WorldWideScience

Sample records for identify important contributions

  1. The Importance of identifiers: IWGSC Meeting 20170720

    OpenAIRE

    Haak, Laurel

    2017-01-01

    Presentation by Laure Haak at the 20 July 2017 meeting of the IWGSC, about use of identifiers in connecting researchers, funding, facilities, and publications. Description of approach and initial results of User Facilities and Publications Working Group, and applications for Scientific Collections.

  2. Identifying Importance-Performance Matrix Analysis (IPMA) of ...

    African Journals Online (AJOL)

    Identifying Importance-Performance Matrix Analysis (IPMA) of intellectual capital and Islamic work ethics in Malaysian SMES. ... capital and Islamic work ethics significantly influenced business performance. ... AJOL African Journals Online.

  3. Identifying the important factors in simulation models with many factors

    NARCIS (Netherlands)

    Bettonvil, B.; Kleijnen, J.P.C.

    1994-01-01

    Simulation models may have many parameters and input variables (together called factors), while only a few factors are really important (parsimony principle). For such models this paper presents an effective and efficient screening technique to identify and estimate those important factors. The

  4. Identifying risk factors that contribute to acute mountain sickness ...

    African Journals Online (AJOL)

    This study is a questionnaire-based study conducted in London and at Everest Base Camp, in which 116 lowlanders were invited to participate and fill in a questionnaire to identify potential risk factors in their history that may have contributed to development of or protection against AMS. Results. A total of 89 lowlanders ...

  5. Importance biasing quality criterion based on contribution response theory

    International Nuclear Information System (INIS)

    Borisov, N.M.; Panin, M.P.

    2001-01-01

    The report proposes a visual criterion of importance biasing both of forward and adjoint simulation. The similarity of contribution Monte Carlo and importance biasing random collision event distribution is proved. The conservation of total number of random trajectory crossings of surfaces, which separate the source and the detector is proposed as importance biasing quality criterion. The use of this criterion is demonstrated on the example of forward vs. adjoint importance biasing in gamma ray deep penetration problem. The larger amount of published data on forward field characteristics than on adjoint leads to the more accurate approximation of adjoint importance function in comparison to forward, for it adjoint importance simulation is more effective than forward. The proposed criterion indicates it visually, showing the most uniform distribution of random trajectory crossing events for the most effective importance biasing parameters and pointing to the direction of tuning importance biasing parameters. (orig.)

  6. Prof. Ikeda’s important contributions to nuclear physics

    CERN Document Server

    Brink, D M

    2010-01-01

    Professor Ikeda has made many fundamental contributions to nuclear physics, especially to the theory of Gamow-Teller giant resonances, to nuclear cluster physics, to hypernuclear physics, and to the physics of neutron-rich nuclei. He also has played an important role in the education of young researchers in Japan and on the contacts between theoreticians and experimentalists.

  7. Identifying important nodes by adaptive LeaderRank

    Science.gov (United States)

    Xu, Shuang; Wang, Pei

    2017-03-01

    Spreading process is a common phenomenon in complex networks. Identifying important nodes in complex networks is of great significance in real-world applications. Based on the spreading process on networks, a lot of measures have been proposed to evaluate the importance of nodes. However, most of the existing measures are appropriate to static networks, which are fragile to topological perturbations. Many real-world complex networks are dynamic rather than static, meaning that the nodes and edges of such networks may change with time, which challenge numerous existing centrality measures. Based on a new weighted mechanism and the newly proposed H-index and LeaderRank (LR), this paper introduces a variant of the LR measure, called adaptive LeaderRank (ALR), which is a new member of the LR-family. Simulations on six real-world networks reveal that the new measure can well balance between prediction accuracy and robustness. More interestingly, the new measure can better adapt to the adjustment or local perturbations of network topologies, as compared with the existing measures. By discussing the detailed properties of the measures from the LR-family, we illustrate that the ALR has its competitive advantages over the other measures. The proposed algorithm enriches the measures to understand complex networks, and may have potential applications in social networks and biological systems.

  8. Identifying important motivational factors for professionals in Greek hospitals

    Science.gov (United States)

    Kontodimopoulos, Nick; Paleologou, Victoria; Niakas, Dimitris

    2009-01-01

    Background The purpose of this study was to identify important motivational factors according to the views of health-care professionals in Greek hospitals and particularly to determine if these might differ in the public and private sectors. Methods A previously developed -and validated- instrument addressing four work-related motivators (job attributes, remuneration, co-workers and achievements) was used. Three categories of health care professionals, doctors (N = 354), nurses (N = 581) and office workers (N = 418), working in public and private hospitals, participated and motivation was compared across socio-demographic and occupational variables. Results The range of reported motivational factors was mixed and Maslow's conclusions that lower level motivational factors must be met before ascending to the next level were not confirmed. The highest ranked motivator for the entire sample, and by professional subgroup, was achievements (P motivators were similar, and only one significant difference was observed, namely between doctors and nurses in respect to co-workers (P motivated by all factors significantly more than their public-hospital counterparts. Conclusion The results are in agreement with the literature which focuses attention to management approaches employing both monetary and non-monetary incentives to motivate health care workers. This study showed that intrinsic factors are particularly important and should become a target for effective employee motivation. PMID:19754968

  9. Uric acid, an important antioxidant contributing to survival in termites

    Science.gov (United States)

    Tasaki, Eisuke; Sakurai, Hiroki; Nitao, Masaru; Matsuura, Kenji; Iuchi, Yoshihito

    2017-01-01

    Reactive oxygen species (ROS) are generated spontaneously in all organisms and cause oxidative damage to biomolecules when present in excess. Accumulated oxidative damage accelerates aging; enhanced antioxidant capacity may be a positive factor for longevity. Recently, numerous studies of aging and longevity have been performed using short-lived animals, however, longevity mechanisms remain unknown. Here we show that a termite Reticulitermes speratus that is thought to be long-lived eusocial insect than other solitary insects uses large quantities of uric acid as an antioxidant against ROS. We demonstrated that the accumulation of uric acid considerably increases the free radical-scavenging activity and resistance against ultraviolet-induced oxidative stress in laboratory-maintained termites. In addition, we found that externally administered uric acid aided termite survival under highly oxidative conditions. The present data demonstrates that in addition to nutritional and metabolic roles, uric acid is an essential antioxidant for survival and contributes significantly to longevity. Uric acid also plays important roles in primates but causes gout when present in excess in humans. Further longevity studies of long-lived organisms may provide important breakthroughs with human health applications. PMID:28609463

  10. Predicting General Academic Performance and Identifying the Differential Contribution of Participating Variables Using Artificial Neural Networks

    Science.gov (United States)

    Musso, Mariel F.; Kyndt, Eva; Cascallar, Eduardo C.; Dochy, Filip

    2013-01-01

    Many studies have explored the contribution of different factors from diverse theoretical perspectives to the explanation of academic performance. These factors have been identified as having important implications not only for the study of learning processes, but also as tools for improving curriculum designs, tutorial systems, and students'…

  11. The importance of TVET and its contribution to sustainable development

    Science.gov (United States)

    Paryono

    2017-09-01

    Technical and Vocational Education and Training (TVET) has been gaining its popularity and considered as the driving force for sustainable development. TVET is also considered highly in strategic and operational priorities of the G20, the Organisation for Economic Co-operation and Development (OECD), and of multilateral organizations such as the International Labour Organization (ILO), UNESCO, ASEAN, and SEAMEO. As reflected in Shanghai Consensus, TVET systems need sustained transformation and revitalization if TVET is to realize its enormous potential to impact development. This paper will elaborate relevant policies considered as major drivers for promoting TVET at global, regional, and national levels. The paper also shares TVET initiatives in response the policies, especially in meeting the labour market demands in the 21st century. Lastly, the paper highlights TVET contribution to sustainable development, particularly on the sustainable environmental development, including green jobs. The integration of sustainable development into TVET curriculum, learning contents, and also school policies and practices are important indicators to consider. The paper was based secondary data and documents from the meetings and also reports.

  12. Identifying important parameters for a continuous bioscouring process

    NARCIS (Netherlands)

    Lenting, H.B.M.; Lenting, H.B.M.; Zwier, E.; Nierstrasz, Vincent

    2002-01-01

    Compared to a bioscouring process in the batch mode, a continuously operating process requires relatively short processing steps. This study focusses on minimizing the required enzymatic incubation time. It is clear that the presence of a sufficient level of surfactant is of major importance in

  13. Identifying risk factors that contribute to acute mountain sickness

    African Journals Online (AJOL)

    Acute mountain sickness (AMS) is an ever-increasing burden on the health sector. With reported incidences .... schedule to reduce the likelihood of AMS. The data ... of Health and. Multidisciplinary Board on Exercise to identify individuals who.

  14. A landscape ecology approach identifies important drivers of urban biodiversity.

    Science.gov (United States)

    Turrini, Tabea; Knop, Eva

    2015-04-01

    Cities are growing rapidly worldwide, yet a mechanistic understanding of the impact of urbanization on biodiversity is lacking. We assessed the impact of urbanization on arthropod diversity (species richness and evenness) and abundance in a study of six cities and nearby intensively managed agricultural areas. Within the urban ecosystem, we disentangled the relative importance of two key landscape factors affecting biodiversity, namely the amount of vegetated area and patch isolation. To do so, we a priori selected sites that independently varied in the amount of vegetated area in the surrounding landscape at the 500-m scale and patch isolation at the 100-m scale, and we hold local patch characteristics constant. As indicator groups, we used bugs, beetles, leafhoppers, and spiders. Compared to intensively managed agricultural ecosystems, urban ecosystems supported a higher abundance of most indicator groups, a higher number of bug species, and a lower evenness of bug and beetle species. Within cities, a high amount of vegetated area increased species richness and abundance of most arthropod groups, whereas evenness showed no clear pattern. Patch isolation played only a limited role in urban ecosystems, which contrasts findings from agro-ecological studies. Our results show that urban areas can harbor a similar arthropod diversity and abundance compared to intensively managed agricultural ecosystems. Further, negative consequences of urbanization on arthropod diversity can be mitigated by providing sufficient vegetated space in the urban area, while patch connectivity is less important in an urban context. This highlights the need for applying a landscape ecological approach to understand the mechanisms shaping urban biodiversity and underlines the potential of appropriate urban planning for mitigating biodiversity loss. © 2015 John Wiley & Sons Ltd.

  15. Identifying factors contributing to slow growth in pigs.

    Science.gov (United States)

    He, Y; Deen, J; Shurson, G C; Wang, L; Chen, C; Keisler, D H; Li, Y Z

    2016-05-01

    Pigs that grow slower than their contemporaries can cause complications for animal welfare and profitability. This study was conducted to investigate factors that may contribute to slow growth of pigs. Pigs ( = 440) farrowed by 65 sows were monitored from birth to market. Pigs were categorized as slow, average, and fast growers based on market weight adjusted to 170 d of age (slow growers were 125 kg). Blood samples were collected from 48 focal pigs at 9 and 21 wk of age and analyzed for hormone and free AA concentrations. Data were analyzed using the Mixed and Logistic procedures of SAS. Slow-growing pigs accounted for 10% of pigs marketed, average growers accounted for 49% of pigs marketed, and fast growers accounted for 41% of pigs marketed. Compared with fast growers, slow growers were lighter at birth ( ratio = 2.17, 95% confidence interval = 1.19 to 3.96, = 0.01). Litter size and parity of the pigs' dam were not associated with slow growth. These results suggest that low concentrations of IGF-1, insulin, leptin, and AA may contribute to or be associated with slow growth in pigs.

  16. Identifying high ability students: a contribution from neuropsychological indicators

    Directory of Open Access Journals (Sweden)

    Dora Cortat Simonetti

    2010-06-01

    Full Text Available This paper presents some data on the convergence between psychometric intelligence measurements (IQ tests and physiological signs of mental activity found in high ability adolescents. The research study focus on a small group of 15 subjects submitted to electric encephalograms, previously chosen from a larger group of 77 classmates on the basis of scores on the WISC-III IQ Test. The results suggest continuous predominance of Alpha waves for the gifted group (higher frequency percentile and higher amplitude what was not observed in the group without any superior intellectual ability. Even taking into account methodological limitations, this study may contribute to the understanding of a relationship between the intellectual quotient (IQ and alpha waves frequency and amplitude, as observed during performance on cognitive tasks. Such results may suggest a possibility to complement psychometric measures with encephalic registers in giftedness research studies.

  17. Identifying the contribution of different urban highway air pollution sources

    International Nuclear Information System (INIS)

    Peace, H.; Owen, B.; Raper, D.W.

    2004-01-01

    This paper describes the methodology and results, and draws conclusions from a large-scale source apportionment study undertaken in a large urban conurbation in the northwest of England. Annual average oxides of nitrogen (NOx) emission and ambient air pollution contributions have been estimated for road traffic sources. Ground level air pollution concentrations were estimated over a 1552-km 2 area with a resolution of up to 20 m, using emissions estimates and the second generation ADMS-Urban Gaussian dispersion model. Road traffic emissions were split into car and motorcycles; heavy and light goods vehicles; and buses to represent domestic users; commercial users and bus companies. Car related emissions were split further in to journey lengths under 3 km; journeys between 3 and 8 km; and journeys over 8 km to represent journeys which could be either walked or cycled; journeys for which a bus can easily be used and other journeys. These source sections were chosen so that the relevant authorities could target key groups in terms of reducing air pollution. The results confirm that the areas most likely to exceed air quality objectives are typically close to main arterial routes and close to urban centres and that the major culprits of road traffic related air pollution are goods vehicles and car journeys over 8 km. The paper also discusses the implications of the results and suggests how these can be used in the assessment of actions to reduce air pollution concentrations

  18. Identifying the contribution of different urban highway air pollution sources.

    Science.gov (United States)

    Peace, H; Owen, B; Raper, D W

    2004-12-01

    This paper describes the methodology and results, and draws conclusions from a large-scale source apportionment study undertaken in a large urban conurbation in the northwest of England. Annual average oxides of nitrogen (NOx) emission and ambient air pollution contributions have been estimated for road traffic sources. Ground level air pollution concentrations were estimated over a 1552-km(2) area with a resolution of up to 20 m, using emissions estimates and the second generation ADMS-Urban Gaussian dispersion model. Road traffic emissions were split into car and motorcycles; heavy and light goods vehicles; and buses to represent domestic users; commercial users and bus companies. Car related emissions were split further in to journey lengths under 3 km; journeys between 3 and 8 km; and journeys over 8 km to represent journeys which could be either walked or cycled; journeys for which a bus can easily be used and other journeys. These source sections were chosen so that the relevant authorities could target key groups in terms of reducing air pollution. The results confirm that the areas most likely to exceed air quality objectives are typically close to main arterial routes and close to urban centres and that the major culprits of road traffic related air pollution are goods vehicles and car journeys over 8 km. The paper also discusses the implications of the results and suggests how these can be used in the assessment of actions to reduce air pollution concentrations.

  19. The importance of values for brand purchase : A managerial contribution

    NARCIS (Netherlands)

    Voorn, Ronaldus Johannes Jan; van der Veen, Gerrita; van Rompay, Thomas Johannes Lucas; Hegner, Sabrina; Pruyn, Adriaan T.H.

    2017-01-01

    Consumers currently place increasing importance on the values that companies represent. Modern values such as transparency, benevolence to society, sustainability and fairness are becoming more relevant, as noted by many major consulting firms among which Nielsen (2013), the World Federation of

  20. Patient and carer identified factors which contribute to safety incidents in primary care: a qualitative study.

    Science.gov (United States)

    Hernan, Andrea L; Giles, Sally J; Fuller, Jeffrey; Johnson, Julie K; Walker, Christine; Dunbar, James A

    2015-09-01

    Patients can have an important role in reducing harm in primary-care settings. Learning from patient experience and feedback could improve patient safety. Evidence that captures patients' views of the various contributory factors to creating safe primary care is largely absent. The aim of this study was to address this evidence gap. Four focus groups and eight semistructured interviews were conducted with 34 patients and carers from south-east Australia. Participants were asked to describe their experiences of primary care. Audio recordings were transcribed verbatim and specific factors that contribute to safety incidents were identified in the analysis using the Yorkshire Contributory Factors Framework (YCFF). Other factors emerging from the data were also ascertained and added to the analytical framework. Thirteen factors that contribute to safety incidents in primary care were ascertained. Five unique factors for the primary-care setting were discovered in conjunction with eight factors present in the YCFF from hospital settings. The five unique primary care contributing factors to safety incidents represented a range of levels within the primary-care system from local working conditions to the upstream organisational level and the external policy context. The 13 factors included communication, access, patient factors, external policy context, dignity and respect, primary-secondary interface, continuity of care, task performance, task characteristics, time in the consultation, safety culture, team factors and the physical environment. Patient and carer feedback of this type could help primary-care professionals better understand and identify potential safety concerns and make appropriate service improvements. The comprehensive range of factors identified provides the groundwork for developing tools that systematically capture the multiple contributory factors to patient safety. Published by the BMJ Publishing Group Limited. For permission to use (where not

  1. CVExplorer: identifying candidate developers by mining and exploring their open source contributions.

    CSIR Research Space (South Africa)

    Greene, GJ

    2016-09-01

    Full Text Available Open source code contributions contain a large amount of technical skill information about developers, which can help to identify suitable candidates for a particular development job and therefore impact the success of a development team. We develop...

  2. Identify the Important Decision Factors of Online Shopping Adoption in Indonesia

    Directory of Open Access Journals (Sweden)

    Lailatul HIJRAH

    2017-12-01

    Full Text Available The objective of this study is to identify factors encouraging a consumer to engage in online shopping activities. The expected contribution of this study is for online entrepreneurs, in order to develop the most suitable business strategy, so that it will be clearly identified and sorted out which factors are the most important and the main motivation of Indonesian consumers to shop via online by using responses from respondents who usually shop online and offline in 3 cities in Indonesia, Jakarta, Surabaya and Samarinda. The research instruments were developed by conducting FGDs on relevant groups, either academics, online shopping activists, suppliers and courier businessmen in Jakarta, Surabaya and Samarinda Cities in effort to extract any information that encourages consumers to online shopping. After conducting FGD, the researcher produced 48 items proposed for factor analysis and after extracted to form eleven constructs, some items were removed because they had less loading factors. The eleven constructs or dimensions are trust, risk, consumer factors, website factors, price, service quality, convenience, subjective norm, product guarantee, variety of products and lifestyle. The implications of this study provide valuable insights about consumer decisions to online shopping or not online shopping.

  3. The Contribution of Qualitative Methods for Identifying the Educational Needs of Adults

    Science.gov (United States)

    Boz, Hayat; Dagli, Yakup

    2017-01-01

    This study addresses the contribution of applying qualitative research methods for identifying the educational activities planned for adults. The paper is based on the experience gained during in-depth interviews with 39 elderly and 33 middle-aged participants, by purposive sampling method and maximum variation technique, within a needs analysis…

  4. Methodology for identifying boundaries of systems important to safety in CANDU nuclear power plants

    International Nuclear Information System (INIS)

    Therrien, S.; Komljenovic, D.; Therrien, P.; Ruest, C.; Prevost, P.; Vaillancourt, R.

    2007-01-01

    This paper presents a methodology developed to identify the boundaries of the systems important to safety (SIS) at the Gentilly-2 Nuclear Power Plant (NPP), Hydro-Quebec. The SIS boundaries identification considers nuclear safety only. Components that are not identified as important to safety are systematically identified as related to safety. A global assessment process such as WANO/INPO AP-913 'Equipment Reliability Process' will be needed to implement adequate changes in the management rules of those components. The paper depicts results in applying the methodology to the Shutdown Systems 1 and 2 (SDS 1, 2), and to the Emergency Core Cooling System (ECCS). This validation process enabled fine tuning the methodology, performing a better estimate of the effort required to evaluate a system, and identifying components important to safety of these systems. (author)

  5. Genes Important for Schizosaccharomyces pombe Meiosis Identified Through a Functional Genomics Screen

    Science.gov (United States)

    Blyth, Julie; Makrantoni, Vasso; Barton, Rachael E.; Spanos, Christos; Rappsilber, Juri; Marston, Adele L.

    2018-01-01

    Meiosis is a specialized cell division that generates gametes, such as eggs and sperm. Errors in meiosis result in miscarriages and are the leading cause of birth defects; however, the molecular origins of these defects remain unknown. Studies in model organisms are beginning to identify the genes and pathways important for meiosis, but the parts list is still poorly defined. Here we present a comprehensive catalog of genes important for meiosis in the fission yeast, Schizosaccharomyces pombe. Our genome-wide functional screen surveyed all nonessential genes for roles in chromosome segregation and spore formation. Novel genes important at distinct stages of the meiotic chromosome segregation and differentiation program were identified. Preliminary characterization implicated three of these genes in centrosome/spindle pole body, centromere, and cohesion function. Our findings represent a near-complete parts list of genes important for meiosis in fission yeast, providing a valuable resource to advance our molecular understanding of meiosis. PMID:29259000

  6. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C. dubliniensis.

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, P.H.M.

    2003-01-01

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  7. Reducing uncertainty at minimal cost: a method to identify important input parameters and prioritize data collection

    NARCIS (Netherlands)

    Uwizeye, U.A.; Groen, E.A.; Gerber, P.J.; Schulte, Rogier P.O.; Boer, de I.J.M.

    2016-01-01

    The study aims to illustrate a method to identify important input parameters that explain most of the output variance ofenvironmental assessment models. The method is tested for the computation of life-cycle nitrogen (N) use efficiencyindicators among mixed dairy production systems in Rwanda. We

  8. The Importance of the Foreign Language Learning Contributing to World Peace

    Science.gov (United States)

    Sahin, Yusuf

    2011-01-01

    The aim of this paper is to determine the elements which hinder peace, and emphasize the importance of the contribution of foreign language learning to international peace. Language affects the thought and behavior of human beings. The attitude of a person knowing more than one language of a position is not the same as a person not knowing a…

  9. Genome-wide association study identified copy number variants important for appendicular lean mass.

    Science.gov (United States)

    Ran, Shu; Liu, Yong-Jun; Zhang, Lei; Pei, Yufang; Yang, Tie-Lin; Hai, Rong; Han, Ying-Ying; Lin, Yong; Tian, Qing; Deng, Hong-Wen

    2014-01-01

    Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM), is a heritable trait. Copy number variation (CNV) is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2) and 3.34×10(-3), respectively). In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2) and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1), which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL) gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.

  10. Genome-wide association study identified copy number variants important for appendicular lean mass.

    Directory of Open Access Journals (Sweden)

    Shu Ran

    Full Text Available Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM, is a heritable trait. Copy number variation (CNV is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2 and 3.34×10(-3, respectively. In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2 and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1, which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.

  11. A century of nuclear science. Important contributions of early generation Chinese physicist to nuclear science

    International Nuclear Information System (INIS)

    Zheng Chunkai; Xu Furong

    2003-01-01

    The great discoveries and applications of nuclear science have had tremendous impact on the progress and development of mankind over the last 100 years. In the 1920's to 1940's, many young Chinese who yearned to save the country through science and education went to west Europe and north America to study science, including physics. Studying and working with famous physicists throughout the world, they made many important contributions and discoveries in the development of nuclear science. This paper describes the historical contributions of the older generation of Chinese physicists to nuclear science

  12. Study of a methodology of identifying important research problems by the PIRT process

    International Nuclear Information System (INIS)

    Aoki, Takayuki; Takagi, Toshiyuki; Urayama, Ryoichi; Komura, Ichiro; Furukawa, Takashi; Yusa, Noritaka

    2014-01-01

    In this paper, we propose a new methodology of identifying important research problems to be solved to improve the performance of some specific scientific technologies by the phenomena identification and ranking table (PIRT) process which has been used as a methodology for demonstrating the validity of the best estimate simulation codes in US Nuclear Regulatory Commission (USNRC) licensing of nuclear power plants. The new methodology makes it possible to identify important factors affecting the performance of the technologies from the viewpoint of the figure of merit and problems associated with them while it keeps the fundamental concepts of the original PIRT process. Also in this paper, we demonstrate the effectiveness of the new methodology by applying it to a task of extracting research problems for improving an inspection accuracy of ultrasonic testing or eddy current testing in the inspection of objects having cracks due to fatigue or stress corrosion cracking. (author)

  13. Study of a methodology of identifying important research problems by the PIRT process

    International Nuclear Information System (INIS)

    Aoki, Takayuki; Takagi, Toshiyuki; Urayama, Ryoichi; Komura, Ichiro; Furukawa, Takashi; Yusa, Noritaka

    2013-01-01

    In this paper, we propose a new methodology of identifying important research problems to be solved to improve the performance of some specific scientific technologies by the phenomena identification and ranking table (PIRT) process, which has been used as a methodology for demonstrating the validity of the best estimate simulation codes in USNRC licensing of nuclear power plants. It keeps the fundamental concepts of the original PIRT process but makes it possible to identify important factors affecting the performance of the technologies from the viewpoint of the figure of merit and problems associated with them, which need to be solved to improve the performance. Also in this paper, we demonstrate the effectiveness of the developed method by showing a specific example of the application to physical events or phenomena in objects having fatigue or SCC crack(s) under ultrasonic testing and eddy current testing. (author)

  14. Resequencing 50 accessions of cultivated and wild rice yields markers for identifying agronomically important genes

    DEFF Research Database (Denmark)

    Xu, Xun; Liu, Xin; Ge, Song

    2012-01-01

    Rice is a staple crop that has undergone substantial phenotypic and physiological changes during domestication. Here we resequenced the genomes of 40 cultivated accessions selected from the major groups of rice and 10 accessions of their wild progenitors (Oryza rufipogon and Oryza nivara) to >15 x...... diversity in cultivated but not wild rice, which represent candidate regions selected during domestication. Some of these variants are associated with important biological features, whereas others have yet to be functionally characterized. The molecular markers we have identified should be valuable...... raw data coverage. We investigated genome-wide variation patterns in rice and obtained 6.5 million high-quality single nucleotide polymorphisms (SNPs) after excluding sites with missing data in any accession. Using these population SNP data, we identified thousands of genes with significantly lower...

  15. On the importance of identifying, characterizing, and predicting fundamental phenomena towards microbial electrochemistry applications.

    Science.gov (United States)

    Torres, César Iván

    2014-06-01

    The development of microbial electrochemistry research toward technological applications has increased significantly in the past years, leading to many process configurations. This short review focuses on the need to identify and characterize the fundamental phenomena that control the performance of microbial electrochemical cells (MXCs). Specifically, it discusses the importance of recent efforts to discover and characterize novel microorganisms for MXC applications, as well as recent developments to understand transport limitations in MXCs. As we increase our understanding of how MXCs operate, it is imperative to continue modeling efforts in order to effectively predict their performance, design efficient MXC technologies, and implement them commercially. Thus, the success of MXC technologies largely depends on the path of identifying, understanding, and predicting fundamental phenomena that determine MXC performance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. “Thanks for sharing”—Identifying users’ roles based on knowledge contribution in Enterprise Social Networks

    DEFF Research Database (Denmark)

    Cetto, Alexandra; Klier, Mathias; Richter, Alexander

    2018-01-01

    in the network and help others to get their work done. In this paper, we propose a new methodological approach consisting of three steps, namely “message classification”, “identification of users’ roles” as well as “characterization of users’ roles”. We apply the approach to a dataset from a multinational......, are a central element of the network. In conclusion, the development and application of a new methodological approach allows us to contribute to a more refined understanding of users’ knowledge exchanging behavior in Enterprise Social Networks which can ultimately help companies to take measures to improve......While ever more companies use Enterprise Social Networks for knowledge management, there is still a lack of understanding of users’ knowledge exchanging behavior. In this context, it is important to be able to identify and characterize users who contribute and communicate their knowledge...

  17. Statistical Analyses of Scatterplots to Identify Important Factors in Large-Scale Simulations

    Energy Technology Data Exchange (ETDEWEB)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-04-01

    The robustness of procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses is investigated. These procedures are based on attempts to detect increasingly complex patterns in the scatterplots under consideration and involve the identification of (1) linear relationships with correlation coefficients, (2) monotonic relationships with rank correlation coefficients, (3) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (4) trends in variability as defined by variances and interquartile ranges, and (5) deviations from randomness as defined by the chi-square statistic. The following two topics related to the robustness of these procedures are considered for a sequence of example analyses with a large model for two-phase fluid flow: the presence of Type I and Type II errors, and the stability of results obtained with independent Latin hypercube samples. Observations from analysis include: (1) Type I errors are unavoidable, (2) Type II errors can occur when inappropriate analysis procedures are used, (3) physical explanations should always be sought for why statistical procedures identify variables as being important, and (4) the identification of important variables tends to be stable for independent Latin hypercube samples.

  18. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae

    Directory of Open Access Journals (Sweden)

    Seong Hwan Park

    2013-01-01

    Full Text Available Identifying species of insects used to estimate postmortem interval (PMI is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science.

  19. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae)

    Science.gov (United States)

    Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon

    2013-01-01

    Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044

  20. Global sensitivity analysis for identifying important parameters of nitrogen nitrification and denitrification under model uncertainty and scenario uncertainty

    Science.gov (United States)

    Chen, Zhuowei; Shi, Liangsheng; Ye, Ming; Zhu, Yan; Yang, Jinzhong

    2018-06-01

    Nitrogen reactive transport modeling is subject to uncertainty in model parameters, structures, and scenarios. By using a new variance-based global sensitivity analysis method, this paper identifies important parameters for nitrogen reactive transport with simultaneous consideration of these three uncertainties. A combination of three scenarios of soil temperature and two scenarios of soil moisture creates a total of six scenarios. Four alternative models describing the effect of soil temperature and moisture content are used to evaluate the reduction functions used for calculating actual reaction rates. The results show that for nitrogen reactive transport problem, parameter importance varies substantially among different models and scenarios. Denitrification and nitrification process is sensitive to soil moisture content status rather than to the moisture function parameter. Nitrification process becomes more important at low moisture content and low temperature. However, the changing importance of nitrification activity with respect to temperature change highly relies on the selected model. Model-averaging is suggested to assess the nitrification (or denitrification) contribution by reducing the possible model error. Despite the introduction of biochemical heterogeneity or not, fairly consistent parameter importance rank is obtained in this study: optimal denitrification rate (Kden) is the most important parameter; reference temperature (Tr) is more important than temperature coefficient (Q10); empirical constant in moisture response function (m) is the least important one. Vertical distribution of soil moisture but not temperature plays predominant role controlling nitrogen reaction. This study provides insight into the nitrogen reactive transport modeling and demonstrates an effective strategy of selecting the important parameters when future temperature and soil moisture carry uncertainties or when modelers face with multiple ways of establishing nitrogen

  1. Genome-wide association study identifies a single major locus contributing to survival into old age; the APOE locus revisited

    DEFF Research Database (Denmark)

    Deelen, Joris; Beekman, Marian; Uh, Hae-Won

    2011-01-01

    By studying the loci which contribute to human longevity, we aim to identify mechanisms that contribute to healthy aging. To identify such loci, we performed a genome-wide association study (GWAS) comparing 403 unrelated nonagenarians from long-living families included in the Leiden Longevity Stu...

  2. Systematic reviews identify important methodological flaws in stroke rehabilitation therapy primary studies: review of reviews.

    Science.gov (United States)

    Santaguida, Pasqualina; Oremus, Mark; Walker, Kathryn; Wishart, Laurie R; Siegel, Karen Lohmann; Raina, Parminder

    2012-04-01

    A "review of reviews" was undertaken to assess methodological issues in studies evaluating nondrug rehabilitation interventions in stroke patients. MEDLINE, CINAHL, PsycINFO, and the Cochrane Database of Systematic Reviews were searched from January 2000 to January 2008 within the stroke rehabilitation setting. Electronic searches were supplemented by reviews of reference lists and citations identified by experts. Eligible studies were systematic reviews; excluded citations were narrative reviews or reviews of reviews. Review characteristics and criteria for assessing methodological quality of primary studies within them were extracted. The search yielded 949 English-language citations. We included a final set of 38 systematic reviews. Cochrane reviews, which have a standardized methodology, were generally of higher methodological quality than non-Cochrane reviews. Most systematic reviews used standardized quality assessment criteria for primary studies, but not all were comprehensive. Reviews showed that primary studies had problems with randomization, allocation concealment, and blinding. Baseline comparability, adverse events, and co-intervention or contamination were not consistently assessed. Blinding of patients and providers was often not feasible and was not evaluated as a source of bias. The eligible systematic reviews identified important methodological flaws in the evaluated primary studies, suggesting the need for improvement of research methods and reporting. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. Identifying Sources of Funding That Contribute to Scholastic Productivity in Academic Plastic Surgeons.

    Science.gov (United States)

    Ruan, Qing Zhao; Cohen, Justin B; Baek, Yoonji; Chen, Austin D; Doval, Andres F; Singhal, Dhruv; Fukudome, Eugene Y; Lin, Samuel J; Lee, Bernard T

    2018-04-01

    Scholastic productivity has previously been shown to be positively associated with National Institute of Health (NIH) grants and industry funding. This study examines whether society, industry, or federal funding contributes toward academic productivity as measured by scholastic output of academic plastic surgeons. Institution Web sites were used to acquire academic attributes of full-time academic plastic surgeons. The Center for Medicare and Medicaid Services Open Payment database, NIH reporter, the Plastic Surgery Foundation (PSF), and American Association of Plastic Surgeons (AAPS) Web sites were accessed for funding and endowment details. Bibliometric data of each surgeon were then collected via Scopus to ascertain strengths of association with each source. Multiple linear regression analysis was used to identify significant contributors to high scholastic output. We identified 935 academic plastic surgeons with 94 (10.1%), 24 (2.6%), 724 (77.4%), and 62 (6.6%) receiving funding from PSF, AAPS, industry, and NIH, respectively. There were positive correlations in receiving NIH, PSF, and/or AAPS funding (P funding was found to negatively associate with PSF (r = -0.75, P = 0.022) grants. The NIH R award was consistently found to be the most predictive of academic output across bibliometrics, followed by the AAPS academic scholarship award. Conventional measures of academic seniority remained predictive across all measures used. Our study demonstrates for the first time interactions between industry, federal, and association funding. The NIH R award was the strongest determinant of high scholastic productivity. Recognition through AAPS academic scholarships seemed to associate with subsequent success in NIH funding.

  4. Identifying selectively important amino acid positions associated with alternative habitat environments in fish mitochondrial genomes.

    Science.gov (United States)

    Xia, Jun Hong; Li, Hong Lian; Zhang, Yong; Meng, Zi Ning; Lin, Hao Ran

    2018-05-01

    Fish species inhabitating seawater (SW) or freshwater (FW) habitats have to develop genetic adaptations to alternative environment factors, especially salinity. Functional consequences of the protein variations associated with habitat environments in fish mitochondrial genomes have not yet received much attention. We analyzed 829 complete fish mitochondrial genomes and compared the amino acid differences of 13 mitochondrial protein families between FW and SW fish groups. We identified 47 specificity determining sites (SDS) that associated with FW or SW environments from 12 mitochondrial protein families. Thirty-two (68%) of the SDS sites are hydrophobic, 13 (28%) are neutral, and the remaining sites are acidic or basic. Seven of those SDS from ND1, ND2 and ND5 were scored as probably damaging to the protein structures. Furthermore, phylogenetic tree based Bayes Empirical Bayes analysis also detected 63 positive sites associated with alternative habitat environments across ten mtDNA proteins. These signatures could be important for studying mitochondrial genetic variation relevant to fish physiology and ecology.

  5. PCR-RFLP Method to Identify Salmonid Species of Economic Importance

    Directory of Open Access Journals (Sweden)

    Andreea Dudu

    2011-05-01

    Full Text Available The identification of different fish species by molecular methods has become necessary to avoid both the incorrect labelling of individuals involved in repopulation programmes and the commercial frauds on the fish market. Different fish species of great economical importance, like the salmonids, which are very much requested for their meat, can be identified using molecular techniques such as PCR-RFLP. The method is based on the amplification of a target region from the genome by PCR reaction followed by endonucleases digestion to detect the polymorphism of restriction fragments. In our study we analysed the following salmonid species from Romania: Salmo trutta fario, Salmo labrax, Salvelinus fontinalis, Onchorhynchus mykiss, Thymallus thymallus and Hucho hucho. In order to discriminate between the analysed species we amplified a fragment of mitochondrial genome comprising tRNAGlu/ cytochrome b/ tRNAThr/ tRNAPro/ D-loop/ tRNAPhe, followed by digestion with a specific restriction enzyme. The direct digestion of unpurified PCR products generated species-specific restriction patterns and proved to be a simple, reliable, inexpensive and fast method. Thus, it may be successfully utilized in specialized laboratories for the correct identification of the fish species for multiple purposes, including the traceability of fish food products.

  6. Identifying Important Atlantic Areas for the conservation of Balearic shearwaters: Spatial overlap with conservation areas

    Science.gov (United States)

    Pérez-Roda, Amparo; Delord, Karine; Boué, Amélie; Arcos, José Manuel; García, David; Micol, Thierry; Weimerskirch, Henri; Pinaud, David; Louzao, Maite

    2017-07-01

    Marine protected areas (MPAs) are considered one of the main tools in both fisheries and conservation management to protect threatened species and their habitats around the globe. However, MPAs are underrepresented in marine environments compared to terrestrial environments. Within this context, we studied the Atlantic non-breeding distribution of the southern population of Balearic shearwaters (Puffinus mauretanicus) breeding in Eivissa during the 2011-2012 period based on global location sensing (GLS) devices. Our objectives were (1) to identify overall Important Atlantic Areas (IAAs) from a southern population, (2) to describe spatio-temporal patterns of oceanographic habitat use, and (3) to assess whether existing conservation areas (Natura 2000 sites and marine Important Bird Areas (IBAs)) cover the main IAAs of Balearic shearwaters. Our results highlighted that the Atlantic staging (from June to October in 2011) dynamic of the southern population was driven by individual segregation at both spatial and temporal scales. Individuals ranged in the North-East Atlantic over four main IAAs (Bay of Biscay: BoB, Western Iberian shelf: WIS, Gulf of Cadiz: GoC, West of Morocco: WoM). While most individuals spent more time on the WIS or in the GoC, a small number of birds visited IAAs at the extremes of their Atlantic distribution range (i.e., BoB and WoM). The chronology of the arrivals to the IAAs showed a latitudinal gradient with northern areas reached earlier during the Atlantic staging. The IAAs coincided with the most productive areas (higher chlorophyll a values) in the NE Atlantic between July and October. The spatial overlap between IAAs and conservation areas was higher for Natura 2000 sites than marine IBAs (areas with and without legal protection, respectively). Concerning the use of these areas, a slightly higher proportion of estimated positions fell within marine IBAs compared to designated Natura 2000 sites, with Spanish and Portuguese conservation

  7. An untold story: The important contributions of Muslim scholars for the understanding of human anatomy.

    Science.gov (United States)

    Alghamdi, Malak A; Ziermann, Janine M; Diogo, Rui

    2017-06-01

    It is usually assumed that Galen is one of the fathers of anatomy and that between the Corpus Galenicum and the Renaissance there was no major advance in anatomical knowledge. However, it is also consensually accepted that Muslim scholars had the intellectual leadership from the 8th/9th to 13th centuries, and that they made remarkable progresses in numerous scientific fields including medicine. So, how is it possible that they did not contribute to advance human anatomy during that period? According to the dominant view, Muslim scholars exclusively had a passive role: their transmission of knowledge from the Greeks to the West. Here, we summarize, for the first time in a single paper, the studies of major Muslim scholars that published on human anatomy before Vesalius. This summary is based on analyses of original Arabic texts and of more recent publications by anatomists and historians, and on comparisons between the descriptions provided by Galen and by these Muslim scholars. We show that Arabic speakers and Persians made important advances in human anatomy well before Vesalius. The most notable exception concerns the muscular system: strikingly, there were apparently neither advances made by Muslims nor by Westerners for more than 1000 years. Unbiased discussions of these and other related issues, and particularly of the mainly untold story about the major contributions of Muslim scholars to anatomy, are crucial to our knowledge of the history of anatomy, biology and sciences, and also of our way of thinking, biases, and prejudices. Anat Rec, 300:986-1008, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  8. Identifying and Characterizing Important Trembling Aspen Competitors with Juvenile Lodgepole Pine in Three South-Central British Columbia Ecosystems

    Directory of Open Access Journals (Sweden)

    Teresa A. Newsome

    2012-01-01

    Full Text Available Critical height ratios for predicting competition between trembling aspen and lodgepole pine were identified in six juvenile stands in three south-central British Columbia ecosystems. We used a series of regression analyses predicting pine stem diameter from the density of neighbouring aspen in successively shorter relative height classes to identify the aspen-pine height ratio that maximized R2. Critical height ratios varied widely among sites when stands were 8–12 years old but, by age 14–19, had converged at 1.25–1.5. Maximum R2 values at age 14–19 ranged from 13.4% to 69.8%, demonstrating that the importance of aspen competition varied widely across a relatively small geographic range. Logistic regression also indicated that the risk of poor pine vigour in the presence of aspen varied between sites. Generally, the degree of competition, risk to pine vigour, and size of individual aspen contributing to the models declined along a gradient of decreasing ecosystem productivity.

  9. The contribution of nature to people: Applying concepts of values and properties to rate the management importance of natural elements.

    Science.gov (United States)

    Smith, Michael J; Wagner, Christian; Wallace, Ken J; Pourabdollah, Amir; Lewis, Loretta

    2016-06-15

    An important, and yet unresolved question in natural resource management is how best to manage natural elements and their associated values to ensure human wellbeing. Specifically, there is a lack of measurement tools to assess the contribution of nature to people. We present one approach to overcome this global issue and show that the preferred state of any system element, in terms of realising human values, is a function of element properties. Consequently, natural resource managers need to understand the nature of the relationships between element properties and values if they are to successfully manage for human wellbeing. In two case studies of applied planning, we demonstrate how to identify key element properties, quantify their relationships to priority human values, and combine this information to model the contribution of elements to human wellbeing. In one of the two case studies we also compared the modelling outputs with directly elicited stakeholder opinions regarding the importance of the elements for realising the given priority values. The two, largely congruent outputs provide additional support for the approach. The study shows that rating sets of elements on their relative overall value for human wellbeing, or utility, provides critical information for subsequent management decisions and a basis for productive new research. We consider that the described approach is broadly applicable within the domain of natural resource management. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  10. Genome wide association study identifies KCNMA1 contributing to human obesity

    DEFF Research Database (Denmark)

    Jiao, Hong; Arner, Peter; Hoffstedt, Johan

    2011-01-01

    Recent genome-wide association (GWA) analyses have identified common single nucleotide polymorphisms (SNPs) that are associated with obesity. However, the reported genetic variation in obesity explains only a minor fraction of the total genetic variation expected to be present in the population....... Thus many genetic variants controlling obesity remain to be identified. The aim of this study was to use GWA followed by multiple stepwise validations to identify additional genes associated with obesity....

  11. The Importance of Parenting and Financial Contributions in Promoting Fathers' Psychological Health

    Science.gov (United States)

    Schindler, Holly S.

