WorldWideScience

Sample records for identify important differences

  1. What Does It Take to Change an Editor's Mind? Identifying Minimally Important Difference Thresholds for Peer Reviewer Rating Scores of Scientific Articles.

    Science.gov (United States)

    Callaham, Michael; John, Leslie K

    2018-01-05

    We define a minimally important difference for the Likert-type scores frequently used in scientific peer review (similar to existing minimally important differences for scores in clinical medicine). The magnitude of score change required to change editorial decisions has not been studied, to our knowledge. Experienced editors at a journal in the top 6% by impact factor were asked how large a change of rating in "overall desirability for publication" was required to trigger a change in their initial decision on an article. Minimally important differences were assessed twice for each editor: once assessing the rating change required to shift the editor away from an initial decision to accept, and the other assessing the magnitude required to shift away from an initial rejection decision. Forty-one editors completed the survey (89% response rate). In the acceptance frame, the median minimally important difference was 0.4 points on a scale of 1 to 5. Editors required a greater rating change to shift from an initial rejection decision; in the rejection frame, the median minimally important difference was 1.2 points. Within each frame, there was considerable heterogeneity: in the acceptance frame, 38% of editors did not change their decision within the maximum available range; in the rejection frame, 51% did not. To our knowledge, this is the first study to determine the minimally important difference for Likert-type ratings of research article quality, or in fact any nonclinical scientific assessment variable. Our findings may be useful for future research assessing whether changes to the peer review process produce clinically meaningful differences in editorial decisionmaking. Copyright © 2017 American College of Emergency Physicians. Published by Elsevier Inc. All rights reserved.

  2. Systemic analysis of different colorectal cancer cell lines and TCGA datasets identified IGF-1R/EGFR-PPAR-CASPASE axis as important indicator for radiotherapy sensitivity.

    Science.gov (United States)

    Chen, Lin; Zhu, Zhe; Gao, Wei; Jiang, Qixin; Yu, Jiangming; Fu, Chuangang

    2017-09-05

    Insulin-like growth factor 1 receptor (IGF-1R) is proved to contribute the development of many types of cancers. But, little is known about its roles in radio-resistance of colorectal cancer (CRC). Here, we demonstrated that low IGF-1R expression value was associated with the better radiotherapy sensitivity of CRC. Besides, through Quantitative Real-time PCR (qRT-PCR), the elevated expression value of epidermal growth factor receptor (EGFR) was observed in CRC cell lines (HT29, RKO) with high radio-sensitivity compared with those with low sensitivity (SW480, LOVO). The irradiation induced apoptosis rates of wild type and EGFR agonist (EGF) or IGF-1R inhibitor (NVP-ADW742) treated HT29 and SW480 cells were quantified by flow cytometry. As a result, the apoptosis rate of EGF and NVP-ADW742 treated HT29 cells was significantly higher than that of those wild type ones, which indicated that high EGFR and low IGF-1R expression level in CRC was associated with the high sensitivity to radiotherapy. We next conducted systemic bioinformatics analysis of genome-wide expression profiles of CRC samples from the Cancer Genome Atlas (TCGA). Differential expression analysis between IGF-1R and EGFR abnormal CRC samples, i.e. CRC samples with higher IGF-1R and lower EGFR expression levels based on their median expression values, and the rest of CRC samples identified potential genes contribute to radiotherapy sensitivity. Functional enrichment of analysis of those differential expression genes (DEGs) in the Database for Annotation, Visualization and Integrated Discovery (DAVID) indicated PPAR signaling pathway as an important pathway for the radio-resistance of CRC. Our study identified the potential biomarkers for the rational selection of radiotherapy for CRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. The Importance of identifiers: IWGSC Meeting 20170720

    OpenAIRE

    Haak, Laurel

    2017-01-01

    Presentation by Laure Haak at the 20 July 2017 meeting of the IWGSC, about use of identifiers in connecting researchers, funding, facilities, and publications. Description of approach and initial results of User Facilities and Publications Working Group, and applications for Scientific Collections.

  4. Principal component analysis of normalized full spectrum mass spectrometry data in multiMS-toolbox: An effective tool to identify important factors for classification of different metabolic patterns and bacterial strains.

    Science.gov (United States)

    Cejnar, Pavel; Kuckova, Stepanka; Prochazka, Ales; Karamonova, Ludmila; Svobodova, Barbora

    2018-06-15

    Explorative statistical analysis of mass spectrometry data is still a time-consuming step. We analyzed critical factors for application of principal component analysis (PCA) in mass spectrometry and focused on two whole spectrum based normalization techniques and their application in the analysis of registered peak data and, in comparison, in full spectrum data analysis. We used this technique to identify different metabolic patterns in the bacterial culture of Cronobacter sakazakii, an important foodborne pathogen. Two software utilities, the ms-alone, a python-based utility for mass spectrometry data preprocessing and peak extraction, and the multiMS-toolbox, an R software tool for advanced peak registration and detailed explorative statistical analysis, were implemented. The bacterial culture of Cronobacter sakazakii was cultivated on Enterobacter sakazakii Isolation Agar, Blood Agar Base and Tryptone Soya Agar for 24 h and 48 h and applied by the smear method on an Autoflex speed MALDI-TOF mass spectrometer. For three tested cultivation media only two different metabolic patterns of Cronobacter sakazakii were identified using PCA applied on data normalized by two different normalization techniques. Results from matched peak data and subsequent detailed full spectrum analysis identified only two different metabolic patterns - a cultivation on Enterobacter sakazakii Isolation Agar showed significant differences to the cultivation on the other two tested media. The metabolic patterns for all tested cultivation media also proved the dependence on cultivation time. Both whole spectrum based normalization techniques together with the full spectrum PCA allow identification of important discriminative factors in experiments with several variable condition factors avoiding any problems with improper identification of peaks or emphasis on bellow threshold peak data. The amounts of processed data remain still manageable. Both implemented software utilities are available

  5. Identifying important motivational factors for professionals in Greek hospitals

    Science.gov (United States)

    Kontodimopoulos, Nick; Paleologou, Victoria; Niakas, Dimitris

    2009-01-01

    Background The purpose of this study was to identify important motivational factors according to the views of health-care professionals in Greek hospitals and particularly to determine if these might differ in the public and private sectors. Methods A previously developed -and validated- instrument addressing four work-related motivators (job attributes, remuneration, co-workers and achievements) was used. Three categories of health care professionals, doctors (N = 354), nurses (N = 581) and office workers (N = 418), working in public and private hospitals, participated and motivation was compared across socio-demographic and occupational variables. Results The range of reported motivational factors was mixed and Maslow's conclusions that lower level motivational factors must be met before ascending to the next level were not confirmed. The highest ranked motivator for the entire sample, and by professional subgroup, was achievements (P motivators were similar, and only one significant difference was observed, namely between doctors and nurses in respect to co-workers (P motivated by all factors significantly more than their public-hospital counterparts. Conclusion The results are in agreement with the literature which focuses attention to management approaches employing both monetary and non-monetary incentives to motivate health care workers. This study showed that intrinsic factors are particularly important and should become a target for effective employee motivation. PMID:19754968

  6. Identifying Importance-Performance Matrix Analysis (IPMA) of ...

    African Journals Online (AJOL)

    Identifying Importance-Performance Matrix Analysis (IPMA) of intellectual capital and Islamic work ethics in Malaysian SMES. ... capital and Islamic work ethics significantly influenced business performance. ... AJOL African Journals Online.

  7. Identifying the important factors in simulation models with many factors

    NARCIS (Netherlands)

    Bettonvil, B.; Kleijnen, J.P.C.

    1994-01-01

    Simulation models may have many parameters and input variables (together called factors), while only a few factors are really important (parsimony principle). For such models this paper presents an effective and efficient screening technique to identify and estimate those important factors. The

  8. Identifying important nodes by adaptive LeaderRank

    Science.gov (United States)

    Xu, Shuang; Wang, Pei

    2017-03-01

    Spreading process is a common phenomenon in complex networks. Identifying important nodes in complex networks is of great significance in real-world applications. Based on the spreading process on networks, a lot of measures have been proposed to evaluate the importance of nodes. However, most of the existing measures are appropriate to static networks, which are fragile to topological perturbations. Many real-world complex networks are dynamic rather than static, meaning that the nodes and edges of such networks may change with time, which challenge numerous existing centrality measures. Based on a new weighted mechanism and the newly proposed H-index and LeaderRank (LR), this paper introduces a variant of the LR measure, called adaptive LeaderRank (ALR), which is a new member of the LR-family. Simulations on six real-world networks reveal that the new measure can well balance between prediction accuracy and robustness. More interestingly, the new measure can better adapt to the adjustment or local perturbations of network topologies, as compared with the existing measures. By discussing the detailed properties of the measures from the LR-family, we illustrate that the ALR has its competitive advantages over the other measures. The proposed algorithm enriches the measures to understand complex networks, and may have potential applications in social networks and biological systems.

  9. Identifying important parameters for a continuous bioscouring process

    NARCIS (Netherlands)

    Lenting, H.B.M.; Lenting, H.B.M.; Zwier, E.; Nierstrasz, Vincent

    2002-01-01

    Compared to a bioscouring process in the batch mode, a continuously operating process requires relatively short processing steps. This study focusses on minimizing the required enzymatic incubation time. It is clear that the presence of a sufficient level of surfactant is of major importance in

  10. A landscape ecology approach identifies important drivers of urban biodiversity.

    Science.gov (United States)

    Turrini, Tabea; Knop, Eva

    2015-04-01

    Cities are growing rapidly worldwide, yet a mechanistic understanding of the impact of urbanization on biodiversity is lacking. We assessed the impact of urbanization on arthropod diversity (species richness and evenness) and abundance in a study of six cities and nearby intensively managed agricultural areas. Within the urban ecosystem, we disentangled the relative importance of two key landscape factors affecting biodiversity, namely the amount of vegetated area and patch isolation. To do so, we a priori selected sites that independently varied in the amount of vegetated area in the surrounding landscape at the 500-m scale and patch isolation at the 100-m scale, and we hold local patch characteristics constant. As indicator groups, we used bugs, beetles, leafhoppers, and spiders. Compared to intensively managed agricultural ecosystems, urban ecosystems supported a higher abundance of most indicator groups, a higher number of bug species, and a lower evenness of bug and beetle species. Within cities, a high amount of vegetated area increased species richness and abundance of most arthropod groups, whereas evenness showed no clear pattern. Patch isolation played only a limited role in urban ecosystems, which contrasts findings from agro-ecological studies. Our results show that urban areas can harbor a similar arthropod diversity and abundance compared to intensively managed agricultural ecosystems. Further, negative consequences of urbanization on arthropod diversity can be mitigated by providing sufficient vegetated space in the urban area, while patch connectivity is less important in an urban context. This highlights the need for applying a landscape ecological approach to understand the mechanisms shaping urban biodiversity and underlines the potential of appropriate urban planning for mitigating biodiversity loss. © 2015 John Wiley & Sons Ltd.

  11. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  12. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C. dubliniensis.

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, P.H.M.

    2003-01-01

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  13. How important are sex differences in cannabinoid action?

    Science.gov (United States)

    Fattore, Liana; Fratta, Walter

    2010-06-01

    In humans as in animals, males and females are dissimilar in their genetic and hormonally driven behaviour; they process information differently, perceive experience and emotions in different ways, display diverse attitudes, language and social skills, and show sex-related differences in the brain anatomy and organization. Drug addiction is a widespread relapsing illness that affects both men and women. Sex-dependent differences have been frequently observed in the biological and behavioural effects of substances of abuse, including cannabis. Beside sex differences observed in the cannabinoid-induced effects related to cannabis abuse and dependence, cannabinoids have been shown to exert sex-dependent effects also in other physiological and behavioural aspects, such as food intake and energy balance (more evident in males), or anxiety and depression (more evident in females). Research has just begun to identify factors which could provide a neurobiological basis for gender-based differences in cannabinoid effects, among which, gonadal hormones seem to play a crucial role. Yet, cannabinoid pharmacodynamic and pharmacokinetic may also be important, as sex differences in cannabinoid effects might be due, at least in part, to differences in muscle mass and fat tissue distribution between males and females. Here, we will review both clinical and laboratory-based research evidence revealing important sex-related differences in cannabinoid effects, and put forward some suggestions for future studies to fill the gap in our knowledge of gender-specific bias in cannabinoid pharmacology.

  14. Drosophila Cancer Models Identify Functional Differences between Ret Fusions.

    Science.gov (United States)

    Levinson, Sarah; Cagan, Ross L

    2016-09-13

    We generated and compared Drosophila models of RET fusions CCDC6-RET and NCOA4-RET. Both RET fusions directed cells to migrate, delaminate, and undergo EMT, and both resulted in lethality when broadly expressed. In all phenotypes examined, NCOA4-RET was more severe than CCDC6-RET, mirroring their effects on patients. A functional screen against the Drosophila kinome and a library of cancer drugs found that CCDC6-RET and NCOA4-RET acted through different signaling networks and displayed distinct drug sensitivities. Combining data from the kinome and drug screens identified the WEE1 inhibitor AZD1775 plus the multi-kinase inhibitor sorafenib as a synergistic drug combination that is specific for NCOA4-RET. Our work emphasizes the importance of identifying and tailoring a patient's treatment to their specific RET fusion isoform and identifies a multi-targeted therapy that may prove effective against tumors containing the NCOA4-RET fusion. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  15. Efficiency of different techniques to identify changes in land use

    Science.gov (United States)

    Zornoza, Raúl; Mateix-Solera, Jorge; Gerrero, César

    2013-04-01

    The need for the development of sensitive and efficient methodologies for soil quality evaluation is increasing. The ability to assess soil quality and identify key soil properties that serve as indicators of soil function is complicated by the multiplicity of physical, chemical and biological factors that control soil processes. In the mountain region of the Mediterranean Basin of Spain, almond trees have been cultivated in terraced orchards for centuries. These crops are immersed in the Mediterranean forest scenery, configuring a mosaic landscape where orchards are integrated in the forest masses. In the last decades, almond orchards are being abandoned, leading to an increase in vegetation cover, since abandoned fields are naturally colonized by the surrounded natural vegetation. Soil processes and properties are expected to be associated with vegetation successional dynamics. Thus, the establishment of suitable parameters to monitor soil quality related to land use changes is particularly important to guarantee the regeneration of the mature community. In this study, we selected three land uses, constituted by forest, almond trees orchards, and orchards abandoned between 10 and 15 years previously to sampling. Sampling was carried out in four different locations in SE Spain. The main purpose was to evaluate if changes in management have significantly influenced different sets of soil characteristics. For this purpose, we used a discriminant analysis (DA). The different sets of soil characteristics tested in this study were 1: physical, chemical and biochemical properties; 2: soil near infrared (NIR) spectra; and 3: phospholipid fatty acids (PLFAs). After the DA performed with the sets 1 and 2, the three land uses were clearly separated by the two first discriminant functions, and more than 85 % of the samples were correctly classified (grouped). Using the sets 3 and 4 for DA resulted in a slightly better separation of land uses, being more than 85% of the

  16. Methodology for identifying boundaries of systems important to safety in CANDU nuclear power plants

    International Nuclear Information System (INIS)

    Therrien, S.; Komljenovic, D.; Therrien, P.; Ruest, C.; Prevost, P.; Vaillancourt, R.

    2007-01-01

    This paper presents a methodology developed to identify the boundaries of the systems important to safety (SIS) at the Gentilly-2 Nuclear Power Plant (NPP), Hydro-Quebec. The SIS boundaries identification considers nuclear safety only. Components that are not identified as important to safety are systematically identified as related to safety. A global assessment process such as WANO/INPO AP-913 'Equipment Reliability Process' will be needed to implement adequate changes in the management rules of those components. The paper depicts results in applying the methodology to the Shutdown Systems 1 and 2 (SDS 1, 2), and to the Emergency Core Cooling System (ECCS). This validation process enabled fine tuning the methodology, performing a better estimate of the effort required to evaluate a system, and identifying components important to safety of these systems. (author)

  17. Relative importance of the different radionuclides for radiological consequences

    International Nuclear Information System (INIS)

    Manesse, D.

    1984-12-01

    This paper tries, for several source-terms, to estimate the relative importance of the different families of radioactive products in the calculation of radiological consequences; the study takes place in the case of accidental situations of PWR reactors [fr

  18. PCR-RFLP Method to Identify Salmonid Species of Economic Importance

    Directory of Open Access Journals (Sweden)

    Andreea Dudu

    2011-05-01

    Full Text Available The identification of different fish species by molecular methods has become necessary to avoid both the incorrect labelling of individuals involved in repopulation programmes and the commercial frauds on the fish market. Different fish species of great economical importance, like the salmonids, which are very much requested for their meat, can be identified using molecular techniques such as PCR-RFLP. The method is based on the amplification of a target region from the genome by PCR reaction followed by endonucleases digestion to detect the polymorphism of restriction fragments. In our study we analysed the following salmonid species from Romania: Salmo trutta fario, Salmo labrax, Salvelinus fontinalis, Onchorhynchus mykiss, Thymallus thymallus and Hucho hucho. In order to discriminate between the analysed species we amplified a fragment of mitochondrial genome comprising tRNAGlu/ cytochrome b/ tRNAThr/ tRNAPro/ D-loop/ tRNAPhe, followed by digestion with a specific restriction enzyme. The direct digestion of unpurified PCR products generated species-specific restriction patterns and proved to be a simple, reliable, inexpensive and fast method. Thus, it may be successfully utilized in specialized laboratories for the correct identification of the fish species for multiple purposes, including the traceability of fish food products.

  19. Genes Important for Schizosaccharomyces pombe Meiosis Identified Through a Functional Genomics Screen

    Science.gov (United States)

    Blyth, Julie; Makrantoni, Vasso; Barton, Rachael E.; Spanos, Christos; Rappsilber, Juri; Marston, Adele L.

    2018-01-01

    Meiosis is a specialized cell division that generates gametes, such as eggs and sperm. Errors in meiosis result in miscarriages and are the leading cause of birth defects; however, the molecular origins of these defects remain unknown. Studies in model organisms are beginning to identify the genes and pathways important for meiosis, but the parts list is still poorly defined. Here we present a comprehensive catalog of genes important for meiosis in the fission yeast, Schizosaccharomyces pombe. Our genome-wide functional screen surveyed all nonessential genes for roles in chromosome segregation and spore formation. Novel genes important at distinct stages of the meiotic chromosome segregation and differentiation program were identified. Preliminary characterization implicated three of these genes in centrosome/spindle pole body, centromere, and cohesion function. Our findings represent a near-complete parts list of genes important for meiosis in fission yeast, providing a valuable resource to advance our molecular understanding of meiosis. PMID:29259000

  20. Identifying selectively important amino acid positions associated with alternative habitat environments in fish mitochondrial genomes.

    Science.gov (United States)

    Xia, Jun Hong; Li, Hong Lian; Zhang, Yong; Meng, Zi Ning; Lin, Hao Ran

    2018-05-01

    Fish species inhabitating seawater (SW) or freshwater (FW) habitats have to develop genetic adaptations to alternative environment factors, especially salinity. Functional consequences of the protein variations associated with habitat environments in fish mitochondrial genomes have not yet received much attention. We analyzed 829 complete fish mitochondrial genomes and compared the amino acid differences of 13 mitochondrial protein families between FW and SW fish groups. We identified 47 specificity determining sites (SDS) that associated with FW or SW environments from 12 mitochondrial protein families. Thirty-two (68%) of the SDS sites are hydrophobic, 13 (28%) are neutral, and the remaining sites are acidic or basic. Seven of those SDS from ND1, ND2 and ND5 were scored as probably damaging to the protein structures. Furthermore, phylogenetic tree based Bayes Empirical Bayes analysis also detected 63 positive sites associated with alternative habitat environments across ten mtDNA proteins. These signatures could be important for studying mitochondrial genetic variation relevant to fish physiology and ecology.

  1. Reducing uncertainty at minimal cost: a method to identify important input parameters and prioritize data collection

    NARCIS (Netherlands)

    Uwizeye, U.A.; Groen, E.A.; Gerber, P.J.; Schulte, Rogier P.O.; Boer, de I.J.M.

    2016-01-01

    The study aims to illustrate a method to identify important input parameters that explain most of the output variance ofenvironmental assessment models. The method is tested for the computation of life-cycle nitrogen (N) use efficiencyindicators among mixed dairy production systems in Rwanda. We

  2. Latent cluster analysis of ALS phenotypes identifies prognostically differing groups.

    Directory of Open Access Journals (Sweden)

    Jeban Ganesalingam

    2009-09-01

    Full Text Available Amyotrophic lateral sclerosis (ALS is a degenerative disease predominantly affecting motor neurons and manifesting as several different phenotypes. Whether these phenotypes correspond to different underlying disease processes is unknown. We used latent cluster analysis to identify groupings of clinical variables in an objective and unbiased way to improve phenotyping for clinical and research purposes.Latent class cluster analysis was applied to a large database consisting of 1467 records of people with ALS, using discrete variables which can be readily determined at the first clinic appointment. The model was tested for clinical relevance by survival analysis of the phenotypic groupings using the Kaplan-Meier method.The best model generated five distinct phenotypic classes that strongly predicted survival (p<0.0001. Eight variables were used for the latent class analysis, but a good estimate of the classification could be obtained using just two variables: site of first symptoms (bulbar or limb and time from symptom onset to diagnosis (p<0.00001.The five phenotypic classes identified using latent cluster analysis can predict prognosis. They could be used to stratify patients recruited into clinical trials and generating more homogeneous disease groups for genetic, proteomic and risk factor research.

  3. Identifying Differences in Cultural Behavior in Online Groups

    Energy Technology Data Exchange (ETDEWEB)

    Gregory, Michelle L.; Engel, David W.; Bell, Eric B.; Mcgrath, Liam R.

    2012-07-23

    We have developed methods to identify online communities, or groups, using a combination of structural information variables and content information variables from weblog posts and their comments to build a characteristic footprint for groups. We have worked with both explicitly connected groups and 'abstract' groups, in which the connection between individuals is in interest (as determined by content based features) and behavior (metadata based features) as opposed to explicit links. We find that these variables do a good job at identifying groups, placing members within a group, and helping determine the appropriate granularity for group boundaries. The group footprint can then be used to identify differences between the online groups. In the work described here we are interested in determining how an individual's online behavior is influenced by their membership in more than one group. For example, individuals belong to a certain culture; they may belong as well to a demographic group, and other 'chosen' groups such as churches or clubs. There is a plethora of evidence surrounding the culturally sensitive adoption, use, and behavior on the Internet. In this work we begin to investigate how culturally defined internet behaviors may influence behaviors of subgroups. We do this through a series of experiments in which we analyze the interaction between culturally defined behaviors and the behaviors of the subgroups. Our goal is to (a) identify if our features can capture cultural distinctions in internet use, and (b) determine what kinds of interaction there are between levels and types of groups.

  4. Atrioventricular depolarization differences identify coronary artery anomalies in Kawasaki disease.

    Science.gov (United States)

    Cortez, Daniel; Sharma, Nandita; Jone, Pei-Ni

    2017-03-01

    Kawasaki disease (KD) is the leading cause of acquired heart disease in children. Signal average electrocardiogram changes in patients during the acute phase of KD with coronary artery anomalies (CAA) include depolarization changes. We set out to determine if 12-lead-derived atrioventricular depolarization differences can identify CAA in patients with KD. A blinded, retrospective case-control study of patients with KD was performed. Deep Q waves, corrected QT-intervals (QTc), spatial QRS-T angles, T-wave vector magnitudes (RMS-T), and a novel parameter for assessment of atrioventricular depolarization difference (the spatial PR angle) and a two dimensional PR angle were assessed. Comparisons between groups were performed to test for significant differences. One hundred one patients with KD were evaluated, with 68 having CAA (67.3%, mean age 3.6 ± 3.0 years, 82.6% male), and 32 without CAA (31.7%, mean age 2.7 ± 3.2 years, 70.4% male). The spatial PR angle significantly discriminated KD patients with CAA from those without, 59.7° ± 31.1° versus 41.6° ± 11.5° (p differences, measured by the spatial or two dimensional PR angle differentiate KD patients with CAA versus those without. © 2016 Wiley Periodicals, Inc.

  5. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C-dubliniensis

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, PHM

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  6. Study of a methodology of identifying important research problems by the PIRT process

    International Nuclear Information System (INIS)

    Aoki, Takayuki; Takagi, Toshiyuki; Urayama, Ryoichi; Komura, Ichiro; Furukawa, Takashi; Yusa, Noritaka

    2014-01-01

    In this paper, we propose a new methodology of identifying important research problems to be solved to improve the performance of some specific scientific technologies by the phenomena identification and ranking table (PIRT) process which has been used as a methodology for demonstrating the validity of the best estimate simulation codes in US Nuclear Regulatory Commission (USNRC) licensing of nuclear power plants. The new methodology makes it possible to identify important factors affecting the performance of the technologies from the viewpoint of the figure of merit and problems associated with them while it keeps the fundamental concepts of the original PIRT process. Also in this paper, we demonstrate the effectiveness of the new methodology by applying it to a task of extracting research problems for improving an inspection accuracy of ultrasonic testing or eddy current testing in the inspection of objects having cracks due to fatigue or stress corrosion cracking. (author)

  7. Study of a methodology of identifying important research problems by the PIRT process

    International Nuclear Information System (INIS)

    Aoki, Takayuki; Takagi, Toshiyuki; Urayama, Ryoichi; Komura, Ichiro; Furukawa, Takashi; Yusa, Noritaka

    2013-01-01

    In this paper, we propose a new methodology of identifying important research problems to be solved to improve the performance of some specific scientific technologies by the phenomena identification and ranking table (PIRT) process, which has been used as a methodology for demonstrating the validity of the best estimate simulation codes in USNRC licensing of nuclear power plants. It keeps the fundamental concepts of the original PIRT process but makes it possible to identify important factors affecting the performance of the technologies from the viewpoint of the figure of merit and problems associated with them, which need to be solved to improve the performance. Also in this paper, we demonstrate the effectiveness of the developed method by showing a specific example of the application to physical events or phenomena in objects having fatigue or SCC crack(s) under ultrasonic testing and eddy current testing. (author)

  8. Identifying Controlling Nodes in Neuronal Networks in Different Scales

    Science.gov (United States)

    Tang, Yang; Gao, Huijun; Zou, Wei; Kurths, Jürgen

    2012-01-01

    Recent studies have detected hubs in neuronal networks using degree, betweenness centrality, motif and synchronization and revealed the importance of hubs in their structural and functional roles. In addition, the analysis of complex networks in different scales are widely used in physics community. This can provide detailed insights into the intrinsic properties of networks. In this study, we focus on the identification of controlling regions in cortical networks of cats’ brain in microscopic, mesoscopic and macroscopic scales, based on single-objective evolutionary computation methods. The problem is investigated by considering two measures of controllability separately. The impact of the number of driver nodes on controllability is revealed and the properties of controlling nodes are shown in a statistical way. Our results show that the statistical properties of the controlling nodes display a concave or convex shape with an increase of the allowed number of controlling nodes, revealing a transition in choosing driver nodes from the areas with a large degree to the areas with a low degree. Interestingly, the community Auditory in cats’ brain, which has sparse connections with other communities, plays an important role in controlling the neuronal networks. PMID:22848475

  9. Resequencing 50 accessions of cultivated and wild rice yields markers for identifying agronomically important genes

    DEFF Research Database (Denmark)

    Xu, Xun; Liu, Xin; Ge, Song

    2012-01-01

    Rice is a staple crop that has undergone substantial phenotypic and physiological changes during domestication. Here we resequenced the genomes of 40 cultivated accessions selected from the major groups of rice and 10 accessions of their wild progenitors (Oryza rufipogon and Oryza nivara) to >15 x...... diversity in cultivated but not wild rice, which represent candidate regions selected during domestication. Some of these variants are associated with important biological features, whereas others have yet to be functionally characterized. The molecular markers we have identified should be valuable...... raw data coverage. We investigated genome-wide variation patterns in rice and obtained 6.5 million high-quality single nucleotide polymorphisms (SNPs) after excluding sites with missing data in any accession. Using these population SNP data, we identified thousands of genes with significantly lower...

  10. On the importance of identifying, characterizing, and predicting fundamental phenomena towards microbial electrochemistry applications.

    Science.gov (United States)

    Torres, César Iván

    2014-06-01

    The development of microbial electrochemistry research toward technological applications has increased significantly in the past years, leading to many process configurations. This short review focuses on the need to identify and characterize the fundamental phenomena that control the performance of microbial electrochemical cells (MXCs). Specifically, it discusses the importance of recent efforts to discover and characterize novel microorganisms for MXC applications, as well as recent developments to understand transport limitations in MXCs. As we increase our understanding of how MXCs operate, it is imperative to continue modeling efforts in order to effectively predict their performance, design efficient MXC technologies, and implement them commercially. Thus, the success of MXC technologies largely depends on the path of identifying, understanding, and predicting fundamental phenomena that determine MXC performance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. Statistical Analyses of Scatterplots to Identify Important Factors in Large-Scale Simulations

    Energy Technology Data Exchange (ETDEWEB)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-04-01

    The robustness of procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses is investigated. These procedures are based on attempts to detect increasingly complex patterns in the scatterplots under consideration and involve the identification of (1) linear relationships with correlation coefficients, (2) monotonic relationships with rank correlation coefficients, (3) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (4) trends in variability as defined by variances and interquartile ranges, and (5) deviations from randomness as defined by the chi-square statistic. The following two topics related to the robustness of these procedures are considered for a sequence of example analyses with a large model for two-phase fluid flow: the presence of Type I and Type II errors, and the stability of results obtained with independent Latin hypercube samples. Observations from analysis include: (1) Type I errors are unavoidable, (2) Type II errors can occur when inappropriate analysis procedures are used, (3) physical explanations should always be sought for why statistical procedures identify variables as being important, and (4) the identification of important variables tends to be stable for independent Latin hypercube samples.

  12. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae

    Directory of Open Access Journals (Sweden)

    Seong Hwan Park

    2013-01-01

    Full Text Available Identifying species of insects used to estimate postmortem interval (PMI is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science.

  13. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae)

    Science.gov (United States)

    Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon

    2013-01-01

    Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044

  14. Identify the Important Decision Factors of Online Shopping Adoption in Indonesia

    Directory of Open Access Journals (Sweden)

    Lailatul HIJRAH

    2017-12-01

    Full Text Available The objective of this study is to identify factors encouraging a consumer to engage in online shopping activities. The expected contribution of this study is for online entrepreneurs, in order to develop the most suitable business strategy, so that it will be clearly identified and sorted out which factors are the most important and the main motivation of Indonesian consumers to shop via online by using responses from respondents who usually shop online and offline in 3 cities in Indonesia, Jakarta, Surabaya and Samarinda. The research instruments were developed by conducting FGDs on relevant groups, either academics, online shopping activists, suppliers and courier businessmen in Jakarta, Surabaya and Samarinda Cities in effort to extract any information that encourages consumers to online shopping. After conducting FGD, the researcher produced 48 items proposed for factor analysis and after extracted to form eleven constructs, some items were removed because they had less loading factors. The eleven constructs or dimensions are trust, risk, consumer factors, website factors, price, service quality, convenience, subjective norm, product guarantee, variety of products and lifestyle. The implications of this study provide valuable insights about consumer decisions to online shopping or not online shopping.

  15. Systematic reviews identify important methodological flaws in stroke rehabilitation therapy primary studies: review of reviews.

    Science.gov (United States)

    Santaguida, Pasqualina; Oremus, Mark; Walker, Kathryn; Wishart, Laurie R; Siegel, Karen Lohmann; Raina, Parminder

    2012-04-01

    A "review of reviews" was undertaken to assess methodological issues in studies evaluating nondrug rehabilitation interventions in stroke patients. MEDLINE, CINAHL, PsycINFO, and the Cochrane Database of Systematic Reviews were searched from January 2000 to January 2008 within the stroke rehabilitation setting. Electronic searches were supplemented by reviews of reference lists and citations identified by experts. Eligible studies were systematic reviews; excluded citations were narrative reviews or reviews of reviews. Review characteristics and criteria for assessing methodological quality of primary studies within them were extracted. The search yielded 949 English-language citations. We included a final set of 38 systematic reviews. Cochrane reviews, which have a standardized methodology, were generally of higher methodological quality than non-Cochrane reviews. Most systematic reviews used standardized quality assessment criteria for primary studies, but not all were comprehensive. Reviews showed that primary studies had problems with randomization, allocation concealment, and blinding. Baseline comparability, adverse events, and co-intervention or contamination were not consistently assessed. Blinding of patients and providers was often not feasible and was not evaluated as a source of bias. The eligible systematic reviews identified important methodological flaws in the evaluated primary studies, suggesting the need for improvement of research methods and reporting. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Identifying and managing cross-cultural differences in the classroom ...

    African Journals Online (AJOL)

    Many learning institutions are now designed to cater to the needs of students and staff from different cultures. The United States International University (USIU) in. Kenya is no different. It provides learning opportunities to learners from different nations and regions of the world. When these learners and other staff come into ...

  17. Identifying Different Registers of Digital Literacy in Virtual Learning Environments

    Science.gov (United States)

    Knutsson, Ola; Blasjo, Mona.; Hallsten, Stina; Karlstrom, Petter

    2012-01-01

    In this paper social semiotics, and systemic functional linguistics in particular, are used in order to identify registers of digital literacy in the use of virtual learning environments. The framework of social semiotics provides means to systemize and discuss digital literacy as a linguistic and semiotic issue. The following research question…

  18. Similar or different?: the importance of similarities and differences for support between siblings

    NARCIS (Netherlands)

    Voorpostel, M.; van der Lippe, T.; Dykstra, P.A.; Flap, H.

    2007-01-01

    Using a large-scale Dutch national sample (N = 7,126), the authors examine the importance of similarities and differences in the sibling dyad for the provision of support. Similarities are assumed to enhance attraction and empathy; differences are assumed to be related to different possibilities for

  19. Similar or Different? The Importance of Similarities and Differences for Support Between Siblings

    NARCIS (Netherlands)

    Voorpostel, Marieke; Lippe, Tanja van der; Dykstra, Pearl A.; Flap, Henk

    2007-01-01

    Using a large-scale Dutch national sample (N = 7,126), the authors examine the importance of similarities and differences in the sibling dyad for the provision of support. Similarities are assumed to enhance attraction and empathy; differences are assumed to be related to different possibilities for

  20. Minimal clinically important difference in the fibromyalgia impact questionnaire.

    Science.gov (United States)

    Bennett, Robert M; Bushmakin, Andrew G; Cappelleri, Joseph C; Zlateva, Gergana; Sadosky, Alesia B

    2009-06-01

    The Fibromyalgia Impact Questionnaire (FIQ) is a disease-specific composite instrument that measures the effect of problems experienced by patients with fibromyalgia (FM). Utilization of the FIQ in measuring changes due to interventions in FM requires derivation of a clinically meaningful change for that instrument. Analyses were conducted to estimate the minimal clinically important difference (MCID), and to propose FIQ severity categories. Data from 3 similarly designed, 3-month placebo-controlled, clinical treatment trials of pregabalin 300, 450, and 600 mg/day in patients with FM were modeled to estimate the change in the mean FIQ total and stiffness items corresponding to each category on the Patient Global Impression of Change. FIQ severity categories were modeled and determined using established pain severity cutpoints as an anchor. A total of 2228 patients, mean age 49 years, 93% women, with a mean baseline FIQ total score of 62 were treated in the 3 studies. Estimated MCID on a given measure were similar across the studies. In a pooled analysis the estimated MCID (95% confidence interval) was 14% (13; 15) and for FIQ stiffness it was 13% (12; 14). In the severity analysis a FIQ total score from 0 to or= 39 to or=59 to 100 a severe effect. The analysis indicates that a 14% change in the FIQ total score is clinically relevant, and results of these analyses should enhance the clinical utility of the FIQ in research and practice.

  1. Public and Private Sector IT Governance: Identifying Contextual Differences

    Directory of Open Access Journals (Sweden)

    John Campbell

    2010-01-01

    Full Text Available This paper highlights systemic contextual differences and the unique IT Governance issues that might arise in public and private sector organizations. Public sector organizations constitute a significant component of economic activity in most countries. Like their private sector counterparts, many public sector agencies are struggling to cope with reduced or inadequate IT budgets and are continuously looking for ways to extract maximum value from IT resources. While both sectors face similar managerial-level IT issues and challenges, we argue that there are systemic differences between private and public sector organizations suggesting that a one size fits all approach to IT Governance may not apply.

  2. Identifying the dominating perceptual differences in headphone reproduction

    DEFF Research Database (Denmark)

    Volk, Christer Peter; Lavandier, Mathieu; Bech, Søren

    2016-01-01

    The perceptual differences between the sound reproductions of headphones were investigated in a pair-wise comparison study. Two musical excerpts were reproduced over 21 headphones positioned on a mannequin and recorded. The recordings were then processed and reproduced over one set of headphones ...

  3. Public and Private Sector IT Governance: Identifying Contextual Differences

    OpenAIRE

    John Campbell; Craig McDonald; Tsholofelo Sethibe

    2010-01-01

    This paper highlights systemic contextual differences and the unique IT Governance issues that might arise in public and private sector organizations. Public sector organizations constitute a significant component of economic activity in most countries. Like their private sector counterparts, many public sector agencies are struggling to cope with reduced or inadequate IT budgets and are continuously looking for ways to extract maximum value from IT resources. While both sectors face similar ...

  4. Computational Approach to Identify Different Injuries by Firearms.

    Science.gov (United States)

    Costa, Sarah Teixeira; Freire, Alexandre Rodrigues; Matoso, Rodrigo Ivo; Daruge Júnior, Eduardo; Rossi, Ana Cláudia; Prado, Felippe Bevilacqua

    2017-03-01

    Complications arise in the analysis of gunshot wounds to the maxillofacial region, when neither the projectile nor the gun is found at the crime scene. We simulated 5- and 15-cm firing distances at a human mandible to investigate the external morphology of entrance wounds based on fire range. The ammunition models, .40-caliber S&W, .380-caliber, and 9 × 19-mm Luger, were constructed with free-form NURBS surfaces. In a dynamic simulation, projectiles were fired against mandibular body 3D model at 5 and 15 cm. All entrance wounds presented oval aspect. Maximum diameter and von Mises stress values were 16.5 mm and 50.8 MPa, both for .40-caliber S&W fired at 5 cm. The maximum energy loss was 138.4 J for .40 S&W fired at 15 cm. In conclusion, the mandible was most affected by .40-caliber S&W and morphological differences were observable in holes caused by different incoming projectile calibers fired at different distances. © 2017 American Academy of Forensic Sciences.

  5. Identifying Important Atlantic Areas for the conservation of Balearic shearwaters: Spatial overlap with conservation areas

    Science.gov (United States)

    Pérez-Roda, Amparo; Delord, Karine; Boué, Amélie; Arcos, José Manuel; García, David; Micol, Thierry; Weimerskirch, Henri; Pinaud, David; Louzao, Maite

    2017-07-01

    Marine protected areas (MPAs) are considered one of the main tools in both fisheries and conservation management to protect threatened species and their habitats around the globe. However, MPAs are underrepresented in marine environments compared to terrestrial environments. Within this context, we studied the Atlantic non-breeding distribution of the southern population of Balearic shearwaters (Puffinus mauretanicus) breeding in Eivissa during the 2011-2012 period based on global location sensing (GLS) devices. Our objectives were (1) to identify overall Important Atlantic Areas (IAAs) from a southern population, (2) to describe spatio-temporal patterns of oceanographic habitat use, and (3) to assess whether existing conservation areas (Natura 2000 sites and marine Important Bird Areas (IBAs)) cover the main IAAs of Balearic shearwaters. Our results highlighted that the Atlantic staging (from June to October in 2011) dynamic of the southern population was driven by individual segregation at both spatial and temporal scales. Individuals ranged in the North-East Atlantic over four main IAAs (Bay of Biscay: BoB, Western Iberian shelf: WIS, Gulf of Cadiz: GoC, West of Morocco: WoM). While most individuals spent more time on the WIS or in the GoC, a small number of birds visited IAAs at the extremes of their Atlantic distribution range (i.e., BoB and WoM). The chronology of the arrivals to the IAAs showed a latitudinal gradient with northern areas reached earlier during the Atlantic staging. The IAAs coincided with the most productive areas (higher chlorophyll a values) in the NE Atlantic between July and October. The spatial overlap between IAAs and conservation areas was higher for Natura 2000 sites than marine IBAs (areas with and without legal protection, respectively). Concerning the use of these areas, a slightly higher proportion of estimated positions fell within marine IBAs compared to designated Natura 2000 sites, with Spanish and Portuguese conservation

  6. Gender differences in identifying emotions from auditory and visual stimuli.

    Science.gov (United States)

    Waaramaa, Teija

    2017-12-01

    The present study focused on gender differences in emotion identification from auditory and visual stimuli produced by two male and two female actors. Differences in emotion identification from nonsense samples, language samples and prolonged vowels were investigated. It was also studied whether auditory stimuli can convey the emotional content of speech without visual stimuli, and whether visual stimuli can convey the emotional content of speech without auditory stimuli. The aim was to get a better knowledge of vocal attributes and a more holistic understanding of the nonverbal communication of emotion. Females tended to be more accurate in emotion identification than males. Voice quality parameters played a role in emotion identification in both genders. The emotional content of the samples was best conveyed by nonsense sentences, better than by prolonged vowels or shared native language of the speakers and participants. Thus, vocal non-verbal communication tends to affect the interpretation of emotion even in the absence of language. The emotional stimuli were better recognized from visual stimuli than auditory stimuli by both genders. Visual information about speech may not be connected to the language; instead, it may be based on the human ability to understand the kinetic movements in speech production more readily than the characteristics of the acoustic cues.

  7. Identifying Gender Differences in an Australian Youth Offender Population

    Directory of Open Access Journals (Sweden)

    Stephane M. Shepherd

    2013-06-01

    Full Text Available The study examined gender differences in risk factors for violence in a sample of 213 male and female youths held in Youth Justice Centres in Victoria, Australia. Although violence risk factors are considered to be commensurate across gender, a growing body of international literature is categorizing gender-specific criminal trajectories. The study aimed to investigate this concept in an Australian juvenile context. Through the use of a widely validated youth violence risk assessment inventory, the prevalence of salient risk items was compared across gender. Young female offenders were found to present with higher levels of family dysfunction, peer rejection and self-injurious behavior reflecting international female offending pathways literature.

  8. The most important culture differences and elements of intercultural communication

    Institute of Scientific and Technical Information of China (English)

    张乐

    2012-01-01

    This paper wrote about the cultural differences. There are four dimensions: power distance, uncertainty avoidance, individualism and masculinity. After that, paper talked about the intercultural communication, which contains language, non-verbal communication, time and space concept. Then talked different cultures do cause problems in business. To avoid misunderstanding and clashes, the international managers should realize and understand the different cultures, adapt themselves to fit into the business environment in order to get the best achievement in business.

  9. Global sensitivity analysis for identifying important parameters of nitrogen nitrification and denitrification under model uncertainty and scenario uncertainty

    Science.gov (United States)

    Chen, Zhuowei; Shi, Liangsheng; Ye, Ming; Zhu, Yan; Yang, Jinzhong

    2018-06-01

    Nitrogen reactive transport modeling is subject to uncertainty in model parameters, structures, and scenarios. By using a new variance-based global sensitivity analysis method, this paper identifies important parameters for nitrogen reactive transport with simultaneous consideration of these three uncertainties. A combination of three scenarios of soil temperature and two scenarios of soil moisture creates a total of six scenarios. Four alternative models describing the effect of soil temperature and moisture content are used to evaluate the reduction functions used for calculating actual reaction rates. The results show that for nitrogen reactive transport problem, parameter importance varies substantially among different models and scenarios. Denitrification and nitrification process is sensitive to soil moisture content status rather than to the moisture function parameter. Nitrification process becomes more important at low moisture content and low temperature. However, the changing importance of nitrification activity with respect to temperature change highly relies on the selected model. Model-averaging is suggested to assess the nitrification (or denitrification) contribution by reducing the possible model error. Despite the introduction of biochemical heterogeneity or not, fairly consistent parameter importance rank is obtained in this study: optimal denitrification rate (Kden) is the most important parameter; reference temperature (Tr) is more important than temperature coefficient (Q10); empirical constant in moisture response function (m) is the least important one. Vertical distribution of soil moisture but not temperature plays predominant role controlling nitrogen reaction. This study provides insight into the nitrogen reactive transport modeling and demonstrates an effective strategy of selecting the important parameters when future temperature and soil moisture carry uncertainties or when modelers face with multiple ways of establishing nitrogen

  10. Statistical analyses of scatterplots to identify important factors in large-scale simulations, 1: Review and comparison of techniques

    International Nuclear Information System (INIS)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-01-01

    Procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses are described and illustrated. These procedures attempt to detect increasingly complex patterns in scatterplots and involve the identification of (i) linear relationships with correlation coefficients, (ii) monotonic relationships with rank correlation coefficients, (iii) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (iv) trends in variability as defined by variances and interquartile ranges, and (v) deviations from randomness as defined by the chi-square statistic. A sequence of example analyses with a large model for two-phase fluid flow illustrates how the individual procedures can differ in the variables that they identify as having effects on particular model outcomes. The example analyses indicate that the use of a sequence of procedures is a good analysis strategy and provides some assurance that an important effect is not overlooked

  11. Health status measurement in COPD : the minimal clinically important difference of the clinical COPD questionnaire

    NARCIS (Netherlands)

    Kocks, J. W. H.; Tuinenga, M. G.; Uil, S. M.; van den Berg, J. W. K.; Stahl, E.; van der Molen, T.

    2006-01-01

    Background: Patient-reported outcomes ( PRO) questionnaires are being increasingly used in COPD clinical studies. The challenge facing investigators is to determine what change is significant, ie what is the minimal clinically important difference (MCID). This study aimed to identify the MCID for

  12. Promoting wellbeing in young unemployed adults: the importance of identifying meaningful patterns of time use.

    Science.gov (United States)

    Scanlan, Justin Newton; Bundy, Anita C; Matthews, Lynda R

    2011-04-01

    This study set out to explore the differences in time use between 'unemployed', 'unemployed but in education' and part-time and full-time employed 18- to 25-year-old Australians. Unemployed individuals generally experience poor health and this may be related to the way they use their time. Activity-based interventions may be one health-promoting strategy. This knowledge is important for all occupational therapists, as many service users are likely to be unemployed. Time use of unemployed 18- to 25-year-olds (measured using the Modified Occupational Questionnaire) was compared with the time use of part- and full-time employed 18- to 25-year-olds (from the 2006 Australian Time Use Survey). Individuals in the 'unemployed' groups spent significantly less time engaged in work-related activities than their employed peers. This time was reallocated mainly to recreation and leisure and household work (for both men and women) and child care and sleeping (women only). Recreation and leisure activities were generally passive, home-based activities such as watching television or 'doing nothing'. Individuals in the 'unemployed but in education' groups also spent less time in employment-related activities, but the majority of this time was reallocated to education activities. Individuals in the 'unemployed' groups spent large amounts of time engaged in potentially non-directed use of time (e.g. watching television or 'doing nothing'). Such patterns of time use have previously been associated with poor health. To support the health of unemployed individuals more effectively, occupational therapy interventions must focus on enhancing the quality of time use for this population. © 2010 The Authors. Australian Occupational Therapy Journal © 2010 Australian Association of Occupational Therapists.

  13. Imaging-Based Screen Identifies Laminin 411 as a Physiologically Relevant Niche Factor with Importance for i-Hep Applications

    Directory of Open Access Journals (Sweden)

    John Ong

    2018-03-01

    Full Text Available Summary: Use of hepatocytes derived from induced pluripotent stem cells (i-Heps is limited by their functional differences in comparison with primary cells. Extracellular niche factors likely play a critical role in bridging this gap. Using image-based characterization (high content analysis; HCA of freshly isolated hepatocytes from 17 human donors, we devised and validated an algorithm (Hepatocyte Likeness Index; HLI for comparing the hepatic properties of cells against a physiological gold standard. The HLI was then applied in a targeted screen of extracellular niche factors to identify substrates driving i-Heps closer to the standard. Laminin 411, the top hit, was validated in two additional induced pluripotent stem cell (iPSC lines, primary tissue, and an in vitro model of α1-antitrypsin deficiency. Cumulatively, these data provide a reference method to control and screen for i-Hep differentiation, identify Laminin 411 as a key niche protein, and underscore the importance of combining substrates, soluble factors, and HCA when developing iPSC applications. : Rashid and colleagues demonstrate the utility of a high-throughput imaging platform for identification of physiologically relevant extracellular niche factors to advance i-Heps closer to their primary tissue counterparts. The extracellular matrix (ECM protein screen identified Laminin 411 as an important niche factor facilitating i-Hep-based disease modeling in vitro. Keywords: iPS hepatocytes, extracellular niche, image-based screening, disease modeling, laminin

  14. Importance of life domains in different cultural groups.

    Science.gov (United States)

    Elizur, Dov; Kantor, Jeffrey; Yaniv, Eyal; Sagie, Abraham

    2008-01-01

    This study assessed the role of individualism and collectivism in the shaping of personal values of Canadians, Israelis, and Palestinians. Based on Sagie and Elizur's (1996) multifaceted approach, we distinguished personal values that are individual centered (i.e., associated with one's home, family, or work) from collective-centered values (i.e., associated with the religion, sports, or politics). The magnitude of the difference between both value types differs according to cultural orientation. As compared with Palestinians, we predicted that Canadians and Israelis would rank individual-centered values higher and collective-centered values lower. Data obtained from samples of Palestinians, Israelis, and Canadians supported this hypothesis.

  15. Are gender differences important for the clinical effects of antidepressants?

    DEFF Research Database (Denmark)

    Hildebrandt, Malene Grubbe; Steyerberg, Ewout Willem; Stage, Kurt Bjerregaard

    2003-01-01

    OBJECTIVE: Gender differences in antidepressant treatment response, side effects, dropout rates, and plasma concentrations were examined in patients with major and predominantly melancholic depression. METHOD: The study included a subgroup of 292 inpatients (96 men, 196 women) from three Danish...... and multiple linear and logistic regression models were used for statistical evaluations. RESULTS: Both genders had similar remission rates (Hamilton depression scale score .... The plasma concentrations of clomipramine were significantly higher for female than for male patients. No gender differences were found in posttreatment Hamilton depression scale scores, nor did the therapeutic effects of treatment depend on gender. Rates of dropout and side effects were similar for men...

  16. Competence Description for Personal Recommendations: The Importance of Identifying the Complexity of Learning and Performance Situations

    Science.gov (United States)

    Prins, Frans J.; Nadolski, Rob J.; Berlanga, Adriana J.; Drachsler, Hendrik; Hummel, Hans G. K.; Koper, Rob

    2008-01-01

    For competences development of learners and professionals, target competences and corresponding competence development opportunities have to be identified. Personal Recommender Systems (PRS) provide personal recommendations for learners aimed at finding and selecting learning activities that best match their needs. This article argues that a…

  17. Identifying Important Career Indicators of Undergraduate Geoscience Students Upon Completion of Their Degree

    Science.gov (United States)

    Wilson, C. E.; Keane, C. M.; Houlton, H. R.

    2012-12-01

    The American Geosciences Institute (AGI) decided to create the National Geoscience Student Exit Survey in order to identify the initial pathways into the workforce for these graduating students, as well as assess their preparedness for entering the workforce upon graduation. The creation of this survey stemmed from a combination of experiences with the AGI/AGU Survey of Doctorates and discussions at the following Science Education Research Center (SERC) workshops: "Developing Pathways to Strong Programs for the Future", "Strengthening Your Geoscience Program", and "Assessing Geoscience Programs". These events identified distinct gaps in understanding the experiences and perspectives of geoscience students during one of their most profound professional transitions. Therefore, the idea for the survey arose as a way to evaluate how the discipline is preparing and educating students, as well as identifying the students' desired career paths. The discussions at the workshops solidified the need for this survey and created the initial framework for the first pilot of the survey. The purpose of this assessment tool is to evaluate student preparedness for entering the geosciences workforce; identify student decision points for entering geosciences fields and remaining in the geosciences workforce; identify geosciences fields that students pursue in undergraduate and graduate school; collect information on students' expected career trajectories and geosciences professions; identify geosciences career sectors that are hiring new graduates; collect information about salary projections; overall effectiveness of geosciences departments regionally and nationally; demonstrate the value of geosciences degrees to future students, the institutions, and employers; and establish a benchmark to perform longitudinal studies of geosciences graduates to understand their career pathways and impacts of their educational experiences on these decisions. AGI's Student Exit Survey went through

  18. Genome-wide association study identified copy number variants important for appendicular lean mass.

    Science.gov (United States)

    Ran, Shu; Liu, Yong-Jun; Zhang, Lei; Pei, Yufang; Yang, Tie-Lin; Hai, Rong; Han, Ying-Ying; Lin, Yong; Tian, Qing; Deng, Hong-Wen

    2014-01-01

    Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM), is a heritable trait. Copy number variation (CNV) is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2) and 3.34×10(-3), respectively). In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2) and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1), which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL) gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.

  19. Genome-wide association study identified copy number variants important for appendicular lean mass.

    Directory of Open Access Journals (Sweden)

    Shu Ran

    Full Text Available Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM, is a heritable trait. Copy number variation (CNV is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2 and 3.34×10(-3, respectively. In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2 and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1, which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.

  20. Identifying faecal impaction is important for ensuring the timely diagnosis of childhood functional constipation

    DEFF Research Database (Denmark)

    Modin, Line; Walsted, Anne-Mette; Jakobsen, Marianne Skytte

    2015-01-01

    AIM: Most research on functional constipation has been carried out at a tertiary level. We focused this study on a secondary-level hospital outpatients' department, assessing the distribution of diagnostic criteria for childhood functional constipation and evaluating the consequences of current...... diagnostic practice based on current guidelines. METHODS: We enrolled 235 children, aged two to 16 years of age, with functional constipation according to the Rome III criteria and assessed them using medical histories and physical examinations, including rectal examinations and ultrasound measurements...... the timely diagnosis of childhood functional constipation at the secondary care level. Ultrasound examination proved a reliable alternative to rectal examination or abdominal radiography when identifying faecal impaction....

  1. Use of DNA sequences to identify forensically important fly species and their distribution in the coastal region of Central California.

    Science.gov (United States)

    Nakano, Angie; Honda, Jeff

    2015-08-01

    Forensic entomology has gained prominence in recent years, as improvements in DNA technology and molecular methods have allowed insect and other arthropod evidence to become increasingly useful in criminal and civil investigations. However, comprehensive faunal inventories are still needed, including cataloging local DNA sequences for forensically significant Diptera. This multi-year fly-trapping study was built upon and expanded a previous survey of these flies in Santa Clara County, including the addition of genetic barcoding data from collected species of flies. Flies from the families Calliphoridae, Sarcophagidae, and Muscidae were trapped in meat-baited traps set in a variety of locations throughout the county. Flies were identified using morphological features and confirmed by molecular analysis. A total of 16 calliphorid species, 11 sarcophagid species, and four muscid species were collected and differentiated. This study found more species of flies than previous area surveys and established new county records for two calliphorid species: Cynomya cadaverina and Chrysomya rufifacies. Differences were found in fly fauna in different areas of the county, indicating the importance of microclimates in the distribution of these flies. Molecular analysis supported the use of DNA barcoding as an effective method of identifying cryptic fly species. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  2. Crowd-sourced Ontology for Photoleukocoria: Identifying Common Internet Search Terms for a Potentially Important Pediatric Ophthalmic Sign.

    Science.gov (United States)

    Staffieri, Sandra E; Kearns, Lisa S; Sanfilippo, Paul G; Craig, Jamie E; Mackey, David A; Hewitt, Alex W

    2018-02-01

    Leukocoria is the most common presenting sign for pediatric eye disease including retinoblastoma and cataract, with worse outcomes if diagnosis is delayed. We investigated whether individuals could identify leukocoria in photographs (photoleukocoria) and examined their subsequent Internet search behavior. Using a web-based questionnaire, in this cross-sectional study we invited adults aged over 18 years to view two photographs of a child with photoleukocoria, and then search the Internet to determine a possible diagnosis and action plan. The most commonly used search terms and websites accessed were recorded. The questionnaire was completed by 1639 individuals. Facebook advertisement was the most effective recruitment strategy. The mean age of all respondents was 38.95 ± 14.59 years (range, 18-83), 94% were female, and 59.3% had children. An abnormality in the images presented was identified by 1613 (98.4%) participants. The most commonly used search terms were: "white," "pupil," "photo," and "eye" reaching a variety of appropriate websites or links to print or social media articles. Different words or phrases were used to describe the same observation of photoleukocoria leading to a range of websites. Variations in the description of observed signs and search words influenced the sites reached, information obtained, and subsequent help-seeking intentions. Identifying the most commonly used search terms for photoleukocoria is an important step for search engine optimization. Being directed to the most appropriate websites informing of the significance of photoleukocoria and the appropriate actions to take could improve delays in diagnosis of important pediatric eye disease such as retinoblastoma or cataract.

  3. Pattern check of TLD disc readings - an important tool to identify abnormal conditions in workplace

    International Nuclear Information System (INIS)

    Pradhan, S.M.; Sneha, C.; Bhattacharya, M.; Sahai, M.K.; Pradeep, Ratna; Datta, D.; Bhatnagar, Amit

    2016-01-01

    Personnel monitoring for external radiation using CaSO 4 :Dy based TLD badge is well established in Indian radiation protection program. TLD badge enables evaluation of occupational dose based on the pattern and values of the three disc readings. Different patterns of disc readings are obtained depending on the type and energy of radiation in the workplace. Pattern not conforming to the radiation in the workplace also called as improper pattern can be a useful tool for investigation of any deviation / abnormality in workplace or monitoring practices. The paper presents different examples of improper pattern observed in monitoring that has helped to find out the deviations in the workplace or monitoring practices. Results of the experiments conducted to simulate some of the observed pattern are also presented in the paper

  4. A case study of identify importance of land use planning in road safety, Benidorm

    Energy Technology Data Exchange (ETDEWEB)

    Casares Blanco, J.; Sanchez Galiano, J.C.; Fernandez Aracil, P.; Ortuño Padilla, A.

    2016-07-01

    This research analyses how urban form, land use and urban density, may influence the incidence of traffic-related crashes injuries and deaths. It begins with a theoretical overview of studies which deal with the study of the relationship between urban patterns and road safety. Next, it details the development of a database of crash incidence and urban form at the district level for the city of Benidorm (Alicante, Spain) in 2010. Subsequently, it is developed a negative binomial approach for intra-city motor vehicle crash analysis. One-year crash data for Benidorm (the fourth largest tourism destination of Spain, after Barcelona, Madrid and San Bartolomé de Tirajana, and exclusively tourist-oriented city) are analyzed using a geographic information system (GIS) to generate relevant inputs for the analysis. In general, the study finds that a strong land use mix results on fewer road accidents, whereas accidents are more common but less severe in areas of high urban density. Finally, pedestrian accidents research showed that rural and low density environment is related to an important road accident numbers unlike tourism-oriented zones, much more safe for them. Based on these findings, the paper discusses the implications for urban design practice. (Author)

  5. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  6. To Identify the Important Soil Properties Affecting Dinoseb Adsorption with Statistical Analysis

    Directory of Open Access Journals (Sweden)

    Yiqing Guan

    2013-01-01

    Full Text Available Investigating the influences of soil characteristic factors on dinoseb adsorption parameter with different statistical methods would be valuable to explicitly figure out the extent of these influences. The correlation coefficients and the direct, indirect effects of soil characteristic factors on dinoseb adsorption parameter were analyzed through bivariate correlation analysis, and path analysis. With stepwise regression analysis the factors which had little influence on the adsorption parameter were excluded. Results indicate that pH and CEC had moderate relationship and lower direct effect on dinoseb adsorption parameter due to the multicollinearity with other soil factors, and organic carbon and clay contents were found to be the most significant soil factors which affect the dinoseb adsorption process. A regression is thereby set up to explore the relationship between the dinoseb adsorption parameter and the two soil factors: the soil organic carbon and clay contents. A 92% of the variation of dinoseb sorption coefficient could be attributed to the variation of the soil organic carbon and clay contents.

  7. Identifying the ideal profile of French yogurts for different clusters of consumers.

    Science.gov (United States)

    Masson, M; Saint-Eve, A; Delarue, J; Blumenthal, D

    2016-05-01

    Identifying the sensory properties that affect consumer preferences for food products is an important feature of product development. Different methods, such as external preference mapping or partial least squares regression, are used to establish relationships between sensory data and consumer preferences and to identify sensory attributes that drive consumer preferences, by highlighting optimum products. Plain French yogurts were evaluated by a sensory profiling method performed by 12 trained judges. In parallel, 180 consumers were asked to score their overall liking and complete a cognitive restraint questionnaire. After hierarchical cluster analysis on the liking scores, preference mapping using a quadratic regression model was performed. Five clusters of consumers were identified as a function of different preference patterns. Contrary to our expectations, fat levels were not discriminating. For each cluster, the results of preference mapping enabled the identification of optimum products. A comparison of the 5 sensory profiles revealed numerous differences between key sensory attributes. For example, one consumer cluster had a strong preference for products perceived as very thick, grainy, but with a less flowing texture, less sticky, whey presence and color, in contrast to other clusters. In addition, each segment of consumers was characterized according to the results of the cognitive restraint questionnaire. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  8. Molecular characterization of NRXN1 deletions from 19,263 clinical microarray cases identifies exons important for neurodevelopmental disease expression

    Science.gov (United States)

    Lowther, Chelsea; Speevak, Marsha; Armour, Christine M.; Goh, Elaine S.; Graham, Gail E.; Li, Chumei; Zeesman, Susan; Nowaczyk, Malgorzata J.M.; Schultz, Lee-Anne; Morra, Antonella; Nicolson, Rob; Bikangaga, Peter; Samdup, Dawa; Zaazou, Mostafa; Boyd, Kerry; Jung, Jack H.; Siu, Victoria; Rajguru, Manjulata; Goobie, Sharan; Tarnopolsky, Mark A.; Prasad, Chitra; Dick, Paul T.; Hussain, Asmaa S.; Walinga, Margreet; Reijenga, Renske G.; Gazzellone, Matthew; Lionel, Anath C.; Marshall, Christian R.; Scherer, Stephen W.; Stavropoulos, Dimitri J.; McCready, Elizabeth; Bassett, Anne S.

    2016-01-01

    Purpose The purpose of the current study was to assess the penetrance of NRXN1 deletions. Methods We compared the prevalence and genomic extent of NRXN1 deletions identified among 19,263 clinically referred cases to that of 15,264 controls. The burden of additional clinically relevant CNVs was used as a proxy to estimate the relative penetrance of NRXN1 deletions. Results We identified 41 (0.21%) previously unreported exonic NRXN1 deletions ascertained for developmental delay/intellectual disability, significantly greater than in controls [OR=8.14 (95% CI 2.91–22.72), p< 0.0001)]. Ten (22.7%) of these had a second clinically relevant CNV. Subjects with a deletion near the 3′ end of NRXN1 were significantly more likely to have a second rare CNV than subjects with a 5′ NRXN1 deletion [OR=7.47 (95% CI 2.36–23.61), p=0.0006]. The prevalence of intronic NRXN1 deletions was not statistically different between cases and controls (p=0.618). The majority (63.2%) of intronic NRXN1 deletion cases had a second rare CNV, a two-fold greater prevalence than for exonic NRXN1 deletion cases (p=0.0035). Conclusions The results support the importance of exons near the 5′ end of NRXN1 in the expression of neurodevelopmental disorders. Intronic NRXN1 deletions do not appear to substantially increase the risk for clinical phenotypes. PMID:27195815

  9. Identifying organisational principles and management practices important to the quality of health care services for chronic conditions.

    Science.gov (United States)

    Frølich, Anne

    2012-02-01

    effect of financial incentives and public performance reporting on the behaviour of professionals and quality of care. Using secondary data, KP and the Danish health care system were compared in terms of six central dimensions: population, health care professionals, health care organisations, utilization patterns, quality measurements, and costs. Differences existed between the two systems on all dimensions, complicating the interpretation of findings. For instance, observed differences might be due to similar tendencies in the two health care systems that were observed at different times, rather than true structural differences. The expenses in the two health care systems were corrected for differences in the populations served and the purchasing power of currencies. However, no validated methods existed to correct for observed differences in case-mixes of chronic conditions. Data from a population of about half a million patients with diabetes in a large U.S. integrated health care delivery system affiliated with 41 medical centers employing 15 different CCM management practices was the basis for identifying effective management practices. Through the use of statistical modelling, the management practice of provider alerts was identified as most effective for promoting screening for hemoglobin A1c and lipid profile. The CCM was used as a framework for implementing four rehabilitation programs. The model promoted continuity of care and quality of health care services. New management practices were developed in the study, and known practices were further developed. However, the observational nature of the study limited the generalisability of the findings. In a structured literature survey focusing on the effect of financial incentives and public performance reporting on the quality of health care services, few studies documenting an effect were identified. The results varied, and important program aspects or contextual variables were often omitted. A model describing

  10. The hierarchy-by-interval approach to identifying important models that need improvement in severe-accident simulation codes

    International Nuclear Information System (INIS)

    Heames, T.J.; Khatib-Rahbar, M.; Kelly, J.E.

    1995-01-01

    The hierarchy-by-interval (HBI) methodology was developed to determine an appropriate phenomena identification and ranking table for an independent peer review of severe-accident computer codes. The methodology is described, and the results of a specific code review are presented. Use of this systematic and structured approach ensures that important code models that need improvement are identified and prioritized, which allows code sponsors to more effectively direct limited resources in future code development. In addition, critical phenomenological areas that need more fundamental work, such as experimentation, are identified

  11. What's the difference? Insider perspectives on the importance of interpersonal differences

    NARCIS (Netherlands)

    Oosterhof, A.; Oosterhof, Aad; van der Vegt, Gerben S.; van de Vliert, Evert; Sanders, Karin; Kiers, Henk A.L.

    2009-01-01

    This study presents a new approach to examine how team members experience interpersonal differences. This approach offers a way to examine how team members experience their differences with specific other individuals, and how these differences are related to the amount of perceived conflict with

  12. Differences between insurance organizations: do consumers perceive differences in important areas?

    NARCIS (Netherlands)

    Delnoij, D.M.J.; Hendriks, M.; Brouwer, W.; Spreeuwenberg, P.

    2006-01-01

    Background: Competition on the insurance market assumes that insurance organizations differ in what they offer, that the consumers of insurance products perceive differences, and that information about differences is available in a transparent way. With the introduction of the insurance reform in

  13. Application of representational difference analysis to identify genomic differences between Bradyrhizobium elkanii and B. Japonicum species.

    Science.gov (United States)

    Soares, René Arderius; Passaglia, Luciane Maria Pereira

    2010-10-01

    Bradyrhizobium elkanii is successfully used in the formulation of commercial inoculants and, together with B. japonicum, it fully supplies the plant nitrogen demands. Despite the similarity between B. japonicum and B. elkanii species, several works demonstrated genetic and physiological differences between them. In this work Representational Difference Analysis (RDA) was used for genomic comparison between B. elkanii SEMIA 587, a crop inoculant strain, and B. japonicum USDA 110, a reference strain. Two hundred sequences were obtained. From these, 46 sequences belonged exclusively to the genome of B. elkanii strain, and 154 showed similarity to sequences from B. japonicum genome. From the 46 sequences with no similarity to sequences from B. japonicum, 39 showed no similarity to sequences in public databases and seven showed similarity to sequences of genes coding for known proteins. These seven sequences were divided in three groups: similar to sequences from other Bradyrhizobium strains, similar to sequences from other nitrogen-fixing bacteria, and similar to sequences from non nitrogen-fixing bacteria. These new sequences could be used as DNA markers in order to investigate the rates of genetic material gain and loss in natural Bradyrhizobium strains.

  14. QM/MM simulations identify the determinants of catalytic activity differences between type II dehydroquinase enzymes.

    Science.gov (United States)

    Lence, Emilio; van der Kamp, Marc W; González-Bello, Concepción; Mulholland, Adrian J

    2018-05-16

    Type II dehydroquinase enzymes (DHQ2), recognized targets for antibiotic drug discovery, show significantly different activities dependent on the species: DHQ2 from Mycobacterium tuberculosis (MtDHQ2) and Helicobacter pylori (HpDHQ2) show a 50-fold difference in catalytic efficiency. Revealing the determinants of this activity difference is important for our understanding of biological catalysis and further offers the potential to contribute to tailoring specificity in drug design. Molecular dynamics simulations using a quantum mechanics/molecular mechanics potential, with correlated ab initio single point corrections, identify and quantify the subtle determinants of the experimentally observed difference in efficiency. The rate-determining step involves the formation of an enolate intermediate: more efficient stabilization of the enolate and transition state of the key step in MtDHQ2, mainly by the essential residues Tyr24 and Arg19, makes it more efficient than HpDHQ2. Further, a water molecule, which is absent in MtDHQ2 but involved in generation of the catalytic Tyr22 tyrosinate in HpDHQ2, was found to destabilize both the transition state and the enolate intermediate. The quantification of the contribution of key residues and water molecules in the rate-determining step of the mechanism also leads to improved understanding of higher potencies and specificity of known inhibitors, which should aid ongoing inhibitor design.

  15. THE IMPORTANCE OF OBSERVING THE DIFFERENCE IN WEBSITE EVALUATIONS OBTAINED FROM DIFFERENT PERSPECTIVES

    Directory of Open Access Journals (Sweden)

    Biljana Rondović

    2017-06-01

    Full Text Available The purpose of this paper is to show how website evaulations differ if performed by different evaluators despite the same methodological framework being used for the assessment. A quantitative analysis of websites was performed according to the modified evaluation framework based on the 2QCV3Q-model. The AHP method was used for the verification of the weight criteria, while a single-factor ANOVA was used to check the difference in the average scores of the evaluations performed by three groups of evaluators The results obtained by the single-factor ANOVA showed a statistically significant difference in the average scores of internal evaluation when compared to the evaluation done by clients and independent evaluators. The results obtained can be used in the banking industry as guidelines and recommendations for the future design or redesign of websites, as well as a literary base for comparative analyses of this kind in developing countries.

  16. NRC Information No. 90-01: Importance of proper response to self-identified violations by licensees

    International Nuclear Information System (INIS)

    Cunningham, R.E.

