Identifying Importance-Performance Matrix Analysis (IPMA) of ...
African Journals Online (AJOL)
Identifying Importance-Performance Matrix Analysis (IPMA) of intellectual capital and Islamic work ethics in Malaysian SMES. ... capital and Islamic work ethics significantly influenced business performance. ... AJOL African Journals Online.
Identifying important motivational factors for professionals in Greek hospitals
Kontodimopoulos, Nick; Paleologou, Victoria; Niakas, Dimitris
2009-01-01
Background The purpose of this study was to identify important motivational factors according to the views of health-care professionals in Greek hospitals and particularly to determine if these might differ in the public and private sectors. Methods A previously developed -and validated- instrument addressing four work-related motivators (job attributes, remuneration, co-workers and achievements) was used. Three categories of health care professionals, doctors (N = 354), nurses (N = 581) and office workers (N = 418), working in public and private hospitals, participated and motivation was compared across socio-demographic and occupational variables. Results The range of reported motivational factors was mixed and Maslow's conclusions that lower level motivational factors must be met before ascending to the next level were not confirmed. The highest ranked motivator for the entire sample, and by professional subgroup, was achievements (P motivators were similar, and only one significant difference was observed, namely between doctors and nurses in respect to co-workers (P motivated by all factors significantly more than their public-hospital counterparts. Conclusion The results are in agreement with the literature which focuses attention to management approaches employing both monetary and non-monetary incentives to motivate health care workers. This study showed that intrinsic factors are particularly important and should become a target for effective employee motivation. PMID:19754968
Identifying the important factors in simulation models with many factors
Bettonvil, B.; Kleijnen, J.P.C.
1994-01-01
Simulation models may have many parameters and input variables (together called factors), while only a few factors are really important (parsimony principle). For such models this paper presents an effective and efficient screening technique to identify and estimate those important factors. The
How important are sex differences in cannabinoid action?
Fattore, Liana; Fratta, Walter
2010-06-01
In humans as in animals, males and females are dissimilar in their genetic and hormonally driven behaviour; they process information differently, perceive experience and emotions in different ways, display diverse attitudes, language and social skills, and show sex-related differences in the brain anatomy and organization. Drug addiction is a widespread relapsing illness that affects both men and women. Sex-dependent differences have been frequently observed in the biological and behavioural effects of substances of abuse, including cannabis. Beside sex differences observed in the cannabinoid-induced effects related to cannabis abuse and dependence, cannabinoids have been shown to exert sex-dependent effects also in other physiological and behavioural aspects, such as food intake and energy balance (more evident in males), or anxiety and depression (more evident in females). Research has just begun to identify factors which could provide a neurobiological basis for gender-based differences in cannabinoid effects, among which, gonadal hormones seem to play a crucial role. Yet, cannabinoid pharmacodynamic and pharmacokinetic may also be important, as sex differences in cannabinoid effects might be due, at least in part, to differences in muscle mass and fat tissue distribution between males and females. Here, we will review both clinical and laboratory-based research evidence revealing important sex-related differences in cannabinoid effects, and put forward some suggestions for future studies to fill the gap in our knowledge of gender-specific bias in cannabinoid pharmacology.
Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, PHM
Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis
Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, P.H.M.
2003-01-01
Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis
Drosophila Cancer Models Identify Functional Differences between Ret Fusions.
Levinson, Sarah; Cagan, Ross L
2016-09-13
We generated and compared Drosophila models of RET fusions CCDC6-RET and NCOA4-RET. Both RET fusions directed cells to migrate, delaminate, and undergo EMT, and both resulted in lethality when broadly expressed. In all phenotypes examined, NCOA4-RET was more severe than CCDC6-RET, mirroring their effects on patients. A functional screen against the Drosophila kinome and a library of cancer drugs found that CCDC6-RET and NCOA4-RET acted through different signaling networks and displayed distinct drug sensitivities. Combining data from the kinome and drug screens identified the WEE1 inhibitor AZD1775 plus the multi-kinase inhibitor sorafenib as a synergistic drug combination that is specific for NCOA4-RET. Our work emphasizes the importance of identifying and tailoring a patient's treatment to their specific RET fusion isoform and identifies a multi-targeted therapy that may prove effective against tumors containing the NCOA4-RET fusion. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
PCR-RFLP Method to Identify Salmonid Species of Economic Importance
Directory of Open Access Journals (Sweden)
Andreea Dudu
2011-05-01
Full Text Available The identification of different fish species by molecular methods has become necessary to avoid both the incorrect labelling of individuals involved in repopulation programmes and the commercial frauds on the fish market. Different fish species of great economical importance, like the salmonids, which are very much requested for their meat, can be identified using molecular techniques such as PCR-RFLP. The method is based on the amplification of a target region from the genome by PCR reaction followed by endonucleases digestion to detect the polymorphism of restriction fragments. In our study we analysed the following salmonid species from Romania: Salmo trutta fario, Salmo labrax, Salvelinus fontinalis, Onchorhynchus mykiss, Thymallus thymallus and Hucho hucho. In order to discriminate between the analysed species we amplified a fragment of mitochondrial genome comprising tRNAGlu/ cytochrome b/ tRNAThr/ tRNAPro/ D-loop/ tRNAPhe, followed by digestion with a specific restriction enzyme. The direct digestion of unpurified PCR products generated species-specific restriction patterns and proved to be a simple, reliable, inexpensive and fast method. Thus, it may be successfully utilized in specialized laboratories for the correct identification of the fish species for multiple purposes, including the traceability of fish food products.
Identifying important nodes by adaptive LeaderRank
Xu, Shuang; Wang, Pei
2017-03-01
Spreading process is a common phenomenon in complex networks. Identifying important nodes in complex networks is of great significance in real-world applications. Based on the spreading process on networks, a lot of measures have been proposed to evaluate the importance of nodes. However, most of the existing measures are appropriate to static networks, which are fragile to topological perturbations. Many real-world complex networks are dynamic rather than static, meaning that the nodes and edges of such networks may change with time, which challenge numerous existing centrality measures. Based on a new weighted mechanism and the newly proposed H-index and LeaderRank (LR), this paper introduces a variant of the LR measure, called adaptive LeaderRank (ALR), which is a new member of the LR-family. Simulations on six real-world networks reveal that the new measure can well balance between prediction accuracy and robustness. More interestingly, the new measure can better adapt to the adjustment or local perturbations of network topologies, as compared with the existing measures. By discussing the detailed properties of the measures from the LR-family, we illustrate that the ALR has its competitive advantages over the other measures. The proposed algorithm enriches the measures to understand complex networks, and may have potential applications in social networks and biological systems.
Cejnar, Pavel; Kuckova, Stepanka; Prochazka, Ales; Karamonova, Ludmila; Svobodova, Barbora
2018-06-15
Explorative statistical analysis of mass spectrometry data is still a time-consuming step. We analyzed critical factors for application of principal component analysis (PCA) in mass spectrometry and focused on two whole spectrum based normalization techniques and their application in the analysis of registered peak data and, in comparison, in full spectrum data analysis. We used this technique to identify different metabolic patterns in the bacterial culture of Cronobacter sakazakii, an important foodborne pathogen. Two software utilities, the ms-alone, a python-based utility for mass spectrometry data preprocessing and peak extraction, and the multiMS-toolbox, an R software tool for advanced peak registration and detailed explorative statistical analysis, were implemented. The bacterial culture of Cronobacter sakazakii was cultivated on Enterobacter sakazakii Isolation Agar, Blood Agar Base and Tryptone Soya Agar for 24 h and 48 h and applied by the smear method on an Autoflex speed MALDI-TOF mass spectrometer. For three tested cultivation media only two different metabolic patterns of Cronobacter sakazakii were identified using PCA applied on data normalized by two different normalization techniques. Results from matched peak data and subsequent detailed full spectrum analysis identified only two different metabolic patterns - a cultivation on Enterobacter sakazakii Isolation Agar showed significant differences to the cultivation on the other two tested media. The metabolic patterns for all tested cultivation media also proved the dependence on cultivation time. Both whole spectrum based normalization techniques together with the full spectrum PCA allow identification of important discriminative factors in experiments with several variable condition factors avoiding any problems with improper identification of peaks or emphasis on bellow threshold peak data. The amounts of processed data remain still manageable. Both implemented software utilities are available
Blyth, Julie; Makrantoni, Vasso; Barton, Rachael E.; Spanos, Christos; Rappsilber, Juri; Marston, Adele L.
2018-01-01
Meiosis is a specialized cell division that generates gametes, such as eggs and sperm. Errors in meiosis result in miscarriages and are the leading cause of birth defects; however, the molecular origins of these defects remain unknown. Studies in model organisms are beginning to identify the genes and pathways important for meiosis, but the parts list is still poorly defined. Here we present a comprehensive catalog of genes important for meiosis in the fission yeast, Schizosaccharomyces pombe. Our genome-wide functional screen surveyed all nonessential genes for roles in chromosome segregation and spore formation. Novel genes important at distinct stages of the meiotic chromosome segregation and differentiation program were identified. Preliminary characterization implicated three of these genes in centrosome/spindle pole body, centromere, and cohesion function. Our findings represent a near-complete parts list of genes important for meiosis in fission yeast, providing a valuable resource to advance our molecular understanding of meiosis. PMID:29259000
Callaham, Michael; John, Leslie K
2018-01-05
We define a minimally important difference for the Likert-type scores frequently used in scientific peer review (similar to existing minimally important differences for scores in clinical medicine). The magnitude of score change required to change editorial decisions has not been studied, to our knowledge. Experienced editors at a journal in the top 6% by impact factor were asked how large a change of rating in "overall desirability for publication" was required to trigger a change in their initial decision on an article. Minimally important differences were assessed twice for each editor: once assessing the rating change required to shift the editor away from an initial decision to accept, and the other assessing the magnitude required to shift away from an initial rejection decision. Forty-one editors completed the survey (89% response rate). In the acceptance frame, the median minimally important difference was 0.4 points on a scale of 1 to 5. Editors required a greater rating change to shift from an initial rejection decision; in the rejection frame, the median minimally important difference was 1.2 points. Within each frame, there was considerable heterogeneity: in the acceptance frame, 38% of editors did not change their decision within the maximum available range; in the rejection frame, 51% did not. To our knowledge, this is the first study to determine the minimally important difference for Likert-type ratings of research article quality, or in fact any nonclinical scientific assessment variable. Our findings may be useful for future research assessing whether changes to the peer review process produce clinically meaningful differences in editorial decisionmaking. Copyright © 2017 American College of Emergency Physicians. Published by Elsevier Inc. All rights reserved.
Methodology for identifying boundaries of systems important to safety in CANDU nuclear power plants
International Nuclear Information System (INIS)
Therrien, S.; Komljenovic, D.; Therrien, P.; Ruest, C.; Prevost, P.; Vaillancourt, R.
2007-01-01
This paper presents a methodology developed to identify the boundaries of the systems important to safety (SIS) at the Gentilly-2 Nuclear Power Plant (NPP), Hydro-Quebec. The SIS boundaries identification considers nuclear safety only. Components that are not identified as important to safety are systematically identified as related to safety. A global assessment process such as WANO/INPO AP-913 'Equipment Reliability Process' will be needed to implement adequate changes in the management rules of those components. The paper depicts results in applying the methodology to the Shutdown Systems 1 and 2 (SDS 1, 2), and to the Emergency Core Cooling System (ECCS). This validation process enabled fine tuning the methodology, performing a better estimate of the effort required to evaluate a system, and identifying components important to safety of these systems. (author)
Identifying the ideal profile of French yogurts for different clusters of consumers.
Masson, M; Saint-Eve, A; Delarue, J; Blumenthal, D
2016-05-01
Identifying the sensory properties that affect consumer preferences for food products is an important feature of product development. Different methods, such as external preference mapping or partial least squares regression, are used to establish relationships between sensory data and consumer preferences and to identify sensory attributes that drive consumer preferences, by highlighting optimum products. Plain French yogurts were evaluated by a sensory profiling method performed by 12 trained judges. In parallel, 180 consumers were asked to score their overall liking and complete a cognitive restraint questionnaire. After hierarchical cluster analysis on the liking scores, preference mapping using a quadratic regression model was performed. Five clusters of consumers were identified as a function of different preference patterns. Contrary to our expectations, fat levels were not discriminating. For each cluster, the results of preference mapping enabled the identification of optimum products. A comparison of the 5 sensory profiles revealed numerous differences between key sensory attributes. For example, one consumer cluster had a strong preference for products perceived as very thick, grainy, but with a less flowing texture, less sticky, whey presence and color, in contrast to other clusters. In addition, each segment of consumers was characterized according to the results of the cognitive restraint questionnaire. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Kocks, J. W. H.; Tuinenga, M. G.; Uil, S. M.; van den Berg, J. W. K.; Stahl, E.; van der Molen, T.
2006-01-01
Background: Patient-reported outcomes ( PRO) questionnaires are being increasingly used in COPD clinical studies. The challenge facing investigators is to determine what change is significant, ie what is the minimal clinically important difference (MCID). This study aimed to identify the MCID for
Study of a methodology of identifying important research problems by the PIRT process
International Nuclear Information System (INIS)
Aoki, Takayuki; Takagi, Toshiyuki; Urayama, Ryoichi; Komura, Ichiro; Furukawa, Takashi; Yusa, Noritaka
2014-01-01
In this paper, we propose a new methodology of identifying important research problems to be solved to improve the performance of some specific scientific technologies by the phenomena identification and ranking table (PIRT) process which has been used as a methodology for demonstrating the validity of the best estimate simulation codes in US Nuclear Regulatory Commission (USNRC) licensing of nuclear power plants. The new methodology makes it possible to identify important factors affecting the performance of the technologies from the viewpoint of the figure of merit and problems associated with them while it keeps the fundamental concepts of the original PIRT process. Also in this paper, we demonstrate the effectiveness of the new methodology by applying it to a task of extracting research problems for improving an inspection accuracy of ultrasonic testing or eddy current testing in the inspection of objects having cracks due to fatigue or stress corrosion cracking. (author)
Study of a methodology of identifying important research problems by the PIRT process
International Nuclear Information System (INIS)
Aoki, Takayuki; Takagi, Toshiyuki; Urayama, Ryoichi; Komura, Ichiro; Furukawa, Takashi; Yusa, Noritaka
2013-01-01
In this paper, we propose a new methodology of identifying important research problems to be solved to improve the performance of some specific scientific technologies by the phenomena identification and ranking table (PIRT) process, which has been used as a methodology for demonstrating the validity of the best estimate simulation codes in USNRC licensing of nuclear power plants. It keeps the fundamental concepts of the original PIRT process but makes it possible to identify important factors affecting the performance of the technologies from the viewpoint of the figure of merit and problems associated with them, which need to be solved to improve the performance. Also in this paper, we demonstrate the effectiveness of the developed method by showing a specific example of the application to physical events or phenomena in objects having fatigue or SCC crack(s) under ultrasonic testing and eddy current testing. (author)
Statistical Analyses of Scatterplots to Identify Important Factors in Large-Scale Simulations
Energy Technology Data Exchange (ETDEWEB)
Kleijnen, J.P.C.; Helton, J.C.
1999-04-01
The robustness of procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses is investigated. These procedures are based on attempts to detect increasingly complex patterns in the scatterplots under consideration and involve the identification of (1) linear relationships with correlation coefficients, (2) monotonic relationships with rank correlation coefficients, (3) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (4) trends in variability as defined by variances and interquartile ranges, and (5) deviations from randomness as defined by the chi-square statistic. The following two topics related to the robustness of these procedures are considered for a sequence of example analyses with a large model for two-phase fluid flow: the presence of Type I and Type II errors, and the stability of results obtained with independent Latin hypercube samples. Observations from analysis include: (1) Type I errors are unavoidable, (2) Type II errors can occur when inappropriate analysis procedures are used, (3) physical explanations should always be sought for why statistical procedures identify variables as being important, and (4) the identification of important variables tends to be stable for independent Latin hypercube samples.
The Minimal Clinically Important Difference for the Mayo-Portland Adaptability Inventory.
Malec, James F; Kean, Jacob; Monahan, Patrick O
To determine the Minimal Clinically Important Difference (MCID) and Robust Clinically Important Difference (RCID) of the Mayo-Portland Adaptability Inventory-4 (MPAI-4) as measures of response to intervention. Retrospective analysis of existing data. Both distribution- and anchor-based methods were used to triangulate on the MCID and to identify a moderate, that is, more robust, level of change (RCID) for the MPAI-4. These were further evaluated with respect to clinical provider ratings. Data for individuals with acquired brain injury in rehabilitation programs throughout the United States in the OutcomeInfo Database (n = 3087) with 2 MPAI-4 ratings. MPAI-4, Supervision Rating Scale, Clinician Rating of Global Clinical Improvement. Initial analyses suggested 5 T-score points (5T) as the MCID and 9T as the RCID. Eighty-one percent to 87% of clinical raters considered a 5T change and 99% considered a 9T change to indicate meaningful improvement. 5T represents the MCID for the MPAI-4 and 9T, the RCID. Both values are notably less than the Reliable Change Index (RCI). While the RCI indicates change with a high level of statistical confidence, it may be insensitive to change that is considered meaningful by providers and participants as indicated by the MCID.
Similar or different?: the importance of similarities and differences for support between siblings
Voorpostel, M.; van der Lippe, T.; Dykstra, P.A.; Flap, H.
2007-01-01
Using a large-scale Dutch national sample (N = 7,126), the authors examine the importance of similarities and differences in the sibling dyad for the provision of support. Similarities are assumed to enhance attraction and empathy; differences are assumed to be related to different possibilities for
Similar or Different? The Importance of Similarities and Differences for Support Between Siblings
Voorpostel, Marieke; Lippe, Tanja van der; Dykstra, Pearl A.; Flap, Henk
2007-01-01
Using a large-scale Dutch national sample (N = 7,126), the authors examine the importance of similarities and differences in the sibling dyad for the provision of support. Similarities are assumed to enhance attraction and empathy; differences are assumed to be related to different possibilities for
Staffieri, Sandra E; Kearns, Lisa S; Sanfilippo, Paul G; Craig, Jamie E; Mackey, David A; Hewitt, Alex W
2018-02-01
Leukocoria is the most common presenting sign for pediatric eye disease including retinoblastoma and cataract, with worse outcomes if diagnosis is delayed. We investigated whether individuals could identify leukocoria in photographs (photoleukocoria) and examined their subsequent Internet search behavior. Using a web-based questionnaire, in this cross-sectional study we invited adults aged over 18 years to view two photographs of a child with photoleukocoria, and then search the Internet to determine a possible diagnosis and action plan. The most commonly used search terms and websites accessed were recorded. The questionnaire was completed by 1639 individuals. Facebook advertisement was the most effective recruitment strategy. The mean age of all respondents was 38.95 ± 14.59 years (range, 18-83), 94% were female, and 59.3% had children. An abnormality in the images presented was identified by 1613 (98.4%) participants. The most commonly used search terms were: "white," "pupil," "photo," and "eye" reaching a variety of appropriate websites or links to print or social media articles. Different words or phrases were used to describe the same observation of photoleukocoria leading to a range of websites. Variations in the description of observed signs and search words influenced the sites reached, information obtained, and subsequent help-seeking intentions. Identifying the most commonly used search terms for photoleukocoria is an important step for search engine optimization. Being directed to the most appropriate websites informing of the significance of photoleukocoria and the appropriate actions to take could improve delays in diagnosis of important pediatric eye disease such as retinoblastoma or cataract.
Liu, Zhaohua; Ji, Zhibin; Wang, Guizhi; Chao, Tianle; Hou, Lei; Wang, Jianmin
2016-11-03
Throughout a long period of adaptation and selection, sheep have thrived in a diverse range of ecological environments. Mongolian sheep is the common ancestor of the Chinese short fat-tailed sheep. Migration to different ecoregions leads to changes in selection pressures and results in microevolution. Mongolian sheep and its subspecies differ in a number of important traits, especially reproductive traits. Genome-wide intraspecific variation is required to dissect the genetic basis of these traits. This research resequenced 3 short fat-tailed sheep breeds with a 43.2-fold coverage of the sheep genome. We report more than 17 million single nucleotide polymorphisms and 2.9 million indels and identify 143 genomic regions with reduced pooled heterozygosity or increased genetic distance to each other breed that represent likely targets for selection during the migration. These regions harbor genes related to developmental processes, cellular processes, multicellular organismal processes, biological regulation, metabolic processes, reproduction, localization, growth and various components of the stress responses. Furthermore, we examined the haplotype diversity of 3 genomic regions involved in reproduction and found significant differences in TSHR and PRL gene regions among 8 sheep breeds. Our results provide useful genomic information for identifying genes or causal mutations associated with important economic traits in sheep and for understanding the genetic basis of adaptation to different ecological environments.
Directory of Open Access Journals (Sweden)
John Ong
2018-03-01
Full Text Available Summary: Use of hepatocytes derived from induced pluripotent stem cells (i-Heps is limited by their functional differences in comparison with primary cells. Extracellular niche factors likely play a critical role in bridging this gap. Using image-based characterization (high content analysis; HCA of freshly isolated hepatocytes from 17 human donors, we devised and validated an algorithm (Hepatocyte Likeness Index; HLI for comparing the hepatic properties of cells against a physiological gold standard. The HLI was then applied in a targeted screen of extracellular niche factors to identify substrates driving i-Heps closer to the standard. Laminin 411, the top hit, was validated in two additional induced pluripotent stem cell (iPSC lines, primary tissue, and an in vitro model of α1-antitrypsin deficiency. Cumulatively, these data provide a reference method to control and screen for i-Hep differentiation, identify Laminin 411 as a key niche protein, and underscore the importance of combining substrates, soluble factors, and HCA when developing iPSC applications. : Rashid and colleagues demonstrate the utility of a high-throughput imaging platform for identification of physiologically relevant extracellular niche factors to advance i-Heps closer to their primary tissue counterparts. The extracellular matrix (ECM protein screen identified Laminin 411 as an important niche factor facilitating i-Hep-based disease modeling in vitro. Keywords: iPS hepatocytes, extracellular niche, image-based screening, disease modeling, laminin
Identify the Important Decision Factors of Online Shopping Adoption in Indonesia
Directory of Open Access Journals (Sweden)
Lailatul HIJRAH
2017-12-01
Full Text Available The objective of this study is to identify factors encouraging a consumer to engage in online shopping activities. The expected contribution of this study is for online entrepreneurs, in order to develop the most suitable business strategy, so that it will be clearly identified and sorted out which factors are the most important and the main motivation of Indonesian consumers to shop via online by using responses from respondents who usually shop online and offline in 3 cities in Indonesia, Jakarta, Surabaya and Samarinda. The research instruments were developed by conducting FGDs on relevant groups, either academics, online shopping activists, suppliers and courier businessmen in Jakarta, Surabaya and Samarinda Cities in effort to extract any information that encourages consumers to online shopping. After conducting FGD, the researcher produced 48 items proposed for factor analysis and after extracted to form eleven constructs, some items were removed because they had less loading factors. The eleven constructs or dimensions are trust, risk, consumer factors, website factors, price, service quality, convenience, subjective norm, product guarantee, variety of products and lifestyle. The implications of this study provide valuable insights about consumer decisions to online shopping or not online shopping.
The Importance of identifiers: IWGSC Meeting 20170720
Haak, Laurel
2017-01-01
Presentation by Laure Haak at the 20 July 2017 meeting of the IWGSC, about use of identifiers in connecting researchers, funding, facilities, and publications. Description of approach and initial results of User Facilities and Publications Working Group, and applications for Scientific Collections.
Chamorro-Premuzic, Tomas; Arteche, Adriane; Bremner, Andrew J.; Greven, Corina; Furnham, Adrian
2010-01-01
Three UK studies on the relationship between a purpose-built instrument to assess the importance and development of 15 "soft skills" are reported. "Study 1" (N = 444) identified strong latent components underlying these soft skills, such that differences "between-skills" were over-shadowed by differences…
Cuong, Do Manh; Arasu, Mariadhas Valan; Jeon, Jin; Park, Yun Ji; Kwon, Soon-Jae; Al-Dhabi, Naif Abdullah; Park, Sang Un
2017-12-01
Carotenoids, found in the fruit and different organs of bitter melon ( Momordica charantia ), have attracted great attention for their potential health benefits in treating several major chronic diseases. Therefore, study related to the identification and quantification of the medically important carotenoid metabolites is highly important for the treatment of various disorderes. The present study involved in the identification and quantification of the various carotenoids present in the different organs of M. charantia and the identification of the genes responsible for the accumulation of the carotenoids with respect to the transcriptome levels were investigated. In this study, using the transcriptome database of bitter melon, a partial-length cDNA clone encoding geranylgeranyl pyrophosphate synthase ( McGGPPS2 ), and several full-length cDNA clones encoding geranylgeranyl pyrophosphate synthase ( McGGPPS1 ), zeta-carotene desaturase ( McZDS ), lycopene beta-cyclase ( McLCYB ), lycopene epsilon cyclases ( McLCYE1 and McLCYE2 ), beta-carotene hydroxylase ( McCHXB ), and zeaxanthin epoxidase ( McZEP ) were identified in bitter melon . The expression levels of the mRNAs encoding these eight putative biosynthetic enzymes, as well as the accumulation of lycopene, α-carotene, lutein, 13Z-β-carotene, E-β-carotene, 9Z-β-carotene, β-cryptoxanthin, zeaxanthin, antheraxanthin, and violaxanthin were investigated in different organs from M. charantia as well as in the four different stages of its fruit maturation. Transcripts were found to be constitutively expressed at high levels in the leaves where carotenoids were also found at the highest levels . Collectively, these results indicate that the putative McGGPPS2, McZDS, McLCYB, McLCYE1, McLCYE2, and McCHXB enzymes might be key factors in controlling carotenoid content in bitter melon . In conclusion, the over expression of the carotenoid biosynthetic genes from M. charantia crops to increase the yield of these
International Nuclear Information System (INIS)
Kleijnen, J.P.C.; Helton, J.C.
1999-01-01
Procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses are described and illustrated. These procedures attempt to detect increasingly complex patterns in scatterplots and involve the identification of (i) linear relationships with correlation coefficients, (ii) monotonic relationships with rank correlation coefficients, (iii) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (iv) trends in variability as defined by variances and interquartile ranges, and (v) deviations from randomness as defined by the chi-square statistic. A sequence of example analyses with a large model for two-phase fluid flow illustrates how the individual procedures can differ in the variables that they identify as having effects on particular model outcomes. The example analyses indicate that the use of a sequence of procedures is a good analysis strategy and provides some assurance that an important effect is not overlooked
Jansen, Esther J S; Dijkman, Koen P; van Lingen, Richard A; de Vries, Willem B; Vijlbrief, Daniel C; de Boode, Willem P; Andriessen, Peter
2017-10-01
The aim of this study was to identify inter-centre differences in persistent ductus arteriosus treatment and their related outcomes. Materials and methods We carried out a retrospective, multicentre study including infants between 24+0 and 27+6 weeks of gestation in the period between 2010 and 2011. In all centres, echocardiography was used as the standard procedure to diagnose a patent ductus arteriosus and to document ductal closure. In total, 367 preterm infants were included. All four participating neonatal ICU had a comparable number of preterm infants; however, differences were observed in the incidence of treatment (33-63%), choice and dosing of medication (ibuprofen or indomethacin), number of pharmacological courses (1-4), and the need for surgical ligation after failure of pharmacological treatment (8-52%). Despite the differences in treatment, we found no difference in short-term morbidity between the centres. Adjusted mortality showed independent risk contribution of gestational age, birth weight, ductal ligation, and perinatal centre. Using benchmarking as a tool identified inter-centre differences. In these four perinatal centres, the factors that explained the differences in patent ductus arteriosus treatment are quite complex. Timing, choice of medication, and dosing are probably important determinants for successful patent ductus arteriosus closure.
Xia, Jun Hong; Li, Hong Lian; Zhang, Yong; Meng, Zi Ning; Lin, Hao Ran
2018-05-01
Fish species inhabitating seawater (SW) or freshwater (FW) habitats have to develop genetic adaptations to alternative environment factors, especially salinity. Functional consequences of the protein variations associated with habitat environments in fish mitochondrial genomes have not yet received much attention. We analyzed 829 complete fish mitochondrial genomes and compared the amino acid differences of 13 mitochondrial protein families between FW and SW fish groups. We identified 47 specificity determining sites (SDS) that associated with FW or SW environments from 12 mitochondrial protein families. Thirty-two (68%) of the SDS sites are hydrophobic, 13 (28%) are neutral, and the remaining sites are acidic or basic. Seven of those SDS from ND1, ND2 and ND5 were scored as probably damaging to the protein structures. Furthermore, phylogenetic tree based Bayes Empirical Bayes analysis also detected 63 positive sites associated with alternative habitat environments across ten mtDNA proteins. These signatures could be important for studying mitochondrial genetic variation relevant to fish physiology and ecology.
Dewland, Thomas A; Wintermark, Max; Vaysman, Anna; Smith, Lisa M; Tong, Elizabeth; Vittinghoff, Eric; Marcus, Gregory M
2013-01-01
Left atrial (LA) tissue characteristics may play an important role in atrial fibrillation (AF) induction and perpetuation. Although frequently used in clinical practice, computed tomography (CT) has not been employed to describe differences in LA wall properties between AF patients and controls. We sought to noninvasively characterize AF-associated differences in LA tissue using CT. CT images of the LA were obtained in 98 consecutive patients undergoing AF ablation and in 89 controls. A custom software algorithm was used to measure wall thickness and density in four prespecified regions of the LA. On average, LA walls were thinner (-15.5%, 95% confidence interval [CI] -23.2 to -7.8%, P identified significant thinning of the LA wall and regional alterations in tissue density in patients with a history of AF. These findings suggest differences in LA tissue composition can be noninvasively identified and quantified using CT. ©2012, The Authors. Journal compilation ©2012 Wiley Periodicals, Inc.
Chen, Zhuowei; Shi, Liangsheng; Ye, Ming; Zhu, Yan; Yang, Jinzhong
2018-06-01
Nitrogen reactive transport modeling is subject to uncertainty in model parameters, structures, and scenarios. By using a new variance-based global sensitivity analysis method, this paper identifies important parameters for nitrogen reactive transport with simultaneous consideration of these three uncertainties. A combination of three scenarios of soil temperature and two scenarios of soil moisture creates a total of six scenarios. Four alternative models describing the effect of soil temperature and moisture content are used to evaluate the reduction functions used for calculating actual reaction rates. The results show that for nitrogen reactive transport problem, parameter importance varies substantially among different models and scenarios. Denitrification and nitrification process is sensitive to soil moisture content status rather than to the moisture function parameter. Nitrification process becomes more important at low moisture content and low temperature. However, the changing importance of nitrification activity with respect to temperature change highly relies on the selected model. Model-averaging is suggested to assess the nitrification (or denitrification) contribution by reducing the possible model error. Despite the introduction of biochemical heterogeneity or not, fairly consistent parameter importance rank is obtained in this study: optimal denitrification rate (Kden) is the most important parameter; reference temperature (Tr) is more important than temperature coefficient (Q10); empirical constant in moisture response function (m) is the least important one. Vertical distribution of soil moisture but not temperature plays predominant role controlling nitrogen reaction. This study provides insight into the nitrogen reactive transport modeling and demonstrates an effective strategy of selecting the important parameters when future temperature and soil moisture carry uncertainties or when modelers face with multiple ways of establishing nitrogen
Identifying Differences in Cultural Behavior in Online Groups
Energy Technology Data Exchange (ETDEWEB)
Gregory, Michelle L.; Engel, David W.; Bell, Eric B.; Mcgrath, Liam R.
2012-07-23
We have developed methods to identify online communities, or groups, using a combination of structural information variables and content information variables from weblog posts and their comments to build a characteristic footprint for groups. We have worked with both explicitly connected groups and 'abstract' groups, in which the connection between individuals is in interest (as determined by content based features) and behavior (metadata based features) as opposed to explicit links. We find that these variables do a good job at identifying groups, placing members within a group, and helping determine the appropriate granularity for group boundaries. The group footprint can then be used to identify differences between the online groups. In the work described here we are interested in determining how an individual's online behavior is influenced by their membership in more than one group. For example, individuals belong to a certain culture; they may belong as well to a demographic group, and other 'chosen' groups such as churches or clubs. There is a plethora of evidence surrounding the culturally sensitive adoption, use, and behavior on the Internet. In this work we begin to investigate how culturally defined internet behaviors may influence behaviors of subgroups. We do this through a series of experiments in which we analyze the interaction between culturally defined behaviors and the behaviors of the subgroups. Our goal is to (a) identify if our features can capture cultural distinctions in internet use, and (b) determine what kinds of interaction there are between levels and types of groups.
NRC Information No. 90-01: Importance of proper response to self-identified violations by licensees
International Nuclear Information System (INIS)
Cunningham, R.E.
1992-01-01
NRC expects a high standard of compliance by its licensees and requires that licensees provide NRC accurate and complete information and that required records will also be complete and accurate in all material respects. Licensees should be aware of the importance placed by NRC on licensee programs for self detection, correction and reporting of violations or errors related to regulatory requirements. The General Statement of Policy and Procedures for NRC Enforcement Actions in Appendix C to 10 CFR Part 2 underscores the importance of licensees responding promptly and properly to self-identified violations in two ways. It is suggested that when a licensee identifies a violation involving an NRC-required record, the licensee should make a dated notation indicating identification, either on the record itself or other appropriate documentation retrievable for NRC review. The record with the self-identified violation noted should not be altered in any way to mask the correction. The licensee should determine the cause of the violation, correct the root cause of the violation, and document such findings in an appropriate manner. Licensees should also assure that if a report of the violation is required, the report is submitted to NRC in a timely manner. These actions will be considered by NRC in making any enforcement decision, and generally lead to lesser or no civil penalty
Carter, Christine; Sellman, Edward
2013-08-01
This article applies socio-cultural theories to explore how differences in essay writing experience are constituted for a group of students identified as dyslexic. It reports on a qualitative study with eleven student writers, seven of whom are formally identified as dyslexic, from the schools of archaeology, history and philosophy in a 'traditional' UK university. Semi-structured interviews before, during and after writing a coursework essay revealed well-documented dyslexia-related difficulties and also strong differences in how writing was experienced. The multiple and fluid dimensions that construct these differences suggest the importance of position within the context, previous and developing writing and learning experience, and metacognitive, meta-affective and metalinguistic awareness. They also suggest tensions between specialist and inclusive policies in relation to writing pedagogy for students identified as dyslexic. Copyright © 2013 John Wiley & Sons, Ltd.
Torres, César Iván
2014-06-01
The development of microbial electrochemistry research toward technological applications has increased significantly in the past years, leading to many process configurations. This short review focuses on the need to identify and characterize the fundamental phenomena that control the performance of microbial electrochemical cells (MXCs). Specifically, it discusses the importance of recent efforts to discover and characterize novel microorganisms for MXC applications, as well as recent developments to understand transport limitations in MXCs. As we increase our understanding of how MXCs operate, it is imperative to continue modeling efforts in order to effectively predict their performance, design efficient MXC technologies, and implement them commercially. Thus, the success of MXC technologies largely depends on the path of identifying, understanding, and predicting fundamental phenomena that determine MXC performance. Copyright © 2013 Elsevier Ltd. All rights reserved.
Relative importance of the different radionuclides for radiological consequences
International Nuclear Information System (INIS)
Manesse, D.
1984-12-01
This paper tries, for several source-terms, to estimate the relative importance of the different families of radioactive products in the calculation of radiological consequences; the study takes place in the case of accidental situations of PWR reactors [fr
How important is importance for prospective memory? A review
Directory of Open Access Journals (Sweden)
Stefan eWalter
2014-06-01
Full Text Available Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover, we address the relationship between importance and other factors known to affect prospective memory and ongoing task performance such as type of prospective memory task (time-, event- or activity-based, cognitive loads, and cue focality. Finally, we provide a connection to motivation, we summarize the effects of task importance and we identify important venues for future research.
How important is importance for prospective memory? A review
Walter, Stefan; Meier, Beat
2014-01-01
Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover, we address the relationship between importance and other factors known to affect prospective memory and ongoing task performance such as type of prospective memory task (time-, event-, or activity-based), cognitive loads, and processing overlaps. Finally, we provide a connection to motivation, we summarize the effects of task importance and we identify important venues for future research. PMID:25018743
Uwizeye, U.A.; Groen, E.A.; Gerber, P.J.; Schulte, Rogier P.O.; Boer, de I.J.M.
2016-01-01
The study aims to illustrate a method to identify important input parameters that explain most of the output variance ofenvironmental assessment models. The method is tested for the computation of life-cycle nitrogen (N) use efficiencyindicators among mixed dairy production systems in Rwanda. We
Rashid, Barnaly; Damaraju, Eswar; Pearlson, Godfrey D; Calhoun, Vince D
2014-01-01
Schizophrenia (SZ) and bipolar disorder (BP) share significant overlap in clinical symptoms, brain characteristics, and risk genes, and both are associated with dysconnectivity among large-scale brain networks. Resting state functional magnetic resonance imaging (rsfMRI) data facilitates studying macroscopic connectivity among distant brain regions. Standard approaches to identifying such connectivity include seed-based correlation and data-driven clustering methods such as independent component analysis (ICA) but typically focus on average connectivity. In this study, we utilize ICA on rsfMRI data to obtain intrinsic connectivity networks (ICNs) in cohorts of healthy controls (HCs) and age matched SZ and BP patients. Subsequently, we investigated difference in functional network connectivity, defined as pairwise correlations among the timecourses of ICNs, between HCs and patients. We quantified differences in both static (average) and dynamic (windowed) connectivity during the entire scan duration. Disease-specific differences were identified in connectivity within different dynamic states. Notably, results suggest that patients make fewer transitions to some states (states 1, 2, and 4) compared to HCs, with most such differences confined to a single state. SZ patients showed more differences from healthy subjects than did bipolars, including both hyper and hypo connectivity in one common connectivity state (dynamic state 3). Also group differences between SZ and bipolar patients were identified in patterns (states) of connectivity involving the frontal (dynamic state 1) and frontal-parietal regions (dynamic state 3). Our results provide new information about these illnesses and strongly suggest that state-based analyses are critical to avoid averaging together important factors that can help distinguish these clinical groups.
Gender Differences in Perceived Importance and Performance of Penang Island Attributes
Directory of Open Access Journals (Sweden)
Omar Shida Irwana
2014-01-01
Full Text Available This paper examines the gender differences in perceived importance and performance of Penang Island attributes. The data was drawn from questionnaire survey of 801 international tourists who visited the island between August and November 2012. Previous studies related to gender differences in Malaysian destinations are found scarce and neglected, thus this paper aims to bridge this knowledge gap. The needs to study gender differences are related to the suggestions that men and women engage in different leisure activities, possess different travel motivations and perceive differently when embarking for holiday. The study found a number of gender similarities and differences between the men and women tourists, in terms of their travel style and perceptions of importance and performance of destination attributes. These results indicate that gender may not be the only influence on behaviour and perceptions, and those men and women should not be regarded as homogenous groups.
Hewer, Micah J.; Scott, Daniel J.; Gough, William A.
2017-10-01
Parks and protected areas represent an important resource for tourism in Canada, in which camping is a common recreational activity. The important relationship between weather and climate with recreation and tourism has been widely acknowledged within the academic literature. Howbeit, the need for activity-specific assessments has been identified as an on-going need for future research in the field of tourism climatology. Furthermore, very little is known about the interrelationships between personal characteristics and socio-demographics with weather preferences and behavioural thresholds. This study uses a stated climate preferences approach (survey responses) to explore differences in the importance of weather and related weather-based decisions among summer campers in Ontario parks. Statistically significant differences were found among campers for each of the four dependent variables tested in this study. Physically active campers placed greater importance on weather but were still more tolerant of adverse weather conditions. Older campers placed greater importance on weather. Campers travelling shorter distances placed greater importance on weather and were more likely to leave the park early due to adverse weather. Campers staying for longer periods of time were less likely to leave early due to weather and were willing to endure longer durations of adverse weather conditions. Beginner campers placed greater importance on weather, were more likely to leave early due to weather and recorded lower temporal weather thresholds. The results of this study contribute to the study of tourism climatology by furthering understanding of how personal characteristics such as gender, age, activity selection, trip duration, distance travelled, travel experience and life cycles affect weather preferences and decisions, focusing this time on recreational camping in a park tourism context.
Measures of risk importance and their applications
International Nuclear Information System (INIS)
Vesely, W.E.; Davis, T.C.; Denning, R.S.; Saltos, N.
1983-07-01
This work is part of a project being conducted for the Division of Risk Analysis (DRA) of the Nuclear Regulatory Commission (NRC). The objectives of the project are to evaluate the importances of containment, the different safety functions, and other various contributers as assessed in probabilistic risk analyses and to identify generic conclusions regarding the importances. Effective display of the importances is an important part of these objectives. To address these objectives, measures of risk importance need to be first identified and then they need to be evaluated for the different risk analyses which have been performed. This report describes the risk importance measures that were defined and were applied to the risk analyses which were performed as part of the Reactor Safety Study Methodology Applications Program (RSSMAP). The risk importance measures defined in this report measure the importance of features not only with regard to risk reduction but also with regard to reliability assurance, or risk maintenance. The goal of this report is not to identify new mathematical formulas for risk importance but to show how importance measures can be interpreted and can be applied
Directory of Open Access Journals (Sweden)
Seong Hwan Park
2013-01-01
Full Text Available Identifying species of insects used to estimate postmortem interval (PMI is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science.
Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon
2013-01-01
Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044
Ling, Zhi-Qiang; Wang, Yi; Mukaisho, Kenichi; Hattori, Takanori; Tatsuta, Takeshi; Ge, Ming-Hua; Jin, Li; Mao, Wei-Min; Sugihara, Hiroyuki
2010-06-01
Tests of differentially expressed genes (DEGs) from microarray experiments are based on the null hypothesis that genes that are irrelevant to the phenotype/stimulus are expressed equally in the target and control samples. However, this strict hypothesis is not always true, as there can be several transcriptomic background differences between target and control samples, including different cell/tissue types, different cell cycle stages and different biological donors. These differences lead to increased false positives, which have little biological/medical significance. In this article, we propose a statistical framework to identify DEGs between target and control samples from expression microarray data allowing transcriptomic background differences between these samples by introducing a modified null hypothesis that the gene expression background difference is normally distributed. We use an iterative procedure to perform robust estimation of the null hypothesis and identify DEGs as outliers. We evaluated our method using our own triplicate microarray experiment, followed by validations with reverse transcription-polymerase chain reaction (RT-PCR) and on the MicroArray Quality Control dataset. The evaluations suggest that our technique (i) results in less false positive and false negative results, as measured by the degree of agreement with RT-PCR of the same samples, (ii) can be applied to different microarray platforms and results in better reproducibility as measured by the degree of DEG identification concordance both intra- and inter-platforms and (iii) can be applied efficiently with only a few microarray replicates. Based on these evaluations, we propose that this method not only identifies more reliable and biologically/medically significant DEG, but also reduces the power-cost tradeoff problem in the microarray field. Source code and binaries freely available for download at http://comonca.org.cn/fdca/resources/softwares/deg.zip.
Nakano, Angie; Honda, Jeff
2015-08-01
Forensic entomology has gained prominence in recent years, as improvements in DNA technology and molecular methods have allowed insect and other arthropod evidence to become increasingly useful in criminal and civil investigations. However, comprehensive faunal inventories are still needed, including cataloging local DNA sequences for forensically significant Diptera. This multi-year fly-trapping study was built upon and expanded a previous survey of these flies in Santa Clara County, including the addition of genetic barcoding data from collected species of flies. Flies from the families Calliphoridae, Sarcophagidae, and Muscidae were trapped in meat-baited traps set in a variety of locations throughout the county. Flies were identified using morphological features and confirmed by molecular analysis. A total of 16 calliphorid species, 11 sarcophagid species, and four muscid species were collected and differentiated. This study found more species of flies than previous area surveys and established new county records for two calliphorid species: Cynomya cadaverina and Chrysomya rufifacies. Differences were found in fly fauna in different areas of the county, indicating the importance of microclimates in the distribution of these flies. Molecular analysis supported the use of DNA barcoding as an effective method of identifying cryptic fly species. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
DEFF Research Database (Denmark)
Xu, Xun; Liu, Xin; Ge, Song
2012-01-01
Rice is a staple crop that has undergone substantial phenotypic and physiological changes during domestication. Here we resequenced the genomes of 40 cultivated accessions selected from the major groups of rice and 10 accessions of their wild progenitors (Oryza rufipogon and Oryza nivara) to >15 x...... diversity in cultivated but not wild rice, which represent candidate regions selected during domestication. Some of these variants are associated with important biological features, whereas others have yet to be functionally characterized. The molecular markers we have identified should be valuable...... raw data coverage. We investigated genome-wide variation patterns in rice and obtained 6.5 million high-quality single nucleotide polymorphisms (SNPs) after excluding sites with missing data in any accession. Using these population SNP data, we identified thousands of genes with significantly lower...
Importance of Country-of-Origin on Different Product Categories Purchase Decision
Krupka Zoran; Arežina Darija
2017-01-01
Country of origin is an important factor in product evaluation process as well as for purchase decision. Its importance depends on the amount of information consumers have about the product and product category. This paper investigates the importance of coutry of origin in purchase decision-making process for three different product categories: high risk and high level of consumer involvement in purchasing process (car), medium risk and midium level of consumer involvement in purchasing proce...
Identifying important parameters for a continuous bioscouring process
Lenting, H.B.M.; Lenting, H.B.M.; Zwier, E.; Nierstrasz, Vincent
2002-01-01
Compared to a bioscouring process in the batch mode, a continuously operating process requires relatively short processing steps. This study focusses on minimizing the required enzymatic incubation time. It is clear that the presence of a sufficient level of surfactant is of major importance in
International Nuclear Information System (INIS)
Heames, T.J.; Khatib-Rahbar, M.; Kelly, J.E.
1995-01-01
The hierarchy-by-interval (HBI) methodology was developed to determine an appropriate phenomena identification and ranking table for an independent peer review of severe-accident computer codes. The methodology is described, and the results of a specific code review are presented. Use of this systematic and structured approach ensures that important code models that need improvement are identified and prioritized, which allows code sponsors to more effectively direct limited resources in future code development. In addition, critical phenomenological areas that need more fundamental work, such as experimentation, are identified
Latent cluster analysis of ALS phenotypes identifies prognostically differing groups.
Directory of Open Access Journals (Sweden)
Jeban Ganesalingam
2009-09-01
Full Text Available Amyotrophic lateral sclerosis (ALS is a degenerative disease predominantly affecting motor neurons and manifesting as several different phenotypes. Whether these phenotypes correspond to different underlying disease processes is unknown. We used latent cluster analysis to identify groupings of clinical variables in an objective and unbiased way to improve phenotyping for clinical and research purposes.Latent class cluster analysis was applied to a large database consisting of 1467 records of people with ALS, using discrete variables which can be readily determined at the first clinic appointment. The model was tested for clinical relevance by survival analysis of the phenotypic groupings using the Kaplan-Meier method.The best model generated five distinct phenotypic classes that strongly predicted survival (p<0.0001. Eight variables were used for the latent class analysis, but a good estimate of the classification could be obtained using just two variables: site of first symptoms (bulbar or limb and time from symptom onset to diagnosis (p<0.00001.The five phenotypic classes identified using latent cluster analysis can predict prognosis. They could be used to stratify patients recruited into clinical trials and generating more homogeneous disease groups for genetic, proteomic and risk factor research.
International Nuclear Information System (INIS)
Kleijnen, J.P.C.; Helton, J.C.
1999-01-01
The robustness of procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses is investigated. These procedures are based on attempts to detect increasingly complex patterns in the scatterplots under consideration and involve the identification of (i) linear relationships with correlation coefficients, (ii) monotonic relationships with rank correlation coefficients, (iii) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (iv) trends in variability as defined by variances and interquartile ranges, and (v) deviations from randomness as defined by the chi-square statistic. The following two topics related to the robustness of these procedures are considered for a sequence of example analyses with a large model for two-phase fluid flow: the presence of Type I and Type II errors, and the stability of results obtained with independent Latin hypercube samples. Observations from analysis include: (i) Type I errors are unavoidable, (ii) Type II errors can occur when inappropriate analysis procedures are used, (iii) physical explanations should always be sought for why statistical procedures identify variables as being important, and (iv) the identification of important variables tends to be stable for independent Latin hypercube samples
DEFF Research Database (Denmark)
Leyk, Dieter; Witzki, Alexander; Sievert, Alexander
2012-01-01
The number of sedentary young adults has dramatically increased in past decades, and sedentary lifestyles are adopted at an increasingly earlier age. Little is known about barriers or predictors to (re)initiate regular physical activity in this group. The purpose of the study is to (a) identify...... subgroups in nonathletes differing in their amenability to physical exercise, (b) to analyze them for differences in barriers and intention to exercise, and (c) compare importance of sports during youth in nonathletes to trained peers. Using a health and fitness questionnaire 589 nonathletes were queried.......5%), the other groups showed significantly more barriers and a broader distribution. Similar characteristics but minor differences were observed for perceived importance of sports during youth. The most significant differences between athletes and nonathletes emerged enquiring the attitude and activity...
Frølich, Anne
2012-02-01
effect of financial incentives and public performance reporting on the behaviour of professionals and quality of care. Using secondary data, KP and the Danish health care system were compared in terms of six central dimensions: population, health care professionals, health care organisations, utilization patterns, quality measurements, and costs. Differences existed between the two systems on all dimensions, complicating the interpretation of findings. For instance, observed differences might be due to similar tendencies in the two health care systems that were observed at different times, rather than true structural differences. The expenses in the two health care systems were corrected for differences in the populations served and the purchasing power of currencies. However, no validated methods existed to correct for observed differences in case-mixes of chronic conditions. Data from a population of about half a million patients with diabetes in a large U.S. integrated health care delivery system affiliated with 41 medical centers employing 15 different CCM management practices was the basis for identifying effective management practices. Through the use of statistical modelling, the management practice of provider alerts was identified as most effective for promoting screening for hemoglobin A1c and lipid profile. The CCM was used as a framework for implementing four rehabilitation programs. The model promoted continuity of care and quality of health care services. New management practices were developed in the study, and known practices were further developed. However, the observational nature of the study limited the generalisability of the findings. In a structured literature survey focusing on the effect of financial incentives and public performance reporting on the quality of health care services, few studies documenting an effect were identified. The results varied, and important program aspects or contextual variables were often omitted. A model describing
Using reporter gene assays to identify cis regulatory differences between humans and chimpanzees.
Chabot, Adrien; Shrit, Ralla A; Blekhman, Ran; Gilad, Yoav
2007-08-01
Most phenotypic differences between human and chimpanzee are likely to result from differences in gene regulation, rather than changes to protein-coding regions. To date, however, only a handful of human-chimpanzee nucleotide differences leading to changes in gene regulation have been identified. To hone in on differences in regulatory elements between human and chimpanzee, we focused on 10 genes that were previously found to be differentially expressed between the two species. We then designed reporter gene assays for the putative human and chimpanzee promoters of the 10 genes. Of seven promoters that we found to be active in human liver cell lines, human and chimpanzee promoters had significantly different activity in four cases, three of which recapitulated the gene expression difference seen in the microarray experiment. For these three genes, we were therefore able to demonstrate that a change in cis influences expression differences between humans and chimpanzees. Moreover, using site-directed mutagenesis on one construct, the promoter for the DDA3 gene, we were able to identify three nucleotides that together lead to a cis regulatory difference between the species. High-throughput application of this approach can provide a map of regulatory element differences between humans and our close evolutionary relatives.
Importance of Country-of-Origin on Different Product Categories Purchase Decision
Directory of Open Access Journals (Sweden)
Krupka Zoran
2017-12-01
Full Text Available Country of origin is an important factor in product evaluation process as well as for purchase decision. Its importance depends on the amount of information consumers have about the product and product category. This paper investigates the importance of coutry of origin in purchase decision-making process for three different product categories: high risk and high level of consumer involvement in purchasing process (car, medium risk and midium level of consumer involvement in purchasing process (TV, and low risk and low level of consumer involvement in purchasing process (confectionery products. Also, this paper investigates importance of country of manufacturing for purchase decision-making process in relation to country of origin’s importance. Research was conducted on 215 respondents from Belgium and Republic of Croatia. Results have shown that country of origin is important only for car purchase, but not for TV and confectionery products. For all product categories, country of origin has been shown to be more important in the decision-making process than country of manufacturing.
Lence, Emilio; van der Kamp, Marc W; González-Bello, Concepción; Mulholland, Adrian J
2018-05-16
Type II dehydroquinase enzymes (DHQ2), recognized targets for antibiotic drug discovery, show significantly different activities dependent on the species: DHQ2 from Mycobacterium tuberculosis (MtDHQ2) and Helicobacter pylori (HpDHQ2) show a 50-fold difference in catalytic efficiency. Revealing the determinants of this activity difference is important for our understanding of biological catalysis and further offers the potential to contribute to tailoring specificity in drug design. Molecular dynamics simulations using a quantum mechanics/molecular mechanics potential, with correlated ab initio single point corrections, identify and quantify the subtle determinants of the experimentally observed difference in efficiency. The rate-determining step involves the formation of an enolate intermediate: more efficient stabilization of the enolate and transition state of the key step in MtDHQ2, mainly by the essential residues Tyr24 and Arg19, makes it more efficient than HpDHQ2. Further, a water molecule, which is absent in MtDHQ2 but involved in generation of the catalytic Tyr22 tyrosinate in HpDHQ2, was found to destabilize both the transition state and the enolate intermediate. The quantification of the contribution of key residues and water molecules in the rate-determining step of the mechanism also leads to improved understanding of higher potencies and specificity of known inhibitors, which should aid ongoing inhibitor design.
Enhanced finite difference scheme for the neutron diffusion equation using the importance function
International Nuclear Information System (INIS)
Vagheian, Mehran; Vosoughi, Naser; Gharib, Morteza
2016-01-01
Highlights: • An enhanced finite difference scheme for the neutron diffusion equation is proposed. • A seven-step algorithm is considered based on the importance function. • Mesh points are distributed through entire reactor core with respect to the importance function. • The results all proved that the proposed algorithm is highly efficient. - Abstract: Mesh point positions in Finite Difference Method (FDM) of discretization for the neutron diffusion equation can remarkably affect the averaged neutron fluxes as well as the effective multiplication factor. In this study, by aid of improving the mesh point positions, an enhanced finite difference scheme for the neutron diffusion equation is proposed based on the neutron importance function. In order to determine the neutron importance function, the adjoint (backward) neutron diffusion calculations are performed in the same procedure as for the forward calculations. Considering the neutron importance function, the mesh points can be improved through the entire reactor core. Accordingly, in regions with greater neutron importance, density of mesh elements is higher than that in regions with less importance. The forward calculations are then performed for both of the uniform and improved non-uniform mesh point distributions and the results (the neutron fluxes along with the corresponding eigenvalues) for the two cases are compared with each other. The results are benchmarked against the reference values (with fine meshes) for Kang and Rod Bundle BWR benchmark problems. These benchmark cases revealed that the improved non-uniform mesh point distribution is highly efficient.
Directory of Open Access Journals (Sweden)
Rachmi Rida Utami
2013-12-01
Full Text Available Todays situations force telecomunication company to continuously evaluate, select and prioritize its product portfolio in order to determine the strategically important products. An analysis of critical success factors that determine product’s strategic importance acts as a good introduction to review and manage the product portfolio as well as to seek ways to develop the product. To achieve this, the company is required to have good alliances and collaborations between departments, develop a clear focus and seek innovative ways of doing business, particularly between marketing and product divisions. This study analyzed the alignment between product and marketing divisions of a telecommunication company in Indonesia, in determining the company’s strategic products. The results indicated that both divisions agreed on using financial performance and revenue as the most important criteria and sub-criteria for identifying strategic product. However, the divisions also faced some different visions in selecting alternative criteria. The Product divisions were more focused on technical spesification of product, while the Marketing division were more oriented on customer and market conditions. The study reported the consequences of these difference in practice.
Xie, Dongwei; Dai, Zhigang; Yang, Zemao; Sun, Jian; Zhao, Debao; Yang, Xue; Zhang, Liguo; Tang, Qing; Su, Jianguang
2017-01-01
Flax ( Linum usitatissimum L.) is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq) was employed to perform a genome-wide association study (GWAS) for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP) loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM) and a mixed linear model (MLM) as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.
Directory of Open Access Journals (Sweden)
Dongwei Xie
2018-01-01
Full Text Available Flax (Linum usitatissimum L. is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq was employed to perform a genome-wide association study (GWAS for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM and a mixed linear model (MLM as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.
Chen, Lin; Zhu, Zhe; Gao, Wei; Jiang, Qixin; Yu, Jiangming; Fu, Chuangang
2017-09-05
Insulin-like growth factor 1 receptor (IGF-1R) is proved to contribute the development of many types of cancers. But, little is known about its roles in radio-resistance of colorectal cancer (CRC). Here, we demonstrated that low IGF-1R expression value was associated with the better radiotherapy sensitivity of CRC. Besides, through Quantitative Real-time PCR (qRT-PCR), the elevated expression value of epidermal growth factor receptor (EGFR) was observed in CRC cell lines (HT29, RKO) with high radio-sensitivity compared with those with low sensitivity (SW480, LOVO). The irradiation induced apoptosis rates of wild type and EGFR agonist (EGF) or IGF-1R inhibitor (NVP-ADW742) treated HT29 and SW480 cells were quantified by flow cytometry. As a result, the apoptosis rate of EGF and NVP-ADW742 treated HT29 cells was significantly higher than that of those wild type ones, which indicated that high EGFR and low IGF-1R expression level in CRC was associated with the high sensitivity to radiotherapy. We next conducted systemic bioinformatics analysis of genome-wide expression profiles of CRC samples from the Cancer Genome Atlas (TCGA). Differential expression analysis between IGF-1R and EGFR abnormal CRC samples, i.e. CRC samples with higher IGF-1R and lower EGFR expression levels based on their median expression values, and the rest of CRC samples identified potential genes contribute to radiotherapy sensitivity. Functional enrichment of analysis of those differential expression genes (DEGs) in the Database for Annotation, Visualization and Integrated Discovery (DAVID) indicated PPAR signaling pathway as an important pathway for the radio-resistance of CRC. Our study identified the potential biomarkers for the rational selection of radiotherapy for CRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.
Efficiency of different techniques to identify changes in land use
Zornoza, Raúl; Mateix-Solera, Jorge; Gerrero, César
2013-04-01
The need for the development of sensitive and efficient methodologies for soil quality evaluation is increasing. The ability to assess soil quality and identify key soil properties that serve as indicators of soil function is complicated by the multiplicity of physical, chemical and biological factors that control soil processes. In the mountain region of the Mediterranean Basin of Spain, almond trees have been cultivated in terraced orchards for centuries. These crops are immersed in the Mediterranean forest scenery, configuring a mosaic landscape where orchards are integrated in the forest masses. In the last decades, almond orchards are being abandoned, leading to an increase in vegetation cover, since abandoned fields are naturally colonized by the surrounded natural vegetation. Soil processes and properties are expected to be associated with vegetation successional dynamics. Thus, the establishment of suitable parameters to monitor soil quality related to land use changes is particularly important to guarantee the regeneration of the mature community. In this study, we selected three land uses, constituted by forest, almond trees orchards, and orchards abandoned between 10 and 15 years previously to sampling. Sampling was carried out in four different locations in SE Spain. The main purpose was to evaluate if changes in management have significantly influenced different sets of soil characteristics. For this purpose, we used a discriminant analysis (DA). The different sets of soil characteristics tested in this study were 1: physical, chemical and biochemical properties; 2: soil near infrared (NIR) spectra; and 3: phospholipid fatty acids (PLFAs). After the DA performed with the sets 1 and 2, the three land uses were clearly separated by the two first discriminant functions, and more than 85 % of the samples were correctly classified (grouped). Using the sets 3 and 4 for DA resulted in a slightly better separation of land uses, being more than 85% of the
Quality of Life After Cardiac Surgery Based on the Minimal Clinically Important Difference Concept.
Grand, Nathalie; Bouchet, Jean Baptiste; Zufferey, Paul; Beraud, Anne Marie; Awad, Sahar; Sandri, Fabricio; Campisi, Salvator; Fuzellier, Jean François; Molliex, Serge; Vola, Marco; Morel, Jerome
2018-03-23
Health-related quality of life (HRQOL) is an increasingly important issue in assessing the consequences of any surgical or medical intervention. Our study aimed to evaluate change in HRQOL 6 months after elective cardiac surgery and to identify specific predictors of poor HRQOL. In this prospective, single-center study, HRQOL was evaluated before and 6 months after surgery using the SF-36 questionnaire and its two components: the physical component summary (PCS) and the mental component summary (MCS). We distinguished patients with worsening of HRQOL according to the minimal clinically important difference. All consecutive adult patients undergoing cardiac surgery were included. 326 patients completed the preoperative and postoperative SF-36 questionnaires and 24 patients died before completing follow-up questionnaires. Based on the definition used, clinically significant deterioration of HRQOL was observed in 93 patients (26.6%) for PCS and 99 patients (28.2%) for MCS. Renal replacement for acute renal failure and mechanical ventilation for longer than 48 hours were independent risk factors for PCS and MCS worsening or death. Although our study showed overall improvement of QOL after cardiac surgery, over a quarter of the patients manifested deterioration of HRQOL at 6 months post-surgery. The findings from this study should help clinicians to inform patients about their likely postoperative functional status and quality of life. Copyright © 2018. Published by Elsevier Inc.
Identifying Controlling Nodes in Neuronal Networks in Different Scales
Tang, Yang; Gao, Huijun; Zou, Wei; Kurths, Jürgen
2012-01-01
Recent studies have detected hubs in neuronal networks using degree, betweenness centrality, motif and synchronization and revealed the importance of hubs in their structural and functional roles. In addition, the analysis of complex networks in different scales are widely used in physics community. This can provide detailed insights into the intrinsic properties of networks. In this study, we focus on the identification of controlling regions in cortical networks of cats’ brain in microscopic, mesoscopic and macroscopic scales, based on single-objective evolutionary computation methods. The problem is investigated by considering two measures of controllability separately. The impact of the number of driver nodes on controllability is revealed and the properties of controlling nodes are shown in a statistical way. Our results show that the statistical properties of the controlling nodes display a concave or convex shape with an increase of the allowed number of controlling nodes, revealing a transition in choosing driver nodes from the areas with a large degree to the areas with a low degree. Interestingly, the community Auditory in cats’ brain, which has sparse connections with other communities, plays an important role in controlling the neuronal networks. PMID:22848475
2012-11-07
...] Minimum Clinically Important Difference: An Outcome Metric in Orthopaedic Device Science and Regulation... Clinically Important Difference: An Outcome Metric in Orthopaedic Device Science and Regulation.'' FDA is co... (MCID) for patient-reported outcome (PRO) instruments used in orthopaedic extremity device-related...
Atrioventricular depolarization differences identify coronary artery anomalies in Kawasaki disease.
Cortez, Daniel; Sharma, Nandita; Jone, Pei-Ni
2017-03-01
Kawasaki disease (KD) is the leading cause of acquired heart disease in children. Signal average electrocardiogram changes in patients during the acute phase of KD with coronary artery anomalies (CAA) include depolarization changes. We set out to determine if 12-lead-derived atrioventricular depolarization differences can identify CAA in patients with KD. A blinded, retrospective case-control study of patients with KD was performed. Deep Q waves, corrected QT-intervals (QTc), spatial QRS-T angles, T-wave vector magnitudes (RMS-T), and a novel parameter for assessment of atrioventricular depolarization difference (the spatial PR angle) and a two dimensional PR angle were assessed. Comparisons between groups were performed to test for significant differences. One hundred one patients with KD were evaluated, with 68 having CAA (67.3%, mean age 3.6 ± 3.0 years, 82.6% male), and 32 without CAA (31.7%, mean age 2.7 ± 3.2 years, 70.4% male). The spatial PR angle significantly discriminated KD patients with CAA from those without, 59.7° ± 31.1° versus 41.6° ± 11.5° (p differences, measured by the spatial or two dimensional PR angle differentiate KD patients with CAA versus those without. © 2016 Wiley Periodicals, Inc.
Lowther, Chelsea; Speevak, Marsha; Armour, Christine M.; Goh, Elaine S.; Graham, Gail E.; Li, Chumei; Zeesman, Susan; Nowaczyk, Malgorzata J.M.; Schultz, Lee-Anne; Morra, Antonella; Nicolson, Rob; Bikangaga, Peter; Samdup, Dawa; Zaazou, Mostafa; Boyd, Kerry; Jung, Jack H.; Siu, Victoria; Rajguru, Manjulata; Goobie, Sharan; Tarnopolsky, Mark A.; Prasad, Chitra; Dick, Paul T.; Hussain, Asmaa S.; Walinga, Margreet; Reijenga, Renske G.; Gazzellone, Matthew; Lionel, Anath C.; Marshall, Christian R.; Scherer, Stephen W.; Stavropoulos, Dimitri J.; McCready, Elizabeth; Bassett, Anne S.