    2010-01-01

    This study explores the relationship between residential, biological fathers' parental engagement, financial contributions, and psychological well-being in 2-parent families. Specifically, this study focuses on how fathers' parental engagement and financial contributions are related to their self-esteem, self-efficacy, and psychological distress.…

  12. Competence Description for Personal Recommendations: The Importance of Identifying the Complexity of Learning and Performance Situations

    Science.gov (United States)

    Prins, Frans J.; Nadolski, Rob J.; Berlanga, Adriana J.; Drachsler, Hendrik; Hummel, Hans G. K.; Koper, Rob

    2008-01-01

    For competences development of learners and professionals, target competences and corresponding competence development opportunities have to be identified. Personal Recommender Systems (PRS) provide personal recommendations for learners aimed at finding and selecting learning activities that best match their needs. This article argues that a…

  13. Identifying Important Career Indicators of Undergraduate Geoscience Students Upon Completion of Their Degree

    Science.gov (United States)

    Wilson, C. E.; Keane, C. M.; Houlton, H. R.

    2012-12-01

    The American Geosciences Institute (AGI) decided to create the National Geoscience Student Exit Survey in order to identify the initial pathways into the workforce for these graduating students, as well as assess their preparedness for entering the workforce upon graduation. The creation of this survey stemmed from a combination of experiences with the AGI/AGU Survey of Doctorates and discussions at the following Science Education Research Center (SERC) workshops: "Developing Pathways to Strong Programs for the Future", "Strengthening Your Geoscience Program", and "Assessing Geoscience Programs". These events identified distinct gaps in understanding the experiences and perspectives of geoscience students during one of their most profound professional transitions. Therefore, the idea for the survey arose as a way to evaluate how the discipline is preparing and educating students, as well as identifying the students' desired career paths. The discussions at the workshops solidified the need for this survey and created the initial framework for the first pilot of the survey. The purpose of this assessment tool is to evaluate student preparedness for entering the geosciences workforce; identify student decision points for entering geosciences fields and remaining in the geosciences workforce; identify geosciences fields that students pursue in undergraduate and graduate school; collect information on students' expected career trajectories and geosciences professions; identify geosciences career sectors that are hiring new graduates; collect information about salary projections; overall effectiveness of geosciences departments regionally and nationally; demonstrate the value of geosciences degrees to future students, the institutions, and employers; and establish a benchmark to perform longitudinal studies of geosciences graduates to understand their career pathways and impacts of their educational experiences on these decisions. AGI's Student Exit Survey went through

  14. Presence of polybrominated diphenyl ethers in Spanish sewage sludges. Important contribution of deca-BDE

    Energy Technology Data Exchange (ETDEWEB)

    Fabrellas, B.; Larrazabal, D.; Martinez, M.A. [CIEMAT, Madrid (Spain); Eljarrat, E.; Barcelo, D. [I.I.Q.A.B., C.S.I.C, Barcelona (Spain)

    2004-09-15

    Introduction Polybrominated diphenyl ethers (PBDE) are a family of synthetic chemicals widely used in industry to delay, inhibit or even suppress combustion process in manufactured items. Flame retardant products are frequently added into plastic, electronic, paint and textile materials to reduce the risk of ignition. During last years, increasing levels of PBDE have been detected in the environment, suggesting release from the treated surface as main pathway for environmental intake. Their physicochemical structure make them substances of highly lypophylic, bioaccumulative and persistent nature, with potential toxic effects observed onto wildlife and humans. Some European countries (Switzerland and Sweden) have promoted strategies to enlarge the knowledge of PBDE, in particular their occurrence and levels on sewage sludge. Observations point domestic washing of garment/clothes and industrial discharges from plastic and textile manufacture industry as major sources of contamination. First European results from 1988 revealed levels of about 20-30 {mu}g/kg dw of PBDEs (BDEs 47, 99 and 100) in sludge samples collected in Sweden. More recently, another Swedish survey conducted on three waste-water treatment facilities pointed levels of PBDE (BDE 47, 99 and 209) of about 200 ng/g dw, along with minor contribution of other contaminants such as TBBPA and HBCD iv. Few studies have been carried out in US. Hale et al. compared levels of Tetra-, PentaBDE (BDE 47, BDE 99 and BDE 100) and DecaBDE 209 congeners in sludge from different US locations. Values ranged from 1000 to 2290 {mu}g/kg dw (Tri- to HexaBDE) and from 84 to 4890 {mu}g/kg dw for DecaBDE 209, with mean values of about 1600 and 1000 {mu}g/kg dw, respectively. In general, concentrations of BDE 47, 99, 100 and 209 exceeded those of the major PCB congeners and other halogenated contaminants also found in the sludge. Following this trend, this work aims a preliminary assessment of selected PBDE congener levels on

  15. Identifying faecal impaction is important for ensuring the timely diagnosis of childhood functional constipation

    DEFF Research Database (Denmark)

    Modin, Line; Walsted, Anne-Mette; Jakobsen, Marianne Skytte

    2015-01-01

    AIM: Most research on functional constipation has been carried out at a tertiary level. We focused this study on a secondary-level hospital outpatients' department, assessing the distribution of diagnostic criteria for childhood functional constipation and evaluating the consequences of current...... diagnostic practice based on current guidelines. METHODS: We enrolled 235 children, aged two to 16 years of age, with functional constipation according to the Rome III criteria and assessed them using medical histories and physical examinations, including rectal examinations and ultrasound measurements...... the timely diagnosis of childhood functional constipation at the secondary care level. Ultrasound examination proved a reliable alternative to rectal examination or abdominal radiography when identifying faecal impaction....

  16. Exome sequencing of a large family identifies potential candidate genes contributing risk to bipolar disorder.

    Science.gov (United States)

    Zhang, Tianxiao; Hou, Liping; Chen, David T; McMahon, Francis J; Wang, Jen-Chyong; Rice, John P

    2018-03-01

    Bipolar disorder is a mental illness with lifetime prevalence of about 1%. Previous genetic studies have identified multiple chromosomal linkage regions and candidate genes that might be associated with bipolar disorder. The present study aimed to identify potential susceptibility variants for bipolar disorder using 6 related case samples from a four-generation family. A combination of exome sequencing and linkage analysis was performed to identify potential susceptibility variants for bipolar disorder. Our study identified a list of five potential candidate genes for bipolar disorder. Among these five genes, GRID1(Glutamate Receptor Delta-1 Subunit), which was previously reported to be associated with several psychiatric disorders and brain related traits, is particularly interesting. Variants with functional significance in this gene were identified from two cousins in our bipolar disorder pedigree. Our findings suggest a potential role for these genes and the related rare variants in the onset and development of bipolar disorder in this one family. Additional research is needed to replicate these findings and evaluate their patho-biological significance. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Contribution of WUSCHEL-related homeobox (WOX genes to identify the phylogenetic relationships among Petunia species

    Directory of Open Access Journals (Sweden)

    Ana Lúcia Anversa Segatto

    Full Text Available Abstract Developmental genes are believed to contribute to major changes during plant evolution, from infrageneric to higher levels. Due to their putative high sequence conservation, developmental genes are rarely used as molecular markers, and few studies including these sequences at low taxonomic levels exist. WUSCHEL-related homeobox genes (WOX are transcription factors exclusively present in plants and are involved in developmental processes. In this study, we characterized the infrageneric genetic variation of Petunia WOX genes. We obtained phylogenetic relationships consistent with other phylogenies based on nuclear markers, but with higher statistical support, resolution in terminals, and compatibility with flower morphological changes.

  18. Remembering the past and imagining the future: Identifying and enhancing the contribution of episodic memory

    Science.gov (United States)

    Schacter, Daniel L; Madore, Kevin P

    2016-01-01

    Recent studies have shown that imagining or simulating future events relies on many of the same cognitive and neural processes as remembering past events. According to the constructive episodic simulation hypothesis (Schacter and Addis, 2007), such overlap indicates that both remembered past and imagined future events rely heavily on episodic memory: future simulations are built on retrieved details of specific past experiences that are recombined into novel events. An alternative possibility is that commonalities between remembering and imagining reflect the influence of more general, non-episodic factors such as narrative style or communicative goals that shape the expression of both memory and imagination. We consider recent studies that distinguish the contributions of episodic and non-episodic processes in remembering the past and imagining the future by using an episodic specificity induction – brief training in recollecting the details of a past experience – and also extend this approach to the domains of problem solving and creative thinking. We conclude by suggesting that the specificity induction may target a process of scene construction that contributes to episodic memory as well as to imagination, problem solving, and creative thinking. PMID:28163775

  19. Identifying temporal and causal contributions of neural processes underlying the Implicit Association Test (IAT

    Directory of Open Access Journals (Sweden)

    Chad Edward Forbes

    2012-11-01

    Full Text Available The Implicit Association Test (IAT is a popular behavioral measure that assesses the associative strength between outgroup members and stereotypical and counterstereotypical traits. Less is known, however, about the degree to which the IAT reflects automatic processing. Two studies examined automatic processing contributions to a gender-IAT using a data driven, social neuroscience approach. Performance on congruent (e.g., categorizing male names with synonyms of strength and incongruent (e.g., categorizing female names with synonyms of strength IAT blocks were separately analyzed using EEG (event-related potentials, or ERPs, and coherence; Study 1 and lesion (Study 2 methodologies. Compared to incongruent blocks, performance on congruent IAT blocks was associated with more positive ERPs that manifested in frontal and occipital regions at automatic processing speeds, occipital regions at more controlled processing speeds and was compromised by volume loss in the anterior temporal lobe, insula and medial PFC. Performance on incongruent blocks was associated with volume loss in supplementary motor areas, cingulate gyrus and a region in medial PFC similar to that found for congruent blocks. Greater coherence was found between frontal and occipital regions to the extent individuals exhibited more bias. This suggests there are separable neural contributions to congruent and incongruent blocks of the IAT but there is also a surprising amount of overlap. Given the temporal and regional neural distinctions, these results provide converging evidence that stereotypic associative strength assessed by the IAT indexes automatic processing to a degree.

  20. Identifying specific prefrontal neurons that contribute to autism-associated abnormalities in physiology and social behavior

    DEFF Research Database (Denmark)

    Brumback, A C; Ellwood, I T; Kjaerby, C

    2017-01-01

    Functional imaging and gene expression studies both implicate the medial prefrontal cortex (mPFC), particularly deep-layer projection neurons, as a potential locus for autism pathology. Here, we explored how specific deep-layer prefrontal neurons contribute to abnormal physiology and behavior...... in mouse models of autism. First, we find that across three etiologically distinct models-in utero valproic acid (VPA) exposure, CNTNAP2 knockout and FMR1 knockout-layer 5 subcortically projecting (SC) neurons consistently exhibit reduced input resistance and action potential firing. To explore how altered...... SC neuron physiology might impact behavior, we took advantage of the fact that in deep layers of the mPFC, dopamine D2 receptors (D2Rs) are mainly expressed by SC neurons, and used D2-Cre mice to label D2R+ neurons for calcium imaging or optogenetics. We found that social exploration preferentially...

  1. The Concept of "Ubuntu": Africa's Most Important Contribution to Multicultural Education?

    Science.gov (United States)

    Le Roux, Johann

    2000-01-01

    Examines the African concept of "ubuntu", which indicates an inner state of almost complete humanization and is the essence of community and commonality. Discusses how ubuntu could contribute to multi-cultural education. Central to the concept of ubuntu, and much like the philosophy underlying multi-cultural education, is that caring for…

  2. A case study of identify importance of land use planning in road safety, Benidorm

    Energy Technology Data Exchange (ETDEWEB)

    Casares Blanco, J.; Sanchez Galiano, J.C.; Fernandez Aracil, P.; Ortuño Padilla, A.

    2016-07-01

    This research analyses how urban form, land use and urban density, may influence the incidence of traffic-related crashes injuries and deaths. It begins with a theoretical overview of studies which deal with the study of the relationship between urban patterns and road safety. Next, it details the development of a database of crash incidence and urban form at the district level for the city of Benidorm (Alicante, Spain) in 2010. Subsequently, it is developed a negative binomial approach for intra-city motor vehicle crash analysis. One-year crash data for Benidorm (the fourth largest tourism destination of Spain, after Barcelona, Madrid and San Bartolomé de Tirajana, and exclusively tourist-oriented city) are analyzed using a geographic information system (GIS) to generate relevant inputs for the analysis. In general, the study finds that a strong land use mix results on fewer road accidents, whereas accidents are more common but less severe in areas of high urban density. Finally, pedestrian accidents research showed that rural and low density environment is related to an important road accident numbers unlike tourism-oriented zones, much more safe for them. Based on these findings, the paper discusses the implications for urban design practice. (Author)

  3. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  4. Promoting wellbeing in young unemployed adults: the importance of identifying meaningful patterns of time use.

    Science.gov (United States)

    Scanlan, Justin Newton; Bundy, Anita C; Matthews, Lynda R

    2011-04-01

    This study set out to explore the differences in time use between 'unemployed', 'unemployed but in education' and part-time and full-time employed 18- to 25-year-old Australians. Unemployed individuals generally experience poor health and this may be related to the way they use their time. Activity-based interventions may be one health-promoting strategy. This knowledge is important for all occupational therapists, as many service users are likely to be unemployed. Time use of unemployed 18- to 25-year-olds (measured using the Modified Occupational Questionnaire) was compared with the time use of part- and full-time employed 18- to 25-year-olds (from the 2006 Australian Time Use Survey). Individuals in the 'unemployed' groups spent significantly less time engaged in work-related activities than their employed peers. This time was reallocated mainly to recreation and leisure and household work (for both men and women) and child care and sleeping (women only). Recreation and leisure activities were generally passive, home-based activities such as watching television or 'doing nothing'. Individuals in the 'unemployed but in education' groups also spent less time in employment-related activities, but the majority of this time was reallocated to education activities. Individuals in the 'unemployed' groups spent large amounts of time engaged in potentially non-directed use of time (e.g. watching television or 'doing nothing'). Such patterns of time use have previously been associated with poor health. To support the health of unemployed individuals more effectively, occupational therapy interventions must focus on enhancing the quality of time use for this population. © 2010 The Authors. Australian Occupational Therapy Journal © 2010 Australian Association of Occupational Therapists.

  5. Using a Delphi Method to Identify Human Factors Contributing to Nursing Errors.

    Science.gov (United States)

    Roth, Cheryl; Brewer, Melanie; Wieck, K Lynn

    2017-07-01

    The purpose of this study was to identify human factors associated with nursing errors. Using a Delphi technique, this study used feedback from a panel of nurse experts (n = 25) on an initial qualitative survey questionnaire followed by summarizing the results with feedback and confirmation. Synthesized factors regarding causes of errors were incorporated into a quantitative Likert-type scale, and the original expert panel participants were queried a second time to validate responses. The list identified 24 items as most common causes of nursing errors, including swamping and errors made by others that nurses are expected to recognize and fix. The responses provided a consensus top 10 errors list based on means with heavy workload and fatigue at the top of the list. The use of the Delphi survey established consensus and developed a platform upon which future study of nursing errors can evolve as a link to future solutions. This list of human factors in nursing errors should serve to stimulate dialogue among nurses about how to prevent errors and improve outcomes. Human and system failures have been the subject of an abundance of research, yet nursing errors continue to occur. © 2016 Wiley Periodicals, Inc.

  6. Protecting Important Sites for Biodiversity Contributes to Meeting Global Conservation Targets

    Science.gov (United States)

    Butchart, Stuart H. M.; Scharlemann, Jörn P. W.; Evans, Mike I.; Quader, Suhel; Aricò, Salvatore; Arinaitwe, Julius; Balman, Mark; Bennun, Leon A.; Bertzky, Bastian; Besançon, Charles; Boucher, Timothy M.; Brooks, Thomas M.; Burfield, Ian J.; Burgess, Neil D.; Chan, Simba; Clay, Rob P.; Crosby, Mike J.; Davidson, Nicholas C.; De Silva, Naamal; Devenish, Christian; Dutson, Guy C. L.; Fernández, David F. Día z; Fishpool, Lincoln D. C.; Fitzgerald, Claire; Foster, Matt; Heath, Melanie F.; Hockings, Marc; Hoffmann, Michael; Knox, David; Larsen, Frank W.; Lamoreux, John F.; Loucks, Colby; May, Ian; Millett, James; Molloy, Dominic; Morling, Paul; Parr, Mike; Ricketts, Taylor H.; Seddon, Nathalie; Skolnik, Benjamin; Stuart, Simon N.; Upgren, Amy; Woodley, Stephen

    2012-01-01

    Protected areas (PAs) are a cornerstone of conservation efforts and now cover nearly 13% of the world's land surface, with the world's governments committed to expand this to 17%. However, as biodiversity continues to decline, the effectiveness of PAs in reducing the extinction risk of species remains largely untested. We analyzed PA coverage and trends in species' extinction risk at globally significant sites for conserving birds (10,993 Important Bird Areas, IBAs) and highly threatened vertebrates and conifers (588 Alliance for Zero Extinction sites, AZEs) (referred to collectively hereafter as ‘important sites’). Species occurring in important sites with greater PA coverage experienced smaller increases in extinction risk over recent decades: the increase was half as large for bird species with>50% of the IBAs at which they occur completely covered by PAs, and a third lower for birds, mammals and amphibians restricted to protected AZEs (compared with unprotected or partially protected sites). Globally, half of the important sites for biodiversity conservation remain unprotected (49% of IBAs, 51% of AZEs). While PA coverage of important sites has increased over time, the proportion of PA area covering important sites, as opposed to less important land, has declined (by 0.45–1.14% annually since 1950 for IBAs and 0.79–1.49% annually for AZEs). Thus, while appropriately located PAs may slow the rate at which species are driven towards extinction, recent PA network expansion has under-represented important sites. We conclude that better targeted expansion of PA networks would help to improve biodiversity trends. PMID:22457717

  7. Protecting important sites for biodiversity contributes to meeting global conservation targets.

    Directory of Open Access Journals (Sweden)

    Stuart H M Butchart

    Full Text Available Protected areas (PAs are a cornerstone of conservation efforts and now cover nearly 13% of the world's land surface, with the world's governments committed to expand this to 17%. However, as biodiversity continues to decline, the effectiveness of PAs in reducing the extinction risk of species remains largely untested. We analyzed PA coverage and trends in species' extinction risk at globally significant sites for conserving birds (10,993 Important Bird Areas, IBAs and highly threatened vertebrates and conifers (588 Alliance for Zero Extinction sites, AZEs (referred to collectively hereafter as 'important sites'. Species occurring in important sites with greater PA coverage experienced smaller increases in extinction risk over recent decades: the increase was half as large for bird species with>50% of the IBAs at which they occur completely covered by PAs, and a third lower for birds, mammals and amphibians restricted to protected AZEs (compared with unprotected or partially protected sites. Globally, half of the important sites for biodiversity conservation remain unprotected (49% of IBAs, 51% of AZEs. While PA coverage of important sites has increased over time, the proportion of PA area covering important sites, as opposed to less important land, has declined (by 0.45-1.14% annually since 1950 for IBAs and 0.79-1.49% annually for AZEs. Thus, while appropriately located PAs may slow the rate at which species are driven towards extinction, recent PA network expansion has under-represented important sites. We conclude that better targeted expansion of PA networks would help to improve biodiversity trends.

  8. The Importance of Cholesterol in Psychopathology: A Review of Recent Contributions.

    Science.gov (United States)

    Pereira, Henrique

    2017-01-01

    The aim of this study was to describe systematically recent studies that show the importance of cholesterol in psychopathology. This study was a review. The following databases were searched for relevant published articles on human studies: MEDLINE, Web of Science, EBSCOhost Academic Search Complete, and Psychology and Behavioral Sciences Collection (papers from January 2012 to March 2016). Eighteen recent papers were selected, and thematic dimensions showing correlations between cholesterol and behavioral and psychopathological variables were depression, suicide, personality, and aggression. This paper demonstrates that recent research corroborates the idea that cholesterol plays an important role in governing behavior and psychopathology in humans. Deepening the studies in this field could be a promising avenue for future research, with implications for treating people with behavior or mental health problems.

  9. Long-Term Cognitive Outcomes of Birth Asphyxia and the Contribution of Identified Perinatal Asphyxia to Cerebral Palsy.

    Science.gov (United States)

    Pappas, Athina; Korzeniewski, Steven J

    2016-09-01

    Neonatal encephalopathy among survivors of presumed perinatal asphyxia is recognized as an important cause of cerebral palsy (CP) and neuromotor impairment. Recent studies suggest that moderate to severe neonatal encephalopathy contributes to a wide range of neurodevelopmental and cognitive impairments among survivors with and without CP. Nearly 1 of every 4 to 5 neonates treated with hypothermia has or develops CP. Neonatal encephalopathy is diagnosed in only approximately 10% of all cases. This article reviews the long-term cognitive outcomes of children with presumed birth asphyxia and describes what is known about its contribution to CP. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. The alternative energies, its contribution, importance and projections in the Country

    International Nuclear Information System (INIS)

    Rodriguez P, F.

    1995-01-01

    Colombia is an energetic country, each one of regions have large potentials of at least both renewable or not renewable resources. With the objective of avoiding energetic crisis in the future, different energetic planning studies guided to the development of a sustainable energetic system, evaluations of resource potentials energetic and the technologies development to future applications, must be accomplished. These investigations, they are function of the UPME (Unit of planning of mines and energies), but are considered that the regional entities with the participation of their communities, they should play a role important in this process and on decisions that are taken

  11. Putrescine importer PlaP contributes to swarming motility and urothelial cell invasion in Proteus mirabilis.

    Science.gov (United States)

    Kurihara, Shin; Sakai, Yumi; Suzuki, Hideyuki; Muth, Aaron; Phanstiel, Otto; Rather, Philip N

    2013-05-31

    Previously, we reported that the speA gene, encoding arginine decarboxylase, is required for swarming in the urinary tract pathogen Proteus mirabilis. In addition, this previous study suggested that putrescine may act as a cell-to-cell signaling molecule (Sturgill, G., and Rather, P. N. (2004) Mol. Microbiol. 51, 437-446). In this new study, PlaP, a putative putrescine importer, was characterized in P. mirabilis. In a wild-type background, a plaP null mutation resulted in a modest swarming defect and slightly decreased levels of intracellular putrescine. In a P. mirabilis speA mutant with greatly reduced levels of intracellular putrescine, plaP was required for the putrescine-dependent rescue of swarming motility. When a speA/plaP double mutant was grown in the presence of extracellular putrescine, the intracellular levels of putrescine were greatly reduced compared with the speA mutant alone, indicating that PlaP functioned as the primary putrescine importer. In urothelial cell invasion assays, a speA mutant exhibited a 50% reduction in invasion when compared with wild type, and this defect could be restored by putrescine in a PlaP-dependent manner. The putrescine analog Triamide-44 partially inhibited the uptake of putrescine by PlaP and decreased both putrescine stimulated swarming and urothelial cell invasion in a speA mutant.

  12. Hot and Cool Executive Functions in Adolescence: Development and Contributions to Important Developmental Outcomes

    Science.gov (United States)

    Poon, Kean

    2018-01-01

    Despite significant theoretical advancement in the area of child neuropsychology, limited attention has been paid to the developmental features of adolescence. The present study intends to address this issue in relation to executive function (EF). EF refers to the psychological processes that underlie goal-directed behavior; recent studies separate cool EF (psychological process involves pure logic and critical analysis) and hot EF (psychological process driven by emotion). Although neurological findings suggest that adolescence is a sensitive period for EF development, data on comparing the developmental progression in hot or cool EFs is highly missing. Moreover, while evidence has confirmed the relationships between EF and day-to-day functioning, whether and how hot and cool EFs contribute to core developmental outcomes in adolescence is still remained unknown. The current study aims to enhance our understanding of the development and impacts of hot and cool EFs in adolescence. A total of 136 typically developing adolescents from age 12 to 17 completed four cool EF tasks including Backward digit span, Contingency naming test, Stockings of Cambridge, and Stroop Color and Word test, and one hot task on Cambridge gambling task. Data on academic performance and psychological adjustment was also collected. Results showed that cool and hot EF exhibited different patterns of age-related growth in adolescence. Specifically, cool EF ascended with age while hot EF showed a bell-shaped development. Moreover, there were correlations among cool EF measures but no association between cool and hot EFs. Further, cool EF was a better predictor of academic performance, while hot EF uniquely related to emotional problems. The results provide evidence for the association among cool EF tests and the differentiation of hot and cool EFs. The bell-shaped development of hot EF might suggest a period of heightened risk-taking propensity in middle adolescence. Given the plastic nature of

  13. Hot and Cool Executive Functions in Adolescence: Development and Contributions to Important Developmental Outcomes

    Directory of Open Access Journals (Sweden)

    Kean Poon

    2018-01-01

    Full Text Available Despite significant theoretical advancement in the area of child neuropsychology, limited attention has been paid to the developmental features of adolescence. The present study intends to address this issue in relation to executive function (EF. EF refers to the psychological processes that underlie goal-directed behavior; recent studies separate cool EF (psychological process involves pure logic and critical analysis and hot EF (psychological process driven by emotion. Although neurological findings suggest that adolescence is a sensitive period for EF development, data on comparing the developmental progression in hot or cool EFs is highly missing. Moreover, while evidence has confirmed the relationships between EF and day-to-day functioning, whether and how hot and cool EFs contribute to core developmental outcomes in adolescence is still remained unknown. The current study aims to enhance our understanding of the development and impacts of hot and cool EFs in adolescence. A total of 136 typically developing adolescents from age 12 to 17 completed four cool EF tasks including Backward digit span, Contingency naming test, Stockings of Cambridge, and Stroop Color and Word test, and one hot task on Cambridge gambling task. Data on academic performance and psychological adjustment was also collected. Results showed that cool and hot EF exhibited different patterns of age-related growth in adolescence. Specifically, cool EF ascended with age while hot EF showed a bell-shaped development. Moreover, there were correlations among cool EF measures but no association between cool and hot EFs. Further, cool EF was a better predictor of academic performance, while hot EF uniquely related to emotional problems. The results provide evidence for the association among cool EF tests and the differentiation of hot and cool EFs. The bell-shaped development of hot EF might suggest a period of heightened risk-taking propensity in middle adolescence. Given the

  14. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C-dubliniensis

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, PHM

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  15. The hierarchy-by-interval approach to identifying important models that need improvement in severe-accident simulation codes

    International Nuclear Information System (INIS)

    Heames, T.J.; Khatib-Rahbar, M.; Kelly, J.E.

    1995-01-01

    The hierarchy-by-interval (HBI) methodology was developed to determine an appropriate phenomena identification and ranking table for an independent peer review of severe-accident computer codes. The methodology is described, and the results of a specific code review are presented. Use of this systematic and structured approach ensures that important code models that need improvement are identified and prioritized, which allows code sponsors to more effectively direct limited resources in future code development. In addition, critical phenomenological areas that need more fundamental work, such as experimentation, are identified

  16. Study of rare neutron induced processes and coincidence analyses to identify and reduce background contributions in the COBRA experiment

    International Nuclear Information System (INIS)

    Timm, Jan Horst Karl

    2015-11-01

    The aim of the COBRA experiment is the observation of neutrinoless double-beta decay, primarily of the isotope 116 Cd. The applied semiconductor detectors of cadmium zinc telluride that are 90% to be enriched enable both the detection and the source of this decay. The half-lives of decays of this kind are expected in the range of more than 10 26 years. Therefore, the reduction of contributions to the background is of decisive importance. The main subjects of this work are, on the one hand, the time synchronization of the data, which provides the basis for coincidence analysis. This analysis method has access not only to identification of contributions to the background, but also to observe decays involving positron annihilation and decays into excited states. In this study, the intrinsic detector contamination of some decay products of 238 U and 232 Th was measured and sensitivities to the half-lives of the decays like 120 Te and 128 Te in each case to the first excited state of daughter products are given. On the other hand, qualitative studies on the importance of neutrons in the COBRA experiment were conducted. These have shown that fast neutrons, thus with energies greater than 10 keV, only result in an insignificant contribution to the background for the detection of neutrinoless double-beta decay of the 116 Cd. Previous studies have also shown that the thermal neutron flux can be in situ determined by coincidence analysis.

  17. Imaging-Based Screen Identifies Laminin 411 as a Physiologically Relevant Niche Factor with Importance for i-Hep Applications

    Directory of Open Access Journals (Sweden)

    John Ong

    2018-03-01

    Full Text Available Summary: Use of hepatocytes derived from induced pluripotent stem cells (i-Heps is limited by their functional differences in comparison with primary cells. Extracellular niche factors likely play a critical role in bridging this gap. Using image-based characterization (high content analysis; HCA of freshly isolated hepatocytes from 17 human donors, we devised and validated an algorithm (Hepatocyte Likeness Index; HLI for comparing the hepatic properties of cells against a physiological gold standard. The HLI was then applied in a targeted screen of extracellular niche factors to identify substrates driving i-Heps closer to the standard. Laminin 411, the top hit, was validated in two additional induced pluripotent stem cell (iPSC lines, primary tissue, and an in vitro model of α1-antitrypsin deficiency. Cumulatively, these data provide a reference method to control and screen for i-Hep differentiation, identify Laminin 411 as a key niche protein, and underscore the importance of combining substrates, soluble factors, and HCA when developing iPSC applications. : Rashid and colleagues demonstrate the utility of a high-throughput imaging platform for identification of physiologically relevant extracellular niche factors to advance i-Heps closer to their primary tissue counterparts. The extracellular matrix (ECM protein screen identified Laminin 411 as an important niche factor facilitating i-Hep-based disease modeling in vitro. Keywords: iPS hepatocytes, extracellular niche, image-based screening, disease modeling, laminin

  18. NRC Information No. 90-01: Importance of proper response to self-identified violations by licensees

    International Nuclear Information System (INIS)

    Cunningham, R.E.

    1992-01-01

    NRC expects a high standard of compliance by its licensees and requires that licensees provide NRC accurate and complete information and that required records will also be complete and accurate in all material respects. Licensees should be aware of the importance placed by NRC on licensee programs for self detection, correction and reporting of violations or errors related to regulatory requirements. The General Statement of Policy and Procedures for NRC Enforcement Actions in Appendix C to 10 CFR Part 2 underscores the importance of licensees responding promptly and properly to self-identified violations in two ways. It is suggested that when a licensee identifies a violation involving an NRC-required record, the licensee should make a dated notation indicating identification, either on the record itself or other appropriate documentation retrievable for NRC review. The record with the self-identified violation noted should not be altered in any way to mask the correction. The licensee should determine the cause of the violation, correct the root cause of the violation, and document such findings in an appropriate manner. Licensees should also assure that if a report of the violation is required, the report is submitted to NRC in a timely manner. These actions will be considered by NRC in making any enforcement decision, and generally lead to lesser or no civil penalty

  19. Growth and contribution of stocked channel catfish, Ictalurus punctatus (Rafinesque, 1818): the importance of measuring post-stocking performance

    Science.gov (United States)

    Stewart, David R.; Long, James M.

    2015-01-01

    In this study it was sought to quantify post-stocking growth, survival, and contribution of advanced size (178 mm total length [TL]) channel catfish Ictalurus punctatus fingerlings, something rarely done. Channel catfish populations were evaluated before (May 2010) and after (May to August 2011 and 2012) stocking. Relative abundance, stocking contribution, and growth were different (P stocked in Lake Lone Chimney, stocking contribution was lower (3–35%), and average length and weight of stocked fish by age-2 reached 230 mm TL and 85 g, whereas the stocking contribution (84–98%) and growth in length (340 mm TL) and weight (280 g) were higher by age-2 in Lake Greenleaf. Given these unambiguous differences of post-stocking performance, benchmark metrics that represent population-level information such as relative abundance and average length and weight of the sample masked these significant differences, highlighting the importance of marking hatchery-fish and then following them through time to determine the effectiveness of stocking. These results suggest that stock enhancement programmes would benefit from studies that quantify post-stocking performance of hatchery fish.

  20. Statistical analyses of scatterplots to identify important factors in large-scale simulations, 1: Review and comparison of techniques

    International Nuclear Information System (INIS)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-01-01

    Procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses are described and illustrated. These procedures attempt to detect increasingly complex patterns in scatterplots and involve the identification of (i) linear relationships with correlation coefficients, (ii) monotonic relationships with rank correlation coefficients, (iii) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (iv) trends in variability as defined by variances and interquartile ranges, and (v) deviations from randomness as defined by the chi-square statistic. A sequence of example analyses with a large model for two-phase fluid flow illustrates how the individual procedures can differ in the variables that they identify as having effects on particular model outcomes. The example analyses indicate that the use of a sequence of procedures is a good analysis strategy and provides some assurance that an important effect is not overlooked

  1. Important contributions of M.C. Wang and C.S. Wang Chang to non-equilibrium statistical physics

    International Nuclear Information System (INIS)

    Liu Jixing

    2004-01-01

    In the middle of the 20th century two Chinese women physicists, Ming-Chen Wang and Cheng-Shu Wang Chang made great contributions to statistical physics. The famous review article 'On the theory of the Brownian motion II' by Ming-Chen Wang and G.E. Uhlenbeck published in Rev. of Mod. Phys. in 1945 provided a complete scientific classification of stochastic processes which is still adopted by the scientific community as the standard classification. The Wang-Chang-Uhlenbeck (WCU) equation proposed jointly by C.S. Wang-Chang and Uhlenbeck became the fundamental kinetic equation for the treatment of transport properties of multi-atomic gases with internal degrees of freedom in the physics literature. These important scientific contributions are analyzed and reviewed

  2. Statistical analyses of scatterplots to identify important factors in large-scale simulations, 2: robustness of techniques

    International Nuclear Information System (INIS)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-01-01

    The robustness of procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses is investigated. These procedures are based on attempts to detect increasingly complex patterns in the scatterplots under consideration and involve the identification of (i) linear relationships with correlation coefficients, (ii) monotonic relationships with rank correlation coefficients, (iii) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (iv) trends in variability as defined by variances and interquartile ranges, and (v) deviations from randomness as defined by the chi-square statistic. The following two topics related to the robustness of these procedures are considered for a sequence of example analyses with a large model for two-phase fluid flow: the presence of Type I and Type II errors, and the stability of results obtained with independent Latin hypercube samples. Observations from analysis include: (i) Type I errors are unavoidable, (ii) Type II errors can occur when inappropriate analysis procedures are used, (iii) physical explanations should always be sought for why statistical procedures identify variables as being important, and (iv) the identification of important variables tends to be stable for independent Latin hypercube samples

  3. Crowd-sourced Ontology for Photoleukocoria: Identifying Common Internet Search Terms for a Potentially Important Pediatric Ophthalmic Sign.

    Science.gov (United States)

    Staffieri, Sandra E; Kearns, Lisa S; Sanfilippo, Paul G; Craig, Jamie E; Mackey, David A; Hewitt, Alex W

    2018-02-01

    Leukocoria is the most common presenting sign for pediatric eye disease including retinoblastoma and cataract, with worse outcomes if diagnosis is delayed. We investigated whether individuals could identify leukocoria in photographs (photoleukocoria) and examined their subsequent Internet search behavior. Using a web-based questionnaire, in this cross-sectional study we invited adults aged over 18 years to view two photographs of a child with photoleukocoria, and then search the Internet to determine a possible diagnosis and action plan. The most commonly used search terms and websites accessed were recorded. The questionnaire was completed by 1639 individuals. Facebook advertisement was the most effective recruitment strategy. The mean age of all respondents was 38.95 ± 14.59 years (range, 18-83), 94% were female, and 59.3% had children. An abnormality in the images presented was identified by 1613 (98.4%) participants. The most commonly used search terms were: "white," "pupil," "photo," and "eye" reaching a variety of appropriate websites or links to print or social media articles. Different words or phrases were used to describe the same observation of photoleukocoria leading to a range of websites. Variations in the description of observed signs and search words influenced the sites reached, information obtained, and subsequent help-seeking intentions. Identifying the most commonly used search terms for photoleukocoria is an important step for search engine optimization. Being directed to the most appropriate websites informing of the significance of photoleukocoria and the appropriate actions to take could improve delays in diagnosis of important pediatric eye disease such as retinoblastoma or cataract.

  4. Use of DNA sequences to identify forensically important fly species and their distribution in the coastal region of Central California.

    Science.gov (United States)

    Nakano, Angie; Honda, Jeff

    2015-08-01

    Forensic entomology has gained prominence in recent years, as improvements in DNA technology and molecular methods have allowed insect and other arthropod evidence to become increasingly useful in criminal and civil investigations. However, comprehensive faunal inventories are still needed, including cataloging local DNA sequences for forensically significant Diptera. This multi-year fly-trapping study was built upon and expanded a previous survey of these flies in Santa Clara County, including the addition of genetic barcoding data from collected species of flies. Flies from the families Calliphoridae, Sarcophagidae, and Muscidae were trapped in meat-baited traps set in a variety of locations throughout the county. Flies were identified using morphological features and confirmed by molecular analysis. A total of 16 calliphorid species, 11 sarcophagid species, and four muscid species were collected and differentiated. This study found more species of flies than previous area surveys and established new county records for two calliphorid species: Cynomya cadaverina and Chrysomya rufifacies. Differences were found in fly fauna in different areas of the county, indicating the importance of microclimates in the distribution of these flies. Molecular analysis supported the use of DNA barcoding as an effective method of identifying cryptic fly species. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  5. Combining Methods to Describe Important Marine Habitats for Top Predators: Application to Identify Biological Hotspots in Tropical Waters.

    Science.gov (United States)

    Thiers, Laurie; Louzao, Maite; Ridoux, Vincent; Le Corre, Matthieu; Jaquemet, Sébastien; Weimerskirch, Henri

    2014-01-01

    In tropical waters resources are usually scarce and patchy, and predatory species generally show specific adaptations for foraging. Tropical seabirds often forage in association with sub-surface predators that create feeding opportunities by bringing prey close to the surface, and the birds often aggregate in large multispecific flocks. Here we hypothesize that frigatebirds, a tropical seabird adapted to foraging with low energetic costs, could be a good predictor of the distribution of their associated predatory species, including other seabirds (e.g. boobies, terns) and subsurface predators (e.g., dolphins, tunas). To test this hypothesis, we compared distribution patterns of marine predators in the Mozambique Channel based on a long-term dataset of both vessel- and aerial surveys, as well as tracking data of frigatebirds. By developing species distribution models (SDMs), we identified key marine areas for tropical predators in relation to contemporaneous oceanographic features to investigate multi-species spatial overlap areas and identify predator hotspots in the Mozambique Channel. SDMs reasonably matched observed patterns and both static (e.g. bathymetry) and dynamic (e.g. Chlorophyll a concentration and sea surface temperature) factors were important explaining predator distribution patterns. We found that the distribution of frigatebirds included the distributions of the associated species. The central part of the channel appeared to be the best habitat for the four groups of species considered in this study (frigatebirds, brown terns, boobies and sub-surface predators).

  6. Combining Methods to Describe Important Marine Habitats for Top Predators: Application to Identify Biological Hotspots in Tropical Waters.

    Directory of Open Access Journals (Sweden)

    Laurie Thiers

    Full Text Available In tropical waters resources are usually scarce and patchy, and predatory species generally show specific adaptations for foraging. Tropical seabirds often forage in association with sub-surface predators that create feeding opportunities by bringing prey close to the surface, and the birds often aggregate in large multispecific flocks. Here we hypothesize that frigatebirds, a tropical seabird adapted to foraging with low energetic costs, could be a good predictor of the distribution of their associated predatory species, including other seabirds (e.g. boobies, terns and subsurface predators (e.g., dolphins, tunas. To test this hypothesis, we compared distribution patterns of marine predators in the Mozambique Channel based on a long-term dataset of both vessel- and aerial surveys, as well as tracking data of frigatebirds. By developing species distribution models (SDMs, we identified key marine areas for tropical predators in relation to contemporaneous oceanographic features to investigate multi-species spatial overlap areas and identify predator hotspots in the Mozambique Channel. SDMs reasonably matched observed patterns and both static (e.g. bathymetry and dynamic (e.g. Chlorophyll a concentration and sea surface temperature factors were important explaining predator distribution patterns. We found that the distribution of frigatebirds included the distributions of the associated species. The central part of the channel appeared to be the best habitat for the four groups of species considered in this study (frigatebirds, brown terns, boobies and sub-surface predators.

  7. Importance of Sulfate Aerosol in Evaluating the Relative Contributions of Regional Emissions to the Historical Global Temperature Change

    International Nuclear Information System (INIS)

    Andronova, N.; Schlesinger, M.

    2004-01-01

    During the negotiations of the Kyoto Protocol the delegation of Brazil presented an approach for distributing the burden of emissions reductions among the Parties based on the effect of their cumulative historical emissions on the global-average near-surface temperature. The Letter to the Parties does not limit the emissions to be considered to be only greenhouse gas (GHG) emissions. Thus, in this paper we explore the importance of anthropogenic SOx emissions that are converted to sulfate aerosol in the atmosphere, together with the cumulative greenhouse gas emissions, in attributing historical temperature change. We use historical emissions and our simple climate model to estimate the relative contributions to global warming of the regional emissions by four Parties: OECD90, Africa and Latin America, Asia, and Eastern Europe and the Former Soviet Union. Our results show that for most Parties the large warming contributed by their GHG emissions is largely offset by the correspondingly large cooling by their SOx emissions. Thus, OECD90 has become the dominant contributor to recent global warming following its large reduction in SOx emissions after 1980

  8. Evaluating the importance of surface soil contributions to reservoir sediment in alpine environments: a combined modelling and fingerprinting approach in the Posets-Maladeta Natural Park

    Science.gov (United States)

    Palazón, L.; Gaspar, L.; Latorre, B.; Blake, W. H.; Navas, A.