    1992-01-01

    NRC expects a high standard of compliance by its licensees and requires that licensees provide NRC accurate and complete information and that required records will also be complete and accurate in all material respects. Licensees should be aware of the importance placed by NRC on licensee programs for self detection, correction and reporting of violations or errors related to regulatory requirements. The General Statement of Policy and Procedures for NRC Enforcement Actions in Appendix C to 10 CFR Part 2 underscores the importance of licensees responding promptly and properly to self-identified violations in two ways. It is suggested that when a licensee identifies a violation involving an NRC-required record, the licensee should make a dated notation indicating identification, either on the record itself or other appropriate documentation retrievable for NRC review. The record with the self-identified violation noted should not be altered in any way to mask the correction. The licensee should determine the cause of the violation, correct the root cause of the violation, and document such findings in an appropriate manner. Licensees should also assure that if a report of the violation is required, the report is submitted to NRC in a timely manner. These actions will be considered by NRC in making any enforcement decision, and generally lead to lesser or no civil penalty

  17. Medically important carotenoids from Momordica charantia and their gene expressions in different organs.

    Science.gov (United States)

    Cuong, Do Manh; Arasu, Mariadhas Valan; Jeon, Jin; Park, Yun Ji; Kwon, Soon-Jae; Al-Dhabi, Naif Abdullah; Park, Sang Un

    2017-12-01

    Carotenoids, found in the fruit and different organs of bitter melon ( Momordica charantia ), have attracted great attention for their potential health benefits in treating several major chronic diseases. Therefore, study related to the identification and quantification of the medically important carotenoid metabolites is highly important for the treatment of various disorderes. The present study involved in the identification and quantification of the various carotenoids present in the different organs of M. charantia and the identification of the genes responsible for the accumulation of the carotenoids with respect to the transcriptome levels were investigated. In this study, using the transcriptome database of bitter melon, a partial-length cDNA clone encoding geranylgeranyl pyrophosphate synthase ( McGGPPS2 ), and several full-length cDNA clones encoding geranylgeranyl pyrophosphate synthase ( McGGPPS1 ), zeta-carotene desaturase ( McZDS ), lycopene beta-cyclase ( McLCYB ), lycopene epsilon cyclases ( McLCYE1 and McLCYE2 ), beta-carotene hydroxylase ( McCHXB ), and zeaxanthin epoxidase ( McZEP ) were identified in bitter melon . The expression levels of the mRNAs encoding these eight putative biosynthetic enzymes, as well as the accumulation of lycopene, α-carotene, lutein, 13Z-β-carotene, E-β-carotene, 9Z-β-carotene, β-cryptoxanthin, zeaxanthin, antheraxanthin, and violaxanthin were investigated in different organs from M. charantia as well as in the four different stages of its fruit maturation. Transcripts were found to be constitutively expressed at high levels in the leaves where carotenoids were also found at the highest levels . Collectively, these results indicate that the putative McGGPPS2, McZDS, McLCYB, McLCYE1, McLCYE2, and McCHXB enzymes might be key factors in controlling carotenoid content in bitter melon . In conclusion, the over expression of the carotenoid biosynthetic genes from M. charantia crops to increase the yield of these

  18. Statistical analyses of scatterplots to identify important factors in large-scale simulations, 2: robustness of techniques

    International Nuclear Information System (INIS)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-01-01

    The robustness of procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses is investigated. These procedures are based on attempts to detect increasingly complex patterns in the scatterplots under consideration and involve the identification of (i) linear relationships with correlation coefficients, (ii) monotonic relationships with rank correlation coefficients, (iii) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (iv) trends in variability as defined by variances and interquartile ranges, and (v) deviations from randomness as defined by the chi-square statistic. The following two topics related to the robustness of these procedures are considered for a sequence of example analyses with a large model for two-phase fluid flow: the presence of Type I and Type II errors, and the stability of results obtained with independent Latin hypercube samples. Observations from analysis include: (i) Type I errors are unavoidable, (ii) Type II errors can occur when inappropriate analysis procedures are used, (iii) physical explanations should always be sought for why statistical procedures identify variables as being important, and (iv) the identification of important variables tends to be stable for independent Latin hypercube samples

  19. The Minimal Clinically Important Difference for the Mayo-Portland Adaptability Inventory.

    Science.gov (United States)

    Malec, James F; Kean, Jacob; Monahan, Patrick O

    To determine the Minimal Clinically Important Difference (MCID) and Robust Clinically Important Difference (RCID) of the Mayo-Portland Adaptability Inventory-4 (MPAI-4) as measures of response to intervention. Retrospective analysis of existing data. Both distribution- and anchor-based methods were used to triangulate on the MCID and to identify a moderate, that is, more robust, level of change (RCID) for the MPAI-4. These were further evaluated with respect to clinical provider ratings. Data for individuals with acquired brain injury in rehabilitation programs throughout the United States in the OutcomeInfo Database (n = 3087) with 2 MPAI-4 ratings. MPAI-4, Supervision Rating Scale, Clinician Rating of Global Clinical Improvement. Initial analyses suggested 5 T-score points (5T) as the MCID and 9T as the RCID. Eighty-one percent to 87% of clinical raters considered a 5T change and 99% considered a 9T change to indicate meaningful improvement. 5T represents the MCID for the MPAI-4 and 9T, the RCID. Both values are notably less than the Reliable Change Index (RCI). While the RCI indicates change with a high level of statistical confidence, it may be insensitive to change that is considered meaningful by providers and participants as indicated by the MCID.

  20. Identifying and Characterizing Important Trembling Aspen Competitors with Juvenile Lodgepole Pine in Three South-Central British Columbia Ecosystems

    Directory of Open Access Journals (Sweden)

    Teresa A. Newsome

    2012-01-01

    Full Text Available Critical height ratios for predicting competition between trembling aspen and lodgepole pine were identified in six juvenile stands in three south-central British Columbia ecosystems. We used a series of regression analyses predicting pine stem diameter from the density of neighbouring aspen in successively shorter relative height classes to identify the aspen-pine height ratio that maximized R2. Critical height ratios varied widely among sites when stands were 8–12 years old but, by age 14–19, had converged at 1.25–1.5. Maximum R2 values at age 14–19 ranged from 13.4% to 69.8%, demonstrating that the importance of aspen competition varied widely across a relatively small geographic range. Logistic regression also indicated that the risk of poor pine vigour in the presence of aspen varied between sites. Generally, the degree of competition, risk to pine vigour, and size of individual aspen contributing to the models declined along a gradient of decreasing ecosystem productivity.

  1. Combining Methods to Describe Important Marine Habitats for Top Predators: Application to Identify Biological Hotspots in Tropical Waters.

    Science.gov (United States)

    Thiers, Laurie; Louzao, Maite; Ridoux, Vincent; Le Corre, Matthieu; Jaquemet, Sébastien; Weimerskirch, Henri

    2014-01-01

    In tropical waters resources are usually scarce and patchy, and predatory species generally show specific adaptations for foraging. Tropical seabirds often forage in association with sub-surface predators that create feeding opportunities by bringing prey close to the surface, and the birds often aggregate in large multispecific flocks. Here we hypothesize that frigatebirds, a tropical seabird adapted to foraging with low energetic costs, could be a good predictor of the distribution of their associated predatory species, including other seabirds (e.g. boobies, terns) and subsurface predators (e.g., dolphins, tunas). To test this hypothesis, we compared distribution patterns of marine predators in the Mozambique Channel based on a long-term dataset of both vessel- and aerial surveys, as well as tracking data of frigatebirds. By developing species distribution models (SDMs), we identified key marine areas for tropical predators in relation to contemporaneous oceanographic features to investigate multi-species spatial overlap areas and identify predator hotspots in the Mozambique Channel. SDMs reasonably matched observed patterns and both static (e.g. bathymetry) and dynamic (e.g. Chlorophyll a concentration and sea surface temperature) factors were important explaining predator distribution patterns. We found that the distribution of frigatebirds included the distributions of the associated species. The central part of the channel appeared to be the best habitat for the four groups of species considered in this study (frigatebirds, brown terns, boobies and sub-surface predators).

  2. Combining Methods to Describe Important Marine Habitats for Top Predators: Application to Identify Biological Hotspots in Tropical Waters.

    Directory of Open Access Journals (Sweden)

    Laurie Thiers

    Full Text Available In tropical waters resources are usually scarce and patchy, and predatory species generally show specific adaptations for foraging. Tropical seabirds often forage in association with sub-surface predators that create feeding opportunities by bringing prey close to the surface, and the birds often aggregate in large multispecific flocks. Here we hypothesize that frigatebirds, a tropical seabird adapted to foraging with low energetic costs, could be a good predictor of the distribution of their associated predatory species, including other seabirds (e.g. boobies, terns and subsurface predators (e.g., dolphins, tunas. To test this hypothesis, we compared distribution patterns of marine predators in the Mozambique Channel based on a long-term dataset of both vessel- and aerial surveys, as well as tracking data of frigatebirds. By developing species distribution models (SDMs, we identified key marine areas for tropical predators in relation to contemporaneous oceanographic features to investigate multi-species spatial overlap areas and identify predator hotspots in the Mozambique Channel. SDMs reasonably matched observed patterns and both static (e.g. bathymetry and dynamic (e.g. Chlorophyll a concentration and sea surface temperature factors were important explaining predator distribution patterns. We found that the distribution of frigatebirds included the distributions of the associated species. The central part of the channel appeared to be the best habitat for the four groups of species considered in this study (frigatebirds, brown terns, boobies and sub-surface predators.

  3. Quality of Life After Cardiac Surgery Based on the Minimal Clinically Important Difference Concept.

    Science.gov (United States)

    Grand, Nathalie; Bouchet, Jean Baptiste; Zufferey, Paul; Beraud, Anne Marie; Awad, Sahar; Sandri, Fabricio; Campisi, Salvator; Fuzellier, Jean François; Molliex, Serge; Vola, Marco; Morel, Jerome

    2018-03-23

    Health-related quality of life (HRQOL) is an increasingly important issue in assessing the consequences of any surgical or medical intervention. Our study aimed to evaluate change in HRQOL 6 months after elective cardiac surgery and to identify specific predictors of poor HRQOL. In this prospective, single-center study, HRQOL was evaluated before and 6 months after surgery using the SF-36 questionnaire and its two components: the physical component summary (PCS) and the mental component summary (MCS). We distinguished patients with worsening of HRQOL according to the minimal clinically important difference. All consecutive adult patients undergoing cardiac surgery were included. 326 patients completed the preoperative and postoperative SF-36 questionnaires and 24 patients died before completing follow-up questionnaires. Based on the definition used, clinically significant deterioration of HRQOL was observed in 93 patients (26.6%) for PCS and 99 patients (28.2%) for MCS. Renal replacement for acute renal failure and mechanical ventilation for longer than 48 hours were independent risk factors for PCS and MCS worsening or death. Although our study showed overall improvement of QOL after cardiac surgery, over a quarter of the patients manifested deterioration of HRQOL at 6 months post-surgery. The findings from this study should help clinicians to inform patients about their likely postoperative functional status and quality of life. Copyright © 2018. Published by Elsevier Inc.

  4. 77 FR 66848 - Minimum Clinically Important Difference: An Outcome Metric in Orthopaedic Device Science and...

    Science.gov (United States)

    2012-11-07

    ...] Minimum Clinically Important Difference: An Outcome Metric in Orthopaedic Device Science and Regulation... Clinically Important Difference: An Outcome Metric in Orthopaedic Device Science and Regulation.'' FDA is co... (MCID) for patient-reported outcome (PRO) instruments used in orthopaedic extremity device-related...

  5. Soft Skills in Higher Education: Importance and Improvement Ratings as a Function of Individual Differences and Academic Performance

    Science.gov (United States)

    Chamorro-Premuzic, Tomas; Arteche, Adriane; Bremner, Andrew J.; Greven, Corina; Furnham, Adrian

    2010-01-01

    Three UK studies on the relationship between a purpose-built instrument to assess the importance and development of 15 "soft skills" are reported. "Study 1" (N = 444) identified strong latent components underlying these soft skills, such that differences "between-skills" were over-shadowed by differences…

  6. Kinematic analysis quantifies gait abnormalities associated with lameness in broiler chickens and identifies evolutionary gait differences.

    Directory of Open Access Journals (Sweden)

    Gina Caplen

    Full Text Available This is the first time that gait characteristics of broiler (meat chickens have been compared with their progenitor, jungle fowl, and the first kinematic study to report a link between broiler gait parameters and defined lameness scores. A commercial motion-capturing system recorded three-dimensional temporospatial information during walking. The hypothesis was that the gait characteristics of non-lame broilers (n = 10 would be intermediate to those of lame broilers (n = 12 and jungle fowl (n = 10, tested at two ages: immature and adult. Data analysed using multi-level models, to define an extensive range of baseline gait parameters, revealed inter-group similarities and differences. Natural selection is likely to have made jungle fowl walking gait highly efficient. Modern broiler chickens possess an unbalanced body conformation due to intense genetic selection for additional breast muscle (pectoral hypertrophy and whole body mass. Together with rapid growth, this promotes compensatory gait adaptations to minimise energy expenditure and triggers high lameness prevalence within commercial flocks; lameness creating further disruption to the gait cycle and being an important welfare issue. Clear differences were observed between the two lines (short stance phase, little double-support, low leg lift, and little back displacement in adult jungle fowl; much double-support, high leg lift, and substantial vertical back movement in sound broilers presumably related to mass and body conformation. Similarities included stride length and duration. Additional modifications were also identified in lame broilers (short stride length and duration, substantial lateral back movement, reduced velocity presumably linked to musculo-skeletal abnormalities. Reduced walking velocity suggests an attempt to minimise skeletal stress and/or discomfort, while a shorter stride length and time, together with longer stance and double-support phases, are associated

  7. Identifying the Individual Differences among Students during Learning and Teaching Process by Science Teachers

    Science.gov (United States)

    Kubat, Ulas

    2018-01-01

    It is important for teachers to know variables such as physical characteristics, intelligence, perception, gender, ability, learning styles, which are individual differences of the learners. An effective and productive learning-teaching process can be planned by considering these individual differences of the students. Since the learners' own…

  8. Self- and Peer-Identified Victims in Late Childhood: Differences in Perceptions of the School Ecology.

    Science.gov (United States)

    Dawes, Molly; Chen, Chin-Chih; Farmer, Thomas W; Hamm, Jill V

    2017-11-01

    Patterns of adjustment for youth victimized by peers vary depending on whether youth are identified as victims through self-reports, peer-reports, or both. In order to provide more targeted strategies that may help mitigate negative consequences associated with specific victimization groups, more information is needed about how these youth perceive their school ecology (bullying and academic ecology), their feelings of school belonging, and their valuing of school. Based on the convergence of self- and peer-reports of victimization, we identified four victim groups from a sample of students in 5th grade classrooms (N = 1360; 52.8% girls, 53.1% White, 34.6% Black or Hispanic, 12.2% Native American, Asian, or other) using Latent Profile Analysis (LPA): convergent victims (high self- and peer-reports), self-identified victims (high self-, low peer-reports), peer-identified victims (low self-, high peer-reports), and nonvictims (low self- and peer-reports). Convergent victims' perceptions were similar to nonvictims with key differences being convergent victims' greater willingness to protect peers being bullied but lower feelings of school belonging compared to nonvictims. Peer-identified and self-identified victims perceived differences in the bullying and academic ecology including peer-identified victims' greater willingness to protect peers and expectations for more peers to encourage bulling against them compared to self-identified victims. However, both peer- and self-identified victims perceived greater emotional risk of participating in class and had lower feelings of school belonging compared to nonvictims. Implications for supporting youth with divergent self- and peer-reported victimization status as they transition to middle school are discussed.

  9. Gene Expression Profiling Identifies Important Genes Affected by R2 Compound Disrupting FAK and P53 Complex

    International Nuclear Information System (INIS)

    Golubovskaya, Vita M.; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G.

    2014-01-01

    Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53 +/+ and p53 −/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53 +/+ cells but not in p53 −/− cells. Among up-regulated genes in HCT p53 +/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53 +/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach

  10. DNA-SIP identifies sulfate-reducing Clostridia as important toluene degraders in tar-oil-contaminated aquifer sediment

    Energy Technology Data Exchange (ETDEWEB)

    Winderl, C.; Penning, H.; von Netzer, F.; Meckenstock, R.U.; Lueders, T. [Helmholtz Zentrum Munchen, Neuherberg (Germany)

    2010-10-15

    Global groundwater resources are constantly challenged by a multitude of contaminants such as aromatic hydrocarbons. Especially in anaerobic habitats, a large diversity of unrecognized microbial populations may be responsible for their degradation. Still, our present understanding of the respective microbiota and their ecophysiology is almost exclusively based on a small number of cultured organisms, mostly within the Proteobacteria. Here, by DNA-based stable isotope probing (SIP), we directly identified the most active sulfate-reducing toluene degraders in a diverse sedimentary microbial community originating from a tar-oil-contaminated aquifer at a former coal gasification plant. On incubation of fresh sediments with {sup 13}C{sub 7}-toluene, the production of both sulfide and (CS{sub 2}){sup 13}CO{sub 2} was clearly coupled to the {sup 13}Clabeling of DNA of microbes related to Desulfosporosinus spp. within the Peptococcaceae (Clostridia). The screening of labeled DNA fractions also suggested a novel benzylsuccinate synthase alpha-subunit (bssA) sequence type previously only detected in the environment to be tentatively affiliated with these degraders. However, carbon flow from the contaminant into degrader DNA was only similar to 50%, pointing toward high ratios of heterotrophic CS{sub 2}-fixation during assimilation of acetyl-CoA originating from the contaminant by these degraders. These findings demonstrate that the importance of non-proteobacterial populations in anaerobic aromatics degradation, as well as their specific ecophysiology in the subsurface may still be largely ungrasped.

  11. Evaluation of bentonite alteration due to interactions with iron. Sensitivity analyses to identify the important factors for the bentonite alteration

    International Nuclear Information System (INIS)

    Sasamoto, Hiroshi; Wilson, James; Sato, Tsutomu

    2013-01-01

    Performance assessment of geological disposal systems for high-level radioactive waste requires a consideration of long-term systems behaviour. It is possible that the alteration of swelling clay present in bentonite buffers might have an impact on buffer functions. In the present study, iron (as a candidate overpack material)-bentonite (I-B) interactions were evaluated as the main buffer alteration scenario. Existing knowledge on alteration of bentonite during I-B interactions was first reviewed, then the evaluation methodology was developed considering modeling techniques previously used overseas. A conceptual model for smectite alteration during I-B interactions was produced. The following reactions and processes were selected: 1) release of Fe 2+ due to overpack corrosion; 2) diffusion of Fe 2+ in compacted bentonite; 3) sorption of Fe 2+ on smectite edge and ion exchange in interlayers; 4) dissolution of primary phases and formation of alteration products. Sensitivity analyses were performed to identify the most important factors for the alteration of bentonite by I-B interactions. (author)

  12. Using reporter gene assays to identify cis regulatory differences between humans and chimpanzees.

    Science.gov (United States)

    Chabot, Adrien; Shrit, Ralla A; Blekhman, Ran; Gilad, Yoav

    2007-08-01

    Most phenotypic differences between human and chimpanzee are likely to result from differences in gene regulation, rather than changes to protein-coding regions. To date, however, only a handful of human-chimpanzee nucleotide differences leading to changes in gene regulation have been identified. To hone in on differences in regulatory elements between human and chimpanzee, we focused on 10 genes that were previously found to be differentially expressed between the two species. We then designed reporter gene assays for the putative human and chimpanzee promoters of the 10 genes. Of seven promoters that we found to be active in human liver cell lines, human and chimpanzee promoters had significantly different activity in four cases, three of which recapitulated the gene expression difference seen in the microarray experiment. For these three genes, we were therefore able to demonstrate that a change in cis influences expression differences between humans and chimpanzees. Moreover, using site-directed mutagenesis on one construct, the promoter for the DDA3 gene, we were able to identify three nucleotides that together lead to a cis regulatory difference between the species. High-throughput application of this approach can provide a map of regulatory element differences between humans and our close evolutionary relatives.

  13. Different Combinations of Perceived Autonomy Support and Control: Identifying the Most Optimal Motivating Style

    Science.gov (United States)

    Haerens, L.; Vansteenkiste, M.; De Meester, A.; Delrue, J.; Tallir, I.; Vande Broek, G.; Goris, W.; Aelterman, N.

    2018-01-01

    Background: According to Self-Determination Theory, teachers and sport coaches can differ in the motivating style they rely upon to motivate young people. When endorsing an autonomy-supportive motivating style, instructors try to identify, vitalize, and nurture youngsters' inner motivational resources. In contrast, instructors with a dominant…

  14. The minimal important difference of the epistaxis severity score in hereditary hemorrhagic telangiectasia.

    Science.gov (United States)

    Yin, Linda X; Reh, Douglas D; Hoag, Jeffrey B; Mitchell, Sally E; Mathai, Stephen C; Robinson, Gina M; Merlo, Christian A

    2016-05-01

    Hereditary hemorrhagic telangiectasia (HHT) is a disease of abnormal angiogenesis, causing epistaxis in over 96% of patients. The Epistaxis Severity Score (ESS) was developed as a standardized measurement of nasal symptoms among HHT patients. The minimal important difference (MID) of a disease index estimates the smallest change that a patient and clinician would identify as important. This study aims to establish the MID of the ESS in a diverse population of HHT patients. Retrospective cross-sectional study in patients with a diagnosis of HHT using Curacao criteria or genetic testing. The ESS questionnaire and Medical Outcomes Study 36-Item Short Form (SF-36) were administered to participants recruited through the HHT Foundation Web site. Demographics and relevant medical histories were collected from all participants. An anchor-based method using a change of 5 in the Physical Component Summary (PCS) of the SF-36 and a distributional method were used to estimate the MID. A total of 604 subjects were recruited between April and August 2008. All participants reported epistaxis. An increasing ESS in the study cohort showed a significant negative correlation to the PCS (r = -0.43, P < 0.001). The MID was determined to be 0.41 via the anchor-based approach and 1.01 via the distribution-based approach, giving a mean MID of 0.71. Using both the anchor-based and distribution-based approaches, the estimated MID for the ESS in HHT is 0.71. Further implications include key metrics to help guide treatment responses in clinical care and essential information to calculate power and sample size for future clinical trials. 4. Laryngoscope, 126:1029-1032, 2016. © 2015 The American Laryngological, Rhinological and Otological Society, Inc.

  15. Health status measurement in COPD: the minimal clinically important difference of the clinical COPD questionnaire

    Directory of Open Access Journals (Sweden)

    van den Berg JWK

    2006-04-01

    Full Text Available Abstract Background Patient-reported outcomes (PRO questionnaires are being increasingly used in COPD clinical studies. The challenge facing investigators is to determine what change is significant, ie what is the minimal clinically important difference (MCID. This study aimed to identify the MCID for the clinical COPD questionnaire (CCQ in terms of patient referencing, criterion referencing, and by the standard error of measurement (SEM. Methods Patients were ≥40 years of age, diagnosed with COPD, had a smoking history of >10 pack-years, and were participating in a randomized, controlled clinical trial comparing intravenous and oral prednisolone in patients admitted with an acute exacerbation of COPD. The CCQ was completed on Days 1–7 and 42. A Global Rating of Change (GRC assessment was taken to establish the MCID by patient referencing. For criterion referencing, health events during a period of 1 year after Day 42 were included in this analysis. Results 210 patients were recruited, 168 completed the CCQ questionnaire on Day42. The MCID of the CCQ total score, as indicated by patient referencing in terms of the GRC, was 0.44. The MCID of the CCQ in terms of criterion referencing for the major outcomes was 0.39, and calculation of the SEM resulted in a value of 0.21. Conclusion This investigation, which is the first to determine the MCID of a PRO questionnaire via more than one approach, indicates that the MCID of the CCQ total score is 0.4.

  16. Importance of Country-of-Origin on Different Product Categories Purchase Decision

    OpenAIRE

    Krupka Zoran; Arežina Darija

    2017-01-01

    Country of origin is an important factor in product evaluation process as well as for purchase decision. Its importance depends on the amount of information consumers have about the product and product category. This paper investigates the importance of coutry of origin in purchase decision-making process for three different product categories: high risk and high level of consumer involvement in purchasing process (car), medium risk and midium level of consumer involvement in purchasing proce...

  17. Identifying important and feasible policies and actions for health at community sports clubs: a consensus-generating approach.

    Science.gov (United States)

    Kelly, Bridget; King, Lesley; Bauman, Adrian E; Baur, Louise A; Macniven, Rona; Chapman, Kathy; Smith, Ben J

    2014-01-01

    Children's high participation in organised sport in Australia makes sport an ideal setting for health promotion. This study aimed to generate consensus on priority health promotion objectives for community sports clubs, based on informed expert judgements. Delphi survey using three structured questionnaires. Forty-six health promotion, nutrition, physical activity and sport management/delivery professionals were approached to participate in the survey. Questionnaires used an iterative process to determine aspects of sports clubs deemed necessary for developing healthy sporting environments for children. Initially, participants were provided with a list of potential standards for a range of health promotion areas and asked to rate standards based on their importance and feasibility, and any barriers to implementation. Subsequently, participants were provided with information that summarised ratings for each standard to indicate convergence of the group, and asked to review and potentially revise their responses where they diverged. In a third round, participants ranked confirmed standards by priority. 26 professionals completed round 1, 21 completed round 2, and 18 completed round 3. The highest ranked standards related to responsible alcohol practices, availability of healthy food and drinks at sports canteens, smoke-free club facilities, restricting the sale and consumption of alcohol during junior sporting activities, and restricting unhealthy food and beverage company sponsorship. Identifying and prioritising health promotion areas that are relevant to children's sports clubs assists in focusing public health efforts and may guide future engagement of sports clubs. Approaches for providing informational and financial support to clubs to operationalise these standards are proposed. Copyright © 2013 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  18. Ecosystem services and climate change: Understanding the differences and identifying opportunities for forest carbon

    Science.gov (United States)

    Robert L. Deal; Crystal Raymond; David L. Peterson; Cindy. Glick

    2010-01-01

    There are a number of misunderstandings about “ecosystem services” and “climate change” and these terms are often used incorrectly to describe different concepts. These concepts address different issues and objectives but have some important integrating themes relating to carbon and carbon sequestration. In this paper, we provide definitions and distinctions between...

  19. Gender Differences in Perceived Importance and Performance of Penang Island Attributes

    Directory of Open Access Journals (Sweden)

    Omar Shida Irwana

    2014-01-01

    Full Text Available This paper examines the gender differences in perceived importance and performance of Penang Island attributes. The data was drawn from questionnaire survey of 801 international tourists who visited the island between August and November 2012. Previous studies related to gender differences in Malaysian destinations are found scarce and neglected, thus this paper aims to bridge this knowledge gap. The needs to study gender differences are related to the suggestions that men and women engage in different leisure activities, possess different travel motivations and perceive differently when embarking for holiday. The study found a number of gender similarities and differences between the men and women tourists, in terms of their travel style and perceptions of importance and performance of destination attributes. These results indicate that gender may not be the only influence on behaviour and perceptions, and those men and women should not be regarded as homogenous groups.

  20. Novel statistical framework to identify differentially expressed genes allowing transcriptomic background differences.

    Science.gov (United States)

    Ling, Zhi-Qiang; Wang, Yi; Mukaisho, Kenichi; Hattori, Takanori; Tatsuta, Takeshi; Ge, Ming-Hua; Jin, Li; Mao, Wei-Min; Sugihara, Hiroyuki

    2010-06-01

    Tests of differentially expressed genes (DEGs) from microarray experiments are based on the null hypothesis that genes that are irrelevant to the phenotype/stimulus are expressed equally in the target and control samples. However, this strict hypothesis is not always true, as there can be several transcriptomic background differences between target and control samples, including different cell/tissue types, different cell cycle stages and different biological donors. These differences lead to increased false positives, which have little biological/medical significance. In this article, we propose a statistical framework to identify DEGs between target and control samples from expression microarray data allowing transcriptomic background differences between these samples by introducing a modified null hypothesis that the gene expression background difference is normally distributed. We use an iterative procedure to perform robust estimation of the null hypothesis and identify DEGs as outliers. We evaluated our method using our own triplicate microarray experiment, followed by validations with reverse transcription-polymerase chain reaction (RT-PCR) and on the MicroArray Quality Control dataset. The evaluations suggest that our technique (i) results in less false positive and false negative results, as measured by the degree of agreement with RT-PCR of the same samples, (ii) can be applied to different microarray platforms and results in better reproducibility as measured by the degree of DEG identification concordance both intra- and inter-platforms and (iii) can be applied efficiently with only a few microarray replicates. Based on these evaluations, we propose that this method not only identifies more reliable and biologically/medically significant DEG, but also reduces the power-cost tradeoff problem in the microarray field. Source code and binaries freely available for download at http://comonca.org.cn/fdca/resources/softwares/deg.zip.

  1. Use of computed tomography to identify atrial fibrillation associated differences in left atrial wall thickness and density.

    Science.gov (United States)

    Dewland, Thomas A; Wintermark, Max; Vaysman, Anna; Smith, Lisa M; Tong, Elizabeth; Vittinghoff, Eric; Marcus, Gregory M

    2013-01-01

    Left atrial (LA) tissue characteristics may play an important role in atrial fibrillation (AF) induction and perpetuation. Although frequently used in clinical practice, computed tomography (CT) has not been employed to describe differences in LA wall properties between AF patients and controls. We sought to noninvasively characterize AF-associated differences in LA tissue using CT. CT images of the LA were obtained in 98 consecutive patients undergoing AF ablation and in 89 controls. A custom software algorithm was used to measure wall thickness and density in four prespecified regions of the LA. On average, LA walls were thinner (-15.5%, 95% confidence interval [CI] -23.2 to -7.8%, P identified significant thinning of the LA wall and regional alterations in tissue density in patients with a history of AF. These findings suggest differences in LA tissue composition can be noninvasively identified and quantified using CT. ©2012, The Authors. Journal compilation ©2012 Wiley Periodicals, Inc.

  2. Identifying Important Gaps in Randomized Controlled Trials of Adult Cardiac Arrest Treatments: A Systematic Review of the Published Literature

    Science.gov (United States)

    Sinha, Shashank S.; Sukul, Devraj; Lazarus, John J.; Polavarapu, Vivek; Chan, Paul S.; Neumar, Robert W.; Nallamothu, Brahmajee K.

    2016-01-01

    Background Cardiac arrests are a major public health concern worldwide. The extent and types of randomized controlled trials (RCTs) – our most reliable source of clinical evidence – conducted in these high-risk patients over recent years are largely unknown. Methods and Results We performed a systematic review, identifying all RCTs published in PubMed, EMBASE, Scopus, Web of Science, and the Cochrane Library from 1995 to 2014 that focused on acute treatment of non-traumatic cardiac arrest in adults. We then extracted data on the setting of study populations, types and timing of interventions studied, risk of bias, outcomes reported and how these factors have changed over time. Over this twenty-year period, 92 RCTs were published containing 64,309 patients (median, 225.5 per trial). Of these, 81 RCTs (88.0%) involved out-of-hospital cardiac arrest whereas 4 (4.3%) involved in-hospital cardiac arrest and 7 (7.6%) included both. Eighteen RCTs (19.6%) were performed in the U.S., 68 (73.9%) were performed outside the U.S., and 6 (6.5%) were performed in both settings. Thirty-eight RCTs (41.3%) evaluated drug therapy, 39 (42.4%) evaluated device therapy, and 15 (16.3%) evaluated protocol improvements. Seventy-four RCTs (80.4%) examined interventions during the cardiac arrest, 15 (16.3%) examined post-cardiac arrest treatment, and 3 (3.3%) studied both. Overall, reporting of risk of bias was limited. The most common outcome reported was ROSC: 86 (93.5%) with only 22 (23.9%) reporting survival beyond 6 months. Fifty-three RCTs (57.6%) reported global ordinal outcomes whereas 15 (16.3%) reported quality-of-life. RCTs in the last 5 years were more likely to be focused on protocol improvement and post-cardiac arrest care. Conclusions Important gaps in RCTs of cardiac arrest treatments exist, especially those examining in-hospital cardiac arrest, protocol improvement, post-cardiac arrest care, and long-term or quality-of-life outcomes. PMID:27756794

  3. Enhanced finite difference scheme for the neutron diffusion equation using the importance function

    International Nuclear Information System (INIS)

    Vagheian, Mehran; Vosoughi, Naser; Gharib, Morteza

    2016-01-01

    Highlights: • An enhanced finite difference scheme for the neutron diffusion equation is proposed. • A seven-step algorithm is considered based on the importance function. • Mesh points are distributed through entire reactor core with respect to the importance function. • The results all proved that the proposed algorithm is highly efficient. - Abstract: Mesh point positions in Finite Difference Method (FDM) of discretization for the neutron diffusion equation can remarkably affect the averaged neutron fluxes as well as the effective multiplication factor. In this study, by aid of improving the mesh point positions, an enhanced finite difference scheme for the neutron diffusion equation is proposed based on the neutron importance function. In order to determine the neutron importance function, the adjoint (backward) neutron diffusion calculations are performed in the same procedure as for the forward calculations. Considering the neutron importance function, the mesh points can be improved through the entire reactor core. Accordingly, in regions with greater neutron importance, density of mesh elements is higher than that in regions with less importance. The forward calculations are then performed for both of the uniform and improved non-uniform mesh point distributions and the results (the neutron fluxes along with the corresponding eigenvalues) for the two cases are compared with each other. The results are benchmarked against the reference values (with fine meshes) for Kang and Rod Bundle BWR benchmark problems. These benchmark cases revealed that the improved non-uniform mesh point distribution is highly efficient.

  4. Metabolomic biomarkers identify differences in milk produced by Holstein cows and other minor dairy animals.

    Science.gov (United States)

    Yang, Yongxin; Zheng, Nan; Zhao, Xiaowei; Zhang, Yangdong; Han, Rongwei; Yang, Jinhui; Zhao, Shengguo; Li, Songli; Guo, Tongjun; Zang, Changjiang; Wang, Jiaqi

    2016-03-16

    Several milk metabolites are associated with breeds or species of dairy animals. A better understanding of milk metabolites from different dairy animals would advance their use in evaluating milk traits and detecting milk adulteration. The objective of this study was to characterize the milk metabolite profiles of Chinese Holstein, Jersey, yak, buffalo, goat, camel, and horse and identify any differences using non-targeted metabolomic approaches. Milk samples were tested using nuclear magnetic resonance (NMR) spectroscopy and liquid chromatography-tandem mass spectrometry (LC-MS). Data were analyzed using a multivariate analysis of variance and differences in milk metabolites between Holstein and the other dairy animals were assessed using orthogonal partial least-squares discriminant analysis. Differential metabolites were identified and some metabolites, such as choline and succinic acid, were used to distinguish Holstein milk from that of the other studied animals. Metabolic pathway analysis of different metabolites revealed that glycerophospholipid metabolism as well as valine, leucine, and isoleucine biosynthesis were shared in the other ruminant animals (Jersey, buffalo, yak, and goat), and biosynthesis of unsaturated fatty acids was shared in the non-ruminant animals (camel and horse). These results can be useful for gaining a better understanding of the differences in milk synthesis between Holstein and the other dairy animals. Copyright © 2016. Published by Elsevier B.V.

  5. How Do Psychiatrists Apply the Minimum Clinically Important Difference to Assess Patient Responses to Treatment?

    Directory of Open Access Journals (Sweden)

    Alan J. McMichael BSc

    2016-11-01

    Full Text Available Symptom report scales are used in clinical practice to monitor patient outcomes. Using them permits the definition of a minimum clinically important difference (MCID beyond which a patient may be judged as having responded to treatment. Despite recommendations that clinicians routinely use MCIDs in clinical practice, statisticians disagree about how MCIDs should be used to evaluate individual patient outcomes and responses to treatment. To address this issue, we asked how clinicians actually use MCIDs to evaluate patient outcomes in response to treatment. Sixty-eight psychiatrists made judgments about whether hypothetical patients had responded to treatment based on their pre- and posttreatment change scores on the widely used Positive and Negative Syndrome Scale. Psychiatrists were provided with the scale’s MCID on which to base their judgments. Our secondary objective was to assess whether knowledge of the patient’s genotype influenced psychiatrists’ responder judgments. Thus, psychiatrists were also informed of whether patients possessed a genotype indicating hyperresponsiveness to treatment. While many psychiatrists appropriately used the MCID, others accepted a far lower posttreatment change as indicative of a response to treatment. When psychiatrists accepted a lower posttreatment change than the MCID, they were less confident in such judgments compared to when a patient’s posttreatment change exceeded the scale’s MCID. Psychiatrists were also less likely to identify patients as responders to treatment if they possessed a hyperresponsiveness genotype. Clinicians should recognize that when judging patient responses to treatment, they often tolerate lower response thresholds than warranted. At least some conflate their judgments with information, such as the patient’s genotype, that is irrelevant to a post hoc response-to-treatment assessment. Consequently, clinicians may be at risk of persisting with treatments that have failed

  6. Notions of reliability: considering the importance of difference in guiding patients to health care Web sites.

    Science.gov (United States)

    Adams, S A; De Bont, A A

    2003-01-01

    This article analyzes the efforts of three organizations to provide a standard that guides Internet users to reliable health care sites. Comparison of health Internet sites, interviews and document studies. In comparing these approaches, three different constructions of reliability are identified. The resulting possibilities and restrictions of these constructions for users that are searching for health information on the Internet are revealed.

  7. Development of a non-destructive method to identify different grades of stainless steel

    International Nuclear Information System (INIS)

    Meor Yusoff Meor Sulaiman

    2003-01-01

    One of the non-destructive methods used for the identification and verification of metals is by the energy-dispersive X-ray fluorescence (EDXRF) technique. EDXRF analysis provides several important advantages such as simultaneous determination of the elements present, enable to analyse a very wide concentration range, fast analysis with no sample preparation. The paper shows how this technique is developed and applied in the identification and verification of different grades of stainless steels. Comparison of the results for certified reference standards obtained from this analysis and that of its certified value shows very small differences between them. (Author)

  8. Development of a non-destructive method to identify different grades of stainless steel

    International Nuclear Information System (INIS)

    Meor Yusoff Meor Sulaiman

    2004-01-01

    One of the non-destructive methods used for the identification and verification of metals is by the energy-dispersive x-ray fluorescence (EDXRF) technique. EDXRF analysis provides several important advantages such as simultaneous determination of the elements present, enable to analyze a very wide concentration range, fast analysis with no tedious sample preparation. The paper shows how this technique is developed and applied in the identification and verification of different grades of stainless steels. Comparison of the results obtained from this analysis with certified reference standards show very small differences between them. (Author)

  9. A large-scale RNA interference screen identifies genes that regulate autophagy at different stages.

    Science.gov (United States)

    Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man; He, Bin; Zhang, Liqing; Varmark, Hanne; Green, Michael R; Sheng, Zhi

    2018-02-12

    Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed a large-scale RNA interference screen in K562 human chronic myeloid leukemia cells using monodansylcadaverine staining, an autophagy-detecting approach equivalent to immunoblotting of the autophagy marker LC3B or fluorescence microscopy of GFP-LC3B. By coupling monodansylcadaverine staining with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays revealed that 57 autophagy-regulating genes suppressed autophagy initiation, whereas 21 candidates promoted autophagy maturation. Our RNA interference screen identifies identified genes that regulate autophagy at different stages, which helps decode autophagy regulation in cancer and offers novel avenues to develop autophagy-related therapies for cancer.

  10. Attitudinal and behavioral differences between cigarette users who do and do not identify as "smokers".

    Science.gov (United States)

    Berg, Michael B; Lin, Linda; White, Madeleine; Alfonso-Barry, Jacqueline

    2017-01-01

    The current research aimed to understand differences in smoking-related identity among college students and to illustrate the distinct characteristics of nonidentified smokers (NIS). Students from 2 colleges in Massachusetts (N = 538; April 2016). Respondents reported by online survey whether or not they had smoked a cigarette in the past 30 days and if they self-identified as smokers. Nonsmokers (NIS) and identified smokers (IS) were then compared on their smoking attitudes and behavior. NIS made up 12.5% of the sample and 64% of all tobacco users. NIS perceived themselves as less addicted and were more confident in their ability to quit smoking. They also were less likely to smoke alone, buy their own cigarettes, or have friends who smoked. College health officials can best motivate NIS to quit smoking by focusing on peer norms and the potential of long-term addiction.

  11. Identifying different transcribed proteins in the newly described Theraphosidae Pamphobeteus verdolaga.

    Science.gov (United States)

    Estrada-Gómez, Sebastian; Vargas-Muñoz, Leidy Johana; Saldarriaga-Córdoba, Mónica; Cifuentes, Yeimy; Perafan, Carlos

    2017-04-01

    Theraphosidae spider venoms are well known for possess a complex mixture of protein and non-protein compounds in their venom. The objective of this study was to report and identify different proteins translated from the venom gland DNA information of the recently described Theraphosidae spider Pamphobeteus verdolaga. Using a venom gland transcriptomic analysis, we reported a set of the first complete sequences of seven different proteins of the recenlty described Theraphosidae spider P. verdolaga. Protein analysis indicates the presence of different proteins on the venom composition of this new spider, some of them uncommon in the Theraphosidae family. MS/MS analysis of P. verdolaga showed different fragments matching sphingomyelinases (sicaritoxin), barytoxins, hexatoxins, latroinsectotoxins, and linear (zadotoxins) peptides. Only four of the MS/MS fragments showed 100% sequence similarity with one of the transcribed proteins. Transcriptomic analysis showed the presence of different groups of proteins like phospholipases, hyaluronidases, inhibitory cysteine knots (ICK) peptides among others. The three database of protein domains used in this study (Pfam, SMART and CDD) showed congruency in the search of unique conserved protein domain for only four of the translated proteins. Those proteins matched with EF-hand proteins, cysteine rich secretory proteins, jingzhaotoxins, theraphotoxins and hexatoxins, from different Mygalomorphae spiders belonging to the families Theraphosidae, Barychelidae and Hexathelidae. None of the analyzed sequences showed a complete 100% similarity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Genomic suppression subtractive hybridization as a tool to identify differences in mycorrhizal fungal genomes.

    Science.gov (United States)

    Murat, Claude; Zampieri, Elisa; Vallino, Marta; Daghino, Stefania; Perotto, Silvia; Bonfante, Paola

    2011-05-01

    Characterization of genomic variation among different microbial species, or different strains of the same species, is a field of significant interest with a wide range of potential applications. We have investigated the genomic variation in mycorrhizal fungal genomes through genomic suppressive subtractive hybridization. The comparison was between phylogenetically distant and close truffle species (Tuber spp.), and between isolates of the ericoid mycorrhizal fungus Oidiodendron maius featuring different degrees of metal tolerance. In the interspecies experiment, almost all the sequences that were identified in the Tuber melanosporum genome and absent in Tuber borchii and Tuber indicum corresponded to transposable elements. In the intraspecies comparison, some specific sequences corresponded to regions coding for enzymes, among them a glutathione synthetase known to be involved in metal tolerance. This approach is a quick and rather inexpensive tool to develop molecular markers for mycorrhizal fungi tracking and barcoding, to identify functional genes and to investigate the genome plasticity, adaptation and evolution. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  13. Determining minimally important score differences in scales of the Copenhagen Psychosocial Questionnaire

    DEFF Research Database (Denmark)

    Pejtersen, Jan Hyld; Bjorner, Jakob Bue; Hasle, Peter

    2010-01-01

    AIM: To determine minimally important differences (MIDs) for scales in the first version of the Copenhagen Psychosocial Questionnaire (COPSOQ). METHODS: Data were taken from two separate studies: a national population survey (N = 1062), and an intervention study at 14 workplaces (N = 1505). On th...

  14. Comparing the importance of different aspects of quality of life to older adults across diverse cultures.

    Science.gov (United States)

    Molzahn, Anita E; Kalfoss, Mary; Schick Makaroff, Kara; Skevington, Suzanne M

    2011-03-01

    there is limited research examining the relative importance of aspects of quality of life (QOL) to older adults across cultures. to examine the relative importance of 31 internationally agreed areas of QOL to older adults in 22 countries in relation to health status, age and level of economic development. a survey quota sampling design was used to collect cross-cultural data. This study reports a secondary analysis of WHOQOL-OLD pilot study, which was collected simultaneously in 22 centres. a variety of community, primary, secondary and tertiary health care settings located in Australia, France, Switzerland, England, Scotland, USA, Israel, Spain, Japan, China (mainland and Hong Kong), Turkey, Lithuania, Czech Republic, Hungary, Canada, Norway, Sweden, Denmark, Germany, Brazil and Uruguay. the total sample contained 7,401 people over 60 years with a mean age of 73.1 years; 57.8% were women and 70.1% considered themselves 'healthy'. there were significant differences in the importance given to various aspects of QOL for people living in medium and high-development countries. Culture explained 15.9% of the variance in the importance ratings of QOL. However, the interaction showed that cultural differences were reduced once health status, gender and age were taken into account. The importance of QOL to age bands in different cultures was not significantly affected by whether or not participants perceived themselves to be healthy. understanding the self-reported importance of diverse aspects of QOL for different cultures and for healthy and less healthy people may assist national and international policy makers to decide on priorities for the development of programmes for the ageing population.

  15. Identifying organisational principles and management practices important to the quality of health care services for chronic conditions

    DEFF Research Database (Denmark)

    Frølich, Anne

    2012-01-01

    are limited, it is necessary to identify efficient methods to improve the quality of care. Comparing health care systems is a well-known method for identifying new knowledge regarding, for instance, organisational methods and principles. Kaiser Permanente (KP), an integrated health care delivery system...... in the U.S., is recognized as providing high-quality chronic care; to some extent, this is due to KP's implementation of the chronic care model (CCM). This model recommends a range of evidence-based management practices that support the implementation of evidence-based medicine. However, it is not clear...... which management practices in the CCM are most efficient and in what combinations. In addition, financial incentives and public reporting of performance are often considered effective at improving the quality of health care services, but this has not yet been definitively proved....

  16. Importance of Country-of-Origin on Different Product Categories Purchase Decision

    Directory of Open Access Journals (Sweden)

    Krupka Zoran

    2017-12-01

    Full Text Available Country of origin is an important factor in product evaluation process as well as for purchase decision. Its importance depends on the amount of information consumers have about the product and product category. This paper investigates the importance of coutry of origin in purchase decision-making process for three different product categories: high risk and high level of consumer involvement in purchasing process (car, medium risk and midium level of consumer involvement in purchasing process (TV, and low risk and low level of consumer involvement in purchasing process (confectionery products. Also, this paper investigates importance of country of manufacturing for purchase decision-making process in relation to country of origin’s importance. Research was conducted on 215 respondents from Belgium and Republic of Croatia. Results have shown that country of origin is important only for car purchase, but not for TV and confectionery products. For all product categories, country of origin has been shown to be more important in the decision-making process than country of manufacturing.

  17. Using benchmarking to identify inter-centre differences in persistent ductus arteriosus treatment: can we improve outcome?

    Science.gov (United States)

    Jansen, Esther J S; Dijkman, Koen P; van Lingen, Richard A; de Vries, Willem B; Vijlbrief, Daniel C; de Boode, Willem P; Andriessen, Peter

    2017-10-01

    The aim of this study was to identify inter-centre differences in persistent ductus arteriosus treatment and their related outcomes. Materials and methods We carried out a retrospective, multicentre study including infants between 24+0 and 27+6 weeks of gestation in the period between 2010 and 2011. In all centres, echocardiography was used as the standard procedure to diagnose a patent ductus arteriosus and to document ductal closure. In total, 367 preterm infants were included. All four participating neonatal ICU had a comparable number of preterm infants; however, differences were observed in the incidence of treatment (33-63%), choice and dosing of medication (ibuprofen or indomethacin), number of pharmacological courses (1-4), and the need for surgical ligation after failure of pharmacological treatment (8-52%). Despite the differences in treatment, we found no difference in short-term morbidity between the centres. Adjusted mortality showed independent risk contribution of gestational age, birth weight, ductal ligation, and perinatal centre. Using benchmarking as a tool identified inter-centre differences. In these four perinatal centres, the factors that explained the differences in patent ductus arteriosus treatment are quite complex. Timing, choice of medication, and dosing are probably important determinants for successful patent ductus arteriosus closure.

  18. Differences in handgrip strength protocols to identify sarcopenia and frailty - a systematic review.

    Science.gov (United States)

    Sousa-Santos, A R; Amaral, T F

    2017-10-16

    Hand grip strength (HGS) is used for the diagnosis of sarcopenia and frailty. Several factors have been shown to influence HGS values during measurement. Therefore, variations in the protocols used to assess HGS, as part of the diagnosis of sarcopenia and frailty, may lead to the identification of different individuals with low HGS, introducing bias. The aim of this systematic review is to gather all the relevant studies that measured HGS to diagnose sarcopenia and frailty and to identify the differences between the protocols used. A systematic review was carried out following the recommendations of The Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) Statement. PubMed and Web of Science were systematically searched, until August 16, 2016. The evidence regarding HGS measurement protocols used to diagnose sarcopenia and frailty was summarised and the most recent protocols regarding the procedure were compared. From the described search 4393 articles were identified. Seventy-two studies were included in this systematic review, in which 37 referred to sarcopenia articles, 33 to frailty and two evaluated both conditions. Most studies presented limited information regarding the protocols used. The majority of the studies included did not describe a complete procedure of HGS measurement. The high heterogeneity between the protocols used, in sarcopenia and frailty studies, create an enormous difficulty in drawing comparative conclusions among them.

  19. Identifying dietary differences between Scotland and England: a rapid review of the literature.

    Science.gov (United States)

    Chambers, Stephanie; Barton, Karen L; Albani, Viviana; Anderson, Annie S; Wrieden, Wendy L

    2017-10-01

    Rates of premature mortality have been higher in Scotland than in England since the 1970s. Given the known association of diet with chronic disease, the study objective was to identify and synthesise evidence on current and historical differences in food and nutrient intakes in Scotland and England. A rapid review of the peer-reviewed and grey literature was carried out. After an initial scoping search, Medline, CINAHL, Embase and Web of Science were searched. Relevant grey literature was also included. Inclusion criteria were: any date; measures of dietary intake; representative populations; cross-sectional or observational cohort studies; and English-language publications. Study quality was assessed using the Quality Assessment Tool for Observational Cohort and Cross-sectional Studies. A narrative synthesis of extracted information was conducted. Fifty publications and reports were included in the review. Results indicated that children and adults in Scotland had lower intakes of vegetables and vitamins compared with those living in England. Higher intakes of salt in Scotland were also identified. Data were limited by small Scottish samples, difficulty in finding England-level data, lack of statistical testing and adjustment for key confounders. Further investigation of adequately powered and analysed surveys is required to examine more fully dietary differences between Scotland and England. This would provide greater insight into potential causes of excess mortality in Scotland compared with England and suitable policy recommendations to address these inequalities.

  20. A new index for identifying different types of El Niño Modoki events

    Science.gov (United States)

    Wang, Xin; Tan, Wei; Wang, Chunzai

    2018-04-01

    El Niño Modoki events can be further classified into El Niño Modoki I and II in terms of their opposite impacts on southern China rainfall (Wang and Wang, J Clim 26:1322-1338, 2013) and the Indian Ocean dipole mode (Wang and Wang, Clim Dyn 42:991-1005, 2014). The present paper develops an index to identify the types of El Niño events. The El Niño Modoki II (MII) index is defined as the leading principle component of multivariate empirical orthogonal function analysis of the normalized El Niño Modoki index, Niño4 index and 850 hPa relative vorticity anomalies averaged near the Philippine Sea during autumn. The MII index exhibits dominant variations on interannual (2-3 and 4-5 years) and decadal (10-20 years) timescales. El Niño Modoki II events can be well identified by using the MII index value being larger than 1 standard deviation. Further analyses and numerical model experiments confirm that the MII index can portray the major oceanic and atmospheric features of El Niño Modoki II events. The constructed MII index along with previous ENSO indices can be used for classifying and identifying all types of El Niño events. Because of distinct impacts induced by different types of El Niño events, the implication of the present study is that climate prediction and future climate projection under global warming can be improved by using the MII index and other indices to identify the types of El Niño events.

  1. Comparison of Different Internal Dosimetry Systems for Selected Radionuclides Important to Nuclear Power Production

    Energy Technology Data Exchange (ETDEWEB)

    Leggett, Richard Wayne [ORNL; Eckerman, Keith F [ORNL; Manger, Ryan P [ORNL

    2013-08-01

    This report compares three different radiation dosimetry systems currently applied by various U.S. Federal agencies and dose estimates based on these three dosimetry systems for a set of radionuclides often identified in power reactor effluents. These dosimetry systems were developed and applied by the International Commission on Radiological Protection at different times over the past six decades. Two primary modes of intake of radionuclides are addressed: ingestion in drinking water and inhalation. Estimated doses to individual organs and to the whole body based on each dosimetry system are compared for each of four age groups: infant, child, teenager, and adult. Substantial differences between dosimetry systems in estimated dose per unit intake are found for some individual radionuclides, but differences in estimated dose per unit intake generally are modest for mixtures of radionuclides typically found in nuclear power plant effluents.

  2. Linking the Salt Transcriptome with Physiological Responses of a Salt-Resistant Populus Species as a Strategy to Identify Genes Important for Stress Acclimation1[W][OA

    Science.gov (United States)

    Brinker, Monika; Brosché, Mikael; Vinocur, Basia; Abo-Ogiala, Atef; Fayyaz, Payam; Janz, Dennis; Ottow, Eric A.; Cullmann, Andreas D.; Saborowski, Joachim; Kangasjärvi, Jaakko; Altman, Arie; Polle, Andrea

    2010-01-01

    To investigate early salt acclimation mechanisms in a salt-tolerant poplar species (Populus euphratica), the kinetics of molecular, metabolic, and physiological changes during a 24-h salt exposure were measured. Three distinct phases of salt stress were identified by analyses of the osmotic pressure and the shoot water potential: dehydration, salt accumulation, and osmotic restoration associated with ionic stress. The duration and intensity of these phases differed between leaves and roots. Transcriptome analysis using P. euphratica-specific microarrays revealed clusters of coexpressed genes in these phases, with only 3% overlapping salt-responsive genes in leaves and roots. Acclimation of cellular metabolism to high salt concentrations involved remodeling of amino acid and protein biosynthesis and increased expression of molecular chaperones (dehydrins, osmotin). Leaves suffered initially from dehydration, which resulted in changes in transcript levels of mitochondrial and photosynthetic genes, indicating adjustment of energy metabolism. Initially, decreases in stress-related genes were found, whereas increases occurred only when leaves had restored the osmotic balance by salt accumulation. Comparative in silico analysis of the poplar stress regulon with Arabidopsis (Arabidopsis thaliana) orthologs was used as a strategy to reduce the number of candidate genes for functional analysis. Analysis of Arabidopsis knockout lines identified a lipocalin-like gene (AtTIL) and a gene encoding a protein with previously unknown functions (AtSIS) to play roles in salt tolerance. In conclusion, by dissecting the stress transcriptome of tolerant species, novel genes important for salt endurance can be identified. PMID:20959419

  3. Linking the salt transcriptome with physiological responses of a salt-resistant Populus species as a strategy to identify genes important for stress acclimation.

    Science.gov (United States)

    Brinker, Monika; Brosché, Mikael; Vinocur, Basia; Abo-Ogiala, Atef; Fayyaz, Payam; Janz, Dennis; Ottow, Eric A; Cullmann, Andreas D; Saborowski, Joachim; Kangasjärvi, Jaakko; Altman, Arie; Polle, Andrea

    2010-12-01

    To investigate early salt acclimation mechanisms in a salt-tolerant poplar species (Populus euphratica), the kinetics of molecular, metabolic, and physiological changes during a 24-h salt exposure were measured. Three distinct phases of salt stress were identified by analyses of the osmotic pressure and the shoot water potential: dehydration, salt accumulation, and osmotic restoration associated with ionic stress. The duration and intensity of these phases differed between leaves and roots. Transcriptome analysis using P. euphratica-specific microarrays revealed clusters of coexpressed genes in these phases, with only 3% overlapping salt-responsive genes in leaves and roots. Acclimation of cellular metabolism to high salt concentrations involved remodeling of amino acid and protein biosynthesis and increased expression of molecular chaperones (dehydrins, osmotin). Leaves suffered initially from dehydration, which resulted in changes in transcript levels of mitochondrial and photosynthetic genes, indicating adjustment of energy metabolism. Initially, decreases in stress-related genes were found, whereas increases occurred only when leaves had restored the osmotic balance by salt accumulation. Comparative in silico analysis of the poplar stress regulon with Arabidopsis (Arabidopsis thaliana) orthologs was used as a strategy to reduce the number of candidate genes for functional analysis. Analysis of Arabidopsis knockout lines identified a lipocalin-like gene (AtTIL) and a gene encoding a protein with previously unknown functions (AtSIS) to play roles in salt tolerance. In conclusion, by dissecting the stress transcriptome of tolerant species, novel genes important for salt endurance can be identified.

  4. Dynamic connectivity states estimated from resting fMRI Identify differences among Schizophrenia, bipolar disorder, and healthy control subjects.

    Science.gov (United States)

    Rashid, Barnaly; Damaraju, Eswar; Pearlson, Godfrey D; Calhoun, Vince D

    2014-01-01

    Schizophrenia (SZ) and bipolar disorder (BP) share significant overlap in clinical symptoms, brain characteristics, and risk genes, and both are associated with dysconnectivity among large-scale brain networks. Resting state functional magnetic resonance imaging (rsfMRI) data facilitates studying macroscopic connectivity among distant brain regions. Standard approaches to identifying such connectivity include seed-based correlation and data-driven clustering methods such as independent component analysis (ICA) but typically focus on average connectivity. In this study, we utilize ICA on rsfMRI data to obtain intrinsic connectivity networks (ICNs) in cohorts of healthy controls (HCs) and age matched SZ and BP patients. Subsequently, we investigated difference in functional network connectivity, defined as pairwise correlations among the timecourses of ICNs, between HCs and patients. We quantified differences in both static (average) and dynamic (windowed) connectivity during the entire scan duration. Disease-specific differences were identified in connectivity within different dynamic states. Notably, results suggest that patients make fewer transitions to some states (states 1, 2, and 4) compared to HCs, with most such differences confined to a single state. SZ patients showed more differences from healthy subjects than did bipolars, including both hyper and hypo connectivity in one common connectivity state (dynamic state 3). Also group differences between SZ and bipolar patients were identified in patterns (states) of connectivity involving the frontal (dynamic state 1) and frontal-parietal regions (dynamic state 3). Our results provide new information about these illnesses and strongly suggest that state-based analyses are critical to avoid averaging together important factors that can help distinguish these clinical groups.

  5. Identifying different methods for creating knowledge from lessons learned in project oriented organizations

    Directory of Open Access Journals (Sweden)

    Ahmad Norang

    2016-01-01

    Full Text Available Nowadays, the increase in competition has increased the relative importance of innovation for most firms and many managers believe a good innovation must be knowledge oriented. This paper has tried to determine different methods for creating knowledge in project oriented organizations. The study designs a questionnaire in Likert scale and distributes it among 32 experts who were well informed about different methods of knowledge creation and lessons learned. Cronbach alphas for all components of the survey were well above the desirable level. The study has detected 11 methods for knowledge creation and lessons learned. In terms of preliminary assessment, business transactions has received the highest impact while knowledge team has received the highest effect in terms of necessary assessment. The results of this survey have indicated that although there are several methods for detecting knowledge within organizations, in most cases, it is not easy to gain value added knowledge within an organization, quickly. The people who participated in our survey have indicated that organizational commitment, brainstorming, Delphi and storytelling also have played important role for creation of knowledge. The results have also shown that brainstorming, knowledge brokers, map knowledge and work experience were easier to use for knowledge creation and lessons learned compared with other forms of knowledge creation.

  6. Competing endogenous RNA network analysis identifies critical genes among the different breast cancer subtypes.

    Science.gov (United States)

    Chen, Juan; Xu, Juan; Li, Yongsheng; Zhang, Jinwen; Chen, Hong; Lu, Jianping; Wang, Zishan; Zhao, Xueying; Xu, Kang; Li, Yixue; Li, Xia; Zhang, Yan

    2017-02-07

    Although competing endogenous RNAs (ceRNAs) have been implicated in many solid tumors, their roles in breast cancer subtypes are not well understood. We therefore generated a ceRNA network for each subtype based on the significance of both, positive co-expression and the shared miRNAs, in the corresponding subtype miRNA dys-regulatory network, which was constructed based on negative regulations between differentially expressed miRNAs and targets. All four subtype ceRNA networks exhibited scale-free architecture and showed that the common ceRNAs were at the core of the networks. Furthermore, the common ceRNA hubs had greater connectivity than the subtype-specific hubs. Functional analysis of the common subtype ceRNA hubs highlighted factors involved in proliferation, MAPK signaling pathways and tube morphogenesis. Subtype-specific ceRNA hubs highlighted unique subtype-specific pathways, like the estrogen response and inflammatory pathways in the luminal subtypes or the factors involved in the coagulation process that participates in the basal-like subtype. Ultimately, we identified 29 critical subtype-specific ceRNA hubs that characterized the different breast cancer subtypes. Our study thus provides new insight into the common and specific subtype ceRNA interactions that define the different categories of breast cancer and enhances our understanding of the pathology underlying the different breast cancer subtypes, which can have prognostic and therapeutic implications in the future.

  7. Determining Minimal Clinically Important Differences in Japanese Cedar/Cypress Pollinosis Patients

    OpenAIRE

    Takaya Higaki; Mitsuhiro Okano; Shin Kariya; Tazuko Fujiwara; Takenori Haruna; Haruka Hirai; Aya Murai; Minoru Gotoh; Kimihiro Okubo; Shuji Yonekura; Yoshitaka Okamoto; Kazunori Nishizaki

    2013-01-01

    Background: Statistically significant results of medical intervention trials are not always clinically meaningful. We sought to estimate the minimal clinically important difference (MCID) (the smallest change in a given endpoint that is meaningful to a patient) during seasonal alteration of Japanese cedar/cypress pollinosis (JCCP). Methods: Results of a double-blinded, placebo-controlled trial of JCCP patients conducted between 2008 and 2010 were analyzed using an anchor-based method in wh...

  8. Functional brain activation differences in stuttering identified with a rapid fMRI sequence

    Science.gov (United States)

    Kraft, Shelly Jo; Choo, Ai Leen; Sharma, Harish; Ambrose, Nicoline G.

    2011-01-01

    The purpose of this study was to investigate whether brain activity related to the presence of stuttering can be identified with rapid functional MRI (fMRI) sequences that involved overt and covert speech processing tasks. The long-term goal is to develop sensitive fMRI approaches with developmentally appropriate tasks to identify deviant speech motor and auditory brain activity in children who stutter closer to the age at which recovery from stuttering is documented. Rapid sequences may be preferred for individuals or populations who do not tolerate long scanning sessions. In this report, we document the application of a picture naming and phoneme monitoring task in three minute fMRI sequences with adults who stutter (AWS). If relevant brain differences are found in AWS with these approaches that conform to previous reports, then these approaches can be extended to younger populations. Pairwise contrasts of brain BOLD activity between AWS and normally fluent adults indicated the AWS showed higher BOLD activity in the right inferior frontal gyrus (IFG), right temporal lobe and sensorimotor cortices during picture naming and and higher activity in the right IFG during phoneme monitoring. The right lateralized pattern of BOLD activity together with higher activity in sensorimotor cortices is consistent with previous reports, which indicates rapid fMRI sequences can be considered for investigating stuttering in younger participants. PMID:22133409

  9. Identifying well-bleached quartz using the different bleaching rates of quartz and feldspar luminescence signals

    DEFF Research Database (Denmark)

    Murray, A.S.; Thomsen, Kristina Jørkov; Masuda, N.

    2012-01-01

    When dating older sedimentary deposits using quartz, there are no unambiguous methods for identifying the presence of incomplete bleaching. Current statistical analysis of dose distributions depends entirely on the assumption that incomplete bleaching and mixing are the main causes of any excess...... dispersion in the distribution; the only existing way to test this assumption is using independent age control. Here we suggest a new approach to this question, based on the differential bleaching rates of quartz and feldspar luminescence signals. We first present data that confirm the differences...... in relative bleaching rates of quartz optically stimulated luminescence (OSL) and feldspar luminescence stimulated at 50 °C by infrared light (IR50) and feldspar luminescence stimulated at 290 °C by infrared light after a stimulation at 50 °C (pIRIR290), and use recently deposited samples to determine...

  10. Development of a model system to identify differences in spring and winter oat.

    Science.gov (United States)

    Chawade, Aakash; Lindén, Pernilla; Bräutigam, Marcus; Jonsson, Rickard; Jonsson, Anders; Moritz, Thomas; Olsson, Olof

    2012-01-01

    Our long-term goal is to develop a Swedish winter oat (Avena sativa). To identify molecular differences that correlate with winter hardiness, a winter oat model comprising of both non-hardy spring lines and winter hardy lines is needed. To achieve this, we selected 294 oat breeding lines, originating from various Russian, German, and American winter oat breeding programs and tested them in the field in south- and western Sweden. By assaying for winter survival and agricultural properties during four consecutive seasons, we identified 14 breeding lines of different origins that not only survived the winter but also were agronomically better than the rest. Laboratory tests including electrolytic leakage, controlled crown freezing assay, expression analysis of the AsVrn1 gene and monitoring of flowering time suggested that the American lines had the highest freezing tolerance, although the German lines performed better in the field. Finally, six lines constituting the two most freezing tolerant lines, two intermediate lines and two spring cultivars were chosen to build a winter oat model system. Metabolic profiling of non-acclimated and cold acclimated leaf tissue samples isolated from the six selected lines revealed differential expression patterns of 245 metabolites including several sugars, amino acids, organic acids and 181 hitherto unknown metabolites. The expression patterns of 107 metabolites showed significant interactions with either a cultivar or a time-point. Further identification, characterisation and validation of these metabolites will lead to an increased understanding of the cold acclimation process in oats. Furthermore, by using the winter oat model system, differential sequencing of crown mRNA populations would lead to identification of various biomarkers to facilitate winter oat breeding.

  11. Identifying diabetes-related important protein targets with few interacting partners with the PageRank algorithm.

    Science.gov (United States)

    Grolmusz, Vince I

    2015-04-01

    Diabetes is a growing concern for the developed nations worldwide. New genomic, metagenomic and gene-technologic approaches may yield considerable results in the next several years in its early diagnosis, or in advances in therapy and management. In this work, we highlight some human proteins that may serve as new targets in the early diagnosis and therapy. With the help of a very successful mathematical tool for network analysis that formed the basis of the early successes of Google(TM), Inc., we analyse the human protein-protein interaction network gained from the IntAct database with a mathematical algorithm. The novelty of our approach is that the new protein targets suggested do not have many interacting partners (so, they are not hubs or super-hubs), so their inhibition or promotion probably will not have serious side effects. We have identified numerous possible protein targets for diabetes therapy and/or management; some of these have been well known for a long time (these validate our method), some of them appeared in the literature in the last 12 months (these show the cutting edge of the algorithm), and the remainder are still unknown to be connected with diabetes, witnessing completely new hits of the method.

  12. Gene expression profiling and candidate gene resequencing identifies pathways and mutations important for malignant transformation caused by leukemogenic fusion genes.

    Science.gov (United States)

    Novak, Rachel L; Harper, David P; Caudell, David; Slape, Christopher; Beachy, Sarah H; Aplan, Peter D

    2012-12-01

    NUP98-HOXD13 (NHD13) and CALM-AF10 (CA10) are oncogenic fusion proteins produced by recurrent chromosomal translocations in patients with acute myeloid leukemia (AML). Transgenic mice that express these fusions develop AML with a long latency and incomplete penetrance, suggesting that collaborating genetic events are required for leukemic transformation. We employed genetic techniques to identify both preleukemic abnormalities in healthy transgenic mice as well as collaborating events leading to leukemic transformation. Candidate gene resequencing revealed that 6 of 27 (22%) CA10 AMLs spontaneously acquired a Ras pathway mutation and 8 of 27 (30%) acquired an Flt3 mutation. Two CA10 AMLs acquired an Flt3 internal-tandem duplication, demonstrating that these mutations can be acquired in murine as well as human AML. Gene expression profiles revealed a marked upregulation of Hox genes, particularly Hoxa5, Hoxa9, and Hoxa10 in both NHD13 and CA10 mice. Furthermore, mir196b, which is embedded within the Hoxa locus, was overexpressed in both CA10 and NHD13 samples. In contrast, the Hox cofactors Meis1 and Pbx3 were differentially expressed; Meis1 was increased in CA10 AMLs but not NHD13 AMLs, whereas Pbx3 was consistently increased in NHD13 but not CA10 AMLs. Silencing of Pbx3 in NHD13 cells led to decreased proliferation, increased apoptosis, and decreased colony formation in vitro, suggesting a previously unexpected role for Pbx3 in leukemic transformation. Published by Elsevier Inc.

  13. Modeling vehicle emissions in different types of Chinese cities: Importance of vehicle fleet and local features

    International Nuclear Information System (INIS)

    Huo Hong; Zhang Qiang; He Kebin; Yao Zhiliang; Wang Xintong; Zheng Bo; Streets, David G.; Wang Qidong; Ding Yan

    2011-01-01

    We propose a method to simulate vehicle emissions in Chinese cities of different sizes and development stages. Twenty two cities are examined in this study. The target year is 2007. Among the cities, the vehicle emission factors were remarkably different (the highest is 50-90% higher than the lowest) owing to their distinct local features and vehicle technology levels, and the major contributors to total vehicle emissions were also different. A substantial increase in vehicle emissions is foreseeable unless stronger measures are implemented because the benefit of current policies can be quickly offset by the vehicle growth. Major efforts should be focused on all cities, especially developing cities where the requirements are lenient. This work aims a better understanding of vehicle emissions in all types of Chinese cities. The proposed method could benefit national emission inventory studies in improving accuracy and help in designing national and local policies for vehicle emission control. - Highlights: → We examine vehicle emissions in 22 Chinese cities of different types and locations. → Vehicle emission factors of the cities differ by 50-90% due to distinct local features. → Each vehicle type contributes differently to total emissions among the cities. → A substantial increase in vehicle emissions in most Chinese cities is foreseeable. → City-specific fleet and local features are important in research and policy making. - Vehicle emission characteristics of Chinese cities are remarkably different, and local features need to be taken into account in vehicle emission studies and control strategy.

  14. Genome-wide analysis reveals signatures of selection for important traits in domestic sheep from different ecoregions.

    Science.gov (United States)

    Liu, Zhaohua; Ji, Zhibin; Wang, Guizhi; Chao, Tianle; Hou, Lei; Wang, Jianmin

    2016-11-03

    Throughout a long period of adaptation and selection, sheep have thrived in a diverse range of ecological environments. Mongolian sheep is the common ancestor of the Chinese short fat-tailed sheep. Migration to different ecoregions leads to changes in selection pressures and results in microevolution. Mongolian sheep and its subspecies differ in a number of important traits, especially reproductive traits. Genome-wide intraspecific variation is required to dissect the genetic basis of these traits. This research resequenced 3 short fat-tailed sheep breeds with a 43.2-fold coverage of the sheep genome. We report more than 17 million single nucleotide polymorphisms and 2.9 million indels and identify 143 genomic regions with reduced pooled heterozygosity or increased genetic distance to each other breed that represent likely targets for selection during the migration. These regions harbor genes related to developmental processes, cellular processes, multicellular organismal processes, biological regulation, metabolic processes, reproduction, localization, growth and various components of the stress responses. Furthermore, we examined the haplotype diversity of 3 genomic regions involved in reproduction and found significant differences in TSHR and PRL gene regions among 8 sheep breeds. Our results provide useful genomic information for identifying genes or causal mutations associated with important economic traits in sheep and for understanding the genetic basis of adaptation to different ecological environments.

  15. [The different point of view about the sanitary control of importation of psychotropic substances in Brazil].

    Science.gov (United States)

    Sebastião, Patrícia Cristina Antunes; Lucchese, Geraldo

    2010-11-01

    The purpose of this work is to analyze the process of importation, that is a part of the sanitary control of psychotropic substances, made by Brazilian National Health Surveillance Agency's ports, airports and borders. For this work, psychotropic substances are defined as active pharmaceutical raw materials present in the list B1 of Portaria nº 344/98; which need Anvisa's permission to be imported. For this purpose we used semistructured interviews with key informers and participant observation. The information were collected and systematized through the content analysis, thematic modality. The results show a very complex control which involves an intense bureaucratic process. The main identified critical points of the process were: the information system precariousness; the absence of human resources; deficiency of laboratorial support and infra-structure at customs. Anvisa's web page and the specific law are strong points of the process, but still needing improvements. We understood that despite of the progress made, there are many things to do for giving the country an efficient health control system to the importation of these substances.

  16. Identifying rural-urban differences in the predictors of emergency ambulance service demand and misuse.

    Science.gov (United States)

    Wong, Ho Ting; Lin, Teng-Kang; Lin, Jen-Jia

    2018-06-13

    This study aims to assess rural-urban differences in the predictors of emergency ambulance service (EAS) demand and misuse in New Taipei City. Identifying the predictors of EAS demand will help the EAS service managing authority in formulating focused policies to maintain service quality. Over 160,000 electronic EAS usage records were used with a negative binomial regression model to assess rural-urban differences in the predictors of EAS demand and misuse. The factors of 1) ln-transformed population density, 2) percentage of residents who completed up to junior high school education, 3) accessibility of hospitals without an emergency room, and 4) accessibility of EAS were found to be predictors of EAS demand in rural areas, whereas only the factor of percentage of people aged above 65 was found to predict EAS demand in urban areas. For EAS misuse, only the factor of percentage of low-income households was found to be a predictor in rural areas, whereas no predictor was found in the urban areas. Results showed that the factors predicting EAS demand and misuse in rural areas were more complicated compared to urban areas and, therefore, formulating EAS policies for rural areas based on the results of urban studies may not be appropriate. Copyright © 2018. Published by Elsevier B.V.