2016-01-01
Purpose The purpose of the current study was to assess the penetrance of NRXN1 deletions. Methods We compared the prevalence and genomic extent of NRXN1 deletions identified among 19,263 clinically referred cases to that of 15,264 controls. The burden of additional clinically relevant CNVs was used as a proxy to estimate the relative penetrance of NRXN1 deletions. Results We identified 41 (0.21%) previously unreported exonic NRXN1 deletions ascertained for developmental delay/intellectual disability, significantly greater than in controls [OR=8.14 (95% CI 2.91–22.72), p< 0.0001)]. Ten (22.7%) of these had a second clinically relevant CNV. Subjects with a deletion near the 3′ end of NRXN1 were significantly more likely to have a second rare CNV than subjects with a 5′ NRXN1 deletion [OR=7.47 (95% CI 2.36–23.61), p=0.0006]. The prevalence of intronic NRXN1 deletions was not statistically different between cases and controls (p=0.618). The majority (63.2%) of intronic NRXN1 deletion cases had a second rare CNV, a two-fold greater prevalence than for exonic NRXN1 deletion cases (p=0.0035). Conclusions The results support the importance of exons near the 5′ end of NRXN1 in the expression of neurodevelopmental disorders. Intronic NRXN1 deletions do not appear to substantially increase the risk for clinical phenotypes. PMID:27195815
Dawes, Molly; Chen, Chin-Chih; Farmer, Thomas W; Hamm, Jill V
2017-11-01
Patterns of adjustment for youth victimized by peers vary depending on whether youth are identified as victims through self-reports, peer-reports, or both. In order to provide more targeted strategies that may help mitigate negative consequences associated with specific victimization groups, more information is needed about how these youth perceive their school ecology (bullying and academic ecology), their feelings of school belonging, and their valuing of school. Based on the convergence of self- and peer-reports of victimization, we identified four victim groups from a sample of students in 5th grade classrooms (N = 1360; 52.8% girls, 53.1% White, 34.6% Black or Hispanic, 12.2% Native American, Asian, or other) using Latent Profile Analysis (LPA): convergent victims (high self- and peer-reports), self-identified victims (high self-, low peer-reports), peer-identified victims (low self-, high peer-reports), and nonvictims (low self- and peer-reports). Convergent victims' perceptions were similar to nonvictims with key differences being convergent victims' greater willingness to protect peers being bullied but lower feelings of school belonging compared to nonvictims. Peer-identified and self-identified victims perceived differences in the bullying and academic ecology including peer-identified victims' greater willingness to protect peers and expectations for more peers to encourage bulling against them compared to self-identified victims. However, both peer- and self-identified victims perceived greater emotional risk of participating in class and had lower feelings of school belonging compared to nonvictims. Implications for supporting youth with divergent self- and peer-reported victimization status as they transition to middle school are discussed.
Santaguida, Pasqualina; Oremus, Mark; Walker, Kathryn; Wishart, Laurie R; Siegel, Karen Lohmann; Raina, Parminder
2012-04-01
A "review of reviews" was undertaken to assess methodological issues in studies evaluating nondrug rehabilitation interventions in stroke patients. MEDLINE, CINAHL, PsycINFO, and the Cochrane Database of Systematic Reviews were searched from January 2000 to January 2008 within the stroke rehabilitation setting. Electronic searches were supplemented by reviews of reference lists and citations identified by experts. Eligible studies were systematic reviews; excluded citations were narrative reviews or reviews of reviews. Review characteristics and criteria for assessing methodological quality of primary studies within them were extracted. The search yielded 949 English-language citations. We included a final set of 38 systematic reviews. Cochrane reviews, which have a standardized methodology, were generally of higher methodological quality than non-Cochrane reviews. Most systematic reviews used standardized quality assessment criteria for primary studies, but not all were comprehensive. Reviews showed that primary studies had problems with randomization, allocation concealment, and blinding. Baseline comparability, adverse events, and co-intervention or contamination were not consistently assessed. Blinding of patients and providers was often not feasible and was not evaluated as a source of bias. The eligible systematic reviews identified important methodological flaws in the evaluated primary studies, suggesting the need for improvement of research methods and reporting. Copyright © 2012 Elsevier Inc. All rights reserved.
The relative importance of different perceptual-cognitive skills during anticipation.
North, Jamie S; Hope, Ed; Williams, A Mark
2016-10-01
We examined whether anticipation is underpinned by perceiving structured patterns or postural cues and whether the relative importance of these processes varied as a function of task constraints. Skilled and less-skilled soccer players completed anticipation paradigms in video-film and point light display (PLD) format. Skilled players anticipated more accurately regardless of display condition, indicating that both perception of structured patterns between players and postural cues contribute to anticipation. However, the Skill×Display interaction showed skilled players' advantage was enhanced in the video-film condition, suggesting that they make better use of postural cues when available during anticipation. We also examined anticipation as a function of proximity to the ball. When participants were near the ball, anticipation was more accurate for video-film than PLD clips, whereas when the ball was far away there was no difference between viewing conditions. Perceiving advance postural cues appears more important than structured patterns when the ball is closer to the observer, whereas the reverse is true when the ball is far away. Various perceptual-cognitive skills contribute to anticipation with the relative importance of perceiving structured patterns and advance postural cues being determined by task constraints and the availability of perceptual information. Copyright © 2016 Elsevier B.V. All rights reserved.
Anderson, Jonathan P.; Hane, James K.; Stoll, Thomas; Pain, Nicholas; Hastie, Marcus L.; Kaur, Parwinder; Hoogland, Christine; Gorman, Jeffrey J.; Singh, Karam B.
2016-01-01
Rhizoctonia solani is an important root infecting pathogen of a range of food staples worldwide including wheat, rice, maize, soybean, potato and others. Conventional resistance breeding strategies are hindered by the absence of tractable genetic resistance in any crop host. Understanding the biology and pathogenicity mechanisms of this fungus is important for addressing these disease issues, however, little is known about how R. solani causes disease. This study capitalizes on recent genomic studies by applying mass spectrometry based proteomics to identify soluble, membrane-bound and culture filtrate proteins produced under wheat infection and vegetative growth conditions. Many of the proteins found in the culture filtrate had predicted functions relating to modification of the plant cell wall, a major activity required for pathogenesis on the plant host, including a number found only under infection conditions. Other infection related proteins included a high proportion of proteins with redox associated functions and many novel proteins without functional classification. The majority of infection only proteins tested were confirmed to show transcript up-regulation during infection including a thaumatin which increased susceptibility to R. solani when expressed in Nicotiana benthamiana. In addition, analysis of expression during infection of different plant hosts highlighted how the infection strategy of this broad host range pathogen can be adapted to the particular host being encountered. Data are available via ProteomeXchange with identifier PXD002806. PMID:26811357
Estrada-Gómez, Sebastian; Vargas-Muñoz, Leidy Johana; Saldarriaga-Córdoba, Mónica; Cifuentes, Yeimy; Perafan, Carlos
2017-04-01
Theraphosidae spider venoms are well known for possess a complex mixture of protein and non-protein compounds in their venom. The objective of this study was to report and identify different proteins translated from the venom gland DNA information of the recently described Theraphosidae spider Pamphobeteus verdolaga. Using a venom gland transcriptomic analysis, we reported a set of the first complete sequences of seven different proteins of the recenlty described Theraphosidae spider P. verdolaga. Protein analysis indicates the presence of different proteins on the venom composition of this new spider, some of them uncommon in the Theraphosidae family. MS/MS analysis of P. verdolaga showed different fragments matching sphingomyelinases (sicaritoxin), barytoxins, hexatoxins, latroinsectotoxins, and linear (zadotoxins) peptides. Only four of the MS/MS fragments showed 100% sequence similarity with one of the transcribed proteins. Transcriptomic analysis showed the presence of different groups of proteins like phospholipases, hyaluronidases, inhibitory cysteine knots (ICK) peptides among others. The three database of protein domains used in this study (Pfam, SMART and CDD) showed congruency in the search of unique conserved protein domain for only four of the translated proteins. Those proteins matched with EF-hand proteins, cysteine rich secretory proteins, jingzhaotoxins, theraphotoxins and hexatoxins, from different Mygalomorphae spiders belonging to the families Theraphosidae, Barychelidae and Hexathelidae. None of the analyzed sequences showed a complete 100% similarity. Copyright © 2017 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Pejtersen, Jan Hyld; Bjorner, Jakob Bue; Hasle, Peter
2010-01-01
AIM: To determine minimally important differences (MIDs) for scales in the first version of the Copenhagen Psychosocial Questionnaire (COPSOQ). METHODS: Data were taken from two separate studies: a national population survey (N = 1062), and an intervention study at 14 workplaces (N = 1505). On th...
Directory of Open Access Journals (Sweden)
Nicoline Ondari-Okemwa
2011-01-01
Full Text Available This article discusses the strategic importance of identifying intangible assets for creating value and enhancing competitiveness and innovation in science and technology in a knowledge economy with particular reference to the sub- Saharan Africa region. It has always been difficult to gather the prerequisite information to manage such assets and create value from them. The paper discusses the nature of intangible assets, the characteristics of a knowledge economy and the role of knowledge workers in a knowledge economy. The paper also discusses the importance of identifying intangible assets in relation to capturing the value of such assets, the transfer of intangible assets to other owners and the challenges of managing organizational intangible assets. Objectives of the article include: underscoring the strategic importance of identifying intangible assets in sub-Saharan Africa; examining the performance of intangible assets in a knowledge economy; how intangible assets may generate competitiveness, economic growth and innovation; and assess how knowledge workers are becoming a dominant factor in the knowledge economy. An extensive literature review was employed to collect data for this article. It is concluded in the article that organizations and governments in sub-Saharan Africa should look at knowledge-based assets as strategic resources, even though the traditional accounting systems may still be having problems in determining the exact book value of such assets. It is recommended that organizations and government departments in sub-Saharan Africa should implement a system of the reporting of the value of intangible organizational assets just like the reporting of the value of tangible assets; and that organizations in sub-Saharan Africa should use knowledge to produce “smart products and services” which command premium prices.
Yin, Linda X; Reh, Douglas D; Hoag, Jeffrey B; Mitchell, Sally E; Mathai, Stephen C; Robinson, Gina M; Merlo, Christian A
2016-05-01
Hereditary hemorrhagic telangiectasia (HHT) is a disease of abnormal angiogenesis, causing epistaxis in over 96% of patients. The Epistaxis Severity Score (ESS) was developed as a standardized measurement of nasal symptoms among HHT patients. The minimal important difference (MID) of a disease index estimates the smallest change that a patient and clinician would identify as important. This study aims to establish the MID of the ESS in a diverse population of HHT patients. Retrospective cross-sectional study in patients with a diagnosis of HHT using Curacao criteria or genetic testing. The ESS questionnaire and Medical Outcomes Study 36-Item Short Form (SF-36) were administered to participants recruited through the HHT Foundation Web site. Demographics and relevant medical histories were collected from all participants. An anchor-based method using a change of 5 in the Physical Component Summary (PCS) of the SF-36 and a distributional method were used to estimate the MID. A total of 604 subjects were recruited between April and August 2008. All participants reported epistaxis. An increasing ESS in the study cohort showed a significant negative correlation to the PCS (r = -0.43, P < 0.001). The MID was determined to be 0.41 via the anchor-based approach and 1.01 via the distribution-based approach, giving a mean MID of 0.71. Using both the anchor-based and distribution-based approaches, the estimated MID for the ESS in HHT is 0.71. Further implications include key metrics to help guide treatment responses in clinical care and essential information to calculate power and sample size for future clinical trials. 4. Laryngoscope, 126:1029-1032, 2016. © 2015 The American Laryngological, Rhinological and Otological Society, Inc.
Who Sees Human? The Stability and Importance of Individual Differences in Anthropomorphism.
Waytz, Adam; Cacioppo, John; Epley, Nicholas
2010-05-01
Anthropomorphism is a far-reaching phenomenon that incorporates ideas from social psychology, cognitive psychology, developmental psychology, and the neurosciences. Although commonly considered to be a relatively universal phenomenon with only limited importance in modern industrialized societies-more cute than critical-our research suggests precisely the opposite. In particular, we provide a measure of stable individual differences in anthropomorphism that predicts three important consequences for everyday life. This research demonstrates that individual differences in anthropomorphism predict the degree of moral care and concern afforded to an agent, the amount of responsibility and trust placed on an agent, and the extent to which an agent serves as a source of social influence on the self. These consequences have implications for disciplines outside of psychology including human-computer interaction, business (marketing and finance), and law. Concluding discussion addresses how understanding anthropomorphism not only informs the burgeoning study of nonpersons, but how it informs classic issues underlying person perception as well. © The Author(s) 2010.
Kubat, Ulas
2018-01-01
It is important for teachers to know variables such as physical characteristics, intelligence, perception, gender, ability, learning styles, which are individual differences of the learners. An effective and productive learning-teaching process can be planned by considering these individual differences of the students. Since the learners' own…
Determining Minimal Clinically Important Differences in Japanese Cedar/Cypress Pollinosis Patients
Takaya Higaki; Mitsuhiro Okano; Shin Kariya; Tazuko Fujiwara; Takenori Haruna; Haruka Hirai; Aya Murai; Minoru Gotoh; Kimihiro Okubo; Shuji Yonekura; Yoshitaka Okamoto; Kazunori Nishizaki
2013-01-01
Background: Statistically significant results of medical intervention trials are not always clinically meaningful. We sought to estimate the minimal clinically important difference (MCID) (the smallest change in a given endpoint that is meaningful to a patient) during seasonal alteration of Japanese cedar/cypress pollinosis (JCCP). Methods: Results of a double-blinded, placebo-controlled trial of JCCP patients conducted between 2008 and 2010 were analyzed using an anchor-based method in wh...
Murat, Claude; Zampieri, Elisa; Vallino, Marta; Daghino, Stefania; Perotto, Silvia; Bonfante, Paola
2011-05-01
Characterization of genomic variation among different microbial species, or different strains of the same species, is a field of significant interest with a wide range of potential applications. We have investigated the genomic variation in mycorrhizal fungal genomes through genomic suppressive subtractive hybridization. The comparison was between phylogenetically distant and close truffle species (Tuber spp.), and between isolates of the ericoid mycorrhizal fungus Oidiodendron maius featuring different degrees of metal tolerance. In the interspecies experiment, almost all the sequences that were identified in the Tuber melanosporum genome and absent in Tuber borchii and Tuber indicum corresponded to transposable elements. In the intraspecies comparison, some specific sequences corresponded to regions coding for enzymes, among them a glutathione synthetase known to be involved in metal tolerance. This approach is a quick and rather inexpensive tool to develop molecular markers for mycorrhizal fungi tracking and barcoding, to identify functional genes and to investigate the genome plasticity, adaptation and evolution. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Identifying public expectations of genetic biobanks.
Critchley, Christine; Nicol, Dianne; McWhirter, Rebekah
2017-08-01
Understanding public priorities for biobanks is vital for maximising utility and efficiency of genetic research and maintaining respect for donors. This research directly assessed the relative importance the public place on different expectations of biobanks. Quantitative and qualitative results from a national sample of 800 Australians revealed that the majority attributed more importance to protecting privacy and ethical conduct than maximising new healthcare benefits, which was in turn viewed as more important than obtaining specific consent, benefit sharing, collaborating and sharing data. A latent class analysis identified two distinct classes displaying different patterns of expectations. One placed higher priority on behaviours that respect the donor ( n = 623), the other on accelerating science ( n = 278). Additional expectations derived from qualitative data included the need for biobanks to be transparent and to prioritise their research focus, educate the public and address commercialisation.
Approaches for estimating minimal clinically important differences in systemic lupus erythematosus.
Rai, Sharan K; Yazdany, Jinoos; Fortin, Paul R; Aviña-Zubieta, J Antonio
2015-06-03
A minimal clinically important difference (MCID) is an important concept used to determine whether a medical intervention improves perceived outcomes in patients. Prior to the introduction of the concept in 1989, studies focused primarily on statistical significance. As most recent clinical trials in systemic lupus erythematosus (SLE) have failed to show significant effects, determining a clinically relevant threshold for outcome scores (that is, the MCID) of existing instruments may be critical for conducting and interpreting meaningful clinical trials as well as for facilitating the establishment of treatment recommendations for patients. To that effect, methods to determine the MCID can be divided into two well-defined categories: distribution-based and anchor-based approaches. Distribution-based approaches are based on statistical characteristics of the obtained samples. There are various methods within the distribution-based approach, including the standard error of measurement, the standard deviation, the effect size, the minimal detectable change, the reliable change index, and the standardized response mean. Anchor-based approaches compare the change in a patient-reported outcome to a second, external measure of change (that is, one that is more clearly understood, such as a global assessment), which serves as the anchor. Finally, the Delphi technique can be applied as an adjunct to defining a clinically important difference. Despite an abundance of methods reported in the literature, little work in MCID estimation has been done in the context of SLE. As the MCID can help determine the effect of a given therapy on a patient and add meaning to statistical inferences made in clinical research, we believe there ought to be renewed focus on this area. Here, we provide an update on the use of MCIDs in clinical research, review some of the work done in this area in SLE, and propose an agenda for future research.
Haerens, L.; Vansteenkiste, M.; De Meester, A.; Delrue, J.; Tallir, I.; Vande Broek, G.; Goris, W.; Aelterman, N.
2018-01-01
Background: According to Self-Determination Theory, teachers and sport coaches can differ in the motivating style they rely upon to motivate young people. When endorsing an autonomy-supportive motivating style, instructors try to identify, vitalize, and nurture youngsters' inner motivational resources. In contrast, instructors with a dominant…
Directory of Open Access Journals (Sweden)
Teresa A. Newsome
2012-01-01
Full Text Available Critical height ratios for predicting competition between trembling aspen and lodgepole pine were identified in six juvenile stands in three south-central British Columbia ecosystems. We used a series of regression analyses predicting pine stem diameter from the density of neighbouring aspen in successively shorter relative height classes to identify the aspen-pine height ratio that maximized R2. Critical height ratios varied widely among sites when stands were 8–12 years old but, by age 14–19, had converged at 1.25–1.5. Maximum R2 values at age 14–19 ranged from 13.4% to 69.8%, demonstrating that the importance of aspen competition varied widely across a relatively small geographic range. Logistic regression also indicated that the risk of poor pine vigour in the presence of aspen varied between sites. Generally, the degree of competition, risk to pine vigour, and size of individual aspen contributing to the models declined along a gradient of decreasing ecosystem productivity.
Grissom, Jason A.; Loeb, Susanna
2009-01-01
While the importance of effective principals is undisputed, few studies have addressed what specific skills principals need to promote school success. This study draws on unique data combining survey responses from principals, assistant principals, teachers and parents with rich administrative data to identify which principal skills matter most…
Brinker, Monika; Brosché, Mikael; Vinocur, Basia; Abo-Ogiala, Atef; Fayyaz, Payam; Janz, Dennis; Ottow, Eric A; Cullmann, Andreas D; Saborowski, Joachim; Kangasjärvi, Jaakko; Altman, Arie; Polle, Andrea
2010-12-01
To investigate early salt acclimation mechanisms in a salt-tolerant poplar species (Populus euphratica), the kinetics of molecular, metabolic, and physiological changes during a 24-h salt exposure were measured. Three distinct phases of salt stress were identified by analyses of the osmotic pressure and the shoot water potential: dehydration, salt accumulation, and osmotic restoration associated with ionic stress. The duration and intensity of these phases differed between leaves and roots. Transcriptome analysis using P. euphratica-specific microarrays revealed clusters of coexpressed genes in these phases, with only 3% overlapping salt-responsive genes in leaves and roots. Acclimation of cellular metabolism to high salt concentrations involved remodeling of amino acid and protein biosynthesis and increased expression of molecular chaperones (dehydrins, osmotin). Leaves suffered initially from dehydration, which resulted in changes in transcript levels of mitochondrial and photosynthetic genes, indicating adjustment of energy metabolism. Initially, decreases in stress-related genes were found, whereas increases occurred only when leaves had restored the osmotic balance by salt accumulation. Comparative in silico analysis of the poplar stress regulon with Arabidopsis (Arabidopsis thaliana) orthologs was used as a strategy to reduce the number of candidate genes for functional analysis. Analysis of Arabidopsis knockout lines identified a lipocalin-like gene (AtTIL) and a gene encoding a protein with previously unknown functions (AtSIS) to play roles in salt tolerance. In conclusion, by dissecting the stress transcriptome of tolerant species, novel genes important for salt endurance can be identified.
Robert L. Deal; Crystal Raymond; David L. Peterson; Cindy. Glick
2010-01-01
There are a number of misunderstandings about âecosystem servicesâ and âclimate changeâ and these terms are often used incorrectly to describe different concepts. These concepts address different issues and objectives but have some important integrating themes relating to carbon and carbon sequestration. In this paper, we provide definitions and distinctions between...
Development of a non-destructive method to identify different grades of stainless steel
International Nuclear Information System (INIS)
Meor Yusoff Meor Sulaiman
2004-01-01
One of the non-destructive methods used for the identification and verification of metals is by the energy-dispersive x-ray fluorescence (EDXRF) technique. EDXRF analysis provides several important advantages such as simultaneous determination of the elements present, enable to analyze a very wide concentration range, fast analysis with no tedious sample preparation. The paper shows how this technique is developed and applied in the identification and verification of different grades of stainless steels. Comparison of the results obtained from this analysis with certified reference standards show very small differences between them. (Author)
Yang, Yongxin; Zheng, Nan; Zhao, Xiaowei; Zhang, Yangdong; Han, Rongwei; Yang, Jinhui; Zhao, Shengguo; Li, Songli; Guo, Tongjun; Zang, Changjiang; Wang, Jiaqi
2016-03-16
Several milk metabolites are associated with breeds or species of dairy animals. A better understanding of milk metabolites from different dairy animals would advance their use in evaluating milk traits and detecting milk adulteration. The objective of this study was to characterize the milk metabolite profiles of Chinese Holstein, Jersey, yak, buffalo, goat, camel, and horse and identify any differences using non-targeted metabolomic approaches. Milk samples were tested using nuclear magnetic resonance (NMR) spectroscopy and liquid chromatography-tandem mass spectrometry (LC-MS). Data were analyzed using a multivariate analysis of variance and differences in milk metabolites between Holstein and the other dairy animals were assessed using orthogonal partial least-squares discriminant analysis. Differential metabolites were identified and some metabolites, such as choline and succinic acid, were used to distinguish Holstein milk from that of the other studied animals. Metabolic pathway analysis of different metabolites revealed that glycerophospholipid metabolism as well as valine, leucine, and isoleucine biosynthesis were shared in the other ruminant animals (Jersey, buffalo, yak, and goat), and biosynthesis of unsaturated fatty acids was shared in the non-ruminant animals (camel and horse). These results can be useful for gaining a better understanding of the differences in milk synthesis between Holstein and the other dairy animals. Copyright © 2016. Published by Elsevier B.V.
Cahill, Daniel J.; Sias, Patricia M.
1997-01-01
Investigates gender differences and similarities in the perceived social costs and importance of seeking emotional support regarding work-related problems. Finds women perceived such support to be more important than did men. Finds no gender differences regarding perceived social costs associated with seeking support from coworkers. Finds women…
Differences between insurance organizations: do consumers perceive differences in important areas?
Delnoij, D.M.J.; Hendriks, M.; Brouwer, W.; Spreeuwenberg, P.
2006-01-01
Background: Competition on the insurance market assumes that insurance organizations differ in what they offer, that the consumers of insurance products perceive differences, and that information about differences is available in a transparent way. With the introduction of the insurance reform in
What's the difference? Insider perspectives on the importance of interpersonal differences
Oosterhof, A.; Oosterhof, Aad; van der Vegt, Gerben S.; van de Vliert, Evert; Sanders, Karin; Kiers, Henk A.L.
2009-01-01
This study presents a new approach to examine how team members experience interpersonal differences. This approach offers a way to examine how team members experience their differences with specific other individuals, and how these differences are related to the amount of perceived conflict with
Molzahn, Anita E; Kalfoss, Mary; Schick Makaroff, Kara; Skevington, Suzanne M
2011-03-01
there is limited research examining the relative importance of aspects of quality of life (QOL) to older adults across cultures. to examine the relative importance of 31 internationally agreed areas of QOL to older adults in 22 countries in relation to health status, age and level of economic development. a survey quota sampling design was used to collect cross-cultural data. This study reports a secondary analysis of WHOQOL-OLD pilot study, which was collected simultaneously in 22 centres. a variety of community, primary, secondary and tertiary health care settings located in Australia, France, Switzerland, England, Scotland, USA, Israel, Spain, Japan, China (mainland and Hong Kong), Turkey, Lithuania, Czech Republic, Hungary, Canada, Norway, Sweden, Denmark, Germany, Brazil and Uruguay. the total sample contained 7,401 people over 60 years with a mean age of 73.1 years; 57.8% were women and 70.1% considered themselves 'healthy'. there were significant differences in the importance given to various aspects of QOL for people living in medium and high-development countries. Culture explained 15.9% of the variance in the importance ratings of QOL. However, the interaction showed that cultural differences were reduced once health status, gender and age were taken into account. The importance of QOL to age bands in different cultures was not significantly affected by whether or not participants perceived themselves to be healthy. understanding the self-reported importance of diverse aspects of QOL for different cultures and for healthy and less healthy people may assist national and international policy makers to decide on priorities for the development of programmes for the ageing population.
Maifiah, Mohd Hafidz Mahamad; Cheah, Soon-Ee; Johnson, Matthew D; Han, Mei-Ling; Boyce, John D; Thamlikitkul, Visanu; Forrest, Alan; Kaye, Keith S; Hertzog, Paul; Purcell, Anthony W; Song, Jiangning; Velkov, Tony; Creek, Darren J; Li, Jian
2016-02-29
Multidrug-resistant Acinetobacter baumannii presents a global medical crisis and polymyxins are used as the last-line therapy. This study aimed to identify metabolic differences between polymyxin-susceptible and polymyxin-resistant A. baumannii using untargeted metabolomics. The metabolome of each A. baumannii strain was measured using liquid chromatography-mass spectrometry. Multivariate and univariate statistics and pathway analyses were employed to elucidate metabolic differences between the polymyxin-susceptible and -resistant A. baumannii strains. Significant differences were identified between the metabolic profiles of the polymyxin-susceptible and -resistant A. baumannii strains. The lipopolysaccharide (LPS) deficient, polymyxin-resistant 19606R showed perturbation in specific amino acid and carbohydrate metabolites, particularly pentose phosphate pathway (PPP) and tricarboxylic acid (TCA) cycle intermediates. Levels of nucleotides were lower in the LPS-deficient 19606R. Furthermore, 19606R exhibited a shift in its glycerophospholipid profile towards increased abundance of short-chain lipids compared to the parent polymyxin-susceptible ATCC 19606. In contrast, in a pair of clinical isolates 03-149.1 (polymyxin-susceptible) and 03-149.2 (polymyxin-resistant, due to modification of lipid A), minor metabolic differences were identified. Notably, peptidoglycan biosynthesis metabolites were significantly depleted in both of the aforementioned polymyxin-resistant strains. This is the first comparative untargeted metabolomics study to show substantial differences in the metabolic profiles of the polymyxin-susceptible and -resistant A. baumannii.
Development of a non-destructive method to identify different grades of stainless steel
International Nuclear Information System (INIS)
Meor Yusoff Meor Sulaiman
2003-01-01
One of the non-destructive methods used for the identification and verification of metals is by the energy-dispersive X-ray fluorescence (EDXRF) technique. EDXRF analysis provides several important advantages such as simultaneous determination of the elements present, enable to analyse a very wide concentration range, fast analysis with no sample preparation. The paper shows how this technique is developed and applied in the identification and verification of different grades of stainless steels. Comparison of the results for certified reference standards obtained from this analysis and that of its certified value shows very small differences between them. (Author)
Perceived cultural importance and actual self-importance of values in cultural identification.
Wan, Ching; Chiu, Chi-yue; Tam, Kim-pong; Lee, Sau-lai; Lau, Ivy Yee-man; Peng, Siqing
2007-02-01
Cross-cultural psychologists assume that core cultural values define to a large extent what a culture is. Typically, core values are identified through an actual self-importance approach, in which core values are those that members of the culture as a group strongly endorse. In this article, the authors propose a perceived cultural importance approach to identifying core values, in which core values are values that members of the culture as a group generally believe to be important in the culture. In 5 studies, the authors examine the utility of the perceived cultural importance approach. Results consistently showed that, compared with values of high actual self-importance, values of high perceived cultural importance play a more important role in cultural identification. These findings have important implications for conceptualizing and measuring cultures. ((c) 2007 APA, all rights reserved).
Differences in handgrip strength protocols to identify sarcopenia and frailty - a systematic review.
Sousa-Santos, A R; Amaral, T F
2017-10-16
Hand grip strength (HGS) is used for the diagnosis of sarcopenia and frailty. Several factors have been shown to influence HGS values during measurement. Therefore, variations in the protocols used to assess HGS, as part of the diagnosis of sarcopenia and frailty, may lead to the identification of different individuals with low HGS, introducing bias. The aim of this systematic review is to gather all the relevant studies that measured HGS to diagnose sarcopenia and frailty and to identify the differences between the protocols used. A systematic review was carried out following the recommendations of The Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) Statement. PubMed and Web of Science were systematically searched, until August 16, 2016. The evidence regarding HGS measurement protocols used to diagnose sarcopenia and frailty was summarised and the most recent protocols regarding the procedure were compared. From the described search 4393 articles were identified. Seventy-two studies were included in this systematic review, in which 37 referred to sarcopenia articles, 33 to frailty and two evaluated both conditions. Most studies presented limited information regarding the protocols used. The majority of the studies included did not describe a complete procedure of HGS measurement. The high heterogeneity between the protocols used, in sarcopenia and frailty studies, create an enormous difficulty in drawing comparative conclusions among them.
Identifying dietary differences between Scotland and England: a rapid review of the literature.
Chambers, Stephanie; Barton, Karen L; Albani, Viviana; Anderson, Annie S; Wrieden, Wendy L
2017-10-01
Rates of premature mortality have been higher in Scotland than in England since the 1970s. Given the known association of diet with chronic disease, the study objective was to identify and synthesise evidence on current and historical differences in food and nutrient intakes in Scotland and England. A rapid review of the peer-reviewed and grey literature was carried out. After an initial scoping search, Medline, CINAHL, Embase and Web of Science were searched. Relevant grey literature was also included. Inclusion criteria were: any date; measures of dietary intake; representative populations; cross-sectional or observational cohort studies; and English-language publications. Study quality was assessed using the Quality Assessment Tool for Observational Cohort and Cross-sectional Studies. A narrative synthesis of extracted information was conducted. Fifty publications and reports were included in the review. Results indicated that children and adults in Scotland had lower intakes of vegetables and vitamins compared with those living in England. Higher intakes of salt in Scotland were also identified. Data were limited by small Scottish samples, difficulty in finding England-level data, lack of statistical testing and adjustment for key confounders. Further investigation of adequately powered and analysed surveys is required to examine more fully dietary differences between Scotland and England. This would provide greater insight into potential causes of excess mortality in Scotland compared with England and suitable policy recommendations to address these inequalities.
Identification of important nodes in directed biological networks: a network motif approach.
Directory of Open Access Journals (Sweden)
Pei Wang
Full Text Available Identification of important nodes in complex networks has attracted an increasing attention over the last decade. Various measures have been proposed to characterize the importance of nodes in complex networks, such as the degree, betweenness and PageRank. Different measures consider different aspects of complex networks. Although there are numerous results reported on undirected complex networks, few results have been reported on directed biological networks. Based on network motifs and principal component analysis (PCA, this paper aims at introducing a new measure to characterize node importance in directed biological networks. Investigations on five real-world biological networks indicate that the proposed method can robustly identify actually important nodes in different networks, such as finding command interneurons, global regulators and non-hub but evolutionary conserved actually important nodes in biological networks. Receiver Operating Characteristic (ROC curves for the five networks indicate remarkable prediction accuracy of the proposed measure. The proposed index provides an alternative complex network metric. Potential implications of the related investigations include identifying network control and regulation targets, biological networks modeling and analysis, as well as networked medicine.
The Relative Importance of Specific Self-Efficacy Sources in Pretraining Self-Efficacy Beliefs
Howardson, Garett N.; Behrend, Tara S.
2015-01-01
Self-efficacy is clearly important for learning. Research identifying the most important sources of self-efficacy beliefs, however, has been somewhat limited to date in that different disciplines focus largely on different sources of self-efficacy. Whereas education researchers focus on Bandura's original sources of "enactive mastery,"…
Discriminative ability of two different external anchors: improvement appears better than importance
DEFF Research Database (Denmark)
Lauridsen, Henrik Hein
2009-01-01
interpretable statistics such as proportions and numbers needed to treat can be reported based on the MIC. Estimating the MIC using the anchor-based method is, however, not without difficulties. For instance issues relating to calculation methods, measurement error, rater perspective, population specificity...... and baseline dependence have been raised, and little attention has been paid to how improvement and importance of a treatment outcome should be interpreted. The purpose of this study is to explore the adequateness of two different external anchors using the anchor-based MIC distribution method and probability...... of improvement/importance curves. Methods Two hundred and twenty-four patients with chronic low back pain and/or leg pain were recruited from an out-patient hospital back pain clinic and followed over an 8-week period. Participants received the Danish Oswestry Disability Index (ODI), the numeric rating scale...
Wilson, C. E.; Keane, C. M.; Houlton, H. R.
2012-12-01
The American Geosciences Institute (AGI) decided to create the National Geoscience Student Exit Survey in order to identify the initial pathways into the workforce for these graduating students, as well as assess their preparedness for entering the workforce upon graduation. The creation of this survey stemmed from a combination of experiences with the AGI/AGU Survey of Doctorates and discussions at the following Science Education Research Center (SERC) workshops: "Developing Pathways to Strong Programs for the Future", "Strengthening Your Geoscience Program", and "Assessing Geoscience Programs". These events identified distinct gaps in understanding the experiences and perspectives of geoscience students during one of their most profound professional transitions. Therefore, the idea for the survey arose as a way to evaluate how the discipline is preparing and educating students, as well as identifying the students' desired career paths. The discussions at the workshops solidified the need for this survey and created the initial framework for the first pilot of the survey. The purpose of this assessment tool is to evaluate student preparedness for entering the geosciences workforce; identify student decision points for entering geosciences fields and remaining in the geosciences workforce; identify geosciences fields that students pursue in undergraduate and graduate school; collect information on students' expected career trajectories and geosciences professions; identify geosciences career sectors that are hiring new graduates; collect information about salary projections; overall effectiveness of geosciences departments regionally and nationally; demonstrate the value of geosciences degrees to future students, the institutions, and employers; and establish a benchmark to perform longitudinal studies of geosciences graduates to understand their career pathways and impacts of their educational experiences on these decisions. AGI's Student Exit Survey went through
Dietrich, Susanne; Borst, Nadine; Schlee, Sandra; Schneider, Daniel; Janda, Jan-Oliver; Sterner, Reinhard; Merkl, Rainer
2012-07-17
The analysis of a multiple-sequence alignment (MSA) with correlation methods identifies pairs of residue positions whose occupation with amino acids changes in a concerted manner. It is plausible to assume that positions that are part of many such correlation pairs are important for protein function or stability. We have used the algorithm H2r to identify positions k in the MSAs of the enzymes anthranilate phosphoribosyl transferase (AnPRT) and indole-3-glycerol phosphate synthase (IGPS) that show a high conn(k) value, i.e., a large number of significant correlations in which k is involved. The importance of the identified residues was experimentally validated by performing mutagenesis studies with sAnPRT and sIGPS from the archaeon Sulfolobus solfataricus. For sAnPRT, five H2r mutant proteins were generated by replacing nonconserved residues with alanine or the prevalent residue of the MSA. As a control, five residues with conn(k) values of zero were chosen randomly and replaced with alanine. The catalytic activities and conformational stabilities of the H2r and control mutant proteins were analyzed by steady-state enzyme kinetics and thermal unfolding studies. Compared to wild-type sAnPRT, the catalytic efficiencies (k(cat)/K(M)) were largely unaltered. In contrast, the apparent thermal unfolding temperature (T(M)(app)) was lowered in most proteins. Remarkably, the strongest observed destabilization (ΔT(M)(app) = 14 °C) was caused by the V284A exchange, which pertains to the position with the highest correlation signal [conn(k) = 11]. For sIGPS, six H2r mutant and four control proteins with alanine exchanges were generated and characterized. The k(cat)/K(M) values of four H2r mutant proteins were reduced between 13- and 120-fold, and their T(M)(app) values were decreased by up to 5 °C. For the sIGPS control proteins, the observed activity and stability decreases were much less severe. Our findings demonstrate that positions with high conn(k) values have an
Leyk, Dieter; Witzki, Alexander; Sievert, Alexander; Rohde, Ulrich; Moedl, Anne; Rüther, Thomas; Löllgen, Herbert; Hackfort, Dieter
2012-07-01
The number of sedentary young adults has dramatically increased in past decades, and sedentary lifestyles are adopted at an increasingly earlier age. Little is known about barriers or predictors to (re)initiate regular physical activity in this group. The purpose of the study is to (a) identify subgroups in nonathletes differing in their amenability to physical exercise, (b) to analyze them for differences in barriers and intention to exercise, and (c) compare importance of sports during youth in nonathletes to trained peers. Using a health and fitness questionnaire 589 nonathletes were queried in the cross-sectional survey and compared with 270 trained peers. Athletic abstainers (A), lower (L), and higher (H) motivated nonathletes were separated based on previous engagement in sports. Of the nonathletes, 54.7% reported only 1 barrier to exercise. Although this feature was most prominent in H (71.5%), the other groups showed significantly more barriers and a broader distribution. Similar characteristics but minor differences were observed for perceived importance of sports during youth. The most significant differences between athletes and nonathletes emerged enquiring the attitude and activity of the parents. The majority of nonathletes (72.8%) indicate their intention to exercise in the future. Their intention differed significantly in H (88.1%), L (76.1%), and A (59.1%). However, there are good reasons to doubt that most of those intending nonathletes will actually become physically active. Even in the analyzed narrow age range of men different motivated groups of nonathletes were found. Because of the differences in receptiveness and approachability health promotion policies may not only consider the often recommended tailored interventions but also carefully designed incentive programs.
A landscape ecology approach identifies important drivers of urban biodiversity.
Turrini, Tabea; Knop, Eva
2015-04-01
Cities are growing rapidly worldwide, yet a mechanistic understanding of the impact of urbanization on biodiversity is lacking. We assessed the impact of urbanization on arthropod diversity (species richness and evenness) and abundance in a study of six cities and nearby intensively managed agricultural areas. Within the urban ecosystem, we disentangled the relative importance of two key landscape factors affecting biodiversity, namely the amount of vegetated area and patch isolation. To do so, we a priori selected sites that independently varied in the amount of vegetated area in the surrounding landscape at the 500-m scale and patch isolation at the 100-m scale, and we hold local patch characteristics constant. As indicator groups, we used bugs, beetles, leafhoppers, and spiders. Compared to intensively managed agricultural ecosystems, urban ecosystems supported a higher abundance of most indicator groups, a higher number of bug species, and a lower evenness of bug and beetle species. Within cities, a high amount of vegetated area increased species richness and abundance of most arthropod groups, whereas evenness showed no clear pattern. Patch isolation played only a limited role in urban ecosystems, which contrasts findings from agro-ecological studies. Our results show that urban areas can harbor a similar arthropod diversity and abundance compared to intensively managed agricultural ecosystems. Further, negative consequences of urbanization on arthropod diversity can be mitigated by providing sufficient vegetated space in the urban area, while patch connectivity is less important in an urban context. This highlights the need for applying a landscape ecological approach to understand the mechanisms shaping urban biodiversity and underlines the potential of appropriate urban planning for mitigating biodiversity loss. © 2015 John Wiley & Sons Ltd.
Energy Technology Data Exchange (ETDEWEB)
Leggett, Richard Wayne [ORNL; Eckerman, Keith F [ORNL; Manger, Ryan P [ORNL
2013-08-01
This report compares three different radiation dosimetry systems currently applied by various U.S. Federal agencies and dose estimates based on these three dosimetry systems for a set of radionuclides often identified in power reactor effluents. These dosimetry systems were developed and applied by the International Commission on Radiological Protection at different times over the past six decades. Two primary modes of intake of radionuclides are addressed: ingestion in drinking water and inhalation. Estimated doses to individual organs and to the whole body based on each dosimetry system are compared for each of four age groups: infant, child, teenager, and adult. Substantial differences between dosimetry systems in estimated dose per unit intake are found for some individual radionuclides, but differences in estimated dose per unit intake generally are modest for mixtures of radionuclides typically found in nuclear power plant effluents.
A large-scale RNA interference screen identifies genes that regulate autophagy at different stages.
Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man; He, Bin; Zhang, Liqing; Varmark, Hanne; Green, Michael R; Sheng, Zhi
2018-02-12
Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed a large-scale RNA interference screen in K562 human chronic myeloid leukemia cells using monodansylcadaverine staining, an autophagy-detecting approach equivalent to immunoblotting of the autophagy marker LC3B or fluorescence microscopy of GFP-LC3B. By coupling monodansylcadaverine staining with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays revealed that 57 autophagy-regulating genes suppressed autophagy initiation, whereas 21 candidates promoted autophagy maturation. Our RNA interference screen identifies identified genes that regulate autophagy at different stages, which helps decode autophagy regulation in cancer and offers novel avenues to develop autophagy-related therapies for cancer.
Directory of Open Access Journals (Sweden)
Matej Majerič
2016-06-01
Full Text Available The main purpose of this research was to analyse the gender differences among students at the University of Ljubljana in the importance of sport in their lives and the frequency of sport participation. The research was done in the 2013 academic year on a random sample of 3% of the students (N = 1390; a questionnaire about students’ lifestyles was used (Majerič, 2013. In this study, two variables were analysed: the importance of sport in students’ lives and the frequency of sport participation; the data were analysed with SPSS for Windows. The basic statistical parameters for both variables were calculated. To calculate the gender differences, a t-test for independent samples and the Mann-Whitney U test were run. For the variable ‘importance of sport in students’ lives’, 61.95% of male and 53.20% of female respondents reported that sport is important and very important in their lives. The gender differences were small but statistically significant (p=0.013. For the variable ‘frequency of participation in sport activity’, 79.61% of male and 77.10% of female respondents reported that they were sport active every day, 4 to 6 times a week or 2 to 3 times a week. The gender differences in this variable were also statistically significant (p=0.000. Our findings and conclusions provide useful guidance to the closer and wider professional public who organize sport programmes for students.
Directory of Open Access Journals (Sweden)
Ahmad Norang
2016-01-01
Full Text Available Nowadays, the increase in competition has increased the relative importance of innovation for most firms and many managers believe a good innovation must be knowledge oriented. This paper has tried to determine different methods for creating knowledge in project oriented organizations. The study designs a questionnaire in Likert scale and distributes it among 32 experts who were well informed about different methods of knowledge creation and lessons learned. Cronbach alphas for all components of the survey were well above the desirable level. The study has detected 11 methods for knowledge creation and lessons learned. In terms of preliminary assessment, business transactions has received the highest impact while knowledge team has received the highest effect in terms of necessary assessment. The results of this survey have indicated that although there are several methods for detecting knowledge within organizations, in most cases, it is not easy to gain value added knowledge within an organization, quickly. The people who participated in our survey have indicated that organizational commitment, brainstorming, Delphi and storytelling also have played important role for creation of knowledge. The results have also shown that brainstorming, knowledge brokers, map knowledge and work experience were easier to use for knowledge creation and lessons learned compared with other forms of knowledge creation.
Identifying influential spreaders in interconnected networks
International Nuclear Information System (INIS)
Zhao, Dawei; Li, Lixiang; Huo, Yujia; Yang, Yixian; Li, Shudong
2014-01-01
Identifying the most influential spreaders in spreading dynamics is of the utmost importance for various purposes for understanding or controlling these processes. The existing relevant works are limited to a single network. Most real networks are actually not isolated, but typically coupled and affected by others. The properties of epidemic spreading have recently been found to have some significant differences in interconnected networks from those in a single network. In this paper, we focus on identifying the influential spreaders in interconnected networks. We find that the well-known k-shell index loses effectiveness; some insignificant spreaders in a single network become the influential spreaders in the whole interconnected networks while some influential spreaders become no longer important. The simulation results show that the spreading capabilities of the nodes not only depend on their influence for the network topology, but also are dramatically influenced by the spreading rate. Based on this perception, a novel index is proposed for measuring the influential spreaders in interconnected networks. We then support the efficiency of this index with numerical simulations. (paper)
Genes Important for Catalase Activity in Enterococcus faecalis
Baureder, Michael; Hederstedt, Lars
2012-01-01
Little in general is known about how heme proteins are assembled from their constituents in cells. The Gram-positive bacterium Enterococcus faecalis cannot synthesize heme and does not depend on it for growth. However, when supplied with heme in the growth medium the cells can synthesize two heme proteins; catalase (KatA) and cytochrome bd (CydAB). To identify novel factors important for catalase biogenesis libraries of E. faecalis gene insertion mutants were generated using two different types of transposons. The libraries of mutants were screened for clones deficient in catalase activity using a colony zymogram staining procedure. Analysis of obtained clones identified, in addition to katA (encoding the catalase enzyme protein), nine genes distributed over five different chromosomal loci. No factors with a dedicated essential role in catalase biogenesis or heme trafficking were revealed, but the results indicate the RNA degradosome (srmB, rnjA), an ABC-type oligopeptide transporter (oppBC), a two-component signal transducer (etaR), and NADH peroxidase (npr) as being important for expression of catalase activity in E. faecalis. It is demonstrated that catalase biogenesis in E. faecalis is independent of the CydABCD proteins and that a conserved proline residue in the N-terminal region of KatA is important for catalase assembly. PMID:22590595
International Nuclear Information System (INIS)
Almoghathawi, Yasser; Barker, Kash; Rocco, Claudio M.; Nicholson, Charles D.
2017-01-01
Analyzing network vulnerability is a key element of network planning in order to be prepared for any disruptive event that might impact the performance of the network. Hence, many importance measures have been proposed to identify the important components in a network with respect to vulnerability and rank them accordingly based on individual importance measure. However, in this paper, we propose a new approach to identify the most important network components based on multiple importance measures using a multi criteria decision making (MCDM) method, namely the technique for order performance by similarity to ideal solution (TOPSIS), able to take into account the preferences of decision-makers. We consider multiple edge-specific flow-based importance measures provided as the multiple criteria of a network where the alternatives are the edges. Accordingly, TOPSIS is used to rank the edges of the network based on their importance considering multiple different importance measures. The proposed approach is illustrated through different networks with different densities along with the effects of weighs. - Highlights: • We integrate several perspectives on network vulnerability to generate a component importance ranking. • We apply these measures to determine the importance of edges after disruptions. • Networks of varying size and density are explored.
Pérez-Roda, Amparo; Delord, Karine; Boué, Amélie; Arcos, José Manuel; García, David; Micol, Thierry; Weimerskirch, Henri; Pinaud, David; Louzao, Maite
2017-07-01
Marine protected areas (MPAs) are considered one of the main tools in both fisheries and conservation management to protect threatened species and their habitats around the globe. However, MPAs are underrepresented in marine environments compared to terrestrial environments. Within this context, we studied the Atlantic non-breeding distribution of the southern population of Balearic shearwaters (Puffinus mauretanicus) breeding in Eivissa during the 2011-2012 period based on global location sensing (GLS) devices. Our objectives were (1) to identify overall Important Atlantic Areas (IAAs) from a southern population, (2) to describe spatio-temporal patterns of oceanographic habitat use, and (3) to assess whether existing conservation areas (Natura 2000 sites and marine Important Bird Areas (IBAs)) cover the main IAAs of Balearic shearwaters. Our results highlighted that the Atlantic staging (from June to October in 2011) dynamic of the southern population was driven by individual segregation at both spatial and temporal scales. Individuals ranged in the North-East Atlantic over four main IAAs (Bay of Biscay: BoB, Western Iberian shelf: WIS, Gulf of Cadiz: GoC, West of Morocco: WoM). While most individuals spent more time on the WIS or in the GoC, a small number of birds visited IAAs at the extremes of their Atlantic distribution range (i.e., BoB and WoM). The chronology of the arrivals to the IAAs showed a latitudinal gradient with northern areas reached earlier during the Atlantic staging. The IAAs coincided with the most productive areas (higher chlorophyll a values) in the NE Atlantic between July and October. The spatial overlap between IAAs and conservation areas was higher for Natura 2000 sites than marine IBAs (areas with and without legal protection, respectively). Concerning the use of these areas, a slightly higher proportion of estimated positions fell within marine IBAs compared to designated Natura 2000 sites, with Spanish and Portuguese conservation
Jansen, E.J.; Dijkman, K.P.; Lingen, R.A. van; Vries, W.B. de; Vijlbrief, D.C.; Boode, W.P. de; Andriessen, P.
2017-01-01
OBJECTIVE: The aim of this study was to identify inter-centre differences in persistent ductus arteriosus treatment and their related outcomes. Materials and methods We carried out a retrospective, multicentre study including infants between 24+0 and 27+6 weeks of gestation in the period between
Jansen, Esther J. S.; Dijkman, Koen P.; Van Lingen, Richard A.; de Vries, Willem B; Vijlbrief, Daniel C; de Boode, Willem P; Andriessen, Peter
2017-01-01
Objective: The aim of this study was to identify inter-centre differences in persistent ductus arteriosus treatment and their related outcomes. Materials and methods: We carried out a retrospective, multicentre study including infants between 24+0 and 27+6 weeks of gestation in the period between
Chen, Qianqian; Wang, Yuren
2015-01-01
With the fast growing Chinese online marketplace and the increasing popularity of shopping imported products online in China, more and more practitioners and researchers are interested in understanding the cues that Chinese consumers use to evaluate imported products consumption online. Our quantitative study aims to identify what factors affect the behavior of Chinese online consumers towards imported products and the relationships between the identified factors and purchase intention, and t...
Development of a model system to identify differences in spring and winter oat.
Chawade, Aakash; Lindén, Pernilla; Bräutigam, Marcus; Jonsson, Rickard; Jonsson, Anders; Moritz, Thomas; Olsson, Olof
2012-01-01
Our long-term goal is to develop a Swedish winter oat (Avena sativa). To identify molecular differences that correlate with winter hardiness, a winter oat model comprising of both non-hardy spring lines and winter hardy lines is needed. To achieve this, we selected 294 oat breeding lines, originating from various Russian, German, and American winter oat breeding programs and tested them in the field in south- and western Sweden. By assaying for winter survival and agricultural properties during four consecutive seasons, we identified 14 breeding lines of different origins that not only survived the winter but also were agronomically better than the rest. Laboratory tests including electrolytic leakage, controlled crown freezing assay, expression analysis of the AsVrn1 gene and monitoring of flowering time suggested that the American lines had the highest freezing tolerance, although the German lines performed better in the field. Finally, six lines constituting the two most freezing tolerant lines, two intermediate lines and two spring cultivars were chosen to build a winter oat model system. Metabolic profiling of non-acclimated and cold acclimated leaf tissue samples isolated from the six selected lines revealed differential expression patterns of 245 metabolites including several sugars, amino acids, organic acids and 181 hitherto unknown metabolites. The expression patterns of 107 metabolites showed significant interactions with either a cultivar or a time-point. Further identification, characterisation and validation of these metabolites will lead to an increased understanding of the cold acclimation process in oats. Furthermore, by using the winter oat model system, differential sequencing of crown mRNA populations would lead to identification of various biomarkers to facilitate winter oat breeding.
Riemann, Bryan L; Lininger, Monica R
2018-01-01
To describe the concepts of measurement reliability and minimal important change. All measurements have some magnitude of error. Because clinical practice involves measurement, clinicians need to understand measurement reliability. The reliability of an instrument is integral in determining if a change in patient status is meaningful. Measurement reliability is the extent to which a test result is consistent and free of error. Three perspectives of reliability-relative reliability, systematic bias, and absolute reliability-are often reported. However, absolute reliability statistics, such as the minimal detectable difference, are most relevant to clinicians because they provide an expected error estimate. The minimal important difference is the smallest change in a treatment outcome that the patient would identify as important. Clinicians should use absolute reliability characteristics, preferably the minimal detectable difference, to determine the extent of error around a patient's measurement. The minimal detectable difference, coupled with an appropriately estimated minimal important difference, can assist the practitioner in identifying clinically meaningful changes in patients.
Brinker, Monika; Brosché, Mikael; Vinocur, Basia; Abo-Ogiala, Atef; Fayyaz, Payam; Janz, Dennis; Ottow, Eric A.; Cullmann, Andreas D.; Saborowski, Joachim; Kangasjärvi, Jaakko; Altman, Arie; Polle, Andrea
2010-01-01
To investigate early salt acclimation mechanisms in a salt-tolerant poplar species (Populus euphratica), the kinetics of molecular, metabolic, and physiological changes during a 24-h salt exposure were measured. Three distinct phases of salt stress were identified by analyses of the osmotic pressure and the shoot water potential: dehydration, salt accumulation, and osmotic restoration associated with ionic stress. The duration and intensity of these phases differed between leaves and roots. Transcriptome analysis using P. euphratica-specific microarrays revealed clusters of coexpressed genes in these phases, with only 3% overlapping salt-responsive genes in leaves and roots. Acclimation of cellular metabolism to high salt concentrations involved remodeling of amino acid and protein biosynthesis and increased expression of molecular chaperones (dehydrins, osmotin). Leaves suffered initially from dehydration, which resulted in changes in transcript levels of mitochondrial and photosynthetic genes, indicating adjustment of energy metabolism. Initially, decreases in stress-related genes were found, whereas increases occurred only when leaves had restored the osmotic balance by salt accumulation. Comparative in silico analysis of the poplar stress regulon with Arabidopsis (Arabidopsis thaliana) orthologs was used as a strategy to reduce the number of candidate genes for functional analysis. Analysis of Arabidopsis knockout lines identified a lipocalin-like gene (AtTIL) and a gene encoding a protein with previously unknown functions (AtSIS) to play roles in salt tolerance. In conclusion, by dissecting the stress transcriptome of tolerant species, novel genes important for salt endurance can be identified. PMID:20959419
International Nuclear Information System (INIS)
Zhang, Yulong; Ma, Xiaoxuan; Ran, Yong
2014-01-01
Shale was thermally treated to obtain a series of kerogen with varied maturation. Their chemical, structural and porous properties were related to the sorption and/or desorption behaviors of phenanthrene and benzene. As the treatment temperature increases, aliphatic and carbonyl carbon of the kerogen samples decrease, while their aromaticity and maturation increase. Meanwhile, the isothermal nonlinearity of phenanthrene and benzene increases whereas the sorption capacity and micropore adsorption volumes (V o,d ) initially increase and then decrease. The V o,d of benzene is significantly correlated with, but higher than that of phenanthrene, suggesting similar micropore filling mechanism and molecular sieve effect. The benzene desorption exhibits hysteresis, which is related to the pore deformation of the kerogen and the entrapment of solute in the kerogen matrix. The V o,d of phenanthrene and benzene on the kerogen samples accounts for 23–46% and 36–65% of the maximum sorption volumes, respectively, displaying the importance of the micropore filling. -- Highlights: • The microporosity estimated by benzene vapor differs greatly from that by N 2 . • The micropore volume changes with kerogen maturation. • The phenanthrene or benzene sorption is related to the microporosity of kerogen. • Higher adsorption volume for benzene than for phenanthrene suggests molecular sieve effect. • The pore-filling plays an important role in the sorption of phenanthrene and benzene. -- The sorption behaviors of benzene and phenanthrene are related to the microporosity of the differently matured kerogen, indicating the importance of pore-filling
International Nuclear Information System (INIS)
Tamura, Hiroyuki; Hikita, Shiro
1985-01-01
In this paper, we develop an interactive algorithm for identifying multiattribute measurable value functions based on the concept of finite-order independence of structural difference. This concept includes Dyer and Sarin's weak difference independence as special cases. The algorithm developed is composed of four major parts: 1) formulation of the problem 2) assessment of normalized conditional value functions and structural difference functions 3) assessment of corner values 4) assessment of the order of independence of structural difference and selection of the model. A hypothetical numerical example of a trade-off analysis for siting a nuclear power plant is included. (author)
Sebastião, Patrícia Cristina Antunes; Lucchese, Geraldo
2010-11-01
The purpose of this work is to analyze the process of importation, that is a part of the sanitary control of psychotropic substances, made by Brazilian National Health Surveillance Agency's ports, airports and borders. For this work, psychotropic substances are defined as active pharmaceutical raw materials present in the list B1 of Portaria nº 344/98; which need Anvisa's permission to be imported. For this purpose we used semistructured interviews with key informers and participant observation. The information were collected and systematized through the content analysis, thematic modality. The results show a very complex control which involves an intense bureaucratic process. The main identified critical points of the process were: the information system precariousness; the absence of human resources; deficiency of laboratorial support and infra-structure at customs. Anvisa's web page and the specific law are strong points of the process, but still needing improvements. We understood that despite of the progress made, there are many things to do for giving the country an efficient health control system to the importation of these substances.
Important Non-Technical Skills in Video-Assisted Thoracoscopic Surgery Lobectomy
DEFF Research Database (Denmark)
Gjeraa, Kirsten; Mundt, Anna S.; Spanager, Lene
2017-01-01
Background Safety in the operating room is dependent on the team's non-technical skills. The importance of non-technical skills appears to be different for minimally invasive surgery as compared with open surgery. The aim of this study was to identify which non-technical skills are perceived...... with complementary and overlapping scopes of practice between surgical and anesthesia subteams. Conclusions This study identified six non-technical skills that serve as the foundation for shared mental models of the patient, the current situation, and team resources. These findings contribute three important...... by team members to be most important for patient safety, in the setting of video-assisted thoracoscopic surgery (VATS) lobectomy. Methods This was an explorative, semistructured interview-based study with 21 participants from all four thoracic surgery centers in Denmark that perform VATS lobectomy. Data...
Digital Repository Service at National Institute of Oceanography (India)
Radhakrishnan, K.V.; Li, Y.; Jayalakshmy, K.V.; Liu, M.; Murphy, B.R.; Xie, S.
The variability in otolith shape of the tapertail anchovy Coilia ectenes was investigated as a tool for identifying its different ecotypes. The outlines of 350 sagittal otoliths of known ecotypes collected from seven sampling areas, covering most...
Montesó-Curto, Pilar; Ferré-Grau, Carme; Lleixà-Fortuño, Mar; Albacar-Riobóo, Nuria; Lejeune, Marylene
2014-02-01
The aims of this study were to explore the prevalence and the conceptualizations of depression detected by the healthcare system, identified by the patient or classified/identified in the validated Goldberg's questionnaire in a community. We conducted a cross-sectional evaluation of 317 patients. The different types of depression diagnosed, identified, current or total were stratified by age and gender groups. The difference in the conceptualization of depression from the medical or ordinary people point of view indicate that depression care requires the understanding of the lifestyle, beliefs, attitudes, family and social networks of the people the physicians and nurses care for. © 2014.
Johnson, Tracy L; Kaldor, Jill; Sutherland, Kim; Humphries, Jacob; Jorm, Louisa R; Levesque, Jean-Frederic
2018-01-01
Objective This observational study critically explored the performance of different predictive risk models simulating three data access scenarios, comparing: (1) sociodemographic and clinical profiles; (2) consistency in high-risk designation across models; and (3) persistence of high-risk status over time. Methods Cross-sectional health survey data (2006–2009) for more than 260 000 Australian adults 45+ years were linked to longitudinal individual hospital, primary care, pharmacy and mortality data. Three risk models predicting acute emergency hospitalisations were explored, simulating conditions where data are accessed through primary care practice management systems, or through hospital-based electronic records, or through a hypothetical ‘full’ model using a wider array of linked data. High-risk patients were identified using different risk score thresholds. Models were reapplied monthly for 24 months to assess persistence in high-risk categorisation. Results The three models displayed similar statistical performance. Three-quarters of patients in the high-risk quintile from the ‘full’ model were also identified using the primary care or hospital-based models, with the remaining patients differing according to age, frailty, multimorbidity, self-rated health, polypharmacy, prior hospitalisations and imminent mortality. The use of higher risk prediction thresholds resulted in lower levels of agreement in high-risk designation across models and greater morbidity and mortality in identified patient populations. Persistence of high-risk status varied across approaches according to updated information on utilisation history, with up to 25% of patients reassessed as lower risk within 1 year. Conclusion/implications Small differences in risk predictors or risk thresholds resulted in comparatively large differences in who was classified as high risk and for how long. Pragmatic predictive risk modelling design decisions based on data availability or projected
CERN. Geneva
2005-01-01
As business processes and information transactions have become an inextricably intertwined with the Web, the importance of assignment, registration, discovery, and maintenance of identifiers has increased. In spite of this, integrated frameworks for managing identifiers have been slow to emerge. Instead, identification systems arise (quite naturally) from immediate business needs without consideration for how they fit into larger information architectures. In addition, many legacy identifier systems further complicate the landscape, making it difficult for content managers to select and deploy identifier systems that meet both the business case and long term information management objectives. This presentation will outline a model for evaluating identifier applications and the functional requirements of the systems necessary to support them. The model is based on a layered analysis of the characteristics of identifier systems, including: * Functional characteristics * Technology * Policy * Business * Social T...
A new importance measure for sensitivity analysis
International Nuclear Information System (INIS)
Liu, Qiao; Homma, Toshimitsu
2010-01-01
Uncertainty is an integral part of risk assessment of complex engineering systems, such as nuclear power plants and space crafts. The aim of sensitivity analysis is to identify the contribution of the uncertainty in model inputs to the uncertainty in the model output. In this study, a new importance measure that characterizes the influence of the entire input distribution on the entire output distribution was proposed. It represents the expected deviation of the cumulative distribution function (CDF) of the model output that would be obtained when one input parameter of interest were known. The applicability of this importance measure was tested with two models, a nonlinear nonmonotonic mathematical model and a risk model. In addition, a comparison of this new importance measure with several other importance measures was carried out and the differences between these measures were explained. (author)
Directory of Open Access Journals (Sweden)
Cristiano de Oliveira Maciel
2006-11-01
Full Text Available This study is about the different models of decision process analyzing the organizational strategy. The article presents the strategy according to a cognitive approach. The discussion about that approach has three models of decision process: rational actor model, organizational behavior, and political model. These models, respectively, present some improvement in the decision making results, search for a good decision facing the cognitive restrictions of the administrator, and lots of talks for making a decision. According to the emphasis of each model, the possibilities for analyzing the strategy are presented. The article also shows that it is necessary to take into account the three different ways of analysis. That statement is justified once the analysis as well as the decision making become more complex, mainly those which are more important for the organizations.
A new index for identifying different types of El Niño Modoki events
Wang, Xin; Tan, Wei; Wang, Chunzai
2018-04-01
El Niño Modoki events can be further classified into El Niño Modoki I and II in terms of their opposite impacts on southern China rainfall (Wang and Wang, J Clim 26:1322-1338, 2013) and the Indian Ocean dipole mode (Wang and Wang, Clim Dyn 42:991-1005, 2014). The present paper develops an index to identify the types of El Niño events. The El Niño Modoki II (MII) index is defined as the leading principle component of multivariate empirical orthogonal function analysis of the normalized El Niño Modoki index, Niño4 index and 850 hPa relative vorticity anomalies averaged near the Philippine Sea during autumn. The MII index exhibits dominant variations on interannual (2-3 and 4-5 years) and decadal (10-20 years) timescales. El Niño Modoki II events can be well identified by using the MII index value being larger than 1 standard deviation. Further analyses and numerical model experiments confirm that the MII index can portray the major oceanic and atmospheric features of El Niño Modoki II events. The constructed MII index along with previous ENSO indices can be used for classifying and identifying all types of El Niño events. Because of distinct impacts induced by different types of El Niño events, the implication of the present study is that climate prediction and future climate projection under global warming can be improved by using the MII index and other indices to identify the types of El Niño events.
Minimal clinically important difference on the Motor Examination part of MDS-UPDRS.
Horváth, Krisztina; Aschermann, Zsuzsanna; Ács, Péter; Deli, Gabriella; Janszky, József; Komoly, Sámuel; Balázs, Éva; Takács, Katalin; Karádi, Kázmér; Kovács, Norbert
2015-12-01
Recent studies increasingly utilize the Movement Disorders Society Sponsored Unified Parkinson's Disease Rating Scale (MDS-UPDRS). However, the minimal clinically important difference (MCID) has not been fully established for MDS-UPDRS yet. To assess the MCID thresholds for MDS-UPDRS Motor Examination (Part III). 728 paired investigations of 260 patients were included. At each visit both MDS-UPDRS and Clinician-reported Global Impression-Improvement (CGI-I) scales were assessed. MDS-UPDRS Motor Examination (ME) score changes associated with CGI-I score 4 (no change) were compared with MDS-UPDRS ME score changes associated with CGI-I score 3 (minimal improvement) and CGI-I score 5 (minimal worsening). Both anchor- and distribution-based techniques were utilized to determine the magnitude of MCID. The MCID estimates for MDS-UPDRS ME were asymmetric: -3.25 points for detecting minimal, but clinically pertinent, improvement and 4.63 points for observing minimal, but clinically pertinent, worsening. MCID is the smallest change of scores that are clinically meaningful to patients. These MCID estimates may allow the judgement of a numeric change in MDS-UPDRS ME on its clinical importance. Copyright © 2015 Elsevier Ltd. All rights reserved.
Lu, Bin; Harley, Ronald G.; Du, Liang; Yang, Yi; Sharma, Santosh K.; Zambare, Prachi; Madane, Mayura A.
2014-06-17
A method identifies electric load types of a plurality of different electric loads. The method includes providing a self-organizing map load feature database of a plurality of different electric load types and a plurality of neurons, each of the load types corresponding to a number of the neurons; employing a weight vector for each of the neurons; sensing a voltage signal and a current signal for each of the loads; determining a load feature vector including at least four different load features from the sensed voltage signal and the sensed current signal for a corresponding one of the loads; and identifying by a processor one of the load types by relating the load feature vector to the neurons of the database by identifying the weight vector of one of the neurons corresponding to the one of the load types that is a minimal distance to the load feature vector.