    2014-09-01

    Soil in alpine environments plays a key role in the development of ecosystem services and in order to maintain and preserve this important resource, information is required on processes that lead to soil erosion. Similar to other mountain alpine environments, the Benasque catchment is characterised by temperatures below freezing that can last from November to April, intense rainfall events, typically in spring and autumn, and rugged topography which makes assessment of erosion challenging. Indirect approaches to soil erosion assessment, such as combined model approaches, offer an opportunity to evaluate soil erosion in such areas. In this study (i) the SWAT (Soil and Water Assessment Tool) hydrological and erosion model and (ii) sediment fingerprinting procedures were used in parallel to assess the viability of a combined modelling and tracing approach to evaluate soil erosion processes in the area of the Posets-Maladeta Natural Park (central Spanish Pyrenees). Soil erosion rates and sediment contribution of potential sediment sources defined by soil type (Kastanozems/Phaeozems; Fluvisols and Cambisols) were assessed. The SWAT model suggested that, with the highest specific sediment yields, Cambisols are the main source of sediment in the Benasque catchment and Phaeozems and Fluvisols were identified as the lowest sediment contributors. Spring and winter model runs gave the highest and lowest specific sediment yield, respectively. In contrast, sediment fingerprinting analysis identified Fluvisols, which dominate the riparian zone, as the main sediment source at the time of sampling. This indicates the importance of connectivity as well as potential differences in the source dynamic of material in storage versus that transported efficiently from the system at times of high flow. The combined approach enabled us to better understand soil erosion processes in the Benasque alpine catchment, wherein SWAT identified areas of potential high sediment yield in large flood

  9. Expression and functional assessment of candidate type 2 diabetes susceptibility genes identify four new genes contributing to human insulin secretion

    Directory of Open Access Journals (Sweden)

    Fatou K. Ndiaye

    2017-06-01

    Full Text Available Objectives: Genome-wide association studies (GWAS have identified >100 loci independently contributing to type 2 diabetes (T2D risk. However, translational implications for precision medicine and for the development of novel treatments have been disappointing, due to poor knowledge of how these loci impact T2D pathophysiology. Here, we aimed to measure the expression of genes located nearby T2D associated signals and to assess their effect on insulin secretion from pancreatic beta cells. Methods: The expression of 104 candidate T2D susceptibility genes was measured in a human multi-tissue panel, through PCR-free expression assay. The effects of the knockdown of beta-cell enriched genes were next investigated on insulin secretion from the human EndoC-βH1 beta-cell line. Finally, we performed RNA-sequencing (RNA-seq so as to assess the pathways affected by the knockdown of the new genes impacting insulin secretion from EndoC-βH1, and we analyzed the expression of the new genes in mouse models with altered pancreatic beta-cell function. Results: We found that the candidate T2D susceptibility genes' expression is significantly enriched in pancreatic beta cells obtained by laser capture microdissection or sorted by flow cytometry and in EndoC-βH1 cells, but not in insulin sensitive tissues. Furthermore, the knockdown of seven T2D-susceptibility genes (CDKN2A, GCK, HNF4A, KCNK16, SLC30A8, TBC1D4, and TCF19 with already known expression and/or function in beta cells changed insulin secretion, supporting our functional approach. We showed first evidence for a role in insulin secretion of four candidate T2D-susceptibility genes (PRC1, SRR, ZFAND3, and ZFAND6 with no previous knowledge of presence and function in beta cells. RNA-seq in EndoC-βH1 cells with decreased expression of PRC1, SRR, ZFAND6, or ZFAND3 identified specific gene networks related to T2D pathophysiology. Finally, a positive correlation between the expression of Ins2 and the

  10. Identifying Watershed Regions Sensitive to Soil Erosion and Contributing to Lake Eutrophication—A Case Study in the Taihu Lake Basin (China)

    Science.gov (United States)

    Lin, Chen; Ma, Ronghua; He, Bin

    2015-01-01

    Taihu Lake in China is suffering from severe eutrophication partly due to non-point pollution from the watershed. There is an increasing need to identify the regions within the watershed that most contribute to lake water degradation. The selection of appropriate temporal scales and lake indicators is important to identify sensitive watershed regions. This study selected three eutrophic lake areas, including Meiliang Bay (ML), Zhushan Bay (ZS), and the Western Coastal region (WC), as well as multiple buffer zones next to the lake boundary as the study sites. Soil erosion intensity was designated as a watershed indicator, and the lake algae area was designated as a lake quality indicator. The sensitive watershed region was identified based on the relationship between these two indicators among different lake divisions for a temporal sequence from 2000 to 2012. The results show that the relationship between soil erosion modulus and lake quality varied among different lake areas. Soil erosion from the two bay areas was more closely correlated with water quality than soil erosion from the WC region. This was most apparent at distances of 5 km to 10 km from the lake, where the r2 was as high as 0.764. Results indicate that soil erosion could be used as an indicator for identifying key watershed protection areas. Different lake areas need to be considered separately due to differences in geographical features, land use, and the corresponding effects on lake water quality. PMID:26712772

  11. Identifying Watershed Regions Sensitive to Soil Erosion and Contributing to Lake Eutrophication--A Case Study in the Taihu Lake Basin (China).

    Science.gov (United States)

    Lin, Chen; Ma, Ronghua; He, Bin

    2015-12-24

    Taihu Lake in China is suffering from severe eutrophication partly due to non-point pollution from the watershed. There is an increasing need to identify the regions within the watershed that most contribute to lake water degradation. The selection of appropriate temporal scales and lake indicators is important to identify sensitive watershed regions. This study selected three eutrophic lake areas, including Meiliang Bay (ML), Zhushan Bay (ZS), and the Western Coastal region (WC), as well as multiple buffer zones next to the lake boundary as the study sites. Soil erosion intensity was designated as a watershed indicator, and the lake algae area was designated as a lake quality indicator. The sensitive watershed region was identified based on the relationship between these two indicators among different lake divisions for a temporal sequence from 2000 to 2012. The results show that the relationship between soil erosion modulus and lake quality varied among different lake areas. Soil erosion from the two bay areas was more closely correlated with water quality than soil erosion from the WC region. This was most apparent at distances of 5 km to 10 km from the lake, where the r² was as high as 0.764. Results indicate that soil erosion could be used as an indicator for identifying key watershed protection areas. Different lake areas need to be considered separately due to differences in geographical features, land use, and the corresponding effects on lake water quality.

  12. Genome wide analysis of inbred mouse lines identifies a locus containing Ppar-gamma as contributing to enhanced malaria survival.

    Directory of Open Access Journals (Sweden)

    Selina E R Bopp

    2010-05-01

    Full Text Available The genetic background of a patient determines in part if a person develops a mild form of malaria and recovers, or develops a severe form and dies. We have used a mouse model to detect genes involved in the resistance or susceptibility to Plasmodium berghei malaria infection. To this end we first characterized 32 different mouse strains infected with P. berghei and identified survival as the best trait to discriminate between the strains. We found a locus on chromosome 6 by linking the survival phenotypes of the mouse strains to their genetic variations using genome wide analyses such as haplotype associated mapping and the efficient mixed-model for association. This new locus involved in malaria resistance contains only two genes and confirms the importance of Ppar-gamma in malaria infection.

  13. High throughput phenotypic selection of Mycobacterium tuberculosis mutants with impaired resistance to reactive oxygen species identifies genes important for intracellular growth.

    Directory of Open Access Journals (Sweden)

    Olga Mestre

    Full Text Available Mycobacterium tuberculosis has the remarkable capacity to survive within the hostile environment of the macrophage, and to resist potent antibacterial molecules such as reactive oxygen species (ROS. Thus, understanding mycobacterial resistance mechanisms against ROS may contribute to the development of new anti-tuberculosis therapies. Here we identified genes involved in such mechanisms by screening a high-density transposon mutant library, and we show that several of them are involved in the intracellular lifestyle of the pathogen. Many of these genes were found to play a part in cell envelope functions, further strengthening the important role of the mycobacterial cell envelope in protection against aggressions such as the ones caused by ROS inside host cells.

  14. Molecular characterization of NRXN1 deletions from 19,263 clinical microarray cases identifies exons important for neurodevelopmental disease expression

    Science.gov (United States)

    Lowther, Chelsea; Speevak, Marsha; Armour, Christine M.; Goh, Elaine S.; Graham, Gail E.; Li, Chumei; Zeesman, Susan; Nowaczyk, Malgorzata J.M.; Schultz, Lee-Anne; Morra, Antonella; Nicolson, Rob; Bikangaga, Peter; Samdup, Dawa; Zaazou, Mostafa; Boyd, Kerry; Jung, Jack H.; Siu, Victoria; Rajguru, Manjulata; Goobie, Sharan; Tarnopolsky, Mark A.; Prasad, Chitra; Dick, Paul T.; Hussain, Asmaa S.; Walinga, Margreet; Reijenga, Renske G.; Gazzellone, Matthew; Lionel, Anath C.; Marshall, Christian R.; Scherer, Stephen W.; Stavropoulos, Dimitri J.; McCready, Elizabeth; Bassett, Anne S.

    2016-01-01

    Purpose The purpose of the current study was to assess the penetrance of NRXN1 deletions. Methods We compared the prevalence and genomic extent of NRXN1 deletions identified among 19,263 clinically referred cases to that of 15,264 controls. The burden of additional clinically relevant CNVs was used as a proxy to estimate the relative penetrance of NRXN1 deletions. Results We identified 41 (0.21%) previously unreported exonic NRXN1 deletions ascertained for developmental delay/intellectual disability, significantly greater than in controls [OR=8.14 (95% CI 2.91–22.72), p< 0.0001)]. Ten (22.7%) of these had a second clinically relevant CNV. Subjects with a deletion near the 3′ end of NRXN1 were significantly more likely to have a second rare CNV than subjects with a 5′ NRXN1 deletion [OR=7.47 (95% CI 2.36–23.61), p=0.0006]. The prevalence of intronic NRXN1 deletions was not statistically different between cases and controls (p=0.618). The majority (63.2%) of intronic NRXN1 deletion cases had a second rare CNV, a two-fold greater prevalence than for exonic NRXN1 deletion cases (p=0.0035). Conclusions The results support the importance of exons near the 5′ end of NRXN1 in the expression of neurodevelopmental disorders. Intronic NRXN1 deletions do not appear to substantially increase the risk for clinical phenotypes. PMID:27195815

  15. Gene Expression Profiling Identifies Important Genes Affected by R2 Compound Disrupting FAK and P53 Complex

    International Nuclear Information System (INIS)

    Golubovskaya, Vita M.; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G.

    2014-01-01

    Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53 +/+ and p53 −/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53 +/+ cells but not in p53 −/− cells. Among up-regulated genes in HCT p53 +/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53 +/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach

  16. DNA-SIP identifies sulfate-reducing Clostridia as important toluene degraders in tar-oil-contaminated aquifer sediment

    Energy Technology Data Exchange (ETDEWEB)

    Winderl, C.; Penning, H.; von Netzer, F.; Meckenstock, R.U.; Lueders, T. [Helmholtz Zentrum Munchen, Neuherberg (Germany)

    2010-10-15

    Global groundwater resources are constantly challenged by a multitude of contaminants such as aromatic hydrocarbons. Especially in anaerobic habitats, a large diversity of unrecognized microbial populations may be responsible for their degradation. Still, our present understanding of the respective microbiota and their ecophysiology is almost exclusively based on a small number of cultured organisms, mostly within the Proteobacteria. Here, by DNA-based stable isotope probing (SIP), we directly identified the most active sulfate-reducing toluene degraders in a diverse sedimentary microbial community originating from a tar-oil-contaminated aquifer at a former coal gasification plant. On incubation of fresh sediments with {sup 13}C{sub 7}-toluene, the production of both sulfide and (CS{sub 2}){sup 13}CO{sub 2} was clearly coupled to the {sup 13}Clabeling of DNA of microbes related to Desulfosporosinus spp. within the Peptococcaceae (Clostridia). The screening of labeled DNA fractions also suggested a novel benzylsuccinate synthase alpha-subunit (bssA) sequence type previously only detected in the environment to be tentatively affiliated with these degraders. However, carbon flow from the contaminant into degrader DNA was only similar to 50%, pointing toward high ratios of heterotrophic CS{sub 2}-fixation during assimilation of acetyl-CoA originating from the contaminant by these degraders. These findings demonstrate that the importance of non-proteobacterial populations in anaerobic aromatics degradation, as well as their specific ecophysiology in the subsurface may still be largely ungrasped.

  17. Evaluation of bentonite alteration due to interactions with iron. Sensitivity analyses to identify the important factors for the bentonite alteration

    International Nuclear Information System (INIS)

    Sasamoto, Hiroshi; Wilson, James; Sato, Tsutomu

    2013-01-01

    Performance assessment of geological disposal systems for high-level radioactive waste requires a consideration of long-term systems behaviour. It is possible that the alteration of swelling clay present in bentonite buffers might have an impact on buffer functions. In the present study, iron (as a candidate overpack material)-bentonite (I-B) interactions were evaluated as the main buffer alteration scenario. Existing knowledge on alteration of bentonite during I-B interactions was first reviewed, then the evaluation methodology was developed considering modeling techniques previously used overseas. A conceptual model for smectite alteration during I-B interactions was produced. The following reactions and processes were selected: 1) release of Fe 2+ due to overpack corrosion; 2) diffusion of Fe 2+ in compacted bentonite; 3) sorption of Fe 2+ on smectite edge and ion exchange in interlayers; 4) dissolution of primary phases and formation of alteration products. Sensitivity analyses were performed to identify the most important factors for the alteration of bentonite by I-B interactions. (author)

  18. Analysis of copy number variations in Holstein cows identify potential mechanisms contributing to differences in residual feed intake.

    Science.gov (United States)

    Hou, Yali; Bickhart, Derek M; Chung, Hoyoung; Hutchison, Jana L; Norman, H Duane; Connor, Erin E; Liu, George E

    2012-11-01

    Genomic structural variation is an important and abundant source of genetic and phenotypic variation. In this study, we performed an initial analysis of copy number variations (CNVs) using BovineHD SNP genotyping data from 147 Holstein cows identified as having high or low feed efficiency as estimated by residual feed intake (RFI). We detected 443 candidate CNV regions (CNVRs) that represent 18.4 Mb (0.6 %) of the genome. To investigate the functional impacts of CNVs, we created two groups of 30 individual animals with extremely low or high estimated breeding values (EBVs) for RFI, and referred to these groups as low intake (LI; more efficient) or high intake (HI; less efficient), respectively. We identified 240 (~9.0 Mb) and 274 (~10.2 Mb) CNVRs from LI and HI groups, respectively. Approximately 30-40 % of the CNVRs were specific to the LI group or HI group of animals. The 240 LI CNVRs overlapped with 137 Ensembl genes. Network analyses indicated that the LI-specific genes were predominantly enriched for those functioning in the inflammatory response and immunity. By contrast, the 274 HI CNVRs contained 177 Ensembl genes. Network analyses indicated that the HI-specific genes were particularly involved in the cell cycle, and organ and bone development. These results relate CNVs to two key variables, namely immune response and organ and bone development. The data indicate that greater feed efficiency relates more closely to immune response, whereas cattle with reduced feed efficiency may have a greater capacity for organ and bone development.

  19. Genetic association study identifies a functional CNV in the WWOX gene contributes to the risk of intracranial aneurysms.

    Science.gov (United States)

    Fan, Jin; Sun, Wen; Lin, Min; Yu, Ke; Wang, Jian; Duan, Dan; Zheng, Bo; Yang, Zhenghui; Wang, Qingsong

    2016-03-29

    Intracranial aneurysms (IAs) accounts for 85% of hemorrhagic stroke. Genetic factors have been known to play an important role in the development of IAs. A functional CNV (CNV-67048) of human WW domain-containing oxidoreductase (WWOX), which has been identified as a tumor suppressor gene in multiple cancers, was identified to be associated with gliomas risk previously. Here, we hypothesized that the CNV-67048 could also affect susceptibility of IAs. Based on a two-stage, case- control study with a total of 976 patients of IAs and 1,200 matched healthy controls, we found the effect size for per copy deletion was 1.35 (95% CI = 1.16-1.57; Ptrend = 1.18 × 10-4). Compared with the individuals having no deletion, significantly higher risk of IAs was detected for both subjects carrying 1 copy deletion (OR = 1.24, 95% CI = 1.02-1.52) and subjects carrying 2 copy deletion (OR = 1.77, 95% CI = 1.24-2.53). Real-time PCR was used to confirm the abnormal expression of WWOX in tissues of IA patients and influence of genotypes of CNV-67048. The expression level of WWOX in IA tissues was significantly lower than that in corresponding normal tissues (P = 0.004), and the deletion genotypes of CNV-67048 have lower WWOX mRNA levels in both tumor tissues and border tissues (P 48 in WWOX predispose their carriers to IAs, which might be a genetic biomarker to predict risk of IAs in Chinese.

  20. Identifying important and feasible policies and actions for health at community sports clubs: a consensus-generating approach.

    Science.gov (United States)

    Kelly, Bridget; King, Lesley; Bauman, Adrian E; Baur, Louise A; Macniven, Rona; Chapman, Kathy; Smith, Ben J

    2014-01-01

    Children's high participation in organised sport in Australia makes sport an ideal setting for health promotion. This study aimed to generate consensus on priority health promotion objectives for community sports clubs, based on informed expert judgements. Delphi survey using three structured questionnaires. Forty-six health promotion, nutrition, physical activity and sport management/delivery professionals were approached to participate in the survey. Questionnaires used an iterative process to determine aspects of sports clubs deemed necessary for developing healthy sporting environments for children. Initially, participants were provided with a list of potential standards for a range of health promotion areas and asked to rate standards based on their importance and feasibility, and any barriers to implementation. Subsequently, participants were provided with information that summarised ratings for each standard to indicate convergence of the group, and asked to review and potentially revise their responses where they diverged. In a third round, participants ranked confirmed standards by priority. 26 professionals completed round 1, 21 completed round 2, and 18 completed round 3. The highest ranked standards related to responsible alcohol practices, availability of healthy food and drinks at sports canteens, smoke-free club facilities, restricting the sale and consumption of alcohol during junior sporting activities, and restricting unhealthy food and beverage company sponsorship. Identifying and prioritising health promotion areas that are relevant to children's sports clubs assists in focusing public health efforts and may guide future engagement of sports clubs. Approaches for providing informational and financial support to clubs to operationalise these standards are proposed. Copyright © 2013 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  1. The two putative comS homologs of the biotechnologically important Bacillus licheniformis do not contribute to competence development.

    Science.gov (United States)

    Jakobs, Mareike; Hoffmann, Kerstin; Liesegang, Heiko; Volland, Sonja; Meinhardt, Friedhelm

    2015-03-01

    In Bacillus subtilis, natural genetic competence is subject to complex genetic regulation and quorum sensing dependent. Upon extracellular accumulation of the peptide-pheromone ComX, the membrane-bound sensor histidine kinase ComP initiates diverse signaling pathways by activating-among others-DegQ and ComS. While DegQ favors the expression of extracellular enzymes rather than competence development, ComS is crucial for competence development as it prevents proteolytic degradation of ComK, the key transcriptional activator of all genes required for the uptake and integration of DNA. In Bacillus licheniformis, ComX/ComP sensed cell density negatively influences competence development, suggesting differences from the quorum-sensing-dependent control mechanism in Bacillus subtilis. Here, we show that each of six investigated strains possesses both of two different, recently identified putative comS genes. When expressed from an inducible promoter, none of the comS candidate genes displayed an impact on competence development neither in B. subtilis nor in B. licheniformis. Moreover, disruption of the genes did not reduce transformation efficiency. While the putative comS homologs do not contribute to competence development, we provide evidence that the degQ gene as for B. subtilis negatively influences genetic competency in B. licheniformis.

  2. Identifying organisational principles and management practices important to the quality of health care services for chronic conditions.

    Science.gov (United States)

    Frølich, Anne

    2012-02-01

    effect of financial incentives and public performance reporting on the behaviour of professionals and quality of care. Using secondary data, KP and the Danish health care system were compared in terms of six central dimensions: population, health care professionals, health care organisations, utilization patterns, quality measurements, and costs. Differences existed between the two systems on all dimensions, complicating the interpretation of findings. For instance, observed differences might be due to similar tendencies in the two health care systems that were observed at different times, rather than true structural differences. The expenses in the two health care systems were corrected for differences in the populations served and the purchasing power of currencies. However, no validated methods existed to correct for observed differences in case-mixes of chronic conditions. Data from a population of about half a million patients with diabetes in a large U.S. integrated health care delivery system affiliated with 41 medical centers employing 15 different CCM management practices was the basis for identifying effective management practices. Through the use of statistical modelling, the management practice of provider alerts was identified as most effective for promoting screening for hemoglobin A1c and lipid profile. The CCM was used as a framework for implementing four rehabilitation programs. The model promoted continuity of care and quality of health care services. New management practices were developed in the study, and known practices were further developed. However, the observational nature of the study limited the generalisability of the findings. In a structured literature survey focusing on the effect of financial incentives and public performance reporting on the quality of health care services, few studies documenting an effect were identified. The results varied, and important program aspects or contextual variables were often omitted. A model describing

  3. Why so many "rigorous" evaluations fail to identify unintended consequences of development programs: How mixed methods can contribute.

    Science.gov (United States)

    Bamberger, Michael; Tarsilla, Michele; Hesse-Biber, Sharlene

    2016-04-01

    Many widely-used impact evaluation designs, including randomized control trials (RCTs) and quasi-experimental designs (QEDs), frequently fail to detect what are often quite serious unintended consequences of development programs. This seems surprising as experienced planners and evaluators are well aware that unintended consequences frequently occur. Most evaluation designs are intended to determine whether there is credible evidence (statistical, theory-based or narrative) that programs have achieved their intended objectives and the logic of many evaluation designs, even those that are considered the most "rigorous," does not permit the identification of outcomes that were not specified in the program design. We take the example of RCTs as they are considered by many to be the most rigorous evaluation designs. We present a numbers of cases to illustrate how infusing RCTs with a mixed-methods approach (sometimes called an "RCT+" design) can strengthen the credibility of these designs and can also capture important unintended consequences. We provide a Mixed Methods Evaluation Framework that identifies 9 ways in which UCs can occur, and we apply this framework to two of the case studies. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Systemic analysis of different colorectal cancer cell lines and TCGA datasets identified IGF-1R/EGFR-PPAR-CASPASE axis as important indicator for radiotherapy sensitivity.

    Science.gov (United States)

    Chen, Lin; Zhu, Zhe; Gao, Wei; Jiang, Qixin; Yu, Jiangming; Fu, Chuangang

    2017-09-05

    Insulin-like growth factor 1 receptor (IGF-1R) is proved to contribute the development of many types of cancers. But, little is known about its roles in radio-resistance of colorectal cancer (CRC). Here, we demonstrated that low IGF-1R expression value was associated with the better radiotherapy sensitivity of CRC. Besides, through Quantitative Real-time PCR (qRT-PCR), the elevated expression value of epidermal growth factor receptor (EGFR) was observed in CRC cell lines (HT29, RKO) with high radio-sensitivity compared with those with low sensitivity (SW480, LOVO). The irradiation induced apoptosis rates of wild type and EGFR agonist (EGF) or IGF-1R inhibitor (NVP-ADW742) treated HT29 and SW480 cells were quantified by flow cytometry. As a result, the apoptosis rate of EGF and NVP-ADW742 treated HT29 cells was significantly higher than that of those wild type ones, which indicated that high EGFR and low IGF-1R expression level in CRC was associated with the high sensitivity to radiotherapy. We next conducted systemic bioinformatics analysis of genome-wide expression profiles of CRC samples from the Cancer Genome Atlas (TCGA). Differential expression analysis between IGF-1R and EGFR abnormal CRC samples, i.e. CRC samples with higher IGF-1R and lower EGFR expression levels based on their median expression values, and the rest of CRC samples identified potential genes contribute to radiotherapy sensitivity. Functional enrichment of analysis of those differential expression genes (DEGs) in the Database for Annotation, Visualization and Integrated Discovery (DAVID) indicated PPAR signaling pathway as an important pathway for the radio-resistance of CRC. Our study identified the potential biomarkers for the rational selection of radiotherapy for CRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Identifying Important Gaps in Randomized Controlled Trials of Adult Cardiac Arrest Treatments: A Systematic Review of the Published Literature

    Science.gov (United States)

    Sinha, Shashank S.; Sukul, Devraj; Lazarus, John J.; Polavarapu, Vivek; Chan, Paul S.; Neumar, Robert W.; Nallamothu, Brahmajee K.

    2016-01-01

    Background Cardiac arrests are a major public health concern worldwide. The extent and types of randomized controlled trials (RCTs) – our most reliable source of clinical evidence – conducted in these high-risk patients over recent years are largely unknown. Methods and Results We performed a systematic review, identifying all RCTs published in PubMed, EMBASE, Scopus, Web of Science, and the Cochrane Library from 1995 to 2014 that focused on acute treatment of non-traumatic cardiac arrest in adults. We then extracted data on the setting of study populations, types and timing of interventions studied, risk of bias, outcomes reported and how these factors have changed over time. Over this twenty-year period, 92 RCTs were published containing 64,309 patients (median, 225.5 per trial). Of these, 81 RCTs (88.0%) involved out-of-hospital cardiac arrest whereas 4 (4.3%) involved in-hospital cardiac arrest and 7 (7.6%) included both. Eighteen RCTs (19.6%) were performed in the U.S., 68 (73.9%) were performed outside the U.S., and 6 (6.5%) were performed in both settings. Thirty-eight RCTs (41.3%) evaluated drug therapy, 39 (42.4%) evaluated device therapy, and 15 (16.3%) evaluated protocol improvements. Seventy-four RCTs (80.4%) examined interventions during the cardiac arrest, 15 (16.3%) examined post-cardiac arrest treatment, and 3 (3.3%) studied both. Overall, reporting of risk of bias was limited. The most common outcome reported was ROSC: 86 (93.5%) with only 22 (23.9%) reporting survival beyond 6 months. Fifty-three RCTs (57.6%) reported global ordinal outcomes whereas 15 (16.3%) reported quality-of-life. RCTs in the last 5 years were more likely to be focused on protocol improvement and post-cardiac arrest care. Conclusions Important gaps in RCTs of cardiac arrest treatments exist, especially those examining in-hospital cardiac arrest, protocol improvement, post-cardiac arrest care, and long-term or quality-of-life outcomes. PMID:27756794

  6. Systems-based analysis of the Sarcocystis neurona genome identifies pathways that contribute to a heteroxenous life cycle.

    Science.gov (United States)

    Blazejewski, Tomasz; Nursimulu, Nirvana; Pszenny, Viviana; Dangoudoubiyam, Sriveny; Namasivayam, Sivaranjani; Chiasson, Melissa A; Chessman, Kyle; Tonkin, Michelle; Swapna, Lakshmipuram S; Hung, Stacy S; Bridgers, Joshua; Ricklefs, Stacy M; Boulanger, Martin J; Dubey, Jitender P; Porcella, Stephen F; Kissinger, Jessica C; Howe, Daniel K; Grigg, Michael E; Parkinson, John

    2015-02-10

    Sarcocystis neurona is a member of the coccidia, a clade of single-celled parasites of medical and veterinary importance including Eimeria, Sarcocystis, Neospora, and Toxoplasma. Unlike Eimeria, a single-host enteric pathogen, Sarcocystis, Neospora, and Toxoplasma are two-host parasites that infect and produce infectious tissue cysts in a wide range of intermediate hosts. As a genus, Sarcocystis is one of the most successful protozoan parasites; all vertebrates, including birds, reptiles, fish, and mammals are hosts to at least one Sarcocystis species. Here we sequenced Sarcocystis neurona, the causal agent of fatal equine protozoal myeloencephalitis. The S. neurona genome is 127 Mbp, more than twice the size of other sequenced coccidian genomes. Comparative analyses identified conservation of the invasion machinery among the coccidia. However, many dense-granule and rhoptry kinase genes, responsible for altering host effector pathways in Toxoplasma and Neospora, are absent from S. neurona. Further, S. neurona has a divergent repertoire of SRS proteins, previously implicated in tissue cyst formation in Toxoplasma. Systems-based analyses identified a series of metabolic innovations, including the ability to exploit alternative sources of energy. Finally, we present an S. neurona model detailing conserved molecular innovations that promote the transition from a purely enteric lifestyle (Eimeria) to a heteroxenous parasite capable of infecting a wide range of intermediate hosts. Sarcocystis neurona is a member of the coccidia, a clade of single-celled apicomplexan parasites responsible for major economic and health care burdens worldwide. A cousin of Plasmodium, Cryptosporidium, Theileria, and Eimeria, Sarcocystis is one of the most successful parasite genera; it is capable of infecting all vertebrates (fish, reptiles, birds, and mammals-including humans). The past decade has witnessed an increasing number of human outbreaks of clinical significance associated with

  7. Identifying significant factors which can contribute to successful transitions from school to lasting employment affiliation for pupils in vocational training programs

    Directory of Open Access Journals (Sweden)

    Nils Breilid

    2017-06-01

    Full Text Available Introduction: This study deals with young people receiving special needs education in schools and their transition to lasting employment in private or public sector. Through a qualitative approach, the article aims at “identifying significant factors which can, contribute to successful transitions from school to lasting employment affiliation for pupils in vocational training programs”Theoretical approach: The theoretical approach of this article is descriptions and interpretation of the Norwegian educational legislation and the theory of «empowerment». These theoretical perspectives will be included in the empirical discussion. Method: The methodological approach is qualitative. Through four semi-structured interviews of young informants who have completed upper secondary school in a vocational education program, and have had a minimum of one-year training in an enterprise. Thematic analysis of the data is conducted with the application of NVivo 11, a computer program that is suitable for qualitative data-analysis and mixed research methods.Results and discussion: Through thematic analysis of the data, we found three significant factors contributing to successful transitions from school to lasting employment:      a Application and development of the pupil’s competence - mastery and meaning      b The significance of relations, communication and well-functioning socio-ecological          networks      c The importance of pupil participation and involvement in decision making

  8. Factors contributing to the perpetration of workplace incivility: the importance of organizational aspects and experiencing incivility from others

    Science.gov (United States)

    Torkelson, Eva; Holm, Kristoffer; Bäckström, Martin; Schad, Elinor

    2016-01-01

    ABSTRACT In recent years a growing amount of research has been conducted in the area of workplace incivility. Whereas many studies have focused on the victims and the consequences of incivility, little attention has been paid to the perpetrators and antecedents of workplace incivility. This study aims to identify possible antecedents of workplace incivility, by investigating organizational aspects as well as the possibility that being the target of incivility from co-workers and supervisors could induce incivility. A total of 512 employees (378 women and 133 men) in the school sector in a Swedish municipality completed an online questionnaire. Overall, the results of structural equation modelling analyses showed that organizational variables were related to the perpetration of incivility. A direct relationship was found between being uncivil and organizational change, job insecurity, low social support from co-workers and high job demands. However, the strongest relationship was found between experienced incivility from co-workers and instigated incivility. This could be reflecting a climate or culture of incivility in the organization, and carry implications for future practice in interventions against workplace incivility. The results indicate the importance of focusing on the perspective of the instigator to gain knowledge about the process of workplace incivility. PMID:27226677

  9. Identifying organisational principles and management practices important to the quality of health care services for chronic conditions

    DEFF Research Database (Denmark)

    Frølich, Anne

    2012-01-01

    are limited, it is necessary to identify efficient methods to improve the quality of care. Comparing health care systems is a well-known method for identifying new knowledge regarding, for instance, organisational methods and principles. Kaiser Permanente (KP), an integrated health care delivery system...... in the U.S., is recognized as providing high-quality chronic care; to some extent, this is due to KP's implementation of the chronic care model (CCM). This model recommends a range of evidence-based management practices that support the implementation of evidence-based medicine. However, it is not clear...... which management practices in the CCM are most efficient and in what combinations. In addition, financial incentives and public reporting of performance are often considered effective at improving the quality of health care services, but this has not yet been definitively proved....

  10. Integrated physiological, biochemical and molecular analysis identifies important traits and mechanisms associated with differential response of rice genotypes to elevated temperature

    Directory of Open Access Journals (Sweden)

    Boghireddy eSailaja

    2015-11-01

    Full Text Available In changing climate, heat stress caused by high temperature poses a serious threat to rice cultivation. A multiple organizational analysis at physiological, biochemical and molecular level is required to fully understand the impact of elevated temperature in rice. This study was aimed at deciphering the elevated temperature response in eleven popular and mega rice cultivars widely grown in India. Physiological and biochemical traits specifically membrane thermostability (MTS, antioxidants, and photosynthesis were studied at vegetative and reproductive phases which were used to establish a correlation with grain yield under stress. Several useful traits in different genotypes were identified which will be important resource to develop high temperature tolerant rice cultivars. Interestingly, Nagina22 emerged as best performer in terms of yield as well as expression of physiological and biochemical traits at elevated temperature. It showed lesser relative injury, lesser reduction in chlorophyll content, increased super oxide dismutase, catalase and peroxidase activity, lesser reduction in net photosynthetic rate (PN, high transpiration rate (E and other photosynthetic/ fluorescence parameters contributing to least reduction in spikelet fertility and grain yield at elevated temperature. Further, expression of 14 genes including heat shock transcription factors and heat shock proteins was analyzed in Nagina22 (tolerant and Vandana (susceptible at flowering phase, strengthening the fact that N22 performs better at molecular level also during elevated temperature. This study shows that elevated temperature response is complex and involves multiple biological processes which are needed to be characterized to address the challenges of future climate extreme conditions.

  11. Evaluation of the contribution of the importance of neuroimaging for the diagnostics of dementias - comparison to the psychological diagnostics

    International Nuclear Information System (INIS)

    Hentschel, F.; Kreis, M.; Damian, M.; Syren, M.; Krumm, B.

    2003-01-01

    Objective: While psychology is accepted as a necessary component of the dementia diagnostics, the extended clinical diagnostics with neuroimaging is differently estimated. The goal of the study is the quantification of the individual contribution of the two different methods. Methods: Of 100 patient the diagnosis of entrance, the neurological, the psychological, and the final clinical diagnosis were documented. For both imaging and psychology the sensitivity, specificity, and the positive predictive value were computed. The diagnostic of each method was determined from the change of the final in relation to the initial clinical diagnosis. The neuroradiological investigation took place with MRI, the psychological examination used both usual power and special speed tests. Results: The extended clinical diagnostics led for 26% of the patients to the change of the clinical diagnosis. Imaging and psychology supplied different own but supplementing contributions. In the case of annihilation imaging contributed with 73.3%, psychology with 54.1% to the diagnosis of a neurodegenerative dementia, whereas the contributions to the diagnosis of a vascular dementia were 83.3% and 70.8%, respectively. However psychology diagnosed and quantified the dementia. The contribution of neuroimaging consisted in the differential diagnosis of the dementias organic causes of symptomatic clementias and vascular encephalopathy without dementia but with consequences for a secondary prophylaxis were additional information also. Conclusion: Psychology improves the diagnostic accuracy of dementias. Neuroimaging improves the differential diagnosis of dementias and supplies additional clinically relevant findings. In the qualified diagnostics and differential diagnostics of the dementias both methods are indispensable. (orig.) [de

  12. Identifying diabetes-related important protein targets with few interacting partners with the PageRank algorithm.

    Science.gov (United States)

    Grolmusz, Vince I

    2015-04-01

    Diabetes is a growing concern for the developed nations worldwide. New genomic, metagenomic and gene-technologic approaches may yield considerable results in the next several years in its early diagnosis, or in advances in therapy and management. In this work, we highlight some human proteins that may serve as new targets in the early diagnosis and therapy. With the help of a very successful mathematical tool for network analysis that formed the basis of the early successes of Google(TM), Inc., we analyse the human protein-protein interaction network gained from the IntAct database with a mathematical algorithm. The novelty of our approach is that the new protein targets suggested do not have many interacting partners (so, they are not hubs or super-hubs), so their inhibition or promotion probably will not have serious side effects. We have identified numerous possible protein targets for diabetes therapy and/or management; some of these have been well known for a long time (these validate our method), some of them appeared in the literature in the last 12 months (these show the cutting edge of the algorithm), and the remainder are still unknown to be connected with diabetes, witnessing completely new hits of the method.

  13. Gene expression profiling and candidate gene resequencing identifies pathways and mutations important for malignant transformation caused by leukemogenic fusion genes.

    Science.gov (United States)

    Novak, Rachel L; Harper, David P; Caudell, David; Slape, Christopher; Beachy, Sarah H; Aplan, Peter D

    2012-12-01

    NUP98-HOXD13 (NHD13) and CALM-AF10 (CA10) are oncogenic fusion proteins produced by recurrent chromosomal translocations in patients with acute myeloid leukemia (AML). Transgenic mice that express these fusions develop AML with a long latency and incomplete penetrance, suggesting that collaborating genetic events are required for leukemic transformation. We employed genetic techniques to identify both preleukemic abnormalities in healthy transgenic mice as well as collaborating events leading to leukemic transformation. Candidate gene resequencing revealed that 6 of 27 (22%) CA10 AMLs spontaneously acquired a Ras pathway mutation and 8 of 27 (30%) acquired an Flt3 mutation. Two CA10 AMLs acquired an Flt3 internal-tandem duplication, demonstrating that these mutations can be acquired in murine as well as human AML. Gene expression profiles revealed a marked upregulation of Hox genes, particularly Hoxa5, Hoxa9, and Hoxa10 in both NHD13 and CA10 mice. Furthermore, mir196b, which is embedded within the Hoxa locus, was overexpressed in both CA10 and NHD13 samples. In contrast, the Hox cofactors Meis1 and Pbx3 were differentially expressed; Meis1 was increased in CA10 AMLs but not NHD13 AMLs, whereas Pbx3 was consistently increased in NHD13 but not CA10 AMLs. Silencing of Pbx3 in NHD13 cells led to decreased proliferation, increased apoptosis, and decreased colony formation in vitro, suggesting a previously unexpected role for Pbx3 in leukemic transformation. Published by Elsevier Inc.

  14. Importance of d-wave contributions in the charge symmetry breaking reaction dd →4Heπ0

    Science.gov (United States)

    Adlarson, P.; Augustyniak, W.; Bardan, W.; Bashkanov, M.; Bergmann, F. S.; Berłowski, M.; Bondar, A.; Büscher, M.; Calén, H.; Ciepał, I.; Clement, H.; Czerwiński, E.; Demmich, K.; Engels, R.; Erven, A.; Erven, W.; Eyrich, W.; Fedorets, P.; Föhl, K.; Fransson, K.; Goldenbaum, F.; Goswami, A.; Grigoryev, K.; Gullström, C.-O.; Hanhart, C.; Heijkenskjöld, L.; Hejny, V.; Hüsken, N.; Jarczyk, L.; Johansson, T.; Kamys, B.; Kemmerling, G.; Khatri, G.; Khoukaz, A.; Khreptak, O.; Kirillov, D. A.; Kistryn, S.; Kleines, H.; Kłos, B.; Krzemień, W.; Kulessa, P.; Kupść, A.; Kuzmin, A.; Lalwani, K.; Lersch, D.; Lorentz, B.; Magiera, A.; Maier, R.; Marciniewski, P.; Mariański, B.; Morsch, H.-P.; Moskal, P.; Ohm, H.; Parol, W.; Perez del Rio, E.; Piskunov, N. M.; Prasuhn, D.; Pszczel, D.; Pysz, K.; Pyszniak, A.; Ritman, J.; Roy, A.; Rudy, Z.; Rundel, O.; Sawant, S.; Schadmand, S.; Schätti-Ozerianska, I.; Sefzick, T.; Serdyuk, V.; Shwartz, B.; Sitterberg, K.; Skorodko, T.; Skurzok, M.; Smyrski, J.; Sopov, V.; Stassen, R.; Stepaniak, J.; Stephan, E.; Sterzenbach, G.; Stockhorst, H.; Ströher, H.; Szczurek, A.; Trzciński, A.; Wolke, M.; Wrońska, A.; Wüstner, P.; Yamamoto, A.; Zabierowski, J.; Zieliński, M. J.; Złomańczuk, J.; Żuprański, P.; Żurek, M.; WASA-at-COSY Collaboration

    2018-06-01

    This letter reports a first quantitative analysis of the contribution of higher partial waves in the charge symmetry breaking reaction dd →4Heπ0 using the WASA-at-COSY detector setup at an excess energy of Q = 60MeV. The determined differential cross section can be parametrized as d σ /d Ω = a + bcos2 ⁡θ*, where θ* is the production angle of the pion in the center-of-mass coordinate system, and the results for the parameters are a = (1.55 ± 0.46(stat) + 0.32 - 0.8 (syst)) pb /sr and b = (13.1 ± 2.1 (stat)-2.7+1.0 (syst)) pb /sr. The data are compatible with vanishing p-waves and a sizable d-wave contribution. This finding should strongly constrain the contribution of the Δ isobar to the dd →4Heπ0 reaction and is, therefore, crucial for a quantitative understanding of quark mass effects in nuclear production reactions.

  15. Using the apparent diffusion coefficient to identifying MGMT promoter methylation status early in glioblastoma: importance of analytical method

    Energy Technology Data Exchange (ETDEWEB)

    Rundle-Thiele, Dayle [Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia); Day, Bryan; Stringer, Brett [Brain Cancer Research Unit, Queensland Institute of Medical Research, Brisbane, Queensland (Australia); Fay, Michael [Department of Radiation Oncology, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Martin, Jennifer [Discipline of Clinical Pharmacology, School of Medicine and Public Health, University of Newcastle, Newcastle, New South Wales (Australia); Jeffree, Rosalind L [Department of Neurosurgery, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Thomas, Paul [Queensland PET Service, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Bell, Christopher [Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia); Salvado, Olivier [CSIRO Digital Productivity Flagship, CSIRO, Herston, Queensland (Australia); Gal, Yaniv [Centre for Medical Diagnostic Technologies in Queensland, University of Queensland, Brisbane, Queensland (Australia); Coulthard, Alan [Discipline of Medical Imaging, University of Queensland, St Lucia, Queensland (Australia); Department of Medical Imaging, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Crozier, Stuart [Centre for Medical Diagnostic Technologies in Queensland, University of Queensland, Brisbane, Queensland (Australia); Rose, Stephen, E-mail: stephen.rose@csiro.au [CSIRO Digital Productivity Flagship, CSIRO, Herston, Queensland (Australia); Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia)

    2015-06-15

    Accurate knowledge of O{sup 6}-methylguanine methyltransferase (MGMT) gene promoter subtype in patients with glioblastoma (GBM) is important for treatment. However, this test is not always available. Pre-operative diffusion MRI (dMRI) can be used to probe tumour biology using the apparent diffusion coefficient (ADC); however, its ability to act as a surrogate to predict MGMT status has shown mixed results. We investigated whether this was due to variations in the method used to analyse ADC. We undertook a retrospective study of 32 patients with GBM who had MGMT status measured. Matching pre-operative MRI data were used to calculate the ADC within contrast enhancing regions of tumour. The relationship between ADC and MGMT was examined using two published ADC methods. A strong trend between a measure of ‘minimum ADC’ and methylation status was seen. An elevated minimum ADC was more likely in the methylated compared to the unmethylated MGMT group (U = 56, P = 0.0561). In contrast, utilising a two-mixture model histogram approach, a significant reduction in mean measure of the ‘low ADC’ component within the histogram was associated with an MGMT promoter methylation subtype (P < 0.0246). This study shows that within the same patient cohort, the method selected to analyse ADC measures has a significant bearing on the use of that metric as a surrogate marker of MGMT status. Thus for dMRI data to be clinically useful, consistent methods of data analysis need to be established prior to establishing any relationship with genetic or epigenetic profiling.

  16. Using the apparent diffusion coefficient to identifying MGMT promoter methylation status early in glioblastoma: importance of analytical method

    International Nuclear Information System (INIS)

    Rundle-Thiele, Dayle; Day, Bryan; Stringer, Brett; Fay, Michael; Martin, Jennifer; Jeffree, Rosalind L; Thomas, Paul; Bell, Christopher; Salvado, Olivier; Gal, Yaniv; Coulthard, Alan; Crozier, Stuart; Rose, Stephen

    2015-01-01

    Accurate knowledge of O 6 -methylguanine methyltransferase (MGMT) gene promoter subtype in patients with glioblastoma (GBM) is important for treatment. However, this test is not always available. Pre-operative diffusion MRI (dMRI) can be used to probe tumour biology using the apparent diffusion coefficient (ADC); however, its ability to act as a surrogate to predict MGMT status has shown mixed results. We investigated whether this was due to variations in the method used to analyse ADC. We undertook a retrospective study of 32 patients with GBM who had MGMT status measured. Matching pre-operative MRI data were used to calculate the ADC within contrast enhancing regions of tumour. The relationship between ADC and MGMT was examined using two published ADC methods. A strong trend between a measure of ‘minimum ADC’ and methylation status was seen. An elevated minimum ADC was more likely in the methylated compared to the unmethylated MGMT group (U = 56, P = 0.0561). In contrast, utilising a two-mixture model histogram approach, a significant reduction in mean measure of the ‘low ADC’ component within the histogram was associated with an MGMT promoter methylation subtype (P < 0.0246). This study shows that within the same patient cohort, the method selected to analyse ADC measures has a significant bearing on the use of that metric as a surrogate marker of MGMT status. Thus for dMRI data to be clinically useful, consistent methods of data analysis need to be established prior to establishing any relationship with genetic or epigenetic profiling

  17. Sonication contribution to identifying prosthetic joint infection with Ralstonia pickettii: a case report and review of the literature.

