with the prediction accuracy of 0.962 at the Matthew's correlation coefficient of 0.89 and area under curve of 0.964.

  18. Features for detecting smoke in laparoscopic videos

    Directory of Open Access Journals (Sweden)

    Jalal Nour Aldeen

    2017-09-01

    Full Text Available Video-based smoke detection in laparoscopic surgery has different potential applications, such as the automatic addressing of surgical events associated with the electrocauterization task and the development of automatic smoke removal. In the literature, video-based smoke detection has been studied widely for fire surveillance systems. Nevertheless, the proposed methods are insufficient for smoke detection in laparoscopic videos because they often depend on assumptions which rarely hold in laparoscopic surgery such as static camera. In this paper, ten visual features based on motion, texture and colour of smoke are proposed and evaluated for smoke detection in laparoscopic videos. These features are RGB channels, energy-based feature, texture features based on gray level co-occurrence matrix (GLCM, HSV colour space feature, features based on the detection of moving regions using optical flow and the smoke colour in HSV colour space. These features were tested on four laparoscopic cholecystectomy videos. Experimental observations show that each feature can provide valuable information in performing the smoke detection task. However, each feature has weaknesses to detect the presence of smoke in some cases. By combining all proposed features smoke with high and even low density can be identified robustly and the classification accuracy increases significantly.

  19. Proposal of Non-Contact Type Interface of Command Input Using Lip Motion Features

    Science.gov (United States)

    Sato, Yoshiyuki; Kageyama, Yoichi; Nishida, Makoto

    Lip motion features are of practical use in identifying individuals. It is therefore important to develop non-contact type interface. For the interface using lip motion features, individual differences such as accents and dialects in commands should be accepted. In this paper, we propose a method to identify commands by analyzing three kinds of lip motion features. They are lip width, lip length, and ratio of width and length. The analysis is made on the basis of these features' relative values obtained from the primary and object frame. The proposed method has three steps. First, we extracted the lip motion features on the basis of both positions and shapes of lip in each frame of facial images. Second, standard patterns were created from features of six utterances per command. The standard pattern is able to reduce the relative difference in the lip motion features. Third, similarities among commands were computed by Dynamic-Programming (DP) matching. And then, the command with the largest similarity was selected as the target one. Our experimental results suggest that proposed method is useful to construct the non-contact type interface of command input using lip motion features.

  20. FEATURES OF STUDENT PSYCHOLOGICAL COUNSELLING

    Directory of Open Access Journals (Sweden)

    Maria Dorina PASCA

    2013-10-01

    Full Text Available Student psychological counseling is one of the means to acknowledge student identity by employing counseling tools that allow the psychologist to make use of a set of skills essential in achieving envisaged outcomes. To act as counseling psychologist for students is to guide actions by the five wh- questions: who (the client is, why (the counselor is approached, who (the counselor talks to, what (problem the student has to tackle, how (the problem can be solved. Some of the most important features that contribute to solving student problems are the counselor’s deontology, trustworthiness and attitude that are to be relied on without impeding the client’s personality traits. Thus, developing awareness of the features underlying student psychological counseling and acting accordingly is the real test for any professional in the field. Therefore, the real challenge is not being in the lion’s den, but living with it.

  1. How important is importance for prospective memory? A review

    Directory of Open Access Journals (Sweden)

    Stefan eWalter

    2014-06-01

    Full Text Available Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover, we address the relationship between importance and other factors known to affect prospective memory and ongoing task performance such as type of prospective memory task (time-, event- or activity-based, cognitive loads, and cue focality. Finally, we provide a connection to motivation, we summarize the effects of task importance and we identify important venues for future research.

  2. How important is importance for prospective memory? A review

    Science.gov (United States)

    Walter, Stefan; Meier, Beat

    2014-01-01

    Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover, we address the relationship between importance and other factors known to affect prospective memory and ongoing task performance such as type of prospective memory task (time-, event-, or activity-based), cognitive loads, and processing overlaps. Finally, we provide a connection to motivation, we summarize the effects of task importance and we identify important venues for future research. PMID:25018743

  3. Text feature extraction based on deep learning: a review.

    Science.gov (United States)

    Liang, Hong; Sun, Xiao; Sun, Yunlei; Gao, Yuan

    2017-01-01

    Selection of text feature item is a basic and important matter for text mining and information retrieval. Traditional methods of feature extraction require handcrafted features. To hand-design, an effective feature is a lengthy process, but aiming at new applications, deep learning enables to acquire new effective feature representation from training data. As a new feature extraction method, deep learning has made achievements in text mining. The major difference between deep learning and conventional methods is that deep learning automatically learns features from big data, instead of adopting handcrafted features, which mainly depends on priori knowledge of designers and is highly impossible to take the advantage of big data. Deep learning can automatically learn feature representation from big data, including millions of parameters. This thesis outlines the common methods used in text feature extraction first, and then expands frequently used deep learning methods in text feature extraction and its applications, and forecasts the application of deep learning in feature extraction.

  4. Feature displacement interpolation

    DEFF Research Database (Denmark)

    Nielsen, Mads; Andresen, Per Rønsholt

    1998-01-01

    Given a sparse set of feature matches, we want to compute an interpolated dense displacement map. The application may be stereo disparity computation, flow computation, or non-rigid medical registration. Also estimation of missing image data, may be phrased in this framework. Since the features...... often are very sparse, the interpolation model becomes crucial. We show that a maximum likelihood estimation based on the covariance properties (Kriging) show properties more expedient than methods such as Gaussian interpolation or Tikhonov regularizations, also including scale......-selection. The computational complexities are identical. We apply the maximum likelihood interpolation to growth analysis of the mandibular bone. Here, the features used are the crest-lines of the object surface....

  5. INNOVATION POLICY FEATURES IN THE OECD COUNTRIES

    Directory of Open Access Journals (Sweden)

    Ivan Anisimov

    2015-11-01

    Full Text Available The purpose of the paper is to analyze the innovation policy features in the OECD countries and give the basic framework which defines rights and obligations of intellectual property rights (IPRs owners. Governments play an important role in determining demand-side policies, such as smart regulations, standards, consumer education, taxation and public procurement that can affect innovation. Because demand linked to supply, policies that affect both need to be better harnessed to drive long-term innovation and sustainable growth. Policies to stimulate innovation require taking account of changes in the international economy and the transformation of innovation processes. To transform invention into innovation requires a range of activities. Innovation now encompasses much more than research and development (R&D, albeit R&D remains vitally important. Methodology. The data for the paper is taken from the publications and reports of the European Commission, OECD, World Bank etc. In the paper the descriptive analysis, supported by the quantitative analysis is applied. Results. It is identified that rises in R&D intensity and innovation are driven by such factors: reduction of anti-competitive market regulations, which promotes business R&D and strengthens the incentives for innovations; stable economic conditions and low interest rates which encourage the growth of inno vation activity by creating a low-cost environment for investment in innovation; availability of internal and external finance. Practical implication. It is given the basic legal framework which defines rights and obligations of IPR owners: reviewing exemptions to copyright in the light of the internet’s different uses; clarifying exemptions for research use; promoting an active and open commercialization policy for universities; encouraging the commercialization and monetization of IPR: for example draft licensing contracts, valuation standards; standards: encouraging pooling

  6. Feature selection for splice site prediction: A new method using EDA-based feature ranking

    Directory of Open Access Journals (Sweden)

    Rouzé Pierre

    2004-05-01

    Full Text Available Abstract Background The identification of relevant biological features in large and complex datasets is an important step towards gaining insight in the processes underlying the data. Other advantages of feature selection include the ability of the classification system to attain good or even better solutions using a restricted subset of features, and a faster classification. Thus, robust methods for fast feature selection are of key importance in extracting knowledge from complex biological data. Results In this paper we present a novel method for feature subset selection applied to splice site prediction, based on estimation of distribution algorithms, a more general framework of genetic algorithms. From the estimated distribution of the algorithm, a feature ranking is derived. Afterwards this ranking is used to iteratively discard features. We apply this technique to the problem of splice site prediction, and show how it can be used to gain insight into the underlying biological process of splicing. Conclusion We show that this technique proves to be more robust than the traditional use of estimation of distribution algorithms for feature selection: instead of returning a single best subset of features (as they normally do this method provides a dynamical view of the feature selection process, like the traditional sequential wrapper methods. However, the method is faster than the traditional techniques, and scales better to datasets described by a large number of features.

  7. Consumers’ Preferences for Electronic Nicotine Delivery System Product Features: A Structured Content Analysis

    Directory of Open Access Journals (Sweden)

    Christine E. Kistler

    2017-06-01

    Full Text Available To inform potential governmental regulations, we aimed to develop a list of electronic nicotine delivery system (ENDS product features important to U.S. consumers by age and gender. We employed qualitative data methods. Participants were eligible if they had used an ENDS at least once. Groups were selected by age and gender (young adult group aged 18–25, n = 11; middle-age group aged 26–64, n = 9; and women’s group aged 26–64, n = 9. We conducted five individual older adult interviews (aged 68–80. Participants discussed important ENDS features. We conducted a structured content analysis of the group and interview responses. Of 34 participants, 68% were white and 56% were female. Participants mentioned 12 important ENDS features, including: (1 user experience; (2 social acceptability; (3 cost; (4 health risks/benefits; (5 ease of use; (6 flavors; (7 smoking cessation aid; (8 nicotine content; (9 modifiability; (10 ENDS regulation; (11 bridge between tobacco cigarettes; (12 collectability. The most frequently mentioned ENDS feature was modifiability for young adults, user experience for middle-age and older adults, and flavor for the women’s group. This study identified multiple features important to ENDS consumers. Groups differed in how they viewed various features by age and gender. These results can inform ongoing regulatory efforts.

  8. Engineering features of ISX

    International Nuclear Information System (INIS)

    Lousteau, D.C.; Jernigan, T.C.; Schaffer, M.J.; Hussung, R.O.

    1975-01-01

    ISX, an Impurity Study Experiment, is presently being designed at Oak Ridge National Laboratory as a joint scientific effort between ORNL and General Atomic Company. ISX is a moderate size tokamak dedicated to the study of impurity production, diffusion, and control. The significant engineering features of this device are discussed

  9. News and Features Updates from USA.gov

    Data.gov (United States)

    General Services Administration — Stay on top of important government news and information with the USA.gov Updates: News and Features RSS feed. We'll update this feed when we add news and featured...

  10. Colorectal Cancer: The Importance of Early Detection

    Science.gov (United States)

    ... of this page please turn JavaScript on. Feature: Colorectal Cancer The Importance of Early Detection Past Issues / Summer ... Cancer of the colon or rectum is called colorectal cancer. The colon and the rectum are part of ...

  11. Analytical Features: A Knowledge-Based Approach to Audio Feature Generation

    Directory of Open Access Journals (Sweden)

    Pachet François

    2009-01-01

    Full Text Available We present a feature generation system designed to create audio features for supervised classification tasks. The main contribution to feature generation studies is the notion of analytical features (AFs, a construct designed to support the representation of knowledge about audio signal processing. We describe the most important aspects of AFs, in particular their dimensional type system, on which are based pattern-based random generators, heuristics, and rewriting rules. We show how AFs generalize or improve previous approaches used in feature generation. We report on several projects using AFs for difficult audio classification tasks, demonstrating their advantage over standard audio features. More generally, we propose analytical features as a paradigm to bring raw signals into the world of symbolic computation.

  12. Rare features associated with Mobius syndrome: Report of two cases

    Directory of Open Access Journals (Sweden)

    Rumela Ghosh

    2017-03-01

    Full Text Available Mobius syndrome is a rare congenital disorder with the preliminary diagnostic criteria of congenital facial and abducent nerve palsy. Involvement of other cranial nerves, too, is common. Prevalence rate of this syndrome is approximately 1 in 100,000 neonates. It is of unknown etiology with sporadic occurrence. However, data regarding the occurrence rate in India is limited. Features such as orofacial malformations, limb defects, and musculoskeletal, behavioral, and cognitive abnormalities might be associated. A thorough evaluation to identify the condition and establishing an adequate treatment plan is of utmost important in this condition. We are reporting clinical and radiographic features of Mobius syndrome in two cases along with unusual findings of limb and neck deformity.

  13. Understanding Protein-Protein Interactions Using Local Structural Features

    DEFF Research Database (Denmark)

    Planas-Iglesias, Joan; Bonet, Jaume; García-García, Javier

    2013-01-01

    Protein-protein interactions (PPIs) play a relevant role among the different functions of a cell. Identifying the PPI network of a given organism (interactome) is useful to shed light on the key molecular mechanisms within a biological system. In this work, we show the role of structural features...... interacting and non-interacting protein pairs to classify the structural features that sustain the binding (or non-binding) behavior. Our study indicates that not only the interacting region but also the rest of the protein surface are important for the interaction fate. The interpretation...... to score the likelihood of the interaction between two proteins and to develop a method for the prediction of PPIs. We have tested our method on several sets with unbalanced ratios of interactions and non-interactions to simulate real conditions, obtaining accuracies higher than 25% in the most unfavorable...

  14. An integrated multi-sensor fusion-based deep feature learning approach for rotating machinery diagnosis

    Science.gov (United States)

    Liu, Jie; Hu, Youmin; Wang, Yan; Wu, Bo; Fan, Jikai; Hu, Zhongxu

    2018-05-01

    The diagnosis of complicated fault severity problems in rotating machinery systems is an important issue that affects the productivity and quality of manufacturing processes and industrial applications. However, it usually suffers from several deficiencies. (1) A considerable degree of prior knowledge and expertise is required to not only extract and select specific features from raw sensor signals, and but also choose a suitable fusion for sensor information. (2) Traditional artificial neural networks with shallow architectures are usually adopted and they have a limited ability to learn the complex and variable operating conditions. In multi-sensor-based diagnosis applications in particular, massive high-dimensional and high-volume raw sensor signals need to be processed. In this paper, an integrated multi-sensor fusion-based deep feature learning (IMSFDFL) approach is developed to identify the fault severity in rotating machinery processes. First, traditional statistics and energy spectrum features are extracted from multiple sensors with multiple channels and combined. Then, a fused feature vector is constructed from all of the acquisition channels. Further, deep feature learning with stacked auto-encoders is used to obtain the deep features. Finally, the traditional softmax model is applied to identify the fault severity. The effectiveness of the proposed IMSFDFL approach is primarily verified by a one-stage gearbox experimental platform that uses several accelerometers under different operating conditions. This approach can identify fault severity more effectively than the traditional approaches.

  15. Identifiability in stochastic models

    CERN Document Server

    1992-01-01

    The problem of identifiability is basic to all statistical methods and data analysis, occurring in such diverse areas as Reliability Theory, Survival Analysis, and Econometrics, where stochastic modeling is widely used. Mathematics dealing with identifiability per se is closely related to the so-called branch of ""characterization problems"" in Probability Theory. This book brings together relevant material on identifiability as it occurs in these diverse fields.

  16. Feature ranking and rank aggregation for automatic sleep stage classification: a comparative study.

    Science.gov (United States)

    Najdi, Shirin; Gharbali, Ali Abdollahi; Fonseca, José Manuel

    2017-08-18

    Nowadays, sleep quality is one of the most important measures of healthy life, especially considering the huge number of sleep-related disorders. Identifying sleep stages using polysomnographic (PSG) signals is the traditional way of assessing sleep quality. However, the manual process of sleep stage classification is time-consuming, subjective and costly. Therefore, in order to improve the accuracy and efficiency of the sleep stage classification, researchers have been trying to develop automatic classification algorithms. Automatic sleep stage classification mainly consists of three steps: pre-processing, feature extraction and classification. Since classification accuracy is deeply affected by the extracted features, a poor feature vector will adversely affect the classifier and eventually lead to low classification accuracy. Therefore, special attention should be given to the feature extraction and selection process. In this paper the performance of seven feature selection methods, as well as two feature rank aggregation methods, were compared. Pz-Oz EEG, horizontal EOG and submental chin EMG recordings of 22 healthy males and females were used. A comprehensive feature set including 49 features was extracted from these recordings. The extracted features are among the most common and effective features used in sleep stage classification from temporal, spectral, entropy-based and nonlinear categories. The feature selection methods were evaluated and compared using three criteria: classification accuracy, stability, and similarity. Simulation results show that MRMR-MID achieves the highest classification performance while Fisher method provides the most stable ranking. In our simulations, the performance of the aggregation methods was in the average level, although they are known to generate more stable results and better accuracy. The Borda and RRA rank aggregation methods could not outperform significantly the conventional feature ranking methods. Among

  17. Idiosyncratic Features of the Contemporary Regional Economic Architecture in Asia

    Directory of Open Access Journals (Sweden)

    Dilip K. Das

    2012-06-01

    Full Text Available The objective of this article is to examine the characteristic features of contemporary policy-led regionalism in Asia. It identifies the positive and negative features associated with the free trade agreements that have proliferated in Asia during the first decade of the 21st century. There has been a marked transformation in Asia's regional architecture in a short span of a decade-and-a-half. The mode and conduct of multilateral trade has been signifThe objective of this article is to examine the characteristic features of contemporary policy-led regionalism in Asia. It identifies the positive and negative features associated with the free trade agreements that have proliferated in Asia during the first decade of the 21st century. There has been a marked transformation in Asia's regional architecture in a short span of a decade-and-a-half. The mode and conduct of multilateral trade has been significantly transformed during recent years and Asia could not possibly remain immune to this transformation. The importance of regionalism in multilateral trade has increased steadily. In addition, the trade-investment-services nexus has developed and grown increasingly important. As business firms now manufacture parts of their products across the border, bilateral trade agreements (BTAs, regional trade agreements (RTAs and free trade agreements (FTAs of the contemporary period need to take into account the new kind of trade barriers that have been created due to the changing mode of trade. The contemporary regional agreements need to be designed to facilitate the new modes of conducting business and trade. It was understood rather late in Asia that the 'WTO-Plus' FTAs are more functional and result-oriented than their predecessors.

  18. Imaging features of thalassemia

    Energy Technology Data Exchange (ETDEWEB)

    Tunaci, M.; Tunaci, A.; Engin, G.; Oezkorkmaz, B.; Acunas, G.; Acunas, B. [Dept. of Radiology, Istanbul Univ. (Turkey); Dincol, G. [Dept. of Internal Medicine, Istanbul Univ. (Turkey)

    1999-07-01

    Thalassemia is a kind of chronic, inherited, microcytic anemia characterized by defective hemoglobin synthesis and ineffective erythropoiesis. In all thalassemias clinical features that result from anemia, transfusional, and absorptive iron overload are similar but vary in severity. The radiographic features of {beta}-thalassemia are due in large part to marrow hyperplasia. Markedly expanded marrow space lead to various skeletal manifestations including spine, skull, facial bones, and ribs. Extramedullary hematopoiesis (ExmH), hemosiderosis, and cholelithiasis are among the non-skeletal manifestations of thalassemia. The skeletal X-ray findings show characteristics of chronic overactivity of the marrow. In this article both skeletal and non-skeletal manifestations of thalassemia are discussed with an overview of X-ray findings, including MRI and CT findings. (orig.)