  17. Using the apparent diffusion coefficient to identifying MGMT promoter methylation status early in glioblastoma: importance of analytical method

    Energy Technology Data Exchange (ETDEWEB)

    Rundle-Thiele, Dayle [Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia); Day, Bryan; Stringer, Brett [Brain Cancer Research Unit, Queensland Institute of Medical Research, Brisbane, Queensland (Australia); Fay, Michael [Department of Radiation Oncology, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Martin, Jennifer [Discipline of Clinical Pharmacology, School of Medicine and Public Health, University of Newcastle, Newcastle, New South Wales (Australia); Jeffree, Rosalind L [Department of Neurosurgery, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Thomas, Paul [Queensland PET Service, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Bell, Christopher [Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia); Salvado, Olivier [CSIRO Digital Productivity Flagship, CSIRO, Herston, Queensland (Australia); Gal, Yaniv [Centre for Medical Diagnostic Technologies in Queensland, University of Queensland, Brisbane, Queensland (Australia); Coulthard, Alan [Discipline of Medical Imaging, University of Queensland, St Lucia, Queensland (Australia); Department of Medical Imaging, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Crozier, Stuart [Centre for Medical Diagnostic Technologies in Queensland, University of Queensland, Brisbane, Queensland (Australia); Rose, Stephen, E-mail: stephen.rose@csiro.au [CSIRO Digital Productivity Flagship, CSIRO, Herston, Queensland (Australia); Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia)

    2015-06-15

    Accurate knowledge of O{sup 6}-methylguanine methyltransferase (MGMT) gene promoter subtype in patients with glioblastoma (GBM) is important for treatment. However, this test is not always available. Pre-operative diffusion MRI (dMRI) can be used to probe tumour biology using the apparent diffusion coefficient (ADC); however, its ability to act as a surrogate to predict MGMT status has shown mixed results. We investigated whether this was due to variations in the method used to analyse ADC. We undertook a retrospective study of 32 patients with GBM who had MGMT status measured. Matching pre-operative MRI data were used to calculate the ADC within contrast enhancing regions of tumour. The relationship between ADC and MGMT was examined using two published ADC methods. A strong trend between a measure of ‘minimum ADC’ and methylation status was seen. An elevated minimum ADC was more likely in the methylated compared to the unmethylated MGMT group (U = 56, P = 0.0561). In contrast, utilising a two-mixture model histogram approach, a significant reduction in mean measure of the ‘low ADC’ component within the histogram was associated with an MGMT promoter methylation subtype (P < 0.0246). This study shows that within the same patient cohort, the method selected to analyse ADC measures has a significant bearing on the use of that metric as a surrogate marker of MGMT status. Thus for dMRI data to be clinically useful, consistent methods of data analysis need to be established prior to establishing any relationship with genetic or epigenetic profiling.

  18. Using the apparent diffusion coefficient to identifying MGMT promoter methylation status early in glioblastoma: importance of analytical method

    International Nuclear Information System (INIS)

    Rundle-Thiele, Dayle; Day, Bryan; Stringer, Brett; Fay, Michael; Martin, Jennifer; Jeffree, Rosalind L; Thomas, Paul; Bell, Christopher; Salvado, Olivier; Gal, Yaniv; Coulthard, Alan; Crozier, Stuart; Rose, Stephen

    2015-01-01

    Accurate knowledge of O 6 -methylguanine methyltransferase (MGMT) gene promoter subtype in patients with glioblastoma (GBM) is important for treatment. However, this test is not always available. Pre-operative diffusion MRI (dMRI) can be used to probe tumour biology using the apparent diffusion coefficient (ADC); however, its ability to act as a surrogate to predict MGMT status has shown mixed results. We investigated whether this was due to variations in the method used to analyse ADC. We undertook a retrospective study of 32 patients with GBM who had MGMT status measured. Matching pre-operative MRI data were used to calculate the ADC within contrast enhancing regions of tumour. The relationship between ADC and MGMT was examined using two published ADC methods. A strong trend between a measure of ‘minimum ADC’ and methylation status was seen. An elevated minimum ADC was more likely in the methylated compared to the unmethylated MGMT group (U = 56, P = 0.0561). In contrast, utilising a two-mixture model histogram approach, a significant reduction in mean measure of the ‘low ADC’ component within the histogram was associated with an MGMT promoter methylation subtype (P < 0.0246). This study shows that within the same patient cohort, the method selected to analyse ADC measures has a significant bearing on the use of that metric as a surrogate marker of MGMT status. Thus for dMRI data to be clinically useful, consistent methods of data analysis need to be established prior to establishing any relationship with genetic or epigenetic profiling

  19. Sorption of phenanthrene and benzene on differently structural kerogen: Important role of micropore-filling

    International Nuclear Information System (INIS)

    Zhang, Yulong; Ma, Xiaoxuan; Ran, Yong

    2014-01-01

    Shale was thermally treated to obtain a series of kerogen with varied maturation. Their chemical, structural and porous properties were related to the sorption and/or desorption behaviors of phenanthrene and benzene. As the treatment temperature increases, aliphatic and carbonyl carbon of the kerogen samples decrease, while their aromaticity and maturation increase. Meanwhile, the isothermal nonlinearity of phenanthrene and benzene increases whereas the sorption capacity and micropore adsorption volumes (V o,d ) initially increase and then decrease. The V o,d of benzene is significantly correlated with, but higher than that of phenanthrene, suggesting similar micropore filling mechanism and molecular sieve effect. The benzene desorption exhibits hysteresis, which is related to the pore deformation of the kerogen and the entrapment of solute in the kerogen matrix. The V o,d of phenanthrene and benzene on the kerogen samples accounts for 23–46% and 36–65% of the maximum sorption volumes, respectively, displaying the importance of the micropore filling. -- Highlights: • The microporosity estimated by benzene vapor differs greatly from that by N 2 . • The micropore volume changes with kerogen maturation. • The phenanthrene or benzene sorption is related to the microporosity of kerogen. • Higher adsorption volume for benzene than for phenanthrene suggests molecular sieve effect. • The pore-filling plays an important role in the sorption of phenanthrene and benzene. -- The sorption behaviors of benzene and phenanthrene are related to the microporosity of the differently matured kerogen, indicating the importance of pore-filling

  20. Gene Network for Identifying the Entropy Changes of Different Modules in Pediatric Sepsis

    Directory of Open Access Journals (Sweden)

    Jing Yang

    2016-12-01

    Full Text Available Background/Aims: Pediatric sepsis is a disease that threatens life of children. The incidence of pediatric sepsis is higher in developing countries due to various reasons, such as insufficient immunization and nutrition, water and air pollution, etc. Exploring the potential genes via different methods is of significance for the prevention and treatment of pediatric sepsis. This study aimed to identify potential genes associated with pediatric sepsis utilizing analysis of gene network and entropy. Methods: The mRNA expression in the blood samples collected from 20 septic children and 30 healthy controls was quantified by using Affymetrix HG-U133A microarray. Two condition-specific protein-protein interaction networks (PINs, one for the healthy control and the other one for the children with sepsis, were deduced by combining the fundamental human PINs with gene expression profiles in the two phenotypes. Subsequently, distinct modules from the two conditional networks were extracted by adopting a maximal clique-merging approach. Delta entropy (ΔS was calculated between sepsis and control modules. Results: Then, key genes displaying changes in gene composition were identified by matching the control and sepsis modules. Two objective modules were obtained, in which ribosomal protein RPL4 and RPL9 as well as TOP2A were probably considered as the key genes differentiating sepsis from healthy controls. Conclusion: According to previous reports and this work, TOP2A is the potential gene therapy target for pediatric sepsis. The relationship between pediatric sepsis and RPL4 and RPL9 needs further investigation.

  1. Ethnic differences in the ability of triglyceride levels to identify insulin resistance.

    Science.gov (United States)

    Sumner, Anne E; Cowie, Catherine C

    2008-02-01

    The Metabolic Syndrome is used to predict the onset of coronary artery disease and Type 2 diabetes. As the predictive value of the Metabolic Syndrome has been challenged, alternative syndromes have been developed. All of these syndromes were developed in populations that were predominantly non-Hispanic white (NHW). They include the Enlarged Waist Elevated Triglyceride Syndrome, the Overweight-Lipid Syndrome and the Hypertriglyceridemic Waist Syndrome. The first applies to postmenopausal women, the second to overweight individuals (BMI> or =25 kg/m(2)), and the third to men. Each syndrome uses hypertriglyceridemia as a criterion. However, the definition of hypertriglyceridemia varies by syndrome i.e. TG> or =128 mg/dL for the Enlarged Waist Elevated Triglyceride Syndrome, TG> or =130 mg/dL for the Overweight-Lipid Syndrome, > or =150 mg/dL for the Metabolic Syndrome, and TG> or =176 mg/dL for the Hypertriglyceridemic Waist Syndrome. Insulin resistance and hypertriglyceridemia are highly correlated. But as insulin resistant non-Hispanic blacks (NHB) often have triglyceride (TG) levels below the thresholds set by these syndromes, the ability of either TG or these syndromes to identify high risk NHB is unknown. Using the National Health and Nutrition Examination Survey (NHANES) 1999-2002, our goals were to determine by ethnicity: (1) the prevalence of each of these syndromes; (2) the ability of fasting TG concentrations to identify insulin resistance at cut-off levels established by these syndromes, specifically 130, 150 and 176 mg/dL. Participants were 2804 adults from NHANES 1999-2002. The cohort was divided into tertiles of homeostasis model assessment. Insulin resistance was defined as the upper tertile (> or =2.73). The prevalence of each syndrome was lower in NHB than NHW or Mexican Americans (MA) (all Pidentify individuals at high risk for conditions such as cardiovascular disease and Type 2 diabetes, ethnic differences in TG levels should be considered.

  2. Discriminative ability of two different external anchors: improvement appears better than importance

    DEFF Research Database (Denmark)

    Lauridsen, Henrik Hein

    2009-01-01

    interpretable statistics such as proportions and numbers needed to treat can be reported based on the MIC. Estimating the MIC using the anchor-based method is, however, not without difficulties. For instance issues relating to calculation methods, measurement error, rater perspective, population specificity...... and baseline dependence have been raised, and little attention has been paid to how improvement and importance of a treatment outcome should be interpreted. The purpose of this study is to explore the adequateness of two different external anchors using the anchor-based MIC distribution method and probability...... of improvement/importance curves. Methods Two hundred and twenty-four patients with chronic low back pain and/or leg pain were recruited from an out-patient hospital back pain clinic and followed over an 8-week period. Participants received the Danish Oswestry Disability Index (ODI), the numeric rating scale...

  3. DNA comet assay to identify different freezing temperatures of irradiated liver chicken

    International Nuclear Information System (INIS)

    Duarte, Renato C.; Mozeika, Michel A.; Fanaro, Gustavo B.; Villavicencio, Anna L.C.H.; Marchioni, Eric

    2009-01-01

    The cold chain is a succession of steps which maintain the food at low temperature. The thawed food never be frozen again and the best solution being to consume it quickly to avoid the microorganism growth which causes decay and nutrients damage. One of most important point is that freezing process, unlike irradiation, do not destroy microorganisms, only inactive them as long as they remain in a frozen state. The Comet Assay is an original test used to detect irradiated foods that's recognize the DNA damage and can then be used to control the overall degradation of the food and in a certain extend to evaluate the damage caused by irradiation, different forms of freeze and storage time on liver chicken cells. Different freezing temperatures were used, deep freeze -196 deg C and slow freeze -10 deg C. Samples were irradiated in a 60 Co irradiator with 1.5, 3.0 and 4.5 kGy radiation doses. Fast freezing technique induces a low percent of DNA degradation comparing to slow freezing technique. This procedure could be a good choose to chicken freezing processing. (author)

  4. Intraguild Predation Responses in Two Aphidophagous Coccinellids Identify Differences among Juvenile Stages and Aphid Densities.

    Science.gov (United States)

    Rondoni, Gabriele; Ielo, Fulvio; Ricci, Carlo; Conti, Eric

    2014-12-08

    (1) Intraguild predation (IGP) can occur among aphidophagous predators thus reducing their effectiveness in controlling crop pests. Among ladybirds, Coccinella septempunctata L. and Hippodamia variegata Goeze are the most effective predators upon Aphis gossypii Glov., which is an economically important pest of melon. Understanding their likelihood to engage in reciprocal predation is a key point for conservation of biological control. Here, we aim to investigate, under laboratory conditions, the level of IGP between the two above mentioned aphidophagous species. (2) Fourth-instars of the two species were isolated in petri dishes with combinations of different stages of the heterospecific ladybird and different densities of A. gossypii. The occurrence of IGP events was recorded after six hours. (3) C. septempunctata predated H. variegata at a higher rate than vice versa (70% vs. 43% overall). Higher density of the aphid or older juvenile stage of the IG-prey (22% of fourth instars vs. 74% of eggs and second instars) reduces the likelihood of predation. (4) To our knowledge, IGP between C. septempunctata and H. variegata was investigated for the first time. Results represent a baseline, necessary to predict the likelihood of IGP occurrence in the field.

  5. DNA comet assay to identify different freezing temperatures of irradiated liver chicken

    Energy Technology Data Exchange (ETDEWEB)

    Duarte, Renato C.; Mozeika, Michel A.; Fanaro, Gustavo B.; Villavicencio, Anna L.C.H. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)], e-mail: renatocduarte@yahoo.com.br; Marchioni, Eric [Universite de Strasbourg, Illkirch (France). Faculte de Pharmacie. Lab. de Chimie Analytique et Sciences de l' Aliment

    2009-07-01

    The cold chain is a succession of steps which maintain the food at low temperature. The thawed food never be frozen again and the best solution being to consume it quickly to avoid the microorganism growth which causes decay and nutrients damage. One of most important point is that freezing process, unlike irradiation, do not destroy microorganisms, only inactive them as long as they remain in a frozen state. The Comet Assay is an original test used to detect irradiated foods that's recognize the DNA damage and can then be used to control the overall degradation of the food and in a certain extend to evaluate the damage caused by irradiation, different forms of freeze and storage time on liver chicken cells. Different freezing temperatures were used, deep freeze -196 deg C and slow freeze -10 deg C. Samples were irradiated in a {sup 60}Co irradiator with 1.5, 3.0 and 4.5 kGy radiation doses. Fast freezing technique induces a low percent of DNA degradation comparing to slow freezing technique. This procedure could be a good choose to chicken freezing processing. (author)

  6. Medically important differences in snake venom composition are dictated by distinct postgenomic mechanisms.

    Science.gov (United States)

    Casewell, Nicholas R; Wagstaff, Simon C; Wüster, Wolfgang; Cook, Darren A N; Bolton, Fiona M S; King, Sarah I; Pla, Davinia; Sanz, Libia; Calvete, Juan J; Harrison, Robert A

    2014-06-24

    Variation in venom composition is a ubiquitous phenomenon in snakes and occurs both interspecifically and intraspecifically. Venom variation can have severe outcomes for snakebite victims by rendering the specific antibodies found in antivenoms ineffective against heterologous toxins found in different venoms. The rapid evolutionary expansion of different toxin-encoding gene families in different snake lineages is widely perceived as the main cause of venom variation. However, this view is simplistic and disregards the understudied influence that processes acting on gene transcription and translation may have on the production of the venom proteome. Here, we assess the venom composition of six related viperid snakes and compare interspecific changes in the number of toxin genes, their transcription in the venom gland, and their translation into proteins secreted in venom. Our results reveal that multiple levels of regulation are responsible for generating variation in venom composition between related snake species. We demonstrate that differential levels of toxin transcription, translation, and their posttranslational modification have a substantial impact upon the resulting venom protein mixture. Notably, these processes act to varying extents on different toxin paralogs found in different snakes and are therefore likely to be as important as ancestral gene duplication events for generating compositionally distinct venom proteomes. Our results suggest that these processes may also contribute to altering the toxicity of snake venoms, and we demonstrate how this variability can undermine the treatment of a neglected tropical disease, snakebite.

  7. THE IMPORTANCE OF ‘SIGNIFICANT OTHERS’ IN BRIDGING THE GAPS BETWEEN DIFFERENT READING CONTEXTS

    Directory of Open Access Journals (Sweden)

    Anna-Karin Svensson

    2018-04-01

    Full Text Available The current research is an in-depth study of four pre-service teachers’ own experience of reading in various contexts and for different reasons. The aim is to analyse what has been significant regarding reading in a life history perspective by the use of narratives. A socio-cultural perspective on reading is used as analysis tool. The over-arching result from analysing pre-service teachers’ narratives is that reading is a relational process regardless of the context reading takes place in. The emerging themes allow a deeper understanding on critical aspects for developing reading in various contexts and at different levels. Significant others seem important in every reading practice, from new readers in primary school to pre-service teachers’ reading at university level. The narratives reveal a need for bridging the gaps that arise between the reading practices in the various contexts that students meet in school and university.

  8. IMPORTANCE OF DIFFERENT MODELS IN DECISION MAKING, EXPLAINING THE STRATEGIC BEHAVIOR IN ORGANIZATIONS

    Directory of Open Access Journals (Sweden)

    Cristiano de Oliveira Maciel

    2006-11-01

    Full Text Available This study is about the different models of decision process analyzing the organizational strategy. The article presents the strategy according to a cognitive approach. The discussion about that approach has three models of decision process: rational actor model, organizational behavior, and political model. These models, respectively, present some improvement in the decision making results, search for a good decision facing the cognitive restrictions of the administrator, and lots of talks for making a decision. According to the emphasis of each model, the possibilities for analyzing the strategy are presented. The article also shows that it is necessary to take into account the three different ways of analysis. That statement is justified once the analysis as well as the decision making become more complex, mainly those which are more important for the organizations.

  9. Identifying the causes of differences in ozone production from the CB05 and CBMIV chemical mechanisms

    Directory of Open Access Journals (Sweden)

    R. D. Saylor

    2012-02-01

    Full Text Available An investigation was conducted to identify the mechanistic differences between two versions of the carbon bond gas-phase chemical mechanism (CB05 and CBMIV which consistently lead to larger ground-level ozone concentrations being produced in the CB05 version of the National Air Quality Forecasting Capability (NAQFC modeling system even though the two parallel forecast systems utilize the same meteorology and base emissions and similar initial and boundary conditions. Box models of each of the mechanisms as they are implemented in the NAQFC were created and a set of 12 sensitivity simulations was designed. The sensitivity simulations independently probed the conceptual mechanistic differences between CB05 and CBMIV and were exercised over a 45-scenario simulation suite designed to emulate the wide range of chemical regimes encountered in a continental-scale atmospheric chemistry model. Results of the sensitivity simulations indicate that two sets of reactions that were included in the CB05 mechanism, but which were absent from the CBMIV mechanism, are the primary causes of the greater ozone production in the CB05 version of the NAQFC. One set of reactions recycles the higher organic peroxide species of CB05 (ROOH, resulting in additional photochemically reactive products that act to produce additional ozone in some chemical regimes. The other set of reactions recycles reactive nitrogen from less reactive forms back to NO2, increasing the effective NOx concentration of the system. In particular, the organic nitrate species (NTR, which was a terminal product for reactive nitrogen in the CBMIV mechanism, acts as a reservoir species in CB05 to redistribute NOx from major source areas to potentially NOx-sensitive areas where additional ozone may be produced in areas remote from direct NOx sources.

  10. Genome-Wide Expression Profiling of Five Mouse Models Identifies Similarities and Differences with Human Psoriasis

    Science.gov (United States)

    Swindell, William R.; Johnston, Andrew; Carbajal, Steve; Han, Gangwen; Wohn, Christian; Lu, Jun; Xing, Xianying; Nair, Rajan P.; Voorhees, John J.; Elder, James T.; Wang, Xiao-Jing; Sano, Shigetoshi; Prens, Errol P.; DiGiovanni, John; Pittelkow, Mark R.; Ward, Nicole L.; Gudjonsson, Johann E.

    2011-01-01

    Development of a suitable mouse model would facilitate the investigation of pathomechanisms underlying human psoriasis and would also assist in development of therapeutic treatments. However, while many psoriasis mouse models have been proposed, no single model recapitulates all features of the human disease, and standardized validation criteria for psoriasis mouse models have not been widely applied. In this study, whole-genome transcriptional profiling is used to compare gene expression patterns manifested by human psoriatic skin lesions with those that occur in five psoriasis mouse models (K5-Tie2, imiquimod, K14-AREG, K5-Stat3C and K5-TGFbeta1). While the cutaneous gene expression profiles associated with each mouse phenotype exhibited statistically significant similarity to the expression profile of psoriasis in humans, each model displayed distinctive sets of similarities and differences in comparison to human psoriasis. For all five models, correspondence to the human disease was strong with respect to genes involved in epidermal development and keratinization. Immune and inflammation-associated gene expression, in contrast, was more variable between models as compared to the human disease. These findings support the value of all five models as research tools, each with identifiable areas of convergence to and divergence from the human disease. Additionally, the approach used in this paper provides an objective and quantitative method for evaluation of proposed mouse models of psoriasis, which can be strategically applied in future studies to score strengths of mouse phenotypes relative to specific aspects of human psoriasis. PMID:21483750

  11. Using cluster analysis to identify patterns in students’ responses to contextually different conceptual problems

    Directory of Open Access Journals (Sweden)

    John Stewart

    2012-10-01

    Full Text Available This study examined the evolution of student responses to seven contextually different versions of two Force Concept Inventory questions in an introductory physics course at the University of Arkansas. The consistency in answering the closely related questions evolved little over the seven-question exam. A model for the state of student knowledge involving the probability of selecting one of the multiple-choice answers was developed. Criteria for using clustering algorithms to extract model parameters were explored and it was found that the overlap between the probability distributions of the model vectors was an important parameter in characterizing the cluster models. The course data were then clustered and the extracted model showed that students largely fit into two groups both pre- and postinstruction: one that answered all questions correctly with high probability and one that selected the distracter representing the same misconception with high probability. For the course studied, 14% of the students were left with persistent misconceptions post instruction on a static force problem and 30% on a dynamic Newton’s third law problem. These students selected the answer representing the predominant misconception slightly more consistently postinstruction, indicating that the course studied had been ineffective at moving this subgroup of students nearer a Newtonian force concept and had instead moved them slightly farther away from a correct conceptual understanding of these two problems. The consistency in answering pairs of problems with varied physical contexts is shown to be an important supplementary statistic to the score on the problems and suggests that the inclusion of such problem pairs in future conceptual inventories would be efficacious. Multiple, contextually varied questions further probe the structure of students’ knowledge. To allow working instructors to make use of the additional insight gained from cluster analysis, it

  12. Differences in the importance of weather and weather-based decisions among campers in Ontario parks (Canada)

    Science.gov (United States)

    Hewer, Micah J.; Scott, Daniel J.; Gough, William A.

    2017-10-01

    Parks and protected areas represent an important resource for tourism in Canada, in which camping is a common recreational activity. The important relationship between weather and climate with recreation and tourism has been widely acknowledged within the academic literature. Howbeit, the need for activity-specific assessments has been identified as an on-going need for future research in the field of tourism climatology. Furthermore, very little is known about the interrelationships between personal characteristics and socio-demographics with weather preferences and behavioural thresholds. This study uses a stated climate preferences approach (survey responses) to explore differences in the importance of weather and related weather-based decisions among summer campers in Ontario parks. Statistically significant differences were found among campers for each of the four dependent variables tested in this study. Physically active campers placed greater importance on weather but were still more tolerant of adverse weather conditions. Older campers placed greater importance on weather. Campers travelling shorter distances placed greater importance on weather and were more likely to leave the park early due to adverse weather. Campers staying for longer periods of time were less likely to leave early due to weather and were willing to endure longer durations of adverse weather conditions. Beginner campers placed greater importance on weather, were more likely to leave early due to weather and recorded lower temporal weather thresholds. The results of this study contribute to the study of tourism climatology by furthering understanding of how personal characteristics such as gender, age, activity selection, trip duration, distance travelled, travel experience and life cycles affect weather preferences and decisions, focusing this time on recreational camping in a park tourism context.

  13. The relative importance of different perceptual-cognitive skills during anticipation.

    Science.gov (United States)

    North, Jamie S; Hope, Ed; Williams, A Mark

    2016-10-01

    We examined whether anticipation is underpinned by perceiving structured patterns or postural cues and whether the relative importance of these processes varied as a function of task constraints. Skilled and less-skilled soccer players completed anticipation paradigms in video-film and point light display (PLD) format. Skilled players anticipated more accurately regardless of display condition, indicating that both perception of structured patterns between players and postural cues contribute to anticipation. However, the Skill×Display interaction showed skilled players' advantage was enhanced in the video-film condition, suggesting that they make better use of postural cues when available during anticipation. We also examined anticipation as a function of proximity to the ball. When participants were near the ball, anticipation was more accurate for video-film than PLD clips, whereas when the ball was far away there was no difference between viewing conditions. Perceiving advance postural cues appears more important than structured patterns when the ball is closer to the observer, whereas the reverse is true when the ball is far away. Various perceptual-cognitive skills contribute to anticipation with the relative importance of perceiving structured patterns and advance postural cues being determined by task constraints and the availability of perceptual information. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Minimal important difference in field walking tests in non-cystic fibrosis bronchiectasis following exercise training.

    Science.gov (United States)

    Lee, A L; Hill, C J; Cecins, N; Jenkins, S; McDonald, C F; Burge, A T; Rautela, L; Stirling, R G; Thompson, P J; Holland, A E

    2014-09-01

    The 6-min walk distance (6MWD) and incremental shuttle walk distance (ISWD) are clinically meaningful measures of exercise capacity in people with non-cystic fibrosis (CF) bronchiectasis, but the change in walking distance which constitutes clinical benefit is undefined. This study aimed to determine the minimal important difference for the 6MWD and ISWD in non-CF bronchiectasis. Thirty-seven participants with mean FEV1 70% predicted completed both field walking tests before and after an 8-week exercise program. The minimal important difference was calculated using a distribution-based and anchor-based method, with the global rating of change scale used. The mean change in 6MWD in participants who reported themselves to be unchanged was 10 m, compared to 36 m (small change) and 45 m (substantial change) (p = 0.01). For the ISWD, the mean change in participants who reported themselves to be unchanged was 33 m, compared to 54 m (small change) and 73 m (substantial change) (p = 0.04). The anchor-based method defined the minimal important difference for 6MWD as 24.5 m (AUC 0.76, 95% CI 0.61-0.91) and for ISWD as 35 m (AUC 0.88, 95% CI 0.73-0.99), based on participant's global rating of change. The distribution-based method indicated a value of 22.3 m for the 6MWD and 37 m for the ISWD. There was excellent agreement between the two methods for the 6MWD (kappa = 0.91) and the ISWD (kappa = 0.92). Small changes in 6MWD and ISWD may represent clinically important benefits in people with non-CF bronchiectasis. These data are likely to assist in the interpretation of change in exercise capacity following intervention. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Who Sees Human? The Stability and Importance of Individual Differences in Anthropomorphism.

    Science.gov (United States)

    Waytz, Adam; Cacioppo, John; Epley, Nicholas

    2010-05-01

    Anthropomorphism is a far-reaching phenomenon that incorporates ideas from social psychology, cognitive psychology, developmental psychology, and the neurosciences. Although commonly considered to be a relatively universal phenomenon with only limited importance in modern industrialized societies-more cute than critical-our research suggests precisely the opposite. In particular, we provide a measure of stable individual differences in anthropomorphism that predicts three important consequences for everyday life. This research demonstrates that individual differences in anthropomorphism predict the degree of moral care and concern afforded to an agent, the amount of responsibility and trust placed on an agent, and the extent to which an agent serves as a source of social influence on the self. These consequences have implications for disciplines outside of psychology including human-computer interaction, business (marketing and finance), and law. Concluding discussion addresses how understanding anthropomorphism not only informs the burgeoning study of nonpersons, but how it informs classic issues underlying person perception as well. © The Author(s) 2010.

  16. Approaches for estimating minimal clinically important differences in systemic lupus erythematosus.

    Science.gov (United States)

    Rai, Sharan K; Yazdany, Jinoos; Fortin, Paul R; Aviña-Zubieta, J Antonio

    2015-06-03

    A minimal clinically important difference (MCID) is an important concept used to determine whether a medical intervention improves perceived outcomes in patients. Prior to the introduction of the concept in 1989, studies focused primarily on statistical significance. As most recent clinical trials in systemic lupus erythematosus (SLE) have failed to show significant effects, determining a clinically relevant threshold for outcome scores (that is, the MCID) of existing instruments may be critical for conducting and interpreting meaningful clinical trials as well as for facilitating the establishment of treatment recommendations for patients. To that effect, methods to determine the MCID can be divided into two well-defined categories: distribution-based and anchor-based approaches. Distribution-based approaches are based on statistical characteristics of the obtained samples. There are various methods within the distribution-based approach, including the standard error of measurement, the standard deviation, the effect size, the minimal detectable change, the reliable change index, and the standardized response mean. Anchor-based approaches compare the change in a patient-reported outcome to a second, external measure of change (that is, one that is more clearly understood, such as a global assessment), which serves as the anchor. Finally, the Delphi technique can be applied as an adjunct to defining a clinically important difference. Despite an abundance of methods reported in the literature, little work in MCID estimation has been done in the context of SLE. As the MCID can help determine the effect of a given therapy on a patient and add meaning to statistical inferences made in clinical research, we believe there ought to be renewed focus on this area. Here, we provide an update on the use of MCIDs in clinical research, review some of the work done in this area in SLE, and propose an agenda for future research.

  17. Identifying Genetic Differences Between Dongxiang Blue-Shelled and White Leghorn Chickens Using Sequencing Data

    Directory of Open Access Journals (Sweden)

    Qing-bo Zhao

    2018-02-01

    Full Text Available The Dongxiang Blue-shelled chicken is one of the most valuable Chinese indigenous poultry breeds. However, compared to the Italian native White Leghorn, although this Chinese breed possesses numerous favorable characteristics, it also exhibits lower growth performance and fertility. Here, we utilized genotyping sequencing data obtained via genome reduction on a sequencing platform to detect 100,114 single nucleotide polymorphisms and perform further biological analysis and functional annotation. We employed cross-population extended haplotype homozygosity, eigenvector decomposition combined with genome-wide association studies (EigenGWAS, and efficient mixed-model association expedited methods to detect areas of the genome that are potential selected regions (PSR in both chicken breeds, and performed gene ontology (GO enrichment and quantitative trait loci (QTL analyses annotating using the Kyoto Encyclopedia of Genes and Genomes. The results of this study revealed a total of 2424 outlier loci (p-value <0.01, of which 2144 occur in the White Leghorn breed and 280 occur in the Dongxiang Blue-shelled chicken. These correspond to 327 and 94 PSRs containing 297 and 54 genes, respectively. The most significantly selected genes in Blue-shelled chicken are TMEM141 and CLIC3, while the SLCO1B3 gene, related to eggshell color, was identified via EigenGWAS. We show that the White Leghorn genes JARID2, RBMS3, GPC3, TRIB2, ROBO1, SAMSN1, OSBP2, and IGFALS are involved in immunity, reproduction, and growth, and thus might represent footprints of the selection process. In contrast, we identified six significantly enriched pathways in the Dongxiang Blue-shelled chicken that are related to amino acid and lipid metabolism as well as signal transduction. Our results also reveal the presence of a GO term associated with cell metabolism that occurs mainly in the White Leghorn breed, while the most significant QTL regions mapped to the Chicken QTL Database (GG_4

  18. Proteomic Analysis of Rhizoctonia solani Identifies Infection-specific, Redox Associated Proteins and Insight into Adaptation to Different Plant Hosts*

    Science.gov (United States)

    Anderson, Jonathan P.; Hane, James K.; Stoll, Thomas; Pain, Nicholas; Hastie, Marcus L.; Kaur, Parwinder; Hoogland, Christine; Gorman, Jeffrey J.; Singh, Karam B.

    2016-01-01

    Rhizoctonia solani is an important root infecting pathogen of a range of food staples worldwide including wheat, rice, maize, soybean, potato and others. Conventional resistance breeding strategies are hindered by the absence of tractable genetic resistance in any crop host. Understanding the biology and pathogenicity mechanisms of this fungus is important for addressing these disease issues, however, little is known about how R. solani causes disease. This study capitalizes on recent genomic studies by applying mass spectrometry based proteomics to identify soluble, membrane-bound and culture filtrate proteins produced under wheat infection and vegetative growth conditions. Many of the proteins found in the culture filtrate had predicted functions relating to modification of the plant cell wall, a major activity required for pathogenesis on the plant host, including a number found only under infection conditions. Other infection related proteins included a high proportion of proteins with redox associated functions and many novel proteins without functional classification. The majority of infection only proteins tested were confirmed to show transcript up-regulation during infection including a thaumatin which increased susceptibility to R. solani when expressed in Nicotiana benthamiana. In addition, analysis of expression during infection of different plant hosts highlighted how the infection strategy of this broad host range pathogen can be adapted to the particular host being encountered. Data are available via ProteomeXchange with identifier PXD002806. PMID:26811357

  19. Functional importance of different patterns of correlation between adjacent cassette exons in human and mouse.

    Science.gov (United States)

    Peng, Tao; Xue, Chenghai; Bi, Jianning; Li, Tingting; Wang, Xiaowo; Zhang, Xuegong; Li, Yanda

    2008-04-26

    Alternative splicing expands transcriptome diversity and plays an important role in regulation of gene expression. Previous studies focus on the regulation of a single cassette exon, but recent experiments indicate that multiple cassette exons within a gene may interact with each other. This interaction can increase the potential to generate various transcripts and adds an extra layer of complexity to gene regulation. Several cases of exon interaction have been discovered. However, the extent to which the cassette exons coordinate with each other remains unknown. Based on EST data, we employed a metric of correlation coefficients to describe the interaction between two adjacent cassette exons and then categorized these exon pairs into three different groups by their interaction (correlation) patterns. Sequence analysis demonstrates that strongly-correlated groups are more conserved and contain a higher proportion of pairs with reading frame preservation in a combinatorial manner. Multiple genome comparison further indicates that different groups of correlated pairs have different evolutionary courses: (1) The vast majority of positively-correlated pairs are old, (2) most of the weakly-correlated pairs are relatively young, and (3) negatively-correlated pairs are a mixture of old and young events. We performed a large-scale analysis of interactions between adjacent cassette exons. Compared with weakly-correlated pairs, the strongly-correlated pairs, including both the positively and negatively correlated ones, show more evidence that they are under delicate splicing control and tend to be functionally important. Additionally, the positively-correlated pairs bear strong resemblance to constitutive exons, which suggests that they may evolve from ancient constitutive exons, while negatively and weakly correlated pairs are more likely to contain newly emerging exons.

  20. Carbon dioxide emissions due to Swedish imports and consumption: estimates using different methods

    International Nuclear Information System (INIS)

    Carlsson-Kanyama, Annika; Assefa, Getachew; Wadeskog, Anders

    2007-04-01

    Global trade of products and services challenges the traditional way in which emissions of carbon dioxide are declared and accounted for. Instead of only considering territorial emissions there are now strong reasons to determine how the carbon dioxide emitted in the production of imports are partitioned around the world and how the total emissions change for a country's final consumption compared to final production. In this report results from four different methods of calculating the total carbon dioxide emissions from Sweden's overall consumption are presented. Total carbon dioxide emissions for Sweden's final consumption vary from 57 to 109 M tons during one year depending on the methodology. The four methods used for estimating these emissions give results of 57, 61, 68 and 109 Mton of carbon dioxide. Two methods are based on information concerning Sweden's imports and our national production of goods and services excluding production that is exported while two methods are based on final consumer expenditures. Three of the methods use mainly emission data from Sweden while one method depends entirely upon emission data from Sweden's trading partners. The last method also gives the highest emissions level, 109 Mton of carbon dioxide. The calculations performed here can be compared to the emissions reported by Sweden, 54 Mton of carbon dioxide per year. Our estimates give per capita emission levels of between 6,3 and 12 tons of carbon dioxide per year. The estimate of 12 tons per capita is a result of using emissions data from Sweden's trading partners. The total emissions as a result of Sweden's imports are 26 or 74 M tons of carbon dioxide depending on how they are calculated. The lower figure is based upon the imports of today but with emissions as if everything was produced as in Sweden. The higher level is based upon using existing but partly inadequate international emission statistics. These levels can be compared to the about 35 M tons of carbon dioxide

  1. Prenatal Particulate Air Pollution and Asthma Onset in Urban Children. Identifying Sensitive Windows and Sex Differences.

    Science.gov (United States)

    Hsu, Hsiao-Hsien Leon; Chiu, Yueh-Hsiu Mathilda; Coull, Brent A; Kloog, Itai; Schwartz, Joel; Lee, Alison; Wright, Robert O; Wright, Rosalind J

    2015-11-01

    The influence of particulate air pollution on respiratory health starts in utero. Fetal lung growth and structural development occurs in stages; thus, effects on postnatal respiratory disorders may differ based on timing of exposure. We implemented an innovative method to identify sensitive windows for effects of prenatal exposure to particulate matter with a diameter less than or equal to 2.5 μm (PM2.5) on children's asthma development in an urban pregnancy cohort. Analyses included 736 full-term (≥37 wk) children. Each mother's daily PM2.5 exposure was estimated over gestation using a validated satellite-based spatiotemporal resolved model. Using distributed lag models, we examined associations between weekly averaged PM2.5 levels over pregnancy and physician-diagnosed asthma in children by age 6 years. Effect modification by sex was also examined. Most mothers were ethnic minorities (54% Hispanic, 30% black), had 12 or fewer years of education (66%), and did not smoke in pregnancy (80%). In the sample as a whole, distributed lag models adjusting for child age, sex, and maternal factors (education, race and ethnicity, smoking, stress, atopy, prepregnancy obesity) showed that increased PM2.5 exposure levels at 16-25 weeks gestation were significantly associated with early childhood asthma development. An interaction between PM2.5 and sex was significant (P = 0.01) with sex-stratified analyses showing that the association exists only for boys. Higher prenatal PM2.5 exposure at midgestation was associated with asthma development by age 6 years in boys. Methods to better characterize vulnerable windows may provide insight into underlying mechanisms.

  2. Androgen receptors and serum testosterone levels identify different subsets of postmenopausal breast cancers

    Directory of Open Access Journals (Sweden)

    Secreto Giorgio

    2012-12-01

    Full Text Available Abstract Background Androgen receptors (AR are frequently expressed in breast cancers, but their implication in cancer growth is still controversial. In the present study, we further investigated the role of the androgen/AR pathway in breast cancer development. Methods AR expression was evaluated by immunochemistry in a cohort of 528 postmenopausal breast cancer patients previously examined for the association of serum testosterone levels with patient and tumor characteristics. AR expression was classified according to the percentage of stained cells: AR-absent (0% and AR-poorly (1%-30%, AR-moderately (>30%-60%, and AR-highly (>60% positive. Results Statistical analysis was performed in 451 patients who experienced natural menopause. AR-high expression was significantly related with low histologic grade and estrogen receptor (ER- and progesterone receptor (PR-positive status (P trendP=0.022, although a trend across the AR expression categories was not present. When women defined by ER status were analyzed separately, regression analysis in the ER-positive group showed a significant association of high testosterone levels with AR-highly-positive expression (OR 1.86; 95% CI, 1.10-3.16, but the association was essentially due to patients greater than or equal to 65 years (OR 2.42; 95% CI, 1.22-4.82. In ER-positive group, elevated testosterone levels appeared also associated with AR-absent expression, although the small number of patients in this category limited the appearance of significant effects (OR 1.92; 95% CI, 0.73–5.02: the association was present in both age groups ( Conclusions The findings in the present study confirm that testosterone levels are a marker of hormone-dependent breast cancer and suggest that the contemporary evaluation of ER status, AR expression, and circulating testosterone levels may identify different subsets of cancers whose growth may be influenced by androgens.

  3. Minimal clinically important difference on the Motor Examination part of MDS-UPDRS.

    Science.gov (United States)

    Horváth, Krisztina; Aschermann, Zsuzsanna; Ács, Péter; Deli, Gabriella; Janszky, József; Komoly, Sámuel; Balázs, Éva; Takács, Katalin; Karádi, Kázmér; Kovács, Norbert

    2015-12-01

    Recent studies increasingly utilize the Movement Disorders Society Sponsored Unified Parkinson's Disease Rating Scale (MDS-UPDRS). However, the minimal clinically important difference (MCID) has not been fully established for MDS-UPDRS yet. To assess the MCID thresholds for MDS-UPDRS Motor Examination (Part III). 728 paired investigations of 260 patients were included. At each visit both MDS-UPDRS and Clinician-reported Global Impression-Improvement (CGI-I) scales were assessed. MDS-UPDRS Motor Examination (ME) score changes associated with CGI-I score 4 (no change) were compared with MDS-UPDRS ME score changes associated with CGI-I score 3 (minimal improvement) and CGI-I score 5 (minimal worsening). Both anchor- and distribution-based techniques were utilized to determine the magnitude of MCID. The MCID estimates for MDS-UPDRS ME were asymmetric: -3.25 points for detecting minimal, but clinically pertinent, improvement and 4.63 points for observing minimal, but clinically pertinent, worsening. MCID is the smallest change of scores that are clinically meaningful to patients. These MCID estimates may allow the judgement of a numeric change in MDS-UPDRS ME on its clinical importance. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses

    Directory of Open Access Journals (Sweden)

    Su Zhen

    2011-07-01

    Full Text Available Abstract Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants.

  5. Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses

    Science.gov (United States)

    2011-01-01

    Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants. PMID:21718548

  6. Microarray analysis identifies a common set of cellular genes modulated by different HCV replicon clones

    Directory of Open Access Journals (Sweden)

    Gerosolimo Germano

    2008-06-01

    Full Text Available Abstract Background Hepatitis C virus (HCV RNA synthesis and protein expression affect cell homeostasis by modulation of gene expression. The impact of HCV replication on global cell transcription has not been fully evaluated. Thus, we analysed the expression profiles of different clones of human hepatoma-derived Huh-7 cells carrying a self-replicating HCV RNA which express all viral proteins (HCV replicon system. Results First, we compared the expression profile of HCV replicon clone 21-5 with both the Huh-7 parental cells and the 21-5 cured (21-5c cells. In these latter, the HCV RNA has been eliminated by IFN-α treatment. To confirm data, we also analyzed microarray results from both the 21-5 and two other HCV replicon clones, 22-6 and 21-7, compared to the Huh-7 cells. The study was carried out by using the Applied Biosystems (AB Human Genome Survey Microarray v1.0 which provides 31,700 probes that correspond to 27,868 human genes. Microarray analysis revealed a specific transcriptional program induced by HCV in replicon cells respect to both IFN-α-cured and Huh-7 cells. From the original datasets of differentially expressed genes, we selected by Venn diagrams a final list of 38 genes modulated by HCV in all clones. Most of the 38 genes have never been described before and showed high fold-change associated with significant p-value, strongly supporting data reliability. Classification of the 38 genes by Panther System identified functional categories that were significantly enriched in this gene set, such as histones and ribosomal proteins as well as extracellular matrix and intracellular protein traffic. The dataset also included new genes involved in lipid metabolism, extracellular matrix and cytoskeletal network, which may be critical for HCV replication and pathogenesis. Conclusion Our data provide a comprehensive analysis of alterations in gene expression induced by HCV replication and reveal modulation of new genes potentially useful

  7. Different Perspectives Between Product and Marketing Division towards Product Critical Success Factors and Its Strategic Importance in Telecommunication Sectors

    Directory of Open Access Journals (Sweden)

    Rachmi Rida Utami

    2013-12-01

    Full Text Available Todays situations force telecomunication company to continuously evaluate, select and prioritize its product portfolio in order to determine the strategically important products. An analysis of critical success factors that determine product’s strategic importance acts as a good introduction to review and manage the product portfolio as well as to seek ways to develop the product. To achieve this, the company is required to have good alliances and collaborations between departments, develop a clear focus and seek innovative ways of doing business, particularly between marketing and product divisions. This study analyzed the alignment between product and marketing divisions of a telecommunication company in Indonesia, in determining the company’s strategic products. The results indicated that both divisions agreed on using financial performance and revenue as the most important criteria and sub-criteria for identifying strategic product. However, the divisions also faced some different visions in selecting alternative criteria. The Product divisions were more focused on technical spesification of product, while the Marketing division were more oriented on customer and market conditions. The study reported the consequences of these difference in practice.

  8. The relative importance of different types of rewards for employee motivation and commitment in South Africa

    Directory of Open Access Journals (Sweden)

    Aleeshah Nujjoo

    2012-11-01

    Research purpose: The study sought to establish the relationship between intrinsic and different extrinsic rewards with intrinsic motivation and affective commitment. Motivation for the study: South African organisations are grappling with employee retention. Literature shows that employees who are more motivated and committed to their organisation are less likely to quit. Rewards management strategies serve to create a motivated and committed workforce. Using the correct types of rewards can thus provide a competitive advantage. Research design, approach and method: A cross-sectional, correlational study was conducted. Questionnaire data of 399 South African employees were analysed using bivariate correlations and multiple regression. Main findings: Three main findings emerged. Firstly, there is a relationship between all types of rewards investigated and the two outcome variables. Secondly, this relationship is stronger for intrinsic than for extrinsic rewards and thirdly, monetary rewards do not account for the variance in intrinsic motivation above that of non-monetary rewards. Practical/managerial implications: Rewards management strategies should focus on job characteristics and designs to increase staff intrinsic rewards and include non-monetary rewards, such as supportive leadership, to encourage employees’ intrinsic motivation and affective commitment. Contribution/value-add: This research demonstrated the important role different rewards, particularly intrinsic non-monetary rewards, play in creating a committed and motivated workforce. The insights gained from this study can promote organisational effectiveness. Suggestions of how to expand on and refine the current study are addressed.

  9. Toxic metals distribution in different components of Pakistani and imported cigarettes by electrothermal atomic absorption spectrometer

    International Nuclear Information System (INIS)

    Kazi, T.G.; Jalbani, N.; Arain, M.B.; Jamali, M.K.; Afridi, H.I.; Sarfraz, R.A.; Shah, A.Q.

    2009-01-01

    It was extensively investigated that a significant flux of toxic metals, along with other toxins, reaches the lungs through smoking. In present study toxic metals (TMs) (Al, Cd, Ni and Pb) were determined in different components of Pakistani local branded and imported cigarettes, including filler tobacco (FT), filter (before and after normal smoking by a single volunteer) and ash by electrothermal atomic absorption spectrometer (ETAAS). Microwave-assisted digestion method was employed. The validity and accuracy of methodology were checked by using certified sample of Virginia tobacco leaves (ICHTJ-cta-VTL-2). The percentages (%) of TMs in different components of cigarette were calculated with respect to their total contents in FT of all branded cigarettes before smoking, while smoke concentration has been calculated by subtracting the filter and ash contents from the filler tobacco content of each branded cigarette. The highest percentage (%) of Al was observed in ash of all cigarettes, with range 97.3-99.0%, while in the case of Cd, a reverse behaviour was observed, as a range of 15.0-31.3% of total contents were left in the ash of all branded cigarettes understudy

  10. Integrated physiological, biochemical and molecular analysis identifies important traits and mechanisms associated with differential response of rice genotypes to elevated temperature

    Directory of Open Access Journals (Sweden)

    Boghireddy eSailaja

    2015-11-01

    Full Text Available In changing climate, heat stress caused by high temperature poses a serious threat to rice cultivation. A multiple organizational analysis at physiological, biochemical and molecular level is required to fully understand the impact of elevated temperature in rice. This study was aimed at deciphering the elevated temperature response in eleven popular and mega rice cultivars widely grown in India. Physiological and biochemical traits specifically membrane thermostability (MTS, antioxidants, and photosynthesis were studied at vegetative and reproductive phases which were used to establish a correlation with grain yield under stress. Several useful traits in different genotypes were identified which will be important resource to develop high temperature tolerant rice cultivars. Interestingly, Nagina22 emerged as best performer in terms of yield as well as expression of physiological and biochemical traits at elevated temperature. It showed lesser relative injury, lesser reduction in chlorophyll content, increased super oxide dismutase, catalase and peroxidase activity, lesser reduction in net photosynthetic rate (PN, high transpiration rate (E and other photosynthetic/ fluorescence parameters contributing to least reduction in spikelet fertility and grain yield at elevated temperature. Further, expression of 14 genes including heat shock transcription factors and heat shock proteins was analyzed in Nagina22 (tolerant and Vandana (susceptible at flowering phase, strengthening the fact that N22 performs better at molecular level also during elevated temperature. This study shows that elevated temperature response is complex and involves multiple biological processes which are needed to be characterized to address the challenges of future climate extreme conditions.

  11. Triangulating Principal Effectiveness: How Perspectives of Parents, Teachers, and Assistant Principals Identify the Central Importance of Managerial Skills. Working Paper 35

    Science.gov (United States)

    Grissom, Jason A.; Loeb, Susanna

    2009-01-01

    While the importance of effective principals is undisputed, few studies have addressed what specific skills principals need to promote school success. This study draws on unique data combining survey responses from principals, assistant principals, teachers and parents with rich administrative data to identify which principal skills matter most…

  12. Importance of different physiological groups of iron reducing microorganisms in an acidic mining lake remediation experiment.

    Science.gov (United States)

    Porsch, Katharina; Meier, Jutta; Kleinsteuber, Sabine; Wendt-Potthoff, Katrin

    2009-05-01

    Iron- and sulfate-reducing microorganisms play an important role for alkalinity-generating processes in mining lakes with low pH. In the acidic mining lake 111 in Lusatia, Germany, a passive in situ remediation method was tested in a large scale experiment, in which microbial iron and sulfate reduction are stimulated by addition of Carbokalk (a mixture of the nonsugar compounds of sugar beets and lime) and straw. The treated surface sediment consisted of three layers of different pH and geochemical composition. The top layer was acidic and rich in Fe(III), the second and third layer both showed moderately acidic to circum-neutral pH values, but only the second was rich in organics, strongly reduced and sulfidic. Aim of the study was to elucidate the relative importance of neutrophilic heterotrophic, acidophilic heterotrophic, and acidophilic autotrophic iron-reducing microorganisms in each of the three layers. In order to distinguish between them, the effect of their respective characteristic electron donors acetate, glucose, and elemental sulfur on potential iron reduction rates was investigated. Limitation of iron reduction by the availability of Fe(III) was revealed by the addition of Fe(OH)(3). The three groups of iron-reducing microorganisms were quantified by most probable number (MPN) technique and their community composition was analyzed by cloning and sequencing of 16S rRNA genes. In the acidic surface layer, none of the three electron donors stimulated iron reduction; acetate even had an inhibiting effect. In agreement with this, no decrease of the added electron donors was observed. Iron reduction rates were low in comparison to the other layers. Iron reduction in layers 2 and 3 was enhanced by glucose and acetate, accompanied by a decrease of these electron donors. Addition of elemental sulfur did not enhance iron reduction in either layer. Layer 2 exhibited the highest iron reduction rate (4.08 mmol dm(-3) d(-1)) and the highest cell numbers in MPN

  13. A method to identify important dynamical states in Boolean models of regulatory networks: application to regulation of stomata closure by ABA in A. thaliana.

    Science.gov (United States)

    Bugs, Cristhian A; Librelotto, Giovani R; Mombach, José C M

    2011-12-22

    We introduce a method to analyze the states of regulatory Boolean models that identifies important network states and their biological influence on the global network dynamics. It consists in (1) finding the states of the network that are most frequently visited and (2) the identification of variable and frozen nodes of the network. The method, along with a simulation that includes random features, is applied to the study of stomata closure by abscisic acid (ABA) in A. thaliana proposed by Albert and coworkers. We find that for the case of study, that the dynamics of wild and mutant networks have just two states that are highly visited in their space of states and about a third of all nodes of the wild network are variable while the rest remain frozen in True or False states. This high number of frozen elements explains the low cardinality of the space of states of the wild network. Similar results are observed in the mutant networks. The application of the method allowed us to explain how wild and mutants behave dynamically in the SS and determined an essential feature of the activation of the closure node (representing stomata closure), i.e. its synchronization with the AnionEm node (representing anion efflux at the plasma membrane). The dynamics of this synchronization explains the efficiency reached by the wild and each of the mutant networks. For the biological problem analyzed, our method allows determining how wild and mutant networks differ 'phenotypically'. It shows that the different efficiencies of stomata closure reached among the simulated wild and mutant networks follow from a dynamical behavior of two nodes that are always synchronized. Additionally, we predict that the involvement of the anion efflux at the plasma membrane is crucial for the plant response to ABA. The algorithm used in the simulations is available upon request.

  14. The relative importance of different types of rewards for employee motivation and commitment in South Africa

    Directory of Open Access Journals (Sweden)

    Aleeshah Nujjoo

    2012-02-01

    Full Text Available Orientation: Employees’ perceptions of rewards are related to their affective commitment and intrinsic motivation, which have been associated with staff turnover.Research purpose: The study sought to establish the relationship between intrinsic and different extrinsic rewards with intrinsic motivation and affective commitment.Motivation for the study: South African organisations are grappling with employee retention. Literature shows that employees who are more motivated and committed to their organisation are less likely to quit. Rewards management strategies serve to create a motivated and committed workforce. Using the correct types of rewards can thus provide a competitive advantage.Research design, approach and method: A cross-sectional, correlational study was conducted. Questionnaire data of 399 South African employees were analysed using bivariate correlations and multiple regression.Main findings: Three main findings emerged. Firstly, there is a relationship between all types of rewards investigated and the two outcome variables. Secondly, this relationship is stronger for intrinsic than for extrinsic rewards and thirdly, monetary rewards do not account for the variance in intrinsic motivation above that of non-monetary rewards.Practical/managerial implications: Rewards management strategies should focus on job characteristics and designs to increase staff intrinsic rewards and include non-monetary rewards, such as supportive leadership, to encourage employees’ intrinsic motivation and affective commitment.Contribution/value-add: This research demonstrated the important role different rewards, particularly intrinsic non-monetary rewards, play in creating a committed and motivated workforce. The insights gained from this study can promote organisational effectiveness. Suggestions of how to expand on and refine the current study are addressed.

  15. Birth cohorts in Asia: The importance, advantages, and disadvantages of different-sized cohorts.

    Science.gov (United States)

    Kishi, Reiko; Araki, Atsuko; Minatoya, Machiko; Itoh, Sachiko; Goudarzi, Houman; Miyashita, Chihiro

    2018-02-15

    Asia contains half of the world's children, and the countries of Asia are the most rapidly industrializing nations on the globe. Environmental threats to the health of children in Asia are myriad. Several birth cohorts were started in Asia in early 2000, and currently more than 30 cohorts in 13 countries have been established for study. Cohorts can contain from approximately 100-200 to 20,000-30,000 participants. Furthermore, national cohorts targeting over 100,000 participants have been launched in Japan and Korea. The aim of this manuscript is to discuss the importance of Asian cohorts, and the advantages and disadvantages of different-sized cohorts. As for case, one small-sized (n=514) cohort indicate that even relatively low level exposure to dioxin in utero could alter birth size, neurodevelopment, and immune and hormonal functions. Several Asian cohorts focus prenatal exposure to perfluoroalkyo substances and reported associations with birth size, thyroid hormone levels, allergies and neurodevelopment. Inconsistent findings may possibly be explained by the differences in exposure levels and target chemicals, and by possible statistical errors. In a smaller cohort, novel hypotheses or preliminary examinations are more easily verifiable. In larger cohorts, the etiology of rare diseases, such as birth defects, can be analyzed; however, they require a large cost and significant human resources. Therefore, conducting studies in only one large cohort may not always be the best strategy. International collaborations, such as the Birth Cohort Consortium of Asia, would cover the inherent limitation of sample size in addition to heterogeneity of exposure, ethnicity, and socioeconomic conditions. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Hip Arthroscopy Outcomes With Respect to Patient Acceptable Symptomatic State and Minimal Clinically Important Difference.

    Science.gov (United States)

    Levy, David M; Kuhns, Benjamin D; Chahal, Jaskarndip; Philippon, Marc J; Kelly, Bryan T; Nho, Shane J

    2016-09-01

    To determine whether the hip arthroscopy literature to date has shown outcomes consistent with published patient acceptable symptomatic state (PASS) and minimal clinically important difference (MCID) estimates. All clinical investigations of hip arthroscopy using modified Harris Hip Score (mHHS) and/or Hip Outcome Score (HOS) outcomes with at least 1 year of follow-up were reviewed. Ninety-one studies (9,746 hips) were included for review. Eighty-one studies (9,317 hips) contained only primary hip arthroscopies and were the primary focus of this review. The remaining studies (429 hips) did not exclude patients with prior surgical history and were thus considered separately. Mean mHHS, HOS-ADL (Activities of Daily Living) and HOS-SS (Sports-Specific) scores were compared with previously published PASS and MCID values. After 31 ± 20 months, 5.8% of study populations required revision arthroscopy and 5.5% total hip arthroplasty. A total of 88%, 25%, and 30% of study populations met PASS for mHHS, HOS-ADL, and HOS-SS, respectively, and 97%, 90%, and 93% met MCID. On bivariate analysis, increasing age was associated with significantly worse postoperative mHHS (P arthroscopy, we have found that more than 90% of study populations meet MCID standards for the most commonly used patient-reported outcomes measures in hip arthroscopy literature, mHHS and HOS. Eighty-eight percent meet PASS standards for the mHHS, but PASS standards are far more difficult to achieve for HOS-ADL (25%) and HOS-SS (30%) subscales. Differences in psychometric properties of the mHHS and HOS likely account for the discrepancies in PASS. Level IV, systematic review of Level I to IV studies. Copyright © 2016 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.

  17. Evaluating clinically meaningful change on the ITP-PAQ: preliminary estimates of minimal important differences.

    Science.gov (United States)

    Mathias, Susan D; Gao, Sue K; Rutstein, Mark; Snyder, Claire F; Wu, Albert W; Cella, David

    2009-02-01

    Interpretation of data from health-related quality of life (HRQoL) questionnaires can be enhanced with the availability of minimally important difference (MID) estimates. This information will aid clinicians in interpreting HRQoL differences within patients over time and between treatment groups. The Immune Thrombocytopenic Purpura (ITP)-Patient Assessment Questionnaire (PAQ) is the only comprehensive HRQoL questionnaire available for adults with ITP. Forty centers from within the US and Europe enrolled ITP patients into one of two multicenter, randomized, placebo-controlled, double-blind, 6-month, phase III clinical trials of romiplostim. Patients enrolled in these studies self-administered the ITP-PAQ and two items assessing global change (anchors) at baseline and weeks 4, 12, and 24. Using data from the ITP-PAQ and these two anchors, an anchor-based estimate was computed and combined with the standard error of measurement and standard deviation to compute a distribution-based estimate in order to provide an MID range for each of the 11 scales of the ITP-PAQ. A total of 125 patients participated in these clinical trials and provided data for use in these analyses. Combining results from anchor- and distribution-based approaches, MID values were computed for 9 of the 11 scales. MIDs ranged from 8 to 12 points for Symptoms, Bother, Psychological, Overall QOL, Social Activity, Menstrual Symptoms, and Fertility, while the range was 10 to 15 points for the Fatigue and Activity scales of the ITP-PAQ. These estimates, while slightly higher than other published MID estimates, were consistent with moderate effect sizes. These MID estimates will serve as a useful tool to researchers and clinicians using the ITP-PAQ, providing guidance for interpretation of baseline scores as well as changes in ITP-PAQ scores over time. Additional work should be done to finalize these initial estimates using more appropriate anchors that correlate more highly with the ITP-PAQ scales.

  18. Establishing the minimal clinically important difference for the Questionnaire of Olfactory Disorders.

    Science.gov (United States)

    Mattos, Jose L; Schlosser, Rodney J; Mace, Jess C; Smith, Timothy L; Soler, Zachary M

    2018-05-02

    Olfactory-specific quality of life (QOL) can be measured using the Questionnaire of Olfactory Disorders Negative Statements (QOD-NS). Changes in the QOD-NS after treatment can be difficult to interpret since there is no standardized definition of clinically meaningful improvement. Patients with chronic rhinosinusitis (CRS) completed the QOD-NS. Four distribution-based methods were used to calculate the minimal clinically important difference (MCID): (1) one-half standard deviation (SD); (2) standard error of the mean (SEM); (3) Cohen's effect size (d) of the smallest unit of change; and (4) minimal detectable change (MDC). We also averaged all 4 of the scores together. Finally, the likelihood of achieving a MCID after sinus surgery using these methods, as well as average QOD-NS scores, was stratified by normal vs abnormal baseline QOD-NS scores. Outcomes were examined on 128 patients. The mean ± SD improvement in QOD-NS score after surgery was 4.3 ± 11.0 for the entire cohort and 9.6 ± 12.9 for those with abnormal baseline scores (p < 0.001). The MCID values using the different techniques were: (1) SD = 6.5; (2) SEM = 3.1; (3) d = 2.6; and (4) MDC = 8.6. The MCID score was 5.2 on average. For the total cohort analysis, the likelihood of reporting a MCID ranged from 26% to 51%, and 49% to 70% for patients reporting preoperative abnormal olfaction. Distribution-based MCID values of the QOD-NS range between 2.6 and 8.6 points, with an average of 5.2. When stratified by preoperative QOD-NS scores the majority of patients reporting abnormal preoperative QOD-NS scores achieved a MCID. © 2018 ARS-AAOA, LLC.

  19. Determining the minimally important difference for the Oral Health Impact Profile-20.

    LENUS (Irish Health Repository)

    Allen, P Finbarr

    2009-04-01

    In the context of clinical trials, measurement of change is critical. The aim of this study was to determine the minimally important difference (MID) for the Oral Health Impact Profile-20 (OHIP-20) when used with partially dentate patients undergoing treatment that included the provision of removable partial dentures. In a prospective clinical trial, 51 consecutive patients were provided with removable partial dentures. In addition to demographic and dental status data, patients completed an OHIP-20 prior to treatment. One month postoperatively, patients completed a post-treatment OHIP-20 and a global transition scale. Domains assessed in the global transition scale were appearance, ability to chew food, oral comfort, and speech. The MID for the OHIP-20 was calculated using the anchor-based approach. From the initial sample of 51 patients, 44 completed post-treatment questionnaires and were included in the analysis. Change scores in the four transition domains indicated that new dentures had a positive impact in the majority of subjects, especially in perceived impact on chewing and appearance. The study provided a guideline as to what constitutes the MID for the OHIP-20. This benchmark can be used when interpreting the impact of clinical intervention for replacing missing teeth and for power calculation in statistical analyses.

  20. The importance of different frequency bands in predicting subcutaneous glucose concentration in type 1 diabetic patients.

    Science.gov (United States)

    Lu, Yinghui; Gribok, Andrei V; Ward, W Kenneth; Reifman, Jaques

    2010-08-01

    We investigated the relative importance and predictive power of different frequency bands of subcutaneous glucose signals for the short-term (0-50 min) forecasting of glucose concentrations in type 1 diabetic patients with data-driven autoregressive (AR) models. The study data consisted of minute-by-minute glucose signals collected from nine deidentified patients over a five-day period using continuous glucose monitoring devices. AR models were developed using single and pairwise combinations of frequency bands of the glucose signal and compared with a reference model including all bands. The results suggest that: for open-loop applications, there is no need to explicitly represent exogenous inputs, such as meals and insulin intake, in AR models; models based on a single-frequency band, with periods between 60-120 min and 150-500 min, yield good predictive power (error bands produce predictions that are indistinguishable from those of the reference model as long as the 60-120 min period band is included; and AR models can be developed on signals of short length (approximately 300 min), i.e., ignoring long circadian rhythms, without any detriment in prediction accuracy. Together, these findings provide insights into efficient development of more effective and parsimonious data-driven models for short-term prediction of glucose concentrations in diabetic patients.

  1. Bacterial endophyte communities of three agricultural important grass species differ in their response towards management regimes

    Science.gov (United States)

    Wemheuer, Franziska; Kaiser, Kristin; Karlovsky, Petr; Daniel, Rolf; Vidal, Stefan; Wemheuer, Bernd

    2017-01-01

    Endophytic bacteria are critical for plant growth and health. However, compositional and functional responses of bacterial endophyte communities towards agricultural practices are still poorly understood. Hence, we analyzed the influence of fertilizer application and mowing frequency on bacterial endophytes in three agriculturally important grass species. For this purpose, we examined bacterial endophytic communities in aerial plant parts of Dactylis glomerata L., Festuca rubra L., and Lolium perenne L. by pyrotag sequencing of bacterial 16S rRNA genes over two consecutive years. Although management regimes influenced endophyte communities, observed responses were grass species-specific. This might be attributed to several bacteria specifically associated with a single grass species. We further predicted functional profiles from obtained 16S rRNA data. These profiles revealed that predicted abundances of genes involved in plant growth promotion or nitrogen metabolism differed between grass species and between management regimes. Moreover, structural and functional community patterns showed no correlation to each other indicating that plant species-specific selection of endophytes is driven by functional rather than phylogenetic traits. The unique combination of 16S rRNA data and functional profiles provided a holistic picture of compositional and functional responses of bacterial endophytes in agricultural relevant grass species towards management practices.

  2. Determining the Minimal Clinically Important Difference for Six-Minute Walk Distance in Fibromyalgia

    Science.gov (United States)

    Kaleth, Anthony S.; Slaven, James E.; Ang, Dennis C.

    2016-01-01

    Objective To estimate the minimal clinically important difference (MCID) for 6-minute walk distance (6MWD) in patients with fibromyalgia (FM). Design Data from a recently completed trial that included 187 patients who completed the 6-minute walk test, Fibromyalgia Impact Questionnaire (FIQ), and Short-Form 36 (SF36) at 12 and 36 weeks were used to examine longitudinal changes in 6MWD. An anchor-based approach that used linear regression analyses was used to determine the MCID for 6MWD, using the total FIQ score (FIQ-Total) and SF36-physical function domain (SF36-PF) as clinical anchors. Results The mean (SD) change in 6MWD from baseline to week 36 was 34.4 (65.2) m (pFIQ and SF36-PF, respectively. These MCID’s correspond with clinically meaningful improvements in FIQ (14% reduction) and SF36-PF (10 point increase). Conclusion The MCID for 6MWD in patients with FM was 156 to 167 m. These findings provide the first evidence of the change in 6MWD that is perceived by patients to be clinically meaningful. Further research using other MCID calculation methods is needed to refine estimates of the MCID for 6MWD in patients with FM. PMID:27003201

  3. Determining the Minimal Clinically Important Difference for 6-Minute Walk Distance in Fibromyalgia.

    Science.gov (United States)

    Kaleth, Anthony S; Slaven, James E; Ang, Dennis C

    2016-10-01

    The aim of this study was to estimate the minimal clinically important difference (MCID) for 6-min walk distance (6MWD) in patients with fibromyalgia. Data from a recently completed trial that included 187 patients who completed the 6-min walk test, Fibromyalgia Impact Questionnaire (FIQ), and Short-Form 36 (SF36) at 12 and 36 wks were used to examine longitudinal changes in 6MWD. An anchor-based approach that used linear regression analyses was used to determine the MCID for 6MWD, using the total FIQ score (FIQ-Total) and SF36-physical function domain as clinical anchors. The mean (SD) change in 6MWD from baseline to week 36 was 34.4 (65.2) m (P FIQ and SF36-physical function domain, respectively. These MCIDs correspond with clinically meaningful improvements in FIQ (14% reduction) and SF36-physical function domain (10-point increase). The MCID for 6MWD in patients with fibromyalgia was 156 to 167 m. These findings provide the first evidence of the change in 6MWD that is perceived by patients to be clinically meaningful. Further research using other MCID calculation methods is needed to refine estimates of the MCID for 6MWD in patients with fibromyalgia.

  4. Gene Expression Differences between Noccaea caerulescens Ecotypes Help to Identify Candidate Genes for Metal Phytoremediation

    NARCIS (Netherlands)

    Halimaa, P.; Lin, Y.F.; Ahonen, V.H.; Blande, D.; Clemens, S.; Gyenesei, A.; Haikio, E.; Karenlampi, S.O.; Laiho, A.; Aarts, M.G.M.; Pursiheimo, J.P.; Schat, H.; Schmidt, H.; Tuomainen, M.H.; Tervahauta, A.I.

    2014-01-01

    Populations of Noccaea caerulescens show tremendous differences in their capacity to hyperaccumulate and hypertolerate metals. To explore the differences that could contribute to these traits, we undertook SOLiD high-throughput sequencing of the root transcriptomes of three phenotypically

  5. A large-scale RNA interference screen identifies genes that regulate autophagy at different stages

    DEFF Research Database (Denmark)

    Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man

    2018-01-01

    Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed...... with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes...... have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays...

  6. Multiplatform serum metabolic phenotyping combined with pathway mapping to identify biochemical differences in smokers.

    Science.gov (United States)

    Kaluarachchi, Manuja R; Boulangé, Claire L; Garcia-Perez, Isabel; Lindon, John C; Minet, Emmanuel F

    2016-10-01

    Determining perturbed biochemical functions associated with tobacco smoking should be helpful for establishing causal relationships between exposure and adverse events. A multiplatform comparison of serum of smokers (n = 55) and never-smokers (n = 57) using nuclear magnetic resonance spectroscopy, UPLC-MS and statistical modeling revealed clustering of the classes, distinguished by metabolic biomarkers. The identified metabolites were subjected to metabolic pathway enrichment, modeling adverse biological events using available databases. Perturbation of metabolites involved in chronic obstructive pulmonary disease, cardiovascular diseases and cancer were identified and discussed. Combining multiplatform metabolic phenotyping with knowledge-based mapping gives mechanistic insights into disease development, which can be applied to next-generation tobacco and nicotine products for comparative risk assessment.

  7. Identifying behavioural differences in working donkeys in response to analgesic administration.

    Science.gov (United States)

    Regan, F H; Hockenhull, J; Pritchard, J C; Waterman-Pearson, A E; Whay, H R

    2016-01-01

    To identify pain-related behaviour in working donkeys in order to assist their owners and veterinarians to recognise and manage pain. To identify general and specific behaviours associated with pain or its relief using a trial with the nonsteroidal anti-inflammatory drug meloxicam (Metacam). Observer-blinded, placebo-controlled trial. Forty adult male working donkeys with common clinical abnormalities were randomly assigned to receive either a single loading dose of meloxicam (1.2 mg/kg bwt per os; n = 20) or a placebo (30 mg honey/250 ml water per os; n = 20). Observation of postural and event behaviours was undertaken at 2 pretreatment time points followed by 4 post treatment time points, using scan (instantaneous) and focal sampling. In comparison to pretreatment baselines, donkeys receiving meloxicam were more alert post treatment than the placebo group. They were observed lying down less frequently (P = 0.007), with their eyes closed less frequently (P = 0.04) and having a high head carriage more frequently (P = 0.02). Dozing behaviour decreased after meloxicam compared with the pretreatment baseline (P = 0.03). Donkeys given meloxicam also showed more interest in their environment, turning to look at environmental stimuli more frequently (P = 0.05) than those in the placebo group post treatment. Neither the meloxicam nor the placebo group showed a significant post treatment improvement in lameness scores. Working donkeys receiving meloxicam were more active and alert compared with their pretreatment behaviour, confirming the potential value of nonsteroidal anti-inflammatory drugs in identifying behaviours indicative of pain in working donkeys. Behavioural assessment of pain in working donkeys in field clinic conditions will enable veterinary staff and owners to identify welfare issues promptly and monitor response to analgesia. The Summary is available in Chinese--see Supporting information. © 2015 EVJ Ltd.

  8. Critical differences between elective and emergency surgery: identifying domains for quality improvement in emergency general surgery.

    Science.gov (United States)

    Columbus, Alexandra B; Morris, Megan A; Lilley, Elizabeth J; Harlow, Alyssa F; Haider, Adil H; Salim, Ali; Havens, Joaquim M

    2018-04-01

    The objective of our study was to characterize providers' impressions of factors contributing to disproportionate rates of morbidity and mortality in emergency general surgery to identify targets for care quality improvement. Emergency general surgery is characterized by a high-cost burden and disproportionate morbidity and mortality. Factors contributing to these observed disparities are not comprehensively understood and targets for quality improvement have not been formally developed. Using a grounded theory approach, emergency general surgery providers were recruited through purposive-criterion-based sampling to participate in semi-structured interviews and focus groups. Participants were asked to identify contributors to emergency general surgery outcomes, to define effective care for EGS patients, and to describe operating room team structure. Interviews were performed to thematic saturation. Transcripts were iteratively coded and analyzed within and across cases to identify emergent themes. Member checking was performed to establish credibility of the findings. A total of 40 participants from 5 academic hospitals participated in either individual interviews (n = 25 [9 anesthesia, 12 surgery, 4 nursing]) or focus groups (n = 2 [15 nursing]). Emergency general surgery was characterized by an exceptionally high level of variability, which can be subcategorized as patient-variability (acute physiology and comorbidities) and system-variability (operating room resources and workforce). Multidisciplinary communication is identified as a modifier to variability in emergency general surgery; however, nursing is often left out of early communication exchanges. Critical variability in emergency general surgery may impact outcomes. Patient-variability and system-variability, with focus on multidisciplinary communication, represent potential domains for quality improvement in this field. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Family-centred service: differences in what parents of children with cerebral palsy rate important.