    Science.gov (United States)

    Birlutiu, Rares Mircea; Roman, Mihai Dan; Cismasiu, Razvan Silviu; Fleaca, Sorin Radu; Popa, Crina Maria; Mihalache, Manuela; Birlutiu, Victoria

    2017-07-19

    In the context of an increase number of primary and revision total hip and total knee arthroplasty performed yearly, an increased risk of complication is expected. Prosthetic joint infection (PJI) remains the most common and feared arthroplasty complication. Ralstonia pickettii is a Gram-negative bacterium, that has also been identified in biofilms. It remains an extremely rare cause of PJI. There is no report of an identification of R. pickettii on an extracted spacer loaded with antibiotic. We present the case of an 83-years-old Caucasian male patient, that underwent a right cemented total hip replacement surgery. The patient is diagnosed with an early PJI with no isolated microorganism. A debridement and change of mobile parts is performed. At the beginning of 2016, the patient in readmitted into the Orthopedic Department for sever, right abdominal and groin pain and elevated serum erythrocyte sedimentation rate and C-reactive protein. A joint aspiration is performed with a negative microbiological examination. A two-stage exchange with long interval management is adopted, and a preformed spacer loaded with gentamicin was implanted. In July 2016, based on the proinflammatory markers evolution, a shift a three-stage exchange strategy is decided. In September 2016, a debridement, and changing of the preformed spacer loaded with gentamicin with another was carried out. Bacteriological examination of the tissues sampled intraoperatively was positive for Pseudomonas aeruginosa. From the sonication fluid, no bacteria were isolated on culture or identified using the bbFISH assay. During the hospitalization period, the patient received i.v. ceftazidime 3x2g/day and p.o. ciprofloxacin 2x750mg/day, antibiotic therapy that was continued after discharge with p.o. ciprofloxacin 2x750mg/day for 6 weeks. In February 2017, a reimplantation of a revision prosthesis is performed. The retrieved spacer is sonicated, and after 4 days of incubation of the sonication fluid, R

  18. Factors contributing to the perpetration of workplace incivility: the importance of organizational aspects and experiencing incivility from others

    OpenAIRE

    Torkelson, Eva; Holm, Kristoffer; B?ckstr?m, Martin; Schad, Elinor

    2016-01-01

    ABSTRACT In recent years a growing amount of research has been conducted in the area of workplace incivility. Whereas many studies have focused on the victims and the consequences of incivility, little attention has been paid to the perpetrators and antecedents of workplace incivility. This study aims to identify possible antecedents of workplace incivility, by investigating organizational aspects as well as the possibility that being the target of incivility from co-workers and supervisors c...

  19. The Contribution of Knowledge Intensive Business Services to Successful Innovation in Manufacturing Firms - The Importance of Geographical Proximity

    DEFF Research Database (Denmark)

    Drejer, Ina; Vinding, Anker Lund

    2003-01-01

    The present paper addresses the importance of geographical location of firms in relation to processes of transfer and creation of knowledge with respect to product development, or more specific in terms of firm access to external knowledge provided by knowledge intensive service providers. The an...

  20. Retention in medication-assisted treatment programs in Ukraine-Identifying factors contributing to a continuing HIV epidemic.

    Science.gov (United States)

    Dumchev, Kostyantyn; Dvoryak, Sergii; Chernova, Olena; Morozova, Olga; Altice, Frederick L

    2017-10-01

    Opioid agonist treatments (OAT) are widely-used, evidence-based strategies for treating opioid dependence and reducing HIV transmission. The positive benefits of OAT are strongly correlated with time spent in treatment, making retention a key indicator for program quality. This study assessed patient retention and associated factors in Ukraine, where OAT was first introduced in 2004. Data from clinical records of 2916 patients enrolled in OAT at thirteen sites from 2005 to 2012 were entered into an electronic monitoring system. Survival analysis methods were used to determine the probability of retention and its correlates. Twelve-month retention was 65.8%, improving from 27.7% in 2005, to 70.9% in 2011. In multivariable analyses, the correlates of retention were receiving medium and high doses of medication (compared to low doses, dropout aHR=0.57 for both medium and high doses), having not been tested for HIV and tuberculosis (compared to not being tested, dropout aHR=4.44 and 3.34, respectively), and among those who were tested-a negative TB test result (compared to receiving a positive test result, dropout aHR=0.67). Retention in Ukrainian OAT programs, especially in recent years, is comparable to other countries. The results confirm the importance of adequate OAT dosing (≥60mg of methadone, ≥8mg of buprenorphine). Higher dosing, however, will require interventions that address negative attitudes toward OAT by patients and providers. Interruption of OAT, in the case developing tuberculosis, should incorporate continuity of OAT for TB patients through integrated care delivery systems. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Using dynamic walking models to identify factors that contribute to increased risk of falling in older adults.

    Science.gov (United States)

    Roos, Paulien E; Dingwell, Jonathan B

    2013-10-01

    Falls are common in older adults. The most common cause of falls is tripping while walking. Simulation studies demonstrated that older adults may be restricted by lower limb strength and movement speed to regain balance after a trip. This review examines how modeling approaches can be used to determine how different measures predict actual fall risk and what some of the causal mechanisms of fall risk are. Although increased gait variability predicts increased fall risk experimentally, it is not clear which variability measures could best be used, or what magnitude of change corresponded with increased fall risk. With a simulation study we showed that the increase in fall risk with a certain increase in gait variability was greatly influenced by the initial level of variability. Gait variability can therefore not easily be used to predict fall risk. We therefore explored other measures that may be related to fall risk and investigated the relationship between stability measures such as Floquet multipliers and local divergence exponents and actual fall risk in a dynamic walking model. We demonstrated that short-term local divergence exponents were a good early predictor for fall risk. Neuronal noise increases with age. It has however not been fully understood if increased neuronal noise would cause an increased fall risk. With our dynamic walking model we showed that increased neuronal noise caused increased fall risk. Although people who are at increased risk of falling reduce their walking speed it had been questioned whether this slower speed would actually cause a reduced fall risk. With our model we demonstrated that a reduced walking speed caused a reduction in fall risk. This may be due to the decreased kinematic variability as a result of the reduced signal-dependent noise of the smaller muscle forces that are required for slower. These insights may be used in the development of fall prevention programs in order to better identify those at increased risk of

  2. Using Dynamic Walking Models to Identify Factors that Contribute to Increased Risk of Falling in Older Adults

    Science.gov (United States)

    Roos, Paulien E.; Dingwell, Jonathan B.

    2013-01-01

    Falls are common in older adults. The most common cause of falls is tripping while walking. Simulation studies demonstrated that older adults may be restricted by lower limb strength and movement speed to regain balance after a trip. This review examines how modeling approaches can be used to determine how different measures predict actual fall risk and what some of the causal mechanisms of fall risk are. Although increased gait variability predicts increased fall risk experimentally, it is not clear which variability measures could best be used, or what magnitude of change corresponded with increased fall risk. With a simulation study we showed that the increase in fall risk with a certain increase in gait variability was greatly influenced by the initial level of variability. Gait variability can therefore not easily be used to predict fall risk. We therefore explored other measures that may be related to fall risk and investigated the relationship between stability measures such as Floquet multipliers and local divergence exponents and actual fall risk in a dynamic walking model. We demonstrated that short-term local divergence exponents were a good early predictor for fall risk. Neuronal noise increases with age. It has however not been fully understood if increased neuronal noise would cause an increased fall risk. With our dynamic walking model we showed that increased neuronal noise caused increased fall risk. Although people who are at increased risk of falling reduce their walking speed it had been questioned whether this slower speed would actually cause a reduced fall risk. With our model we demonstrated that a reduced walking speed caused a reduction in fall risk. This may be due to the decreased kinematic variability as a result of the reduced signal-dependent noise of the smaller muscle forces that are required for slower. These insights may be used in the development of fall prevention programs in order to better identify those at increased risk of

  3. Identifying significant factors which can contribute to successful transitions from school to lasting employment affiliation for pupils in vocational training programs

    OpenAIRE

    Nils Breilid; Eva Dyrnes

    2017-01-01

    Introduction: This study deals with young people receiving special needs education in schools and their transition to lasting employment in private or public sector. Through a qualitative approach, the article aims at “identifying significant factors which can, contribute to successful transitions from school to lasting employment affiliation for pupils in vocational training programs”Theoretical approach: The theoretical approach of this article is descriptions and interpretation of the Norw...

  4. Triangulating Principal Effectiveness: How Perspectives of Parents, Teachers, and Assistant Principals Identify the Central Importance of Managerial Skills. Working Paper 35

    Science.gov (United States)

    Grissom, Jason A.; Loeb, Susanna

    2009-01-01

    While the importance of effective principals is undisputed, few studies have addressed what specific skills principals need to promote school success. This study draws on unique data combining survey responses from principals, assistant principals, teachers and parents with rich administrative data to identify which principal skills matter most…

  5. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L.) Using SLAF-seq.

    Science.gov (United States)

    Xie, Dongwei; Dai, Zhigang; Yang, Zemao; Sun, Jian; Zhao, Debao; Yang, Xue; Zhang, Liguo; Tang, Qing; Su, Jianguang

    2017-01-01

    Flax ( Linum usitatissimum L.) is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq) was employed to perform a genome-wide association study (GWAS) for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP) loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM) and a mixed linear model (MLM) as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  6. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L. Using SLAF-seq

    Directory of Open Access Journals (Sweden)

    Dongwei Xie

    2018-01-01

    Full Text Available Flax (Linum usitatissimum L. is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq was employed to perform a genome-wide association study (GWAS for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM and a mixed linear model (MLM as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  7. The strategic importance of identifying knowledge-based and intangible assets for generating value, competitiveness and innovation in sub-Saharan Africa

    Directory of Open Access Journals (Sweden)

    Nicoline Ondari-Okemwa

    2011-01-01

    Full Text Available This article discusses the strategic importance of identifying intangible assets for creating value and enhancing competitiveness and innovation in science and technology in a knowledge economy with particular reference to the sub- Saharan Africa region. It has always been difficult to gather the prerequisite information to manage such assets and create value from them. The paper discusses the nature of intangible assets, the characteristics of a knowledge economy and the role of knowledge workers in a knowledge economy. The paper also discusses the importance of identifying intangible assets in relation to capturing the value of such assets, the transfer of intangible assets to other owners and the challenges of managing organizational intangible assets. Objectives of the article include: underscoring the strategic importance of identifying intangible assets in sub-Saharan Africa; examining the performance of intangible assets in a knowledge economy; how intangible assets may generate competitiveness, economic growth and innovation; and assess how knowledge workers are becoming a dominant factor in the knowledge economy. An extensive literature review was employed to collect data for this article. It is concluded in the article that organizations and governments in sub-Saharan Africa should look at knowledge-based assets as strategic resources, even though the traditional accounting systems may still be having problems in determining the exact book value of such assets. It is recommended that organizations and government departments in sub-Saharan Africa should implement a system of the reporting of the value of intangible organizational assets just like the reporting of the value of tangible assets; and that organizations in sub-Saharan Africa should use knowledge to produce “smart products and services” which command premium prices.

  8. Identifying obstacles and ranking common biological control research priorities for Europe to manage most economically important pests in arable, vegetable and perennial crops.

    Science.gov (United States)

    Lamichhane, Jay Ram; Bischoff-Schaefer, Monika; Bluemel, Sylvia; Dachbrodt-Saaydeh, Silke; Dreux, Laure; Jansen, Jean-Pierre; Kiss, Jozsef; Köhl, Jürgen; Kudsk, Per; Malausa, Thibaut; Messéan, Antoine; Nicot, Philippe C; Ricci, Pierre; Thibierge, Jérôme; Villeneuve, François

    2017-01-01

    EU agriculture is currently in transition from conventional crop protection to integrated pest management (IPM). Because biocontrol is a key component of IPM, many European countries recently have intensified their national efforts on biocontrol research and innovation (R&I), although such initiatives are often fragmented. The operational outputs of national efforts would benefit from closer collaboration among stakeholders via transnationally coordinated approaches, as most economically important pests are similar across Europe. This paper proposes a common European framework on biocontrol R&I. It identifies generic R&I bottlenecks and needs as well as priorities for three crop types (arable, vegetable and perennial crops). The existing gap between the market offers of biocontrol solutions and the demand of growers, the lengthy and expensive registration process for biocontrol solutions and their varying effectiveness due to variable climatic conditions and site-specific factors across Europe are key obstacles hindering the development and adoption of biocontrol solutions in Europe. Considering arable, vegetable and perennial crops, a dozen common target pests are identified for each type of crop and ranked by order of importance at European level. Such a ranked list indicates numerous topics on which future joint transnational efforts would be justified. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  9. Linking the Salt Transcriptome with Physiological Responses of a Salt-Resistant Populus Species as a Strategy to Identify Genes Important for Stress Acclimation1[W][OA

    Science.gov (United States)

    Brinker, Monika; Brosché, Mikael; Vinocur, Basia; Abo-Ogiala, Atef; Fayyaz, Payam; Janz, Dennis; Ottow, Eric A.; Cullmann, Andreas D.; Saborowski, Joachim; Kangasjärvi, Jaakko; Altman, Arie; Polle, Andrea

    2010-01-01

    To investigate early salt acclimation mechanisms in a salt-tolerant poplar species (Populus euphratica), the kinetics of molecular, metabolic, and physiological changes during a 24-h salt exposure were measured. Three distinct phases of salt stress were identified by analyses of the osmotic pressure and the shoot water potential: dehydration, salt accumulation, and osmotic restoration associated with ionic stress. The duration and intensity of these phases differed between leaves and roots. Transcriptome analysis using P. euphratica-specific microarrays revealed clusters of coexpressed genes in these phases, with only 3% overlapping salt-responsive genes in leaves and roots. Acclimation of cellular metabolism to high salt concentrations involved remodeling of amino acid and protein biosynthesis and increased expression of molecular chaperones (dehydrins, osmotin). Leaves suffered initially from dehydration, which resulted in changes in transcript levels of mitochondrial and photosynthetic genes, indicating adjustment of energy metabolism. Initially, decreases in stress-related genes were found, whereas increases occurred only when leaves had restored the osmotic balance by salt accumulation. Comparative in silico analysis of the poplar stress regulon with Arabidopsis (Arabidopsis thaliana) orthologs was used as a strategy to reduce the number of candidate genes for functional analysis. Analysis of Arabidopsis knockout lines identified a lipocalin-like gene (AtTIL) and a gene encoding a protein with previously unknown functions (AtSIS) to play roles in salt tolerance. In conclusion, by dissecting the stress transcriptome of tolerant species, novel genes important for salt endurance can be identified. PMID:20959419

  10. Linking the salt transcriptome with physiological responses of a salt-resistant Populus species as a strategy to identify genes important for stress acclimation.

    Science.gov (United States)

    Brinker, Monika; Brosché, Mikael; Vinocur, Basia; Abo-Ogiala, Atef; Fayyaz, Payam; Janz, Dennis; Ottow, Eric A; Cullmann, Andreas D; Saborowski, Joachim; Kangasjärvi, Jaakko; Altman, Arie; Polle, Andrea

    2010-12-01

    To investigate early salt acclimation mechanisms in a salt-tolerant poplar species (Populus euphratica), the kinetics of molecular, metabolic, and physiological changes during a 24-h salt exposure were measured. Three distinct phases of salt stress were identified by analyses of the osmotic pressure and the shoot water potential: dehydration, salt accumulation, and osmotic restoration associated with ionic stress. The duration and intensity of these phases differed between leaves and roots. Transcriptome analysis using P. euphratica-specific microarrays revealed clusters of coexpressed genes in these phases, with only 3% overlapping salt-responsive genes in leaves and roots. Acclimation of cellular metabolism to high salt concentrations involved remodeling of amino acid and protein biosynthesis and increased expression of molecular chaperones (dehydrins, osmotin). Leaves suffered initially from dehydration, which resulted in changes in transcript levels of mitochondrial and photosynthetic genes, indicating adjustment of energy metabolism. Initially, decreases in stress-related genes were found, whereas increases occurred only when leaves had restored the osmotic balance by salt accumulation. Comparative in silico analysis of the poplar stress regulon with Arabidopsis (Arabidopsis thaliana) orthologs was used as a strategy to reduce the number of candidate genes for functional analysis. Analysis of Arabidopsis knockout lines identified a lipocalin-like gene (AtTIL) and a gene encoding a protein with previously unknown functions (AtSIS) to play roles in salt tolerance. In conclusion, by dissecting the stress transcriptome of tolerant species, novel genes important for salt endurance can be identified.

  11. Contribution of fish to intakes of micronutrients important for fetal development: a dietary survey of pregnant women in the Republic of Seychelles.

    Science.gov (United States)

    Bonham, Maxine P; Duffy, Emeir M; Robson, Paula J; Wallace, Julie M; Myers, Gary J; Davidson, Philip W; Clarkson, Tom W; Shamlaye, Conrad F; Strain, J J; Livingstone, M Barbara E

    2009-09-01

    To characterise the diets of pregnant women in the Republic of Seychelles and to determine the contribution of fish to intakes of nutrients important for fetal and neonatal development. Observational, prospective study. Seychelles Child Development Centre, Mahé, Republic of Seychelles. Pregnant women (n 300) were recruited at their first visit to an antenatal clinic. At 28 weeks' gestation subjects completed a 4 d diet diary (n 273) and intakes were analysed using dietary analysis software. Mean (sd) energy intake was 9.0 (2.5) MJ/d and fat intakes were higher than UK recommendations for almost two-thirds of the cohort. Fish consumption was lower than in previous surveys, suggesting a move towards a more Westernised diet. Low intakes of a number of nutrients important during pregnancy for fetal development (Fe, Zn, Se and iodine) were observed. However, women who met the current recommendations for these nutrients consumed significantly more fish than those who did not (97 v. 73 g/d). The present study highlights the importance of fish in the diet of pregnant Seychellois women for ensuring adequate intakes of micronutrients important in fetal development. Dietary patterns in Seychelles, however, are in a state of transition, with a move towards a Western-style diet as evidenced by higher fat and lower fish intakes. If these dietary trends continue and fish consumption declines further, micronutrient status may be compromised. These findings suggest caution in establishing public health policies that promote limitation of fish intake during pregnancy.

  12. Using the community pharmacy to identify patients at risk of poor asthma control and factors which contribute to this poor control.

    Science.gov (United States)

    Armour, Carol L; Lemay, Kate; Saini, Bandana; Reddel, Helen K; Bosnic-Anticevich, Sinthia Z; Smith, Lorraine D; Burton, Deborah; Song, Yun Ju Christine; Alles, Marie Chehani; Stewart, Kay; Emmerton, Lynne; Krass, Ines

    2011-11-01

    BMQ) and were more likely to have poor control. Community pharmacists were able to identify patients with asthma at risk of suboptimal control, and factors that contributed to this were elicited. This poorly controlled group that was identified may not be visible or accessible to other health-care professionals. There is an opportunity within pharmacies to target poorly controlled asthma and provide timely and tailored interventions.

  13. Experimental assessment of the importance of amino acid positions identified by an entropy-based correlation analysis of multiple-sequence alignments.

    Science.gov (United States)

    Dietrich, Susanne; Borst, Nadine; Schlee, Sandra; Schneider, Daniel; Janda, Jan-Oliver; Sterner, Reinhard; Merkl, Rainer

    2012-07-17

    The analysis of a multiple-sequence alignment (MSA) with correlation methods identifies pairs of residue positions whose occupation with amino acids changes in a concerted manner. It is plausible to assume that positions that are part of many such correlation pairs are important for protein function or stability. We have used the algorithm H2r to identify positions k in the MSAs of the enzymes anthranilate phosphoribosyl transferase (AnPRT) and indole-3-glycerol phosphate synthase (IGPS) that show a high conn(k) value, i.e., a large number of significant correlations in which k is involved. The importance of the identified residues was experimentally validated by performing mutagenesis studies with sAnPRT and sIGPS from the archaeon Sulfolobus solfataricus. For sAnPRT, five H2r mutant proteins were generated by replacing nonconserved residues with alanine or the prevalent residue of the MSA. As a control, five residues with conn(k) values of zero were chosen randomly and replaced with alanine. The catalytic activities and conformational stabilities of the H2r and control mutant proteins were analyzed by steady-state enzyme kinetics and thermal unfolding studies. Compared to wild-type sAnPRT, the catalytic efficiencies (k(cat)/K(M)) were largely unaltered. In contrast, the apparent thermal unfolding temperature (T(M)(app)) was lowered in most proteins. Remarkably, the strongest observed destabilization (ΔT(M)(app) = 14 °C) was caused by the V284A exchange, which pertains to the position with the highest correlation signal [conn(k) = 11]. For sIGPS, six H2r mutant and four control proteins with alanine exchanges were generated and characterized. The k(cat)/K(M) values of four H2r mutant proteins were reduced between 13- and 120-fold, and their T(M)(app) values were decreased by up to 5 °C. For the sIGPS control proteins, the observed activity and stability decreases were much less severe. Our findings demonstrate that positions with high conn(k) values have an

  14. Favorable Alleles for Stem Water-Soluble Carbohydrates Identified by Association Analysis Contribute to Grain Weight under Drought Stress Conditions in Wheat

    Science.gov (United States)

    Li, Runzhi; Chang, Xiaoping; Jing, Ruilian

    2015-01-01

    Drought is a major environmental constraint to crop distribution and productivity. Stem water-soluble carbohydrates (WSC) buffer wheat grain yield against conditions unfavorable for photosynthesis during the grain filling stage. In this study, 262 winter wheat accessions and 209 genome-wide SSR markers were collected and used to undertake association analysis based on a mixed linear model (MLM). The WSC in different internodes at three growth stages and 1000-grain weight (TGW) were investigated under four environmental regimes (well-watered, drought stress during the whole growth period, and two levels of terminal drought stress imposed by chemical desiccation under the well-watered and drought stress during the whole growth period conditions). Under diverse drought stress conditions, WSC in lower internodes showed significant positive correlations with TGW, especially at the flowering stage under well-watered conditions and at grain filling under drought stress. Sixteen novel WSC-favorable alleles were identified, and five of them contributed to significantly higher TGW. In addition, pyramiding WSC favorable alleles was not only effective for obtaining accessions with higher WSC, but also for enhancing TGW under different water regimes. During the past fifty years of wheat breeding, WSC was selected incidentally. The average number of favorable WSC alleles increased from 1.13 in the pre-1960 period to 4.41 in the post-2000 period. The results indicate a high potential for using marker-assisted selection to pyramid WSC favorable alleles in improving WSC and TGW in wheat. PMID:25768726

  15. Contribution of the C-terminal tri-lysine regions of human immunodeficiency virus type 1 integrase for efficient reverse transcription and viral DNA nuclear import

    Directory of Open Access Journals (Sweden)

    Fowke Keith R

    2005-10-01

    Full Text Available Abstract Background In addition to mediating the integration process, HIV-1 integrase (IN has also been implicated in different steps during viral life cycle including reverse transcription and viral DNA nuclear import. Although the karyophilic property of HIV-1 IN has been well demonstrated using a variety of experimental approaches, the definition of domain(s and/or motif(s within the protein that mediate viral DNA nuclear import and its mechanism are still disputed and controversial. In this study, we performed mutagenic analyses to investigate the contribution of different regions in the C-terminal domain of HIV-1 IN to protein nuclear localization as well as their effects on virus infection. Results Our analysis showed that replacing lysine residues in two highly conserved tri-lysine regions, which are located within previously described Region C (235WKGPAKLLWKGEGAVV and sequence Q (211KELQKQITK in the C-terminal domain of HIV-1 IN, impaired protein nuclear accumulation, while mutations for RK263,4 had no significant effect. Analysis of their effects on viral infection in a VSV-G pseudotyped RT/IN trans-complemented HIV-1 single cycle replication system revealed that all three C-terminal mutant viruses (KK215,9AA, KK240,4AE and RK263,4AA exhibited more severe defect of induction of β-Gal positive cells and luciferase activity than an IN class 1 mutant D64E in HeLa-CD4-CCR5-β-Gal cells, and in dividing as well as non-dividing C8166 T cells, suggesting that some viral defects are occurring prior to viral integration. Furthermore, by analyzing viral DNA synthesis and the nucleus-associated viral DNA level, the results clearly showed that, although all three C-terminal mutants inhibited viral reverse transcription to different extents, the KK240,4AE mutant exhibited most profound effect on this step, whereas KK215,9AA significantly impaired viral DNA nuclear import. In addition, our analysis could not detect viral DNA integration in each C

  16. Whole-exome sequencing of muscle-invasive bladder cancer identifies recurrent mutations of UNC5C and prognostic importance of DNA repair gene mutations on survival.

    Science.gov (United States)

    Yap, Kai Lee; Kiyotani, Kazuma; Tamura, Kenji; Antic, Tatjana; Jang, Miran; Montoya, Magdeline; Campanile, Alexa; Yew, Poh Yin; Ganshert, Cory; Fujioka, Tomoaki; Steinberg, Gary D; O'Donnell, Peter H; Nakamura, Yusuke

    2014-12-15

    Because of suboptimal outcomes in muscle-invasive bladder cancer even with multimodality therapy, determination of potential genetic drivers offers the possibility of improving therapeutic approaches and discovering novel prognostic indicators. Using pTN staging, we case-matched 81 patients with resected ≥pT2 bladder cancers for whom perioperative chemotherapy use and disease recurrence status were known. Whole-exome sequencing was conducted in 43 cases to identify recurrent somatic mutations and targeted sequencing of 10 genes selected from the initial screening in an additional 38 cases was completed. Mutational profiles along with clinicopathologic information were correlated with recurrence-free survival (RFS) in the patients. We identified recurrent novel somatic mutations in the gene UNC5C (9.9%), in addition to TP53 (40.7%), KDM6A (21.0%), and TSC1 (12.3%). Patients who were carriers of somatic mutations in DNA repair genes (one or more of ATM, ERCC2, FANCD2, PALB2, BRCA1, or BRCA2) had a higher overall number of somatic mutations (P = 0.011). Importantly, after a median follow-up of 40.4 months, carriers of somatic mutations (n = 25) in any of these six DNA repair genes had significantly enhanced RFS compared with noncarriers [median, 32.4 vs. 14.8 months; hazard ratio of 0.46, 95% confidence interval (CI), 0.22-0.98; P = 0.0435], after adjustment for pathologic pTN staging and independent of adjuvant chemotherapy usage. Better prognostic outcomes of individuals carrying somatic mutations in DNA repair genes suggest these mutations as favorable prognostic events in muscle-invasive bladder cancer. Additional mechanistic investigation into the previously undiscovered role of UNC5C in bladder cancer is warranted. ©2014 American Association for Cancer Research.

  17. Results from an exploratory study to identify the factors that contribute to success for UK medical device small- and medium-sized enterprises.

    Science.gov (United States)

    Hourd, P C; Williams, D J

    2008-07-01

    This paper reports the results from an exploratory study that sets out to identify and compare the strategic approaches and patterns of business practice employed by 14 UK small- and medium-sized enterprises to achieve success in the medical device sector of the health-care industry. An interview-based survey was used to construct individual case studies of the medical device technology (MDT) companies. A cross-case analysis was performed to search for patterns and themes that cut across these individual cases. Exploratory results revealed the heterogeneity of MDT companies and the distinctive features of the MDT innovation process that emphasize the importance of a strategic approach for achieving milestones in the product development and exploitation process and for creating value for the company and its stakeholders. Recognizing the heterogeneity of MDT companies, these exploratory findings call for further investigation to understand better the influence of components of the MDT innovation process on the commercialization life cycle and value trajectory. This is required to assist start-up or spin-out MDT companies in the UK and worldwide to navigate the critical transitions that determine access to financial and consumer markets and enhance the potential to build a successful business. This will be important not only for bioscience-based companies but also for engineering-based companies aiming to convert their activities into medical devices and the health- and social-care market.

  18. Machine Learning Analysis Identifies Drosophila Grunge/Atrophin as an Important Learning and Memory Gene Required for Memory Retention and Social Learning.

    Science.gov (United States)

    Kacsoh, Balint Z; Greene, Casey S; Bosco, Giovanni

    2017-11-06

    High-throughput experiments are becoming increasingly common, and scientists must balance hypothesis-driven experiments with genome-wide data acquisition. We sought to predict novel genes involved in Drosophila learning and long-term memory from existing public high-throughput data. We performed an analysis using PILGRM, which analyzes public gene expression compendia using machine learning. We evaluated the top prediction alongside genes involved in learning and memory in IMP, an interface for functional relationship networks. We identified Grunge/Atrophin ( Gug/Atro ), a transcriptional repressor, histone deacetylase, as our top candidate. We find, through multiple, distinct assays, that Gug has an active role as a modulator of memory retention in the fly and its function is required in the adult mushroom body. Depletion of Gug specifically in neurons of the adult mushroom body, after cell division and neuronal development is complete, suggests that Gug function is important for memory retention through regulation of neuronal activity, and not by altering neurodevelopment. Our study provides a previously uncharacterized role for Gug as a possible regulator of neuronal plasticity at the interface of memory retention and memory extinction. Copyright © 2017 Kacsoh et al.

  19. Important Roles of Enthalpic and Entropic Contributions to CO 2 Capture from Simulated Flue Gas and Ambient Air Using Mesoporous Silica Grafted Amines

    KAUST Repository

    Alkhabbaz, Mustafa A.; Bollini, Praveen; Foo, Guo Shiou; Sievers, Carsten; Jones, Christopher W.

    2014-01-01

    © 2014 American Chemical Society. The measurement of isosteric heats of adsorption of silica supported amine materials in the low pressure range (0- 0.1 bar) is critical for understanding the interactions between CO2 and amine sites at low coverage and hence to the development of efficient amine adsorbents for CO2 capture from flue gas and ambient air. Heats of adsorption for an array of silica-supported amine materials are experimentally measured at low coverage using a Calvet calorimeter equipped with a customized dosing manifold. In a series of 3-aminopropylfunctionalized silica materials, higher amine densities resulted in higher isosteric heats of adsorption, clearly showing that the density/proximity of amine sites can influence the amine efficiency of adsorbents. In a series of materials with fixed amine loading but different amine types, strongly basic primary and secondary amine materials are shown to have essentially identical heats of adsorption near 90 kJ/mol. However, the adsorption uptakes vary substantially as a function of CO2 partial pressure for different primary and secondary amines, demonstrating that entropic contributions to adsorption may play a key role in adsorption at secondary amine sites, making adsorption at these sites less effi cient at the low coverages that are important to the direct capture of CO2 from ambient air. Thus, while primary amines are confirmed to be the most effective amine types for CO2 capture from ambient air, this is not due to enhanced enthalpic contributions associated with primary amines over secondary amines, but may be due to unfavorable entropic factors associated with organization of the second alkyl chain on the secondary amine during CO2 adsorption. Given this hypothesis, favorable entropic factors may be the main reason primary amine based adsorbents are more effective under air capture conditions.

  20. Important Roles of Enthalpic and Entropic Contributions to CO 2 Capture from Simulated Flue Gas and Ambient Air Using Mesoporous Silica Grafted Amines

    KAUST Repository

    Alkhabbaz, Mustafa A.

    2014-09-24

    © 2014 American Chemical Society. The measurement of isosteric heats of adsorption of silica supported amine materials in the low pressure range (0- 0.1 bar) is critical for understanding the interactions between CO2 and amine sites at low coverage and hence to the development of efficient amine adsorbents for CO2 capture from flue gas and ambient air. Heats of adsorption for an array of silica-supported amine materials are experimentally measured at low coverage using a Calvet calorimeter equipped with a customized dosing manifold. In a series of 3-aminopropylfunctionalized silica materials, higher amine densities resulted in higher isosteric heats of adsorption, clearly showing that the density/proximity of amine sites can influence the amine efficiency of adsorbents. In a series of materials with fixed amine loading but different amine types, strongly basic primary and secondary amine materials are shown to have essentially identical heats of adsorption near 90 kJ/mol. However, the adsorption uptakes vary substantially as a function of CO2 partial pressure for different primary and secondary amines, demonstrating that entropic contributions to adsorption may play a key role in adsorption at secondary amine sites, making adsorption at these sites less effi cient at the low coverages that are important to the direct capture of CO2 from ambient air. Thus, while primary amines are confirmed to be the most effective amine types for CO2 capture from ambient air, this is not due to enhanced enthalpic contributions associated with primary amines over secondary amines, but may be due to unfavorable entropic factors associated with organization of the second alkyl chain on the secondary amine during CO2 adsorption. Given this hypothesis, favorable entropic factors may be the main reason primary amine based adsorbents are more effective under air capture conditions.

  1. Important roles of enthalpic and entropic contributions to CO2 capture from simulated flue gas and ambient air using mesoporous silica grafted amines.

    Science.gov (United States)

    Alkhabbaz, Mustafa A; Bollini, Praveen; Foo, Guo Shiou; Sievers, Carsten; Jones, Christopher W

    2014-09-24

    The measurement of isosteric heats of adsorption of silica supported amine materials in the low pressure range (0-0.1 bar) is critical for understanding the interactions between CO2 and amine sites at low coverage and hence to the development of efficient amine adsorbents for CO2 capture from flue gas and ambient air. Heats of adsorption for an array of silica-supported amine materials are experimentally measured at low coverage using a Calvet calorimeter equipped with a customized dosing manifold. In a series of 3-aminopropyl-functionalized silica materials, higher amine densities resulted in higher isosteric heats of adsorption, clearly showing that the density/proximity of amine sites can influence the amine efficiency of adsorbents. In a series of materials with fixed amine loading but different amine types, strongly basic primary and secondary amine materials are shown to have essentially identical heats of adsorption near 90 kJ/mol. However, the adsorption uptakes vary substantially as a function of CO2 partial pressure for different primary and secondary amines, demonstrating that entropic contributions to adsorption may play a key role in adsorption at secondary amine sites, making adsorption at these sites less efficient at the low coverages that are important to the direct capture of CO2 from ambient air. Thus, while primary amines are confirmed to be the most effective amine types for CO2 capture from ambient air, this is not due to enhanced enthalpic contributions associated with primary amines over secondary amines, but may be due to unfavorable entropic factors associated with organization of the second alkyl chain on the secondary amine during CO2 adsorption. Given this hypothesis, favorable entropic factors may be the main reason primary amine based adsorbents are more effective under air capture conditions.

  2. Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses

    Directory of Open Access Journals (Sweden)

    Su Zhen

    2011-07-01

    Full Text Available Abstract Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants.

  3. A method to identify important dynamical states in Boolean models of regulatory networks: application to regulation of stomata closure by ABA in A. thaliana.

    Science.gov (United States)

    Bugs, Cristhian A; Librelotto, Giovani R; Mombach, José C M

    2011-12-22

    We introduce a method to analyze the states of regulatory Boolean models that identifies important network states and their biological influence on the global network dynamics. It consists in (1) finding the states of the network that are most frequently visited and (2) the identification of variable and frozen nodes of the network. The method, along with a simulation that includes random features, is applied to the study of stomata closure by abscisic acid (ABA) in A. thaliana proposed by Albert and coworkers. We find that for the case of study, that the dynamics of wild and mutant networks have just two states that are highly visited in their space of states and about a third of all nodes of the wild network are variable while the rest remain frozen in True or False states. This high number of frozen elements explains the low cardinality of the space of states of the wild network. Similar results are observed in the mutant networks. The application of the method allowed us to explain how wild and mutants behave dynamically in the SS and determined an essential feature of the activation of the closure node (representing stomata closure), i.e. its synchronization with the AnionEm node (representing anion efflux at the plasma membrane). The dynamics of this synchronization explains the efficiency reached by the wild and each of the mutant networks. For the biological problem analyzed, our method allows determining how wild and mutant networks differ 'phenotypically'. It shows that the different efficiencies of stomata closure reached among the simulated wild and mutant networks follow from a dynamical behavior of two nodes that are always synchronized. Additionally, we predict that the involvement of the anion efflux at the plasma membrane is crucial for the plant response to ABA. The algorithm used in the simulations is available upon request.

  4. Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses

    Science.gov (United States)

    2011-01-01

    Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants. PMID:21718548

  5. The importance of Foxp3 antibody and fixation/permeabilization buffer combinations in identifying CD4+CD25+Foxp3+ regulatory T cells.

    Science.gov (United States)

    Law, Jacqueline P; Hirschkorn, Dale F; Owen, Rachel E; Biswas, Hope H; Norris, Philip J; Lanteri, Marion C

    2009-12-01

    Foxp3 is a key marker for CD4(+) regulatory T cells (T(regs)) and was used in developing a multiparameter flow cytometric panel to identify T(regs). Achieving reproducible staining and analysis first required optimization of Foxp3 staining. We present a comparative study of PCH101, 236A/E7, 3G3, 206D, 150D, and 259D/C7 clones of anti-human-Foxp3 antibodies used in combination with five different fixation/permeabilization buffers. Staining for CD25, CD152, and CD127 was also compared between fixation/permeabilization treatments. Promising antibody/buffer combinations were tested in a panel of peripheral blood mononuclear cells from 10 individuals, and then on fresh versus frozen cells from four individuals. Finally, different fluorochromes coupled to two representative antibodies were compared to optimize separation of Foxp3(+) from Foxp3(-) events. Foxp3 gates were set using two gating strategies based on CD127(+)CD25(-) "non-T(regs)" or based on isotype controls. For Foxp3 staining, the best conditions for fixation/permeabilization were obtained using the eBioscience Foxp3, Imgenex, BioLegend, and BD Foxp3 buffers. Comparing results from 10 subjects, 259D/C7, PCH101, 236A/E7, and 206D antibodies yielded statistically higher levels of Foxp3 cells than those by 150D and 3G3 antibodies (mean = 6.9, 5.1, 4.7, and 3.7% compared with 1.7, and 0.3% of CD25(+)Foxp3(+) events within CD4(+) cells, respectively). Importantly, the "nonspecificity" of some antibodies observed with a Foxp3 gate based on isotype controls could be eliminated by setting the Foxp3 gate on "non-T(regs)". Better separation of Foxp3(+) and Foxp3(-) populations was observed using the PCH101 clone coupled to Alexa647 compared with FITC or the 259D/C7 clone coupled to PE compared with Alexa488 fluorochrome. Foxp3 staining can be highly variable and depends on the choice of antibody/buffer pair and the fluorochrome used. Selecting the correct population for setting the Foxp3 gate is critical to avoid

  6. Does information on novel identified autoantibodies contribute to predicting the progression from undifferentiated arthritis to rheumatoid arthritis: a study on anti-CarP antibodies as an example.

    Science.gov (United States)

    Boeters, Debbie M; Trouw, Leendert A; van der Helm-van Mil, Annette H M; van Steenbergen, Hanna W

    2018-05-03

    The presence of autoantibodies is considered an important characteristic of rheumatoid arthritis (RA); therefore, both anticitrullinated protein antibodies (ACPA) and rheumatoid factor (RF) are included in the 2010 classification criteria for rheumatoid arthritis (RA). However, a considerable number of RA patients lack both these autoantibodies. Recently, several novel autoantibodies have been identified but their value for the classification of RA patients is unclear. Therefore, we studied the value of novel autoantibodies using the presence of anticarbamylated protein (anti-CarP) antibodies as an example for predicting RA development in patients with undifferentiated arthritis (UA). There were 1352 UA patients included in the Leiden Early Arthritis Clinic (EAC) cohort according to the 1987 criteria. When the 2010 criteria were used, there were 838 UA patients. Of these, we evaluated whether they fulfilled the 1987 or 2010 criteria after 1 year, respectively. Logistic regression analyses were performed with RA as outcome and ACPA, RF, and anti-CarP antibodies as predictors. Analyses were repeated after stratification for ACPA and RF. Thirty-three percent of the 1987-UA patients and 6% of the 2010-UA patients progressed to RA during the first year of follow-up. For the 1987-UA patients, anti-CarP antibodies were associated with progression to RA, an association which remained when a correction was made for the presence of ACPA and RF (odds ratio (OR) 1.7, 95% confidence interval (CI) 1.2-2.4). After stratification for ACPA and RF, anti-CarP antibodies were associated with progression to RA only for ACPA- and RF-negative patients (OR 2.1, 95% CI 1.3-3.7). For the 2010-UA patients, anti-CarP antibodies were associated with progression to RA; however, they were not when a correction was made for the presence of ACPA and RF (OR 0.8, 95% CI 0.3-2.1). Our finding that anti-CarP antibodies have no additional value when RA is defined according to the 2010 criteria might

  7. A novel screening method for cell wall mutants in Aspergillus niger identifies UDP-galactopyranose mutase as an important protein in fungal cell wall biosynthesis

    NARCIS (Netherlands)

    Damveld, R.A.; Franken, A.; Arentshorst, M.; Punt, P.J.; Klis, F.M.; van den Hondel, C.A.M.J.J.; Ram, A.F.J.

    2008-01-01

    To identify cell wall biosynthetic genes in filamentous fungi and thus potential targets for the discovery of new antifungals, we developed a novel screening method for cell wall mutants. It is based on our earlier observation that the Aspergillus niger agsA gene, which encodes a putative

  8. Gene expression profiling identifies FYN as an important molecule in tamoxifen resistance and a predictor of early recurrence in patients treated with endocrine therapy

    DEFF Research Database (Denmark)

    Elias, D; (Hansen) Vever, Henriette; Lænkholm, A-V

    2015-01-01

    To elucidate the molecular mechanisms of tamoxifen resistance in breast cancer, we performed gene array analyses and identified 366 genes with altered expression in four unique tamoxifen-resistant (TamR) cell lines vs the parental tamoxifen-sensitive MCF-7/S0.5 cell line. Most of these genes were...

  9. A novel screening method for cell wall mutants in Aspergillus niger identifies UDP-galactopyranose mutase as an important protein in fungal cell wall biosynthesis

    NARCIS (Netherlands)

    Damveld, R.A.; Franken, A.; Arentshorst, M.; Punt, P.J.; Klis, F.M.; Hondel, C.A.M.J.J. van den; Ram, A.F.J.

    2008-01-01

    To identify cell wall biosynthetic genes in filamentous fungi and thus potential targets for the discovery of new antifungals, we developed a novel screening method for cell wall mutants. It is based on our earlier observation that the Aspergillus niger agsA gene, which encodes a putative a-glucan

  10. Prevalence and Clinical Import of Thoracic Injury Identified by Chest Computed Tomography but Not Chest Radiography in Blunt Trauma: Multicenter Prospective Cohort Study.