  19. Imaging features of thalassemia

    International Nuclear Information System (INIS)

    Tunaci, M.; Tunaci, A.; Engin, G.; Oezkorkmaz, B.; Acunas, G.; Acunas, B.; Dincol, G.

    1999-01-01

    Thalassemia is a kind of chronic, inherited, microcytic anemia characterized by defective hemoglobin synthesis and ineffective erythropoiesis. In all thalassemias clinical features that result from anemia, transfusional, and absorptive iron overload are similar but vary in severity. The radiographic features of β-thalassemia are due in large part to marrow hyperplasia. Markedly expanded marrow space lead to various skeletal manifestations including spine, skull, facial bones, and ribs. Extramedullary hematopoiesis (ExmH), hemosiderosis, and cholelithiasis are among the non-skeletal manifestations of thalassemia. The skeletal X-ray findings show characteristics of chronic overactivity of the marrow. In this article both skeletal and non-skeletal manifestations of thalassemia are discussed with an overview of X-ray findings, including MRI and CT findings. (orig.)

  20. Classification Using Markov Blanket for Feature Selection

    DEFF Research Database (Denmark)

    Zeng, Yifeng; Luo, Jian

    2009-01-01

    Selecting relevant features is in demand when a large data set is of interest in a classification task. It produces a tractable number of features that are sufficient and possibly improve the classification performance. This paper studies a statistical method of Markov blanket induction algorithm...... for filtering features and then applies a classifier using the Markov blanket predictors. The Markov blanket contains a minimal subset of relevant features that yields optimal classification performance. We experimentally demonstrate the improved performance of several classifiers using a Markov blanket...... induction as a feature selection method. In addition, we point out an important assumption behind the Markov blanket induction algorithm and show its effect on the classification performance....

  1. Comparing experts and novices in Martian surface feature change detection and identification

    Science.gov (United States)

    Wardlaw, Jessica; Sprinks, James; Houghton, Robert; Muller, Jan-Peter; Sidiropoulos, Panagiotis; Bamford, Steven; Marsh, Stuart

    2018-02-01

    Change detection in satellite images is a key concern of the Earth Observation field for environmental and climate change monitoring. Satellite images also provide important clues to both the past and present surface conditions of other planets, which cannot be validated on the ground. With the volume of satellite imagery continuing to grow, the inadequacy of computerised solutions to manage and process imagery to the required professional standard is of critical concern. Whilst studies find the crowd sourcing approach suitable for the counting of impact craters in single images, images of higher resolution contain a much wider range of features, and the performance of novices in identifying more complex features and detecting change, remains unknown. This paper presents a first step towards understanding whether novices can identify and annotate changes in different geomorphological features. A website was developed to enable visitors to flick between two images of the same location on Mars taken at different times and classify 1) if a surface feature changed and if so, 2) what feature had changed from a pre-defined list of six. Planetary scientists provided ;expert; data against which classifications made by novices could be compared when the project subsequently went public. Whilst no significant difference was found in images identified with surface changes by expert and novices, results exhibited differences in consensus within and between experts and novices when asked to classify the type of change. Experts demonstrated higher levels of agreement in classification of changes as dust devil tracks, slope streaks and impact craters than other features, whilst the consensus of novices was consistent across feature types; furthermore, the level of consensus amongst regardless of feature type. These trends are secondary to the low levels of consensus found, regardless of feature type or classifier expertise. These findings demand the attention of researchers who

  2. Model Checking Feature Interactions

    DEFF Research Database (Denmark)

    Le Guilly, Thibaut; Olsen, Petur; Pedersen, Thomas

    2015-01-01

    This paper presents an offline approach to analyzing feature interactions in embedded systems. The approach consists of a systematic process to gather the necessary information about system components and their models. The model is first specified in terms of predicates, before being refined to t...... to timed automata. The consistency of the model is verified at different development stages, and the correct linkage between the predicates and their semantic model is checked. The approach is illustrated on a use case from home automation....

  3. Clinical and microbiological features of cryptococcal meningitis

    Directory of Open Access Journals (Sweden)

    Lucia Kioko Hasimoto e Souza

    2013-06-01

    Full Text Available Introduction In this study, the clinical features, underlying diseases and clinical outcomes of patients with cryptococcosis were investigated. In addition, a molecular analysis of the Cryptococcus neoformans species complex isolated from these patients was performed. Methods A prospective study of 62 cases of patients with cryptococcal infection was conducted at the Hospital de Doenças Tropicais de Goiás Dr. Anuar Auad from 2009-2010. Cryptococcal meningitis cases were diagnosed by direct examination and cerebrospinal fluid (CSF sample culture. The profiling of these patients was assessed. The CSF samples were submitted to India ink preparation and cultured on Sabouraud dextrose agar, and C. neoformans was identified by the production of urease, a positive phenoloxidase test and assimilation of carbohydrates. C. neoformans and C. gattii isolates were distinguished by growth on L-canavanine-glycine-bromothymol blue medium, and molecular analysis was conducted via PCR fingerprinting reactions using M13 and (GACA4 primers. Results From the 62 patients with cryptococcosis, 71 isolates of CSF were obtained; 67 (94.4% isolates were identified as C. neoformans var. grubii/VNI, and 4 (5.6% were identified as C. gattii/VGII. Of these patients, 53 had an HIV diagnosis. The incidence of cryptococcosis was higher among patients 20-40 years of age, with 74.2% of the cases reported in males. Cryptococcus-related mortality was noted in 48.4% of the patients, and the symptoms were altered sensorium, headache, fever and stiff neck. Conclusions The high morbidity and mortality observed among patients with cryptococcosis demonstrate the importance of obtaining information regarding the epidemiological profile and clinical course of the disease in the State of Goiás, Brazil.

  4. Features influencing Islamic websites use: A Muslim user perspective

    Directory of Open Access Journals (Sweden)

    Mansur Aliyu

    2013-06-01

    Full Text Available Muslim scholars and organisations use the Internet through various websites to spread Islam globally. The presence of many websites providing Islamic contents online makes it necessary to examine their Islamic features and the factors that influence Muslims to use Islamic websites. This paper empirically investigates the Islamic features that influence the use of Islamic websites by Muslim users. The identified Islamic factors were grouped under five factors: beliefs, ethics, services, symbols, and values. A survey of 246 Muslim Islamic website users was conducted between November and December  2012 at the International Islamic University Malaysia (IIUM. The study develops and tests a path measurement model to confirm the psychometric properties of the five identified factors. The study found that Islamic features significantly influence Muslims to use Islamic websites. The measurement model and empirical results provide valuable indicators for the direction of future research and also suggest guidelines for developing Islamic websites that will easily influence many Internet users to visit them in order to learn about Islamic teachings and practices. The findings are also of considerable importance as they contribute to the present body of knowledge on Islamic websites’ evaluation and for practice in designing and developing quality Islamic websites.

  5. Stylistic Features of the Legal Discourse | Alabi | UJAH: Unizik ...

    African Journals Online (AJOL)

    Every profession, every occupation, for example architecture, journalism, medicine, sports, has its specialised language features. These features may be viewed at the phonological, semantic, syntactic, lexical and graphological levels, among others. The language features identified with certain professions are most of the ...

  6. A HYBRID FILTER AND WRAPPER FEATURE SELECTION APPROACH FOR DETECTING CONTAMINATION IN DRINKING WATER MANAGEMENT SYSTEM

    Directory of Open Access Journals (Sweden)

    S. VISALAKSHI

    2017-07-01

    Full Text Available Feature selection is an important task in predictive models which helps to identify the irrelevant features in the high - dimensional dataset. In this case of water contamination detection dataset, the standard wrapper algorithm alone cannot be applied because of the complexity. To overcome this computational complexity problem and making it lighter, filter-wrapper based algorithm has been proposed. In this work, reducing the feature space is a significant component of water contamination. The main findings are as follows: (1 The main goal is speeding up the feature selection process, so the proposed filter - based feature pre-selection is applied and guarantees that useful data are improbable to be detached in the initial stage which discussed briefly in this paper. (2 The resulting features are again filtered by using the Genetic Algorithm coded with Support Vector Machine method, where it facilitates to nutshell the subset of features with high accuracy and decreases the expense. Experimental results show that the proposed methods trim down redundant features effectively and achieved better classification accuracy.

  7. The Non-motor Features of Essential Tremor: A Primary Disease Feature or Just a Secondary Phenomenon?

    Directory of Open Access Journals (Sweden)

    Ketan Jhunjhunwala

    2014-08-01

    Full Text Available Essential tremor (ET is a pathologically heterogeneous neurodegenerative disorder with both motor and increasingly recognized non-motor features. It is debated whether the non-motor manifestations in ET result from widespread neurodegeneration or are merely secondary to impaired motor functions and decreased quality of life due to tremor. It is important to review these features to determine how to best treat the non-motor symptoms of patients and to understand the basic pathophysiology of the disease and develop appropriate pharmacotherapies. In this review, retrospective and prospective clinical studies were critically analyzed to identify possible correlations between the severities of non-motor features and tremor. We speculated that if such a correlation existed, the non-motor features were likely to be secondary to tremor. According to the current literature, the deficits in executive function, attention, concentration, and memory often observed in ET are likely to be a primary manifestation of the disease. It has also been documented that patients with ET often exhibit characteristic personality traits. However, it remains to be determined whether the other non-motor features often seen in ET, such as anxiety, depression, and sleep disturbances are primary or secondary to motor manifestations of ET and subsequent poor quality of life. Finally, there is evidence that patients with ET can also have impaired color vision, disturbances of olfaction, and hearing impairments, though there are few studies in these areas. Further investigations of large cohorts of patients with ET are required to understand the prevalence, nature, and true significance of the non-motor features in ET.

  8. Features of MCNP6

    International Nuclear Information System (INIS)

    Goorley, T.; James, M.; Booth, T.; Brown, F.; Bull, J.; Cox, L.J.; Durkee, J.; Elson, J.; Fensin, M.; Forster, R.A.; Hendricks, J.; Hughes, H.G.; Johns, R.; Kiedrowski, B.; Martz, R.; Mashnik, S.; McKinney, G.; Pelowitz, D.; Prael, R.; Sweezy, J.

    2016-01-01

    Highlights: • MCNP6 is simply and accurately described as the merger of MCNP5 and MCNPX capabilities, but it is much more than the sum of these two computer codes. • MCNP6 is the result of six years of effort by the MCNP5 and MCNPX code development teams. • These groups of people, residing in Los Alamos National Laboratory’s X Computational Physics Division, Monte Carlo Codes Group (XCP-3) and Nuclear Engineering and Nonproliferation Division, Radiation Transport Modeling Team (NEN-5) respectively, have combined their code development efforts to produce the next evolution of MCNP. • While maintenance and major bug fixes will continue for MCNP5 1.60 and MCNPX 2.7.0 for upcoming years, new code development capabilities only will be developed and released in MCNP6. • In fact, the initial release of MCNP6 contains numerous new features not previously found in either code. • These new features are summarized in this document. • Packaged with MCNP6 is also the new production release of the ENDF/B-VII.1 nuclear data files usable by MCNP. • The high quality of the overall merged code, usefulness of these new features, along with the desire in the user community to start using the merged code, have led us to make the first MCNP6 production release: MCNP6 version 1. • High confidence in the MCNP6 code is based on its performance with the verification and validation test suites, comparisons to its predecessor codes, our automated nightly software debugger tests, the underlying high quality nuclear and atomic databases, and significant testing by many beta testers. - Abstract: MCNP6 can be described as the merger of MCNP5 and MCNPX capabilities, but it is much more than the sum of these two computer codes. MCNP6 is the result of six years of effort by the MCNP5 and MCNPX code development teams. These groups of people, residing in Los Alamos National Laboratory’s X Computational Physics Division, Monte Carlo Codes Group (XCP-3) and Nuclear Engineering and

  9. Pulmonary vasculitis: imaging features

    International Nuclear Information System (INIS)

    Seo, Joon Beom; Im, Jung Gi; Chung, Jin Wook; Goo, Jin Mo; Park, Jae Hyung; Yeon, Kyung Mo; Song, Jae Woo

    1999-01-01

    Vasculitis is defined as an inflammatory process involving blood vessels, and can lead to destruction of the vascular wall and ischemic damage to the organs supplied by these vessels. The lung is commonly affected. A number of attempts have been made to classify and organize pulmonary vasculitis, but because the clinical manifestations and pathologic features of the condition overlap considerably, these afforts have failed to achieve a consensus. We classified pulmonary vasculitis as belonging to either the angitiis-granulomatosis group, the diffuse pulmonary hemorrhage with capillaritis group, or 'other'. Characteristic radiographic and CT findings of the different types of pulmonary vasculitis are illustrated, with a brief discussion of the respective disease entities

  10. Onychomatricoma with misleading features.

    Science.gov (United States)

    Fayol, J; Baran, R; Perrin, C; Labrousse, F

    2000-01-01

    Onychomatricoma is a rare tumour of the nail matrix with peculiar clinical and histological features and electron microscopic findings. We report on 5 cases with appearances which were misleading. Three presented as longitudinal melanonychia, a previously unreported observation. One case had the appearance of a cutaneous horn. In 3 of the 5 cases the tumour was associated with an onychomycosis and this may thus have been a predisposing factor in the secondary fungal infestation. Onychomatricoma appears as a multi-faceted tumour which can be mimicked by longitudinal melanonychia and/or onychomycosis.

  11. Common Features in Electronic Structure of the Oxypnictide Superconductors from Photoemission Spectroscopy

    International Nuclear Information System (INIS)

    Xiao-Wen, Jia; Hai-Yun, Liu; Wen-Tao, Zhang; Lin, Zhao; Jian-Qiao, Meng; Guo-Dong, Liu; Xiao-Li, Dong; Zhi-An, Ren; Wei, Yi; Guang-Can, Che; Zhong-Xian, Zhao; Gang, Wu; Rong-Hua, Liu; Xian-Hui, Chen; Gen-Fu, Chen; Nan-Lin, Wang; Yong, Zhu; Xiao-Yang, Wang; Gui-Ling, Wang; Yong, Zhou

    2008-01-01

    High resolution photoemission measurements are carried out on non-superconducting LaFeAsO parent compound and various superconducting RFeAs(O 1-x F x ) (R=La, Ce and Pr) compounds. It is found that the parent LaFeAsO compound shows a metallic character. By extensive measurements, several common features are identified in the electronic structure of these Fe-based compounds: (1) 0.2 eV feature in the valence band, (2) a universal 13-16 meV feature, (3) near Ef spectral weight suppression with decreasing temperature. These universal features can provide important information about band structure, superconducting gap and pseudogap in these Fe-based materials

  12. Identifying Strategic Scientific Opportunities

    Science.gov (United States)

    As NCI's central scientific strategy office, CRS collaborates with the institute's divisions, offices, and centers to identify research opportunities to advance NCI's vision for the future of cancer research.

  13. PERPETUAL LEASE: FEATURES OF ACCOUNTING

    Directory of Open Access Journals (Sweden)

    Tetiana Yurchenko

    2017-03-01

    Full Text Available The article namely deals with the peculiarities of legal regulation of the right to use someone else's land for agricultural purposes under the perpetual lease contract. Recognition of the legitimacy of perpetual lease as an intangible asset and, therefore, the object of accounting was justified. The features of the primary account perpetual lease rights were analyzed. It was found that for documenting transactions receipt, commissioning, de-recognition perpetual lease specialized forms of primary documents is not installed. The main aspects of accounting reflection of land under perpetual lease contracts were identified and ways of their improving were developed. The period on which the land is transferred for use under perpetual lease contract was proposed. During the study, general scientific methods – induction, deduction, synthesis, analysis, dialectical, historical, generalizations and specific methods of accounting – documentation, evaluation, accounting records were used. Keywords: accounting, land, perpetual lease, intangible assets, the right to use.

  14. Identifying Breast Cancer Oncogenes

    Science.gov (United States)

    2011-10-01

    cells we observed that it promoted transformation of HMLE cells, suggesting a tumor suppressive role of Merlin in breast cancer (Figure 4B). A...08-1-0767 TITLE: Identifying Breast Cancer Oncogenes PRINCIPAL INVESTIGATOR: Yashaswi Shrestha...Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std. Z39.18 W81XWH-08-1-0767 Identifying Breast Cancer Oncogenes Yashaswi Shrestha Dana-Farber

  15. Mapping genomic features to functional traits through microbial whole genome sequences.

    Science.gov (United States)

    Zhang, Wei; Zeng, Erliang; Liu, Dan; Jones, Stuart E; Emrich, Scott

    2014-01-01

    Recently, the utility of trait-based approaches for microbial communities has been identified. Increasing availability of whole genome sequences provide the opportunity to explore the genetic foundations of a variety of functional traits. We proposed a machine learning framework to quantitatively link the genomic features with functional traits. Genes from bacteria genomes belonging to different functional traits were grouped to Cluster of Orthologs (COGs), and were used as features. Then, TF-IDF technique from the text mining domain was applied to transform the data to accommodate the abundance and importance of each COG. After TF-IDF processing, COGs were ranked using feature selection methods to identify their relevance to the functional trait of interest. Extensive experimental results demonstrated that functional trait related genes can be detected using our method. Further, the method has the potential to provide novel biological insights.

  16. Print Advertisements for Alzheimer’s Disease Drugs: Informational and Transformational Features

    Science.gov (United States)

    Gooblar, Jonathan; Carpenter, Brian D.

    2014-01-01

    Purpose We examined print advertisements for Alzheimer’s disease drugs published in journals and magazines between January 2008 and February 2012, using an informational versus transformational theoretical framework to identify objective and persuasive features. Methods In 29 unique advertisements, we used qualitative methods to code and interpret identifying information, charts, benefit and side effect language, and persuasive appeals embedded in graphics and narratives. Results Most elements contained a mixture of informational and transformational features. Charts were used infrequently, but when they did appear the accompanying text often exaggerated the data. Benefit statements covered an array of symptoms, drug properties, and caregiver issues. Side effect statements often used positive persuasive appeals. Graphics and narrative features emphasized positive emotions and outcomes. Implications We found subtle and sophisticated attempts both to educate and to persuade readers. It is important for consumers and prescribing physicians to read print advertisements critically so that they can make informed treatment choices. PMID:23687184

  17. Astronomy and big data a data clustering approach to identifying uncertain galaxy morphology

    CERN Document Server

    Edwards, Kieran Jay

    2014-01-01

    With the onset of massive cosmological data collection through media such as the Sloan Digital Sky Survey (SDSS), galaxy classification has been accomplished for the most part with the help of citizen science communities like Galaxy Zoo. Seeking the wisdom of the crowd for such Big Data processing has proved extremely beneficial. However, an analysis of one of the Galaxy Zoo morphological classification data sets has shown that a significant majority of all classified galaxies are labelled as “Uncertain”. This book reports on how to use data mining, more specifically clustering, to identify galaxies that the public has shown some degree of uncertainty for as to whether they belong to one morphology type or another. The book shows the importance of transitions between different data mining techniques in an insightful workflow. It demonstrates that Clustering enables to identify discriminating features in the analysed data sets, adopting a novel feature selection algorithms called Incremental Feature Select...