    Science.gov (United States)

    Terwiel, M; Alsem, M W; Siebes, R C; Bieleman, K; Verhoef, M; Ketelaar, M

    2017-09-01

    A family-centred approach to services of children with disabilities is widely accepted as the foundational approach to service delivery in paediatric health care. The 56 items of the Measure of Processes of Care questionnaire (MPOC-56) all reflect elements of family-centred service. In this study, we investigated which elements of family-centred service are rated important by parents of children with cerebral palsy by adding a question on importance to each item of the MPOC-56 (MPOC-56-I). In total, 175 parents of children with cerebral palsy completed the MPOC-56-I. For each MPOC item, parents were asked to rate the importance on a 5-point scale ranging from 0 (not important at all) up to and including 4 (very important). We used Spearman's rank correlation coefficient to further explore the variation in parents' importance ratings. Parents' importance ratings of the MPOC-56 items varied. The percentage of parents rating an item important (importance rating 3 or 4) varied between 43.8% and 96.8%. The percentage of parents rating an item unimportant (rating 0 or 1) varied between 0.0% and 20.3%, and the percentage of parents rating an item neutral (rating 2) varied between 3.0% and 36.0%. Most diverse importance ratings were found for five items concerning the provision of general information. Three correlations between these items and child and parent characteristics were found. Six items were rated important by almost all (≥95%) parents. These items concern elements of specific information about the child, co-ordinated and comprehensive care for child and family and enabling and partnership. Parents rate the importance of family-centred services for their situation in various ways. These findings endorse that family-centred services should recognize the uniqueness of families and should be tailored to what parents find important. © 2017 John Wiley & Sons Ltd.

  10. Minimal Clinically Important Differences for American Orthopaedic Foot & Ankle Society Score in Hallux Valgus Surgery.

    Science.gov (United States)

    Chan, Hiok Yang; Chen, Jerry Yongqiang; Zainul-Abidin, Suraya; Ying, Hao; Koo, Kevin; Rikhraj, Inderjeet Singh

    2017-05-01

    The American Orthopaedic Foot & Ankle Society (AOFAS) score is one of the most common and adapted outcome scales in hallux valgus surgery. However, AOFAS is predominantly physician based and not patient based. Although it may be straightforward to derive statistical significance, it may not equate to the true subjective benefit of the patient's experience. There is a paucity of literature defining MCID for AOFAS in hallux valgus surgery although it could have a great impact on the accuracy of analyzing surgical outcomes. Hence, the primary aim of this study was to define the Minimal Clinically Important Difference (MCID) for the AOFAS score in these patients, and the secondary aim was to correlate patients' demographics to the MCID. We conducted a retrospective cross-sectional study. A total of 446 patients were reviewed preoperatively and followed up for 2 years. An anchor question was asked 2 years postoperation: "How would you rate the overall results of your treatment for your foot and ankle condition?" (excellent, very good, good, fair, poor, terrible). The MCID was derived using 4 methods, 3 from an anchor-based approach and 1 from a distribution-based approach. Anchor-based approaches were (1) mean difference in 2-year AOFAS scores of patients who answered "good" versus "fair" based on the anchor question; (2) mean change of AOFAS score preoperatively and at 2-year follow-up in patients who answered good; (3) receiver operating characteristic (ROC) curves method, where the area under the curve (AUC) represented the likelihood that the scoring system would accurately discriminate these 2 groups of patients. The distribution-based approach used to calculate MCID was the effect size method. There were 405 (90.8%) females and 41 (9.2%) males. Mean age was 51.2 (standard deviation [SD] = 13) years, mean preoperative BMI was 24.2 (SD = 4.1). Mean preoperative AOFAS score was 55.6 (SD = 16.8), with significant improvement to 85.7 (SD = 14.4) in 2 years ( P value

  11. Detecting and Identifying Industrial Gases by a Method Based on Olfactory Machine at Different Concentrations

    OpenAIRE

    Sun, Yunlong; Luo, Dehan; Li, Hui; Zhu, Chuchu; Xu, Ou; Gholam Hosseini, Hamid

    2018-01-01

    Gas sensors have been widely reported for industrial gas detection and monitoring. However, the rapid detection and identification of industrial gases are still a challenge. In this work, we measure four typical industrial gases including CO2, CH4, NH3, and volatile organic compounds (VOCs) based on electronic nose (EN) at different concentrations. To solve the problem of effective classification and identification of different industrial gases, we propose an algorithm based on the selective ...

  12. Comparison of important nutrients/ elements and chemical/ microbiological contaminants in different types of meat

    International Nuclear Information System (INIS)

    Ihsanullah; Khattak, T.N.; Mehmood, N.; Sattar, A.

    2001-01-01

    Studies were conducted to see the levels of important nutrients and selected essential/toxic metals in different types of meat i.e. beef, poultry, mutton and fish. The meat samples were also analyzed for bacterial contamination. Highest value of protein (20.32 +- 1.86% was detected in poultry (chicken) while maximum fats and fiber contents (13.50 +- 0.14 and 0.135 +- 0.112%) were found in beef samples. The Pb content was found to be 7.0 +- 0.61 (mutton), 6.6 +- 0.58 (beef) and 3.3 +- 0.39 ppm (poultry). The highest level of Cd was determined in poultry (1.00 +- 0.13) followed by mutton (0.80 +- 0.07), beef (0.70 +- 0.08) and fish (0.25 +- 0.04 ppm). The maximum level of Cu (10.0 +- 0.55 and 7.0 +- 0.43 ppm) was detected in beef and mutton respectively while comparatively low Cu content was found in poultry as well as fish samples. It was observed that fresh meat had low levels of heavy metals. Highest concentrations of Fe (3.29 +- 0.41ppm) and P (167.8 +- 10.31) were found in mutton and beef respectively. The data revealed that majority of meat samples were also contaminated with bacteria and showed presence of E. coli. Hence, were considered unfit for human consumption. In addition % moisture and ash were also examined. The results were compared with recommended daily allowances and some remedial measures to control environmental pollution of meat sold in the open air are suggested. (author)

  13. Hydrogen Exchange Differences between Chemoreceptor Signaling Complexes Localize to Functionally Important Subdomains

    Science.gov (United States)

    2015-01-01

    The goal of understanding mechanisms of transmembrane signaling, one of many key life processes mediated by membrane proteins, has motivated numerous studies of bacterial chemotaxis receptors. Ligand binding to the receptor causes a piston motion of an α helix in the periplasmic and transmembrane domains, but it is unclear how the signal is then propagated through the cytoplasmic domain to control the activity of the associated kinase CheA. Recent proposals suggest that signaling in the cytoplasmic domain involves opposing changes in dynamics in different subdomains. However, it has been difficult to measure dynamics within the functional system, consisting of extended arrays of receptor complexes with two other proteins, CheA and CheW. We have combined hydrogen exchange mass spectrometry with vesicle template assembly of functional complexes of the receptor cytoplasmic domain to reveal that there are significant signaling-associated changes in exchange, and these changes localize to key regions of the receptor involved in the excitation and adaptation responses. The methylation subdomain exhibits complex changes that include slower hydrogen exchange in complexes in a kinase-activating state, which may be partially consistent with proposals that this subdomain is stabilized in this state. The signaling subdomain exhibits significant protection from hydrogen exchange in complexes in a kinase-activating state, suggesting a tighter and/or larger interaction interface with CheA and CheW in this state. These first measurements of the stability of protein subdomains within functional signaling complexes demonstrate the promise of this approach for measuring functionally important protein dynamics within the various physiologically relevant states of multiprotein complexes. PMID:25420045

  14. Potential Causes of Significant Inventory Differences at Bulk Handling Facilities and the Importance of Inventory Difference Action Levels

    International Nuclear Information System (INIS)

    Homer, Alan; O’Hagan, Brendan

    2015-01-01

    Accountancy for nuclear material can be split into two categories. Firstly, where possible, accountancy should be in terms of items that can be transferred as discrete packages and their contents fixed at the time of their creation. All items must remain accounted for at all times, and a single missing item is considered significant. Secondly, where nuclear material is unconstrained, for example in a reprocessing plant where it can change form, there is an uncertainty that relates to the amount of material present in any location. Cumulatively, these uncertainties can be summed and provide a context for any estimate of material in a process. Any apparent loss or gain between what has been physically measured within a facility during its physical inventory take and what is reported within its nuclear material accounts is known as an inventory difference. The cumulative measurement uncertainties can be used to set an action level for the inventory difference so that if an inventory difference is observed outside of such action levels, the difference is classified as significant and an investigation to find the root cause(s) is required. The purpose of this paper is to explore the potential causes of significant inventory differences and to provide a framework within which an inventory difference investigation can be carried out.

  15. Gender Differences in the Importance of Personality Traits in Predicting Leadership Self-Efficacy

    Science.gov (United States)

    Huszczo, Gregory; Endres, Megan Lee

    2017-01-01

    Our goal in this study was to investigate antecedents to formation of leadership self-efficacy (LSE) for men versus women. We used a relative importance analysis, which allows more precise identification of important predictors without concern of multicollinearity effects on R[superscript 2]. Using a sample of 325 business students, we found that…

  16. Surface electromyographic amplitude does not identify differences in neural drive to synergistic muscles.

    Science.gov (United States)

    Martinez-Valdes, Eduardo; Negro, Francesco; Falla, Deborah; De Nunzio, Alessandro Marco; Farina, Dario

    2018-04-01

    Surface electromyographic (EMG) signal amplitude is typically used to compare the neural drive to muscles. We experimentally investigated this association by studying the motor unit (MU) behavior and action potentials in the vastus medialis (VM) and vastus lateralis (VL) muscles. Eighteen participants performed isometric knee extensions at four target torques [10, 30, 50, and 70% of the maximum torque (MVC)] while high-density EMG signals were recorded from the VM and VL. The absolute EMG amplitude was greater for VM than VL ( P differences in EMG amplitude can be due to both differences in the neural drive and in the size of the MU action potentials, we indirectly inferred the neural drives received by the two muscles by estimating the synaptic inputs received by the corresponding motor neuron pools. For this purpose, we analyzed the increase in discharge rate from recruitment to target torque for motor units matched by recruitment threshold in the two muscles. This analysis indicated that the two muscles received similar levels of neural drive. Nonetheless, the size of the MU action potentials was greater for VM than VL ( P difference explained most of the differences in EMG amplitude between the two muscles (~63% of explained variance). These results indicate that EMG amplitude, even following normalization, does not reflect the neural drive to synergistic muscles. Moreover, absolute EMG amplitude is mainly explained by the size of MU action potentials. NEW & NOTEWORTHY Electromyographic (EMG) amplitude is widely used to compare indirectly the strength of neural drive received by synergistic muscles. However, there are no studies validating this approach with motor unit data. Here, we compared between-muscles differences in surface EMG amplitude and motor unit behavior. The results clarify the limitations of surface EMG to interpret differences in neural drive between muscles.

  17. Application of otolith shape analysis in identifying different ecotypes of Coilia ectenes in the Yangtze Basin, China

    Digital Repository Service at National Institute of Oceanography (India)

    Radhakrishnan, K.V.; Li, Y.; Jayalakshmy, K.V.; Liu, M.; Murphy, B.R.; Xie, S.

    The variability in otolith shape of the tapertail anchovy Coilia ectenes was investigated as a tool for identifying its different ecotypes. The outlines of 350 sagittal otoliths of known ecotypes collected from seven sampling areas, covering most...

  18. Membrane fatty acid composition of different target populations: Importance of baseline on supplementation

    Directory of Open Access Journals (Sweden)

    Veronica Silva

    2015-09-01

    Full Text Available Omega-3 fatty acids (n-3 FA supplementation has been widely used regardless the initial FA composition of the studied population. In this work we compared the red blood cell FA (RBC-FA composition in healthy and different diseased populations at baseline and show how this affects the incorporation of n-3 FA supplementation in ICU-trauma patients. Blood was drawn from Healthy (H, n = 22, Psoriasis (P, n = 13, Cancer(C, n = 81, Geriatric (G, n = 49, Social-phobia (SP, n = 27 and ICU-trauma (T, n = 40 patients before n-3 FA supplementation. For the T group blood was also drawn 8 days after receiving a formula with 4.1 g/L EPA and 5.5 g/L GLA (Oxepa, Abbott. RBC-FA was assessed by gas chromatography and the percentage of each FA was calculated in relation to the total identified FAs. Baseline RBC-FA profile was significantly different between groups (p < 0.0001 with subjects in the healthy group having higher n-3 FA status. H and SP showed the highest content in total n-3 FA (11.89 ± 0.22% H vs 7.45 ± 0.26% T and EPA (1.61 ± 0.03% H vs 0.41 ± 0.13% P. DHA was higher in C and H than in the other groups (6.15 ± 0.15% C vs 4.32 ± 0.11% T. ARA was highest in C (16.04 ± 0.20% C vs 14.85 ± 0.22% H and comparable in the rest of the groups. The n-6/n-3 ratio was lowest for H and highest for T (2.75 ± 0.07 vs 4.96 ± 0.13. Moreover, we showed that for the T group, the treatment-associated changes in the n-3 content are dependent on the initial n-3 FA status, since a negative correlation between the baseline omega 3 index (EPA + DHA and its change after supplementation was found (p = 0.002, r2 = 0.219. We conclude that RBC-FA profile should be evaluated and considered individually for each patient or groups before generalized supplementation schemes, strengthening the concept of personalized medicine.

  19. Identifying the Generation Gap in Higher Education: Where Do the Differences Really Lie?

    Science.gov (United States)

    Garcia, Paula; Qin, Jingjing

    2007-01-01

    The new generation of incoming college students come complete with new technological skills and, seemingly, new expectations for learning. Yet how different are these students from the ones educators have encountered in the past? Under the auspices of Northern Arizona University's e-Learning Center, Paula Garcia and Jingjing Qin investigated the…

  20. Involvement in Extracurricular Activities: Identifying Differences in Perceptions of School Climate

    Science.gov (United States)

    Martinez, Andrew; Coker, Crystal; McMahon, Susan D.; Cohen, Jonathan; Thapa, Amrit

    2016-01-01

    Many youth participate in extracurricular activities, and research has linked activity participation with school engagement and academic success. Social-ecological theory suggests that the social contexts of different types of extracurricular activities may differentially affect student outcomes. Yet, there is scant research examining the relation…

  1. Identifying consumer preference for beef produced with different levels of growth promotant technology

    Science.gov (United States)

    Objectives: Objectives of this study were to 1) evaluate growth performance and carcass characteristics, and 2) determine environmental and economic impacts of cattle raised with different levels of growth promoting technology. Materials and Methods: Angus' Simmental,and crossbred steer calves (n =...

  2. Identifying target groups for environmentally sustainable transport: assessment of different segmentation approaches

    DEFF Research Database (Denmark)

    Haustein, Sonja; Hunecke, Marcel

    2013-01-01

    Recently, the use of attitude-based market segmentation to promote environmentally sustainable transport has significantly increased. The segmentation of the population into meaningful groups sharing similar attitudes and preferences provides valuable information about how green measures should...... and behavioural segmentations are compared regarding marketing criteria. Although none of the different approaches can claim absolute superiority, attitudinal approaches show advantages in providing startingpoints for interventions to reduce car use....

  3. Gene expression differences between Noccaea caerulescens ecotypes help to identify candidate genes for metal phytoremediation.

    Science.gov (United States)

    Halimaa, Pauliina; Lin, Ya-Fen; Ahonen, Viivi H; Blande, Daniel; Clemens, Stephan; Gyenesei, Attila; Häikiö, Elina; Kärenlampi, Sirpa O; Laiho, Asta; Aarts, Mark G M; Pursiheimo, Juha-Pekka; Schat, Henk; Schmidt, Holger; Tuomainen, Marjo H; Tervahauta, Arja I

    2014-03-18

    Populations of Noccaea caerulescens show tremendous differences in their capacity to hyperaccumulate and hypertolerate metals. To explore the differences that could contribute to these traits, we undertook SOLiD high-throughput sequencing of the root transcriptomes of three phenotypically well-characterized N. caerulescens accessions, i.e., Ganges, La Calamine, and Monte Prinzera. Genes with possible contribution to zinc, cadmium, and nickel hyperaccumulation and hypertolerance were predicted. The most significant differences between the accessions were related to metal ion (di-, trivalent inorganic cation) transmembrane transporter activity, iron and calcium ion binding, (inorganic) anion transmembrane transporter activity, and antioxidant activity. Analysis of correlation between the expression profile of each gene and the metal-related characteristics of the accessions disclosed both previously characterized (HMA4, HMA3) and new candidate genes (e.g., for nickel IRT1, ZIP10, and PDF2.3) as possible contributors to the hyperaccumulation/tolerance phenotype. A number of unknown Noccaea-specific transcripts also showed correlation with Zn(2+), Cd(2+), or Ni(2+) hyperaccumulation/tolerance. This study shows that N. caerulescens populations have evolved great diversity in the expression of metal-related genes, facilitating adaptation to various metalliferous soils. The information will be helpful in the development of improved plants for metal phytoremediation.

  4. Using freelisting to identify, assess, and characterize age differences in shared cultural domains.

    Science.gov (United States)

    Schrauf, Robert W; Sanchez, Julia

    2008-11-01

    Freelisting is a brief, paper-and-pencil technique in which participants make lists of items that they believe belong in a particular domain. Where cultural domains are shared, as for young and old in the same society, subtle intracultural differences may be difficult to detect. This article presents a series of techniques for revealing and describing this intracultural variation in freelisted data among young versus old age groups. Older (N = 30) and younger (N = 31) Mexicans in Mexico City made freelists in four quotidian domains: animals, emotions, illnesses, and gendered occupations. We used minimum residual factor analysis (consensus analysis) to establish domain coherence and assess overall consensus concerning contents of the domains. We established subvariation within the overall consensus by comparing levels of observed versus predicted inter-informant agreement. Results showed divergent patterns of inter-informant agreement between young and old participants across domains. Qualitative examination of items with higher salience for young versus old revealed age differences consistent with prior findings in each domain. The concatenation of these techniques renders freelisting an accessible, easily administered tool for probing age and group differences in cultural domains.

  5. Identifying Different Transportation Modes from Trajectory Data Using Tree-Based Ensemble Classifiers

    Directory of Open Access Journals (Sweden)

    Zhibin Xiao

    2017-02-01

    Full Text Available Recognition of transportation modes can be used in different applications including human behavior research, transport management and traffic control. Previous work on transportation mode recognition has often relied on using multiple sensors or matching Geographic Information System (GIS information, which is not possible in many cases. In this paper, an approach based on ensemble learning is proposed to infer hybrid transportation modes using only Global Position System (GPS data. First, in order to distinguish between different transportation modes, we used a statistical method to generate global features and extract several local features from sub-trajectories after trajectory segmentation, before these features were combined in the classification stage. Second, to obtain a better performance, we used tree-based ensemble models (Random Forest, Gradient Boosting Decision Tree, and XGBoost instead of traditional methods (K-Nearest Neighbor, Decision Tree, and Support Vector Machines to classify the different transportation modes. The experiment results on the later have shown the efficacy of our proposed approach. Among them, the XGBoost model produced the best performance with a classification accuracy of 90.77% obtained on the GEOLIFE dataset, and we used a tree-based ensemble method to ensure accurate feature selection to reduce the model complexity.

  6. Diagnosed, identified, current and complete depression among patients attending primary care in southern Catalonia: different aspects of the same concept.

    Science.gov (United States)

    Montesó-Curto, Pilar; Ferré-Grau, Carme; Lleixà-Fortuño, Mar; Albacar-Riobóo, Nuria; Lejeune, Marylene

    2014-02-01

    The aims of this study were to explore the prevalence and the conceptualizations of depression detected by the healthcare system, identified by the patient or classified/identified in the validated Goldberg's questionnaire in a community. We conducted a cross-sectional evaluation of 317 patients. The different types of depression diagnosed, identified, current or total were stratified by age and gender groups. The difference in the conceptualization of depression from the medical or ordinary people point of view indicate that depression care requires the understanding of the lifestyle, beliefs, attitudes, family and social networks of the people the physicians and nurses care for. © 2014.

  7. The importance of Foxp3 antibody and fixation/permeabilization buffer combinations in identifying CD4+CD25+Foxp3+ regulatory T cells.

    Science.gov (United States)

    Law, Jacqueline P; Hirschkorn, Dale F; Owen, Rachel E; Biswas, Hope H; Norris, Philip J; Lanteri, Marion C

    2009-12-01

    Foxp3 is a key marker for CD4(+) regulatory T cells (T(regs)) and was used in developing a multiparameter flow cytometric panel to identify T(regs). Achieving reproducible staining and analysis first required optimization of Foxp3 staining. We present a comparative study of PCH101, 236A/E7, 3G3, 206D, 150D, and 259D/C7 clones of anti-human-Foxp3 antibodies used in combination with five different fixation/permeabilization buffers. Staining for CD25, CD152, and CD127 was also compared between fixation/permeabilization treatments. Promising antibody/buffer combinations were tested in a panel of peripheral blood mononuclear cells from 10 individuals, and then on fresh versus frozen cells from four individuals. Finally, different fluorochromes coupled to two representative antibodies were compared to optimize separation of Foxp3(+) from Foxp3(-) events. Foxp3 gates were set using two gating strategies based on CD127(+)CD25(-) "non-T(regs)" or based on isotype controls. For Foxp3 staining, the best conditions for fixation/permeabilization were obtained using the eBioscience Foxp3, Imgenex, BioLegend, and BD Foxp3 buffers. Comparing results from 10 subjects, 259D/C7, PCH101, 236A/E7, and 206D antibodies yielded statistically higher levels of Foxp3 cells than those by 150D and 3G3 antibodies (mean = 6.9, 5.1, 4.7, and 3.7% compared with 1.7, and 0.3% of CD25(+)Foxp3(+) events within CD4(+) cells, respectively). Importantly, the "nonspecificity" of some antibodies observed with a Foxp3 gate based on isotype controls could be eliminated by setting the Foxp3 gate on "non-T(regs)". Better separation of Foxp3(+) and Foxp3(-) populations was observed using the PCH101 clone coupled to Alexa647 compared with FITC or the 259D/C7 clone coupled to PE compared with Alexa488 fluorochrome. Foxp3 staining can be highly variable and depends on the choice of antibody/buffer pair and the fluorochrome used. Selecting the correct population for setting the Foxp3 gate is critical to avoid

  8. Femoral head shape differences during development may identify hips at risk of degeneration.

    Science.gov (United States)

    Vanden Berg-Foels, Wendy S; Schwager, Steven J; Todhunter, Rory J; Reeves, Anthony P

    2011-12-01

    Developmental dysplasia of the hip (DDH) is a common cause of elevated contact stress and early onset osteoarthritis (OA). We hypothesized that adaptation to focal loading during postnatal development would result in signature changes to the shape of the femoral head secondary center of ossification (SCO). SCO shape was evaluated in a canine model of DDH at ages 14 and 32 weeks. The evolving 3D morphology of the SCO was captured using serial quantitative computed tomography. A discrete medial representation shape model was fit to each SCO and served as the basis for quantitative thickness and bending measurements. Shape measurements were tested for associations with hip subluxation and degeneration. At 32 weeks, the SCO was thinner (flatter) in the perifoveal region, the site of focal loading; a greater bend to the SCO was present lateral to the site of thinning; SCO thinning and bending were associated with less femoral head coverage and with a higher probability of degeneration. Shape changes were not detected at 14 weeks. Measurement and visualization of SCO shape changes due to altered loading may provide a basis for identifying hips at risk of early onset OA and a tool for surgical planning of hip restructuring.

  9. Combination of FTIR and SEM for Identifying Freshwater-Cultured Pearls from Different Quality

    Science.gov (United States)

    Satitkune, Somruedee; Monarumit, Natthapong; Boonmee, Chakkrich; Phlayrahan, Aumaparn; Promdee, Kittiphop; Won-in, Krit

    2016-03-01

    The freshwater-cultured pearl ( Chamberlainia hainesiana species) is an organic gemstone mainly composed of calcium carbonate mineral including calcite, aragonite and vaterite phases. Generally, the quality of freshwater-cultured pearl is based on its luster. The high luster pearl is full of the aragonite phase without vaterite phase. On the other hand, the low luster pearl consists of aragonite and vaterite phases. These data could be proved by the Fourier Transform Infrared (FTIR) spectroscopy combined with the scanning electron microscopy (SEM). As the results, the high luster pearl similarly shows the FTIR spectrum of aragonite phase, and also, it shows the hexagonal shape of aragonite for the SEM image. On the other hand, the FTIR spectrum of low luster pearl has been pointed to the mixture component among aragonite and vaterite phases, and based on the SEM image; the irregular form is also interpreted to the mixture of aragonite and vaterite phases. This research concludes that the quality of freshwater-cultured pearls can be identified by the combination data of FTIR spectra and SEM images. These techniques are suitable for applied gemology.

  10. Identifying and prioritizing different factors influencing the success of advertisement during the economic depression

    Directory of Open Access Journals (Sweden)

    Aram Rashidi

    2014-04-01

    Full Text Available During the financial crisis of 2007, many businesses and banks faced unexpected circumstances and declared bankruptcy. Market mortgage crisis and the collapse of the economic system in United States created a substantial amount of damage in world economy. Within a few years, the economic downturn was transferred to developing countries such as Iran. The recession has created conditions for Iranian companies that have led them to focus more on the subject of advertising since this is the primary tool of communication and business customers business. Success and failure of many organizations and companies depend on their advertisement planning. In this study, the factors contributing to the success and effectiveness of advertising during the recession time are identified. This survey has been accomplished on investigating an Iranian dairy firm named “Kalle”. Using a questionnaire in Likert scale, the study determines the effects of various factors of advertisement on sales improvement in this firm using Pearson correlation ratio and rank them based on Freedman test. Cronbach alpha has been calculated as 0.93. According to the results, factors that contribute to the success of advertising during a recession include: Responsiveness to customers’ needs, advertising tools, content factors, the amount of money spent and availability.

  11. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L.) Using SLAF-seq.

    Science.gov (United States)

    Xie, Dongwei; Dai, Zhigang; Yang, Zemao; Sun, Jian; Zhao, Debao; Yang, Xue; Zhang, Liguo; Tang, Qing; Su, Jianguang

    2017-01-01

    Flax ( Linum usitatissimum L.) is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq) was employed to perform a genome-wide association study (GWAS) for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP) loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM) and a mixed linear model (MLM) as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  12. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L. Using SLAF-seq

    Directory of Open Access Journals (Sweden)

    Dongwei Xie

    2018-01-01

    Full Text Available Flax (Linum usitatissimum L. is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq was employed to perform a genome-wide association study (GWAS for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM and a mixed linear model (MLM as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  13. Collecting and learning to identify edible fungi in southeastern Poland: age and gender differences.

    Science.gov (United States)

    Luczaj, Lukasz; Nieroda, Zofia

    2011-01-01

    The gathering of 17 folk taxa of edible fungi (most commonly Boletus edulis, Leccinum spp., Xerocomus spp., Suillus spp., Cantharellus cibarius, Armillaria spp., Russula spp., Lactarius salmonicolor, Macrolepiota procera, Boletus erythropus) was recorded in three villages in southeast Poland, but only 13 of them are gathered by children. Gender and age differences were small (apart from the fact that more adults than children collect non-Boletaceae species), and relatives of both sexes took part in teaching children about mushrooms, although fathers were most frequently mentioned as first teachers. Collecting mushrooms, mainly for own use, sometimes for sale, is still a culturally significant activity.

  14. Detecting and Identifying Industrial Gases by a Method Based on Olfactory Machine at Different Concentrations

    Directory of Open Access Journals (Sweden)

    Yunlong Sun

    2018-01-01

    Full Text Available Gas sensors have been widely reported for industrial gas detection and monitoring. However, the rapid detection and identification of industrial gases are still a challenge. In this work, we measure four typical industrial gases including CO2, CH4, NH3, and volatile organic compounds (VOCs based on electronic nose (EN at different concentrations. To solve the problem of effective classification and identification of different industrial gases, we propose an algorithm based on the selective local linear embedding (SLLE to reduce the dimensionality and extract the features of high-dimensional data. Combining the Euclidean distance (ED formula with the proposed algorithm, we can achieve better classification and identification of four kinds of gases. We compared the classification and recognition results of classical principal component analysis (PCA, linear discriminate analysis (LDA, and PCA + LDA algorithms with the proposed SLLE algorithm after selecting the original data and performing feature extraction. The experimental results show that the recognition accuracy rate of the SLLE reaches 91.36%, which is better than the other three algorithms. In addition, the SLLE algorithm provides more efficient and accurate responses to high-dimensional industrial gas data. It can be used in real-time industrial gas detection and monitoring combined with gas sensor networks.

  15. Mixed models identify physic nut genotypes adapted to environments with different phosphorus availability.

    Science.gov (United States)

    Teodoro, P E; Laviola, B G; Martins, L D; Amaral, J F T; Rodrigues, W N

    2016-08-19

    The aim of this study was to screen physic nut (Jatropha curcas) genotypes that differ in their phosphorous (P) use, using mixed models. The experiment was conducted in a greenhouse located in the experimental area of the Centro de Ciências Agrárias of the Universidade Federal do Espírito Santo, in Alegre, ES, Brazil. The experiment was arranged in a randomized block design, using a 10 x 3-factorial scheme, including ten physic nut genotypes and two environments that differed in their levels of soil P availability (10 and 60 mg/dm 3 ), each with four replications. After 100 days of cultivation, we evaluated the plant height, stem diameter, root volume, root dry matter, aerial part dry matter, total dry matter, as well as the efficiency of absorption, and use. The parameters were estimated for combined selection while considering the studied parameters: stability and adaptability for both environments were obtained using the harmonic mean of the relative performance of the predicted genotypic values. High genotype by environment interactions were observed for most physic nut traits, indicating considerable influences of P availability on the phenotypic value. The genotype Paraíso simultaneously presented high adaptability and stability for aerial part dry matter, total dry matter, and P translocation efficiency. The genotype CNPAE-C2 showed a positive response to P fertilization by increasing both the total and aerial part dry matter.

  16. Size-matched alkyne-conjugated cyanine fluorophores to identify differences in protein glycosylation.

    Science.gov (United States)

    Burnham-Marusich, Amanda R; Plechaty, Anna M; Berninsone, Patricia M

    2014-09-01

    Currently, there are few methods to detect differences in posttranslational modifications (PTMs) in a specific manner from complex mixtures. Thus, we developed an approach that combines the sensitivity and specificity of click chemistry with the resolution capabilities of 2D-DIGE. In "Click-DIGE", posttranslationally modified proteins are metabolically labeled with azido-substrate analogs, then size- and charge-matched alkyne-Cy3 or alkyne-Cy5 dyes are covalently attached to the azide of the PTM by click chemistry. The fluorescently-tagged protein samples are then multiplexed for 2DE analysis. Whereas standard DIGE labels all proteins, Click-DIGE focuses the analysis of protein differences to a targeted subset of posttranslationally modified proteins within a complex sample (i.e. specific labeling and analysis of azido glycoproteins within a cell lysate). Our data indicate that (i) Click-DIGE specifically labels azido proteins, (ii) the resulting Cy-protein conjugates are spectrally distinct, and (iii) the conjugates are size- and charge-matched at the level of 2DE. We demonstrate the utility of this approach by detecting multiple differentially expressed glycoproteins between a mutant cell line defective in UDP-galactose transport and the parental cell line. We anticipate that the diversity of azido substrates already available will enable Click-DIGE to be compatible with analysis of a wide range of PTMs. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Ability of Different Measures of Adiposity to Identify High Metabolic Risk in Adolescents

    Directory of Open Access Journals (Sweden)

    Carla Moreira

    2011-01-01

    Full Text Available Introduction. This study aimed to evaluate the screening performance of different measures of adiposity: body mass index (BMI, waist circumference (WC, and waist-to-height ratio (WHtR for high metabolic risk in a sample of adolescents. Methods. A cross-sectional school-based study was conducted on 517 adolescents aged 15–18, from the Azorean Islands, Portugal. We measured fasting glucose, insulin, total cholesterol (TC, HDL-cholesterol, triglycerides, and systolic blood pressure. HOMA and TC/HDL-C ratio were calculated. For each of these variables, a Z-score was computed by age and sex. A metabolic risk score (MRS was constructed by summing the Z-scores of all individual risk factors. High risk was considered when the individual had ≥1SD of this score. Receiver-operating characteristics (ROC were used. Results. Linear regression analyses showed that, after adjusting for age and pubertal stage, all different measures of adiposity are positively and significantly associated with MRS in both sexes, with exception of WHtR for boys. BMI, WC, and WHtR performed well in detecting high MRS, indicated by areas under the curve (AUC, with slightly greater AUC for BMI than for WC and WHtR in both sexes. Conclusion. All measures of adiposity were significantly associated with metabolic risk factors in a sample of Portuguese adolescents.

  18. Identifying the Potential for Robotics to Assist Older Adults in Different Living Environments

    Science.gov (United States)

    Mitzner, Tracy L.; Chen, Tiffany L.; Kemp, Charles C.; Rogers, Wendy A.

    2014-01-01

    As the older adult population grows and becomes more diverse, so will their needs and preferences for living environments. Many adults over 65 years of age require some assistance [1, 2]; yet it is important for their feelings of well-being that the assistance not restrict their autonomy [3]. Not only is autonomy correlated with quality of life [4], autonomy enhancement may improve functionality [2, 5]. The goal of this paper is to provide guidance for the development of technology to enhance autonomy and quality of life for older adults. We explore the potential for robotics to meet these needs. We evaluated older adults' diverse living situations and the predictors of residential moves to higher levels of care in the United States. We also examined older adults' needs for assistance with activities of daily living (ADLs), instrumental activities of daily living (IADLs), and medical conditions when living independently or in a long-term care residence. By providing support for older adults, mobile manipulator robots may reduce need-driven, undesired moves from residences with lower levels of care (i.e., private homes, assisted living) to those with higher levels of care (i.e., skilled nursing). PMID:24729800

  19. Previously identified patellar tendinopathy risk factors differ between elite and sub-elite volleyball players.

    Science.gov (United States)

    Janssen, I; Steele, J R; Munro, B J; Brown, N A T

    2015-06-01

    Patellar tendinopathy is the most common knee injury incurred in volleyball, with its prevalence in elite athletes more than three times that of their sub-elite counterparts. The purpose of this study was to determine whether patellar tendinopathy risk factors differed between elite and sub-elite male volleyball players. Nine elite and nine sub-elite male volleyball players performed a lateral stop-jump block movement. Maximum vertical jump, training history, muscle extensibility and strength, three-dimensional landing kinematics (250 Hz), along with lower limb neuromuscular activation patterns (1500 Hz), and patellar tendon loading were collected during each trial. Multivariate analyses of variance (P volleyball players. Interventions designed to reduce landing frequency and improve quadriceps extensibility are recommended to reduce patellar tendinopathy prevalence in volleyball players. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. The Perceived Social Costs and Importance of Seeking Emotional Support in the Workplace: Gender Differences and Similarities.

    Science.gov (United States)

    Cahill, Daniel J.; Sias, Patricia M.

    1997-01-01

    Investigates gender differences and similarities in the perceived social costs and importance of seeking emotional support regarding work-related problems. Finds women perceived such support to be more important than did men. Finds no gender differences regarding perceived social costs associated with seeking support from coworkers. Finds women…

  1. Comparative Transcriptome Analysis of Penicillium citrinum Cultured with Different Carbon Sources Identifies Genes Involved in Citrinin Biosynthesis

    Directory of Open Access Journals (Sweden)

    Taotao Li

    2017-02-01

    Full Text Available Citrinin is a toxic secondary metabolite of Penicillium citrinum and its contamination in many food items has been widely reported. However, research on the citrinin biosynthesis pathway and its regulation mechanism in P. citrinum is rarely reported. In this study, we investigated the effect of different carbon sources on citrinin production by P. citrinum and used transcriptome analysis to study the underlying molecular mechanism. Our results indicated that glucose, used as the sole carbon source, could significantly promote citrinin production by P. citrinum in Czapek’s broth medium compared with sucrose. A total of 19,967 unigenes were annotated by BLAST in Nr, Nt, Swiss-Prot and Kyoto Encyclopedia of Genes and Genomes (KEGG databases. Transcriptome comparison between P. citrinum cultured with sucrose and glucose revealed 1085 differentially expressed unigenes. Among them, 610 were upregulated while 475 were downregulated under glucose as compared to sucrose. KEGG pathway and Gene ontology (GO analysis indicated that many metabolic processes (e.g., carbohydrate, secondary metabolism, fatty acid and amino acid metabolism were affected, and potentially interesting genes that encoded putative components of signal transduction, stress response and transcription factor were identified. These genes obviously had important impacts on their regulation in citrinin biosynthesis, which provides a better understanding of the molecular mechanism of citrinin biosynthesis by P. citrinum.

  2. ASSOCIATION OF COSTUMER VALUE CHAIN ANALYSIS TO QUALITY FUNCTION DEPLOYMENT: DIFFERENT IDENTIFIED COSTUMERS AND REQUIREMENTS ON DEVELOPMENT OF CPM DEVICE

    Directory of Open Access Journals (Sweden)

    Raffaela Leane Zenni Tanure

    2013-06-01

    Full Text Available This study aims to present the differences between the use of QFD and its association with CVCA tool in the development of a CPM device for elbow and forearm rehabilitation. To achieve this goal, the study was divided into three steps. The development of a conceptual model that integrates the proposed CVCA + QFD tool for application in the health device development was done in the first step. The second step consisted of applying the proposed model, referring to the QFD method using 8 matrixes: quality matrix, product, characteristics of the parts, process, process parameters, human resources, infrastructure and costs matrix. The proposed conceptual model was employed fully in the third step, allowing the comparison between the methods. The results enabled to identify a discrepancy between the critical costumers in the use of mentioned methods. Customers were limited to the direct and indirect users in the QFD application: the patient, physician and physical therapist. This list got a considerable increase when CVCA was applied: the clinical engineering, product engineering, process and reliability engineering, project and product managers, financial sector, quality system and regulatory issues. These results show the importance of analyzing the supply chain systemically in order to consider all stakeholders to the CPM device development. Thus, needs and relationships delineation of all process customers can be done.

  3. Liposome accumulation in irradiated tumors display important tumor and dose dependent differences

    DEFF Research Database (Denmark)

    Hansen, Anders Elias; Fliedner, Frederikke Petrine; Henriksen, Jonas Rosager

    2018-01-01

    Radiation therapy may affect several important parameters in the tumor microenvironment and thereby influence the accumulation of liposomes by the enhanced permeability and retention (EPR)-effect. Here we investigate the effect of single dose radiation therapy on liposome tumor accumulation by PET...

  4. Multiplex SSR analysis of Phytophthora infestans in different countries and the importance for potato breeding

    NARCIS (Netherlands)

    Li, Y.

    2012-01-01

    Potato is the most important non-cereal crop in the world. Late blight, caused by the oomycete pathogen Phytophthora infestans, is the most devastating disease of potato. In the mid-19th century, P. infestans attacked the European potato fields and this resulted in a widespread famine in Ireland

  5. Random Forests Are Able to Identify Differences in Clotting Dynamics from Kinetic Models of Thrombin Generation.

    Science.gov (United States)

    Arumugam, Jayavel; Bukkapatnam, Satish T S; Narayanan, Krishna R; Srinivasa, Arun R

    2016-01-01

    Current methods for distinguishing acute coronary syndromes such as heart attack from stable coronary artery disease, based on the kinetics of thrombin formation, have been limited to evaluating sensitivity of well-established chemical species (e.g., thrombin) using simple quantifiers of their concentration profiles (e.g., maximum level of thrombin concentration, area under the thrombin concentration versus time curve). In order to get an improved classifier, we use a 34-protein factor clotting cascade model and convert the simulation data into a high-dimensional representation (about 19000 features) using a piecewise cubic polynomial fit. Then, we systematically find plausible assays to effectively gauge changes in acute coronary syndrome/coronary artery disease populations by introducing a statistical learning technique called Random Forests. We find that differences associated with acute coronary syndromes emerge in combinations of a handful of features. For instance, concentrations of 3 chemical species, namely, active alpha-thrombin, tissue factor-factor VIIa-factor Xa ternary complex, and intrinsic tenase complex with factor X, at specific time windows, could be used to classify acute coronary syndromes to an accuracy of about 87.2%. Such a combination could be used to efficiently assay the coagulation system.

  6. Not Just a Sum? Identifying Different Types of Interplay between Constituents in Combined Interventions.

    Science.gov (United States)

    Van Deun, Katrijn; Thorrez, Lieven; van den Berg, Robert A; Smilde, Age K; Van Mechelen, Iven

    2015-01-01

    Experiments in which the effect of combined manipulations is compared with the effects of their pure constituents have received a great deal of attention. Examples include the study of combination therapies and the comparison of double and single knockout model organisms. Often the effect of the combined manipulation is not a mere addition of the effects of its constituents, with quite different forms of interplay between the constituents being possible. Yet, a well-formalized taxonomy of possible forms of interplay is lacking, let alone a statistical methodology to test for their presence in empirical data. Starting from a taxonomy of a broad range of forms of interplay between constituents of a combined manipulation, we propose a sound statistical hypothesis testing framework to test for the presence of each particular form of interplay. We illustrate the framework with analyses of public gene expression data on the combined treatment of dendritic cells with curdlan and GM-CSF and show that these lead to valuable insights into the mode of action of the constituent treatments and their combination. R code implementing the statistical testing procedure for microarray gene expression data is available as supplementary material. The data are available from the Gene Expression Omnibus with accession number GSE32986.

  7. Identifying resistance gene analogs associated with resistances to different pathogens in common bean.

    Science.gov (United States)

    López, Camilo E; Acosta, Iván F; Jara, Carlos; Pedraza, Fabio; Gaitán-Solís, Eliana; Gallego, Gerardo; Beebe, Steve; Tohme, Joe

    2003-01-01

    ABSTRACT A polymerase chain reaction approach using degenerate primers that targeted the conserved domains of cloned plant disease resistance genes (R genes) was used to isolate a set of 15 resistance gene analogs (RGAs) from common bean (Phaseolus vulgaris). Eight different classes of RGAs were obtained from nucleotide binding site (NBS)-based primers and seven from not previously described Toll/Interleukin-1 receptor-like (TIR)-based primers. Putative amino acid sequences of RGAs were significantly similar to R genes and contained additional conserved motifs. The NBS-type RGAs were classified in two subgroups according to the expected final residue in the kinase-2 motif. Eleven RGAs were mapped at 19 loci on eight linkage groups of the common bean genetic map constructed at Centro Internacional de Agricultura Tropical. Genetic linkage was shown for eight RGAs with partial resistance to anthracnose, angular leaf spot (ALS) and Bean golden yellow mosaic virus (BGYMV). RGA1 and RGA2 were associated with resistance loci to anthracnose and BGYMV and were part of two clusters of R genes previously described. A new major cluster was detected by RGA7 and explained up to 63.9% of resistance to ALS and has a putative contribution to anthracnose resistance. These results show the usefulness of RGAs as candidate genes to detect and eventually isolate numerous R genes in common bean.

  8. Random Forests Are Able to Identify Differences in Clotting Dynamics from Kinetic Models of Thrombin Generation.

    Directory of Open Access Journals (Sweden)

    Jayavel Arumugam

    Full Text Available Current methods for distinguishing acute coronary syndromes such as heart attack from stable coronary artery disease, based on the kinetics of thrombin formation, have been limited to evaluating sensitivity of well-established chemical species (e.g., thrombin using simple quantifiers of their concentration profiles (e.g., maximum level of thrombin concentration, area under the thrombin concentration versus time curve. In order to get an improved classifier, we use a 34-protein factor clotting cascade model and convert the simulation data into a high-dimensional representation (about 19000 features using a piecewise cubic polynomial fit. Then, we systematically find plausible assays to effectively gauge changes in acute coronary syndrome/coronary artery disease populations by introducing a statistical learning technique called Random Forests. We find that differences associated with acute coronary syndromes emerge in combinations of a handful of features. For instance, concentrations of 3 chemical species, namely, active alpha-thrombin, tissue factor-factor VIIa-factor Xa ternary complex, and intrinsic tenase complex with factor X, at specific time windows, could be used to classify acute coronary syndromes to an accuracy of about 87.2%. Such a combination could be used to efficiently assay the coagulation system.

  9. Difference gel electrophoresis (DiGE) identifies differentially expressed proteins in endoscopically-collected pancreatic fluid

    Science.gov (United States)

    Paulo, Joao A.; Lee, Linda S.; Banks, Peter A.; Steen, Hanno; Conwell, Darwin L.

    2012-01-01

    Alterations in the pancreatic fluid proteome of individuals with chronic pancreatitis may offer insights into the development and progression of the disease. The endoscopic pancreas function test (ePFT) can safely collect large volumes of pancreatic fluid that are potentially amenable to proteomic analyses using difference gel electrophoresis (DiGE) coupled with liquid chromatography-tandem mass spectrometry (LC-MS/MS). Pancreatic fluid was collected endoscopically using the ePFT method following secretin stimulation from three individuals with severe chronic pancreatitis and three chronic abdominal pain controls. The fluid was processed to minimize protein degradation and the protein profiles of each cohort, as determined by DiGE and LC-MS/MS, were compared. This DiGE-LC-MS/MS analysis reveals proteins that are differentially expressed in chronic pancreatitis compared to chronic abdominal pain controls. Proteins with higher abundance in pancreatic fluid from chronic pancreatitis individuals include: actin, desmoplankin, alpha-1-antitrypsin, SNC73, and serotransferrin. Those of relatively lower abundance include carboxypeptidase B, lipase, alpha-1-antichymotrypsin, alpha-2-macroglobulin, Arp2/3 subunit 4, glyceraldehyde-3-phosphate dehydrogenase, and protein disulfide isomerase. Endoscopic collection (ePFT) in tandem with DiGE-LC-MS/MS is a suitable approach for pancreatic fluid proteome analysis, however, further optimization of our protocol, as outlined herein, may improve proteome coverage in future analyses. PMID:21792986

  10. Psychosocial differences associated with body weight among female adolescents: the importance of body image.

    Science.gov (United States)

    Pesa, J A; Syre, T R; Jones, E

    2000-05-01

    To determine whether overweight female adolescents differ from normal and underweight female adolescents with respect to a set of psychosocial factors, while controlling for body image. Female participants of the National Longitudinal Study of Adolescent Health (n = 3197) were selected for analysis. Multivariate Analysis of Variance (MANOVA) was used to test whether overweight subjects differed from normal and underweight subjects with respect to measures of depression, self-esteem, trouble in school, school connectedness, family connectedness, sense of community, autonomy, protective factors, and grades. Stepdown F-tests and discriminant function coefficients provided information regarding the strength of specific factors in contributing to overall differences. MANOVA revealed significant differences between groups on the combined set of psychosocial factors. Self-esteem defined the difference in a positive direction while grades defined the difference inversely. When controlling for body image, multidimensional group differences were still evident; however, self-esteem was no longer a significant contributing variable. While overweight female adolescents seem to suffer from low self-esteem, it may be explained by body image. Efforts should be directed toward encouraging and supporting healthy eating patterns and physical activity while encouraging students to recognize personal strengths not related to physique.

  11. Different minimally important clinical difference (MCID) scores lead to different clinical prediction rules for the Oswestry disability index for the same sample of patients.

    Science.gov (United States)

    Schwind, Julie; Learman, Kenneth; O'Halloran, Bryan; Showalter, Christopher; Cook, Chad

    2013-05-01

    Minimal clinically important difference (MCID) scores for outcome measures are frequently used evidence-based guides to gage meaningful changes. There are numerous outcome instruments used for analyzing pain, disability, and dysfunction of the low back; perhaps the most common of these is the Oswestry disability index (ODI). A single agreed-upon MCID score for the ODI has yet to be established. What is also unknown is whether selected baseline variables will be universal predictors regardless of the MCID used for a particular outcome measure. To explore the relationship between predictive models and the MCID cutpoint on the ODI. Data were collected from 16 outpatient physical therapy clinics in 10 states. Secondary database analysis using backward stepwise deletion logistic regression of data from a randomized controlled trial (RCT) to create prognostic clinical prediction rules (CPR). One hundred and forty-nine patients with low back pain (LBP) were enrolled in the RCT. All were treated with manual therapy, with a majority also receiving spine-strengthening exercises. The resultant predictive models were dependent upon the MCID used and baseline sample characteristics. All CPR were statistically significant (P < 001). All six MCID cutpoints used resulted in completely different significant predictor variables with no predictor significant across all models. The primary limitations include sub-optimal sample size and study design. There is extreme variability among predictive models created using different MCIDs on the ODI within the same patient population. Our findings highlight the instability of predictive modeling, as these models are significantly affected by population baseline characteristics along with the MCID used. Clinicians must be aware of the fragility of CPR prior to applying each in clinical practice.

  12. In vivo import of plastocyanin and a fusion protein into developmentally different plastids of transgenic plants

    NARCIS (Netherlands)

    Boer, Douwe de; Cremers, Fons; Teertstra, Renske; Smits, Lianne; Hille, Jacques; Smeekens, Sjef; Weisbeek, Peter

    1988-01-01

    Transgenic tomato plants that constitutively express a foreign plastocyanin gene were used to study protein transport in different tissues. Normally expression of endogenous plastocyanin genes in plants is restricted to photosynthetic tissues only, whereas this foreign plastocyanin protein is found

  13. The strategic importance of identifying knowledge-based and intangible assets for generating value, competitiveness and innovation in sub-Saharan Africa

    Directory of Open Access Journals (Sweden)

    Nicoline Ondari-Okemwa

    2011-01-01

    Full Text Available This article discusses the strategic importance of identifying intangible assets for creating value and enhancing competitiveness and innovation in science and technology in a knowledge economy with particular reference to the sub- Saharan Africa region. It has always been difficult to gather the prerequisite information to manage such assets and create value from them. The paper discusses the nature of intangible assets, the characteristics of a knowledge economy and the role of knowledge workers in a knowledge economy. The paper also discusses the importance of identifying intangible assets in relation to capturing the value of such assets, the transfer of intangible assets to other owners and the challenges of managing organizational intangible assets. Objectives of the article include: underscoring the strategic importance of identifying intangible assets in sub-Saharan Africa; examining the performance of intangible assets in a knowledge economy; how intangible assets may generate competitiveness, economic growth and innovation; and assess how knowledge workers are becoming a dominant factor in the knowledge economy. An extensive literature review was employed to collect data for this article. It is concluded in the article that organizations and governments in sub-Saharan Africa should look at knowledge-based assets as strategic resources, even though the traditional accounting systems may still be having problems in determining the exact book value of such assets. It is recommended that organizations and government departments in sub-Saharan Africa should implement a system of the reporting of the value of intangible organizational assets just like the reporting of the value of tangible assets; and that organizations in sub-Saharan Africa should use knowledge to produce “smart products and services” which command premium prices.

  14. The importance of studying sex differences in disease: The example of multiple sclerosis.

    Science.gov (United States)

    Golden, Lisa C; Voskuhl, Rhonda

    2017-01-02

    To date, scientific research has often focused on one sex, with assumptions that study of the other sex would yield similar results. However, many diseases affect males and females differently. The sex of a patient can affect the risk for both disease susceptibility and progression. Such differences can be brought to the laboratory bench to be investigated, potentially bringing new treatments back to the clinic. This method of research, known as a "bedside to bench to bedside" approach, has been applied to studying sex differences in multiple sclerosis (MS). Females have greater susceptibly to MS, while males have worse disease progression. These two characteristics of the disease are influenced by the immune system and the nervous system, respectively. Thus, sex differences in each system must be studied. Personalized medicine has been at the forefront of research recently, and studying sex differences in disease fits with this initiative. This review will discuss the known sex differences in MS and highlight how investigating them can lead to new insights and potential treatments for both men and women. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  15. Relative importance of different surface regions for thermal comfort in humans.

    Science.gov (United States)

    Nakamura, Mayumi; Yoda, Tamae; Crawshaw, Larry I; Kasuga, Momoko; Uchida, Yuki; Tokizawa, Ken; Nagashima, Kei; Kanosue, Kazuyuki

    2013-01-01

    In a previous study, we investigated the contribution of the surface of the face, chest, abdomen, and thigh to thermal comfort by applying local temperature stimulation during whole-body exposure to mild heat or cold. In hot conditions, humans prefer a cool face, and in cold they prefer a warm abdomen. In this study, we extended investigation of regional differences in thermal comfort to the neck, hand, soles, abdomen (Experiment 1), the upper and lower back, upper arm, and abdomen (Experiment 2). The methodology was similar to that used in the previous study. To compare the results of each experiment, we utilized the abdomen as the reference area in these experiments. Thermal comfort feelings were not particularly strong for the limbs and extremities, in spite of the fact that changes in skin temperature induced by local temperature stimulation of the limbs and extremities were always larger than changes that were induced in the more proximal body parts. For the trunk areas, a significant difference in thermal comfort was not observed among the abdomen, and upper and lower back. An exception involved local cooling during whole-body mild cold exposure, wherein the most dominant preference was for a warmer temperature of the abdomen. As for the neck and abdomen, clear differences were observed during local cooling, while no significant difference was observed during local warming. We combined the results for the current and the previous study, and characterized regional differences in thermal comfort and thermal preference for the whole-body surface.

  16. Modeling vehicle emissions in different types of Chinese cities: importance of vehicle fleet and local features.

    Science.gov (United States)

    Huo, Hong; Zhang, Qiang; He, Kebin; Yao, Zhiliang; Wang, Xintong; Zheng, Bo; Streets, David G; Wang, Qidong; Ding, Yan

    2011-10-01

    We propose a method to simulate vehicle emissions in Chinese cities of different sizes and development stages. Twenty two cities are examined in this study. The target year is 2007. Among the cities, the vehicle emission factors were remarkably different (the highest is 50-90% higher than the lowest) owing to their distinct local features and vehicle technology levels, and the major contributors to total vehicle emissions were also different. A substantial increase in vehicle emissions is foreseeable unless stronger measures are implemented because the benefit of current policies can be quickly offset by the vehicle growth. Major efforts should be focused on all cities, especially developing cities where the requirements are lenient. This work aims a better understanding of vehicle emissions in all types of Chinese cities. The proposed method could benefit national emission inventory studies in improving accuracy and help in designing national and local policies for vehicle emission control. Copyright © 2011 Elsevier Ltd. All rights reserved.

  17. A view of dyslexia in context: implications for understanding differences in essay writing experience amongst higher education students identified as dyslexic.

    Science.gov (United States)

    Carter, Christine; Sellman, Edward

    2013-08-01

    This article applies socio-cultural theories to explore how differences in essay writing experience are constituted for a group of students identified as dyslexic. It reports on a qualitative study with eleven student writers, seven of whom are formally identified as dyslexic, from the schools of archaeology, history and philosophy in a 'traditional' UK university. Semi-structured interviews before, during and after writing a coursework essay revealed well-documented dyslexia-related difficulties and also strong differences in how writing was experienced. The multiple and fluid dimensions that construct these differences suggest the importance of position within the context, previous and developing writing and learning experience, and metacognitive, meta-affective and metalinguistic awareness. They also suggest tensions between specialist and inclusive policies in relation to writing pedagogy for students identified as dyslexic. Copyright © 2013 John Wiley & Sons, Ltd.

  18. Determining Minimal Clinically Important Differences in Japanese Cedar/Cypress Pollinosis Patients

    Directory of Open Access Journals (Sweden)

    Takaya Higaki

    2013-01-01

    Conclusions: For T5SS in the diary, T6SS and QOL in JRQLQ, unit differences of 1.5 (0.3 per item, 3.6 (0.6 and 8.2 (0.5, respectively, were considered clinically meaningful by JCCP patients. The MCID for symptoms recorded in the diary was stable irrespective of the dispersed pollen level.

  19. Meta-analysis on continuous outcomes in minimal important difference units

    DEFF Research Database (Denmark)

    Shrier, Ian; Christensen, Robin; Juhl, Carsten

    2016-01-01

    on the values of rho and coefficient of variation of the MID (CoVMID), estimates of treatment effect and P-values between an approach considering the MID as a constant vs. as a random variable may differ appreciably. Using our data sets, we provide examples of the potential magnitude. When rho = 0.5 and Co...

  20. Identifying obstacles and ranking common biological control research priorities for Europe to manage most economically important pests in arable, vegetable and perennial crops.

    Science.gov (United States)

    Lamichhane, Jay Ram; Bischoff-Schaefer, Monika; Bluemel, Sylvia; Dachbrodt-Saaydeh, Silke; Dreux, Laure; Jansen, Jean-Pierre; Kiss, Jozsef; Köhl, Jürgen; Kudsk, Per; Malausa, Thibaut; Messéan, Antoine; Nicot, Philippe C; Ricci, Pierre; Thibierge, Jérôme; Villeneuve, François

    2017-01-01

    EU agriculture is currently in transition from conventional crop protection to integrated pest management (IPM). Because biocontrol is a key component of IPM, many European countries recently have intensified their national efforts on biocontrol research and innovation (R&I), although such initiatives are often fragmented. The operational outputs of national efforts would benefit from closer collaboration among stakeholders via transnationally coordinated approaches, as most economically important pests are similar across Europe. This paper proposes a common European framework on biocontrol R&I. It identifies generic R&I bottlenecks and needs as well as priorities for three crop types (arable, vegetable and perennial crops). The existing gap between the market offers of biocontrol solutions and the demand of growers, the lengthy and expensive registration process for biocontrol solutions and their varying effectiveness due to variable climatic conditions and site-specific factors across Europe are key obstacles hindering the development and adoption of biocontrol solutions in Europe. Considering arable, vegetable and perennial crops, a dozen common target pests are identified for each type of crop and ranked by order of importance at European level. Such a ranked list indicates numerous topics on which future joint transnational efforts would be justified. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  1. Air pollution, asthma and allergy - the importance of different types of particles

    International Nuclear Information System (INIS)

    Ormstad, Heidi; Loevik, Martinus

    2002-01-01

    Particulate air pollution has been much discussed in Norway during the last few years. Coarse particles from asphalt are likely to have quite different properties than the far smaller particles from diesel exhaust. On the basis of data from the literature and our own research, we discuss the health problem of different types of particles with a focus on allergy and respiratory symptoms. Diesel exhaust particles have well-documented adverse effects in relation to allergic airway disease. They increase symptoms load in already allergic individuals and also seem to contribute to the increased prevalence of allergy. PM 10 is today measured on the basis of weight, not on number. Diesel exhaust particles are much smaller than road surface particles; hence PM 10 measurements reflect road surface dust pollution more than exhaust particles. Focus should now be given to diesel exhaust particles in order to reduce the adverse health effects of particulate air pollution in Norwegian cities. (author)

  2. The relative importance of different types of rewards for employee motivation and commitment in South Africa

    OpenAIRE

    Aleeshah Nujjoo; Ines Meyer

    2012-01-01

    Orientation: Employees’ perceptions of rewards are related to their affective commitment and intrinsic motivation, which have been associated with staff turnover.Research purpose: The study sought to establish the relationship between intrinsic and different extrinsic rewards with intrinsic motivation and affective commitment.Motivation for the study: South African organisations are grappling with employee retention. Literature shows that employees who are more motivated and committed to ...

  3. The Importance of Differing Types of Io Volcanic Activity for the Jupiter Magnetosphere

    Science.gov (United States)

    Howell, R. R.

    2016-12-01

    The Jupiter magnetosphere is populated largely by sulfur and oxygen ultimately derived from the volcanoes on Io and correlations have been detected between changes in volcanic activity and the magnetosphere. However different types of volcanic activity on Io vary widely in the amount and composition of the gasses they release. For example while Loki is often the brightest volcanic hotspot in the infrared (and therefore most easily monitored from earth) it appears to release a comparatively small amount of gas compared to Prometheus type plumes and the giant plumes such as Pele. The dominant volatile released at most sites is sulfur dioxide but giant plumes such as Pele appear to contain significantly fractions of S2 gas. The amounts and type of dust produced may also differ. Finally, the way material is buffered in Io's surface and atmosphere before escaping to the magnetosphere is also uncertain. A better understanding of the connection between volcanic activity and the magnetosphere will require studying not just correlations between broad measures of activity but rather specific indices of different types of activity. Observations of possible storage buffers such as the atmosphere, as are now becoming possible with ALMA, will also be essential.

  4. Importance of isovector effects in reproducing neutron total cross section differences in the W isotopes

    International Nuclear Information System (INIS)

    Dietrich, F.S.; Anderson, J.D.; Bauer, R.W.; Grimes, S.M.; Finlay, R.W.; Abfalterer, W.P.; Bateman, F.B.; Haight, R.C.; Morgan, G.L.; Bauge, E.; Delaroche, J.-P.; Romain, P.

    2003-01-01

    Cross section differences among the isotopes 182,184,186 W have been measured as a part of a study of total cross sections in the 5-560 MeV energy range. These difference measurements show oscillations up to 150 mb between 5 and 100 MeV. Calculations with spherical and deformed phenomenological optical potentials employing standard radial and isospin dependences show much smaller oscillations than the experimental data. In a simple Ramsauer model, this discrepancy can be traced to a cancellation between radial and isospin effects. Understanding this problem requires a more detailed model that incorporates a realistic description of the neutron and proton density distributions. This has been done with the results of Hartree-Fock-Bogoliubov calculations using the Gogny force, together with a microscopic folding model employing a modification of the Jeukenne, Lejeune, and Mahaux potential as an effective interaction. This treatment yields a satisfactory interpretation of the observed total cross section differences up to 200 MeV. The calculations have been extended above that energy with a folding model based on an empirical effective interaction

  5. An interactive algorithm for identifying multiattribute measurable value functions based on finite-order independence of structural difference

    International Nuclear Information System (INIS)

    Tamura, Hiroyuki; Hikita, Shiro

    1985-01-01

    In this paper, we develop an interactive algorithm for identifying multiattribute measurable value functions based on the concept of finite-order independence of structural difference. This concept includes Dyer and Sarin's weak difference independence as special cases. The algorithm developed is composed of four major parts: 1) formulation of the problem 2) assessment of normalized conditional value functions and structural difference functions 3) assessment of corner values 4) assessment of the order of independence of structural difference and selection of the model. A hypothetical numerical example of a trade-off analysis for siting a nuclear power plant is included. (author)

  6. Super champions, champions and almosts: Important differences and commonalities on the rocky road

    Directory of Open Access Journals (Sweden)

    Dave eCollins

    2016-01-01

    Full Text Available The real-world experiences of young athletes follow a non-linear and dynamic trajectory and there is growing recognition that facing and overcoming a degree of challenge is desirable for aspiring elites and as such, should be recognized and employed. However, there are some misunderstandings of this talent needs trauma perspective with some research focusing excessively or incorrectly on the incidence of life and sport challenge as a feature of effective talent development. The objective of the study was to examine what factors associated with such trauma experiences may or may not discriminate between high, medium and low achievers in sport, classified as super-champions, champions or almosts. A series of retrospective interviews were used with matched triads (i.e., super-champions, champions or almosts of performers (N = 54 from different sports. Data collection was organized in three phases. In the first phase, a graphic time line of each performer’s career was developed. The second phase explored the specific issues highlighted by each participant in a chronological sequence. The third phase was a retrospective reflection on traumatic motivators, coach/significant other inputs and psychological challenges experienced and skills employed. Data suggested qualitative differences between categories of performers, relating to several perceptual and experiential features of their development. No evidence was found for the necessity of major trauma as a feature of development. There was a lack of discrimination across categories of performers associated with the incidence of trauma and, more particularly, life or non-sport trauma. These findings suggest that differences between levels of adult achievement relate more to what performers bring to the challenges than what they experience. A periodized and progressive set of challenge, preceded and associated with specific skill development, would seem to offer the best pathway to success for the

  7. Urban-rural differences in physical activity in Belgian adults and the importance of psychosocial factors.

    Science.gov (United States)

    Dyck, Delfien Van; Cardon, Greet; Deforche, Benedicte; De Bourdeaudhuij, Ilse

    2011-02-01

    Recent research in urban planning and public health has drawn attention to the associations between urban form and physical activity in adults. Because little is known on the urban-rural differences in physical activity, the main aims of the present study were to examine differences in physical activity between urban and rural adults and to investigate the moderating effects of the physical environment on the relationship between psychosocial factors and physical activity. In Flanders, Belgium, five rural and five urban neighborhoods were selected. A sample of 350 adults (20-65 years of age; 35 adults per neighborhood) participated in the study. Participants wore a pedometer for 7 days, and self-reported physical activity and psychosocial data were also collected. Results showed that urban adults took more steps/day and reported more walking and cycling for transport in the neighborhood, more recreational walking in the neighborhood, and more walking for transportation outside the neighborhood than rural adults. Rural adults reported more recreational cycling in the neighborhoods. The physical environment was a significant moderator of the associations between several psychosocial factors (modeling from family, self-efficacy, and perceived barriers) and physical activity. In rural participants, adults with psychosocial scores above average were more physically active, whereas there were no differences in physical activity according to psychosocial factors in urban participants. These results are promising and plead for the development of multidimensional interventions, targeting specific population subgroups. In rural environments, where changing the environment would be a very challenging task, interventions focusing on modifiable psychosocial constructs could possibly be effective.

  8. Our Environment Shapes Us: The Importance of Environment and Sex Differences in Regulation of Autoantibody Production

    Directory of Open Access Journals (Sweden)

    Michael Edwards

    2018-03-01

    Full Text Available Consequential differences exist between the male and female immune systems’ ability to respond to pathogens, environmental insults or self-antigens, and subsequent effects on immunoregulation. In general, females when compared with their male counterparts, respond to pathogenic stimuli and vaccines more robustly, with heightened production of antibodies, pro-inflammatory cytokines, and chemokines. While the precise reasons for sex differences in immune response to different stimuli are not yet well understood, females are more resistant to infectious diseases and much more likely to develop autoimmune diseases. Intrinsic (i.e., sex hormones, sex chromosomes, etc. and extrinsic (microbiome composition, external triggers, and immune modulators factors appear to impact the overall outcome of immune responses between sexes. Evidence suggests that interactions between environmental contaminants [e.g., endocrine disrupting chemicals (EDCs] and host leukocytes affect the ability of the immune system to mount a response to exogenous and endogenous insults, and/or return to normal activity following clearance of the threat. Inherently, males and females have differential immune response to external triggers. In this review, we describe how environmental chemicals, including EDCs, may have sex differential influence on the outcome of immune responses through alterations in epigenetic status (such as modulation of microRNA expression, gene methylation, or histone modification status, direct and indirect activation of the estrogen receptors to drive hormonal effects, and differential modulation of microbial sensing and composition of host microbiota. Taken together, an intriguing question develops as to how an individual’s environment directly and indirectly contributes to an altered immune response, dysregulation of autoantibody production, and influence autoimmune disease development. Few studies exist utilizing well-controlled cohorts of both sexes

  9. Performance evaluation of the short-time objective intelligibility measure with different band importance functions

    DEFF Research Database (Denmark)

    Heidemann Andersen, Asger; de Haan, Jan Mark; Tan, Zheng-Hua

    performance measures: root-mean-squared-error, Pearson correlation, and Kendall rank correlation. The results show substantially improved performance when fitting and evaluating on the same dataset. However, this advantage does not necessarily subsist when fitting and evaluating on different datasets. When...... with a filter bank, 2) envelopes are extracted from each band, 3) the temporal correlation between clean and degraded envelopes is computed in short time segments, and 4) the correlation is averaged across time and frequency bands to obtain the final output. An unusual choice in the design of the STOI measure...

  10. The importance of plant-soil interactions for N mineralisation in different soil types

    Science.gov (United States)

    Murphy, Conor; Paterson, Eric; Baggs, Elizabeth; Morley, Nicholas; Wall, David; Schulte, Rogier

    2013-04-01

    The last hundred years has seen major advancements in our knowledge of nitrogen mineralisation in soil, but key drivers and controls remain poorly understood. Due to an increase in the global population there is a higher demand on food production. To accommodate this demand agriculture has increased its use of N based fertilizers, but these pose risks for water quality and GHG emissions as N can be lost through nitrate leaching, ammonia volatilization, and denitrification processes (Velthof, et al., 2009). Therefore, understanding the underlying processes that determine the soils ability to supply N to the plant is vital for effective optimisation of N-fertilisation with crop demand. Carbon rich compounds exuded from plant roots to the rhizosphere, which are utilized by the microbial biomass and support activities including nutrient transformations, may be a key unaccounted for driver of N mineralisation. The main aim of this study was to study the impact of root exudates on turnover of C and N in soil, as mediated by the microbial community. Two soil types, known to contrast in N-mineralisation capacity, were used to determine relationships between C inputs, organic matter mineralisation (priming effects) and N fluxes. 15N and 13C stable isotope approaches were used to quantify the importance of rhizosphere processes on C and N mineralisation. Gross nitrogen mineralisation was measured using 15N pool dilution. Total soil CO2 efflux was measured and 13C isotope partitioning was applied to quantify SOM turnover and microbial biomass respiration. Also, 13C was traced through the microbial biomass (chloroform fumigation) to separate pool-substitution effects (apparent priming) from altered microbial utilisation of soil organic matter (real priming effects). Addition of labile carbon resulted in an increase in N-mineralisation from soil organic matter in both soils. Concurrent with this there was an increase in microbial biomass size, indicating that labile C elicited

  11. Gender, Parenthood and Wage Differences: The Importance of Time-Consuming Job Characteristics.

    Science.gov (United States)

    Magnusson, Charlotta; Nermo, Magnus

    2017-01-01

    Using data from the Swedish Level of Living Survey (2000, 2010), we investigate how the gender wage gap varies with occupational prestige and family status and also examine the extent to which this gap is explained by time-consuming working conditions. In addition, we investigate whether there is an association between parenthood, job characteristics and wage (as differentiated by gender). The analyses indicate that there are gender differences regarding prestige-based pay-offs among parents that are partly explained by fathers' greater access to employment characterized by time-consuming conditions. Separate analyses for men and women demonstrate the presence of a marriage wage premium for both genders, although only men have a parenthood wage premium. This fatherhood premium is however only present in high-prestigious occupations. Compared with childless men, fathers are also more advantaged in terms of access to jobs with time-consuming working conditions, but the wage gap between fathers and childless men is not explained by differences in access to such working conditions.

  12. [Important differences between faculties of medicine. Implications for family and community medicine].

    Science.gov (United States)

    González Lopez-Valcarcel, Beatriz; Ortún, Vicente; Barber, Patricia; Harris, Jeffrey E

    2014-03-01

    To determine if there are significant differences between universities in the proclivity to choose Family and Community Medicine (FCM), given the constraints imposed by the number of choice. To test the hypothesis that the Schools of Medicine that have the FCM as a compulsory subject in the degree (3 of 27) had the highest preference for this specialty. Observational study on the data file of all the individuals taking the MIR examination between 2003 and 2011. Spain. All those who sat the examinations called by MIR 2003-2011. Position in the ranking of each candidate, elected position (specialty and center), post code of residence, sex, nationality and university in which they studied, and post code location for the residence chosen. The percentage electing FCM is highly correlated with the position in the ranking: 8% of graduates for the 'best' college, 46% for the worst. Very noticeable and consistent differences in the preparation for the MIR among the 27 medical schools. Ranking in the exam, female and foreigner, help predict the choice of FCM. The FCM compulsory curriculum from three universities does not seem to exert any influence. The convenient yardstick competition between the schools of medicine, FCM in their curriculum and the emphasis on the most attractive attributes of the specialty can contribute to the necessary renewal of FCM. Copyright © 2013 Elsevier España, S.L. All rights reserved.