Lee, A L; Hill, C J; Cecins, N; Jenkins, S; McDonald, C F; Burge, A T; Rautela, L; Stirling, R G; Thompson, P J; Holland, A E
2014-09-01
The 6-min walk distance (6MWD) and incremental shuttle walk distance (ISWD) are clinically meaningful measures of exercise capacity in people with non-cystic fibrosis (CF) bronchiectasis, but the change in walking distance which constitutes clinical benefit is undefined. This study aimed to determine the minimal important difference for the 6MWD and ISWD in non-CF bronchiectasis. Thirty-seven participants with mean FEV1 70% predicted completed both field walking tests before and after an 8-week exercise program. The minimal important difference was calculated using a distribution-based and anchor-based method, with the global rating of change scale used. The mean change in 6MWD in participants who reported themselves to be unchanged was 10 m, compared to 36 m (small change) and 45 m (substantial change) (p = 0.01). For the ISWD, the mean change in participants who reported themselves to be unchanged was 33 m, compared to 54 m (small change) and 73 m (substantial change) (p = 0.04). The anchor-based method defined the minimal important difference for 6MWD as 24.5 m (AUC 0.76, 95% CI 0.61-0.91) and for ISWD as 35 m (AUC 0.88, 95% CI 0.73-0.99), based on participant's global rating of change. The distribution-based method indicated a value of 22.3 m for the 6MWD and 37 m for the ISWD. There was excellent agreement between the two methods for the 6MWD (kappa = 0.91) and the ISWD (kappa = 0.92). Small changes in 6MWD and ISWD may represent clinically important benefits in people with non-CF bronchiectasis. These data are likely to assist in the interpretation of change in exercise capacity following intervention. Copyright © 2014 Elsevier Ltd. All rights reserved.
Lu, Bin; Yang, Yi; Sharma, Santosh K; Zambare, Prachi; Madane, Mayura A
2014-12-23
A method identifies electric load types of a plurality of different electric loads. The method includes providing a load feature database of a plurality of different electric load types, each of the different electric load types including a first load feature vector having at least four different load features; sensing a voltage signal and a current signal for each of the different electric loads; determining a second load feature vector comprising at least four different load features from the sensed voltage signal and the sensed current signal for a corresponding one of the different electric loads; and identifying by a processor one of the different electric load types by determining a minimum distance of the second load feature vector to the first load feature vector of the different electric load types of the load feature database.
DNA comet assay to identify different freezing temperatures of irradiated liver chicken
International Nuclear Information System (INIS)
Duarte, Renato C.; Mozeika, Michel A.; Fanaro, Gustavo B.; Villavicencio, Anna L.C.H.; Marchioni, Eric
2009-01-01
The cold chain is a succession of steps which maintain the food at low temperature. The thawed food never be frozen again and the best solution being to consume it quickly to avoid the microorganism growth which causes decay and nutrients damage. One of most important point is that freezing process, unlike irradiation, do not destroy microorganisms, only inactive them as long as they remain in a frozen state. The Comet Assay is an original test used to detect irradiated foods that's recognize the DNA damage and can then be used to control the overall degradation of the food and in a certain extend to evaluate the damage caused by irradiation, different forms of freeze and storage time on liver chicken cells. Different freezing temperatures were used, deep freeze -196 deg C and slow freeze -10 deg C. Samples were irradiated in a 60 Co irradiator with 1.5, 3.0 and 4.5 kGy radiation doses. Fast freezing technique induces a low percent of DNA degradation comparing to slow freezing technique. This procedure could be a good choose to chicken freezing processing. (author)
DNA comet assay to identify different freezing temperatures of irradiated liver chicken
Energy Technology Data Exchange (ETDEWEB)
Duarte, Renato C.; Mozeika, Michel A.; Fanaro, Gustavo B.; Villavicencio, Anna L.C.H. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)], e-mail: renatocduarte@yahoo.com.br; Marchioni, Eric [Universite de Strasbourg, Illkirch (France). Faculte de Pharmacie. Lab. de Chimie Analytique et Sciences de l' Aliment
2009-07-01
The cold chain is a succession of steps which maintain the food at low temperature. The thawed food never be frozen again and the best solution being to consume it quickly to avoid the microorganism growth which causes decay and nutrients damage. One of most important point is that freezing process, unlike irradiation, do not destroy microorganisms, only inactive them as long as they remain in a frozen state. The Comet Assay is an original test used to detect irradiated foods that's recognize the DNA damage and can then be used to control the overall degradation of the food and in a certain extend to evaluate the damage caused by irradiation, different forms of freeze and storage time on liver chicken cells. Different freezing temperatures were used, deep freeze -196 deg C and slow freeze -10 deg C. Samples were irradiated in a {sup 60}Co irradiator with 1.5, 3.0 and 4.5 kGy radiation doses. Fast freezing technique induces a low percent of DNA degradation comparing to slow freezing technique. This procedure could be a good choose to chicken freezing processing. (author)
Directory of Open Access Journals (Sweden)
Natália Cristina Morais Fernandes
Full Text Available Abstract The Brazilian wine industry has shown significant growth in recent years and the insertion of new concepts, such as geographical indications as signs of quality, has placed Brazil in tune with the tendencies of world wine production. The aim of this work was to apply the Solid Phase Microextraction technique in combination with Gas Chromatography-Mass Spectrometry to study Brazilian wines made from different grape varieties, in order to separate and identify their volatile organic compounds. These substances were identified by comparisons between the spectra obtained with those presented in the NIST library database, and by comparisons with linear retention indices and literature data. The amounts of the compounds were calculated based on the total peak areas of the chromatograms. Forty-seven volatile compounds were identified and grouped into alcohols, aldehydes, fatty acids, esters, hydrocarbons, ketones and terpenes. Most of them belonged to the ester function, conferring a fruity aroma on the wines. The alcohols may have originated from the yeast metabolism, contributing to the alcoholic and floral aromas. Ethyl lactate, 1-hexanol and diethyl maleate were identified in all the varieties, except Merlot. Decanal, methyl citronellate, (E-2-hexenyl-3-methylbutyrate were only found in Merlot, while 2,3-butanediol was only present in the Tannat wines. 2-Phenylethanol was present in all varieties and is recognized as giving pleasant rose and honey attributes to wines. This study showed that the volatile profile of red wines is mainly characterized by esters and higher alcohols. The statistical analysis of the comparison of averages showed a greater amount of averages significantly different in the relative areas of Merlot wine. The Principal Component Analysis showed one grouping composed only of the Merlot wine samples, and this was probably related to the existence of the volatile organic compounds that were specifically identified in
Minimal clinically important difference in the fibromyalgia impact questionnaire.
Bennett, Robert M; Bushmakin, Andrew G; Cappelleri, Joseph C; Zlateva, Gergana; Sadosky, Alesia B
2009-06-01
The Fibromyalgia Impact Questionnaire (FIQ) is a disease-specific composite instrument that measures the effect of problems experienced by patients with fibromyalgia (FM). Utilization of the FIQ in measuring changes due to interventions in FM requires derivation of a clinically meaningful change for that instrument. Analyses were conducted to estimate the minimal clinically important difference (MCID), and to propose FIQ severity categories. Data from 3 similarly designed, 3-month placebo-controlled, clinical treatment trials of pregabalin 300, 450, and 600 mg/day in patients with FM were modeled to estimate the change in the mean FIQ total and stiffness items corresponding to each category on the Patient Global Impression of Change. FIQ severity categories were modeled and determined using established pain severity cutpoints as an anchor. A total of 2228 patients, mean age 49 years, 93% women, with a mean baseline FIQ total score of 62 were treated in the 3 studies. Estimated MCID on a given measure were similar across the studies. In a pooled analysis the estimated MCID (95% confidence interval) was 14% (13; 15) and for FIQ stiffness it was 13% (12; 14). In the severity analysis a FIQ total score from 0 to or= 39 to or=59 to 100 a severe effect. The analysis indicates that a 14% change in the FIQ total score is clinically relevant, and results of these analyses should enhance the clinical utility of the FIQ in research and practice.
Thiers, Laurie; Louzao, Maite; Ridoux, Vincent; Le Corre, Matthieu; Jaquemet, Sébastien; Weimerskirch, Henri
2014-01-01
In tropical waters resources are usually scarce and patchy, and predatory species generally show specific adaptations for foraging. Tropical seabirds often forage in association with sub-surface predators that create feeding opportunities by bringing prey close to the surface, and the birds often aggregate in large multispecific flocks. Here we hypothesize that frigatebirds, a tropical seabird adapted to foraging with low energetic costs, could be a good predictor of the distribution of their associated predatory species, including other seabirds (e.g. boobies, terns) and subsurface predators (e.g., dolphins, tunas). To test this hypothesis, we compared distribution patterns of marine predators in the Mozambique Channel based on a long-term dataset of both vessel- and aerial surveys, as well as tracking data of frigatebirds. By developing species distribution models (SDMs), we identified key marine areas for tropical predators in relation to contemporaneous oceanographic features to investigate multi-species spatial overlap areas and identify predator hotspots in the Mozambique Channel. SDMs reasonably matched observed patterns and both static (e.g. bathymetry) and dynamic (e.g. Chlorophyll a concentration and sea surface temperature) factors were important explaining predator distribution patterns. We found that the distribution of frigatebirds included the distributions of the associated species. The central part of the channel appeared to be the best habitat for the four groups of species considered in this study (frigatebirds, brown terns, boobies and sub-surface predators).
Directory of Open Access Journals (Sweden)
Laurie Thiers
Full Text Available In tropical waters resources are usually scarce and patchy, and predatory species generally show specific adaptations for foraging. Tropical seabirds often forage in association with sub-surface predators that create feeding opportunities by bringing prey close to the surface, and the birds often aggregate in large multispecific flocks. Here we hypothesize that frigatebirds, a tropical seabird adapted to foraging with low energetic costs, could be a good predictor of the distribution of their associated predatory species, including other seabirds (e.g. boobies, terns and subsurface predators (e.g., dolphins, tunas. To test this hypothesis, we compared distribution patterns of marine predators in the Mozambique Channel based on a long-term dataset of both vessel- and aerial surveys, as well as tracking data of frigatebirds. By developing species distribution models (SDMs, we identified key marine areas for tropical predators in relation to contemporaneous oceanographic features to investigate multi-species spatial overlap areas and identify predator hotspots in the Mozambique Channel. SDMs reasonably matched observed patterns and both static (e.g. bathymetry and dynamic (e.g. Chlorophyll a concentration and sea surface temperature factors were important explaining predator distribution patterns. We found that the distribution of frigatebirds included the distributions of the associated species. The central part of the channel appeared to be the best habitat for the four groups of species considered in this study (frigatebirds, brown terns, boobies and sub-surface predators.
Pharmaceutically important plants used in traditional system of Arab ...
African Journals Online (AJOL)
A study on the pharmaceutical importance of some medicinal pants used for the treatment of livestock ailments was conducted during summer 2010 in different parts of Saudi Arabia, where no such study has been conducted so far. The aim of the study was to identify and document the medicinal plants used for the treatment ...
Berg, Michael B; Lin, Linda; White, Madeleine; Alfonso-Barry, Jacqueline
2017-01-01
The current research aimed to understand differences in smoking-related identity among college students and to illustrate the distinct characteristics of nonidentified smokers (NIS). Students from 2 colleges in Massachusetts (N = 538; April 2016). Respondents reported by online survey whether or not they had smoked a cigarette in the past 30 days and if they self-identified as smokers. Nonsmokers (NIS) and identified smokers (IS) were then compared on their smoking attitudes and behavior. NIS made up 12.5% of the sample and 64% of all tobacco users. NIS perceived themselves as less addicted and were more confident in their ability to quit smoking. They also were less likely to smoke alone, buy their own cigarettes, or have friends who smoked. College health officials can best motivate NIS to quit smoking by focusing on peer norms and the potential of long-term addiction.
Casewell, Nicholas R; Wagstaff, Simon C; Wüster, Wolfgang; Cook, Darren A N; Bolton, Fiona M S; King, Sarah I; Pla, Davinia; Sanz, Libia; Calvete, Juan J; Harrison, Robert A
2014-06-24
Variation in venom composition is a ubiquitous phenomenon in snakes and occurs both interspecifically and intraspecifically. Venom variation can have severe outcomes for snakebite victims by rendering the specific antibodies found in antivenoms ineffective against heterologous toxins found in different venoms. The rapid evolutionary expansion of different toxin-encoding gene families in different snake lineages is widely perceived as the main cause of venom variation. However, this view is simplistic and disregards the understudied influence that processes acting on gene transcription and translation may have on the production of the venom proteome. Here, we assess the venom composition of six related viperid snakes and compare interspecific changes in the number of toxin genes, their transcription in the venom gland, and their translation into proteins secreted in venom. Our results reveal that multiple levels of regulation are responsible for generating variation in venom composition between related snake species. We demonstrate that differential levels of toxin transcription, translation, and their posttranslational modification have a substantial impact upon the resulting venom protein mixture. Notably, these processes act to varying extents on different toxin paralogs found in different snakes and are therefore likely to be as important as ancestral gene duplication events for generating compositionally distinct venom proteomes. Our results suggest that these processes may also contribute to altering the toxicity of snake venoms, and we demonstrate how this variability can undermine the treatment of a neglected tropical disease, snakebite.
Ram, Nilam; Grimm, Kevin J.
2009-01-01
Growth mixture modeling (GMM) is a method for identifying multiple unobserved sub-populations, describing longitudinal change within each unobserved sub-population, and examining differences in change among unobserved sub-populations. We provide a practical primer that may be useful for researchers beginning to incorporate GMM analysis into their…
Functional brain activation differences in stuttering identified with a rapid fMRI sequence
Kraft, Shelly Jo; Choo, Ai Leen; Sharma, Harish; Ambrose, Nicoline G.
2011-01-01
The purpose of this study was to investigate whether brain activity related to the presence of stuttering can be identified with rapid functional MRI (fMRI) sequences that involved overt and covert speech processing tasks. The long-term goal is to develop sensitive fMRI approaches with developmentally appropriate tasks to identify deviant speech motor and auditory brain activity in children who stutter closer to the age at which recovery from stuttering is documented. Rapid sequences may be preferred for individuals or populations who do not tolerate long scanning sessions. In this report, we document the application of a picture naming and phoneme monitoring task in three minute fMRI sequences with adults who stutter (AWS). If relevant brain differences are found in AWS with these approaches that conform to previous reports, then these approaches can be extended to younger populations. Pairwise contrasts of brain BOLD activity between AWS and normally fluent adults indicated the AWS showed higher BOLD activity in the right inferior frontal gyrus (IFG), right temporal lobe and sensorimotor cortices during picture naming and and higher activity in the right IFG during phoneme monitoring. The right lateralized pattern of BOLD activity together with higher activity in sensorimotor cortices is consistent with previous reports, which indicates rapid fMRI sequences can be considered for investigating stuttering in younger participants. PMID:22133409
Directory of Open Access Journals (Sweden)
van den Berg JWK
2006-04-01
Full Text Available Abstract Background Patient-reported outcomes (PRO questionnaires are being increasingly used in COPD clinical studies. The challenge facing investigators is to determine what change is significant, ie what is the minimal clinically important difference (MCID. This study aimed to identify the MCID for the clinical COPD questionnaire (CCQ in terms of patient referencing, criterion referencing, and by the standard error of measurement (SEM. Methods Patients were ≥40 years of age, diagnosed with COPD, had a smoking history of >10 pack-years, and were participating in a randomized, controlled clinical trial comparing intravenous and oral prednisolone in patients admitted with an acute exacerbation of COPD. The CCQ was completed on Days 1–7 and 42. A Global Rating of Change (GRC assessment was taken to establish the MCID by patient referencing. For criterion referencing, health events during a period of 1 year after Day 42 were included in this analysis. Results 210 patients were recruited, 168 completed the CCQ questionnaire on Day42. The MCID of the CCQ total score, as indicated by patient referencing in terms of the GRC, was 0.44. The MCID of the CCQ in terms of criterion referencing for the major outcomes was 0.39, and calculation of the SEM resulted in a value of 0.21. Conclusion This investigation, which is the first to determine the MCID of a PRO questionnaire via more than one approach, indicates that the MCID of the CCQ total score is 0.4.
Genetic screens to identify new Notch pathway mutants in Drosophila.
Giagtzoglou, Nikolaos
2014-01-01
Notch signaling controls a wide range of developmental processes, including proliferation, apoptosis, and cell fate specification during both development and adult tissue homeostasis. The functional versatility of the Notch signaling pathway is tightly linked with the complexity of its regulation in different cellular contexts. To unravel the complexity of Notch signaling, it is important to identify the different components of the Notch signaling pathway. A powerful strategy to accomplish this task is based on genetic screens. Given that the developmental context of signaling is important, these screens should be customized to specific cell populations or tissues. Here, I describe how to perform F1 clonal forward genetic screens in Drosophila to identify novel components of the Notch signaling pathway. These screens combine a classical EMS (ethyl methanesulfonate) chemical mutagenesis protocol along with clonal analysis via FRT-mediated mitotic recombination. These F1 clonal screens allow rapid phenotypic screening within clones of mutant cells induced at specific developmental stages and in tissues of interest, bypassing the pleiotropic effects of isolated mutations. More importantly, since EMS mutations have been notoriously difficult to map to specific genes in the past, I briefly discuss mapping methods that allow rapid identification of the causative mutations.
4C-ker: A Method to Reproducibly Identify Genome-Wide Interactions Captured by 4C-Seq Experiments.
Raviram, Ramya; Rocha, Pedro P; Müller, Christian L; Miraldi, Emily R; Badri, Sana; Fu, Yi; Swanzey, Emily; Proudhon, Charlotte; Snetkova, Valentina; Bonneau, Richard; Skok, Jane A
2016-03-01
4C-Seq has proven to be a powerful technique to identify genome-wide interactions with a single locus of interest (or "bait") that can be important for gene regulation. However, analysis of 4C-Seq data is complicated by the many biases inherent to the technique. An important consideration when dealing with 4C-Seq data is the differences in resolution of signal across the genome that result from differences in 3D distance separation from the bait. This leads to the highest signal in the region immediately surrounding the bait and increasingly lower signals in far-cis and trans. Another important aspect of 4C-Seq experiments is the resolution, which is greatly influenced by the choice of restriction enzyme and the frequency at which it can cut the genome. Thus, it is important that a 4C-Seq analysis method is flexible enough to analyze data generated using different enzymes and to identify interactions across the entire genome. Current methods for 4C-Seq analysis only identify interactions in regions near the bait or in regions located in far-cis and trans, but no method comprehensively analyzes 4C signals of different length scales. In addition, some methods also fail in experiments where chromatin fragments are generated using frequent cutter restriction enzymes. Here, we describe 4C-ker, a Hidden-Markov Model based pipeline that identifies regions throughout the genome that interact with the 4C bait locus. In addition, we incorporate methods for the identification of differential interactions in multiple 4C-seq datasets collected from different genotypes or experimental conditions. Adaptive window sizes are used to correct for differences in signal coverage in near-bait regions, far-cis and trans chromosomes. Using several datasets, we demonstrate that 4C-ker outperforms all existing 4C-Seq pipelines in its ability to reproducibly identify interaction domains at all genomic ranges with different resolution enzymes.
4C-ker: A Method to Reproducibly Identify Genome-Wide Interactions Captured by 4C-Seq Experiments.
Directory of Open Access Journals (Sweden)
Ramya Raviram
2016-03-01
Full Text Available 4C-Seq has proven to be a powerful technique to identify genome-wide interactions with a single locus of interest (or "bait" that can be important for gene regulation. However, analysis of 4C-Seq data is complicated by the many biases inherent to the technique. An important consideration when dealing with 4C-Seq data is the differences in resolution of signal across the genome that result from differences in 3D distance separation from the bait. This leads to the highest signal in the region immediately surrounding the bait and increasingly lower signals in far-cis and trans. Another important aspect of 4C-Seq experiments is the resolution, which is greatly influenced by the choice of restriction enzyme and the frequency at which it can cut the genome. Thus, it is important that a 4C-Seq analysis method is flexible enough to analyze data generated using different enzymes and to identify interactions across the entire genome. Current methods for 4C-Seq analysis only identify interactions in regions near the bait or in regions located in far-cis and trans, but no method comprehensively analyzes 4C signals of different length scales. In addition, some methods also fail in experiments where chromatin fragments are generated using frequent cutter restriction enzymes. Here, we describe 4C-ker, a Hidden-Markov Model based pipeline that identifies regions throughout the genome that interact with the 4C bait locus. In addition, we incorporate methods for the identification of differential interactions in multiple 4C-seq datasets collected from different genotypes or experimental conditions. Adaptive window sizes are used to correct for differences in signal coverage in near-bait regions, far-cis and trans chromosomes. Using several datasets, we demonstrate that 4C-ker outperforms all existing 4C-Seq pipelines in its ability to reproducibly identify interaction domains at all genomic ranges with different resolution enzymes.
Genome-wide association study identified copy number variants important for appendicular lean mass.
Ran, Shu; Liu, Yong-Jun; Zhang, Lei; Pei, Yufang; Yang, Tie-Lin; Hai, Rong; Han, Ying-Ying; Lin, Yong; Tian, Qing; Deng, Hong-Wen
2014-01-01
Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM), is a heritable trait. Copy number variation (CNV) is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2) and 3.34×10(-3), respectively). In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2) and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1), which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL) gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.
Genome-wide association study identified copy number variants important for appendicular lean mass.
Directory of Open Access Journals (Sweden)
Shu Ran
Full Text Available Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM, is a heritable trait. Copy number variation (CNV is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2 and 3.34×10(-3, respectively. In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2 and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1, which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.
The importance of civilian nursing organizations: integrative literature review.
Santos, James Farley Estevam Dos; Santos, Regina Maria Dos; Costa, Laís de Miranda Crispim; Almeida, Lenira Maria Wanderley Santos de; Macêdo, Amanda Cavalcante de; Santos, Tânia Cristina Franco
2016-06-01
to identify and analyze evidence from studies about the importance of civilian nursing organizations. an integrative literature review, for which searches were conducted in the databases LILACS, PubMed/MEDLINE, SciELO, BDENF, and Scopus. sixteen articles published between the years 2004-2013 were selected, 68.75% of which were sourced from Brazilian journals and 31.25% from American journals. civilian nursing organizations are important and necessary, because they have collaborated decisively in nursing struggles in favor of the working class and society in general, and these contributions influence different axes of professional performance.
Lamichhane, Jay Ram; Bischoff-Schaefer, Monika; Bluemel, Sylvia; Dachbrodt-Saaydeh, Silke; Dreux, Laure; Jansen, Jean-Pierre; Kiss, Jozsef; Köhl, Jürgen; Kudsk, Per; Malausa, Thibaut; Messéan, Antoine; Nicot, Philippe C; Ricci, Pierre; Thibierge, Jérôme; Villeneuve, François
2017-01-01
EU agriculture is currently in transition from conventional crop protection to integrated pest management (IPM). Because biocontrol is a key component of IPM, many European countries recently have intensified their national efforts on biocontrol research and innovation (R&I), although such initiatives are often fragmented. The operational outputs of national efforts would benefit from closer collaboration among stakeholders via transnationally coordinated approaches, as most economically important pests are similar across Europe. This paper proposes a common European framework on biocontrol R&I. It identifies generic R&I bottlenecks and needs as well as priorities for three crop types (arable, vegetable and perennial crops). The existing gap between the market offers of biocontrol solutions and the demand of growers, the lengthy and expensive registration process for biocontrol solutions and their varying effectiveness due to variable climatic conditions and site-specific factors across Europe are key obstacles hindering the development and adoption of biocontrol solutions in Europe. Considering arable, vegetable and perennial crops, a dozen common target pests are identified for each type of crop and ranked by order of importance at European level. Such a ranked list indicates numerous topics on which future joint transnational efforts would be justified. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth
2015-01-01
Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.
Identifying clinical course patterns in SMS data using cluster analysis
DEFF Research Database (Denmark)
Kent, Peter; Kongsted, Alice
2012-01-01
ABSTRACT: BACKGROUND: Recently, there has been interest in using the short message service (SMS or text messaging), to gather frequent information on the clinical course of individual patients. One possible role for identifying clinical course patterns is to assist in exploring clinically important...... showed that clinical course patterns can be identified by cluster analysis using all SMS time points as cluster variables. This method is simple, intuitive and does not require a high level of statistical skill. However, there are alternative ways of managing SMS data and many different methods...
Adams, S A; De Bont, A A
2003-01-01
This article analyzes the efforts of three organizations to provide a standard that guides Internet users to reliable health care sites. Comparison of health Internet sites, interviews and document studies. In comparing these approaches, three different constructions of reliability are identified. The resulting possibilities and restrictions of these constructions for users that are searching for health information on the Internet are revealed.
Identifying and managing cross-cultural differences in the classroom ...
African Journals Online (AJOL)
Many learning institutions are now designed to cater to the needs of students and staff from different cultures. The United States International University (USIU) in. Kenya is no different. It provides learning opportunities to learners from different nations and regions of the world. When these learners and other staff come into ...
Computational Approach to Identify Different Injuries by Firearms.
Costa, Sarah Teixeira; Freire, Alexandre Rodrigues; Matoso, Rodrigo Ivo; Daruge Júnior, Eduardo; Rossi, Ana Cláudia; Prado, Felippe Bevilacqua
2017-03-01
Complications arise in the analysis of gunshot wounds to the maxillofacial region, when neither the projectile nor the gun is found at the crime scene. We simulated 5- and 15-cm firing distances at a human mandible to investigate the external morphology of entrance wounds based on fire range. The ammunition models, .40-caliber S&W, .380-caliber, and 9 × 19-mm Luger, were constructed with free-form NURBS surfaces. In a dynamic simulation, projectiles were fired against mandibular body 3D model at 5 and 15 cm. All entrance wounds presented oval aspect. Maximum diameter and von Mises stress values were 16.5 mm and 50.8 MPa, both for .40-caliber S&W fired at 5 cm. The maximum energy loss was 138.4 J for .40 S&W fired at 15 cm. In conclusion, the mandible was most affected by .40-caliber S&W and morphological differences were observable in holes caused by different incoming projectile calibers fired at different distances. © 2017 American Academy of Forensic Sciences.
Directory of Open Access Journals (Sweden)
Taotao Li
2017-02-01
Full Text Available Citrinin is a toxic secondary metabolite of Penicillium citrinum and its contamination in many food items has been widely reported. However, research on the citrinin biosynthesis pathway and its regulation mechanism in P. citrinum is rarely reported. In this study, we investigated the effect of different carbon sources on citrinin production by P. citrinum and used transcriptome analysis to study the underlying molecular mechanism. Our results indicated that glucose, used as the sole carbon source, could significantly promote citrinin production by P. citrinum in Czapek’s broth medium compared with sucrose. A total of 19,967 unigenes were annotated by BLAST in Nr, Nt, Swiss-Prot and Kyoto Encyclopedia of Genes and Genomes (KEGG databases. Transcriptome comparison between P. citrinum cultured with sucrose and glucose revealed 1085 differentially expressed unigenes. Among them, 610 were upregulated while 475 were downregulated under glucose as compared to sucrose. KEGG pathway and Gene ontology (GO analysis indicated that many metabolic processes (e.g., carbohydrate, secondary metabolism, fatty acid and amino acid metabolism were affected, and potentially interesting genes that encoded putative components of signal transduction, stress response and transcription factor were identified. These genes obviously had important impacts on their regulation in citrinin biosynthesis, which provides a better understanding of the molecular mechanism of citrinin biosynthesis by P. citrinum.
How important is importance for prospective memory? A review
Walter, Stefan; Meier, Beat
2014-01-01
Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover...
Cultural Differences in Donation Decision-Making.
Wang, Yan; Tang, Yi-Yuan; Wang, Jinjun
2015-01-01
Decisions to help those in need are essential for human development and survival. Previous studies have demonstrated the "identified effect", in which one identifiable individual typically invokes stronger feelings of compassion and receives greater aid than statistical victim. However, this preference might be influenced by cultural differences. In the current study, Chinese respondents' ratings of distress and sympathy and their willingness to contribute are greater for a group of sick children than an individual. In the U.S., greater willingness to help and sympathy are elicited by an identified victim in comparison with an unidentified one. The different results may demonstrate the importance of cultural differences when trying to understand people's prosocial behavior.
Carbon dioxide emissions due to Swedish imports and consumption: estimates using different methods
International Nuclear Information System (INIS)
Carlsson-Kanyama, Annika; Assefa, Getachew; Wadeskog, Anders
2007-04-01
Global trade of products and services challenges the traditional way in which emissions of carbon dioxide are declared and accounted for. Instead of only considering territorial emissions there are now strong reasons to determine how the carbon dioxide emitted in the production of imports are partitioned around the world and how the total emissions change for a country's final consumption compared to final production. In this report results from four different methods of calculating the total carbon dioxide emissions from Sweden's overall consumption are presented. Total carbon dioxide emissions for Sweden's final consumption vary from 57 to 109 M tons during one year depending on the methodology. The four methods used for estimating these emissions give results of 57, 61, 68 and 109 Mton of carbon dioxide. Two methods are based on information concerning Sweden's imports and our national production of goods and services excluding production that is exported while two methods are based on final consumer expenditures. Three of the methods use mainly emission data from Sweden while one method depends entirely upon emission data from Sweden's trading partners. The last method also gives the highest emissions level, 109 Mton of carbon dioxide. The calculations performed here can be compared to the emissions reported by Sweden, 54 Mton of carbon dioxide per year. Our estimates give per capita emission levels of between 6,3 and 12 tons of carbon dioxide per year. The estimate of 12 tons per capita is a result of using emissions data from Sweden's trading partners. The total emissions as a result of Sweden's imports are 26 or 74 M tons of carbon dioxide depending on how they are calculated. The lower figure is based upon the imports of today but with emissions as if everything was produced as in Sweden. The higher level is based upon using existing but partly inadequate international emission statistics. These levels can be compared to the about 35 M tons of carbon dioxide
Collins, Rebecca L; Haas, Ann; Haviland, Amelia M; Elliott, Marc N
2017-11-01
Some aspects of patient experience are more strongly related to overall ratings of care than others, reflecting their importance to patients. However, little is known about whether the importance of different aspects of this experience differs across subgroups. To determine whether the aspects of health care most important to patients differ according to patient race, ethnicity, and language preference. In response to the 2013 Medicare Consumer Assessment of Health Plans Study (CAHPS) survey, patients rated their overall health care and completed items measuring five patient experience domains. We estimated a linear regression model to assess associations between overall rating of care and the 5 domains, testing for differences in these relationships for race/ethnicity/language groups, controlling for covariates. In total 242,782 Medicare beneficiaries, age 65 years or older. Overall rating of health care, composite patient experience scores for: doctor communication, getting needed care, getting care quickly, customer service, and care coordination. A joint test of the interactions between the composite scores and the 5 largest racial/ethnic/language subgroups was statistically significant (P importance of domains varied across subgroups. Doctor communication had the strongest relationship with care ratings for non-Hispanic whites and English-preferring Hispanics. Getting needed care had the strongest relationship for Spanish-preferring Hispanics and Asian/Pacific Islanders. Doctor communication and getting care quickly were strongest for African Americans. Tailoring quality improvement programs to the factors most important to the racial, ethnic, and language mix of the patient population of the practice, hospital, or plan may more efficiently reduce disparities and improve quality.
Directory of Open Access Journals (Sweden)
Gina Caplen
Full Text Available This is the first time that gait characteristics of broiler (meat chickens have been compared with their progenitor, jungle fowl, and the first kinematic study to report a link between broiler gait parameters and defined lameness scores. A commercial motion-capturing system recorded three-dimensional temporospatial information during walking. The hypothesis was that the gait characteristics of non-lame broilers (n = 10 would be intermediate to those of lame broilers (n = 12 and jungle fowl (n = 10, tested at two ages: immature and adult. Data analysed using multi-level models, to define an extensive range of baseline gait parameters, revealed inter-group similarities and differences. Natural selection is likely to have made jungle fowl walking gait highly efficient. Modern broiler chickens possess an unbalanced body conformation due to intense genetic selection for additional breast muscle (pectoral hypertrophy and whole body mass. Together with rapid growth, this promotes compensatory gait adaptations to minimise energy expenditure and triggers high lameness prevalence within commercial flocks; lameness creating further disruption to the gait cycle and being an important welfare issue. Clear differences were observed between the two lines (short stance phase, little double-support, low leg lift, and little back displacement in adult jungle fowl; much double-support, high leg lift, and substantial vertical back movement in sound broilers presumably related to mass and body conformation. Similarities included stride length and duration. Additional modifications were also identified in lame broilers (short stride length and duration, substantial lateral back movement, reduced velocity presumably linked to musculo-skeletal abnormalities. Reduced walking velocity suggests an attempt to minimise skeletal stress and/or discomfort, while a shorter stride length and time, together with longer stance and double-support phases, are associated
Directory of Open Access Journals (Sweden)
Biljana Rondović
2017-06-01
Full Text Available The purpose of this paper is to show how website evaulations differ if performed by different evaluators despite the same methodological framework being used for the assessment. A quantitative analysis of websites was performed according to the modified evaluation framework based on the 2QCV3Q-model. The AHP method was used for the verification of the weight criteria, while a single-factor ANOVA was used to check the difference in the average scores of the evaluations performed by three groups of evaluators The results obtained by the single-factor ANOVA showed a statistically significant difference in the average scores of internal evaluation when compared to the evaluation done by clients and independent evaluators. The results obtained can be used in the banking industry as guidelines and recommendations for the future design or redesign of websites, as well as a literary base for comparative analyses of this kind in developing countries.
DEFF Research Database (Denmark)
Kristjansdottir, Katrin; Shafiee, Sara; Hvam, Lars
2017-01-01
-toorder (ETO) companies that support gradual implementation of PCS due to large product variety and, several times, higher complexity of products and processes. The overall PCS process can thereby be broken down, and the risk minimised. This paper provides a three-step framework to identify different......Product configuration systems (PCS) play an essential role when providing customised and engineered products efficiently. Literature in the field describes numerous strategies to develop PCS but neglects to identify different application areas. This topic is particularly important for engineer...
Identifying Different Registers of Digital Literacy in Virtual Learning Environments
Knutsson, Ola; Blasjo, Mona.; Hallsten, Stina; Karlstrom, Petter
2012-01-01
In this paper social semiotics, and systemic functional linguistics in particular, are used in order to identify registers of digital literacy in the use of virtual learning environments. The framework of social semiotics provides means to systemize and discuss digital literacy as a linguistic and semiotic issue. The following research question…
Woods, Carl T; Keller, Brad S; McKeown, Ian; Robertson, Sam
2016-09-01
Woods, CT, Keller, BS, McKeown, I, and Robertson, S. A comparison of athletic movement among talent-identified juniors from different football codes in Australia: implications for talent development. J Strength Cond Res 30(9): 2440-2445, 2016-This study aimed to compare the athletic movement skill of talent-identified (TID) junior Australian Rules football (ARF) and soccer players. The athletic movement skill of 17 TID junior ARF players (17.5-18.3 years) was compared against 17 TID junior soccer players (17.9-18.7 years). Players in both groups were members of an elite junior talent development program within their respective football codes. All players performed an athletic movement assessment that included an overhead squat, double lunge, single-leg Romanian deadlift (both movements performed on right and left legs), a push-up, and a chin-up. Each movement was scored across 3 essential assessment criteria using a 3-point scale. The total score for each movement (maximum of 9) and the overall total score (maximum of 63) were used as the criterion variables for analysis. A multivariate analysis of variance tested the main effect of football code (2 levels) on the criterion variables, whereas a 1-way analysis of variance identified where differences occurred. A significant effect was noted, with the TID junior ARF players outscoring their soccer counterparts when performing the overhead squat and push-up. No other criterions significantly differed according to the main effect. Practitioners should be aware that specific sporting requirements may incur slight differences in athletic movement skill among TID juniors from different football codes. However, given the low athletic movement skill noted in both football codes, developmental coaches should address the underlying movement skill capabilities of juniors when prescribing physical training in both codes.
Identifying Cancer Subtypes from miRNA-TF-mRNA Regulatory Networks and Expression Data.
Directory of Open Access Journals (Sweden)
Taosheng Xu
Full Text Available Identifying cancer subtypes is an important component of the personalised medicine framework. An increasing number of computational methods have been developed to identify cancer subtypes. However, existing methods rarely use information from gene regulatory networks to facilitate the subtype identification. It is widely accepted that gene regulatory networks play crucial roles in understanding the mechanisms of diseases. Different cancer subtypes are likely caused by different regulatory mechanisms. Therefore, there are great opportunities for developing methods that can utilise network information in identifying cancer subtypes.In this paper, we propose a method, weighted similarity network fusion (WSNF, to utilise the information in the complex miRNA-TF-mRNA regulatory network in identifying cancer subtypes. We firstly build the regulatory network where the nodes represent the features, i.e. the microRNAs (miRNAs, transcription factors (TFs and messenger RNAs (mRNAs and the edges indicate the interactions between the features. The interactions are retrieved from various interatomic databases. We then use the network information and the expression data of the miRNAs, TFs and mRNAs to calculate the weight of the features, representing the level of importance of the features. The feature weight is then integrated into a network fusion approach to cluster the samples (patients and thus to identify cancer subtypes. We applied our method to the TCGA breast invasive carcinoma (BRCA and glioblastoma multiforme (GBM datasets. The experimental results show that WSNF performs better than the other commonly used computational methods, and the information from miRNA-TF-mRNA regulatory network contributes to the performance improvement. The WSNF method successfully identified five breast cancer subtypes and three GBM subtypes which show significantly different survival patterns. We observed that the expression patterns of the features in some mi
Methods to quantify variable importance: implications for theanalysis of noisy ecological data
Murray, Kim; Conner, Mary M.
2009-01-01
Determining the importance of independent variables is of practical relevance to ecologists and managers concerned with allocating limited resources to the management of natural systems. Although techniques that identify explanatory variables having the largest influence on the response variable are needed to design management actions effectively, the use of various indices to evaluate variable importance is poorly understood. Using Monte Carlo simulations, we compared six different indices c...
Matej Majerič
2016-01-01
The main purpose of this research was to analyse the gender differences among students at the University of Ljubljana in the importance of sport in their lives and the frequency of sport participation. The research was done in the 2013 academic year on a random sample of 3% of the students (N = 1390); a questionnaire about students’ lifestyles was used (Majerič, 2013). In this study, two variables were analysed: the importance of sport in students’ lives and the frequency of sport participati...
Energy Technology Data Exchange (ETDEWEB)
Winderl, C.; Penning, H.; von Netzer, F.; Meckenstock, R.U.; Lueders, T. [Helmholtz Zentrum Munchen, Neuherberg (Germany)
2010-10-15
Global groundwater resources are constantly challenged by a multitude of contaminants such as aromatic hydrocarbons. Especially in anaerobic habitats, a large diversity of unrecognized microbial populations may be responsible for their degradation. Still, our present understanding of the respective microbiota and their ecophysiology is almost exclusively based on a small number of cultured organisms, mostly within the Proteobacteria. Here, by DNA-based stable isotope probing (SIP), we directly identified the most active sulfate-reducing toluene degraders in a diverse sedimentary microbial community originating from a tar-oil-contaminated aquifer at a former coal gasification plant. On incubation of fresh sediments with {sup 13}C{sub 7}-toluene, the production of both sulfide and (CS{sub 2}){sup 13}CO{sub 2} was clearly coupled to the {sup 13}Clabeling of DNA of microbes related to Desulfosporosinus spp. within the Peptococcaceae (Clostridia). The screening of labeled DNA fractions also suggested a novel benzylsuccinate synthase alpha-subunit (bssA) sequence type previously only detected in the environment to be tentatively affiliated with these degraders. However, carbon flow from the contaminant into degrader DNA was only similar to 50%, pointing toward high ratios of heterotrophic CS{sub 2}-fixation during assimilation of acetyl-CoA originating from the contaminant by these degraders. These findings demonstrate that the importance of non-proteobacterial populations in anaerobic aromatics degradation, as well as their specific ecophysiology in the subsurface may still be largely ungrasped.
Chen, Juan; Xu, Juan; Li, Yongsheng; Zhang, Jinwen; Chen, Hong; Lu, Jianping; Wang, Zishan; Zhao, Xueying; Xu, Kang; Li, Yixue; Li, Xia; Zhang, Yan
2017-02-07
Although competing endogenous RNAs (ceRNAs) have been implicated in many solid tumors, their roles in breast cancer subtypes are not well understood. We therefore generated a ceRNA network for each subtype based on the significance of both, positive co-expression and the shared miRNAs, in the corresponding subtype miRNA dys-regulatory network, which was constructed based on negative regulations between differentially expressed miRNAs and targets. All four subtype ceRNA networks exhibited scale-free architecture and showed that the common ceRNAs were at the core of the networks. Furthermore, the common ceRNA hubs had greater connectivity than the subtype-specific hubs. Functional analysis of the common subtype ceRNA hubs highlighted factors involved in proliferation, MAPK signaling pathways and tube morphogenesis. Subtype-specific ceRNA hubs highlighted unique subtype-specific pathways, like the estrogen response and inflammatory pathways in the luminal subtypes or the factors involved in the coagulation process that participates in the basal-like subtype. Ultimately, we identified 29 critical subtype-specific ceRNA hubs that characterized the different breast cancer subtypes. Our study thus provides new insight into the common and specific subtype ceRNA interactions that define the different categories of breast cancer and enhances our understanding of the pathology underlying the different breast cancer subtypes, which can have prognostic and therapeutic implications in the future.
Gene Network for Identifying the Entropy Changes of Different Modules in Pediatric Sepsis
Directory of Open Access Journals (Sweden)
Jing Yang
2016-12-01
Full Text Available Background/Aims: Pediatric sepsis is a disease that threatens life of children. The incidence of pediatric sepsis is higher in developing countries due to various reasons, such as insufficient immunization and nutrition, water and air pollution, etc. Exploring the potential genes via different methods is of significance for the prevention and treatment of pediatric sepsis. This study aimed to identify potential genes associated with pediatric sepsis utilizing analysis of gene network and entropy. Methods: The mRNA expression in the blood samples collected from 20 septic children and 30 healthy controls was quantified by using Affymetrix HG-U133A microarray. Two condition-specific protein-protein interaction networks (PINs, one for the healthy control and the other one for the children with sepsis, were deduced by combining the fundamental human PINs with gene expression profiles in the two phenotypes. Subsequently, distinct modules from the two conditional networks were extracted by adopting a maximal clique-merging approach. Delta entropy (ΔS was calculated between sepsis and control modules. Results: Then, key genes displaying changes in gene composition were identified by matching the control and sepsis modules. Two objective modules were obtained, in which ribosomal protein RPL4 and RPL9 as well as TOP2A were probably considered as the key genes differentiating sepsis from healthy controls. Conclusion: According to previous reports and this work, TOP2A is the potential gene therapy target for pediatric sepsis. The relationship between pediatric sepsis and RPL4 and RPL9 needs further investigation.
Distributed design approach in persistent identifiers systems
Golodoniuc, Pavel; Car, Nicholas; Klump, Jens
2017-04-01
The need to identify both digital and physical objects is ubiquitous in our society. Past and present persistent identifier (PID) systems, of which there is a great variety in terms of technical and social implementations, have evolved with the advent of the Internet, which has allowed for globally unique and globally resolvable identifiers. PID systems have catered for identifier uniqueness, integrity, persistence, and trustworthiness, regardless of the identifier's application domain, the scope of which has expanded significantly in the past two decades. Since many PID systems have been largely conceived and developed by small communities, or even a single organisation, they have faced challenges in gaining widespread adoption and, most importantly, the ability to survive change of technology. This has left a legacy of identifiers that still exist and are being used but which have lost their resolution service. We believe that one of the causes of once successful PID systems fading is their reliance on a centralised technical infrastructure or a governing authority. Golodoniuc et al. (2016) proposed an approach to the development of PID systems that combines the use of (a) the Handle system, as a distributed system for the registration and first-degree resolution of persistent identifiers, and (b) the PID Service (Golodoniuc et al., 2015), to enable fine-grained resolution to different information object representations. The proposed approach solved the problem of guaranteed first-degree resolution of identifiers, but left fine-grained resolution and information delivery under the control of a single authoritative source, posing risk to the long-term availability of information resources. Herein, we develop these approaches further and explore the potential of large-scale decentralisation at all levels: (i) persistent identifiers and information resources registration; (ii) identifier resolution; and (iii) data delivery. To achieve large-scale decentralisation
Importance of life domains in different cultural groups.
Elizur, Dov; Kantor, Jeffrey; Yaniv, Eyal; Sagie, Abraham
2008-01-01
This study assessed the role of individualism and collectivism in the shaping of personal values of Canadians, Israelis, and Palestinians. Based on Sagie and Elizur's (1996) multifaceted approach, we distinguished personal values that are individual centered (i.e., associated with one's home, family, or work) from collective-centered values (i.e., associated with the religion, sports, or politics). The magnitude of the difference between both value types differs according to cultural orientation. As compared with Palestinians, we predicted that Canadians and Israelis would rank individual-centered values higher and collective-centered values lower. Data obtained from samples of Palestinians, Israelis, and Canadians supported this hypothesis.
Directory of Open Access Journals (Sweden)
Boghireddy eSailaja
2015-11-01
Full Text Available In changing climate, heat stress caused by high temperature poses a serious threat to rice cultivation. A multiple organizational analysis at physiological, biochemical and molecular level is required to fully understand the impact of elevated temperature in rice. This study was aimed at deciphering the elevated temperature response in eleven popular and mega rice cultivars widely grown in India. Physiological and biochemical traits specifically membrane thermostability (MTS, antioxidants, and photosynthesis were studied at vegetative and reproductive phases which were used to establish a correlation with grain yield under stress. Several useful traits in different genotypes were identified which will be important resource to develop high temperature tolerant rice cultivars. Interestingly, Nagina22 emerged as best performer in terms of yield as well as expression of physiological and biochemical traits at elevated temperature. It showed lesser relative injury, lesser reduction in chlorophyll content, increased super oxide dismutase, catalase and peroxidase activity, lesser reduction in net photosynthetic rate (PN, high transpiration rate (E and other photosynthetic/ fluorescence parameters contributing to least reduction in spikelet fertility and grain yield at elevated temperature. Further, expression of 14 genes including heat shock transcription factors and heat shock proteins was analyzed in Nagina22 (tolerant and Vandana (susceptible at flowering phase, strengthening the fact that N22 performs better at molecular level also during elevated temperature. This study shows that elevated temperature response is complex and involves multiple biological processes which are needed to be characterized to address the challenges of future climate extreme conditions.
Directory of Open Access Journals (Sweden)
Olga Mestre
Full Text Available Mycobacterium tuberculosis has the remarkable capacity to survive within the hostile environment of the macrophage, and to resist potent antibacterial molecules such as reactive oxygen species (ROS. Thus, understanding mycobacterial resistance mechanisms against ROS may contribute to the development of new anti-tuberculosis therapies. Here we identified genes involved in such mechanisms by screening a high-density transposon mutant library, and we show that several of them are involved in the intracellular lifestyle of the pathogen. Many of these genes were found to play a part in cell envelope functions, further strengthening the important role of the mycobacterial cell envelope in protection against aggressions such as the ones caused by ROS inside host cells.
Identifying behavioural differences in working donkeys in response to analgesic administration.
Regan, F H; Hockenhull, J; Pritchard, J C; Waterman-Pearson, A E; Whay, H R
2016-01-01
To identify pain-related behaviour in working donkeys in order to assist their owners and veterinarians to recognise and manage pain. To identify general and specific behaviours associated with pain or its relief using a trial with the nonsteroidal anti-inflammatory drug meloxicam (Metacam). Observer-blinded, placebo-controlled trial. Forty adult male working donkeys with common clinical abnormalities were randomly assigned to receive either a single loading dose of meloxicam (1.2 mg/kg bwt per os; n = 20) or a placebo (30 mg honey/250 ml water per os; n = 20). Observation of postural and event behaviours was undertaken at 2 pretreatment time points followed by 4 post treatment time points, using scan (instantaneous) and focal sampling. In comparison to pretreatment baselines, donkeys receiving meloxicam were more alert post treatment than the placebo group. They were observed lying down less frequently (P = 0.007), with their eyes closed less frequently (P = 0.04) and having a high head carriage more frequently (P = 0.02). Dozing behaviour decreased after meloxicam compared with the pretreatment baseline (P = 0.03). Donkeys given meloxicam also showed more interest in their environment, turning to look at environmental stimuli more frequently (P = 0.05) than those in the placebo group post treatment. Neither the meloxicam nor the placebo group showed a significant post treatment improvement in lameness scores. Working donkeys receiving meloxicam were more active and alert compared with their pretreatment behaviour, confirming the potential value of nonsteroidal anti-inflammatory drugs in identifying behaviours indicative of pain in working donkeys. Behavioural assessment of pain in working donkeys in field clinic conditions will enable veterinary staff and owners to identify welfare issues promptly and monitor response to analgesia. The Summary is available in Chinese--see Supporting information. © 2015 EVJ Ltd.
Identifying the dominating perceptual differences in headphone reproduction
DEFF Research Database (Denmark)
Volk, Christer Peter; Lavandier, Mathieu; Bech, Søren
2016-01-01
The perceptual differences between the sound reproductions of headphones were investigated in a pair-wise comparison study. Two musical excerpts were reproduced over 21 headphones positioned on a mannequin and recorded. The recordings were then processed and reproduced over one set of headphones ...
Schroeder, Susan A.; Cornicelli, Louis; Fulton, David C.; Merchant, Steven S.
2018-01-01
Although research has advanced methods for clarifying factors that relate to customer satisfaction, they have not been embraced by leisure researchers. Using results from a survey of wild turkey hunters, we applied traditional and revised importance-performance (IPA/RIPA), importance-grid analysis (IGA), and penalty-reward-contrast analysis (PRCA) to examine how activity-specific factors influenced satisfaction. Results suggested differences between the explicit and implicit importance of factors related to turkey hunting. Opportunities to kill turkeys were explicitly rated as less important than seeing, hearing, or calling in turkeys, but opportunities for harvest had relatively higher levels of implicit importance. PRCA identified “calling turkeys in” and “hearing gobbling” as minimum requirements that cause dissatisfaction if not fulfilled, but do not provide satisfaction, whereas “seeing turkeys” and an “opportunity to kill a turkey” related to both satisfaction and dissatisfaction. RIPA, IGA, and PRCA could provide valuable insights about factors that may improve satisfaction for leisure participants.
Ethnic differences in the ability of triglyceride levels to identify insulin resistance.
Sumner, Anne E; Cowie, Catherine C
2008-02-01
The Metabolic Syndrome is used to predict the onset of coronary artery disease and Type 2 diabetes. As the predictive value of the Metabolic Syndrome has been challenged, alternative syndromes have been developed. All of these syndromes were developed in populations that were predominantly non-Hispanic white (NHW). They include the Enlarged Waist Elevated Triglyceride Syndrome, the Overweight-Lipid Syndrome and the Hypertriglyceridemic Waist Syndrome. The first applies to postmenopausal women, the second to overweight individuals (BMI> or =25 kg/m(2)), and the third to men. Each syndrome uses hypertriglyceridemia as a criterion. However, the definition of hypertriglyceridemia varies by syndrome i.e. TG> or =128 mg/dL for the Enlarged Waist Elevated Triglyceride Syndrome, TG> or =130 mg/dL for the Overweight-Lipid Syndrome, > or =150 mg/dL for the Metabolic Syndrome, and TG> or =176 mg/dL for the Hypertriglyceridemic Waist Syndrome. Insulin resistance and hypertriglyceridemia are highly correlated. But as insulin resistant non-Hispanic blacks (NHB) often have triglyceride (TG) levels below the thresholds set by these syndromes, the ability of either TG or these syndromes to identify high risk NHB is unknown. Using the National Health and Nutrition Examination Survey (NHANES) 1999-2002, our goals were to determine by ethnicity: (1) the prevalence of each of these syndromes; (2) the ability of fasting TG concentrations to identify insulin resistance at cut-off levels established by these syndromes, specifically 130, 150 and 176 mg/dL. Participants were 2804 adults from NHANES 1999-2002. The cohort was divided into tertiles of homeostasis model assessment. Insulin resistance was defined as the upper tertile (> or =2.73). The prevalence of each syndrome was lower in NHB than NHW or Mexican Americans (MA) (all Pidentify individuals at high risk for conditions such as cardiovascular disease and Type 2 diabetes, ethnic differences in TG levels should be considered.
Directory of Open Access Journals (Sweden)
Alan J. McMichael BSc
2016-11-01
Full Text Available Symptom report scales are used in clinical practice to monitor patient outcomes. Using them permits the definition of a minimum clinically important difference (MCID beyond which a patient may be judged as having responded to treatment. Despite recommendations that clinicians routinely use MCIDs in clinical practice, statisticians disagree about how MCIDs should be used to evaluate individual patient outcomes and responses to treatment. To address this issue, we asked how clinicians actually use MCIDs to evaluate patient outcomes in response to treatment. Sixty-eight psychiatrists made judgments about whether hypothetical patients had responded to treatment based on their pre- and posttreatment change scores on the widely used Positive and Negative Syndrome Scale. Psychiatrists were provided with the scale’s MCID on which to base their judgments. Our secondary objective was to assess whether knowledge of the patient’s genotype influenced psychiatrists’ responder judgments. Thus, psychiatrists were also informed of whether patients possessed a genotype indicating hyperresponsiveness to treatment. While many psychiatrists appropriately used the MCID, others accepted a far lower posttreatment change as indicative of a response to treatment. When psychiatrists accepted a lower posttreatment change than the MCID, they were less confident in such judgments compared to when a patient’s posttreatment change exceeded the scale’s MCID. Psychiatrists were also less likely to identify patients as responders to treatment if they possessed a hyperresponsiveness genotype. Clinicians should recognize that when judging patient responses to treatment, they often tolerate lower response thresholds than warranted. At least some conflate their judgments with information, such as the patient’s genotype, that is irrelevant to a post hoc response-to-treatment assessment. Consequently, clinicians may be at risk of persisting with treatments that have failed
Identifying key nodes in multilayer networks based on tensor decomposition.
Wang, Dingjie; Wang, Haitao; Zou, Xiufen
2017-06-01
The identification of essential agents in multilayer networks characterized by different types of interactions is a crucial and challenging topic, one that is essential for understanding the topological structure and dynamic processes of multilayer networks. In this paper, we use the fourth-order tensor to represent multilayer networks and propose a novel method to identify essential nodes based on CANDECOMP/PARAFAC (CP) tensor decomposition, referred to as the EDCPTD centrality. This method is based on the perspective of multilayer networked structures, which integrate the information of edges among nodes and links between different layers to quantify the importance of nodes in multilayer networks. Three real-world multilayer biological networks are used to evaluate the performance of the EDCPTD centrality. The bar chart and ROC curves of these multilayer networks indicate that the proposed approach is a good alternative index to identify real important nodes. Meanwhile, by comparing the behavior of both the proposed method and the aggregated single-layer methods, we demonstrate that neglecting the multiple relationships between nodes may lead to incorrect identification of the most versatile nodes. Furthermore, the Gene Ontology functional annotation demonstrates that the identified top nodes based on the proposed approach play a significant role in many vital biological processes. Finally, we have implemented many centrality methods of multilayer networks (including our method and the published methods) and created a visual software based on the MATLAB GUI, called ENMNFinder, which can be used by other researchers.
IDENTIFYING COLLISIONAL FAMILIES IN THE KUIPER BELT
International Nuclear Information System (INIS)
Marcus, Robert A.; Ragozzine, Darin; Murray-Clay, Ruth A.; Holman, Matthew J.
2011-01-01
The identification and characterization of numerous collisional families-clusters of bodies with a common collisional origin-in the asteroid belt has added greatly to the understanding of asteroid belt formation and evolution. More recent study has also led to an appreciation of physical processes that had previously been neglected (e.g., the Yarkovsky effect). Collisions have certainly played an important role in the evolution of the Kuiper Belt as well, though only one collisional family has been identified in that region to date, around the dwarf planet Haumea. In this paper, we combine insights into collisional families from numerical simulations with the current observational constraints on the dynamical structure of the Kuiper Belt to investigate the ideal sizes and locations for identifying collisional families. We find that larger progenitors (r ∼ 500 km) result in more easily identifiable families, given the difficulty in identifying fragments of smaller progenitors in magnitude-limited surveys, despite their larger spread and less frequent occurrence. However, even these families do not stand out well from the background. Identifying families as statistical overdensities is much easier than characterizing families by distinguishing individual members from interlopers. Such identification seems promising, provided the background population is well known. In either case, families will also be much easier to study where the background population is small, i.e., at high inclinations. Overall, our results indicate that entirely different techniques for identifying families will be needed for the Kuiper Belt, and we provide some suggestions.
When is connectivity important? A case study of the spatial pattern of sudden oak death
A. Ellis; T. Vaclavik; R.K. Meentemeyer
2010-01-01
Although connectivity has been examined from many different angles and in many ecological disciplines, few studies have tested in which systems and under what conditions connectivity is important in determining ecological dynamics. Identifying general rules governing when connectivity is important is crucial not only for basic ecology, but also for our ability to...
Peng, Tao; Xue, Chenghai; Bi, Jianning; Li, Tingting; Wang, Xiaowo; Zhang, Xuegong; Li, Yanda
2008-04-26
Alternative splicing expands transcriptome diversity and plays an important role in regulation of gene expression. Previous studies focus on the regulation of a single cassette exon, but recent experiments indicate that multiple cassette exons within a gene may interact with each other. This interaction can increase the potential to generate various transcripts and adds an extra layer of complexity to gene regulation. Several cases of exon interaction have been discovered. However, the extent to which the cassette exons coordinate with each other remains unknown. Based on EST data, we employed a metric of correlation coefficients to describe the interaction between two adjacent cassette exons and then categorized these exon pairs into three different groups by their interaction (correlation) patterns. Sequence analysis demonstrates that strongly-correlated groups are more conserved and contain a higher proportion of pairs with reading frame preservation in a combinatorial manner. Multiple genome comparison further indicates that different groups of correlated pairs have different evolutionary courses: (1) The vast majority of positively-correlated pairs are old, (2) most of the weakly-correlated pairs are relatively young, and (3) negatively-correlated pairs are a mixture of old and young events. We performed a large-scale analysis of interactions between adjacent cassette exons. Compared with weakly-correlated pairs, the strongly-correlated pairs, including both the positively and negatively correlated ones, show more evidence that they are under delicate splicing control and tend to be functionally important. Additionally, the positively-correlated pairs bear strong resemblance to constitutive exons, which suggests that they may evolve from ancient constitutive exons, while negatively and weakly correlated pairs are more likely to contain newly emerging exons.
THE IMPORTANCE OF ‘SIGNIFICANT OTHERS’ IN BRIDGING THE GAPS BETWEEN DIFFERENT READING CONTEXTS
Directory of Open Access Journals (Sweden)
Anna-Karin Svensson
2018-04-01
Full Text Available The current research is an in-depth study of four pre-service teachers’ own experience of reading in various contexts and for different reasons. The aim is to analyse what has been significant regarding reading in a life history perspective by the use of narratives. A socio-cultural perspective on reading is used as analysis tool. The over-arching result from analysing pre-service teachers’ narratives is that reading is a relational process regardless of the context reading takes place in. The emerging themes allow a deeper understanding on critical aspects for developing reading in various contexts and at different levels. Significant others seem important in every reading practice, from new readers in primary school to pre-service teachers’ reading at university level. The narratives reveal a need for bridging the gaps that arise between the reading practices in the various contexts that students meet in school and university.
Rothenfluh, Fabia; Schulz, Peter J
2017-05-01
Physician rating websites (PRWs) offer health care consumers the opportunity to evaluate their doctor anonymously. However, physicians' professional training and experience create a vast knowledge gap in medical matters between physicians and patients. This raises ethical concerns about the relevance and significance of health care consumers' evaluation of physicians' performance. To identify the aspects physician rating websites should offer for evaluation, this study investigated the aspects of physicians and their practice relevant for identifying a good doctor, and whether health care consumers are capable of evaluating these aspects. In a first step, a Delphi study with physicians from 4 specializations was conducted, testing various indicators to identify a good physician. These indicators were theoretically derived from Donabedian, who classifies quality in health care into pillars of structure, process, and outcome. In a second step, a cross-sectional survey with health care consumers in Switzerland (N=211) was launched based on the indicators developed in the Delphi study. Participants were asked to rate the importance of these indicators to identify a good physician and whether they would feel capable to evaluate those aspects after the first visit to a physician. All indicators were ordered into a 4×4 grid based on evaluation and importance, as judged by the physicians and health care consumers. Agreement between the physicians and health care consumers was calculated applying Holsti's method. In the majority of aspects, physicians and health care consumers agreed on what facets of care were important and not important to identify a good physician and whether patients were able to evaluate them, yielding a level of agreement of 74.3%. The two parties agreed that the infrastructure, staff, organization, and interpersonal skills are both important for a good physician and can be evaluated by health care consumers. Technical skills of a doctor and outcomes
Directory of Open Access Journals (Sweden)
Chelo González-Martínez
2015-10-01
Full Text Available Nowadays, there is an increasing need of new skills for PhD students to face the future labour market prospects. PhD graduates must have qualities attractive not only in academia but also outside, in both manufacture and service-oriented enterprises, in small innovative companies, and in the civil services and public administration, among others. To know what the needs of these future employees are, is of great importance to be able to improve their personal and academic formation. The aim of this work was, in the framework of the EC-funded ISEKI_Food 4 network, to evaluate the most desirable specific and soft skills that PhD students should acquire by the end of their doctoral studies. To this aim, several surveys were conducted and sent to the different stakeholders (academia and food industry partners in order to collect the information needed. Results showed that competences related to research skills and techniques, research management, personal effectiveness and communication skills were considered to be the most valuable skills to be acquired by our PhD students to meet the future needs of the labour market. The importance of these skills was appreciated differently, depending on the stakeholder. To sum up, some recommendations to integrate such valuable skills into the curricula of the PhD student are given.
Peters, Susan E; Truong, Anthony P; Johnston, Venerina
2018-01-01
Stakeholders involved in the return-to-work (RTW) process have different roles and qualificationsOBJECTIVE:To explore the perspectives of Australian stakeholders of the RTW barriers and strategies for a worker with an upper extremity condition and a complex workers' compensation case. Using a case vignette, stakeholders were asked to identify barriers and recommend strategies to facilitate RTW. Content analysis was performed on the open-ended responses. The responses were categorised into RTW barriers and strategies using the biopsychosocial model. Pearson's Chi Square and ANOVA were performed to establish group differences. 621 participants (488 healthcare providers (HCPs), 62 employers, 55 insurers and 16 lawyers) identified 36 barriers (31 modifiable): 4 demographic; 8 biological; 15 psychological and 9 social barriers. 484 participants reported 16 RTW strategies: 4 biological; 6 psychological and 6 social strategies. 'Work relationship stressors' (83.4%) and 'Personal relationship stressors' (64.7%) were the most frequently nominated barriers. HCPs most frequently nominated 'Pain management' (49.6%), while employers, insurers and lawyers nominated 'RTW planning/Suitable duties programs' (40.5%; 42.9%; 80%). Stakeholders perceived similar barriers for RTW but recommended different strategies. Stakeholders appeared to be more proficient in identifying barriers than recommending strategies. Future research should focus on tools to both identify RTW barriers and direct intervention.
Johnson, Earl E; Mueller, H Gustav; Ricketts, Todd A
2009-01-01
To determine the amount of importance audiologists place on various items related to their selection of a preferred hearing aid brand manufacturer. Three hundred forty-three hearing aid-dispensing audiologists rated a total of 32 randomized items by survey methodology. Principle component analysis identified seven orthogonal statistical factors of importance. In rank order, these factors were Aptitude of the Brand, Image, Cost, Sales and Speed of Delivery, Exposure, Colleague Recommendations, and Contracts and Incentives. While it was hypothesized that differences among audiologists in the importance ratings of these factors would dictate their preference for a given brand, that was not our finding. Specifically, mean ratings for the six most important factors did not differ among audiologists preferring different brands. A statistically significant difference among audiologists preferring different brands was present, however, for one factor: Contracts and Incentives. Its assigned importance, though, was always lower than that for the other six factors. Although most audiologists have a preferred hearing aid brand, differences in the perceived importance of common factors attributed to brands do not largely determine preference for a particular brand.
Geoscience is Important? Show Me Why
Boland, M. A.
2017-12-01
"The public" is not homogenous and no single message or form of messaging will connect the entire public with the geosciences. One approach to promoting trust in, and engagement with, the geosciences is to identify specific sectors of the public and then develop interactions and communication products that are immediately relevant to that sector's interests. If the content and delivery are appropriate, this approach empowers people to connect with the geosciences on their own terms and to understand the relevance of the geosciences to their own situation. Federal policy makers are a distinct and influential subgroup of the general public. In preparation for the 2016 presidential election, the American Geosciences Institute (AGI) in collaboration with its 51 member societies prepared Geoscience for America's Critical Needs: Invitation to a National Dialogue, a document that identified major geoscience policy issues that should be addressed in a national policy platform. Following the election, AGI worked with eight other geoscience societies to develop Geoscience Policy Recommendations for the New Administration and the 115th Congress, which outlines specific policy actions to address national issues. State and local decision makers are another important subgroup of the public. AGI has developed online content, factsheets, and case studies with different levels of technical complexity so people can explore societally-relevant geoscience topics at their level of technical proficiency. A related webinar series is attracting a growing worldwide audience from many employment sectors. Partnering with government agencies and other scientific and professional societies has increased the visibility and credibility of these information products with our target audience. Surveys and other feedback show that these products are raising awareness of the geosciences and helping to build reciprocal relationships between geoscientists and decision makers. The core message of all
Volgushev, Maxim; Malyshev, Aleksey; Balaban, Pavel; Chistiakova, Marina; Volgushev, Stanislav; Wolf, Fred
2008-01-01
The generation of action potentials (APs) is a key process in the operation of nerve cells and the communication between neurons. Action potentials in mammalian central neurons are characterized by an exceptionally fast onset dynamics, which differs from the typically slow and gradual onset dynamics seen in identified snail neurons. Here we describe a novel method of analysis which provides a quantitative measure of the onset dynamics of action potentials. This method captures the...