  18. MRI features associated with acute appendicitis

    Energy Technology Data Exchange (ETDEWEB)

    Leeuwenburgh, Marjolein M.N. [University of Amsterdam, Department of Surgery, Academic Medical Center, Amsterdam (Netherlands); University of Amsterdam, Department of Radiology, Academic Medical Center, Amsterdam (Netherlands); Academic Medical Center, Department of Radiology (G1-223.1), Amsterdam (Netherlands); Jensch, Sebastiaan [Sint Lucas Andreas Hospital, Department of Radiology, Amsterdam (Netherlands); Gratama, Jan W.C. [Gelre Hospitals, Department of Radiology, Apeldoorn (Netherlands); Spilt, Aart [Kennemer Gasthuis, Department of Radiology, Haarlem (Netherlands); Wiarda, Bart M. [Alkmaar Medical Center, Department of Radiology, Alkmaar (Netherlands); Es, H.W. van [Sint Antonius Hospital, Department of Radiology, Nieuwegein (Netherlands); Cobben, Lodewijk P.J. [Haaglanden Medical Center, Department of Radiology, Leidschendam (Netherlands); Bossuyt, Patrick M.M. [University of Amsterdam, Department of Clinical Epidemiology, Academic Medical Center, Amsterdam (Netherlands); Boermeester, Marja A. [University of Amsterdam, Department of Surgery, Academic Medical Center, Amsterdam (Netherlands); Stoker, Jaap [University of Amsterdam, Department of Radiology, Academic Medical Center, Amsterdam (Netherlands); Collaboration: on behalf of the OPTIMAP study group

    2014-01-15

    To identify MRI features associated with appendicitis. Features expected to be associated with appendicitis were recorded in consensus by two expert radiologists on 223 abdominal MRIs in patients with suspected appendicitis. Nine MRI features were studied: appendix diameter >7 mm, appendicolith, peri-appendiceal fat infiltration, peri-appendiceal fluid, absence of gas in the appendix, appendiceal wall destruction, restricted diffusion of the appendiceal wall, lumen or focal fluid collections. Appendicitis was assigned as the final diagnosis in 117/223 patients. Associations between imaging features and appendicitis were evaluated with logistic regression analysis. All investigated features were significantly associated with appendicitis in univariate analysis. Combinations of two and three features were associated with a probability of appendicitis of 88 % and 92 %, respectively. In patients without any of the nine features, appendicitis was present in 2 % of cases. After multivariate analysis, only an appendix diameter >7 mm, peri-appendiceal fat infiltration and restricted diffusion of the appendiceal wall were significantly associated with appendicitis. The probability of appendicitis was 96 % in their presence and 2 % in their absence. An appendix diameter >7 mm, peri-appendiceal fat infiltration and restricted diffusion of the appendiceal wall have the strongest association with appendicitis on MRI. (orig.)

  19. MRI features associated with acute appendicitis

    International Nuclear Information System (INIS)

    Leeuwenburgh, Marjolein M.N.; Jensch, Sebastiaan; Gratama, Jan W.C.; Spilt, Aart; Wiarda, Bart M.; Es, H.W. van; Cobben, Lodewijk P.J.; Bossuyt, Patrick M.M.; Boermeester, Marja A.; Stoker, Jaap

    2014-01-01

    To identify MRI features associated with appendicitis. Features expected to be associated with appendicitis were recorded in consensus by two expert radiologists on 223 abdominal MRIs in patients with suspected appendicitis. Nine MRI features were studied: appendix diameter >7 mm, appendicolith, peri-appendiceal fat infiltration, peri-appendiceal fluid, absence of gas in the appendix, appendiceal wall destruction, restricted diffusion of the appendiceal wall, lumen or focal fluid collections. Appendicitis was assigned as the final diagnosis in 117/223 patients. Associations between imaging features and appendicitis were evaluated with logistic regression analysis. All investigated features were significantly associated with appendicitis in univariate analysis. Combinations of two and three features were associated with a probability of appendicitis of 88 % and 92 %, respectively. In patients without any of the nine features, appendicitis was present in 2 % of cases. After multivariate analysis, only an appendix diameter >7 mm, peri-appendiceal fat infiltration and restricted diffusion of the appendiceal wall were significantly associated with appendicitis. The probability of appendicitis was 96 % in their presence and 2 % in their absence. An appendix diameter >7 mm, peri-appendiceal fat infiltration and restricted diffusion of the appendiceal wall have the strongest association with appendicitis on MRI. (orig.)

  20. Titan's Ammonia Feature

    Science.gov (United States)

    Smythe, W.; Nelson, R.; Boryta, M.; Choukroun, M.

    2011-01-01

    NH3 has long been considered an important component in the formation and evolution of the outer planet satellites. NH3 is particularly important for Titan, since it may serve as the reservoir for atmospheric nitrogen. A brightening seen on Titan starting in 2004 may arise from a transient low-lying fog or surface coating of ammonia. The spectral shape suggests the ammonia is anhydrous, a molecule that hydrates quickly in the presence of water.

  1. Integrated reporting and board features

    Directory of Open Access Journals (Sweden)

    Rares HURGHIS

    2017-02-01

    Full Text Available In the last two decades the concept of sustainability reporting gained more importance in the companies’ annual reports, a trend which is embedded also in integrated reporting. Issuing an integrated report became a necessity, because the report explains to the investors how the organization creates value over time. The governance structure, more exactly the board of directors, decides whether or not the company will issue an integrated report. Thus, are there certain features of the board that might influence the issue of an integrated report? Do the companies which issue an integrated report have certain features of the governance structure? Looking for an answer to these questions, we seek for any possible correlations between a disclosure index and the corporate governance structure characteristics, on a sample from the companies participating at the International Integrated Reporting Council Examples Database. The results highlight that only the size of the board influences the extent to which the issued integrated report is in accordance with the International Framework.

  2. Determination of morphological features and molecular interactions ...

    African Journals Online (AJOL)

    This research focused on identifying the morphological features and molecular interactions of the Nigerian Bentonitic clays using Scanning Electron Microscope (SEM) characterisation technique. The SEM microstructure images indicated that the bentonite samples are generally moderately dispersive to dispersive with ...

  3. HEDIS Research Identifiable Files

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Healthcare Effectiveness Data and Information Set (HEDIS) is a tool used by more than 90 percent of Americas health plans to measure performance on important...

  4. New learning resource features CERN

    CERN Multimedia

    Katarina Anthony

    2011-01-01

    A new educational website, STEM Works, has been launched this month, presenting science and technology in an industrial context for students aged 11-14. Developed with contributions from CERN, the site highlights the Laboratory as a “real-world” example of the opportunities available to science graduates. While the site was developed in Northern Ireland, STEM Works addresses issues of global relevance.   Students share their projects with Steve Myers, Richard Hanna (CCEA), and Catriona Ruane (Education Minister). STEM stands for Science, Technology, Engineering and Mathematics – the four cornerstones of the curriculum featured on the STEM Works website. It is part of a nationwide push in Northern Ireland to highlight how important STEM subjects are to both academia and industry. CERN worked closely with the Northern Ireland Council for the Curriculum, Examinations and Assessment (CCEA) to develop educational content for the site. “The CCEA STEM Works site i...

  5. Odontogenic keratocyst radiographic features

    International Nuclear Information System (INIS)

    Nartey, N. O.; Saini, T.

    1990-01-01

    The clinical features often patients with odontogenic keratocysts were studied. One patient had Gorlin-GoJtz syndrome. A total of fourteen radiolucent lesions were observed on radiographic examination. All the fourteen lesions were diagnosed as odontogenic keratocyst after histopathclogical examination of biopsied tissue from the patients. The age at diagnosis ranged from 25-72 years with a mean age of 37.6 years. The male : female ratio was 2.3:1. Thirteen of these lesions occurred in the mandible, nine involved the mandibular third molar region. Involvement of the ramus of the mandible produced a sausage-shaped radiolucency. Cystic lesions which have been present for long periods of time showed scalloped margins, due to the regional resorption of the surrounding bone. The bony ledges present on the cortical bones simulated multilocular appearance in such cases. It was also observed that the lesions in older individuals perforated the cortical plates rather than eliciting a periostally induced bony expansion. (author)

  6. Proctographic features of anismus.

    Science.gov (United States)

    Halligan, S; Bartram, C I; Park, H J; Kamm, M A

    1995-12-01

    To document the proctographic features of anismus at evacuation proctography and determine the optimum radiologic measurements for diagnosis. Twenty-four patients with anismus according to clinical and multiple physiologic criteria were examined with evacuation proctography. Structural and functional measurements were compared with those of a group of 20 asymptomatic subjects. No significant difference between patients and control subjects was found with respect to pelvic descent, rectocele, or any anorectal angle measurement. In patients with anismus, initiation of evacuation was prolonged (median, 9 vs 3 seconds for control subjects; P anismus should be abandoned. Patients with anismus demonstrate delayed initiation of evacuation, which is also prolonged and incomplete. Incomplete evacuation after 30 seconds is highly suggestive of anismus.

  7. Multispectral Image Feature Points

    Directory of Open Access Journals (Sweden)

    Cristhian Aguilera

    2012-09-01

    Full Text Available This paper presents a novel feature point descriptor for the multispectral image case: Far-Infrared and Visible Spectrum images. It allows matching interest points on images of the same scene but acquired in different spectral bands. Initially, points of interest are detected on both images through a SIFT-like based scale space representation. Then, these points are characterized using an Edge Oriented Histogram (EOH descriptor. Finally, points of interest from multispectral images are matched by finding nearest couples using the information from the descriptor. The provided experimental results and comparisons with similar methods show both the validity of the proposed approach as well as the improvements it offers with respect to the current state-of-the-art.

  8. More features, greater connectivity.

    Science.gov (United States)

    Hunt, Sarah

    2015-09-01

    Changes in our political infrastructure, the continuing frailties of our economy, and a stark growth in population, have greatly impacted upon the perceived stability of the NHS. Healthcare teams have had to adapt to these changes, and so too have the technologies upon which they rely to deliver first-class patient care. Here Sarah Hunt, marketing co-ordinator at Aid Call, assesses how the changing healthcare environment has affected one of its fundamental technologies - the nurse call system, argues the case for wireless such systems in terms of what the company claims is greater adaptability to changing needs, and considers the ever-wider range of features and functions available from today's nurse call equipment, particularly via connectivity with both mobile devices, and ancillaries ranging from enuresis sensors to staff attack alert 'badges'.

  9. Abdominal tuberculosis: Imaging features

    Energy Technology Data Exchange (ETDEWEB)

    Pereira, Jose M. [Department of Radiology, Hospital de S. Joao, Porto (Portugal)]. E-mail: jmpjesus@yahoo.com; Madureira, Antonio J. [Department of Radiology, Hospital de S. Joao, Porto (Portugal); Vieira, Alberto [Department of Radiology, Hospital de S. Joao, Porto (Portugal); Ramos, Isabel [Department of Radiology, Hospital de S. Joao, Porto (Portugal)

    2005-08-01

    Radiological findings of abdominal tuberculosis can mimic those of many different diseases. A high level of suspicion is required, especially in high-risk population. In this article, we will describe barium studies, ultrasound (US) and computed tomography (CT) findings of abdominal tuberculosis (TB), with emphasis in the latest. We will illustrate CT findings that can help in the diagnosis of abdominal tuberculosis and describe imaging features that differentiate it from other inflammatory and neoplastic diseases, particularly lymphoma and Crohn's disease. As tuberculosis can affect any organ in the abdomen, emphasis is placed to ileocecal involvement, lymphadenopathy, peritonitis and solid organ disease (liver, spleen and pancreas). A positive culture or hystologic analysis of biopsy is still required in many patients for definitive diagnosis. Learning objectives:1.To review the relevant pathophysiology of abdominal tuberculosis. 2.Illustrate CT findings that can help in the diagnosis.

  10. Abdominal tuberculosis: Imaging features

    International Nuclear Information System (INIS)

    Pereira, Jose M.; Madureira, Antonio J.; Vieira, Alberto; Ramos, Isabel

    2005-01-01

    Radiological findings of abdominal tuberculosis can mimic those of many different diseases. A high level of suspicion is required, especially in high-risk population. In this article, we will describe barium studies, ultrasound (US) and computed tomography (CT) findings of abdominal tuberculosis (TB), with emphasis in the latest. We will illustrate CT findings that can help in the diagnosis of abdominal tuberculosis and describe imaging features that differentiate it from other inflammatory and neoplastic diseases, particularly lymphoma and Crohn's disease. As tuberculosis can affect any organ in the abdomen, emphasis is placed to ileocecal involvement, lymphadenopathy, peritonitis and solid organ disease (liver, spleen and pancreas). A positive culture or hystologic analysis of biopsy is still required in many patients for definitive diagnosis. Learning objectives:1.To review the relevant pathophysiology of abdominal tuberculosis. 2.Illustrate CT findings that can help in the diagnosis

  11. Features of Multifinality

    NARCIS (Netherlands)

    Kruglanski, Arie W.; Koepetz, Catalina; Belanger, Jocelyn J.; Chun, Woo Young; Orehek, Edward; Fishbach, Ayelet

    Diverse facets of the multifinality configuration in goal-directed behavior are identified and empirically explored. The multifinality construct denotes a motivational structure wherein a single means is linked to several ends. A multifinality configuration maximizes value that a given means

  12. Identifying ambassador species for conservation marketing

    Directory of Open Access Journals (Sweden)

    E.A. Macdonald

    2017-10-01

    Full Text Available Conservation relies heavily on external funding, much of it from a supportive public. Therefore it is important to know which species are most likely to catalyse such funding. Whilst previous work has looked at the physical attributes that contribute to a species' appeal, no previous studies have tried to examine the extent to which a species' sympatriots might contribute to it's potential as flagship for wider conservation. Therefore, here we estimate ‘flexibility’ and ‘appeal’ scores for all terrestrial mammals (n = 4320 and identify which of these might serve as ambassadors (defined as both highly appealing and flexible. Relatively few mammals (between 240 and 331 emerged as ambassadors, with carnivores featuring heavily in this group (representing 5% of terrestrial mammals but 39% of ambassadors. ‘Top ambassadors’ were defined as those with both flexibility and appeal scores greater than 1 standard deviation above the mean. Less than a quarter of the 20 most endangered and evolutionary distinct species in this study were classed as ambassadors, highlighting the need for surrogate species to catalyse conservation effort in areas with such priority species. This is the first global analysis bringing together flexibility and appeal for all terrestrial mammals, and demonstrates an approach for determining how best to market species in order to achieve maximal conservation gain in a world with urgent conservation need but limited resources.

  13. Features of Coping with Disease in Iranian Multiple Sclerosis Patients: a Qualitative Study.

    Science.gov (United States)

    Dehghani, Ali; Dehghan Nayeri, Nahid; Ebadi, Abbas

    2018-03-01

    Introduction: Coping with disease is of the main components improving the quality of life in multiple sclerosis patients. Identifying the characteristics of this concept is based on the experiences of patients. Using qualitative research is essential to improve the quality of life. This study was conducted to explore the features of coping with the disease in patients with multiple sclerosis. Method: In this conventional content analysis study, eleven multiple sclerosis patients from Iran MS Society in Tehran (Iran) participated. Purposive sampling was used to select participants. Data were gathered using semi structured interviews. To analyze data, a conventional content analysis approach was used to identify meaning units and to make codes and categories. Results: Results showed that features of coping with disease in multiple sclerosis patients consists of (a) accepting the current situation, (b) maintenance and development of human interactions, (c) self-regulation and (d) self-efficacy. Each of these categories is composed of sub-categories and codes that showed the perception and experience of patients about the coping with disease. Conclusion: Accordingly, a unique set of features regarding features of coping with the disease were identified among the patients with multiple sclerosis. Therefore, working to ensure the emergence of, and subsequent reinforcement of these features in MS patients can be an important step in improving the adjustment and quality of their lives.

  14. DYNAMIC FEATURE SELECTION FOR WEB USER IDENTIFICATION ON LINGUISTIC AND STYLISTIC FEATURES OF ONLINE TEXTS

    Directory of Open Access Journals (Sweden)

    A. A. Vorobeva

    2017-01-01

    Full Text Available The paper deals with identification and authentication of web users participating in the Internet information processes (based on features of online texts.In digital forensics web user identification based on various linguistic features can be used to discover identity of individuals, criminals or terrorists using the Internet to commit cybercrimes. Internet could be used as a tool in different types of cybercrimes (fraud and identity theft, harassment and anonymous threats, terrorist or extremist statements, distribution of illegal content and information warfare. Linguistic identification of web users is a kind of biometric identification, it can be used to narrow down the suspects, identify a criminal and prosecute him. Feature set includes various linguistic and stylistic features extracted from online texts. We propose dynamic feature selection for each web user identification task. Selection is based on calculating Manhattan distance to k-nearest neighbors (Relief-f algorithm. This approach improves the identification accuracy and minimizes the number of features. Experiments were carried out on several datasets with different level of class imbalance. Experiment results showed that features relevance varies in different set of web users (probable authors of some text; features selection for each set of web users improves identification accuracy by 4% at the average that is approximately 1% higher than with the use of static set of features. The proposed approach is most effective for a small number of training samples (messages per user.

  15. Identifying and Managing Risk.

    Science.gov (United States)

    Abraham, Janice M.

    1999-01-01

    The role of the college or university chief financial officer in institutional risk management is (1) to identify risk (physical, casualty, fiscal, business, reputational, workplace safety, legal liability, employment practices, general liability), (2) to develop a campus plan to reduce and control risk, (3) to transfer risk, and (4) to track and…

  16. Mobile personal health records: an evaluation of features and functionality.

    Science.gov (United States)

    Kharrazi, Hadi; Chisholm, Robin; VanNasdale, Dean; Thompson, Benjamin

    2012-09-01

    To evaluate stand-alone mobile personal health record (mPHR) applications for the three leading cellular phone platforms (iOS, BlackBerry, and Android), assessing each for content, function, security, and marketing characteristics. Nineteen stand-alone mPHR applications (8 for iOS, 5 for BlackBerry, and 6 for Android) were identified and evaluated. Main criteria used to include mPHRs were: operating standalone on a mobile platform; not requiring external connectivity; and covering a wide range of health topics. Selected mPHRs were analyzed considering product characteristics, data elements, and application features. We also reviewed additional features such as marketing tactics. Within and between the different mobile platforms attributes for the mPHR were highly variable. None of the mPHRs contained all attributes included in our evaluation. The top four mPHRs contained 13 of the 14 features omitting only the in-case-of emergency feature. Surprisingly, seven mPHRs lacked basic security measures as important as password protection. The mPHRs were relatively inexpensive: ranging from no cost to $9.99. The mPHR application cost varied in some instances based on whether it supported single or multiple users. Ten mPHRs supported multiple user profiles. Notably, eight mPHRs used scare tactics as marketing strategy. mPHR is an emerging health care technology. The majority of existing mPHR apps is limited by at least one of the attributes considered for this study; however, as the mobile market continues to expand it is likely that more comprehensive mPHRs will be developed in the near future. New advancements in mobile technology can be utilized to enhance mPHRs by long-term patient empowerment features. Marketing strategies for mPHRs should target specific subpopulations and avoid scare tactics. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  17. A prototype feature system for feature retrieval using relationships

    Science.gov (United States)

    Choi, J.; Usery, E.L.