  13. Sorption of phenanthrene and benzene on differently structural kerogen: important role of micropore-filling.

    Science.gov (United States)

    Zhang, Yulong; Ma, Xiaoxuan; Ran, Yong

    2014-02-01

    Shale was thermally treated to obtain a series of kerogen with varied maturation. Their chemical, structural and porous properties were related to the sorption and/or desorption behaviors of phenanthrene and benzene. As the treatment temperature increases, aliphatic and carbonyl carbon of the kerogen samples decrease, while their aromaticity and maturation increase. Meanwhile, the isothermal nonlinearity of phenanthrene and benzene increases whereas the sorption capacity and micropore adsorption volumes (Vo,d) initially increase and then decrease. The Vo,d of benzene is significantly correlated with, but higher than that of phenanthrene, suggesting similar micropore filling mechanism and molecular sieve effect. The benzene desorption exhibits hysteresis, which is related to the pore deformation of the kerogen and the entrapment of solute in the kerogen matrix. The Vo,d of phenanthrene and benzene on the kerogen samples accounts for 23-46% and 36-65% of the maximum sorption volumes, respectively, displaying the importance of the micropore filling. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Different indicators of socioeconomic status and their relative importance as determinants of health in old age.

    Science.gov (United States)

    Darin-Mattsson, Alexander; Fors, Stefan; Kåreholt, Ingemar

    2017-09-26

    Socioeconomic status has been operationalised in a variety of ways, most commonly as education, social class, or income. In this study, we also use occupational complexity and a SES-index as alternative measures of socioeconomic status. Studies show that in analyses of health inequalities in the general population, the choice of indicators influence the magnitude of the observed inequalities. Less is known about the influence of indicator choice in studies of older adults. The aim of this study is twofold: i) to analyse the impact of the choice of socioeconomic status indicator on the observed health inequalities among older adults, ii) to explore whether different indicators of socioeconomic status are independently associated with health in old age. We combined data from two nationally representative Swedish surveys, providing more than 20 years of follow-up. Average marginal effects were estimated to compare the association between the five indicators of SES, and three late-life health outcomes: mobility limitations, limitations in activities of daily living (ADL), and psychological distress. All socioeconomic status indicators were associated with late-life health; there were only minor differences in the effect sizes. Income was most strongly associated to all indicators of late-life health, the associations remained statistically significant when adjusting for the other indicators. In the fully adjusted models, education contributed to the model fits with 0-3% (depending on the outcome), social class with 0-1%, occupational complexity with 1-8%, and income with 3-18%. Our results indicate overlapping properties between socioeconomic status indicators in relation to late-life health. However, income is associated to late-life health independently of all other variables. Moreover, income did not perform substantially worse than the composite SES-index in capturing health variation. Thus, if the primary objective of including an indicator of socioeconomic

  15. Methods and Measures: Growth Mixture Modeling--A Method for Identifying Differences in Longitudinal Change among Unobserved Groups

    Science.gov (United States)

    Ram, Nilam; Grimm, Kevin J.

    2009-01-01

    Growth mixture modeling (GMM) is a method for identifying multiple unobserved sub-populations, describing longitudinal change within each unobserved sub-population, and examining differences in change among unobserved sub-populations. We provide a practical primer that may be useful for researchers beginning to incorporate GMM analysis into their…

  16. Using benchmarking to identify inter-centre differences in persistent ductus arteriosus treatment: can we improve outcome?

    NARCIS (Netherlands)

    Jansen, E.J.; Dijkman, K.P.; Lingen, R.A. van; Vries, W.B. de; Vijlbrief, D.C.; Boode, W.P. de; Andriessen, P.

    2017-01-01

    OBJECTIVE: The aim of this study was to identify inter-centre differences in persistent ductus arteriosus treatment and their related outcomes. Materials and methods We carried out a retrospective, multicentre study including infants between 24+0 and 27+6 weeks of gestation in the period between

  17. Using benchmarking to identify inter-centre differences in persistent ductus arteriosus treatment : can we improve outcome?

    NARCIS (Netherlands)

    Jansen, Esther J. S.; Dijkman, Koen P.; Van Lingen, Richard A.; de Vries, Willem B; Vijlbrief, Daniel C; de Boode, Willem P; Andriessen, Peter

    2017-01-01

    Objective: The aim of this study was to identify inter-centre differences in persistent ductus arteriosus treatment and their related outcomes. Materials and methods: We carried out a retrospective, multicentre study including infants between 24+0 and 27+6 weeks of gestation in the period between

  18. Studies on comparative immune response of broiler chicken to different imported live infectious bursal disease vaccines

    International Nuclear Information System (INIS)

    Shoukat, T.M.; Sheikh, M.A.; Akhtar, S.S.; Hassan, S.S.

    2007-01-01

    In the present study the comparative efficacy of different vaccines was carried out. These include Gumbokal. Vaccine, IBA-Vac and IBD, Vac. The vaccines were evaluated on the basis of immure response developed by using indirect haemaggtutination (IHA) test in all the birds the presence of material antibodies on day first of their age by IHA. The titre varied from 1:4 to 1:6. All the vaccinated group and control group was examined for their immune response on the 7th and then gradual increase in titre occurred on day 15th and highest values were observed on 30th day post vaccination. All the three vaccines gave identical results as far as their efficacy against IBDV infection was concerned. (author)

  19. Experimental assessment of the importance of amino acid positions identified by an entropy-based correlation analysis of multiple-sequence alignments.

    Science.gov (United States)

    Dietrich, Susanne; Borst, Nadine; Schlee, Sandra; Schneider, Daniel; Janda, Jan-Oliver; Sterner, Reinhard; Merkl, Rainer

    2012-07-17

    The analysis of a multiple-sequence alignment (MSA) with correlation methods identifies pairs of residue positions whose occupation with amino acids changes in a concerted manner. It is plausible to assume that positions that are part of many such correlation pairs are important for protein function or stability. We have used the algorithm H2r to identify positions k in the MSAs of the enzymes anthranilate phosphoribosyl transferase (AnPRT) and indole-3-glycerol phosphate synthase (IGPS) that show a high conn(k) value, i.e., a large number of significant correlations in which k is involved. The importance of the identified residues was experimentally validated by performing mutagenesis studies with sAnPRT and sIGPS from the archaeon Sulfolobus solfataricus. For sAnPRT, five H2r mutant proteins were generated by replacing nonconserved residues with alanine or the prevalent residue of the MSA. As a control, five residues with conn(k) values of zero were chosen randomly and replaced with alanine. The catalytic activities and conformational stabilities of the H2r and control mutant proteins were analyzed by steady-state enzyme kinetics and thermal unfolding studies. Compared to wild-type sAnPRT, the catalytic efficiencies (k(cat)/K(M)) were largely unaltered. In contrast, the apparent thermal unfolding temperature (T(M)(app)) was lowered in most proteins. Remarkably, the strongest observed destabilization (ΔT(M)(app) = 14 °C) was caused by the V284A exchange, which pertains to the position with the highest correlation signal [conn(k) = 11]. For sIGPS, six H2r mutant and four control proteins with alanine exchanges were generated and characterized. The k(cat)/K(M) values of four H2r mutant proteins were reduced between 13- and 120-fold, and their T(M)(app) values were decreased by up to 5 °C. For the sIGPS control proteins, the observed activity and stability decreases were much less severe. Our findings demonstrate that positions with high conn(k) values have an

  20. Demonstrating the importance of phytochemical profile of different teas on antioxidant and anti-inflammatory capacities

    Directory of Open Access Journals (Sweden)

    Xiu-Min Chen

    2017-06-01

    Full Text Available Background:Indigenous or traditional aqueous plant extractsare commonly used by nearly80% of the world’s population for primary health needs.Accordingly,teas such as Camellia sinensisand herbal teaswere characterized fortheirphytochemical content and potential to offerspecific bioactivities that could benefit human health by mitigating oxidative stress andinflammation.Methods:In the present study, we comparedthe phytochemical profiles, antioxidant,and anti-inflammatory activities of four Camellia sinensisteas,including white, green, oolong, black, andtwo herbal teassuch as Rooibos and Yerba mate,which are producedand consumed by different populationsworldwide. We alsostudied the impact oftheRooibos tea on the production of inflammatory mediators, including nitric oxide(NO, inducible nitric oxide synthase (iNOS, cyclooxygenase 2 (COX-2,and different cytokinesin Raw 264.7 cells, bothwith or without interferon γ (IFN-γand lipopolysaccharide (LPSstimulation.Results:White tea hadthe highest total phenolic content(TPCand antioxidantactivity among the six teasthat wereexamined. In contrast, Rooibos tea hadthe lowest TPC,antioxidant,and anti-inflammatory activities. Yerba mate tea exhibitedthe greatest potential to inhibit NO production in IFN-γ and LPS-induced Raw 264.7 cells.The anti-inflammatory activity of teas was discoveredto be correlated withantioxidant activity and phytochemical composition.Among thesix teasexamined, only Rooibos tea was found to induce NO in unstimulated Raw 264.7 cells. Under basal conditions, Rooibos tea inducedinterleukin-1α (IL-1α, IL-1β, IL-6, IL-10, granulocyte-colony stimulating factor (G-CSF, granulocyte macrophage colony-stimulating factor (GM-CSF,tumor necrosis factor-alpha (TNF-α,iNOS,and COX-2 production. However, Rooibos tea alsodemonstrateda dose-dependent inhibition of IL-6, IL-10, iNOS,and COX-2 expression in stimulated Raw 264.7 cells. Although a high concentration of Rooibos tea was effective in

  1. The Academic Diligence Task (ADT): Assessing Individual Differences in Effort on Tedious but Important Schoolwork.

    Science.gov (United States)

    Galla, Brian M; Plummer, Benjamin D; White, Rachel E; Meketon, David; D'Mello, Sidney K; Duckworth, Angela L

    2014-10-01

    The current study reports on the development and validation of the Academic Diligence Task (ADT), designed to assess the tendency to expend effort on academic tasks which are tedious in the moment but valued in the long-term. In this novel online task, students allocate their time between solving simple math problems (framed as beneficial for problem solving skills) and, alternatively, playing Tetris or watching entertaining videos. Using a large sample of high school seniors ( N = 921), the ADT demonstrated convergent validity with self-report ratings of Big Five conscientiousness and its facets, self-control and grit, as well as discriminant validity from theoretically unrelated constructs, such as Big Five extraversion, openness, and emotional stability, test anxiety, life satisfaction, and positive and negative affect. The ADT also demonstrated incremental predictive validity for objectively measured GPA, standardized math and reading achievement test scores, high school graduation, and college enrollment, over and beyond demographics and intelligence. Collectively, findings suggest the feasibility of online behavioral measures to assess noncognitive individual differences that predict academic outcomes.

  2. Antifungal activity of different neem leaf extracts and the nimonol against some important human pathogens

    Directory of Open Access Journals (Sweden)

    D.A Mahmoud

    2011-09-01

    Full Text Available This study was conducted to evaluate the effect of aqueous, ethanolic and ethyl acetate extracts from neem leaves on growth of some human pathogens (Aspergillus flavus, Aspergillus fumigatus, Aspergillus niger, Aspergillus terreus, Candida albicans and Microsporum gypseum in vitro. Different concentrations (5, 10, 15 and 20% prepared from these extracts inhibited the growth of the test pathogens and the effect gradually increased with concentration. The 20% ethyl acetate extract gave the strongest inhibition compared with the activity obtained by the same concentration of the other extracts. High Performance Liquid Chromatography (HPLC analysis of ethyl acetate extract showed the presence of a main component (nimonol which was purified and chemically confirmed by Nuclear Magnetic Resonance (NMR spectroscopic analysis. The 20% ethyl acetate extract lost a part of its antifungal effect after pooling out the nimonol and this loss in activity was variable on test pathogens. The purified nimonol as a separate compound did not show any antifungal activity when assayed against all the six fungal pathogens.

  3. Multinomial Response Models, for Modeling and Determining Important Factors in Different Contraceptive Methods in Women

    Directory of Open Access Journals (Sweden)

    E Haji Nejad

    2001-06-01

    Full Text Available Difference aspects of multinomial statistical modelings and its classifications has been studied so far. In these type of problems Y is the qualitative random variable with T possible states which are considered as classifications. The goal is prediction of Y based on a random Vector X ? IR^m. Many methods for analyzing these problems were considered. One of the modern and general method of classification is Classification and Regression Trees (CART. Another method is recursive partitioning techniques which has a strange relationship with nonparametric regression. Classical discriminant analysis is a standard method for analyzing these type of data. Flexible discriminant analysis method which is a combination of nonparametric regression and discriminant analysis and classification using spline that includes least square regression and additive cubic splines. Neural network is an advanced statistical method for analyzing these types of data. In this paper properties of multinomial logistics regression were investigated and this method was used for modeling effective factors in selecting contraceptive methods in Ghom province for married women age 15-49. The response variable has a tetranomial distibution. The levels of this variable are: nothing, pills, traditional and a collection of other contraceptive methods. A collection of significant independent variables were: place, age of women, education, history of pregnancy and family size. Menstruation age and age at marriage were not statistically significant.

  4. Different types of inks having certain medicolegal importance: Deciphering the faded and physically erased handwriting

    Directory of Open Access Journals (Sweden)

    Manal Abd-ElAziz Abd-ElZaher

    2014-06-01

    Full Text Available Disappearing ink is a type of ink which could be used to forge documents as it will fade away without any trace within 40–65 h. Erasable ink is another type of ink easily removed by certain rubbers incorporated in each pen. Both types of inks were applied separately on different types of papers (checks, standard white foolscap, and plain white A4 paper. For vanishing ink, it was observed visually in the first 6 h and then every 6 h. It was found that the vanishing ink disappeared completely within 2 h on checks, 36 h on standard white foolscap paper, and 40 h on plain white A4 paper. For erasable ink, the written strokes were manipulated manually using the incorporated eraser. Deciphering the faded writing failed by the conventional methods, but oblique light can reveal the indentation marks. The faded writing became visible when treated with weak alkaline (NaOH solutions. Erasable ink was deciphered with the aid of infra-red radiation combined with VSC-6000 as clear white traces against red fluorescence. It was concluded that the use of a weak (NaOH solution is an effective method for revealing the faded writing, and the infra-red illumination is also effective.

  5. Individualization of psychological training and its importance at different stages of many years’ perfection in tennis

    Directory of Open Access Journals (Sweden)

    N.L. Vysochina

    2015-08-01

    Full Text Available Purpose: to determine significance of individualized approach during psychological training at different stages of many years’ perfection in tennis. The tasks of the research were studying of place and role of psychological component in general system of tennis players’ sport training as well as determination of specificities of individualized approach during 14-15 years old and elite tennis players’ psychological training. Material: In the research 24 experts, coaches of combined teams and clubs, elite tennis players took part. Results: Role of psychological training in general system of many years’ perfection has been determined. We also found out that individualization of psychological training in modern tennis is not paid sufficient attention to at present. Most of the questioned respondents pointed, that such training is conducted mainly with elite sportsmen (42%. Only 14% noted that individual psychological training is carried out at basic stages of many years’ perfection. Conclusions: Principle of individualization is a determining one in the course of sportsmen’s training at stages of many years’ perfection. About 86% of experts stressed on significance of application of individualized approach in work with tennis players. Consideration of tennis players’ individual features during psychological training is a compulsory matter in increasing of effectiveness of sportsmen’s training and competition functioning.

  6. Individualism: a valid and important dimension of cultural differences between nations.

    Science.gov (United States)

    Schimmack, Ulrich; Oishi, Shigehiro; Diener, Ed

    2005-01-01

    Oyserman, Coon, and Kemmelmeier's (2002) meta-analysis suggested problems in the measurement of individualism and collectivism. Studies using Hofstede's individualism scores show little convergent validity with more recent measures of individualism and collectivism. We propose that the lack of convergent validity is due to national differences in response styles. Whereas Hofstede statistically controlled for response styles, Oyserman et al.'s meta-analysis relied on uncorrected ratings. Data from an international student survey demonstrated convergent validity between Hofstede's individualism dimension and horizontal individualism when response styles were statistically controlled, whereas uncorrected scores correlated highly with the individualism scores in Oyserman et al.'s meta-analysis. Uncorrected horizontal individualism scores and meta-analytic individualism scores did not correlate significantly with nations' development, whereas corrected horizontal individualism scores and Hofstede's individualism dimension were significantly correlated with development. This pattern of results suggests that individualism is a valid construct for cross-cultural comparisons, but that the measurement of this construct needs improvement.

  7. High throughput phenotypic selection of Mycobacterium tuberculosis mutants with impaired resistance to reactive oxygen species identifies genes important for intracellular growth.

    Directory of Open Access Journals (Sweden)

    Olga Mestre

    Full Text Available Mycobacterium tuberculosis has the remarkable capacity to survive within the hostile environment of the macrophage, and to resist potent antibacterial molecules such as reactive oxygen species (ROS. Thus, understanding mycobacterial resistance mechanisms against ROS may contribute to the development of new anti-tuberculosis therapies. Here we identified genes involved in such mechanisms by screening a high-density transposon mutant library, and we show that several of them are involved in the intracellular lifestyle of the pathogen. Many of these genes were found to play a part in cell envelope functions, further strengthening the important role of the mycobacterial cell envelope in protection against aggressions such as the ones caused by ROS inside host cells.

  8. Global metabolic analyses identify key differences in metabolite levels between polymyxin-susceptible and polymyxin-resistant Acinetobacter baumannii.

    Science.gov (United States)

    Maifiah, Mohd Hafidz Mahamad; Cheah, Soon-Ee; Johnson, Matthew D; Han, Mei-Ling; Boyce, John D; Thamlikitkul, Visanu; Forrest, Alan; Kaye, Keith S; Hertzog, Paul; Purcell, Anthony W; Song, Jiangning; Velkov, Tony; Creek, Darren J; Li, Jian

    2016-02-29

    Multidrug-resistant Acinetobacter baumannii presents a global medical crisis and polymyxins are used as the last-line therapy. This study aimed to identify metabolic differences between polymyxin-susceptible and polymyxin-resistant A. baumannii using untargeted metabolomics. The metabolome of each A. baumannii strain was measured using liquid chromatography-mass spectrometry. Multivariate and univariate statistics and pathway analyses were employed to elucidate metabolic differences between the polymyxin-susceptible and -resistant A. baumannii strains. Significant differences were identified between the metabolic profiles of the polymyxin-susceptible and -resistant A. baumannii strains. The lipopolysaccharide (LPS) deficient, polymyxin-resistant 19606R showed perturbation in specific amino acid and carbohydrate metabolites, particularly pentose phosphate pathway (PPP) and tricarboxylic acid (TCA) cycle intermediates. Levels of nucleotides were lower in the LPS-deficient 19606R. Furthermore, 19606R exhibited a shift in its glycerophospholipid profile towards increased abundance of short-chain lipids compared to the parent polymyxin-susceptible ATCC 19606. In contrast, in a pair of clinical isolates 03-149.1 (polymyxin-susceptible) and 03-149.2 (polymyxin-resistant, due to modification of lipid A), minor metabolic differences were identified. Notably, peptidoglycan biosynthesis metabolites were significantly depleted in both of the aforementioned polymyxin-resistant strains. This is the first comparative untargeted metabolomics study to show substantial differences in the metabolic profiles of the polymyxin-susceptible and -resistant A. baumannii.

  9. Identifying most important skills for PhD students in Food Science and Technology: a comparison between industry and academic stakeholders

    Directory of Open Access Journals (Sweden)

    Chelo González-Martínez

    2015-10-01

    Full Text Available Nowadays, there is an increasing need of new skills for PhD students to face the future labour market prospects. PhD graduates must have qualities attractive not only in academia but also outside, in both manufacture and service-oriented enterprises, in small innovative companies, and in the civil services and public administration, among others. To know what the needs of these future employees are, is of great importance to be able to improve their personal and academic formation. The aim of this work was, in the framework of the EC-funded ISEKI_Food 4 network, to evaluate the most desirable specific and soft skills that PhD students should acquire by the end of their doctoral studies. To this aim, several surveys were conducted and sent to the different stakeholders (academia and food industry partners in order to collect the information needed. Results showed that competences related to research skills and techniques, research management, personal effectiveness and communication skills were considered to be the most valuable skills to be acquired by our PhD students to meet the future needs of the labour market.  The importance of these skills was appreciated differently, depending on the stakeholder. To sum up, some recommendations to integrate such valuable skills into the curricula of the PhD student are given.

  10. Onset Dynamics of Action Potentials in Rat Neocortical Neurons and Identified Snail Neurons: Quantification of the Difference

    OpenAIRE

    Volgushev, Maxim; Malyshev, Aleksey; Balaban, Pavel; Chistiakova, Marina; Volgushev, Stanislav; Wolf, Fred

    2008-01-01

    The generation of action potentials (APs) is a key process in the operation of nerve cells and the communication between neurons. Action potentials in mammalian central neurons are characterized by an exceptionally fast onset dynamics, which differs from the typically slow and gradual onset dynamics seen in identified snail neurons. Here we describe a novel method of analysis which provides a quantitative measure of the onset dynamics of action potentials. This method captures the...

  11. Whole-exome sequencing of muscle-invasive bladder cancer identifies recurrent mutations of UNC5C and prognostic importance of DNA repair gene mutations on survival.

    Science.gov (United States)

    Yap, Kai Lee; Kiyotani, Kazuma; Tamura, Kenji; Antic, Tatjana; Jang, Miran; Montoya, Magdeline; Campanile, Alexa; Yew, Poh Yin; Ganshert, Cory; Fujioka, Tomoaki; Steinberg, Gary D; O'Donnell, Peter H; Nakamura, Yusuke

    2014-12-15

    Because of suboptimal outcomes in muscle-invasive bladder cancer even with multimodality therapy, determination of potential genetic drivers offers the possibility of improving therapeutic approaches and discovering novel prognostic indicators. Using pTN staging, we case-matched 81 patients with resected ≥pT2 bladder cancers for whom perioperative chemotherapy use and disease recurrence status were known. Whole-exome sequencing was conducted in 43 cases to identify recurrent somatic mutations and targeted sequencing of 10 genes selected from the initial screening in an additional 38 cases was completed. Mutational profiles along with clinicopathologic information were correlated with recurrence-free survival (RFS) in the patients. We identified recurrent novel somatic mutations in the gene UNC5C (9.9%), in addition to TP53 (40.7%), KDM6A (21.0%), and TSC1 (12.3%). Patients who were carriers of somatic mutations in DNA repair genes (one or more of ATM, ERCC2, FANCD2, PALB2, BRCA1, or BRCA2) had a higher overall number of somatic mutations (P = 0.011). Importantly, after a median follow-up of 40.4 months, carriers of somatic mutations (n = 25) in any of these six DNA repair genes had significantly enhanced RFS compared with noncarriers [median, 32.4 vs. 14.8 months; hazard ratio of 0.46, 95% confidence interval (CI), 0.22-0.98; P = 0.0435], after adjustment for pathologic pTN staging and independent of adjuvant chemotherapy usage. Better prognostic outcomes of individuals carrying somatic mutations in DNA repair genes suggest these mutations as favorable prognostic events in muscle-invasive bladder cancer. Additional mechanistic investigation into the previously undiscovered role of UNC5C in bladder cancer is warranted. ©2014 American Association for Cancer Research.

  12. A Comparison of Athletic Movement Among Talent-Identified Juniors From Different Football Codes in Australia: Implications for Talent Development.

    Science.gov (United States)

    Woods, Carl T; Keller, Brad S; McKeown, Ian; Robertson, Sam

    2016-09-01

    Woods, CT, Keller, BS, McKeown, I, and Robertson, S. A comparison of athletic movement among talent-identified juniors from different football codes in Australia: implications for talent development. J Strength Cond Res 30(9): 2440-2445, 2016-This study aimed to compare the athletic movement skill of talent-identified (TID) junior Australian Rules football (ARF) and soccer players. The athletic movement skill of 17 TID junior ARF players (17.5-18.3 years) was compared against 17 TID junior soccer players (17.9-18.7 years). Players in both groups were members of an elite junior talent development program within their respective football codes. All players performed an athletic movement assessment that included an overhead squat, double lunge, single-leg Romanian deadlift (both movements performed on right and left legs), a push-up, and a chin-up. Each movement was scored across 3 essential assessment criteria using a 3-point scale. The total score for each movement (maximum of 9) and the overall total score (maximum of 63) were used as the criterion variables for analysis. A multivariate analysis of variance tested the main effect of football code (2 levels) on the criterion variables, whereas a 1-way analysis of variance identified where differences occurred. A significant effect was noted, with the TID junior ARF players outscoring their soccer counterparts when performing the overhead squat and push-up. No other criterions significantly differed according to the main effect. Practitioners should be aware that specific sporting requirements may incur slight differences in athletic movement skill among TID juniors from different football codes. However, given the low athletic movement skill noted in both football codes, developmental coaches should address the underlying movement skill capabilities of juniors when prescribing physical training in both codes.

  13. Use of solid phase microextraction to identify volatile organic compounds in brazilian wines from different grape varieties

    Directory of Open Access Journals (Sweden)

    Natália Cristina Morais Fernandes

    Full Text Available Abstract The Brazilian wine industry has shown significant growth in recent years and the insertion of new concepts, such as geographical indications as signs of quality, has placed Brazil in tune with the tendencies of world wine production. The aim of this work was to apply the Solid Phase Microextraction technique in combination with Gas Chromatography-Mass Spectrometry to study Brazilian wines made from different grape varieties, in order to separate and identify their volatile organic compounds. These substances were identified by comparisons between the spectra obtained with those presented in the NIST library database, and by comparisons with linear retention indices and literature data. The amounts of the compounds were calculated based on the total peak areas of the chromatograms. Forty-seven volatile compounds were identified and grouped into alcohols, aldehydes, fatty acids, esters, hydrocarbons, ketones and terpenes. Most of them belonged to the ester function, conferring a fruity aroma on the wines. The alcohols may have originated from the yeast metabolism, contributing to the alcoholic and floral aromas. Ethyl lactate, 1-hexanol and diethyl maleate were identified in all the varieties, except Merlot. Decanal, methyl citronellate, (E-2-hexenyl-3-methylbutyrate were only found in Merlot, while 2,3-butanediol was only present in the Tannat wines. 2-Phenylethanol was present in all varieties and is recognized as giving pleasant rose and honey attributes to wines. This study showed that the volatile profile of red wines is mainly characterized by esters and higher alcohols. The statistical analysis of the comparison of averages showed a greater amount of averages significantly different in the relative areas of Merlot wine. The Principal Component Analysis showed one grouping composed only of the Merlot wine samples, and this was probably related to the existence of the volatile organic compounds that were specifically identified in

  14. Importance of sports during youth and exercise barriers in 20- to 29-year-old male nonathletes differently motivated for regular physical activities

    DEFF Research Database (Denmark)

    Leyk, Dieter; Witzki, Alexander; Sievert, Alexander

    2012-01-01

    The number of sedentary young adults has dramatically increased in past decades, and sedentary lifestyles are adopted at an increasingly earlier age. Little is known about barriers or predictors to (re)initiate regular physical activity in this group. The purpose of the study is to (a) identify...... subgroups in nonathletes differing in their amenability to physical exercise, (b) to analyze them for differences in barriers and intention to exercise, and (c) compare importance of sports during youth in nonathletes to trained peers. Using a health and fitness questionnaire 589 nonathletes were queried.......5%), the other groups showed significantly more barriers and a broader distribution. Similar characteristics but minor differences were observed for perceived importance of sports during youth. The most significant differences between athletes and nonathletes emerged enquiring the attitude and activity...

  15. Identifying Differences in Abiotic Stress Gene Networks between Lowland and Upland Ecotypes of Switchgrass (DE-SC0008338)

    Energy Technology Data Exchange (ETDEWEB)

    Childs, Kevin [Michigan State Univ., East Lansing, MI (United States); Buell, Robin [Michigan State Univ., East Lansing, MI (United States); Zhao, Bingyu [Virginia Polytechnic Inst. and State Univ. (Virginia Tech), Blacksburg, VA (United States); Zhang, Xunzhong [Virginia Polytechnic Inst. and State Univ. (Virginia Tech), Blacksburg, VA (United States)

    2016-11-10

    Switchgrass (Panicum virgatum) is a warm-season C4 grass that is a target lignocellulosic biofuel species for use in the United States due to its local adaption capabilities and high biomass accumulation. Two ecotypes of switchgrass have been described. Members of the lowland ecotype are taller, have narrower leaf blades and generate more biomass compared to individuals from the upland ecotype. Additionally, lowland plants are generally found in the southern United States while upland switchgrass is more typically present in the northern United States. These differences are important as it is envisioned that switchgrass for biofuel production will typically be grown on marginal lands in the northern United States to supplement and diversify farmers' traditional crop incomes. While lowland switchgrass is more productive, it has poor winter survivability in northern latitudes where upland switchgrass is expected to be grown for biofuel use. Abiotic stresses likely to be encountered by switchgrass include drought and salinity. Despite initially being described as preferring wetter environments, members of the lowland ecotype have been characterized as being more drought tolerant than plants of the upland ecotype. Nonetheless, direct trials have indicated that variation for drought tolerance exists in both ecotypes, but prior to this project, only a relatively small number of switchgrass lines had been tested for drought responses. Similarly, switchgrass cultivars have not been widely tested for salt tolerance, but a few studies have shown that even mild salt stress can inhibit growth. The effects of drought and salt stress on plant growth are complex. Both drought and salinity affect the osmotic potential of plant cells and negatively affect plant growth due to reduced water potential and reduced photosynthesis that results from lower stomatal conductance of CO2. Plants respond to drought and salt stress by activating genes that directly attempt to

  16. The Importance of Sport in Students’ Lives and the Frequency of Sport Participation Among Students - Gender Differences

    Directory of Open Access Journals (Sweden)

    Matej Majerič

    2016-06-01

    Full Text Available The main purpose of this research was to analyse the gender differences among students at the University of Ljubljana in the importance of sport in their lives and the frequency of sport participation. The research was done in the 2013 academic year on a random sample of 3% of the students (N = 1390; a questionnaire about students’ lifestyles was used (Majerič, 2013. In this study, two variables were analysed: the importance of sport in students’ lives and the frequency of sport participation; the data were analysed with SPSS for Windows. The basic statistical parameters for both variables were calculated. To calculate the gender differences, a t-test for independent samples and the Mann-Whitney U test were run. For the variable ‘importance of sport in students’ lives’, 61.95% of male and 53.20% of female respondents reported that sport is important and very important in their lives. The gender differences were small but statistically significant (p=0.013. For the variable ‘frequency of participation in sport activity’, 79.61% of male and 77.10% of female respondents reported that they were sport active every day, 4 to 6 times a week or 2 to 3 times a week. The gender differences in this variable were also statistically significant (p=0.000. Our findings and conclusions provide useful guidance to the closer and wider professional public who organize sport programmes for students.

  17. Machine Learning Analysis Identifies Drosophila Grunge/Atrophin as an Important Learning and Memory Gene Required for Memory Retention and Social Learning.

    Science.gov (United States)

    Kacsoh, Balint Z; Greene, Casey S; Bosco, Giovanni

    2017-11-06

    High-throughput experiments are becoming increasingly common, and scientists must balance hypothesis-driven experiments with genome-wide data acquisition. We sought to predict novel genes involved in Drosophila learning and long-term memory from existing public high-throughput data. We performed an analysis using PILGRM, which analyzes public gene expression compendia using machine learning. We evaluated the top prediction alongside genes involved in learning and memory in IMP, an interface for functional relationship networks. We identified Grunge/Atrophin ( Gug/Atro ), a transcriptional repressor, histone deacetylase, as our top candidate. We find, through multiple, distinct assays, that Gug has an active role as a modulator of memory retention in the fly and its function is required in the adult mushroom body. Depletion of Gug specifically in neurons of the adult mushroom body, after cell division and neuronal development is complete, suggests that Gug function is important for memory retention through regulation of neuronal activity, and not by altering neurodevelopment. Our study provides a previously uncharacterized role for Gug as a possible regulator of neuronal plasticity at the interface of memory retention and memory extinction. Copyright © 2017 Kacsoh et al.

  18. Method and system employing finite state machine modeling to identify one of a plurality of different electric load types

    Science.gov (United States)

    Du, Liang; Yang, Yi; Harley, Ronald Gordon; Habetler, Thomas G.; He, Dawei

    2016-08-09

    A system is for a plurality of different electric load types. The system includes a plurality of sensors structured to sense a voltage signal and a current signal for each of the different electric loads; and a processor. The processor acquires a voltage and current waveform from the sensors for a corresponding one of the different electric load types; calculates a power or current RMS profile of the waveform; quantizes the power or current RMS profile into a set of quantized state-values; evaluates a state-duration for each of the quantized state-values; evaluates a plurality of state-types based on the power or current RMS profile and the quantized state-values; generates a state-sequence that describes a corresponding finite state machine model of a generalized load start-up or transient profile for the corresponding electric load type; and identifies the corresponding electric load type.

  19. Predictive risk modelling under different data access scenarios: who is identified as high risk and for how long?

    Science.gov (United States)

    Johnson, Tracy L; Kaldor, Jill; Sutherland, Kim; Humphries, Jacob; Jorm, Louisa R; Levesque, Jean-Frederic

    2018-01-01

    Objective This observational study critically explored the performance of different predictive risk models simulating three data access scenarios, comparing: (1) sociodemographic and clinical profiles; (2) consistency in high-risk designation across models; and (3) persistence of high-risk status over time. Methods Cross-sectional health survey data (2006–2009) for more than 260 000 Australian adults 45+ years were linked to longitudinal individual hospital, primary care, pharmacy and mortality data. Three risk models predicting acute emergency hospitalisations were explored, simulating conditions where data are accessed through primary care practice management systems, or through hospital-based electronic records, or through a hypothetical ‘full’ model using a wider array of linked data. High-risk patients were identified using different risk score thresholds. Models were reapplied monthly for 24 months to assess persistence in high-risk categorisation. Results The three models displayed similar statistical performance. Three-quarters of patients in the high-risk quintile from the ‘full’ model were also identified using the primary care or hospital-based models, with the remaining patients differing according to age, frailty, multimorbidity, self-rated health, polypharmacy, prior hospitalisations and imminent mortality. The use of higher risk prediction thresholds resulted in lower levels of agreement in high-risk designation across models and greater morbidity and mortality in identified patient populations. Persistence of high-risk status varied across approaches according to updated information on utilisation history, with up to 25% of patients reassessed as lower risk within 1 year. Conclusion/implications Small differences in risk predictors or risk thresholds resulted in comparatively large differences in who was classified as high risk and for how long. Pragmatic predictive risk modelling design decisions based on data availability or projected

  20. Bipolar disorder: The importance of clinical assessment in identifying prognostic factors - An Audit. Part 1: An analysis of potential prognostic factors.

    Science.gov (United States)

    Verdolini, Norma; Dean, Jonathon; Elisei, Sandro; Quartesan, Roberto; Zaman, Rashid; Agius, Mark

    2014-11-01

    Prognostic factors of bipolar disorder must be identified to assist in staging and treatment, and this may be done primarily during the initial psychiatric assessment. In fact, most of the prognostic factors, which determine disease outcome, could be detected from simple but often-unrecorded questions asked during the psychiatric clinic visit. We collected data from the clinical notes of 70 bipolar outpatients seen at the initial psychiatric assessment clinic about socio-demographic and clinical factors to determine whether various factors had relevance to prevalence, prognosis, or outcome. The sample comprised 16 bipolar I (22.9%) and 54 bipolar II (77.1%) outpatients; a psychiatric comorbidity was noted in 26 patients (37.1%). 60.9% (42 patients) reported anxiety features and 12 patients (17.6%) were noted to have obsessive-compulsive characteristics. Percentages reported in our results are of the sample for which the data was available. Anhedonia is a depressive feature that was present in most of the population where this data was available (92.2%, 59 patients) and 81.8% (54 patients) reported suicidal thoughts during a depressive episode. 74.6% (47 patients) had a family history of bipolar disorder, depression, suicide or psychosis. 27 patients (39.7%) reported current alcohol use and 14 patients (22.6%) current illicit drug use. A comparison between 10 prognostic factors found that only the correlations between current illicit drug use/previous illicit drug use (χ(2)=11.471, Palcohol use/previous alcohol use (χ(2)=31.510, Palcohol use (χ(2)=5.071, P=0.023) and previous alcohol use/family history (χ(2)=4.309, P=0.037) were almost statistically significant. 17 patients (24.3%) of the 70 bipolar patients were assigned to a care coordinator; we have evaluated the possible differences between the patients with or without a care coordinator on the basis of the presence of 10 possible prognostic factors and found no statistically significant differences between

  1. The morphology of saccular otoliths as a tool to identify different mugilid species from the Northeastern Atlantic and Mediterranean Sea

    Science.gov (United States)

    Callicó Fortunato, Roberta; Benedito Durà, Vicent; Volpedo, Alejandra

    2014-06-01

    In the Northeastern Atlantic and Mediterranean Sea there are 8 species of the Mugilidae family: Mugil cephalus, Liza aurata, Liza ramada, Oedalechilus labeo, Chelon labrosus, Liza saliens, Liza carinata and Liza haematocheila. The identification of mugilids is very important for local fisheries management and regulations, but it is difficult using gross morphological characters. This work aims to contribute to the identification of mullets present in the Northeastern Atlantic Ocean and Mediterranean Sea using saccular otolith features of each species. Specimens of C. labrosus, L. aurata, L. ramada, L. saliens and M. cephalus were obtained from Delta del Ebro (40°38'N-0°44'E) in artisanal catches. For L. carinata and O. labeo photographs extracted from AFORO online database were used. L. haematocheila was not studied for lack of otolith samples. A general pattern of the saccular otoliths for this family was identified: the shape of the otoliths are rectangular to oblong with irregular margins; they present a heterosulcoid, ostial sulcus acusticus, with an open funnel-like ostium to the anterior margin and a closed, tubular cauda, ending towards the posterior ventral corner, always larger than the ostium. In the present study, the mugilid species could be recognized using their saccular otolith morphology. Here we give the first key to identify Northeastern Atlantic and Mediterranean mullets. The distinctive features between the species were the position and centrality of the sulcus, the curvature of the cauda, the presence of areal depositions and plateaus, and the type of anterior and posterior regions. These features could be used not only to reinforce the identification keys through morphological and meristic characters of the species, but also to identify the species consumed by piscivores, being the otoliths the only identifiable remains of the individuals.

  2. Laser capture microdissection-based in vivo genomic profiling of wound keratinocytes identifies similarities and differences to squamous cell carcinoma

    DEFF Research Database (Denmark)

    Pedersen, Tanja Xenia; Leethanakul, Chidchanop; Patel, Vyomesh

    2003-01-01

    keratinocytes from incisional mouse skin wounds and adjacent normal skin keratinocytes. Changes in gene expression were determined by comparative cDNA array analyses, and the approach was validated by in situ hybridization. The analyses identified 48 candidate genes not previously associated with wound...... reepithelialization. Furthermore, the analyses revealed that the phenotypic resemblance of wound keratinocytes to squamous cell carcinoma is mimicked at the level of gene expression, but notable differences between the two tissue-remodeling processes were also observed. The combination of laser capture...

  3. Sex and gender differences in autism spectrum disorder: summarizing evidence gaps and identifying emerging areas of priority.

    Science.gov (United States)

    Halladay, Alycia K; Bishop, Somer; Constantino, John N; Daniels, Amy M; Koenig, Katheen; Palmer, Kate; Messinger, Daniel; Pelphrey, Kevin; Sanders, Stephan J; Singer, Alison Tepper; Taylor, Julie Lounds; Szatmari, Peter

    2015-01-01

    One of the most consistent findings in autism spectrum disorder (ASD) research is a higher rate of ASD diagnosis in males than females. Despite this, remarkably little research has focused on the reasons for this disparity. Better understanding of this sex difference could lead to major advancements in the prevention or treatment of ASD in both males and females. In October of 2014, Autism Speaks and the Autism Science Foundation co-organized a meeting that brought together almost 60 clinicians, researchers, parents, and self-identified autistic individuals. Discussion at the meeting is summarized here with recommendations on directions of future research endeavors.

  4. Statistical Parametric Mapping to Identify Differences between Consensus-Based Joint Patterns during Gait in Children with Cerebral Palsy.

    Science.gov (United States)

    Nieuwenhuys, Angela; Papageorgiou, Eirini; Desloovere, Kaat; Molenaers, Guy; De Laet, Tinne

    2017-01-01

    Experts recently identified 49 joint motion patterns in children with cerebral palsy during a Delphi consensus study. Pattern definitions were therefore the result of subjective expert opinion. The present study aims to provide objective, quantitative data supporting the identification of these consensus-based patterns. To do so, statistical parametric mapping was used to compare the mean kinematic waveforms of 154 trials of typically developing children (n = 56) to the mean kinematic waveforms of 1719 trials of children with cerebral palsy (n = 356), which were classified following the classification rules of the Delphi study. Three hypotheses stated that: (a) joint motion patterns with 'no or minor gait deviations' (n = 11 patterns) do not differ significantly from the gait pattern of typically developing children; (b) all other pathological joint motion patterns (n = 38 patterns) differ from typically developing gait and the locations of difference within the gait cycle, highlighted by statistical parametric mapping, concur with the consensus-based classification rules. (c) all joint motion patterns at the level of each joint (n = 49 patterns) differ from each other during at least one phase of the gait cycle. Results showed that: (a) ten patterns with 'no or minor gait deviations' differed somewhat unexpectedly from typically developing gait, but these differences were generally small (≤3°); (b) all other joint motion patterns (n = 38) differed from typically developing gait and the significant locations within the gait cycle that were indicated by the statistical analyses, coincided well with the classification rules; (c) joint motion patterns at the level of each joint significantly differed from each other, apart from two sagittal plane pelvic patterns. In addition to these results, for several joints, statistical analyses indicated other significant areas during the gait cycle that were not included in the pattern definitions of the consensus study

  5. A typology of vaping: Identifying differing beliefs, motivations for use, identity and political interest amongst e-cigarette users.

    Science.gov (United States)

    Farrimond, Hannah

    2017-10-01

    The aim of this study was to identify and differentiate socially shared accounts of e-cigarette use (vaping) using Q-methodology, combining factor analysis with qualitative comments. Seventy statements on e-cigarettes, drawn from media, academic and online discussions, were sorted by participants along a continuum of agreement/disagreement, commenting on strongly ranked items. Each participant thus created their own 'account' of their vaping. A by-person correlation matrix of the sorts was conducted, then factor analysed, to identify similar accounts (pmotivated to maintain the rights of adults to vape. In Factor Two, 'Vaping as Medical Treatment', vaping was understood as a pragmatic choice about how to medicate one's smoking addiction, with the aim being to treat and ultimately reduce nicotine dependence. In Factor Three, 'Ambivalent E-Cigarette Use', participants reported fewer benefits and harboured more negative beliefs about e-cigarettes; they also strongly rejected a vaper identity, having no interest in online forums or being labelled a 'vaper' themselves. The UK e-cigarette users in this sample were not a homogeneous group; differing in their beliefs, motivations for use, identity and political interest. In particular they diverged on whether they accepted a medicalized account of vaping and identified as a vaper. Public health messages targeted to one group of e-cigarette users may not resonate with others. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  6. Identifying potential differences in ontogentic ages between modern and archaeological Nacella deaurata shells, Tierra del Fuego, Argentina

    Science.gov (United States)

    Surge, D. M.; Godino, I. B. I.; Álvarez, M.; López, M. B. I.

    2017-12-01

    Patelloid limpet shells are common constituents of rocky shore habitats along the eastern Atlantic basin and are often found in archaeological shell middens. Nacella deaurata is an intertidal species found in the Magellanic Province along the southern tip of South America. Recent discoveries of archaeological shell middens in Tierra del Fuego, Argentina, identify N. deaurata as one of the abundant shells in these deposits. Preliminary observations reveal that modern N. deaurata shells achieve larger sizes compared to those found in the archaeological middens. Here, we provide preliminary data to test the hypothesis that the larger, modern specimens grow to older ontogenetic ages than the smaller archaeological specimens. Our results may provide insights into harvesting pressures on this species during the time when the archaeological sites were inhabited. Understanding their annual growth patterns also has important implications for generating oxygen isotope proxy data to reconstruct seasonal variation in sea surface temperature.

  7. What Matters Most to Whom: Racial, Ethnic, and Language Differences in the Health Care Experiences Most Important to Patients.

    Science.gov (United States)

    Collins, Rebecca L; Haas, Ann; Haviland, Amelia M; Elliott, Marc N

    2017-11-01

    Some aspects of patient experience are more strongly related to overall ratings of care than others, reflecting their importance to patients. However, little is known about whether the importance of different aspects of this experience differs across subgroups. To determine whether the aspects of health care most important to patients differ according to patient race, ethnicity, and language preference. In response to the 2013 Medicare Consumer Assessment of Health Plans Study (CAHPS) survey, patients rated their overall health care and completed items measuring five patient experience domains. We estimated a linear regression model to assess associations between overall rating of care and the 5 domains, testing for differences in these relationships for race/ethnicity/language groups, controlling for covariates. In total 242,782 Medicare beneficiaries, age 65 years or older. Overall rating of health care, composite patient experience scores for: doctor communication, getting needed care, getting care quickly, customer service, and care coordination. A joint test of the interactions between the composite scores and the 5 largest racial/ethnic/language subgroups was statistically significant (P importance of domains varied across subgroups. Doctor communication had the strongest relationship with care ratings for non-Hispanic whites and English-preferring Hispanics. Getting needed care had the strongest relationship for Spanish-preferring Hispanics and Asian/Pacific Islanders. Doctor communication and getting care quickly were strongest for African Americans. Tailoring quality improvement programs to the factors most important to the racial, ethnic, and language mix of the patient population of the practice, hospital, or plan may more efficiently reduce disparities and improve quality.

  8. The Importance of Sport in Students’ Lives and the Frequency of Sport Participation Among Students - Gender Differences

    OpenAIRE

    Matej Majerič

    2016-01-01

    The main purpose of this research was to analyse the gender differences among students at the University of Ljubljana in the importance of sport in their lives and the frequency of sport participation. The research was done in the 2013 academic year on a random sample of 3% of the students (N = 1390); a questionnaire about students’ lifestyles was used (Majerič, 2013). In this study, two variables were analysed: the importance of sport in students’ lives and the frequency of sport participati...

  9. Nonsphericity Index and Size Ratio Identify Morphologic Differences between Growing and Stable Aneurysms in a Longitudinal Study of 93 Cases.

    Science.gov (United States)

    Chien, A; Xu, M; Yokota, H; Scalzo, F; Morimoto, E; Salamon, N

    2018-01-25

    Recent studies have strongly associated intracranial aneurysm growth with increased risk of rupture. Identifying aneurysms that are likely to grow would be beneficial to plan more effective monitoring and intervention strategies. Our hypothesis is that for unruptured intracranial aneurysms of similar size, morphologic characteristics differ between aneurysms that continue to grow and those that do not. From aneurysms in our medical center with follow-up imaging dates in 2015, ninety-three intracranial aneurysms (23 growing, 70 stable) were selected. All CTA images for the aneurysm diagnosis and follow-up were collected, a total of 348 3D imaging studies. Aneurysm 3D geometry for each imaging study was reconstructed, and morphologic characteristics, including volume, surface area, nonsphericity index, aspect ratio, and size ratio were calculated. Morphologic characteristics were found to differ between growing and stable groups. For aneurysms of 7 mm, volume ( P differ between those that are growing and those that are stable. The nonsphericity index, in particular, was found to be higher among growing aneurysms. The size ratio was found to be the second most significant parameter associated with growth. © 2018 by American Journal of Neuroradiology.

  10. Microarray analysis to identify the similarities and differences of pathogenesis between aortic occlusive disease and abdominal aortic aneurysm.

    Science.gov (United States)

    Wang, Guofu; Bi, Lechang; Wang, Gaofeng; Huang, Feilai; Lu, Mingjing; Zhu, Kai

    2018-06-01

    Objectives Expression profile of GSE57691 was analyzed to identify the similarities and differences between aortic occlusive disease and abdominal aortic aneurysm. Methods The expression profile of GSE57691 was downloaded from Gene Expression Omnibus database, including 20 small abdominal aortic aneurysm samples, 29 large abdominal aortic aneurysm samples, 9 aortic occlusive disease samples, and 10 control samples. Using the limma package in R, the differentially expressed genes were screened. Followed by enrichment analysis was performed for the differentially expressed genes using database for annotation, visualization, and integrated discovery online tool. Based on string online tool and Cytoscape software, protein-protein interaction network and module analyses were carried out. Moreover, integrated TF platform database and Cytoscape software were used for constructing transcriptional regulatory networks. Results As a result, 1757, 354, and 396 differentially expressed genes separately were identified in aortic occlusive disease, large abdominal aortic aneurysm, and small abdominal aortic aneurysm samples. UBB was significantly enriched in proteolysis related pathways with a high degree in three groups. SPARCL1 was another gene shared by these groups and regulated by NFIA, which had a high degree in transcriptional regulatory network. ACTB, a significant upregulated gene in abdominal aortic aneurysm samples, could be regulated by CLIC4, which was significantly enriched in cell motions. ACLY and NFIB were separately identified in aortic occlusive disease and small abdominal aortic aneurysm samples, and separately enriched in lipid metabolism and negative regulation of cell proliferation. Conclusions The downregulated UBB, NFIA, and SPARCL1 might play key roles in both aortic occlusive disease and abdominal aortic aneurysm, while the upregulated ACTB might only involve in abdominal aortic aneurysm. ACLY and NFIB were specifically involved in aortic occlusive

  11. Identifying barriers to remaining physically active after rehabilitation: differences in perception between physical therapists and older adult patients.

    Science.gov (United States)

    Zalewski, Kathryn; Alt, Carlynn; Arvinen-Barrow, Monna

    2014-06-01

    Cross-sectional study. To describe readiness for change and barriers to physical activity in older adults and to contrast perceptions of physical therapists and patients using the Barriers to Being Active Quiz. Regular physical activity is vital to recovery after discharge from physical therapy. Physical therapists are positioned to support change in physical activity habits for those transitioning to home care. Understanding of readiness for change and barriers to physical activity could optimize recovery. Thirteen physical therapists enrolled in the study and invited patients who met the inclusion criteria to enroll (79 patients enrolled). The physical therapists provided the ICD-9 code, the physical therapist diagnosis, and completed the Barriers to Being Active Quiz as they perceived their patients would. The enrolled patients provided demographics and filled out the Satisfaction With Life Scale, the stages-of-change scale for physical activity, and the Barriers to Being Active Quiz. Patients were predominantly in the early stages of readiness for change. Both patients and physical therapists identified lack of willpower as the primary barrier to physical activity. Patients identified lack of willpower and social influence as critical barriers more often than physical therapists, whereas physical therapists identified fear of injury and lack of time more often than their patients did. Differences between physical therapists and their patients were noted for fear of injury (z = 2.66, P = .008) and lack of time (z = 3.46, P = .001). The stage of change for physical activity impacted perception of social influence (χ2 = 9.64, Pbarriers to physical activity may allow physical therapists to better tailor intervention strategies to impact physical activity behavior change.

  12. Frameshift mutational target gene analysis identifies similarities and differences in constitutional mismatch repair-deficiency and Lynch syndrome.

    Science.gov (United States)

    Maletzki, Claudia; Huehns, Maja; Bauer, Ingrid; Ripperger, Tim; Mork, Maureen M; Vilar, Eduardo; Klöcking, Sabine; Zettl, Heike; Prall, Friedrich; Linnebacher, Michael

    2017-07-01

    Mismatch-repair deficient (MMR-D) malignancies include Lynch Syndrome (LS), which is secondary to germline mutations in one of the MMR genes, and the rare childhood-form of constitutional mismatch repair-deficiency (CMMR-D); caused by bi-allelic MMR gene mutations. A hallmark of LS-associated cancers is microsatellite instability (MSI), characterized by coding frameshift mutations (cFSM) in target genes. By contrast, tumors arising in CMMR-D patients are thought to display a somatic mutation pattern differing from LS. This study has the main goal to identify cFSM in MSI target genes relevant in CMMR-D and to compare the spectrum of common somatic mutations, including alterations in DNA polymerases POLE and D1 between LS and CMMR-D. CMMR-D-associated tumors harbored more somatic mutations compared to LS cases, especially in the TP53 gene and in POLE and POLD1, where novel mutations were additionally identified. Strikingly, MSI in classical mononucleotide markers BAT40 and CAT25 was frequent in CMMR-D cases. MSI-target gene analysis revealed mutations in CMMR-D-associated tumors, some of them known to be frequently hit in LS, such as RNaseT2, HT001, and TGFβR2. Our results imply a general role for these cFSM as potential new drivers of MMR-D tumorigenesis. © 2017 Wiley Periodicals, Inc.

  13. Anisotropic flow studies with identified particles with ALICE: a tool to probe different stages of a heavy-ion collision

    CERN Multimedia

    CERN. Geneva

    2017-01-01

    Anisotropic flow studies play a crucial role in the characterization of the nature of the quark gluon plasma (QGP) created in collisions of heavy ions at ultra-relativistic energies. These studies rely on measuring the coefficients vn of the Fourier expansion of the azimuthal particle distribution. They have been essential in establishing that the QGP is a strongly coupled, almost perfect fluid. In this seminar, I review the latest results from measurements of elliptic (v2), triangular (v3), quadrangular (v4) and pentagonal (v5) flow of identified particles at the LHC measured with ALICE. I will discuss how these results allow us to gain insight into the transport properties of the QGP and the initial conditions of a heavy-ion collision. In addition, they reveal the role of different hadronisation mechanisms as well as the highly dissipative hadronic rescattering phase to the development of vn.

  14. Colony-level behavioural variation correlates with differences in expression of the foraging gene in red imported fire ants.

    Science.gov (United States)

    Bockoven, Alison A; Coates, Craig J; Eubanks, Micky D

    2017-11-01

    Among social insects, colony-level variation is likely to be widespread and has significant ecological consequences. Very few studies, however, have documented how genetic factors relate to behaviour at the colony level. Differences in expression of the foraging gene have been associated with differences in foraging and activity of a wide variety of organisms. We quantified expression of the red imported fire ant foraging gene (sifor) in workers from 21 colonies collected across the natural range of Texas fire ant populations, but maintained under standardized, environmentally controlled conditions. Colonies varied significantly in their behaviour. The most active colonies had up to 10 times more active foragers than the least active colony and more than 16 times as many workers outside the nest. Expression differences among colonies correlated with this colony-level behavioural variation. Colonies with higher sifor expression in foragers had, on average, significantly higher foraging activity, exploratory activity and recruitment to nectar than colonies with lower expression. Expression of sifor was also strongly correlated with worker task (foraging vs. working in the interior of the nest). These results provide insight into the genetic and physiological processes underlying collective differences in social behaviour. Quantifying variation in expression of the foraging gene may provide an important tool for understanding and predicting the ecological consequences of colony-level behavioural variation. © 2017 John Wiley & Sons Ltd.

  15. How powerful are summary-based methods for identifying expression-trait associations under different genetic architectures?

    Science.gov (United States)

    Veturi, Yogasudha; Ritchie, Marylyn D

    2018-01-01

    Transcriptome-wide association studies (TWAS) have recently been employed as an approach that can draw upon the advantages of genome-wide association studies (GWAS) and gene expression studies to identify genes associated with complex traits. Unlike standard GWAS, summary level data suffices for TWAS and offers improved statistical power. Two popular TWAS methods include either (a) imputing the cis genetic component of gene expression from smaller sized studies (using multi-SNP prediction or MP) into much larger effective sample sizes afforded by GWAS - TWAS-MP or (b) using summary-based Mendelian randomization - TWAS-SMR. Although these methods have been effective at detecting functional variants, it remains unclear how extensive variability in the genetic architecture of complex traits and diseases impacts TWAS results. Our goal was to investigate the different scenarios under which these methods yielded enough power to detect significant expression-trait associations. In this study, we conducted extensive simulations based on 6000 randomly chosen, unrelated Caucasian males from Geisinger's MyCode population to compare the power to detect cis expression-trait associations (within 500 kb of a gene) using the above-described approaches. To test TWAS across varying genetic backgrounds we simulated gene expression and phenotype using different quantitative trait loci per gene and cis-expression /trait heritability under genetic models that differentiate the effect of causality from that of pleiotropy. For each gene, on a training set ranging from 100 to 1000 individuals, we either (a) estimated regression coefficients with gene expression as the response using five different methods: LASSO, elastic net, Bayesian LASSO, Bayesian spike-slab, and Bayesian ridge regression or (b) performed eQTL analysis. We then sampled with replacement 50,000, 150,000, and 300,000 individuals respectively from the testing set of the remaining 5000 individuals and conducted GWAS on each

  16. Analysis of copy number variations in Holstein cows identify potential mechanisms contributing to differences in residual feed intake.

    Science.gov (United States)

    Hou, Yali; Bickhart, Derek M; Chung, Hoyoung; Hutchison, Jana L; Norman, H Duane; Connor, Erin E; Liu, George E

    2012-11-01

    Genomic structural variation is an important and abundant source of genetic and phenotypic variation. In this study, we performed an initial analysis of copy number variations (CNVs) using BovineHD SNP genotyping data from 147 Holstein cows identified as having high or low feed efficiency as estimated by residual feed intake (RFI). We detected 443 candidate CNV regions (CNVRs) that represent 18.4 Mb (0.6 %) of the genome. To investigate the functional impacts of CNVs, we created two groups of 30 individual animals with extremely low or high estimated breeding values (EBVs) for RFI, and referred to these groups as low intake (LI; more efficient) or high intake (HI; less efficient), respectively. We identified 240 (~9.0 Mb) and 274 (~10.2 Mb) CNVRs from LI and HI groups, respectively. Approximately 30-40 % of the CNVRs were specific to the LI group or HI group of animals. The 240 LI CNVRs overlapped with 137 Ensembl genes. Network analyses indicated that the LI-specific genes were predominantly enriched for those functioning in the inflammatory response and immunity. By contrast, the 274 HI CNVRs contained 177 Ensembl genes. Network analyses indicated that the HI-specific genes were particularly involved in the cell cycle, and organ and bone development. These results relate CNVs to two key variables, namely immune response and organ and bone development. The data indicate that greater feed efficiency relates more closely to immune response, whereas cattle with reduced feed efficiency may have a greater capacity for organ and bone development.

  17. The importance of distinguishing between the different eating disorders (sub)types when assessing emotion regulation strategies.

    Science.gov (United States)

    Danner, Unna N; Sternheim, Lot; Evers, Catharine

    2014-03-30

    People with eating disorders (ED) have difficulties regulating their emotions adaptively. Little is known about differences and similarities between different types of ED and how these regulation difficulties relate to other emotional problems. The present study examines maladaptive (suppression) and adaptive (cognitive reappraisal) emotion regulation strategies in women with different ED and relationships with anxiety and depression levels. In 32 women with AN restrictive subtype (ANR), 32 with AN binge-purge subtype (ANBP), 30 with bulimia nervosa (BN), 29 with binge eating disorder (BED), and 64 healthy women, the ERQ (emotion regulation) as well as STAI-T (anxiety), BDI-SF (depression), and EDDS (eating pathology) were administered. Women across different ED subtypes were inclined to suppress emotions and lacked the capacity to reappraise emotions (except women with ANBP). Correlational relations of suppression and reappraisal with anxiety and depression levels differed across ED groups. Emotion regulation problems were found across ED subtypes. However, the types of emotion regulation problems, and the effect of coexisting other emotional problems such as anxiety and depression may differ across ED subtypes. These findings illustrate the importance to of considering ED subtypes in emotion regulation research rather than consider ED as a whole. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  18. Genetic differences in transcript responses to low-dose ionizing radiation identify tissue functions associated with breast cancer susceptibility.

    Science.gov (United States)

    Snijders, Antoine M; Marchetti, Francesco; Bhatnagar, Sandhya; Duru, Nadire; Han, Ju; Hu, Zhi; Mao, Jian-Hua; Gray, Joe W; Wyrobek, Andrew J

    2012-01-01

    High dose ionizing radiation (IR) is a well-known risk factor for breast cancer but the health effects after low-dose (LD, differences in their sensitivity to radiation-induced mammary cancer (BALB/c and C57BL/6) for the purpose of identifying mechanisms of mammary cancer susceptibility. Unirradiated mammary and blood tissues of these strains differed significantly in baseline expressions of DNA repair, tumor suppressor, and stress response genes. LD exposures of 7.5 cGy (weekly for 4 weeks) did not induce detectable genomic instability in either strain. However, the mammary glands of the sensitive strain but not the resistant strain showed early transcriptional responses involving: (a) diminished immune response, (b) increased cellular stress, (c) altered TGFβ-signaling, and (d) inappropriate expression of developmental genes. One month after LD exposure, the two strains showed opposing responses in transcriptional signatures linked to proliferation, senescence, and microenvironment functions. We also discovered a pre-exposure expression signature in both blood and mammary tissues that is predictive for poor survival among human cancer patients (p = 0.0001), and a post-LD-exposure signature also predictive for poor patient survival (pidentify genetic features that predispose or protect individuals from LD-induced breast cancer.

  19. Metabolic profiles of triple-negative and luminal A breast cancer subtypes in African-American identify key metabolic differences.

    Science.gov (United States)

    Tayyari, Fariba; Gowda, G A Nagana; Olopade, Olufunmilayo F; Berg, Richard; Yang, Howard H; Lee, Maxwell P; Ngwa, Wilfred F; Mittal, Suresh K; Raftery, Daniel; Mohammed, Sulma I

    2018-02-20

    Breast cancer, a heterogeneous disease with variable pathophysiology and biology, is classified into four major subtypes. While hormonal- and antibody-targeted therapies are effective in the patients with luminal and HER-2 subtypes, the patients with triple-negative breast cancer (TNBC) subtype do not benefit from these therapies. The incidence rates of TNBC subtype are higher in African-American women, and the evidence indicates that these women have worse prognosis compared to women of European descent. The reasons for this disparity remain unclear but are often attributed to TNBC biology. In this study, we performed metabolic analysis of breast tissues to identify how TNBC differs from luminal A breast cancer (LABC) subtypes within the African-American and Caucasian breast cancer patients, respectively. We used High-Resolution Magic Angle Spinning (HR-MAS) 1H Nuclear magnetic resonance (NMR) to perform the metabolomic analysis of breast cancer and adjacent normal tissues (total n=82 samples). TNBC and LABC subtypes in African American women exhibited different metabolic profiles. Metabolic profiles of these subtypes were also distinct from those revealed in Caucasian women. TNBC in African-American women expressed higher levels of glutathione, choline, and glutamine as well as profound metabolic alterations characterized by decreased mitochondrial respiration and increased glycolysis concomitant with decreased levels of ATP. TNBC in Caucasian women was associated with increased pyrimidine synthesis. These metabolic alterations could potentially be exploited as novel treatment targets for TNBC.

  20. Comparative Genomic Hybridization Analysis of Yersinia enterocolitica and Yersinia pseudotuberculosis Identifies Genetic Traits to Elucidate Their Different Ecologies

    Directory of Open Access Journals (Sweden)

    Kaisa Jaakkola

    2015-01-01

    Full Text Available Enteropathogenic Yersinia enterocolitica and Yersinia pseudotuberculosis are both etiological agents for intestinal infection known as yersiniosis, but their epidemiology and ecology bear many differences. Swine are the only known reservoir for Y. enterocolitica 4/O:3 strains, which are the most common cause of human disease, while Y. pseudotuberculosis has been isolated from a variety of sources, including vegetables and wild animals. Infections caused by Y. enterocolitica mainly originate from swine, but fresh produce has been the source for widespread Y. pseudotuberculosis outbreaks within recent decades. A comparative genomic hybridization analysis with a DNA microarray based on three Yersinia enterocolitica and four Yersinia pseudotuberculosis genomes was conducted to shed light on the genomic differences between enteropathogenic Yersinia. The hybridization results identified Y. pseudotuberculosis strains to carry operons linked with the uptake and utilization of substances not found in living animal tissues but present in soil, plants, and rotting flesh. Y. pseudotuberculosis also harbors a selection of type VI secretion systems targeting other bacteria and eukaryotic cells. These genetic traits are not found in Y. enterocolitica, and it appears that while Y. pseudotuberculosis has many tools beneficial for survival in varied environments, the Y. enterocolitica genome is more streamlined and adapted to their preferred animal reservoir.

  1. Using stable isotopes and functional wood anatomy to identify underlying mechanisms of drought tolerance in different provenances of lodgepole pine

    Science.gov (United States)

    Isaac-Renton, Miriam; Montwé, David; Hamann, Andreas; Spiecker, Heinrich; Cherubini, Paolo; Treydte, Kerstin

    2016-04-01

    Choosing drought-tolerant seed sources for reforestation may help adapt forests to climate change. By combining dendroecological growth analysis with a long-term provenance trial, we assessed growth and drought tolerance of different populations of a wide-ranging conifer, lodgepole pine (Pinus contorta). This experimental design simulated a climate warming scenario through southward seed transfer, and an exceptional drought also occurred in 2002. We felled over 500 trees, representing 23 seed sources, which were grown for 32 years at three warm, dry sites in southern British Columbia, Canada. Northern populations showed poor growth and drought tolerance. These seed sources therefore appear to be especially at risk under climate change. Before recommending assisted migration of southern seeds towards the north, however, it is important to understand the physiological mechanisms underlying these responses. We combine functional wood anatomy with a dual-isotope approach to evaluate these mechanisms to drought response.

  2. Identifying differences in early literacy skills across subgroups of language-minority children: A latent profile analysis.

    Science.gov (United States)

    Lonigan, Christopher J; Goodrich, J Marc; Farver, JoAnn M

    2018-04-01

    Despite acknowledgment that language-minority children come from a wide variety of home language backgrounds and have a wide range of proficiency in their first (L1) and second (L2) languages, it is unknown whether differences across language-minority children in relative and absolute levels of proficiency in L1 and L2 predict subsequent development of literacy-related skills. The purpose of this study was to identify subgroups of language-minority children and evaluate whether differences in level and rate of growth of early literacy skills differed across subgroups. Five-hundred and twenty-six children completed measures of Spanish and English language and early literacy skills at the beginning, middle, and end of the preschool year. Latent growth models indicated that children's early literacy skills were increasing over the course of the preschool year. Latent profile analysis indicated that language-minority children could be classified into nine distinct groups, each with unique patterns of absolute and relative levels of proficiency in L1 and L2. Results of three-step mixture models indicated that profiles were closely associated with level of early literacy skills at the beginning of the preschool year. Initial level of early literacy skills was positively associated with growth in code-related skills (i.e., print knowledge, phonological awareness) and inversely associated with growth in language skills. These findings suggest that language-minority children are a diverse group with regard to their L1 and L2 proficiencies and that growth in early literacy skills is most associated with level of proficiency in the same language. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

  3. A novel screening method for cell wall mutants in Aspergillus niger identifies UDP-galactopyranose mutase as an important protein in fungal cell wall biosynthesis

    NARCIS (Netherlands)

    Damveld, R.A.; Franken, A.; Arentshorst, M.; Punt, P.J.; Klis, F.M.; van den Hondel, C.A.M.J.J.; Ram, A.F.J.

    2008-01-01

    To identify cell wall biosynthetic genes in filamentous fungi and thus potential targets for the discovery of new antifungals, we developed a novel screening method for cell wall mutants. It is based on our earlier observation that the Aspergillus niger agsA gene, which encodes a putative

  4. Gene expression profiling identifies FYN as an important molecule in tamoxifen resistance and a predictor of early recurrence in patients treated with endocrine therapy

    DEFF Research Database (Denmark)

    Elias, D; (Hansen) Vever, Henriette; Lænkholm, A-V

    2015-01-01

    To elucidate the molecular mechanisms of tamoxifen resistance in breast cancer, we performed gene array analyses and identified 366 genes with altered expression in four unique tamoxifen-resistant (TamR) cell lines vs the parental tamoxifen-sensitive MCF-7/S0.5 cell line. Most of these genes were...

  5. A novel screening method for cell wall mutants in Aspergillus niger identifies UDP-galactopyranose mutase as an important protein in fungal cell wall biosynthesis

    NARCIS (Netherlands)

    Damveld, R.A.; Franken, A.; Arentshorst, M.; Punt, P.J.; Klis, F.M.; Hondel, C.A.M.J.J. van den; Ram, A.F.J.

    2008-01-01

    To identify cell wall biosynthetic genes in filamentous fungi and thus potential targets for the discovery of new antifungals, we developed a novel screening method for cell wall mutants. It is based on our earlier observation that the Aspergillus niger agsA gene, which encodes a putative a-glucan

  6. Stability Constants of Some Biologically Important Pyrazoles and Their Ni2+ Complexes in Different Dielectric Constant of Medium

    Directory of Open Access Journals (Sweden)

    S. D. Deosarkar

    2012-01-01

    Full Text Available The proton-ligand stability constants of some biologically important new pyrazoles and formation constants of their complexes with Ni(II were determined at 0.1 mol dm-3 ionic strength and at 303.15 K in different dielectric constant of dioxane-water mixture by potentiometric method. The Calvin-Bjerrum's pH-titration technique as used by Irving and Rossotti was used for determination of stability constants. The results enabled to study the electrostatic forces of attraction between metal ion and ligand with changes in dielectric constant of the medium.

  7. Individual differences in the ability to identify, select and use appropriate frames of reference for perceptuo-motor control.

    Science.gov (United States)

    Isableu, B; Ohlmann, T; Cremieux, J; Vuillerme, N; Amblard, B; Gresty, M A

    2010-09-01

    The causes of the interindividual differences (IDs) in how we perceive and control spatial orientation are poorly understood. Here, we propose that IDs partly reflect preferred modes of spatial referencing and that these preferences or "styles" are maintained from the level of spatial perception to that of motor control. Two groups of experimental subjects, one with high visual field dependency (FD) and one with marked visual field independency (FI) were identified by the Rod and Frame Test, which identifies relative dependency on a visual frame of reference (VFoR). FD and FI subjects were tasked with standing still in conditions of increasing postural difficulty while visual cues of self-orientation (a visual frame tilted in roll) and self-motion (in stroboscopic illumination) were varied and in darkness to assess visual dependency. Postural stability, overall body orientation and modes of segmental stabilization relative to either external (space) or egocentric (adjacent segments) frames of reference in the roll plane were analysed. We hypothesized that a moderate challenge to balance should enhance subjects' reliance on VFoR, particularly in FD subjects, whereas a substantial challenge should constrain subjects to use a somatic-vestibular based FoR to prevent falling in which case IDs would vanish. The results showed that with increasing difficulty, FD subjects became more unstable and more disoriented shown by larger effects of the tilted visual frame on posture. Furthermore, their preference to coalign body/VFoR coordinate systems lead to greater fixation of the head-trunk articulation and stabilization of the hip in space, whereas the head and trunk remained more stabilized in space with the hip fixed on the leg in FI subjects. These results show that FD subjects have difficulties at identifying and/or adopting a more appropriate FoR based on proprioceptive and vestibular cues to regulate the coalignment of posturo/exocentric FoRs. The FI subjects' resistance

  8. Prevalence and Clinical Import of Thoracic Injury Identified by Chest Computed Tomography but Not Chest Radiography in Blunt Trauma: Multicenter Prospective Cohort Study.

    Science.gov (United States)

    Langdorf, Mark I; Medak, Anthony J; Hendey, Gregory W; Nishijima, Daniel K; Mower, William R; Raja, Ali S; Baumann, Brigitte M; Anglin, Deirdre R; Anderson, Craig L; Lotfipour, Shahram; Reed, Karin E; Zuabi, Nadia; Khan, Nooreen A; Bithell, Chelsey A; Rowther, Armaan A; Villar, Julian; Rodriguez, Robert M

    2015-12-01

    Chest computed tomography (CT) diagnoses more injuries than chest radiography, so-called occult injuries. Wide availability of chest CT has driven substantial increase in emergency department use, although the incidence and clinical significance of chest CT findings have not been fully described. We determine the frequency, severity, and clinical import of occult injury, as determined by changes in management. These data will better inform clinical decisions, need for chest CT, and odds of intervention. Our sample included prospective data (2009 to 2013) on 5,912 patients at 10 Level I trauma center EDs with both chest radiography and chest CT at physician discretion. These patients were 40.6% of 14,553 enrolled in the parent study who had either chest radiography or chest CT. Occult injuries were pneumothorax, hemothorax, sternal or greater than 2 rib fractures, pulmonary contusion, thoracic spine or scapula fracture, and diaphragm or great vessel injury found on chest CT but not on preceding chest radiography. A priori, we categorized thoracic injuries as major (having invasive procedures), minor (observation or inpatient pain control >24 hours), or of no clinical significance. Primary outcome was prevalence and proportion of occult injury with major interventions of chest tube, mechanical ventilation, or surgery. Secondary outcome was minor interventions of admission rate or observation hours because of occult injury. Two thousand forty-eight patients (34.6%) had chest injury on chest radiography or chest CT, whereas 1,454 of these patients (71.0%, 24.6% of all patients) had occult injury. Of these, in 954 patients (46.6% of injured, 16.1% of total), chest CT found injuries not observed on immediately preceding chest radiography. In 500 more patients (24.4% of injured patients, 8.5% of all patients), chest radiography found some injury, but chest CT found occult injury. Chest radiography found all injuries in only 29.0% of injured patients. Two hundred and two

  9. Differences in the structure of copepod assemblages in four tropical estuaries: Importance of pollution and the estuary hydrodynamics.