Directory of Open Access Journals (Sweden)
Shuo Lin
2018-01-01
Full Text Available Aims. Whether neck circumference (NC could be used as a valuable tool for identifying metabolic syndrome (MS by different criteria in Chinese is still unclear. Methods. We conducted a cross-sectional survey from October 2010 to January 2011 in Shipai community, Guangzhou, Guangdong Province, China. A total of 1473 subjects aged over 50 years were investigated. We measured height, weight, NC, waist circumference, blood pressure, blood glucose, and lipids in all subjects. MS was identified by criteria of the National Cholesterol Education Program-Adult Treatment Panel III (NCEP-ATP III, Chinese Diabetes Society (CDS, and International Diabetes Federation (IDF. Results. Mean NC was 38.0 ± 2.7 cm in men and 34.2 ± 2.5 cm in women. By using receiver operating characteristic curves, the area under the curve (AUC of NC for identifying MS (IDF was 0.823 in men and 0.777 in women, while for identifying MS (CDS, it was 0.788 in men and 0.762 in women. The AUC of NC for diagnosing MS (ATP III was 0.776 in men and 0.752 in women. The optimal cut points of NC for MS were 38.5 cm by three definitions in men, while those were 34.2 cm, 33.4 cm, and 34.0 cm in women by IDF, ATP III, and CDS definitions, respectively. No significant difference was observed between the AUC of NC and BMI for diagnosing MS by using different criteria (all p>0.05. Conclusions. NC is associated with MS by different definitions in Chinese subjects over 50 years old. It may be a useful tool to identify MS in a community population.
Identifying Key Attributes for Protein Beverages.
Oltman, A E; Lopetcharat, K; Bastian, E; Drake, M A
2015-06-01
This study identified key attributes of protein beverages and evaluated effects of priming on liking of protein beverages. An adaptive choice-based conjoint study was conducted along with Kano analysis to gain insight on protein beverage consumers (n = 432). Attributes evaluated included label claim, protein type, amount of protein, carbohydrates, sweeteners, and metabolic benefits. Utility scores for levels and importance scores for attributes were determined. Subsequently, two pairs of clear acidic whey protein beverages were manufactured that differed by age of protein source or the amount of whey protein per serving. Beverages were evaluated by 151 consumers on two occasions with or without priming statements. One priming statement declared "great flavor," the other priming statement declared 20 g protein per serving. A two way analysis of variance was applied to discern the role of each priming statement. The most important attribute for protein beverages was sweetener type, followed by amount of protein, followed by type of protein followed by label claim. Beverages with whey protein, naturally sweetened, reduced sugar and ≥15 g protein per serving were most desired. Three consumer clusters were identified, differentiated by their preferences for protein type, sweetener and amount of protein. Priming statements positively impacted concept liking (P 0.05). Consistent with trained panel profiles of increased cardboard flavor with higher protein content, consumers liked beverages with 10 g protein more than beverages with 20 g protein (6.8 compared with 5.7, P appeal. © 2015 Institute of Food Technologists®
Identifying and evaluating E-procurement in supply chain risk by Fuzzy MADM
Directory of Open Access Journals (Sweden)
Mostafa Memarzade
2012-08-01
Full Text Available E-procurement risks has emerged as an important issue for researchers and practitioners because mitigating supply chain risk helps improve firms’ as well as supply chains’ performance. E-marketplaces have been steadily growing and there have been significant interest in e-business research. There are different risks and uncertainties involved with E-marketplaces, which jeopardizes the sector but we have had a large amount of hype and the business still continue to grow. The primary aim of this study is to identify E-procurement risks and evaluate them using a fuzzy AHP framework. We contribute E-procurement risk by identifying 13 critical criteria and determine four important ones including the extent of acceptable information, interrelationship risk, lack of honesty in relationships and product quality and safety for evaluating suppliers’ risk.
Wong, Ho Ting; Lin, Teng-Kang; Lin, Jen-Jia
2018-06-13
This study aims to assess rural-urban differences in the predictors of emergency ambulance service (EAS) demand and misuse in New Taipei City. Identifying the predictors of EAS demand will help the EAS service managing authority in formulating focused policies to maintain service quality. Over 160,000 electronic EAS usage records were used with a negative binomial regression model to assess rural-urban differences in the predictors of EAS demand and misuse. The factors of 1) ln-transformed population density, 2) percentage of residents who completed up to junior high school education, 3) accessibility of hospitals without an emergency room, and 4) accessibility of EAS were found to be predictors of EAS demand in rural areas, whereas only the factor of percentage of people aged above 65 was found to predict EAS demand in urban areas. For EAS misuse, only the factor of percentage of low-income households was found to be a predictor in rural areas, whereas no predictor was found in the urban areas. Results showed that the factors predicting EAS demand and misuse in rural areas were more complicated compared to urban areas and, therefore, formulating EAS policies for rural areas based on the results of urban studies may not be appropriate. Copyright © 2018. Published by Elsevier B.V.
Learning environments matter: Identifying influences on the motivation to learn science
Directory of Open Access Journals (Sweden)
Salomé Schulze
2015-05-01
Full Text Available In the light of the poor academic achievement in science by secondary school students in South Africa, students' motivation for science learning should be enhanced. It is argued that this can only be achieved with insight into which motivational factors to target, with due consideration of the diversity in schools. The study therefore explored the impact of six motivational factors for science learning in a sample of 380 Grade Nine boys and girls from three racial groups, in both public and independent schools. The students completed the Student Motivation for Science Learning questionnaire. Significant differences were identified between different groups and school types. The study is important for identifying the key role of achievement goals, science learning values and science self-efficacies. The main finding emphasises the significant role played by science teachers in motivating students for science in terms of the learning environments that they create. This has important implications for future research, aimed at a better understanding of these environments. Such insights are needed to promote scientific literacy among the school students, and so contribute to the improvement of science achievement in South Africa.
Cinamon, Rachel Gali; Rich, Yisrael
2002-01-01
Cluster analysis identified 3 groups of individuals who differed systematically on attributions of relative importance to work and to family roles. Participants were 213 married computer workers and lawyers, 126 men and 87 women. Questionnaires gathered data on attributions of importance to life roles, work-family conflict, spousal and managerial…
Import of metal scrap - risks associated with radioactivity
International Nuclear Information System (INIS)
Elert, M.
1992-11-01
There is a growing concern in Sweden for the possibility that imported metal scrap is radioactive. The recent political and economical changes in eastern Europe and the increased cooperation with the CEC has affected Swedens import. In the last years, the import of metal scrap from the former USSR has increased considerably. In view of recent incidents, when radioactive materials have been found, the Swedish Radiation Protection Institute has detected a need for identifying the potential risk sources and evaluating the magnitude of the risk associated with the import of metal scrap. The purpose of this report is to provide some background material concerning import statistics, use of metal scrap in Sweden and to identify potential sources of radioactive metal scrap. In addition, the radionuclides of most concern has been identified and the possibility of detecting them in metal scrap shipments is analyzed
Tang, Shaojun; Hemberg, Martin; Cansizoglu, Ertugrul; Belin, Stephane; Kosik, Kenneth; Kreiman, Gabriel; Steen, Hanno; Steen, Judith
2016-01-01
The ability to integrate 'omics' (i.e., transcriptomics and proteomics) is becoming increasingly important to the understanding of regulatory mechanisms. There are currently no tools available to identify differentially expressed genes (DEGs)across different 'omics'data types or multi-dimensional data including time courses. We present a model capable of simultaneously identifying DEGs from continuous and discrete transcriptomic, proteomic and integrated proteogenomic data. We show that...
Jenkins, Mary G; Ford, Jane B; Morris, Jonathan M; Roberts, Christine L
2014-09-01
Although surveys have identified that women are generally highly satisfied with maternity care provision, those aspects of care that women highlight as most important for achieving satisfaction and a satisfactory maternity care experience have not been reported. The aim of this study was to investigate how women understand and experience their maternity care and to report which aspects of care women highlight as most important. This large qualitative study explored women's expectations and experiences of maternity care provision. In-depth semi-structured interviews were conducted with 53 women experiencing maternity care in a range of tertiary, regional, rural, remote hospitals and midwife-led practices in the state of New South Wales, Australia during 2011-2012. Included in the interview schedule was the question 'What 3 aspects would you see as most important for delivery of maternity care?' Descriptive analyses of entire transcripts and responses to the question on most important aspects of care were undertaken. Descriptive analyses of women's responses identified 5 important aspects of care: woman-focused care, staff qualities, systems and facilities, family-focused care and continuity of care/information. First-time mothers were more likely to identify woman-focused care, staff qualities and continuity of care/information as important aspects than multiparous mothers. Urban and regional mothers highlighted staff qualities as having greater importance for satisfaction with their care while rural and particularly remote women nominated systems and facilities as important. Our study showed that women from a range of settings are more concerned with staff and relational issues than facilities. Differences in perceptions among primiparous versus multiparous women, at different stages of pregnancy and among women from rural and remote compared to urban settings highlight the need to include women with a diversity of experience when trying to understand the aspects
The role of surgeons in identifying emerging technologies for health technology assessment.
Stafinski, Tania; Topfer, Leigh-Ann; Zakariasen, Ken; Menon, Devidas
2010-04-01
Health technology assessment (HTA) is a tool intended to help policy-makers decide which technologies to fund. However, given the proliferation of new technologies, it is not possible to undertake an HTA of each one before it becomes funded. Consequently, "horizon-scanning" processes have been developed to identify emerging technologies that are likely to have a substantial impact on clinical practice. Although the importance of physicians in the adoption of new technologies is well recognized, their role in horizon scanning in Canada has been limited. The purpose of this project was to pilot an approach to engage physicians, specifically surgeons, in provincial horizon-scanning activities. We invited 18 surgeons from Alberta's 2 medical schools to a horizon-scanning workshop to solicit their views on emerging technologies expected to impact surgical practice within the next 5 years and/or the importance of different attributes or characteristics of new technologies. Surgeons, regardless of specialty, identified developments designed to enhance existing minimally invasive surgical techniques, such as endoscopic, robotic and image-guided surgery. Several nonsurgical areas, including molecular genetics and nano technology, were also identified. Of the 13 technology attributes discussed, safety or risk, effectiveness and feasibility were rated as most important. Lastly, participating surgeons expressed an interest in becoming further involved in local HTA initiatives. Surgeons, as adopters and users of health technologies, represent an important and accessible information source for identifying emerging technologies for HTA. A more formal, ongoing relationship between the government, HTA and surgeons may help to optimize the use of HTA resources.
Liesenfeld, David B; Grapov, Dmitry; Fahrmann, Johannes F; Salou, Mariam; Scherer, Dominique; Toth, Reka; Habermann, Nina; Böhm, Jürgen; Schrotz-King, Petra; Gigic, Biljana; Schneider, Martin; Ulrich, Alexis; Herpel, Esther; Schirmacher, Peter; Fiehn, Oliver; Lampe, Johanna W; Ulrich, Cornelia M
2015-08-01
Metabolic and transcriptomic differences between visceral adipose tissue (VAT) and subcutaneous adipose tissue (SAT) compartments, particularly in the context of obesity, may play a role in colorectal carcinogenesis. We investigated the differential functions of their metabolic compositions. Biochemical differences between adipose tissues (VAT compared with SAT) in patients with colorectal carcinoma (CRC) were investigated by using mass spectrometry metabolomics and gene expression profiling. Metabolite compositions were compared between VAT, SAT, and serum metabolites. The relation between patients' tumor stage and metabolic profiles was assessed. Presurgery blood and paired VAT and SAT samples during tumor surgery were obtained from 59 CRC patients (tumor stages I-IV) of the ColoCare cohort. Gas chromatography time-of-flight mass spectrometry and liquid chromatography quadrupole time-of-flight mass spectrometry were used to measure 1065 metabolites in adipose tissue (333 identified compounds) and 1810 metabolites in serum (467 identified compounds). Adipose tissue gene expression was measured by using Illumina's HumanHT-12 Expression BeadChips. Compared with SAT, VAT displayed elevated markers of inflammatory lipid metabolism, free arachidonic acid, phospholipases (PLA2G10), and prostaglandin synthesis-related enzymes (PTGD/PTGS2S). Plasmalogen concentrations were lower in VAT than in SAT, which was supported by lower gene expression of FAR1, the rate-limiting enzyme for ether-lipid synthesis in VAT. Serum sphingomyelin concentrations were inversely correlated (P = 0.0001) with SAT adipose triglycerides. Logistic regression identified lipids in patients' adipose tissues, which were associated with CRC tumor stage. As one of the first studies, we comprehensively assessed differences in metabolic, lipidomic, and transcriptomic profiles between paired human VAT and SAT and their association with CRC tumor stage. We identified markers of inflammation in VAT, which
Component state-based integrated importance measure for multi-state systems
International Nuclear Information System (INIS)
Si, Shubin; Levitin, Gregory; Dui, Hongyan; Sun, Shudong
2013-01-01
Importance measures in reliability engineering are used to identify weak components and/or states in contributing to the reliable functioning of a system. Traditionally, importance measures do not consider the possible effect of groups of transition rates among different component states, which, however, has great effect on the component probability distribution and should therefore be taken into consideration. This paper extends the integrated importance measure (IIM) to estimate the effect of a component residing at certain states on the performance of the entire multi-state systems. This generalization of IIM describes in which state it is most worthy to keep the component to provide the desired level of system performance, and which component is the most important to keep in some state and above for improving the performance of the system. An application to an oil transportation system is presented to illustrate the use of the suggested importance measure
Role of Pediatric Emergency Physicians in Identifying Bullying.
Waseem, Muhammad; Paul, Audrey; Schwartz, Gerald; Pauzé, Denis; Eakin, Paul; Barata, Isabel; Holtzman, Doug; Benjamin, Lee S; Wright, Joseph L; Nickerson, Amanda B; Joseph, Madeline
2017-02-01
Bullying is an important public health issue with broad implications. Although this issue has been studied extensively, there is limited emergency medicine literature addressing bullying. The emergency department (ED) physician has a unique opportunity to identify children and adolescents that are victims of bullying, and make a difference in their lives. Our aim is to discuss the role of the emergency physician (EP) in identifying patients who have been victims of bullying and how to provide effective management as well as referral for further resources. This document provides a framework for recognizing, stabilizing, and managing children who have experienced bullying. With the advent of social media, bullying behavior is not limited to in-person situations, and often occurs via electronic communication, further complicating recognition because it may not impart any physical harm to the child. Recognition of bullying requires a high level of suspicion, as patients may not offer this history. After the stabilization of any acute or overt indications of physical injury, along with obtaining a history of the mechanism of injury, the EP has the opportunity to identify the existence of bullying as the cause of the injury, and can address the issue in the ED while collaborating with "physician-extenders," such as social workers, toward identifying local resources for further support. The ED is an important arena for the assessment and management of children who have experienced bullying. It is imperative that EPs on the front lines of patient care address this public health epidemic. They have the opportunity to exert a positive impact on the lives of the children and families who are the victims of bullying. Copyright © 2016 Elsevier Inc. All rights reserved.
Importance Sampling for Stochastic Timed Automata
DEFF Research Database (Denmark)
Jegourel, Cyrille; Larsen, Kim Guldstrand; Legay, Axel
2016-01-01
We present an importance sampling framework that combines symbolic analysis and simulation to estimate the probability of rare reachability properties in stochastic timed automata. By means of symbolic exploration, our framework first identifies states that cannot reach the goal. A state-wise cha......We present an importance sampling framework that combines symbolic analysis and simulation to estimate the probability of rare reachability properties in stochastic timed automata. By means of symbolic exploration, our framework first identifies states that cannot reach the goal. A state...
Veturi, Yogasudha; Ritchie, Marylyn D
2018-01-01
Transcriptome-wide association studies (TWAS) have recently been employed as an approach that can draw upon the advantages of genome-wide association studies (GWAS) and gene expression studies to identify genes associated with complex traits. Unlike standard GWAS, summary level data suffices for TWAS and offers improved statistical power. Two popular TWAS methods include either (a) imputing the cis genetic component of gene expression from smaller sized studies (using multi-SNP prediction or MP) into much larger effective sample sizes afforded by GWAS - TWAS-MP or (b) using summary-based Mendelian randomization - TWAS-SMR. Although these methods have been effective at detecting functional variants, it remains unclear how extensive variability in the genetic architecture of complex traits and diseases impacts TWAS results. Our goal was to investigate the different scenarios under which these methods yielded enough power to detect significant expression-trait associations. In this study, we conducted extensive simulations based on 6000 randomly chosen, unrelated Caucasian males from Geisinger's MyCode population to compare the power to detect cis expression-trait associations (within 500 kb of a gene) using the above-described approaches. To test TWAS across varying genetic backgrounds we simulated gene expression and phenotype using different quantitative trait loci per gene and cis-expression /trait heritability under genetic models that differentiate the effect of causality from that of pleiotropy. For each gene, on a training set ranging from 100 to 1000 individuals, we either (a) estimated regression coefficients with gene expression as the response using five different methods: LASSO, elastic net, Bayesian LASSO, Bayesian spike-slab, and Bayesian ridge regression or (b) performed eQTL analysis. We then sampled with replacement 50,000, 150,000, and 300,000 individuals respectively from the testing set of the remaining 5000 individuals and conducted GWAS on each
International Nuclear Information System (INIS)
Golubovskaya, Vita M.; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G.
2014-01-01
Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53 +/+ and p53 −/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53 +/+ cells but not in p53 −/− cells. Among up-regulated genes in HCT p53 +/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53 +/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach
International Nuclear Information System (INIS)
Sasamoto, Hiroshi; Wilson, James; Sato, Tsutomu
2013-01-01
Performance assessment of geological disposal systems for high-level radioactive waste requires a consideration of long-term systems behaviour. It is possible that the alteration of swelling clay present in bentonite buffers might have an impact on buffer functions. In the present study, iron (as a candidate overpack material)-bentonite (I-B) interactions were evaluated as the main buffer alteration scenario. Existing knowledge on alteration of bentonite during I-B interactions was first reviewed, then the evaluation methodology was developed considering modeling techniques previously used overseas. A conceptual model for smectite alteration during I-B interactions was produced. The following reactions and processes were selected: 1) release of Fe 2+ due to overpack corrosion; 2) diffusion of Fe 2+ in compacted bentonite; 3) sorption of Fe 2+ on smectite edge and ion exchange in interlayers; 4) dissolution of primary phases and formation of alteration products. Sensitivity analyses were performed to identify the most important factors for the alteration of bentonite by I-B interactions. (author)
Danner, Unna N; Sternheim, Lot; Evers, Catharine
2014-03-30
People with eating disorders (ED) have difficulties regulating their emotions adaptively. Little is known about differences and similarities between different types of ED and how these regulation difficulties relate to other emotional problems. The present study examines maladaptive (suppression) and adaptive (cognitive reappraisal) emotion regulation strategies in women with different ED and relationships with anxiety and depression levels. In 32 women with AN restrictive subtype (ANR), 32 with AN binge-purge subtype (ANBP), 30 with bulimia nervosa (BN), 29 with binge eating disorder (BED), and 64 healthy women, the ERQ (emotion regulation) as well as STAI-T (anxiety), BDI-SF (depression), and EDDS (eating pathology) were administered. Women across different ED subtypes were inclined to suppress emotions and lacked the capacity to reappraise emotions (except women with ANBP). Correlational relations of suppression and reappraisal with anxiety and depression levels differed across ED groups. Emotion regulation problems were found across ED subtypes. However, the types of emotion regulation problems, and the effect of coexisting other emotional problems such as anxiety and depression may differ across ED subtypes. These findings illustrate the importance to of considering ED subtypes in emotion regulation research rather than consider ED as a whole. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Public and Private Sector IT Governance: Identifying Contextual Differences
Directory of Open Access Journals (Sweden)
John Campbell
2010-01-01
Full Text Available This paper highlights systemic contextual differences and the unique IT Governance issues that might arise in public and private sector organizations. Public sector organizations constitute a significant component of economic activity in most countries. Like their private sector counterparts, many public sector agencies are struggling to cope with reduced or inadequate IT budgets and are continuously looking for ways to extract maximum value from IT resources. While both sectors face similar managerial-level IT issues and challenges, we argue that there are systemic differences between private and public sector organizations suggesting that a one size fits all approach to IT Governance may not apply.
Schwind, Julie; Learman, Kenneth; O'Halloran, Bryan; Showalter, Christopher; Cook, Chad
2013-05-01
Minimal clinically important difference (MCID) scores for outcome measures are frequently used evidence-based guides to gage meaningful changes. There are numerous outcome instruments used for analyzing pain, disability, and dysfunction of the low back; perhaps the most common of these is the Oswestry disability index (ODI). A single agreed-upon MCID score for the ODI has yet to be established. What is also unknown is whether selected baseline variables will be universal predictors regardless of the MCID used for a particular outcome measure. To explore the relationship between predictive models and the MCID cutpoint on the ODI. Data were collected from 16 outpatient physical therapy clinics in 10 states. Secondary database analysis using backward stepwise deletion logistic regression of data from a randomized controlled trial (RCT) to create prognostic clinical prediction rules (CPR). One hundred and forty-nine patients with low back pain (LBP) were enrolled in the RCT. All were treated with manual therapy, with a majority also receiving spine-strengthening exercises. The resultant predictive models were dependent upon the MCID used and baseline sample characteristics. All CPR were statistically significant (P < 001). All six MCID cutpoints used resulted in completely different significant predictor variables with no predictor significant across all models. The primary limitations include sub-optimal sample size and study design. There is extreme variability among predictive models created using different MCIDs on the ODI within the same patient population. Our findings highlight the instability of predictive modeling, as these models are significantly affected by population baseline characteristics along with the MCID used. Clinicians must be aware of the fragility of CPR prior to applying each in clinical practice.
Interspecies comparison of probiotics isolated from different animals
Directory of Open Access Journals (Sweden)
Amr M. Abdou
2018-02-01
Full Text Available Aim: The aim of the current study was to isolate and identify naturally occurring probiotic Lactobacillus species in different animals with the different environmental background including fish, and farm animals to investigate interspecies differences in probiotics on the species level. Materials and Methods: A total of 44 fecal and milk samples were collected under aseptic conditions from cattle, buffalo, camel, sheep, goats, and fish. The samples were cultured, and the isolated strains were confirmed biochemically and molecularly using 16S rRNA multiplex polymerase chain reaction (PCR analysis following DNA extraction from the bacterial isolates. Results: A total of 31 isolates identified as lactobacilli were isolated from cattle milk, goat feces, sheep feces, fish feces, buffalo milk, camel milk, and goats' milk. Lactobacillus species were identified based on the size of the PCR product. The results showed that different species were different in their lactobacilli content. At the same time, there were some differences between individuals of the same species. Conclusion: The diversity of probiotic strains isolated from different animal species implies different types of benefits to the host. Although it would be both money - and time-consuming research, discovering the benefit of each of these strains may provide very important information for the health of both human and animal. Furthermore, transferring these beneficial effects either to individuals within the same species or between different species would be of great importance.
DEFF Research Database (Denmark)
Sol, E-ri Maria; Wagner, Sebastian A; Weinert, Brian T
2012-01-01
Lysine acetylation is a posttranslational modification that is dynamically regulated by the activity of acetyltransferases and deacetylases. The human and mouse genomes encode 18 different lysine deacetylases (KDACs) which are key regulators of many cellular processes. Identifying substrates...... of KDACs and pinpointing the regulated acetylation sites on target proteins may provide important information about the molecular basis of their functions. Here we apply quantitative proteomics to identify endogenous substrates of the mitochondrial deacetylase Sirtuin 3 (Sirt3) by comparing site...... by modulating acetylation on diverse substrates. The experimental strategy described here is generic and can be applied to identify endogenous substrates of other lysine deacetylases....
Proteogenomic Analysis Identifies a Novel Human SHANK3 Isoform
Directory of Open Access Journals (Sweden)
Fahad Benthani
2015-05-01
Full Text Available Mutations of the SHANK3 gene have been associated with autism spectrum disorder. Individuals harboring different SHANK3 mutations display considerable heterogeneity in their cognitive impairment, likely due to the high SHANK3 transcriptional diversity. In this study, we report a novel interaction between the Mutated in colorectal cancer (MCC protein and a newly identified SHANK3 protein isoform in human colon cancer cells and mouse brain tissue. Hence, our proteogenomic analysis identifies a new human long isoform of the key synaptic protein SHANK3 that was not predicted by the human reference genome. Taken together, our findings describe a potential new role for MCC in neurons, a new human SHANK3 long isoform and, importantly, highlight the use of proteomic data towards the re-annotation of GC-rich genomic regions.
Alves, Manuela; Rodrigues, Cristina S.; Rocha, Ana Maria A. C.; Coutinho, Clara
2016-01-01
The accomplishment in mathematics has gained attention from educators and arises as an emerging field of study, including in engineering education. However, in Portugal, there is still incipient research in the area; so it is high time to explore factors that might enlighten the gap in the study of the relationship between Portuguese engineering students and the learning of mathematics. The main purpose of this study is to explore three factors identified in the literature as influencing the learning of mathematical concepts - self-efficacy, anxiety towards mathematics and perceived importance of mathematics - and search for differences by gender and by type of engineering course, a dimension not much reported in the literature but which was revealed as important in the team's previous research. Based on a sample of 140 undergraduate students of different engineering courses from University of Minho, results only identify differences in the type of course and not in gender. These results constitute a contribution and open new paths for future research in the engineering education.
Lovrić, Robert; Prlić, Nada; Zec, Davor; Pušeljić, Silvija; Žvanut, Boštjan
2015-01-01
The students' assessment of clinical faculty competencies and the faculty members' self-assessment can provide important information about nursing clinical education. The aim of this study was to identify the differences between the students' assessment of the clinical faculty member's competencies and the faculty member's self-assessment. These differences can reveal interesting insights relevant for improving clinical practice.
Differences Between British and Americans’ Cultures in Values
Institute of Scientific and Technical Information of China (English)
潘巍巍; 戴立黎
2008-01-01
<正>Values are the most important issue in identifying one particular culture.Social values are the feelings people have about what is important,worthwhile,and just.In this paper,the differences between British and American values are discussed in two aspects which mainly lie respectively in the comparisons of values and characteristics in both cultures.
Bockoven, Alison A; Coates, Craig J; Eubanks, Micky D
2017-11-01
Among social insects, colony-level variation is likely to be widespread and has significant ecological consequences. Very few studies, however, have documented how genetic factors relate to behaviour at the colony level. Differences in expression of the foraging gene have been associated with differences in foraging and activity of a wide variety of organisms. We quantified expression of the red imported fire ant foraging gene (sifor) in workers from 21 colonies collected across the natural range of Texas fire ant populations, but maintained under standardized, environmentally controlled conditions. Colonies varied significantly in their behaviour. The most active colonies had up to 10 times more active foragers than the least active colony and more than 16 times as many workers outside the nest. Expression differences among colonies correlated with this colony-level behavioural variation. Colonies with higher sifor expression in foragers had, on average, significantly higher foraging activity, exploratory activity and recruitment to nectar than colonies with lower expression. Expression of sifor was also strongly correlated with worker task (foraging vs. working in the interior of the nest). These results provide insight into the genetic and physiological processes underlying collective differences in social behaviour. Quantifying variation in expression of the foraging gene may provide an important tool for understanding and predicting the ecological consequences of colony-level behavioural variation. © 2017 John Wiley & Sons Ltd.
Bugs, Cristhian A; Librelotto, Giovani R; Mombach, José C M
2011-12-22
We introduce a method to analyze the states of regulatory Boolean models that identifies important network states and their biological influence on the global network dynamics. It consists in (1) finding the states of the network that are most frequently visited and (2) the identification of variable and frozen nodes of the network. The method, along with a simulation that includes random features, is applied to the study of stomata closure by abscisic acid (ABA) in A. thaliana proposed by Albert and coworkers. We find that for the case of study, that the dynamics of wild and mutant networks have just two states that are highly visited in their space of states and about a third of all nodes of the wild network are variable while the rest remain frozen in True or False states. This high number of frozen elements explains the low cardinality of the space of states of the wild network. Similar results are observed in the mutant networks. The application of the method allowed us to explain how wild and mutants behave dynamically in the SS and determined an essential feature of the activation of the closure node (representing stomata closure), i.e. its synchronization with the AnionEm node (representing anion efflux at the plasma membrane). The dynamics of this synchronization explains the efficiency reached by the wild and each of the mutant networks. For the biological problem analyzed, our method allows determining how wild and mutant networks differ 'phenotypically'. It shows that the different efficiencies of stomata closure reached among the simulated wild and mutant networks follow from a dynamical behavior of two nodes that are always synchronized. Additionally, we predict that the involvement of the anion efflux at the plasma membrane is crucial for the plant response to ABA. The algorithm used in the simulations is available upon request.
Quantifying the relative irreplaceability of important bird and biodiversity areas.
Di Marco, Moreno; Brooks, Thomas; Cuttelod, Annabelle; Fishpool, Lincoln D C; Rondinini, Carlo; Smith, Robert J; Bennun, Leon; Butchart, Stuart H M; Ferrier, Simon; Foppen, Ruud P B; Joppa, Lucas; Juffe-Bignoli, Diego; Knight, Andrew T; Lamoreux, John F; Langhammer, Penny F; May, Ian; Possingham, Hugh P; Visconti, Piero; Watson, James E M; Woodley, Stephen
2016-04-01
World governments have committed to increase the global protected areas coverage by 2020, but the effectiveness of this commitment for protecting biodiversity depends on where new protected areas are located. Threshold- and complementarity-based approaches have been independently used to identify important sites for biodiversity. We brought together these approaches by performing a complementarity-based analysis of irreplaceability in important bird and biodiversity areas (IBAs), which are sites identified using a threshold-based approach. We determined whether irreplaceability values are higher inside than outside IBAs and whether any observed difference depends on known characteristics of the IBAs. We focused on 3 regions with comprehensive IBA inventories and bird distribution atlases: Australia, southern Africa, and Europe. Irreplaceability values were significantly higher inside than outside IBAs, although differences were much smaller in Europe than elsewhere. Higher irreplaceability values in IBAs were associated with the presence and number of restricted-range species; number of criteria under which the site was identified; and mean geographic range size of the species for which the site was identified (trigger species). In addition, IBAs were characterized by higher irreplaceability values when using proportional species representation targets, rather than fixed targets. There were broadly comparable results when measuring irreplaceability for trigger species and when considering all bird species, which indicates a good surrogacy effect of the former. Recently, the International Union for Conservation of Nature has convened a consultation to consolidate global standards for the identification of key biodiversity areas (KBAs), building from existing approaches such as IBAs. Our results informed this consultation, and in particular a proposed irreplaceability criterion that will allow the new KBA standard to draw on the strengths of both threshold- and
Barbour, Elie K; Itani, Houssam H; Sleiman, Fawwak T; Saade, Maya F; Harakeh, Steve; Nour, Afif M Abdel; Shaib, Houssam A
2012-01-01
Three objectives were included in this research work. The first objective compared different immune components in healthy mature males, mature females, and female kids of local and imported Saanen goats, reared under a sub-tropical environment. The significantly differing immune components were the blood monocyte percent, blood CD8 count, and the total white blood cell count. The second objective compared the performance of Saanen versus local does. The means of the milk yield and prolificacy of the imported Saanen does were significantly higher than those of the local does (pgoats on protection potential against prevalent diseases in the sub-tropical zone of the eastern Mediterranean countries is discussed.
Directory of Open Access Journals (Sweden)
Laraine Winter
2016-01-01
Full Text Available Purpose: This study aimed to identify the sequelae of traumatic brain injury (TBI that are most troubling to veterans with TBI and their families and identify veteran-family differences in content and ranking. Instead of standardized measures of symptom frequency or severity, which may be insensitive to change or intervention effects, we used a target outcome measure for veterans with TBI and their key family members, which elicited open-ended reports concerning the three most serious TBI-related problems. This was followed by Likert-scaled ratings of difficulty in managing the problem. Methods: In this cross-sectional study, interviews were conducted in veterans’ homes. Participants included 83 veterans with TBI diagnosed at a Veterans Affairs medical rehabilitation service and a key family member of each veteran. We utilized open-ended questions to determine the problems caused by TBI within the last month. Sociodemographic characteristics of veterans and family members, and veterans’ military and medical characteristics were collected. A coding scheme was developed to categorize open-ended responses. Results: Families identified nearly twice as many categories of problems as did veterans, and veterans and families ranked problem categories very differently. Veterans ranked cognitive and physical problems worst; families ranked emotional and interpersonal problems worst. Conclusions: Easily administered open-ended questions about the most troubling TBI-related problems yield novel insights and reveal important veteran-family discrepancies.
Directory of Open Access Journals (Sweden)
Su Zhen
2011-07-01
Full Text Available Abstract Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants.
2011-01-01
Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants. PMID:21718548
Morgan, Kerri A; Engsberg, Jack R; Gray, David B
2017-01-01
The purpose of this project was to identify wheelchair skills currently being taught to new manual wheelchair users, identify areas of importance for manual wheelchair skills' training during initial rehabilitation, identify similarities and differences between the perspectives of health care professionals and manual wheelchair users and use the ICF to organize themes related to rehabilitation and learning how to use a manual wheelchair. Focus groups were conducted with health care professionals and experienced manual wheelchair users. ICF codes were used to identify focus group themes. The Activities and Participation codes were more frequently used than Structure, Function and Environment codes. Wheelchair skills identified as important for new manual wheelchair users included propulsion techniques, transfers in an out of the wheelchair, providing maintenance to the wheelchair and navigating barriers such as curbs, ramps and rough terrain. Health care professionals and manual wheelchair users identified the need to incorporate the environment (home and community) into the wheelchair training program. Identifying essential components for training the proper propulsion mechanics and wheelchair skills in new manual wheelchair users is an important step in preventing future health and participation restrictions. Implications for Rehabilitation Wheelchair skills are being addressed frequently during rehabilitation at the activity-dependent level. Propulsion techniques, transfers in an out of the wheelchair, providing maintenance to the wheelchair and navigating barriers such as curbs, ramps and rough terrain are important skills to address during wheelchair training. Environment factors (in the home and community) are important to incorporate into wheelchair training to maximize safe and multiple-environmental-setting uses of manual wheelchairs. The ICF has application to understanding manual wheelchair rehabilitation for wheelchair users and therapists for improving
International Nuclear Information System (INIS)
Huo Hong; Zhang Qiang; He Kebin; Yao Zhiliang; Wang Xintong; Zheng Bo; Streets, David G.; Wang Qidong; Ding Yan
2011-01-01
We propose a method to simulate vehicle emissions in Chinese cities of different sizes and development stages. Twenty two cities are examined in this study. The target year is 2007. Among the cities, the vehicle emission factors were remarkably different (the highest is 50-90% higher than the lowest) owing to their distinct local features and vehicle technology levels, and the major contributors to total vehicle emissions were also different. A substantial increase in vehicle emissions is foreseeable unless stronger measures are implemented because the benefit of current policies can be quickly offset by the vehicle growth. Major efforts should be focused on all cities, especially developing cities where the requirements are lenient. This work aims a better understanding of vehicle emissions in all types of Chinese cities. The proposed method could benefit national emission inventory studies in improving accuracy and help in designing national and local policies for vehicle emission control. - Highlights: → We examine vehicle emissions in 22 Chinese cities of different types and locations. → Vehicle emission factors of the cities differ by 50-90% due to distinct local features. → Each vehicle type contributes differently to total emissions among the cities. → A substantial increase in vehicle emissions in most Chinese cities is foreseeable. → City-specific fleet and local features are important in research and policy making. - Vehicle emission characteristics of Chinese cities are remarkably different, and local features need to be taken into account in vehicle emission studies and control strategy.
Olsen, Svein Ottar; Tuu, Ho Huu; Grunert, Klaus G
2017-10-01
The main purpose of this study is to identify consumer segments based on the importance of product attributes when buying seafood for homemade meals on weekdays. There is a particular focus on the relative importance of the packaging attributes of fresh seafood. The results are based on a representative survey of 840 Norwegian consumers between 18 and 80 years of age. This study found that taste, freshness, nutritional value and naturalness are the most important attributes for the home consumption of seafood. Except for the high importance of information about expiration date, most other packaging attributes have only medium importance. Three consumer segments are identified based on the importance of 33 attributes associated with seafood: Perfectionists, Quality Conscious and Careless Consumers. The Quality Conscious consumers feel more self-confident in their evaluation of quality, and are less concerned with packaging, branding, convenience and emotional benefits compared to the Perfectionists. Careless Consumers are important as regular consumers of convenient and pre-packed seafood products and value recipe information on the packaging. The seafood industry may use the results provided in this study to strengthen their positioning of seafood across three different consumer segments. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Simonete Silva
Full Text Available Children from developed and developing countries differ in their body size and shape due to marked differences across their life history caused by social, economic and cultural differences which are also linked to their motor performance (MP. We used allometric models to identify size/shape characteristics associated with MP tests between Brazilian and Peruvian schoolchildren. A total of 4,560 subjects, 2,385 girls and 2,175 boys aged 9-15 years were studied. Height and weight were measured; biological maturation was estimated with the maturity offset technique; MP measures included the 12 minute run (12MR, handgrip strength (HG, standing long jump (SLJ and the shuttle run speed (SR tests; physical activity (PA was assessed using the Baecke questionnaire. A multiplicative allometric model was adopted to adjust for body size differences across countries. Reciprocal ponderal index (RPI was found to be the most suitable body shape indicator associated with the 12MR, SLJ, HG and SR performance. A positive maturation offset parameter was also associated with a better performance in SLJ, HG and SR tests. Sex differences were found in all motor tests. Brazilian youth showed better scores in MP than their Peruvian peers, even when controlling for their body size differences The current study identified the key body size associated with four body mass-dependent MP tests. Biological maturation and PA were associated with strength and motor performance. Sex differences were found in all motor tests, as well as across countries favoring Brazilian children even when accounting for their body size/shape differences.
Silva, Simonete; Bustamante, Alcibíades; Nevill, Alan; Katzmarzyk, Peter T; Freitas, Duarte; Prista, António; Maia, José
2016-01-01
Children from developed and developing countries differ in their body size and shape due to marked differences across their life history caused by social, economic and cultural differences which are also linked to their motor performance (MP). We used allometric models to identify size/shape characteristics associated with MP tests between Brazilian and Peruvian schoolchildren. A total of 4,560 subjects, 2,385 girls and 2,175 boys aged 9-15 years were studied. Height and weight were measured; biological maturation was estimated with the maturity offset technique; MP measures included the 12 minute run (12MR), handgrip strength (HG), standing long jump (SLJ) and the shuttle run speed (SR) tests; physical activity (PA) was assessed using the Baecke questionnaire. A multiplicative allometric model was adopted to adjust for body size differences across countries. Reciprocal ponderal index (RPI) was found to be the most suitable body shape indicator associated with the 12MR, SLJ, HG and SR performance. A positive maturation offset parameter was also associated with a better performance in SLJ, HG and SR tests. Sex differences were found in all motor tests. Brazilian youth showed better scores in MP than their Peruvian peers, even when controlling for their body size differences The current study identified the key body size associated with four body mass-dependent MP tests. Biological maturation and PA were associated with strength and motor performance. Sex differences were found in all motor tests, as well as across countries favoring Brazilian children even when accounting for their body size/shape differences.
Silva, Simonete; Bustamante, Alcibíades; Nevill, Alan; Katzmarzyk, Peter T.; Freitas, Duarte; Prista, António; Maia, José
2016-01-01
Children from developed and developing countries differ in their body size and shape due to marked differences across their life history caused by social, economic and cultural differences which are also linked to their motor performance (MP). We used allometric models to identify size/shape characteristics associated with MP tests between Brazilian and Peruvian schoolchildren. A total of 4,560 subjects, 2,385 girls and 2,175 boys aged 9–15 years were studied. Height and weight were measured; biological maturation was estimated with the maturity offset technique; MP measures included the 12 minute run (12MR), handgrip strength (HG), standing long jump (SLJ) and the shuttle run speed (SR) tests; physical activity (PA) was assessed using the Baecke questionnaire. A multiplicative allometric model was adopted to adjust for body size differences across countries. Reciprocal ponderal index (RPI) was found to be the most suitable body shape indicator associated with the 12MR, SLJ, HG and SR performance. A positive maturation offset parameter was also associated with a better performance in SLJ, HG and SR tests. Sex differences were found in all motor tests. Brazilian youth showed better scores in MP than their Peruvian peers, even when controlling for their body size differences The current study identified the key body size associated with four body mass-dependent MP tests. Biological maturation and PA were associated with strength and motor performance. Sex differences were found in all motor tests, as well as across countries favoring Brazilian children even when accounting for their body size/shape differences. PMID:26939118
Identifying Corridors among Large Protected Areas in the United States.
Directory of Open Access Journals (Sweden)
R Travis Belote
Full Text Available Conservation scientists emphasize the importance of maintaining a connected network of protected areas to prevent ecosystems and populations from becoming isolated, reduce the risk of extinction, and ultimately sustain biodiversity. Keeping protected areas connected in a network is increasingly recognized as a conservation priority in the current era of rapid climate change. Models that identify suitable linkages between core areas have been used to prioritize potentially important corridors for maintaining functional connectivity. Here, we identify the most "natural" (i.e., least human-modified corridors between large protected areas in the contiguous Unites States. We aggregated results from multiple connectivity models to develop a composite map of corridors reflecting agreement of models run under different assumptions about how human modification of land may influence connectivity. To identify which land units are most important for sustaining structural connectivity, we used the composite map of corridors to evaluate connectivity priorities in two ways: (1 among land units outside of our pool of large core protected areas and (2 among units administratively protected as Inventoried Roadless (IRAs or Wilderness Study Areas (WSAs. Corridor values varied substantially among classes of "unprotected" non-core land units, and land units of high connectivity value and priority represent diverse ownerships and existing levels of protections. We provide a ranking of IRAs and WSAs that should be prioritized for additional protection to maintain minimal human modification. Our results provide a coarse-scale assessment of connectivity priorities for maintaining a connected network of protected areas.
Mattos, Jose L; Schlosser, Rodney J; Mace, Jess C; Smith, Timothy L; Soler, Zachary M
2018-05-02
Olfactory-specific quality of life (QOL) can be measured using the Questionnaire of Olfactory Disorders Negative Statements (QOD-NS). Changes in the QOD-NS after treatment can be difficult to interpret since there is no standardized definition of clinically meaningful improvement. Patients with chronic rhinosinusitis (CRS) completed the QOD-NS. Four distribution-based methods were used to calculate the minimal clinically important difference (MCID): (1) one-half standard deviation (SD); (2) standard error of the mean (SEM); (3) Cohen's effect size (d) of the smallest unit of change; and (4) minimal detectable change (MDC). We also averaged all 4 of the scores together. Finally, the likelihood of achieving a MCID after sinus surgery using these methods, as well as average QOD-NS scores, was stratified by normal vs abnormal baseline QOD-NS scores. Outcomes were examined on 128 patients. The mean ± SD improvement in QOD-NS score after surgery was 4.3 ± 11.0 for the entire cohort and 9.6 ± 12.9 for those with abnormal baseline scores (p < 0.001). The MCID values using the different techniques were: (1) SD = 6.5; (2) SEM = 3.1; (3) d = 2.6; and (4) MDC = 8.6. The MCID score was 5.2 on average. For the total cohort analysis, the likelihood of reporting a MCID ranged from 26% to 51%, and 49% to 70% for patients reporting preoperative abnormal olfaction. Distribution-based MCID values of the QOD-NS range between 2.6 and 8.6 points, with an average of 5.2. When stratified by preoperative QOD-NS scores the majority of patients reporting abnormal preoperative QOD-NS scores achieved a MCID. © 2018 ARS-AAOA, LLC.
The most important culture differences and elements of intercultural communication
Institute of Scientific and Technical Information of China (English)
张乐
2012-01-01
This paper wrote about the cultural differences. There are four dimensions: power distance, uncertainty avoidance, individualism and masculinity. After that, paper talked about the intercultural communication, which contains language, non-verbal communication, time and space concept. Then talked different cultures do cause problems in business. To avoid misunderstanding and clashes, the international managers should realize and understand the different cultures, adapt themselves to fit into the business environment in order to get the best achievement in business.
Biodiversity of Aspergillus species in some important agricultural products.
Perrone, G; Susca, A; Cozzi, G; Ehrlich, K; Varga, J; Frisvad, J C; Meijer, M; Noonim, P; Mahakarnchanakul, W; Samson, R A
2007-01-01
The genus Aspergillus is one of the most important filamentous fungal genera. Aspergillus species are used in the fermentation industry, but they are also responsible of various plant and food secondary rot, with the consequence of possible accumulation of mycotoxins. The aflatoxin producing A. flavus and A. parasiticus, and ochratoxinogenic A. niger, A. ochraceus and A. carbonarius species are frequently encountered in agricultural products. Studies on the biodiversity of toxigenic Aspergillus species is useful to clarify molecular, ecological and biochemical characteristics of the different species in relation to their different adaptation to environmental and geographical conditions, and to their potential toxigenicity. Here we analyzed the biodiversity of ochratoxin producing species occurring on two important crops: grapes and coffee, and the genetic diversity of A. flavus populations occurring in agricultural fields. Altogether nine different black Aspergillus species can be found on grapes which are often difficult to identify with classical methods. The polyphasic approach used in our studies led to the identification of three new species occurring on grapes: A. brasiliensis, A. ibericus, and A. uvarum. Similar studies on the Aspergillus species occurring on coffee beans have evidenced in the last five years that A. carbonarius is an important source of ochratoxin A in coffee. Four new species within the black aspergilli were also identified in coffee beans: A. sclerotioniger, A. lacticoffeatus, A. sclerotiicarbonarius, and A. aculeatinus. The genetic diversity within A. flavus populations has been widely studied in relation to their potential aflatoxigenicity and morphological variants L- and S-strains. Within A. flavus and other Aspergillus species capable of aflatoxin production, considerable diversity is found. We summarise the main recent achievements in the diversity of the aflatoxin gene cluster in A. flavus populations, A. parasiticus and the non
Persistent Identifier Practice for Big Data Management at NCI
Directory of Open Access Journals (Sweden)
Jingbo Wang
2017-04-01
Full Text Available The National Computational Infrastructure (NCI manages over 10 PB research data, which is co-located with the high performance computer (Raijin and an HPC class 3000 core OpenStack cloud system (Tenjin. In support of this integrated High Performance Computing/High Performance Data (HPC/HPD infrastructure, NCI’s data management practices includes building catalogues, DOI minting, data curation, data publishing, and data delivery through a variety of data services. The metadata catalogues, DOIs, THREDDS, and Vocabularies, all use different Uniform Resource Locator (URL styles. A Persistent IDentifier (PID service provides an important utility to manage URLs in a consistent, controlled and monitored manner to support the robustness of our national ‘Big Data’ infrastructure. In this paper we demonstrate NCI’s approach of utilising the NCI’s 'PID Service 'to consistently manage its persistent identifiers with various applications.
DEFF Research Database (Denmark)
Modin, Line; Walsted, Anne-Mette; Jakobsen, Marianne Skytte
2015-01-01
AIM: Most research on functional constipation has been carried out at a tertiary level. We focused this study on a secondary-level hospital outpatients' department, assessing the distribution of diagnostic criteria for childhood functional constipation and evaluating the consequences of current...... diagnostic practice based on current guidelines. METHODS: We enrolled 235 children, aged two to 16 years of age, with functional constipation according to the Rome III criteria and assessed them using medical histories and physical examinations, including rectal examinations and ultrasound measurements...... the timely diagnosis of childhood functional constipation at the secondary care level. Ultrasound examination proved a reliable alternative to rectal examination or abdominal radiography when identifying faecal impaction....
DEFF Research Database (Denmark)
Murray, A.S.; Thomsen, Kristina Jørkov; Masuda, N.
2012-01-01
When dating older sedimentary deposits using quartz, there are no unambiguous methods for identifying the presence of incomplete bleaching. Current statistical analysis of dose distributions depends entirely on the assumption that incomplete bleaching and mixing are the main causes of any excess...... dispersion in the distribution; the only existing way to test this assumption is using independent age control. Here we suggest a new approach to this question, based on the differential bleaching rates of quartz and feldspar luminescence signals. We first present data that confirm the differences...... in relative bleaching rates of quartz optically stimulated luminescence (OSL) and feldspar luminescence stimulated at 50 °C by infrared light (IR50) and feldspar luminescence stimulated at 290 °C by infrared light after a stimulation at 50 °C (pIRIR290), and use recently deposited samples to determine...
Scanlan, Justin Newton; Bundy, Anita C; Matthews, Lynda R
2011-04-01
This study set out to explore the differences in time use between 'unemployed', 'unemployed but in education' and part-time and full-time employed 18- to 25-year-old Australians. Unemployed individuals generally experience poor health and this may be related to the way they use their time. Activity-based interventions may be one health-promoting strategy. This knowledge is important for all occupational therapists, as many service users are likely to be unemployed. Time use of unemployed 18- to 25-year-olds (measured using the Modified Occupational Questionnaire) was compared with the time use of part- and full-time employed 18- to 25-year-olds (from the 2006 Australian Time Use Survey). Individuals in the 'unemployed' groups spent significantly less time engaged in work-related activities than their employed peers. This time was reallocated mainly to recreation and leisure and household work (for both men and women) and child care and sleeping (women only). Recreation and leisure activities were generally passive, home-based activities such as watching television or 'doing nothing'. Individuals in the 'unemployed but in education' groups also spent less time in employment-related activities, but the majority of this time was reallocated to education activities. Individuals in the 'unemployed' groups spent large amounts of time engaged in potentially non-directed use of time (e.g. watching television or 'doing nothing'). Such patterns of time use have previously been associated with poor health. To support the health of unemployed individuals more effectively, occupational therapy interventions must focus on enhancing the quality of time use for this population. © 2010 The Authors. Australian Occupational Therapy Journal © 2010 Australian Association of Occupational Therapists.
Problemi dei contingenti all'importazione (The problem with import quotas
Directory of Open Access Journals (Sweden)
V. BARATTIERI
2014-03-01
Full Text Available Today trade policy and the politics of protectionism in Italy, for the most part carried out within the EEC, essentially rely on the Community system of customs duties on imported products and variable taxes on agricultural imports. However, there is also a set of domestic trade policy instruments, among which the system of quantitative import restrictions. The present article analyzes the economic, legal and practical aspects of the complex problem of the allocation of import licenses between national operators. In the first part the authors summarize the main differences between quotas and customs duties. The formulas adopted to date in Italy are then re-examined and the criteria used by the other CEE countries are referred to. Finally, the objectives identified as priorities in the field of Public Administration are specified, the main shortcomings of the current system highlighted and some changes proposed. JEL: F13, F15
Institute of Scientific and Technical Information of China (English)
黄嘉
2014-01-01
Strategic human resource management is playing a more and more important role in modern organization management. Recruitment is the front line of human resource management. The effectiveness of recruitment directly influences the normal operation and management of business. The aim of this report is to identify a recruitment procedure that can solve the current problems of Dongfeng Cinema Equipment Company, supporting by related strategic human resource theories and concepts. It found out that different recruitment policy and procedure should be adopted according to the different developing stage of organization, and the scientific and systematic evaluation mechanism is also of vital importance.
Kelly, Bridget; King, Lesley; Bauman, Adrian E; Baur, Louise A; Macniven, Rona; Chapman, Kathy; Smith, Ben J
2014-01-01
Children's high participation in organised sport in Australia makes sport an ideal setting for health promotion. This study aimed to generate consensus on priority health promotion objectives for community sports clubs, based on informed expert judgements. Delphi survey using three structured questionnaires. Forty-six health promotion, nutrition, physical activity and sport management/delivery professionals were approached to participate in the survey. Questionnaires used an iterative process to determine aspects of sports clubs deemed necessary for developing healthy sporting environments for children. Initially, participants were provided with a list of potential standards for a range of health promotion areas and asked to rate standards based on their importance and feasibility, and any barriers to implementation. Subsequently, participants were provided with information that summarised ratings for each standard to indicate convergence of the group, and asked to review and potentially revise their responses where they diverged. In a third round, participants ranked confirmed standards by priority. 26 professionals completed round 1, 21 completed round 2, and 18 completed round 3. The highest ranked standards related to responsible alcohol practices, availability of healthy food and drinks at sports canteens, smoke-free club facilities, restricting the sale and consumption of alcohol during junior sporting activities, and restricting unhealthy food and beverage company sponsorship. Identifying and prioritising health promotion areas that are relevant to children's sports clubs assists in focusing public health efforts and may guide future engagement of sports clubs. Approaches for providing informational and financial support to clubs to operationalise these standards are proposed. Copyright © 2013 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.
Determining the minimally important difference for the Oral Health Impact Profile-20.
LENUS (Irish Health Repository)
Allen, P Finbarr
2009-04-01
In the context of clinical trials, measurement of change is critical. The aim of this study was to determine the minimally important difference (MID) for the Oral Health Impact Profile-20 (OHIP-20) when used with partially dentate patients undergoing treatment that included the provision of removable partial dentures. In a prospective clinical trial, 51 consecutive patients were provided with removable partial dentures. In addition to demographic and dental status data, patients completed an OHIP-20 prior to treatment. One month postoperatively, patients completed a post-treatment OHIP-20 and a global transition scale. Domains assessed in the global transition scale were appearance, ability to chew food, oral comfort, and speech. The MID for the OHIP-20 was calculated using the anchor-based approach. From the initial sample of 51 patients, 44 completed post-treatment questionnaires and were included in the analysis. Change scores in the four transition domains indicated that new dentures had a positive impact in the majority of subjects, especially in perceived impact on chewing and appearance. The study provided a guideline as to what constitutes the MID for the OHIP-20. This benchmark can be used when interpreting the impact of clinical intervention for replacing missing teeth and for power calculation in statistical analyses.
Halladay, Alycia K; Bishop, Somer; Constantino, John N; Daniels, Amy M; Koenig, Katheen; Palmer, Kate; Messinger, Daniel; Pelphrey, Kevin; Sanders, Stephan J; Singer, Alison Tepper; Taylor, Julie Lounds; Szatmari, Peter
2015-01-01
One of the most consistent findings in autism spectrum disorder (ASD) research is a higher rate of ASD diagnosis in males than females. Despite this, remarkably little research has focused on the reasons for this disparity. Better understanding of this sex difference could lead to major advancements in the prevention or treatment of ASD in both males and females. In October of 2014, Autism Speaks and the Autism Science Foundation co-organized a meeting that brought together almost 60 clinicians, researchers, parents, and self-identified autistic individuals. Discussion at the meeting is summarized here with recommendations on directions of future research endeavors.
Survey of Forensically Important Calliphoridae in Samsun
Directory of Open Access Journals (Sweden)
Meltem Kökdener
2016-08-01
Full Text Available Objective: This study was conducted from June 2009 to 2010 in north of Turkey, province Samsun. The objective was to determine forensically important Calliphoridae (Diptera species and their seasonal distribution on dog carrcass during one year, this studies were carried out in a three different area of Samsun. Material and Methods: Three dogs carcass (Canis lupus familiaris L., weighing approximately 15-20 kg each, were used as models for studying decomposition and insect succession in each experiments. Ambient daily temperature (maximum and minimum, relative humidity (RH were recorded and existing keys were used for identification of different species. Results: Lucillia sericata (Meigen, Chrysomya albiceps (Wiedemann, Calliphora vomitoria (Linnaeus and Calliphora vicina (Robineau-Desvoidy species were encountered. It was shown that the seasonal distribution of the collected species was different from each other. Chrysomya albiceps was observed in summer, auntumn and spring. In the spring and winter, the dominant fly species were Calliphora vicina. The rate of carcass's decomposition was faster in summer and autumn as compared to spring and winter. Results indicated that ambient temperature is the chief factor determining the seasonal variations in decay rate. Conclusion: This report also identified some of the Calliphoridae that occur in north of Turkey. The importance of regional faunistic studies of the calliphoridous community, the results of which may be applied to forensic practice in the future. Keywords: Forensic entomology, insect succession, corpse, postmortem interval, decomposition.
Directory of Open Access Journals (Sweden)
Raffaela Leane Zenni Tanure
2013-06-01
Full Text Available This study aims to present the differences between the use of QFD and its association with CVCA tool in the development of a CPM device for elbow and forearm rehabilitation. To achieve this goal, the study was divided into three steps. The development of a conceptual model that integrates the proposed CVCA + QFD tool for application in the health device development was done in the first step. The second step consisted of applying the proposed model, referring to the QFD method using 8 matrixes: quality matrix, product, characteristics of the parts, process, process parameters, human resources, infrastructure and costs matrix. The proposed conceptual model was employed fully in the third step, allowing the comparison between the methods. The results enabled to identify a discrepancy between the critical costumers in the use of mentioned methods. Customers were limited to the direct and indirect users in the QFD application: the patient, physician and physical therapist. This list got a considerable increase when CVCA was applied: the clinical engineering, product engineering, process and reliability engineering, project and product managers, financial sector, quality system and regulatory issues. These results show the importance of analyzing the supply chain systemically in order to consider all stakeholders to the CPM device development. Thus, needs and relationships delineation of all process customers can be done.
Combinatorial Drug Screening Identifies Ewing Sarcoma-specific Sensitivities.
Radic-Sarikas, Branka; Tsafou, Kalliopi P; Emdal, Kristina B; Papamarkou, Theodore; Huber, Kilian V M; Mutz, Cornelia; Toretsky, Jeffrey A; Bennett, Keiryn L; Olsen, Jesper V; Brunak, Søren; Kovar, Heinrich; Superti-Furga, Giulio
2017-01-01
Improvements in survival for Ewing sarcoma pediatric and adolescent patients have been modest over the past 20 years. Combinations of anticancer agents endure as an option to overcome resistance to single treatments caused by compensatory pathways. Moreover, combinations are thought to lessen any associated adverse side effects through reduced dosing, which is particularly important in childhood tumors. Using a parallel phenotypic combinatorial screening approach of cells derived from three pediatric tumor types, we identified Ewing sarcoma-specific interactions of a diverse set of targeted agents including approved drugs. We were able to retrieve highly synergistic drug combinations specific for Ewing sarcoma and identified signaling processes important for Ewing sarcoma cell proliferation determined by EWS-FLI1 We generated a molecular target profile of PKC412, a multikinase inhibitor with strong synergistic propensity in Ewing sarcoma, revealing its targets in critical Ewing sarcoma signaling routes. Using a multilevel experimental approach including quantitative phosphoproteomics, we analyzed the molecular rationale behind the disease-specific synergistic effect of simultaneous application of PKC412 and IGF1R inhibitors. The mechanism of the drug synergy between these inhibitors is different from the sum of the mechanisms of the single agents. The combination effectively inhibited pathway crosstalk and averted feedback loop repression, in EWS-FLI1-dependent manner. Mol Cancer Ther; 16(1); 88-101. ©2016 AACR. ©2016 American Association for Cancer Research.
Identification of a tripartite import signal in the Ewing Sarcoma protein (EWS)
International Nuclear Information System (INIS)
Shaw, Debra J.; Morse, Robert; Todd, Adrian G.; Eggleton, Paul; Lorson, Christian L.; Young, Philip J.
2009-01-01
The Ewing Sarcoma (EWS) protein is a ubiquitously expressed RNA processing factor that localises predominantly to the nucleus. However, the mechanism through which EWS enters the nucleus remains unclear, with differing reports identifying three separate import signals within the EWS protein. Here we have utilized a panel of truncated EWS proteins to clarify the reported nuclear localisation signals. We describe three C-terminal domains that are important for efficient EWS nuclear localization: (1) the third RGG-motif; (2) the last 10 amino acids (known as the PY-import motif); and (3) the zinc-finger motif. Although these three domains are involved in nuclear import, they are not independently capable of driving the efficient import of a GFP-moiety. However, collectively they form a complex tripartite signal that efficiently drives GFP-import into the nucleus. This study helps clarify the EWS import signal, and the identification of the involvement of both the RGG- and zinc-finger motifs has wide reaching implications.
Identification of a tripartite import signal in the Ewing Sarcoma protein (EWS)
Energy Technology Data Exchange (ETDEWEB)
Shaw, Debra J.; Morse, Robert; Todd, Adrian G. [Clinical Neurobiology, IBCS, Peninsula College of Medicine and Dentistry, Exeter EX1 2LU (United Kingdom); Eggleton, Paul [Inflammation and Musculoskeletal Disease, IBCS, Peninsula College of Medicine and Dentistry, Exeter EX1 2LU (United Kingdom); MRC Immunochemistry Unit, University of Oxford, Oxford OX1 3QU (United Kingdom); Lorson, Christian L. [Department of Veterinary Pathobiology, Bond Life Sciences Center, 1201 Rollins Road, University of Missouri, Columbia, MO 65211 (United States); Young, Philip J., E-mail: philip.young@pms.ac.uk [Clinical Neurobiology, IBCS, Peninsula College of Medicine and Dentistry, Exeter EX1 2LU (United Kingdom)
2009-12-25
The Ewing Sarcoma (EWS) protein is a ubiquitously expressed RNA processing factor that localises predominantly to the nucleus. However, the mechanism through which EWS enters the nucleus remains unclear, with differing reports identifying three separate import signals within the EWS protein. Here we have utilized a panel of truncated EWS proteins to clarify the reported nuclear localisation signals. We describe three C-terminal domains that are important for efficient EWS nuclear localization: (1) the third RGG-motif; (2) the last 10 amino acids (known as the PY-import motif); and (3) the zinc-finger motif. Although these three domains are involved in nuclear import, they are not independently capable of driving the efficient import of a GFP-moiety. However, collectively they form a complex tripartite signal that efficiently drives GFP-import into the nucleus. This study helps clarify the EWS import signal, and the identification of the involvement of both the RGG- and zinc-finger motifs has wide reaching implications.
Directory of Open Access Journals (Sweden)
Jianmin Yan
Full Text Available The translocon at the outer envelope membrane of chloroplasts (Toc mediates the recognition and initial import into the organelle of thousands of nucleus-encoded proteins. These proteins are translated in the cytosol as precursor proteins with cleavable amino-terminal targeting sequences called transit peptides. The majority of the known Toc components that mediate chloroplast protein import were originally identified in pea, and more recently have been studied most extensively in Arabidopsis. With the completion of the tomato genome sequencing project, it is now possible to identify putative homologues of the chloroplast import components in tomato. In the work reported here, the Toc GTPase cDNAs from tomato were identified, cloned and analyzed. The analysis revealed that there are four Toc159 homologues (slToc159-1, -2, -3 and -4 and two Toc34 homologues (slToc34-1 and -2 in tomato, and it was shown that tomato Toc159 and Toc34 homologues share high sequence similarity with the comparable import apparatus components from Arabidopsis and pea. Thus, tomato is a valid model for further study of this system. The expression level of Toc complex components was also investigated in different tissues during tomato development. The two tomato Toc34 homologues are expressed at higher levels in non-photosynthetic tissues, whereas, the expression of two tomato Toc159 homologues, slToc159-1 and slToc159-4, were higher in photosynthetic tissues, and the expression patterns of slToc159-2 was not significantly different in photosynthetic and non-photosynthetic tissues, and slToc159-3 expression was limited to a few select tissues.
Analysis Monthly Import of Palm Oil Products Using Box-Jenkins Model
Ahmad, Nurul F. Y.; Khalid, Kamil; Saifullah Rusiman, Mohd; Ghazali Kamardan, M.; Roslan, Rozaini; Che-Him, Norziha
2018-04-01
The palm oil industry has been an important component of the national economy especially the agriculture sector. The aim of this study is to identify the pattern of import of palm oil products, to model the time series using Box-Jenkins model and to forecast the monthly import of palm oil products. The method approach is included in the statistical test for verifying the equivalence model and statistical measurement of three models, namely Autoregressive (AR) model, Moving Average (MA) model and Autoregressive Moving Average (ARMA) model. The model identification of all product import palm oil is different in which the AR(1) was found to be the best model for product import palm oil while MA(3) was found to be the best model for products import palm kernel oil. For the palm kernel, MA(4) was found to be the best model. The results forecast for the next four months for products import palm oil, palm kernel oil and palm kernel showed the most significant decrease compared to the actual data.
PATTERNS FOR IDENTIFYING APPROPRIATE KNOWLEDGE MANAGEMENT STRATEGIES IN ORGANIZATIONS
Directory of Open Access Journals (Sweden)
Khadijeh Salmani
2012-06-01
Full Text Available Nowadays, striving to find an efficient way for developing or identifying appropriate knowledge management strategies in organizations has become so critical. Researchers and practitioners have attached great importance to information pyramids in organizations and have highlighted the lack of trained and skilled staff as a serious problem. On the other hand, having more flexibility at workplace, offering better service, and fulfilling customers' demands require a strategy for managing knowledge and its consequence. Knowledge management provides a wide range of different strategies and methods for identifying, creating, and sharing knowledge in organizations. This deep insight which consists of individual, organization’s experience, knowledge, and understanding helps organization respond to both internal and external stimuli and act in harmony. One fact which has seemingly achieved a consensus is the need for different strategies of knowledge management. Among the wide range of various and often unclear knowledge management strategies one can choose a strategy in a specific situation. The aim of this paper is to respond to strategic questions which emphasize competitive intelligence and internal knowledge retrieval system. The implications are discussed in detail.