    2009-01-01

    Using a feature data model, geographic phenomena can be represented effectively by integrating space, theme, and time. This paper extends and implements a feature data model that supports query and visualization of geographic features using their non-spatial and temporal relationships. A prototype feature-oriented geographic information system (FOGIS) is then developed and storage of features named Feature Database is designed. Buildings from the U.S. Marine Corps Base, Camp Lejeune, North Carolina and subways in Chicago, Illinois are used to test the developed system. The results of the applications show the strength of the feature data model and the developed system 'FOGIS' when they utilize non-spatial and temporal relationships in order to retrieve and visualize individual features.

  18. Optimized feature subsets for epileptic seizure prediction studies.

    Science.gov (United States)

    Direito, Bruno; Ventura, Francisco; Teixeira, César; Dourado, António

    2011-01-01

    The reduction of the number of EEG features to give as inputs to epilepsy seizure predictors is a needed step towards the development of a transportable device for real-time warning. This paper presents a comparative study of three feature selection methods, based on Support Vector Machines. Minimum-Redundancy Maximum-Relevance, Recursive Feature Elimination, Genetic Algorithms, show that, for three patients of the European Database on Epilepsy, the most important univariate features are related to spectral information and statistical moments.

  19. Distributed Persistent Identifiers System Design

    Directory of Open Access Journals (Sweden)

    Pavel Golodoniuc

    2017-06-01

    Full Text Available The need to identify both digital and physical objects is ubiquitous in our society. Past and present persistent identifier (PID systems, of which there is a great variety in terms of technical and social implementation, have evolved with the advent of the Internet, which has allowed for globally unique and globally resolvable identifiers. PID systems have, by in large, catered for identifier uniqueness, integrity, and persistence, regardless of the identifier’s application domain. Trustworthiness of these systems has been measured by the criteria first defined by Bütikofer (2009 and further elaborated by Golodoniuc 'et al'. (2016 and Car 'et al'. (2017. Since many PID systems have been largely conceived and developed by a single organisation they faced challenges for widespread adoption and, most importantly, the ability to survive change of technology. We believe that a cause of PID systems that were once successful fading away is the centralisation of support infrastructure – both organisational and computing and data storage systems. In this paper, we propose a PID system design that implements the pillars of a trustworthy system – ensuring identifiers’ independence of any particular technology or organisation, implementation of core PID system functions, separation from data delivery, and enabling the system to adapt for future change. We propose decentralisation at all levels — persistent identifiers and information objects registration, resolution, and data delivery — using Distributed Hash Tables and traditional peer-to-peer networks with information replication and caching mechanisms, thus eliminating the need for a central PID data store. This will increase overall system fault tolerance thus ensuring its trustworthiness. We also discuss important aspects of the distributed system’s governance, such as the notion of the authoritative source and data integrity

  20. Naive Bayes-Guided Bat Algorithm for Feature Selection

    Directory of Open Access Journals (Sweden)

    Ahmed Majid Taha

    2013-01-01

    Full Text Available When the amount of data and information is said to double in every 20 months or so, feature selection has become highly important and beneficial. Further improvements in feature selection will positively affect a wide array of applications in fields such as pattern recognition, machine learning, or signal processing. Bio-inspired method called Bat Algorithm hybridized with a Naive Bayes classifier has been presented in this work. The performance of the proposed feature selection algorithm was investigated using twelve benchmark datasets from different domains and was compared to three other well-known feature selection algorithms. Discussion focused on four perspectives: number of features, classification accuracy, stability, and feature generalization. The results showed that BANB significantly outperformed other algorithms in selecting lower number of features, hence removing irrelevant, redundant, or noisy features while maintaining the classification accuracy. BANB is also proven to be more stable than other methods and is capable of producing more general feature subsets.

  1. Naive Bayes-Guided Bat Algorithm for Feature Selection

    Science.gov (United States)

    Taha, Ahmed Majid; Mustapha, Aida; Chen, Soong-Der

    2013-01-01

    When the amount of data and information is said to double in every 20 months or so, feature selection has become highly important and beneficial. Further improvements in feature selection will positively affect a wide array of applications in fields such as pattern recognition, machine learning, or signal processing. Bio-inspired method called Bat Algorithm hybridized with a Naive Bayes classifier has been presented in this work. The performance of the proposed feature selection algorithm was investigated using twelve benchmark datasets from different domains and was compared to three other well-known feature selection algorithms. Discussion focused on four perspectives: number of features, classification accuracy, stability, and feature generalization. The results showed that BANB significantly outperformed other algorithms in selecting lower number of features, hence removing irrelevant, redundant, or noisy features while maintaining the classification accuracy. BANB is also proven to be more stable than other methods and is capable of producing more general feature subsets. PMID:24396295

  2. Microhabitat features influencing habitat use by Florida black bears

    Directory of Open Access Journals (Sweden)

    Dana L. Karelus

    2018-01-01

    Full Text Available Understanding fine-scale habitat needs of species and the factors influencing heterogeneous use of habitat within home range would help identify limiting resources and inform habitat management practices. This information is especially important for large mammals living in fragmented habitats where resources may be scarcer and more patchily distributed than in contiguous habitats. Using bihourly Global Position System (GPS location data collected from 10 individuals during 2011–2014, we investigated microhabitat features of areas within home ranges that received high vs. low intensity of use by Florida black bears (Ursus americanus floridanus in north-central, Florida. We identified areas receiving high and low levels of use by bears based on their utilization distributions estimated with the dynamic Brownian bridge movement model, and performed vegetation sampling at bear locations within high- and low-use areas. Using univariate analyses and generalized linear mixed models, we found that (1 canopy cover, visual obstruction, and hardwood density were important in defining high-use sites; (2 the probability of high use was positively associated with principal components that represented habitat closer to creeks and with high canopy and shrub cover and higher hardwood densities, likely characteristic of forested wetlands; and (3 the probability of high use was, to a lesser extent, associated with principal components that represented habitat with high canopy cover, high pine density, and low visual obstruction and hardwood density; likely representing sand pine and pine plantations. Our results indicate that the high bear-use sites were in forested wetlands, where cover and food resources for bears are likely to occur in higher abundance. Habitat management plans whereby bears are a focal species should aim to increase the availability and quality of forested wetlands. Keywords: Habitat selection, Heterogeneous habitat use, Forest management

  3. [Feature extraction for breast cancer data based on geometric algebra theory and feature selection using differential evolution].

    Science.gov (United States)

    Li, Jing; Hong, Wenxue

    2014-12-01

    The feature extraction and feature selection are the important issues in pattern recognition. Based on the geometric algebra representation of vector, a new feature extraction method using blade coefficient of geometric algebra was proposed in this study. At the same time, an improved differential evolution (DE) feature selection method was proposed to solve the elevated high dimension issue. The simple linear discriminant analysis was used as the classifier. The result of the 10-fold cross-validation (10 CV) classification of public breast cancer biomedical dataset was more than 96% and proved superior to that of the original features and traditional feature extraction method.

  4. Feature Set Evaluation for Offline Handwriting Recognition Systems: Application to the Recurrent Neural Network Model.

    Science.gov (United States)

    Chherawala, Youssouf; Roy, Partha Pratim; Cheriet, Mohamed

    2016-12-01

    The performance of handwriting recognition systems is dependent on the features extracted from the word image. A large body of features exists in the literature, but no method has yet been proposed to identify the most promising of these, other than a straightforward comparison based on the recognition rate. In this paper, we propose a framework for feature set evaluation based on a collaborative setting. We use a weighted vote combination of recurrent neural network (RNN) classifiers, each trained with a particular feature set. This combination is modeled in a probabilistic framework as a mixture model and two methods for weight estimation are described. The main contribution of this paper is to quantify the importance of feature sets through the combination weights, which reflect their strength and complementarity. We chose the RNN classifier because of its state-of-the-art performance. Also, we provide the first feature set benchmark for this classifier. We evaluated several feature sets on the IFN/ENIT and RIMES databases of Arabic and Latin script, respectively. The resulting combination model is competitive with state-of-the-art systems.

  5. Facial expression identification using 3D geometric features from Microsoft Kinect device

    Science.gov (United States)

    Han, Dongxu; Al Jawad, Naseer; Du, Hongbo

    2016-05-01

    Facial expression identification is an important part of face recognition and closely related to emotion detection from face images. Various solutions have been proposed in the past using different types of cameras and features. Microsoft Kinect device has been widely used for multimedia interactions. More recently, the device has been increasingly deployed for supporting scientific investigations. This paper explores the effectiveness of using the device in identifying emotional facial expressions such as surprise, smile, sad, etc. and evaluates the usefulness of 3D data points on a face mesh structure obtained from the Kinect device. We present a distance-based geometric feature component that is derived from the distances between points on the face mesh and selected reference points in a single frame. The feature components extracted across a sequence of frames starting and ending by neutral emotion represent a whole expression. The feature vector eliminates the need for complex face orientation correction, simplifying the feature extraction process and making it more efficient. We applied the kNN classifier that exploits a feature component based similarity measure following the principle of dynamic time warping to determine the closest neighbors. Preliminary tests on a small scale database of different facial expressions show promises of the newly developed features and the usefulness of the Kinect device in facial expression identification.

  6. A statistical-textural-features based approach for classification of solid drugs using surface microscopic images.

    Science.gov (United States)

    Tahir, Fahima; Fahiem, Muhammad Abuzar

    2014-01-01

    The quality of pharmaceutical products plays an important role in pharmaceutical industry as well as in our lives. Usage of defective tablets can be harmful for patients. In this research we proposed a nondestructive method to identify defective and nondefective tablets using their surface morphology. Three different environmental factors temperature, humidity and moisture are analyzed to evaluate the performance of the proposed method. Multiple textural features are extracted from the surface of the defective and nondefective tablets. These textural features are gray level cooccurrence matrix, run length matrix, histogram, autoregressive model and HAAR wavelet. Total textural features extracted from images are 281. We performed an analysis on all those 281, top 15, and top 2 features. Top 15 features are extracted using three different feature reduction techniques: chi-square, gain ratio and relief-F. In this research we have used three different classifiers: support vector machine, K-nearest neighbors and naïve Bayes to calculate the accuracies against proposed method using two experiments, that is, leave-one-out cross-validation technique and train test models. We tested each classifier against all selected features and then performed the comparison of their results. The experimental work resulted in that in most of the cases SVM performed better than the other two classifiers.

  7. Intelligent Fault Diagnosis of HVCB with Feature Space Optimization-Based Random Forest.

    Science.gov (United States)

    Ma, Suliang; Chen, Mingxuan; Wu, Jianwen; Wang, Yuhao; Jia, Bowen; Jiang, Yuan

    2018-04-16

    Mechanical faults of high-voltage circuit breakers (HVCBs) always happen over long-term operation, so extracting the fault features and identifying the fault type have become a key issue for ensuring the security and reliability of power supply. Based on wavelet packet decomposition technology and random forest algorithm, an effective identification system was developed in this paper. First, compared with the incomplete description of Shannon entropy, the wavelet packet time-frequency energy rate (WTFER) was adopted as the input vector for the classifier model in the feature selection procedure. Then, a random forest classifier was used to diagnose the HVCB fault, assess the importance of the feature variable and optimize the feature space. Finally, the approach was verified based on actual HVCB vibration signals by considering six typical fault classes. The comparative experiment results show that the classification accuracy of the proposed method with the origin feature space reached 93.33% and reached up to 95.56% with optimized input feature vector of classifier. This indicates that feature optimization procedure is successful, and the proposed diagnosis algorithm has higher efficiency and robustness than traditional methods.

  8. Why replication is important in landscape genetics: American black bear in the Rocky Mountains

    Science.gov (United States)

    Short, Bull R.A.; Cushman, S.A.; MacE, R.; Chilton, T.; Kendall, K.C.; Landguth, E.L.; Schwartz, Maurice L.; McKelvey, K.; Allendorf, F.W.; Luikart, G.

    2011-01-01

    We investigated how landscape features influence gene flow of black bears by testing the relative support for 36 alternative landscape resistance hypotheses, including isolation by distance (IBD) in each of 12 study areas in the north central U.S. Rocky Mountains. The study areas all contained the same basic elements, but differed in extent of forest fragmentation, altitude, variation in elevation and road coverage. In all but one of the study areas, isolation by landscape resistance was more supported than IBD suggesting gene flow is likely influenced by elevation, forest cover, and roads. However, the landscape features influencing gene flow varied among study areas. Using subsets of loci usually gave models with the very similar landscape features influencing gene flow as with all loci, suggesting the landscape features influencing gene flow were correctly identified. To test if the cause of the variability of supported landscape features in study areas resulted from landscape differences among study areas, we conducted a limiting factor analysis. We found that features were supported in landscape models only when the features were highly variable. This is perhaps not surprising but suggests an important cautionary note – that if landscape features are not found to influence gene flow, researchers should not automatically conclude that the features are unimportant to the species’ movement and gene flow. Failure to investigate multiple study areas that have a range of variability in landscape features could cause misleading inferences about which landscape features generally limit gene flow. This could lead to potentially erroneous identification of corridors and barriers if models are transferred between areas with different landscape characteristics.

  9. Depth estimation of features in video frames with improved feature matching technique using Kinect sensor

    Science.gov (United States)

    Sharma, Kajal; Moon, Inkyu; Kim, Sung Gaun

    2012-10-01

    Estimating depth has long been a major issue in the field of computer vision and robotics. The Kinect sensor's active sensing strategy provides high-frame-rate depth maps and can recognize user gestures and human pose. This paper presents a technique to estimate the depth of features extracted from video frames, along with an improved feature-matching method. In this paper, we used the Kinect camera developed by Microsoft, which captured color and depth images for further processing. Feature detection and selection is an important task for robot navigation. Many feature-matching techniques have been proposed earlier, and this paper proposes an improved feature matching between successive video frames with the use of neural network methodology in order to reduce the computation time of feature matching. The features extracted are invariant to image scale and rotation, and different experiments were conducted to evaluate the performance of feature matching between successive video frames. The extracted features are assigned distance based on the Kinect technology that can be used by the robot in order to determine the path of navigation, along with obstacle detection applications.

  10. Internally readable identifying tag

    International Nuclear Information System (INIS)

    Jefferts, K.B.; Jefferts, E.R.

    1980-01-01

    A method of identifying non-metallic objects by means of X-ray equipment is described in detail. A small metal pin with a number of grooves cut in a pre-determined equi-spaced pattern is implanted into the non-metallic object and by decoding the groove patterns using X-ray equipment, the object is uniquely identified. A specific example of such an application is in studying the migratory habits of fish. The pin inserted into the snout of the fish is 0.010 inch in diameter, 0.040 inch in length with 8 possible positions for grooves if spaced 0.005 inch apart. With 6 of the groove positions available for data, the capacity is 2 6 or 64 combinations; clearly longer pins would increase the data capacity. This method of identification is a major advance over previous techniques which necessitated destruction of the fish in order to recover the identification tag. (UK)

  11. Localized scleroderma: imaging features

    International Nuclear Information System (INIS)

    Liu, P.; Uziel, Y.; Chuang, S.; Silverman, E.; Krafchik, B.; Laxer, R.

    1994-01-01

    Localized scleroderma is distinct from the diffuse form of scleroderma and does not show Raynaud's phenomenon and visceral involvement. The imaging features in 23 patients ranging from 2 to 17 years of age (mean 11.1 years) were reviewed. Leg length discrepancy and muscle atrophy were the most common findings (five patients), with two patients also showing modelling deformity of the fibula. One patient with lower extremity involvement showed abnormal bone marrow signals on MR. Disabling joint contracture requiring orthopedic intervention was noted in one patient. In two patients with ''en coup de sabre'' facial deformity, CT and MR scans revealed intracranial calcifications and white matter abnormality in the ipsilateral frontal lobes, with one also showing migrational abnormality. In a third patient, CT revealed white matter abnormality in the ipsilateral parietal lobe. In one patient with progressive facial hemiatrophy, CT and MR scans showed the underlying hypoplastic left maxillary antrum and cheek. Imaging studies of areas of clinical concern revealed positive findings in half our patients. (orig.)

  12. Localized scleroderma: imaging features

    Energy Technology Data Exchange (ETDEWEB)

    Liu, P. (Dept. of Diagnostic Imaging, Hospital for Sick Children, Toronto, ON (Canada)); Uziel, Y. (Div. of Rheumatology, Hospital for Sick Children, Toronto, ON (Canada)); Chuang, S. (Dept. of Diagnostic Imaging, Hospital for Sick Children, Toronto, ON (Canada)); Silverman, E. (Div. of Rheumatology, Hospital for Sick Children, Toronto, ON (Canada)); Krafchik, B. (Div. of Dermatology, Dept. of Pediatrics, Hospital for Sick Children, Toronto, ON (Canada)); Laxer, R. (Div. of Rheumatology, Hospital for Sick Children, Toronto, ON (Canada))

    1994-06-01

    Localized scleroderma is distinct from the diffuse form of scleroderma and does not show Raynaud's phenomenon and visceral involvement. The imaging features in 23 patients ranging from 2 to 17 years of age (mean 11.1 years) were reviewed. Leg length discrepancy and muscle atrophy were the most common findings (five patients), with two patients also showing modelling deformity of the fibula. One patient with lower extremity involvement showed abnormal bone marrow signals on MR. Disabling joint contracture requiring orthopedic intervention was noted in one patient. In two patients with ''en coup de sabre'' facial deformity, CT and MR scans revealed intracranial calcifications and white matter abnormality in the ipsilateral frontal lobes, with one also showing migrational abnormality. In a third patient, CT revealed white matter abnormality in the ipsilateral parietal lobe. In one patient with progressive facial hemiatrophy, CT and MR scans showed the underlying hypoplastic left maxillary antrum and cheek. Imaging studies of areas of clinical concern revealed positive findings in half our patients. (orig.)

  13. Identifying Breast Cancer Oncogenes

    Science.gov (United States)

    2010-10-01

    tyrosine kinases with an SH3, SH2 and catalytic domain, it lacks a native myristylation signal shared by most members of this class [14], [38]. The...therapeutics and consequently, improve clinical outcomes. We aim to identify novel drivers of breast oncogenesis. We hypothesize that a kinase gain-of...human mammary epithelial cells. A pBabe-Puro-Myr-Flag kinase open reading frame (ORF) library was screened in immortalized human mammary epithelial

  14. Rock disposal problems identified

    Energy Technology Data Exchange (ETDEWEB)

    Knox, R

    1978-06-01

    Mathematical models are the only way of examining the return of radioactivity from nuclear waste to the environment over long periods of time. Work in Britain has helped identify areas where more basic data is required, but initial results look very promising for final disposal of high level waste in hard rock repositories. A report by the National Radiological Protection Board of a recent study, is examined.