    Science.gov (United States)

    Langdorf, Mark I; Medak, Anthony J; Hendey, Gregory W; Nishijima, Daniel K; Mower, William R; Raja, Ali S; Baumann, Brigitte M; Anglin, Deirdre R; Anderson, Craig L; Lotfipour, Shahram; Reed, Karin E; Zuabi, Nadia; Khan, Nooreen A; Bithell, Chelsey A; Rowther, Armaan A; Villar, Julian; Rodriguez, Robert M

    2015-12-01

    Chest computed tomography (CT) diagnoses more injuries than chest radiography, so-called occult injuries. Wide availability of chest CT has driven substantial increase in emergency department use, although the incidence and clinical significance of chest CT findings have not been fully described. We determine the frequency, severity, and clinical import of occult injury, as determined by changes in management. These data will better inform clinical decisions, need for chest CT, and odds of intervention. Our sample included prospective data (2009 to 2013) on 5,912 patients at 10 Level I trauma center EDs with both chest radiography and chest CT at physician discretion. These patients were 40.6% of 14,553 enrolled in the parent study who had either chest radiography or chest CT. Occult injuries were pneumothorax, hemothorax, sternal or greater than 2 rib fractures, pulmonary contusion, thoracic spine or scapula fracture, and diaphragm or great vessel injury found on chest CT but not on preceding chest radiography. A priori, we categorized thoracic injuries as major (having invasive procedures), minor (observation or inpatient pain control >24 hours), or of no clinical significance. Primary outcome was prevalence and proportion of occult injury with major interventions of chest tube, mechanical ventilation, or surgery. Secondary outcome was minor interventions of admission rate or observation hours because of occult injury. Two thousand forty-eight patients (34.6%) had chest injury on chest radiography or chest CT, whereas 1,454 of these patients (71.0%, 24.6% of all patients) had occult injury. Of these, in 954 patients (46.6% of injured, 16.1% of total), chest CT found injuries not observed on immediately preceding chest radiography. In 500 more patients (24.4% of injured patients, 8.5% of all patients), chest radiography found some injury, but chest CT found occult injury. Chest radiography found all injuries in only 29.0% of injured patients. Two hundred and two

  11. What Does It Take to Change an Editor's Mind? Identifying Minimally Important Difference Thresholds for Peer Reviewer Rating Scores of Scientific Articles.

    Science.gov (United States)

    Callaham, Michael; John, Leslie K

    2018-01-05

    We define a minimally important difference for the Likert-type scores frequently used in scientific peer review (similar to existing minimally important differences for scores in clinical medicine). The magnitude of score change required to change editorial decisions has not been studied, to our knowledge. Experienced editors at a journal in the top 6% by impact factor were asked how large a change of rating in "overall desirability for publication" was required to trigger a change in their initial decision on an article. Minimally important differences were assessed twice for each editor: once assessing the rating change required to shift the editor away from an initial decision to accept, and the other assessing the magnitude required to shift away from an initial rejection decision. Forty-one editors completed the survey (89% response rate). In the acceptance frame, the median minimally important difference was 0.4 points on a scale of 1 to 5. Editors required a greater rating change to shift from an initial rejection decision; in the rejection frame, the median minimally important difference was 1.2 points. Within each frame, there was considerable heterogeneity: in the acceptance frame, 38% of editors did not change their decision within the maximum available range; in the rejection frame, 51% did not. To our knowledge, this is the first study to determine the minimally important difference for Likert-type ratings of research article quality, or in fact any nonclinical scientific assessment variable. Our findings may be useful for future research assessing whether changes to the peer review process produce clinically meaningful differences in editorial decisionmaking. Copyright © 2017 American College of Emergency Physicians. Published by Elsevier Inc. All rights reserved.

  12. A Data Mining Project to Identify Cardiovascular Related Factors That May Contribute to Changes in Visual Acuity Within the US Astronaut Corps

    Science.gov (United States)

    Westby, Christian M.; Stein, Sydney P.; Platts, Steven H.

    2011-01-01

    Many of the cardiovascular-related adaptations that occur in the microgravity environment are due, in part, to a well-characterized cephalad-fluid shift that is evidenced by facial edema and decreased lower limb circumference. It is believed that most of these alterations occur as a compensatory response necessary to maintain a "normal" blood pressure and cardiac output while in space. However, data from both flight and analog research suggest that in some instances these microgravity-induced alterations may contribute to cardiovascular-related pathologies. Most concerning is the potential relation between the vision disturbances experienced by some long duration crewmembers and changes in cerebral blood flow and intra-ocular pressure. The purpose of this project was to identify cardiovascular measures that may potentially distinguish individuals at risk for visual disturbances after long duration space flight. Toward this goal, we constructed a dataset from Medical Operation tilt/stand test evaluations pre- (days L-15-L-5) and immediate post-flight (day R+0) on 20 (3 females, 17 males). We restricted our evaluation to only crewmembers who participated in both shuttle and space station missions. Data analysis was performed using both descriptive and analytical methods (Stata 11.2, College Station, TX) and are presented as means +/- 95% CI. Crewmembers averaged 5207 (3447 - 8934) flight hours across both long (MIR-23 through Expedition16) and short (STS-27 through STS-101) duration missions between 1988 and 2008. The mean age of the crew at the time of their most recent shuttle flight was 41 (34-44) compared to 47 (40-54) years during their time on station. In order to focus our analysis (we did not have codes to separate out subjects by symptomotology) , we performed a visual inspection of each cardiovascular measures captured during testing and plotted them against stand time, pre- to post-flight, and between mission duration. It was found that pulse pressure most

  13. Studies on the contribution of drinking water to the daily intake of some trace elements of importance in nutrition and radiation protection - a preliminary survey

    International Nuclear Information System (INIS)

    Dang, H.S.

    1998-01-01

    The data were obtained on the concentration of sixteen trace elements in drinking water collected from various parts of India, and from various sources such as river, lake, and well (including borewell). These data were then employed to determine the possible contribution of drinking water to the daily intake of the trace elements by Indian population. The study showed that for the elements Ca, K, Fe, Mn, Mo, As and Rb, their maximum contribution from drinking water, to their daily intake ranged between 3.2-10% of the total daily intake. For elements Na, Mg, Zn, I and Th, however, drinking water contributed up to 40% of the total intake. In the case of elements such as, Cu, Cr, U and Sr, the drinking water could in some cases become the main contributor of their daily intake. (author)

  14. Importance of intrinsic and non-network contribution in PageRank centrality and its effect on PageRank localization

    OpenAIRE

    Deyasi, Krishanu

    2016-01-01

    PageRank centrality is used by Google for ranking web-pages to present search result for a user query. Here, we have shown that PageRank value of a vertex also depends on its intrinsic, non-network contribution. If the intrinsic, non-network contributions of the vertices are proportional to their degrees or zeros, then their PageRank centralities become proportion to their degrees. Some simulations and empirical data are used to support our study. In addition, we have shown that localization ...

  15. Comparison of Spot Urine Protein to Creatinine Ratio to 24-Hour Proteinuria to Identify Important Change Over Time in Proteinuria in Lupus.

    Science.gov (United States)

    Medina-Rosas, Jorge; Su, Jiandong; Cook, Richard J; Sabapathy, Arthy; Touma, Zahi

    2017-09-01

    The aim of this study was to determine whether spot urine protein-to-creatinine ratio (PCR) accurately measures the change in proteinuria compared with 24-hour proteinuria (24H-P). This was a retrospective analysis on patients' paired visits and paired urine samples for PCR and 24H-P. Patients with both abnormal 24H-P (>0.5 g/d) and PCR (>0.05 g/mmol) or both normal 24H-P (≤0.5 g/d) and PCR (≤0.05 g/mmol) at baseline visit were identified.The first follow-up visit with partial recovery (50% decrease in proteinuria) or complete recovery (≤0.5 g/d) was identified for those with abnormal baseline 24H-P, and new proteinuria (>0.5 g/d) was identified for those with normal 24H-P. Twenty-four-hour urine collection and PCR end-point frequencies were compared. Twenty-four-hour urine collection results were converted to 24H-PCR. Twenty-four-hour PCR and PCR were utilized to measure the magnitude of change (by standardized response mean [SRM]) in patients who achieved the end points. Of 230 patients, at baseline, 95 patients had abnormal and 109 had normal 24H-P and PCR. On follow-up, 57 achieved partial recovery, and 53 achieved complete recovery by 24H-P. Standardized response mean was -1.03 and -1.10 for 24H-PCR and PCR, respectively. By PCR, 53 patients had partial recovery, and 27 had complete recovery. Standardized response mean was -1.25 and -0.86 by 24H-PCR and PCR, respectively.For new proteinuria, 28 patients were identified by 24H-P and 21 by PCR. Twenty-four-hour PCR SRM was 0.80, and PCR SRM was 0.68. Protein-to-creatinine ratio does not have sufficient accuracy compared with 24H-P for improvement and worsening to be used in lieu of 24H-P.

  16. Exome chip meta-analysis identifies novel loci and East Asian-specific coding variants that contribute to lipid levels and coronary artery disease

    DEFF Research Database (Denmark)

    Lu, Xiangfeng; Peloso, Gina M; Liu, Dajiang J

    2017-01-01

    Most genome-wide association studies have been of European individuals, even though most genetic variation in humans is seen only in non-European samples. To search for novel loci associated with blood lipid levels and clarify the mechanism of action at previously identified lipid loci, we used a...

  17. Manual blood exchange transfusion does not significantly contribute to parasite clearance in artesunate-treated individuals with imported severe Plasmodium falciparum malaria

    NARCIS (Netherlands)

    Kreeftmeijer-Vegter, Annemarie R.; Melo, Mariana de Mendonça; de Vries, Peter J.; Koelewijn, Rob; van Hellemond, Jaap J.; van Genderen, Perry J. J.

    2013-01-01

    Exchange transfusion (ET) has remained a controversial adjunct therapy for the treatment of severe malaria. In order to assess the relative contribution of ET to parasite clearance in severe malaria, all patients receiving ET as an adjunct treatment to parenteral quinine or to artesunate were

  18. Manual blood exchange transfusion does not significantly contribute to parasite clearance in artesunate-treated individuals with imported severe Plasmodium falciparum malaria

    NARCIS (Netherlands)

    A.R. Kreeftmeijer-Vegter (Annemarie); M.M. de Melo (Mariana ); P.J. de Vries (Peter); R. Koelewijn (Rob); J.J. van Hellemond (Jaap); P.J.J. van Genderen (Perry)

    2013-01-01

    textabstractBackground: Exchange transfusion (ET) has remained a controversial adjunct therapy for the treatment of severe malaria. In order to assess the relative contribution of ET to parasite clearance in severe malaria, all patients receiving ET as an adjunct treatment to parenteral quinine or

  19. Integrated modeling of groundwater-surface water interactions in a tile-drained agricultural field: The importance of directly measured flow route contributions

    NARCIS (Netherlands)

    Rozemeijer, J.C.; Velde, Y. van der; McLaren, R.G.; Geer, F.C. van; Broers, H.P.; Bierkens, M.F.P.

    2010-01-01

    Understanding the dynamics of groundwater-surface water interaction is needed to evaluate and simulate water and solute transport in catchments. However, direct measurements of the contributions of different flow routes from specific surfaces within a catchment toward the surface water are rarely

  20. Identifying most important skills for PhD students in Food Science and Technology: a comparison between industry and academic stakeholders

    Directory of Open Access Journals (Sweden)

    Chelo González-Martínez

    2015-10-01

    Full Text Available Nowadays, there is an increasing need of new skills for PhD students to face the future labour market prospects. PhD graduates must have qualities attractive not only in academia but also outside, in both manufacture and service-oriented enterprises, in small innovative companies, and in the civil services and public administration, among others. To know what the needs of these future employees are, is of great importance to be able to improve their personal and academic formation. The aim of this work was, in the framework of the EC-funded ISEKI_Food 4 network, to evaluate the most desirable specific and soft skills that PhD students should acquire by the end of their doctoral studies. To this aim, several surveys were conducted and sent to the different stakeholders (academia and food industry partners in order to collect the information needed. Results showed that competences related to research skills and techniques, research management, personal effectiveness and communication skills were considered to be the most valuable skills to be acquired by our PhD students to meet the future needs of the labour market.  The importance of these skills was appreciated differently, depending on the stakeholder. To sum up, some recommendations to integrate such valuable skills into the curricula of the PhD student are given.

  1. Post-hoc principal component analysis on a largely illiterate elderly population from North-west India to identify important elements of mini-mental state examination

    Directory of Open Access Journals (Sweden)

    Sunil Kumar Raina

    2016-01-01

    Full Text Available Background: Mini-mental state examination (MMSE scale measures cognition using specific elements that can be isolated, defined, and subsequently measured. This study was conducted with the aim to analyze the factorial structure of MMSE in a largely, illiterate, elderly population in India and to reduce the number of variables to a few meaningful and interpretable combinations. Methodology: Principal component analysis (PCA was performed post-hoc on the data generated by a research project conducted to estimate the prevalence of dementia in four geographically defined habitations in Himachal Pradesh state of India. Results: Questions on orientation and registration account for high percentage of cumulative variance in comparison to other questions. Discussion: The PCA conducted on the data derived from a largely, illiterate population reveals that the most important components to consider for the estimation of cognitive impairment in illiterate Indian population are temporal orientation, spatial orientation, and immediate memory.

  2. Post-hoc principal component analysis on a largely illiterate elderly population from North-west India to identify important elements of mini-mental state examination.

    Science.gov (United States)

    Raina, Sunil Kumar; Chander, Vishav; Raina, Sujeet; Grover, Ashoo

    2016-01-01

    Mini-mental state examination (MMSE) scale measures cognition using specific elements that can be isolated, defined, and subsequently measured. This study was conducted with the aim to analyze the factorial structure of MMSE in a largely, illiterate, elderly population in India and to reduce the number of variables to a few meaningful and interpretable combinations. Principal component analysis (PCA) was performed post-hoc on the data generated by a research project conducted to estimate the prevalence of dementia in four geographically defined habitations in Himachal Pradesh state of India. Questions on orientation and registration account for high percentage of cumulative variance in comparison to other questions. The PCA conducted on the data derived from a largely, illiterate population reveals that the most important components to consider for the estimation of cognitive impairment in illiterate Indian population are temporal orientation, spatial orientation, and immediate memory.

  3. Bipolar disorder: The importance of clinical assessment in identifying prognostic factors - An Audit. Part 1: An analysis of potential prognostic factors.

    Science.gov (United States)

    Verdolini, Norma; Dean, Jonathon; Elisei, Sandro; Quartesan, Roberto; Zaman, Rashid; Agius, Mark

    2014-11-01

    Prognostic factors of bipolar disorder must be identified to assist in staging and treatment, and this may be done primarily during the initial psychiatric assessment. In fact, most of the prognostic factors, which determine disease outcome, could be detected from simple but often-unrecorded questions asked during the psychiatric clinic visit. We collected data from the clinical notes of 70 bipolar outpatients seen at the initial psychiatric assessment clinic about socio-demographic and clinical factors to determine whether various factors had relevance to prevalence, prognosis, or outcome. The sample comprised 16 bipolar I (22.9%) and 54 bipolar II (77.1%) outpatients; a psychiatric comorbidity was noted in 26 patients (37.1%). 60.9% (42 patients) reported anxiety features and 12 patients (17.6%) were noted to have obsessive-compulsive characteristics. Percentages reported in our results are of the sample for which the data was available. Anhedonia is a depressive feature that was present in most of the population where this data was available (92.2%, 59 patients) and 81.8% (54 patients) reported suicidal thoughts during a depressive episode. 74.6% (47 patients) had a family history of bipolar disorder, depression, suicide or psychosis. 27 patients (39.7%) reported current alcohol use and 14 patients (22.6%) current illicit drug use. A comparison between 10 prognostic factors found that only the correlations between current illicit drug use/previous illicit drug use (χ(2)=11.471, Palcohol use/previous alcohol use (χ(2)=31.510, Palcohol use (χ(2)=5.071, P=0.023) and previous alcohol use/family history (χ(2)=4.309, P=0.037) were almost statistically significant. 17 patients (24.3%) of the 70 bipolar patients were assigned to a care coordinator; we have evaluated the possible differences between the patients with or without a care coordinator on the basis of the presence of 10 possible prognostic factors and found no statistically significant differences between

  4. Improving a full-text search engine: the importance of negation detection and family history context to identify cases in a biomedical data warehouse.

    Science.gov (United States)

    Garcelon, Nicolas; Neuraz, Antoine; Benoit, Vincent; Salomon, Rémi; Burgun, Anita

    2017-05-01

    The repurposing of electronic health records (EHRs) can improve clinical and genetic research for rare diseases. However, significant information in rare disease EHRs is embedded in the narrative reports, which contain many negated clinical signs and family medical history. This paper presents a method to detect family history and negation in narrative reports and evaluates its impact on selecting populations from a clinical data warehouse (CDW). We developed a pipeline to process 1.6 million reports from multiple sources. This pipeline is part of the load process of the Necker Hospital CDW. We identified patients with "Lupus and diarrhea," "Crohn's and diabetes," and "NPHP1" from the CDW. The overall precision, recall, specificity, and F-measure were 0.85, 0.98, 0.93, and 0.91, respectively. The proposed method generates a highly accurate identification of cases from a CDW of rare disease EHRs. © The Author 2016. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  5. Proteome analysis identifies the Dpr protein of Streptococcus mutans as an important factor in the presence of early streptococcal colonizers of tooth surfaces.

    Directory of Open Access Journals (Sweden)

    Akihiro Yoshida

    Full Text Available Oral streptococci are primary colonizers of tooth surfaces and Streptococcus mutans is the principal causative agent of dental caries in humans. A number of proteins are involved in the formation of monospecies biofilms by S. mutans. This study analyzed the protein expression profiles of S. mutans biofilms formed in the presence or absence of S. gordonii, a pioneer colonizer of the tooth surface, by two-dimensional gel electrophoresis (2-DE. After identifying S. mutans proteins by Mass spectrometric analysis, their expression in the presence of S. gordonii was analyzed. S. mutans was inoculated with or without S. gordonii DL1. The two species were compartmentalized using 0.2-μl Anopore membranes. The biofilms on polystyrene plates were harvested, and the solubilized proteins were separated by 2-DE. When S. mutans biofilms were formed in the presence of S. gordonii, the peroxide resistance protein Dpr of the former showed 4.3-fold increased expression compared to biofilms that developed in the absence of the pioneer colonizer. In addition, we performed a competition assay using S. mutans antioxidant protein mutants together with S. gordonii and other initial colonizers. Growth of the dpr-knockout S. mutans mutant was significantly inhibited by S. gordonii, as well as by S. sanguinis. Furthermore, a cell viability assay revealed that the viability of the dpr-defective mutant was significantly attenuated compared to the wild-type strain when co-cultured with S. gordonii. Therefore, these results suggest that Dpr might be one of the essential proteins for S. mutans survival on teeth in the presence of early colonizing oral streptococci.

  6. Proteome Analysis Identifies the Dpr Protein of Streptococcus mutans as an Important Factor in the Presence of Early Streptococcal Colonizers of Tooth Surfaces

    Science.gov (United States)

    Yoshida, Akihiro; Niki, Mamiko; Yamamoto, Yuji; Yasunaga, Ai; Ansai, Toshihiro

    2015-01-01

    Oral streptococci are primary colonizers of tooth surfaces and Streptococcus mutans is the principal causative agent of dental caries in humans. A number of proteins are involved in the formation of monospecies biofilms by S. mutans. This study analyzed the protein expression profiles of S. mutans biofilms formed in the presence or absence of S. gordonii, a pioneer colonizer of the tooth surface, by two-dimensional gel electrophoresis (2-DE). After identifying S. mutans proteins by Mass spectrometric analysis, their expression in the presence of S. gordonii was analyzed. S. mutans was inoculated with or without S. gordonii DL1. The two species were compartmentalized using 0.2-μl Anopore membranes. The biofilms on polystyrene plates were harvested, and the solubilized proteins were separated by 2-DE. When S. mutans biofilms were formed in the presence of S. gordonii, the peroxide resistance protein Dpr of the former showed 4.3-fold increased expression compared to biofilms that developed in the absence of the pioneer colonizer. In addition, we performed a competition assay using S. mutans antioxidant protein mutants together with S. gordonii and other initial colonizers. Growth of the dpr-knockout S. mutans mutant was significantly inhibited by S. gordonii, as well as by S. sanguinis. Furthermore, a cell viability assay revealed that the viability of the dpr-defective mutant was significantly attenuated compared to the wild-type strain when co-cultured with S. gordonii. Therefore, these results suggest that Dpr might be one of the essential proteins for S. mutans survival on teeth in the presence of early colonizing oral streptococci. PMID:25816242

  7. 2D and 3D Stem Cell Models of Primate Cortical Development Identify Species-Specific Differences in Progenitor Behavior Contributing to Brain Size.

    Science.gov (United States)

    Otani, Tomoki; Marchetto, Maria C; Gage, Fred H; Simons, Benjamin D; Livesey, Frederick J

    2016-04-07

    Variation in cerebral cortex size and complexity is thought to contribute to differences in cognitive ability between humans and other animals. Here we compare cortical progenitor cell output in humans and three nonhuman primates using directed differentiation of pluripotent stem cells (PSCs) in adherent two-dimensional (2D) and organoid three-dimensional (3D) culture systems. Clonal lineage analysis showed that primate cortical progenitors proliferate for a protracted period of time, during which they generate early-born neurons, in contrast to rodents, where this expansion phase largely ceases before neurogenesis begins. The extent of this additional cortical progenitor expansion differs among primates, leading to differences in the number of neurons generated by each progenitor cell. We found that this mechanism for controlling cortical size is regulated cell autonomously in culture, suggesting that primate cerebral cortex size is regulated at least in part at the level of individual cortical progenitor cell clonal output. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Foxtail millet NF-Y families: genome-wide survey and evolution analyses identified two functional genes important in abiotic stresses

    Directory of Open Access Journals (Sweden)

    Zhi-Juan eFeng

    2015-12-01

    Full Text Available It was reported that Nuclear Factor Y (NF-Y genes were involved in abiotic stress in plants. Foxtail millet (Setaria italica, an elite stress tolerant crop, provided an impetus for the investigation of the NF-Y families in abiotic responses. In the present study, a total of 39 NF-Y genes were identified in foxtail millet. Synteny analyses suggested that foxtail millet NF-Y genes had experienced rapid expansion and strong purifying selection during the process of plant evolution. De novo transcriptome assembly of foxtail millet revealed 11 drought up-regulated NF-Y genes. SiNF-YA1 and SiNF-YB8 were highly activated in leaves and/or roots by drought and salt stresses. Abscisic acid (ABA and H2O2 played positive roles in the induction of SiNF-YA1 and SiNF-YB8 under stress treatments. Transient luciferase (LUC expression assays revealed that SiNF-YA1 and SiNF-YB8 could activate the LUC gene driven by the tobacco (Nicotiana tobacam NtERD10, NtLEA5, NtCAT, NtSOD or NtPOD promoter under normal or stress conditions. Overexpression of SiNF-YA1 enhanced drought and salt tolerance by activating stress-related genes NtERD10 and NtCAT1 and by maintaining relatively stable relative water content (RWC and contents of chlorophyll, superoxide dismutase (SOD, peroxidase (POD, catalase (CAT and malondialdehyde (MDA in transgenic lines under stresses. SiNF-YB8 regulated expression of NtSOD, NtPOD, NtLEA5 and NtERD10 and conferred relatively high RWC and chlorophyll contents and low MDA content, resulting in drought and osmotic tolerance in transgenic lines under stresses. Therefore, SiNF-YA1 and SiNF-YB8 could activate stress-related genes and improve physiological traits, resulting in tolerance to abiotic stresses in plants. All these results will facilitate functional characterization of foxtail millet NF-Ys in future studies.

  9. The use of population viability analysis to identify possible factors contributing to the decline of a rare ungulate population in south-eastern Zimbabwe

    Directory of Open Access Journals (Sweden)

    Simon D. Capon

    2013-02-01

    Full Text Available Populations that are vulnerable to decline are of particular concern to wildlife managers and uncovering the mechanisms responsible for downward trends is a crucial step towards developing future viable populations. The aims of this study were to better understand the mechanisms behind the historic decline of the sable antelope, Hippotragus niger, population at the Malilangwe Wildlife Reserve (MWR, to assess its future viability and to use this analysis to determine key areas of breakdown in population growth and link these to potential limiting factors. VORTEX, a population viability model was used to assess the future viability of the sable antelope population and a sensitivity analysis was applied to identify the key areas of breakdown in growth. The sable population is currently viable, but remains highly vulnerable to changes in adult female survival, a factor which had the greatest influence on overall population fitness. Lion predation, impacting on the adult segment of the population, appeared to be the main factor responsible for the historic decline at the MWR.Conservation implications: Sable generally occur at low densities in the lowveld region of Zimbabwe and, as such, populations are vulnerable to increases in mortality rates. The role of lions in driving the decline at the MWR suggests a need to control their numbers and develop prey refuges through improved management of artificial water.

  10. Genome-wide association study identifies a novel locus contributing to type 2 diabetes susceptibility in Sikhs of Punjabi origin from India.

    Science.gov (United States)

    Saxena, Richa; Saleheen, Danish; Been, Latonya F; Garavito, Martha L; Braun, Timothy; Bjonnes, Andrew; Young, Robin; Ho, Weang Kee; Rasheed, Asif; Frossard, Philippe; Sim, Xueling; Hassanali, Neelam; Radha, Venkatesan; Chidambaram, Manickam; Liju, Samuel; Rees, Simon D; Ng, Daniel Peng-Keat; Wong, Tien-Yin; Yamauchi, Toshimasa; Hara, Kazuo; Tanaka, Yasushi; Hirose, Hiroshi; McCarthy, Mark I; Morris, Andrew P; Basit, Abdul; Barnett, Anthony H; Katulanda, Prasad; Matthews, David; Mohan, Viswanathan; Wander, Gurpreet S; Singh, Jai Rup; Mehra, Narinder K; Ralhan, Sarju; Kamboh, M Ilyas; Mulvihill, John J; Maegawa, Hiroshi; Tobe, Kazuyuki; Maeda, Shiro; Cho, Yoon S; Tai, E Shyong; Kelly, M Ann; Chambers, John C; Kooner, Jaspal S; Kadowaki, Takashi; Deloukas, Panos; Rader, Daniel J; Danesh, John; Sanghera, Dharambir K

    2013-05-01

    We performed a genome-wide association study (GWAS) and a multistage meta-analysis of type 2 diabetes (T2D) in Punjabi Sikhs from India. Our discovery GWAS in 1,616 individuals (842 case subjects) was followed by in silico replication of the top 513 independent single nucleotide polymorphisms (SNPs) (P Punjabi Sikhs (n = 2,819; 801 case subjects). We further replicated 66 SNPs (P Punjabi Sikh sample (n = 2,894; 1,711 case subjects). On combined meta-analysis in Sikh populations (n = 7,329; 3,354 case subjects), we identified a novel locus in association with T2D at 13q12 represented by a directly genotyped intronic SNP (rs9552911, P = 1.82 × 10⁻⁸) in the SGCG gene. Next, we undertook in silico replication (stage 2b) of the top 513 signals (P < 10⁻³) in 29,157 non-Sikh South Asians (10,971 case subjects) and de novo genotyping of up to 31 top signals (P < 10⁻⁴) in 10,817 South Asians (5,157 case subjects) (stage 3b). In combined South Asian meta-analysis, we observed six suggestive associations (P < 10⁻⁵ to < 10⁻⁷), including SNPs at HMG1L1/CTCFL, PLXNA4, SCAP, and chr5p11. Further evaluation of 31 top SNPs in 33,707 East Asians (16,746 case subjects) (stage 3c) and 47,117 Europeans (8,130 case subjects) (stage 3d), and joint meta-analysis of 128,127 individuals (44,358 case subjects) from 27 multiethnic studies, did not reveal any additional loci nor was there any evidence of replication for the new variant. Our findings provide new evidence on the presence of a population-specific signal in relation to T2D, which may provide additional insights into T2D pathogenesis.

  11. Dietary 232Th and 238U intakes for Japanese as obtained in a market basket study and contributions of imported foods to internal doses

    International Nuclear Information System (INIS)

    Shiraishi, K.

    1995-01-01

    Thorium-232 and 238 U contents in four food groups were measured by inductively coupled plasma mass spectrometry (ICP-MS). Daily intakes of 232 Th and 238 U for Japanese were estimated to 2.22 mBq and 15.5 mBq per person, respectively. Furthermore, preliminary estimations were made for the effects of imported foods on internal exposures for Japanese. (author). 16 refs., 1 fig., 3 tabs

  12. Which sociodemographic factors are important on smoking behaviour of high school students? The contribution of classification and regression tree methodology in a broad epidemiological survey.

    Science.gov (United States)

    Ozge, C; Toros, F; Bayramkaya, E; Camdeviren, H; Sasmaz, T

    2006-08-01

    The purpose of this study is to evaluate the most important sociodemographic factors on smoking status of high school students using a broad randomised epidemiological survey. Using in-class, self administered questionnaire about their sociodemographic variables and smoking behaviour, a representative sample of total 3304 students of preparatory, 9th, 10th, and 11th grades, from 22 randomly selected schools of Mersin, were evaluated and discriminative factors have been determined using appropriate statistics. In addition to binary logistic regression analysis, the study evaluated combined effects of these factors using classification and regression tree methodology, as a new statistical method. The data showed that 38% of the students reported lifetime smoking and 16.9% of them reported current smoking with a male predominancy and increasing prevalence by age. Second hand smoking was reported at a 74.3% frequency with father predominance (56.6%). The significantly important factors that affect current smoking in these age groups were increased by household size, late birth rank, certain school types, low academic performance, increased second hand smoking, and stress (especially reported as separation from a close friend or because of violence at home). Classification and regression tree methodology showed the importance of some neglected sociodemographic factors with a good classification capacity. It was concluded that, as closely related with sociocultural factors, smoking was a common problem in this young population, generating important academic and social burden in youth life and with increasing data about this behaviour and using new statistical methods, effective coping strategies could be composed.

  13. Isotopic signatures suggest important contributions from recycled gasoline, road dust and non-exhaust traffic sources for copper, zinc and lead in PM10 in London, United Kingdom

    Science.gov (United States)

    Dong, Shuofei; Ochoa Gonzalez, Raquel; Harrison, Roy M.; Green, David; North, Robin; Fowler, Geoff; Weiss, Dominik

    2017-09-01

    The aim of this study was to improve our understanding of what controls the isotope composition of Cu, Zn and Pb in particulate matter (PM) in the urban environment and to develop these isotope systems as possible source tracers. To this end, isotope ratios (Cu, Zn and Pb) and trace element concentrations (Fe, Al, Cu, Zn, Sb, Ba, Pb, Cr, Ni and V) were determined in PM10 collected at two road sites with contrasting traffic densities in central London, UK, during two weeks in summer 2010, and in potential sources, including non-combustion traffic emissions (tires and brakes), road furniture (road paint, manhole cover and road tarmac surface) and road dust. Iron, Ba and Sb were used as proxies for emissions derived from brake pads, and Ni, and V for emissions derived from fossil fuel oil. The isotopic composition of Pb (expressed using 206Pb/207Pb) ranged between 1.1137 and 1.1364. The isotope ratios of Cu and Zn expressed as δ65CuNIST976 and δ66ZnLyon ranged between -0.01‰ and +0.51‰ and between -0.21‰ and +0.33‰, respectively. We did not find significant differences in the isotope signatures in PM10 over the two weeks sampling period and between the two sites, suggesting similar sources for each metal at both sites despite their different traffic densities. The stable isotope composition of Pb suggests significant contribution from road dust resuspension and from recycled leaded gasoline. The Cu and Zn isotope signatures of tires, brakes and road dust overlap with those of PM10. The correlation between the enrichments of Sb, Cu, Ba and Fe in PM10 support the previously established hypothesis that Cu isotope ratios are controlled by non-exhaust traffic emission sources in urban environments (Ochoa Gonzalez et al., 2016). Analysis of the Zn isotope signatures in PM10 and possible sources at the two sites suggests significant contribution from tire wear. However, temporary additional sources, likely high temperature industrial emissions, need to be invoked

  14. Cardiorespiratory adaptations induced by aerobic training in middle-aged men: the importance of a decrease in sympathetic stimulation for the contribution of dynamic exercise tachycardia

    Directory of Open Access Journals (Sweden)

    Chacon-Mikahil M.P.T.

    1998-01-01

    Full Text Available We investigated the effects of aerobic training on the efferent autonomic control of heart rate (HR during dynamic exercise in middle-aged men, eight of whom underwent exercise training (T while the other seven continued their sedentary (S life style. The training was conducted over 10 months (three 1-h sessions/week on a field track at 70-85% of the peak HR. The contribution of sympathetic and parasympathetic exercise tachycardia was determined in terms of differences in the time constant effects on the HR response obtained using a discontinuous protocol (4-min tests at 25, 50, 100 and 125 watts on a cycle ergometer, and a continuous protocol (25 watts/min until exhaustion allowed the quantification of the parameters (anaerobic threshold, VO2 AT; peak O2 uptake, VO2 peak; power peak that reflect oxygen transport. The results obtained for the S and the T groups were: 1 a smaller resting HR in T (66 beats/min when compared to S (84 beats/min; 2 during exercise, a small increase in the fast tachycardia (D0-10 s related to vagal withdrawal (P<0.05, only at 25 watts was observed in T at all powers; at middle and higher powers a significant decrease (P<0.05 at 50, 100 and 125 watts in the slow tachycardia (D1-4 min related to a sympathetic-dependent mechanism was observed in T; 3 the VO2 AT (S = 1.06 and T = 1.33 l/min and VO2 peak (S = 1.97 and T = 2.47 l/min were higher in T (P<0.05. These results demonstrate that aerobic training can induce significant physiological adaptations in middle-aged men, mainly expressed as a decrease in the sympathetic effects on heart rate associated with an increase in oxygen transport during dynamic exercise.

  15. Determining the most important physiological and agronomic traits contributing to maize grain yield through machine learning algorithms: a new avenue in intelligent agriculture.

    Directory of Open Access Journals (Sweden)

    Avat Shekoofa

    Full Text Available Prediction is an attempt to accurately forecast the outcome of a specific situation while using input information obtained from a set of variables that potentially describe the situation. They can be used to project physiological and agronomic processes; regarding this fact, agronomic traits such as yield can be affected by a large number of variables. In this study, we analyzed a large number of physiological and agronomic traits by screening, clustering, and decision tree models to select the most relevant factors for the prospect of accurately increasing maize grain yield. Decision tree models (with nearly the same performance evaluation were the most useful tools in understanding the underlying relationships in physiological and agronomic features for selecting the most important and relevant traits (sowing date-location, kernel number per ear, maximum water content, kernel weight, and season duration corresponding to the maize grain yield. In particular, decision tree generated by C&RT algorithm was the best model for yield prediction based on physiological and agronomical traits which can be extensively employed in future breeding programs. No significant differences in the decision tree models were found when feature selection filtering on data were used, but positive feature selection effect observed in clustering models. Finally, the results showed that the proposed model techniques are useful tools for crop physiologists to search through large datasets seeking patterns for the physiological and agronomic factors, and may assist the selection of the most important traits for the individual site and field. In particular, decision tree models are method of choice with the capability of illustrating different pathways of yield increase in breeding programs, governed by their hierarchy structure of feature ranking as well as pattern discovery via various combinations of features.

  16. 137Cs and 40K concentrations on imported powder milk and its contribution to the annual effective dose by ingestion for children

    International Nuclear Information System (INIS)

    Vargas, D.; Borrell Munnoz, J. L.; D'Alessandro, K.; Gelen Rudnikas, A.; Diaz Rizo, O.; Martinez Herrera, E.; Gonzales Mesa, A.; Marrero Arias, L.; Hilda Zambrano, M.

    2013-01-01

    Low Background Gamma Spectrometry was used to determine activity concentrations of 137 Cs and 40 K on different powder milk samples imported in Cuba for local consumption. Radionuclide concentration has been evaluated using a high-purity germanium (HPGe) detector (2.04 keV of FWHM and 30% of relative efficiency coupled to a low background system. A relative procedure, using the Certified Reference Materials (CRM) IAEA-152 and 154, was implemented. Samples were dried at 105 o C, macerated and sieved at 125 μm using standardized procedures . Results show that radionuclide activities is strongly dependent on milk type (full and skimmed milk) and on its origin, showing in all samples an activity concentration for 137 Cs is from 1.30 to 2.69 Bq kg -1 only in the 54.7 % of them. Annual effective dose committed by powder milk ingestion for children has been estimated as 9.3x10 -3 mSv y -1 , beneath the permissible dose regulated by the Cuban authorities based on doses reported worldwide for population affected only by global fallout. (Author)

  17. Physician Rating Websites: What Aspects Are Important to Identify a Good Doctor, and Are Patients Capable of Assessing Them? A Mixed-Methods Approach Including Physicians' and Health Care Consumers' Perspectives.

    Science.gov (United States)

    Rothenfluh, Fabia; Schulz, Peter J

    2017-05-01

    Physician rating websites (PRWs) offer health care consumers the opportunity to evaluate their doctor anonymously. However, physicians' professional training and experience create a vast knowledge gap in medical matters between physicians and patients. This raises ethical concerns about the relevance and significance of health care consumers' evaluation of physicians' performance. To identify the aspects physician rating websites should offer for evaluation, this study investigated the aspects of physicians and their practice relevant for identifying a good doctor, and whether health care consumers are capable of evaluating these aspects. In a first step, a Delphi study with physicians from 4 specializations was conducted, testing various indicators to identify a good physician. These indicators were theoretically derived from Donabedian, who classifies quality in health care into pillars of structure, process, and outcome. In a second step, a cross-sectional survey with health care consumers in Switzerland (N=211) was launched based on the indicators developed in the Delphi study. Participants were asked to rate the importance of these indicators to identify a good physician and whether they would feel capable to evaluate those aspects after the first visit to a physician. All indicators were ordered into a 4×4 grid based on evaluation and importance, as judged by the physicians and health care consumers. Agreement between the physicians and health care consumers was calculated applying Holsti's method. In the majority of aspects, physicians and health care consumers agreed on what facets of care were important and not important to identify a good physician and whether patients were able to evaluate them, yielding a level of agreement of 74.3%. The two parties agreed that the infrastructure, staff, organization, and interpersonal skills are both important for a good physician and can be evaluated by health care consumers. Technical skills of a doctor and outcomes

  18. Principal component analysis of normalized full spectrum mass spectrometry data in multiMS-toolbox: An effective tool to identify important factors for classification of different metabolic patterns and bacterial strains.

    Science.gov (United States)

    Cejnar, Pavel; Kuckova, Stepanka; Prochazka, Ales; Karamonova, Ludmila; Svobodova, Barbora

    2018-06-15

    Explorative statistical analysis of mass spectrometry data is still a time-consuming step. We analyzed critical factors for application of principal component analysis (PCA) in mass spectrometry and focused on two whole spectrum based normalization techniques and their application in the analysis of registered peak data and, in comparison, in full spectrum data analysis. We used this technique to identify different metabolic patterns in the bacterial culture of Cronobacter sakazakii, an important foodborne pathogen. Two software utilities, the ms-alone, a python-based utility for mass spectrometry data preprocessing and peak extraction, and the multiMS-toolbox, an R software tool for advanced peak registration and detailed explorative statistical analysis, were implemented. The bacterial culture of Cronobacter sakazakii was cultivated on Enterobacter sakazakii Isolation Agar, Blood Agar Base and Tryptone Soya Agar for 24 h and 48 h and applied by the smear method on an Autoflex speed MALDI-TOF mass spectrometer. For three tested cultivation media only two different metabolic patterns of Cronobacter sakazakii were identified using PCA applied on data normalized by two different normalization techniques. Results from matched peak data and subsequent detailed full spectrum analysis identified only two different metabolic patterns - a cultivation on Enterobacter sakazakii Isolation Agar showed significant differences to the cultivation on the other two tested media. The metabolic patterns for all tested cultivation media also proved the dependence on cultivation time. Both whole spectrum based normalization techniques together with the full spectrum PCA allow identification of important discriminative factors in experiments with several variable condition factors avoiding any problems with improper identification of peaks or emphasis on bellow threshold peak data. The amounts of processed data remain still manageable. Both implemented software utilities are available

  19. Formal consensus to identify clinically important changes in management resulting from the use of cardiovascular magnetic resonance (CMR) in patients who activate the primary percutaneous coronary intervention (PPCI) pathway.

    Science.gov (United States)

    Pufulete, Maria; Brierley, Rachel C; Bucciarelli-Ducci, Chiara; Greenwood, John P; Dorman, Stephen; Anderson, Richard A; Harris, Jessica; McAlindon, Elisa; Rogers, Chris A; Reeves, Barnaby C

    2017-06-22

    To define important changes in management arising from the use of cardiovascular magnetic resonance (CMR) in patients who activate the primary percutaneous coronary intervention (PPCI) pathway. Formal consensus study using literature review and cardiologist expert opinion to formulate consensus statements and setting up a consensus panel to review the statements (by completing a web-based survey, attending a face-to-face meeting to discuss survey results and modify the survey to reflect group discussion and completing the modified survey to determine which statements were in consensus). Formulation of consensus statements: four cardiologists (two CMR and two interventional) and six non-clinical researchers. Formal consensus: seven cardiologists (two CMR and three interventional, one echocardiography and one heart failure). Forty-nine additional cardiologists completed the modified survey. Thirty-seven draft statements describing changes in management following CMR were generated; these were condensed into 12 statements and reviewed through the formal consensus process. Three of 12 statements were classified in consensus in the first survey; these related to the role of CMR in identifying the cause of out-of-hospital cardiac arrest, providing a definitive diagnosis in patients found to have unobstructed arteries on angiography and identifying patients with left ventricular thrombus. Two additional statements were in consensus in the modified survey, relating to the ability of CMR to identify patients who have a poor prognosis after PPCI and assess ischaemia and viability in patients with multivessel disease. There was consensus that CMR leads to clinically important changes in management in five subgroups of patients who activate the PPCI pathway. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  20. MicroRNAs regulate T-cell production of interleukin-9 and identify hypoxia-inducible factor-2α as an important regulator of T helper 9 and regulatory T-cell differentiation.

    Science.gov (United States)

    Singh, Yogesh; Garden, Oliver A; Lang, Florian; Cobb, Bradley S

    2016-09-01

    MicroRNAs (miRNAs) regulate many aspects of helper T cell (Th) development and function. Here we found that they are required for the suppression of interleukin-9 (IL-9) expression in Th9 cells and other Th subsets. Two highly related miRNAs (miR-15b and miR-16) that we previously found to play an important role in regulatory T (Treg) cell differentiation were capable of suppressing IL-9 expression when they were over-expressed in Th9 cells. We used these miRNAs as tools to identify novel regulators of IL-9 expression and found that they could regulate the expression of Epas1, which encodes hypoxia-inducible factor (HIF)-2α. HIF proteins regulate metabolic pathway usage that is important in determining appropriate Th differentiation. The related protein, HIF-1α enhances Th17 differentiation and inhibits Treg cell differentiation. Here we found that HIF-2α was required for IL-9 expression in Th9 cells, but its expression was not sufficient in other Th subsets. Furthermore, HIF-2α suppressed Treg cell differentiation like HIF-1α, demonstrating both similar and distinct roles of the HIF proteins in Th differentiation and adding a further dimension to their function. Ironically, even though miR-15b and miR-16 suppressed HIF-2α expression in Treg cells, inhibiting their function in Treg cells did not lead to an increase in IL-9 expression. Therefore, the physiologically relevant miRNAs that regulate IL-9 expression in Treg cells and other subsets remain unknown. Nevertheless, the analysis of miR-15b and miR-16 function led to the discovery of the importance of HIF-2α so this work demonstrated the utility of studying miRNA function to identify novel regulatory pathways in helper T-cell development. © 2016 John Wiley & Sons Ltd.