Prins, Frans J.; Nadolski, Rob J.; Berlanga, Adriana J.; Drachsler, Hendrik; Hummel, Hans G. K.; Koper, Rob
2008-01-01
For competences development of learners and professionals, target competences and corresponding competence development opportunities have to be identified. Personal Recommender Systems (PRS) provide personal recommendations for learners aimed at finding and selecting learning activities that best match their needs. This article argues that a…
Identify alternative splicing events based on position-specific evolutionary conservation.
Directory of Open Access Journals (Sweden)
Liang Chen
Full Text Available The evolution of eukaryotes is accompanied by the increased complexity of alternative splicing which greatly expands genome information. One of the greatest challenges in the post-genome era is a complete revelation of human transcriptome with consideration of alternative splicing. Here, we introduce a comparative genomics approach to systemically identify alternative splicing events based on the differential evolutionary conservation between exons and introns and the high-quality annotation of the ENCODE regions. Specifically, we focus on exons that are included in some transcripts but are completely spliced out for others and we call them conditional exons. First, we characterize distinguishing features among conditional exons, constitutive exons and introns. One of the most important features is the position-specific conservation score. There are dramatic differences in conservation scores between conditional exons and constitutive exons. More importantly, the differences are position-specific. For flanking intronic regions, the differences between conditional exons and constitutive exons are also position-specific. Using the Random Forests algorithm, we can classify conditional exons with high specificities (97% for the identification of conditional exons from intron regions and 95% for the classification of known exons and fair sensitivities (64% and 32% respectively. We applied the method to the human genome and identified 39,640 introns that actually contain conditional exons and classified 8,813 conditional exons from the current RefSeq exon list. Among those, 31,673 introns containing conditional exons and 5,294 conditional exons classified from known exons cannot be inferred from RefSeq, UCSC or Ensembl annotations. Some of these de novo predictions were experimentally verified.
Sagebrush, greater sage-grouse, and the occurrence and importance of forbs
Pennington, Victoria E.; Schlaepfer, Daniel R.; Beck, Jeffrey L.; Bradford, John B.; Palmquist, Kyle A.; Lauenroth, William K.
2016-01-01
Big sagebrush (Artemisia tridentata Nutt.) ecosystems provide habitat for sagebrush-obligate wildlife species such as the Greater Sage-Grouse (Centrocercus urophasianus). The understory of big sagebrush plant communities is composed of grasses and forbs that are important sources of cover and food for wildlife. The grass component is well described in the literature, but the composition, abundance, and habitat role of forbs in these communities is largely unknown. Our objective was to synthesize information about forbs and their importance to Greater Sage-Grouse diets and habitats, how rangeland management practices affect forbs, and how forbs respond to changes in temperature and precipitation. We also sought to identify research gaps and needs concerning forbs in big sagebrush plant communities. We searched for relevant literature including journal articles and state and federal agency reports. Our results indicated that in the spring and summer, Greater Sage-Grouse diets consist of forbs (particularly species in the Asteraceae family), arthropods, and lesser amounts of sagebrush. The diets transition to sagebrush in fall and winter. Forbs provide cover for Greater Sage-Grouse individuals at their lekking, nesting, and brood-rearing sites, and the species has a positive relationship with arthropod presence. The effect of grazing on native forbs may be compounded by invasion of nonnative species and differs depending on grazing intensity. The effect of fire on forbs varies greatly and may depend on time elapsed since burning. In addition, chemical and mechanical treatments affect annual and perennial forbs differently. Temperature and precipitation influence forb phenology, biomass, and abundance differently among species. Our review identified several uncertainties and research needs about forbs in big sagebrush ecosystems. First, in many cases the literature about forbs is reported only at the genus or functional type level. Second, information about forb
The Rome II and Rome III criteria identify the same subtype-populations in irritable bowel syndrome
DEFF Research Database (Denmark)
Engsbro, A L; Simrén, M; Bytzer, P
2012-01-01
For comparing trials using different classifications for irritable bowel syndrome (IBS) subtypes, it is important to know whether these identify the same sub-populations. Our aim was to determine the agreement between Rome II and Rome III subtypes, and to explore whether agreement depends...
The use of citation indicators to identify and support high-quality research in Poland.
Pilc, Andrzej
2008-01-01
In large, mostly English-speaking countries, where the "critical mass" of scientists working in different subfields of science is achieved, the peer review system may be sufficient to assess the quality of scientific research. However, in smaller countries, outside the Anglo-American circle, it is important to introduce different systems to identify research of high quality. In Poland, a parametric system for assessing the quality of research has been introduced. It was largely based on the impact factor of scientific journals. While the use of this indicator to assess research quality is highly questionable, the implementation of the system in the Polish reality is even worse. Therefore it is important to change and improve the system currently used by the Ministry of Science and Higher Education to both evaluate and, more importantly, finance science in Poland. Here, a system based on three factors, i.e. the impact factor, the institutional h-index, and the institutional number of citations, is proposed. The scientific quality of institutions in Division VI: Medical Sciences of the Polish Academy of Sciences were evaluated and the results were compared with the existing system. Moreover, a method to identify high-quality researchers and institutions at the national level based on the quantity of highly cited papers is shown. Additionally, an attempt to identify the highest quality Polish research on an international level is proposed. This is based on the number of individual citations, the individual h-index, the number of publications, and the priority of the discovery.
The importance of epidemiological predictors for healthcare costs for chronic patients
DEFF Research Database (Denmark)
Hansen, Louise
SUMMARY Healthcare systems around the world continue to see their expenditures increase, measured as a percentage of gross domestic product. Within health economics, the need for models that can predict healthcare costs is of substantial importance, as decisions to introduce as well as to decommi......SUMMARY Healthcare systems around the world continue to see their expenditures increase, measured as a percentage of gross domestic product. Within health economics, the need for models that can predict healthcare costs is of substantial importance, as decisions to introduce as well...... to consider, and lastly choosing the most appropriate statistical model. This framework was developed as a result of five quantitative studies, of which four were based on patient specific data from registers, and one on cost of illness theory. The framework was applied for predicting the cost for all...... which these patients are treated, as different resources were affected differently by the clinical and behavioural predictors included. In conclusion, the results from this dissertation highlight the importance being familiar with the population of interest, identifying the relevant resources, including...
Rondoni, Gabriele; Ielo, Fulvio; Ricci, Carlo; Conti, Eric
2014-12-08
(1) Intraguild predation (IGP) can occur among aphidophagous predators thus reducing their effectiveness in controlling crop pests. Among ladybirds, Coccinella septempunctata L. and Hippodamia variegata Goeze are the most effective predators upon Aphis gossypii Glov., which is an economically important pest of melon. Understanding their likelihood to engage in reciprocal predation is a key point for conservation of biological control. Here, we aim to investigate, under laboratory conditions, the level of IGP between the two above mentioned aphidophagous species. (2) Fourth-instars of the two species were isolated in petri dishes with combinations of different stages of the heterospecific ladybird and different densities of A. gossypii. The occurrence of IGP events was recorded after six hours. (3) C. septempunctata predated H. variegata at a higher rate than vice versa (70% vs. 43% overall). Higher density of the aphid or older juvenile stage of the IG-prey (22% of fourth instars vs. 74% of eggs and second instars) reduces the likelihood of predation. (4) To our knowledge, IGP between C. septempunctata and H. variegata was investigated for the first time. Results represent a baseline, necessary to predict the likelihood of IGP occurrence in the field.
Cerebral ischemic stroke: is gender important?
Gibson, Claire L
2013-09-01
Cerebral stroke continues to be a major cause of death and the leading cause of long-term disability in developed countries. Evidence reviewed here suggests that gender influences various aspects of the clinical spectrum of ischemic stroke, in terms of influencing how a patients present with ischemic stroke through to how they respond to treatment. In addition, this review focuses on discussing the various pathologic mechanisms of ischemic stroke that may differ according to gender and compares how intrinsic and hormonal mechanisms may account for such gender differences. All clinical trials to date investigating putative neuroprotective treatments for ischemic stroke have failed, and it may be that our understanding of the injury cascade initiated after ischemic injury is incomplete. Revealing aspects of the pathophysiological consequences of ischemic stroke that are gender specific may enable gender relevant and effective neuroprotective strategies to be identified. Thus, it is possible to conclude that gender does, in fact, have an important role in ischemic stroke and must be factored into experimental and clinical investigations of ischemic stroke.
Identifying barriers in the diffusion of renewable energy sources
International Nuclear Information System (INIS)
Eleftheriadis, Iordanis M.; Anagnostopoulou, Evgenia G.
2015-01-01
Rapid diffusion of renewable energy sources (RES) in the electricity power sector is crucial if the EU wants to fulfill its 2050 CO 2 reduction commitments. For this reason, identifying and alleviating all barriers that hinder the development of RES is necessary to the successful deployment of these technologies. This paper discusses the main barriers in the diffusion of wind and photovoltaic (PV) solar power in the Greek electricity sector by drawing on the literature of technological innovation systems and system functions. Furthermore, we provide an explanation of the different diffusion rates between the two technologies. Inadequate financial resources, low grid capacity, delays in the issuance of building permits, opposition from local communities to the construction of wind farms and the lack of a stable institutional framework are among the most important barriers that inhibit the diffusion of the wind and PV solar power. The nature of the barriers identified in this study calls for policy intervention. - Highlights: • Firms in the Greek wind and solar power sectors assess RES barriers. • Lack of financial resources is the most important RES barrier. • Lack of a stable institutional framework negatively affects RES deployment. • The support of the public sector is crucial to the diffusion of RES. •Wind power faces strong legitimization barriers
Surge, D. M.; Godino, I. B. I.; Álvarez, M.; López, M. B. I.
2017-12-01
Patelloid limpet shells are common constituents of rocky shore habitats along the eastern Atlantic basin and are often found in archaeological shell middens. Nacella deaurata is an intertidal species found in the Magellanic Province along the southern tip of South America. Recent discoveries of archaeological shell middens in Tierra del Fuego, Argentina, identify N. deaurata as one of the abundant shells in these deposits. Preliminary observations reveal that modern N. deaurata shells achieve larger sizes compared to those found in the archaeological middens. Here, we provide preliminary data to test the hypothesis that the larger, modern specimens grow to older ontogenetic ages than the smaller archaeological specimens. Our results may provide insights into harvesting pressures on this species during the time when the archaeological sites were inhabited. Understanding their annual growth patterns also has important implications for generating oxygen isotope proxy data to reconstruct seasonal variation in sea surface temperature.
Directory of Open Access Journals (Sweden)
Domenico eIaria
2016-01-01
Full Text Available During ripening, the fruits of the olive tree (Olea europaea L. undergo a progressive chromatic change characterized by the formation of a red-brown spot which gradually extends on the epidermis and in the innermost part of the mesocarp. This event finds an exception in the Leucocarpa cultivar, in which we observe a destabilized equilibrium between the metabolisms of chlorophyll and other pigments, particularly the anthocyanins whose switch-off during maturation promotes the white coloration of fruits. Despite its importance, genomic information on the olive tree is still lacking. Different RNA-seq libraries were generated from drupes of ‘Leucocarpa’ and ‘Cassanese’ olive genotypes, sampled at 100 and 130 days after flowering (DAF, and were used in order to identify transcripts involved in the main phenotypic changes of fruits during maturation and their corresponding expression patterns. A total of 103,359 transcripts were obtained and 3792 and 3064 were differentially expressed in ‘Leucocarpa’ and ‘Cassanese’ genotypes, respectively, during 100-130 DAF transition. Among them flavonoid and anthocyanin related transcripts such as phenylalanine ammonia lyase (PAL, cinnamate 4-hydroxylase (C4H, 4-coumarate-CoA ligase (4CL, chalcone synthase (CHS, chalcone isomerase (CHI, flavanone 3-hydroxylase (F3H, flavonol 3’-hydrogenase (F3'H, flavonol 3’5’-hydrogenase (F3'5'H, flavonol synthase (FLS, dihydroflavonol 4-reductase (DFR, anthocyanidin synthase (ANS, UDP-glucose:anthocianidin:flavonoid glucosyltransferase (UFGT were identified.These results contribute to reducing the current gap in information regarding metabolic processes, including those linked to fruit pigmentation in the olive.
Importance of intellectual capital disclosure in Spanish universities
Directory of Open Access Journals (Sweden)
Yolanda Ramírez Córcoles
2013-09-01
Full Text Available Purpose: The increasing social concern about establishing procedures of accountability and ensuring information transparency in public universities prompted us to raise the need to disclose information on their intellectual capital.Design/methodology/approach: In this study we developed a questionnaire which was sent to members of the Social Councils of Spanish public universities, in order to identify which intangible elements university stakeholders demand most.Findings: The results of this research demonstrate how important it is for Spanish public universities to provide information on their intellectual capital in order to satisfy their stakedolders’ information needs.Practical implications: The results of this research lead us to recommend that universities include in their accounting statements the information on intellectual capital demanded by the different stakeholders.Originality/value: No previous research was conducted for Spanish universities. Our results represent a starting point for public universities to identify which is the most requested information about intellectual capital.
Family-centred service: differences in what parents of children with cerebral palsy rate important.
Terwiel, M; Alsem, M W; Siebes, R C; Bieleman, K; Verhoef, M; Ketelaar, M
2017-09-01
A family-centred approach to services of children with disabilities is widely accepted as the foundational approach to service delivery in paediatric health care. The 56 items of the Measure of Processes of Care questionnaire (MPOC-56) all reflect elements of family-centred service. In this study, we investigated which elements of family-centred service are rated important by parents of children with cerebral palsy by adding a question on importance to each item of the MPOC-56 (MPOC-56-I). In total, 175 parents of children with cerebral palsy completed the MPOC-56-I. For each MPOC item, parents were asked to rate the importance on a 5-point scale ranging from 0 (not important at all) up to and including 4 (very important). We used Spearman's rank correlation coefficient to further explore the variation in parents' importance ratings. Parents' importance ratings of the MPOC-56 items varied. The percentage of parents rating an item important (importance rating 3 or 4) varied between 43.8% and 96.8%. The percentage of parents rating an item unimportant (rating 0 or 1) varied between 0.0% and 20.3%, and the percentage of parents rating an item neutral (rating 2) varied between 3.0% and 36.0%. Most diverse importance ratings were found for five items concerning the provision of general information. Three correlations between these items and child and parent characteristics were found. Six items were rated important by almost all (≥95%) parents. These items concern elements of specific information about the child, co-ordinated and comprehensive care for child and family and enabling and partnership. Parents rate the importance of family-centred services for their situation in various ways. These findings endorse that family-centred services should recognize the uniqueness of families and should be tailored to what parents find important. © 2017 John Wiley & Sons Ltd.
GFT centrality: A new node importance measure for complex networks
Singh, Rahul; Chakraborty, Abhishek; Manoj, B. S.
2017-12-01
Identifying central nodes is very crucial to design efficient communication networks or to recognize key individuals of a social network. In this paper, we introduce Graph Fourier Transform Centrality (GFT-C), a metric that incorporates local as well as global characteristics of a node, to quantify the importance of a node in a complex network. GFT-C of a reference node in a network is estimated from the GFT coefficients derived from the importance signal of the reference node. Our study reveals the superiority of GFT-C over traditional centralities such as degree centrality, betweenness centrality, closeness centrality, eigenvector centrality, and Google PageRank centrality, in the context of various arbitrary and real-world networks with different degree-degree correlations.
Ju, Song; Zhang, Dalun; Pacha, Jacqueline
2012-01-01
Individuals with disabilities face persistent challenges in gaining meaningful employment. One of the barriers to successful employment is a lack of employability skills. The purpose of this study was to identify employability skills that employers value as being important and to examine whether employers have different expectations for…
Serrano, João; Shahidian, Shakib; Sampaio, Jaime; Leite, Nuno
2013-01-01
The aim of this study was to identify the importance assigned by futsal coaches with different education levels to the sports performance factors (technical, tactical, physical and psychological) and to the training contents. The sample was divided into three groups (novice: n=35, intermediate: n=42; and elite coaches: n=15) depending on the degree of specific education, coaching experience and the level of the teams trained. To achieve this goal, the coaches answered a questionnaire previously validated by specialists in sport sciences. The results showed significant differences between the novice and elite group in small-sided games, inferiority games, opposition and execution timing of the training and drill items. The analyses also showed significant differences between the novice and intermediate group in inferiority games and opposition of the training and drill items. Although, no differences were identified between groups for the remaining performance factors and training and drill items considered, the identified trends provide a baseline related to the knowledge that contributes to the development of expertise of futsal coaches. PMID:24235991
Farrimond, Hannah
2017-10-01
The aim of this study was to identify and differentiate socially shared accounts of e-cigarette use (vaping) using Q-methodology, combining factor analysis with qualitative comments. Seventy statements on e-cigarettes, drawn from media, academic and online discussions, were sorted by participants along a continuum of agreement/disagreement, commenting on strongly ranked items. Each participant thus created their own 'account' of their vaping. A by-person correlation matrix of the sorts was conducted, then factor analysed, to identify similar accounts (pmotivated to maintain the rights of adults to vape. In Factor Two, 'Vaping as Medical Treatment', vaping was understood as a pragmatic choice about how to medicate one's smoking addiction, with the aim being to treat and ultimately reduce nicotine dependence. In Factor Three, 'Ambivalent E-Cigarette Use', participants reported fewer benefits and harboured more negative beliefs about e-cigarettes; they also strongly rejected a vaper identity, having no interest in online forums or being labelled a 'vaper' themselves. The UK e-cigarette users in this sample were not a homogeneous group; differing in their beliefs, motivations for use, identity and political interest. In particular they diverged on whether they accepted a medicalized account of vaping and identified as a vaper. Public health messages targeted to one group of e-cigarette users may not resonate with others. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.
Distributed Persistent Identifiers System Design
Directory of Open Access Journals (Sweden)
Pavel Golodoniuc
2017-06-01
Full Text Available The need to identify both digital and physical objects is ubiquitous in our society. Past and present persistent identifier (PID systems, of which there is a great variety in terms of technical and social implementation, have evolved with the advent of the Internet, which has allowed for globally unique and globally resolvable identifiers. PID systems have, by in large, catered for identifier uniqueness, integrity, and persistence, regardless of the identifier’s application domain. Trustworthiness of these systems has been measured by the criteria first defined by Bütikofer (2009 and further elaborated by Golodoniuc 'et al'. (2016 and Car 'et al'. (2017. Since many PID systems have been largely conceived and developed by a single organisation they faced challenges for widespread adoption and, most importantly, the ability to survive change of technology. We believe that a cause of PID systems that were once successful fading away is the centralisation of support infrastructure – both organisational and computing and data storage systems. In this paper, we propose a PID system design that implements the pillars of a trustworthy system – ensuring identifiers’ independence of any particular technology or organisation, implementation of core PID system functions, separation from data delivery, and enabling the system to adapt for future change. We propose decentralisation at all levels — persistent identifiers and information objects registration, resolution, and data delivery — using Distributed Hash Tables and traditional peer-to-peer networks with information replication and caching mechanisms, thus eliminating the need for a central PID data store. This will increase overall system fault tolerance thus ensuring its trustworthiness. We also discuss important aspects of the distributed system’s governance, such as the notion of the authoritative source and data integrity
Public and Private Sector IT Governance: Identifying Contextual Differences
John Campbell; Craig McDonald; Tsholofelo Sethibe
2010-01-01
This paper highlights systemic contextual differences and the unique IT Governance issues that might arise in public and private sector organizations. Public sector organizations constitute a significant component of economic activity in most countries. Like their private sector counterparts, many public sector agencies are struggling to cope with reduced or inadequate IT budgets and are continuously looking for ways to extract maximum value from IT resources. While both sectors face similar ...
Birth cohorts in Asia: The importance, advantages, and disadvantages of different-sized cohorts.
Kishi, Reiko; Araki, Atsuko; Minatoya, Machiko; Itoh, Sachiko; Goudarzi, Houman; Miyashita, Chihiro
2018-02-15
Asia contains half of the world's children, and the countries of Asia are the most rapidly industrializing nations on the globe. Environmental threats to the health of children in Asia are myriad. Several birth cohorts were started in Asia in early 2000, and currently more than 30 cohorts in 13 countries have been established for study. Cohorts can contain from approximately 100-200 to 20,000-30,000 participants. Furthermore, national cohorts targeting over 100,000 participants have been launched in Japan and Korea. The aim of this manuscript is to discuss the importance of Asian cohorts, and the advantages and disadvantages of different-sized cohorts. As for case, one small-sized (n=514) cohort indicate that even relatively low level exposure to dioxin in utero could alter birth size, neurodevelopment, and immune and hormonal functions. Several Asian cohorts focus prenatal exposure to perfluoroalkyo substances and reported associations with birth size, thyroid hormone levels, allergies and neurodevelopment. Inconsistent findings may possibly be explained by the differences in exposure levels and target chemicals, and by possible statistical errors. In a smaller cohort, novel hypotheses or preliminary examinations are more easily verifiable. In larger cohorts, the etiology of rare diseases, such as birth defects, can be analyzed; however, they require a large cost and significant human resources. Therefore, conducting studies in only one large cohort may not always be the best strategy. International collaborations, such as the Birth Cohort Consortium of Asia, would cover the inherent limitation of sample size in addition to heterogeneity of exposure, ethnicity, and socioeconomic conditions. Copyright © 2017 Elsevier B.V. All rights reserved.
Are All Pixels Equally Important?
CERN. Geneva
2015-01-01
When we look at our environment, we primarily pay attention to visually distinctive objects. We refer to these objects as visually important or salient. For efficient visual processing, the human visual system identifies salients objects and dedicates most of its processing resources to them. An analogous resource allocation can be performed by salient-object detection algorithms, which identify objects of interest in an image. Consequently, thanks to salient-object detection, complex visual computing operations can focus on the important parts of the visual data and can save time and resources. About the speaker Dr. Gokhan Yildirim is a research assistant in the School of Computer and Communication Sciences (IC) at the École Polytechnique Fédérale de Lausanne (EPFL). His research interests include image understanding, multimedia, pattern recognition, machine learning, salient-object detection on images & videos and its applications on image proces...
Du, Liang; Yang, Yi; Harley, Ronald Gordon; Habetler, Thomas G.; He, Dawei
2016-08-09
A system is for a plurality of different electric load types. The system includes a plurality of sensors structured to sense a voltage signal and a current signal for each of the different electric loads; and a processor. The processor acquires a voltage and current waveform from the sensors for a corresponding one of the different electric load types; calculates a power or current RMS profile of the waveform; quantizes the power or current RMS profile into a set of quantized state-values; evaluates a state-duration for each of the quantized state-values; evaluates a plurality of state-types based on the power or current RMS profile and the quantized state-values; generates a state-sequence that describes a corresponding finite state machine model of a generalized load start-up or transient profile for the corresponding electric load type; and identifies the corresponding electric load type.
Musso, Mariel F.; Kyndt, Eva; Cascallar, Eduardo C.; Dochy, Filip
2013-01-01
Many studies have explored the contribution of different factors from diverse theoretical perspectives to the explanation of academic performance. These factors have been identified as having important implications not only for the study of learning processes, but also as tools for improving curriculum designs, tutorial systems, and students'…
Interpersonal Conflicts Among Family Caregivers of the Elderly: The Importance of Social Skills
Directory of Open Access Journals (Sweden)
Francine Náthalie Ferraresi Rodrigues Pinto
2016-08-01
Full Text Available Abstract Caring for someone, even when this person is highly regarded, can be stressful, resulting in a decrease in the caregiver's quality of life. The aim of this study was to identify the main conflicts involved in the task of caring for an elderly relative, reported by caregivers, elderly care-recipients and professionals in the field of aging, and to identify social skills (SS considered as being important to accomplish this task, helping to minimize the conflicts in this context. We interviewed 50 caregivers of the elderly, 25 elderly care-recipients, and 25 professionals in the field of aging, who answered questions about conflicts linked to this context and about SS that are important when taking care of an elderly person. The main conflicts involved difficulties to reconcile differences of opinion, or financial issues. The SSs considered most useful included: expressing positive feelings, controlling aggressiveness, and discussing problems. It will be important to verify if caregivers who develop their SS repertoire also improve their quality of life.
The contribution of smoking to regional mortality differences in The Netherlands
Janssen, F.; Spriensma, A.S.
2012-01-01
BACKGROUND: Smoking is an important preventable determinant of morbidity and mortality. Knowledge about its role in regional mortality differences can help us to identify relevant policy areas, and to explain national mortality differences. OBJECTIVE: We explored the extent to which the regional
The contribution of smoking to regional mortality differences in the Netherlands
Janssen, Fanny; Spriensma, Alette Sigrid
2012-01-01
BACKGROUND Smoking is an important preventable determinant of morbidity and mortality. Knowledge about its role in regional mortality differences can help us to identify relevant policy areas, and to explain national mortality differences. OBJECTIVE We explored the extent to which the regional
International Nuclear Information System (INIS)
Li, Tong; Wan, Yi; Ben, Yujie; Fan, Senrong; Hu, Jianying
2017-01-01
The potential health effects of toxic chemicals (e.g. heavy metals) emitted by municipal solid waste incinerators (MSWIs) are of great concern to local residents, however there have been few studies on the contributions of different exposure pathways and their subsequent effects on the body burden of residents living near MSWIs. In this study, multiple exposure routes of heavy metals including Pb, Cr, Cd and Mn were assessed by investigating the metals in foods (such as vegetables, crops, meats and fruits etc.), drinking water, ambient air and soil collected surrounding an MSWI in Shenzhen, south China. Vegetable ingestion played the most important role in the total average daily dose of Pb and Cr, and cereals were the key exposure routes for Mn and Cd. Compound-specific contaminations were observed in the investigated areas, with Pb and Cr present in the surrounding environment, having accumulated to relatively high levels in the local vegetables, and the intake of contaminated vegetable foods greatly influencing the body burden of Pb and Cr. Consistently, significantly high blood concentrations of Pb and Cr were detected in the local residents compared to a referenced population, and a lack of significant differences was found for Cd and Mn. The results possibly suggested that emission of MSWI influenced the external exposure doses of the major pathways of Pb and Cr in this study, and resulted in the different body burden of metals in humans living near a MSWI. MSWI-local food-humans is an important exposure pathway for residents living near MSWI, and thus should not be neglected in developing future strategies and policies to prevent the high risks suffered by residents living near MSWIs. - Highlights: • Vegetable and cereal ingestion were the main contributors to exposure of Pb/Cr and Mn/Cd, respectively. • Concentrations of Pb/Cr in vegetables grown near MSWI were significantly higher. • Blood concentrations of Pb/Cr in populations near MSWI were
Granero-Gallegos, Antonio; Baena-Extremera, Antonio; Pérez-Quero, Francisco J; Ortiz-Camacho, Maria M; Bracho-Amador, Clara
2012-01-01
The purpose of this study was to analyze the motivational profiles of satisfaction with and importance of physical education in high school students and its relation with gender and the practice of sport. The sample comprised 2002 students aged from 12 to 19 who completed the Sport Motivation Scale (Núñez et al., 2006), the Sport Satisfaction Instrument (Baena-Extremera et al., 2012) and the Importance of Physical Education Scale (Moreno et al., 2009). Descriptive analyzes, correlations between the scales, a cluster analysis for profiles, and a MANOVA were conducted to examine differences by gender. Three clusters (profiles) were identified. The first profile identified was "moderate" motivation (n = 463) and was associated with boys who practice physical activity for less than 3 hours per week. The second profile identified was "low" motivation (n = 545) and was associated mainly with girls who practice physical activity for less than 3 hours per week. And lastly the third profile identified was "high" motivation (n = 910), which was found to be greater in boys who practiced physical exercise for more than 3 hours a week.
Law, Jacqueline P; Hirschkorn, Dale F; Owen, Rachel E; Biswas, Hope H; Norris, Philip J; Lanteri, Marion C
2009-12-01
Foxp3 is a key marker for CD4(+) regulatory T cells (T(regs)) and was used in developing a multiparameter flow cytometric panel to identify T(regs). Achieving reproducible staining and analysis first required optimization of Foxp3 staining. We present a comparative study of PCH101, 236A/E7, 3G3, 206D, 150D, and 259D/C7 clones of anti-human-Foxp3 antibodies used in combination with five different fixation/permeabilization buffers. Staining for CD25, CD152, and CD127 was also compared between fixation/permeabilization treatments. Promising antibody/buffer combinations were tested in a panel of peripheral blood mononuclear cells from 10 individuals, and then on fresh versus frozen cells from four individuals. Finally, different fluorochromes coupled to two representative antibodies were compared to optimize separation of Foxp3(+) from Foxp3(-) events. Foxp3 gates were set using two gating strategies based on CD127(+)CD25(-) "non-T(regs)" or based on isotype controls. For Foxp3 staining, the best conditions for fixation/permeabilization were obtained using the eBioscience Foxp3, Imgenex, BioLegend, and BD Foxp3 buffers. Comparing results from 10 subjects, 259D/C7, PCH101, 236A/E7, and 206D antibodies yielded statistically higher levels of Foxp3 cells than those by 150D and 3G3 antibodies (mean = 6.9, 5.1, 4.7, and 3.7% compared with 1.7, and 0.3% of CD25(+)Foxp3(+) events within CD4(+) cells, respectively). Importantly, the "nonspecificity" of some antibodies observed with a Foxp3 gate based on isotype controls could be eliminated by setting the Foxp3 gate on "non-T(regs)". Better separation of Foxp3(+) and Foxp3(-) populations was observed using the PCH101 clone coupled to Alexa647 compared with FITC or the 259D/C7 clone coupled to PE compared with Alexa488 fluorochrome. Foxp3 staining can be highly variable and depends on the choice of antibody/buffer pair and the fluorochrome used. Selecting the correct population for setting the Foxp3 gate is critical to avoid
Biodiversity of Aspergillus species in some important agricultural products
DEFF Research Database (Denmark)
Perrone, Giancarlo; Susca, A.,; Cozzi, G.
2007-01-01
The genus Aspergillus is one of the most important filamentous fungal genera. Aspergillus species are used in the fermentation industry, but they are also responsible of various plant and food secondary rot, with the consequence of possible accumulation of mycotoxins. The aflatoxin producing A....... flavus and A. parasiticus, and ochratoxinogenic A. niger, A. ochraceus and A. carbonarius species are frequently encountered in agricultural products. Studies on the biodiversity of toxigenic Aspergillus species is useful to clarify molecular, ecological and biochemical characteristics of the different...... occurring in agricultural fields. Altogether nine different black Aspergillus species can be found on grapes which are often difficult to identify with classical methods. The polyphasic approach used in our studies led to the identification of three new species occurring on grapes: A. brasiliensis, A...
McMurry, Julie A; Juty, Nick; Blomberg, Niklas; Burdett, Tony; Conlin, Tom; Conte, Nathalie; Courtot, Mélanie; Deck, John; Dumontier, Michel; Fellows, Donal K; Gonzalez-Beltran, Alejandra; Gormanns, Philipp; Grethe, Jeffrey; Hastings, Janna; Hériché, Jean-Karim; Hermjakob, Henning; Ison, Jon C; Jimenez, Rafael C; Jupp, Simon; Kunze, John; Laibe, Camille; Le Novère, Nicolas; Malone, James; Martin, Maria Jesus; McEntyre, Johanna R; Morris, Chris; Muilu, Juha; Müller, Wolfgang; Rocca-Serra, Philippe; Sansone, Susanna-Assunta; Sariyar, Murat; Snoep, Jacky L; Soiland-Reyes, Stian; Stanford, Natalie J; Swainston, Neil; Washington, Nicole; Williams, Alan R; Wimalaratne, Sarala M; Winfree, Lilly M; Wolstencroft, Katherine; Goble, Carole; Mungall, Christopher J; Haendel, Melissa A; Parkinson, Helen
2017-06-01
In many disciplines, data are highly decentralized across thousands of online databases (repositories, registries, and knowledgebases). Wringing value from such databases depends on the discipline of data science and on the humble bricks and mortar that make integration possible; identifiers are a core component of this integration infrastructure. Drawing on our experience and on work by other groups, we outline 10 lessons we have learned about the identifier qualities and best practices that facilitate large-scale data integration. Specifically, we propose actions that identifier practitioners (database providers) should take in the design, provision and reuse of identifiers. We also outline the important considerations for those referencing identifiers in various circumstances, including by authors and data generators. While the importance and relevance of each lesson will vary by context, there is a need for increased awareness about how to avoid and manage common identifier problems, especially those related to persistence and web-accessibility/resolvability. We focus strongly on web-based identifiers in the life sciences; however, the principles are broadly relevant to other disciplines.
Directory of Open Access Journals (Sweden)
Julie A McMurry
2017-06-01
Full Text Available In many disciplines, data are highly decentralized across thousands of online databases (repositories, registries, and knowledgebases. Wringing value from such databases depends on the discipline of data science and on the humble bricks and mortar that make integration possible; identifiers are a core component of this integration infrastructure. Drawing on our experience and on work by other groups, we outline 10 lessons we have learned about the identifier qualities and best practices that facilitate large-scale data integration. Specifically, we propose actions that identifier practitioners (database providers should take in the design, provision and reuse of identifiers. We also outline the important considerations for those referencing identifiers in various circumstances, including by authors and data generators. While the importance and relevance of each lesson will vary by context, there is a need for increased awareness about how to avoid and manage common identifier problems, especially those related to persistence and web-accessibility/resolvability. We focus strongly on web-based identifiers in the life sciences; however, the principles are broadly relevant to other disciplines.
Identifying lubricant options for compressor bearing designs
Karnaz, J.; Seeton, C.; Dixon, L.
2017-08-01
Today’s refrigeration and air conditioning market is not only driven by the environmental aspects of the refrigerants, but also by the energy efficiency and reliability of system operation. Numerous types of compressor designs are used in refrigeration and air conditioning applications which means that different bearings are used; and in some cases, multiple bearing types within a single compressor. Since only one lubricant is used, it is important to try to optimize the lubricant to meet the various demands and requirements for operation. This optimization entails investigating different types of lubricant chemistries, viscosities, and various formulation options. What makes evaluating these options more challenging is the refrigerant which changes the properties of the lubricant delivered to the bearing. Once the lubricant and refrigerant interaction are understood, through various test methods, then work can start on collaborating with compressor engineers on identifying the lubricant chemistry and formulation options. These interaction properties are important to the design engineer to make decisions on the adequacy of the lubricant before compressor tests are started. This paper will discuss the process to evaluate lubricants for various types of compressors and bearing design with focus on what’s needed for current refrigerant trends. In addition, the paper will show how the lubricant chemistry choice can be manipulated through understanding of the bearing design and knowledge of interaction with the refrigerant to maximize performance. Emphasis will be placed on evaluation of synthetic lubricants for both natural and synthetic low GWP refrigerants.
Identifying Factors for Worker Motivation in Zambia's Rural Health Facilities.
Cross, Samuel S; Baernholdt, Dr Marianne
2017-01-01
Within Zambia there is a shortage of health workers in rural areas. This study aims to identify motivating factors for retaining rural health workers. Sixty rural health workers completed surveys and 46 were interviewed. They rated the importance of six motivating factors and discussed these and other factors in interviews. An interview was conducted with a Government Human Resources Manager (HR Manager) to elicit contextual information. All six factors were identified as being very important motivators, as were two additional factors. Additional career training was identified by many as the most important factor. Comparison of results and the HR Manager interview revealed that workers lacked knowledge about opportunities and that the HR manager was aware of barriers to career development. The Zambian government might better motivate and retain rural health workers by offering them any combination of identified factors, and by addressing the barriers to career development.
Armitage, Jack; Poyzer, Jillian K.
2010-01-01
The research question addressed in this study is to compare and identify differences between academics teaching auditing classes and practicing accountants regarding the importance of topics covered in the first university auditing course. This is accomplished by surveying academics and practitioners regarding their perceptions of the importance…
Ranking of input parameters importance for BWR stability based on Ringhals-1
International Nuclear Information System (INIS)
Gajev, Ivan; Kozlowski, Tomasz; Xu, Yunlin; Downar, Thomas
2011-01-01
Unstable behavior of Boiling Water Reactors (BWRs) is known to occur during operation at certain power and flow conditions. Uncertainty calculations for BWR stability, based on the Wilks' formula, have been already done for the Ringhals-1 benchmark. In this work, these calculations have been used to identify and rank the most important parameters affecting the stability of the Ringhals-1 plant. The ranking has been done in two different ways and a comparison of these two methods has been demonstrated. Results show that the methods provide different, but meaningful evaluations of the ranking. (author)
Blau, Gary; Chapman, Susan; Gibson, Gregory; Bentley, Melissa A
2011-01-01
The purpose of our study was to investigate the importance of different items as reasons for leaving the Emergency Medical Service (EMS) profession. An exit survey was returned by three distinct EMS samples: 127 full compensated, 45 partially compensated and 72 non-compensated/volunteer respondents, who rated the importance of 17 different items for affecting their decision to leave EMS. Unfortunately, there were a high percentage of "not applicable" responses for 10 items. We focused on those seven items that had a majority of useable responses across the three samples. Results showed that the desire for better pay and benefits was a more important reason for leaving EMS for the partially compensated versus fully compensated respondents. Perceived lack of advancement opportunity was a more important reason for leaving for the partially compensated and volunteer groups versus the fully compensated group. Study limitations are discussed and suggestions for future research offered.
International Nuclear Information System (INIS)
Vieno, T.; Hautojaervi, A.; Raiko, H.; Ahonen, L.; Salo, J.P.
1994-12-01
Rock Engineering Systems (RES) is an approach to discover the important characteristics and interactions of a complex problem. Recently RES has been applied to identify features, events and processes (FEPs) for performance analysis of nuclear waste repositories. The RES methodology was applied to identify FEPs for the near-field analysis of the copper-steel canister for spent fuel disposal. The aims of the exercise were to learn and test the RES methodology and, secondly, to find out how much the results differ when RES is applied by two different groups on the same problem. A similar exercise was previously carried out by a SKB group. A total of 90 potentially significant FEPs were identified. The exercise showed that the RES methodology is a practicable tool to get a comprehensive and transparent picture of a complex problem. The approach is easy to learn and use. It reveals the important characteristics and interactions and organizes them in a format easy to understand. (9 refs., 5 figs., 3 tabs.)
Importance Sampling for Failure Probabilities in Computing and Data Transmission
DEFF Research Database (Denmark)
Asmussen, Søren
We study efficient simulation algorithms for estimating P(Χ > χ), where Χ is the total time of a job with ideal time T that needs to be restarted after a failure. The main tool is importance sampling where one tries to identify a good importance distribution via an asymptotic description...... of the conditional distribution of T given Χ > χ. If T ≡ t is constant, the problem reduces to the efficient simulation of geometric sums, and a standard algorithm involving a Cramér type root γ(t) is available. However, we also discuss an algorithm avoiding the rootfinding. If T is random, particular attention...... is given to T having either a gamma-like tail or a regularly varying tail, and to failures at Poisson times. Different type of conditional limits occur, in particular exponentially tilted Gumbel distributions and Pareto distributions. The algorithms based upon importance distributions for T using...
Importance sampling for failure probabilities in computing and data transmission
DEFF Research Database (Denmark)
Asmussen, Søren
2009-01-01
In this paper we study efficient simulation algorithms for estimating P(X›x), where X is the total time of a job with ideal time $T$ that needs to be restarted after a failure. The main tool is importance sampling, where a good importance distribution is identified via an asymptotic description...... of the conditional distribution of T given X›x. If T≡t is constant, the problem reduces to the efficient simulation of geometric sums, and a standard algorithm involving a Cramér-type root, γ(t), is available. However, we also discuss an algorithm that avoids finding the root. If T is random, particular attention...... is given to T having either a gamma-like tail or a regularly varying tail, and to failures at Poisson times. Different types of conditional limit occur, in particular exponentially tilted Gumbel distributions and Pareto distributions. The algorithms based upon importance distributions for T using...
Identifying organic nitrogen compounds in Rocky Mountain National Park aerosols
Beem, K. B.; Desyaterik, Y.; Ozel, M. Z.; Hamilton, J. F.; Collett, J. L.
2010-12-01
Nitrogen deposition is an important issue in Rocky Mountain National Park (RMNP). While inorganic nitrogen contributions to the ecosystems in this area have been studied, the sources of organic nitrogen are still largely unknown. To better understand the potential sources of organic nitrogen, filter samples were collected and analyzed for organic nitrogen species. Samples were collected in RMNP using a Thermo Fisher Scientific TSP (total suspended particulate) high-volume sampler with a PM2.5 impactor plate from April - November of 2008. The samples presented the opportunity to compare two different methods for identification of individual organic nitrogen species. The first type of analysis was performed with a comprehensive two dimensional gas chromatography (GCxGC) system using a nitrogen chemiluminescence detector (NCD). The filter samples were spiked with propanil in dichloromethane to use as an internal standard and were then extracted in water followed by solid phase extraction. The GCxGC system was comprised of a volatility based separation (DB5 column) followed by a polarity based separation (RXI-17 column). A NCD was used to specifically detect nitrogen compounds and remove the complex background matrix. Individual standards were used to identify peaks by comparing retention times. This method has the added benefit of an equimolar response for nitrogen so only a single calibration is needed for all species. In the second analysis, a portion of the same filter samples were extracted in DI water and analyzed with liquid chromatography coupled with mass spectroscopy (LC/MS). The separation was performed using a C18 column and a water-methanol gradient elution. Electrospray ionization into a time of flight mass spectrometer was used for detection. High accuracy mass measurement allowed unambiguous assignments of elemental composition of resulting ions. Positive and negative polarities were used since amines tend to show up in positive mode and nitrates in
DEFF Research Database (Denmark)
Frølich, Anne
2012-01-01
are limited, it is necessary to identify efficient methods to improve the quality of care. Comparing health care systems is a well-known method for identifying new knowledge regarding, for instance, organisational methods and principles. Kaiser Permanente (KP), an integrated health care delivery system...... in the U.S., is recognized as providing high-quality chronic care; to some extent, this is due to KP's implementation of the chronic care model (CCM). This model recommends a range of evidence-based management practices that support the implementation of evidence-based medicine. However, it is not clear...... which management practices in the CCM are most efficient and in what combinations. In addition, financial incentives and public reporting of performance are often considered effective at improving the quality of health care services, but this has not yet been definitively proved....
Gender Differences in the Importance of Personality Traits in Predicting Leadership Self-Efficacy
Huszczo, Gregory; Endres, Megan Lee
2017-01-01
Our goal in this study was to investigate antecedents to formation of leadership self-efficacy (LSE) for men versus women. We used a relative importance analysis, which allows more precise identification of important predictors without concern of multicollinearity effects on R[superscript 2]. Using a sample of 325 business students, we found that…
Seizure semiology identifies patients with bilateral temporal lobe epilepsy.
Loesch, Anna Mira; Feddersen, Berend; Tezer, F Irsel; Hartl, Elisabeth; Rémi, Jan; Vollmar, Christian; Noachtar, Soheyl
2015-01-01
Laterality in temporal lobe epilepsy is usually defined by EEG and imaging results. We investigated whether the analysis of seizure semiology including lateralizing seizure phenomena identifies bilateral independent temporal lobe seizure onset. We investigated the seizure semiology in 17 patients in whom invasive EEG-video-monitoring documented bilateral temporal seizure onset. The results were compared to 20 left and 20 right consecutive temporal lobe epilepsy (TLE) patients who were seizure free after anterior temporal lobe resection. The seizure semiology was analyzed using the semiological seizure classification with particular emphasis on the sequence of seizure phenomena over time and lateralizing seizure phenomena. Statistical analysis included chi-square test or Fisher's exact test. Bitemporal lobe epilepsy patients had more frequently different seizure semiology (100% vs. 40%; p<0.001) and significantly more often lateralizing seizure phenomena pointing to bilateral seizure onset compared to patients with unilateral TLE (67% vs. 11%; p<0.001). The sensitivity of identical vs. different seizure semiology for the identification of bilateral TLE was high (100%) with a specificity of 60%. Lateralizing seizure phenomena had a low sensitivity (59%) but a high specificity (89%). The combination of lateralizing seizure phenomena and different seizure semiology showed a high specificity (94%) but a low sensitivity (59%). The analysis of seizure semiology including lateralizing seizure phenomena adds important clinical information to identify patients with bilateral TLE. Copyright © 2014 Elsevier B.V. All rights reserved.
Evaluations and utilizations of risk importances
International Nuclear Information System (INIS)
Vesely, W.E.; Davis, T.C.
1985-08-01
This report presents approaches for utilizing Probabilistic Risk Analyses (PRA's) to determine risk importances. Risk importances are determined for design features, plant operations, and other factors that can affect risk. PRA's can be used to identify the importances of risk contributors or proposed changes to designs or operations. The objective of this report is to serve as a handbook and guide in evaluating and applying risk importances. The utilization of both qualitative risk importances and quantitative risk importances is described in this report. Qualitative risk importances are based on the logic models in the PRA, while quantitative risk importances are based on the quantitative results of the PRA. Both types of importances are among the most robust and meaningful information a PRA can provide. A wide variety of risk importance evaluations are described including evaluations of the importances of design changes, testing, maintenance, degrading environments, and aging. Specific utilizations are described in inspection and in reliability assurance programs, however the general approaches have widespread applicability. The role of personal computers and decision support programs in applying risk importance evaluations is also described
Nieuwenhuys, Angela; Papageorgiou, Eirini; Desloovere, Kaat; Molenaers, Guy; De Laet, Tinne
2017-01-01
Experts recently identified 49 joint motion patterns in children with cerebral palsy during a Delphi consensus study. Pattern definitions were therefore the result of subjective expert opinion. The present study aims to provide objective, quantitative data supporting the identification of these consensus-based patterns. To do so, statistical parametric mapping was used to compare the mean kinematic waveforms of 154 trials of typically developing children (n = 56) to the mean kinematic waveforms of 1719 trials of children with cerebral palsy (n = 356), which were classified following the classification rules of the Delphi study. Three hypotheses stated that: (a) joint motion patterns with 'no or minor gait deviations' (n = 11 patterns) do not differ significantly from the gait pattern of typically developing children; (b) all other pathological joint motion patterns (n = 38 patterns) differ from typically developing gait and the locations of difference within the gait cycle, highlighted by statistical parametric mapping, concur with the consensus-based classification rules. (c) all joint motion patterns at the level of each joint (n = 49 patterns) differ from each other during at least one phase of the gait cycle. Results showed that: (a) ten patterns with 'no or minor gait deviations' differed somewhat unexpectedly from typically developing gait, but these differences were generally small (≤3°); (b) all other joint motion patterns (n = 38) differed from typically developing gait and the significant locations within the gait cycle that were indicated by the statistical analyses, coincided well with the classification rules; (c) joint motion patterns at the level of each joint significantly differed from each other, apart from two sagittal plane pelvic patterns. In addition to these results, for several joints, statistical analyses indicated other significant areas during the gait cycle that were not included in the pattern definitions of the consensus study
Website Policies / Important Links | DOepatents
Links Website Policies / Important Links Javascript Not Enabled OSTI Security Website Policies and first) Publication Date (oldest first) Close Clear All Find DOepatents Website Policies / Important Important Links Some links on this page may take you to non-federal websites. Their policies may differ from
Are gender differences important for the clinical effects of antidepressants?
DEFF Research Database (Denmark)
Hildebrandt, Malene Grubbe; Steyerberg, Ewout Willem; Stage, Kurt Bjerregaard
2003-01-01
OBJECTIVE: Gender differences in antidepressant treatment response, side effects, dropout rates, and plasma concentrations were examined in patients with major and predominantly melancholic depression. METHOD: The study included a subgroup of 292 inpatients (96 men, 196 women) from three Danish...... and multiple linear and logistic regression models were used for statistical evaluations. RESULTS: Both genders had similar remission rates (Hamilton depression scale score .... The plasma concentrations of clomipramine were significantly higher for female than for male patients. No gender differences were found in posttreatment Hamilton depression scale scores, nor did the therapeutic effects of treatment depend on gender. Rates of dropout and side effects were similar for men...
Callicó Fortunato, Roberta; Benedito Durà, Vicent; Volpedo, Alejandra
2014-06-01
In the Northeastern Atlantic and Mediterranean Sea there are 8 species of the Mugilidae family: Mugil cephalus, Liza aurata, Liza ramada, Oedalechilus labeo, Chelon labrosus, Liza saliens, Liza carinata and Liza haematocheila. The identification of mugilids is very important for local fisheries management and regulations, but it is difficult using gross morphological characters. This work aims to contribute to the identification of mullets present in the Northeastern Atlantic Ocean and Mediterranean Sea using saccular otolith features of each species. Specimens of C. labrosus, L. aurata, L. ramada, L. saliens and M. cephalus were obtained from Delta del Ebro (40°38'N-0°44'E) in artisanal catches. For L. carinata and O. labeo photographs extracted from AFORO online database were used. L. haematocheila was not studied for lack of otolith samples. A general pattern of the saccular otoliths for this family was identified: the shape of the otoliths are rectangular to oblong with irregular margins; they present a heterosulcoid, ostial sulcus acusticus, with an open funnel-like ostium to the anterior margin and a closed, tubular cauda, ending towards the posterior ventral corner, always larger than the ostium. In the present study, the mugilid species could be recognized using their saccular otolith morphology. Here we give the first key to identify Northeastern Atlantic and Mediterranean mullets. The distinctive features between the species were the position and centrality of the sulcus, the curvature of the cauda, the presence of areal depositions and plateaus, and the type of anterior and posterior regions. These features could be used not only to reinforce the identification keys through morphological and meristic characters of the species, but also to identify the species consumed by piscivores, being the otoliths the only identifiable remains of the individuals.
DEFF Research Database (Denmark)
Kristensen, Kristian; Ericson, Lars
2008-01-01
The interest in organic grown cereals has increased the need for variety tests under organic growing systems and/or the knowledge on whether growth characteristics describe yield differently under conventional and organic conditions. This paper is a contribution to that question by examining...... the relationships between some important growth characteristics in barley trials in both systems in Northern Sweden and in Denmark. Mixed model analyses were used for regressions of growth characteristics (or transformations of those) on yield (and log-transformed yield), allowing the slope to depend on the growing...... system. The analyses showed that diseases seemed to have a less negative effect on yield in the organic growing system than in the conventional growing system if pesticides were not applied. For other characteristics the effect depended on the country. This was the case for grain characteristics where...
International Nuclear Information System (INIS)
Limkitjaroenporn, P.; Kaewkhao, J.
2014-01-01
In this work, the gamma-rays interaction properties of zircons from Cambodia and South Africa have been studied. The densities of Cambodian and South African’s zircons are 4.6716±0.0040 g/cm 3 and 4.5505±0.0018 g/cm 3 , respectively. The mass attenuation coefficient and the effective atomic number of gemstones were measured with the gamma-ray in energies range 223–662 keV using the Compton scattering technique. The mass attenuation coefficients of both zircons decreased with the increasing of gamma-rays energies. The different mass attenuation coefficients between the two zircons observed at gamma-ray energies below 400 keV are attributed to the differences in the photoelectric interaction. The effective atomic number of zircons was decreased with the increasing of gamma-ray energies and showed totally different values between the Cambodia and South Africa sources. The origins of the two zircons could be successfully identified by the method based on gamma-rays interaction with matter with advantage of being a non-destructive testing. - Highlights: • Gamma-rays interaction of zircons from Cambodia and South Africa studied. • Measured energy is during 223–662 keV. • Different μ m between the two zircons observed at gamma-ray energies below 400 keV. • The origins the two zircons could be successfully identified
DEFF Research Database (Denmark)
Pedersen, Tanja Xenia; Leethanakul, Chidchanop; Patel, Vyomesh
2003-01-01
keratinocytes from incisional mouse skin wounds and adjacent normal skin keratinocytes. Changes in gene expression were determined by comparative cDNA array analyses, and the approach was validated by in situ hybridization. The analyses identified 48 candidate genes not previously associated with wound...... reepithelialization. Furthermore, the analyses revealed that the phenotypic resemblance of wound keratinocytes to squamous cell carcinoma is mimicked at the level of gene expression, but notable differences between the two tissue-remodeling processes were also observed. The combination of laser capture...
Porsch, Katharina; Meier, Jutta; Kleinsteuber, Sabine; Wendt-Potthoff, Katrin
2009-05-01
Iron- and sulfate-reducing microorganisms play an important role for alkalinity-generating processes in mining lakes with low pH. In the acidic mining lake 111 in Lusatia, Germany, a passive in situ remediation method was tested in a large scale experiment, in which microbial iron and sulfate reduction are stimulated by addition of Carbokalk (a mixture of the nonsugar compounds of sugar beets and lime) and straw. The treated surface sediment consisted of three layers of different pH and geochemical composition. The top layer was acidic and rich in Fe(III), the second and third layer both showed moderately acidic to circum-neutral pH values, but only the second was rich in organics, strongly reduced and sulfidic. Aim of the study was to elucidate the relative importance of neutrophilic heterotrophic, acidophilic heterotrophic, and acidophilic autotrophic iron-reducing microorganisms in each of the three layers. In order to distinguish between them, the effect of their respective characteristic electron donors acetate, glucose, and elemental sulfur on potential iron reduction rates was investigated. Limitation of iron reduction by the availability of Fe(III) was revealed by the addition of Fe(OH)(3). The three groups of iron-reducing microorganisms were quantified by most probable number (MPN) technique and their community composition was analyzed by cloning and sequencing of 16S rRNA genes. In the acidic surface layer, none of the three electron donors stimulated iron reduction; acetate even had an inhibiting effect. In agreement with this, no decrease of the added electron donors was observed. Iron reduction rates were low in comparison to the other layers. Iron reduction in layers 2 and 3 was enhanced by glucose and acetate, accompanied by a decrease of these electron donors. Addition of elemental sulfur did not enhance iron reduction in either layer. Layer 2 exhibited the highest iron reduction rate (4.08 mmol dm(-3) d(-1)) and the highest cell numbers in MPN
Level of importance attached to competitive intelligence at a mass import retail organization
Directory of Open Access Journals (Sweden)
M. Begg
2007-12-01
Full Text Available The purpose of this research was to establish the level of importance attached to competitive intelligence (CI at a mass import retail organization in South Africa. The rationale of CI is to alert an organization about the current situation as it relates to its business environment and competitors, and how these aspects affect the competitive situation. In this article, the value and significance that CI presents to organizations upon implementation are discussed by focusing upon the need for a competitive strategy, the significance of institutionalizing CI, various organizational structure options and the establishment of a CI culture. A survey was conducted at a mass import retail organization to determine the level of importance attached to CI. A total of 107 employees were randomly selected to participate in the completion of a questionnaire. Based on the results, it was found that this organization practised CI, albeit in an informal manner, and it was concluded that there was a relatively high level of importance attached to CI within this organization. However, areas for improvement were identified and a recommendation was made of implementing a formal CI function within the organization.
Level of importance attached to competitive intelligence at a mass import retail organization
Directory of Open Access Journals (Sweden)
M. Begg
2008-01-01
Full Text Available The purpose of this research was to establish the level of importance attached to competitive intelligence (CI at a mass import retail organization in South Africa. The rationale of CI is to alert an organization about the current situation as it relates to its business environment and competitors, and how these aspects affect the competitive situation. In this article, the value and significance that CI presents to organizations upon implementation are discussed by focusing upon the need for a competitive strategy, the significance of institutionalizing CI, various organizational structure options and the establishment of a CI culture. A survey was conducted at a mass import retail organization to determine the level of importance attached to CI. A total of 107 employees were randomly selected to participate in the completion of a questionnaire. Based on the results, it was found that this organization practised CI, albeit in an informal manner, and it was concluded that there was a relatively high level of importance attached to CI within this organization. However, areas for improvement were identified and a recommendation was made of implementing a formal CI function within the organization.
Te Wierike, Sanne Cornelia Maria; Huijgen, Barbara Catharina Helena; Jonker, Laura; Elferink-Gemser, Marije Titia; Visscher, Chris
2018-03-01
This study first investigated the importance of ball control and (self-reported) self-regulatory skills in achieving the elite level in basketball. The second aim was to gain insight into the development of, and association between ball control and (self-reported) self-regulatory skills that contribute to achieving the elite level, with taking into account positional differences. Talented male players (N = 73; age 16.56 ± 1.96) completed the STARtest to measure ball control and a questionnaire to measure (self-reported) self-regulation from 2008-2012. Results showed that (self-reported) reflective skills were most important to achieve the elite level (OR = 11.76; P self-reported) reflection over time for guards, forwards, and centers. Improvement in ball control was evident for guards (r = -0.65; P self-reported) reflection and ball control, i.e., higher reflection was related to better ball control (guards r = -0.19; forwards r = -0.18) in contrast to centers (r = 0.34). It is concluded that (self-reported) reflective skills are important to achieve the elite level, while ball control seems especially important for guards.
Determining the Minimal Clinically Important Difference for Six-Minute Walk Distance in Fibromyalgia
Kaleth, Anthony S.; Slaven, James E.; Ang, Dennis C.
2016-01-01
Objective To estimate the minimal clinically important difference (MCID) for 6-minute walk distance (6MWD) in patients with fibromyalgia (FM). Design Data from a recently completed trial that included 187 patients who completed the 6-minute walk test, Fibromyalgia Impact Questionnaire (FIQ), and Short-Form 36 (SF36) at 12 and 36 weeks were used to examine longitudinal changes in 6MWD. An anchor-based approach that used linear regression analyses was used to determine the MCID for 6MWD, using the total FIQ score (FIQ-Total) and SF36-physical function domain (SF36-PF) as clinical anchors. Results The mean (SD) change in 6MWD from baseline to week 36 was 34.4 (65.2) m (pFIQ and SF36-PF, respectively. These MCID’s correspond with clinically meaningful improvements in FIQ (14% reduction) and SF36-PF (10 point increase). Conclusion The MCID for 6MWD in patients with FM was 156 to 167 m. These findings provide the first evidence of the change in 6MWD that is perceived by patients to be clinically meaningful. Further research using other MCID calculation methods is needed to refine estimates of the MCID for 6MWD in patients with FM. PMID:27003201
Determining the Minimal Clinically Important Difference for 6-Minute Walk Distance in Fibromyalgia.
Kaleth, Anthony S; Slaven, James E; Ang, Dennis C
2016-10-01
The aim of this study was to estimate the minimal clinically important difference (MCID) for 6-min walk distance (6MWD) in patients with fibromyalgia. Data from a recently completed trial that included 187 patients who completed the 6-min walk test, Fibromyalgia Impact Questionnaire (FIQ), and Short-Form 36 (SF36) at 12 and 36 wks were used to examine longitudinal changes in 6MWD. An anchor-based approach that used linear regression analyses was used to determine the MCID for 6MWD, using the total FIQ score (FIQ-Total) and SF36-physical function domain as clinical anchors. The mean (SD) change in 6MWD from baseline to week 36 was 34.4 (65.2) m (P FIQ and SF36-physical function domain, respectively. These MCIDs correspond with clinically meaningful improvements in FIQ (14% reduction) and SF36-physical function domain (10-point increase). The MCID for 6MWD in patients with fibromyalgia was 156 to 167 m. These findings provide the first evidence of the change in 6MWD that is perceived by patients to be clinically meaningful. Further research using other MCID calculation methods is needed to refine estimates of the MCID for 6MWD in patients with fibromyalgia.
International Nuclear Information System (INIS)
Millwater, Harry; Singh, Gulshan; Cortina, Miguel
2012-01-01
There are many methods to identify the important variable out of a set of random variables, i.e., “inter-variable” importance; however, to date there are no comparable methods to identify the “region” of importance within a random variable, i.e., “intra-variable” importance. Knowledge of the critical region of an input random variable (tail, near-tail, and central region) can provide valuable information towards characterizing, understanding, and improving a model through additional modeling or testing. As a result, an intra-variable probabilistic sensitivity method was developed and demonstrated for independent random variables that computes the partial derivative of a probabilistic response with respect to a localized perturbation in the CDF values of each random variable. These sensitivities are then normalized in absolute value with respect to the largest sensitivity within a distribution to indicate the region of importance. The methodology is implemented using the Score Function kernel-based method such that existing samples can be used to compute sensitivities for negligible cost. Numerical examples demonstrate the accuracy of the method through comparisons with finite difference and numerical integration quadrature estimates. - Highlights: ► Probabilistic sensitivity methodology. ► Determines the “region” of importance within random variables such as left tail, near tail, center, right tail, etc. ► Uses the Score Function approach to reuse the samples, hence, negligible cost. ► No restrictions on the random variable types or limit states.
Schunk, Gerhard; Fürst, Josef U; Förtsch, Michael; Strekalov, Dmitry V; Vogl, Ulrich; Sedlmeir, Florian; Schwefel, Harald G L; Leuchs, Gerd; Marquardt, Christoph
2014-12-15
Identifying the mode numbers in whispering-gallery mode resonators (WGMRs) is important for tailoring them to experimental needs. Here we report on a novel experimental mode analysis technique based on the combination of frequency analysis and far-field imaging for high mode numbers of large WGMRs. The radial mode numbers q and the angular mode numbers p = ℓ-m are identified and labeled via far-field imaging. The polar mode numbers ℓ are determined unambiguously by fitting the frequency differences between individual whispering gallery modes (WGMs). This allows for the accurate determination of the geometry and the refractive index at different temperatures of the WGMR. For future applications in classical and quantum optics, this mode analysis enables one to control the narrow-band phase-matching conditions in nonlinear processes such as second-harmonic generation or parametric down-conversion.
2015-01-01
The goal of understanding mechanisms of transmembrane signaling, one of many key life processes mediated by membrane proteins, has motivated numerous studies of bacterial chemotaxis receptors. Ligand binding to the receptor causes a piston motion of an α helix in the periplasmic and transmembrane domains, but it is unclear how the signal is then propagated through the cytoplasmic domain to control the activity of the associated kinase CheA. Recent proposals suggest that signaling in the cytoplasmic domain involves opposing changes in dynamics in different subdomains. However, it has been difficult to measure dynamics within the functional system, consisting of extended arrays of receptor complexes with two other proteins, CheA and CheW. We have combined hydrogen exchange mass spectrometry with vesicle template assembly of functional complexes of the receptor cytoplasmic domain to reveal that there are significant signaling-associated changes in exchange, and these changes localize to key regions of the receptor involved in the excitation and adaptation responses. The methylation subdomain exhibits complex changes that include slower hydrogen exchange in complexes in a kinase-activating state, which may be partially consistent with proposals that this subdomain is stabilized in this state. The signaling subdomain exhibits significant protection from hydrogen exchange in complexes in a kinase-activating state, suggesting a tighter and/or larger interaction interface with CheA and CheW in this state. These first measurements of the stability of protein subdomains within functional signaling complexes demonstrate the promise of this approach for measuring functionally important protein dynamics within the various physiologically relevant states of multiprotein complexes. PMID:25420045
Atkinson, Mark J; Lohs, Jan; Kuhagen, Ilka; Kaufman, Julie; Bhaidani, Shamsu
2006-09-22
This proof of concept (POC) study was designed to evaluate the use of an Internet-based bulletin board technology to aid parallel cross-cultural development of thematic content for a new set of patient-reported outcome measures (PROs). The POC study, conducted in Germany and the United States, utilized Internet Focus Groups (IFGs) to assure the validity of new PRO items across the two cultures--all items were designed to assess the impact of excess facial oil on individuals' lives. The on-line IFG activities were modeled after traditional face-to-face focus groups and organized by a common 'Topic' Guide designed with input from thought leaders in dermatology and health outcomes research. The two sets of IFGs were professionally moderated in the native language of each country. IFG moderators coded the thematic content of transcripts, and a frequency analysis of code endorsement was used to identify areas of content similarity and difference between the two countries. Based on this information, draft PRO items were designed and a majority (80%) of the original participants returned to rate the relative importance of the newly designed questions. The use of parallel cross-cultural content analysis of IFG transcripts permitted identification of the major content themes in each country as well as exploration of the possible reasons for any observed differences between the countries. Results from coded frequency counts and transcript reviews informed the design and wording of the test questions for the future PRO instrument(s). Subsequent ratings of item importance also deepened our understanding of potential areas of cross-cultural difference, differences that would be explored over the course of future validation studies involving these PROs. The use of IFGs for cross-cultural content development received positive reviews from participants and was found to be both cost and time effective. The novel thematic coding methodology provided an empirical platform on which to
Kacsoh, Balint Z; Greene, Casey S; Bosco, Giovanni
2017-11-06
High-throughput experiments are becoming increasingly common, and scientists must balance hypothesis-driven experiments with genome-wide data acquisition. We sought to predict novel genes involved in Drosophila learning and long-term memory from existing public high-throughput data. We performed an analysis using PILGRM, which analyzes public gene expression compendia using machine learning. We evaluated the top prediction alongside genes involved in learning and memory in IMP, an interface for functional relationship networks. We identified Grunge/Atrophin ( Gug/Atro ), a transcriptional repressor, histone deacetylase, as our top candidate. We find, through multiple, distinct assays, that Gug has an active role as a modulator of memory retention in the fly and its function is required in the adult mushroom body. Depletion of Gug specifically in neurons of the adult mushroom body, after cell division and neuronal development is complete, suggests that Gug function is important for memory retention through regulation of neuronal activity, and not by altering neurodevelopment. Our study provides a previously uncharacterized role for Gug as a possible regulator of neuronal plasticity at the interface of memory retention and memory extinction. Copyright © 2017 Kacsoh et al.
International Nuclear Information System (INIS)
Metwally, E.; Abd-El-Khalik, H.; El-Sweify, F.H.; El-Sweify, A.H.H.
2004-01-01
Instrumental neutron activation analysis technique was used to determine some trace elements in seeds of jute (corchorus capsularis). The seed samples were obtained from Agricultural Research Center (ARC), Giza, (EG). The analyzed seed samples were produced from cultivation of three different strains, namely: St. DC 1105, st. JRC 7447 and St. PADMA. These strains were imported from Bangladesh. The jute plant was cultivated in sandy soil in Ismailaya research station farm at may on two seasons 1999 and 2000. The plant was irrigated with water from Ismailaya canal. The study was carried out to compare the influence of applying different kinds of fertilizers of different rates, i.e. mineral fertilizer and biofertilizer, on the uptake of some biologically important trace elements and to determine their concentration in the analyzed jute seed samples. These elements were; Co,Cr,Fe,Zn and others eight elements were analyzed quantitatively
Leading change: 1--identifying the issue.