  15. Feature-based attentional modulation increases with stimulus separation in divided-attention tasks.

    Science.gov (United States)

    Sally, Sharon L; Vidnyánsky, Zoltán; Papathomas, Thomas V

    2009-01-01

    Attention modifies our visual experience by selecting certain aspects of a scene for further processing. It is therefore important to understand factors that govern the deployment of selective attention over the visual field. Both location and feature-specific mechanisms of attention have been identified and their modulatory effects can interact at a neural level (Treue and Martinez-Trujillo, 1999). The effects of spatial parameters on feature-based attentional modulation were examined for the feature dimensions of orientation, motion and color using three divided-attention tasks. Subjects performed concurrent discriminations of two briefly presented targets (Gabor patches) to the left and right of a central fixation point at eccentricities of +/-2.5 degrees , 5 degrees , 10 degrees and 15 degrees in the horizontal plane. Gabors were size-scaled to maintain consistent single-task performance across eccentricities. For all feature dimensions, the data show a linear increase in the attentional effects with target separation. In a control experiment, Gabors were presented on an isoeccentric viewing arc at 10 degrees and 15 degrees at the closest spatial separation (+/-2.5 degrees ) of the main experiment. Under these conditions, the effects of feature-based attentional effects were largely eliminated. Our results are consistent with the hypothesis that feature-based attention prioritizes the processing of attended features. Feature-based attentional mechanisms may have helped direct the attentional focus to the appropriate target locations at greater separations, whereas similar assistance may not have been necessary at closer target spacings. The results of the present study specify conditions under which dual-task performance benefits from sharing similar target features and may therefore help elucidate the processes by which feature-based attention operates.

  16. Classifying web pages with visual features

    NARCIS (Netherlands)

    de Boer, V.; van Someren, M.; Lupascu, T.; Filipe, J.; Cordeiro, J.

    2010-01-01

    To automatically classify and process web pages, current systems use the textual content of those pages, including both the displayed content and the underlying (HTML) code. However, a very important feature of a web page is its visual appearance. In this paper, we show that using generic visual

  17. Feature extraction for dynamic integration of classifiers

    NARCIS (Netherlands)

    Pechenizkiy, M.; Tsymbal, A.; Puuronen, S.; Patterson, D.W.

    2007-01-01

    Recent research has shown the integration of multiple classifiers to be one of the most important directions in machine learning and data mining. In this paper, we present an algorithm for the dynamic integration of classifiers in the space of extracted features (FEDIC). It is based on the technique

  18. Currency features for visually impaired people

    Science.gov (United States)

    Hyland, Sandra L.; Legge, Gordon E.; Shannon, Robert R.; Baer, Norbert S.

    1996-03-01

    The estimated 3.7 million Americans with low vision experience a uniquely difficult task in identifying the denominations of U.S. banknotes because the notes are remarkably uniform in size, color, and general design. The National Research Council's Committee on Currency Features Usable by the Visually Impaired assessed features that could be used by people who are visually disabled to distinguish currency from other documents and to denominate and authenticate banknotes using available technology. Variation of length and height, introduction of large numerals on a uniform, high-contrast background, use of different colors for each of the six denominations printed, and the introduction of overt denomination codes that could lead to development of effective, low-cost devices for examining banknotes were all deemed features available now. Issues affecting performance, including the science of visual and tactile perception, were addressed for these features, as well as for those features requiring additional research and development. In this group the committee included durable tactile features such as those printed with transparent ink, and the production of currency with holes to indicate denomination. Among long-range approaches considered were the development of technologically advanced devices and smart money.

  19. Internet marketing global features

    Directory of Open Access Journals (Sweden)

    Rakita Branko

    2005-01-01

    Full Text Available Business environment incessantly bringing a yard of a new challenges to market entities. One of the greatest challenges that companies faced during the last couple of decades was development of information systems as well as a large scale usage of world's greatest computer network - Internet - no matter how big they were or what their activities included. There are many papers about Internet, its development, social and economic significance. However, there is no paper or article written by a local author that systematically and thoroughly treats marketing importance of Internet. This paper presents potentials and business importance of internet marketing in new millennium. It considers internet as a communication, trade and distribution channel. In addition, the paper highlights research potentials of Internet.

  20. Large datasets: Segmentation, feature extraction, and compression

    Energy Technology Data Exchange (ETDEWEB)

    Downing, D.J.; Fedorov, V.; Lawkins, W.F.; Morris, M.D.; Ostrouchov, G.

    1996-07-01

    Large data sets with more than several mission multivariate observations (tens of megabytes or gigabytes of stored information) are difficult or impossible to analyze with traditional software. The amount of output which must be scanned quickly dilutes the ability of the investigator to confidently identify all the meaningful patterns and trends which may be present. The purpose of this project is to develop both a theoretical foundation and a collection of tools for automated feature extraction that can be easily customized to specific applications. Cluster analysis techniques are applied as a final step in the feature extraction process, which helps make data surveying simple and effective.

  1. CONSIDERATIONS ABOUT THE ESSENTIAL FEATURES OF INNOVATION

    Directory of Open Access Journals (Sweden)

    Geanina S. BANU

    2014-11-01

    Full Text Available Defining and classifying innovation represents a complex approach both theoretical and practical. While comprising various views, the innovation concept is permanently redefined according to various criteria. Nevertheless, approaching innovation generic features should be always considered as defining the core of innovation as a concept. The aim of the present paper is to perform a literature review identifying the essential features of innovation with the aim of providing a comprehensive and holistic view of the concept. Furthermore, the present article aims at delivering a theoretical guide on innovation. To this end, the review comprises definition of concept, classification, risk factors, innovation systems and measuring indicators.

  2. Mummified trophy heads from Peru: diagnostic features and medicolegal significance.

    Science.gov (United States)

    Verano, John W

    2003-05-01

    Several forms of mummified human trophy heads were produced by prehistoric and historic native groups in South America. This paper describes the diagnostic features of trophy heads produced by the Nasca culture of ancient Peru. A growing interest in these mummified heads among collectors of Pre-Columbian art and antiquities has led to their illegal exportation from Peru, in violation of national and international antiquities laws. Requests from the Peruvian government to protect its cultural patrimony led the United States in 1997 to declare these heads as items subject to U.S. import restriction, along with six other categories of human remains. Despite such restrictions, Nasca trophy heads continue to reach private collectors outside of Peru and thus may be encountered by local, state, or federal law enforcement officials unfamiliar with their characteristic features and origin. The objective of this paper is to describe the features that allow Nasca trophy heads to be identified and distinguished from other archaeological and forensic specimens that may be submitted to a forensic anthropologist for identification.

  3. Feature Inference Learning and Eyetracking

    Science.gov (United States)

    Rehder, Bob; Colner, Robert M.; Hoffman, Aaron B.

    2009-01-01

    Besides traditional supervised classification learning, people can learn categories by inferring the missing features of category members. It has been proposed that feature inference learning promotes learning a category's internal structure (e.g., its typical features and interfeature correlations) whereas classification promotes the learning of…

  4. Pharmacological features of osthole

    Directory of Open Access Journals (Sweden)

    Agata Jarząb

    2017-05-01

    Full Text Available Coumarins are a group of naturally occurring compounds common in the plant world. These substances and their derivatives exhibit a broad range of biological activities.One of the naturally occurring coumarins is osthole, which can most frequently be found in plants of the Apiaceae family. Cnidium monnieri (L. Cusson ex Juss. Angelica pubescens Maxim. and Peucedanum ostruthium (L.. It has anti-proliferative, anti-inflammatory, anti-convulsant, and antiallergic properties; apart from that, inhibition of platelet aggregation has also been proved. The impact of osthole on bone metabolism has been demonstrated; also its hepatoprotective and neuroprotective properties have been confirmed. The inhibitory effect of this metokcompound on the development of neurodegenerative diseases has been proved in experimental models. Anticancer features of osthole have been also demonstrated both in vitro on different cell lines, and in vivo using animals xenografts. Osthole inhibited proliferation, motility and invasiveness of tumor cells, which may be associated with the induction of apoptosis and cell cycle slowdown. The exact molecular mechanism of osthole anti-cancer mode of action has not been fully elucidated. A synergistic effect of osthole with other anti-tumor substances has been also reported. Modification of its chemical structure led to the synthesis of many derivatives with significant anticancer effects.To sum up, osthole is an interesting therapeutic option, due to both its direct effect on tumor cells, as well as its neuroprotective or anti-inflammatory properties. Thus, there is a chance to use osthole or its synthetic derivatives in the treatment of cancer.

  5. Slim Battery Modelling Features

    Science.gov (United States)

    Borthomieu, Y.; Prevot, D.

    2011-10-01

    Saft has developed a life prediction model for VES and MPS cells and batteries. The Saft Li-ion Model (SLIM) is a macroscopic electrochemical model based on energy (global at cell level). The main purpose is to predict the battery performances during the life for GEO, MEO and LEO missions. This model is based on electrochemical characteristics such as Energy, Capacity, EMF, Internal resistance, end of charge voltage. It uses fading and calendar law effects on energy and internal impedance vs. time, temperature, End of Charge voltage. Based on the mission profile, satellite power system characteristics, the model proposes the various battery configurations. For each configuration, the model gives the battery performances using mission figures and profiles: power, duration, DOD, end of charge voltages, temperatures during eclipses and solstices, thermal dissipations and cell failures. For the GEO/MEO missions, eclipse and solstice periods can include specific profile such as plasmic propulsion fires and specific balancing operations. For LEO missions, the model is able to simulate high power peaks to predict radar pulses. Saft's main customers have been using the SLIM model available in house for two years. The purpose is to have the satellite builder power engineers able to perform by themselves in the battery pre-dimensioning activities their own battery simulations. The simulations can be shared with Saft engineers to refine the power system designs. This model has been correlated with existing life and calendar tests performed on all the VES and MPS cells. In comparing with more than 10 year lasting life tests, the accuracy of the model from a voltage point of view is less than 10 mV at end Of Life. In addition, thethe comparison with in-orbit data has been also done. b This paper will present the main features of the SLIM software and outputs comparison with real life tests. b0

  6. ORCID: Author Identifiers for Librarians

    Directory of Open Access Journals (Sweden)

    Robyn B. Reed

    2017-10-01

    Full Text Available Generating accurate publication lists by researchers can be challenging when faced with scholars who have common names or who have published under name variations. This article describes ORCID and the goal of generating author identifiers for scholars to connect their research outputs. Included are the reasons for having author identifiers as well as the types of information within individual profiles. This article includes information on how academic libraries are playing a role with ORCID initiatives as well as describing how publishers, institutions, and funders are employing ORCID in their workflows. Highlighted is material on academic institutions in Pennsylvania using ORCID. The purpose of the article is to provide an overview of ORCID and its uses to inform librarians about this important initiative.

  7. Identifying phenomenal consciousness.

    Science.gov (United States)

    Schier, Elizabeth

    2009-03-01

    This paper examines the possibility of finding evidence that phenomenal consciousness is independent of access. The suggestion reviewed is that we should look for isomorphisms between phenomenal and neural activation spaces. It is argued that the fact that phenomenal spaces are mapped via verbal report is no problem for this methodology. The fact that activation and phenomenal space are mapped via different means does not mean that they cannot be identified. The paper finishes by examining how data addressing this theoretical question could be obtained.

  8. Are All Pixels Equally Important?

    CERN Multimedia

    CERN. Geneva

    2015-01-01

    When we look at our environment, we primarily pay attention to visually distinctive objects. We refer to these objects as visually important or salient. For efficient visual processing, the human visual system identifies salients objects and dedicates most of its processing resources to them. An analogous resource allocation can be performed by salient-object detection algorithms, which identify objects of interest in an image. Consequently, thanks to salient-object detection, complex visual computing operations can focus on the important parts of the visual data and can save time and resources. About the speaker Dr. Gokhan Yildirim is a research assistant in the School of Computer and Communication Sciences (IC) at the École Polytechnique Fédérale de Lausanne (EPFL). His research interests include image understanding, multimedia, pattern recognition, machine learning, salient-object detection on images & videos and its applications on image proces...

  9. Special feature - Gas

    International Nuclear Information System (INIS)

    Cope, David.

    1995-01-01

    In an introduction to a series of articles about the United Kingdom gas industry, the author criticises Government policy as being too full of assertions, yet lacking in substance. Despite agreeing with the proposition that free markets lead to the best allocation of resources and the best deal for consumers, the author argues that evidence for such assertions must be made public if citizens are to have any confidence in them. It is claimed that gas should be the subject of a Review, such as the coal and nuclear industries have recently undergone, in order to demonstrate its central importance to the United Kingdom power supply. (UK)

  10. ECOPHARMACOVIGILANCE: ITS IMPORTANCE AND CHALLENGES

    OpenAIRE

    Dr. Bhavana Srivastava

    2014-01-01

    Active pharmaceutical ingredients represent a group of emerging environmental contamination. Even in trace amounts, they are of great concern due to then continuous introduction into the environment, their impact an ecosystem and human and vetenery health is of great importance. This has given birth to the science of Ecopharmacovigilance (EPV). It aims to ensure that significant environmental issues associated with pharmaceuticals in the environment are identified and managed appropriately. ...

  11. Features of multifinality.

    Science.gov (United States)

    Kruglanski, Arie W; Köpetz, Catalina; Bélanger, Jocelyn J; Chun, Woo Young; Orehek, Edward; Fishbach, Ayelet

    2013-02-01

    Diverse facets of the multifinality configuration in goal-directed behavior are identified and empirically explored. The multifinality construct denotes a motivational structure wherein a single means is linked to several ends. A multifinality configuration maximizes value that a given means promises to deliver while sacrificing expectancy of attainment due to a dilution effect. Several phenomena implied by multifinality theory are investigated, including an unconscious quest for multifinal means, the constraints that such quest imposes on means to a focal goal, and structural conditions under which an activity may be experienced as intrinsically motivated. Multifinality phenomena appear in numerous domains of social cognition, and the present theory offers a novel perspective on classic motivational effects.

  12. Identifying Cancer Subtypes from miRNA-TF-mRNA Regulatory Networks and Expression Data.

    Directory of Open Access Journals (Sweden)

    Taosheng Xu

    Full Text Available Identifying cancer subtypes is an important component of the personalised medicine framework. An increasing number of computational methods have been developed to identify cancer subtypes. However, existing methods rarely use information from gene regulatory networks to facilitate the subtype identification. It is widely accepted that gene regulatory networks play crucial roles in understanding the mechanisms of diseases. Different cancer subtypes are likely caused by different regulatory mechanisms. Therefore, there are great opportunities for developing methods that can utilise network information in identifying cancer subtypes.In this paper, we propose a method, weighted similarity network fusion (WSNF, to utilise the information in the complex miRNA-TF-mRNA regulatory network in identifying cancer subtypes. We firstly build the regulatory network where the nodes represent the features, i.e. the microRNAs (miRNAs, transcription factors (TFs and messenger RNAs (mRNAs and the edges indicate the interactions between the features. The interactions are retrieved from various interatomic databases. We then use the network information and the expression data of the miRNAs, TFs and mRNAs to calculate the weight of the features, representing the level of importance of the features. The feature weight is then integrated into a network fusion approach to cluster the samples (patients and thus to identify cancer subtypes. We applied our method to the TCGA breast invasive carcinoma (BRCA and glioblastoma multiforme (GBM datasets. The experimental results show that WSNF performs better than the other commonly used computational methods, and the information from miRNA-TF-mRNA regulatory network contributes to the performance improvement. The WSNF method successfully identified five breast cancer subtypes and three GBM subtypes which show significantly different survival patterns. We observed that the expression patterns of the features in some mi

  13. The importance of coughs

    African Journals Online (AJOL)

    2012-03-14

    Mar 14, 2012 ... how important it can be. It is at best ... e. rise of intrathoracic pressure up to 200mm Hg., f. glottic opening and ... The differential diagnosis may be reviewed from knowledge .... cigarette smoking is an important example. 3.

  14. Imaging features of foot osteoid osteoma

    Energy Technology Data Exchange (ETDEWEB)

    Shukla, Satyen; Clarke, Andrew W.; Saifuddin, Asif [Royal National Orthopaedic Hospital NHS Trust, Department of Radiology, Stanmore, Middlesex (United Kingdom)

    2010-07-15

    We performed a retrospective review of the imaging of nine patients with a diagnosis of foot osteoid osteoma (OO). Radiographs, computed tomography (CT) and magnetic resonance imaging (MRI) had been performed in all patients. Radiographic features evaluated were the identification of a nidus and cortical thickening. CT features noted were nidus location (affected bone - intramedullary, intracortical, subarticular) and nidus calcification. MRI features noted were the presence of an identifiable nidus, presence and grade of bone oedema and whether a joint effusion was identified. Of the nine patients, three were female and six male, with a mean age of 21 years (range 11-39 years). Classical symptoms of OO (night pain, relief with aspirin) were identified in five of eight (62.5%) cases (in one case, the medical records could not be retrieved). In five patients the lesion was located in the hindfoot (four calcaneus, one talus), while four were in the mid- or forefoot (two metatarsal and two phalangeal). Radiographs were normal in all patients with hindfoot OO. CT identified the nidus in all cases (89%) except one terminal phalanx lesion, while MRI demonstrated a nidus in six of nine cases (67%). The nidus was of predominantly intermediate signal intensity on T1-weighted (T1W) sequences, with intermediate to high signal intensity on T2-weighted (T2W) sequences. High-grade bone marrow oedema, limited to the affected bone and adjacent soft tissue oedema was identified in all cases. In a young patient with chronic hindfoot pain and a normal radiograph, MRI features suggestive of possible OO include extensive bone marrow oedema limited to one bone, with a possible nidus demonstrated in two-thirds of cases. The presence or absence of a nidus should be confirmed with high-resolution CT. (orig.)

  15. Fractal Complexity-Based Feature Extraction Algorithm of Communication Signals

    Science.gov (United States)

    Wang, Hui; Li, Jingchao; Guo, Lili; Dou, Zheng; Lin, Yun; Zhou, Ruolin

    How to analyze and identify the characteristics of radiation sources and estimate the threat level by means of detecting, intercepting and locating has been the central issue of electronic support in the electronic warfare, and communication signal recognition is one of the key points to solve this issue. Aiming at accurately extracting the individual characteristics of the radiation source for the increasingly complex communication electromagnetic environment, a novel feature extraction algorithm for individual characteristics of the communication radiation source based on the fractal complexity of the signal is proposed. According to the complexity of the received signal and the situation of environmental noise, use the fractal dimension characteristics of different complexity to depict the subtle characteristics of the signal to establish the characteristic database, and then identify different broadcasting station by gray relation theory system. The simulation results demonstrate that the algorithm can achieve recognition rate of 94% even in the environment with SNR of -10dB, and this provides an important theoretical basis for the accurate identification of the subtle features of the signal at low SNR in the field of information confrontation.

  16. Features of the Manufacturing Vision Development Process

    DEFF Research Database (Denmark)

    Dukovska-Popovska, Iskra; Riis, Jens Ove; Boer, Harry

    2005-01-01

    of action research. The methodology recommends wide participation of people from different hierarchical and functional positions, who engage in a relatively short, playful and creative process and come up with a vision (concept) for the future manufacturing system in the company. Based on three case studies......This paper discusses the key features of the process of Manufacturing Vision Development, a process that enables companies to develop their future manufacturing concept. The basis for the process is a generic five-phase methodology (Riis and Johansen, 2003) developed as a result of ten years...... of companies going through the initial phases of the methodology, this research identified the key features of the Manufacturing Vision Development process. The paper elaborates the key features by defining them, discussing how and when they can appear, and how they influence the process....