  1. A starch-binding domain identified in α-amylase (AmyP) represents a new family of carbohydrate-binding modules that contribute to enzymatic hydrolysis of soluble starch.

    Science.gov (United States)

    Peng, Hui; Zheng, Yunyun; Chen, Maojiao; Wang, Ying; Xiao, Yazhong; Gao, Yi

    2014-04-02

    A novel starch-binding domain (SBD) that represents a new carbohydrate-binding module family (CBM69) was identified in the α-amylase (AmyP) of the recently established alpha-amylase subfamily GH13_37. The SBD and its homologues come mostly from marine bacteria, and phylogenetic analysis indicates that they are closely related to the CBM20 and CBM48 families. The SBD exhibited a binding preference toward raw rice starch, but the truncated mutant (AmyPΔSBD) still retained similar substrate preference. Kinetic analyses revealed that the SBD plays an important role in soluble starch hydrolysis because different catalytic efficiencies have been observed in AmyP and the AmyPΔSBD. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  2. Importance measures

    International Nuclear Information System (INIS)

    Gomez Cobo, A.

    1997-01-01

    The presentation discusses the following: general concepts of importance measures; example fault tree, used to illustrate importance measures; Birnbaum's structural importance; criticality importance; Fussel-Vesely importance; upgrading function; risk achievement worth; risk reduction worth

  3. A putative biomarker signature for clinically effective AKT inhibition: correlation of in vitro, in vivo and clinical data identifies the importance of modulation of the mTORC1 pathway.

    Science.gov (United States)

    Cheraghchi-Bashi, Azadeh; Parker, Christine A; Curry, Ed; Salazar, Jean-Frederic; Gungor, Hatice; Saleem, Azeem; Cunnea, Paula; Rama, Nona; Salinas, Cristian; Mills, Gordon B; Morris, Shannon R; Kumar, Rakesh; Gabra, Hani; Stronach, Euan A

    2015-12-08

    Our identification of dysregulation of the AKT pathway in ovarian cancer as a platinum resistance specific event led to a comprehensive analysis of in vitro, in vivo and clinical behaviour of the AKT inhibitor GSK2141795. Proteomic biomarker signatures correlating with effects of GSK2141795 were developed using in vitro and in vivo models, well characterised for related molecular, phenotypic and imaging endpoints. Signatures were validated in temporally paired biopsies from patients treated with GSK2141795 in a clinical study. GSK2141795 caused growth-arrest as single agent in vitro, enhanced cisplatin-induced apoptosis in vitro and reduced tumour volume in combination with platinum in vivo. GSK2141795 treatment in vitro and in vivo resulted in ~50-90% decrease in phospho-PRAS40 and 20-80% decrease in fluoro-deoxyglucose (FDG) uptake. Proteomic analysis of GSK2141795 in vitro and in vivo identified a signature of pathway inhibition including changes in AKT and p38 phosphorylation and total Bim, IGF1R, AR and YB1 levels. In patient biopsies, prior to treatment with GSK2141795 in a phase 1 clinical trial, this signature was predictive of post-treatment changes in the response marker CA125. Development of this signature represents an opportunity to demonstrate the clinical importance of AKT inhibition for re-sensitisation of platinum resistant ovarian cancer to platinum.

  4. Bipolar disorder: The importance of clinical assessment in identifying prognostic factors - An Audit. Part 3: A comparison between Italian and English mental health services and a survey of bipolar disorder.

    Science.gov (United States)

    Verdolini, Norma; Dean, Jonathon; Massucci, Giampaolo; Elisei, Sandro; Quartesan, Roberto; Zaman, Rashid; Agius, Mark

    2014-11-01

    Most of the prognostic factors of bipolar disorder, which determine disease course and outcome, could be detected from simple but often-unrecorded questions asked during the psychiatric clinic assessments. In previous parts of this research, we analysed various prognostic factors and focused on mixed states and rapid cycling subsets. We now compare our sample in England with a small sample from Italy to demonstrate the utility of focused prognostic questioning and of international comparison. We collected data from the clinical notes of 70 English bipolar and 8 Italian bipolar outpatients seen at the initial psychiatric assessment clinic about socio-demographic and clinical factors to determine whether various factors had relevance to prevalence, prognosis, or outcome. The sample comprised 16 bipolar I (22.9%) and 54 bipolar II (77.1%) English outpatients and 7 bipolar I (87.5%) and 1 bipolar II (12.5%) Italian outpatients. Differences between the groups are seen mainly in terms of age of onset, duration of both depressive and hypomanic episodes, presence of psychiatric family history, incidence of mixed state features and rapid cycling, presence of elated mood in response to past antidepressant treatment, and misuse of illicit drugs and alcohol. In order to promote improved mental health primary care, mental health systems in all countries should develop standardized epidemiological tools that are shared between countries. We recommend the use of a questionnaire that reminds clinicians of potentially prognostic information and suggest that this might identify important components of a potential standardized diagnostic and prognostic tool.

  5. Important Mutations Contributing to High-Level Penicillin Resistance in Taiwan19F-14, Taiwan23F-15, and Spain23F-1 of Streptococcus pneumoniae Isolated from Taiwan.

    Science.gov (United States)

    Liu, Esther Yip-Mei; Chang, Jen-Chang; Lin, Jung-Chung; Chang, Feng-Yee; Fung, Chang-Phone

    2016-12-01

    Penicillin-resistant Streptococcus pneumoniae is a serious concern worldwide. In this study, we analyzed the cause of β-lactam resistance in pandemic multidrug-resistant clones. A total of 41 penicillin-nonsusceptible clinical isolates were collected from 1996 to 2012. Sero- and molecular typing confirmed that these isolates were clonal types of Taiwan 19F -14, Taiwan 23F -15, and Spain 23F -1. Sero-switching was found in four isolates. All isolates were multidrug resistant. Sequencing analysis of the penicillin binding proteins (PBPs) was performed on PBP1a, 2b, and 2x, and a large number of mutations were identified in comparing to clinical penicillin-susceptible isolates and the recipient strain R6 used for homologous recombination. The T 451 A substitution was the key amino acid in PBP2b that contributed to penicillin resistance. T 338 A in PBP2x played a role in resistance and reached the highest level of resistance when combined with other mutations in PBP2x. High-level penicillin resistance could not be obtained without the combination of mutations in PBP1a with PBP2b and 2x. The amino acid substitutions in PBP1a, 2b, and 2x were the crucial factors for β-lactam resistance.

  6. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  7. The genesis of an ‘interesting’ and important social and environmental accounting conversation: Celebrating the contribution of professor David Owen to social and environmental accounting and auditing (SEAA) research and practice

    NARCIS (Netherlands)

    O'Dwyer, B.

    2011-01-01

    This paper reflects on the nature of ‘interesting’ research in the context of the contributions Professor David Owen has made to the social and environmental accounting and auditing (SEAA) research field over his academic career. The paper reviews some of Professor Owen's key research themes and

  8. IMPORTANT NOTIFICATION

    CERN Multimedia

    HR Department

    2009-01-01

    Green plates, removals and importation of personal effects Please note that, as from 1 April 2009, formalities relating to K and CD special series French vehicle plates (green plates), removals and importation of personal effects into France and Switzerland will be dealt with by GS Department (Building 73/3-014, tel. 73683/74407). Importation and purchase of tax-free vehicles in Switzerland, as well as diplomatic privileges, will continue to be dealt with by the Installation Service of HR Department (Building 33/1-011, tel. 73962). HR and GS Departments

  9. Using Matrix-Assisted Laser Desorption Ionization-Time of Flight (MALDI-TOF) Complemented with Selected 16S rRNA and gyrB Genes Sequencing to Practically Identify Clinical Important Viridans Group Streptococci (VGS).

    Science.gov (United States)

    Zhou, Menglan; Yang, Qiwen; Kudinha, Timothy; Zhang, Li; Xiao, Meng; Kong, Fanrong; Zhao, Yupei; Xu, Ying-Chun

    2016-01-01

    There are challenges in viridans group streptococci (VGS) identification especially for the mitis group. Few studies have investigated the performance of MALDI-TOF MS system in VGS identification. Using 16S rRNA gene and gyrB gene sequencing as a gold standard, the performance of two MALDI-TOF MS instruments in the identification of 181 VGS clinical isolates was studied. The Bruker Biotyper and Vitek MS IVD systems correctly identified 88.4% and 98.9% of the 181 isolates, respectively. The Vitek MS RUO system was the least reliable, only correctly identifying 38.7% of the isolates to species level with several misidentifications and invalid results. The Bruker Biotyper system was very unreliable in the identification of species within the mitis group. Among 22 non-pneumococci isolates (S. mitis/S. oralis/S. pseudopneumoniae), Biotyper misidentified 21 of them as S. pneumoniae leading to a low sensitivity and low positive predictive value in these species. In contrast, the Vitek MS IVD demonstrated a better resolution for pneumococci and non-pneumococci despite the inability to distinguish between S. mitis/S. oralis. For more accurate species-level identification, further improvements in the VGS spectra databases are needed. Based on MALDI-TOF analysis and selected 16S rRNA gene plus gyrB genes sequencing, we designed a practical VGS identification algorithm.

  10. Social Contributions in Romania

    Directory of Open Access Journals (Sweden)

    Attila Gyorgy

    2012-12-01

    Full Text Available Social contributions have an important impact on payroll policy. Also, social contributions represent a significant budgetary revenue item which can be viewed at the edge between taxation and insurance. Social contributions in Romania experienced many changes which ended in 2008. Nowadays, they are within a long transaction period towards partial externalization of the insurance activity to privately managed funds. The aim of this paper is to analyse the homogeneity of Romanian social security public scheme using annual data extracted from 2002-2009.The main findings reveal that social contributions reached the pinnacle of diversification, being too many, some of them with a small contribution rates; fiscal reforms which reduced contribution rates advantaged employers, and state will be interested to externalize this activity as far private sector will be able to assume this responsibility and the budgetary effects are acceptable for the public finance.

  11. Contributions: SAGE

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. Contributions: SAGE. Space Alternating Generalized Expectation (SAGE) Maximization algorithm provides an iterative approach to parameter estimation when direct maximization of the likelihood function may be infeasible. Complexity is less in those applications ...

  12. Various Contributions

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. Various Contributions. Developed an Off –Diagonal MIMO Canceller to mitigate Upstream Crosstalk in VDSL. Developed a low complexity, Expectation Maximization based iterative Crosstalk cancellation. Developed an optimal way of computational complexity ...

  13. Original contributions

    African Journals Online (AJOL)

    hefere

    Original contributions ... Results suggest that there is a significant positive ... psychological abuse, including economic abuse, intimidation, harassment, stalking, damage ... or maintaining the structure and function of the African home (Alio et al., 2011; Jewkes,. Levin ... Revictimisation occurs due to emotional violence and.

  14. Importance classification

    International Nuclear Information System (INIS)

    Mizumachi, Wataru; Kobayashi, Masahide

    2008-01-01

    Conventionally, the design of a nuclear reactor has been performed from a viewpoint of a safety function and the importance on earthquake-proof on the basis of not giving off the mainly included radioactivity outside. In this Niigataken-Chuetsuoki earthquake, there is almost no damage to the system, components and structure on safe also in the earthquake beyond assumption, and the validity of the design was checked. But, the situation peculiar to a big earthquake was also generated. The emergency plan room which should serve as a connection center with the exterior was not able to open a door and use at the beginning. Fire-extinguishing system piping fractured and self-defense fire fighting was not made. And so on. Discussion from the following three viewpoints was performed. 1st: The importance from a viewpoint which should maintain a function also with the disaster in case of an earthquake like an emergency plan room etc. 2nd: In the earthquake, since the safe system and un-safe system was influenced, the importance from a viewpoint which may have influence safely inquired when the un-safe system broke down. 3rd: Although it was not directly related safely, discussion from a viewpoint which influences fear of insecurity, such as taking out smoke, for example, was performed (author)

  15. Measures of risk importance and their applications

    International Nuclear Information System (INIS)

    Vesely, W.E.; Davis, T.C.; Denning, R.S.; Saltos, N.

    1983-07-01

    This work is part of a project being conducted for the Division of Risk Analysis (DRA) of the Nuclear Regulatory Commission (NRC). The objectives of the project are to evaluate the importances of containment, the different safety functions, and other various contributers as assessed in probabilistic risk analyses and to identify generic conclusions regarding the importances. Effective display of the importances is an important part of these objectives. To address these objectives, measures of risk importance need to be first identified and then they need to be evaluated for the different risk analyses which have been performed. This report describes the risk importance measures that were defined and were applied to the risk analyses which were performed as part of the Reactor Safety Study Methodology Applications Program (RSSMAP). The risk importance measures defined in this report measure the importance of features not only with regard to risk reduction but also with regard to reliability assurance, or risk maintenance. The goal of this report is not to identify new mathematical formulas for risk importance but to show how importance measures can be interpreted and can be applied

  16. Thoughts on identifiers

    CERN Multimedia

    CERN. Geneva

    2005-01-01

    As business processes and information transactions have become an inextricably intertwined with the Web, the importance of assignment, registration, discovery, and maintenance of identifiers has increased. In spite of this, integrated frameworks for managing identifiers have been slow to emerge. Instead, identification systems arise (quite naturally) from immediate business needs without consideration for how they fit into larger information architectures. In addition, many legacy identifier systems further complicate the landscape, making it difficult for content managers to select and deploy identifier systems that meet both the business case and long term information management objectives. This presentation will outline a model for evaluating identifier applications and the functional requirements of the systems necessary to support them. The model is based on a layered analysis of the characteristics of identifier systems, including: * Functional characteristics * Technology * Policy * Business * Social T...

  17. Kant's Contribution to Moral Education: The Relevance of Catechistics

    Science.gov (United States)

    Surprenant, Chris W.

    2010-01-01

    Kant's deontological ethics, along with Aristotle's virtue ethics and Mill's utilitarian ethics, is often identified as one of the three primary moral options between which individuals can choose. Given the importance of Kant's moral philosophy, it is surprising and disappointing how little has been written on his important contributions to moral…

  18. Unconventional imports

    International Nuclear Information System (INIS)

    Yamaguchi, N.D.

    2001-01-01

    This article focuses on bitumens and bitumen products from Canadian oil sands and explores how they will affect the Canadian oil industry and the US refining industry. The falling production of crude, the growing demand for it, and the stagnating refining capacity in the US are reported, and Canadian and Mexican exports to the US, the definition of bitumens and bitumen quality, and the position of Canada as world leader in bitumen resources are considered. Bitumen production techniques, sales of bitumens and synthetic crude, the production outlook, and the quality and refining of bitumen and synthetic crude are examined. Plots illustrating North American crude refining capacity, production and demand for 1980-2000; US crude imports from Canada and Mexico (1981-2000), world proven oil reserves (2001), world bitumen resources, and Canadian oil production (1998-2000) are provided. Details of the composition of crudes and bitumens, and recent synthetic crude production are tabulated

  19. Ergonomics Contribution in Maintainability

    Science.gov (United States)

    Teymourian, Kiumars; Seneviratne, Dammika; Galar, Diego

    2017-09-01

    The objective of this paper is to describe an ergonomics contribution in maintainability. The economical designs, inputs and training helps to increase the maintainability indicators for industrial devices. This analysis can be helpful, among other cases, to compare systems, to achieve a better design regarding maintainability requirements, to improve this maintainability under specific industrial environment and to foresee maintainability problems due to eventual changes in a device operation conditions. With this purpose, this work first introduces the notion of ergonomics and human factors, maintainability and the implementation of assessment of human postures, including some important postures to perform maintenance activities. A simulation approach is used to identify the critical posture of the maintenance personnel and implements the defined postures with minimal loads on the personnel who use the equipment in a practical scenario. The simulation inputs are given to the designers to improve the workplace/equipment in order to high level of maintainability. Finally, the work concludes summarizing the more significant aspects and suggesting future research.

  20. National contributions to observed global warming

    International Nuclear Information System (INIS)

    Matthews, H Damon; Graham, Tanya L; Keverian, Serge; Lamontagne, Cassandra; Seto, Donny; Smith, Trevor J

    2014-01-01

    There is considerable interest in identifying national contributions to global warming as a way of allocating historical responsibility for observed climate change. This task is made difficult by uncertainty associated with national estimates of historical emissions, as well as by difficulty in estimating the climate response to emissions of gases with widely varying atmospheric lifetimes. Here, we present a new estimate of national contributions to observed climate warming, including CO 2 emissions from fossil fuels and land-use change, as well as methane, nitrous oxide and sulfate aerosol emissions While some countries’ warming contributions are reasonably well defined by fossil fuel CO 2 emissions, many countries have dominant contributions from land-use CO 2 and non-CO 2 greenhouse gas emissions, emphasizing the importance of both deforestation and agriculture as components of a country’s contribution to climate warming. Furthermore, because of their short atmospheric lifetime, recent sulfate aerosol emissions have a large impact on a country’s current climate contribution We show also that there are vast disparities in both total and per-capita climate contributions among countries, and that across most developed countries, per-capita contributions are not currently consistent with attempts to restrict global temperature change to less than 2 °C above pre-industrial temperatures. (paper)

  1. RO applications and wastewater reuse - two important fossil power plant contributions to conservation of water resources; Umkehrosmose und Wiederverwertung von Abwasser - zwei wichtige Beitraege der Kraftwerksindustrie zur Schonung von Wasserresourcen

    Energy Technology Data Exchange (ETDEWEB)

    Fahlke, J. [Grosskraftwerk Mannheim AG (Germany)

    1999-07-01

    The concept of the new makeup treatment system with permeate-staged reverse osmosis proved successful since commissioning. One important advantage is the short time required from startup until reaching the full load (within approximately 15 minutes). The pH of the decarbonation outlet decisively affects the degassing of carbon dioxide and thus also the permeate conductivity. By dosing acid or caustic, optimal operating conditions may be adjusted for both the carbon dioxide removal in the vacuum degasifier and the salt retention in the reverse osmosis system. Thus, during continuous operation, the permeate conductivity of < 0.2 {mu}S/cm is achieved. As compared to the older concentrate-staged reverse osmosis system, the loading of the downstream condensate polishers is markedly reduced because of the considerably lower permeate conductivity. Recycling of cleaned ash quenching water for process water in the FGD is principally possible and done for eight years now, as is demonstrated by the example of Unit 7 of Grosskraftwerk Mannheim. The RO concentrate is recycled since November 1997. Since the start of this approach a total amount of 799,288 m{sup 3} ash quenching water and 198,778 m{sup 3} RO concentrate was recycled in units 7 and 8. For units 3 and 4, the recycled quantity of ash quenching water and RO concentrate amounts to 688,982 m{sup 3}. This equals 168,704 DM of saved well water extraction fees since the start of the recycling approach. (orig.) [German] Das Konzept der neuen Zusatzwasseraufbereitung mit permeatgestufter Umkehrosmose hat sich bestens bewaehrt. Der Hauptvorteil ist das schnelle Anfahren der Anlage vom Stillstand auf Vollast innerhalb von ca. 15 Minuten. Der pH Wert im Austritt der Entkarbonisierung beeinflusst die Entgasung von CO{sub 2} und damit auch die elektrische Leitfaehigkeit des Permeats. Durch das Eindosieren von HCl oder NaOH koennen auch bei schwankender Zulaufqualitaet die optimalen Betriebsbedingungen eingestellt werden. Im

  2. Nobel Prizes: Contributions to Cardiology

    International Nuclear Information System (INIS)

    Mesquita, Evandro Tinoco; Marchese, Luana de Decco; Dias, Danielle Warol; Barbeito, Andressa Brasil; Gomes, Jonathan Costa; Muradas, Maria Clara Soares; Lanzieri, Pedro Gemal; Gismondi, Ronaldo Altenburg

    2015-01-01

    The Nobel Prize was created by Alfred Nobel. The first prize was awarded in 1901 and Emil Adolf von Behring was the first laureate in medicine due to his research in diphtheria serum. Regarding cardiology, Nobel Prize’s history permits a global comprehension of progress in pathophysiology, diagnosis and therapeutics of various cardiac diseases in last 120 years. The objective of this study was to review the major scientific discoveries contemplated by Nobel Prizes that contributed to cardiology. In addition, we also hypothesized why Carlos Chagas, one of our most important scientists, did not win the prize in two occasions. We carried out a non-systematic review of Nobel Prize winners, selecting the main studies relevant to heart diseaseamong the laureates. In the period between 1901 and 2013, 204 researches and 104 prizes were awarded in Nobel Prize, of which 16 (15%) studies were important for cardiovascular area. There were 33 (16%) laureates, and two (6%) were women. Fourteen (42%) were American, 15 (45%) Europeans and four (13%) were from other countries. There was only one winner born in Brazil, Peter Medawar, whose career was all in England. Reviewing the history of the Nobel Prize in physiology or medicine area made possible to identify which researchers and studies had contributed to advances in the diagnosis, prevention and treatment of cardiovascular diseases. Most winners were North Americans and Europeans, and male

  3. Nobel Prizes: Contributions to Cardiology

    Energy Technology Data Exchange (ETDEWEB)

    Mesquita, Evandro Tinoco; Marchese, Luana de Decco; Dias, Danielle Warol; Barbeito, Andressa Brasil; Gomes, Jonathan Costa; Muradas, Maria Clara Soares; Lanzieri, Pedro Gemal; Gismondi, Ronaldo Altenburg, E-mail: ronaldo@floralia.com.br [Universidade Federal Fluminense, Niterói, RJ (Brazil)

    2015-08-15

    The Nobel Prize was created by Alfred Nobel. The first prize was awarded in 1901 and Emil Adolf von Behring was the first laureate in medicine due to his research in diphtheria serum. Regarding cardiology, Nobel Prize’s history permits a global comprehension of progress in pathophysiology, diagnosis and therapeutics of various cardiac diseases in last 120 years. The objective of this study was to review the major scientific discoveries contemplated by Nobel Prizes that contributed to cardiology. In addition, we also hypothesized why Carlos Chagas, one of our most important scientists, did not win the prize in two occasions. We carried out a non-systematic review of Nobel Prize winners, selecting the main studies relevant to heart diseaseamong the laureates. In the period between 1901 and 2013, 204 researches and 104 prizes were awarded in Nobel Prize, of which 16 (15%) studies were important for cardiovascular area. There were 33 (16%) laureates, and two (6%) were women. Fourteen (42%) were American, 15 (45%) Europeans and four (13%) were from other countries. There was only one winner born in Brazil, Peter Medawar, whose career was all in England. Reviewing the history of the Nobel Prize in physiology or medicine area made possible to identify which researchers and studies had contributed to advances in the diagnosis, prevention and treatment of cardiovascular diseases. Most winners were North Americans and Europeans, and male.

  4. Important species differences regarding lymph contribution to gut hormone responses

    DEFF Research Database (Denmark)

    Hansen, Marie; Hjøllund, Karina R; Hartmann, Bolette

    2015-01-01

    pigs of the YDL-strain were catheterized in the portal vein, carotid artery and cisterna chyli (lymph). Neuromedin C (NC) was infused through an ear vein catheter, before and after injection of a selective DPP-4 inhibitor (vildagliptin). Total and intact GLP-1 levels were measured throughout the 150min....../presence of vildagliptin. In contrast, total and intact GLP-1 levels increased significantly in the portal vein and carotid artery. DPP-4 activity was lower in lymph than plasma, and was reduced further by vildagliptin. CONCLUSION: Our observations indicate that the lymphatic system does not transport high levels...

  5. Italian Literature in Russia. Some Recent Important Contributions

    Directory of Open Access Journals (Sweden)

    Claudia Lasorsa Siedina

    2013-02-01

    Full Text Available The paper presents an updated review of translations of contemporary Italian literature published in two issues of the popular Russian literary magazine “Inostrannaja literatura”. The first issue (2008, 10, entitled Italian Literature in Search of a Form, published translations by poets, prose writers, especially authors of stories, specimens of classic authors of the twentieth century: futurists, expressionists, surrealists, and writers of critical essays. Translation of some precious octaves of Ariosto’s poem Orlando furioso were also included. The second ‘special’ issue (2011, 8, entitled Italy: Seasons, is devoted to contemporary women writers of fiction. Particularly valuable is the Literature heritage section, which contains translations of Vivaldi’s sonnets by M. Amelin and of G.G. Belli’s Roman sonnets by E. Solonovič, both representatives of the excellence of the Russian school of translation. The two issues include a complete index of Italian authors translated into Russian between 1994 and 2011.

  6. The contribution of the Important Bird Areas programme to the ...

    African Journals Online (AJOL)

    Institutional capacity of the BirdLife Partners has been strengthened through developing partnerships, credibility and ability to undertake conservation action and advocacy. More work is required to update the lists of IBAs, monitor their status and scale up the programme to cover the whole continent. Ostrich 2007, 78(2): ...

  7. Elements that contribute to boost female entrepreneurship: A prospective analysis

    Directory of Open Access Journals (Sweden)

    Pilar Ortiz García

    2016-06-01

    Full Text Available This paper aims to identify what environmental modulators elements favor and contribute to enhance female entrepreneurship from a gender perspective. The qualitative study draws on 10 interviews in depth after being tested on their contents, from a relational perspective, allow a set of conclusions and recommendations that contribute to the empowerment of women entrepreneurs figure. The results highlight the importance of social support and comprehensive training in creating a culture that promotes and makes visible the role of women entrepreneurs.

  8. A new importance measure for sensitivity analysis

    International Nuclear Information System (INIS)

    Liu, Qiao; Homma, Toshimitsu

    2010-01-01

    Uncertainty is an integral part of risk assessment of complex engineering systems, such as nuclear power plants and space crafts. The aim of sensitivity analysis is to identify the contribution of the uncertainty in model inputs to the uncertainty in the model output. In this study, a new importance measure that characterizes the influence of the entire input distribution on the entire output distribution was proposed. It represents the expected deviation of the cumulative distribution function (CDF) of the model output that would be obtained when one input parameter of interest were known. The applicability of this importance measure was tested with two models, a nonlinear nonmonotonic mathematical model and a risk model. In addition, a comparison of this new importance measure with several other importance measures was carried out and the differences between these measures were explained. (author)

  9. Interactive Contributions of Cumulative Peer Stress and Executive Function Deficits to Depression in Early Adolescence

    Science.gov (United States)

    Agoston, Anna M.; Rudolph, Karen D.

    2016-01-01

    Exposure to peer stress contributes to adolescent depression, yet not all youth experience these effects. Thus, it is important to identify individual differences that shape the consequences of peer stress. This research investigated the interactive contribution of cumulative peer stress during childhood (second-fifth grades) and executive…

  10. Contribution of the intervention on the economic control - CIEC. and the liberation of the derivatives trading and imports in Brazil: the search for the wide opening of the market; Contribuicao de intervencao no dominio economico - CIDE e a liberacao da comercializacao e importacao dos derivados no Brasil: a busca pela plena abertura do mercado no setor

    Energy Technology Data Exchange (ETDEWEB)

    Simao, Newton [Agencia Nacional do Petroleo (ANP), Brasilia, DF (Brazil). Superintendencia de Participacoes Governamentais; Sala, Janaina [Agencia Nacional do Petroleo (ANP), Brasilia, DF (Brazil). Superintendencia de Refino e Processamento de Gas Natural

    2002-07-01

    This paper presents the evolution of the petroleum derivatives price structure from the year of 1988, and point out the main changes in the downstream segment of the petroleum industry after the market opening occurred in January 2002. An comparative analysis have been performed between the two periods, mainly of the substitution of the Specific Price Parcel - SPP by the CIED - Contribution of the Intervention in the Economic Domain, and an approach made on the positive and negative points of the present structure of taxation on the derivatives trading and import in Brazil.

  11. Jesuits' Contribution to Meteorology.

    Science.gov (United States)

    Udías, Agustín

    1996-10-01

    Starting in the middle of the nineteenth century, as part of their scientific tradition, Jesuits founded a considerable number of meteorological observatories throughout the world. In many countries, Jesuits established and maintained the first meteorological stations during the period from 1860 to 1950. The Jesuits' most important contribution to atmospheric science was their pioneer work related to the study and forecast of tropical hurricanes. That research was carried out at observatories of Belén (Cuba), Manila (Philippines), and Zikawei (China). B. Viñes, M. Decheyrens, J. Aigué, and C.E. Deppermann stood out in this movement.

  12. Examining suicide: imaging's contributions.

    Science.gov (United States)

    Church, Elizabeth J

    2015-01-01

    For many people, the death of hope leads inexorably to the conclusion that the only viable solution, the only way to put an end to unendurable pain, is suicide. What leads a person to commit this final, desperate act, and how might we predict, intervene, and prevent suicide? Health care workers, including radiologic technologists, can play an important role in detecting warning signs in patients and in better understanding what factors may lead to suicide. Although certain forms of suicide such as suicide bombings and assisted suicide are beyond its scope, this article explores medical imaging's contributions to the study of this phenomenon.

  13. Contributions to sampling statistics

    CERN Document Server

    Conti, Pier; Ranalli, Maria

    2014-01-01

    This book contains a selection of the papers presented at the ITACOSM 2013 Conference, held in Milan in June 2013. ITACOSM is the bi-annual meeting of the Survey Sampling Group S2G of the Italian Statistical Society, intended as an international  forum of scientific discussion on the developments of theory and application of survey sampling methodologies and applications in human and natural sciences. The book gathers research papers carefully selected from both invited and contributed sessions of the conference. The whole book appears to be a relevant contribution to various key aspects of sampling methodology and techniques; it deals with some hot topics in sampling theory, such as calibration, quantile-regression and multiple frame surveys, and with innovative methodologies in important topics of both sampling theory and applications. Contributions cut across current sampling methodologies such as interval estimation for complex samples, randomized responses, bootstrap, weighting, modeling, imputati...

  14. Important motivators for buying green products

    Directory of Open Access Journals (Sweden)

    Kamyar Kianpour

    2014-12-01

    Full Text Available Purpose: To addresses the main motivators that influence customers to buy green products as well as well as profiling the decisions that shape their behavior. Design/methodology/approach: The authors have conducted a review of the major research related to consumers to identify motivational factors, to draw conclusions about their impact on buying green products.   Factor analysis is conducted on the collected data to find the underlying factors that motivate consumers to buy green products and most importantly motivational factors were identified by T test. Findings: Results show that 1 Environmental Concern, Perceived Consumer Effectiveness, Consumer Knowledge 2 Laws and regulation and 3 Promotional Tools’ were the most important of motivators. Practical implications: The results could help companies, authorities, governments, producers, sellers to know what motivate customers to buy green products and persuade the customers for buying them. Social implications: Furthermore this research will indirectly contribute to increase the customers and public intention for buying green products which in turn will help to solve some of environmental issues and make less environmental side effect caused by products. It is notable that motivated consumers for buying green product will finally expect to have healthy life and clean environment which leads to a healthy and clean society. Originality/value: This article contributes to the literature on the customers’ intention for buying green products by filling the gap in the concrete issues of the customers’ motivation.

  15. COP 21: the national contributions

    International Nuclear Information System (INIS)

    Jouette, Isabelle

    2015-01-01

    This article comments the content of the national contributions (the so-called Intended Nationally Determined Contributions or INDC) which every country should have transmitted to the UN before the COP 21. In fact, 148 contributions, i.e. 75 per cent of the expected ones, have been transmitted. The author recalls that the content of these contributions had to obey some principles which had been defined in Lima in 2014, and that each country must identify its objectives in terms of mitigation (reduction of greenhouse gas emissions) and adaptation (reduction of the vulnerability of natural and human systems). The author comments some specific commitments regarding climate, emission reduction, adaptation to climate change, and more particularly evokes the Ethiopian contribution which is considered as exemplary

  16. Identifying enabling management practices for employee engagement

    Directory of Open Access Journals (Sweden)

    Marius Joubert

    2011-12-01

    Full Text Available Orientation: A currently emerging viewpoint is that today's management practices no longer add value to organisations. The focus of this article is to conduct a systematic review of the scholarly literature on management practices that could be related to employee engagement. Research purpose: This study searched for evidence in support of the notion of a management value chain, and enabling management practices within each value chain component that could relate to employee engagement. Motivation for the study: An alternative management value chain model could contribute towards a better understanding of which management practices may potentially impact employee engagement. Research design, approach, and method: This is a non-empirical (theoretical study, based on a systematic, in-depth literature review to identify the key management components and enabling practices within this proposed management value chain. Scholarly research databases were sourced for relevant peer reviewed research conducted since 1990, not excluding important contributions prior to 1990. The literature was systematically searched, selected, studied, and contextualized within this study. Main findings: Support was found for the notion of a management value chain, for enabling management practices within each proposed management value chain component, and it was also established these management practices indeed have an impact on employee engagement. Practical/managerial/implications: The possibility that management work can be presented as a generic management value chain allows managers to approach engaging management practices more systematically. Contribution/value-add: This study highlights the importance of some management practices that have never been seen as part of management work.

  17. How important is importance for prospective memory? A review

    Directory of Open Access Journals (Sweden)

    Stefan eWalter

    2014-06-01

    Full Text Available Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover, we address the relationship between importance and other factors known to affect prospective memory and ongoing task performance such as type of prospective memory task (time-, event- or activity-based, cognitive loads, and cue focality. Finally, we provide a connection to motivation, we summarize the effects of task importance and we identify important venues for future research.

  18. How important is importance for prospective memory? A review

    Science.gov (United States)

    Walter, Stefan; Meier, Beat

    2014-01-01

    Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover, we address the relationship between importance and other factors known to affect prospective memory and ongoing task performance such as type of prospective memory task (time-, event-, or activity-based), cognitive loads, and processing overlaps. Finally, we provide a connection to motivation, we summarize the effects of task importance and we identify important venues for future research. PMID:25018743

  19. Financial Network Systemic Risk Contributions

    NARCIS (Netherlands)

    Hautsch, N.; Schaumburg, J.; Schienle, M.

    2015-01-01

    We propose the realized systemic risk beta as a measure of financial companies' contribution to systemic risk, given network interdependence between firms' tail risk exposures. Conditional on statistically pre-identified network spillover effects and market and balance sheet information, we define

  20. A complex network-based importance measure for mechatronics systems

    Science.gov (United States)

    Wang, Yanhui; Bi, Lifeng; Lin, Shuai; Li, Man; Shi, Hao

    2017-01-01

    In view of the negative impact of functional dependency, this paper attempts to provide an alternative importance measure called Improved-PageRank (IPR) for measuring the importance of components in mechatronics systems. IPR is a meaningful extension of the centrality measures in complex network, which considers usage reliability of components and functional dependency between components to increase importance measures usefulness. Our work makes two important contributions. First, this paper integrates the literature of mechatronic architecture and complex networks theory to define component network. Second, based on the notion of component network, a meaningful IPR is brought into the identifying of important components. In addition, the IPR component importance measures, and an algorithm to perform stochastic ordering of components due to the time-varying nature of usage reliability of components and functional dependency between components, are illustrated with a component network of bogie system that consists of 27 components.

  1. Transverse momentum distributions of identified particles produced ...

    Indian Academy of Sciences (India)

    We assume that the transverse momentum distributions of identified particles measured in final state are contributed by a few energy sources which can be regarded as partons or quarks in the interacting system. The particle is contributed by each source with gluons which have transverse momentum distributions in an ...

  2. Contribution mapping: a method for mapping the contribution of research to enhance its impact

    Science.gov (United States)

    2012-01-01

    Background At a time of growing emphasis on both the use of research and accountability, it is important for research funders, researchers and other stakeholders to monitor and evaluate the extent to which research contributes to better action for health, and find ways to enhance the likelihood that beneficial contributions are realized. Past attempts to assess research 'impact' struggle with operationalizing 'impact', identifying the users of research and attributing impact to research projects as source. In this article we describe Contribution Mapping, a novel approach to research monitoring and evaluation that aims to assess contributions instead of impacts. The approach focuses on processes and actors and systematically assesses anticipatory efforts that aim to enhance contributions, so-called alignment efforts. The approach is designed to be useful for both accountability purposes and for assisting in better employing research to contribute to better action for health. Methods Contribution Mapping is inspired by a perspective from social studies of science on how research and knowledge utilization processes evolve. For each research project that is assessed, a three-phase process map is developed that includes the main actors, activities and alignment efforts during research formulation, production and knowledge extension (e.g. dissemination and utilization). The approach focuses on the actors involved in, or interacting with, a research project (the linked actors) and the most likely influential users, who are referred to as potential key users. In the first stage, the investigators of the assessed project are interviewed to develop a preliminary version of the process map and first estimation of research-related contributions. In the second stage, potential key-users and other informants are interviewed to trace, explore and triangulate possible contributions. In the third stage, the presence and role of alignment efforts is analyzed and the preliminary

  3. Identifying ambassador species for conservation marketing

    Directory of Open Access Journals (Sweden)

    E.A. Macdonald

    2017-10-01

    Full Text Available Conservation relies heavily on external funding, much of it from a supportive public. Therefore it is important to know which species are most likely to catalyse such funding. Whilst previous work has looked at the physical attributes that contribute to a species' appeal, no previous studies have tried to examine the extent to which a species' sympatriots might contribute to it's potential as flagship for wider conservation. Therefore, here we estimate ‘flexibility’ and ‘appeal’ scores for all terrestrial mammals (n = 4320 and identify which of these might serve as ambassadors (defined as both highly appealing and flexible. Relatively few mammals (between 240 and 331 emerged as ambassadors, with carnivores featuring heavily in this group (representing 5% of terrestrial mammals but 39% of ambassadors. ‘Top ambassadors’ were defined as those with both flexibility and appeal scores greater than 1 standard deviation above the mean. Less than a quarter of the 20 most endangered and evolutionary distinct species in this study were classed as ambassadors, highlighting the need for surrogate species to catalyse conservation effort in areas with such priority species. This is the first global analysis bringing together flexibility and appeal for all terrestrial mammals, and demonstrates an approach for determining how best to market species in order to achieve maximal conservation gain in a world with urgent conservation need but limited resources.

  4. The importance of civilian nursing organizations: integrative literature review.

    Science.gov (United States)

    Santos, James Farley Estevam Dos; Santos, Regina Maria Dos; Costa, Laís de Miranda Crispim; Almeida, Lenira Maria Wanderley Santos de; Macêdo, Amanda Cavalcante de; Santos, Tânia Cristina Franco

    2016-06-01

    to identify and analyze evidence from studies about the importance of civilian nursing organizations. an integrative literature review, for which searches were conducted in the databases LILACS, PubMed/MEDLINE, SciELO, BDENF, and Scopus. sixteen articles published between the years 2004-2013 were selected, 68.75% of which were sourced from Brazilian journals and 31.25% from American journals. civilian nursing organizations are important and necessary, because they have collaborated decisively in nursing struggles in favor of the working class and society in general, and these contributions influence different axes of professional performance.

  5. Identifiability in stochastic models

    CERN Document Server

    1992-01-01

    The problem of identifiability is basic to all statistical methods and data analysis, occurring in such diverse areas as Reliability Theory, Survival Analysis, and Econometrics, where stochastic modeling is widely used. Mathematics dealing with identifiability per se is closely related to the so-called branch of ""characterization problems"" in Probability Theory. This book brings together relevant material on identifiability as it occurs in these diverse fields.

  6. Permutation importance: a corrected feature importance measure.

    Science.gov (United States)

    Altmann, André; Toloşi, Laura; Sander, Oliver; Lengauer, Thomas

    2010-05-15

    In life sciences, interpretability of machine learning models is as important as their prediction accuracy. Linear models are probably the most frequently used methods for assessing feature relevance, despite their relative inflexibility. However, in the past years effective estimators of feature relevance have been derived for highly complex or non-parametric models such as support vector machines and RandomForest (RF) models. Recently, it has been observed that RF models are biased in such a way that categorical variables with a large number of categories are preferred. In this work, we introduce a heuristic for normalizing feature importance measures that can correct the feature importance bias. The method is based on repeated permutations of the outcome vector for estimating the distribution of measured importance for each variable in a non-informative setting. The P-value of the observed importance provides a corrected measure of feature importance. We apply our method to simulated data and demonstrate that (i) non-informative predictors do not receive significant P-values, (ii) informative variables can successfully be recovered among non-informative variables and (iii) P-values computed with permutation importance (PIMP) are very helpful for deciding the significance of variables, and therefore improve model interpretability. Furthermore, PIMP was used to correct RF-based importance measures for two real-world case studies. We propose an improved RF model that uses the significant variables with respect to the PIMP measure and show that its prediction accuracy is superior to that of other existing models. R code for the method presented in this article is available at http://www.mpi-inf.mpg.de/ approximately altmann/download/PIMP.R CONTACT: altmann@mpi-inf.mpg.de, laura.tolosi@mpi-inf.mpg.de Supplementary data are available at Bioinformatics online.

  7. Importance analysis for reconfigurable systems

    International Nuclear Information System (INIS)

    Si, Shubin; Levitin, Gregory; Dui, Hongyan; Sun, Shudong

    2014-01-01

    Importance measures are used in reliability engineering to rank the system components according to their contributions to proper functioning of the entire system and to find the most effective ways of reliability enhancement. Traditionally, the importance measures do not consider the possible change of system structure with the improvement of specific component reliability. However, if a component's reliability changes, the optimal system structure/configuration may also change and the importance of the corresponding component will depend on the chosen structure. When the most promising component reliability improvement is determined, the component importance should be taken into account with respect to the possible structure changes. This paper studies the component reliability importance indices with respect to the changes of the optimal component sequencing. This importance measure indicates the critical components in providing the system reliability enhancement by both enhancing the component's reliability and reconfiguring the system. Examples of linear consecutive-k-out-of-n: F and G systems are considered to demonstrate the change of the component Birnbaum importance with the optimal system reconfiguration. The results show that the change of the importance index corresponds to the change of the system optimal configuration and the importance index can change not monotonically with the variation of the component reliability

  8. FACTORS CONTRIBUTING TO PERINATAL MORTALITY : OPTIMIZING OUTCOME

    Directory of Open Access Journals (Sweden)

    Lakshmi

    2015-03-01

    Full Text Available OBJECTIVE: To evaluate the various causes of perinatal deaths and adopt strategies to improve perinatal outcome at a referral teaching hospital in North Kerala. METHODS: A prospective observational study conducted at Institute of Maternal and Child Health, Government Medical College, Kozhikode. All perinatal deaths during the period January 2013 to December 2014 were analysed and from this factors responsible for perinatal deaths were identified. RESULTS: Out of total 30,042 deliveries , there were 966 perinatal deaths during the study period. 566 were still births and 400 early neonatal deaths. The perinatal mortality rate was 31.1 per 1000 live births. Perinatal asphyxia was the major cause of perinatal mortality. The important factors contributing to perinatal asphyxia were prematurity (39%, abruptio placenta (19% and MSAF ( 12%. Among the antenatal factors, hypertensive disorders of pregnancy leading to iatrogenic elective preterm delivery were the most important. CONCLUSION: Perinatal asphyxia due to prematurity and low birth weight emerged as the most important cause of perinatal mortality in this study and hypertensive disorders of pregnancy were the most important antenatal complication leading to prematurity

  9. Factors Contribute to Safety Culture in the Manufacturing Industry in Malaysia

    OpenAIRE

    Ong Choon Hee

    2014-01-01

    The purpose of this paper is to explain the role of safety culture in the manufacturing industry in Malaysia and identify factors contribute to safety culture. It is suggested in this study that leadership support, management commitment and safety management system are important factors that contribute to safety culture. This study also provides theoretical implications to guide future research and offers practical implications to the managers in the development of safety culture. Given that ...