Kerridge, Joanna
To enable sustainable change, nurses need to take the lead in managing it. Recent national initiatives have emphasised the importance of frontline staff in service improvement. The ability to influence and manage change has been identified as an essential skill for delivering new models of care. This article is the first in a three-part series designed to help nurses at all levels develop the knowledge and skills they will need to initiate and manage change. This article focuses on identifying what needs to be changed and why.
Lonigan, Christopher J; Goodrich, J Marc; Farver, JoAnn M
2018-04-01
Despite acknowledgment that language-minority children come from a wide variety of home language backgrounds and have a wide range of proficiency in their first (L1) and second (L2) languages, it is unknown whether differences across language-minority children in relative and absolute levels of proficiency in L1 and L2 predict subsequent development of literacy-related skills. The purpose of this study was to identify subgroups of language-minority children and evaluate whether differences in level and rate of growth of early literacy skills differed across subgroups. Five-hundred and twenty-six children completed measures of Spanish and English language and early literacy skills at the beginning, middle, and end of the preschool year. Latent growth models indicated that children's early literacy skills were increasing over the course of the preschool year. Latent profile analysis indicated that language-minority children could be classified into nine distinct groups, each with unique patterns of absolute and relative levels of proficiency in L1 and L2. Results of three-step mixture models indicated that profiles were closely associated with level of early literacy skills at the beginning of the preschool year. Initial level of early literacy skills was positively associated with growth in code-related skills (i.e., print knowledge, phonological awareness) and inversely associated with growth in language skills. These findings suggest that language-minority children are a diverse group with regard to their L1 and L2 proficiencies and that growth in early literacy skills is most associated with level of proficiency in the same language. (PsycINFO Database Record (c) 2018 APA, all rights reserved).
European policymaking on the tobacco advertising ban: the importance of escape routes.
Adamini, Sandra; Versluis, Esther; Maarse, Hans
2011-01-01
This article analyses the European Union policymaking process regarding tobacco advertising. While others already highlighted the importance of intergovernmental bargaining between member states to explain the outcome of the tobacco advertising case, the main aim of this article is to identify the use of escape routes by the Commission, the European Parliament, the Council and interest groups that played an important role in overcoming the deadlock. When looking at the different institutions that structure policymaking, we argue that indeed focusing on escape routes provides a clear insight in the process and in what strategies were necessary to 'make Europe work'. In the end, it appears to be a combination of escape routes that resulted in the final decision.
Liu, Zhihua; Yang, Jian; He, Hong S.
2013-01-01
The relative importance of fuel, topography, and weather on fire spread varies at different spatial scales, but how the relative importance of these controls respond to changing spatial scales is poorly understood. We designed a “moving window” resampling technique that allowed us to quantify the relative importance of controls on fire spread at continuous spatial scales using boosted regression trees methods. This quantification allowed us to identify the threshold value for fire size at which the dominant control switches from fuel at small sizes to weather at large sizes. Topography had a fluctuating effect on fire spread across the spatial scales, explaining 20–30% of relative importance. With increasing fire size, the dominant control switched from bottom-up controls (fuel and topography) to top-down controls (weather). Our analysis suggested that there is a threshold for fire size, above which fires are driven primarily by weather and more likely lead to larger fire size. We suggest that this threshold, which may be ecosystem-specific, can be identified using our “moving window” resampling technique. Although the threshold derived from this analytical method may rely heavily on the sampling technique, our study introduced an easily implemented approach to identify scale thresholds in wildfire regimes. PMID:23383247
Maletzki, Claudia; Huehns, Maja; Bauer, Ingrid; Ripperger, Tim; Mork, Maureen M; Vilar, Eduardo; Klöcking, Sabine; Zettl, Heike; Prall, Friedrich; Linnebacher, Michael
2017-07-01
Mismatch-repair deficient (MMR-D) malignancies include Lynch Syndrome (LS), which is secondary to germline mutations in one of the MMR genes, and the rare childhood-form of constitutional mismatch repair-deficiency (CMMR-D); caused by bi-allelic MMR gene mutations. A hallmark of LS-associated cancers is microsatellite instability (MSI), characterized by coding frameshift mutations (cFSM) in target genes. By contrast, tumors arising in CMMR-D patients are thought to display a somatic mutation pattern differing from LS. This study has the main goal to identify cFSM in MSI target genes relevant in CMMR-D and to compare the spectrum of common somatic mutations, including alterations in DNA polymerases POLE and D1 between LS and CMMR-D. CMMR-D-associated tumors harbored more somatic mutations compared to LS cases, especially in the TP53 gene and in POLE and POLD1, where novel mutations were additionally identified. Strikingly, MSI in classical mononucleotide markers BAT40 and CAT25 was frequent in CMMR-D cases. MSI-target gene analysis revealed mutations in CMMR-D-associated tumors, some of them known to be frequently hit in LS, such as RNaseT2, HT001, and TGFβR2. Our results imply a general role for these cFSM as potential new drivers of MMR-D tumorigenesis. © 2017 Wiley Periodicals, Inc.
Imports/exports issues and options : discussion paper
International Nuclear Information System (INIS)
2001-01-01
The Alberta marketplace is ideally located for connections to British Columbia, the Pacific Northwest, Saskatchewan, Manitoba and the Mid-Continental Area Power Pool (MAPP). Alignment with other markets becomes an important issue and provides challenges that must be overcome. It provides an opportunity for expanded trade in Alberta based loads and generation. The Real Time (RT) market for the trading of physical, dispatchable energy and the forwards markets (financial and intended to go to delivery through the RT market) are comprised in the Alberta marketplace. The development of a complete marketplace for electricity is fully supported by the Power Poll of Alberta. Developments in those two markets allow greater opportunity for a review of the interconnections in the Alberta electricity market. In this document, an attempt is made to identify issues relating to the imports and exports and develop alternative mechanisms to resolve these issues. Three main objectives were put forth: identify a better mechanism to meet the requirements of the Pool Price Deficiency Regulation (PPDR), identify a better mechanism to allow imports and exports to participate in the Alberta market that takes into consideration the impact of transmission constraints, and to better align with external markets. An hour ahead firm market for interconnections was one option that addresses the issues under consideration
Directory of Open Access Journals (Sweden)
Antonio Granero-Gallegos
2012-12-01
Full Text Available he purpose of this study was to analyze the motivational profiles of satisfaction with and importance of physical education in high school students and its relation with gender and the practice of sport. The sample comprised 2002 students aged from 12 to 19 who completed the Sport Motivation Scale (Núñez et al., 2006, the Perception of Success Scale (Martínez et al., 2006, the Sport Satisfaction Instrument (Baena-Extremera et al., 2012 and the Importance of Physical Education Scale (Moreno et al., 2009. Descriptive analyzes, correlations between the scales, a cluster analysis for profiles, and a MANOVA were conducted to examine differences by gender. Three clusters (profiles were identified. The first profile identified was "moderate" motivation (n = 463 and was associated with boys who practice physical activity for less than 3 hours per week. The second profile identified was "low" motivation (n = 545 and was associated mainly with girls who practice physical activity for less than 3 hours per week. And lastly the third profile identified was "high" motivation (n = 910, which was found to be greater in boys who practiced physical exercise for more than 3 hours a week
Leung, Yuk Yee; Toledo, Jon B.; Nefedov, Alexey; Polikar, Robi; Raghavan, Nandini; Xie, Sharon X.; Farnum, Michael; Schultz, Tim; Baek, Young; Van Deerlin, Vivianna M.; Hu, William T.; Holtzman, David M.; Fagan, Anne M.; Perrin, Richard J.; Grossman, Murray
2015-01-01
Introduction The dynamic range of cerebrospinal fluid (CSF) amyloid ? (A?1?42) measurement does not parallel to cognitive changes in Alzheimer's disease (AD) and cognitively normal (CN) subjects across different studies. Therefore, identifying novel proteins to characterize symptomatic AD samples is important. Methods Proteins were profiled using a multianalyte platform by Rules Based Medicine (MAP-RBM). Due to underlying heterogeneity and unbalanced sample size, we combined subjects (344 AD ...
SPARQL-enabled identifier conversion with Identifiers.org.
Wimalaratne, Sarala M; Bolleman, Jerven; Juty, Nick; Katayama, Toshiaki; Dumontier, Michel; Redaschi, Nicole; Le Novère, Nicolas; Hermjakob, Henning; Laibe, Camille
2015-06-01
On the semantic web, in life sciences in particular, data is often distributed via multiple resources. Each of these sources is likely to use their own International Resource Identifier for conceptually the same resource or database record. The lack of correspondence between identifiers introduces a barrier when executing federated SPARQL queries across life science data. We introduce a novel SPARQL-based service to enable on-the-fly integration of life science data. This service uses the identifier patterns defined in the Identifiers.org Registry to generate a plurality of identifier variants, which can then be used to match source identifiers with target identifiers. We demonstrate the utility of this identifier integration approach by answering queries across major producers of life science Linked Data. The SPARQL-based identifier conversion service is available without restriction at http://identifiers.org/services/sparql. © The Author 2015. Published by Oxford University Press.
SPARQL-enabled identifier conversion with Identifiers.org
Wimalaratne, Sarala M.; Bolleman, Jerven; Juty, Nick; Katayama, Toshiaki; Dumontier, Michel; Redaschi, Nicole; Le Novère, Nicolas; Hermjakob, Henning; Laibe, Camille
2015-01-01
Motivation: On the semantic web, in life sciences in particular, data is often distributed via multiple resources. Each of these sources is likely to use their own International Resource Identifier for conceptually the same resource or database record. The lack of correspondence between identifiers introduces a barrier when executing federated SPARQL queries across life science data. Results: We introduce a novel SPARQL-based service to enable on-the-fly integration of life science data. This service uses the identifier patterns defined in the Identifiers.org Registry to generate a plurality of identifier variants, which can then be used to match source identifiers with target identifiers. We demonstrate the utility of this identifier integration approach by answering queries across major producers of life science Linked Data. Availability and implementation: The SPARQL-based identifier conversion service is available without restriction at http://identifiers.org/services/sparql. Contact: sarala@ebi.ac.uk PMID:25638809
To Identify the Important Soil Properties Affecting Dinoseb Adsorption with Statistical Analysis
Directory of Open Access Journals (Sweden)
Yiqing Guan
2013-01-01
Full Text Available Investigating the influences of soil characteristic factors on dinoseb adsorption parameter with different statistical methods would be valuable to explicitly figure out the extent of these influences. The correlation coefficients and the direct, indirect effects of soil characteristic factors on dinoseb adsorption parameter were analyzed through bivariate correlation analysis, and path analysis. With stepwise regression analysis the factors which had little influence on the adsorption parameter were excluded. Results indicate that pH and CEC had moderate relationship and lower direct effect on dinoseb adsorption parameter due to the multicollinearity with other soil factors, and organic carbon and clay contents were found to be the most significant soil factors which affect the dinoseb adsorption process. A regression is thereby set up to explore the relationship between the dinoseb adsorption parameter and the two soil factors: the soil organic carbon and clay contents. A 92% of the variation of dinoseb sorption coefficient could be attributed to the variation of the soil organic carbon and clay contents.
Michel, Jesse S; Clark, Malissa A
2013-10-01
This study examines the relative importance of individual differences in relation to perceptions of work-family conflict and facilitation, as well as the moderating role of boundary preference for segmentation on these relationships. Relative importance analyses, based on a diverse sample of 380 employees from the USA, revealed that individual differences were consistently predictive of self-reported work-family conflict and facilitation. Conscientiousness, neuroticism, negative affect and core self-evaluations were consistently related to both directions of work-family conflict, whereas agreeableness predicted significant variance in family-to-work conflict only. Positive affect and core self-evaluations were consistently related to both directions of work-family facilitation, whereas agreeableness and neuroticism predicted significant variance in family-to-work facilitation only. Collectively, individual differences explained 25-28% of the variance in work-family conflict (primarily predicted by neuroticism and negative affect) and 11-18% of the variance in work-family facilitation (primarily predicted by positive affect and core self-evaluations). Moderated regression analyses showed that boundary preference for segmentation strengthened many of the relationships between individual differences and work-family conflict and facilitation. Implications for addressing the nature of work and family are discussed. Copyright © 2012 John Wiley & Sons, Ltd.
Trustworthy persistent identifier systems of the future
Golodoniuc, Pavel; Klump, Jens; Car, Nicholas
2016-04-01
Over the last two decades, persistent identifier (PID) systems have seen some significant changes in their governance policies, system capabilities, and technology. The development of most systems was driven by two main application areas, namely archives and libraries. Guidelines and criteria for trustworthy PID systems have been clearly devised (Bütikofer, 2009) and many PID system implementations for the identification of static digital objects have been built (e.g., PURL). However systems delivering persistent identifiers for dynamic datasets are not yet mature. There has been a rapid proliferation of different PID systems caused by the specific technical or organisational requirements of various communities that could not be met by existing systems such as DOI, ISBN, and EAN. Many of these different systems were limited by their inability to provide native means of persistent identifier resolution. This has prompted a decoupling of PID-associated data from the resolution service and this is where the Handle system has played a significant role. The Handle allowed to build a distributed system of independently managed resolver services. A trustworthy PID system must be designed to outlive the objects it provides persistent identifiers for, which may cease to exist or otherwise be deprecated, and the technology used to implement it, which will certainly need to change with time. We propose that such a system should rest on four pillars of agreements - (i) definitions, (ii) policies, (iii) services, and (iv) data services, to ensure longevity. While we believe all four pillars are equally important, we intentionally leave regulating aspects of issuing of identifiers and their registration out of the scope of this paper and focus on the agreements that have to be established between PID resolver services and the data sources indicated by the persistent identifiers. We propose an approach to development of PID systems that combines the use of (a) the Handle system
Directory of Open Access Journals (Sweden)
V.O. Lisowski
2013-12-01
Full Text Available The aim - to identify the role and importance of coordination abilities in the manifestation of professionally important qualities of psychophysical military experts. It is established that the exercise of general, special and specific coordination abilities provides the most efficient and reliable psychophysical military readiness and suitability to the successful solution of the tasks of combat mission. It is noted that a professionally-applied physical training future military specialist should focus on the development of a certain amount of knowledge and skills. Also - on the formation of professionally important psychophysical qualities that ensure a high degree of readiness of the military to successfully complete the tasks in extreme conditions. Set of system- level structural relationships of mental and physical indicators of the motor and functional fitness, mental processes, and psychomotor ability to control motor actions in different conditions of military occupation.
Identifying Gender Differences in an Australian Youth Offender Population
Directory of Open Access Journals (Sweden)
Stephane M. Shepherd
2013-06-01
Full Text Available The study examined gender differences in risk factors for violence in a sample of 213 male and female youths held in Youth Justice Centres in Victoria, Australia. Although violence risk factors are considered to be commensurate across gender, a growing body of international literature is categorizing gender-specific criminal trajectories. The study aimed to investigate this concept in an Australian juvenile context. Through the use of a widely validated youth violence risk assessment inventory, the prevalence of salient risk items was compared across gender. Young female offenders were found to present with higher levels of family dysfunction, peer rejection and self-injurious behavior reflecting international female offending pathways literature.
Identification of items and activities important to waste form acceptance by Westinghouse GoCo sites
International Nuclear Information System (INIS)
Plodinec, M.J.; Marra, S.L.; Dempster, J.; Randklev, E.H.
1993-01-01
The Department of Energy has established specifications (Waste Acceptance Product Specifications for Vitrified High-Level Waste Forms, or WAPS) for canistered waste forms produced at Hanford, Savannah River, and West Valley. Compliance with these specifications requires that each waste form producer identify the items and activities which must be controlled to ensure compliance. As part of quality assurance oversight activities, reviewers have tried to compare the methodologies used by the waste form producers to identify items and activities important to waste form acceptance. Due to the lack of a documented comparison of the methods used by each producer, confusion has resulted over whether the methods being used are consistent. This confusion has been exacerbated by different systems of nomenclature used by each producer, and the different stages of development of each project. The waste form producers have met three times in the last two years, most recently on June 28, 1993, to exchange information on each producer's program. These meetings have been sponsored by the Westinghouse GoCo HLW Vitrification Committee. This document is the result of this most recent exchange. It fills the need for a documented comparison of the methodologies used to identify items and activities important to waste form acceptance. In this document, the methodology being used by each waste form producer is summarized, and the degree of consistency among the waste form producers is determined
Controlled searching in reversibly de-identified medical imaging archives.
Silva, Jorge Miguel; Pinho, Eduardo; Monteiro, Eriksson; Silva, João Figueira; Costa, Carlos
2018-01-01
Nowadays, digital medical imaging in healthcare has become a fundamental tool for medical diagnosis. This growth has been accompanied by the development of technologies and standards, such as the DICOM standard and PACS. This environment led to the creation of collaborative projects where there is a need to share medical data between different institutions for research and educational purposes. In this context, it is necessary to maintain patient data privacy and provide an easy and secure mechanism for authorized personnel access. This paper presents a solution that fully de-identifies standard medical imaging objects, including metadata and pixel data, providing at the same time a reversible de-identifier mechanism that retains search capabilities from the original data. The last feature is important in some scenarios, for instance, in collaborative platforms where data is anonymized when shared with the community but searchable for data custodians or authorized entities. The solution was integrated into an open source PACS archive and validated in a multidisciplinary collaborative scenario. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
John Stewart
2012-10-01
Full Text Available This study examined the evolution of student responses to seven contextually different versions of two Force Concept Inventory questions in an introductory physics course at the University of Arkansas. The consistency in answering the closely related questions evolved little over the seven-question exam. A model for the state of student knowledge involving the probability of selecting one of the multiple-choice answers was developed. Criteria for using clustering algorithms to extract model parameters were explored and it was found that the overlap between the probability distributions of the model vectors was an important parameter in characterizing the cluster models. The course data were then clustered and the extracted model showed that students largely fit into two groups both pre- and postinstruction: one that answered all questions correctly with high probability and one that selected the distracter representing the same misconception with high probability. For the course studied, 14% of the students were left with persistent misconceptions post instruction on a static force problem and 30% on a dynamic Newton’s third law problem. These students selected the answer representing the predominant misconception slightly more consistently postinstruction, indicating that the course studied had been ineffective at moving this subgroup of students nearer a Newtonian force concept and had instead moved them slightly farther away from a correct conceptual understanding of these two problems. The consistency in answering pairs of problems with varied physical contexts is shown to be an important supplementary statistic to the score on the problems and suggests that the inclusion of such problem pairs in future conceptual inventories would be efficacious. Multiple, contextually varied questions further probe the structure of students’ knowledge. To allow working instructors to make use of the additional insight gained from cluster analysis, it
International Nuclear Information System (INIS)
Kazi, T.G.; Jalbani, N.; Arain, M.B.; Jamali, M.K.; Afridi, H.I.; Sarfraz, R.A.; Shah, A.Q.
2009-01-01
It was extensively investigated that a significant flux of toxic metals, along with other toxins, reaches the lungs through smoking. In present study toxic metals (TMs) (Al, Cd, Ni and Pb) were determined in different components of Pakistani local branded and imported cigarettes, including filler tobacco (FT), filter (before and after normal smoking by a single volunteer) and ash by electrothermal atomic absorption spectrometer (ETAAS). Microwave-assisted digestion method was employed. The validity and accuracy of methodology were checked by using certified sample of Virginia tobacco leaves (ICHTJ-cta-VTL-2). The percentages (%) of TMs in different components of cigarette were calculated with respect to their total contents in FT of all branded cigarettes before smoking, while smoke concentration has been calculated by subtracting the filter and ash contents from the filler tobacco content of each branded cigarette. The highest percentage (%) of Al was observed in ash of all cigarettes, with range 97.3-99.0%, while in the case of Cd, a reverse behaviour was observed, as a range of 15.0-31.3% of total contents were left in the ash of all branded cigarettes understudy
Seed Potato Production and Its Importance
Erdoğan ÖZTÜRK; Taşkın POLAT
2017-01-01
Our country has different agricultural regions showed different ecological properties in terms of climate and soil characteristics increase the plant variety. Within this variety the potato is one of the most important plants for agriculture and economic of our country, also it is an important food source for human. It is important to use productive and quality seed for healthy agricultural production. With the using of good quality seed, can be obtained about 20% increase in yield. Certified...
Hou, Yali; Bickhart, Derek M; Chung, Hoyoung; Hutchison, Jana L; Norman, H Duane; Connor, Erin E; Liu, George E
2012-11-01
Genomic structural variation is an important and abundant source of genetic and phenotypic variation. In this study, we performed an initial analysis of copy number variations (CNVs) using BovineHD SNP genotyping data from 147 Holstein cows identified as having high or low feed efficiency as estimated by residual feed intake (RFI). We detected 443 candidate CNV regions (CNVRs) that represent 18.4 Mb (0.6 %) of the genome. To investigate the functional impacts of CNVs, we created two groups of 30 individual animals with extremely low or high estimated breeding values (EBVs) for RFI, and referred to these groups as low intake (LI; more efficient) or high intake (HI; less efficient), respectively. We identified 240 (~9.0 Mb) and 274 (~10.2 Mb) CNVRs from LI and HI groups, respectively. Approximately 30-40 % of the CNVRs were specific to the LI group or HI group of animals. The 240 LI CNVRs overlapped with 137 Ensembl genes. Network analyses indicated that the LI-specific genes were predominantly enriched for those functioning in the inflammatory response and immunity. By contrast, the 274 HI CNVRs contained 177 Ensembl genes. Network analyses indicated that the HI-specific genes were particularly involved in the cell cycle, and organ and bone development. These results relate CNVs to two key variables, namely immune response and organ and bone development. The data indicate that greater feed efficiency relates more closely to immune response, whereas cattle with reduced feed efficiency may have a greater capacity for organ and bone development.
Zalewski, Kathryn; Alt, Carlynn; Arvinen-Barrow, Monna
2014-06-01
Cross-sectional study. To describe readiness for change and barriers to physical activity in older adults and to contrast perceptions of physical therapists and patients using the Barriers to Being Active Quiz. Regular physical activity is vital to recovery after discharge from physical therapy. Physical therapists are positioned to support change in physical activity habits for those transitioning to home care. Understanding of readiness for change and barriers to physical activity could optimize recovery. Thirteen physical therapists enrolled in the study and invited patients who met the inclusion criteria to enroll (79 patients enrolled). The physical therapists provided the ICD-9 code, the physical therapist diagnosis, and completed the Barriers to Being Active Quiz as they perceived their patients would. The enrolled patients provided demographics and filled out the Satisfaction With Life Scale, the stages-of-change scale for physical activity, and the Barriers to Being Active Quiz. Patients were predominantly in the early stages of readiness for change. Both patients and physical therapists identified lack of willpower as the primary barrier to physical activity. Patients identified lack of willpower and social influence as critical barriers more often than physical therapists, whereas physical therapists identified fear of injury and lack of time more often than their patients did. Differences between physical therapists and their patients were noted for fear of injury (z = 2.66, P = .008) and lack of time (z = 3.46, P = .001). The stage of change for physical activity impacted perception of social influence (χ2 = 9.64, Pbarriers to physical activity may allow physical therapists to better tailor intervention strategies to impact physical activity behavior change.
Importance-performance analysis of dental satisfaction among three ethnic groups in malaysia.
Dewi, Fellani Danasra; Gundavarapu, Kalyan C; Cugati, Navaneetha
2013-01-01
To find the differences in patient satisfaction related to dental services among three ethnic groups - Chinese, Indian and Malay - at AIMST University Dental Centre and analyse them with an importance-performance grid, identifying the weak and strong points, in order to provide better service. This questionnaire-based study consisted of convenience samples of 174 patients of Chinese, Indian and Malay ethnicity. Importance-performance analysis for 20 attributes were compared using Likert's scale. The data obtained were statistically analysed using the Kruskal-Wallis test. Chinese and Indians both emphasised low performance on the interpersonal relationship attribute in terms of the receptionist's courtesy, whereas the Malay participants were concerned with convenience attributes. All the ethnic groups favoured maintaining existing major attributes towards technical competency, interpersonal relationship and facility factors. This study demonstrated priority differences between the ethnic groups' perception of the quality of dental services, where ethnic Chinese showed the highest gap (measure of dissatisfaction) between importance and performance compared to ethnic Malays, followed by ethnic Indians. The patients from the three major ethnic groups of Malaysia were generally well satisfied. Perhaps more priority should be placed on improving the interpersonal relationship attribute, especially with the receptionists.
The importance of knowledge for wellbeing of society in the contemporary world
Directory of Open Access Journals (Sweden)
Marković Dušan Z.
2017-01-01
Full Text Available Following the recent wave of globalization, the possession of different types of knowledge became even more important for economic development than the possession of physical resources. The ability of a society to adopt existing and create new knowledge thus gained fundamental importance for its wellbeing. In this paper, we identify important aspects of the relationship between education, creation of knowledge, economic growth, as well as both material and immaterial wellbeing of a society. We describe potential problems that prevent societies from maximizing the benefit from the effort its members invest in acquiring knowledge. The problems of failure of the national markets for education as well as the global migrations which lead to drain of knowledge towards economically highly developed countries are especially analyzed. In the long run, they lead to a decline in both national competitiveness and different aspects of the immaterial wellbeing. As the basis for solving these problems we propose a combination of economic theory and the concept of solidarity between more and less developed countries, individuals and societies of their origin, respecting the free will of individuals.
Importance measures for use in PRAs and risk management
International Nuclear Information System (INIS)
Schmidt, E.R.; Jamali, K.M.; Parry, G.W.; Gibbon, S.H.
1985-01-01
There are many quantities estimated in probabilistic risk assessments (PRAs) to index the level of plant safety. If the PRA is to be used as a risk management tool to assist in the safe operation of the plant, it is essential that those elements of the plant design and its mode of operation that have the greatest impact on plant safety be identified. These elements may be identified by performing importance calculations. There are certain decisions that must be made before the importance calculation is carried out. The first is the definition of the events for which importance is to be evaluated; that is, to what level of resolution the analysis is to be performed. The second decision that must be made--and the major subject of this paper--is the choice of importance measure. Many measures of importance have been proposed; this discussion is restricted to three: the risk achievement (or degradation) worth, the risk reduction worth, and criticality importance. In the paper these measures of importance are defined, their interrelationships are discussed, and a generalized importance measure is introduced. The use of these three measures is compared and their advantages and disadvantages are discussed
Relative importance of different surface regions for thermal comfort in humans.
Nakamura, Mayumi; Yoda, Tamae; Crawshaw, Larry I; Kasuga, Momoko; Uchida, Yuki; Tokizawa, Ken; Nagashima, Kei; Kanosue, Kazuyuki
2013-01-01
In a previous study, we investigated the contribution of the surface of the face, chest, abdomen, and thigh to thermal comfort by applying local temperature stimulation during whole-body exposure to mild heat or cold. In hot conditions, humans prefer a cool face, and in cold they prefer a warm abdomen. In this study, we extended investigation of regional differences in thermal comfort to the neck, hand, soles, abdomen (Experiment 1), the upper and lower back, upper arm, and abdomen (Experiment 2). The methodology was similar to that used in the previous study. To compare the results of each experiment, we utilized the abdomen as the reference area in these experiments. Thermal comfort feelings were not particularly strong for the limbs and extremities, in spite of the fact that changes in skin temperature induced by local temperature stimulation of the limbs and extremities were always larger than changes that were induced in the more proximal body parts. For the trunk areas, a significant difference in thermal comfort was not observed among the abdomen, and upper and lower back. An exception involved local cooling during whole-body mild cold exposure, wherein the most dominant preference was for a warmer temperature of the abdomen. As for the neck and abdomen, clear differences were observed during local cooling, while no significant difference was observed during local warming. We combined the results for the current and the previous study, and characterized regional differences in thermal comfort and thermal preference for the whole-body surface.
Prioritising Marketing Activities in Different Types of Marketing Functions
DEFF Research Database (Denmark)
Martensen, Anne; Mouritsen, Jan
2017-01-01
performance (BP) and top management's respect. An empirical survey identifies four types of MFs: (1) the broad spectrum; (2) the hesitant; (3) the traditional and (4) the market-creating. Findings show that for each of the four types, the effect of investing in a particular role varies: all roles......Marketing functions (MFs) differ in how they practise marketing roles. The purpose of this article is to differentiate between MFs that practice marketing roles in a particular manner and then study how these different types of MFs differ with regard to the marketing roles’ effect on business...... are not equally important to practise. Moreover, all roles are not equally important to all marketing functions, but depend on the marketing function's unique starting point. Since MFs differ, relevant investments in marketing roles also differ, making it beneficial to prioritise them. However, management...
Shahid, Hinna; Sebastian, Rajani; Schnur, Tatiana T; Hanayik, Taylor; Wright, Amy; Tippett, Donna C; Fridriksson, Julius; Rorden, Chris; Hillis, Argye E
2017-06-01
Lesion-symptom mapping is an important method of identifying networks of brain regions critical for functions. However, results might be influenced substantially by the imaging modality and timing of assessment. We tested the hypothesis that brain regions found to be associated with acute language deficits depend on (1) timing of behavioral measurement, (2) imaging sequences utilized to define the "lesion" (structural abnormality only or structural plus perfusion abnormality), and (3) power of the study. We studied 191 individuals with acute left hemisphere stroke with MRI and language testing to identify areas critical for spoken word comprehension. We use the data from this study to examine the potential impact of these three variables on lesion-symptom mapping. We found that only the combination of structural and perfusion imaging within 48 h of onset identified areas where more abnormal voxels was associated with more severe acute deficits, after controlling for lesion volume and multiple comparisons. The critical area identified with this methodology was the left posterior superior temporal gyrus, consistent with other methods that have identified an important role of this area in spoken word comprehension. Results have implications for interpretation of other lesion-symptom mapping studies, as well as for understanding areas critical for auditory word comprehension in the healthy brain. We propose that lesion-symptom mapping at the acute stage of stroke addresses a different sort of question about brain-behavior relationships than lesion-symptom mapping at the chronic stage, but that timing of behavioral measurement and imaging modalities should be considered in either case. Hum Brain Mapp 38:2990-3000, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
ORCID: Author Identifiers for Librarians
Directory of Open Access Journals (Sweden)
Robyn B. Reed
2017-10-01
Full Text Available Generating accurate publication lists by researchers can be challenging when faced with scholars who have common names or who have published under name variations. This article describes ORCID and the goal of generating author identifiers for scholars to connect their research outputs. Included are the reasons for having author identifiers as well as the types of information within individual profiles. This article includes information on how academic libraries are playing a role with ORCID initiatives as well as describing how publishers, institutions, and funders are employing ORCID in their workflows. Highlighted is material on academic institutions in Pennsylvania using ORCID. The purpose of the article is to provide an overview of ORCID and its uses to inform librarians about this important initiative.
Kaluarachchi, Manuja R; Boulangé, Claire L; Garcia-Perez, Isabel; Lindon, John C; Minet, Emmanuel F
2016-10-01
Determining perturbed biochemical functions associated with tobacco smoking should be helpful for establishing causal relationships between exposure and adverse events. A multiplatform comparison of serum of smokers (n = 55) and never-smokers (n = 57) using nuclear magnetic resonance spectroscopy, UPLC-MS and statistical modeling revealed clustering of the classes, distinguished by metabolic biomarkers. The identified metabolites were subjected to metabolic pathway enrichment, modeling adverse biological events using available databases. Perturbation of metabolites involved in chronic obstructive pulmonary disease, cardiovascular diseases and cancer were identified and discussed. Combining multiplatform metabolic phenotyping with knowledge-based mapping gives mechanistic insights into disease development, which can be applied to next-generation tobacco and nicotine products for comparative risk assessment.
Liposome accumulation in irradiated tumors display important tumor and dose dependent differences
DEFF Research Database (Denmark)
Hansen, Anders Elias; Fliedner, Frederikke Petrine; Henriksen, Jonas Rosager
2018-01-01
Radiation therapy may affect several important parameters in the tumor microenvironment and thereby influence the accumulation of liposomes by the enhanced permeability and retention (EPR)-effect. Here we investigate the effect of single dose radiation therapy on liposome tumor accumulation by PET...
Identifying maternity services in public hospitals in rural and remote Australia.
Longman, Jo; Pilcher, Jennifer M; Donoghue, Deborah A; Rolfe, Margaret; Kildea, Sue V; Kruske, Sue; Oats, Jeremy J N; Morgan, Geoffrey G; Barclay, Lesley M
2014-06-01
This paper articulates the importance of accurately identifying maternity services. It describes the process and challenges of identifying the number, level and networks of rural and remote maternity services in public hospitals serving communities of between 1000 and 25000 people across Australia, and presents the findings of this process. Health departments and the national government's websites, along with lists of public hospitals, were used to identify all rural and remote Australian public hospitals offering maternity services in small towns. State perinatal reports were reviewed to establish numbers of births by hospital. The level of maternity services and networks of hospitals within which services functioned were determined via discussion with senior jurisdictional representatives. In all, 198 rural and remote public hospitals offering maternity services were identified. There were challenges in sourcing information on maternity services to generate an accurate national picture. The nature of information about maternity services held centrally by jurisdictions varied, and different frameworks were used to describe minimum requirements for service levels. Service networks appeared to be based on a combination of individual links, geography and transport infrastructure. The lack of readily available centralised and comparable information on rural and remote maternity services has implications for policy review and development, equity, safety and quality, network development and planning. Accountability for services and capacity to identify problems is also compromised.
Recognition of intellectual capital importance in the university sector
Directory of Open Access Journals (Sweden)
Yolanda Ramírez
2013-07-01
Full Text Available The main aim of this paper is to know the opinion of the university stakeholders regarding the importance they give to intellectual capital reporting. To this end, a questionnaire was designed and sent to every member of the Social Councils of Spanish public universities. The results of our empirical study show that the current annual accounts published by universities barely cover the information needs of the different stakeholders. These results allow us to recommend extending the limits of universities’ annual accounts so as to include the information on intellectual capital demanded by the different stakeholders. In our opinion, the traditional accounting systems do not suffice for higher education institutions, whose value creation depends more on intellectual capital type resources. Finally, this empirical study identifies which of components of intellectual capital (human, structural and relation is the most relevant for publication. The results show that the information most valued by the different stakeholder groups is that related to relational capital, followed by human and then lastly structural capital.
Directory of Open Access Journals (Sweden)
Qing-bo Zhao
2018-02-01
Full Text Available The Dongxiang Blue-shelled chicken is one of the most valuable Chinese indigenous poultry breeds. However, compared to the Italian native White Leghorn, although this Chinese breed possesses numerous favorable characteristics, it also exhibits lower growth performance and fertility. Here, we utilized genotyping sequencing data obtained via genome reduction on a sequencing platform to detect 100,114 single nucleotide polymorphisms and perform further biological analysis and functional annotation. We employed cross-population extended haplotype homozygosity, eigenvector decomposition combined with genome-wide association studies (EigenGWAS, and efficient mixed-model association expedited methods to detect areas of the genome that are potential selected regions (PSR in both chicken breeds, and performed gene ontology (GO enrichment and quantitative trait loci (QTL analyses annotating using the Kyoto Encyclopedia of Genes and Genomes. The results of this study revealed a total of 2424 outlier loci (p-value <0.01, of which 2144 occur in the White Leghorn breed and 280 occur in the Dongxiang Blue-shelled chicken. These correspond to 327 and 94 PSRs containing 297 and 54 genes, respectively. The most significantly selected genes in Blue-shelled chicken are TMEM141 and CLIC3, while the SLCO1B3 gene, related to eggshell color, was identified via EigenGWAS. We show that the White Leghorn genes JARID2, RBMS3, GPC3, TRIB2, ROBO1, SAMSN1, OSBP2, and IGFALS are involved in immunity, reproduction, and growth, and thus might represent footprints of the selection process. In contrast, we identified six significantly enriched pathways in the Dongxiang Blue-shelled chicken that are related to amino acid and lipid metabolism as well as signal transduction. Our results also reveal the presence of a GO term associated with cell metabolism that occurs mainly in the White Leghorn breed, while the most significant QTL regions mapped to the Chicken QTL Database (GG_4
Schramm, H.L.; Gerard, P.D.; Gill, D.A.
2003-01-01
We measured the importance of 24 fishing site attributes to Mississippi freshwater anglers. Factor analysis identified four multiattribute factors as important in the selection of fishing location: CLEAN ENVIRONMENT CATCH, COST AND HARVEST and AMENITIES AND SAFETY. In general, the importance of site selection factors differed little among anglers grouped by preferred type of fish, preferred fishing location (lakes and reservoirs, rivers and streams, ponds, or reservoir tailwaters), usual manner of fishing (engine-powered boat, nonpowered boat, or shore), or change in fishing frequency. COST AND HARVEST was more important to anglers with high harvest orientations. We found low correlations between site selection factor importance scores and angler age, fishing frequency, fishing expenditures, or fishing motivation factors. We suggest that the general lack of differences in site selection factors among angler groups indicates that management strategies to improve fishing site attributes should benefit all angler groups. Clean fishing environments and awareness of the availability of desired sport fishes were "very" or "extremely" important to fishing site selection by more than 70% of Mississippi freshwater anglers and should be priority management objectives.
Directory of Open Access Journals (Sweden)
S. D. Deosarkar
2012-01-01
Full Text Available The proton-ligand stability constants of some biologically important new pyrazoles and formation constants of their complexes with Ni(II were determined at 0.1 mol dm-3 ionic strength and at 303.15 K in different dielectric constant of dioxane-water mixture by potentiometric method. The Calvin-Bjerrum's pH-titration technique as used by Irving and Rossotti was used for determination of stability constants. The results enabled to study the electrostatic forces of attraction between metal ion and ligand with changes in dielectric constant of the medium.
Pufulete, Maria; Brierley, Rachel C; Bucciarelli-Ducci, Chiara; Greenwood, John P; Dorman, Stephen; Anderson, Richard A; Harris, Jessica; McAlindon, Elisa; Rogers, Chris A; Reeves, Barnaby C
2017-06-22
To define important changes in management arising from the use of cardiovascular magnetic resonance (CMR) in patients who activate the primary percutaneous coronary intervention (PPCI) pathway. Formal consensus study using literature review and cardiologist expert opinion to formulate consensus statements and setting up a consensus panel to review the statements (by completing a web-based survey, attending a face-to-face meeting to discuss survey results and modify the survey to reflect group discussion and completing the modified survey to determine which statements were in consensus). Formulation of consensus statements: four cardiologists (two CMR and two interventional) and six non-clinical researchers. Formal consensus: seven cardiologists (two CMR and three interventional, one echocardiography and one heart failure). Forty-nine additional cardiologists completed the modified survey. Thirty-seven draft statements describing changes in management following CMR were generated; these were condensed into 12 statements and reviewed through the formal consensus process. Three of 12 statements were classified in consensus in the first survey; these related to the role of CMR in identifying the cause of out-of-hospital cardiac arrest, providing a definitive diagnosis in patients found to have unobstructed arteries on angiography and identifying patients with left ventricular thrombus. Two additional statements were in consensus in the modified survey, relating to the ability of CMR to identify patients who have a poor prognosis after PPCI and assess ischaemia and viability in patients with multivessel disease. There was consensus that CMR leads to clinically important changes in management in five subgroups of patients who activate the PPCI pathway. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Identifying Social Trust in Cross-Country Analysis: Do We Really Measure the Same?
Torpe, Lars; Lolle, Henrik
2011-01-01
Many see trust as an important social resource for the welfare of individuals as well as nations. It is therefore important to be able to identify trust and explain its sources. Cross-country survey analysis has been an important tool in this respect, and often one single variable is used to identify social trust understood as trust in strangers,…
Directory of Open Access Journals (Sweden)
Nan eWu
2015-09-01
Full Text Available Despite the identification of many genes and pathways involved in the persistence phenomenon of bacteria, the relative importance of these genes in a single organism remains unclear. Here, using Escherichia coli as a model, we generated mutants of 21 known candidate persister genes and compared the relative importance of these mutants in persistence to various antibiotics (ampicillin, gentamicin, norfloxacin, and trimethoprim at different times. We found that oxyR, dnaK, sucB, relA, rpoS, clpB, mqsR, and recA were prominent persister genes involved in persistence to multiple antibiotics. These genes map to the following pathways: antioxidative defense pathway (oxyR, global regulators (dnaK, clpB, and rpoS, energy production (sucB, stringent response (relA, toxin–antitoxin (TA module (mqsR, and SOS response (recA. Among the TA modules, the ranking order was mqsR, lon, relE, tisAB, hipA, and dinJ. Intriguingly, rpoS deletion caused a defect in persistence to gentamicin but increased persistence to ampicillin and norfloxacin. Mutants demonstrated dramatic differences in persistence to different antibiotics at different time points: some mutants (oxyR, dnaK, phoU, lon, recA, mqsR, and tisAB displayed defect in persistence from early time points, while other mutants (relE, smpB, glpD, umuD, and tnaA showed defect only at later time points. These results indicate that varying hierarchy and importance of persister genes exist and that persister genes can be divided into those involved in shallow persistence and those involved in deep persistence. Our findings suggest that the persistence phenomenon is a dynamic process with different persister genes playing roles of variable significance at different times. These findings have implications for improved understanding of persistence phenomenon and developing new drugs targeting persisters for more effective cure of persistent infections.
IMPORT COMPONENTS AND IMPORT MULTIPLIERS IN INDONESIAN ECONOMY: WORLD INPUT-OUTPUT ANALYSIS
Directory of Open Access Journals (Sweden)
Muchdie Muchdie
2018-03-01
Full Text Available This paper calculates, presents and discusses on import components and the impact of final demand change on Indonesian imports using Indonesian 36 sector input-output tables of years: 2000, 2005, 2010 and 2014 from World Input-Output Tables. The results showed that firstly, Indonesian import components of input were, on average, more than 20 percent; meaning that input that locally provided were less than 80 percent. Secondly, Indonesian import of input had increased significantly from US$ 36,011 million in 2000 to US$ 151,505 million in 2014. Thirdly, Indonesian imports have been dominated by Sector-3: Manufacture of food products, beverages and tobacco products, Sector-4: Manufacture of textiles, wearing apparel and leather products, Sector-24: Construction, Sector-25: Wholesale and retail trade and repair, and Sector-26: Transportation and post services. Fourthly, by country of origin, Indonesian imports have been dominated by Japan, Korea, the USA, Australia, and China. Imports from Australia, Japan, and the US have been decreased significantly, but import from China has steadily increased. Finally, highest sectoral import multipliers occurred if final demands change in Sector-1: Crop and animal production, forestry, fishing and aquaculture, Sector-2: Mining and quarrying, Sector-23: Water collection; sewerage; waste collection, treatment and disposal activities, and Sector-30: Real estate activities, but there was no significant difference of import multipliers for country origin of import.
Gender differences in identifying emotions from auditory and visual stimuli.
Waaramaa, Teija
2017-12-01
The present study focused on gender differences in emotion identification from auditory and visual stimuli produced by two male and two female actors. Differences in emotion identification from nonsense samples, language samples and prolonged vowels were investigated. It was also studied whether auditory stimuli can convey the emotional content of speech without visual stimuli, and whether visual stimuli can convey the emotional content of speech without auditory stimuli. The aim was to get a better knowledge of vocal attributes and a more holistic understanding of the nonverbal communication of emotion. Females tended to be more accurate in emotion identification than males. Voice quality parameters played a role in emotion identification in both genders. The emotional content of the samples was best conveyed by nonsense sentences, better than by prolonged vowels or shared native language of the speakers and participants. Thus, vocal non-verbal communication tends to affect the interpretation of emotion even in the absence of language. The emotional stimuli were better recognized from visual stimuli than auditory stimuli by both genders. Visual information about speech may not be connected to the language; instead, it may be based on the human ability to understand the kinetic movements in speech production more readily than the characteristics of the acoustic cues.
Wang, Guofu; Bi, Lechang; Wang, Gaofeng; Huang, Feilai; Lu, Mingjing; Zhu, Kai
2018-06-01
Objectives Expression profile of GSE57691 was analyzed to identify the similarities and differences between aortic occlusive disease and abdominal aortic aneurysm. Methods The expression profile of GSE57691 was downloaded from Gene Expression Omnibus database, including 20 small abdominal aortic aneurysm samples, 29 large abdominal aortic aneurysm samples, 9 aortic occlusive disease samples, and 10 control samples. Using the limma package in R, the differentially expressed genes were screened. Followed by enrichment analysis was performed for the differentially expressed genes using database for annotation, visualization, and integrated discovery online tool. Based on string online tool and Cytoscape software, protein-protein interaction network and module analyses were carried out. Moreover, integrated TF platform database and Cytoscape software were used for constructing transcriptional regulatory networks. Results As a result, 1757, 354, and 396 differentially expressed genes separately were identified in aortic occlusive disease, large abdominal aortic aneurysm, and small abdominal aortic aneurysm samples. UBB was significantly enriched in proteolysis related pathways with a high degree in three groups. SPARCL1 was another gene shared by these groups and regulated by NFIA, which had a high degree in transcriptional regulatory network. ACTB, a significant upregulated gene in abdominal aortic aneurysm samples, could be regulated by CLIC4, which was significantly enriched in cell motions. ACLY and NFIB were separately identified in aortic occlusive disease and small abdominal aortic aneurysm samples, and separately enriched in lipid metabolism and negative regulation of cell proliferation. Conclusions The downregulated UBB, NFIA, and SPARCL1 might play key roles in both aortic occlusive disease and abdominal aortic aneurysm, while the upregulated ACTB might only involve in abdominal aortic aneurysm. ACLY and NFIB were specifically involved in aortic occlusive
Directory of Open Access Journals (Sweden)
Secreto Giorgio
2012-12-01
Full Text Available Abstract Background Androgen receptors (AR are frequently expressed in breast cancers, but their implication in cancer growth is still controversial. In the present study, we further investigated the role of the androgen/AR pathway in breast cancer development. Methods AR expression was evaluated by immunochemistry in a cohort of 528 postmenopausal breast cancer patients previously examined for the association of serum testosterone levels with patient and tumor characteristics. AR expression was classified according to the percentage of stained cells: AR-absent (0% and AR-poorly (1%-30%, AR-moderately (>30%-60%, and AR-highly (>60% positive. Results Statistical analysis was performed in 451 patients who experienced natural menopause. AR-high expression was significantly related with low histologic grade and estrogen receptor (ER- and progesterone receptor (PR-positive status (P trendP=0.022, although a trend across the AR expression categories was not present. When women defined by ER status were analyzed separately, regression analysis in the ER-positive group showed a significant association of high testosterone levels with AR-highly-positive expression (OR 1.86; 95% CI, 1.10-3.16, but the association was essentially due to patients greater than or equal to 65 years (OR 2.42; 95% CI, 1.22-4.82. In ER-positive group, elevated testosterone levels appeared also associated with AR-absent expression, although the small number of patients in this category limited the appearance of significant effects (OR 1.92; 95% CI, 0.73–5.02: the association was present in both age groups ( Conclusions The findings in the present study confirm that testosterone levels are a marker of hormone-dependent breast cancer and suggest that the contemporary evaluation of ER status, AR expression, and circulating testosterone levels may identify different subsets of cancers whose growth may be influenced by androgens.
Tian, Ye; Wang, Wei D.; Zou, Wen-Bo; Qian, Jian-Qin; Hu, Chang-Qin
2018-04-01
The solid form of an active pharmaceutical ingredient is important when developing a new chemical entity. A solid understanding of the crystal structure and morphology that affect the mechanical and physical characteristics of pharmaceutical powders determines the manufacturing process. Solid-state NMR, thermogravimetric analysis, X-ray diffraction, and Fourier-transform infrared spectroscopy were combined with theoretical calculation to investigate different crystal packings of α-cefazolin sodium from three different vendors and conformational polymorphism was identified to exist in the α-cefazolin sodium. Marginal differences observed among CEZ-Na pentahydrate 1, 2, and 3 were speculated as the proportion of conformation 2. Understanding the differences in the polymorphic structure of α-cefazolin sodium may help with making modifications to incorporate new knowledge with a product’s development.
Loneliness, immigration background and self-identified ethnicity
DEFF Research Database (Denmark)
Madsen, Katrine Rich; Damsgaard, Mogens Trab; Jervelund, Signe Smith
2016-01-01
an increased risk of loneliness compared to adolescents with a Danish origin. The results also suggest that adolescents’ self-identified ethnicity plays an essential role but differently for immigrants and descendants: identifying with the Danish majority was protective against loneliness among immigrants...
Cluster Analysis of Clinical Data Identifies Fibromyalgia Subgroups
Docampo, Elisa; Collado, Antonio; Escaramís, Geòrgia; Carbonell, Jordi; Rivera, Javier; Vidal, Javier; Alegre, José
2013-01-01
Introduction Fibromyalgia (FM) is mainly characterized by widespread pain and multiple accompanying symptoms, which hinder FM assessment and management. In order to reduce FM heterogeneity we classified clinical data into simplified dimensions that were used to define FM subgroups. Material and Methods 48 variables were evaluated in 1,446 Spanish FM cases fulfilling 1990 ACR FM criteria. A partitioning analysis was performed to find groups of variables similar to each other. Similarities between variables were identified and the variables were grouped into dimensions. This was performed in a subset of 559 patients, and cross-validated in the remaining 887 patients. For each sample and dimension, a composite index was obtained based on the weights of the variables included in the dimension. Finally, a clustering procedure was applied to the indexes, resulting in FM subgroups. Results Variables clustered into three independent dimensions: “symptomatology”, “comorbidities” and “clinical scales”. Only the two first dimensions were considered for the construction of FM subgroups. Resulting scores classified FM samples into three subgroups: low symptomatology and comorbidities (Cluster 1), high symptomatology and comorbidities (Cluster 2), and high symptomatology but low comorbidities (Cluster 3), showing differences in measures of disease severity. Conclusions We have identified three subgroups of FM samples in a large cohort of FM by clustering clinical data. Our analysis stresses the importance of family and personal history of FM comorbidities. Also, the resulting patient clusters could indicate different forms of the disease, relevant to future research, and might have an impact on clinical assessment. PMID:24098674
Cluster analysis of clinical data identifies fibromyalgia subgroups.
Directory of Open Access Journals (Sweden)
Elisa Docampo
Full Text Available INTRODUCTION: Fibromyalgia (FM is mainly characterized by widespread pain and multiple accompanying symptoms, which hinder FM assessment and management. In order to reduce FM heterogeneity we classified clinical data into simplified dimensions that were used to define FM subgroups. MATERIAL AND METHODS: 48 variables were evaluated in 1,446 Spanish FM cases fulfilling 1990 ACR FM criteria. A partitioning analysis was performed to find groups of variables similar to each other. Similarities between variables were identified and the variables were grouped into dimensions. This was performed in a subset of 559 patients, and cross-validated in the remaining 887 patients. For each sample and dimension, a composite index was obtained based on the weights of the variables included in the dimension. Finally, a clustering procedure was applied to the indexes, resulting in FM subgroups. RESULTS: VARIABLES CLUSTERED INTO THREE INDEPENDENT DIMENSIONS: "symptomatology", "comorbidities" and "clinical scales". Only the two first dimensions were considered for the construction of FM subgroups. Resulting scores classified FM samples into three subgroups: low symptomatology and comorbidities (Cluster 1, high symptomatology and comorbidities (Cluster 2, and high symptomatology but low comorbidities (Cluster 3, showing differences in measures of disease severity. CONCLUSIONS: We have identified three subgroups of FM samples in a large cohort of FM by clustering clinical data. Our analysis stresses the importance of family and personal history of FM comorbidities. Also, the resulting patient clusters could indicate different forms of the disease, relevant to future research, and might have an impact on clinical assessment.
Meta-analysis on continuous outcomes in minimal important difference units
DEFF Research Database (Denmark)
Shrier, Ian; Christensen, Robin; Juhl, Carsten
2016-01-01
on the values of rho and coefficient of variation of the MID (CoVMID), estimates of treatment effect and P-values between an approach considering the MID as a constant vs. as a random variable may differ appreciably. Using our data sets, we provide examples of the potential magnitude. When rho = 0.5 and Co...
Identifying and Ranking the Determinants of Tourism Performance
DEFF Research Database (Denmark)
Assaf, A.George; Josiassen, Alexander
2012-01-01
, their tourism industries, and tourism businesses seek to improve the performance of the tourism industry and its constituents by vigorously promoting themselves to international tourists, cutting costs, and identifying synergies in their tourism endeavors. In seeking to improve the tourism industry......, the determinants that affect tourism performance are of key interest to the stakeholders. A key obstacle toward improving performance is the multitude of determinants that can affect tourism performance. The literature has yet to provide concrete insights into the determinants of tourism performance...... and their relative importance. The present study addresses this important gap. We identify and rank the determinants of tourism performance. We also provide performance measures of international tourism destinations. The results are derived using the Data Envelopment Analysis (DEA) and bootstrap truncated regression...
First survey of forensically important insects from human corpses in Shiraz, Iran.
Moemenbellah-Fard, Mohammad D; Keshavarzi, Davood; Fereidooni, Mehran; Soltani, Aboozar
2018-02-01
The presence of insects on human cadavers has potential judicial value in medicolegal cases. This research emphasized the important role of insects in postmortem decomposition. It was conducted to investigate the composition and abundance of insects from human corpses during autopsies in legal medicine. It was implemented in the city of Shiraz, south Iran. Insects associated with human corpses were carefully collected and put into labelled vials. They were then identified using valid taxonomic keys. Fifteen outdoor (67%) and indoor discovered cadavers were examined. All but one was covered at the time of discovery. From these several species of entomofauna played important roles in the minimum postmortem interval (minPMI) estimate. Insects included the orders of Diptera and Coleoptera. Overall, 14 different species of arthropods were identified. Within Diptera, 2 families of Sarcophagidae and Calliphoridae were present in 73% of the cases with Calliphora vicina Robineau-Desvoidy and Chrysomya albiceps Wiedemann accounting for about half of the cases. The latter family members, Calliphoridae, were more frequently (52%) collected in autumn and winter. Only 4/15 outdoor cadavers had beetles. Four species of Coleopterans; namely Dermestes frischii Kugelann, Nitidula flavomaculata Rossi, Creophilus maxillosus Linnaeus and Saprinus chalcites Illiger; were recorded for the first time from 3 corpses in Iran. The presence and diversity of different insects on human corpses could contribute to the advancement of forensic entomology knowledge and the refined estimates of minPMI in medicolegal cases. Copyright © 2017. Published by Elsevier Ltd.
Singh, Yogesh; Garden, Oliver A; Lang, Florian; Cobb, Bradley S
2016-09-01
MicroRNAs (miRNAs) regulate many aspects of helper T cell (Th) development and function. Here we found that they are required for the suppression of interleukin-9 (IL-9) expression in Th9 cells and other Th subsets. Two highly related miRNAs (miR-15b and miR-16) that we previously found to play an important role in regulatory T (Treg) cell differentiation were capable of suppressing IL-9 expression when they were over-expressed in Th9 cells. We used these miRNAs as tools to identify novel regulators of IL-9 expression and found that they could regulate the expression of Epas1, which encodes hypoxia-inducible factor (HIF)-2α. HIF proteins regulate metabolic pathway usage that is important in determining appropriate Th differentiation. The related protein, HIF-1α enhances Th17 differentiation and inhibits Treg cell differentiation. Here we found that HIF-2α was required for IL-9 expression in Th9 cells, but its expression was not sufficient in other Th subsets. Furthermore, HIF-2α suppressed Treg cell differentiation like HIF-1α, demonstrating both similar and distinct roles of the HIF proteins in Th differentiation and adding a further dimension to their function. Ironically, even though miR-15b and miR-16 suppressed HIF-2α expression in Treg cells, inhibiting their function in Treg cells did not lead to an increase in IL-9 expression. Therefore, the physiologically relevant miRNAs that regulate IL-9 expression in Treg cells and other subsets remain unknown. Nevertheless, the analysis of miR-15b and miR-16 function led to the discovery of the importance of HIF-2α so this work demonstrated the utility of studying miRNA function to identify novel regulatory pathways in helper T-cell development. © 2016 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Jenni Hislop
2014-05-01
Full Text Available Randomised controlled trials (RCTs are widely accepted as the preferred study design for evaluating healthcare interventions. When the sample size is determined, a (target difference is typically specified that the RCT is designed to detect. This provides reassurance that the study will be informative, i.e., should such a difference exist, it is likely to be detected with the required statistical precision. The aim of this review was to identify potential methods for specifying the target difference in an RCT sample size calculation.A comprehensive systematic review of medical and non-medical literature was carried out for methods that could be used to specify the target difference for an RCT sample size calculation. The databases searched were MEDLINE, MEDLINE In-Process, EMBASE, the Cochrane Central Register of Controlled Trials, the Cochrane Methodology Register, PsycINFO, Science Citation Index, EconLit, the Education Resources Information Center (ERIC, and Scopus (for in-press publications; the search period was from 1966 or the earliest date covered, to between November 2010 and January 2011. Additionally, textbooks addressing the methodology of clinical trials and International Conference on Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use (ICH tripartite guidelines for clinical trials were also consulted. A narrative synthesis of methods was produced. Studies that described a method that could be used for specifying an important and/or realistic difference were included. The search identified 11,485 potentially relevant articles from the databases searched. Of these, 1,434 were selected for full-text assessment, and a further nine were identified from other sources. Fifteen clinical trial textbooks and the ICH tripartite guidelines were also reviewed. In total, 777 studies were included, and within them, seven methods were identified-anchor, distribution, health economic, opinion-seeking, pilot
Hislop, Jenni; Adewuyi, Temitope E; Vale, Luke D; Harrild, Kirsten; Fraser, Cynthia; Gurung, Tara; Altman, Douglas G; Briggs, Andrew H; Fayers, Peter; Ramsay, Craig R; Norrie, John D; Harvey, Ian M; Buckley, Brian; Cook, Jonathan A
2014-05-01
Randomised controlled trials (RCTs) are widely accepted as the preferred study design for evaluating healthcare interventions. When the sample size is determined, a (target) difference is typically specified that the RCT is designed to detect. This provides reassurance that the study will be informative, i.e., should such a difference exist, it is likely to be detected with the required statistical precision. The aim of this review was to identify potential methods for specifying the target difference in an RCT sample size calculation. A comprehensive systematic review of medical and non-medical literature was carried out for methods that could be used to specify the target difference for an RCT sample size calculation. The databases searched were MEDLINE, MEDLINE In-Process, EMBASE, the Cochrane Central Register of Controlled Trials, the Cochrane Methodology Register, PsycINFO, Science Citation Index, EconLit, the Education Resources Information Center (ERIC), and Scopus (for in-press publications); the search period was from 1966 or the earliest date covered, to between November 2010 and January 2011. Additionally, textbooks addressing the methodology of clinical trials and International Conference on Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use (ICH) tripartite guidelines for clinical trials were also consulted. A narrative synthesis of methods was produced. Studies that described a method that could be used for specifying an important and/or realistic difference were included. The search identified 11,485 potentially relevant articles from the databases searched. Of these, 1,434 were selected for full-text assessment, and a further nine were identified from other sources. Fifteen clinical trial textbooks and the ICH tripartite guidelines were also reviewed. In total, 777 studies were included, and within them, seven methods were identified-anchor, distribution, health economic, opinion-seeking, pilot study, review of
Mahmoud Bahmani; Mahmoud Rafieian-Kopaei; Hassan Hassanzadazar; Morovat Taherikalani
2016-01-01
Background and Objectives: Pseudomonas aeruginosa is a Gram-negative, aerobic bacterium found in water and soil. It is a normal flora in skin and gastrointestinal tract of human beings. P. aeruginosa as an opportunistic pathogen involved in nosocomial infections having multiple pathogenic factors and shows high rate of resistance to different antibiotics. The aim of this study was to identify the most important native medicinal plants of Iran effective on P. aeruginosa.Materials and Methods: ...
Important Non-Technical Skills in Video-Assisted Thoracoscopic Surgery Lobectomy: Team Perspectives.
Gjeraa, Kirsten; Mundt, Anna S; Spanager, Lene; Hansen, Henrik J; Konge, Lars; Petersen, René H; Østergaard, Doris
2017-07-01
Safety in the operating room is dependent on the team's non-technical skills. The importance of non-technical skills appears to be different for minimally invasive surgery as compared with open surgery. The aim of this study was to identify which non-technical skills are perceived by team members to be most important for patient safety, in the setting of video-assisted thoracoscopic surgery (VATS) lobectomy. This was an explorative, semistructured interview-based study with 21 participants from all four thoracic surgery centers in Denmark that perform VATS lobectomy. Data analysis was deductive, and directed content analysis was used to code the text into the Oxford Non-Technical Skills system for evaluating operating teams' non-technical skills. The most important non-technical skills described by the VATS teams were planning and preparation, situation awareness, problem solving, leadership, risk assessment, and teamwork. These non-technical skills enabled the team to achieve shared mental models, which in turn facilitated their efforts to anticipate next steps. This was viewed as important by the participants as they saw VATS lobectomy as a high-risk procedure with complementary and overlapping scopes of practice between surgical and anesthesia subteams. This study identified six non-technical skills that serve as the foundation for shared mental models of the patient, the current situation, and team resources. These findings contribute three important additions to the shared mental model construct: planning and preparation, risk assessment, and leadership. Shared mental models are crucial for patient safety because they enable VATS teams to anticipate problems through adaptive patterns of both implicit and explicit coordination. Copyright © 2017 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved.
A large-scale RNA interference screen identifies genes that regulate autophagy at different stages
DEFF Research Database (Denmark)
Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man
2018-01-01
Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed...... with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes...... have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays...
DEFF Research Database (Denmark)
Taponen, S.; Simojoki, H.; Haveri, M.
2006-01-01
The coagulase-negative staphylococcal species causing mastitis in lactating cattle were identified and possible differences in the clinical characteristics or persistence of mastitis caused by different CNS were evaluated. The effect of antimicrobial treatment was also assessed. In addition, AFLP...... of these species. Approximately half of the mastitis cases were clinical, and in the majority clinical signs were mild. The severity and persistence of intramammary infection were unaffected by CNS species. Fifty-nine percent of the quarter cases were treated with antimicrobials, and the rest were left without...... treatment. Mastitis due to P-lactamase-negative CNS was treated with penicillin G and that due to beta-lactamase-positive CNS with cloxacillin. Nineteen percent of the isolates were P-lactamase-positive. The bacterial cure rate for quarters treated with antimicrobials was high, 85.9%, as opposed to only 45...
Which outcomes are most important to people with aphasia and their families?
DEFF Research Database (Denmark)
Wallace, Sarah J.; Worrall, Linda; Rose, Tanya
2017-01-01
Purpose: To identify important treatment outcomes from the perspective of people with aphasia and their families using the ICF as a frame of reference. Methods: The nominal group technique was used with people with aphasia and their family members in seven countries to identify and rank important...... for research outcome measurement and clinical service provision which currently focuses on the measurement of body function outcomes. The wide range of desired outcomes generated by both people with aphasia and their family members, highlights the importance of collaborative goal setting within a family...... function components of the ICF. • The outcomes identified in this study suggest a broad role for clinicians working in aphasia rehabilitation. The categories of identified outcomes may be used clinically as a starting point in goal-setting discussions with clients and their families....
Importance of Cross-Cultural Counseling in Rehabilitation Counseling Curricula.
Watson, Albert L.
1988-01-01
Ninety-one members of the National Council on Rehabilitation Education were surveyed concerning the level of importance placed on cross-cultural content in rehabilitation counselor education curricula. Respondents rated 27 of 32 cross-cultural educational offerings as important, and identified seven additional offerings. Respondents' demographic…
White, Jeremy; Stengel, Victoria; Rendon, Samuel; Banta, John
2017-08-01
Computer models of hydrologic systems are frequently used to investigate the hydrologic response of land-cover change. If the modeling results are used to inform resource-management decisions, then providing robust estimates of uncertainty in the simulated response is an important consideration. Here we examine the importance of parameterization, a necessarily subjective process, on uncertainty estimates of the simulated hydrologic response of land-cover change. Specifically, we applied the soil water assessment tool (SWAT) model to a 1.4 km2 watershed in southern Texas to investigate the simulated hydrologic response of brush management (the mechanical removal of woody plants), a discrete land-cover change. The watershed was instrumented before and after brush-management activities were undertaken, and estimates of precipitation, streamflow, and evapotranspiration (ET) are available; these data were used to condition and verify the model. The role of parameterization in brush-management simulation was evaluated by constructing two models, one with 12 adjustable parameters (reduced parameterization) and one with 1305 adjustable parameters (full parameterization). Both models were subjected to global sensitivity analysis as well as Monte Carlo and generalized likelihood uncertainty estimation (GLUE) conditioning to identify important model inputs and to estimate uncertainty in several quantities of interest related to brush management. Many realizations from both parameterizations were identified as behavioral in that they reproduce daily mean streamflow acceptably well according to Nash-Sutcliffe model efficiency coefficient, percent bias, and coefficient of determination. However, the total volumetric ET difference resulting from simulated brush management remains highly uncertain after conditioning to daily mean streamflow, indicating that streamflow data alone are not sufficient to inform the model inputs that influence the simulated outcomes of brush management
Qu, Haiyan; Shewchuk, Richard M; Alarcón, Graciela; Fraenkel, Liana; Leong, Amye; Dall'Era, Maria; Yazdany, Jinoos; Singh, Jasvinder A
2016-12-01
Numerous factors can impede or facilitate patients' medication decision-making and adherence to physicians' recommendations. Little is known about how patients and physicians jointly view issues that affect the decision-making process. Our objective was to derive an empirical framework of patient-identified facilitators to lupus medication decision-making from key stakeholders (including 15 physicians, 5 patients/patient advocates, and 8 medical professionals) using a patient-centered cognitive mapping approach. We used nominal group patient panels to identify facilitators to lupus treatment decision-making. Stakeholders independently sorted the identified facilitators (n = 98) based on their similarities and rated the importance of each facilitator in patient decision-making. Data were analyzed using multidimensional scaling and hierarchical cluster analysis. A cognitive map was derived that represents an empirical framework of facilitators for lupus treatment decisions from multiple stakeholders' perspectives. The facilitator clusters were 1) hope for a normal/healthy life, 2) understand benefits and effectiveness of taking medications, 3) desire to minimize side effects, 4) medication-related data, 5) medication effectiveness for "me," 6) family focus, 7) confidence in physician, 8) medication research, 9) reassurance about medication, and 10) medication economics. Consideration of how different stakeholders perceive the relative importance of lupus medication decision-making clusters is an important step toward improving patient-physician communication and effective shared decision-making. The empirically derived framework of medication decision-making facilitators can be used as a guide to develop a lupus decision aid that focuses on improving physician-patient communication. © 2016, American College of Rheumatology.