  17. MRI features of tuberculosis of peripheral joints

    Energy Technology Data Exchange (ETDEWEB)

    Sawlani, V.; Chandra, T.; Mishra, R.N.; Aggarwal, A.; Jain, U.K.; Gujral, R.B. E-mail: gujralrb@sgpgi.ac.in

    2003-10-01

    The aim of this article is to present the magnetic resonance imaging (MRI) features of peripheral tubercular arthritis. The clinical presentation of peripheral tubercular arthritis is variable and simulates other chronic inflammatory arthritic disorders. MRI is a highly sensitive technique which demonstrates fine anatomical details and identifies the early changes of arthritis, which are not visible on radiographs. The MRI features of tubercular arthritis include synovitis, effusion, central and peripheral erosions, active and chronic pannus, abscess, bone chips and hypo-intense synovium. These imaging features in an appropriate clinical setting may help in the diagnosis of tubercular arthritis. Early diagnosis and treatment can effectively eliminate the long-term morbidity of joints affected by tuberculosis.

  18. MRI features of tuberculosis of peripheral joints

    International Nuclear Information System (INIS)

    Sawlani, V.; Chandra, T.; Mishra, R.N.; Aggarwal, A.; Jain, U.K.; Gujral, R.B.

    2003-01-01

    The aim of this article is to present the magnetic resonance imaging (MRI) features of peripheral tubercular arthritis. The clinical presentation of peripheral tubercular arthritis is variable and simulates other chronic inflammatory arthritic disorders. MRI is a highly sensitive technique which demonstrates fine anatomical details and identifies the early changes of arthritis, which are not visible on radiographs. The MRI features of tubercular arthritis include synovitis, effusion, central and peripheral erosions, active and chronic pannus, abscess, bone chips and hypo-intense synovium. These imaging features in an appropriate clinical setting may help in the diagnosis of tubercular arthritis. Early diagnosis and treatment can effectively eliminate the long-term morbidity of joints affected by tuberculosis

  19. Including product features in process redesign

    DEFF Research Database (Denmark)

    Hvam, Lars; Hauksdóttir, Dagný; Mortensen, Niels Henrik

    2017-01-01

    do not take into account how the product features are applied throughout the process, which makes it difficult to obtain a comprehensive understanding of the activities in the processes and to generate significant improvements. The suggested approach models the product family using the so......This article suggests a visual modelling method for integrating models of product features with business process models for redesigning the business processes involving specifications of customer-tailored products and services. The current methods for redesigning these types of business processes......-called product variant master and the business process modelling notation for modelling the process flow. The product model is combined with the process map by identifying features used in each step of the process flow. Additionally, based on the information absorbed from the integrated model, the value stream...

  20. List identifies threatened ecosystems

    Science.gov (United States)

    Showstack, Randy

    2012-09-01

    The International Union for Conservation of Nature (IUCN) announced on 9 September that it will develop a new Red List of Ecosystems that will identify which ecosystems are vulnerable or endangered. The list, which is modeled on the group's Red List of Threatened Species™, could help to guide conservation activities and influence policy processes such as the Convention on Biological Diversity, according to the group. “We will assess the status of marine, terrestrial, freshwater, and subterranean ecosystems at local, regional, and global levels,” stated Jon Paul Rodriguez, leader of IUCN's Ecosystems Red List Thematic Group. “The assessment can then form the basis for concerted implementation action so that we can manage them sustainably if their risk of collapse is low or restore them if they are threatened and then monitor their recovery.”

  1. Global Microbial Identifier

    DEFF Research Database (Denmark)

    Wielinga, Peter; Hendriksen, Rene S.; Aarestrup, Frank Møller

    2017-01-01

    ) will likely also enable a much better understanding of the pathogenesis of the infection and the molecular basis of the host response to infection. But the full potential of these advances will only transpire if the data in this area become transferable and thereby comparable, preferably in open-source...... of microorganisms, for the identification of relevant genes and for the comparison of genomes to detect outbreaks and emerging pathogens. To harness the full potential of WGS, a shared global database of genomes linked to relevant metadata and the necessary software tools needs to be generated, hence the global...... microbial identifier (GMI) initiative. This tool will ideally be used in amongst others in the diagnosis of infectious diseases in humans and animals, in the identification of microorganisms in food and environment, and to track and trace microbial agents in all arenas globally. This will require...

  2. Fusing Facial Features for Face Recognition

    Directory of Open Access Journals (Sweden)

    Jamal Ahmad Dargham

    2012-06-01

    Full Text Available Face recognition is an important biometric method because of its potential applications in many fields, such as access control, surveillance, and human-computer interaction. In this paper, a face recognition system that fuses the outputs of three face recognition systems based on Gabor jets is presented. The first system uses the magnitude, the second uses the phase, and the third uses the phase-weighted magnitude of the jets. The jets are generated from facial landmarks selected using three selection methods. It was found out that fusing the facial features gives better recognition rate than either facial feature used individually regardless of the landmark selection method.

  3. Process Architecture for Managing Digital Object Identifiers

    Science.gov (United States)

    Wanchoo, L.; James, N.; Stolte, E.

    2014-12-01

    In 2010, NASA's Earth Science Data and Information System (ESDIS) Project implemented a process for registering Digital Object Identifiers (DOIs) for data products distributed by Earth Observing System Data and Information System (EOSDIS). For the first 3 years, ESDIS evolved the process involving the data provider community in the development of processes for creating and assigning DOIs, and guidelines for the landing page. To accomplish this, ESDIS established two DOI User Working Groups: one for reviewing the DOI process whose recommendations were submitted to ESDIS in February 2014; and the other recently tasked to review and further develop DOI landing page guidelines for ESDIS approval by end of 2014. ESDIS has recently upgraded the DOI system from a manually-driven system to one that largely automates the DOI process. The new automated feature include: a) reviewing the DOI metadata, b) assigning of opaque DOI name if data provider chooses, and c) reserving, registering, and updating the DOIs. The flexibility of reserving the DOI allows data providers to embed and test the DOI in the data product metadata before formally registering with EZID. The DOI update process allows the changing of any DOI metadata except the DOI name unless the name has not been registered. Currently, ESDIS has processed a total of 557 DOIs of which 379 DOIs are registered with EZID and 178 are reserved with ESDIS. The DOI incorporates several metadata elements that effectively identify the data product and the source of availability. Of these elements, the Uniform Resource Locator (URL) attribute has the very important function of identifying the landing page which describes the data product. ESDIS in consultation with data providers in the Earth Science community is currently developing landing page guidelines that specify the key data product descriptive elements to be included on each data product's landing page. This poster will describe in detail the unique automated process and

  4. Enhancing facial features by using clear facial features

    Science.gov (United States)

    Rofoo, Fanar Fareed Hanna

    2017-09-01

    The similarity of features between individuals of same ethnicity motivated the idea of this project. The idea of this project is to extract features of clear facial image and impose them on blurred facial image of same ethnic origin as an approach to enhance a blurred facial image. A database of clear images containing 30 individuals equally divided to five different ethnicities which were Arab, African, Chines, European and Indian. Software was built to perform pre-processing on images in order to align the features of clear and blurred images. And the idea was to extract features of clear facial image or template built from clear facial images using wavelet transformation to impose them on blurred image by using reverse wavelet. The results of this approach did not come well as all the features did not align together as in most cases the eyes were aligned but the nose or mouth were not aligned. Then we decided in the next approach to deal with features separately but in the result in some cases a blocky effect was present on features due to not having close matching features. In general the available small database did not help to achieve the goal results, because of the number of available individuals. The color information and features similarity could be more investigated to achieve better results by having larger database as well as improving the process of enhancement by the availability of closer matches in each ethnicity.

  5. Examining the design features of a communication-rich, problem-centred mathematics professional development

    Science.gov (United States)

    de Araujo, Zandra; Orrill, Chandra Hawley; Jacobson, Erik

    2018-04-01

    While there is considerable scholarship describing principles for effective professional development, there have been few attempts to examine these principles in practice. In this paper, we identify and examine the particular design features of a mathematics professional development experience provided for middle grades teachers over 14 weeks. The professional development was grounded in a set of mathematical tasks that each had one right answer, but multiple solution paths. The facilitator engaged participants in problem solving and encouraged participants to work collaboratively to explore different solution paths. Through analysis of this collaborative learning environment, we identified five design features for supporting teacher learning of important mathematics and pedagogy in a problem-solving setting. We discuss these design features in depth and illustrate them by presenting an elaborated example from the professional development. This study extends the existing guidance for the design of professional development by examining and operationalizing the relationships among research-based features of effective professional development and the enacted features of a particular design.

  6. Optimising import phytosanitary inspection

    NARCIS (Netherlands)

    Surkov, I.

    2007-01-01

    Keywords: quarantine pest, plant health policy, optimization, import phytosanitary inspection, ‘reduced checks’, optimal allocation of resources, multinomial logistic regression, the Netherlands World trade is a major vector of spread of quarantine plant pests. Border phytosanitary inspection

  7. Compressive behavior of pervious concretes and a quantification of the influence of random pore structure features

    International Nuclear Information System (INIS)

    Deo, Omkar; Neithalath, Narayanan

    2010-01-01

    Research highlights: → Identified the relevant pore structure features of pervious concretes, provided methodologies to extract those, and quantified the influence of these features on compressive response. → A model for stress-strain relationship of pervious concretes, and relationship between model parameters and parameters of the stress-strain relationship developed. → Statistical model for compressive strength as a function of pore structure features; and a stochastic model for the sensitivity of pore structure features in strength prediction. - Abstract: Properties of a random porous material such as pervious concrete are strongly dependent on its pore structure features, porosity being an important one among them. This study deals with developing an understanding of the material structure-compressive response relationships in pervious concretes. Several pervious concrete mixtures with different pore structure features are proportioned and subjected to static compression tests. The pore structure features such as pore area fractions, pore sizes, mean free spacing of the pores, specific surface area, and the three-dimensional pore distribution density are extracted using image analysis methods. The compressive stress-strain response of pervious concretes, a model to predict the stress-strain response, and its relationship to several of the pore structure features are outlined. Larger aggregate sizes and increase in paste volume fractions are observed to result in increased compressive strengths. The compressive response is found to be influenced by the pore sizes, their distributions and spacing. A statistical model is used to relate the compressive strength to the relevant pore structure features, which is then used as a base model in a Monte-Carlo simulation to evaluate the sensitivity of the predicted compressive strength to the model terms.

  8. Peroxisome protein import: a complex journey.

    Science.gov (United States)

    Baker, Alison; Lanyon-Hogg, Thomas; Warriner, Stuart L

    2016-06-15

    The import of proteins into peroxisomes possesses many unusual features such as the ability to import folded proteins, and a surprising diversity of targeting signals with differing affinities that can be recognized by the same receptor. As understanding of the structure and function of many components of the protein import machinery has grown, an increasingly complex network of factors affecting each step of the import pathway has emerged. Structural studies have revealed the presence of additional interactions between cargo proteins and the PEX5 receptor that affect import potential, with a subtle network of cargo-induced conformational changes in PEX5 being involved in the import process. Biochemical studies have also indicated an interdependence of receptor-cargo import with release of unloaded receptor from the peroxisome. Here, we provide an update on recent literature concerning mechanisms of protein import into peroxisomes. © 2016 The Author(s).

  9. Radiograph identifying means

    International Nuclear Information System (INIS)

    Sheldon, A.D.

    1983-01-01

    A flexible character-indentable plastics embossing tape is backed by and bonded to a lead strip, not more than 0.025 inches thick, to form a tape suitable for identifying radiographs. The lead strip is itself backed by a relatively thin and flimsy plastics or fabric strip which, when removed, allows the lead plastic tape to be pressure-bonded to the surface to be radiographed. A conventional tape-embossing gun is used to indent the desired characters in succession into the lead-backed tape, without necessarily severing the lead; and then the backing strip is peeled away to expose the layer of adhesive which pressure-bonds the indented tape to the object to be radiographed. X-rays incident on the embossed tape will cause the raised characters to show up dark on the subsequently-developed film, whilst the raised side areas will show up white. Each character will thus stand out on the developed film. (author)

  10. The imaging features of neurologic complications of left atrial myxomas

    International Nuclear Information System (INIS)

    Liao, Wei-Hua; Ramkalawan, Divya; Liu, Jian-Ling; Shi, Wei; Zee, Chi-Shing; Yang, Xiao-Su; Li, Guo-Liang; Li, Jing; Wang, Xiao-Yi

    2015-01-01

    Background: Neurologic complications may be the first symptoms of atrial myxomas. Understanding the imaging features of neurologic complications of atrial myxomas can be helpful for the prompt diagnosis. Objective: To identify neuroimaging features for patients with neurologic complications attributed to atrial myxoma. Methods: We retrospectively reviewed the medical records of 103 patients with pathologically confirmed atrial myxoma at Xiangya Hospital from January 2009 to January 2014. The neuroimaging data for patients with neurologic complications were analyzed. Results: Eight patients with atrial myxomas (7.77%) presented with neurologic manifestations, which constituted the initial symptoms for seven patients (87.5%). Neuroimaging showed five cases of cerebral infarctions and three cases of aneurysms. The main patterns of the infarctions were multiplicity (100.0%) and involvement of the middle cerebral artery territory (80.0%). The aneurysms were fusiform in shape, multiple in number (100.0%) and located in the distal middle cerebral artery (100.0%). More specifically, high-density in the vicinity of the aneurysms was observed on CT for two patients (66.7%), and homogenous enhancement surrounding the aneurysms was detected in the enhanced imaging for two patients (66.7%). Conclusion: Neurologic complications secondary to atrial myxoma consist of cerebral infarctions and aneurysms, which show certain characteristic features in neuroimaging. Echocardiography should be performed in patients with multiple cerebral infarctions, and multiple aneurysms, especially when aneurysms are distal in location. More importantly, greater attention should be paid to the imaging changes surrounding the aneurysms when myxomatous aneurysms are suspected and these are going to be the relevant features in our article

  11. The imaging features of neurologic complications of left atrial myxomas

    Energy Technology Data Exchange (ETDEWEB)

    Liao, Wei-Hua; Ramkalawan, Divya; Liu, Jian-Ling; Shi, Wei [Department of Radiology, Xiangya Hospital, Central South University, Changsha 410008, Hunan (China); Zee, Chi-Shing [Department of Radiology, Keck School of Medicine, University of Southern California, Los Angeles, CA 90033 (United States); Yang, Xiao-Su; Li, Guo-Liang; Li, Jing [Department of Neurology, Xiangya Hospital, Central South University, Changsha 410008, Hunan (China); Wang, Xiao-Yi, E-mail: cjr.wangxiaoyi@vip.163.com [Department of Radiology, Xiangya Hospital, Central South University, Changsha 410008, Hunan (China)

    2015-05-15

    Background: Neurologic complications may be the first symptoms of atrial myxomas. Understanding the imaging features of neurologic complications of atrial myxomas can be helpful for the prompt diagnosis. Objective: To identify neuroimaging features for patients with neurologic complications attributed to atrial myxoma. Methods: We retrospectively reviewed the medical records of 103 patients with pathologically confirmed atrial myxoma at Xiangya Hospital from January 2009 to January 2014. The neuroimaging data for patients with neurologic complications were analyzed. Results: Eight patients with atrial myxomas (7.77%) presented with neurologic manifestations, which constituted the initial symptoms for seven patients (87.5%). Neuroimaging showed five cases of cerebral infarctions and three cases of aneurysms. The main patterns of the infarctions were multiplicity (100.0%) and involvement of the middle cerebral artery territory (80.0%). The aneurysms were fusiform in shape, multiple in number (100.0%) and located in the distal middle cerebral artery (100.0%). More specifically, high-density in the vicinity of the aneurysms was observed on CT for two patients (66.7%), and homogenous enhancement surrounding the aneurysms was detected in the enhanced imaging for two patients (66.7%). Conclusion: Neurologic complications secondary to atrial myxoma consist of cerebral infarctions and aneurysms, which show certain characteristic features in neuroimaging. Echocardiography should be performed in patients with multiple cerebral infarctions, and multiple aneurysms, especially when aneurysms are distal in location. More importantly, greater attention should be paid to the imaging changes surrounding the aneurysms when myxomatous aneurysms are suspected and these are going to be the relevant features in our article.

  12. IDGenerator: unique identifier generator for epidemiologic or clinical studies

    Directory of Open Access Journals (Sweden)

    Matthias Olden

    2016-09-01

    Full Text Available Abstract Background Creating study identifiers and assigning them to study participants is an important feature in epidemiologic studies, ensuring the consistency and privacy of the study data. The numbering system for identifiers needs to be random within certain number constraints, to carry extensions coding for organizational information, or to contain multiple layers of numbers per participant to diversify data access. Available software can generate globally-unique identifiers, but identifier-creating tools meeting the special needs of epidemiological studies are lacking. We have thus set out to develop a software program to generate IDs for epidemiological or clinical studies. Results Our software IDGenerator creates unique identifiers that not only carry a random identifier for a study participant, but also support the creation of structured IDs, where organizational information is coded into the ID directly. This may include study center (for multicenter-studies, study track (for studies with diversified study programs, or study visit (baseline, follow-up, regularly repeated visits. Our software can be used to add a check digit to the ID to minimize data entry errors. It facilitates the generation of IDs in batches and the creation of layered IDs (personal data ID, study data ID, temporary ID, external data ID to ensure a high standard of data privacy. The software is supported by a user-friendly graphic interface that enables the generation of IDs in both standard text and barcode 128B format. Conclusion Our software IDGenerator can create identifiers meeting the specific needs for epidemiologic or clinical studies to facilitate study organization and data privacy. IDGenerator is freeware under the GNU General Public License version 3; a Windows port and the source code can be downloaded at the Open Science Framework website: https://osf.io/urs2g/ .

  13. Identification of four class emotion from Indonesian spoken language using acoustic and lexical features

    Science.gov (United States)

    Kasyidi, Fatan; Puji Lestari, Dessi

    2018-03-01

    One of the important aspects in human to human communication is to understand emotion of each party. Recently, interactions between human and computer continues to develop, especially affective interaction where emotion recognition is one of its important components. This paper presents our extended works on emotion recognition of Indonesian spoken language to identify four main class of emotions: Happy, Sad, Angry, and Contentment using combination of acoustic/prosodic features and lexical features. We construct emotion speech corpus from Indonesia television talk show where the situations are as close as possible to the natural situation. After constructing the emotion speech corpus, the acoustic/prosodic and lexical features are extracted to train the emotion model. We employ some machine learning algorithms such as Support Vector Machine (SVM), Naive Bayes, and Random Forest to get the best model. The experiment result of testing data shows that the best model has an F-measure score of 0.447 by using only the acoustic/prosodic feature and F-measure score of 0.488 by using both acoustic/prosodic and lexical features to recognize four class emotion using the SVM RBF Kernel.