  10. Identifying Strategic Scientific Opportunities

    Science.gov (United States)

    As NCI's central scientific strategy office, CRS collaborates with the institute's divisions, offices, and centers to identify research opportunities to advance NCI's vision for the future of cancer research.

  11. Identifying Breast Cancer Oncogenes

    Science.gov (United States)

    2011-10-01

    cells we observed that it promoted transformation of HMLE cells, suggesting a tumor suppressive role of Merlin in breast cancer (Figure 4B). A...08-1-0767 TITLE: Identifying Breast Cancer Oncogenes PRINCIPAL INVESTIGATOR: Yashaswi Shrestha...Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std. Z39.18 W81XWH-08-1-0767 Identifying Breast Cancer Oncogenes Yashaswi Shrestha Dana-Farber

  12. Risk importance measures in the dynamic flowgraph methodology

    International Nuclear Information System (INIS)

    Tyrväinen, T.

    2013-01-01

    This paper presents new risk importance measures applicable to a dynamic reliability analysis approach with multi-state components. Dynamic reliability analysis methods are needed because traditional methods, such as fault tree analysis, can describe system's dynamical behaviour only in limited manner. Dynamic flowgraph methodology (DFM) is an approach used for analysing systems with time dependencies and feedback loops. The aim of DFM is to identify root causes of a top event, usually representing the system's failure. Components of DFM models are analysed at discrete time points and they can have multiple states. Traditional risk importance measures developed for static and binary logic are not applicable to DFM as such. Some importance measures have previously been developed for DFM but their ability to describe how components contribute to the top event is fairly limited. The paper formulates dynamic risk importance measures that measure the importances of states of components and take the time-aspect of DFM into account in a logical way that supports the interpretation of results. Dynamic risk importance measures are developed as generalisations of the Fussell-Vesely importance and the risk increase factor. -- Highlights: • New risk importance measures are developed for the dynamic flowgraph methodology. • Dynamic risk importance measures are formulated for states of components. • An approach to handle failure modes of a component in DFM is presented. • Dynamic risk importance measures take failure times into account. • Component's influence on the system's reliability can be analysed in detail

  13. Identifying Knowledge and Communication

    Directory of Open Access Journals (Sweden)

    Eduardo Coutinho Lourenço de Lima

    2006-12-01

    Full Text Available In this paper, I discuss how the principle of identifying knowledge which Strawson advances in ‘Singular Terms and Predication’ (1961, and in ‘Identifying Reference and Truth-Values’ (1964 turns out to constrain communication. The principle states that a speaker’s use of a referring expression should invoke identifying knowledge on the part of the hearer, if the hearer is to understand what the speaker is saying, and also that, in so referring, speakers are attentive to hearers’ epistemic states. In contrasting it with Russell’s Principle (Evans 1982, as well as with the principle of identifying descriptions (Donnellan 1970, I try to show that the principle of identifying knowledge, ultimately a condition for understanding, makes sense only in a situation of conversation. This allows me to conclude that the cooperative feature of communication (Grice 1975 and reference (Clark andWilkes-Gibbs 1986 holds also at the understanding level. Finally, I discuss where Strawson’s views seem to be unsatisfactory, and suggest how they might be improved.

  14. HEDIS Research Identifiable Files

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Healthcare Effectiveness Data and Information Set (HEDIS) is a tool used by more than 90 percent of Americas health plans to measure performance on important...

  15. QCD contributions to vacuum polarization

    International Nuclear Information System (INIS)

    Reinders, L.J.; Rubinstein, H.R.; Yazaki, S.

    1980-01-01

    We have computed to lowest non-trivial order the perturbative and non-perturbative contributions to the vacuum polarization from all currents up to and including spin 2 ++ . These expressions are important, for example to evaluate QCD sum rules for heavy and light quark systems as shown by Shifman, Vainshtein and Zakharov. Most of the known ones are verified, one slightly changed, and many new ones are displayed. (orig.)

  16. CONTRIBUTION OF INDIRECT TAXES

    Directory of Open Access Journals (Sweden)

    CHIRCULESCU MARIA FELICIA

    2015-08-01

    Full Text Available The work is based on the fact that at any time and in any society, taxation is regarded as undesirable for all taxpayers. The existence and it's manifestation is justified, because the operation of any company involves costs that must be covered by sufficient resources. Since ancient times, each state has adopted its own tax system, more or less perfected, as the state has experienced a greater or lesser economic and military power At the base of this work stays the fact that tax systems are a key factor influencing the overall efficiency of the economy. They determine the size tendency to save, invest and work, influencing the increase in production and employment, which is essential sights integral economic strategy, making tax reform an important component of economic reform. This paper aims to analyze the indirect taxes and their contribution to the public revenues in Romania, the purpose paper contains an analysis based on statistical series as indirect taxation is where tax harmonization was possible. Through analyzes, the paper aims to provide answers to the problem of the contradiction between the growing need for budgetary revenues, which entails a continuous amplification and diversification of taxation, on the one hand, and the need to stimulate economic development, on the other hand. The harmonization of indirect taxation had been achieved since this touches the free movement of goods and the freedom to supply services, not being able to say the same thing about direct taxation, which is why the European Community Treaty does not specify expressly the alignment of direct taxation, considering that direct taxation is a matter of Internal Policies that, for a country free option.

  17. Major contributions to science

    Energy Technology Data Exchange (ETDEWEB)

    Martin, Andre

    1991-03-15

    It may look difficult to describe the scientific contributions of Léon Van Hove, who started his career as a pure mathematician, and then a mathematical physicist, and ended it as a phenomenologist and an adseveral of Léon's students, in particular N. Hugenholtz. In this domain, his contributions were numerous and fundamental.

  18. Major contributions to science

    International Nuclear Information System (INIS)

    Martin, Andre

    1991-01-01

    It may look difficult to describe the scientific contributions of Léon Van Hove, who started his career as a pure mathematician, and then a mathematical physicist, and ended it as a phenomenologist and an adseveral of Léon's students, in particular N. Hugenholtz. In this domain, his contributions were numerous and fundamental

  19. ECONOMIC AND SOCIAL IMPORTANCE OF TOURISM

    OpenAIRE

    Ștefan-Dragoș CÎRSTEA; Andreea CÎRSTEA

    2015-01-01

    Tourism is a sector with a significant share in the economies of many countries. There are nations whose GDP consists of 40% of the total contribution of tourism to this indicator. One such segment requires permanent research of its economic, social and sustainability dimensions and their importance. This study outlines an overview of the main aspects related to economic and social importance of tourism and how tourism relates to the concept of sustainable development. The total contribution ...

  20. Identifying and Managing Risk.

    Science.gov (United States)

    Abraham, Janice M.

    1999-01-01

    The role of the college or university chief financial officer in institutional risk management is (1) to identify risk (physical, casualty, fiscal, business, reputational, workplace safety, legal liability, employment practices, general liability), (2) to develop a campus plan to reduce and control risk, (3) to transfer risk, and (4) to track and…

  1. Red-cockaded woodpecker cavity-tree damage by Hurricane Rita: an evaluation of contributing factors

    Science.gov (United States)

    Ben Bainbridge; Kristen A. Baum; Daniel Saenz; Cory K. Adams

    2011-01-01

    Picoides borealis (Red-cockaded Woodpecker) is an endangered species inhabiting pine savannas of the southeastern United States. Because the intensity of hurricanes striking the southeastern United States is likely to increase as global temperatures rise, it is important to identify factors contributing to hurricane damage to Red-cockaded Woodpecker cavity-trees. Our...

  2. Distributed Persistent Identifiers System Design

    Directory of Open Access Journals (Sweden)

    Pavel Golodoniuc

    2017-06-01

    Full Text Available The need to identify both digital and physical objects is ubiquitous in our society. Past and present persistent identifier (PID systems, of which there is a great variety in terms of technical and social implementation, have evolved with the advent of the Internet, which has allowed for globally unique and globally resolvable identifiers. PID systems have, by in large, catered for identifier uniqueness, integrity, and persistence, regardless of the identifier’s application domain. Trustworthiness of these systems has been measured by the criteria first defined by Bütikofer (2009 and further elaborated by Golodoniuc 'et al'. (2016 and Car 'et al'. (2017. Since many PID systems have been largely conceived and developed by a single organisation they faced challenges for widespread adoption and, most importantly, the ability to survive change of technology. We believe that a cause of PID systems that were once successful fading away is the centralisation of support infrastructure – both organisational and computing and data storage systems. In this paper, we propose a PID system design that implements the pillars of a trustworthy system – ensuring identifiers’ independence of any particular technology or organisation, implementation of core PID system functions, separation from data delivery, and enabling the system to adapt for future change. We propose decentralisation at all levels — persistent identifiers and information objects registration, resolution, and data delivery — using Distributed Hash Tables and traditional peer-to-peer networks with information replication and caching mechanisms, thus eliminating the need for a central PID data store. This will increase overall system fault tolerance thus ensuring its trustworthiness. We also discuss important aspects of the distributed system’s governance, such as the notion of the authoritative source and data integrity

  3. Internally readable identifying tag

    International Nuclear Information System (INIS)

    Jefferts, K.B.; Jefferts, E.R.

    1980-01-01

    A method of identifying non-metallic objects by means of X-ray equipment is described in detail. A small metal pin with a number of grooves cut in a pre-determined equi-spaced pattern is implanted into the non-metallic object and by decoding the groove patterns using X-ray equipment, the object is uniquely identified. A specific example of such an application is in studying the migratory habits of fish. The pin inserted into the snout of the fish is 0.010 inch in diameter, 0.040 inch in length with 8 possible positions for grooves if spaced 0.005 inch apart. With 6 of the groove positions available for data, the capacity is 2 6 or 64 combinations; clearly longer pins would increase the data capacity. This method of identification is a major advance over previous techniques which necessitated destruction of the fish in order to recover the identification tag. (UK)

  4. Identifying Breast Cancer Oncogenes

    Science.gov (United States)

    2010-10-01

    tyrosine kinases with an SH3, SH2 and catalytic domain, it lacks a native myristylation signal shared by most members of this class [14], [38]. The...therapeutics and consequently, improve clinical outcomes. We aim to identify novel drivers of breast oncogenesis. We hypothesize that a kinase gain-of...human mammary epithelial cells. A pBabe-Puro-Myr-Flag kinase open reading frame (ORF) library was screened in immortalized human mammary epithelial

  5. Rock disposal problems identified

    Energy Technology Data Exchange (ETDEWEB)

    Knox, R

    1978-06-01

    Mathematical models are the only way of examining the return of radioactivity from nuclear waste to the environment over long periods of time. Work in Britain has helped identify areas where more basic data is required, but initial results look very promising for final disposal of high level waste in hard rock repositories. A report by the National Radiological Protection Board of a recent study, is examined.

  6. Strategic importance of collaboration

    Energy Technology Data Exchange (ETDEWEB)

    Miller, K.A. [NB Power, Fredericton, New Brunswick (Canada)

    2015-07-01

    In the nuclear industry there is a need to collaborate because of aging equipment, aging people that contribute to dilution of expertise, obsolesce and advances in codes and standards. In the longer term there is a need to focus on operational issues, sustain our suppliers and expertise as well as improve and sustain performance.

  7. Strategic importance of collaboration

    International Nuclear Information System (INIS)

    Miller, K.A.

    2015-01-01

    In the nuclear industry there is a need to collaborate because of aging equipment, aging people that contribute to dilution of expertise, obsolesce and advances in codes and standards. In the longer term there is a need to focus on operational issues, sustain our suppliers and expertise as well as improve and sustain performance.

  8. Play's Importance in School

    Science.gov (United States)

    Sandberg, Anette; Heden, Rebecca

    2011-01-01

    The purpose of this study is to contribute knowledge on and gain an understanding of elementary school teachers' perspectives on the function of play in children's learning processes. The study is qualitative with a hermeneutical approach and has George Herbert Mead as a theoretical frame of reference. Interviews have been carried out with seven…

  9. Neuromarketing and consumer neuroscience: contributions to neurology.

    Science.gov (United States)

    Javor, Andrija; Koller, Monika; Lee, Nick; Chamberlain, Laura; Ransmayr, Gerhard

    2013-02-06

    'Neuromarketing' is a term that has often been used in the media in recent years. These public discussions have generally centered around potential ethical aspects and the public fear of negative consequences for society in general, and consumers in particular. However, positive contributions to the scientific discourse from developing a biological model that tries to explain context-situated human behavior such as consumption have often been neglected. We argue for a differentiated terminology, naming commercial applications of neuroscientific methods 'neuromarketing' and scientific ones 'consumer neuroscience'. While marketing scholars have eagerly integrated neuroscientific evidence into their theoretical framework, neurology has only recently started to draw its attention to the results of consumer neuroscience. In this paper we address key research topics of consumer neuroscience that we think are of interest for neurologists; namely the reward system, trust and ethical issues. We argue that there are overlapping research topics in neurology and consumer neuroscience where both sides can profit from collaboration. Further, neurologists joining the public discussion of ethical issues surrounding neuromarketing and consumer neuroscience could contribute standards and experience gained in clinical research. We identify the following areas where consumer neuroscience could contribute to the field of neurology:First, studies using game paradigms could help to gain further insights into the underlying pathophysiology of pathological gambling in Parkinson's disease, frontotemporal dementia, epilepsy, and Huntington's disease.Second, we identify compulsive buying as a common interest in neurology and consumer neuroscience. Paradigms commonly used in consumer neuroscience could be applied to patients suffering from Parkinson's disease and frontotemporal dementia to advance knowledge of this important behavioral symptom.Third, trust research in the medical context lacks

  10. Neuromarketing and consumer neuroscience: contributions to neurology

    Science.gov (United States)

    2013-01-01

    Background ‘Neuromarketing’ is a term that has often been used in the media in recent years. These public discussions have generally centered around potential ethical aspects and the public fear of negative consequences for society in general, and consumers in particular. However, positive contributions to the scientific discourse from developing a biological model that tries to explain context-situated human behavior such as consumption have often been neglected. We argue for a differentiated terminology, naming commercial applications of neuroscientific methods ‘neuromarketing’ and scientific ones ‘consumer neuroscience’. While marketing scholars have eagerly integrated neuroscientific evidence into their theoretical framework, neurology has only recently started to draw its attention to the results of consumer neuroscience. Discussion In this paper we address key research topics of consumer neuroscience that we think are of interest for neurologists; namely the reward system, trust and ethical issues. We argue that there are overlapping research topics in neurology and consumer neuroscience where both sides can profit from collaboration. Further, neurologists joining the public discussion of ethical issues surrounding neuromarketing and consumer neuroscience could contribute standards and experience gained in clinical research. Summary We identify the following areas where consumer neuroscience could contribute to the field of neurology: First, studies using game paradigms could help to gain further insights into the underlying pathophysiology of pathological gambling in Parkinson’s disease, frontotemporal dementia, epilepsy, and Huntington’s disease. Second, we identify compulsive buying as a common interest in neurology and consumer neuroscience. Paradigms commonly used in consumer neuroscience could be applied to patients suffering from Parkinson’s disease and frontotemporal dementia to advance knowledge of this important behavioral symptom

  11. Summaries of poster contributions

    International Nuclear Information System (INIS)

    1981-01-01

    The 10. meeting covered subjects on the application of electron microscopy in numerous fields such as biology and medicine, solid state physics, semiconductor research and production, crystallography, materials science, and chemistry of polymers. 174 summaries of poster contributions are included

  12. Australian contribution to the science of radioastronomy

    International Nuclear Information System (INIS)

    Mills, B.Y.

    1988-01-01

    Australia has made numerous major contributions to the science of radioastronomy and played a leading role in its early development. The history of the Australian effort is reviewed, from this early seminal work until the present day when contributions continue at an important level

  13. Identifying artificial selection signals in the chicken genome.

    Directory of Open Access Journals (Sweden)

    Yunlong Ma

    Full Text Available Identifying the signals of artificial selection can contribute to further shaping economically important traits. Here, a chicken 600k SNP-array was employed to detect the signals of artificial selection using 331 individuals from 9 breeds, including Jingfen (JF, Jinghong (JH, Araucanas (AR, White Leghorn (WL, Pekin-Bantam (PB, Shamo (SH, Gallus-Gallus-Spadiceus (GA, Rheinlander (RH and Vorwerkhuhn (VO. Per the population genetic structure, 9 breeds were combined into 5 breed-pools, and a 'two-step' strategy was used to reveal the signals of artificial selection. GA, which has little artificial selection, was defined as the reference population, and a total of 204, 155, 305 and 323 potential artificial selection signals were identified in AR_VO, PB, RH_WL and JH_JF, respectively. We also found signals derived from standing and de-novo genetic variations have contributed to adaptive evolution during artificial selection. Further enrichment analysis suggests that the genomic regions of artificial selection signals harbour genes, including THSR, PTHLH and PMCH, responsible for economic traits, such as fertility, growth and immunization. Overall, this study found a series of genes that contribute to the improvement of chicken breeds and revealed the genetic mechanisms of adaptive evolution, which can be used as fundamental information in future chicken functional genomics study.

  14. Uses of risk importance measures

    International Nuclear Information System (INIS)

    Mankamo, T.; Poern, K.; Holmberg, J.

    1991-05-01

    Risk importance measures provide an understandable and practical way of presenting probabilistic safety analysis results which too often tend to remain abstract numbers without real insight into the content. The report clarifies the definitions, relationships and interpretations of the three most basic measures: Risk increase factor, risk decrease factor, and fractional contribution. The above three measures already cover the main types of risk importance measures. Many other importance measures presented in literature are close variants to some of these three measures. They are related in many cases so that, for a technical system considered, the two other measures can be derived from the one calculated first. However, the practical interpretations are different, and hence each three measures have their own uses and rights to existence. The fundamental aspect of importance measures is, that they express some specific influence of a basic event on the total risk. The basic failure or error events are the elements from which the reliability and risk models are constituted. The importance measures are relative, which is an advantage compared to absolute risk numbers, due to insensitivity with respect to quantification uncertainties. Therefore they are particularly adapted to give first hand guidance where to focus main interest from the system's risk and reliability point of view and wherefrom to continue the analysis with more sophisticated methods requiring more effort

  15. ORCID: Author Identifiers for Librarians

    Directory of Open Access Journals (Sweden)

    Robyn B. Reed

    2017-10-01

    Full Text Available Generating accurate publication lists by researchers can be challenging when faced with scholars who have common names or who have published under name variations. This article describes ORCID and the goal of generating author identifiers for scholars to connect their research outputs. Included are the reasons for having author identifiers as well as the types of information within individual profiles. This article includes information on how academic libraries are playing a role with ORCID initiatives as well as describing how publishers, institutions, and funders are employing ORCID in their workflows. Highlighted is material on academic institutions in Pennsylvania using ORCID. The purpose of the article is to provide an overview of ORCID and its uses to inform librarians about this important initiative.

  16. Identifying phenomenal consciousness.

    Science.gov (United States)

    Schier, Elizabeth

    2009-03-01

    This paper examines the possibility of finding evidence that phenomenal consciousness is independent of access. The suggestion reviewed is that we should look for isomorphisms between phenomenal and neural activation spaces. It is argued that the fact that phenomenal spaces are mapped via verbal report is no problem for this methodology. The fact that activation and phenomenal space are mapped via different means does not mean that they cannot be identified. The paper finishes by examining how data addressing this theoretical question could be obtained.

  17. Are All Pixels Equally Important?

    CERN Multimedia

    CERN. Geneva

    2015-01-01

    When we look at our environment, we primarily pay attention to visually distinctive objects. We refer to these objects as visually important or salient. For efficient visual processing, the human visual system identifies salients objects and dedicates most of its processing resources to them. An analogous resource allocation can be performed by salient-object detection algorithms, which identify objects of interest in an image. Consequently, thanks to salient-object detection, complex visual computing operations can focus on the important parts of the visual data and can save time and resources. About the speaker Dr. Gokhan Yildirim is a research assistant in the School of Computer and Communication Sciences (IC) at the École Polytechnique Fédérale de Lausanne (EPFL). His research interests include image understanding, multimedia, pattern recognition, machine learning, salient-object detection on images & videos and its applications on image proces...

  18. Processed foods: contributions to nutrition.

    Science.gov (United States)

    Weaver, Connie M; Dwyer, Johanna; Fulgoni, Victor L; King, Janet C; Leveille, Gilbert A; MacDonald, Ruth S; Ordovas, Jose; Schnakenberg, David

    2014-06-01

    Both fresh and processed foods make up vital parts of the food supply. Processed food contributes to both food security (ensuring that sufficient food is available) and nutrition security (ensuring that food quality meets human nutrient needs). This ASN scientific statement focuses on one aspect of processed foods: their nutritional impacts. Specifically, this scientific statement 1) provides an introduction to how processed foods contribute to the health of populations, 2) analyzes the contribution of processed foods to "nutrients to encourage" and "constituents to limit" in the American diet as recommended by the Dietary Guidelines for Americans, 3) identifies the responsibilities of various stakeholders in improving the American diet, and 4) reviews emerging technologies and the research needed for a better understanding of the role of processed foods in a healthy diet. Analyses of the NHANES 2003-2008 show that processed foods provide both nutrients to encourage and constituents to limit as specified in the 2010 Dietary Guidelines for Americans. Of the nutrients to encourage, processed foods contributed 55% of dietary fiber, 48% of calcium, 43% of potassium, 34% of vitamin D, 64% of iron, 65% of folate, and 46% of vitamin B-12. Of the constituents to limit, processed foods contributed 57% of energy, 52% of saturated fat, 75% of added sugars, and 57% of sodium. Diets are more likely to meet food guidance recommendations if nutrient-dense foods, either processed or not, are selected. Nutrition and food science professionals, the food industry, and other stakeholders can help to improve the diets of Americans by providing a nutritious food supply that is safe, enjoyable, affordable, and sustainable by communicating effectively and accurately with each other and by working together to improve the overall knowledge of consumers. © 2014 American Society for Nutrition.

  19. Global patterns and determinants of the economic importance of bushmeat

    DEFF Research Database (Denmark)

    Nielsen, Martin Reinhardt; Pouliot, Mariéve; Meilby, Henrik

    2017-01-01

    to analyse the economic importance of bushmeat to rural households in sites selected with no consideration of the level of bushmeat hunting. Data were gathered from 7978 households in 333 communities across 24 tropical and sub-tropical countries in Latin America, Asia, and Sub-Saharan Africa. We report......, focusing on six general hypothesis identified from the literature. Hunting is more prevalent than generally assumed (39%) but contributes less to rural household income than expected (2%) and mainly through own consumption (87%). Bushmeat is more important in smaller and more remote communities......, in communities in the middle of the cash income distribution, communities with few domestic animals, in countries characterised by poor governance, and with rising costs of living. We argue that bushmeat is likely to be most important to rural households as a source of protein and micronutrients unavailable...

  20. ECOPHARMACOVIGILANCE: ITS IMPORTANCE AND CHALLENGES

    OpenAIRE

    Dr. Bhavana Srivastava

    2014-01-01

    Active pharmaceutical ingredients represent a group of emerging environmental contamination. Even in trace amounts, they are of great concern due to then continuous introduction into the environment, their impact an ecosystem and human and vetenery health is of great importance. This has given birth to the science of Ecopharmacovigilance (EPV). It aims to ensure that significant environmental issues associated with pharmaceuticals in the environment are identified and managed appropriately. ...

  1. Genes contributing to prion pathogenesis

    DEFF Research Database (Denmark)

    Tamgüney, Gültekin; Giles, Kurt; Glidden, David V

    2008-01-01

    incubation times, indicating that the conversion reaction may be influenced by other gene products. To identify genes that contribute to prion pathogenesis, we analysed incubation times of prions in mice in which the gene product was inactivated, knocked out or overexpressed. We tested 20 candidate genes...... show that many genes previously implicated in prion replication have no discernible effect on the pathogenesis of prion disease. While most genes tested did not significantly affect survival times, ablation of the amyloid beta (A4) precursor protein (App) or interleukin-1 receptor, type I (Il1r1...

  2. The importance of coughs

    African Journals Online (AJOL)

    2012-03-14

    Mar 14, 2012 ... how important it can be. It is at best ... e. rise of intrathoracic pressure up to 200mm Hg., f. glottic opening and ... The differential diagnosis may be reviewed from knowledge .... cigarette smoking is an important example. 3.

  3. Computerized Clinical Decision Support: Contributions from 2015

    Science.gov (United States)

    Bouaud, J.

    2016-01-01

    Summary Objective To summarize recent research and select the best papers published in 2015 in the field of computerized clinical decision support for the Decision Support section of the IMIA yearbook. Method A literature review was performed by searching two bibliographic databases for papers related to clinical decision support systems (CDSSs) and computerized provider order entry (CPOE) systems. The aim was to identify a list of candidate best papers from the retrieved papers that were then peer-reviewed by external reviewers. A consensus meeting between the two section editors and the IMIA editorial team was finally conducted to conclude in the best paper selection. Results Among the 974 retrieved papers, the entire review process resulted in the selection of four best papers. One paper reports on a CDSS routinely applied in pediatrics for more than 10 years, relying on adaptations of the Arden Syntax. Another paper assessed the acceptability and feasibility of an important CPOE evaluation tool in hospitals outside the US where it was developed. The third paper is a systematic, qualitative review, concerning usability flaws of medication-related alerting functions, providing an important evidence-based, methodological contribution in the domain of CDSS design and development in general. Lastly, the fourth paper describes a study quantifying the effect of a complex, continuous-care, guideline-based CDSS on the correctness and completeness of clinicians’ decisions. Conclusions While there are notable examples of routinely used decision support systems, this 2015 review on CDSSs and CPOE systems still shows that, despite methodological contributions, theoretical frameworks, and prototype developments, these technologies are not yet widely spread (at least with their full functionalities) in routine clinical practice. Further research, testing, evaluation, and training are still needed for these tools to be adopted in clinical practice and, ultimately, illustrate

  4. Hidden chromosomal abnormalities in pleuropulmonary blastomas identified by multiplex FISH

    International Nuclear Information System (INIS)

    Quilichini, Benoit; Andre, Nicolas; Bouvier, Corinne; Chrestian, Marie-Anne; Rome, Angelique; Intagliata, Dominique; Coze, Carole; Lena, Gabriel; Zattara, Helene

    2006-01-01

    Pleuropulmonary blastoma (PPB) is a rare childhood dysontogenetic intrathoracic neoplasm associated with an unfavourable clinical behaviour. We report pathological and cytogenetic findings in two cases of PPB at initial diagnosis and recurrence. Both tumors were classified as type III pneumoblastoma and histological findings were similar at diagnosis and relapse. In both cases, conventional cytogenetic techniques revealed complex numerical and structural chromosomal abnormalities. Molecular cytogenetic analysis (interphase/metaphase FISH and multicolor FISH) identified accurately chromosomal aberrations. In one case, TP53 gene deletion was detected on metaphase FISH. To date, only few cytogenetic data have been published about PPB. The PPB genetic profile remains to be established and compared to others embryonal neoplasia. Our cytogenetic data are discussed reviewing cytogenetics PPBs published cases, illustrating the contribution of multicolor FISH in order to identify pathogenetically important recurrent aberrations in PPB

  5. List identifies threatened ecosystems

    Science.gov (United States)

    Showstack, Randy

    2012-09-01

    The International Union for Conservation of Nature (IUCN) announced on 9 September that it will develop a new Red List of Ecosystems that will identify which ecosystems are vulnerable or endangered. The list, which is modeled on the group's Red List of Threatened Species™, could help to guide conservation activities and influence policy processes such as the Convention on Biological Diversity, according to the group. “We will assess the status of marine, terrestrial, freshwater, and subterranean ecosystems at local, regional, and global levels,” stated Jon Paul Rodriguez, leader of IUCN's Ecosystems Red List Thematic Group. “The assessment can then form the basis for concerted implementation action so that we can manage them sustainably if their risk of collapse is low or restore them if they are threatened and then monitor their recovery.”

  6. Global Microbial Identifier

    DEFF Research Database (Denmark)

    Wielinga, Peter; Hendriksen, Rene S.; Aarestrup, Frank Møller

    2017-01-01

    ) will likely also enable a much better understanding of the pathogenesis of the infection and the molecular basis of the host response to infection. But the full potential of these advances will only transpire if the data in this area become transferable and thereby comparable, preferably in open-source...... of microorganisms, for the identification of relevant genes and for the comparison of genomes to detect outbreaks and emerging pathogens. To harness the full potential of WGS, a shared global database of genomes linked to relevant metadata and the necessary software tools needs to be generated, hence the global...... microbial identifier (GMI) initiative. This tool will ideally be used in amongst others in the diagnosis of infectious diseases in humans and animals, in the identification of microorganisms in food and environment, and to track and trace microbial agents in all arenas globally. This will require...

  7. Congenital Heart Diseases associated with Identified Syndromes ...

    African Journals Online (AJOL)

    Recognised syndromes were seen in 69(68%) cases. Down syndrome with 54 children contributed 78.3% of those with known syndromes. Other identified syndromes and associations were Marfan's, Noonan's, Edwards, Prune Belly, Apert, Ellis-van creveld syndrome and congenital rubella syndrome. Congenital heart ...

  8. Using Persuasion Models to Identify Givers.

    Science.gov (United States)

    Ferguson, Mary Ann; And Others

    1986-01-01

    Assesses the feasibility of and suggests using W. J. McGuire's information processing theory and cognitive response analysis theory in research studies to identify "givers"--those who are likely to contribute money and resources to charities or volunteer to aid philanthropic organizations. (SRT)

  9. Panel acoustic contribution analysis.

    Science.gov (United States)

    Wu, Sean F; Natarajan, Logesh Kumar

    2013-02-01

    Formulations are derived to analyze the relative panel acoustic contributions of a vibrating structure. The essence of this analysis is to correlate the acoustic power flow from each panel to the radiated acoustic pressure at any field point. The acoustic power is obtained by integrating the normal component of the surface acoustic intensity, which is the product of the surface acoustic pressure and normal surface velocity reconstructed by using the Helmholtz equation least squares based nearfield acoustical holography, over each panel. The significance of this methodology is that it enables one to analyze and rank relative acoustic contributions of individual panels of a complex vibrating structure to acoustic radiation anywhere in the field based on a single set of the acoustic pressures measured in the near field. Moreover, this approach is valid for both interior and exterior regions. Examples of using this method to analyze and rank the relative acoustic contributions of a scaled vehicle cabin are demonstrated.

  10. Optimising import phytosanitary inspection

    NARCIS (Netherlands)

    Surkov, I.

    2007-01-01

    Keywords: quarantine pest, plant health policy, optimization, import phytosanitary inspection, ‘reduced checks’, optimal allocation of resources, multinomial logistic regression, the Netherlands World trade is a major vector of spread of quarantine plant pests. Border phytosanitary inspection

  11. Denaturalizing the technique: feminists contributions to think the cinematography

    Directory of Open Access Journals (Sweden)

    Marina Cavalcanti Tedesco

    2014-07-01

    Full Text Available Cinematography is generally understood as a technological area, which means neutral for many people. This may account for not deserving the due attention into the cinema and the audiovisual studies. However, as any technique, it was developed starting from some hypotheses to reach specific objectives. In this study, we aim to analyze it with a feministic perspective to identify the gender views that contributed to its expression, which were influenced by it. We ́ll do that by the sudy of some cinematographic manuals edited since the years 1930, comparing their guidelines with some important classic/industrial Mexican films.

  12. DIA-datasnooping and identifiability

    Science.gov (United States)

    Zaminpardaz, S.; Teunissen, P. J. G.

    2018-04-01

    In this contribution, we present and analyze datasnooping in the context of the DIA method. As the DIA method for the detection, identification and adaptation of mismodelling errors is concerned with estimation and testing, it is the combination of both that needs to be considered. This combination is rigorously captured by the DIA estimator. We discuss and analyze the DIA-datasnooping decision probabilities and the construction of the corresponding partitioning of misclosure space. We also investigate the circumstances under which two or more hypotheses are nonseparable in the identification step. By means of a theorem on the equivalence between the nonseparability of hypotheses and the inestimability of parameters, we demonstrate that one can forget about adapting the parameter vector for hypotheses that are nonseparable. However, as this concerns the complete vector and not necessarily functions of it, we also show that parameter functions may exist for which adaptation is still possible. It is shown how this adaptation looks like and how it changes the structure of the DIA estimator. To demonstrate the performance of the various elements of DIA-datasnooping, we apply the theory to some selected examples. We analyze how geometry changes in the measurement setup affect the testing procedure, by studying their partitioning of misclosure space, the decision probabilities and the minimal detectable and identifiable biases. The difference between these two minimal biases is highlighted by showing the difference between their corresponding contributing factors. We also show that if two alternative hypotheses, say Hi and Hj , are nonseparable, the testing procedure may have different levels of sensitivity to Hi -biases compared to the same Hj -biases.

  13. Import, Offshoring and Wages

    DEFF Research Database (Denmark)

    Fosse, Henrik Barslund; Maitra, Madhura

    Offshoring firms are found to pay higher average wages than purely domestic firms. We provide a unifying empirical approach by capturing the different channels through which offshoring may explain this wage difference: (i) due to change in the composition of workers (skill composition effect) (ii......) because all existing workers get higher pay (rent sharing effect). Using Danish worker-firm data we explain how much each channel contributes to higher wages. To estimate the causal effect of offshoring on wages we use China’s accession to the WTO in December 2001 - and the soon after boom in Chinese...

  14. Radiograph identifying means

    International Nuclear Information System (INIS)

    Sheldon, A.D.

    1983-01-01

    A flexible character-indentable plastics embossing tape is backed by and bonded to a lead strip, not more than 0.025 inches thick, to form a tape suitable for identifying radiographs. The lead strip is itself backed by a relatively thin and flimsy plastics or fabric strip which, when removed, allows the lead plastic tape to be pressure-bonded to the surface to be radiographed. A conventional tape-embossing gun is used to indent the desired characters in succession into the lead-backed tape, without necessarily severing the lead; and then the backing strip is peeled away to expose the layer of adhesive which pressure-bonds the indented tape to the object to be radiographed. X-rays incident on the embossed tape will cause the raised characters to show up dark on the subsequently-developed film, whilst the raised side areas will show up white. Each character will thus stand out on the developed film. (author)

  15. Fisher's Contributions to Statistics

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 2; Issue 9. Fisher's Contributions to Statistics. T Krishnan. General Article Volume 2 Issue 9 September 1997 pp 32-37. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/002/09/0032-0037. Author Affiliations.

  16. Newton's Contributions to Optics

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 11; Issue 12. Newton's Contributions to Optics. Arvind Kumar. General Article Volume 11 Issue 12 December 2006 pp 10-20. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/011/12/0010-0020. Keywords.

  17. The contribution of epidemiology

    NARCIS (Netherlands)

    Brandt, P. van den; Voorrips, L.; Hertz-Picciotto, I.; Shuker, D.; Boeing, H.; Speijers, G.; Guittard, C.; Kleiner, J.; Knowles, M.; Wolk, A.; Goldbohm, A.

    2002-01-01

    Epidemiologic studies directly contribute data on risk (or benefit) in humans as the investigated species, and in the full food intake range normally encountered by humans. This paper starts with introducing the epidemiologic approach, followed by a discussion of perceived differences between

  18. ECONOMIC AND SOCIAL IMPORTANCE OF TOURISM

    Directory of Open Access Journals (Sweden)

    Ștefan-Dragoș CÎRSTEA

    2015-11-01

    Full Text Available Tourism is a sector with a significant share in the economies of many countries. There are nations whose GDP consists of 40% of the total contribution of tourism to this indicator. One such segment requires permanent research of its economic, social and sustainability dimensions and their importance. This study outlines an overview of the main aspects related to economic and social importance of tourism and how tourism relates to the concept of sustainable development. The total contribution and the direct contribution of tourism to GDP are elements studied within this research. It is also studied the direct contribution of tourism to employment, and the main positive and negative effects of tourism on social life.

  19. Identifi cation of Sectarianism

    Directory of Open Access Journals (Sweden)

    Martinovich Vladimir

    2016-03-01

    Full Text Available «New religious movements and society» is traditionally one of the most sophisticated topics in the area of new religions studies. Its problem field is so huge that up to now by far not all important research themes where even touched by scientists from all over the world. The problem of the process of the identification of sectarianism by diff erent societal institutions is one of such untouched themes that is taken as the main subject of this article. This process by itself is an inseparable part of the every societal deliberate reaction to the very existence of unconventional religiosity, its unstructured and mainly structured types. The focal point of the article is step-by-step analysis of the general structure elements of the process of the identification of sectarianism without any reference to the specific time and place of its flow. Special attention is paid to the analysis of the subjects of the identification of sectarianism, to the criteria for religious groups to be qualified as new religious movements, and to the specific features of the process of documents filtration. The causes of selective perception of sectarianism are disclosed. Some main consequences and unpredictable outcomes of the process of the identification of sectarianism are described.

  20. Optimal coal import strategy

    International Nuclear Information System (INIS)

    Chen, C.Y.; Shih, L.H.

    1992-01-01

    Recently, the main power company in Taiwan has shifted the primary energy resource from oil to coal and tried to diversify the coal supply from various sources. The company wants to have the imported coal meet the environmental standards and operation requirements as well as to have high heating value. In order to achieve these objectives, establishment of a coal blending system for Taiwan is necessary. A mathematical model using mixed integer programming technique is used to model the import strategy and the blending system. 6 refs., 1 tab

  1. Abstracts of contributed papers

    Energy Technology Data Exchange (ETDEWEB)

    1994-08-01

    This volume contains 571 abstracts of contributed papers to be presented during the Twelfth US National Congress of Applied Mechanics. Abstracts are arranged in the order in which they fall in the program -- the main sessions are listed chronologically in the Table of Contents. The Author Index is in alphabetical order and lists each paper number (matching the schedule in the Final Program) with its corresponding page number in the book.

  2. Contributions to statistics

    CERN Document Server

    Mahalanobis, P C

    1965-01-01

    Contributions to Statistics focuses on the processes, methodologies, and approaches involved in statistics. The book is presented to Professor P. C. Mahalanobis on the occasion of his 70th birthday. The selection first offers information on the recovery of ancillary information and combinatorial properties of partially balanced designs and association schemes. Discussions focus on combinatorial applications of the algebra of association matrices, sample size analogy, association matrices and the algebra of association schemes, and conceptual statistical experiments. The book then examines latt

  3. Identifying Topics in Microblogs Using Wikipedia.

    Directory of Open Access Journals (Sweden)

    Ahmet Yıldırım

    Full Text Available Twitter is an extremely high volume platform for user generated contributions regarding any topic. The wealth of content created at real-time in massive quantities calls for automated approaches to identify the topics of the contributions. Such topics can be utilized in numerous ways, such as public opinion mining, marketing, entertainment, and disaster management. Towards this end, approaches to relate single or partial posts to knowledge base items have been proposed. However, in microblogging systems like Twitter, topics emerge from the culmination of a large number of contributions. Therefore, identifying topics based on collections of posts, where individual posts contribute to some aspect of the greater topic is necessary. Models, such as Latent Dirichlet Allocation (LDA, propose algorithms for relating collections of posts to sets of keywords that represent underlying topics. In these approaches, figuring out what the specific topic(s the keyword sets represent remains as a separate task. Another issue in topic detection is the scope, which is often limited to specific domain, such as health. This work proposes an approach for identifying domain-independent specific topics related to sets of posts. In this approach, individual posts are processed and then aggregated to identify key tokens, which are then mapped to specific topics. Wikipedia article titles are selected to represent topics, since they are up to date, user-generated, sophisticated articles that span topics of human interest. This paper describes the proposed approach, a prototype implementation, and a case study based on data gathered during the heavily contributed periods corresponding to the four US election debates in 2012. The manually evaluated results (0.96 precision and other observations from the study are discussed in detail.

  4. Identifying Topics in Microblogs Using Wikipedia.

    Science.gov (United States)

    Yıldırım, Ahmet; Üsküdarlı, Suzan; Özgür, Arzucan

    2016-01-01

    Twitter is an extremely high volume platform for user generated contributions regarding any topic. The wealth of content created at real-time in massive quantities calls for automated approaches to identify the topics of the contributions. Such topics can be utilized in numerous ways, such as public opinion mining, marketing, entertainment, and disaster management. Towards this end, approaches to relate single or partial posts to knowledge base items have been proposed. However, in microblogging systems like Twitter, topics emerge from the culmination of a large number of contributions. Therefore, identifying topics based on collections of posts, where individual posts contribute to some aspect of the greater topic is necessary. Models, such as Latent Dirichlet Allocation (LDA), propose algorithms for relating collections of posts to sets of keywords that represent underlying topics. In these approaches, figuring out what the specific topic(s) the keyword sets represent remains as a separate task. Another issue in topic detection is the scope, which is often limited to specific domain, such as health. This work proposes an approach for identifying domain-independent specific topics related to sets of posts. In this approach, individual posts are processed and then aggregated to identify key tokens, which are then mapped to specific topics. Wikipedia article titles are selected to represent topics, since they are up to date, user-generated, sophisticated articles that span topics of human interest. This paper describes the proposed approach, a prototype implementation, and a case study based on data gathered during the heavily contributed periods corresponding to the four US election debates in 2012. The manually evaluated results (0.96 precision) and other observations from the study are discussed in detail.

  5. Formalized Search Strategies for Human Risk Contributions

    DEFF Research Database (Denmark)

    Rasmussen, Jens; Pedersen, O. M.

    For risk management, the results of a probabilistic risk analysis (PRA) as well as the underlying assumptions can be used as references in a closed-loop risk control; and the analyses of operational experiences as a means of feedback. In this context, the need for explicit definition...... risk contributions are described on the basis of general plant design features relevant for risk and accident analysis. With this background, search strategies for human risk contributions are treated: Under the designation "work analysis", procedures for the analysis of familiar, well trained, planned...... tasks are proposed. Strategies for identifying human risk contributions outside this category are outlined....

  6. [Diagnosing imported helminthiasis].

    Science.gov (United States)

    Pardo, Javier; Pérez-Arellano, José Luis; Galindo, Inmaculada; Belhassen, Moncef; Cordero, Miguel; Muro, Antonio

    2007-05-01

    In recent years, there has been an increase in cases of imported helminthiasis in Spain because of two complementary causes: immigration and international travel. Although the prevalence of helminthiasis is high in the immigrant population, the risk of transmission to the Spanish population is low. In this review, we provide clues to aid in the diagnosis of the helminthiasis, highlighting the geographic characteristics, clinical findings and analytical results of the most frequent types. The low sensitivity of the classic parasitological diagnostic test, mainly in tissue helminthiasis, is described. In addition, the advantages and limitations of the common serological methods for detecting related circulating antigens and antibodies are presented. Certain molecular methods used in the diagnosis of imported helminthiasis and the best strategies for screening of this condition are discussed.