Clinical review: Ethnic differences in bone mass--clinical implications.
Leslie, William D
2012-12-01
Differences in bone mineral density (BMD) as assessed with dual-energy x-ray absorptiometry are observed between geographic and ethnic groups, with important implications in clinical practice. PubMed was employed to identify relevant studies. A review of the literature was conducted, and data were summarized and integrated. The available data highlight the complex ethnic variations in BMD, which only partially account for observed variations in fracture rates. Factors contributing to ethnic differences include genetics, skeletal size, body size and composition, lifestyle, and social determinants. Despite BMD differences, the gradient of risk for fracture from BMD and other clinical risk factors appears to be similar across ethnic groups. Furthermore, BMD variation is greater within an ethnic population than between ethnic populations. New imaging technologies have identified ethnic differences in bone geometry, volumetric density, microarchitecture, and estimated bone strength that may contribute to a better understanding of ethnic differences in fracture risk. Factors associated with ethnicity affect BMD and fracture risk through direct and indirect mechanisms.
International Nuclear Information System (INIS)
Homer, Alan; O’Hagan, Brendan
2015-01-01
Accountancy for nuclear material can be split into two categories. Firstly, where possible, accountancy should be in terms of items that can be transferred as discrete packages and their contents fixed at the time of their creation. All items must remain accounted for at all times, and a single missing item is considered significant. Secondly, where nuclear material is unconstrained, for example in a reprocessing plant where it can change form, there is an uncertainty that relates to the amount of material present in any location. Cumulatively, these uncertainties can be summed and provide a context for any estimate of material in a process. Any apparent loss or gain between what has been physically measured within a facility during its physical inventory take and what is reported within its nuclear material accounts is known as an inventory difference. The cumulative measurement uncertainties can be used to set an action level for the inventory difference so that if an inventory difference is observed outside of such action levels, the difference is classified as significant and an investigation to find the root cause(s) is required. The purpose of this paper is to explore the potential causes of significant inventory differences and to provide a framework within which an inventory difference investigation can be carried out.
Assessing the relative importance of correlates of loneliness in later life
DEFF Research Database (Denmark)
Ejlskov, Linda; Wulff, Jesper; Bøggild, Henrik
2017-01-01
OBJECTIVES: Improving the design and targeting of interventions is important for alleviating loneliness among older adults. This requires identifying which correlates are the most important predictors of loneliness. This study demonstrates the use of recursive partitioning in exploring...... the characteristics and assessing the relative importance of correlates of loneliness in older adults. METHOD: Using exploratory regression trees and random forests, we examined combinations and the relative importance of 42 correlates in relation to loneliness at age 68 among 2453 participants from the birth cohort...... study the MRC National Survey of Health and Development. RESULTS: Positive mental well-being, personal mastery, identifying the spouse as the closest confidant, being extrovert and informal social contact were the most important correlates of lower loneliness levels. Participation in organised groups...
International Nuclear Information System (INIS)
Foley, Kimberley A.; Feldman-Stewart, Deb; Groome, Patti A.; Brundage, Michael D.; McArdle, Siobhan; Wallace, David; Peng, Yingwei; Mackillop, William J.
2016-01-01
Purpose/Objective: The overall quality of patient care is a function of the quality of both its technical and its nontechnical components. The purpose of this study was to identify the elements of nontechnical (personal) care that are most important to patients undergoing radiation therapy for prostate cancer. Methods and Materials: We reviewed the literature and interviewed patients and health professionals to identify elements of personal care pertinent to patients undergoing radiation therapy for prostate cancer. We identified 143 individual elements relating to 10 aspects of personal care. Patients undergoing radical radiation therapy for prostate cancer completed a self-administered questionnaire in which they rated the importance of each element. The overall importance of each element was measured by the percentage of respondents who rated it as “very important.” The importance of each aspect of personal care was measured by the mean importance of its elements. Results: One hundred eight patients completed the questionnaire. The percentage of patients who rated each element “very important” ranged from 7% to 95% (mean 61%). The mean importance rating of the elements of each aspect of care varied significantly: “perceived competence of caregivers,” 80%; “empathy and respectfulness of caregivers,” 67%; “adequacy of information sharing,” 67%; “patient centeredness,” 59%; “accessibility of caregivers,” 57%; “continuity of care,” 51%; “privacy,” 51%; “convenience,” 45%; “comprehensiveness of services,” 44%; and “treatment environment,” 30% (P<.0001). Neither age nor education was associated with importance ratings, but the patient's health status was associated with the rating of some elements of care. Conclusions: Many different elements of personal care are important to patients undergoing radiation therapy for prostate cancer, but the 3 aspects of care that most believe are most important are these: the perceived
Energy Technology Data Exchange (ETDEWEB)
Foley, Kimberley A. [Cancer Care and Epidemiology, Queen' s Cancer Research Institute, Kingston, Ontario (Canada); Department of Public Health Sciences, Queen' s University, Kingston, Ontario (Canada); Feldman-Stewart, Deb [Cancer Care and Epidemiology, Queen' s Cancer Research Institute, Kingston, Ontario (Canada); Department of Oncology, Queen' s University, Kingston, Ontario (Canada); Groome, Patti A. [Cancer Care and Epidemiology, Queen' s Cancer Research Institute, Kingston, Ontario (Canada); Department of Public Health Sciences, Queen' s University, Kingston, Ontario (Canada); Brundage, Michael D. [Cancer Care and Epidemiology, Queen' s Cancer Research Institute, Kingston, Ontario (Canada); Department of Public Health Sciences, Queen' s University, Kingston, Ontario (Canada); Department of Oncology, Queen' s University, Kingston, Ontario (Canada); Cancer Centre of Southeastern Ontario, Kingston, Ontario (Canada); McArdle, Siobhan [Cancer Centre of Southeastern Ontario, Kingston, Ontario (Canada); Wallace, David [Cancer Care and Epidemiology, Queen' s Cancer Research Institute, Kingston, Ontario (Canada); Department of Public Health Sciences, Queen' s University, Kingston, Ontario (Canada); Peng, Yingwei [Cancer Care and Epidemiology, Queen' s Cancer Research Institute, Kingston, Ontario (Canada); Department of Public Health Sciences, Queen' s University, Kingston, Ontario (Canada); Department of Mathematics and Statistics, Queen' s University, Kingston, Ontario (Canada); Mackillop, William J., E-mail: William.mackillop@krcc.on.ca [Cancer Care and Epidemiology, Queen' s Cancer Research Institute, Kingston, Ontario (Canada); Department of Public Health Sciences, Queen' s University, Kingston, Ontario (Canada); Department of Oncology, Queen' s University, Kingston, Ontario (Canada); Cancer Centre of Southeastern Ontario, Kingston, Ontario (Canada)
2016-02-01
Purpose/Objective: The overall quality of patient care is a function of the quality of both its technical and its nontechnical components. The purpose of this study was to identify the elements of nontechnical (personal) care that are most important to patients undergoing radiation therapy for prostate cancer. Methods and Materials: We reviewed the literature and interviewed patients and health professionals to identify elements of personal care pertinent to patients undergoing radiation therapy for prostate cancer. We identified 143 individual elements relating to 10 aspects of personal care. Patients undergoing radical radiation therapy for prostate cancer completed a self-administered questionnaire in which they rated the importance of each element. The overall importance of each element was measured by the percentage of respondents who rated it as “very important.” The importance of each aspect of personal care was measured by the mean importance of its elements. Results: One hundred eight patients completed the questionnaire. The percentage of patients who rated each element “very important” ranged from 7% to 95% (mean 61%). The mean importance rating of the elements of each aspect of care varied significantly: “perceived competence of caregivers,” 80%; “empathy and respectfulness of caregivers,” 67%; “adequacy of information sharing,” 67%; “patient centeredness,” 59%; “accessibility of caregivers,” 57%; “continuity of care,” 51%; “privacy,” 51%; “convenience,” 45%; “comprehensiveness of services,” 44%; and “treatment environment,” 30% (P<.0001). Neither age nor education was associated with importance ratings, but the patient's health status was associated with the rating of some elements of care. Conclusions: Many different elements of personal care are important to patients undergoing radiation therapy for prostate cancer, but the 3 aspects of care that most believe are most important are these: the
Turner, S; Ollerhead, E; Cook, A
2017-10-09
In the funding of health research and public health research it is vital that research questions posed are important and that funded research meets a research need or a gap in evidence. Many methods are used in the identification of research priorities, however, these can be resource intensive, costly and logistically challenging. Identifying such research priorities can be particularly challenging for complex public health problems as there is a need to consult a number of experts across disciplines and with a range of expertise. This study investigated the use of Delphi-like survey methods in identifying important research priorities relating to health inequalities and framing tractable research questions for topic areas identified. The study was conducted in two phases, both using Delphi-like survey methods. Firstly, public health professionals with an interest in health inequalities were asked to identify research priorities. Secondly academic researchers were asked to frame tractable research questions relating to the priorities identified. These research priorities identified using Delphi-like survey methods were subsequently compared to those identified using different methods. A total of 52 public health professionals and 21 academics across the United Kingdom agreed to take part. The response rates were high, from public health professionals across three survey rounds (69%, 50% and 40%) and from academics across one round (52%), indicating that participants were receptive to the method and motivated to respond. The themes identified as encompassing the most important research priorities were mental health, healthy environment and health behaviours. Within these themes, the topic areas that emerged most strongly included community interventions for prevention of mental health problems and the food and alcohol environment. Some responses received from academic researchers were (as requested) in the form of tractable research questions, whereas others
Identifying 21st Century STEM Competencies Using Workplace Data
Jang, Hyewon
2016-04-01
Gaps between science, technology, engineering, and mathematics (STEM) education and required workplace skills have been identified in industry, academia, and government. Educators acknowledge the need to reform STEM education to better prepare students for their future careers. We pursue this growing interest in the skills needed for STEM disciplines and ask whether frameworks for 21st century skills and engineering education cover all of important STEM competencies. In this study, we identify important STEM competencies and evaluate the relevance of current frameworks applied in education using the standardized job-specific database operated and maintained by the US Department of Labor. Our analysis of the importance of 109 skills, types of knowledge and work activities, revealed 18 skills, seven categories of knowledge, and 27 work activities important for STEM workers. We investigate the perspectives of STEM and non-STEM job incumbents, comparing the importance of each skill, knowledge, and work activity for the two groups. We aimed to condense dimensions of the 52 key areas by categorizing them according to the Katz and Kahn (1978) framework and testing for inter-rater reliability. Our findings show frameworks for 21st century skills and engineering education do not encompass all important STEM competencies. Implications for STEM education programs are discussed, including how they can bridge gaps between education and important workplace competencies.
Guay, Frédéric; Chanal, Julien; Ratelle, Catherine F; Marsh, Herbert W; Larose, Simon; Boivin, Michel
2010-12-01
There are two approaches to the differential examination of school motivation. The first is to examine motivation towards specific school subjects (between school subject differentiation). The second is to examine school motivation as a multidimensional concept that varies in terms of not only intensity but also quality (within school subject differentiation). These two differential approaches have led to important discoveries and provided a better understanding of student motivational dynamics. However, little research has combined these two approaches. This study examines young elementary students' motivations across school subjects (writing, reading, and maths) from the stance of self-determination theory. First, we tested whether children self-report different levels of intrinsic, identified, and controlled motivation towards specific school subjects. Second, we verified whether children self-report differentiated types of motivation across school subjects. Participants were 425 French-Canadian children (225 girls, 200 boys) from three elementary schools. Children were in Grades 1 (N=121), 2 (N=126), and 3 (N=178). Results show that, for a given school subject, young elementary students self-report different levels of intrinsic, identified, and controlled motivation. Results also indicate that children self-report different levels of motivation types across school subjects. Our findings also show that most differentiation effects increase across grades. Some gender effects were also observed. These results highlight the importance of distinguishing among types of school motivation towards specific school subjects in the early elementary years.
Different methods for ethical analysis in health technology assessment: an empirical study.
Saarni, Samuli I; Braunack-Mayer, Annette; Hofmann, Bjørn; van der Wilt, Gert Jan
2011-10-01
Ethical analysis can highlight important ethical issues related to implementing a technology, values inherent in the technology itself, and value-decisions underlying the health technology assessment (HTA) process. Ethical analysis is a well-acknowledged part of HTA, yet seldom included in practice. One reason for this is lack of knowledge about the properties and differences between the methods available. This study compares different methods for ethical analysis within HTA. Ethical issues related to bariatric (obesity) surgery were independently evaluated using axiological, casuist, principlist, and EUnetHTA models for ethical analysis within HTA. The methods and results are presented and compared. Despite varying theoretical underpinnings and practical approaches, the four methods identified similar themes: personal responsibility, self-infliction, discrimination, justice, public funding, and stakeholder involvement. The axiological and EUnetHTA models identified a wider range of arguments, whereas casuistry and principlism concentrated more on analyzing a narrower set of arguments deemed more important. Different methods can be successfully used for conducting ethical analysis within HTA. Although our study does not show that different methods in ethics always produce similar results, it supports the view that different methods of ethics can yield relevantly similar results. This suggests that the key conclusions of ethical analyses within HTA can be transferable between methods and countries. The systematic and transparent use of some method of ethics appears more important than the choice of the exact method.
DEFF Research Database (Denmark)
Dieckmann, Peter; Clemmensen, Marianne Hald; Sørensen, Trine Kart
2016-01-01
Objectives Medicine label design plays an important role in improving patient safety. This study aimed at identifying facilitators and barriers in a medicine label system to prevent medication errors in clinical use by health care professionals. Methods The study design is qualitative and explora......Objectives Medicine label design plays an important role in improving patient safety. This study aimed at identifying facilitators and barriers in a medicine label system to prevent medication errors in clinical use by health care professionals. Methods The study design is qualitative...... of the system and some inconsistencies (different meaning of colors) posed challenges, when considered with the actual application context, in which there is little time to get familiar with the design features. Conclusions For optimizing medicine labels and obtaining the full benefit of label design features...
Zhang, Kaoping; Adams, Jonathan M; Shi, Yu; Yang, Teng; Sun, Ruibo; He, Dan; Ni, Yingying; Chu, Haiyan
2017-09-01
Rhizospheric fungi play major roles in both natural and agricultural ecosystems. However, little is known about the determinants of their diversity and biogeographic patterns. Here, we compared fungal communities in rhizosphere and bulk soils of wheat fields in the North China Plain. The rhizosphere had a lower fungal diversity (observed OTUs and Chao1) than bulk soil, and a distinct fungal community structure in rhizosphere compared with bulk soil. The relative importance of environmental factors and geographic distance for fungal distribution differed between rhizosphere and bulk soil. Environmental factors were the primary cause of variations in total fungal community and major fungal phyla in bulk soil. By contrast, fungal communities in soils loosely attached to roots were predictable from both environmental factors and influences of geographic distance. Communities in soils tightly attached to roots were mainly determined by geographic distance. Our results suggest that both contemporary environment processes (present-day abiotic and biotic environment characters) and historical processes (spatial isolation, dispersal limitation occurred in the past) dominate variations of fungal communities in wheat fields, but their relative importance of all these processes depends on the proximity of fungal community to the plant roots. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.
Araujo, Adriana V; Dias, Cristina O; Bonecker, Sérgio L C
2017-02-15
We examined the relationship between pollution and structure of copepod assemblages in estuaries, using sampling standardization of salinity range to reduce the effects of "Estuarine Quality Paradox". Copepod assemblages were analyzed in four Southeast Brazilian estuaries with different water quality levels and different hydrodynamic characteristics. The pollution negatively impacted the descriptors of the assemblage structure. The distribution of structure of copepod assemblages also showed a main separation trend between the most polluted estuaries and those less polluted. Temperature was the main factor affecting the assemblage structuring in the four estuaries. This factor acted in synergism with the effects of pollution impact and physical characteristics of the estuaries on the structure of copepod assemblages, supporting the potential vulnerability of coastal environments due to nutrient enrichment associated with climate change. Our study demonstrated the importance of sampling standardization of the salinity range in estuaries for reliable analysis of pollution effects on biota. Copyright © 2016 Elsevier Ltd. All rights reserved.
Pattern check of TLD disc readings - an important tool to identify abnormal conditions in workplace
International Nuclear Information System (INIS)
Pradhan, S.M.; Sneha, C.; Bhattacharya, M.; Sahai, M.K.; Pradeep, Ratna; Datta, D.; Bhatnagar, Amit
2016-01-01
Personnel monitoring for external radiation using CaSO 4 :Dy based TLD badge is well established in Indian radiation protection program. TLD badge enables evaluation of occupational dose based on the pattern and values of the three disc readings. Different patterns of disc readings are obtained depending on the type and energy of radiation in the workplace. Pattern not conforming to the radiation in the workplace also called as improper pattern can be a useful tool for investigation of any deviation / abnormality in workplace or monitoring practices. The paper presents different examples of improper pattern observed in monitoring that has helped to find out the deviations in the workplace or monitoring practices. Results of the experiments conducted to simulate some of the observed pattern are also presented in the paper
Combinatorial Drug Screening Identifies Ewing Sarcoma-specific Sensitivities
DEFF Research Database (Denmark)
Radic-Sarikas, Branka; Tsafou, Kalliopi P; Emdal, Kristina B.
2017-01-01
Improvements in survival for Ewing sarcoma pediatric and adolescent patients have been modest over the past 20 years. Combinations of anticancer agents endure as an option to overcome resistance to single treatments caused by compensatory pathways. Moreover, combinations are thought to lessen any...... associated adverse side effects through reduced dosing, which is particularly important in childhood tumors. Using a parallel phenotypic combinatorial screening approach of cells derived from three pediatric tumor types, we identified Ewing sarcoma-specific interactions of a diverse set of targeted agents...... including approved drugs. We were able to retrieve highly synergistic drug combinations specific for Ewing sarcoma and identified signaling processes important for Ewing sarcoma cell proliferation determined by EWS-FLI1 We generated a molecular target profile of PKC412, a multikinase inhibitor with strong...
Comparison of different methods to extract the required coefficient of friction for level walking.
Chang, Wen-Ruey; Chang, Chien-Chi; Matz, Simon
2012-01-01
The required coefficient of friction (RCOF) is an important predictor for slip incidents. Despite the wide use of the RCOF there is no standardised method for identifying the RCOF from ground reaction forces. This article presents a comparison of the outcomes from seven different methods, derived from those reported in the literature, for identifying the RCOF from the same data. While commonly used methods are based on a normal force threshold, percentage of stance phase or time from heel contact, a newly introduced hybrid method is based on a combination of normal force, time and direction of increase in coefficient of friction. Although no major differences were found with these methods in more than half the strikes, significant differences were found in a significant portion of strikes. Potential problems with some of these methods were identified and discussed and they appear to be overcome by the hybrid method. No standard method exists for determining the required coefficient of friction (RCOF), an important predictor for slipping. In this study, RCOF values from a single data set, using various methods from the literature, differed considerably for a significant portion of strikes. A hybrid method may yield improved results.
Baum, Heinz-Georg; Schuch, Dieter
2017-12-01
Benchmarking is a proven and widely used business tool for identifying best practice. To produce robust results, the objects of comparison used in benchmarking analysis need to be structurally comparable and distorting factors need to be eliminated. We focus on a specific example - a benchmark study commissioned by the European Commission's Directorate-General for Environment on the implementation of Extended Producer Responsibility (EPR) for packaging at the national level - to discuss potential distorting factors and take them into account in the calculation. The cost of compliance per inhabitant and year, which is used as the key cost efficiency indicator in the study, is adjusted to take account of seven factors. The results clearly show that differences in performance may play a role, but the (legal) implementation of EPR - which is highly heterogeneous across countries - is the single most important cost determinant and must be taken into account to avoid misinterpretation and false conclusions.
Presence and Distribution of Economically Important Potato Viruses in Montenegro
Directory of Open Access Journals (Sweden)
Jelena Zindović
2011-01-01
Full Text Available The research was carried out, in the period 2002-2004 in order to determine the presence and distribution of potato viruses at 12 different locations and on 9 different potato varieties grown in Montenegro. The research included collecting of samples in seed potato crops and testing of six economically important potato viruses: Potato leaf roll virus (PLRV, Potato virus Y (PVY, Potato virus X (PVX, Potato virus S (PVS, Potato virus A (PVA i Potato virus M (PVM. Using the direct enzyme-linked immunosorbent assay (DAS-ELISA and commercial antisera specific for six potato viruses, it was found that PVY was the most frequent virus during the three-year research period. The second frequent virus was PVS, followed by PVA, PLRV, PVM and PVX. Single and mixed infections were detected, and the most prevalent were the single infections of PVY. Also, in the period 2002-2004, PVY had the highest distribution and the number of present viruses was different at different localities and on different potato varieties. Further investigations were related to detailed characterization of the most prevalent virus (PVY, which is at the same time economically the most important one. Serological characterization of PVY was performed utilizing DAS-ELISA kit with commercial monoclonal antibodies specific for detection of the three strain groups of PVY, and the two straingroups - necrotic (PVYN/PVYNTN and common (PVYO, were identified. Necrotic strains were prevalent in 2002 and 2004, while in 2003 PVYO was the most frequent strain in virus population. The presence of stipple streak strain (PVYC was not detected in any of the testedsamples.
Identifying the new Influencers in the Internet Era: Social Media and Social Network Analysis
Directory of Open Access Journals (Sweden)
MIGUEL DEL FRESNO GARCÍA
2016-01-01
Full Text Available Social media influencers (SMIs can be defined as a new type of independent actor who are able to shape audience attitudes through the use of social media channels in competition and coexistence with professional media. Being able to accurately identify SMIs is critical no matter what is being transmitted in a social system. Social Network Analysis (SNA has been recognized as a powerful tool for representing social network structures and information dissemination. SMIs can be identifi ed by their high-ranking position in a network as the most important or central nodes. The results reveal the existence of three different typologies of SMIs: disseminator, engager and leader. This methodology permits the optimization of resources to create effective online communication strategies.
Hammarlöf, Disa L; Canals, Rocío; Hinton, Jay C D
2013-10-01
The availability of thousands of genome sequences of bacterial pathogens poses a particular challenge because each genome contains hundreds of genes of unknown function (FUN). How can we easily discover which FUN genes encode important virulence factors? One solution is to combine two different functional genomic approaches. First, transcriptomics identifies bacterial FUN genes that show differential expression during the process of mammalian infection. Second, global mutagenesis identifies individual FUN genes that the pathogen requires to cause disease. The intersection of these datasets can reveal a small set of candidate genes most likely to encode novel virulence attributes. We demonstrate this approach with the Salmonella infection model, and propose that a similar strategy could be used for other bacterial pathogens. Copyright © 2013 Elsevier Ltd. All rights reserved.
ECOPHARMACOVIGILANCE: ITS IMPORTANCE AND CHALLENGES
Dr. Bhavana Srivastava
2014-01-01
Active pharmaceutical ingredients represent a group of emerging environmental contamination. Even in trace amounts, they are of great concern due to then continuous introduction into the environment, their impact an ecosystem and human and vetenery health is of great importance. This has given birth to the science of Ecopharmacovigilance (EPV). It aims to ensure that significant environmental issues associated with pharmaceuticals in the environment are identified and managed appropriately. ...
DEFF Research Database (Denmark)
Vogel, Birte Fonnesbech; Venkateswaran, K.; Satomi, M.
2005-01-01
are important in fish spoilage. More than 500 H2S-producing strains were isolated from iced stored marine fish (cod, plaice, and flounder) caught in the Baltic Sea during winter or summer time. All strains were identified as Shewanella species by phenotypic tests. Different Shewanella species were present...... unchanged (i.e., trimethylamine-N-oxide reduction and H2S production); however, the main H2S-producing organism was identified as S. baltica....
Jabson, Jennifer M.; Bowen, Deborah; Weinberg, Janice; Kroenke, Candyce; Luo, Juhua; Messina, Catherine; Shumaker, Sally; Tindle, Hilary A.
2016-01-01
BACKGROUND Strategies for identifying the most relevant psychosocial predictors in studies of racial/ethnic minority women’s health are limited because they largely exclude cultural influences and they assume that psychosocial predictors are independent. This paper proposes and tests an empirical solution. METHODS Hierarchical cluster analysis, conducted with data from 140,652 Women’s Health Initiative participants, identified clusters among individual psychosocial predictors. Multivariable analyses tested associations between clusters and health outcomes. RESULTS A Social Cluster and a Stress Cluster were identified. The Social Cluster was positively associated with well-being and inversely associated with chronic disease index, and the Stress Cluster was inversely associated with well-being and positively associated with chronic disease index. As hypothesized, the magnitude of association between clusters and outcomes differed by race/ethnicity. CONCLUSIONS By identifying psychosocial clusters and their associations with health, we have taken an important step toward understanding how individual psychosocial predictors interrelate and how empirically formed Stress and Social clusters relate to health outcomes. This study has also demonstrated important insight about differences in associations between these psychosocial clusters and health among racial/ethnic minorities. These differences could signal the best pathways for intervention modification and tailoring. PMID:27279761
Directory of Open Access Journals (Sweden)
Dr.Ghassem Faraj Pour
2015-05-01
Full Text Available ABSTRACT Efforts to improve the quality are one of the prerequisites for the success of individual companies and for the competitiveness of all whole companies. In the field of improvement and excellence business excellence models answer to the question that what the better organization is what goals and concepts they follow and according to what standards they behave. The EFQM excellence model can be transition from multiplicity to unity of different existing models. The most important approaches of these models are self-assessment and identifying improvement areas in an organization. On the other side organizations which are at lower level of total quality management will encounter so many areas to improve when using this model and implementing of self-improvement. Choosing the most important key problems are always the main challenges and because of resource constraints and strategic goals organizations have to prioritize identified improvement opportunities. This paper introduces a model for prioritizing and choosing the most significant improvement opportunities using the organization Business Excellence team members and because the analysis and decision making atmosphere for excellence team members is not generally complete with accurate information it seems using of fuzzy decision can be very helpful.
Spectroscopy methods for identifying the country of origin
Hondrogiannis, Ellen; Ehrlinger, Erin; Miziolek, Andrzej W.
2013-05-01
There is a need in many industries and government functions to identify the source of origin for various materials. For example, the food industry needs to ensure that the claimed source of some of the food products (e.g. coffee, spices) are in fact legitimate due to the variation of quality from different source locations world-wide. Another example is to identify the source country for imported commodities going through Customs so as to assess the correct tariff which varies depending on the source country. Laser Induced Breakdown Spectroscopy (LIBS) holds promise for being a field-portable tool for rapid identification of the country of origin of various materials. Recent research at Towson University has identified the elemental markers needed for discrimination of select spices back to their country of origin using wavelength dispersive X-ray fluorescence (WDXRF). The WDXRF device, however, is not particularly suitable for convenient and fast field analysis. We are extending this study to evaluate the potential of a benchtop commercial LIBS device that could be located at ports of entry and to compare its performance with WDXRF. Our initial study on the spice cumin has demonstrated that discriminant function models can not only be created with 100% separation between the 4 countries of origin (China, India, Syria, and Turkey), but also when tested they show 100% correct matching to the country of origin. This study adds to the growing number of publications that indicate the power of LIBS elemental fingerprinting for provenance determinations.
Gender differences in developmental dyscalculia depend on diagnostic criteria.
Devine, Amy; Soltész, Fruzsina; Nobes, Alison; Goswami, Usha; Szűcs, Dénes
2013-10-01
Developmental dyscalculia (DD) is a learning difficulty specific to mathematics learning. The prevalence of DD may be equivalent to that of dyslexia, posing an important challenge for effective educational provision. Nevertheless, there is no agreed definition of DD and there are controversies surrounding cutoff decisions, specificity and gender differences. In the current study, 1004 British primary school children completed mathematics and reading assessments. The prevalence of DD and gender ratio were estimated in this sample using different criteria. When using absolute thresholds, the prevalence of DD was the same for both genders regardless of the cutoff criteria applied, however gender differences emerged when using a mathematics-reading discrepancy definition. Correlations between mathematics performance and the control measures selected to identify a specific learning difficulty affect both prevalence estimates and whether a gender difference is in fact identified. Educational implications are discussed.
Directory of Open Access Journals (Sweden)
Rosić Mladen
2014-01-01
Full Text Available Justification of the diversification strategy is derived from the success of the corporate management of diversified companies in adding value to a portfolio of strategic business units in its composition to a greater amount than they could achieve alone or under someone else's control. Such a level of added value can be achieved by identifying and using strategic fit between strategic business units themselves or between strategic business units and corporate management. Since the strategic fits, which represent a specific interdependence relationships, in modern companies usually exist among the various forms of intangible assets, they often remain unused because they can not be easily identified. Even when we recognize the opportunities to achieve strategic fits, it is not easy to achieve them because it is often necessary coordinated action of different organizational units at different hierarchical levels. Therefore strategic tool Balanced scorecard have great importance in the management of modern diversified enterprises.
Three novel approaches to structural identifiability analysis in mixed-effects models.
Janzén, David L I; Jirstrand, Mats; Chappell, Michael J; Evans, Neil D
2016-05-06
Structural identifiability is a concept that considers whether the structure of a model together with a set of input-output relations uniquely determines the model parameters. In the mathematical modelling of biological systems, structural identifiability is an important concept since biological interpretations are typically made from the parameter estimates. For a system defined by ordinary differential equations, several methods have been developed to analyse whether the model is structurally identifiable or otherwise. Another well-used modelling framework, which is particularly useful when the experimental data are sparsely sampled and the population variance is of interest, is mixed-effects modelling. However, established identifiability analysis techniques for ordinary differential equations are not directly applicable to such models. In this paper, we present and apply three different methods that can be used to study structural identifiability in mixed-effects models. The first method, called the repeated measurement approach, is based on applying a set of previously established statistical theorems. The second method, called the augmented system approach, is based on augmenting the mixed-effects model to an extended state-space form. The third method, called the Laplace transform mixed-effects extension, is based on considering the moment invariants of the systems transfer function as functions of random variables. To illustrate, compare and contrast the application of the three methods, they are applied to a set of mixed-effects models. Three structural identifiability analysis methods applicable to mixed-effects models have been presented in this paper. As method development of structural identifiability techniques for mixed-effects models has been given very little attention, despite mixed-effects models being widely used, the methods presented in this paper provides a way of handling structural identifiability in mixed-effects models previously not
Directory of Open Access Journals (Sweden)
Veronica Silva
2015-09-01
Full Text Available Omega-3 fatty acids (n-3 FA supplementation has been widely used regardless the initial FA composition of the studied population. In this work we compared the red blood cell FA (RBC-FA composition in healthy and different diseased populations at baseline and show how this affects the incorporation of n-3 FA supplementation in ICU-trauma patients. Blood was drawn from Healthy (H, n = 22, Psoriasis (P, n = 13, Cancer(C, n = 81, Geriatric (G, n = 49, Social-phobia (SP, n = 27 and ICU-trauma (T, n = 40 patients before n-3 FA supplementation. For the T group blood was also drawn 8 days after receiving a formula with 4.1 g/L EPA and 5.5 g/L GLA (Oxepa, Abbott. RBC-FA was assessed by gas chromatography and the percentage of each FA was calculated in relation to the total identified FAs. Baseline RBC-FA profile was significantly different between groups (p < 0.0001 with subjects in the healthy group having higher n-3 FA status. H and SP showed the highest content in total n-3 FA (11.89 ± 0.22% H vs 7.45 ± 0.26% T and EPA (1.61 ± 0.03% H vs 0.41 ± 0.13% P. DHA was higher in C and H than in the other groups (6.15 ± 0.15% C vs 4.32 ± 0.11% T. ARA was highest in C (16.04 ± 0.20% C vs 14.85 ± 0.22% H and comparable in the rest of the groups. The n-6/n-3 ratio was lowest for H and highest for T (2.75 ± 0.07 vs 4.96 ± 0.13. Moreover, we showed that for the T group, the treatment-associated changes in the n-3 content are dependent on the initial n-3 FA status, since a negative correlation between the baseline omega 3 index (EPA + DHA and its change after supplementation was found (p = 0.002, r2 = 0.219. We conclude that RBC-FA profile should be evaluated and considered individually for each patient or groups before generalized supplementation schemes, strengthening the concept of personalized medicine.
The importance of interpersonal communication in poison centers.
Crouch, B I; Thomas, K C; Rothwell, E; Planalp, S; Ellington, L; Teemant, K
2013-11-01
Poison control center (PCC) personnel face many challenges in communicating with callers and with each other. The purpose of this study was to identify interpersonal communication issues that affect the work environment within PCCs. As part of a larger questionnaire study distributed electronically to members of the American Association of Poison Control Centers (AAPCC) to assess communication training needs for PCCs, three questions were included to assess interpersonal communication within the work environment: (1) How important is interpersonal communication within your center to a positive work environment? (not at all to extremely important, 1-7); (2) How disruptive is interpersonal communication to your work? (not at all to extremely disruptive, 1-7); and (3) What communication issues do you find most disruptive to your work? (free-text response). Descriptive and qualitative content analyses were used to identify themes in responses. A total of 537 responses were received from SPIs, directors, medical directors, and other PCC staff. Interpersonal communication within the PCC was rated as extremely important to a positive work environment (median = 7 and IQR = 6-7; 62.3% rated as extremely important). Interpersonal communication was rated as less than moderately disruptive on average (median = 3 and IQR = 2-4). Free-text responses were received from 335 (62%) respondents. Free-text comments were broadly categorized as relating to PCC personnel and work environment and issues related to PCC callers. Categories that emerged from the PCC personnel and work environment category included the following: poor interpersonal communication (n = 104; 31%); background noise (n = 96; 29%); poor work procedures (n = 51; 15%); and poor management communication (n = 38; 11%). Interpersonal communication within PCCs was considered to be important for a positive work environment. Although not found to be strongly disruptive by most respondents, several specific interpersonal
Identifying glass compositions in fly ash
Directory of Open Access Journals (Sweden)
Katherine eAughenbaugh
2016-01-01
Full Text Available In this study, four Class F fly ashes were studied with a scanning electron microscope; the glassy phases were identified and their compositions quantified using point compositional analysis with k-means clustering and multispectral image analysis. The results showed that while the bulk oxide contents of the fly ashes were different, the four fly ashes had somewhat similar glassy phase compositions. Aluminosilicate glasses (AS, calcium aluminosilicate glasses (CAS, a mixed glass, and, in one case, a high iron glass were identified in the fly ashes. Quartz and iron crystalline phases were identified in each fly ash as well. The compositions of the three main glasses identified, AS, CAS, and mixed glass, were relatively similar in each ash. The amounts of each glass were varied by fly ash, with the highest calcium fly ash containing the most of calcium-containing glass. Some of the glasses were identified as intermixed in individual particles, particularly the calcium-containing glasses. Finally, the smallest particles in the fly ashes, with the most surface area available to react in alkaline solution, such as when mixed with portland cement or in alkali-activated fly ash, were not different in composition than the large particles, with each of the glasses represented. The method used in the study may be applied to a fly ash of interest for use as a cementing material in order to understand its potential for reactivity.
Identifying phenomenal consciousness.
Schier, Elizabeth
2009-03-01
This paper examines the possibility of finding evidence that phenomenal consciousness is independent of access. The suggestion reviewed is that we should look for isomorphisms between phenomenal and neural activation spaces. It is argued that the fact that phenomenal spaces are mapped via verbal report is no problem for this methodology. The fact that activation and phenomenal space are mapped via different means does not mean that they cannot be identified. The paper finishes by examining how data addressing this theoretical question could be obtained.
Imported emissions. The world trade stowaway
International Nuclear Information System (INIS)
Fink, Meike; Gautier, Celia
2013-05-01
This study first gives an overview of existing tools and methodological challenges to account emissions included in consumed products fabricated elsewhere. It notably discusses the passage from a methodology based on a production principle to a methodology based on a consumption principle, outlines the different methodologies associated with the different analysis levels, and the importance of uncertainty sources. The second part proposes a view on emission flows included in exports and imports. It addresses the following issues: the international level, increasing importance of emissions transferred via world trade, emissions related to consumption per capita and per social class, carbon and energy intensity of products at the origin of emissions, composition of imported and exported products and intensity of their emissions, impact of a methodological change on greenhouse gas emissions by France, extent of emissions imported in France, and Germany as the first trade partner and emission importer of France. The third part discusses the political implications of an accounting of emissions related to consumption and to world trade
Importance of Knowledge Management in Human Resource Development
International Nuclear Information System (INIS)
Pleslic, Sanda
2014-01-01
Human resource management and knowledge management: • In human resource management - important to identify crucial knowledge base on which competitiveness of company depends → according this ensure appropriate development of human resources. • Era of so-called knowledge economy - only individual and organizational knowledge could give competitive advantage. • From operational perspective, knowledge management - systematic processes by which an organization identifies, creates, captures, acquires, shares and increase knowledge
Mathias, Susan D; Gao, Sue K; Rutstein, Mark; Snyder, Claire F; Wu, Albert W; Cella, David
2009-02-01
Interpretation of data from health-related quality of life (HRQoL) questionnaires can be enhanced with the availability of minimally important difference (MID) estimates. This information will aid clinicians in interpreting HRQoL differences within patients over time and between treatment groups. The Immune Thrombocytopenic Purpura (ITP)-Patient Assessment Questionnaire (PAQ) is the only comprehensive HRQoL questionnaire available for adults with ITP. Forty centers from within the US and Europe enrolled ITP patients into one of two multicenter, randomized, placebo-controlled, double-blind, 6-month, phase III clinical trials of romiplostim. Patients enrolled in these studies self-administered the ITP-PAQ and two items assessing global change (anchors) at baseline and weeks 4, 12, and 24. Using data from the ITP-PAQ and these two anchors, an anchor-based estimate was computed and combined with the standard error of measurement and standard deviation to compute a distribution-based estimate in order to provide an MID range for each of the 11 scales of the ITP-PAQ. A total of 125 patients participated in these clinical trials and provided data for use in these analyses. Combining results from anchor- and distribution-based approaches, MID values were computed for 9 of the 11 scales. MIDs ranged from 8 to 12 points for Symptoms, Bother, Psychological, Overall QOL, Social Activity, Menstrual Symptoms, and Fertility, while the range was 10 to 15 points for the Fatigue and Activity scales of the ITP-PAQ. These estimates, while slightly higher than other published MID estimates, were consistent with moderate effect sizes. These MID estimates will serve as a useful tool to researchers and clinicians using the ITP-PAQ, providing guidance for interpretation of baseline scores as well as changes in ITP-PAQ scores over time. Additional work should be done to finalize these initial estimates using more appropriate anchors that correlate more highly with the ITP-PAQ scales.
Kamphuis, W.; Delahaij, R.
2014-01-01
In the current study, the relative importance of different resources for psychological resilience of service members is investigated. The study employs a model of psychological resilience developed for the Netherlands Armed Forces, which identifies 25 resources for resilience at 5 different levels
von Essen, L; Sjödén, P O
1993-08-01
The present study identified psychiatric inpatient (N = 61) and staff (N = 63) perceptions of most and least important nurse caring behaviors using a modified Swedish version of the CARE-Q instrument (Larson, 1981) and compared the results with data from somatic care (von Essen & Sjödén, 1991a, 1991b). The results demonstrated 13 significant mean between-group differences in the rating of 50 specific CARE-Q behaviors. Two significant mean value differences out of six subscales combining individual items were demonstrated between groups. Psychiatric inpatients considered the cognitive aspect, and somatic inpatients the task-oriented aspect of caring as the most important. Staff, in psychiatric as well as somatic care, considered the emotional aspect of caring as the most important. The results suggest that staff has a relatively invariant, human-oriented perception of caring, irrespective of subdisciplines, while patients' perceptions of caring vary more over specialties.
The Architectural and Technical Consequences of Different Window Details in a Danish Passive House
DEFF Research Database (Denmark)
Brunsgaard, Camilla; Heiselberg, Per; Jensen, Rasmus Lund
2008-01-01
This paper focuses on a study of window details from "The Comfort Houses" in relation to "traditional" Danish construction solutions. The aim is to evaluate different ways of solving a window detail and to identify both architectural and technical consequences. It is important to investigate bot...... aspects of a detail because the best technical solution might not be the best architectural solution. A proposal from "The Comfort Houses" - a brick passive house, will be used as a basis....... This paper focuses on a study of window details from "The Comfort Houses" in relation to "traditional" Danish construction solutions. The aim is to evaluate different ways of solving a window detail and to identify both architectural and technical consequences. It is important to investigate both...
Verdolini, Norma; Dean, Jonathon; Elisei, Sandro; Quartesan, Roberto; Zaman, Rashid; Agius, Mark
2014-11-01
Prognostic factors of bipolar disorder must be identified to assist in staging and treatment, and this may be done primarily during the initial psychiatric assessment. In fact, most of the prognostic factors, which determine disease outcome, could be detected from simple but often-unrecorded questions asked during the psychiatric clinic visit. We collected data from the clinical notes of 70 bipolar outpatients seen at the initial psychiatric assessment clinic about socio-demographic and clinical factors to determine whether various factors had relevance to prevalence, prognosis, or outcome. The sample comprised 16 bipolar I (22.9%) and 54 bipolar II (77.1%) outpatients; a psychiatric comorbidity was noted in 26 patients (37.1%). 60.9% (42 patients) reported anxiety features and 12 patients (17.6%) were noted to have obsessive-compulsive characteristics. Percentages reported in our results are of the sample for which the data was available. Anhedonia is a depressive feature that was present in most of the population where this data was available (92.2%, 59 patients) and 81.8% (54 patients) reported suicidal thoughts during a depressive episode. 74.6% (47 patients) had a family history of bipolar disorder, depression, suicide or psychosis. 27 patients (39.7%) reported current alcohol use and 14 patients (22.6%) current illicit drug use. A comparison between 10 prognostic factors found that only the correlations between current illicit drug use/previous illicit drug use (χ(2)=11.471, Palcohol use/previous alcohol use (χ(2)=31.510, Palcohol use (χ(2)=5.071, P=0.023) and previous alcohol use/family history (χ(2)=4.309, P=0.037) were almost statistically significant. 17 patients (24.3%) of the 70 bipolar patients were assigned to a care coordinator; we have evaluated the possible differences between the patients with or without a care coordinator on the basis of the presence of 10 possible prognostic factors and found no statistically significant differences between
Involvement in Extracurricular Activities: Identifying Differences in Perceptions of School Climate
Martinez, Andrew; Coker, Crystal; McMahon, Susan D.; Cohen, Jonathan; Thapa, Amrit
2016-01-01
Many youth participate in extracurricular activities, and research has linked activity participation with school engagement and academic success. Social-ecological theory suggests that the social contexts of different types of extracurricular activities may differentially affect student outcomes. Yet, there is scant research examining the relation…
DEFF Research Database (Denmark)
Granados, Joel; Bonnet, Philippe
2013-01-01
Because of the increased number of cameras employed in environmental sensing and the tremendous image output they produce, we have created a flexible, open-source software solution called EcoIP to help automatically determine different phenophases for different species from digital image sequences....... Onset and ending dates are calculated through an iterative process: (1) training images are chosen and areas of interest identified, (2) separation of foreground and background is accomplished based on a naive Bayesian method, (3) a signal is created based on the separation model and (4) it is then fit...... to a sigmoid that contains the dates of interest. Results using different phenological events of different species indicate that estimated dates fall within a few days of the observed dates for most cases. Our experiments indicate that color separability and scene illumination are contributing factors...
Exome sequencing identifies three novel candidate genes implicated in intellectual disability.
Directory of Open Access Journals (Sweden)
Zehra Agha
Full Text Available Intellectual disability (ID is a major health problem mostly with an unknown etiology. Recently exome sequencing of individuals with ID identified novel genes implicated in the disease. Therefore the purpose of the present study was to identify the genetic cause of ID in one syndromic and two non-syndromic Pakistani families. Whole exome of three ID probands was sequenced. Missense variations in two plausible novel genes implicated in autosomal recessive ID were identified: lysine (K-specific methyltransferase 2B (KMT2B, zinc finger protein 589 (ZNF589, as well as hedgehog acyltransferase (HHAT with a de novo mutation with autosomal dominant mode of inheritance. The KMT2B recessive variant is the first report of recessive Kleefstra syndrome-like phenotype. Identification of plausible causative mutations for two recessive and a dominant type of ID, in genes not previously implicated in disease, underscores the large genetic heterogeneity of ID. These results also support the viewpoint that large number of ID genes converge on limited number of common networks i.e. ZNF589 belongs to KRAB-domain zinc-finger proteins previously implicated in ID, HHAT is predicted to affect sonic hedgehog, which is involved in several disorders with ID, KMT2B associated with syndromic ID fits the epigenetic module underlying the Kleefstra syndromic spectrum. The association of these novel genes in three different Pakistani ID families highlights the importance of screening these genes in more families with similar phenotypes from different populations to confirm the involvement of these genes in pathogenesis of ID.
Importance of Surface Texture to Infrared Remote Sensing Interpretations
Kirkland, L. E.; Adams, P. M.; Herr, K. C.; Salisbury, J. W.
2001-11-01
Thermal infrared remote sensing may be used to identify minerals present on the surface using diagnostic spectral bands. As band depth (spectral contrast) exhibited by the mineral increases, the mineral is easier to detect. In order to determine the expected spectral contrast, thermal infrared spectra of typical mineral endmembers are commonly measured in the laboratory. For example, for calcite, well-crystalline limestone is commonly studied. However, carbonates occur in several forms, including thin coatings, indurated carbonate (calcrete), and hot springs deposits. Different formation pathways may cause different microstructures and surface textures. This in turn can also affect the surface texture of the weathered material. Different surface textures can affect the measured band contrast, through roughness that causes a cavity (hohlraum) effect, and particle size and roughness on a scale that causes volume scattering. Thus since detection limits vary with the spectral contrast, surface texture can be an important variable in how detectable a mineral is. To study these issues, we have examined limestone and calcrete deposits at Mormon Mesa, Nevada that have two distinctly different microstructures and surface texture [Kirkland et al., 2001]. The limestone studied has larger grains and the grains frequently have flat, smooth surfaces on the order of 10-50 microns in cross-section length. The calcrete has smaller, more angular calcite grains, which exhibit almost no flat surfaces longer than 5 microns in cross-section length. We will show scanning electron microscope images to compare the different microstructures and surface textures of both the fresh and weathered surfaces, and we will show corresponding thermal infrared spectra to illustrate the different spectral signatures. The results demonstrate the importance of understanding the microstructure of mineral deposits to accurately interpret infrared remote sensing data, especially for studies that lack ground
Chien, A; Xu, M; Yokota, H; Scalzo, F; Morimoto, E; Salamon, N
2018-01-25
Recent studies have strongly associated intracranial aneurysm growth with increased risk of rupture. Identifying aneurysms that are likely to grow would be beneficial to plan more effective monitoring and intervention strategies. Our hypothesis is that for unruptured intracranial aneurysms of similar size, morphologic characteristics differ between aneurysms that continue to grow and those that do not. From aneurysms in our medical center with follow-up imaging dates in 2015, ninety-three intracranial aneurysms (23 growing, 70 stable) were selected. All CTA images for the aneurysm diagnosis and follow-up were collected, a total of 348 3D imaging studies. Aneurysm 3D geometry for each imaging study was reconstructed, and morphologic characteristics, including volume, surface area, nonsphericity index, aspect ratio, and size ratio were calculated. Morphologic characteristics were found to differ between growing and stable groups. For aneurysms of 7 mm, volume ( P differ between those that are growing and those that are stable. The nonsphericity index, in particular, was found to be higher among growing aneurysms. The size ratio was found to be the second most significant parameter associated with growth. © 2018 by American Journal of Neuroradiology.
Identifying Core Concepts of Cybersecurity: Results of Two Delphi Processes
Parekh, Geet; DeLatte, David; Herman, Geoffrey L.; Oliva, Linda; Phatak, Dhananjay; Scheponik, Travis; Sherman, Alan T.
2018-01-01
This paper presents and analyzes results of two Delphi processes that polled cybersecurity experts to rate cybersecurity topics based on importance, difficulty, and timelessness. These ratings can be used to identify core concepts--cross-cutting ideas that connect knowledge in the discipline. The first Delphi process identified core concepts that…
Soares, René Arderius; Passaglia, Luciane Maria Pereira
2010-10-01
Bradyrhizobium elkanii is successfully used in the formulation of commercial inoculants and, together with B. japonicum, it fully supplies the plant nitrogen demands. Despite the similarity between B. japonicum and B. elkanii species, several works demonstrated genetic and physiological differences between them. In this work Representational Difference Analysis (RDA) was used for genomic comparison between B. elkanii SEMIA 587, a crop inoculant strain, and B. japonicum USDA 110, a reference strain. Two hundred sequences were obtained. From these, 46 sequences belonged exclusively to the genome of B. elkanii strain, and 154 showed similarity to sequences from B. japonicum genome. From the 46 sequences with no similarity to sequences from B. japonicum, 39 showed no similarity to sequences in public databases and seven showed similarity to sequences of genes coding for known proteins. These seven sequences were divided in three groups: similar to sequences from other Bradyrhizobium strains, similar to sequences from other nitrogen-fixing bacteria, and similar to sequences from non nitrogen-fixing bacteria. These new sequences could be used as DNA markers in order to investigate the rates of genetic material gain and loss in natural Bradyrhizobium strains.
Snijders, Antoine M; Marchetti, Francesco; Bhatnagar, Sandhya; Duru, Nadire; Han, Ju; Hu, Zhi; Mao, Jian-Hua; Gray, Joe W; Wyrobek, Andrew J
2012-01-01
High dose ionizing radiation (IR) is a well-known risk factor for breast cancer but the health effects after low-dose (LD, differences in their sensitivity to radiation-induced mammary cancer (BALB/c and C57BL/6) for the purpose of identifying mechanisms of mammary cancer susceptibility. Unirradiated mammary and blood tissues of these strains differed significantly in baseline expressions of DNA repair, tumor suppressor, and stress response genes. LD exposures of 7.5 cGy (weekly for 4 weeks) did not induce detectable genomic instability in either strain. However, the mammary glands of the sensitive strain but not the resistant strain showed early transcriptional responses involving: (a) diminished immune response, (b) increased cellular stress, (c) altered TGFβ-signaling, and (d) inappropriate expression of developmental genes. One month after LD exposure, the two strains showed opposing responses in transcriptional signatures linked to proliferation, senescence, and microenvironment functions. We also discovered a pre-exposure expression signature in both blood and mammary tissues that is predictive for poor survival among human cancer patients (p = 0.0001), and a post-LD-exposure signature also predictive for poor patient survival (pidentify genetic features that predispose or protect individuals from LD-induced breast cancer.
Directory of Open Access Journals (Sweden)
Kaisa Jaakkola
2015-01-01
Full Text Available Enteropathogenic Yersinia enterocolitica and Yersinia pseudotuberculosis are both etiological agents for intestinal infection known as yersiniosis, but their epidemiology and ecology bear many differences. Swine are the only known reservoir for Y. enterocolitica 4/O:3 strains, which are the most common cause of human disease, while Y. pseudotuberculosis has been isolated from a variety of sources, including vegetables and wild animals. Infections caused by Y. enterocolitica mainly originate from swine, but fresh produce has been the source for widespread Y. pseudotuberculosis outbreaks within recent decades. A comparative genomic hybridization analysis with a DNA microarray based on three Yersinia enterocolitica and four Yersinia pseudotuberculosis genomes was conducted to shed light on the genomic differences between enteropathogenic Yersinia. The hybridization results identified Y. pseudotuberculosis strains to carry operons linked with the uptake and utilization of substances not found in living animal tissues but present in soil, plants, and rotting flesh. Y. pseudotuberculosis also harbors a selection of type VI secretion systems targeting other bacteria and eukaryotic cells. These genetic traits are not found in Y. enterocolitica, and it appears that while Y. pseudotuberculosis has many tools beneficial for survival in varied environments, the Y. enterocolitica genome is more streamlined and adapted to their preferred animal reservoir.
History And Importance Of Graphic Design
Lyallya, Kirill
2016-01-01
This thesis is about history and importance of graphic design in different periods, from ancient times until today. The features inherent in different countries are considered. The techniques, basic methods for creating projects and computer software that designers have used are mentioned. In order to understand the importance of graphic design in our lives, it is considered from the side of ordinary people, how it manifests itself in daily lives and how it affects business. The thesis provid...
Yang, Yajie; Boss, Isaac W; McIntyre, Lauren M; Renne, Rolf
2014-08-08
Kaposi's sarcoma associated herpes virus (KSHV) is associated with tumors of endothelial and lymphoid origin. During latent infection, KSHV expresses miR-K12-11, an ortholog of the human tumor gene hsa-miR-155. Both gene products are microRNAs (miRNAs), which are important post-transcriptional regulators that contribute to tissue specific gene expression. Advances in target identification technologies and molecular interaction databases have allowed a systems biology approach to unravel the gene regulatory networks (GRNs) triggered by miR-K12-11 in endothelial and lymphoid cells. Understanding the tissue specific function of miR-K12-11 will help to elucidate underlying mechanisms of KSHV pathogenesis. Ectopic expression of miR-K12-11 differentially affected gene expression in BJAB cells of lymphoid origin and TIVE cells of endothelial origin. Direct miRNA targeting accounted for a small fraction of the observed transcriptome changes: only 29 genes were identified as putative direct targets of miR-K12-11 in both cell types. However, a number of commonly affected biological pathways, such as carbohydrate metabolism and interferon response related signaling, were revealed by gene ontology analysis. Integration of transcriptome profiling, bioinformatic algorithms, and databases of protein-protein interactome from the ENCODE project identified different nodes of GRNs utilized by miR-K12-11 in a tissue-specific fashion. These effector genes, including cancer associated transcription factors and signaling proteins, amplified the regulatory potential of a single miRNA, from a small set of putative direct targets to a larger set of genes. This is the first comparative analysis of miRNA-K12-11's effects in endothelial and B cells, from tissues infected with KSHV in vivo. MiR-K12-11 was able to broadly modulate gene expression in both cell types. Using a systems biology approach, we inferred that miR-K12-11 establishes its GRN by both repressing master TFs and influencing
Fungi identify the geographic origin of dust samples.
Directory of Open Access Journals (Sweden)
Neal S Grantham
Full Text Available There is a long history of archaeologists and forensic scientists using pollen found in a dust sample to identify its geographic origin or history. Such palynological approaches have important limitations as they require time-consuming identification of pollen grains, a priori knowledge of plant species distributions, and a sufficient diversity of pollen types to permit spatial or temporal identification. We demonstrate an alternative approach based on DNA sequencing analyses of the fungal diversity found in dust samples. Using nearly 1,000 dust samples collected from across the continental U.S., our analyses identify up to 40,000 fungal taxa from these samples, many of which exhibit a high degree of geographic endemism. We develop a statistical learning algorithm via discriminant analysis that exploits this geographic endemicity in the fungal diversity to correctly identify samples to within a few hundred kilometers of their geographic origin with high probability. In addition, our statistical approach provides a measure of certainty for each prediction, in contrast with current palynology methods that are almost always based on expert opinion and devoid of statistical inference. Fungal taxa found in dust samples can therefore be used to identify the origin of that dust and, more importantly, we can quantify our degree of certainty that a sample originated in a particular place. This work opens up a new approach to forensic biology that could be used by scientists to identify the origin of dust or soil samples found on objects, clothing, or archaeological artifacts.
Identifying predictors of work engagement: An example from a management consultancy company
Persson, Andreas
2010-01-01
Empirical evidence suggests work engagement to be of crucial importance for business critical aspects such as work performance and employee retention. When building a strategy for enhancing engagement in the workplace, identifying its predictors becomes important. Therefore, the aim of this study was to identify predictors related to work engagement. The study was conducted in a management consultancy company, through analyzing their employee survey. Results indicated satisfaction with leader...
A case study of identify importance of land use planning in road safety, Benidorm
Energy Technology Data Exchange (ETDEWEB)
Casares Blanco, J.; Sanchez Galiano, J.C.; Fernandez Aracil, P.; Ortuño Padilla, A.
2016-07-01
This research analyses how urban form, land use and urban density, may influence the incidence of traffic-related crashes injuries and deaths. It begins with a theoretical overview of studies which deal with the study of the relationship between urban patterns and road safety. Next, it details the development of a database of crash incidence and urban form at the district level for the city of Benidorm (Alicante, Spain) in 2010. Subsequently, it is developed a negative binomial approach for intra-city motor vehicle crash analysis. One-year crash data for Benidorm (the fourth largest tourism destination of Spain, after Barcelona, Madrid and San Bartolomé de Tirajana, and exclusively tourist-oriented city) are analyzed using a geographic information system (GIS) to generate relevant inputs for the analysis. In general, the study finds that a strong land use mix results on fewer road accidents, whereas accidents are more common but less severe in areas of high urban density. Finally, pedestrian accidents research showed that rural and low density environment is related to an important road accident numbers unlike tourism-oriented zones, much more safe for them. Based on these findings, the paper discusses the implications for urban design practice. (Author)
The Importance of Business Model Factors for Cloud Computing Adoption: Role of Previous Experiences
Directory of Open Access Journals (Sweden)
Bogataj Habjan Kristina
2017-08-01
Full Text Available Background and Purpose: Bringing several opportunities for more effective and efficient IT governance and service exploitation, cloud computing is expected to impact the European and global economies significantly. Market data show that despite many advantages and promised benefits the adoption of cloud computing is not as fast and widespread as foreseen. This situation shows the need for further exploration of the potentials of cloud computing and its implementation on the market. The purpose of this research was to identify individual business model factors with the highest impact on cloud computing adoption. In addition, the aim was to identify the differences in opinion regarding the importance of business model factors on cloud computing adoption according to companies’ previous experiences with cloud computing services.
The cross-cultural importance of satisfying vital needs.
Alvarez, Allen Andrew A
2009-11-01
Ethical beliefs may vary across cultures but there are things that must be valued as preconditions to any cultural practice. Physical and mental abilities vital to believing, valuing and practising a culture are such preconditions and it is always important to protect them. If one is to practise a distinct culture, she must at least have these basic abilities. Access to basic healthcare is one way to ensure that vital abilities are protected. John Rawls argued that access to all-purpose primary goods must be ensured. Amartya Sen and Martha Nussbaum claim that universal capabilities are what resources are meant to enable. Len Doyal and Ian Gough identify physical health and autonomy as basic needs of every person in every culture. When we disagree on what to prioritize, when resources to satisfy competing demands are scarce, our common needs can provide a point of normative convergence. Need-based rationing, however, has been criticized for being too indeterminate to give guidance for deciding which healthcare services to prioritize and for tending to create a bottomless-pit problem. But there is a difference between needing something (first-order need) and needing to have the ability to need (second-order need). Even if we disagree about which first-order need to prioritize, we must accept the importance of satisfying our second-order need to have the ability to value things. We all have a second-order need for basic healthcare as a means to protect our vital abilities even if we differ in what our cultures consider to be particular first-order needs.
Sex differences in heritability of BMI
DEFF Research Database (Denmark)
Schousboe, Karoline; Willemsen, Gonneke; Kyvik, Kirsten O
2003-01-01
pairs (including opposite sex pairs) aged 20-29 and 30-39 from eight different twin registries participating in the GenomEUtwin project. Quantitative genetic analyses were conducted and sex differences were explored. Variation in BMI was greater for women than for men, and in both sexes was primarily...... explained by additive genetic variance in all countries. Sex differences in the variance components were consistently significant. Results from analyses of opposite sex pairs also showed evidence of sex-specific genetic effects suggesting there may be some differences between men and women in the genetic...... factors that influence variation in BMI. These results encourage the continued search for genes of importance to the body composition and the development of obesity. Furthermore, they suggest that strategies to identify predisposing genes may benefit from taking into account potential sex specific effects....
Identifying the Gifted Child Humorist.
Fern, Tami L.
1991-01-01
This study attempted to identify gifted child humorists among 1,204 children in grades 3-6. Final identification of 13 gifted child humorists was determined through application of such criteria as funniness, originality, and exemplary performance or product. The influence of intelligence, development, social factors, sex differences, family…
Study of provenance properties on ancient celadon of different kilns with NAA
International Nuclear Information System (INIS)
Feng Songlin; Fan Dongyu; Feng Xiangqian; Xu Qing; Cheng Lin; Lei Yong; Shen Yueming; Zhang Wenjiang; Zhua Zhenxi
2005-01-01
Provenance characteristic is an important scientific parameter to identify ancient porcelain wares unearthed from sites and graves. The porcelain samples of Si-Long-Kou Yue kiln of Zhejiang Province, Hong-Zhou kiln of Jiangxi Province and Yao-Zhou kiln of Shanxi Province have been analyzed with neutron activation analysis (NAA). The experimental data were studied with statistic methods. The results show that the chemical compositions of porcelain body samples for three kilns were different. The difference was able to be identified. The body materials of both Si-Long-Kou Yue kiln and Hong-Zhou kiln of Jiangxi were similar. The samples of Yao-Zhou kiln in north of China existed obvious difference. (authors)
Importance of the producer on retail broiler meat product contamination with Campylobacter spp
DEFF Research Database (Denmark)
Kudirkiene, Egle; Buneviciene, Jurgita; Serniene, Loreta
2013-01-01
Background Campylobacter spp. are a leading cause of human bacterial gastroenteritis worldwide, with poultry meat being considered the most important source of the infection. To obtain data on broiler meat contamination with Campylobacter spp. in Lithuania, the occurrence, counts and genotypes...... of these pathogens on raw broiler meat products from different producers were examined. Results Out of 312 broiler meat product samples examined, 46.8% were contaminated with Campylobacter spp. Campylobacter jejuni was identified in 51.4% and Campylobacter coli in 37.7% of positive samples. Campylobacter jejuni...
Directory of Open Access Journals (Sweden)
Aleeshah Nujjoo
2012-11-01
Research purpose: The study sought to establish the relationship between intrinsic and different extrinsic rewards with intrinsic motivation and affective commitment. Motivation for the study: South African organisations are grappling with employee retention. Literature shows that employees who are more motivated and committed to their organisation are less likely to quit. Rewards management strategies serve to create a motivated and committed workforce. Using the correct types of rewards can thus provide a competitive advantage. Research design, approach and method: A cross-sectional, correlational study was conducted. Questionnaire data of 399 South African employees were analysed using bivariate correlations and multiple regression. Main findings: Three main findings emerged. Firstly, there is a relationship between all types of rewards investigated and the two outcome variables. Secondly, this relationship is stronger for intrinsic than for extrinsic rewards and thirdly, monetary rewards do not account for the variance in intrinsic motivation above that of non-monetary rewards. Practical/managerial implications: Rewards management strategies should focus on job characteristics and designs to increase staff intrinsic rewards and include non-monetary rewards, such as supportive leadership, to encourage employees’ intrinsic motivation and affective commitment. Contribution/value-add: This research demonstrated the important role different rewards, particularly intrinsic non-monetary rewards, play in creating a committed and motivated workforce. The insights gained from this study can promote organisational effectiveness. Suggestions of how to expand on and refine the current study are addressed.
Kil, Namyun; Holland, Stephen M.; Stein, Taylor V.
2012-09-01
Off-highway vehicle (OHV) riding is among the fastest growing recreational activities in the United States. However, little research exists about the central components of outcomes-focused management (OFM) as it relates to motorized recreation. Utilizing a two-activity dichotomy, OHV and non-OHV centric user groups were compared on several key concepts associated with OFM, including desired experiences, perceived and desired recreation opportunity spectrum-type settings, and intentional behaviors (i.e., place-protective behavior, spending-time intentions) toward potential changes in settings. Results indicated that the two groups were different in terms of intensity and relative rankings of their perceived experiences and settings. Although both groups preferred social bonding, stress relief, nostalgia and learning experiences, the OHV user group ranked using equipment and achieving physical fitness experiences as more important than the non-OHV group. The non-OHV user group preferred enjoying nature and solitude/tranquility experiences more strongly than the OHV user group. Further analysis found that both groups perceived settings that they recreated in to be pristine and preferred such conditions, and both groups preferred moderate levels of rules and regulations. Finally, the OHV user group was more reactive to rules and regulations, while the non-OHV user group expressed stronger intentions to protect the environmental quality of recreation areas. The results suggest that planners and managers who understand OHV user's perceptions and behaviors could provide enhanced recreation opportunities potentially providing additional beneficial outcomes for motorized and non-motorized groups in spatially different zones. Additional implications for planners and managers and future studies are discussed.