  14. The features of Saint Louis

    Directory of Open Access Journals (Sweden)

    Pierre-Yves Le Pogam

    2017-12-01

    Full Text Available The recent ninth centenary of the birth of Saint Louis, in 2014, gave the possibility to renew the study of the man and his reign, so important for French history, not in a nationalistic agenda or for a mere celebration, but in order to shed new light on a figure indeed profoundly studied but deserving a repeated attention, so much Louis IX lends to many-sided, even contradictory explanations. In the past, one has paid an almost maniacal attention to the point of the physical appearance of the king, looking in some images for a reflection of, or indeed a portrait of Saint Louis. Or, on the contrary and more recently, one has denied any validity to this trend of studies. In line with the essay I devoted on this question in the catalogue of the recent exhibition on Saint Louis in Paris, I would like here to go further in the analysis, especially regarding the meaning of details of the dress and bodily features of the saint king.

  15. Clinical Features and Outcomes of Gastric Ischemia.

    Science.gov (United States)

    Sharma, Ayush; Mukewar, Saurabh; Chari, Suresh T; Wong Kee Song, Louis M

    2017-12-01

    Gastric ischemia is a rare condition associated with poor prognosis. Our study aim was to highlight the clinical features and outcomes of patients with gastric ischemia. A retrospective review of patients diagnosed with isolated gastric ischemia at our institution from January 1, 2000, to May 5, 2016, was performed. Demographic, clinical, endoscopic, radiologic, and outcome variables were abstracted for analysis. Seventeen patients (65% men) with mean age of 69.3 ± 11.3 years and body mass index of 28.8 ± 11.1 were identified. The etiologies for gastric ischemia included local vascular causes (n = 8), systemic hypoperfusion (n = 4), and mechanical obstruction (n = 5). The most common presenting symptoms were abdominal pain (65%), gastrointestinal bleeding (47%), and altered mental status (23%). The typical endoscopic appearance was mucosal congestion and erythema with or without ulceration. Gastric pneumatosis and portal venous air were more commonly seen on CT imaging. Radiologic and/or surgical intervention was needed in 9 patients, while the remaining 8 patients were managed conservatively with acid suppression, antibiotics, and nasogastric tube decompression. The median duration of hospital stay was 15 days (range 1-36 days). There were no cases of rebleeding and the mortality rate as a direct result of gastric ischemia was 24% within 6 months of diagnosis. Although uncommon, gastric ischemia is associated with significant mortality. Endoscopy and CT imaging play an important role in its diagnosis. The management of gastric ischemia is dictated by its severity and associated comorbidities.

  16. Computational Identification of Genomic Features That Influence 3D Chromatin Domain Formation.

    Science.gov (United States)

    Mourad, Raphaël; Cuvier, Olivier

    2016-05-01

    Recent advances in long-range Hi-C contact mapping have revealed the importance of the 3D structure of chromosomes in gene expression. A current challenge is to identify the key molecular drivers of this 3D structure. Several genomic features, such as architectural proteins and functional elements, were shown to be enriched at topological domain borders using classical enrichment tests. Here we propose multiple logistic regression to identify those genomic features that positively or negatively influence domain border establishment or maintenance. The model is flexible, and can account for statistical interactions among multiple genomic features. Using both simulated and real data, we show that our model outperforms enrichment test and non-parametric models, such as random forests, for the identification of genomic features that influence domain borders. Using Drosophila Hi-C data at a very high resolution of 1 kb, our model suggests that, among architectural proteins, BEAF-32 and CP190 are the main positive drivers of 3D domain borders. In humans, our model identifies well-known architectural proteins CTCF and cohesin, as well as ZNF143 and Polycomb group proteins as positive drivers of domain borders. The model also reveals the existence of several negative drivers that counteract the presence of domain borders including P300, RXRA, BCL11A and ELK1.

  17. Complex Topographic Feature Ontology Patterns

    Science.gov (United States)

    Varanka, Dalia E.; Jerris, Thomas J.

    2015-01-01

    Semantic ontologies are examined as effective data models for the representation of complex topographic feature types. Complex feature types are viewed as integrated relations between basic features for a basic purpose. In the context of topographic science, such component assemblages are supported by resource systems and found on the local landscape. Ontologies are organized within six thematic modules of a domain ontology called Topography that includes within its sphere basic feature types, resource systems, and landscape types. Context is constructed not only as a spatial and temporal setting, but a setting also based on environmental processes. Types of spatial relations that exist between components include location, generative processes, and description. An example is offered in a complex feature type ‘mine.’ The identification and extraction of complex feature types are an area for future research.

  18. The future of primordial features with large-scale structure surveys

    International Nuclear Information System (INIS)

    Chen, Xingang; Namjoo, Mohammad Hossein; Dvorkin, Cora; Huang, Zhiqi; Verde, Licia

    2016-01-01

    Primordial features are one of the most important extensions of the Standard Model of cosmology, providing a wealth of information on the primordial Universe, ranging from discrimination between inflation and alternative scenarios, new particle detection, to fine structures in the inflationary potential. We study the prospects of future large-scale structure (LSS) surveys on the detection and constraints of these features. We classify primordial feature models into several classes, and for each class we present a simple template of power spectrum that encodes the essential physics. We study how well the most ambitious LSS surveys proposed to date, including both spectroscopic and photometric surveys, will be able to improve the constraints with respect to the current Planck data. We find that these LSS surveys will significantly improve the experimental sensitivity on features signals that are oscillatory in scales, due to the 3D information. For a broad range of models, these surveys will be able to reduce the errors of the amplitudes of the features by a factor of 5 or more, including several interesting candidates identified in the recent Planck data. Therefore, LSS surveys offer an impressive opportunity for primordial feature discovery in the next decade or two. We also compare the advantages of both types of surveys.

  19. The future of primordial features with large-scale structure surveys

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Xingang; Namjoo, Mohammad Hossein [Institute for Theory and Computation, Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Dvorkin, Cora [Department of Physics, Harvard University, Cambridge, MA 02138 (United States); Huang, Zhiqi [School of Physics and Astronomy, Sun Yat-Sen University, 135 Xingang Xi Road, Guangzhou, 510275 (China); Verde, Licia, E-mail: xingang.chen@cfa.harvard.edu, E-mail: dvorkin@physics.harvard.edu, E-mail: huangzhq25@sysu.edu.cn, E-mail: mohammad.namjoo@cfa.harvard.edu, E-mail: liciaverde@icc.ub.edu [ICREA and ICC-UB, University of Barcelona (IEEC-UB), Marti i Franques, 1, Barcelona 08028 (Spain)

    2016-11-01

    Primordial features are one of the most important extensions of the Standard Model of cosmology, providing a wealth of information on the primordial Universe, ranging from discrimination between inflation and alternative scenarios, new particle detection, to fine structures in the inflationary potential. We study the prospects of future large-scale structure (LSS) surveys on the detection and constraints of these features. We classify primordial feature models into several classes, and for each class we present a simple template of power spectrum that encodes the essential physics. We study how well the most ambitious LSS surveys proposed to date, including both spectroscopic and photometric surveys, will be able to improve the constraints with respect to the current Planck data. We find that these LSS surveys will significantly improve the experimental sensitivity on features signals that are oscillatory in scales, due to the 3D information. For a broad range of models, these surveys will be able to reduce the errors of the amplitudes of the features by a factor of 5 or more, including several interesting candidates identified in the recent Planck data. Therefore, LSS surveys offer an impressive opportunity for primordial feature discovery in the next decade or two. We also compare the advantages of both types of surveys.

  20. Deep Visual Attributes vs. Hand-Crafted Audio Features on Multidomain Speech Emotion Recognition

    Directory of Open Access Journals (Sweden)

    Michalis Papakostas

    2017-06-01

    Full Text Available Emotion recognition from speech may play a crucial role in many applications related to human–computer interaction or understanding the affective state of users in certain tasks, where other modalities such as video or physiological parameters are unavailable. In general, a human’s emotions may be recognized using several modalities such as analyzing facial expressions, speech, physiological parameters (e.g., electroencephalograms, electrocardiograms etc. However, measuring of these modalities may be difficult, obtrusive or require expensive hardware. In that context, speech may be the best alternative modality in many practical applications. In this work we present an approach that uses a Convolutional Neural Network (CNN functioning as a visual feature extractor and trained using raw speech information. In contrast to traditional machine learning approaches, CNNs are responsible for identifying the important features of the input thus, making the need of hand-crafted feature engineering optional in many tasks. In this paper no extra features are required other than the spectrogram representations and hand-crafted features were only extracted for validation purposes of our method. Moreover, it does not require any linguistic model and is not specific to any particular language. We compare the proposed approach using cross-language datasets and demonstrate that it is able to provide superior results vs. traditional ones that use hand-crafted features.

  1. Hong Kong English: phonological features

    OpenAIRE

    Irina-Ana Drobot

    2008-01-01

    The aim of the paper is to present phonological features of Hong Kong English, which is a variety of New English. I examine features of the sound system (vowel and consonantal systems), characteristics of stress, rhythm, intonation, and phonological processes of the English spoken by Hongkongers. The way in which the accent and characteristics of the Hong Kong variety of English differs from standard, RP English is pointed out. Influences of Chinese and Cantonese on the phonological features ...

  2. Identifying the Universal part of TMDs

    CERN Document Server

    Van der Veken, F.F.

    2016-01-01

    We attempt to identify a path layout in the definition of transverse-momentum-dependent T-odd parton distribution functions (TMD)s which combines features of both, initial- and final-state interactions, so that it remains universal despite the fact that the Wilson lines entering such TMDs change their orientation. The generic structure of the quark correlator for this path layout is calculated.

  3. History And Importance Of Graphic Design

    OpenAIRE

    Lyallya, Kirill

    2016-01-01

    This thesis is about history and importance of graphic design in different periods, from ancient times until today. The features inherent in different countries are considered. The techniques, basic methods for creating projects and computer software that designers have used are mentioned. In order to understand the importance of graphic design in our lives, it is considered from the side of ordinary people, how it manifests itself in daily lives and how it affects business. The thesis provid...

  4. Emergent interfaces for feature modularization

    CERN Document Server

    Ribeiro, Márcio; Brabrand, Claus

    2014-01-01

    Developers frequently introduce errors into software systems when they fail to recognise module dependencies. Using forty-three software families and Software Product Lines (SPLs), where the majority are commonly used in industrial practice, the authors reports on the feature modularization problem and provides a study of how often it may occur in practice. To solve the problem they present the concept of emergent feature modularization which aims to establish contracts between features to prevent developers from breaking other features when performing a maintenance task.

  5. Adaptability: An Important Capacity for Effective Teachers

    Science.gov (United States)

    Collie, Rebecca J.; Martin, Andrew J.

    2016-01-01

    A defining feature of teaching work is that it involves novelty, change, and uncertainty on a daily basis. Being able to respond effectively to this change is known as adaptability. In this article, we discuss the importance of adaptability for teachers and their healthy and effective functioning in the workplace. We discuss approaches for…

  6. Discriminative semi-supervised feature selection via manifold regularization.

    Science.gov (United States)

    Xu, Zenglin; King, Irwin; Lyu, Michael Rung-Tsong; Jin, Rong

    2010-07-01

    Feature selection has attracted a huge amount of interest in both research and application communities of data mining. We consider the problem of semi-supervised feature selection, where we are given a small amount of labeled examples and a large amount of unlabeled examples. Since a small number of labeled samples are usually insufficient for identifying the relevant features, the critical problem arising from semi-supervised feature selection is how to take advantage of the information underneath the unlabeled data. To address this problem, we propose a novel discriminative semi-supervised feature selection method based on the idea of manifold regularization. The proposed approach selects features through maximizing the classification margin between different classes and simultaneously exploiting the geometry of the probability distribution that generates both labeled and unlabeled data. In comparison with previous semi-supervised feature selection algorithms, our proposed semi-supervised feature selection method is an embedded feature selection method and is able to find more discriminative features. We formulate the proposed feature selection method into a convex-concave optimization problem, where the saddle point corresponds to the optimal solution. To find the optimal solution, the level method, a fairly recent optimization method, is employed. We also present a theoretic proof of the convergence rate for the application of the level method to our problem. Empirical evaluation on several benchmark data sets demonstrates the effectiveness of the proposed semi-supervised feature selection method.

  7. Optimal coal import strategy

    International Nuclear Information System (INIS)

    Chen, C.Y.; Shih, L.H.

    1992-01-01

    Recently, the main power company in Taiwan has shifted the primary energy resource from oil to coal and tried to diversify the coal supply from various sources. The company wants to have the imported coal meet the environmental standards and operation requirements as well as to have high heating value. In order to achieve these objectives, establishment of a coal blending system for Taiwan is necessary. A mathematical model using mixed integer programming technique is used to model the import strategy and the blending system. 6 refs., 1 tab

  8. Feature and Region Selection for Visual Learning.

    Science.gov (United States)

    Zhao, Ji; Wang, Liantao; Cabral, Ricardo; De la Torre, Fernando

    2016-03-01

    Visual learning problems, such as object classification and action recognition, are typically approached using extensions of the popular bag-of-words (BoWs) model. Despite its great success, it is unclear what visual features the BoW model is learning. Which regions in the image or video are used to discriminate among classes? Which are the most discriminative visual words? Answering these questions is fundamental for understanding existing BoW models and inspiring better models for visual recognition. To answer these questions, this paper presents a method for feature selection and region selection in the visual BoW model. This allows for an intermediate visualization of the features and regions that are important for visual learning. The main idea is to assign latent weights to the features or regions, and jointly optimize these latent variables with the parameters of a classifier (e.g., support vector machine). There are four main benefits of our approach: 1) our approach accommodates non-linear additive kernels, such as the popular χ(2) and intersection kernel; 2) our approach is able to handle both regions in images and spatio-temporal regions in videos in a unified way; 3) the feature selection problem is convex, and both problems can be solved using a scalable reduced gradient method; and 4) we point out strong connections with multiple kernel learning and multiple instance learning approaches. Experimental results in the PASCAL VOC 2007, MSR Action Dataset II and YouTube illustrate the benefits of our approach.

  9. Face Alignment via Regressing Local Binary Features.

    Science.gov (United States)

    Ren, Shaoqing; Cao, Xudong; Wei, Yichen; Sun, Jian

    2016-03-01

    This paper presents a highly efficient and accurate regression approach for face alignment. Our approach has two novel components: 1) a set of local binary features and 2) a locality principle for learning those features. The locality principle guides us to learn a set of highly discriminative local binary features for each facial landmark independently. The obtained local binary features are used to jointly learn a linear regression for the final output. This approach achieves the state-of-the-art results when tested on the most challenging benchmarks to date. Furthermore, because extracting and regressing local binary features are computationally very cheap, our system is much faster than previous methods. It achieves over 3000 frames per second (FPS) on a desktop or 300 FPS on a mobile phone for locating a few dozens of landmarks. We also study a key issue that is important but has received little attention in the previous research, which is the face detector used to initialize alignment. We investigate several face detectors and perform quantitative evaluation on how they affect alignment accuracy. We find that an alignment friendly detector can further greatly boost the accuracy of our alignment method, reducing the error up to 16% relatively. To facilitate practical usage of face detection/alignment methods, we also propose a convenient metric to measure how good a detector is for alignment initialization.

  10. On the Use of Memory Models in Audio Features

    DEFF Research Database (Denmark)

    Jensen, Karl Kristoffer

    2011-01-01

    Audio feature estimation is potentially improved by including higher- level models. One such model is the Short Term Memory (STM) model. A new paradigm of audio feature estimation is obtained by adding the influence of notes in the STM. These notes are identified when the perceptual spectral flux...

  11. Biometric features and privacy : condemned, based upon your finger print

    NARCIS (Netherlands)

    Bullee, Jan-Willem; Veldhuis, Raymond N.J.

    What information is available in biometric features besides that needed for the biometric recognition process? What if a biometric feature contains Personally Identifiable Information? Will the whole biometric system become a threat to privacy? This paper is an attempt to quantifiy the link between

  12. The Features of Female Managers' Personality Traits in Organization

    Science.gov (United States)

    Gabdreeva, Guzel Sh.; Khalfieva, Alisa R.

    2016-01-01

    The relevance of the "female" management features study is driven by the active penetration of women to management in various fields and the emergence of a new social category "Business-women". The article contains the results of a study aimed to identify the features of personal properties and structure of low-level,…

  13. Ebola outbreak in Conakry, Guinea: Epidemiological, clinical, and outcome features

    OpenAIRE

    Barry, M; Traoré, F A; Sako, F B; Kpamy, D O; Bah, E I; Poncin, M; Keita, S; Cisse, M; Touré, A

    2014-01-01

    The authors studied the epidemiological, clinical, and outcome features of the Ebola virus disease in patients hospitalized at the Ebola treatment center (ETC) in Conakry to identify clinical factors associated with death.

  14. Finding Combination of Features from Promoter Regions for Ovarian Cancer-related Gene Group Classification

    KAUST Repository

    Olayan, Rawan S.

    2012-12-01

    In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.

  15. Finding Combination of Features from Promoter Regions for Ovarian Cancer-related Gene Group Classification

    KAUST Repository

    Olayan, Rawan S.

    2012-01-01

    In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.

  16. Efficient Identification Using a Prime-Feature-Based Technique

    DEFF Research Database (Denmark)

    Hussain, Dil Muhammad Akbar; Haq, Shaiq A.; Valente, Andrea

    2011-01-01

    . Fingerprint identification system, implemented on PC/104 based real-time systems, can accurately identify the operator. Traditionally, the uniqueness of a fingerprint is determined by the overall pattern of ridges and valleys as well as the local ridge anomalies e.g., a ridge bifurcation or a ridge ending......, which are called minutiae points. Designing a reliable automatic fingerprint matching algorithm for minimal platform is quite challenging. In real-time systems, efficiency of the matching algorithm is of utmost importance. To achieve this goal, a prime-feature-based indexing algorithm is proposed......Identification of authorized train drivers through biometrics is a growing area of interest in locomotive radio remote control systems. The existing technique of password authentication is not very reliable and potentially unauthorized personnel may also operate the system on behalf of the operator...

  17. MRI of Creutzfeldt-Jakob disease: Imaging features and recommended MRI protocol

    Energy Technology Data Exchange (ETDEWEB)

    Collie, D.A.; Sellar, R.J.; Zeidler, M.; Colchester, A.C.F.; Knight, R.; Will, R.G

    2001-09-01

    Creutzfeldt-Jakob Disease (CJD) is a rare, progressive and invariably fatal neurodegenerative disease characterized by specific histopathological features. Of the four subtypes of CJD described, the commonest is sporadic CJD (sCJD). More recently, a new clinically distinct form of the disease affecting younger patients, known as variant CJD (vCJD), has been identified, and this has been causally linked to the bovine spongiform encephalopathy (BSE) agent in cattle. Characteristic appearances on magnetic resonance imaging (MRI) have been identified in several forms of CJD; sCJD may be associated with high signal changes in the putamen and caudate head and vCJD is usually associated with hyperintensity of the pulvinar (posterior nuclei) of the thalamus. These appearances and other imaging features are described in this article. Using appropriate clinical and radiological criteria and tailored imaging protocols, MRI plays an important part in the in vivodiagnosis of this disease. Collie, D.A. et al. (2001)

  18. MRI of Creutzfeldt-Jakob disease: Imaging features and recommended MRI protocol

    International Nuclear Information System (INIS)

    Collie, D.A.; Sellar, R.J.; Zeidler, M.; Colchester, A.C.F.; Knight, R.; Will, R.G.