    Science.gov (United States)

    Araujo, Adriana V; Dias, Cristina O; Bonecker, Sérgio L C

    2017-02-15

    We examined the relationship between pollution and structure of copepod assemblages in estuaries, using sampling standardization of salinity range to reduce the effects of "Estuarine Quality Paradox". Copepod assemblages were analyzed in four Southeast Brazilian estuaries with different water quality levels and different hydrodynamic characteristics. The pollution negatively impacted the descriptors of the assemblage structure. The distribution of structure of copepod assemblages also showed a main separation trend between the most polluted estuaries and those less polluted. Temperature was the main factor affecting the assemblage structuring in the four estuaries. This factor acted in synergism with the effects of pollution impact and physical characteristics of the estuaries on the structure of copepod assemblages, supporting the potential vulnerability of coastal environments due to nutrient enrichment associated with climate change. Our study demonstrated the importance of sampling standardization of the salinity range in estuaries for reliable analysis of pollution effects on biota. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Lipidomic approach to identify patterns in phospholipid profiles and define class differences in mammary epithelial and breast cancer cells.

    Science.gov (United States)

    Dória, M Luísa; Cotrim, Zita; Macedo, Bárbara; Simões, Cláudia; Domingues, Pedro; Helguero, Luisa; Domingues, M Rosário

    2012-06-01

    Breast cancer is the leading cause of cancer-related deaths in women. Altered cellular functions of cancer cells lead to uncontrolled cellular growth and morphological changes. Cellular biomembranes are intimately involved in the regulation of cell signaling; however, they remain largely understudied. Phospholipids (PLs) are the main constituents of biological membranes and play important functional, structural and metabolic roles. The aim of this study was to establish if patterns in the PL profiles of mammary epithelial cells and breast cancer cells differ in relation to degree of differentiation and metastatic potential. For this purpose, PLs were analyzed using a lipidomic approach. In brief, PLs were extracted using Bligh and Dyer method, followed by a separation of PL classes by thin layer chromatography, and subsequent analysis by mass spectrometry (MS). Differences and similarities were found in the relative levels of PL content between mammary epithelial and breast cancer cells and between breast cancer cells with different levels of aggressiveness. When compared to the total PL content, phosphatidylcholine levels were reduced and lysophosphatydilcholines increased in the more aggressive cancer cells; while phosphatidylserine levels remained unchanged. MS analysis showed alterations in the classes of phosphatidylcholine, lysophosphatidylcholine, sphingomyelin, and phosphatidylinositides. In particular, the phosphatidylinositides, which are signaling molecules that affect proliferation, survival, and migration, showed dramatic alterations in their profile, where an increase of phosphatdylinositides saturated fatty acids chains and a decrease in C20 fatty acids in cancer cells compared with mammary epithelial cells was observed. At present, information about PL changes in cancer progression is lacking. Therefore, these data will be useful as a starting point to define possible PLs with prospective as biomarkers and disclose metabolic pathways with potential

  11. Imaging Flow Cytometry Analysis to Identify Differences of Survival Motor Neuron Protein Expression in Patients With Spinal Muscular Atrophy.

    Science.gov (United States)

    Arakawa, Reiko; Arakawa, Masayuki; Kaneko, Kaori; Otsuki, Noriko; Aoki, Ryoko; Saito, Kayoko

    2016-08-01

    Spinal muscular atrophy is a neurodegenerative disorder caused by the deficient expression of survival motor neuron protein in motor neurons. A major goal of disease-modifying therapy is to increase survival motor neuron expression. Changes in survival motor neuron protein expression can be monitored via peripheral blood cells in patients; therefore we tested the sensitivity and utility of imaging flow cytometry for this purpose. After the immortalization of peripheral blood lymphocytes from a human healthy control subject and two patients with spinal muscular atrophy type 1 with two and three copies of SMN2 gene, respectively, we used imaging flow cytometry analysis to identify significant differences in survival motor neuron expression. A bright detail intensity analysis was used to investigate differences in the cellular localization of survival motor neuron protein. Survival motor neuron expression was significantly decreased in cells derived from patients with spinal muscular atrophy relative to those derived from a healthy control subject. Moreover, survival motor neuron expression correlated with the clinical severity of spinal muscular atrophy according to SMN2 copy number. The cellular accumulation of survival motor neuron protein was also significantly decreased in cells derived from patients with spinal muscular atrophy relative to those derived from a healthy control subject. The benefits of imaging flow cytometry for peripheral blood analysis include its capacities for analyzing heterogeneous cell populations; visualizing cell morphology; and evaluating the accumulation, localization, and expression of a target protein. Imaging flow cytometry analysis should be implemented in future studies to optimize its application as a tool for spinal muscular atrophy clinical trials. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Use of stable isotopes to identify dietary differences across subpopulations and sex for a free-ranging generalist herbivore.

    Science.gov (United States)

    Walter, W David

    2014-01-01

    Carbon and nitrogen isotopes in tissues can be used to understand plants consumed by various taxa, but can they provide additional information about consumers? Values of δ(13)C and δ(15)N were assessed from tissue of free-ranging elk (Cervus elaphus) occupying disparate habitats of mixed prairie-oak savannah that contained C3 agricultural crops in a C4-dominated landscape and in key plants consumed by elk. Muscle and hoof samples were collected from female and male elk in two subpopulations (forested land and grassland) from private land and one subpopulation from the Wichita Mountains Wildlife Refuge (refuge) in 2001-2006. Previous research identified differences between mean muscle δ(13)C and δ(15)N and mean hoof δ(13)C and δ(15)N indicating that isotopes differed between tissues of varying metabolic activity. Mean δ(13)C in hoof of elk on forested land and grassland were lower than hoof δ(13)C from elk in the refuge indicating greater long-term consumption of C3 plants by elk on forested land and grassland subpopulations. The δ(15)N in hoof was greater for elk outside the refuge than that for elk in the refuge. Interaction of sex and subpopulation only occurred for hoof δ(15)N suggesting that factors such as tissue type, sex, and habitat need to be considered to understand free-ranging ecology of generalist herbivores using stable isotopes. Availability of C3 agricultural crops high in percent nitrogen on a nearly annual basis in a C4-dominated landscape was likely driving differences in tissue δ(13)C and δ(15)N among subpopulations of free-ranging elk. An increase in tissue δ(15)N resulted from an increase in the consumption of higher δ(15)N in forage for sexes and subpopulations of a free-ranging ungulate in North America but δ(15)N should be further evaluated as an index of nutrition for subpopulations of generalist herbivores.

  13. Comparison of Spot Urine Protein to Creatinine Ratio to 24-Hour Proteinuria to Identify Important Change Over Time in Proteinuria in Lupus.

    Science.gov (United States)

    Medina-Rosas, Jorge; Su, Jiandong; Cook, Richard J; Sabapathy, Arthy; Touma, Zahi

    2017-09-01

    The aim of this study was to determine whether spot urine protein-to-creatinine ratio (PCR) accurately measures the change in proteinuria compared with 24-hour proteinuria (24H-P). This was a retrospective analysis on patients' paired visits and paired urine samples for PCR and 24H-P. Patients with both abnormal 24H-P (>0.5 g/d) and PCR (>0.05 g/mmol) or both normal 24H-P (≤0.5 g/d) and PCR (≤0.05 g/mmol) at baseline visit were identified.The first follow-up visit with partial recovery (50% decrease in proteinuria) or complete recovery (≤0.5 g/d) was identified for those with abnormal baseline 24H-P, and new proteinuria (>0.5 g/d) was identified for those with normal 24H-P. Twenty-four-hour urine collection and PCR end-point frequencies were compared. Twenty-four-hour urine collection results were converted to 24H-PCR. Twenty-four-hour PCR and PCR were utilized to measure the magnitude of change (by standardized response mean [SRM]) in patients who achieved the end points. Of 230 patients, at baseline, 95 patients had abnormal and 109 had normal 24H-P and PCR. On follow-up, 57 achieved partial recovery, and 53 achieved complete recovery by 24H-P. Standardized response mean was -1.03 and -1.10 for 24H-PCR and PCR, respectively. By PCR, 53 patients had partial recovery, and 27 had complete recovery. Standardized response mean was -1.25 and -0.86 by 24H-PCR and PCR, respectively.For new proteinuria, 28 patients were identified by 24H-P and 21 by PCR. Twenty-four-hour PCR SRM was 0.80, and PCR SRM was 0.68. Protein-to-creatinine ratio does not have sufficient accuracy compared with 24H-P for improvement and worsening to be used in lieu of 24H-P.

  14. Identifying Differences Between Off-Highway Vehicle (OHV) and Non-OHV User Groups for Recreation Resource Planning

    Science.gov (United States)

    Kil, Namyun; Holland, Stephen M.; Stein, Taylor V.

    2012-09-01

    Off-highway vehicle (OHV) riding is among the fastest growing recreational activities in the United States. However, little research exists about the central components of outcomes-focused management (OFM) as it relates to motorized recreation. Utilizing a two-activity dichotomy, OHV and non-OHV centric user groups were compared on several key concepts associated with OFM, including desired experiences, perceived and desired recreation opportunity spectrum-type settings, and intentional behaviors (i.e., place-protective behavior, spending-time intentions) toward potential changes in settings. Results indicated that the two groups were different in terms of intensity and relative rankings of their perceived experiences and settings. Although both groups preferred social bonding, stress relief, nostalgia and learning experiences, the OHV user group ranked using equipment and achieving physical fitness experiences as more important than the non-OHV group. The non-OHV user group preferred enjoying nature and solitude/tranquility experiences more strongly than the OHV user group. Further analysis found that both groups perceived settings that they recreated in to be pristine and preferred such conditions, and both groups preferred moderate levels of rules and regulations. Finally, the OHV user group was more reactive to rules and regulations, while the non-OHV user group expressed stronger intentions to protect the environmental quality of recreation areas. The results suggest that planners and managers who understand OHV user's perceptions and behaviors could provide enhanced recreation opportunities potentially providing additional beneficial outcomes for motorized and non-motorized groups in spatially different zones. Additional implications for planners and managers and future studies are discussed.

  15. Relative importance of different exposure routes of heavy metals for humans living near a municipal solid waste incinerator

    International Nuclear Information System (INIS)

    Li, Tong; Wan, Yi; Ben, Yujie; Fan, Senrong; Hu, Jianying

    2017-01-01

    The potential health effects of toxic chemicals (e.g. heavy metals) emitted by municipal solid waste incinerators (MSWIs) are of great concern to local residents, however there have been few studies on the contributions of different exposure pathways and their subsequent effects on the body burden of residents living near MSWIs. In this study, multiple exposure routes of heavy metals including Pb, Cr, Cd and Mn were assessed by investigating the metals in foods (such as vegetables, crops, meats and fruits etc.), drinking water, ambient air and soil collected surrounding an MSWI in Shenzhen, south China. Vegetable ingestion played the most important role in the total average daily dose of Pb and Cr, and cereals were the key exposure routes for Mn and Cd. Compound-specific contaminations were observed in the investigated areas, with Pb and Cr present in the surrounding environment, having accumulated to relatively high levels in the local vegetables, and the intake of contaminated vegetable foods greatly influencing the body burden of Pb and Cr. Consistently, significantly high blood concentrations of Pb and Cr were detected in the local residents compared to a referenced population, and a lack of significant differences was found for Cd and Mn. The results possibly suggested that emission of MSWI influenced the external exposure doses of the major pathways of Pb and Cr in this study, and resulted in the different body burden of metals in humans living near a MSWI. MSWI-local food-humans is an important exposure pathway for residents living near MSWI, and thus should not be neglected in developing future strategies and policies to prevent the high risks suffered by residents living near MSWIs. - Highlights: • Vegetable and cereal ingestion were the main contributors to exposure of Pb/Cr and Mn/Cd, respectively. • Concentrations of Pb/Cr in vegetables grown near MSWI were significantly higher. • Blood concentrations of Pb/Cr in populations near MSWI were

  16. Regional Differences of Proteins Expressing in Adipose Depots Isolated from Cows, Steers and Bulls as Identified by a Proteomic Approach

    Directory of Open Access Journals (Sweden)

    Jin Hyoung Cho

    2016-08-01

    Full Text Available Adipose tissue in the loin muscle area of beef cattle as a marbling factor is directly associated with beef quality. To elucidate whether properties of proteins involved in depot specific adipose tissue were sex-dependent, we analyzed protein expression of intramuscular adipose tissue (IMAT and omental adipose tissue (OMAT from Hanwoo cows, steers, and bulls of Korean native beef cattle by liquid chromatography-tandem mass spectrometry (LC-MS/MS–based proteomic analysis, quantitative polymerase chain reaction (PCR and western blot analysis. Two different adipose depots (i.e. intramuscular and omental were collected from cows (n = 7, steers (n = 7, or bulls (n = 7. LC-MS/MS revealed a total of 55 and 35 proteins in IMAT and OMAT, respectively. Of the 55 proteins identified, 44, 40, and 42 proteins were confirmed to be differentially expressed in IMAT of cows, steers, and bulls, respectively. In OMAT of cows, steers, and bulls, 33, 33, and 22 were confirmed to be differentially expressed, respectively. Tropomyosin (TPM 1, TPM 2, and TPM3 were subjected to verification by quantitative PCR and western blot analysis in IMAT and OMAT of Hanwoo cows, steers, and bulls as key factors closely associated with muscle development. Both mRNA levels and protein levels of TPM1, TPM2, and TPM3 in IMAT were lower in bulls compared to in cows or steers suggesting that they were positively correlated with marbling score and quality grade. Our results may aid the regulation of marbling development and improvement of meat quality grades in beef cattle.

  17. Performance differences between male and female marines on standardized physical fitness tests and combat proxy tasks: identifying the gap.

    Science.gov (United States)

    Jameson, Jason; Pappa, Leon; McGuire, Brian; Kelly, Karen R

    2015-01-01

    For decades women have been restricted from direct assignment to certain military occupational specialties such as infantry. These restrictions can limit the advancement of women through the ranks of military leadership. Thus, the purpose of this effort was to identify those physical requirements most likely to serve as barriers for women wanting to enter closed combat arms positions, and to evaluate the quality of existing physical fitness tests as potential measures of assessment of combat readiness. Data were collected from 3 different sites within the US Marine Corps Training and Education Command. All participants (409 male, 379 femaile) were active-duty Marines who recently completed the Physical Fitness Test (PFT) and Combat Fitness Test (CFT). Participants completed 6 physical tasks: 120-mm tank loading drill, 155-mm artillery round carry, negotiating an obstacle course wall while wearing a fighting load (≈30 lb), pull-ups, deadlift, and clean and press. Overall, there was a high rate of successful completion on the combat proxy tasks (men, ≈80% to 100%; women, ≈70% to 100%), with the notable exception being the clean and press (men, 80%; women, 9%) and pull-ups (men, 16±4; women, 4±2). The PFT and CFT components tasks were also related, strongly in some cases, with performance on combat-related proxy tasks (Spearman's ρ typically ranged from 0.60 to 0.80). Estimates of fat-free mass and VO2max were also strongly related to an overall measure of combat readiness (Spearman's ρ=0.77 and ρ=0.56, respectively). The primary physical obstacle for women is upper body strength. However, some women could successfully complete all of the proxy tasks and thus are physically capable of meeting the demands of closed combat occupations. The fact that some female Marines could complete the most challenging upper body strength tasks suggests that these barriers are not inherent but may be due to a lack of training specificity.

  18. Environment and geographic distance differ in relative importance for determining fungal community of rhizosphere and bulk soil.

    Science.gov (United States)

    Zhang, Kaoping; Adams, Jonathan M; Shi, Yu; Yang, Teng; Sun, Ruibo; He, Dan; Ni, Yingying; Chu, Haiyan

    2017-09-01

    Rhizospheric fungi play major roles in both natural and agricultural ecosystems. However, little is known about the determinants of their diversity and biogeographic patterns. Here, we compared fungal communities in rhizosphere and bulk soils of wheat fields in the North China Plain. The rhizosphere had a lower fungal diversity (observed OTUs and Chao1) than bulk soil, and a distinct fungal community structure in rhizosphere compared with bulk soil. The relative importance of environmental factors and geographic distance for fungal distribution differed between rhizosphere and bulk soil. Environmental factors were the primary cause of variations in total fungal community and major fungal phyla in bulk soil. By contrast, fungal communities in soils loosely attached to roots were predictable from both environmental factors and influences of geographic distance. Communities in soils tightly attached to roots were mainly determined by geographic distance. Our results suggest that both contemporary environment processes (present-day abiotic and biotic environment characters) and historical processes (spatial isolation, dispersal limitation occurred in the past) dominate variations of fungal communities in wheat fields, but their relative importance of all these processes depends on the proximity of fungal community to the plant roots. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  19. Post-hoc principal component analysis on a largely illiterate elderly population from North-west India to identify important elements of mini-mental state examination

    Directory of Open Access Journals (Sweden)

    Sunil Kumar Raina

    2016-01-01

    Full Text Available Background: Mini-mental state examination (MMSE scale measures cognition using specific elements that can be isolated, defined, and subsequently measured. This study was conducted with the aim to analyze the factorial structure of MMSE in a largely, illiterate, elderly population in India and to reduce the number of variables to a few meaningful and interpretable combinations. Methodology: Principal component analysis (PCA was performed post-hoc on the data generated by a research project conducted to estimate the prevalence of dementia in four geographically defined habitations in Himachal Pradesh state of India. Results: Questions on orientation and registration account for high percentage of cumulative variance in comparison to other questions. Discussion: The PCA conducted on the data derived from a largely, illiterate population reveals that the most important components to consider for the estimation of cognitive impairment in illiterate Indian population are temporal orientation, spatial orientation, and immediate memory.

  20. Post-hoc principal component analysis on a largely illiterate elderly population from North-west India to identify important elements of mini-mental state examination.

    Science.gov (United States)

    Raina, Sunil Kumar; Chander, Vishav; Raina, Sujeet; Grover, Ashoo

    2016-01-01

    Mini-mental state examination (MMSE) scale measures cognition using specific elements that can be isolated, defined, and subsequently measured. This study was conducted with the aim to analyze the factorial structure of MMSE in a largely, illiterate, elderly population in India and to reduce the number of variables to a few meaningful and interpretable combinations. Principal component analysis (PCA) was performed post-hoc on the data generated by a research project conducted to estimate the prevalence of dementia in four geographically defined habitations in Himachal Pradesh state of India. Questions on orientation and registration account for high percentage of cumulative variance in comparison to other questions. The PCA conducted on the data derived from a largely, illiterate population reveals that the most important components to consider for the estimation of cognitive impairment in illiterate Indian population are temporal orientation, spatial orientation, and immediate memory.

  1. Importance of growth characteristics for yield of barley in different growing systems: will growth characteristics describe yield diffently in different growing systems?

    DEFF Research Database (Denmark)

    Kristensen, Kristian; Ericson, Lars

    2008-01-01

    The interest in organic grown cereals has increased the need for variety tests under organic growing systems and/or the knowledge on whether growth characteristics describe yield differently under conventional and organic conditions. This paper is a contribution to that question by examining...... the relationships between some important growth characteristics in barley trials in both systems in Northern Sweden and in Denmark. Mixed model analyses were used for regressions of growth characteristics (or transformations of those) on yield (and log-transformed yield), allowing the slope to depend on the growing...... system. The analyses showed that diseases seemed to have a less negative effect on yield in the organic growing system than in the conventional growing system if pesticides were not applied. For other characteristics the effect depended on the country. This was the case for grain characteristics where...

  2. Improving a full-text search engine: the importance of negation detection and family history context to identify cases in a biomedical data warehouse.

    Science.gov (United States)

    Garcelon, Nicolas; Neuraz, Antoine; Benoit, Vincent; Salomon, Rémi; Burgun, Anita

    2017-05-01

    The repurposing of electronic health records (EHRs) can improve clinical and genetic research for rare diseases. However, significant information in rare disease EHRs is embedded in the narrative reports, which contain many negated clinical signs and family medical history. This paper presents a method to detect family history and negation in narrative reports and evaluates its impact on selecting populations from a clinical data warehouse (CDW). We developed a pipeline to process 1.6 million reports from multiple sources. This pipeline is part of the load process of the Necker Hospital CDW. We identified patients with "Lupus and diarrhea," "Crohn's and diabetes," and "NPHP1" from the CDW. The overall precision, recall, specificity, and F-measure were 0.85, 0.98, 0.93, and 0.91, respectively. The proposed method generates a highly accurate identification of cases from a CDW of rare disease EHRs. © The Author 2016. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  3. Importance of sports during youth and exercise barriers in 20- to 29-year-old male nonathletes differently motivated for regular physical activities.

    Science.gov (United States)

    Leyk, Dieter; Witzki, Alexander; Sievert, Alexander; Rohde, Ulrich; Moedl, Anne; Rüther, Thomas; Löllgen, Herbert; Hackfort, Dieter

    2012-07-01

    The number of sedentary young adults has dramatically increased in past decades, and sedentary lifestyles are adopted at an increasingly earlier age. Little is known about barriers or predictors to (re)initiate regular physical activity in this group. The purpose of the study is to (a) identify subgroups in nonathletes differing in their amenability to physical exercise, (b) to analyze them for differences in barriers and intention to exercise, and (c) compare importance of sports during youth in nonathletes to trained peers. Using a health and fitness questionnaire 589 nonathletes were queried in the cross-sectional survey and compared with 270 trained peers. Athletic abstainers (A), lower (L), and higher (H) motivated nonathletes were separated based on previous engagement in sports. Of the nonathletes, 54.7% reported only 1 barrier to exercise. Although this feature was most prominent in H (71.5%), the other groups showed significantly more barriers and a broader distribution. Similar characteristics but minor differences were observed for perceived importance of sports during youth. The most significant differences between athletes and nonathletes emerged enquiring the attitude and activity of the parents. The majority of nonathletes (72.8%) indicate their intention to exercise in the future. Their intention differed significantly in H (88.1%), L (76.1%), and A (59.1%). However, there are good reasons to doubt that most of those intending nonathletes will actually become physically active. Even in the analyzed narrow age range of men different motivated groups of nonathletes were found. Because of the differences in receptiveness and approachability health promotion policies may not only consider the often recommended tailored interventions but also carefully designed incentive programs.

  4. Mortality risk and social network position in resident killer whales: sex differences and the importance of resource abundance.

    Science.gov (United States)

    Ellis, S; Franks, D W; Nattrass, S; Cant, M A; Weiss, M N; Giles, D; Balcomb, K C; Croft, D P

    2017-10-25

    An individual's ecological environment affects their mortality risk, which in turn has fundamental consequences for life-history evolution. In many species, social relationships are likely to be an important component of an individual's environment, and therefore their mortality risk. Here, we examine the relationship between social position and mortality risk in resident killer whales ( Orcinus orca ) using over three decades of social and demographic data. We find that the social position of male, but not female, killer whales in their social unit predicts their mortality risk. More socially integrated males have a significantly lower risk of mortality than socially peripheral males, particularly in years of low prey abundance, suggesting that social position mediates access to resources. Male killer whales are larger and require more resources than females, increasing their vulnerability to starvation in years of low salmon abundance. More socially integrated males are likely to have better access to social information and food-sharing opportunities which may enhance their survival in years of low salmon abundance. Our results show that observable variation in the social environment is linked to variation in mortality risk, and highlight how sex differences in social effects on survival may be linked to sex differences in life-history evolution. © 2017 The Authors.

  5. Differences in attentional functioning between preterm and full-term children underline the importance of new neuropsychological detection techniques.

    Science.gov (United States)

    Giordano, V; Fuiko, R; Leiss, U; Brandstetter, S; Hayde, M; Bartha-Doering, E; Klebermaß-Schrehof, K; Weiler, L J

    2017-04-01

    The aim of this study was to investigate specific attentional components in preterm born children who had not yet started school. Between January and December 2011, we assessed 52 preterm and 52 full-term children aged between five years five months and six years two months, of comparable age and gender, at the Medical University of Vienna. Different attentional components were evaluated through selected subtests of the Test of Attentional Performance and the German version of the Wechsler Intelligence Scale for Children. Each child's behaviour was also evaluated using parental ratings and descriptive item-based evaluation during neuropsychological assessment. Children born preterm showed poor attentional performance in sustained attention, focused attention and distractibility, as well as reductions in processing speed in divided attention and flexibility tasks. Children born preterm also showed decreased volitional attention compared with automatic attention. No problems were detected in alertness or inhibition. In addition, a higher rate of aborted tests, decreased motivation and poorer parental ratings were detected among the preterm population compared with full-term born children. Our results highlighted differences in attentional functioning between preterm and full-term children, indicating the importance of new neuropsychological techniques for the detection of specific attentional disorders. ©2016 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

  6. Elastic vesicles for transdermal drug delivery of hydrophilic drugs: a comparison of important physicochemical characteristics of different vesicle types.

    Science.gov (United States)

    Ntimenou, Vassiliki; Fahr, Alfred; Antimisiaris, Sophia G

    2012-08-01

    The aim of this study is to evaluate the influence of different lipid vesicular systems on the skin permeation ability of hydrophilic molecules, and understand if and which vesicle physicochemical properties may be used as predictive tools. Calcein and carboxyfluorescein were used as hydrophilic drug models. All vesicles (conventional liposomes [CLs], transfersomes [TRs] and invasomes [INVs]), were characterized for particle size distribution, zeta-potential, vesicular shape and morphology, encapsulation efficiency, integrity, colloidal stability, elasticity and finally in vitro human skin permeation. Dynamic light scattering (DLS) and cryo-transmission electron microscopy (cryo-TEM) defined that almost all vesicles had spherical structure, low polydispersity (PI Elasticity values (measured by extrusion through membranes) were in the order INVs > TRs > CLs. Three vesicle types were selected (having different elasticity) and in vitro skin permeation experiments demonstrated that calcein permeation was minimal from an aqueous solution, slightly enhanced from CLs, and enhanced by 1.8 and 7.2 times from TRs and INVs, respectively. Permeation and elasticity values were correlated by rank order but not linearly, indicating that elasticity can be used as a crude predictive tool for enhancement of skin transport. Drug encapsulation efficiency was not found to be an important factor in the current study.

  7. Importance of stress-response genes to the survival of airborne Escherichia coli under different levels of relative humidity.

    Science.gov (United States)

    Ng, Tsz Wai; Chan, Wing Lam; Lai, Ka Man

    2017-12-01

    Other than the needs for infection control to investigate the survival and inactivation of airborne bacterial pathogens, there has been a growing interest in exploring bacterial communities in the air and the effect of environmental variables on them. However, the innate biological mechanism influencing the bacterial viability is still unclear. In this study, a mutant-based approach, using Escherichia coli as a model, was used to prove the concept that common stress-response genes are important for airborne survival of bacteria. Mutants with a single gene knockout that are known to respond to general stress (rpoS) and oxidative stress (oxyR, soxR) were selected in the study. Low relative humidity (RH), 30-40% was more detrimental to the bacteria than high RH, >90%. The log reduction of ∆rpoS was always higher than that of the parental strain at all RH levels but the ∆oxyR had a higher log reduction than the parental strain at intermediate RH only. ∆soxR had the same viability compared to the parental strain at all RH levels. The results hint that although different types and levels of stress are produced under different RH conditions, stress-response genes always play a role in the bacterial viability. This study is the first reporting the association between stress-response genes and viability of airborne bacteria.

  8. Proteome analysis identifies the Dpr protein of Streptococcus mutans as an important factor in the presence of early streptococcal colonizers of tooth surfaces.

    Directory of Open Access Journals (Sweden)

    Akihiro Yoshida

    Full Text Available Oral streptococci are primary colonizers of tooth surfaces and Streptococcus mutans is the principal causative agent of dental caries in humans. A number of proteins are involved in the formation of monospecies biofilms by S. mutans. This study analyzed the protein expression profiles of S. mutans biofilms formed in the presence or absence of S. gordonii, a pioneer colonizer of the tooth surface, by two-dimensional gel electrophoresis (2-DE. After identifying S. mutans proteins by Mass spectrometric analysis, their expression in the presence of S. gordonii was analyzed. S. mutans was inoculated with or without S. gordonii DL1. The two species were compartmentalized using 0.2-μl Anopore membranes. The biofilms on polystyrene plates were harvested, and the solubilized proteins were separated by 2-DE. When S. mutans biofilms were formed in the presence of S. gordonii, the peroxide resistance protein Dpr of the former showed 4.3-fold increased expression compared to biofilms that developed in the absence of the pioneer colonizer. In addition, we performed a competition assay using S. mutans antioxidant protein mutants together with S. gordonii and other initial colonizers. Growth of the dpr-knockout S. mutans mutant was significantly inhibited by S. gordonii, as well as by S. sanguinis. Furthermore, a cell viability assay revealed that the viability of the dpr-defective mutant was significantly attenuated compared to the wild-type strain when co-cultured with S. gordonii. Therefore, these results suggest that Dpr might be one of the essential proteins for S. mutans survival on teeth in the presence of early colonizing oral streptococci.

  9. Proteome Analysis Identifies the Dpr Protein of Streptococcus mutans as an Important Factor in the Presence of Early Streptococcal Colonizers of Tooth Surfaces

    Science.gov (United States)

    Yoshida, Akihiro; Niki, Mamiko; Yamamoto, Yuji; Yasunaga, Ai; Ansai, Toshihiro

    2015-01-01

    Oral streptococci are primary colonizers of tooth surfaces and Streptococcus mutans is the principal causative agent of dental caries in humans. A number of proteins are involved in the formation of monospecies biofilms by S. mutans. This study analyzed the protein expression profiles of S. mutans biofilms formed in the presence or absence of S. gordonii, a pioneer colonizer of the tooth surface, by two-dimensional gel electrophoresis (2-DE). After identifying S. mutans proteins by Mass spectrometric analysis, their expression in the presence of S. gordonii was analyzed. S. mutans was inoculated with or without S. gordonii DL1. The two species were compartmentalized using 0.2-μl Anopore membranes. The biofilms on polystyrene plates were harvested, and the solubilized proteins were separated by 2-DE. When S. mutans biofilms were formed in the presence of S. gordonii, the peroxide resistance protein Dpr of the former showed 4.3-fold increased expression compared to biofilms that developed in the absence of the pioneer colonizer. In addition, we performed a competition assay using S. mutans antioxidant protein mutants together with S. gordonii and other initial colonizers. Growth of the dpr-knockout S. mutans mutant was significantly inhibited by S. gordonii, as well as by S. sanguinis. Furthermore, a cell viability assay revealed that the viability of the dpr-defective mutant was significantly attenuated compared to the wild-type strain when co-cultured with S. gordonii. Therefore, these results suggest that Dpr might be one of the essential proteins for S. mutans survival on teeth in the presence of early colonizing oral streptococci. PMID:25816242

  10. Proteomic analysis identifies mitochondrial metabolic enzymes as major discriminators between different stages of the failing human myocardium

    DEFF Research Database (Denmark)

    Urbonavicius, Sigitas; Wiggers, Henrik; Bøtker, Hans Erik

    2009-01-01

    Our aim was to identify patterns in differentially regulated proteins associated with the progression of chronic heart failure. We specifically studied proteomics in chronic reversibly (RDM) and irreversibly dysfunctional myocardium (IRDM), as well as end-stage failing myocardium (ESFM).......Our aim was to identify patterns in differentially regulated proteins associated with the progression of chronic heart failure. We specifically studied proteomics in chronic reversibly (RDM) and irreversibly dysfunctional myocardium (IRDM), as well as end-stage failing myocardium (ESFM)....

  11. Cross-sectional study to identify staphylococcal species isolated from teat and inguinal skin of different-aged dairy heifers.

    Science.gov (United States)

    Adkins, P R F; Dufour, S; Spain, J N; Calcutt, M J; Reilly, T J; Stewart, G C; Middleton, J R

    2018-04-01

    The purpose of this study was to describe the prevalence and distribution of staphylococcal species on the teat and inguinal skin of dairy heifers across the various stages of the heifer life cycle. The cross-sectional study included 106 Holstein heifers with an age range of 0 d to 27 mo that were selected from 11 different groups, based on housing type and age, on a single dairy operation. A composite swabbing sample including all 4 teats and a second composite sample including both inguinal regions of each heifer were collected using gas-sterilized electrostatic dusters (Swiffers; Procter and Gamble, Cincinnati, OH). Swabbing samples were mixed with 10 mL of sterile saline, agitated, and cultured on mannitol salt agar plates. At 24 h, plates were read and up to 10 staphylococcal colonies were saved for further analysis. Staphylococcal isolates were speciated using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry or PCR amplification and partial sequencing of rpoB or tuf. The prevalence of staphylococci was compared between the inguinal and teat regions using the chi-squared or Fisher's exact test, as applicable. Logistic regression models were used to investigate the relationship between a heifer's age (treated as a quantitative continuous variable) and the probability of isolating a given staphylococcal species from a given body site (inguinal region or teats). Overall, the most common species identified were Staphylococcus haemolyticus followed by Staphylococcus chromogenes, Staphylococcus xylosus, Staphylococcus devriesei, and Staphylococcus sciuri. Staphylococcus aureus was more prevalent on the teat than in the inguinal region, whereas Staphylococcus arlettae was more prevalent in the inguinal region than on the teat. All other staphylococcal species were as likely to be found on the teat skin as the inguinal region skin. Isolation from the inguinal and teat skin was associated with age for Staphylococcus agnetis, S. chromogenes

  12. Foxtail millet NF-Y families: genome-wide survey and evolution analyses identified two functional genes important in abiotic stresses

    Directory of Open Access Journals (Sweden)

    Zhi-Juan eFeng

    2015-12-01

    Full Text Available It was reported that Nuclear Factor Y (NF-Y genes were involved in abiotic stress in plants. Foxtail millet (Setaria italica, an elite stress tolerant crop, provided an impetus for the investigation of the NF-Y families in abiotic responses. In the present study, a total of 39 NF-Y genes were identified in foxtail millet. Synteny analyses suggested that foxtail millet NF-Y genes had experienced rapid expansion and strong purifying selection during the process of plant evolution. De novo transcriptome assembly of foxtail millet revealed 11 drought up-regulated NF-Y genes. SiNF-YA1 and SiNF-YB8 were highly activated in leaves and/or roots by drought and salt stresses. Abscisic acid (ABA and H2O2 played positive roles in the induction of SiNF-YA1 and SiNF-YB8 under stress treatments. Transient luciferase (LUC expression assays revealed that SiNF-YA1 and SiNF-YB8 could activate the LUC gene driven by the tobacco (Nicotiana tobacam NtERD10, NtLEA5, NtCAT, NtSOD or NtPOD promoter under normal or stress conditions. Overexpression of SiNF-YA1 enhanced drought and salt tolerance by activating stress-related genes NtERD10 and NtCAT1 and by maintaining relatively stable relative water content (RWC and contents of chlorophyll, superoxide dismutase (SOD, peroxidase (POD, catalase (CAT and malondialdehyde (MDA in transgenic lines under stresses. SiNF-YB8 regulated expression of NtSOD, NtPOD, NtLEA5 and NtERD10 and conferred relatively high RWC and chlorophyll contents and low MDA content, resulting in drought and osmotic tolerance in transgenic lines under stresses. Therefore, SiNF-YA1 and SiNF-YB8 could activate stress-related genes and improve physiological traits, resulting in tolerance to abiotic stresses in plants. All these results will facilitate functional characterization of foxtail millet NF-Ys in future studies.

  13. Effects of Different Models of Dialysis Care on Patient-Important Outcomes: A Systematic Review and Meta-Analysis.

    Science.gov (United States)

    Ramar, Priya; Ahmed, Ahmed T; Wang, Zhen; Chawla, Sagar S; Suarez, Maria Lourdes Gonzalez; Hickson, LaTonya J; Farrell, Ann; Williams, Amy W; Shah, Nilay D; Murad, M Hassan; Thorsteinsdottir, Bjorg

    2017-12-01

    Ongoing payment reform in dialysis necessitates better patient outcomes and lower costs. Suggested improvements to processes of care for maintenance dialysis patients are abundant; however, their impact on patient-important outcomes is unclear. This systematic review included comparative randomized controlled trials or observational studies with no restriction on language, published from 2000 to 2014, involving at least 5 adult dialysis patients who received a minimum of 6 months of follow-up. The effect size was pooled and stratified by intervention strategy (multidisciplinary care [MDC], home dialysis, alternate dialysis settings, and electronic health record implementation). Heterogeneity (I 2 ) was used to assess the variability in study effects related to study differences rather than chance. Of the 1988 articles screened, 25 international studies with 74,833 maintenance dialysis patients were included. Interventions with MDC or home dialysis were associated with a lower mortality (hazard ratio [HR] = 0.72, 95% confidence interval [CI] 0.61, 0.84, I 2  = 41.6%; HR = 0.57, 95% CI 0.41, 0.81, I 2  = 89.0%; respectively) and hospitalizations (incidence rate ratio [IRR] = 0.68, 95% CI 0.51, 0.91, I 2  = NA; IRR = 0.88, 95% CI 0.64, 1.20, I 2  = 79.6%; respectively). Alternate dialysis settings also were associated with a reduction in hospitalizations (IRR = 0.41, 95% CI 0.25, 0.69, I 2  = 0.0%). This systematic review underscores the importance of multidisciplinary care, and also the value of telemedicine as a means to increase access to providers and enhance outcomes for those dialyzing at home or in alternate settings, including those with limited access to nephrology expertise because of travel distance.

  14. Identifying important life stages for monitoring and assessing risks from exposures to environmental contaminants: results of a World Health Organization review.

    Science.gov (United States)

    Cohen Hubal, Elaine A; de Wet, Thea; Du Toit, Lilo; Firestone, Michael P; Ruchirawat, Mathuros; van Engelen, Jacqueline; Vickers, Carolyn

    2014-06-01

    In this paper, we summarize exposure-related issues to consider in determining the most appropriate age ranges and life stages for risk assessment. We then propose a harmonized set of age bins for monitoring and assessing risks from exposures to chemicals for global use. The focus is on preconception through adolescence, though the approach should be applicable to additional life stages. A two-tiered set of early life age groups is recommended. The first tier involves the adoption of guidance similar to the childhood age groups recommended by the U.S. Environmental Protection Agency, whereas the second tier consolidates some of those age groups to reduce the burden of developing age-specific exposure factors for different regions. While there is no single "correct" means of choosing a common set of age groups to use internationally in assessing early life exposure and risk, use of a set of defined age groups is recommended to facilitate comparisons of potential exposures and risks around the globe, the collection of data and analyses of aggregate exposure and cumulative risk. Application of these age groups for robust assessment of exposure and risk for specific populations will require region-specific exposure factors as well as local environmental monitoring data. Copyright © 2013 World Health Organization. Published by Elsevier Inc. All rights reserved.

  15. Validity, responsiveness, and minimal clinically important difference of EQ-5D-5L in stroke patients undergoing rehabilitation.

    Science.gov (United States)

    Chen, Poyu; Lin, Keh-Chung; Liing, Rong-Jiuan; Wu, Ching-Yi; Chen, Chia-Ling; Chang, Ku-Chou

    2016-06-01

    To examine the criterion validity, responsiveness, and minimal clinically important difference (MCID) of the EuroQoL 5-Dimensions Questionnaire (EQ-5D-5L) and visual analog scale (EQ-VAS) in people receiving rehabilitation after stroke. The EQ-5D-5L, along with four criterion measures-the Medical Research Council scales for muscle strength, the Fugl-Meyer assessment, the functional independence measure, and the Stroke Impact Scale-was administered to 65 patients with stroke before and after 3- to 4-week therapy. Criterion validity was estimated using the Spearman correlation coefficient. Responsiveness was analyzed by the effect size, standardized response mean (SRM), and criterion responsiveness. The MCID was determined by anchor-based and distribution-based approaches. The percentage of patients exceeding the MCID was also reported. Concurrent validity of the EQ-Index was better compared with the EQ-VAS. The EQ-Index has better power for predicting the rehabilitation outcome in the activities of daily living than other motor-related outcome measures. The EQ-Index was moderately responsive to change (SRM = 0.63), whereas the EQ-VAS was only mildly responsive to change. The MCID estimation of the EQ-Index (the percentage of patients exceeding the MCID) was 0.10 (33.8 %) and 0.10 (33.8 %) based on the anchor-based and distribution-based approaches, respectively, and the estimation of EQ-VAS was 8.61 (41.5 %) and 10.82 (32.3 %). The EQ-Index has shown reasonable concurrent validity, limited predictive validity, and acceptable responsiveness for detecting the health-related quality of life in stroke patients undergoing rehabilitation, but not for EQ-VAS. Future research considering different recovery stages after stroke is warranted to validate these estimations.

  16. Important patient characteristics differ prior to total knee arthroplasty and total hip arthroplasty between Switzerland and the United States.

    Science.gov (United States)

    Franklin, Patricia D; Miozzari, Hermes; Christofilopoulos, Panayiotis; Hoffmeyer, Pierre; Ayers, David C; Lübbeke, Anne

    2017-01-11

    Outcomes after total knee (TKA) and hip (THA) arthroplasty are often generalized internationally. Patient-dependent factors and preoperative symptom levels may differ across countries. We compared preoperative patient and clinical characteristics from two large cohorts, one in Switzerland, the other in the US. Patient characteristics were collected prospectively on all elective primary TKAs and THAs performed at a large Swiss hospital and in a US national sample. Data included age, sex, education level, BMI, diagnosis, medical co-morbidities, PROMs (WOMAC pain/function), global health (SF-12). Six thousand six hundred eighty primary TKAs (US) and 823 TKAs (Swiss) were evaluated. US vs. Switzerland TKA patients were younger (mean age 67 vs. 72 years.), more obese (BMI ≥30 55% vs. 43%), had higher levels of education, more cardiac disease. Swiss patients had lower preoperative WOMAC pain scores (41 vs. 52) but pre-operative physical disability were comparable. 4,647 primary THAs (US) and 1,023 THAs (Swiss) were evaluated. US vs. Switzerland patients were younger (65 vs. 68 years.), more obese (BMI ≥30: 38% vs. 24%), had higher levels of education, more diabetes. Swiss patients had lower preoperative WOMAC pain scores (40 vs. 48 points). Physical disability was reported comparable, but Swiss patients indicated lower mental health scores. We found substantial differences between US and Swiss cohorts in pre-operative patient characteristics and pain levels, which has potentially important implications for cross-cultural comparison of TKA/THA outcomes. Reports from national registries lack detailed patient information while these data suggest the need for adequate risk adjustment of patient factors.

  17. The German version of the Expanded Prostate Cancer Index Composite (EPIC): translation, validation and minimal important difference estimation.

    Science.gov (United States)

    Umbehr, Martin H; Bachmann, Lucas M; Poyet, Cedric; Hammerer, Peter; Steurer, Johann; Puhan, Milo A; Frei, Anja

    2018-02-20

    No official German translation exists for the 50-item Expanded Prostate Cancer Index Composite (EPIC), and no minimal important difference (MID) has been established yet. The aim of the study was to translate and validate a German version of the EPIC with cultural adaptation to the different German speaking countries and to establish the MID. We translated and culturally adapted the EPIC into German. For validation, we included a consecutive subsample of 92 patients with localized prostate cancer undergoing radical prostatectomy who participated the Prostate Cancer Outcomes Cohort. Baseline and follow-up assessments took place before and six weeks after prostatectomy in 2010 and 2011. We assessed the EPIC, EORTC QLQ-PR25, Feeling Thermometer, SF-36 and a global rating of health state change variable. We calculated the internal consistency, test-retest reliability, construct validity, responsiveness and MID. For most EPIC domains and subscales, our a priori defined criteria for reliability were fulfilled (construct reliability: Cronbach's alpha 0.7-0.9; test-retest reliability: intraclass-correlation coefficient ≥ 0.7). Cross-sectional and longitudinal correlations between EPIC and EORTC QLQ-PR25 domains ranged from 0.14-0.79, and 0.06-0.5 and 0.08-0.72 for Feeling Thermometer and SF-36, respectively. We established MID values of 10, 4, 12, and 6 for the urinary, bowel, sexual and hormonal domain. The German version of the EPIC is reliable, responsive and valid to measure HRQL in prostate cancer patients and is now available in German language. With the suggested MID we provide interpretation to what extent changes in HRQL are clinically relevant for patients. Hence, study results are of interest beyond German speaking countries.

  18. Determining the minimal clinically important difference and responsiveness of the Dermatology Life Quality Index (DLQI): further data.

    Science.gov (United States)

    Basra, M K A; Salek, M S; Camilleri, L; Sturkey, R; Finlay, A Y

    2015-01-01

    To determine the minimal clinically important difference (MCID) of the Dermatology Life Quality Index (DLQI) and its responsiveness to change in inflammatory skin diseases. A longitudinal study: at stage 1, patients completed the DLQI and a disease severity global question; at stage 2, a global rating of change in quality of life (QoL; Global Rating of Change Questionnaire, GRCQ) was added and used as an anchor to measure the MCID of the DLQI. 192 patients completed stage 1 and 107 completed stage 2. The mean DLQI score at stage 1 was 9.8 and 7.4 at stage 2 with a mean change of 2.4 (p < 0.0001). 31 patients experienced a 'small change' in their QoL (±3 and ±2) on the GRCQ. The mean corresponding change in DLQI scores was 3.3, which is regarded as the approximate MCID. Previous estimates of the MCID of the DLQI have varied from 3 to 5. Although this study demonstrated a MCID of 3.3, we recommend that the MCID in inflammatory skin diseases should be 4. © 2015 S. Karger AG, Basel.

  19. Defining the minimal important difference for the visual analogue scale assessing dyspnea in patients with malignant pleural effusions.

    Directory of Open Access Journals (Sweden)

    Eleanor K Mishra

    Full Text Available The minimal important difference (MID is essential for interpreting the results of randomised controlled trials (RCTs. Despite a number of RCTs in patients with malignant pleural effusions (MPEs which use the visual analogue scale for dyspnea (VASD as an outcome measure, the MID has not been established.Patients with suspected MPE undergoing a pleural procedure recorded their baseline VASD and their post-procedure VASD (24 hours after the pleural drainage, and in parallel assessed their breathlessness on a 7 point Likert scale.The mean decrease in VASD in patients with a MPE reporting a 'small but just worthwhile decrease' in their dyspnea (i.e. equivalent to the MID was 19mm (95% CI 14-24mm. The mean drainage volume required to produce a change in VASD of 19mm was 760ml.The mean MID for the VASD in patients with a MPE undergoing a pleural procedure is 19mm (95% CI 14-24mm. Thus choosing an improvement of 19mm in the VASD would be justifiable in the design and analysis of future MPE studies.

  20. Defining the minimum clinically important difference for grade I degenerative lumbar spondylolisthesis: insights from the Quality Outcomes Database.

    Science.gov (United States)

    Asher, Anthony L; Kerezoudis, Panagiotis; Mummaneni, Praveen V; Bisson, Erica F; Glassman, Steven D; Foley, Kevin T; Slotkin, Jonathan; Potts, Eric A; Shaffrey, Mark E; Shaffrey, Christopher I; Coric, Domagoj; Knightly, John J; Park, Paul; Fu, Kai-Ming; Devin, Clinton J; Archer, Kristin R; Chotai, Silky; Chan, Andrew K; Virk, Michael S; Bydon, Mohamad

    2018-01-01

    OBJECTIVE Patient-reported outcomes (PROs) play a pivotal role in defining the value of surgical interventions for spinal disease. The concept of minimum clinically important difference (MCID) is considered the new standard for determining the effectiveness of a given treatment and describing patient satisfaction in response to that treatment. The purpose of this study was to determine the MCID associated with surgical treatment for degenerative lumbar spondylolisthesis. METHODS The authors queried the Quality Outcomes Database registry from July 2014 through December 2015 for patients who underwent posterior lumbar surgery for grade I degenerative spondylolisthesis. Recorded PROs included scores on the Oswestry Disability Index (ODI), EQ-5D, and numeric rating scale (NRS) for leg pain (NRS-LP) and back pain (NRS-BP). Anchor-based (using the North American Spine Society satisfaction scale) and distribution-based (half a standard deviation, small Cohen's effect size, standard error of measurement, and minimum detectable change [MDC]) methods were used to calculate the MCID for each PRO. RESULTS A total of 441 patients (80 who underwent laminectomies alone and 361 who underwent fusion procedures) from 11 participating sites were included in the analysis. The changes in functional outcome scores between baseline and the 1-year postoperative evaluation were as follows: 23.5 ± 17.4 points for ODI, 0.24 ± 0.23 for EQ-5D, 4.1 ± 3.5 for NRS-LP, and 3.7 ± 3.2 for NRS-BP. The different calculation methods generated a range of MCID values for each PRO: 3.3-26.5 points for ODI, 0.04-0.3 points for EQ-5D, 0.6-4.5 points for NRS-LP, and 0.5-4.2 points for NRS-BP. The MDC approach appeared to be the most appropriate for calculating MCID because it provided a threshold greater than the measurement error and was closest to the average change difference between the satisfied and not-satisfied patients. On subgroup analysis, the MCID thresholds for laminectomy-alone patients were

  1. Subtle differences in molecular recognition between modified glycopeptide antibiotics and bacterial receptor peptides identified by electrospray ionization mass spectrometry

    DEFF Research Database (Denmark)

    Jørgensen, Thomas J. D.; Staroske, T; Roepstorff, P

    1999-01-01

    showing that electrospray ionization mass spectrometry (ESI-MS) can be used in the rapid quantitative analysis of mixtures of vancomycin-group antibiotics and their bacterial cell-wall receptors allowing the identification of even subtle differences in binding constants. Differences in affinities...

  2. On the importance of adjusting for distorting factors in benchmarking analysis, as illustrated by a cost comparison of the different forms of implementation of the EU Packaging Directive.

    Science.gov (United States)

    Baum, Heinz-Georg; Schuch, Dieter

    2017-12-01

    Benchmarking is a proven and widely used business tool for identifying best practice. To produce robust results, the objects of comparison used in benchmarking analysis need to be structurally comparable and distorting factors need to be eliminated. We focus on a specific example - a benchmark study commissioned by the European Commission's Directorate-General for Environment on the implementation of Extended Producer Responsibility (EPR) for packaging at the national level - to discuss potential distorting factors and take them into account in the calculation. The cost of compliance per inhabitant and year, which is used as the key cost efficiency indicator in the study, is adjusted to take account of seven factors. The results clearly show that differences in performance may play a role, but the (legal) implementation of EPR - which is highly heterogeneous across countries - is the single most important cost determinant and must be taken into account to avoid misinterpretation and false conclusions.

  3. Quantitative and qualitative differences in celiac disease epitopes among durum wheat varieties identified through deep RNA-amplican sequencing

    NARCIS (Netherlands)

    Salentijn, E.M.J.; Esselink, D.G.; Goryunova, S.V.; Meer, van der I.M.; Gilissen, L.J.W.J.; Smulders, M.J.M.

    2013-01-01

    Background - Wheat gluten is important for the industrial quality of bread wheat (Triticum aestivum L.) and durum wheat (T. turgidum L.). Gluten proteins are also the source of immunogenic peptides that can trigger a T cell reaction in celiac disease (CD) patients, leading to inflammatory responses

  4. Minimal Clinically Important Difference in Parkinson’s Disease as Assessed in Pivotal Trials of Pramipexole Extended Release

    Directory of Open Access Journals (Sweden)

    Robert A. Hauser

    2014-01-01

    Full Text Available Background. The minimal clinically important difference (MCID is the smallest change in an outcome measure that is meaningful for patients. Objectives. To calculate the MCID for Unified Parkinson’s Disease Rating Scale (UPDRS scores in early Parkinson’s disease (EPD and for UPDRS scores and “OFF” time in advanced Parkinson’s disease (APD. Methods. We analyzed data from two pivotal, double-blind, parallel-group trials of pramipexole ER that included pramipexole immediate release (IR as an active comparator. We calculated MCID as the mean change in subjects who received active treatment and rated themselves “a little better” on patient global impression of improvement (PGI-I minus the mean change in subjects who received placebo and rated themselves unchanged. Results. MCIDs in EPD (pramipexole ER, pramipexole IR for UPDRS II were −1.8 and −2.0, for UPDRS III −6.2 and −6.1, and for UPDRS II + III −8.0 and −8.1. MCIDs in APD for UPDRS II were −1.8 and −2.3, for UPDRS III −5.2 and −6.5, and for UPDRS II + III −7.1 and −8.8. MCID for “OFF” time (pramipexole ER, pramipexole IR was −1.0 and −1.3 hours. Conclusions. A range of MCIDs is emerging in the PD literature that provides the basis for power calculations and interpretation of clinical trials.

  5. Effect of feeding frequency on the reproductive efficiency of two species of Triatoma with different epidemiological importance

    Directory of Open Access Journals (Sweden)

    Claudia Rodríguez

    2014-07-01

    Full Text Available Introduction In Triatominae, reproductive efficiency is an important factor influencing population dynamics, and a useful parameter in measuring a species' epidemiological significance as a vector of Trypanosoma cruzi (Chagas, 1909. The reproductive efficiency of triatomines is affected by food availability; hence, we measured and compared the effects of feeding frequency on the reproductive parameters of Triatoma patagonica (Del Ponte, 1929 and Triatoma infestans (Klug, 1934, and the effects of starvation on T. patagonica. Methods Couples from both species were fed weekly, or every 3 weeks; in addition, females in couples of T. patagonica were not fed. Each couple was observed weekly and reproductive efficiency was assessed on the following parameters: fecundity (eggs/female, fertility (eggs hatched/eggs laid, initiation and end of oviposition, initiation of mating, number of matings/week, and number of reproductive weeks. Relative meal size index (RMS, blood consumption index (CI, and E values (eggs/mg blood were also calculated. Results Changes in feeding frequency affected the reproductive parameters of T. patagonica only, with a decrease in fecundity and number of reproductive weeks for those fed every 3 weeks, or not fed. The reproductive period, RMS index, and CI were lower for T. patagonica than T. infestans. However, despite the lower fecundity of T. patagonica, this species required less blood to produce eggs, with an E values of 2 compared to 2.94 for T. infestans. Conclusions Our results suggest that the differences in fecundity observed between species reflect the availability of food in their natural ecotopes.

  6. Virulence characterisation of Salmonella enterica isolates of differing antimicrobial resistance recovered from UK livestock and imported meat samples.

    Directory of Open Access Journals (Sweden)

    Roderick eCard

    2016-05-01

    Full Text Available Salmonella enterica is a foodborne zoonotic pathogen of significant public health concern. We have characterised the virulence and antimicrobial resistance gene content of 95 Salmonella isolates from 11 serovars by DNA microarray recovered from UK livestock or imported meat. Genes encoding resistance to sulphonamides (sul1, sul2, tetracycline (tet(A, tet(B, streptomycin (strA, strB, aminoglycoside (aadA1, aadA2, beta-lactam (blaTEM, and trimethoprim (dfrA17 were common. Virulence gene content differed between serovars; S. Typhimurium formed two subclades based on virulence plasmid presence. Thirteen isolates were selected by their virulence profile for pathotyping using the Galleria mellonella pathogenesis model. Infection with a chicken invasive S. Enteritidis or S. Gallinarum isolate, a multidrug resistant S. Kentucky, or a S. Typhimurium DT104 isolate resulted in high mortality of the larvae; notably presence of the virulence plasmid in S. Typhimurium was not associated with increased larvae mortality. Histopathological examination showed that infection caused severe damage to the Galleria gut structure. Enumeration of intracellular bacteria in the larvae 24 hours post-infection showed increases of up to 7 log above the initial inoculum and transmission electron microscopy (TEM showed bacterial replication in the haemolymph. TEM also revealed the presence of vacuoles containing bacteria in the haemocytes, similar to Salmonella containing vacuoles observed in mammalian macrophages; although there was no evidence from our work of bacterial replication within vacuoles. This work shows that microarrays can be used for rapid virulence genotyping of S. enterica and that the Galleria animal model replicates some aspects of Salmonella infection in mammals. These procedures can be used to help inform on the pathogenicity of isolates that may be antibiotic resistant and have scope to aid the assessment of their potential public and animal health risk.

  7. Functional interrogation of Plasmodium genus metabolism identifies species- and stage-specific differences in nutrient essentiality and drug targeting

    KAUST Repository

    Abdel-Haleem, Alyaa M.; Hefzi, Hooman; Mineta, Katsuhiko; Gao, Xin; Gojobori, Takashi; Palsson, Bernhard O.; Lewis, Nathan E.; Jamshidi, Neema

    2018-01-01

    and predicted potential targets that could affect several life cycle stages. The species-specific models further highlight differences between experimental animal models and the human-infecting species. Comparisons between human- and rodent-infecting species

  8. Identifying the Impact of Individual Differences on the Basis of Affect Intensity Measure on Consumers Response to Advertising Appeals

    OpenAIRE

    Santosh Kumar

    2013-01-01

    This study aims (i) to find out the individuals scoring on Larsen Affect intensity measurement Scale (AIM) for emotional ads and (ii) to know whether the individual differences of response diminishes when they are exposed to the nonemotional (rational) advertisements, (iii) to know whether the cultural differences among other countries and Pakistan mediate the applicability and implications of AIM scale in the field of advertising research. Variety of researchers including consumers behavior,...

  9. Identifying gender differences in reported occupational information from three US population-based case-control studies.

    Science.gov (United States)

    Locke, Sarah J; Colt, Joanne S; Stewart, Patricia A; Armenti, Karla R; Baris, Dalsu; Blair, Aaron; Cerhan, James R; Chow, Wong-Ho; Cozen, Wendy; Davis, Faith; De Roos, Anneclaire J; Hartge, Patricia; Karagas, Margaret R; Johnson, Alison; Purdue, Mark P; Rothman, Nathaniel; Schwartz, Kendra; Schwenn, Molly; Severson, Richard; Silverman, Debra T; Friesen, Melissa C

    2014-12-01

    Growing evidence suggests that gender-blind assessment of exposure may introduce exposure misclassification, but few studies have characterised gender differences across occupations and industries. We pooled control responses to job-specific, industry-specific and exposure-specific questionnaires (modules) that asked detailed questions about work activities from three US population-based case-control studies to examine gender differences in work tasks and their frequencies. We calculated the ratio of female-to-male controls that completed each module. For four job modules (assembly worker, machinist, health professional, janitor/cleaner) and for subgroups of jobs that completed those modules, we evaluated gender differences in task prevalence and frequency using χ(2) and Mann-Whitney U tests, respectively. The 1360 female and 2245 male controls reported 6033 and 12 083 jobs, respectively. Gender differences in female:male module completion ratios were observed for 39 of 45 modules completed by ≥20 controls. Gender differences in task prevalence varied in direction and magnitude. For example, female janitors were significantly more likely to polish furniture (79% vs 44%), while male janitors were more likely to strip floors (73% vs 50%). Women usually reported more time spent on tasks than men. For example, the median hours per week spent degreasing for production workers in product manufacturing industries was 6.3 for women and 3.0 for men. Observed gender differences may reflect actual differences in tasks performed or differences in recall, reporting or perception, all of which contribute to exposure misclassification and impact relative risk estimates. Our findings reinforce the need to capture subject-specific information on work tasks. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  10. Differences in Virulence Markers between Helicobacter pylori Strains from Iraq and Those from Iran: Potential Importance of Regional Differences in H. pylori-Associated Disease▿

    Science.gov (United States)

    Hussein, Nawfal R.; Mohammadi, Marjan; Talebkhan, Yeganeh; Doraghi, Masoumeh; Letley, Darren P.; Muhammad, Merdan K.; Argent, Richard H.; Atherton, John C.

    2008-01-01

    Helicobacter pylori causes peptic ulceration and gastric adenocarcinoma; the latter is common in Iran but not in Iraq. We hypothesized that more virulent H. pylori strains may be found in Iran than in Iraq and so compared established and newly described virulence factors in strains from these countries. We studied 59 unselected dyspeptic patients from Iran and 49 from Iraq. cagA was found in similar proportions of strains from both countries (76% in Iran versus 71% in Iraq) and was significantly associated with peptic ulcer disease in Iraq (P ≤ 0.01) but not in Iran. cagA alleles encoding four or more tyrosine phosphorylation motifs were found in 12% of the Iranian strains but none of the Iraqi strains (P = 0.02). There were no significant differences in the vacA signal-, middle-, or intermediate-region types between Iranian and Iraqi strains. Among the strains from Iran, vacA genotypes showed no specific peptic ulcer associations, but among the strains from Iraq, vacA i1 strains were associated with gastric ulcer (P ≤ 0.02), mimicking their previously demonstrated association with gastric cancer in Iran. dupA was found in similar proportions of Iranian and Iraqi strains (38% and 32%, respectively) and was associated with peptic ulceration in Iraqi patients (P ≤ 0.01) but not Iranian patients. H. pylori strains from Iraq and Iran possess virulence factors similar to those in Western countries. The presence of cagA with more phosphorylation motifs in Iranian strains may contribute to the higher incidence of gastric cancer. However, the association between strain virulence markers and disease in Iraq but not Iran suggests that other host and environmental factors may be more important in the disease-prone Iranian population. PMID:18353934

  11. Using sex differences in the developing brain to identify nodes of influence for seizure susceptibility and epileptogenesis.

    Science.gov (United States)

    Kight, Katherine E; McCarthy, Margaret M

    2014-12-01

    Sexual differentiation of the developing brain organizes the neural architecture differently between males and females, and the main influence on this process is exposure to gonadal steroids during sensitive periods of prenatal and early postnatal development. Many molecular and cellular processes are influenced by steroid hormones in the developing brain, including gene expression, cell birth and death, neurite outgrowth and synaptogenesis, and synaptic activity. Perturbations in these processes can alter neuronal excitability and circuit activity, leading to increased seizure susceptibility and the promotion of pathological processes that constitute epileptogenesis. In this review, we will provide a general overview of sex differences in the early developing brain that may be relevant for altered seizure susceptibility in early life, focusing on limbic areas of the brain. Sex differences that have the potential to alter the progress of epileptogenesis are evident at molecular and cellular levels in the developing brain, and include differences in neuronal excitability, response to environmental insult, and epigenetic control of gene expression. Knowing how these processes differ between the sexes can help us understand fundamental mechanisms underlying gender differences in seizure susceptibility and epileptogenesis. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Predicting anti-fat attitudes: individual differences based on actual and perceived body size, weight importance, entity mindset, and ethnicity.

    Science.gov (United States)

    Scott, Shannon Rich; Rosen, Lisa H

    2015-06-01

    The purpose of the current study was to examine the relative impact of actual and perceived weight, weight importance, entity mindset, and ethnicity on anti-fat attitudes as well as to examine whether certain variables play the role of mediator. Participants included a multiethnic U.S. sample of 923 female undergraduates who completed a series of measures online. Lower BMI, higher perceived weight, higher importance of weight, endorsement of an entity mindset, and identification as White as compared to Black, Hispanic, or Asian predicted higher overall anti-fat attitudes. Examination of the individual Antifat Attitudes Questionnaire subscales (i.e. dislike, fear of fat, and willpower) using Relative Weight Analysis suggested that weight importance is an important predictor of multiple aspects of anti-fat attitudes. In addition, weight importance mediated the relationship between perceived weight and fear of fat as well as the relationship between ethnicity and dislike. Implications of findings and future research directions are discussed.

  13. System and method employing a minimum distance and a load feature database to identify electric load types of different electric loads

    Science.gov (United States)

    Lu, Bin; Yang, Yi; Sharma, Santosh K; Zambare, Prachi; Madane, Mayura A

    2014-12-23

    A method identifies electric load types of a plurality of different electric loads. The method includes providing a load feature database of a plurality of different electric load types, each of the different electric load types including a first load feature vector having at least four different load features; sensing a voltage signal and a current signal for each of the different electric loads; determining a second load feature vector comprising at least four different load features from the sensed voltage signal and the sensed current signal for a corresponding one of the different electric loads; and identifying by a processor one of the different electric load types by determining a minimum distance of the second load feature vector to the first load feature vector of the different electric load types of the load feature database.

  14. Expression profiling of cervical cancers in Indian women at different stages to identify gene signatures during progression of the disease

    International Nuclear Information System (INIS)

    Thomas, Asha; Mahantshetty, Umesh; Kannan, Sadhana; Deodhar, Kedar; Shrivastava, Shyam K; Kumar-Sinha, Chandan; Mulherkar, Rita

    2013-01-01

    Cervical cancer is the second most common cancer among women worldwide, with developing countries accounting for >80% of the disease burden. Although in the West, active screening has been instrumental in reducing the incidence of cervical cancer, disease management is hampered due to lack of biomarkers for disease progression and defined therapeutic targets. Here we carried out gene expression profiling of 29 cervical cancer tissues from Indian women, spanning International Federation of Gynaecology and Obstetrics (FIGO) stages of the disease from early lesion (IA and IIA) to progressive stages (IIB and IIIA–B), and identified distinct gene expression signatures. Overall, metabolic pathways, pathways in cancer and signaling pathways were found to be significantly upregulated, while focal adhesion, cytokine–cytokine receptor interaction and WNT signaling were downregulated. Additionally, we identified candidate biomarkers of disease progression such as SPP1, proliferating cell nuclear antigen (PCNA), STK17A, and DUSP1 among others that were validated by quantitative real-time polymerase chain reaction (qRT-PCR) in the samples used for microarray studies as well in an independent set of 34 additional samples. Integrative analysis of our results with other cervical cancer profiling studies could facilitate the development of multiplex diagnostic markers of cervical cancer progression

  15. Transcriptional differences between normal and glioma-derived glial progenitor cells identify a core set of dysregulated genes.

    Science.gov (United States)

    Auvergne, Romane M; Sim, Fraser J; Wang, Su; Chandler-Militello, Devin; Burch, Jaclyn; Al Fanek, Yazan; Davis, Danielle; Benraiss, Abdellatif; Walter, Kevin; Achanta, Pragathi; Johnson, Mahlon; Quinones-Hinojosa, Alfredo; Natesan, Sridaran; Ford, Heide L; Goldman, Steven A

    2013-06-27

    Glial progenitor cells (GPCs) are a potential source of malignant gliomas. We used A2B5-based sorting to extract tumorigenic GPCs from human gliomas spanning World Health Organization grades II-IV. Messenger RNA profiling identified a cohort of genes that distinguished A2B5+ glioma tumor progenitor cells (TPCs) from A2B5+ GPCs isolated from normal white matter. A core set of genes and pathways was substantially dysregulated in A2B5+ TPCs, which included the transcription factor SIX1 and its principal cofactors, EYA1 and DACH2. Small hairpin RNAi silencing of SIX1 inhibited the expansion of glioma TPCs in vitro and in vivo, suggesting a critical and unrecognized role of the SIX1-EYA1-DACH2 system in glioma genesis or progression. By comparing the expression patterns of glioma TPCs with those of normal GPCs, we have identified a discrete set of pathways by which glial tumorigenesis may be better understood and more specifically targeted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Importance of physical examination in early detection of lump in breast in women of different age groups

    International Nuclear Information System (INIS)

    Abbas, H.; Imran, S.; Waris, Noorul-ain-Hafeez; Khanam, A.; Khurshid, R.

    2010-01-01

    Background: The spectrum of breast lesions in adolescents varies markedly from that for adults, with the former lesions being overwhelmingly benign. Fine needle biopsy can be used to distinguish benign and malignant tumour. Study Design: This study examined the characteristics and outcome of women with different age groups in whom physical examination was their sole method of lump in breast detection. Patients and Methods: A total of 200 patients were included in the study. These were divided into 3 groups. Group A was consisting of 75 girls with age of pubescent. Group B included 69 suspected breast cancer women with age range 26-38 years. Fifty-six suspected breast cancer women with age range 41-60 year were included as group C. Study was carried out in patients admitted in the Department/Out-door of Surgery, Sir Ganga Ram Hospital, Lahore, Pakistan. Study period was 6 months. All women received a physical examination by a breast surgeon. Proforma including demographic and clinical characteristics were filled. The diagnosis for patients in this study was achieved by core needle biopsy using a 14-gauge cutting needle. Results: It was observed that early age at menarche ( 25 may be a risk factor in peri/post menopausal women. Active life style is more important with increasing age as it decreases the risk of developing tumour state. Family history was more common in women with peri/post menopausal status as compared to other age groups. Clinical characteristics showed that lump size <2.5 cm was more common in both pubescent and reproductive age. While lump size with a range of 2.5-5.0 cm, was observed in all groups of patients. Fibroadenoma is observed in almost all women with pubescent age while both benign and malignant tumour observed in women with reproductive age. Malignant tumour was observed mostly in women with peri/post menopausal status. Conclusion: Study concluded that early detection or clinical examination with FNA cut out the patients from harassment

  17. Patient-reported questionnaires in MS rehabilitation: responsiveness and minimal important difference of the multiple sclerosis questionnaire for physiotherapists (MSQPT).

    Science.gov (United States)

    van der Maas, Nico Arie

    2017-03-16

    The Multiple Sclerosis Questionnaire for Physical Therapists (MSQPT) is a patient-rated outcome questionnaire for evaluating the rehabilitation of persons with multiple sclerosis (MS). Responsiveness was evaluated, and minimal important difference (MID) estimates were calculated to provide thresholds for clinical change for four items, three sections and the total score of the MSQPT. This multicentre study used a combined distribution- and anchor-based approach with multiple anchors and multiple rating of change questions. Responsiveness was evaluated using effect size, standardized response mean (SRM), modified SRM and relative efficiency. For distribution-based MID estimates, 0.2 and 0.33 standard deviations (SD), standard error of measurement (SEM) and minimal detectable change were used . Triangulation of anchor- and distribution-based MID estimates provided a range of MID values for each of the four items, the three sections and the total score of the MSQPT. The MID values were tested for their sensitivity and specificity for amelioration and deterioration for each of the four items, the three sections and the total score of the MSQPT. The MID values of each item and section and of the total score with the best sensitivity and specificity were selected as thresholds for clinical change. The outcome measures were the MSQPT, Hamburg Quality of Life Questionnaire for Multiple Sclerosis (HAQUAMS), rating of change questionnaires, Expanded Disability Status Scale, 6-metre timed walking test, Berg Balance Scale and 6-minute walking test. The effect size ranged from 0.46 to 1.49. The SRM data showed comparable results. The modified SRM ranged from 0.00 to 0.60. Anchor-based MID estimates were very low and were comparable with SD- and SEM-based estimates. The MSQPT was more responsive than the HAQUAMS in detecting improvement but less responsive in finding deterioration. The best MID estimates of the items, sections and total score, expressed in percentage of their

  18. Human exposure to brominated flame retardants through dust in different indoor environments: Identifying the sources of concentration differences in hair from men and women.

    Science.gov (United States)

    Li, Junqi; Dong, Zheng; Wang, Ying; Bao, Junsong; Yan, Yijun; Liu, Anming; Jin, Jun

    2018-08-01

    Brominated flame retardants (BFRs) can accumulate in humans and are associated with adverse health effects. The study was conducted to determine the differences in Polybrominated diphenyl ethers (PBDEs) and alternative brominated flame retardant (Alt-BFR) concentrations between men and women. We analyzed hair samples from 14 male and 20 female university students, paired dust samples from their dormitories (10 for males and 8 for females), and six dust samples from university teaching buildings. The total PBDE concentrations in hair from females were significantly (three times) higher (p = 0.012) than that from males (means 372 and 109 ng/g, respectively). The mean total PBDE concentrations in classroom and dormitory dust were 36100 and 2012 ng/g, respectively. The PBDE patterns were different in the male and female hair samples, as were the patterns in the classroom and dormitory dust. There are no reports concerning human exposure to BFRs through dust that was assessed considering academic and residential environments simultaneously. The differences between BFR exposure for males and females and the differences between BFR concentrations in hair samples from males and females were consistent for 71.4% of the compounds. However, using only dormitory dust in the calculations gave consistent differences only for 28.6% of the compounds, suggesting that the BFR concentration differences in hair were mainly because females spent much more time than males in classrooms. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. The importance of distinguishing between the different eating disorders (sub)types when assessing emotion regulation strategies

    NARCIS (Netherlands)

    Danner, Unna; Sternheim, Lot; Evers, Catharine

    2014-01-01

    People with eating disorders (ED) have difficulties regulating their emotions adaptively. Little is known about differences and similarities between different types of ED and how these regulation difficulties relate to other emotional problems. The present study examines maladaptive (suppression)

  20. Exploring Students Intentions to Study Computer Science and Identifying the Differences among ICT and Programming Based Courses

    Science.gov (United States)

    Giannakos, Michail N.