Energy Technology Data Exchange (ETDEWEB)
Childs, Kevin [Michigan State Univ., East Lansing, MI (United States); Buell, Robin [Michigan State Univ., East Lansing, MI (United States); Zhao, Bingyu [Virginia Polytechnic Inst. and State Univ. (Virginia Tech), Blacksburg, VA (United States); Zhang, Xunzhong [Virginia Polytechnic Inst. and State Univ. (Virginia Tech), Blacksburg, VA (United States)
2016-11-10
Switchgrass (Panicum virgatum) is a warm-season C4 grass that is a target lignocellulosic biofuel species for use in the United States due to its local adaption capabilities and high biomass accumulation. Two ecotypes of switchgrass have been described. Members of the lowland ecotype are taller, have narrower leaf blades and generate more biomass compared to individuals from the upland ecotype. Additionally, lowland plants are generally found in the southern United States while upland switchgrass is more typically present in the northern United States. These differences are important as it is envisioned that switchgrass for biofuel production will typically be grown on marginal lands in the northern United States to supplement and diversify farmers' traditional crop incomes. While lowland switchgrass is more productive, it has poor winter survivability in northern latitudes where upland switchgrass is expected to be grown for biofuel use. Abiotic stresses likely to be encountered by switchgrass include drought and salinity. Despite initially being described as preferring wetter environments, members of the lowland ecotype have been characterized as being more drought tolerant than plants of the upland ecotype. Nonetheless, direct trials have indicated that variation for drought tolerance exists in both ecotypes, but prior to this project, only a relatively small number of switchgrass lines had been tested for drought responses. Similarly, switchgrass cultivars have not been widely tested for salt tolerance, but a few studies have shown that even mild salt stress can inhibit growth. The effects of drought and salt stress on plant growth are complex. Both drought and salinity affect the osmotic potential of plant cells and negatively affect plant growth due to reduced water potential and reduced photosynthesis that results from lower stomatal conductance of CO2. Plants respond to drought and salt stress by activating genes that directly attempt to
Economic importance and GIS mapping of medicinal plants in Iran ...
African Journals Online (AJOL)
This study identified the economic importance of medicinal plants and evaluated with Geographical Information System (GIS) tool to develop spatial maps covering medicinal plants prevalent in Darkesh area, Northern Khorasan, Iran. Then provide the coordinates of the identified area as your results. 10 medicinal plants ...
Directory of Open Access Journals (Sweden)
Jane R. Lloyd
2012-01-01
Full Text Available Identifying individual animals is important in understanding their ecology and behaviour, as well as providing estimates of population sizes for conservation efforts. We produce identification keys from photographs of green sea turtles to identify them while foraging in Akumal Bay, Mexico. We create three keys, which (a minimise the length of the key, (b present the most obvious differential characteristics first, and (c remove the strict dichotomy from key b. Keys were capable of identifying >99% of turtles in >2500 photographs during the six-month study period. The keys differed significantly in success rate for students to identify individual turtles, with key (c being the best with >70% success and correctly being followed further than other keys before making a mistake. User-friendly keys are, therefore, a suitable method for the photographic identification of turtles and could be used for other large marine vertebrates in conservation or behavioural studies.
Linsky, Amy; Simon, Steven R
2012-11-02
Despite benefits of adherence, little is known about the degree to which patients will express their perceptions of medications as more or less important to take as prescribed. We determined the frequency with which Veteran patients would explicitly identify one of their medications as "most important" or "least important." We conducted a retrospective cohort study of patients from ambulatory clinics at VA Boston from April 2010-July 2011. Patients answered two questions: "Which one of your medicines, if any, do you think is the most important? (if none, please write 'none')" and "Which one of your medicines, if any, do you think is the least important? (if none, please write 'none')." We determined the prevalence of response categories for each question. Our cohort of 104 patients was predominantly male (95%), with a mean of 9 medications (SD 5.7). Regarding their most important medication, 41 patients (39%) identified one specific medication; 26 (25%) selected more than one; 21 (20%) wrote "none"; and 16 (15%) did not answer the question. For their least important medication, 31 Veterans (30%) chose one specific medication; two (2%) chose more than one; 51 (49%) wrote "none"; and 20 (19%) did not directly answer the question. Thirty-five percent of patients did not identify a most important medication, and 68% did not identify a least important medication. Better understanding of how patients prioritize medications and how best to elicit this information will improve patient-provider communication, which may in turn lead to better adherence.
Directory of Open Access Journals (Sweden)
R. D. Saylor
2012-02-01
Full Text Available An investigation was conducted to identify the mechanistic differences between two versions of the carbon bond gas-phase chemical mechanism (CB05 and CBMIV which consistently lead to larger ground-level ozone concentrations being produced in the CB05 version of the National Air Quality Forecasting Capability (NAQFC modeling system even though the two parallel forecast systems utilize the same meteorology and base emissions and similar initial and boundary conditions. Box models of each of the mechanisms as they are implemented in the NAQFC were created and a set of 12 sensitivity simulations was designed. The sensitivity simulations independently probed the conceptual mechanistic differences between CB05 and CBMIV and were exercised over a 45-scenario simulation suite designed to emulate the wide range of chemical regimes encountered in a continental-scale atmospheric chemistry model. Results of the sensitivity simulations indicate that two sets of reactions that were included in the CB05 mechanism, but which were absent from the CBMIV mechanism, are the primary causes of the greater ozone production in the CB05 version of the NAQFC. One set of reactions recycles the higher organic peroxide species of CB05 (ROOH, resulting in additional photochemically reactive products that act to produce additional ozone in some chemical regimes. The other set of reactions recycles reactive nitrogen from less reactive forms back to NO2, increasing the effective NOx concentration of the system. In particular, the organic nitrate species (NTR, which was a terminal product for reactive nitrogen in the CBMIV mechanism, acts as a reservoir species in CB05 to redistribute NOx from major source areas to potentially NOx-sensitive areas where additional ozone may be produced in areas remote from direct NOx sources.
Integration of multiple networks and pathways identifies cancer driver genes in pan-cancer analysis.
Cava, Claudia; Bertoli, Gloria; Colaprico, Antonio; Olsen, Catharina; Bontempi, Gianluca; Castiglioni, Isabella
2018-01-06
Modern high-throughput genomic technologies represent a comprehensive hallmark of molecular changes in pan-cancer studies. Although different cancer gene signatures have been revealed, the mechanism of tumourigenesis has yet to be completely understood. Pathways and networks are important tools to explain the role of genes in functional genomic studies. However, few methods consider the functional non-equal roles of genes in pathways and the complex gene-gene interactions in a network. We present a novel method in pan-cancer analysis that identifies de-regulated genes with a functional role by integrating pathway and network data. A pan-cancer analysis of 7158 tumour/normal samples from 16 cancer types identified 895 genes with a central role in pathways and de-regulated in cancer. Comparing our approach with 15 current tools that identify cancer driver genes, we found that 35.6% of the 895 genes identified by our method have been found as cancer driver genes with at least 2/15 tools. Finally, we applied a machine learning algorithm on 16 independent GEO cancer datasets to validate the diagnostic role of cancer driver genes for each cancer. We obtained a list of the top-ten cancer driver genes for each cancer considered in this study. Our analysis 1) confirmed that there are several known cancer driver genes in common among different types of cancer, 2) highlighted that cancer driver genes are able to regulate crucial pathways.
Koita, Kadiatou; Novotny, Joseph; Kunene, Simon; Zulu, Zulizile; Ntshalintshali, Nyasatu; Gandhi, Monica; Gosling, Roland
2013-06-27
Swaziland has made great progress towards its goal of malaria elimination by 2015. However, malaria importation from neighbouring high-endemic Mozambique through Swaziland's eastern border remains a major factor that could prevent elimination from being achieved. In order to reach elimination, Swaziland must rapidly identify and treat imported malaria cases before onward transmission occurs. A nationwide formative assessment was conducted over eight weeks to determine if the imported cases of malaria identified by the Swaziland National Malaria Control Programme could be linked to broader social networks and to explore methods to access these networks. Using a structured format, interviews were carried out with malaria surveillance agents (6), health providers (10), previously identified imported malaria cases (19) and people belonging to the networks identified through these interviews (25). Most imported malaria cases were Mozambicans (63%, 12/19) making a living in Swaziland and sustaining their families in Mozambique. The majority of imported cases (73%, 14/19) were labourers and self-employed contractors who travelled frequently to Mozambique to visit their families and conduct business. Social networks of imported cases with similar travel patterns were identified through these interviews. Nearly all imported cases (89%, 17/19) were willing to share contact information to enable network members to be interviewed. Interviews of network members and key informants revealed common congregation points, such as the urban market places in Manzini and Malkerns, as well as certain bus stations, where people with similar travel patterns and malaria risk behaviours could be located and tested for malaria. This study demonstrated that imported cases of malaria belonged to networks of people with similar travel patterns. This study may provide novel methods for screening high-risk groups of travellers using both snowball sampling and time-location sampling of networks to
Spectral Data Captures Important Variability Between and Among Species and Functional Types
Townsend, P. A.; Serbin, S. P.; Kingdon, C.; Singh, A.; Couture, J. J.; Gamon, J. A.
2013-12-01
different genotypes of aspen. A clonal species, aspen is widely recognized for its high genotypic and phenotypic variability, and this variability expresses itself in differences in both functional and spectral traits. We demonstrate that spectral characteristics can be used to identify different genets of aspen and that this spectral variability among genets is also related to differences in traits important to ecosystem processes. Third, we illustrate variability in spectral properties of soybean related to the presence of aphids, and how those spectral properties translate to differences in yield. Finally, we show how short-term variability in milkweed spectra (within hours) is related to changes in cardenolide concentrations associated with induced defensive responses. These results demonstrate the capacity of spectroscopy to not just characterize important plant traits, but also to measure how plants vary naturally and respond dynamically to environmental changes.
Messina: a novel analysis tool to identify biologically relevant molecules in disease.
Directory of Open Access Journals (Sweden)
Mark Pinese
Full Text Available BACKGROUND: Morphologically similar cancers display heterogeneous patterns of molecular aberrations and follow substantially different clinical courses. This diversity has become the basis for the definition of molecular phenotypes, with significant implications for therapy. Microarray or proteomic expression profiling is conventionally employed to identify disease-associated genes, however, traditional approaches for the analysis of profiling experiments may miss molecular aberrations which define biologically relevant subtypes. METHODOLOGY/PRINCIPAL FINDINGS: Here we present Messina, a method that can identify those genes that only sometimes show aberrant expression in cancer. We demonstrate with simulated data that Messina is highly sensitive and specific when used to identify genes which are aberrantly expressed in only a proportion of cancers, and compare Messina to contemporary analysis techniques. We illustrate Messina by using it to detect the aberrant expression of a gene that may play an important role in pancreatic cancer. CONCLUSIONS/SIGNIFICANCE: Messina allows the detection of genes with profiles typical of markers of molecular subtype, and complements existing methods to assist the identification of such markers. Messina is applicable to any global expression profiling data, and to allow its easy application has been packaged into a freely-available stand-alone software package.
Identifying variables that influence manufacturing product quality
Directory of Open Access Journals (Sweden)
Marek Krynke
2014-10-01
Full Text Available In the article a risk analysis of the production process of selected products in a plant producing votive candles was conducted. The Pareto-Lorenz diagram and FMEA method were used which indicated the most important areas affecting the production of selected elements of candles. The synthesis of intangible factors affecting production in the audited company was also carried out with particular emphasis on the operation of the production system. The factors determining the validity of studies was examined, describing the principle of BOST 14 Toyota management. The most important areas of the company were identified, positively affecting the production process.
Coastal upwelling ecosystems are often identified as regions ...
African Journals Online (AJOL)
spamer
... are often identified as regions susceptible to seasonal blooms of harmful ... that the bay acts as a net importer of bottom water and net exporter of surface waters over a synoptic cycle. This ... waves or wind stress on the surface friction layer.
Levy, David M; Kuhns, Benjamin D; Chahal, Jaskarndip; Philippon, Marc J; Kelly, Bryan T; Nho, Shane J
2016-09-01
To determine whether the hip arthroscopy literature to date has shown outcomes consistent with published patient acceptable symptomatic state (PASS) and minimal clinically important difference (MCID) estimates. All clinical investigations of hip arthroscopy using modified Harris Hip Score (mHHS) and/or Hip Outcome Score (HOS) outcomes with at least 1 year of follow-up were reviewed. Ninety-one studies (9,746 hips) were included for review. Eighty-one studies (9,317 hips) contained only primary hip arthroscopies and were the primary focus of this review. The remaining studies (429 hips) did not exclude patients with prior surgical history and were thus considered separately. Mean mHHS, HOS-ADL (Activities of Daily Living) and HOS-SS (Sports-Specific) scores were compared with previously published PASS and MCID values. After 31 ± 20 months, 5.8% of study populations required revision arthroscopy and 5.5% total hip arthroplasty. A total of 88%, 25%, and 30% of study populations met PASS for mHHS, HOS-ADL, and HOS-SS, respectively, and 97%, 90%, and 93% met MCID. On bivariate analysis, increasing age was associated with significantly worse postoperative mHHS (P arthroscopy, we have found that more than 90% of study populations meet MCID standards for the most commonly used patient-reported outcomes measures in hip arthroscopy literature, mHHS and HOS. Eighty-eight percent meet PASS standards for the mHHS, but PASS standards are far more difficult to achieve for HOS-ADL (25%) and HOS-SS (30%) subscales. Differences in psychometric properties of the mHHS and HOS likely account for the discrepancies in PASS. Level IV, systematic review of Level I to IV studies. Copyright © 2016 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.
Unravelling important odorants in horseradish (Armoracia rusticana).
Kroener, Eva-Maria; Buettner, Andrea
2017-10-01
Horseradish (Armoracia rusticana) is a plant well known for its roots' spicy aroma. The present study investigates the main aroma constituents of horseradish roots in general by analysing the aroma profiles of six different horseradish varieties, with one variety grown in two different soils. Odorants were characterised by means of gas chromatography-olfactometry and identified via their mass spectra, retention indices on two columns with different polarity, and their characteristic odour. A series of new aroma compounds from different substance groups were identified that have hitherto not been described in horseradish. Moreover, several of these constituents were successfully shown to exhibit high odour potency, alongside a high potential to influence the overall aroma of horseradish roots, like (3S,3aS,7aR)-wine lactone and 3-isopropyl-2-methoxypyrazine. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Nina Katharina Stock
Full Text Available This study presents the results of a multidisciplinary, nosocomial MRSA outbreak investigation in an 8-bed medical intensive care unit (ICU. The identification of seven MRSA positive patients in the beginning of 2014 led to the closure of the ward for several weeks. A multidisciplinary, retrospective investigation was initiated in order to identify the reason and the source for the outbreak, describe MRSA transmission in the department and identify limitations in infection control.The investigation comprised an epidemiological description of MRSA cases from 2012 to 2014 and a characterization of MRSA isolates, including phage-, spa- and PFGE-typing. Additionally, MRSA screening was performed from the hospital staff and the environment. To identify the reason for the outbreak, work-related, psychological and behavioral factors were investigated by impartial audits and staff interviews.Thirty-one MRSA cases were registered during the study period, and 36 isolates were investigated. Molecular typing determined the outbreak strain (phage type 54/812, PFGE type A4, spa type t003 and identified the probable index case. Nasal carriage in one employee and a high environmental contamination with the outbreak strain was documented. Important gaps in nursing procedures and general management were identified. Elevated stress levels and communication problems preceded the outbreak. Compliance with hand hygiene and isolation procedures was evaluated as appropriate.This study demonstrates the complexity of controlling hospital-associated infections. The combined use of different typing methods is beneficial for outbreak investigations. Psychological, behavioral and other work-related factors have an important impact on the spread of nosocomial pathogens. These factors should be addressed and integrated in routine infection control practice.
Symptom outcomes important to women with anal incontinence: a conceptual framework.
Sung, Vivian W; Rogers, Rebecca G; Bann, Carla M; Arya, Lily; Barber, Matthew D; Lowder, Jerry; Lukacz, Emily S; Markland, Alayne; Siddiqui, Nazema; Wilmot, Amanda; Meikle, Susan F
2014-05-01
To develop a framework that describes the most important symptom outcomes for anal incontinence treatment from the patient perspective. A conceptual framework was developed by the Pelvic Floor Disorders Network based on four semistructured focus groups and confirmed in two sets of 10 cognitive interviews including women with anal incontinence. We explored: 1) patient-preferred terminology for describing anal incontinence symptoms; 2) patient definitions of treatment "success"; 3) importance of symptoms and outcomes in the framework; and 4) conceptual gaps (defined as outcomes not previously identified as important). Sessions were conducted according to grounded theory transcribed, coded, and qualitatively and quantitatively analyzed to identify relevant themes. Content and face validity of the framework were further assessed using cognitive interviews. Thirty-four women participated in focus groups and 20 in cognitive interviews. Overall, 29 (54%) were aged 60 years or older, 42 (78%) were white, and 10 (19%) had a high school degree or less. Two overarching outcome themes were identified: "primary bowel leakage symptoms" and "ancillary bowel symptoms." Subdomains important in primary bowel leakage symptoms included leakage characteristics (symptom frequency, amount of leakage, symptom bother) and conditions when bowel leakage occurs (predictability, awareness, urgency). Subdomains important under ancillary bowel symptoms included emptying disorders (constipation, obstructed defecation, and wiping issues) and discomfort (pain, burning). New outcomes identified included predictability, awareness, wiping issues, and discomfort. Women with anal incontinence desire a wide range of symptom outcomes after treatment. These are captured in our conceptual framework, which can aid clinicians and researchers in assessing anal incontinence. LEVEL OF EVIEDENCE: II.
Directory of Open Access Journals (Sweden)
Megan C. McNamara, M.D., MSc
2008-01-01
Full Text Available AbstractBackground Mentoring is important throughout a physician’s career and has been noted to be particularly important during residency training. Other studies suggest that women may experience difficulty in finding mentors.Purpose This study explored gender-specific differences in residents’ mentoring experiences.Methods The authors conducted two focus groups at the University of Pittsburgh in July, 2004. One group was composed of 12 female residents; the other was composed of nine male residents. Discussions were audiotaped and transcribed. Two investigators coded the transcripts and identified emerging themes.Results Residents of both genders cited multiple barriers to mentoring. Men´s strategies for findingmentors were more numerous than women´s and included identifying mentors through research,similar interests, friendship, and networking. Female strategies were limited and included identifying mentors through “word of mouth” and work experiences. Women described more passiveapproaches for finding a mentor than men.Conclusions Female residents may lack strategies and initiatives for finding mentors. Residency programs should create opportunities for residents to develop mentoring relationships, with special attention paid to gender differences
Sinha, Shashank S.; Sukul, Devraj; Lazarus, John J.; Polavarapu, Vivek; Chan, Paul S.; Neumar, Robert W.; Nallamothu, Brahmajee K.
2016-01-01
Background Cardiac arrests are a major public health concern worldwide. The extent and types of randomized controlled trials (RCTs) – our most reliable source of clinical evidence – conducted in these high-risk patients over recent years are largely unknown. Methods and Results We performed a systematic review, identifying all RCTs published in PubMed, EMBASE, Scopus, Web of Science, and the Cochrane Library from 1995 to 2014 that focused on acute treatment of non-traumatic cardiac arrest in adults. We then extracted data on the setting of study populations, types and timing of interventions studied, risk of bias, outcomes reported and how these factors have changed over time. Over this twenty-year period, 92 RCTs were published containing 64,309 patients (median, 225.5 per trial). Of these, 81 RCTs (88.0%) involved out-of-hospital cardiac arrest whereas 4 (4.3%) involved in-hospital cardiac arrest and 7 (7.6%) included both. Eighteen RCTs (19.6%) were performed in the U.S., 68 (73.9%) were performed outside the U.S., and 6 (6.5%) were performed in both settings. Thirty-eight RCTs (41.3%) evaluated drug therapy, 39 (42.4%) evaluated device therapy, and 15 (16.3%) evaluated protocol improvements. Seventy-four RCTs (80.4%) examined interventions during the cardiac arrest, 15 (16.3%) examined post-cardiac arrest treatment, and 3 (3.3%) studied both. Overall, reporting of risk of bias was limited. The most common outcome reported was ROSC: 86 (93.5%) with only 22 (23.9%) reporting survival beyond 6 months. Fifty-three RCTs (57.6%) reported global ordinal outcomes whereas 15 (16.3%) reported quality-of-life. RCTs in the last 5 years were more likely to be focused on protocol improvement and post-cardiac arrest care. Conclusions Important gaps in RCTs of cardiac arrest treatments exist, especially those examining in-hospital cardiac arrest, protocol improvement, post-cardiac arrest care, and long-term or quality-of-life outcomes. PMID:27756794
DEFF Research Database (Denmark)
Jäkel, Ina Charlotte
2014-01-01
predictions regarding the export market and the role of product differentiation. Empirical results for a sample of Danish manufacturing industries confirm the import- "push" hypothesis as well as the export- "pull" hypothesis, but also reveal differences across industries. The selection effect of trade...... is mainly driven by the "import-push" if product differentiation is high, whereas it is driven by the "export-pull" if goods are homogeneous....
DEFF Research Database (Denmark)
Jäkel, Ina Charlotte
predictions regarding the export market and the role of product differentiation. Empirical results for a sample of Danish manufacturing industries confirm the import-"push" hypothesis as well as the export-"pull" hypothesis, but also reveal differences across industries. The selection effect of trade...... is mainly driven by the "import-push" if product differentiation is high, whereas it is driven by the "export-pull" if goods are homogeneous....
Watzlawik, Meike; Brescó de Luna, Ignacio
2017-06-01
How migration influences the processes of identity development has been under longstanding scrutiny in the social sciences. Usually, stage models have been suggested, and different strategies for acculturation (e.g., integration, assimilation, separation, and marginalization) have been considered as ways to make sense of the psychological transformations of migrants as a group. On an individual level, however, identity development is a more complex endeavor: Identity does not just develop by itself, but is constructed as an ongoing process. To capture these processes, we will look at different aspects of migration and asylum seeking; for example, the cultural-specific values and expectations of the hosting (European) countries (e.g., as identifier), but also of the arriving individuals/groups (e.g., identified as refugees). Since the two may contradict each other, negotiations between identities claims and identity assignments become necessary. Ways to solve these contradictions are discussed, with a special focus on the experienced (and often missing) agency in different settings upon arrival in a new country. In addition, it will be shown how sudden events (e.g., 9/11, the Charlie Hebdo attack) may challenge identity processes in different ways.
Performance testing to identify climate-ready trees
E.Gregory McPherson; Alison M. Berry; Natalie S. van Doorn
2018-01-01
Urban forests produce ecosystem services that can benefit city dwellers, but are especially vulnerable to climate change stressors such as heat, drought, extreme winds and pests. Tree selection is an important decision point for managers wanting to transition to a more stable and resilient urban forest structure. This study describes a five-step process to identify and...
Towards Identify Selective Antibacterial Peptides Based on Abstracts Meaning
Directory of Open Access Journals (Sweden)
Liliana I. Barbosa-Santillán
2016-01-01
Full Text Available We present an Identify Selective Antibacterial Peptides (ISAP approach based on abstracts meaning. Laboratories and researchers have significantly increased the report of their discoveries related to antibacterial peptides in primary publications. It is important to find antibacterial peptides that have been reported in primary publications because they can produce antibiotics of different generations that attack and destroy the bacteria. Unfortunately, researchers used heterogeneous forms of natural language to describe their discoveries (sometimes without the sequence of the peptides. Thus, we propose that learning the words meaning instead of the antibacterial peptides sequence is possible to identify and predict antibacterial peptides reported in the PubMed engine. The ISAP approach consists of two stages: training and discovering. ISAP founds that the 35% of the abstracts sample had antibacterial peptides and we tested in the updated Antimicrobial Peptide Database 2 (APD2. ISAP predicted that 45% of the abstracts had antibacterial peptides. That is, ISAP found that 810 antibacterial peptides were not classified like that, so they are not reported in APD2. As a result, this new search tool would complement the APD2 with a set of peptides that are candidates to be antibacterial. Finally, 20% of the abstracts were not semantic related to APD2.
A Fuzzy Computing Model for Identifying Polarity of Chinese Sentiment Words.
Wang, Bingkun; Huang, Yongfeng; Wu, Xian; Li, Xing
2015-01-01
With the spurt of online user-generated contents on web, sentiment analysis has become a very active research issue in data mining and natural language processing. As the most important indicator of sentiment, sentiment words which convey positive and negative polarity are quite instrumental for sentiment analysis. However, most of the existing methods for identifying polarity of sentiment words only consider the positive and negative polarity by the Cantor set, and no attention is paid to the fuzziness of the polarity intensity of sentiment words. In order to improve the performance, we propose a fuzzy computing model to identify the polarity of Chinese sentiment words in this paper. There are three major contributions in this paper. Firstly, we propose a method to compute polarity intensity of sentiment morphemes and sentiment words. Secondly, we construct a fuzzy sentiment classifier and propose two different methods to compute the parameter of the fuzzy classifier. Thirdly, we conduct extensive experiments on four sentiment words datasets and three review datasets, and the experimental results indicate that our model performs better than the state-of-the-art methods.
Cultural differences in cognition: Rosetta Phase I.
Klein, Helen Altman; Lin, Mei-Hua; Radford, Mark; Masuda, Takahiko; Choi, Incheol; Lien, Yunnwen; Yeh, Yeiyuh; Boff, Kenneth R
2009-10-01
Cultural differences in cognition are important during multinational commercial, military, and humanitarian operations. The Rosetta Project addresses definition and measurement of key cognitive dimensions. Six potential diagnostic measures related to Analytic-Holistic reasoning were assessed: the Exclusion Task, the Attribution Complexity Scale, the Syllogism Task, Categorization, the Framed Line Test, and the Facial Expression Task. 379 participants' ages ranged from 17 to 24 years (M = 19.8, SD = 1.4). 64.6% were women; Eastern Asian groups (Japan, Korea, and Taiwan) were assumed to have Holistic reasoning tendencies, and those from a Western group (USA) were assumed to have Analytic tendencies. Participants were recruited from subject pools in psychology using the procedures of each university. Results on the Exclusion and Categorization Tasks confirmed hypothesized differences in Analytic-Holistic reasoning. The Attribution Complex-ity Scale and the Facial Expression Task identified important differences among the four groups. Outcomes on the final two tasks were confounded by unrelated group differences, making comparisons difficult. Building on this exploratory study, Rosetta Phase II will include additional groups and cognitive tasks. Measures of complex cognition are also incorporated to link findings to the naturalistic contexts.
Identifying Key Drivers of Return Reversal with Dynamical Bayesian Factor Graph.
Directory of Open Access Journals (Sweden)
Shuai Zhao
Full Text Available In the stock market, return reversal occurs when investors sell overbought stocks and buy oversold stocks, reversing the stocks' price trends. In this paper, we develop a new method to identify key drivers of return reversal by incorporating a comprehensive set of factors derived from different economic theories into one unified dynamical Bayesian factor graph. We then use the model to depict factor relationships and their dynamics, from which we make some interesting discoveries about the mechanism behind return reversals. Through extensive experiments on the US stock market, we conclude that among the various factors, the liquidity factors consistently emerge as key drivers of return reversal, which is in support of the theory of liquidity effect. Specifically, we find that stocks with high turnover rates or high Amihud illiquidity measures have a greater probability of experiencing return reversals. Apart from the consistent drivers, we find other drivers of return reversal that generally change from year to year, and they serve as important characteristics for evaluating the trends of stock returns. Besides, we also identify some seldom discussed yet enlightening inter-factor relationships, one of which shows that stocks in Finance and Insurance industry are more likely to have high Amihud illiquidity measures in comparison with those in other industries. These conclusions are robust for return reversals under different thresholds.
An Automated Summarization Assessment Algorithm for Identifying Summarizing Strategies.
Directory of Open Access Journals (Sweden)
Asad Abdi
Full Text Available Summarization is a process to select important information from a source text. Summarizing strategies are the core cognitive processes in summarization activity. Since summarization can be important as a tool to improve comprehension, it has attracted interest of teachers for teaching summary writing through direct instruction. To do this, they need to review and assess the students' summaries and these tasks are very time-consuming. Thus, a computer-assisted assessment can be used to help teachers to conduct this task more effectively.This paper aims to propose an algorithm based on the combination of semantic relations between words and their syntactic composition to identify summarizing strategies employed by students in summary writing. An innovative aspect of our algorithm lies in its ability to identify summarizing strategies at the syntactic and semantic levels. The efficiency of the algorithm is measured in terms of Precision, Recall and F-measure. We then implemented the algorithm for the automated summarization assessment system that can be used to identify the summarizing strategies used by students in summary writing.
Gardner, David K
2008-01-01
Improvements in culture media formulations have led to an increase in the ability to maintain the mammalian embryo in culture throughout the preimplantation and pre-attachment period. Amino acids and specific macromolecules have been identified as being key medium components, whereas temporal dynamics have been recognised as important media characteristics. Furthermore, other laboratory factors that directly impact embryo development and viability have been identified. Such factors include the use of a reduced oxygen tension, an appropriate incubation system and an adequate prescreening of all contact supplies. With rigourous quality systems in place, it is possible to obtain in vivo rates of embryo development in vitro using new media formulations while maintaining high levels of embryo viability. The future of embryo culture will likely be based on novel culture chips capable of providing temporal dynamics while facilitating real-time analysis of embryo physiology.
Epidemiology of Imported Leishmaniasis in Italy: Implications for a European Endemic Country.
Directory of Open Access Journals (Sweden)
Trentina Di Muccio
Full Text Available In the past decade, the number of imported leishmaniasis cases has increased in countries of Western Europe. The trend is associated with increasing travels, ecotourism activity, military operations and immigration. While in endemic countries leishmaniasis is usually well diagnosed, accurate patient history and parasite identification are necessary to distinguish between autochthonous and imported cases. This is particularly important, as new Leishmania species/genotypes may be introduced and transmitted by local phlebotomine vectors without appropriate surveillance, with unpredictable consequences. We report on the surveillance of imported leishmaniasis performed by the Leishmania Identification Reference Centre of Rome from 1986 through 2012, involving health care centres from 16/20 Italian regions. Suspected imported cases were analyzed and conclusions were based on clinical, epidemiological and diagnostic findings. Over the years, different parasite identification methods were employed, including MultiLocus Enzyme Electrophoresis and molecular techniques combining disease diagnosis (SSU rDNA nested-PCR and Leishmania typing (nuclear repetitive sequence and ITS-1 PCR-RFLPs. A total of 105 imported cases were recorded (annual range: 0-20 of which 36 were visceral (VL (16 HIV-coinfections and 69 cutaneous (CL cases; 85 cases (52 CL were from the Old World and 20 (17 CL from the New World. Eight Leishmania species were identified, of which 7 were exotic to Italy. VL importation until 1995 was associated with the spread of Mediterranean Leishmania-HIV co-infections in early 1990s. Following the introduction of HAART treatment, such cases became occasional in Italians but relatively frequent among immigrants. In contrast, a steady increase of CL cases was observed from different areas of the Old and New Worlds, that in recent years included mainly immigrants 'visiting friends and relatives' and Italian tourists. This positive trend likely depends
Grolmusz, Vince I
2015-04-01
Diabetes is a growing concern for the developed nations worldwide. New genomic, metagenomic and gene-technologic approaches may yield considerable results in the next several years in its early diagnosis, or in advances in therapy and management. In this work, we highlight some human proteins that may serve as new targets in the early diagnosis and therapy. With the help of a very successful mathematical tool for network analysis that formed the basis of the early successes of Google(TM), Inc., we analyse the human protein-protein interaction network gained from the IntAct database with a mathematical algorithm. The novelty of our approach is that the new protein targets suggested do not have many interacting partners (so, they are not hubs or super-hubs), so their inhibition or promotion probably will not have serious side effects. We have identified numerous possible protein targets for diabetes therapy and/or management; some of these have been well known for a long time (these validate our method), some of them appeared in the literature in the last 12 months (these show the cutting edge of the algorithm), and the remainder are still unknown to be connected with diabetes, witnessing completely new hits of the method.
Hierarchical structures of correlations networks among Turkey’s exports and imports by currencies
Kocakaplan, Yusuf; Deviren, Bayram; Keskin, Mustafa
2012-12-01
We have examined the hierarchical structures of correlations networks among Turkey’s exports and imports by currencies for the 1996-2010 periods, using the concept of a minimal spanning tree (MST) and hierarchical tree (HT) which depend on the concept of ultrametricity. These trees are useful tools for understanding and detecting the global structure, taxonomy and hierarchy in financial markets. We derived a hierarchical organization and build the MSTs and HTs during the 1996-2001 and 2002-2010 periods. The reason for studying two different sub-periods, namely 1996-2001 and 2002-2010, is that the Euro (EUR) came into use in 2001, and some countries have made their exports and imports with Turkey via the EUR since 2002, and in order to test various time-windows and observe temporal evolution. We have carried out bootstrap analysis to associate a value of the statistical reliability to the links of the MSTs and HTs. We have also used the average linkage cluster analysis (ALCA) to observe the cluster structure more clearly. Moreover, we have obtained the bidimensional minimal spanning tree (BMST) due to economic trade being a bidimensional problem. From the structural topologies of these trees, we have identified different clusters of currencies according to their proximity and economic ties. Our results show that some currencies are more important within the network, due to a tighter connection with other currencies. We have also found that the obtained currencies play a key role for Turkey’s exports and imports and have important implications for the design of portfolio and investment strategies.
A Large-Scale RNAi Screen Identifies SGK1 as a Key Survival Kinase for GBM Stem Cells.
Kulkarni, Shreya; Goel-Bhattacharya, Surbhi; Sengupta, Sejuti; Cochran, Brent H
2018-01-01
Glioblastoma multiforme (GBM) is the most common type of primary malignant brain cancer and has a very poor prognosis. A subpopulation of cells known as GBM stem-like cells (GBM-SC) have the capacity to initiate and sustain tumor growth and possess molecular characteristics similar to the parental tumor. GBM-SCs are known to be enriched in hypoxic niches and may contribute to therapeutic resistance. Therefore, to identify genetic determinants important for the proliferation and survival of GBM stem cells, an unbiased pooled shRNA screen of 10,000 genes was conducted under normoxic as well as hypoxic conditions. A number of essential genes were identified that are required for GBM-SC growth, under either or both oxygen conditions, in two different GBM-SC lines. Interestingly, only about a third of the essential genes were common to both cell lines. The oxygen environment significantly impacts the cellular genetic dependencies as 30% of the genes required under hypoxia were not required under normoxic conditions. In addition to identifying essential genes already implicated in GBM such as CDK4, KIF11 , and RAN , the screen also identified new genes that have not been previously implicated in GBM stem cell biology. The importance of the serum and glucocorticoid-regulated kinase 1 (SGK1) for cellular survival was validated in multiple patient-derived GBM stem cell lines using shRNA, CRISPR, and pharmacologic inhibitors. However, SGK1 depletion and inhibition has little effect on traditional serum grown glioma lines and on differentiated GBM-SCs indicating its specific importance in GBM stem cell survival. Implications: This study identifies genes required for the growth and survival of GBM stem cells under both normoxic and hypoxic conditions and finds SGK1 as a novel potential drug target for GBM. Mol Cancer Res; 16(1); 103-14. ©2017 AACR . ©2017 American Association for Cancer Research.
The importance of studying sex differences in disease: The example of multiple sclerosis.
Golden, Lisa C; Voskuhl, Rhonda
2017-01-02
To date, scientific research has often focused on one sex, with assumptions that study of the other sex would yield similar results. However, many diseases affect males and females differently. The sex of a patient can affect the risk for both disease susceptibility and progression. Such differences can be brought to the laboratory bench to be investigated, potentially bringing new treatments back to the clinic. This method of research, known as a "bedside to bench to bedside" approach, has been applied to studying sex differences in multiple sclerosis (MS). Females have greater susceptibly to MS, while males have worse disease progression. These two characteristics of the disease are influenced by the immune system and the nervous system, respectively. Thus, sex differences in each system must be studied. Personalized medicine has been at the forefront of research recently, and studying sex differences in disease fits with this initiative. This review will discuss the known sex differences in MS and highlight how investigating them can lead to new insights and potential treatments for both men and women. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Anisha, C; Radhakrishnan, E K
2017-06-01
Endophytic fungi associated with rhizomes of four cultivars of Zingiber officinale were identified by molecular and morphological methods and evaluated for their activity against soft rot pathogen Pythium myriotylum and clinical pathogens. The volatile bioactive metabolites produced by these isolates were identified by GC-MS analysis of the fungal crude extracts. Understanding of the metabolites produced by endophytes is also important in the context of raw consumption of ginger as medicine and spice. A total of fifteen isolates were identified from the four varieties studied. The various genera identified were Acremonium sp., Gliocladiopsis sp., Fusarium sp., Colletotrichum sp., Aspergillus sp., Phlebia sp., Earliella sp., and Pseudolagarobasidium sp. The endophytic community was unique to each variety, which could be due to the varying host genotype. Fungi from phylum Basidiomycota were identified for the first time from ginger. Seven isolates showed activity against Pythium, while only two showed antibacterial activity. The bioactive metabolites identified in the fungal crude extracts include tyrosol, benzene acetic acid, ergone, dehydromevalonic lactone, N-aminopyrrolidine, and many bioactive fatty acids and their derivatives which included linoleic acid, oleic acid, myristic acid, n-hexadecanoic acid, palmitic acid methyl ester, and methyl linoleate. The presence of these varying bioactive endophytic fungi may be one of the reasons for the differences in the performance of the different ginger varieties.
Identifying the Multiple Intelligences of Your Students
McClellan, Joyce A.; Conti, Gary J.
2008-01-01
One way of addressing individual differences among adult learners is to identify the Multiple Intelligences of the learner. Multiple Intelligences refers to the concept developed by Howard Gardner that challenges the traditional view of intelligence and explains the presence of nine different Multiple Intelligences. The purpose of this study was…
Directory of Open Access Journals (Sweden)
HOANG T NGUYEN
2016-09-01
Full Text Available Copy-number variation (CNV has been associated with increased risk of complex diseases. High throughput sequencing (HTS technologies facilitate the detection of copy-number variable regions (CNVRs and their breakpoints. This helps in understanding genome structures of genomes as well as their evolution process. Various approaches have been proposed for detecting CNV breakpoints, but currently it is still challenging for tools based on a single analysis method to identify breakpoints of CNVs. It has been shown, however, that pipelines which integrate multiple approaches are able to report more reliable breakpoints. Here, based on HTS data, we have developed a pipeline to identify approximate breakpoints (±10 bp relating to different ancestral events within a specific CNVR. The pipeline combines read-depth and split-read information to infer breakpoints, using information from multiple samples to allow an imputation approach to be taken. The main steps involve using a normal mixture model to cluster samples into different groups, followed by simple kernel-based approaches to maximise information obtained from read-depth and split-read approaches, after which common breakpoints of groups are inferred. The pipeline uses split-read information directly from CIGAR strings of BAM files, without using a re-alignment step. On simulated data sets, it was able to report breakpoints for very low-coverage samples including those for which only single-end reads were available. When applied to three loci from existing human resequencing data sets (NEGR1, LCE3, IRGM the pipeline obtained good concordance with results from the 1000 Genomes Project (92%, 100% and 82%, respectively.The package is available at https://github.com/hoangtn/SRBreak, and also as a docker-based application at https://registry.hub.docker.com/u/hoangtn/srbreak/.
Directory of Open Access Journals (Sweden)
Aleeshah Nujjoo
2012-02-01
Full Text Available Orientation: Employees’ perceptions of rewards are related to their affective commitment and intrinsic motivation, which have been associated with staff turnover.Research purpose: The study sought to establish the relationship between intrinsic and different extrinsic rewards with intrinsic motivation and affective commitment.Motivation for the study: South African organisations are grappling with employee retention. Literature shows that employees who are more motivated and committed to their organisation are less likely to quit. Rewards management strategies serve to create a motivated and committed workforce. Using the correct types of rewards can thus provide a competitive advantage.Research design, approach and method: A cross-sectional, correlational study was conducted. Questionnaire data of 399 South African employees were analysed using bivariate correlations and multiple regression.Main findings: Three main findings emerged. Firstly, there is a relationship between all types of rewards investigated and the two outcome variables. Secondly, this relationship is stronger for intrinsic than for extrinsic rewards and thirdly, monetary rewards do not account for the variance in intrinsic motivation above that of non-monetary rewards.Practical/managerial implications: Rewards management strategies should focus on job characteristics and designs to increase staff intrinsic rewards and include non-monetary rewards, such as supportive leadership, to encourage employees’ intrinsic motivation and affective commitment.Contribution/value-add: This research demonstrated the important role different rewards, particularly intrinsic non-monetary rewards, play in creating a committed and motivated workforce. The insights gained from this study can promote organisational effectiveness. Suggestions of how to expand on and refine the current study are addressed.
Isableu, B; Ohlmann, T; Cremieux, J; Vuillerme, N; Amblard, B; Gresty, M A
2010-09-01
The causes of the interindividual differences (IDs) in how we perceive and control spatial orientation are poorly understood. Here, we propose that IDs partly reflect preferred modes of spatial referencing and that these preferences or "styles" are maintained from the level of spatial perception to that of motor control. Two groups of experimental subjects, one with high visual field dependency (FD) and one with marked visual field independency (FI) were identified by the Rod and Frame Test, which identifies relative dependency on a visual frame of reference (VFoR). FD and FI subjects were tasked with standing still in conditions of increasing postural difficulty while visual cues of self-orientation (a visual frame tilted in roll) and self-motion (in stroboscopic illumination) were varied and in darkness to assess visual dependency. Postural stability, overall body orientation and modes of segmental stabilization relative to either external (space) or egocentric (adjacent segments) frames of reference in the roll plane were analysed. We hypothesized that a moderate challenge to balance should enhance subjects' reliance on VFoR, particularly in FD subjects, whereas a substantial challenge should constrain subjects to use a somatic-vestibular based FoR to prevent falling in which case IDs would vanish. The results showed that with increasing difficulty, FD subjects became more unstable and more disoriented shown by larger effects of the tilted visual frame on posture. Furthermore, their preference to coalign body/VFoR coordinate systems lead to greater fixation of the head-trunk articulation and stabilization of the hip in space, whereas the head and trunk remained more stabilized in space with the hip fixed on the leg in FI subjects. These results show that FD subjects have difficulties at identifying and/or adopting a more appropriate FoR based on proprioceptive and vestibular cues to regulate the coalignment of posturo/exocentric FoRs. The FI subjects' resistance
Gender differences in environmental related behaviour
Energy Technology Data Exchange (ETDEWEB)
Dalen, Hanne Marit; Halvorsen, Bente
2011-11-15
This report discusses gender differences in the data collected in the OECD household survey on environmental behaviour. The survey asked a sample of 10 000 respondents from 10 countries (Norway, Sweden, Canada, France, Italy, the Netherlands, the Czech Republic, Mexico, Australia and Korea) concerning household behaviour with respect to five areas: recycling, energy and water saving, organic food consumption and transportation. This report identifies and describes gender differences in behaviour, in underlying preferences and in household characteristics in this data. We use regression analyses to identify and test for significant gender differences in preferences, and we use differences in means to test for gender differences in background variables and the total effect of gender on behaviour. In our estimations, where we test for significant gender differences in preferences, we find many significant differences with respect to several of the explanatory variables affecting behaviour. However, there was no clear pattern for most of these gender differences. The only systematic gender difference we found in the estimations was that the belief that they can actually contribute to a better environment seems to be a more important motivator for environmental friendly behaviour for men than it is for women. There are also many significant differences between the genders in the distribution of key background variables, in particular with respect to income, car ownership, participation in the workforce, education and choice of residence. However, these gender differences in preferences and background variables only result in pronounced gender differences in behaviour to a small degree. The exception is transportation, where gender differences are large and significant. Men have a higher probability of owning a car or a motorcycle than women. And given that the respondent owns a car, men drive significantly more than women. For the rest of the behaviour measured in this
Bohl, Daniel D; Basques, Bryce A; Golinvaux, Nicholas S; Baumgaertner, Michael R; Grauer, Jonathan N
2014-06-01
National databases are being used with increasing frequency to conduct orthopaedic research. However, there are important differences in these databases, which could result in different answers to similar questions; this important potential limitation pertaining to database research in orthopaedic surgery has not been adequately explored. The purpose of this study was to explore the interdatabase reliability of two commonly used national databases, the Nationwide Inpatient Sample (NIS) and the National Surgical Quality Improvement Program (NSQIP), in terms of (1) demographics; (2) comorbidities; and (3) adverse events. In addition, using the NSQIP database, we identified (4) adverse events that had a higher prevalence after rather than before discharge, which has important implications for interpretation of studies conducted in the NIS. A retrospective cohort study of patients undergoing operative stabilization of transcervical and intertrochanteric hip fractures during 2009 to 2011 was performed in the NIS and NSQIP. Totals of 122,712 and 5021 patients were included from the NIS and NSQIP, respectively. Age, sex, fracture type, and lengths of stay were compared. Comorbidities common to both databases were compared in terms of more or less than twofold difference between the two databases. Similar comparisons were made for adverse events. Finally, adverse events that had a greater postdischarge prevalence were identified from the NSQIP database. Tests for statistical difference were thought to be of little value given the large sample size and the resulting fact that statistical differences would have been identified even for small, clinically inconsequential differences resulting from the associated high power. Because it is of greater clinical importance to focus on the magnitude of differences, the databases were compared by absolute differences. Demographics and hospital lengths of stay were not different between the two databases. In terms of comorbidities
Protein import into isolated pea root leucoplasts
Chu, Chiung-Chih; Li, Hsou-min
2015-01-01
Leucoplasts are important organelles for the synthesis and storage of starch, lipids and proteins. However, molecular mechanism of protein import into leucoplasts and how it differs from that of import into chloroplasts remain unknown. We used pea seedlings for both chloroplast and leucoplast isolations to compare within the same species. We further optimized the isolation and import conditions to improve import efficiency and to permit a quantitative comparison between the two plastid types....
Identifying the "Truly Disadvantaged": A Comprehensive Biosocial Approach
Barnes, J. C.; Beaver, Kevin M.; Connolly, Eric J.; Schwartz, Joseph A.
2016-01-01
There has been significant interest in examining the developmental factors that predispose individuals to chronic criminal offending. This body of research has identified some social-environmental risk factors as potentially important. At the same time, the research producing these results has generally failed to employ genetically sensitive…
Liu, Shelley H; Li, Yan; Liu, Bian
2018-05-17
Chronic kidney disease is a leading cause of death in the United States. We used cluster analysis to explore patterns of chronic kidney disease in 500 of the largest US cities. After adjusting for socio-demographic characteristics, we found that unhealthy behaviors, prevention measures, and health outcomes related to chronic kidney disease differ between cities in Utah and those in the rest of the United States. Cluster analysis can be useful for identifying geographic regions that may have important policy implications for preventing chronic kidney disease.
Bioinformatics approaches for identifying new therapeutic bioactive peptides in food
Directory of Open Access Journals (Sweden)
Nora Khaldi
2012-10-01
Full Text Available ABSTRACT:The traditional methods for mining foods for bioactive peptides are tedious and long. Similar to the drug industry, the length of time to identify and deliver a commercial health ingredient that reduces disease symptoms can take anything between 5 to 10 years. Reducing this time and effort is crucial in order to create new commercially viable products with clear and important health benefits. In the past few years, bioinformatics, the science that brings together fast computational biology, and efficient genome mining, is appearing as the long awaited solution to this problem. By quickly mining food genomes for characteristics of certain food therapeutic ingredients, researchers can potentially find new ones in a matter of a few weeks. Yet, surprisingly, very little success has been achieved so far using bioinformatics in mining for food bioactives.The absence of food specific bioinformatic mining tools, the slow integration of both experimental mining and bioinformatics, and the important difference between different experimental platforms are some of the reasons for the slow progress of bioinformatics in the field of functional food and more specifically in bioactive peptide discovery.In this paper I discuss some methods that could be easily translated, using a rational peptide bioinformatics design, to food bioactive peptide mining. I highlight the need for an integrated food peptide database. I also discuss how to better integrate experimental work with bioinformatics in order to improve the mining of food for bioactive peptides, therefore achieving a higher success rates.
Directory of Open Access Journals (Sweden)
Zhibin Xiao
2017-02-01
Full Text Available Recognition of transportation modes can be used in different applications including human behavior research, transport management and traffic control. Previous work on transportation mode recognition has often relied on using multiple sensors or matching Geographic Information System (GIS information, which is not possible in many cases. In this paper, an approach based on ensemble learning is proposed to infer hybrid transportation modes using only Global Position System (GPS data. First, in order to distinguish between different transportation modes, we used a statistical method to generate global features and extract several local features from sub-trajectories after trajectory segmentation, before these features were combined in the classification stage. Second, to obtain a better performance, we used tree-based ensemble models (Random Forest, Gradient Boosting Decision Tree, and XGBoost instead of traditional methods (K-Nearest Neighbor, Decision Tree, and Support Vector Machines to classify the different transportation modes. The experiment results on the later have shown the efficacy of our proposed approach. Among them, the XGBoost model produced the best performance with a classification accuracy of 90.77% obtained on the GEOLIFE dataset, and we used a tree-based ensemble method to ensure accurate feature selection to reduce the model complexity.
DEFF Research Database (Denmark)
Thune, Jens Jakob; Hoefsten, Dan Eik; Lindholm, Matias Greve
2005-01-01
BACKGROUND: Randomized trials comparing fibrinolysis with primary angioplasty for acute ST-elevation myocardial infarction have demonstrated a beneficial effect of primary angioplasty on the combined end point of death, reinfarction, and disabling stroke but not on all-cause death. Identifying...... a patient group with reduced mortality from an invasive strategy would be important for early triage. The Thrombolysis in Myocardial Infarction (TIMI) risk score is a simple validated integer score that makes it possible to identify high-risk patients on admission to hospital. We hypothesized that a high...... as high risk. There was a significant interaction between risk status and effect of primary angioplasty (P=0.008). In the low-risk group, there was no difference in mortality (primary angioplasty, 8.0%; fibrinolysis, 5.6%; P=0.11); in the high-risk group, there was a significant reduction in mortality...
Determining Minimal Clinically Important Differences in Japanese Cedar/Cypress Pollinosis Patients
Directory of Open Access Journals (Sweden)
Takaya Higaki
2013-01-01
Conclusions: For T5SS in the diary, T6SS and QOL in JRQLQ, unit differences of 1.5 (0.3 per item, 3.6 (0.6 and 8.2 (0.5, respectively, were considered clinically meaningful by JCCP patients. The MCID for symptoms recorded in the diary was stable irrespective of the dispersed pollen level.
Directory of Open Access Journals (Sweden)
Hossein Dastkhan
2016-06-01
Full Text Available Systemic risk events constitute an important issue in current financial systems. A leading course of action used to mitigate such events is identification of systemically important agents in order to implement the prudential policies in a financial system. In this paper, a bi-level cross-shareholding network of the stock market is considered according to direct and integrated ownership structure. Furthermore, different systemic risk indices are applied to identify systemically important companies in an early warning system. Results of application of these indices on cross-shareholding data from Tehran Stock Exchange show that integrated network indices produce more reliable results. Moreover, results of statistical analysis of the networks indicated the existence of scale-free characteristics in the TSE cross-shareholding network.
Swindell, William R.; Johnston, Andrew; Carbajal, Steve; Han, Gangwen; Wohn, Christian; Lu, Jun; Xing, Xianying; Nair, Rajan P.; Voorhees, John J.; Elder, James T.; Wang, Xiao-Jing; Sano, Shigetoshi; Prens, Errol P.; DiGiovanni, John; Pittelkow, Mark R.; Ward, Nicole L.; Gudjonsson, Johann E.
2011-01-01
Development of a suitable mouse model would facilitate the investigation of pathomechanisms underlying human psoriasis and would also assist in development of therapeutic treatments. However, while many psoriasis mouse models have been proposed, no single model recapitulates all features of the human disease, and standardized validation criteria for psoriasis mouse models have not been widely applied. In this study, whole-genome transcriptional profiling is used to compare gene expression patterns manifested by human psoriatic skin lesions with those that occur in five psoriasis mouse models (K5-Tie2, imiquimod, K14-AREG, K5-Stat3C and K5-TGFbeta1). While the cutaneous gene expression profiles associated with each mouse phenotype exhibited statistically significant similarity to the expression profile of psoriasis in humans, each model displayed distinctive sets of similarities and differences in comparison to human psoriasis. For all five models, correspondence to the human disease was strong with respect to genes involved in epidermal development and keratinization. Immune and inflammation-associated gene expression, in contrast, was more variable between models as compared to the human disease. These findings support the value of all five models as research tools, each with identifiable areas of convergence to and divergence from the human disease. Additionally, the approach used in this paper provides an objective and quantitative method for evaluation of proposed mouse models of psoriasis, which can be strategically applied in future studies to score strengths of mouse phenotypes relative to specific aspects of human psoriasis. PMID:21483750
Sensory properties of Californian and imported extra virgin olive oils.
Delgado, Claudia; Guinard, Jean-Xavier
2011-04-01
Production and consumption of extra-virgin olive has been increasing in the United States, particularly in California. The objective of this study was to compare the sensory characteristics of 22 extra virgin olive oils (EVOO) from California, Italy, Spain, Chile, and Australia using a generic descriptive analysis. A total of 22 sensory attributes were identified and defined by the descriptive panel. With the exception of thick and citrus, all sensory attributes were significantly different among the oils. Canonical Variate Analysis (CVA) showed that California oils differed from some imported EVOOs, mainly by their absence of defects. A second analysis, of only those attributes included in the International Olive Council (IOC) official scorecard, provided a less detailed description of the samples and did not allow for a full characterization of the oils. While the IOC attributes allowed for faster classification in terms of clean versus defective EVOOs, the more comprehensive descriptive analysis provided both more information and a more refined classification of the samples. Variety and region of origin were important factors in the classification of both Californian and imported EVOOs. Measuring olive oil sensory quality using the IOC method-positive attributes of fruitiness, bitterness, and pungency, and defects including fusty, musty, winey, and rancid-allows for the certification of oils as extra virgin but it provides limited information on the sensory characteristics of the oils. A full descriptive profile, on the other hand, provides information that can be used by producers in the processing and marketing of their oils, and is a useful tool in the education of consumers about the wide range of (positive) sensory attributes in EVOO and the various sensory styles of EVOO.
Sex differences in prenatal epigenetic programming of stress pathways.
Bale, Tracy L
2011-07-01
Maternal stress experience is associated with neurodevelopmental disorders including schizophrenia and autism. Recent studies have examined mechanisms by which changes in the maternal milieu may be transmitted to the developing embryo and potentially translated into programming of the epigenome. Animal models of prenatal stress have identified important sex- and temporal-specific effects on offspring stress responsivity. As dysregulation of stress pathways is a common feature in most neuropsychiatric diseases, molecular and epigenetic analyses at the maternal-embryo interface, especially in the placenta, may provide unique insight into identifying much-needed predictive biomarkers. In addition, as most neurodevelopmental disorders present with a sex bias, examination of sex differences in the inheritance of phenotypic outcomes may pinpoint gene targets and specific windows of vulnerability in neurodevelopment, which have been disrupted. This review discusses the association and possible contributing mechanisms of prenatal stress in programming offspring stress pathway dysregulation and the importance of sex.
Biologically Important Areas for Cetaceans within U.S. Waters
National Oceanic and Atmospheric Administration, Department of Commerce — The Cetacean Density and Distribution Mapping Working Group identified Biologically Important Areas (BIAs) for 24 cetacean species, stocks, or populations in seven...
Tetrapods on the EDGE: Overcoming data limitations to identify phylogenetic conservation priorities
Gray, Claudia L.; Wearn, Oliver R.; Owen, Nisha R.
2018-01-01
The scale of the ongoing biodiversity crisis requires both effective conservation prioritisation and urgent action. As extinction is non-random across the tree of life, it is important to prioritise threatened species which represent large amounts of evolutionary history. The EDGE metric prioritises species based on their Evolutionary Distinctiveness (ED), which measures the relative contribution of a species to the total evolutionary history of their taxonomic group, and Global Endangerment (GE), or extinction risk. EDGE prioritisations rely on adequate phylogenetic and extinction risk data to generate meaningful priorities for conservation. However, comprehensive phylogenetic trees of large taxonomic groups are extremely rare and, even when available, become quickly out-of-date due to the rapid rate of species descriptions and taxonomic revisions. Thus, it is important that conservationists can use the available data to incorporate evolutionary history into conservation prioritisation. We compared published and new methods to estimate missing ED scores for species absent from a phylogenetic tree whilst simultaneously correcting the ED scores of their close taxonomic relatives. We found that following artificial removal of species from a phylogenetic tree, the new method provided the closest estimates of their “true” ED score, differing from the true ED score by an average of less than 1%, compared to the 31% and 38% difference of the previous methods. The previous methods also substantially under- and over-estimated scores as more species were artificially removed from a phylogenetic tree. We therefore used the new method to estimate ED scores for all tetrapods. From these scores we updated EDGE prioritisation rankings for all tetrapod species with IUCN Red List assessments, including the first EDGE prioritisation for reptiles. Further, we identified criteria to identify robust priority species in an effort to further inform conservation action whilst
Martinez-Valdes, Eduardo; Negro, Francesco; Falla, Deborah; De Nunzio, Alessandro Marco; Farina, Dario
2018-04-01
Surface electromyographic (EMG) signal amplitude is typically used to compare the neural drive to muscles. We experimentally investigated this association by studying the motor unit (MU) behavior and action potentials in the vastus medialis (VM) and vastus lateralis (VL) muscles. Eighteen participants performed isometric knee extensions at four target torques [10, 30, 50, and 70% of the maximum torque (MVC)] while high-density EMG signals were recorded from the VM and VL. The absolute EMG amplitude was greater for VM than VL ( P differences in EMG amplitude can be due to both differences in the neural drive and in the size of the MU action potentials, we indirectly inferred the neural drives received by the two muscles by estimating the synaptic inputs received by the corresponding motor neuron pools. For this purpose, we analyzed the increase in discharge rate from recruitment to target torque for motor units matched by recruitment threshold in the two muscles. This analysis indicated that the two muscles received similar levels of neural drive. Nonetheless, the size of the MU action potentials was greater for VM than VL ( P difference explained most of the differences in EMG amplitude between the two muscles (~63% of explained variance). These results indicate that EMG amplitude, even following normalization, does not reflect the neural drive to synergistic muscles. Moreover, absolute EMG amplitude is mainly explained by the size of MU action potentials. NEW & NOTEWORTHY Electromyographic (EMG) amplitude is widely used to compare indirectly the strength of neural drive received by synergistic muscles. However, there are no studies validating this approach with motor unit data. Here, we compared between-muscles differences in surface EMG amplitude and motor unit behavior. The results clarify the limitations of surface EMG to interpret differences in neural drive between muscles.
International Nuclear Information System (INIS)
Ihsanullah; Khattak, T.N.; Mehmood, N.; Sattar, A.
2001-01-01
Studies were conducted to see the levels of important nutrients and selected essential/toxic metals in different types of meat i.e. beef, poultry, mutton and fish. The meat samples were also analyzed for bacterial contamination. Highest value of protein (20.32 +- 1.86% was detected in poultry (chicken) while maximum fats and fiber contents (13.50 +- 0.14 and 0.135 +- 0.112%) were found in beef samples. The Pb content was found to be 7.0 +- 0.61 (mutton), 6.6 +- 0.58 (beef) and 3.3 +- 0.39 ppm (poultry). The highest level of Cd was determined in poultry (1.00 +- 0.13) followed by mutton (0.80 +- 0.07), beef (0.70 +- 0.08) and fish (0.25 +- 0.04 ppm). The maximum level of Cu (10.0 +- 0.55 and 7.0 +- 0.43 ppm) was detected in beef and mutton respectively while comparatively low Cu content was found in poultry as well as fish samples. It was observed that fresh meat had low levels of heavy metals. Highest concentrations of Fe (3.29 +- 0.41ppm) and P (167.8 +- 10.31) were found in mutton and beef respectively. The data revealed that majority of meat samples were also contaminated with bacteria and showed presence of E. coli. Hence, were considered unfit for human consumption. In addition % moisture and ash were also examined. The results were compared with recommended daily allowances and some remedial measures to control environmental pollution of meat sold in the open air are suggested. (author)
Brouwer-Brolsma, E.M.; Vaes, A.M.M.; Zwaluw, van der N.L.; Wijngaarden, van J.P.; Swart, K.M.A.; Ham, A.C.; Dijk, van S.C.; Enneman, A.W.; Sohl, E.; Schoor, van N.M.; Velde, van der N.; Uitterlinden, A.G.; Lips, P.; Feskens, E.J.M.; Dhonukshe-Rutten, R.A.M.; Groot, de C.P.G.M.
2016-01-01
Background/objectives The prevalence of vitamin D deficiency among seniors is high. Whereas sun exposure, vitamin D intake, genes, demographics, and lifestyle have been identified as being important determinants of vitamin D status, the impact of these factors is expected to differ across
Sanhueza, Loreto; Melo, Ricardo; Montero, Ruth; Maisey, Kevin; Mendoza, Leonora; Wilkens, Marcela
2017-01-01
Synergy could be an effective strategy to potentiate and recover antibiotics nowadays useless in clinical treatments against multi-resistant bacteria. In this study, synergic interactions between antibiotics and grape pomace extract that contains high concentration of phenolic compounds were evaluated by the checkerboard method in clinical isolates of Staphylococcus aureus and Escherichia coli. To define which component of the extract is responsible for the synergic effect, phenolic compounds were identified by RP-HPLC and their relative abundance was determined. Combinations of extract with pure compounds identified there in were also evaluated. Results showed that the grape pomace extract combined with representatives of different classes of antibiotics as β-lactam, quinolone, fluoroquinolone, tetracycline and amphenicol act in synergy in all S. aureus and E. coli strains tested with FICI values varying from 0.031 to 0.155. The minimal inhibitory concentration (MIC) was reduced 4 to 75 times. The most abundant phenolic compounds identified in the extract were quercetin, gallic acid, protocatechuic acid and luteolin with relative abundance of 26.3, 24.4, 16.7 and 11.4%, respectively. All combinations of the extract with the components also showed synergy with FICI values varying from 0.031 to 0.5 and MIC reductions of 4 to 125 times with both bacteria strains. The relative abundance of phenolic compounds has no correlation with the obtained synergic effect, suggesting that the mechanism by which the synergic effect occurs is by a multi-objective action. It was also shown that combinations of grape pomace extract with antibiotics are not toxic for the HeLa cell line at concentrations in which the synergistic effect was observed (47 μg/mL of extract and 0.6-375 μg/mL antibiotics). Therefore, these combinations are good candidates for testing in animal models in order to enhance the effect of antibiotics of different classes and thus restore the currently unused
Directory of Open Access Journals (Sweden)
Loreto Sanhueza
Full Text Available Synergy could be an effective strategy to potentiate and recover antibiotics nowadays useless in clinical treatments against multi-resistant bacteria. In this study, synergic interactions between antibiotics and grape pomace extract that contains high concentration of phenolic compounds were evaluated by the checkerboard method in clinical isolates of Staphylococcus aureus and Escherichia coli. To define which component of the extract is responsible for the synergic effect, phenolic compounds were identified by RP-HPLC and their relative abundance was determined. Combinations of extract with pure compounds identified there in were also evaluated. Results showed that the grape pomace extract combined with representatives of different classes of antibiotics as β-lactam, quinolone, fluoroquinolone, tetracycline and amphenicol act in synergy in all S. aureus and E. coli strains tested with FICI values varying from 0.031 to 0.155. The minimal inhibitory concentration (MIC was reduced 4 to 75 times. The most abundant phenolic compounds identified in the extract were quercetin, gallic acid, protocatechuic acid and luteolin with relative abundance of 26.3, 24.4, 16.7 and 11.4%, respectively. All combinations of the extract with the components also showed synergy with FICI values varying from 0.031 to 0.5 and MIC reductions of 4 to 125 times with both bacteria strains. The relative abundance of phenolic compounds has no correlation with the obtained synergic effect, suggesting that the mechanism by which the synergic effect occurs is by a multi-objective action. It was also shown that combinations of grape pomace extract with antibiotics are not toxic for the HeLa cell line at concentrations in which the synergistic effect was observed (47 μg/mL of extract and 0.6-375 μg/mL antibiotics. Therefore, these combinations are good candidates for testing in animal models in order to enhance the effect of antibiotics of different classes and thus restore the
IMPORTANCE OF MULTIPLE CRITERIA FOR PRIORITY SETTING OF HIV/AIDS INTERVENTIONS.
Tromp, Noor; Prawiranegara, Rozar; Siregar, Adiatma; Sunjaya, Deni; Baltussen, Rob
2015-01-01
This study describes the views of various stakeholders on the importance of different criteria for priority setting of HIV/AIDS interventions in Indonesia. Based on a general list of criteria and a focus group discussion with stakeholders (n = 6), a list was developed of thirty-two criteria that play a role in priority setting in HIV/AIDS control in West-Java province. Criteria were categorized according to the World Health Organization's health system goals and building block frameworks. People living with HIV/AIDS (n = 49), healthcare workers (HCW) (n = 41), the general population (n = 43), and policy makers (n = 22) rated the importance of thirty-two criteria on a 5-point Likert-scale. Thereafter, respondents ranked the highest rated criteria to express more detailed preferences. Stakeholders valued the following criteria as most important for the priority setting of HIV/AIDS interventions: an intervention's impact on the HIV/AIDS epidemic, reduction of stigma, quality of care, effectiveness on individual level, and feasibility in terms of current capacity of the health system (i.e., HCW, product, information, and service requirements), financial sustainability, and acceptance by donors. Overall, stakeholders' preferences for the importance of criteria are similar. Our study design outlines an approach for other settings to identify which criteria are important for priority setting of health interventions. For Indonesia, these study results may be used in priority setting processes for HIV/AIDS control and may contribute to more transparent and systematic allocation of resources.