    2001-01-01

    Creutzfeldt-Jakob Disease (CJD) is a rare, progressive and invariably fatal neurodegenerative disease characterized by specific histopathological features. Of the four subtypes of CJD described, the commonest is sporadic CJD (sCJD). More recently, a new clinically distinct form of the disease affecting younger patients, known as variant CJD (vCJD), has been identified, and this has been causally linked to the bovine spongiform encephalopathy (BSE) agent in cattle. Characteristic appearances on magnetic resonance imaging (MRI) have been identified in several forms of CJD; sCJD may be associated with high signal changes in the putamen and caudate head and vCJD is usually associated with hyperintensity of the pulvinar (posterior nuclei) of the thalamus. These appearances and other imaging features are described in this article. Using appropriate clinical and radiological criteria and tailored imaging protocols, MRI plays an important part in the in vivodiagnosis of this disease. Collie, D.A. et al. (2001)

  19. Feature extraction using fractal codes

    NARCIS (Netherlands)

    B.A.M. Ben Schouten; Paul M. de Zeeuw

    1999-01-01

    Fast and successful searching for an object in a multimedia database is a highly desirable functionality. Several approaches to content based retrieval for multimedia databases can be found in the literature [9,10,12,14,17]. The approach we consider is feature extraction. A feature can be seen as a

  20. Feature Extraction Using Fractal Codes

    NARCIS (Netherlands)

    B.A.M. Schouten (Ben); P.M. de Zeeuw (Paul)

    1999-01-01

    htmlabstractFast and successful searching for an object in a multimedia database is a highly desirable functionality. Several approaches to content based retrieval for multimedia databases can be found in the literature [9,10,12,14,17]. The approach we consider is feature extraction. A feature can

  1. Partial Epilepsy with Auditory Features

    Directory of Open Access Journals (Sweden)

    J Gordon Millichap

    2004-07-01

    Full Text Available The clinical characteristics of 53 sporadic (S cases of idiopathic partial epilepsy with auditory features (IPEAF were analyzed and compared to previously reported familial (F cases of autosomal dominant partial epilepsy with auditory features (ADPEAF in a study at the University of Bologna, Italy.

  2. Tolerance-Based Feature Transforms

    NARCIS (Netherlands)

    Reniers, Dennie; Telea, Alexandru

    2007-01-01

    Tolerance-based feature transforms (TFTs) assign to each pixel in an image not only the nearest feature pixels on the boundary (origins), but all origins from the minimum distance up to a user-defined tolerance. In this paper, we compare four simple-to-implement methods for computing TFTs on binary

  3. Mobility as a feature: Evidence from Zulu

    African Journals Online (AJOL)

    Kate H

    “mobility” property of a DP is encoded on the DP itself and, importantly, that it is this very property that makes the DP “visible” to agreement relations. The concrete claim that I defend in this article is therefore that object-DPs in Zulu may optionally be equipped with an uninterpretable feature with a dual purpose: it repells the ...

  4. [Diagnosing imported helminthiasis].

    Science.gov (United States)

    Pardo, Javier; Pérez-Arellano, José Luis; Galindo, Inmaculada; Belhassen, Moncef; Cordero, Miguel; Muro, Antonio

    2007-05-01

    In recent years, there has been an increase in cases of imported helminthiasis in Spain because of two complementary causes: immigration and international travel. Although the prevalence of helminthiasis is high in the immigrant population, the risk of transmission to the Spanish population is low. In this review, we provide clues to aid in the diagnosis of the helminthiasis, highlighting the geographic characteristics, clinical findings and analytical results of the most frequent types. The low sensitivity of the classic parasitological diagnostic test, mainly in tissue helminthiasis, is described. In addition, the advantages and limitations of the common serological methods for detecting related circulating antigens and antibodies are presented. Certain molecular methods used in the diagnosis of imported helminthiasis and the best strategies for screening of this condition are discussed.

  5. How important is vehicle safety for older consumers in the vehicle purchase process?

    Science.gov (United States)

    Koppel, Sjaan; Clark, Belinda; Hoareau, Effie; Charlton, Judith L; Newstead, Stuart V

    2013-01-01

    This study aimed to investigate the importance of vehicle safety to older consumers in the vehicle purchase process. Older (n = 102), middle-aged (n = 791), and younger (n = 109) participants throughout the eastern Australian states of Victoria, New South Wales, and Queensland who had recently purchased a new or used vehicle completed an online questionnaire about their vehicle purchase process. When asked to list the 3 most important considerations in the vehicle purchase process (in an open-ended format), older consumers were mostly likely to list price as their most important consideration (43%). Similarly, when presented with a list of vehicle factors (such as price, design, Australasian New Car Assessment Program [ANCAP] rating), older consumers were most likely to identify price as the most important vehicle factor (36%). When presented with a list of vehicle features (such as automatic transmission, braking, air bags), older consumers in the current study were most likely to identify an antilock braking system (41%) as the most important vehicle feature, and 50 percent of older consumers identified a safety-related vehicle feature as the highest priority vehicle feature (50%). When asked to list up to 3 factors that make a vehicle safe, older consumers in the current study were most likely to list braking systems (35%), air bags (22%), and the driver's behavior or skill (11%). When asked about the influence of safety in the new vehicle purchase process, one third of older consumers reported that all new vehicles are safe (33%) and almost half of the older consumers rated their vehicle as safer than average (49%). A logistic regression model was developed to predict the profile of older consumers more likely to assign a higher priority to safety features in the vehicle purchasing process. The model predicted that the importance of safety-related features was influenced by several variables, including older consumers' beliefs that they could protect themselves

  6. Plaque echodensity and textural features are associated with histologic carotid plaque instability.

    Science.gov (United States)

    Doonan, Robert J; Gorgui, Jessica; Veinot, Jean P; Lai, Chi; Kyriacou, Efthyvoulos; Corriveau, Marc M; Steinmetz, Oren K; Daskalopoulou, Stella S

    2016-09-01

    Carotid plaque echodensity and texture features predict cerebrovascular symptomatology. Our purpose was to determine the association of echodensity and textural features obtained from a digital image analysis (DIA) program with histologic features of plaque instability as well as to identify the specific morphologic characteristics of unstable plaques. Patients scheduled to undergo carotid endarterectomy were recruited and underwent carotid ultrasound imaging. DIA was performed to extract echodensity and textural features using Plaque Texture Analysis software (LifeQ Medical Ltd, Nicosia, Cyprus). Carotid plaque surgical specimens were obtained and analyzed histologically. Principal component analysis (PCA) was performed to reduce imaging variables. Logistic regression models were used to determine if PCA variables and individual imaging variables predicted histologic features of plaque instability. Image analysis data from 160 patients were analyzed. Individual imaging features of plaque echolucency and homogeneity were associated with a more unstable plaque phenotype on histology. These results were independent of age, sex, and degree of carotid stenosis. PCA reduced 39 individual imaging variables to five PCA variables. PCA1 and PCA2 were significantly associated with overall plaque instability on histology (both P = .02), whereas PCA3 did not achieve statistical significance (P = .07). DIA features of carotid plaques are associated with histologic plaque instability as assessed by multiple histologic features. Importantly, unstable plaques on histology appear more echolucent and homogeneous on ultrasound imaging. These results are independent of stenosis, suggesting that image analysis may have a role in refining the selection of patients who undergo carotid endarterectomy. Copyright © 2016 Society for Vascular Surgery. Published by Elsevier Inc. All rights reserved.

  7. A Comparative Study of Feature Selection and Classification Methods for Gene Expression Data

    KAUST Repository

    Abusamra, Heba

    2013-01-01

    Different experiments have been applied to compare the performance of the classification methods with and without performing feature selection. Results revealed the important role of feature selection in classifying gene expression data. By performing feature selection, the classification accuracy can be significantly boosted by using a small number of genes. The relationship of features selected in different feature selection methods is investigated and the most frequent features selected in each fold among all methods for both datasets are evaluated.

  8. Clinicopathologic Features of Pediatric Oligodendrogliomas

    Science.gov (United States)

    Rodriguez, Fausto J.; Tihan, Tarik; Lin, Doris; McDonald, William; Nigro, Janice; Feuerstein, Burt; Jackson, Sadhana; Cohen, Kenneth; Burger, Peter C.

    2015-01-01

    Oligodendrogliomas are an important adult form of diffuse gliomas with a distinctive clinical and genetic profile. Histologically similar tumors occurring rarely in children are incompletely characterized. We studied 50 patients with oligodendrogliomas (median age at diagnosis 8 y, range 7mo to 20 y). Tumors resembling dysembryoplastic neuroepithelial tumors or pilocytic astrocytomas or those having a “mixed” histology were excluded. Tumors at first diagnosis were low grade (n=38) or anaplastic (n=12). Histologic features included uniform round cells with perinuclear halos (100%), secondary structures (predominantly perineuronal satellitosis) (90%), calcifications (46%), and microcysts (44%). Sequential surgical specimens were obtained in 8 low-grade oligodendroglioma patients, with only 1 progressing to anaplasia. Studies for 1p19q performed in 40 cases demonstrated intact 1p19q loci in 29 (73%), 1p19q codeletion in 10 (25%), and 1p deletion with intact 19q in 1 (2%). Except for 2 young patients (3 and 11 y of age), patients with 1p19q codeletion were older than 16 years at diagnosis. Mutant IDH1 (R132H) protein immunohistochemistry was positive in 4 (of 22) (18%) cases, 3 of which also had 1p19q codeletion, whereas 1p19q status was not available on the fourth case. There was a nonsignificant trend for worse overall survival in grade III tumors, but no significant association with age, extent of resection, or 1p19q status. In summary, oligodendrogliomas with classic histology occur in the pediatric population but lack 1p19q codeletion and IDH1 (R132H) mutations in most instances. They are predominantly low grade, recur/clinically progress in a subset, but demonstrate a relatively low frequency of histologic progression. PMID:24805856

  9. Imaging features of cardiac myxoma

    International Nuclear Information System (INIS)

    Yang Youyou; Zheng Lili; Li Xiangmin; Zhou Xuhui; Kuang Jianyi; Zhang Wenzhao

    2007-01-01

    Objective: To study the imaging features of cardiac myxoma and their diagnostic values. Methods: Twenty-two patrents with cardiac myxoma were reviewed retrospectively for the clinical, pathologic, and radiologic findings. Posteroanterior and lateral chest radiographs, American Imatron C-150 XP Electron Beam CT examination, and Germany Siemens 1.5T Magnetom Vision MR scan were performed on every patient. Results: (1) Radiographs of 17 patients with left atrial myxoma showed evidence of mitral valve obstruction in 14(82.3%), radiographs of 5 patients with right atrial myxoma demonstrated right atrium enlargement in 3(60%) respectively. (2) CT scans of 22 myxomas demonstrated 18 (81.8%) lesions were hypoattenuated and 4 (19.1%) were isoattenuated relative to the myocardium. Calcification or ossification was seen in 3 patients. All myxomas apart from massive one were found attaching to the atrial septum. Movie mode could dis- play the movement of myxoma across the atrioventicular valves. (3) MRI studies of 22 myxomas showed 19 (86.3%) heterogeneous signal intensity and 3 (13.7%) homogeneous. They exhibited slight high or homogeneous signal intensity with both T 1 - and T 2 -weighted sequences, and low signal intensity with cine gradient recalled echo sequences. Point of attachment was visible in 21 (95.4%) cases. Conclusion: The typical radiograph sign of cardiac myxomas is mitral valve obstruction, CT and MR can demonstrate intracavitary lobular masses attacthing to artrial spetum. The latter two kinds of examinations not only provide accurate assessment of the size, location, and attachment point of these lesions, but also have important qualitative diagnostic advantage. (authors)

  10. FEATURES OF MICROFINANCING IN RUSSIA

    Directory of Open Access Journals (Sweden)

    Ekaterina B. Makarova

    2018-03-01

    Full Text Available Small business is the basis for the development of the modern economy of Russia. In modern conditions, small enterprises can be credited in various credit institutions, the most significant and popular among which are banks and microfinance organizations. The volume of the microfinance market is many times smaller than the banking one, although the number of registered microfinance organizations exceeds the number of banking credit institutions by more than 3 times. Microfinance institutions are actively developing, although in recent years, due to the economic and political situation, there has been a slowdown in their growth rates. To date, microfinance organizations are becoming a more significant element of the financial infrastructure that supports and stimulates the growth of small and medium-sized enterprises, which in turn serves as an effective tool for combating poverty and improving the living standards of the country’s population. Microfinance in the narrow interpretation is understood only as the provision of small monetary loans (loans, and in a broader context, “microfinance” includes, in addition to direct lending, operations to attract savings, payments, insurance, leasing and a number of other financial services. This article is devoted to the specifics of microfinance in Russia. On the basis of a comprehensive analysis of the domestic microfinance system with the systems of a developed and a developing country, namely, the USA and India, the features of providing microfinance services for small and medium businesses, as well as for nonprotected sections of the population, are revealed. The analysis of foreign experience is very important for Russia since the mechanisms of microfinance in this country are only being formed.

  11. Reductio ad discrimen: Where features come from

    Directory of Open Access Journals (Sweden)

    Elizabeth Cowper

    2015-04-01

    Full Text Available This paper addresses two fundamental questions about the nature of formal features in phonology and morphosyntax: what is their expressive power, and where do they come from? To answer these questions, we begin with the most restrictive possible hypothesis (all features are privative, and are wholly dictated by Universal Grammar, with no room for cross-linguistic variation, and examine the extent to which empirical evidence from a variety of languages compels a retreat from this position. We argue that there is little to be gained by positing a universal set of specific features, and propose instead that the crucial contribution of UG is the language learner's ability to construct features by identifying correlations between contrasts at different levels of linguistic structure. This view resonates with current research on how the interaction between UG and external 'third factors' shapes the structure of language, while at the same time harking back to the Saussurean notion that contrast is the central function of linguistic representations.

  12. Mobility as a feature: Evidence from Zulu

    Directory of Open Access Journals (Sweden)

    Jochen Zeller

    2016-01-01

    Full Text Available This paper provides evidence for the view that syntactic movement of an element Y to a position X is not driven by features of the target X, but by features of the moving element Y. The data that constitute evidence for this type of analysis come from A-bar movement constructions (object left and right dislocation; object relativisation in the Bantu language Zulu. As I show, only object-DPs that move out of the VP in Zulu are active Goals for Agree-relations and can trigger object agreement with the verb. The fact that the functional head responsible for object agreement must be able to identify a DP in its c-command domain as an active Goal entails that the “mobility” of this DP must be encoded as a property of the DP. Based on this conclusion, I also discuss two proposals about the nature of the feature that activates a DP for movement in Zulu and examine the conditions that determine how this feature is checked and deleted through movement.

  13. Feature-based Ontology Mapping from an Information Receivers’ Viewpoint

    DEFF Research Database (Denmark)

    Glückstad, Fumiko Kano; Mørup, Morten

    2012-01-01

    This paper compares four algorithms for computing feature-based similarities between concepts respectively possessing a distinctive set of features. The eventual purpose of comparing these feature-based similarity algorithms is to identify a candidate term in a Target Language (TL) that can...... optimally convey the original meaning of a culturally-specific Source Language (SL) concept to a TL audience by aligning two culturally-dependent domain-specific ontologies. The results indicate that the Bayesian Model of Generalization [1] performs best, not only for identifying candidate translation terms...

  14. Investigating important factors influencing purchasing from chains

    Directory of Open Access Journals (Sweden)

    Naser Azad

    2012-04-01

    Full Text Available In this paper, we survey important factors, influencing customers to buy more from one of well known food market operating in capital city of Iran named Shahrvand. The survey studies the effects of six factors including customer's perception, persuasive factors, brand, customers' expectations, product's characteristics and special features of store on attracting more customers. We have distributed questionnaire among 196 customers who regularly visit stores and analyzed details of the data. The results indicate that customers' perception is the most important item, which includes eight components. Years of experience is the most important item in our survey followed by impact of color and working hours. Diversity of services is another factor, which plays the most important role followed by quality of services. Next, fidelity and brand are other most important factors and the name of store and risk are in lower degree of importance.

  15. Detection of Seed Methods for Quantification of Feature Confinement

    DEFF Research Database (Denmark)

    Olszak, Andrzej; Bouwers, Eric; Jørgensen, Bo Nørregaard

    2012-01-01

    The way features are implemented in source code has a significant influence on multiple quality aspects of a software system. Hence, it is important to regularly evaluate the quality of feature confinement. Unfortunately, existing approaches to such measurement rely on expert judgement for tracin...

  16. Salient features in 3-D haptic shape perception

    NARCIS (Netherlands)

    Plaisier, Myrthe A; Bergmann Tiest, Wouter M.; Kappers, Astrid M L

    2009-01-01

    Shape is an important cue for recognizing an object by touch. Several features, such as edges, curvature, surface area, and aspect ratio, are associated with 3-D shape. To investigate the saliency of 3-D shape features, we developed a haptic search task. The target and distractor items consisted of

  17. Feature extraction for classification in the data mining process

    NARCIS (Netherlands)

    Pechenizkiy, M.; Puuronen, S.; Tsymbal, A.

    2003-01-01

    Dimensionality reduction is a very important step in the data mining process. In this paper, we consider feature extraction for classification tasks as a technique to overcome problems occurring because of "the curse of dimensionality". Three different eigenvector-based feature extraction approaches

  18. Glacial Features (Point) - Quad 168 (EPPING, NH)

    Data.gov (United States)

    University of New Hampshire — The Glacial Features (Point) layer describes point features associated with surficial geology. These glacial features include, but are not limited to, delta forsets,...

  19. Hong Kong English: phonological features

    Directory of Open Access Journals (Sweden)

    Irina-Ana Drobot

    2008-01-01

    Full Text Available The aim of the paper is to present phonological features of Hong Kong English, which is a variety of New English. I examine features of the sound system (vowel and consonantal systems, characteristics of stress, rhythm, intonation, and phonological processes of the English spoken by Hongkongers. The way in which the accent and characteristics of the Hong Kong variety of English differs from standard, RP English is pointed out. Influences of Chinese and Cantonese on the phonological features of Hong Kong English are noticeable

  20. Risk communication importance

    Energy Technology Data Exchange (ETDEWEB)

    Cunha, Raquel Dalledone Siqueira da; Andrade, Delvonei Alves de, E-mail: raqueldalledonesiqueira@gmail.com, E-mail: delvonei@ipen.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)

    2013-07-01

    Risk Communication has shown its importance in the elaboration of emergency plans in the Chemical industry. In the 90's, the UNEP developed the APELL (Awareness and Preparedness for Emergency at Local Level) plan, a risk management methodology used by dangerous chemical facilities. The methodology comprises the commitment of both Government and the community located in the risk area in the development of the emergency plan. In the nuclear sector, there is no similar methodology developed so far. However, establishing a communication channel between the nuclear segment and the community is essential. In Brazil, the construction of Angra 3 and the RMB (Multi Purpose Reactor) project stand as nuclear initiatives that improve the importance of a good communication to the public. Security issues of these projects are natural sources of concernment to the public, which is aggravated by events such as the Fukushima disaster. Without an effective communication about what means the presence of nuclear plants and reactors in a specific area, the interested public will only have an alarmist vision of the subject, given by those against these facilities. (author)