    2014-01-01

    Computer Science (CS) courses comprise both Programming and Information and Communication Technology (ICT) issues; however these two areas have substantial differences, inter alia the attitudes and beliefs of the students regarding the intended learning content. In this research, factors from the Social Cognitive Theory and Unified Theory of…

  1. The use of differential item functioning analyses to identify cultural differences in responses to the EORTC QLQ-C30

    NARCIS (Netherlands)

    Scott, N. W.; Fayers, P. M.; Aaronson, N. K.; Bottomley, A.; de Graeff, A.; Groenvold, M.; Koller, M.; Petersen, M. A.; Sprangers, M. A. G.

    2007-01-01

    INTRODUCTION: The European Organisation for Research and Treatment of Cancer (EORTC) QLQ-C30 is a widely used health-related quality of life instrument. The main aim of this study is to investigate whether there are international differences in response to the questionnaire that can be explained by

  2. Integrative genome-wide expression profiling identifies three distinct molecular subgroups of renal cell carcinoma with different patient outcome

    Directory of Open Access Journals (Sweden)

    Beleut Manfred

    2012-07-01

    Full Text Available Abstract Background Renal cell carcinoma (RCC is characterized by a number of diverse molecular aberrations that differ among individuals. Recent approaches to molecularly classify RCC were based on clinical, pathological as well as on single molecular parameters. As a consequence, gene expression patterns reflecting the sum of genetic aberrations in individual tumors may not have been recognized. In an attempt to uncover such molecular features in RCC, we used a novel, unbiased and integrative approach. Methods We integrated gene expression data from 97 primary RCC of different pathologic parameters, 15 RCC metastases as well as 34 cancer cell lines for two-way nonsupervised hierarchical clustering using gene groups suggested by the PANTHER Classification System. We depicted the genomic landscape of the resulted tumor groups by means of Single Nuclear Polymorphism (SNP technology. Finally, the achieved results were immunohistochemically analyzed using a tissue microarray (TMA composed of 254 RCC. Results We found robust, genome wide expression signatures, which split RCC into three distinct molecular subgroups. These groups remained stable even if randomly selected gene sets were clustered. Notably, the pattern obtained from RCC cell lines was clearly distinguishable from that of primary tumors. SNP array analysis demonstrated differing frequencies of chromosomal copy number alterations among RCC subgroups. TMA analysis with group-specific markers showed a prognostic significance of the different groups. Conclusion We propose the existence of characteristic and histologically independent genome-wide expression outputs in RCC with potential biological and clinical relevance.

  3. NmeSI restriction-modification system identified by representational difference analysis of a hypervirulent Neisseria meningitidis strain

    NARCIS (Netherlands)

    Bart, A.; Pannekoek, Y.; Dankert, J.; van der Ende, A.

    2001-01-01

    Neisseria meningitidis is a gram-negative bacterium that may cause meningitis, sepsis, or both. The increase in the incidence of meningococcal disease in various countries in the past 2 decades is mainly due the genotypically related lineage III meningococci. The chromosomal DNA differences between

  4. Decreased physical effort, fatigue, and mental distress in patients with coronary artery disease : Importance of personality-related differences

    NARCIS (Netherlands)

    Bunevicius, A.; Brozaitiene, J.; Staniute, M.; Gelziniene, V.; Duoneliene, I.; Pop, V.J.M.; Bunevicius, R.; Denollet, J.

    2014-01-01

    Background Identification of cardio-toxic psychological symptoms in coronary artery disease (CAD) patients is important. Purpose We examined the association of negative affectivity (NA), social inhibition (SI), and their combination in the distressed (Type D) personality with functional status,

  5. Functional interrogation of Plasmodium genus metabolism identifies species- and stage-specific differences in nutrient essentiality and drug targeting.

    Directory of Open Access Journals (Sweden)

    Alyaa M Abdel-Haleem

    2018-01-01

    Full Text Available Several antimalarial drugs exist, but differences between life cycle stages among malaria species pose challenges for developing more effective therapies. To understand the diversity among stages and species, we reconstructed genome-scale metabolic models (GeMMs of metabolism for five life cycle stages and five species of Plasmodium spanning the blood, transmission, and mosquito stages. The stage-specific models of Plasmodium falciparum uncovered stage-dependent changes in central carbon metabolism and predicted potential targets that could affect several life cycle stages. The species-specific models further highlight differences between experimental animal models and the human-infecting species. Comparisons between human- and rodent-infecting species revealed differences in thiamine (vitamin B1, choline, and pantothenate (vitamin B5 metabolism. Thus, we show that genome-scale analysis of multiple stages and species of Plasmodium can prioritize potential drug targets that could be both anti-malarials and transmission blocking agents, in addition to guiding translation from non-human experimental disease models.

  6. Functional interrogation of Plasmodium genus metabolism identifies species- and stage-specific differences in nutrient essentiality and drug targeting

    KAUST Repository

    Abdel-Haleem, Alyaa M.

    2018-01-04

    Several antimalarial drugs exist, but differences between life cycle stages among malaria species pose challenges for developing more effective therapies. To understand the diversity among stages and species, we reconstructed genome-scale models (GEMs) of metabolism for five life cycle stages and five species of Plasmodium spanning the blood, transmission, and mosquito stages. The stage-specific models of Plasmodium falciparum uncovered stage-dependent changes in central carbon metabolism and predicted potential targets that could affect several life cycle stages. The species-specific models further highlight differences between experimental animal models and the human-infecting species. Comparisons between human- and rodent-infecting species revealed differences in thiamine (vitamin B1), choline, and pantothenate (vitamin B5) metabolism. Thus, we show that genome-scale analysis of multiple stages and species of Plasmodium can prioritize potential drug targets that could be both anti-malarials and transmission blocking agents, in addition to guiding translation from non-human experimental disease models.

  7. Bipolar disorder: The importance of clinical assessment in identifying prognostic factors - An Audit. Part 3: A comparison between Italian and English mental health services and a survey of bipolar disorder.

    Science.gov (United States)

    Verdolini, Norma; Dean, Jonathon; Massucci, Giampaolo; Elisei, Sandro; Quartesan, Roberto; Zaman, Rashid; Agius, Mark

    2014-11-01

    Most of the prognostic factors of bipolar disorder, which determine disease course and outcome, could be detected from simple but often-unrecorded questions asked during the psychiatric clinic assessments. In previous parts of this research, we analysed various prognostic factors and focused on mixed states and rapid cycling subsets. We now compare our sample in England with a small sample from Italy to demonstrate the utility of focused prognostic questioning and of international comparison. We collected data from the clinical notes of 70 English bipolar and 8 Italian bipolar outpatients seen at the initial psychiatric assessment clinic about socio-demographic and clinical factors to determine whether various factors had relevance to prevalence, prognosis, or outcome. The sample comprised 16 bipolar I (22.9%) and 54 bipolar II (77.1%) English outpatients and 7 bipolar I (87.5%) and 1 bipolar II (12.5%) Italian outpatients. Differences between the groups are seen mainly in terms of age of onset, duration of both depressive and hypomanic episodes, presence of psychiatric family history, incidence of mixed state features and rapid cycling, presence of elated mood in response to past antidepressant treatment, and misuse of illicit drugs and alcohol. In order to promote improved mental health primary care, mental health systems in all countries should develop standardized epidemiological tools that are shared between countries. We recommend the use of a questionnaire that reminds clinicians of potentially prognostic information and suggest that this might identify important components of a potential standardized diagnostic and prognostic tool.

  8. The Importance of Job and Family Satisfaction for Happiness among Women and Men in Different Gender Regimes

    OpenAIRE

    Mikael Nordenmark

    2017-01-01

    The family and the work place are two arenas of central importance for most adult people. Consequently, one can assume that the level of satisfaction with one’s family life and job may be critical to one’s level of happiness in general. However, there are reasons to believe that there are variations according to gender and gender regime. The general aim of this study is to analyse the relative importance of job satisfaction and satisfaction with family life for happiness among women and men i...

  9. Metabolomics Analysis of Hormone-Responsive and Triple-Negative Breast Cancer Cell Responses to Paclitaxel Identify Key Metabolic Differences.

    Science.gov (United States)

    Stewart, Delisha A; Winnike, Jason H; McRitchie, Susan L; Clark, Robert F; Pathmasiri, Wimal W; Sumner, Susan J

    2016-09-02

    To date, no targeted therapies are available to treat triple negative breast cancer (TNBC), while other breast cancer subtypes are responsive to current therapeutic treatment. Metabolomics was conducted to reveal differences in two hormone receptor-negative TNBC cell lines and two hormone receptor-positive Luminal A cell lines. Studies were conducted in the presence and absence of paclitaxel (Taxol). TNBC cell lines had higher levels of amino acids, branched-chain amino acids, nucleotides, and nucleotide sugars and lower levels of proliferation-related metabolites like choline compared with Luminal A cell lines. In the presence of paclitaxel, each cell line showed unique metabolic responses, with some similarities by type. For example, in the Luminal A cell lines, levels of lactate and creatine decreased while certain choline metabolites and myo-inositol increased with paclitaxel. In the TNBC cell lines levels of glutamine, glutamate, and glutathione increased, whereas lysine, proline, and valine decreased in the presence of drug. Profiling secreted inflammatory cytokines in the conditioned media demonstrated a greater response to paclitaxel in the hormone-positive Luminal cells compared with a secretion profile that suggested greater drug resistance in the TNBC cells. The most significant differences distinguishing the cell types based on pathway enrichment analyses were related to amino acid, lipid and carbohydrate metabolism pathways, whereas several biological pathways were differentiated between the cell lines following treatment.

  10. Is it possible to rapidly and noninvasively identify different plants from Asteraceae using electronic nose with multiple mathematical algorithms?

    Directory of Open Access Journals (Sweden)

    Hui-Qin Zou

    2015-12-01

    Full Text Available Many plants originating from the Asteraceae family are applied as herbal medicines and also beverage ingredients in Asian areas, particularly in China. However, they may be confused due to their similar odor, especially when ground into powder, losing their typical macroscopic characteristics. In this paper, 11 different multiple mathematical algorithms, which are commonly used in data processing, were utilized and compared to analyze the electronic nose (E-nose response signals of different plants from Asteraceae family. Results demonstrate that three-dimensional plot scatter figure of principal component analysis with less extracted components could offer the identification results more visually; simultaneously, all nine kinds of artificial neural network could give classification accuracies at 100%. This paper presents a rapid, accurate, and effective method to distinguish Asteraceae plants based on their response signals in E-nose. It also gives insights to further studies, such as to find unique sensors that are more sensitive and exclusive to volatile components in Chinese herbal medicines and to improve the identification ability of E-nose. Screening sensors made by other novel materials would be also an interesting way to improve identification capability of E-nose.

  11. A de novo transcriptomic approach to identify flavonoids and anthocyanins switch-off in olive (Olea europaea L. drupes at different stages of maturation

    Directory of Open Access Journals (Sweden)

    Domenico eIaria

    2016-01-01

    Full Text Available During ripening, the fruits of the olive tree (Olea europaea L. undergo a progressive chromatic change characterized by the formation of a red-brown spot which gradually extends on the epidermis and in the innermost part of the mesocarp. This event finds an exception in the Leucocarpa cultivar, in which we observe a destabilized equilibrium between the metabolisms of chlorophyll and other pigments, particularly the anthocyanins whose switch-off during maturation promotes the white coloration of fruits. Despite its importance, genomic information on the olive tree is still lacking. Different RNA-seq libraries were generated from drupes of ‘Leucocarpa’ and ‘Cassanese’ olive genotypes, sampled at 100 and 130 days after flowering (DAF, and were used in order to identify transcripts involved in the main phenotypic changes of fruits during maturation and their corresponding expression patterns. A total of 103,359 transcripts were obtained and 3792 and 3064 were differentially expressed in ‘Leucocarpa’ and ‘Cassanese’ genotypes, respectively, during 100-130 DAF transition. Among them flavonoid and anthocyanin related transcripts such as phenylalanine ammonia lyase (PAL, cinnamate 4-hydroxylase (C4H, 4-coumarate-CoA ligase (4CL, chalcone synthase (CHS, chalcone isomerase (CHI, flavanone 3-hydroxylase (F3H, flavonol 3’-hydrogenase (F3'H, flavonol 3’5’-hydrogenase (F3'5'H, flavonol synthase (FLS, dihydroflavonol 4-reductase (DFR, anthocyanidin synthase (ANS, UDP-glucose:anthocianidin:flavonoid glucosyltransferase (UFGT were identified.These results contribute to reducing the current gap in information regarding metabolic processes, including those linked to fruit pigmentation in the olive.

  12. The Racial Wage Gap: The Importance of Labor Force Attachment Differences across Black, Mexican, and White Men

    Science.gov (United States)

    Antecol, Heather; Bedard, Kelly

    2004-01-01

    Labor market attachment differs significantly across young black, Mexican, and white men. Although it has long been agreed that potential experience is a poor proxy for actual experience for women, many view it as an acceptable approximation for men. Using the NLSY, this paper documents the substantial difference between potential and actual…

  13. Combining Temporal and Spectral Information with Spatial Mapping to Identify Differences between Phonological and Semantic Networks: A Magnetoencephalographic Approach.

    Science.gov (United States)

    McNab, Fiona; Hillebrand, Arjan; Swithenby, Stephen J; Rippon, Gina

    2012-01-01

    Early, lesion-based models of language processing suggested that semantic and phonological processes are associated with distinct temporal and parietal regions respectively, with frontal areas more indirectly involved. Contemporary spatial brain mapping techniques have not supported such clear-cut segregation, with strong evidence of activation in left temporal areas by both processes and disputed evidence of involvement of frontal areas in both processes. We suggest that combining spatial information with temporal and spectral data may allow a closer scrutiny of the differential involvement of closely overlapping cortical areas in language processing. Using beamforming techniques to analyze magnetoencephalography data, we localized the neuronal substrates underlying primed responses to nouns requiring either phonological or semantic processing, and examined the associated measures of time and frequency in those areas where activation was common to both tasks. Power changes in the beta (14-30 Hz) and gamma (30-50 Hz) frequency bands were analyzed in pre-selected time windows of 350-550 and 500-700 ms In left temporal regions, both tasks elicited power changes in the same time window (350-550 ms), but with different spectral characteristics, low beta (14-20 Hz) for the phonological task and high beta (20-30 Hz) for the semantic task. In frontal areas (BA10), both tasks elicited power changes in the gamma band (30-50 Hz), but in different time windows, 500-700 ms for the phonological task and 350-550 ms for the semantic task. In the left inferior parietal area (BA40), both tasks elicited changes in the 20-30 Hz beta frequency band but in different time windows, 350-550 ms for the phonological task and 500-700 ms for the semantic task. Our findings suggest that, where spatial measures may indicate overlapping areas of involvement, additional beamforming techniques can demonstrate differential activation in time and frequency domains.

  14. Lay Concepts of the Relative Importance of Different Influences on Health; Are There Major Socio-Demographic Variations?

    Science.gov (United States)

    Macintyre, Sally; McKay, Laura; Ellaway, Anne

    2006-01-01

    There is an extensive literature within anthropology, sociology and psychology about lay concepts of determinants of health and illness. Many of these studies have used single sex or social class samples, often in narrow age bands, and many are qualitative in approach. We asked respondents in a health survey to say how important (on a five-point…

  15. Analysis of dental erosion induced by different beverages and validity of equipment for identifying early dental erosion, in vitro study.

    Science.gov (United States)

    Jameel, Rafey Ahmad; Khan, Shah Salman; Abdul Rahim, Zubaidah Hj; Bakri, Marina Mohd; Siddiqui, Saima

    2016-07-01

    To understand early dental erosion induced by different beverages and the equipment for its detection. The study was conducted at the University Malaya Medical Centre, Kuala Lumpur, Malaysia, from June to September 2014, and comprised single-rooted, unpolished teeth divided into six groups. Electron micrographs and other baseline readings for further analyses were taken before and after the exposure to different beverages. The teeth were exposed to the beverages using a modified Nordini's artificial mouth model. The positioning of the teeth on the motorised stage of the equipment was standardised. Of the several beverages used, CocaCola had the lowest pH value of 2.53, while tap water had the highest pH of 5.4. Deionised distilled water, which was used as a reference, had a pH near to neutral /alkaline of 7.3. The fluoride content ranged between 9.38ppm in tea and 0.005ppm in orange juice. Teeth exposed to beverages with low pH and considerably high fluoride underwent slight remineralisation (roughness increase 8% from tea), while beverages with no fluoride content and low pH roughened the enamel surface (Coca Cola roughened upto 37%). Quantitative analyses of tooth erosion, micro-hardness, surface-roughness, and surface-height showed that all beverages exhibited positive erosive effect on the tooth enamel surface (pCocaCola was found to be the most erosive agent among both hot and cold beverages (37%), while coffee was more erosive among the hot beverages (29%).

  16. The importance of side difference in nasal obstruction and rhinomanometry: a retrospective correlation of symptoms and rhinomanometry in 1000 patients.

    Science.gov (United States)

    Thulesius, H L; Cervin, A; Jessen, M

    2012-02-01

    The correlation between subjective and objective outcomes of nasal obstruction is still a matter of controversy. The aim of this study was to determine the minimal level of side difference in nasal airway resistance (NAR measured by Broms'v(2)) between the two nasal cavities, which could be discerned subjectively by the patient on a visual analogue scale (VAS). Nasal airway resistance was calculated from rhinomanometric measurements of nasal airflow and transnasal pressure after decongestion of the nasal mucosa. A retrospective study. ENT department, Vaxjo Central Hospital, Sweden. We studied 1000 active anterior rhinomanometries from patients with nasal obstructions. We compared the side difference of nasal airway resistance with the side difference of VAS estimated immediately prior to the rhinomanometry. Each measurement was performed after nasal decongestion. When the difference in nasal airway resistance between the two nasal cavities was larger than 20° (Broms'v(2)) or R(2) > 0.36 Pa/cm(3) /s, we found a significant correlation between side differences of the objective measurement and the subjective assessment (VAS). With a nasal airway resistance side difference over 20°, an additional 20° difference corresponded to a 0.9 centimetre average VAS change. The more obstructed side of the nose could be determined by VAS in 823 (82.3%) of 1000 patients. Yet, 177 (17.7%) patients had a paradoxical sensation of nasal obstruction with the low resistance side of the nose experienced as the most congested side. A significant correlation between the side differences of nasal airway resistance and VAS can serve as a supplement to rhinoscopy in decisions about nasal surgery. This study also showed that in 17.7% of patients, there was a negative correlation between subjective and objective evaluations of nasal airway resistance. But in this group, the nasal airway resistance side difference was mostly under 20°. © 2011 Blackwell Publishing Ltd.

  17. Characterisation of different forms of the accessory gp3 canine coronavirus type I protein identified in cats.

    Science.gov (United States)

    d'Orengiani, Anne-Laure Pham-Hung d'Alexandry; Duarte, Lidia; Pavio, Nicole; Le Poder, Sophie

    2015-04-16

    ORF3 is a supplemental open reading frame coding for an accessory glycoprotein gp3 of unknown function, only present in genotype I canine strain (CCoV-I) and some atypical feline FCoV strains. In these latter hosts, the ORF3 gene systematically displays one or two identical deletions leading to the synthesis of truncated proteins gp3-Δ1 and gp3-Δ2. As deletions in CoV accessory proteins have already been involved in tissue or host switch, studies of these different gp3 proteins were conducted in canine and feline cell. All proteins oligomerise through covalent bonds, are N-glycosylated and are maintained in the ER in non-infected but also in CCoV-II infected cells, without any specific retention signal. However, deletions influence their level of expression. In canine cells, all proteins are expressed with similar level whereas in feline cells, the expression of gp3-Δ1 is higher than the two other forms of gp3. None of the gp3 proteins modulate the viral replication cycle of heterologous genotype II CCoV in canine cell line, leading to the conclusion that the gp3 proteins are probably advantageous only for CCoV-I and atypical FCoV strains. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Predatory functional response and prey choice identify predation differences between native/invasive and parasitised/unparasitised crayfish.

    Science.gov (United States)

    Haddaway, Neal R; Wilcox, Ruth H; Heptonstall, Rachael E A; Griffiths, Hannah M; Mortimer, Robert J G; Christmas, Martin; Dunn, Alison M

    2012-01-01

    Invasive predators may change the structure of invaded communities through predation and competition with native species. In Europe, the invasive signal crayfish Pacifastacus leniusculus is excluding the native white clawed crayfish Austropotamobius pallipes. This study compared the predatory functional responses and prey choice of native and invasive crayfish and measured impacts of parasitism on the predatory strength of the native species. Invasive crayfish showed a higher (>10%) prey (Gammarus pulex) intake rate than (size matched) natives, reflecting a shorter (16%) prey handling time. The native crayfish also showed greater selection for crustacean prey over molluscs and bloodworm, whereas the invasive species was a more generalist predator. A. pallipes parasitised by the microsporidian parasite Thelohania contejeani showed a 30% reduction in prey intake. We suggest that this results from parasite-induced muscle damage, and this is supported by a reduced (38%) attack rate and increased (30%) prey handling time. Our results indicate that the per capita (i.e., functional response) difference between the species may contribute to success of the invader and extinction of the native species, as well as decreased biodiversity and biomass in invaded rivers. In addition, the reduced predatory strength of parasitized natives may impair their competitive abilities, facilitating exclusion by the invader.

  19. Identifying disordered eating behaviours in adolescents: how do parent and adolescent reports differ by sex and age?

    Science.gov (United States)

    Bartholdy, Savani; Allen, Karina; Hodsoll, John; O'Daly, Owen G; Campbell, Iain C; Banaschewski, Tobias; Bokde, Arun L W; Bromberg, Uli; Büchel, Christian; Quinlan, Erin Burke; Conrod, Patricia J; Desrivières, Sylvane; Flor, Herta; Frouin, Vincent; Gallinat, Jürgen; Garavan, Hugh; Heinz, Andreas; Ittermann, Bernd; Martinot, Jean-Luc; Artiges, Eric; Nees, Frauke; Orfanos, Dimitri Papadopoulos; Paus, Tomáš; Poustka, Luise; Smolka, Michael N; Mennigen, Eva; Walter, Henrik; Whelan, Robert; Schumann, Gunter; Schmidt, Ulrike

    2017-06-01

    This study investigated the prevalence of disordered eating cognitions and behaviours across mid-adolescence in a large European sample, and explored the extent to which prevalence ratings were affected by informant (parent/adolescent), or the sex or age of the adolescent. The Development and Well-Being Assessment was completed by parent-adolescent dyads at age 14 (n = 2225) and again at age 16 (n = 1607) to explore the prevalence of 7 eating disorder symptoms (binge eating, purging, fear of weight gain, distress over shape/weight, avoidance of fattening foods, food restriction, and exercise for weight loss). Informant agreement was assessed using kappa coefficients. Generalised estimating equations were performed to explore the impact of age, sex and informant on symptom prevalence. Slight to fair agreement was observed between parent and adolescent reports (kappa estimates between 0.045 and 0.318); however, this was largely driven by agreement on the absence of behaviours. Disordered eating behaviours were more consistently endorsed amongst girls compared to boys (odds ratios: 2.96-5.90) and by adolescents compared to their parents (odds ratios: 2.71-9.05). Our data are consistent with previous findings in epidemiological studies. The findings suggest that sex-related differences in the prevalence of disordered eating behaviour are established by mid-adolescence. The greater prevalence rates obtained from adolescent compared to parent reports may be due to the secretive nature of the behaviours and/or lack of awareness by parents. If adolescent reports are overlooked, the disordered behaviour may have a greater opportunity to become more entrenched.

  20. Composition of physiologically important fatty acids in great tits differs between urban and rural populations on a seasonal basis

    Directory of Open Access Journals (Sweden)

    Martin N Andersson

    2015-08-01

    Full Text Available Fatty acids (FA have crucial functions in animals, affecting e.g. inflammatory responses, thermoregulation, and cell membrane fluidity. Diet and ambient temperature affect animals’ FA composition, which, in turn, may influence these physiological processes. Great tits (Parus major −common in both urban and rural habitats− are mainly granivorous during winter and insectivorous during summer. These diets show pronounced differences in FA composition. Such variation has context-dependent effects on physiology, because the thermal environment, food availability, and levels of pro-inflammatory environmental stressors differ between urban and rural areas. Thus, we investigated how great tit plasma FA composition varied between urban and rural habitats and across seasons. Eight FAs differed between urban and rural birds. Among these, arachidonic acid (omega (ω-6 polyunsaturated FA with thermoregulatory and pro-inflammatory properties was more abundant in urban than rural birds in winter, whereas ω-3 FAs with anti-inflammatory properties were more abundant in rural birds. The difference in pro- and anti-inflammatory FAs suggest that the negative health effects that urban birds suffer from being exposed to higher levels of pollutants might be enhanced by an elevated inflammatory response. Eight FAs differed between winter and summer birds. This variation reflected the diet change: FAs common in seeds, e.g. oleic- and linoleic acid, were present in higher amounts in winter birds, whereas ω-3 polyunsaturated FAs that are common in caterpillars were more abundant in summer birds. Overall, a larger seasonal variation was seen among the urban birds. This study is the first to reveal a difference in FA composition between urban and rural populations for all animals studied to date. Future experiments should unravel the physiological implications of this variation, and ultimately, link its effects to fitness of animals with different physiological and

  1. Evaluating bronchodilator response in pediatric patients with post-infectious bronchiolitis obliterans: use of different criteria for identifying airway reversibility.

    Science.gov (United States)

    Mattiello, Rita; Vidal, Paula Cristina; Sarria, Edgar Enrique; Pitrez, Paulo Márcio; Stein, Renato Tetelbom; Mocelin, Helena Teresinha; Fischer, Gilberto Bueno; Jones, Marcus Herbert; Pinto, Leonardo Araújo

    2016-01-01

    Post-infectious bronchiolitis obliterans (PIBO) is a clinical entity that has been classified as constrictive, fixed obstruction of the lumen by fibrotic tissue. However, recent studies using impulse oscillometry have reported bronchodilator responses in PIBO patients. The objective of this study was to evaluate bronchodilator responses in pediatric PIBO patients, comparing different criteria to define the response. We evaluated pediatric patients diagnosed with PIBO and treated at one of two pediatric pulmonology outpatient clinics in the city of Porto Alegre, Brazil. Spirometric parameters were measured in accordance with international recommendations. We included a total of 72 pediatric PIBO patients. The mean pre- and post-bronchodilator values were clearly lower than the reference values for all parameters, especially FEF25-75%. There were post-bronchodilator improvements. When measured as mean percent increases, FEV1 and FEF25-75%, improved by 11% and 20%, respectively. However, when the absolute values were calculated, the mean FEV1 and FEF25-75% both increased by only 0.1 L. We found that age at viral aggression, a family history of asthma, and allergy had no significant effects on bronchodilator responses. Pediatric patients with PIBO have peripheral airway obstruction that is responsive to treatment but is not completely reversible with a bronchodilator. The concept of PIBO as fixed, irreversible obstruction does not seem to apply to this population. Our data suggest that airway obstruction is variable in PIBO patients, a finding that could have major clinical implications. A bronquiolite obliterante pós-infecciosa (BOPI) é uma entidade clínica que tem sido classificada como obstrução fixa e constritiva do lúmen por tecido fibrótico. Entretanto, estudos recentes utilizando oscilometria de impulso relataram resposta ao broncodilatador em pacientes com BOPI. O objetivo deste estudo foi avaliar a resposta broncodilatadora em pacientes pediátricos com

  2. Predicting Emergence of the Most Important Weed Species in Soybean (Glycine max L. under Different Management Operation

    Directory of Open Access Journals (Sweden)

    R. Khakzad

    2017-12-01

    Full Text Available Introduction: Summer annual weeds typically germinate in spring and early summer, grow throughout the summer, and set seeds by fall. Summer annual weeds are a persistent problem in summer annual row crops, competing directly for water, light, and nutrients, causing yield losses in quantity and quality. Although agriculture is increasingly relying on modern technology, knowledge of the biological systems in which these technologies are used is still critical for implementation of management strategies. Biological information about weeds is valuable and necessary for developing management strategies to minimize their impact. Scouting fields for pest problems are essential in any cropping system and knowledge of the timing and sequence of weed species emergence could increase the effectiveness of weed scouting trips and subsequent management practices. The success of any annual plant is directly correlated to its time of seedling emergence because it determines the ability of a plant to compete with its neighbors, survive biotic and abiotic stresses, and reproduce. The period and pattern of emergence of the weed community depend on the species present in the seed bank and their interaction with the environment. Therefore, knowledge of the weed species present in the soil seed bank and when these species are most likely to emerge is important in planning effective weed control programs. Temperature has been reported to be the main environmental factor regulating germination and emergence of weed species. Scientists have developed TT models to predict the emergence of weed species based on a daily accumulation of heat units or growing degree days (GDD above a minimum base threshold value (Tbase. The predictive models for weed emergence based on the accumulation of TT appear to be accurate enough for projections of weed emergence time (Grundy 2003. Moreover, soil temperature data are easily accessible, making this type of model practical and useful to

  3. Aflatoxin B1 in betel nuts (Areca catechu L.) imported to Pakistan from different regions of South Asia.

    Science.gov (United States)

    Asghar, Muhammad Asif; Iqbal, Javed; Ahmed, Aftab; Khan, Mobeen Ahmed; Shamsuddin, Zuzzer Ali

    2014-01-01

    Aflatoxin B1 (AFB1) levels were evaluated in betel nuts (Areca catechu L.) being imported to Pakistan during 2010-2011. In total, 278 betel nut samples (India = 21, Indonesia = 51, Sri-Lanka = 34 and Thailand = 172) were received from the Department of Customs and were analysed by thin layer chromatography (TLC). All Indian origin betel nuts showed AFB1 contamination ranging from 11.7-262.0 µg kg(-1) with a mean of 92.5 µg kg(-1). Among Indonesian and Sri Lankan shipments, 80.4% and 73.5% betel nuts were contaminated with AFB1 ranging between 3.3-39.2 and 6.5-103.4 µg kg(-1) with a mean of 11.6 and 35.0 µg kg(-1), respectively. However, only 30.2% of Thailand origin samples showed AFB1 contamination ranging 3.3-77.0 µg kg(-1) with a mean of 6.6 µg kg(-1). The widespread occurrence of AFB1 increases the hazard associated with betel nuts. Thus, strict control is a pre-requisite for the production and import/export of psychoactive substances as betel nuts.

  4. System and method employing a self-organizing map load feature database to identify electric load types of different electric loads

    Science.gov (United States)

    Lu, Bin; Harley, Ronald G.; Du, Liang; Yang, Yi; Sharma, Santosh K.; Zambare, Prachi; Madane, Mayura A.

    2014-06-17

    A method identifies electric load types of a plurality of different electric loads. The method includes providing a self-organizing map load feature database of a plurality of different electric load types and a plurality of neurons, each of the load types corresponding to a number of the neurons; employing a weight vector for each of the neurons; sensing a voltage signal and a current signal for each of the loads; determining a load feature vector including at least four different load features from the sensed voltage signal and the sensed current signal for a corresponding one of the loads; and identifying by a processor one of the load types by relating the load feature vector to the neurons of the database by identifying the weight vector of one of the neurons corresponding to the one of the load types that is a minimal distance to the load feature vector.

  5. Physician Rating Websites: What Aspects Are Important to Identify a Good Doctor, and Are Patients Capable of Assessing Them? A Mixed-Methods Approach Including Physicians' and Health Care Consumers' Perspectives.

    Science.gov (United States)

    Rothenfluh, Fabia; Schulz, Peter J

    2017-05-01

    Physician rating websites (PRWs) offer health care consumers the opportunity to evaluate their doctor anonymously. However, physicians' professional training and experience create a vast knowledge gap in medical matters between physicians and patients. This raises ethical concerns about the relevance and significance of health care consumers' evaluation of physicians' performance. To identify the aspects physician rating websites should offer for evaluation, this study investigated the aspects of physicians and their practice relevant for identifying a good doctor, and whether health care consumers are capable of evaluating these aspects. In a first step, a Delphi study with physicians from 4 specializations was conducted, testing various indicators to identify a good physician. These indicators were theoretically derived from Donabedian, who classifies quality in health care into pillars of structure, process, and outcome. In a second step, a cross-sectional survey with health care consumers in Switzerland (N=211) was launched based on the indicators developed in the Delphi study. Participants were asked to rate the importance of these indicators to identify a good physician and whether they would feel capable to evaluate those aspects after the first visit to a physician. All indicators were ordered into a 4×4 grid based on evaluation and importance, as judged by the physicians and health care consumers. Agreement between the physicians and health care consumers was calculated applying Holsti's method. In the majority of aspects, physicians and health care consumers agreed on what facets of care were important and not important to identify a good physician and whether patients were able to evaluate them, yielding a level of agreement of 74.3%. The two parties agreed that the infrastructure, staff, organization, and interpersonal skills are both important for a good physician and can be evaluated by health care consumers. Technical skills of a doctor and outcomes

  6. Air pollution, asthma and allergy - the importance of different types of particles; Luftforurensning, astma og allergi - betydningen av ulike partikler

    Energy Technology Data Exchange (ETDEWEB)

    Ormstad, Heidi; Loevik, Martinus

    2002-07-01

    Particulate air pollution has been much discussed in Norway during the last few years. Coarse particles from asphalt are likely to have quite different properties than the far smaller particles from diesel exhaust. On the basis of data from the literature and our own research, we discuss the health problem of different types of particles with a focus on allergy and respiratory symptoms. Diesel exhaust particles have well-documented adverse effects in relation to allergic airway disease. They increase symptoms load in already allergic individuals and also seem to contribute to the increased prevalence of allergy. PM{sub 10} is today measured on the basis of weight, not on number. Diesel exhaust particles are much smaller than road surface particles; hence PM{sub 10} measurements reflect road surface dust pollution more than exhaust particles. Focus should now be given to diesel exhaust particles in order to reduce the adverse health effects of particulate air pollution in Norwegian cities. (author)

  7. [Confidence interval or p-value--similarities and differences between two important methods of statistical inference of quantitative studies].

    Science.gov (United States)

    Harari, Gil

    2014-01-01

    Statistic significance, also known as p-value, and CI (Confidence Interval) are common statistics measures and are essential for the statistical analysis of studies in medicine and life sciences. These measures provide complementary information about the statistical probability and conclusions regarding the clinical significance of study findings. This article is intended to describe the methodologies, compare between the methods, assert their suitability for the different needs of study results analysis and to explain situations in which each method should be used.

  8. Different opinions of physicians on the importance of measures to prevent acquisition of Pseudomonas aeruginosa from the environment.

    Science.gov (United States)

    Steinkamp, Gratiana; Ullrich, Gerald

    2003-12-01

    Since chronic infection with mucoid Pseudomonas aeruginosa (PA) is associated with deteriorating lung function, many parents of young children with cystic fibrosis (CF) fear the first PA positive throat swab as a milestone in the progression of the disease. To reduce the risk of PA acquisition from the environment, they perform preventive measures at home or outdoors. In an attempt to evaluate the attitude of CF physicians towards these measures and the respective consulting practice, we mailed a questionnaire to all 65 certified paediatric CF centres in Germany. Physicians from 54 (83%) CF clinics replied. They expressed widely different ideas about the impact of the environment for the acquisition of P. aeruginosa, and recommended a large spectrum of preventive measures. Some physicians proposed only few precautions, which focussed on the prevention of cross-infection between patients, whereas others suggested prevention of any contact with moist or wet places, e.g. use different toothbrushes for mornings and evenings, or do without air-conditioning in the car. CF physicians have different opinions on the risk of PA acquisition from the environment. Doctors who recommend strict precautions could engender a parental fear of a ubiquous threat from invisible bacteria. The resulting extended safety measures might impair the family's quality of life. Copyright 2003 European Cystic Fibrosis Society

  9. When students from different professions are co-located: the importance of interprofessional rapport for learning to work together.

    Science.gov (United States)

    Croker, Anne; Fisher, Karin; Smith, Tony

    2015-01-01

    With increasing interest and research into interprofessional learning, there is scope to more deeply understand what happens when students from different professions live and study in the same location. This study aimed to explore the issue of co-location and its effects on how students learn to work with other professions. The setting for this study was a rural health education facility in Australia with close links to local health care and community services. Philosophical hermeneutics informed the research method. Interviews were undertaken with 29 participants, including students, academic educators and clinical supervisors in diagnostic radiography, medicine, nursing, nutrition and dietetics, pharmacy, physiotherapy, occupational therapy, and speech pathology. Photo-elicitation was used to facilitate participant engagement with the topic. The findings foreground the value of interprofessional rapport building opportunities for students learning to work together. Enabled by the proximity of different professions in shared educational, clinical and social spaces, interprofessional rapport building was contingent on contextual conditions (balance of professions, shared spaces and adequate time) and individual's interpersonal capabilities (being interested, being inclusive, developing interpersonal bonds, giving and receiving respect, bringing a sense of own profession and being patient-centred). In the absence of these conditions and capabilities, negative professional stereotypes may be inadvertently re-enforced. From these findings suggestions are made for nurturing interprofessional rapport building opportunities to enable students of different professions to learn to work together.

  10. Daily events are important for age differences in mean and duration for negative affect but not positive affect.

    Science.gov (United States)

    Charles, Susan T; Mogle, Jacqueline; Urban, Emily J; Almeida, David M

    2016-11-01

    Across midlife and into old age, older adults often report lower levels of negative affect and similar if not higher levels of positive affect than relatively younger adults. Researchers have offered a simple explanation for this result: Age is related to reductions in stressors and increases in pleasurable activities that result in higher levels of well-being. The current study examines subjective reports of emotional experience assessed across 8 days in a large sample of adults (N = 2,022) ranging from 35 to 84 years old. By modeling age differences before and after adjusting for daily positive uplifts and negative stressors, this article assesses the extent to which daily events account for age differences in positive and negative affect reports. Consistent with previous research, the authors found that older age is related to lower mean levels and shorter duration of a negative emotional experience in a model only adjusting for gender, education, and ethnicity. After adjusting for daily events, however, the linear age-related effects were no longer significant. For positive affect, adjusting for daily events did not alter age-related patterns of experiencing higher mean levels and longer positive experience duration, suggesting that other factors underlie age-related increases in positive affect. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

  11. Tidal Response to Sea-Level Rise in Different Types of Estuaries: The Importance of Length, Bathymetry, and Geometry

    Science.gov (United States)

    Du, Jiabi; Shen, Jian; Zhang, Yinglong J.; Ye, Fei; Liu, Zhuo; Wang, Zhengui; Wang, Ya Ping; Yu, Xin; Sisson, Mac; Wang, Harry V.

    2018-01-01

    Tidal response to sea-level rise (SLR) varies in different coastal systems. To provide a generic pattern of tidal response to SLR, a systematic investigation was conducted using numerical techniques applied to idealized and realistic estuaries, with model results cross-checked by analytical solutions. Our results reveal that the response of tidal range to SLR is nonlinear, spatially heterogeneous, and highly affected by the length and bathymetry of an estuary and weakly affected by the estuary convergence with an exception of strong convergence. Contrary to the common assumption that SLR leads to a weakened bottom friction, resulting in increased tidal amplitude, we demonstrate that tidal range is likely to decrease in short estuaries and in estuaries with a narrow channel and large low-lying shallow areas.

  12. "Seeing" the Difference: The Importance of Visibility and Action as a Mark of "Authenticity" in Co-production

    Science.gov (United States)

    Cooke, Jo; Langley, Joe; Wolstenholme, Dan; Hampshaw, Susan

    2017-01-01

    The Rycroft-Malone paper states that co-production relies on ‘authentic’ collaboration as a context for action. Our commentary supports and extends this assertion. We suggest that ‘authentic’ co-production involves processes where participants can ‘see’ the difference that they have made within the project and beyond. We provide examples including: the use of design in health projects which seek to address power issues and make contributions visible through iteration and prototyping; and the development of ‘actionable outputs’ from research that are the physical embodiment of co-production. Finally, we highlight the elements of the Collaboration for Leadership in Applied Health Research and Care (CLAHRC) architecture that enables the inclusion of such collaborative techniques that demonstrate visible co-production. We reinforce the notion that maintaining collaboration requires time, flexible resources, blurring of knowledge producer-user boundaries, and leaders who promote epistemological tolerance and methodological exploration. PMID:28812827

  13. Age differences in false memory: The importance of retrieval monitoring processes and their modulation by memory quality.

    Science.gov (United States)

    Fandakova, Yana; Sander, Myriam C; Grandy, Thomas H; Cabeza, Roberto; Werkle-Bergner, Markus; Shing, Yee Lee

    2018-02-01

    Older adults are more likely than younger adults to falsely recall past episodes that occurred differently or not at all. We examined whether older adults' propensity for false associative memory is related to declines in postretrieval monitoring processes and their modulation with varying memory representations. Younger (N = 20) and older adults (N = 32) studied and relearned unrelated scene-word pairs, followed by a final cued recall that was used to distribute the pairs for an associative recognition test 24 hours later. This procedure allowed individualized formation of rearranged pairs that were made up of elements of pairs that were correctly recalled in the final cued recall ("high-quality" pairs), and of pairs that were not correctly recalled ("low-quality" pairs). Both age groups falsely recognized more low-quality than high-quality rearranged pairs, with a less pronounced reduction in false alarms to high-quality pairs in older adults. In younger adults, cingulo-opercular activity was enhanced for false alarms and for low-quality correct rejections, consistent with its role in postretrieval monitoring. Older adults did not show such modulated recruitment, suggesting deficits in their selective engagement of monitoring processes given variability in the fidelity of memory representations. There were no age differences in hippocampal activity, which was higher for high-quality than low-quality correct rejections in both age groups. These results demonstrate that the engagement of cingulo-opercular monitoring mechanisms varies with memory representation quality and contributes to age-related deficits in false associative memory. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

  14. Differences in virulence markers between Helicobacter pylori strains from Iraq and those from Iran: potential importance of regional differences in H. pylori-associated disease.

    Science.gov (United States)

    Hussein, Nawfal R; Mohammadi, Marjan; Talebkhan, Yeganeh; Doraghi, Masoumeh; Letley, Darren P; Muhammad, Merdan K; Argent, Richard H; Atherton, John C

    2008-05-01

    Helicobacter pylori causes peptic ulceration and gastric adenocarcinoma; the latter is common in Iran but not in Iraq. We hypothesized that more virulent H. pylori strains may be found in Iran than in Iraq and so compared established and newly described virulence factors in strains from these countries. We studied 59 unselected dyspeptic patients from Iran and 49 from Iraq. cagA was found in similar proportions of strains from both countries (76% in Iran versus 71% in Iraq) and was significantly associated with peptic ulcer disease in Iraq (P dupA was found in similar proportions of Iranian and Iraqi strains (38% and 32%, respectively) and was associated with peptic ulceration in Iraqi patients (P important in the disease-prone Iranian population.

  15. High Throughput Sequencing of Small RNAs in the Two Cucurbita Germplasm with Different Sodium Accumulation Patterns Identifies Novel MicroRNAs Involved in Salt Stress Response.

    Science.gov (United States)

    Xie, Junjun; Lei, Bo; Niu, Mengliang; Huang, Yuan; Kong, Qiusheng; Bie, Zhilong

    2015-01-01

    MicroRNAs (miRNAs), a class of small non-coding RNAs, recognize their mRNA targets based on perfect sequence complementarity. MiRNAs lead to broader changes in gene expression after plants are exposed to stress. High-throughput sequencing is an effective method to identify and profile small RNA populations in non-model plants under salt stresses, significantly improving our knowledge regarding miRNA functions in salt tolerance. Cucurbits are sensitive to soil salinity, and the Cucurbita genus is used as the rootstock of other cucurbits to enhance salt tolerance. Several cucurbit crops have been used for miRNA sequencing but salt stress-related miRNAs in cucurbit species have not been reported. In this study, we subjected two Cucurbita germplasm, namely, N12 (Cucurbita. maxima Duch.) and N15 (Cucurbita. moschata Duch.), with different sodium accumulation patterns, to Illumina sequencing to determine small RNA populations in root tissues after 4 h of salt treatment and control. A total of 21,548,326 and 19,394,108 reads were generated from the control and salt-treated N12 root tissues, respectively. By contrast, 19,108,240 and 20,546,052 reads were obtained from the control and salt-treated N15 root tissues, respectively. Fifty-eight conserved miRNA families and 33 novel miRNAs were identified in the two Cucurbita germplasm. Seven miRNAs (six conserved miRNAs and one novel miRNAs) were up-regulated in salt-treated N12 and N15 samples. Most target genes of differentially expressed novel miRNAs were transcription factors and salt stress-responsive proteins, including dehydration-induced protein, cation/H+ antiporter 18, and CBL-interacting serine/threonine-protein kinase. The differential expression of miRNAs between the two Cucurbita germplasm under salt stress conditions and their target genes demonstrated that novel miRNAs play an important role in the response of the two Cucurbita germplasm to salt stress. The present study initially explored small RNAs in the

  16. High Throughput Sequencing of Small RNAs in the Two Cucurbita Germplasm with Different Sodium Accumulation Patterns Identifies Novel MicroRNAs Involved in Salt Stress Response.

    Directory of Open Access Journals (Sweden)

    Junjun Xie

    Full Text Available MicroRNAs (miRNAs, a class of small non-coding RNAs, recognize their mRNA targets based on perfect sequence complementarity. MiRNAs lead to broader changes in gene expression after plants are exposed to stress. High-throughput sequencing is an effective method to identify and profile small RNA populations in non-model plants under salt stresses, significantly improving our knowledge regarding miRNA functions in salt tolerance. Cucurbits are sensitive to soil salinity, and the Cucurbita genus is used as the rootstock of other cucurbits to enhance salt tolerance. Several cucurbit crops have been used for miRNA sequencing but salt stress-related miRNAs in cucurbit species have not been reported. In this study, we subjected two Cucurbita germplasm, namely, N12 (Cucurbita. maxima Duch. and N15 (Cucurbita. moschata Duch., with different sodium accumulation patterns, to Illumina sequencing to determine small RNA populations in root tissues after 4 h of salt treatment and control. A total of 21,548,326 and 19,394,108 reads were generated from the control and salt-treated N12 root tissues, respectively. By contrast, 19,108,240 and 20,546,052 reads were obtained from the control and salt-treated N15 root tissues, respectively. Fifty-eight conserved miRNA families and 33 novel miRNAs were identified in the two Cucurbita germplasm. Seven miRNAs (six conserved miRNAs and one novel miRNAs were up-regulated in salt-treated N12 and N15 samples. Most target genes of differentially expressed novel miRNAs were transcription factors and salt stress-responsive proteins, including dehydration-induced protein, cation/H+ antiporter 18, and CBL-interacting serine/threonine-protein kinase. The differential expression of miRNAs between the two Cucurbita germplasm under salt stress conditions and their target genes demonstrated that novel miRNAs play an important role in the response of the two Cucurbita germplasm to salt stress. The present study initially explored small

  17. A systems biology approach identified different regulatory networks targeted by KSHV miR-K12-11 in B cells and endothelial cells.

    Science.gov (United States)

    Yang, Yajie; Boss, Isaac W; McIntyre, Lauren M; Renne, Rolf

    2014-08-08

    Kaposi's sarcoma associated herpes virus (KSHV) is associated with tumors of endothelial and lymphoid origin. During latent infection, KSHV expresses miR-K12-11, an ortholog of the human tumor gene hsa-miR-155. Both gene products are microRNAs (miRNAs), which are important post-transcriptional regulators that contribute to tissue specific gene expression. Advances in target identification technologies and molecular interaction databases have allowed a systems biology approach to unravel the gene regulatory networks (GRNs) triggered by miR-K12-11 in endothelial and lymphoid cells. Understanding the tissue specific function of miR-K12-11 will help to elucidate underlying mechanisms of KSHV pathogenesis. Ectopic expression of miR-K12-11 differentially affected gene expression in BJAB cells of lymphoid origin and TIVE cells of endothelial origin. Direct miRNA targeting accounted for a small fraction of the observed transcriptome changes: only 29 genes were identified as putative direct targets of miR-K12-11 in both cell types. However, a number of commonly affected biological pathways, such as carbohydrate metabolism and interferon response related signaling, were revealed by gene ontology analysis. Integration of transcriptome profiling, bioinformatic algorithms, and databases of protein-protein interactome from the ENCODE project identified different nodes of GRNs utilized by miR-K12-11 in a tissue-specific fashion. These effector genes, including cancer associated transcription factors and signaling proteins, amplified the regulatory potential of a single miRNA, from a small set of putative direct targets to a larger set of genes. This is the first comparative analysis of miRNA-K12-11's effects in endothelial and B cells, from tissues infected with KSHV in vivo. MiR-K12-11 was able to broadly modulate gene expression in both cell types. Using a systems biology approach, we inferred that miR-K12-11 establishes its GRN by both repressing master TFs and influencing

  18. Important points for primary cleft palate repair for speech derived from speech outcome after three different types of palatoplasty.

    Science.gov (United States)

    Funayama, Emi; Yamamoto, Yuhei; Nishizawa, Noriko; Mikoya, Tadashi; Okamoto, Toru; Imai, Satoko; Murao, Naoki; Furukawa, Hiroshi; Hayashi, Toshihiko; Oyama, Akihiko

    2014-12-01

    This study was performed to investigate speech outcomes after three different types of palatoplasty for the same cleft type. The objective of this study was to investigate the surgical techniques that are essential for normal speech on the basis of each surgical characteristic. Thirty-eight consecutive nonsyndromic patients with unilateral complete cleft of the lip, alveolus, and palate were enrolled in this study. Speech outcomes, i.e., nasal emission, velopharyngeal insufficiency, and malarticulation after one-stage pushback (PB), one-stage modified Furlow (MF), or conventional two-stage MF palatoplasty, were evaluated at 4 (before intensive speech therapy) and 8 (after closure of oronasal fistula/unclosed hard palate) years of age. Velopharyngeal insufficiency at 4 (and 8) years of age was present in 5.9% (0.0%), 0.0% (0.0%), and 10.0% (10.0%) of patients who underwent one-stage PB, one-stage MF, or two-stage MF palatoplasty, respectively. No significant differences in velopharyngeal function were found among these three groups at 4 and 8 years of age. Malarticulation at 4 years of age was found in 35.3%, 10.0%, and 63.6% of patients who underwent one-stage PB, one-stage MF, and two-stage MF palatoplasty, respectively. Malarticulation at 4 years of age was significantly related to the presence of a fistula/unclosed hard palate (P<0.01). One-stage MF palatoplasty that was not associated with postoperative oronasal fistula (ONF) showed significantly better results than two-stage MF (P<0.01). Although the incidences of malarticulation at 8 years of age were decreased in each group compared to at 4 years of age, the incidence was still high in patients treated with two-stage MF (45.5%). On the whole, there was a significant correlation between ONF/unclosed hard palate at 4 years of age and malarticulation at 8 years of age (P<0.05). Appropriate muscle sling formation can compensate for a lack of retropositioning of the palate for adequate velopharyngeal closure

  19. Gender-related individual differences and the structure of vocational interests: the importance of the people-things dimension.

    Science.gov (United States)

    Lippa, R

    1998-04-01

    In 3 studies (respective Ns = 289, 394, and 1,678), males and females were assessed on Big Five traits, masculine instrumentality (M), feminine expressiveness (F), gender diagnosticity (GD), and RIASEC (Realistic, Investigative, Artistic, Social, Enterprising, Conventional) vocational interest scales. Factor analyses of RIASEC scores consistently showed evidence for D.J. Prediger's (1982) People-Things and Ideas-Data dimensions, and participants' factor scores on these dimensions were computed. In all studies Big Five Openness was related to Ideas-Data but not to People-Things. Gender was strongly related to People-Things but not to Ideas-Data. Within each sex, GD correlated strongly with People-Things but not with Ideas-Data. M, F, and Big Five measures other than Openness tended not to correlate strongly with RIASEC scales or dimensions. The results suggest that gender and gender-related individual differences within the sexes are strongly linked to the People-Things dimension of vocational interests.

  20. Hypovitamininosis D in Childhood Cancer Survivors: Importance of Vitamin D Supplementation and Measurement Over Different Points of Time.

    Science.gov (United States)

    Fouda, Ashraf; Kandil, Shaimaa; Boujettif, Khadijah; Fayea, Najwa

    2018-03-01

    This observational retrospective cross-sectional and case-controlled study measures levels of 25-hydroxy-vitamin D (25-OH-VD) in pediatric cancer survivors at different intervals and assesses the effect of 2 supplementation regimens over a period of 12 months. Sixty-eight patients were included in this quasi-experimental study, of which 32 were boys and 36 were girls. A control group of 30 healthy children were included. It was found that initial 25-OH-VD levels were insufficient (vitamin D during the 12 months in comparison with patients supplemented with 1000 IU/day. Our findings indicate that pediatric cancer survivors who require frequent monitoring of their 25-OH-VD levels yielded better results when supplemented with higher doses of vitamin D over longer periods of time. A course of oral vitamin D supplementation regimen of 50,000 IU/month gave effective results with excellent compliance and no reports of any adverse or harmful effects.

  1. A Pilot Study: The importance of inter-individual differences in inorganic arsenic metabolism for birth weight outcome

    Science.gov (United States)

    Gelmann, Elyssa R; Gurzau, Eugen; Gurzau, Anca; Goessler, Walter; Kunrath, Julie

    2013-01-01

    Inorganic arsenic (iAs) exposure is detrimental to birth outcome. We lack information regarding the potential for iAs metabolism to affect fetal growth. Our pilot study evaluated postpartum Romanian women with known birth weight outcome for differences in iAs metabolism. Subjects were chronically exposed to low-to-moderate drinking water iAs. We analyzed well water, arsenic metabolites in urine, and toenail arsenic. Urine iAs and metabolites, toenail iAs, and secondary methylation efficiency increased as an effect of exposure (piAs and metabolites showed a significant interaction effect between exposure and birth weight. Moderately exposed women with low compared to normal birth weight outcome had greater metabolite excretion (piAs >9μg/L (p=0.019). Metabolic partitioning of iAs toward excretion may impair fetal growth. Prospective studies on iAs excretion before and during pregnancy may provide a biomarker for poor fetal growth risk. PMID:24211595

  2. Relative importance of various regeneration mechanisms in different restoration stages of Quercus variabilis forest after selective logging

    Directory of Open Access Journals (Sweden)

    Yaoqin Xue

    2014-08-01

    Full Text Available Aim of study: Quercus variabilis (Chinese cork oak reproduces asexually and sexually. This study aimed to determine the status and growth of asexual and sexual recruits of Q. variabilis in different forest recovery stages.Area of study: Three selective logged stands and one unlogged stand in Q. variabilis forest, Shaanxi Province, China.Material and Methods: Origin, number, basal diameter, height and size structure of Q. variabilis shoots (height ≤200 cm were investigated in the plots of 5, 10, and 20-years post-logging stands and unlogged stand. Effects of recovery stage on the density and growth of the three original recruits (stump sprouts, stem base sprouts and true seedlings were analysis by One-way ANOVA.Main results: Sprouts dominated logged stands, whereas true seedlings dominated unlogged stand, stem base sprouts only existed in 20-years post-logging and unlogged stands. Stump sprout density and sprout number per stump both declined with extended post-logging time. True seedlings density increased from 7 to 20 shoots/100 m2 as the postlogging time extended, and peaked in unlogged stand (94 shoots/100 m2. An ongoing size structure was observed in true seedlings in all stands. Stump sprouts were taller and greater than true seedlings.Research highlights: Stump sprouts contributed more to Q. variabilis forest recovery in the early stage after disturbance. The contribution of true seedlings was limited in the same stage, but they were beneficial for population long-term development. Stem base sprouts were most likely to be a survival strategy rather than a reproductive strategy.Key words: asexual reproduction; true seedling; post-logging time; Chinese cork oak.

  3. The relative importance of different grass components in controlling runoff and erosion on a hillslope under simulated rainfall

    Science.gov (United States)

    Li, Changjia; Pan, Chengzhong

    2018-03-01

    The effects of vegetation cover on overland flow and erosion processes on hillslopes vary with vegetation type and spatial distribution and the different vegetation components, including the above- and below-ground biomass. However, few attempts have been made to quantify how these factors affect erosion processes. Field experimental plots (5 m × 2 m) with a slope of approximately 25° were constructed and simulated rainfall (60 mm hr-1) (Rainfall) and simulated rainfall combined with upslope overland flow (20 L min-1) (Rainfall + Flow) were applied. Three grass species were planted, specifically Astragalus adsurgens (A. adsurgens), Medicago sativa (M. sativa) and Cosmos bipinnatus (C. bipinnatus). To isolate and quantify the relative contributions of the above-ground grass parts (stems, litter cover and leaves) and the roots to reducing surface runoff and erosion, each of the three grass species was subjected to three treatments: intact grass control (IG), no litter or leaves (only the grass stems and roots were reserved) (NLL), and only roots remaining (OR). The results showed that planting grass significantly reduced overland flow rate and velocity and sediment yield, and the mean reductions were 21.8%, 29.1% and 67.1%, respectively. M. sativa performed the best in controlling water and soil losses due to its thick canopy and dense, fine roots. Grasses reduced soil erosion mainly during the early stage of overland flow generation. The above-ground grass parts primarily contributed to reducing overland flow rate and velocity, with mean relative contributions of 64% and 86%, respectively. The roots played a predominant role in reducing soil erosion, with mean contribution of 84%. Due to the impact of upslope inflow, overland flow rate and velocity and sediment yield increased under the Rainfall + Flow conditions. The results suggest that grass species on downslope parts of semi-arid hillslopes performed better in reducing water and soil losses. This study is

  4. Stakeholders identify similar barriers but different strategies to facilitate return-to-work: A vignette of a worker with an upper extremity condition.

    Science.gov (United States)

    Peters, Susan E; Truong, Anthony P; Johnston, Venerina

    2018-01-01

    Stakeholders involved in the return-to-work (RTW) process have different roles and qualificationsOBJECTIVE:To explore the perspectives of Australian stakeholders of the RTW barriers and strategies for a worker with an upper extremity condition and a complex workers' compensation case. Using a case vignette, stakeholders were asked to identify barriers and recommend strategies to facilitate RTW. Content analysis was performed on the open-ended responses. The responses were categorised into RTW barriers and strategies using the biopsychosocial model. Pearson's Chi Square and ANOVA were performed to establish group differences. 621 participants (488 healthcare providers (HCPs), 62 employers, 55 insurers and 16 lawyers) identified 36 barriers (31 modifiable): 4 demographic; 8 biological; 15 psychological and 9 social barriers. 484 participants reported 16 RTW strategies: 4 biological; 6 psychological and 6 social strategies. 'Work relationship stressors' (83.4%) and 'Personal relationship stressors' (64.7%) were the most frequently nominated barriers. HCPs most frequently nominated 'Pain management' (49.6%), while employers, insurers and lawyers nominated 'RTW planning/Suitable duties programs' (40.5%; 42.9%; 80%). Stakeholders perceived similar barriers for RTW but recommended different strategies. Stakeholders appeared to be more proficient in identifying barriers than recommending strategies. Future research should focus on tools to both identify RTW barriers and direct intervention.

  5. Utility of Neck Circumference for Identifying Metabolic Syndrome by Different Definitions in Chinese Subjects over 50 Years Old: A Community-Based Study

    Directory of Open Access Journals (Sweden)

    Shuo Lin

    2018-01-01

    Full Text Available Aims. Whether neck circumference (NC could be used as a valuable tool for identifying metabolic syndrome (MS by different criteria in Chinese is still unclear. Methods. We conducted a cross-sectional survey from October 2010 to January 2011 in Shipai community, Guangzhou, Guangdong Province, China. A total of 1473 subjects aged over 50 years were investigated. We measured height, weight, NC, waist circumference, blood pressure, blood glucose, and lipids in all subjects. MS was identified by criteria of the National Cholesterol Education Program-Adult Treatment Panel III (NCEP-ATP III, Chinese Diabetes Society (CDS, and International Diabetes Federation (IDF. Results. Mean NC was 38.0 ± 2.7 cm in men and 34.2 ± 2.5 cm in women. By using receiver operating characteristic curves, the area under the curve (AUC of NC for identifying MS (IDF was 0.823 in men and 0.777 in women, while for identifying MS (CDS, it was 0.788 in men and 0.762 in women. The AUC of NC for diagnosing MS (ATP III was 0.776 in men and 0.752 in women. The optimal cut points of NC for MS were 38.5 cm by three definitions in men, while those were 34.2 cm, 33.4 cm, and 34.0 cm in women by IDF, ATP III, and CDS definitions, respectively. No significant difference was observed between the AUC of NC and BMI for diagnosing MS by using different criteria (all p>0.05. Conclusions. NC is associated with MS by different definitions in Chinese subjects over 50 years old. It may be a useful tool to identify MS in a community population.

  6. Exploring the importance of different items as reasons for leaving emergency medical services between fully compensated, partially compensated, and non-compensated/volunteer samples.

    Science.gov (United States)

    Blau, Gary; Chapman, Susan; Gibson, Gregory; Bentley, Melissa A

    2011-01-01

    The purpose of our study was to investigate the importance of different items as reasons for leaving the Emergency Medical Service (EMS) profession. An exit survey was returned by three distinct EMS samples: 127 full compensated, 45 partially compensated and 72 non-compensated/volunteer respondents, who rated the importance of 17 different items for affecting their decision to leave EMS. Unfortunately, there were a high percentage of "not applicable" responses for 10 items. We focused on those seven items that had a majority of useable responses across the three samples. Results showed that the desire for better pay and benefits was a more important reason for leaving EMS for the partially compensated versus fully compensated respondents. Perceived lack of advancement opportunity was a more important reason for leaving for the partially compensated and volunteer groups versus the fully compensated group. Study limitations are discussed and suggestions for future research offered.

  7. Application of an ecosystem model to evaluate the importance of different processes and food web structure for transfer of 13 elements in a shallow lake.

    Science.gov (United States)

    Konovalenko, L; Bradshaw, C; Andersson, E; Kautsky, U

    2017-04-01

    In environmental risk assessments of nuclear waste, there is need to estimate the potential risks of a large number of radionuclides over a long time period during which the environment is likely to change. Usually concentration ratios (CRs) are used to calculate the activity concentrations in organisms. However, CRs are not available for all radionuclides and they are not easily scalable to the varying environment. Here, an ecosystem transport model of elements, which estimates concentrations in organisms using carbon flows and food transfer instead of CR is presented. It is a stochastic compartment model developed for Lake Eckarfjärden at Forsmark in Sweden. The model was based on available data on carbon circulation, physical and biological processes from the site and identifies 11 functional groups of organisms. The ecosystem model was used to estimate the environmental transfer of 13 elements (Al, Ca, Cd, Cl, Cs, I, Ni, Nb, Pb, Se, Sr, Th, U) to various aquatic organisms, using element-specific distribution coefficients for suspended particles (K d PM ) and upper sediment (K d sed ), and subsequent transfer in the foodweb. The modelled CRs for different organism groups were compared with measured CRs from the lake and literature data, and showed good agreement for many elements and organisms, particularly for lower trophic levels. The model is, therefore, proposed as an alternative to measured CR, though it is suggested to further explore active uptake, assimilation and elimination processes to get better correspondence for some of the elements. The benthic organisms (i.e. bacteria, microphytobenthos and macroalgae) were identified as more important than pelagic organisms for transfer of elements to top predators. The element transfer model revealed that most of the radionuclides were channelled through the microbial loop, despite the fact that macroalgae dominated the carbon fluxes in this lake. Thus, element-specific adsorption of elements to the surface of

  8. EcoIP: An Open Source Image Analysis Toolkit to Identify Different Stages of Plant Phenology for Multiple Species with Pan-Tilt-Zoom Cameras

    DEFF Research Database (Denmark)

    Granados, Joel; Bonnet, Philippe

    2013-01-01

    Because of the increased number of cameras employed in environmental sensing and the tremendous image output they produce, we have created a flexible, open-source software solution called EcoIP to help automatically determine different phenophases for different species from digital image sequences....... Onset and ending dates are calculated through an iterative process: (1) training images are chosen and areas of interest identified, (2) separation of foreground and background is accomplished based on a naive Bayesian method, (3) a signal is created based on the separation model and (4) it is then fit...... to a sigmoid that contains the dates of interest. Results using different phenological events of different species indicate that estimated dates fall within a few days of the observed dates for most cases. Our experiments indicate that color separability and scene illumination are contributing factors...

  9. An Allometric Modelling Approach to Identify the Optimal Body Shape Associated with, and Differences between Brazilian and Peruvian Youth Motor Performance.

    Directory of Open Access Journals (Sweden)

    Simonete Silva

    Full Text Available Children from developed and developing countries differ in their body size and shape due to marked differences across their life history caused by social, economic and cultural differences which are also linked to their motor performance (MP. We used allometric models to identify size/shape characteristics associated with MP tests between Brazilian and Peruvian schoolchildren. A total of 4,560 subjects, 2,385 girls and 2,175 boys aged 9-15 years were studied. Height and weight were measured; biological maturation was estimated with the maturity offset technique; MP measures included the 12 minute run (12MR, handgrip strength (HG, standing long jump (SLJ and the shuttle run speed (SR tests; physical activity (PA was assessed using the Baecke questionnaire. A multiplicative allometric model was adopted to adjust for body size differences across countries. Reciprocal ponderal index (RPI was found to be the most suitable body shape indicator associated with the 12MR, SLJ, HG and SR performance. A positive maturation offset parameter was also associated with a better performance in SLJ, HG and SR tests. Sex differences were found in all motor tests. Brazilian youth showed better scores in MP than their Peruvian peers, even when controlling for their body size differences The current study identified the key body size associated with four body mass-dependent MP tests. Biological maturation and PA were associated with strength and motor performance. Sex differences were found in all motor tests, as well as across countries favoring Brazilian children even when accounting for their body size/shape differences.

  10. An Allometric Modelling Approach to Identify the Optimal Body Shape Associated with, and Differences between Brazilian and Peruvian Youth Motor Performance

    Science.gov (United States)

    Silva, Simonete; Bustamante, Alcibíades; Nevill, Alan; Katzmarzyk, Peter T.; Freitas, Duarte; Prista, António; Maia, José

    2016-01-01

    Children from developed and developing countries differ in their body size and shape due to marked differences across their life history caused by social, economic and cultural differences which are also linked to their motor performance (MP). We used allometric models to identify size/shape characteristics associated with MP tests between Brazilian and Peruvian schoolchildren. A total of 4,560 subjects, 2,385 girls and 2,175 boys aged 9–15 years were studied. Height and weight were measured; biological maturation was estimated with the maturity offset technique; MP measures included the 12 minute run (12MR), handgrip strength (HG), standing long jump (SLJ) and the shuttle run speed (SR) tests; physical activity (PA) was assessed using the Baecke questionnaire. A multiplicative allometric model was adopted to adjust for body size differences across countries. Reciprocal ponderal index (RPI) was found to be the most suitable body shape indicator associated with the 12MR, SLJ, HG and SR performance. A positive maturation offset parameter was also associated with a better performance in SLJ, HG and SR tests. Sex differences were found in all motor tests. Brazilian youth showed better scores in MP than their Peruvian peers, even when controlling for their body size differences The current study identified the key body size associated with four body mass-dependent MP tests. Biological maturation and PA were associated with strength and motor performance. Sex differences were found in all motor tests, as well as across countries favoring Brazilian children even when accounting for their body size/shape differences. PMID:26939118

  11. An Allometric Modelling Approach to Identify the Optimal Body Shape Associated with, and Differences between Brazilian and Peruvian Youth Motor Performance.

    Science.gov (United States)

    Silva, Simonete; Bustamante, Alcibíades; Nevill, Alan; Katzmarzyk, Peter T; Freitas, Duarte; Prista, António; Maia, José

    2016-01-01

    Children from developed and developing countries differ in their body size and shape due to marked differences across their life history caused by social, economic and cultural differences which are also linked to their motor performance (MP). We used allometric models to identify size/shape characteristics associated with MP tests between Brazilian and Peruvian schoolchildren. A total of 4,560 subjects, 2,385 girls and 2,175 boys aged 9-15 years were studied. Height and weight were measured; biological maturation was estimated with the maturity offset technique; MP measures included the 12 minute run (12MR), handgrip strength (HG), standing long jump (SLJ) and the shuttle run speed (SR) tests; physical activity (PA) was assessed using the Baecke questionnaire. A multiplicative allometric model was adopted to adjust for body size differences across countries. Reciprocal ponderal index (RPI) was found to be the most suitable body shape indicator associated with the 12MR, SLJ, HG and SR performance. A positive maturation offset parameter was also associated with a better performance in SLJ, HG and SR tests. Sex differences were found in all motor tests. Brazilian youth showed better scores in MP than their Peruvian peers, even when controlling for their body size differences The current study identified the key body size associated with four body mass-dependent MP tests. Biological maturation and PA were associated with strength and motor performance. Sex differences were found in all motor tests, as well as across countries favoring Brazilian children even when accounting for their body size/shape differences.

  12. Preliminary comparison of different immune and production components in local and imported Saanen goats reared under a sub-tropical environment.

    Science.gov (United States)

    Barbour, Elie K; Itani, Houssam H; Sleiman, Fawwak T; Saade, Maya F; Harakeh, Steve; Nour, Afif M Abdel; Shaib, Houssam A

    2012-01-01

    Three objectives were included in this research work. The first objective compared different immune components in healthy mature males, mature females, and female kids of local and imported Saanen goats, reared under a sub-tropical environment. The significantly differing immune components were the blood monocyte percent, blood CD8 count, and the total white blood cell count. The second objective compared the performance of Saanen versus local does. The means of the milk yield and prolificacy of the imported Saanen does were significantly higher than those of the local does (pgoats on protection potential against prevalent diseases in the sub-tropical zone of the eastern Mediterranean countries is discussed.

  13. Metabolomics and transcriptomics identify pathway differences between visceral and subcutaneous adipose tissue in colorectal cancer patients: the ColoCare study.

    Science.gov (United States)

    Liesenfeld, David B; Grapov, Dmitry; Fahrmann, Johannes F; Salou, Mariam; Scherer, Dominique; Toth, Reka; Habermann, Nina; Böhm, Jürgen; Schrotz-King, Petra; Gigic, Biljana; Schneider, Martin; Ulrich, Alexis; Herpel, Esther; Schirmacher, Peter; Fiehn, Oliver; Lampe, Johanna W; Ulrich, Cornelia M

    2015-08-01

    Metabolic and transcriptomic differences between visceral adipose tissue (VAT) and subcutaneous adipose tissue (SAT) compartments, particularly in the context of obesity, may play a role in colorectal carcinogenesis. We investigated the differential functions of their metabolic compositions. Biochemical differences between adipose tissues (VAT compared with SAT) in patients with colorectal carcinoma (CRC) were investigated by using mass spectrometry metabolomics and gene expression profiling. Metabolite compositions were compared between VAT, SAT, and serum metabolites. The relation between patients' tumor stage and metabolic profiles was assessed. Presurgery blood and paired VAT and SAT samples during tumor surgery were obtained from 59 CRC patients (tumor stages I-IV) of the ColoCare cohort. Gas chromatography time-of-flight mass spectrometry and liquid chromatography quadrupole time-of-flight mass spectrometry were used to measure 1065 metabolites in adipose tissue (333 identified compounds) and 1810 metabolites in serum (467 identified compounds). Adipose tissue gene expression was measured by using Illumina's HumanHT-12 Expression BeadChips. Compared with SAT, VAT displayed elevated markers of inflammatory lipid metabolism, free arachidonic acid, phospholipases (PLA2G10), and prostaglandin synthesis-related enzymes (PTGD/PTGS2S). Plasmalogen concentrations were lower in VAT than in SAT, which was supported by lower gene expression of FAR1, the rate-limiting enzyme for ether-lipid synthesis in VAT. Serum sphingomyelin concentrations were inversely correlated (P = 0.0001) with SAT adipose triglycerides. Logistic regression identified lipids in patients' adipose tissues, which were associated with CRC tumor stage. As one of the first studies, we comprehensively assessed differences in metabolic, lipidomic, and transcriptomic profiles between paired human VAT and SAT and their association with CRC tumor stage. We identified markers of inflammation in VAT, which

  14. Formal consensus to identify clinically important changes in management resulting from the use of cardiovascular magnetic resonance (CMR) in patients who activate the primary percutaneous coronary intervention (PPCI) pathway.

    Science.gov (United States)

    Pufulete, Maria; Brierley, Rachel C; Bucciarelli-Ducci, Chiara; Greenwood, John P; Dorman, Stephen; Anderson, Richard A; Harris, Jessica; McAlindon, Elisa; Rogers, Chris A; Reeves, Barnaby C

    2017-06-22

    To define important changes in management arising from the use of cardiovascular magnetic resonance (CMR) in patients who activate the primary percutaneous coronary intervention (PPCI) pathway. Formal consensus study using literature review and cardiologist expert opinion to formulate consensus statements and setting up a consensus panel to review the statements (by completing a web-based survey, attending a face-to-face meeting to discuss survey results and modify the survey to reflect group discussion and completing the modified survey to determine which statements were in consensus). Formulation of consensus statements: four cardiologists (two CMR and two interventional) and six non-clinical researchers. Formal consensus: seven cardiologists (two CMR and three interventional, one echocardiography and one heart failure). Forty-nine additional cardiologists completed the modified survey. Thirty-seven draft statements describing changes in management following CMR were generated; these were condensed into 12 statements and reviewed through the formal consensus process. Three of 12 statements were classified in consensus in the first survey; these related to the role of CMR in identifying the cause of out-of-hospital cardiac arrest, providing a definitive diagnosis in patients found to have unobstructed arteries on angiography and identifying patients with left ventricular thrombus. Two additional statements were in consensus in the modified survey, relating to the ability of CMR to identify patients who have a poor prognosis after PPCI and assess ischaemia and viability in patients with multivessel disease. There was consensus that CMR leads to clinically important changes in management in five subgroups of patients who activate the PPCI pathway. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  15. Gamma-rays attenuation of zircons from Cambodia and South Africa at different energies: A new technique for identifying the origin of gemstone

    International Nuclear Information System (INIS)

    Limkitjaroenporn, P.; Kaewkhao, J.

    2014-01-01

    In this work, the gamma-rays interaction properties of zircons from Cambodia and South Africa have been studied. The densities of Cambodian and South African’s zircons are 4.6716±0.0040 g/cm 3 and 4.5505±0.0018 g/cm 3 , respectively. The mass attenuation coefficient and the effective atomic number of gemstones were measured with the gamma-ray in energies range 223–662 keV using the Compton scattering technique. The mass attenuation coefficients of both zircons decreased with the increasing of gamma-rays energies. The different mass attenuation coefficients between the two zircons observed at gamma-ray energies below 400 keV are attributed to the differences in the photoelectric interaction. The effective atomic number of zircons was decreased with the increasing of gamma-ray energies and showed totally different values between the Cambodia and South Africa sources. The origins of the two zircons could be successfully identified by the method based on gamma-rays interaction with matter with advantage of being a non-destructive testing. - Highlights: • Gamma-rays interaction of zircons from Cambodia and South Africa studied. • Measured energy is during 223–662 keV. • Different μ m between the two zircons observed at gamma-ray energies below 400 keV. • The origins the two zircons could be successfully identified

  16. MicroRNAs regulate T-cell production of interleukin-9 and identify hypoxia-inducible factor-2α as an important regulator of T helper 9 and regulatory T-cell differentiation.

    Science.gov (United States)

    Singh, Yogesh; Garden, Oliver A; Lang, Florian; Cobb, Bradley S

    2016-09-01

    MicroRNAs (miRNAs) regulate many aspects of helper T cell (Th) development and function. Here we found that they are required for the suppression of interleukin-9 (IL-9) expression in Th9 cells and other Th subsets. Two highly related miRNAs (miR-15b and miR-16) that we previously found to play an important role in regulatory T (Treg) cell differentiation were capable of suppressing IL-9 expression when they were over-expressed in Th9 cells. We used these miRNAs as tools to identify novel regulators of IL-9 expression and found that they could regulate the expression of Epas1, which encodes hypoxia-inducible factor (HIF)-2α. HIF proteins regulate metabolic pathway usage that is important in determining appropriate Th differentiation. The related protein, HIF-1α enhances Th17 differentiation and inhibits Treg cell differentiation. Here we found that HIF-2α was required for IL-9 expression in Th9 cells, but its expression was not sufficient in other Th subsets. Furthermore, HIF-2α suppressed Treg cell differentiation like HIF-1α, demonstrating both similar and distinct roles of the HIF proteins in Th differentiation and adding a further dimension to their function. Ironically, even though miR-15b and miR-16 suppressed HIF-2α expression in Treg cells, inhibiting their function in Treg cells did not lead to an increase in IL-9 expression. Therefore, the physiologically relevant miRNAs that regulate IL-9 expression in Treg cells and other subsets remain unknown. Nevertheless, the analysis of miR-15b and miR-16 function led to the discovery of the importance of HIF-2α so this work demonstrated the utility of studying miRNA function to identify novel regulatory pathways in helper T-cell development. © 2016 John Wiley & Sons Ltd.

  17. Differences in health insurance and health service utilization among Asian Americans: method for using the NHIS to identify unique patterns between ethnic groups.

    Science.gov (United States)

    Ruy, Hosihn; Young, Wendy B; Kwak, Hoil

    2002-01-01

    The purpose of this study is to outline a method to identify the characteristics of socioeconomic variables in determining the differences in health insurance coverage and health services utilization patterns for different ethnic groups, using the behavioural model of health service utilization. A sample drawn from Asian American adult respondents to the 1992, 1993, and 1994 National Health Interview Surveys (NHIS) in the USA formed the data set. The results showed Asian Americans as not being homogeneous. There were distinctly different demographic and socioeconomic characteristics between six Asian American ethnic groups that affect health insurance coverage and health service utilization. The study method is useful for constructing health policy and services to address the general public need without adversely affecting smaller minority groups. Secondary analysis of well-constructed national data sets such as the specific Asian ethnic groups in NHIS, offers a rich method for predicting the differential impact of specific health policies on various ethnic groups.

  18. Distribution-based estimates of minimum clinically important difference in cognition, arm function and lower body function after slow release-fampridine treatment of patients with multiple sclerosis

    DEFF Research Database (Denmark)

    Jensen, H B; Mamoei, Sepehr; Ravnborg, M.

    2016-01-01

    OBJECTIVE: To provide distribution-based estimates of the minimal clinical important difference (MCID) after slow release fampridine treatment on cognition and functional capacity in people with MS (PwMS). METHOD: MCID values were determined after SR-Fampridine treatment in 105 PwMS. Testing...

  19. Use of Instrumental Neutron Activation Analysis for Determination of Some Trace Elements of Biological Importance in Different Jute(Corchorus Capsularis) Seed Samples

    International Nuclear Information System (INIS)

    Metwally, E.; Abd-El-Khalik, H.; El-Sweify, F.H.; El-Sweify, A.H.H.

    2004-01-01

    Instrumental neutron activation analysis technique was used to determine some trace elements in seeds of jute (corchorus capsularis). The seed samples were obtained from Agricultural Research Center (ARC), Giza, (EG). The analyzed seed samples were produced from cultivation of three different strains, namely: St. DC 1105, st. JRC 7447 and St. PADMA. These strains were imported from Bangladesh. The jute plant was cultivated in sandy soil in Ismailaya research station farm at may on two seasons 1999 and 2000. The plant was irrigated with water from Ismailaya canal. The study was carried out to compare the influence of applying different kinds of fertilizers of different rates, i.e. mineral fertilizer and biofertilizer, on the uptake of some biologically important trace elements and to determine their concentration in the analyzed jute seed samples. These elements were; Co,Cr,Fe,Zn and others eight elements were analyzed quantitatively

  20. Gender-differences in risk factors for suicidal behaviour identified by perceived burdensomeness, thwarted belongingness and acquired capability: cross-sectional analysis from a longitudinal cohort study.

    Science.gov (United States)

    Donker, Tara; Batterham, Philip J; Van Orden, Kimberly A; Christensen, Helen

    2014-01-01

    The Interpersonal-Psychological Theory of Suicidal Behavior (IPT) is supported by recent epidemiological data. Unique risk factors for the IPT constructs have been identified in community epidemiological studies. Gender differences in these risk factors may contribute substantially to our understanding of suicidal risk, and require further investigation. The present study explores gender differences in the predictors and correlates of perceived burdensomeness, thwarted belongingness and acquired capability for suicide. Participants (547 males, 739 females) aged 32-38 from the PATH through Life study, an Australian population-based longitudinal cohort study (n=1,177) were assessed on perceived burdensomeness, thwarted belongingness and acquired capability for suicide using the Interpersonal Needs Questionnaire and Acquired Capability for Suicide Survey, and on a range of demographic, social support, psychological, mental health and physical health measures. Gender differences in the predictors of the IPT constructs were assessed using linear regression analyses. Higher perceived burdensomeness increased suicide ideation in both genders, while higher thwarted belongingness increased suicide ideation only in females. In females, thwarted belongingness was uniquely related to perceived burdensomeness, while greater physical health was significantly associated with greater thwarted belongingness in males but not in females. There were trends suggesting greater effects of being single and greater perceived burdensomeness for men, and stronger effects of less positive friendship support for women associated with greater thwarted belongingness. Men and women differ in the pattern of psychological characteristics that predict suicide ideation, and in the factors predicting vulnerability. Suicide prevention strategies need to take account of gender differences.

  1. Clinical characteristics and persistence of bovine mastitis caused by different species of coagulase-negative staphylococci identified with API or AFLP

    DEFF Research Database (Denmark)

    Taponen, S.; Simojoki, H.; Haveri, M.

    2006-01-01

    The coagulase-negative staphylococcal species causing mastitis in lactating cattle were identified and possible differences in the clinical characteristics or persistence of mastitis caused by different CNS were evaluated. The effect of antimicrobial treatment was also assessed. In addition, AFLP...... of these species. Approximately half of the mastitis cases were clinical, and in the majority clinical signs were mild. The severity and persistence of intramammary infection were unaffected by CNS species. Fifty-nine percent of the quarter cases were treated with antimicrobials, and the rest were left without...... treatment. Mastitis due to P-lactamase-negative CNS was treated with penicillin G and that due to beta-lactamase-positive CNS with cloxacillin. Nineteen percent of the isolates were P-lactamase-positive. The bacterial cure rate for quarters treated with antimicrobials was high, 85.9%, as opposed to only 45...

  2. Mobile NBM - Android medical mobile application designed to help in learning how to identify the different regions of interest in the brain's white matter.

    Science.gov (United States)

    Sánchez-Rola, Iskander; Zapirain, Begoña García

    2014-07-18

    One of the most critical tasks when conducting neurological studies is identifying the different regions of interest in the brain's white matter. Currently few programs or applications are available that serve as an interactive guide in this process. This is why a mobile application has been designed and developed in order to teach users how to identify the referred regions of the brain. It also enables users to share the results obtained and take an examination on the knowledge thus learnt. In order to provide direct user-user or user-developer contact, the project includes a website and a Twitter account. An application has been designed with a basic, minimalist look, which anyone can access easily in order to learn to identify a specific region in the brain's white matter. A survey has also been conducted on people who have used it, which has shown that the application is attractive both in the student (final mean satisfaction of 4.2/5) and in the professional (final mean satisfaction of 4.3/5) environment. The response obtained in the online part of the project reflects the high practical value and quality of the application, as shown by the fact that the website has seen a large number of visitors (over 1000 visitors) and the Twitter account has a high number of followers (over 280 followers). Mobile NBM is the first mobile application to be used as a guide in the process of identifying a region of interest in the brain's white matter. Although initially not many areas are available in the application, new ones can be added as required by users in their respective studies. Apart from the application itself, the online resources provided (website and Twitter account) significantly enhance users' experience.

  3. Partial protoporphyrinogen oxidase (PPOX gene deletions, due to different Alu-mediated mechanisms, identified by MLPA analysis in patients with variegate porphyria

    Directory of Open Access Journals (Sweden)

    Barbaro Michela

    2013-01-01

    Full Text Available Abstract Variegate porphyria (VP is an autosomal dominantly inherited hepatic porphyria. The genetic defect in the PPOX gene leads to a partial defect of protoporphyrinogen oxidase, the penultimate enzyme of heme biosynthesis. Affected individuals can develop cutaneous symptoms in sun-exposed areas of the skin and/or neuropsychiatric acute attacks. The identification of the genetic defect in VP families is of crucial importance to detect the carrier status which allows counseling to prevent potentially life threatening neurovisceral attacks, usually triggered by factors such as certain drugs, alcohol or fasting. In a total of 31 Swedish VP families sequence analysis had identified a genetic defect in 26. In the remaining five families an extended genetic investigation was necessary. After the development of a synthetic probe set, MLPA analysis to screen for single exon deletions/duplications was performed. We describe here, for the first time, two partial deletions within the PPOX gene detected by MLPA analysis. One deletion affects exon 5 and 6 (c.339-197_616+320del1099 and has been identified in four families, most probably after a founder effect. The other extends from exon 5 to exon 9 (c.339-350_987+229del2609 and was found in one family. We show that both deletions are mediated by Alu repeats. Our findings emphasize the usefulness of MLPA analysis as a complement to PPOX gene sequencing analysis for comprehensive genetic diagnostics in patients with VP.

  4. Importance measures

    International Nuclear Information System (INIS)

    Gomez Cobo, A.

    1997-01-01

    The presentation discusses the following: general concepts of importance measures; example fault tree, used to illustrate importance measures; Birnbaum's structural importance; criticality importance; Fussel-Vesely importance; upgrading function; risk achievement worth; risk reduction worth

  5. Identifying specific profiles in patients with different degrees of painful knee osteoarthritis based on serological biochemical and mechanistic pain biomarkers: a diagnostic approach based on cluster analysis.

    Science.gov (United States)

    Egsgaard, Line Lindhardt; Eskehave, Thomas Navndrup; Bay-Jensen, Anne C; Hoeck, Hans Christian; Arendt-Nielsen, Lars

    2015-01-01

    Biochemical and pain biomarkers can be applied to patients with painful osteoarthritis profiles and may provide more details compared with conventional clinical tools. The aim of this study was to identify an optimal combination of biochemical and pain biomarkers for classification of patients with different degrees of knee pain and joint damage. Such profiling may provide new diagnostic and therapeutic options. A total of 216 patients with different degrees of knee pain (maximal pain during the last 24 hours rated on a visual analog scale [VAS]) (VAS 0-100) and 64 controls (VAS 0-9) were recruited. Patients were separated into 3 groups: VAS 10 to 39 (N = 81), VAS 40 to 69 (N = 70), and VAS 70 to 100 (N = 65). Pressure pain thresholds, temporal summation to pressure stimuli, and conditioning pain modulation were measured from the peripatellar and extrasegmental sites. Biochemical markers indicative for autoinflammation and immunity (VICM, CRP, and CRPM), synovial inflammation (CIIIM), cartilage loss (CIIM), and bone degradation (CIM) were analyzed. WOMAC, Lequesne, and pain catastrophizing scores were collected. Principal component analysis was applied to select the optimal variable subset, and cluster analysis was applied to this subset to create distinctly different knee pain profiles. Four distinct knee pain profiles were identified: profile A (N = 27), profile B (N = 59), profile C (N = 85), and profile D (N = 41). Each knee pain profile had a unique combination of biochemical markers, pain biomarkers, physical impairments, and psychological factors that may provide the basis for mechanism-based diagnosis, individualized treatment, and selection of patients for clinical trials evaluating analgesic compounds. These results introduce a new profiling for knee OA and should be regarded as preliminary.

  6. An integrative transcriptomic approach to identify depot differences in genes and microRNAs in adipose tissues from high fat fed mice.

    Science.gov (United States)

    Wijayatunga, Nadeeja N; Pahlavani, Mandana; Kalupahana, Nishan S; Kottapalli, Kameswara Rao; Gunaratne, Preethi H; Coarfa, Cristian; Ramalingam, Latha; Moustaid-Moussa, Naima

    2018-02-06

    Obesity contributes to metabolic disorders such as diabetes and cardiovascular disease. Characterization of differences between the main adipose tissue depots, white (WAT) [including subcutaneous (SAT) and visceral adipose tissue (VAT)] and brown adipose tissue (BAT) helps to identify their roles in obesity. Thus, we studied depot-specific differences in whole transcriptome and miRNA profiles of SAT, VAT and BAT from high fat diet (HFD/45% of calories from fat) fed mice using RNA sequencing and small RNA-Seq. Using quantitative real-time polymerase chain reaction, we validated depot-specific differences in endoplasmic reticulum (ER) stress related genes and miRNAs using mice fed a HFD vs. low fat diet (LFD/10% of calories from fat). According to the transcriptomic analysis, lipogenesis, adipogenesis, inflammation, endoplasmic reticulum (ER) stress and unfolded protein response (UPR) were higher in VAT compared to BAT, whereas energy expenditure, fatty acid oxidation and oxidative phosphorylation were higher in BAT than in VAT of the HFD fed mice. In contrast to BAT, ER stress marker genes were significantly upregulated in VAT of HFD fed mice than the LFD fed mice. For the first time, we report depot specific differences in ER stress related miRNAs including; downregulation of miR-125b-5p, upregulation miR-143-3p, and miR-222-3p in VAT following HFD and upregulation of miR-30c-2-3p only in BAT following a HFD in mice than the LFD mice. In conclusion, HFD differentially regulates miRNAs and genes in different adipose depots with significant induction of genes related to lipogenesis, adipogenesis, inflammation, ER stress, and UPR in WAT compared to BAT.

  7. The use of a responder analysis to identify clinically meaningful differences in chronic urticaria patients following placebo- controlled treatment with rupatadine 10 and 20 mg.

    Science.gov (United States)

    Giménez-Arnau, A; Izquierdo, I; Maurer, M

    2009-09-01

    According to the EAACI/GA(2)LEN/EDF guidelines for urticaria management, modern non-sedating H1-antihistamines are the first-line symptomatic treatment for chronic urticaria. Two previous randomized clinical trials demonstrated rupatadine efficacy and safety in chronic urticaria treatment. However, a responder analysis to identify clinically meaningful differences in patients with chronic urticaria has not yet been performed. This analysis includes the pooled data from two randomized, double-blind, placebo-controlled, multicentre studies in which chronic urticaria patients were treated with rupatadine at different doses. Responder rates were defined as the percentage of patients after 4 weeks of treatment who exhibited a reduction of symptoms by at least 50% or 75% as compared to baseline. The variables analysed were as follows: Mean Pruritus Score (MPS), Mean Number of Wheals (MNW), and Mean Urticaria Activity Score (UAS). A total of 538 patients were included. This responder analysis, using different response levels, shows that the efficacy of rupatadine 10 mg and 20 mg is significantly better as compared to placebo in the treatment of chronic urticaria patients. Notably, treatment with rupatadine 20 mg daily resulted in a higher percentage of patients with response of 75% symptom reduction or better than rupatadine 10 mg. Our results support the use of higher than standard doses of non sedating antihistamines in chronic urticaria. We strongly recommend performing and reporting responder analyses for established and new drugs used by patients with chronic urticaria.

  8. Gamma-rays attenuation of zircons from Cambodia and South Africa at different energies: A new technique for identifying the origin of gemstone

    Science.gov (United States)

    Limkitjaroenporn, P.; Kaewkhao, J.

    2014-10-01

    In this work, the gamma-rays interaction properties of zircons from Cambodia and South Africa have been studied. The densities of Cambodian and South African's zircons are 4.6716±0.0040 g/cm3 and 4.5505±0.0018 g/cm3, respectively. The mass attenuation coefficient and the effective atomic number of gemstones were measured with the gamma-ray in energies range 223-662 keV using the Compton scattering technique. The mass attenuation coefficients of both zircons decreased with the increasing of gamma-rays energies. The different mass attenuation coefficients between the two zircons observed at gamma-ray energies below 400 keV are attributed to the differences in the photoelectric interaction. The effective atomic number of zircons was decreased with the increasing of gamma-ray energies and showed totally different values between the Cambodia and South Africa sources. The origins of the two zircons could be successfully identified by the method based on gamma-rays interaction with matter with advantage of being a non-destructive testing.

  9. Investigating the relative importance of individual differences on the work-family interface and the moderating role of boundary preference for segmentation.

    Science.gov (United States)

    Michel, Jesse S; Clark, Malissa A

    2013-10-01

    This study examines the relative importance of individual differences in relation to perceptions of work-family conflict and facilitation, as well as the moderating role of boundary preference for segmentation on these relationships. Relative importance analyses, based on a diverse sample of 380 employees from the USA, revealed that individual differences were consistently predictive of self-reported work-family conflict and facilitation. Conscientiousness, neuroticism, negative affect and core self-evaluations were consistently related to both directions of work-family conflict, whereas agreeableness predicted significant variance in family-to-work conflict only. Positive affect and core self-evaluations were consistently related to both directions of work-family facilitation, whereas agreeableness and neuroticism predicted significant variance in family-to-work facilitation only. Collectively, individual differences explained 25-28% of the variance in work-family conflict (primarily predicted by neuroticism and negative affect) and 11-18% of the variance in work-family facilitation (primarily predicted by positive affect and core self-evaluations). Moderated regression analyses showed that boundary preference for segmentation strengthened many of the relationships between individual differences and work-family conflict and facilitation. Implications for addressing the nature of work and family are discussed. Copyright © 2012 John Wiley & Sons, Ltd.

  10. Optimal screening of children with acute malnutrition requires a change in current WHO guidelines as MUAC and WHZ identify different patient groups

    DEFF Research Database (Denmark)

    Laillou, Arnaud; Prak, Sophonneary; de Groot, Richard

    2014-01-01

    BACKGROUND: Timely treatment of acute malnutrition in children 500,000 deaths annually. Screening at community level is essential to identify children with malnutrition. Current WHO guidelines for community screening for malnutrition recommend a Mid Upper Arm...... Circumference (MUAC) of malnutrition (SAM). However, it is currently unclear how MUAC relates to the other indicator used to define acute malnutrition: weight-for-height Z-score (WHZ). METHODS: Secondary data from >11,000 Cambodian children, obtained by different surveys between...... 2010 and 2012, was used to calculate sensitivity and ROC curves for MUAC and WHZ. FINDINGS: The secondary analysis showed that using the current WHO cut-off of 115 mm for screening for severe acute malnutrition over 90% of children with a weight-for-height z-score (WHZ)

  11. Genome Sequencing Identifies Two Nearly Unchanged Strains of Persistent Listeria monocytogenes Isolated at Two Different Fish Processing Plants Sampled 6 Years Apart

    DEFF Research Database (Denmark)

    Holch, Anne; Webb, Kristen; Lukjancenko, Oksana

    2013-01-01

    Listeria monocytogenes is a food-borne human-pathogenic bacterium that can cause infections with a high mortality rate. It has a remarkable ability to persist in food processing facilities. Here we report the genome sequences for two L. monocytogenes strains (N53-1 and La111) that were isolated 6...... that has been isolated as a persistent subtype in several European countries. The purpose of this study was to use genome analyses to identify genes or proteins that could contribute to persistence. In a genome comparison, the two persistent strains were extremely similar and collectively differed from...... are required to determine if the absence of these genes promotes persistence. While the genome comparison did not point to a clear physiological explanation of the persistent phenotype, the remarkable similarity between the two strains indicates that subtypes with specific traits are selected for in the food...

  12. SRBreak: A read-depth and split-read framework to identify breakpoints of different events inside simple copy-number variable regions

    Directory of Open Access Journals (Sweden)

    HOANG T NGUYEN

    2016-09-01

    Full Text Available Copy-number variation (CNV has been associated with increased risk of complex diseases. High throughput sequencing (HTS technologies facilitate the detection of copy-number variable regions (CNVRs and their breakpoints. This helps in understanding genome structures of genomes as well as their evolution process. Various approaches have been proposed for detecting CNV breakpoints, but currently it is still challenging for tools based on a single analysis method to identify breakpoints of CNVs. It has been shown, however, that pipelines which integrate multiple approaches are able to report more reliable breakpoints. Here, based on HTS data, we have developed a pipeline to identify approximate breakpoints (±10 bp relating to different ancestral events within a specific CNVR. The pipeline combines read-depth and split-read information to infer breakpoints, using information from multiple samples to allow an imputation approach to be taken. The main steps involve using a normal mixture model to cluster samples into different groups, followed by simple kernel-based approaches to maximise information obtained from read-depth and split-read approaches, after which common breakpoints of groups are inferred. The pipeline uses split-read information directly from CIGAR strings of BAM files, without using a re-alignment step. On simulated data sets, it was able to report breakpoints for very low-coverage samples including those for which only single-end reads were available. When applied to three loci from existing human resequencing data sets (NEGR1, LCE3, IRGM the pipeline obtained good concordance with results from the 1000 Genomes Project (92%, 100% and 82%, respectively.The package is available at https://github.com/hoangtn/SRBreak, and also as a docker-based application at https://registry.hub.docker.com/u/hoangtn/srbreak/.

  13. Spontaneous bacteriocin resistance in Listeria monocytogenes as a susceptibility screen for identifying different mechanisms of resistance and modes of action by bacteriocins of lactic acid bacteria.

    Science.gov (United States)

    Macwana, Sunita; Muriana, Peter M

    2012-01-01

    A practical system was devised for grouping bacteriocins of lactic acid bacteria (LAB) based on mode of action as determined by changes in inhibitory activity to spontaneously-acquired bacteriocin resistance (Bac(R)). Wild type Listeria monocytogenes 39-2 was sensitive to five bacteriocins produced by 3 genera of LAB: pediocin PA-1 and pediocin Bac3 (Pediococcus), lacticin FS97 and lacticin FS56 (Lactococcus), and curvaticin FS47 (Lactobacillus). A spontaneous Bac(R) derivative of L. monocytogenes 39-2 obtained by selective recovery against lacticin FS56 provided complete resistance to the bacteriocin made by Lactococcus lactis FS56. The lacticin FS56-resistant strain of L. monocyotgenes 39-2 was also cross-resistant to curvaticin FS47 and pediocin PA-1, but not to lacticin FS97 or pediocin Bac3. The same pattern of cross-resistance was also observed with Bac(R) isolates obtained with L. monocytogenes Scott A-2. A spontaneous mutation that renders a strain cross-resistant to different bacteriocins indicates that they share a common mechanism of resistance due to similar modes of action of the bacteriocins. Spontaneous resistance was acquired to other bacteriocins (in aggregate) by following the same procedure against which the Bac(R) strain was still sensitive. In subsequent challenge assays, mixtures of bacteriocins of different modes of action provided greater inhibition than mixtures of bacteriocins of the same mode of action (as determined by our screening method). This study identifies a methodical approach to classify bacteriocins into functional groups based on mechanism of resistance (i.e., mode of action) that could be used for identifying the best mixture of bacteriocins for use as biopreservatives. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. A putative biomarker signature for clinically effective AKT inhibition: correlation of in vitro, in vivo and clinical data identifies the importance of modulation of the mTORC1 pathway.

    Science.gov (United States)

    Cheraghchi-Bashi, Azadeh; Parker, Christine A; Curry, Ed; Salazar, Jean-Frederic; Gungor, Hatice; Saleem, Azeem; Cunnea, Paula; Rama, Nona; Salinas, Cristian; Mills, Gordon B; Morris, Shannon R; Kumar, Rakesh; Gabra, Hani; Stronach, Euan A

    2015-12-08

    Our identification of dysregulation of the AKT pathway in ovarian cancer as a platinum resistance specific event led to a comprehensive analysis of in vitro, in vivo and clinical behaviour of the AKT inhibitor GSK2141795. Proteomic biomarker signatures correlating with effects of GSK2141795 were developed using in vitro and in vivo models, well characterised for related molecular, phenotypic and imaging endpoints. Signatures were validated in temporally paired biopsies from patients treated with GSK2141795 in a clinical study. GSK2141795 caused growth-arrest as single agent in vitro, enhanced cisplatin-induced apoptosis in vitro and reduced tumour volume in combination with platinum in vivo. GSK2141795 treatment in vitro and in vivo resulted in ~50-90% decrease in phospho-PRAS40 and 20-80% decrease in fluoro-deoxyglucose (FDG) uptake. Proteomic analysis of GSK2141795 in vitro and in vivo identified a signature of pathway inhibition including changes in AKT and p38 phosphorylation and total Bim, IGF1R, AR and YB1 levels. In patient biopsies, prior to treatment with GSK2141795 in a phase 1 clinical trial, this signature was predictive of post-treatment changes in the response marker CA125. Development of this signature represents an opportunity to demonstrate the clinical importance of AKT inhibition for re-sensitisation of platinum resistant ovarian cancer to platinum.

  15. Synergistic interactions between phenolic compounds identified in grape pomace extract with antibiotics of different classes against Staphylococcus aureus and Escherichia coli.

    Science.gov (United States)

    Sanhueza, Loreto; Melo, Ricardo; Montero, Ruth; Maisey, Kevin; Mendoza, Leonora; Wilkens, Marcela

    2017-01-01

    Synergy could be an effective strategy to potentiate and recover antibiotics nowadays useless in clinical treatments against multi-resistant bacteria. In this study, synergic interactions between antibiotics and grape pomace extract that contains high concentration of phenolic compounds were evaluated by the checkerboard method in clinical isolates of Staphylococcus aureus and Escherichia coli. To define which component of the extract is responsible for the synergic effect, phenolic compounds were identified by RP-HPLC and their relative abundance was determined. Combinations of extract with pure compounds identified there in were also evaluated. Results showed that the grape pomace extract combined with representatives of different classes of antibiotics as β-lactam, quinolone, fluoroquinolone, tetracycline and amphenicol act in synergy in all S. aureus and E. coli strains tested with FICI values varying from 0.031 to 0.155. The minimal inhibitory concentration (MIC) was reduced 4 to 75 times. The most abundant phenolic compounds identified in the extract were quercetin, gallic acid, protocatechuic acid and luteolin with relative abundance of 26.3, 24.4, 16.7 and 11.4%, respectively. All combinations of the extract with the components also showed synergy with FICI values varying from 0.031 to 0.5 and MIC reductions of 4 to 125 times with both bacteria strains. The relative abundance of phenolic compounds has no correlation with the obtained synergic effect, suggesting that the mechanism by which the synergic effect occurs is by a multi-objective action. It was also shown that combinations of grape pomace extract with antibiotics are not toxic for the HeLa cell line at concentrations in which the synergistic effect was observed (47 μg/mL of extract and 0.6-375 μg/mL antibiotics). Therefore, these combinations are good candidates for testing in animal models in order to enhance the effect of antibiotics of different classes and thus restore the currently unused

  16. Synergistic interactions between phenolic compounds identified in grape pomace extract with antibiotics of different classes against Staphylococcus aureus and Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Loreto Sanhueza

    Full Text Available Synergy could be an effective strategy to potentiate and recover antibiotics nowadays useless in clinical treatments against multi-resistant bacteria. In this study, synergic interactions between antibiotics and grape pomace extract that contains high concentration of phenolic compounds were evaluated by the checkerboard method in clinical isolates of Staphylococcus aureus and Escherichia coli. To define which component of the extract is responsible for the synergic effect, phenolic compounds were identified by RP-HPLC and their relative abundance was determined. Combinations of extract with pure compounds identified there in were also evaluated. Results showed that the grape pomace extract combined with representatives of different classes of antibiotics as β-lactam, quinolone, fluoroquinolone, tetracycline and amphenicol act in synergy in all S. aureus and E. coli strains tested with FICI values varying from 0.031 to 0.155. The minimal inhibitory concentration (MIC was reduced 4 to 75 times. The most abundant phenolic compounds identified in the extract were quercetin, gallic acid, protocatechuic acid and luteolin with relative abundance of 26.3, 24.4, 16.7 and 11.4%, respectively. All combinations of the extract with the components also showed synergy with FICI values varying from 0.031 to 0.5 and MIC reductions of 4 to 125 times with both bacteria strains. The relative abundance of phenolic compounds has no correlation with the obtained synergic effect, suggesting that the mechanism by which the synergic effect occurs is by a multi-objective action. It was also shown that combinations of grape pomace extract with antibiotics are not toxic for the HeLa cell line at concentrations in which the synergistic effect was observed (47 μg/mL of extract and 0.6-375 μg/mL antibiotics. Therefore, these combinations are good candidates for testing in animal models in order to enhance the effect of antibiotics of different classes and thus restore the

  17. The importance and development of ball control and (self-reported) self-regulatory skills in basketball players for different positions.

    Science.gov (United States)

    Te Wierike, Sanne Cornelia Maria; Huijgen, Barbara Catharina Helena; Jonker, Laura; Elferink-Gemser, Marije Titia; Visscher, Chris

    2018-03-01

    This study first investigated the importance of ball control and (self-reported) self-regulatory skills in achieving the elite level in basketball. The second aim was to gain insight into the development of, and association between ball control and (self-reported) self-regulatory skills that contribute to achieving the elite level, with taking into account positional differences. Talented male players (N = 73; age 16.56 ± 1.96) completed the STARtest to measure ball control and a questionnaire to measure (self-reported) self-regulation from 2008-2012. Results showed that (self-reported) reflective skills were most important to achieve the elite level (OR = 11.76; P self-reported) reflection over time for guards, forwards, and centers. Improvement in ball control was evident for guards (r = -0.65; P self-reported) reflection and ball control, i.e., higher reflection was related to better ball control (guards r = -0.19; forwards r = -0.18) in contrast to centers (r = 0.34). It is concluded that (self-reported) reflective skills are important to achieve the elite level, while ball control seems especially important for guards.

  18. An Examination of the Four-Part Theory of the Chinese Self: The Differentiation and Relative Importance of the Different Types of Social-Oriented Self.

    Science.gov (United States)

    Sun, Chien-Ru

    2017-01-01

    Because culture has a deep and far-reaching influence, individuals who grew up within different cultures tend to develop different basic self-constructions. With respect to the Chinese under the influence of Chinese culture, Yang proposed the concepts of individual-oriented self and social-oriented self. He argued that, besides the individual-oriented self, the social-oriented self of the Chinese contains three types of self: the relationship-oriented self, the familistic (group)-oriented self, and the other-oriented self. The theory proposed that the Chinese self is appropriately covered only through this four-part theory of the Chinese self. However, this remains to be tested; whether these three types of sub-level "selves" can be effectively triggered, along with their relative importance. This study examines the four-part theory of the Chinese self. Through photo priming, Experiment 1 shows that the three types of social-oriented self are differentiated from each other and can be individually triggered. In Experiment 2, the importance of the three types of self was investigated, adopting the concept of limited self-regulation resources to design scenarios. The participants were asked to make counterarguments about the notion of each of the three types of self, with performance in the subsequent task serving as the main dependent variable. In Experiment 3, the relative importance of the three types of self was examined by investigating the choices made by individuals within the context of conflict under the three orientations of the social-oriented self. Overall, results of the experiments showed that the Chinese have a four-part self with the importance of the other-oriented self as the most remarkable.

  19. An Examination of the Four-Part Theory of the Chinese Self: The Differentiation and Relative Importance of the Different Types of Social-Oriented Self

    Directory of Open Access Journals (Sweden)

    Chien-Ru Sun

    2017-06-01

    Full Text Available Because culture has a deep and far-reaching influence, individuals who grew up within different cultures tend to develop different basic self-constructions. With respect to the Chinese under the influence of Chinese culture, Yang proposed the concepts of individual-oriented self and social-oriented self. He argued that, besides the individual-oriented self, the social-oriented self of the Chinese contains three types of self: the relationship-oriented self, the familistic (group-oriented self, and the other-oriented self. The theory proposed that the Chinese self is appropriately covered only through this four-part theory of the Chinese self. However, this remains to be tested; whether these three types of sub-level “selves” can be effectively triggered, along with their relative importance. This study examines the four-part theory of the Chinese self. Through photo priming, Experiment 1 shows that the three types of social-oriented self are differentiated from each other and can be individually triggered. In Experiment 2, the importance of the three types of self was investigated, adopting the concept of limited self-regulation resources to design scenarios. The participants were asked to make counterarguments about the notion of each of the three types of self, with performance in the subsequent task serving as the main dependent variable. In Experiment 3, the relative importance of the three types of self was examined by investigating the choices made by individuals within the context of conflict under the three orientations of the social-oriented self. Overall, results of the experiments showed that the Chinese have a four-part self with the importance of the other-oriented self as the most remarkable.

  20. Ranking of persister genes in the same Escherichia coli genetic background demonstrates varying importance of individual persister genes in tolerance to different antibiotics

    Directory of Open Access Journals (Sweden)

    Nan eWu

    2015-09-01

    Full Text Available Despite the identification of many genes and pathways involved in the persistence phenomenon of bacteria, the relative importance of these genes in a single organism remains unclear. Here, using Escherichia coli as a model, we generated mutants of 21 known candidate persister genes and compared the relative importance of these mutants in persistence to various antibiotics (ampicillin, gentamicin, norfloxacin, and trimethoprim at different times. We found that oxyR, dnaK, sucB, relA, rpoS, clpB, mqsR, and recA were prominent persister genes involved in persistence to multiple antibiotics. These genes map to the following pathways: antioxidative defense pathway (oxyR, global regulators (dnaK, clpB, and rpoS, energy production (sucB, stringent response (relA, toxin–antitoxin (TA module (mqsR, and SOS response (recA. Among the TA modules, the ranking order was mqsR, lon, relE, tisAB, hipA, and dinJ. Intriguingly, rpoS deletion caused a defect in persistence to gentamicin but increased persistence to ampicillin and norfloxacin. Mutants demonstrated dramatic differences in persistence to different antibiotics at different time points: some mutants (oxyR, dnaK, phoU, lon, recA, mqsR, and tisAB displayed defect in persistence from early time points, while other mutants (relE, smpB, glpD, umuD, and tnaA showed defect only at later time points. These results indicate that varying hierarchy and importance of persister genes exist and that persister genes can be divided into those involved in shallow persistence and those involved in deep persistence. Our findings suggest that the persistence phenomenon is a dynamic process with different persister genes playing roles of variable significance at different times. These findings have implications for improved understanding of persistence phenomenon and developing new drugs targeting persisters for more effective cure of persistent infections.

  1. Relative importance of climate changes at different time scales on net primary productivity-a case study of the Karst area of northwest Guangxi, China.

    Science.gov (United States)

    Liu, Huiyu; Zhang, Mingyang; Lin, Zhenshan

    2017-10-05

    Climate changes are considered to significantly impact net primary productivity (NPP). However, there are few studies on how climate changes at multiple time scales impact NPP. With MODIS NPP product and station-based observations of sunshine duration, annual average temperature and annual precipitation, impacts of climate changes at different time scales on annual NPP, have been studied with EEMD (ensemble empirical mode decomposition) method in the Karst area of northwest Guangxi, China, during 2000-2013. Moreover, with partial least squares regression (PLSR) model, the relative importance of climatic variables for annual NPP has been explored. The results show that (1) only at quasi 3-year time scale do sunshine duration and temperature have significantly positive relations with NPP. (2) Annual precipitation has no significant relation to NPP by direct comparison, but significantly positive relation at 5-year time scale, which is because 5-year time scale is not the dominant scale of precipitation; (3) the changes of NPP may be dominated by inter-annual variabilities. (4) Multiple time scales analysis will greatly improve the performance of PLSR model for estimating NPP. The variable importance in projection (VIP) scores of sunshine duration and temperature at quasi 3-year time scale, and precipitation at quasi 5-year time scale are greater than 0.8, indicating important for NPP during 2000-2013. However, sunshine duration and temperature at quasi 3-year time scale are much more important. Our results underscore the importance of multiple time scales analysis for revealing the relations of NPP to changing climate.

  2. Individual differences in using geometric and featural cues to maintain spatial orientation: cue quantity and cue ambiguity are more important than cue type.

    Science.gov (United States)

    Kelly, Jonathan W; McNamara, Timothy P; Bodenheimer, Bobby; Carr, Thomas H; Rieser, John J

    2009-02-01

    Two experiments explored the role of environmental cues in maintaining spatial orientation (sense of self-location and direction) during locomotion. Of particular interest was the importance of geometric cues (provided by environmental surfaces) and featural cues (nongeometric properties provided by striped walls) in maintaining spatial orientation. Participants performed a spatial updating task within virtual environments containing geometric or featural cues that were ambiguous or unambiguous indicators of self-location and direction. Cue type (geometric or featural) did not affect performance, but the number and ambiguity of environmental cues did. Gender differences, interpreted as a proxy for individual differences in spatial ability and/or experience, highlight the interaction between cue quantity and ambiguity. When environmental cues were ambiguous, men stayed oriented with either one or two cues, whereas women stayed oriented only with two. When environmental cues were unambiguous, women stayed oriented with one cue.

  3. Validation study of medicare claims to identify older US adults with CKD using the Reasons for Geographic and Racial Differences in Stroke (REGARDS) Study.

    Science.gov (United States)

    Muntner, Paul; Gutiérrez, Orlando M; Zhao, Hong; Fox, Caroline S; Wright, Nicole C; Curtis, Jeffrey R; McClellan, William; Wang, Henry; Kilgore, Meredith; Warnock, David G; Bowling, C Barrett

    2015-02-01

    Health care claims data may provide a cost-efficient approach for studying chronic kidney disease (CKD). Prospective cohort study. We compared characteristics and outcomes for individuals with CKD defined using laboratory measurements versus claims data from 6,982 REGARDS (Reasons for Geographic and Racial Differences in Stroke) Study participants who had Medicare fee-for-service coverage. Presence of CKD as defined by both the REGARDS Study (CKDREGARDS) and Medicare data (CKDMedicare), presence of CKDREGARDS but not CKDMedicare, and presence of CKDMedicare but not CKDREGARDS, and absence of both CKDREGARDS and CKDMedicare. Mortality and incident end-stage renal disease (ESRD). The research study definition of CKD (CKDREGARDS) included estimated glomerular filtration rate (eGFR)  30mg/g at the REGARDS Study visit. CKD in Medicare (CKDMedicare) was identified during the 2 years before each participant's REGARDS visit using a claims-based algorithm. Overall, 32% of participants had CKDREGARDS and 6% had CKDMedicare. Sensitivity, specificity, and positive and negative predictive values of CKDMedicare for identifying CKDREGARDS were 15.5% (95% CI, 14.0%-17.1%), 97.7% (95% CI, 97.2%-98.1%), 75.6% (95% CI, 71.4%-79.5%), and 71.5% (95% CI, 70.4%-72.6%), respectively. Mortality and ESRD incidence rates, expressed per 1,000 person-years, were higher for participants with versus without CKDMedicare (mortality: 72.5 [95% CI, 61.3-83.7] vs 33.3 [95% CI, 31.5-35.2]; ESRD: 16.4 [95% CI, 11.2-21.6] vs 1.3 [95% CI, 0.9-1.6]) and with versus without CKDREGARDS (mortality: 59.9 [95% CI, 55.4-64.4] vs 25.5 [95% CI, 23.6-27.4]; ESRD: 6.8 [95% CI, 5.4-8.3] vs 0.1 [95% CI, 0.0-0.3]). Among participants with CKDREGARDS, those with abdominal obesity, diabetes, anemia, lower eGFR, more outpatient visits, hospitalization, and a nephrologist visit in the 2 years before their REGARDS visit were more likely to have CKDMedicare. CKDREGARDS relied on eGFR and albuminuria assessed at a single

  4. Renal cells express different forms of vimentin: the independent expression alteration of these forms is important in cell resistance to osmotic stress and apoptosis.

    Directory of Open Access Journals (Sweden)

    Bettina S Buchmaier

    Full Text Available Osmotic stress has been shown to regulate cytoskeletal protein expression. It is generally known that vimentin is rapidly degraded during apoptosis by multiple caspases, resulting in diverse vimentin fragments. Despite the existence of the known apoptotic vimentin fragments, we demonstrated in our study the existence of different forms of vimentin VIM I, II, III, and IV with different molecular weights in various renal cell lines. Using a proteomics approach followed by western blot analyses and immunofluorescence staining, we proved the apoptosis-independent existence and differential regulation of different vimentin forms under varying conditions of osmolarity in renal cells. Similar impacts of osmotic stress were also observed on the expression of other cytoskeleton intermediate filament proteins; e.g., cytokeratin. Interestingly, 2D western blot analysis revealed that the forms of vimentin are regulated independently of each other under glucose and NaCl osmotic stress. Renal cells, adapted to high NaCl osmotic stress, express a high level of VIM IV (the form with the highest molecular weight, besides the three other forms, and exhibit higher resistance to apoptotic induction with TNF-α or staurosporin compared to the control. In contrast, renal cells that are adapted to high glucose concentration and express only the lower-molecular-weight forms VIM I and II, were more susceptible to apoptosis. Our data proved the existence of different vimentin forms, which play an important role in cell resistance to osmotic stress and are involved in cell protection against apoptosis.

  5. Transcriptomics identifies differences between ultrapure non-dioxin-like polychlorinated biphenyls (PCBs) and dioxin-like PCB126 in cultured peripheral blood mononuclear cells

    International Nuclear Information System (INIS)

    Wens, B.; De Boever, P.; Maes, M.; Hollanders, K.; Schoeters, G.

    2011-01-01

    Polychlorinated biphenyls (PCBs) remain ubiquitously present in human lipids despite the ban on their production and use. Their presence can be chemically monitored in peripheral blood samples of the general population. We tested whether in vitro exposure to different PCB congeners induced different gene expression profiles in peripheral blood cells. We have isolated peripheral blood mononuclear cells (PBMC) from whole blood of 8 healthy individuals and exposed these cells in vitro to individual non-dioxin-like (NDL)-PCB congeners (PCB52, 138 or 180; 10 μM) or dioxin-like (DL)-PCB congener PCB126 (1 μM) during 18 h. Differential gene expression response was measured using Agilent whole-human genome microarrays. Two-way ANOVA analysis of the data showed that both gender and PCB exposure are important factors influencing gene expression responses in blood cells. Hierarchical cluster analysis of genes influenced by PCB exposure, revealed that DL-PCB126 induced a different gene expression response compared to the NDL-PCBs. Biological interpretation of the results revealed that exposure to PCB126 induced the AhR signaling pathway, whereas the induction of nuclear receptor pathways by the NDL-PCBs was limited in blood cells. Nevertheless, molecular responses of blood cells to individual PCB congeners revealed significantly expressed genes that play a role in biological functions and processes known to be affected by PCB exposure in vivo. Observed gene expression changes in this in vitro model were found to be related to hepatotoxicity, immune and inflammatory response and disturbance of lipid and cholesterol homeostasis.

  6. Which Feedback Is More Effective for Pursuing Multiple Goals of Differing Importance? The Interaction Effects of Goal Importance and Performance Feedback Type on Self-Regulation and Task Achievement

    Science.gov (United States)

    Lee, Hyunjoo

    2016-01-01

    This study examined how performance feedback type (progress vs. distance) affects Korean college students' self-regulation and task achievement according to relative goal importance in the pursuit of multiple goals. For this study, 146 students participated in a computerised task. The results showed the interaction effects of goal importance and…

  7. Beyond imperviousness: A statistical approach to identifying functional differences between development morphologies on variable source area-type response in urbanized watersheds

    Science.gov (United States)

    Lim, T. C.

    2016-12-01

    Empirical evidence has shown linkages between urbanization, hydrological regime change, and degradation of water quality and aquatic habitat. Percent imperviousness, has long been suggested as the dominant source of these negative changes. However, recent research identifying alternative pathways of runoff production at the watershed scale have called into question percent impervious surface area's primacy in urban runoff production compared to other aspects of urbanization including change in vegetative cover, imported water and water leakages, and the presence of drainage infrastructure. In this research I show how a robust statistical methodology can detect evidence of variable source area (VSA)-type hydrologic response associated with incremental hydraulic connectivity in watersheds. I then use logistic regression to explore how evidence of VSA-type response relates to the physical and meterological characteristics of the watershed. I find that impervious surface area is highly correlated with development, but does not add significant explanatory power beyond percent developed in predicting VSA-type response. Other aspects of development morphology, including percent developed open space and type of drainage infrastructure also do not add to the explanatory power of undeveloped land in predicting VSA-type response. Within only developed areas, the effect of developed open space was found to be more similar to that of total impervious area than to undeveloped land. These findings were consistent when tested across a national cross-section of urbanized watersheds, a higher resolution dataset of Baltimore Metropolitan Area watersheds, and a subsample of watersheds confirmed not to be served by combined sewer systems. These findings suggest that land development policies that focus on lot coverage should be revisited, and more focus should be placed on preserving native vegetation and soil conditions alongside development.

  8. Optimal screening of children with acute malnutrition requires a change in current WHO guidelines as MUAC and WHZ identify different patient groups.

    Science.gov (United States)

    Laillou, Arnaud; Prak, Sophonneary; de Groot, Richard; Whitney, Sophie; Conkle, Joel; Horton, Lindsey; Un, Sam Oeurn; Dijkhuizen, Marjoleine A; Wieringa, Frank T

    2014-01-01

    Timely treatment of acute malnutrition in children 500,000 deaths annually. Screening at community level is essential to identify children with malnutrition. Current WHO guidelines for community screening for malnutrition recommend a Mid Upper Arm Circumference (MUAC) of malnutrition (SAM). However, it is currently unclear how MUAC relates to the other indicator used to define acute malnutrition: weight-for-height Z-score (WHZ). Secondary data from >11,000 Cambodian children, obtained by different surveys between 2010 and 2012, was used to calculate sensitivity and ROC curves for MUAC and WHZ. The secondary analysis showed that using the current WHO cut-off of 115 mm for screening for severe acute malnutrition over 90% of children with a weight-for-height z-score (WHZ) children with a MUAC65% of children with a WHZchildren with acute malnutrition, therefore these 2 indicators should be regarded as independent from each other. We suggest a 2-step model with MUAC used a screening at community level, followed by MUAC and WHZ measured at a primary health care unit, with both indicators used independently to diagnose severe acute malnutrition. Current guidelines should be changed to reflect this, with treatment initiated when either MUAC <115 mm or WHZ<-3.

  9. A NEW APPROACH FOR IMPROVEMENT OF THE METHODOLOGY TO IDENTIFY A TYPE OF INTERACTION OF LACTIC ACID BACTERIA IN CONSORTIUMS OF DIFFERENT STAGES OF CULTIVATION

    Directory of Open Access Journals (Sweden)

    V. V. Kondratenko

    2017-01-01

    Full Text Available Existing approaches for evaluation of types of interactions between individual monocultures in consortiums allow obtaining only qualitative results (synergistic, antagonistic, additive interaction as a whole, without regarding to changes in the cultivation process. Therefore, the development of a new approach for the quantitative determination of this indicator as a continuous function defined during the all period of cultivation is in need. In the course of the research a two-component consortium of lactic acid microorganisms cultivated on different mediums according to directed fermentation process in vegetable products was chosen to analyze types of interaction. As a result, the an original approach that was based on comparison of grow speed of biomass of microorganisms with calculated additive curve determined by results of dynamic analysis of titre of microorganism participating in consortium in monoculture during their cultivation has been elaborated. This approach is a convenient tool to identify complex regularity in changes of types of microorganism interaction in consortium represented by continuous function defined during all cultivation period.

  10. Use of Anisotropy, 3D Segmented Atlas, and Computational Analysis to Identify Gray Matter Subcortical Lesions Common to Concussive Injury from Different Sites on the Cortex.

    Directory of Open Access Journals (Sweden)

    Praveen Kulkarni

    Full Text Available Traumatic brain injury (TBI can occur anywhere along the cortical mantel. While the cortical contusions may be random and disparate in their locations, the clinical outcomes are often similar and difficult to explain. Thus a question that arises is, do concussions at different sites on the cortex affect similar subcortical brain regions? To address this question we used a fluid percussion model to concuss the right caudal or rostral cortices in rats. Five days later, diffusion tensor MRI data were acquired for indices of anisotropy (IA for use in a novel method of analysis to detect changes in gray matter microarchitecture. IA values from over 20,000 voxels were registered into a 3D segmented, annotated rat atlas covering 150 brain areas. Comparisons between left and right hemispheres revealed a small population of subcortical sites with altered IA values. Rostral and caudal concussions were of striking similarity in the impacted subcortical locations, particularly the central nucleus of the amygdala, laterodorsal thalamus, and hippocampal complex. Subsequent immunohistochemical analysis of these sites showed significant neuroinflammation. This study presents three significant findings that advance our understanding and evaluation of TBI: 1 the introduction of a new method to identify highly localized disturbances in discrete gray matter, subcortical brain nuclei without postmortem histology, 2 the use of this method to demonstrate that separate injuries to the rostral and caudal cortex produce the same subcortical, disturbances, and 3 the central nucleus of the amygdala, critical in the regulation of emotion, is vulnerable to concussion.

  11. Optimal Screening of Children with Acute Malnutrition Requires a Change in Current WHO Guidelines as MUAC and WHZ Identify Different Patient Groups

    Science.gov (United States)

    Laillou, Arnaud; Prak, Sophonneary; de Groot, Richard; Whitney, Sophie; Conkle, Joel; Horton, Lindsey; Un, Sam Oeurn; Dijkhuizen, Marjoleine A.; Wieringa, Frank T.

    2014-01-01

    Background Timely treatment of acute malnutrition in children 500,000 deaths annually. Screening at community level is essential to identify children with malnutrition. Current WHO guidelines for community screening for malnutrition recommend a Mid Upper Arm Circumference (MUAC) of malnutrition (SAM). However, it is currently unclear how MUAC relates to the other indicator used to define acute malnutrition: weight-for-height Z-score (WHZ). Methods Secondary data from >11,000 Cambodian children, obtained by different surveys between 2010 and 2012, was used to calculate sensitivity and ROC curves for MUAC and WHZ. Findings The secondary analysis showed that using the current WHO cut-off of 115 mm for screening for severe acute malnutrition over 90% of children with a weight-for-height z-score (WHZ) 65% of children with a WHZmalnutrition, therefore these 2 indicators should be regarded as independent from each other. We suggest a 2-step model with MUAC used a screening at community level, followed by MUAC and WHZ measured at a primary health care unit, with both indicators used independently to diagnose severe acute malnutrition. Current guidelines should be changed to reflect this, with treatment initiated when either MUAC <115 mm or WHZ<−3. PMID:24983995

  12. Identifying similar and different factors effecting long-term cardiac exercise rehabilitation behavior modification between New Zealand and the United Kingdom.

    Science.gov (United States)

    Dunn, Stephanie; Lark, Sally; Fallows, Stephen

    2014-07-01

    Cardiac Rehabilitation (CR) programs are the most cost-effective measure for reducing morbidity associated with Coronary Vascular Disease (CVD). To be more effective there is a need to understand what influences the maintenance of healthy behaviors. This study identifies similar and different influences in CR of the United Kingdom (UK) and New Zealand (NZ). A retrospective study. Participants had previously been discharged from CR for 6 to 12+ months within the UK (n = 22) and NZ (n = 21). Participant's attended a focus group. Discussions were digitally recorded, transcribed then thematically analyzed. The CR programs were observed over 2 months to enable comment on findings relating to 'theory in practice.' Similar positive patient experiences influencing behavior between groups and countries were; support, education, positive attitude, and motivation. Companionship and exercising alongside people with similar health problems was the major determinant for positive exercise behavior. Barriers to maintaining exercise included; physical disabilities, time constraints, and weather conditions. NZ participants were more affected by external factors (eg, opportunity, access, and time). Both CR programs were successful in facilitating the maintenance of healthy lifestyles. Exercising with other cardiac patients for support in a structured environment was the strongest influence in maintaining healthy lifestyles beyond CR programs.

  13. How important is importance for prospective memory? A review

    Directory of Open Access Journals (Sweden)

    Stefan eWalter

    2014-06-01

    Full Text Available Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover, we address the relationship between importance and other factors known to affect prospective memory and ongoing task performance such as type of prospective memory task (time-, event- or activity-based, cognitive loads, and cue focality. Finally, we provide a connection to motivation, we summarize the effects of task importance and we identify important venues for future research.

  14. How important is importance for prospective memory? A review

    Science.gov (United States)

    Walter, Stefan; Meier, Beat

    2014-01-01

    Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover, we address the relationship between importance and other factors known to affect prospective memory and ongoing task performance such as type of prospective memory task (time-, event-, or activity-based), cognitive loads, and processing overlaps. Finally, we provide a connection to motivation, we summarize the effects of task importance and we identify important venues for future research. PMID:25018743

  15. A Novel microCT Method for Bone and Marrow Adipose Tissue Alignment Identifies Key Differences Between Mandible and Tibia in Rats.

    Science.gov (United States)

    Coutel, Xavier; Olejnik, Cécile; Marchandise, Pierre; Delattre, Jérôme; Béhal, Hélène; Kerckhofs, Greet; Penel, Guillaume

    2018-01-30

    Bone homeostasis is influenced by the bone marrow adipose tissue (BMAT). BMAT distribution varies from one anatomical location in the skeleton to another. We developed an advanced microfocus computed tomography imaging and analysis protocol that allows accurate alignment of both the BMAT distribution and bone micro-architecture as well as calculation of the distance of the BMAT adipocytes from the bone surface. Using this protocol, we detected a different spatial BMAT distribution between the rat tibia and mandible: in the proximal metaphysis of the tibia a large amount of BMAT (~ 20% of the total BMAT) was located close to the bone surface (BMAT was located between 40 and 60 µm from the bone surface. In the alveolar ridge of rats, the trabecular bone volume was 48.3% higher compared to the proximal metaphysis of the tibia (p BMAT content with almost no contact with the bone surface. These findings are of great interest because of the importance of the fat-bone interaction and its potential relevance to several resorptive bone diseases.

  16. Do Mound Disturbance and Bait Placement Affect Bait Removal and Treatment Efficacy in Red Imported Fire ant (Hymenoptera: Formicidae at Different Seasons?

    Directory of Open Access Journals (Sweden)

    Xing P. Hu

    2009-01-01

    Full Text Available This study provides empirical evidence that disturbing mound immediately before application, as opposed to label recommendation, did not reduce foraging activity of the red imported fire ant, Solenopsis invicta Buren, except for about 10-min delay in foraging. Despite the delayed foraging, there was no significant difference in the amount of baits foraged between disturbed and undisturbed colonies. Eventually, >96% of the baits were foraged, with the maximum removal occurred by 2 and 3 h, respectively, in summer and spring trial. The fastest and great amount of bait removal 1 h post-treatment occurred to baits placed on mound, followed by 0.18–0.3-m from mound base, and the slowest 1.08–1.2-m from mound base. All treatment gave 100% control 1 mo later, regardless of the season, without colony relocation or new colony invasion in the test plots.

  17. Processes affecting altitudinal distribution of invasive Ageratina adenophora in western Himalaya: The role of local adaptation and the importance of different life-cycle stages.

    Science.gov (United States)

    Datta, Arunava; Kühn, Ingolf; Ahmad, Mustaqeem; Michalski, Stefan; Auge, Harald

    2017-01-01

    The spread of invasive plants along elevational gradients is considered a threat to fragile mountain ecosystems, but it can also provide the opportunity to better understand some of the basic processes driving the success of invasive species. Ageratina adenophora (Asteraceae) is an invasive plant of global importance and has a broad distribution along elevational gradients in the Western Himalayas. Our study aimed at understanding the role of evolutionary processes (e.g. local adaptation and clinal differentiation) and different life history stages in shaping the distribution pattern of the invasive plant along an elevational gradient in the Western Himalaya. We carried out extensive distributional surveys, established a reciprocal transplant experiment with common gardens at three elevational levels, and measured a suite of traits related to germination, growth, reproduction and phenology. Our results showed a lack of local adaptation, and we did not find any evidence for clinal differentiation in any measured trait except a rather weak signal for plant height. We found that seed germination was the crucial life-cycle transition in determining the lower range limit while winter mortality of plants shaped the upper range limit in our study area, thus explaining the hump shaped distribution pattern. Differences in trait values between gardens for most traits indicated a high degree of phenotypic plasticity. Possible causes such as apomixis, seed dispersal among sites, and pre-adaptation might have confounded evolutionary processes to act upon. Our results suggest that the success and spread of Ageratina adenophora are dependent on different life history stages at different elevations that are controlled by abiotic conditions.

  18. Distribution-based estimates of minimal important difference for hospital anxiety and depression scale and impact of event scale-revised in survivors of acute respiratory failure.

    Science.gov (United States)

    Chan, Kitty S; Aronson Friedman, Lisa; Bienvenu, O Joseph; Dinglas, Victor D; Cuthbertson, Brian H; Porter, Richard; Jones, Christina; Hopkins, Ramona O; Needham, Dale M

    2016-01-01

    This study will estimate distribution-based minimal important difference (MID) for the Hospital Anxiety and Depression Scale anxiety (HADS-A) and depression (HADS-D) subscales, and the Impact of Event Scale-Revised (IES-R) in survivors of acute respiratory failure (ARF). Secondary analyses of data from two US and three UK studies of ARF survivors (total N=1223). HADS-D and HADS-A were used to assess depression and anxiety symptoms. IES-R assessed post-traumatic stress disorder symptoms. Standard error of measurement, minimal detectable change90, 0.5 standard deviation (S.D.), and 0.2 S.D. were used to estimate MID for the combined sample, by studies, 6- and 12-month follow-ups, country and mental health condition. Overall, MID estimates converged to 2.0-2.5 for the HADS-A, 1.9-2.3 for the HADS-D and 0.17-0.18 for the IES-R. MID estimates were comparable across studies, follow-up, country and mental health condition. Among ARF survivors, 2.0-2.5 is a reasonable range for the MID for both HADS subscales, and 0.2 is reasonable for IES-R. Until anchor-based MIDs for these instruments are available, these distribution-based estimates can help researchers plan future studies and interpret the clinical importance of findings in ARF patient populations. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Monitoring somatic symptoms in patients with mental disorders: Sensitivity to change and minimal clinically important difference of the Somatic Symptom Scale - 8 (SSS-8).

    Science.gov (United States)

    Gierk, Benjamin; Kohlmann, Sebastian; Hagemann-Goebel, Marion; Löwe, Bernd; Nestoriuc, Yvonne

    2017-09-01

    The SSS-8 is a brief questionnaire for the assessment of somatic symptom burden. This study examines its sensitivity to change and the minimal clinically important difference (MCID) in patients with mental disorders. 55 outpatients with mental disorders completed the SSS-8 and measures of anxiety, depression, and disability before and after receiving treatment. Effect sizes and correlations between the change scores were calculated. The MCID was estimated using a one standard error of measurement threshold and the change in disability as an external criterion. There was a medium decline in somatic symptom burden for the complete sample (n=55, d z =0.53) and a large decline in a subgroup with very high somatic symptom burden at baseline (n=11, d z =0.94). Decreases in somatic symptom burden were associated with decreases in anxiety (r=0.68, pSSS-8 is sensitive to change. A 3-point decrease reflects a clinically important improvement. Due to its brevity and sound psychometric properties, the SSS-8 is useful for monitoring somatic symptom burden. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. MLVA-16 typing of 295 marine mammal Brucella isolates from different animal and geographic origins identifies 7 major groups within Brucella ceti and Brucella pinnipedialis

    Directory of Open Access Journals (Sweden)

    Jacques Isabelle

    2009-07-01

    Full Text Available Abstract Background Since 1994, Brucella strains have been isolated from a wide range of marine mammals. They are currently recognized as two new Brucella species, B. pinnipedialis for the pinniped isolates and B. ceti for the cetacean isolates in agreement with host preference and specific phenotypic and molecular markers. In order to investigate the genetic relationships within the marine mammal Brucella isolates and with reference to terrestrial mammal Brucella isolates, we applied in this study the Multiple Loci VNTR (Variable Number of Tandem Repeats Analysis (MLVA approach. A previously published assay comprising 16 loci (MLVA-16 that has been shown to be highly relevant and efficient for typing and clustering Brucella strains from animal and human origin was used. Results 294 marine mammal Brucella strains collected in European waters from 173 animals and a human isolate from New Zealand presumably from marine origin were investigated by MLVA-16. Marine mammal Brucella isolates were shown to be different from the recognized terrestrial mammal Brucella species and biovars and corresponded to 3 major related groups, one specific of the B. ceti strains, one of the B. pinnipedialis strains and the last composed of the human isolate. In the B. ceti group, 3 subclusters were identified, distinguishing a cluster of dolphin, minke whale and porpoise isolates and two clusters mostly composed of dolphin isolates. These results were in accordance with published analyses using other phenotypic or molecular approaches, or different panels of VNTR loci. The B. pinnipedialis group could be similarly subdivided in 3 subclusters, one composed exclusively of isolates from hooded seals (Cystophora cristata and the two others comprising other seal species isolates. Conclusion The clustering analysis of a large collection of marine mammal Brucella isolates from European waters significantly strengthens the current view of the population structure of these two

  1. Genome-wide association study of glioma subtypes identifies specific differences in genetic susceptibility to glioblastoma and non-glioblastoma tumors

    DEFF Research Database (Denmark)

    Melin, Beatrice S; Barnholtz-Sloan, Jill S; Wrensch, Margaret R

    2017-01-01

    Genome-wide association studies (GWAS) have transformed our understanding of glioma susceptibility, but individual studies have had limited power to identify risk loci. We performed a meta-analysis of existing GWAS and two new GWAS, which totaled 12,496 cases and 18,190 controls. We identified fi...

  2. Evaluation of the effect of non-surgical periodontal treatment on oral health-related quality of life: estimation of minimal important differences 1 year after treatment.

    Science.gov (United States)

    Jönsson, Birgitta; Öhrn, Kerstin

    2014-03-01

    To evaluate an individually tailored oral health educational programme on patient-reported outcome compared with a standard oral health educational programme, assess change over time and determine minimal important differences (MID) in change scores for two different oral health related quality of life (OHRQoL) instrument after non-surgical periodontal treatment (NSPT). In a randomized controlled trial evaluating two educational programmes, patients (n = 87) with chronic periodontitis completed a questionnaire at baseline and after 12 months. OHRQoL was assessed with the General Oral Health Assessment Index (GOHAI) and the UK oral health-related quality-of-life measure (OHQoL-UK). In addition, patients' global rating of oral health and socio-demographic variables were recorded. The MID was estimated with anchor-based and distributions-based methods. There were no differences between the two educational groups. The OHRQoL was significantly improved after treatment. The MID was approximately five for OHQoL-UK with a moderate ES, and three for GOHAI with a Small ES, and 46-50% of the patients showed improvements beyond the MID. Both oral health educational groups reported higher scores in OHRQoL after NSPT resulting in more positive well-being (OHQoL-UK) and less frequent oral problems (GOHAI). OHQoL-UK gave a greater effect size and mean change scores but both instruments were associated with the participants' self-rated change in oral health. The changes were meaningful for the patients supported by the estimated MID. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  3. RELATIONSHIP BETWEEN ISOMETRIC THIGH MUSCLE STRENGTH AND MINIMAL CLINICALLY IMPORTANT DIFFERENCES (MCIDS) IN KNEE FUNCTION IN OSTEOARTHRITIS – DATA FROM THE OSTEOARTHRITIS INITIATIVE

    Science.gov (United States)

    Ruhdorfer, Anja; Wirth, Wolfgang; Eckstein, Felix

    2014-01-01

    Objective To determine the relationship between thigh muscle strength and clinically relevant differences in self-assessed lower limb function. Methods Isometric knee extensor and flexor strength of 4553 Osteoarthritis Initiative participants (2651 women/1902 men) was related to Western Ontario McMasters Universities (WOMAC) physical function scores by linear regression. Further, groups of Male and female participant strata with minimal clinically important differences (MCIDs) in WOMAC function scores (6/68) were compared across the full range of observed values, and to participants without functional deficits (WOMAC=0). The effect of WOMAC knee pain and body mass index on the above relationships was explored using stepwise regression. Results Per regression equations, a 3.7% reduction in extensor and a 4.0% reduction in flexor strength were associated with an MCID in WOMAC function in women, and a 3.6%/4.8% reduction in men. For strength divided by body weight, reductions were 5.2%/6.7% in women and 5.8%/6.7% in men. Comparing MCID strata across the full observed range of WOMAC function confirmed the above estimates and did not suggest non-linear relationships across the spectrum of observed values. WOMAC pain correlated strongly with WOMAC function, but extensor (and flexor) muscle strength contributed significant independent information. Conclusion Reductions of approximately 4% in isometric muscle strength and of 6% in strength/weight were related to a clinically relevant difference in WOMAC functional disability. Longitudinal studies will need to confirm these relationships within persons. Muscle extensor (and flexor) strength (per body weight) provided significant independent information in addition to pain in explaining variability in lower limb function. PMID:25303012

  4. Relationship between isometric thigh muscle strength and minimum clinically important differences in knee function in osteoarthritis: data from the osteoarthritis initiative.

    Science.gov (United States)

    Ruhdorfer, Anja; Wirth, Wolfgang; Eckstein, Felix

    2015-04-01

    To determine the relationship between thigh muscle strength and clinically relevant differences in self-assessed lower leg function. Isometric knee extensor and flexor strength of 4,553 Osteoarthritis Initiative participants (2,651 women and 1,902 men) was related to the Western Ontario and McMaster Universities Osteoarthritis Index (WOMAC) physical function scores by linear regression. Further, groups of male and female participant strata with minimum clinically important differences (MCIDs) in WOMAC function scores (6 of 68 units) were compared across the full range of observed values and to participants without functional deficits (WOMAC score 0). The effect of WOMAC knee pain and body mass index on the above relationships was explored using stepwise regression. Per regression equations, a 3.7% reduction in extensor strength and a 4.0% reduction in flexor strength were associated with an MCID in WOMAC function in women, and, respectively, a 3.6% and 4.8% reduction in men. For strength divided by body weight, reductions were 5.2% and 6.7%, respectively, in women and 5.8% and 6.7%, respectively, in men. Comparing MCID strata across the full observed range of WOMAC function confirmed the above estimates and did not suggest nonlinear relationships across the spectrum of observed values. WOMAC pain correlated strongly with WOMAC function, but extensor (and flexor) muscle strength contributed significant independent information. Reductions of approximately 4% in isometric muscle strength and of 6% in strength per body weight were related to a clinically relevant difference in WOMAC functional disability. Longitudinal studies will need to confirm these relationships within persons. Muscle extensor (and flexor) strength (per body weight) provided significant independent information in addition to pain in explaining variability in lower leg function. Copyright © 2015 by the American College of Rheumatology.

  5. Race Differences: Use of Walking Speed to Identify Community-Dwelling Women at Risk for Poor Health Outcomes--Osteoarthritis Initiative Study.

    Science.gov (United States)

    Kirkness, Carmen S; Ren, Jinma

    2015-07-01

    Onset of disability, risk for future falls, frailty, functional decline, and mortality are strongly associated with a walking speed of less than 1.0 m/s. The study objective was to determine whether there were differences in slow walking speed (differences in walking speed can be attributed to age, obesity, socioeconomic factors, disease severity, or comorbidities. A cross-sectional design was used. Community-dwelling adults were recruited from Baltimore, Maryland; Columbus, Ohio; Pittsburgh, Pennsylvania; and Pawtucket, Rhode Island. Participants were 2,648 women (23% African American) who were 45 to 79 years of age and had a self-selected baseline walking speed of 20 m/s in the Osteoarthritis Initiative Study. Mixed-effects logistic regression models were used to examine racial differences in walking speed (<1.0 m/s versus ≥1.0 m/s), with adjustments for demographic factors, socioeconomic factors, disease severity, and comorbidities. Walking speed was significantly slower for African American women than for white American women (mean walking speed=1.19 and 1.33 m/s, respectively). The prevalence of a walking speed of less than 1.0 m/s in this cohort of middle-aged women was 9%; about 50% of the women with a walking speed of less than 1.0 m/s were younger than 65 years. Women with a walking speed of less than 1.0 m/s had lower values for socioeconomic factors, higher values for disease severity, and higher prevalences of obesity and comorbidities than those with a walking speed of ≥1.0 m/s. After controlling for these covariates, it was found that African American women were 3 times (odds ratio=2.9; 95% confidence interval=2.0, 4.1) more likely to have a walking speed of less than 1.0 m/s than white American women. The study design made it impossible to know whether a walking speed of less than 1.0 m/s in women who were 45 years of age or older was a predictor of future poor health outcomes. In this study, race was independently associated with a walking speed

  6. Identifying and Reconciling Risk Across Sectors: The implic