  7. Impacts of removing fuel import subsidies in Nigeria on poverty

    International Nuclear Information System (INIS)

    Siddig, Khalid; Aguiar, Angel; Grethe, Harald; Minor, Peter; Walmsley, Terrie

    2014-01-01

    The petroleum sector contributes substantially to the Nigerian economy; however, the potential benefits are diminished due to the existence of significant subsidies on imports of petroleum products. Subsidies on imported petroleum products are considered to be an important instrument for keeping fuel prices, and hence the cost of living, low. The costs of these subsidies, however, has risen dramatically in recent years due to increased volatility in world petroleum and petroleum product prices and increased illegal exportation of subsidized petroleum products into neighboring countries. Removing the subsidy on fuel is one of the most contentious socio-economic policy issues in Nigeria today. In this paper, an economy-wide framework is used to identify the impact of removing the fuel subsidy on the Nigerian economy and investigates how alternative policies might be used to meet socio-economic objectives related to fuel subsidies. The results show that while a reduction in the subsidy generally results in an increase in Nigerian GDP, it can have a detrimental impact on household income, and in particular on poor households. Accompanying the subsidy reduction with income transfers aimed at poor households or domestic production of petroleum products can alleviate the negative impacts on household income. - Highlights: • Subsidies on imported fuel compromise the contribution of crude oil in Nigeria. • Fuel subsidies benefit households, but harm the economy. • We use an economy-wide model to identify the impact of removing the fuel subsidy. • We simulate scenarios that target the poor and promote fuel's domestic production

  8. Knowledge Contribution in Knowledge Networks: Effects of Participants’ Central Positions on Contribution Quality

    NARCIS (Netherlands)

    Sedighi, M.; Hamedi, Mohsen

    2016-01-01

    Knowledge networks play a crucial role in contemporary organisations to improve participation for knowledge sharing. Examining employees’ knowledge contribution play an important role for in success implementing knowledgenetworks. Whereas most part of studies emphasis on the quantity aspect of

  9. How sonochemistry contributes to green chemistry?

    Science.gov (United States)

    Chatel, Gregory

    2018-01-01

    Based on the analyses of papers from the literature, and especially those published in Ultrasonics Sonochemistry journal, the contribution of sonochemistry to green chemistry area has been discussed here. Important reminders and insights on the good practices and considerations have been made to understand and demonstrate how sonochemistry can continue to efficiently contribute to green chemistry area in the further studies. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Factors contributing to adolescent obesity.

    Science.gov (United States)

    Al-Kloub, Manal I; Froelicher, Erika S

    2009-06-01

    Obesity in children is a significant public health concern. The prevalence of overweight and obesity in Jordanian children, and adolescents has increased in the last decade. The consequences of obesity to health in childhood and adulthood have both medical, and economic cost to individuals and society. This paper reviews the factors that contribute to adolescent obesity and emphasizes behavioral and environmental factors. An individual's behaviors such as increased consumption of high caloric foods, increased sedentary activity while decreasing physical activity has been identified as key issues in the development of obesity. Additionally, the current environment in homes, schools, and neighborhoods tend to discourage a healthy lifestyle. A comprehensive approach that involves the whole community is the best strategy for preventing adolescent obesity. Nurses are in a unique position to provide leadership in developing programs for healthier lifestyle choices for adolescents' and adoption of these goals into their daily lives.

  11. Risk communication importance

    Energy Technology Data Exchange (ETDEWEB)

    Cunha, Raquel Dalledone Siqueira da; Andrade, Delvonei Alves de, E-mail: raqueldalledonesiqueira@gmail.com, E-mail: delvonei@ipen.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)

    2013-07-01

    Risk Communication has shown its importance in the elaboration of emergency plans in the Chemical industry. In the 90's, the UNEP developed the APELL (Awareness and Preparedness for Emergency at Local Level) plan, a risk management methodology used by dangerous chemical facilities. The methodology comprises the commitment of both Government and the community located in the risk area in the development of the emergency plan. In the nuclear sector, there is no similar methodology developed so far. However, establishing a communication channel between the nuclear segment and the community is essential. In Brazil, the construction of Angra 3 and the RMB (Multi Purpose Reactor) project stand as nuclear initiatives that improve the importance of a good communication to the public. Security issues of these projects are natural sources of concernment to the public, which is aggravated by events such as the Fukushima disaster. Without an effective communication about what means the presence of nuclear plants and reactors in a specific area, the interested public will only have an alarmist vision of the subject, given by those against these facilities. (author)

  12. Risk communication importance

    International Nuclear Information System (INIS)

    Cunha, Raquel Dalledone Siqueira da; Andrade, Delvonei Alves de

    2013-01-01

    Risk Communication has shown its importance in the elaboration of emergency plans in the Chemical industry. In the 90's, the UNEP developed the APELL (Awareness and Preparedness for Emergency at Local Level) plan, a risk management methodology used by dangerous chemical facilities. The methodology comprises the commitment of both Government and the community located in the risk area in the development of the emergency plan. In the nuclear sector, there is no similar methodology developed so far. However, establishing a communication channel between the nuclear segment and the community is essential. In Brazil, the construction of Angra 3 and the RMB (Multi Purpose Reactor) project stand as nuclear initiatives that improve the importance of a good communication to the public. Security issues of these projects are natural sources of concernment to the public, which is aggravated by events such as the Fukushima disaster. Without an effective communication about what means the presence of nuclear plants and reactors in a specific area, the interested public will only have an alarmist vision of the subject, given by those against these facilities. (author)

  13. SPARQL-enabled identifier conversion with Identifiers.org

    Science.gov (United States)

    Wimalaratne, Sarala M.; Bolleman, Jerven; Juty, Nick; Katayama, Toshiaki; Dumontier, Michel; Redaschi, Nicole; Le Novère, Nicolas; Hermjakob, Henning; Laibe, Camille

    2015-01-01

    Motivation: On the semantic web, in life sciences in particular, data is often distributed via multiple resources. Each of these sources is likely to use their own International Resource Identifier for conceptually the same resource or database record. The lack of correspondence between identifiers introduces a barrier when executing federated SPARQL queries across life science data. Results: We introduce a novel SPARQL-based service to enable on-the-fly integration of life science data. This service uses the identifier patterns defined in the Identifiers.org Registry to generate a plurality of identifier variants, which can then be used to match source identifiers with target identifiers. We demonstrate the utility of this identifier integration approach by answering queries across major producers of life science Linked Data. Availability and implementation: The SPARQL-based identifier conversion service is available without restriction at http://identifiers.org/services/sparql. Contact: sarala@ebi.ac.uk PMID:25638809

  14. SPARQL-enabled identifier conversion with Identifiers.org.

    Science.gov (United States)

    Wimalaratne, Sarala M; Bolleman, Jerven; Juty, Nick; Katayama, Toshiaki; Dumontier, Michel; Redaschi, Nicole; Le Novère, Nicolas; Hermjakob, Henning; Laibe, Camille

    2015-06-01

    On the semantic web, in life sciences in particular, data is often distributed via multiple resources. Each of these sources is likely to use their own International Resource Identifier for conceptually the same resource or database record. The lack of correspondence between identifiers introduces a barrier when executing federated SPARQL queries across life science data. We introduce a novel SPARQL-based service to enable on-the-fly integration of life science data. This service uses the identifier patterns defined in the Identifiers.org Registry to generate a plurality of identifier variants, which can then be used to match source identifiers with target identifiers. We demonstrate the utility of this identifier integration approach by answering queries across major producers of life science Linked Data. The SPARQL-based identifier conversion service is available without restriction at http://identifiers.org/services/sparql. © The Author 2015. Published by Oxford University Press.

  15. The Contribution of Advocacy NGOs in Governance through Cultivating of a Participatory Culture: Case Studies in Hong Kong

    Science.gov (United States)

    Leung, Yui Kei; Leung, Yan Wing; Yuen, Timothy Wai Wa

    2016-01-01

    A vibrant civil society, composed of active non-governmental organizations (NGOs), has always been identified as an important factor for "good governance". This paper reports a pilot study using semi-structured interviews to find out the contribution of advocacy NGOs in the governance of Hong Kong. It points out that the NGO's conception…

  16. Most important human aluminoses

    Energy Technology Data Exchange (ETDEWEB)

    Avtsyn, A P

    1986-01-01

    Aluminoses are widespread forms of trace element deficiency of various severity. The organism is protected against a possible pathogenic influence of aluminum by a number of physiological mechanisms the most important among which is a regular urine excretion. A complex of pathological symptoms develops if serious homeostasis disturbances take place e. g. when renal deficiency or direct penetration of the trace element occur. The following forms of aluminosis should be distinguished: 1) simple accumulation in central nervous system which occurs in persons over 65 years; 2) aluminum accumulation in Alzheimer disease, in severe form of presenile and senile dementia; 3) dialysis aluminum encephalopathy; 4) non-dialysis infantile encephalopathy; 5) aluminum encephalopathy in total parenteral nutrition; 6) iatrogenic dialysis aluminum osteodystrophy; 7) jatrogenic peritoneal aluminosis; 8) aluminum pneumoconiosis of an occupational origin; 9) bronchospastic syndrome in aluminum smelter workers.

  17. Mexico: Imports or exports?

    International Nuclear Information System (INIS)

    Estrada, J.

    2002-01-01

    This presentation provides an overview of Mexico's energy sector. Proven oil reserves place Mexico in ninth position in the world and fourth largest in natural gas reserves. Energy is one of the most important economic activities of the country, representing 3 per cent of Gross Domestic Product (GDP). Oil exports represent 8.4 per cent of total exports. Approximately 40 per cent of total public investment is earmarked for energy projects. The author discusses energy resources and energy sector limitations. The energy sector plan for the period 2001-2006 is discussed. Its goals are to ensure energy supply, to develop the energy sector, to stimulate participation of Mexican enterprises, to promote renewable energy sources, and to strengthen international energy cooperation. The regulatory framework is being adapted to increase private investment. Some graphs are presented, displaying the primary energy production and primary energy consumption. Energy sector reforms are reviewed, as are electricity and natural gas reforms. The energy sector demand for 2000-2010 and investment requirements are reviewed, as well as fuel consumption for power generation. The author discusses the National Pipeline System (SNG) and the bottlenecks caused by pressure efficiency in the northeast, flow restriction on several pipeline segments, variability of the Petroleos Mexicanos (PEMEX) own use, and pressure drop on central regions. The entire prospect for natural gas in the country is reviewed, along with the Strategic Gas Program (PEG) consisting of 20 projects, including 4 non-associated natural gas, 9 exploration and 7 optimization. A section dealing with multiple service contracts is included in the presentation. The authors conclude by stating that the priority is a national energy policy to address Mexico's energy security requirements, to increase natural gas production while promoting the diversification of imports, and a regulatory framework to be updated in light of current

  18. Defined contribution health benefits.

    Science.gov (United States)

    Fronstin, P

    2001-03-01

    This Issue Brief discusses the emerging issue of "defined contribution" (DC) health benefits. The term "defined contribution" is used to describe a wide variety of approaches to the provision of health benefits, all of which have in common a shift in the responsibility for payment and selection of health care services from employers to employees. DC health benefits often are mentioned in the context of enabling employers to control their outlay for health benefits by avoiding increases in health care costs. DC health benefits may also shift responsibility for choosing a health plan and the associated risks of choosing a plan from employers to employees. There are three primary reasons why some employers currently are considering some sort of DC approach. First, they are once again looking for ways to keep their health care cost increases in line with overall inflation. Second, some employers are concerned that the public "backlash" against managed care will result in new legislation, regulations, and litigation that will further increase their health care costs if they do not distance themselves from health care decisions. Third, employers have modified not only most employee benefit plans, but labor market practices in general, by giving workers more choice, control, and flexibility. DC-type health benefits have existed as cafeteria plans since the 1980s. A cafeteria plan gives each employee the opportunity to determine the allocation of his or her total compensation (within employer-defined limits) among various employee benefits (primarily retirement or health). Most types of DC health benefits currently being discussed could be provided within the existing employment-based health insurance system, with or without the use of cafeteria plans. They could also allow employees to purchase health insurance directly from insurers, or they could drive new technologies and new forms of risk pooling through which health care services are provided and financed. DC health

  19. Contribution of systematic reviews to management decisions.

    Science.gov (United States)

    Cook, Carly N; Possingham, Hugh P; Fuller, Richard A

    2013-10-01

    Systematic reviews comprehensively summarize evidence about the effectiveness of conservation interventions. We investigated the contribution to management decisions made by this growing body of literature. We identified 43 systematic reviews of conservation evidence, 23 of which drew some concrete conclusions relevant to management. Most reviews addressed conservation interventions relevant to policy decisions; only 35% considered practical on-the-ground management interventions. The majority of reviews covered only a small fraction of the geographic and taxonomic breadth they aimed to address (median = 13% of relevant countries and 16% of relevant taxa). The likelihood that reviews contained at least some implications for management tended to increase as geographic coverage increased and to decline as taxonomic breadth increased. These results suggest the breadth of a systematic review requires careful consideration. Reviews identified a mean of 312 relevant primary studies but excluded 88% of these because of deficiencies in design or a failure to meet other inclusion criteria. Reviews summarized on average 284 data sets and 112 years of research activity, yet the likelihood that their results had at least some implications for management did not increase as the amount of primary research summarized increased. In some cases, conclusions were elusive despite the inclusion of hundreds of data sets and years of cumulative research activity. Systematic reviews are an important part of the conservation decision making tool kit, although we believe the benefits of systematic reviews could be significantly enhanced by increasing the number of reviews focused on questions of direct relevance to on-the-ground managers; defining a more focused geographic and taxonomic breadth that better reflects available data; including a broader range of evidence types; and appraising the cost-effectiveness of interventions. © 2013 The Authors. Conservation Biology published by Wiley

  20. Contributions to In Silico Genome Annotation

    KAUST Repository

    Kalkatawi, Manal M.

    2017-11-30

    Genome annotation is an important topic since it provides information for the foundation of downstream genomic and biological research. It is considered as a way of summarizing part of existing knowledge about the genomic characteristics of an organism. Annotating different regions of a genome sequence is known as structural annotation, while identifying functions of these regions is considered as a functional annotation. In silico approaches can facilitate both tasks that otherwise would be difficult and timeconsuming. This study contributes to genome annotation by introducing several novel bioinformatics methods, some based on machine learning (ML) approaches. First, we present Dragon PolyA Spotter (DPS), a method for accurate identification of the polyadenylation signals (PAS) within human genomic DNA sequences. For this, we derived a novel feature-set able to characterize properties of the genomic region surrounding the PAS, enabling development of high accuracy optimized ML predictive models. DPS considerably outperformed the state-of-the-art results. The second contribution concerns developing generic models for structural annotation, i.e., the recognition of different genomic signals and regions (GSR) within eukaryotic DNA. We developed DeepGSR, a systematic framework that facilitates generating ML models to predict GSR with high accuracy. To the best of our knowledge, no available generic and automated method exists for such task that could facilitate the studies of newly sequenced organisms. The prediction module of DeepGSR uses deep learning algorithms to derive highly abstract features that depend mainly on proper data representation and hyperparameters calibration. DeepGSR, which was evaluated on recognition of PAS and translation initiation sites (TIS) in different organisms, yields a simpler and more precise representation of the problem under study, compared to some other hand-tailored models, while producing high accuracy prediction results. Finally

  1. Contributing to Functionality

    DEFF Research Database (Denmark)

    Törpel, Bettina

    2006-01-01

    The objective of this paper is the design of computer supported joint action spaces. It is argued against a view of functionality as residing in computer applications. In such a view the creation of functionality is equivalent to the creation of computer applications. Functionality, in the view...... advocated in this paper, emerges in the specific dynamic interplay of actors, objectives, structures, practices and means. In this view, functionality is the result of creating, harnessing and inhabiting computer supported joint action spaces. The successful creation and further development of a computer...... supported joint action space comprises a whole range of appropriate design contributions. The approach is illustrated by the example of the creation of the computer supported joint action space "exchange network of voluntary union educators". As part of the effort a group of participants created...

  2. Contributing from the margins

    DEFF Research Database (Denmark)

    Chimirri, Niklas Alexander

    empirical study, I focused on kindergarten children’s first-person perspectives on the electronic media technologies they deemed subjectively relevant for conducting everyday life in the practice of their kindergarten. The concept of the children’s perspectives opens possibilities for transcending...... of the practice researcher when engaging with her/his potential co-researchers and the investigated, socio-materially mediated practice. The paper will argue that making sense of first-person perspectives – here on conducting a life with media technologies – presupposes that the researcher conceptualizes him....../herself as a contributor to an investigated practice, as inextricably entangled with the conducts of life of the others in relation to the conditions in practice. Doing research in the kindergarten thus becomes a mutual and collective endeavor, to which pedagogues, parents, children, and the researcher contribute. Even...

  3. Resilience in children: the nature and the importance of the concept

    Directory of Open Access Journals (Sweden)

    Emory L. Cowen

    Full Text Available Considers the meaning of the term childhood resilience and the importance ofits place in the fields of developmental psychopathology and wellness enhancement. Reviews several major longitudinal research projects on childhood resilience that have contributed significantly to the field's emergence and presents more detailed information on the Rochester Child Resilience Project (RCRP. A final section summarizes accomplishments in resilience research to date, and identifies needed foci for future work in this area.

  4. The value contribution of strategic foresight

    DEFF Research Database (Denmark)

    Rohrbeck, René; Schwarz, Jan Oliver

    2013-01-01

    This paper focuses on exploring the potential and empirically observable value creation of strategic foresight activities in firms. We first review the literature on strategic foresight, innovation management and strategic management in order to identify the potential value contributions. We use ......, (3) influencing other actors, (4) and through an enhanced capacity for organizational learning....

  5. Imported coenurosis in sheep

    International Nuclear Information System (INIS)

    Schweizer, G.; Grünenfelder, F.; Sydler, T.; Rademacher, N.; Braun, U.; Deplazes, P.

    2006-01-01

    Thirteen sheep from a milk producing farm in the Canton of Grisons that presented chronic coenurosis were examined and subjected to treatment trials at the veterinary hospital in Zurich. Symptoms were first observed around two months after the import of two dogs from Italy (Abruzza) of which one was infected with Taenia multiceps and Echinococcus granulosus. The most frequently observed clinical symptoms of the sheep were reduced general condition, circling, reduced menace reflex, apathy, unsteady gait and head tilt. Analyses of cerebrospinal fluid revealed an increased leucocyte count in 3 sheep and eosinophilia in 4 sheep. In 4 animals that underwent computertomography, one or more hypodense, definable lesions were found in the brain. In 2 sheep surgical treatment and in 10 animals medical treatment with either Praziquantel (n=8) or Oxfendazol (n=2) was attempted. Only one animal treated with Praziquantel needed not to be euthanized. At necropsy, one or two coenurus cysts could be found either in a side ventricle (n=2), in the cerebellum (n=3) or in the cerebrum (n=7). The locations corresponded with the clinical findings. Despite Praziquantel or Oxfendazol treatment, living protoscoleces could be found in the parasite cysts [de

  6. Relative importance of professional practice and engineering management competencies

    Science.gov (United States)

    Pons, Dirk

    2016-09-01

    Problem: The professional practice of engineering always involves engineering management, but it is difficult to know what specifically to include in the undergraduate curriculum. Approach: The population of New Zealand practising engineers was surveyed to determine the importance they placed on specific professional practice and engineering management competencies. Findings: Results show that communication and project planning were the two most important topics, followed by others as identified. The context in which practitioners use communication skills was found to be primarily with project management, with secondary contexts identified. The necessity for engineers to develop the ability to use multiple soft skills in an integrative manner is strongly supported by the data. Originality: This paper is one of only a few large-scale surveys of practising engineers to have explored the soft skill attributes. It makes a didactic contribution of providing a ranked list of topics which can be used for designing the curriculum and prioritising teaching effort, which has not previously been achieved. It yields the new insight that combinations of topics are sometimes more important than individual topics.

  7. Satellite Contributions to Global Change Studies

    Science.gov (United States)

    Parkinson, Claire L.

    2009-01-01

    By providing a global view with a level playing field (no region missed because of unfavorable surface conditions or political boundaries), satellites have made major contributions to improved monitoring and understanding of our constantly changing planet. The global view has allowed surprising realizations like the relative sparsity of lightning strikes over oceans and the large-scale undulations on the massive Antarctic ice sheet. It has allowed the tracking of all sorts of phenomena, including aerosols, both natural and anthropogenic, as they move with the atmospheric circulation and impact weather and human health. But probably nothing that the global view allows is more important in the long term than its provision. of unbiased data sets to address the issue of global change, considered by many to be among the most important issues facing humankind today. With satellites we can monitor atmospheric temperatures at all latitudes and longitudes, and obtain a global average that lessens the likelihood of becoming endlessly mired in the confusions brought about by the certainty of regional differences. With satellites we can monitor greenhouse gases such as CO2 not just above individual research stations but around the globe. With satellites we can monitor the polar sea ice covers, as we have done since the late 1970s, determining and quantifying the significant reduction in Arctic sea ice and the slight growth in Antarctic sea ice over that period, With satellites we can map the full extent and changes in the Antarctic stratospheric ozone depletions that were first identified from using a single ground station; and through satellite data we have witnessed from afar land surface changes brought about by humans both intentionally, as with wide-scale deforestation, and unintentionally, as with the decay of the Aral Sea. The satellite data are far from sufficient for all that we need in order to understand the global system and forecast its changes, as we also need

  8. Quality Improvement in Hospitals: Identifying and Understanding Behaviors

    Directory of Open Access Journals (Sweden)

    Lukasz M. Mazur

    2012-01-01

    Full Text Available Improving operational performance in hospitals is complicated, particularly if process improvement requires complex behavioral changes. Using single-loop and double-loop learning theory as a foundation, the purpose of this research is to empirically uncover key improvement behaviors and the factors that may be associated with such behaviors in hospitals. A two-phased approach was taken to collect data regarding improvement behaviors and associated factors, and data analysis was conducted using methods proposed by grounded theorists. The contributions of this research are twofold. First, five key behaviors related to process improvement are identified, namely Quick Fixing, Initiating, Conforming, Expediting, and Enhancing. Second, based on these observed behaviors, a set of force field diagrams is developed to structure and organize possible factors that are important to consider when attempting to change improvement behaviors. This begins to fill the gap in the knowledge about what factors drive effective improvement efforts in hospital settings.

  9. Buying Imported Products Online : A quantitative study about Chinese Online consumer behavior towards imported products

    OpenAIRE

    Chen, Qianqian; Wang, Yuren

    2015-01-01

    With the fast growing Chinese online marketplace and the increasing popularity of shopping imported products online in China, more and more practitioners and researchers are interested in understanding the cues that Chinese consumers use to evaluate imported products consumption online. Our quantitative study aims to identify what factors affect the behavior of Chinese online consumers towards imported products and the relationships between the identified factors and purchase intention, and t...

  10. [Psychoanalysis: a research method based on clinical practice: contributions to nursing].

    Science.gov (United States)

    da Silva, Teresa Cristina; Kirschbaum, Débora Isane Ratner

    2008-09-01

    Nursing, in its different fields of practice, is essentially characterized as a clinical practice. In this context, psychoanalysis can make important contributions. This article discusses some basic psychoanalytical concepts and assumptions, proposes psychoanalysis as a research method, and stresses its contributions for nursing. Essential Freudian concepts are identified, as well as the path to be followed by the researcher. As a research method, psychoanalysis can be used as a framework for the studu of human behavior based on unconscious mental processes. In several knowledge areas.

  11. Identifying Emerging Trends of Financial Business Method Patents

    Directory of Open Access Journals (Sweden)

    Won Sang Lee

    2017-09-01

    Full Text Available Financial technology has become an important part of the banking industry in recent times. This study attempts to propose a framework to identify emerging areas and trends using financial business method patents. Based on the abstracts of financial business method patents registered at the United States Patent and Trademark Office, this study first applies latent Dirichlet allocation to identify emerging topics. The probability of the annual occurrence of each topic is adjusted through the exponentially weighted moving average to reflect the importance of the recent probability of topics. Each topic is classified as “hot” or “cold” depending on whether the exponentially weighted moving average of the probabilities exceeds the threshold. We applied survival analysis to the time gap of recurrently becoming hot from a cold status with the associated factor of financial business method patents. The findings suggest that the topic with the short granted period and high forward citation is likely to become hot. In addition, the topic that is aged and specific in narrow areas is likely to continuously change into the hot or cold status. The approach proposed in this study contributes toward understanding topic emergence in the financial area and pursuing sustainable development.

  12. Contribution to postnonclassical psychopathology.

    Directory of Open Access Journals (Sweden)

    Quintino-Aires J.

    2014-09-01

    Full Text Available Any psychological paradigm needs a psychopathological system that helps professionals to describe and explain the behavioral expressions that deviate from “normal” (whether this term is used with the semantic property of statistical or ideal adaptations. In this work, I seek to present the system that I have been developing since 1998 among the psychologists at the Instituto Vegotsky de Lisboa (Vygotsky Institute of Lisbon, Portugal, to understand psychopathology with regard to the vygotskian approach. It was conceived and designed according to the work of Rita Mendes Leal and her contribution to socioemotional development theory, AR Luria’s systemic and dynamic theory of the human brain, the theory of Activity (dyatel’nost of AN Leont’ev, and the psychopathological German school of E Kraepelin, presented and disseminated in Portugal in the early twentieth century by Professor Sobral Cid. It is intended to be a proposal to colleagues who are interested in postnonclassical psychology and a request for arguments.

  13. Five important advances in hematopathology.

    Science.gov (United States)

    Shi, Min; Xiao, Ruobing; Woda, Bruce A; Yu, Hongbo

    2014-03-01

    Hematopathology is a dynamic field that has always been on the frontier of clinical research within the scope of pathology. Several recent developments in hematopathology will likely affect its practice clinically. To review 5 important recent advances in hematopathology: (1) detection and prognostic implication of MYC in diffuse large B-cell lymphomas, (2) determining origin and prognosis through immunoglobulin gene usage in mature B-cell neoplasms, (3)detecting minimal residual disease in multiple myeloma, (4) using genome-wide analysis in myelodysplastic syndromes, and (5) employing whole-genome sequencing in acute myeloid leukemias. Literature review and the authors' experiences in an academic center. These advances will bring hematopathology into a new molecular era and help us to better understand the molecular, pathologic mechanisms of lymphomas, leukemias, myelomas, and myelodysplastic syndromes. They will help us to identify diagnostic and prognostic markers and eventually provide new therapeutic targets and treatments for these diseases.

  14. 27 CFR 478.92 - How must licensed manufacturers and licensed importers identify firearms, armor piercing...

    Science.gov (United States)

    2010-04-01

    ... section will be measured as the distance between the latitudinal ends of the character impression bottoms... the effective administration of this part. (Approved by the Office of Management and Budget under...

  15. Development of a framework identifying domains and elements of importance for arthritis rehabilitation

    DEFF Research Database (Denmark)

    Klokkerud, Mari; Hagen, Kåre Birger; Kjeken, Ingvild

    2012-01-01

    Rehabilitation is effective and beneficial for patients with arthritis. The lack of a common structure for describing the content of rehabilitation makes it difficult to compare, transfer and implement research evidence into clinical practice....

  16. To Identify the Important Soil Properties Affecting Dinoseb Adsorption with Statistical Analysis

    Directory of Open Access Journals (Sweden)

    Yiqing Guan

    2013-01-01

    Full Text Available Investigating the influences of soil characteristic factors on dinoseb adsorption parameter with different statistical methods would be valuable to explicitly figure out the extent of these influences. The correlation coefficients and the direct, indirect effects of soil characteristic factors on dinoseb adsorption parameter were analyzed through bivariate correlation analysis, and path analysis. With stepwise regression analysis the factors which had little influence on the adsorption parameter were excluded. Results indicate that pH and CEC had moderate relationship and lower direct effect on dinoseb adsorption parameter due to the multicollinearity with other soil factors, and organic carbon and clay contents were found to be the most significant soil factors which affect the dinoseb adsorption process. A regression is thereby set up to explore the relationship between the dinoseb adsorption parameter and the two soil factors: the soil organic carbon and clay contents. A 92% of the variation of dinoseb sorption coefficient could be attributed to the variation of the soil organic carbon and clay contents.

  17. Pattern check of TLD disc readings - an important tool to identify abnormal conditions in workplace

    International Nuclear Information System (INIS)

    Pradhan, S.M.; Sneha, C.; Bhattacharya, M.; Sahai, M.K.; Pradeep, Ratna; Datta, D.; Bhatnagar, Amit

    2016-01-01

    Personnel monitoring for external radiation using CaSO 4 :Dy based TLD badge is well established in Indian radiation protection program. TLD badge enables evaluation of occupational dose based on the pattern and values of the three disc readings. Different patterns of disc readings are obtained depending on the type and energy of radiation in the workplace. Pattern not conforming to the radiation in the workplace also called as improper pattern can be a useful tool for investigation of any deviation / abnormality in workplace or monitoring practices. The paper presents different examples of improper pattern observed in monitoring that has helped to find out the deviations in the workplace or monitoring practices. Results of the experiments conducted to simulate some of the observed pattern are also presented in the paper

  18. Mechanical and mechanobiological influences on bone fracture repair : identifying important cellular characteristics

    NARCIS (Netherlands)

    Isaksson, H.E.

    2007-01-01

    Fracture repair is a complex and multifactorial process, which involves a well-programmed series of cellular and molecular events that result in a combination of intramembranous and endochondral bone formation. The vast majority of fractures is treated successfully. They heal through ‘secondary

  19. Population pharmacokinetic analysis of oxaliplatin in adults and children identifies important covariates for dosing.

    Science.gov (United States)

    Nikanjam, Mina; Stewart, Clinton F; Takimoto, Chris H; Synold, Timothy W; Beaty, Orren; Fouladi, Maryam; Capparelli, Edmund V

    2015-03-01

    To characterize the determinants of variability for oxaliplatin pharmacokinetics including age, renal function, and hepatic function in children and adults. Oxaliplatin pharmacokinetic data were combined from phase I and II clinical trials: three pediatric trials (Peds1-3) and two adult NCI organ dysfunction studies (Hepatic and Renal). A population pharmacokinetic model was developed utilizing platinum ultrafiltrate concentrations to characterize changes in oxaliplatin disposition with age and organ dysfunction along with other potential sources of oxaliplatin pharmacokinetic variability. A total of 1,508 concentrations from 186 children and adults were used in the study. The data were well described by a three-compartment model. Serum creatinine (SCR) was an independent predictor of clearance (CL) while age was an independent predictor of volume of distribution. Although age was a significant covariate on CL in the univariate analysis, age effects on CL were entirely accounted for by SCR. Gender, hepatic function, and race had no effect on CL or volume of distribution. Median CL values were 0.58 (Hepatic), 0.34 (Renal), 0.78 (Peds1), 0.74 (Peds2), and 0.81 (Peds3) (L/h/kg(0.75)). Monte Carlo simulations of the final model with 130 mg/m(2) yielded median AUC values of: 14.2 (2-6 years), 16.8 (6-12 years), 16.5 (12-18 years), and 17.3 (>18 years) (µg h/mL). Renal function had the greatest effect on CL with a small age effect seen on the distribution of oxaliplatin. Young pediatric patients had higher CL values than adults as a result of better renal function.

  20. Identifying Computer-Generated Portraits: The Importance of Training and Incentives.

    Science.gov (United States)

    Mader, Brandon; Banks, Martin S; Farid, Hany

    2017-09-01

    The past two decades have seen remarkable advances in photo-realistic rendering of everything from inanimate objects to landscapes, animals, and humans. We previously showed that despite these tremendous advances, human observers remain fairly good at distinguishing computer-generated from photographic images. Building on these results, we describe a series of follow-up experiments that reveal how to improve observer performance. Of general interest to anyone performing psychophysical studies on Mechanical Turk or similar platforms, we find that observer performance can be significantly improved with the proper incentives.

  1. Overfat Adults and Children in Developed Countries: The Public Health Importance of Identifying Excess Body Fat

    Directory of Open Access Journals (Sweden)

    Philip B. Maffetone

    2017-07-01

    Full Text Available The global overfat pandemic is a serious public health crisis that places a substantial burden on economic resources in developed countries. The term overfat refers to the presence of excess body fat that can impair health, even for normal weight non-obese individuals. Excess body fat is associated with cardiometabolic dysfunction, a clinical situation that can progressively worsen, potentially leading to various common disease risk factors, chronic diseases, increased morbidity and mortality, and reduced quality of life. The prevalence of overfat populations in 30 of the world’s most developed countries is substantially higher than recent global estimations, with the largest growth due to a relatively recent increased number of people with excess abdominal fat. Abdominal overfat is the most unhealthful form of this condition, so it is concerning that average waist circumference measures, generally indicative of abdominal overfat, have increased. Despite a leveling off appearance of being overweight and/or obese in some developed countries, the overfat pandemic continues to grow.

  2. The contribution of genetics and environment to obesity.

    Science.gov (United States)

    Albuquerque, David; Nóbrega, Clévio; Manco, Licínio; Padez, Cristina

    2017-09-01

    Obesity is a global health problem mainly attributed to lifestyle changes such as diet, low physical activity or socioeconomics factors. However, several evidences consistently showed that genetics contributes significantly to the weight-gain susceptibility. A systematic literature search of most relevant original, review and meta-analysis, restricted to English was conducted in PubMed, Web of Science and Google scholar up to May 2017 concerning the contribution of genetics and environmental factors to obesity. Several evidences suggest that obesogenic environments contribute to the development of an obese phenotype. However, not every individual from the same population, despite sharing the same obesogenic environment, develop obesity. After more than 10 years of investigation on the genetics of obesity, the variants found associated with obesity represent only 3% of the estimated BMI-heritability, which is around 47-80%. Moreover, genetic factors per se were unable to explain the rapid spread of obesity prevalence. The integration of multi-omics data enables scientists having a better picture and to elucidate unknown pathways contributing to obesity. New studies based on case-control or gene candidate approach will be important to identify new variants associated with obesity susceptibility and consequently unveiling its genetic architecture. This will lead to an improvement of our understanding about underlying mechanisms involved in development and origin of the actual obesity epidemic. The integration of several omics will also provide insights about the interplay between genes and environments contributing to the obese phenotype. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

  3. Greenhouse effect contributions of US landfill methane

    International Nuclear Information System (INIS)

    Augenstein, D.

    1991-01-01

    The greenhouse effect has recently been receiving a great deal of scientific and popular attention. The term refers to a cause-and-effect relationship in which ''heat blanketing'' of the earth, due to trace gas increases in the atmosphere, is expected to result in global warming. The trace gases are increasing as the result of human activities. Carbon dioxide (CO 2 ) is the trace gas contributing most importantly to the ''heat blanketing'' and currently receives the most attention. Less widely recognized has been the high importance of methane (CH 4 ). Methane's contribution to the increased heat blanketing occurring since 1980 is estimated to be over a third as much as that of carbon dioxide. Gas from landfills has in turn been recognized to be a source of methane to the atmospheric buildup. However the magnitude of the landfill methane contribution, and the overall significance of landfill methane to the greenhouse phenomenon has been uncertain and the subject of some debate. (Author)

  4. Our contributions to the study of carbonatites

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. Our contributions to the study of carbonatites. Carbonatite magmatism in flood basalt provinces has important implications. Liquid immiscibility is responsible for evolution of carbonate and silicate parental magmas. Crustal contamination of the primary magma is ...

  5. Elements that contribute to healthy building design

    NARCIS (Netherlands)

    Loftness, V.; Hakkinen, B.; Adan, O.C.G.; Nevalainen, A.

    2007-01-01

    Abstract Background: The elements that contribute to a healthy building are multifactorial and can be discussed from different perspectives. Objectives: We present three viewpoints of designing a healthy building: the importance of sustainable development, the role of occupants for ensuring indoor

  6. Elements that contribute to healthy building design

    NARCIS (Netherlands)

    Loftness, V.; Hakkinen, B.; Adan, O.; Nevalainen, A.

    2007-01-01

    Background: The elements that contribute to a healthy building are multifactorial and can be discussed from different perspectives. Objectives: We present three viewpoints of designing a healthy building: the importance of sustainable development, the role of occupants for ensuring indoor air

  7. Perceived cultural importance and actual self-importance of values in cultural identification.

    Science.gov (United States)

    Wan, Ching; Chiu, Chi-yue; Tam, Kim-pong; Lee, Sau-lai; Lau, Ivy Yee-man; Peng, Siqing

    2007-02-01

    Cross-cultural psychologists assume that core cultural values define to a large extent what a culture is. Typically, core values are identified through an actual self-importance approach, in which core values are those that members of the culture as a group strongly endorse. In this article, the authors propose a perceived cultural importance approach to identifying core values, in which core values are values that members of the culture as a group generally believe to be important in the culture. In 5 studies, the authors examine the utility of the perceived cultural importance approach. Results consistently showed that, compared with values of high actual self-importance, values of high perceived cultural importance play a more important role in cultural identification. These findings have important implications for conceptualizing and measuring cultures. ((c) 2007 APA, all rights reserved).

  8. Experience feedback from event reports: the human contribution

    International Nuclear Information System (INIS)

    Swaton, E.; Tolstykh, V.

    1990-01-01

    Analysis of reported events reveals that in a large number of areas human intervention contributed to the initiation and/or development of these events. Since an accident at any nuclear power plant can have a world-wide effect on public acceptance, the need for attentive and reliable human behavior assumes an even greater significance. The identification of areas where human interaction can have an impact on safe operation is mainly relying on the analysis of events reported to the nuclear community. Any substantial compilation of safety significant operational events such as contained in the IAEA-IRS (Incident Reporting System) is bound to provide valuable and factual insights into problem areas, their origin, development, impact and some remedial actions. Thus a systematic analysis has been carried out on over 200 events where a human contribution could be identified. Some events of particular interest will be discussed and furthermore generic lessons will be presented. In addition the Assessment of Safety Significant Event Technique (ASSET) developed within IAEA which provides a structured methodology to identify not only the direct cause explaining why an individual failed but more important, insights on the root causes explaining why this latent deficiency was not detected earlier through the plant surveillance programme was applied. (author)

  9. Identifying ELIXIR Core Data Resources.

    Science.gov (United States)

    Durinx, Christine; McEntyre, Jo; Appel, Ron; Apweiler, Rolf; Barlow, Mary; Blomberg, Niklas; Cook, Chuck; Gasteiger, Elisabeth; Kim, Jee-Hyub; Lopez, Rodrigo; Redaschi, Nicole; Stockinger, Heinz; Teixeira, Daniel; Valencia, Alfonso

    2016-01-01

    The core mission of ELIXIR is to build a stable and sustainable infrastructure for biological information across Europe. At the heart of this are the data resources, tools and services that ELIXIR offers to the life-sciences community, providing stable and sustainable access to biological data. ELIXIR aims to ensure that these resources are available long-term and that the life-cycles of these resources are managed such that they support the scientific needs of the life-sciences, including biological research. ELIXIR Core Data Resources are defined as a set of European data resources that are of fundamental importance to the wider life-science community and the long-term preservation of biological data. They are complete collections of generic value to life-science, are considered an authority in their field with respect to one or more characteristics, and show high levels of scientific quality and service. Thus, ELIXIR Core Data Resources are of wide applicability and usage. This paper describes the structures, governance and processes that support the identification and evaluation of ELIXIR Core Data Resources. It identifies key indicators which reflect the essence of the definition of an ELIXIR Core Data Resource and support the promotion of excellence in resource development and operation. It describes the specific indicators in more detail and explains their application within ELIXIR's sustainability strategy and science policy actions, and in capacity building, life-cycle management and technical actions. The identification process is currently being implemented and tested for the first time. The findings and outcome will be evaluated by the ELIXIR Scientific Advisory Board in March 2017. Establishing the portfolio of ELIXIR Core Data Resources and ELIXIR Services is a key priority for ELIXIR and publicly marks the transition towards a cohesive infrastructure.

  10. IDENTIFYING FACTORS THAT CONTRIBUTE TO THE SATISFACTION OF STUDENTS IN E-LEARNING

    Directory of Open Access Journals (Sweden)

    Levent CALLI,

    2013-01-01

    Full Text Available There has been an increasing interest in the application of e-learning through the enhancement of internet and computer technologies. Satisfaction has appeared as a key factor in order to develop efficient course content in line with students’ demands and expectations. Thus, a lot of research has been conducted on the concept of satisfaction in electronic environments. Satisfaction has been seen to be the most significant variable on loyalty and usage intention in marketing and information science terms, which can also be highly related to academic success. In this regard, this study set out to investigate the effects of several variables on the learning processes of 930 e-learning students in the Sakarya University distance learning program. The findings of the research indicated that factors perceived playfulness, perceived ease of use and multimedia content effectiveness had a significant effect on perceived usefulness. Furthermore, it was concluded that satisfaction was affected by perceived usefulness, perceived playfulness and multimedia content effectivenes

  11. Contribution of radioisotopic techniques to identify sentinel lymph-nodes (SLN) in breast cancer

    International Nuclear Information System (INIS)

    Zarlenga, Ana C.; Katz, Lidia; Armesto, Amparo; Noblia, Cristina; Gorostidi, Susana; Perez, Juan; Parma, Patricia

    2009-01-01

    The SLN (one or several) is the first to receive lymph from a tumor. When a cancer cell comes off the tumor and circulates along the outgoing lymph, it meets a barrier, the SLN that intercepts and destroys it. If not, the cancer cell can stay and reproduce in the SLN making a metastasis which can affect other nodes in the same way. It has been shown that if the original tumor is small there is little chance that the SLN could be invaded and therefore little chance of dissemination to other lymph-nodes. Nowadays due to early detection, breast tumors are smaller than one cm, therefore with such size there is little chance of axillary lymph-nodes being affected. If it is confirmed by histological study that the SLN is free of metastasis, it is not necessary to perform a axillary emptying. This identification of SLNs has been achieved because of the advances of Radioisotopic Techniques, which has been carried out in our Hospital since 1997. We have been adapting this technique to the national supply of equipment and radio compounds always under a reliable and secure way. The aim of this presentation is to highlight the radioisotopic identification of SLNs in clinical investigation in 'Angel H. Roffo Institute', and its daily practice compare with Positron Emission Tomography (PET). By combining Radioisotopic Lymphography, Lymphochromography and intra surgical detection of the SN with Gamma Probe, we have obtained a true negative value of 95% of the SN, with 5% false negative. Due to this method we have included SN study in daily practice breast tumor patients with tumor up to 5 cm of diameter. Comparing this methods result (5% false negative), with the PET results, using 18 F-FDG, that has 33% false negatives, we conclude that a negative result can not replace this method of SN detection. (author)

  12. Electron and hole contributions to the terahertz photoconductivityof a conjugated polymer:Fullerene blend identified

    Czech Academy of Sciences Publication Activity Database

    Ponseca, C.S.; Němec, Hynek; Vukmirović, N.; Fusco, S.; Wang, E.; Andersson, M.R.; Chábera, P.; Yartsev, A.; Sundström, V.

    2012-01-01

    Roč. 3, č. 17 (2012), s. 2442-2446 ISSN 1948-7185 Grant - others:AV ČR(CZ) M100101218 Institutional research plan: CEZ:AV0Z10100520 Keywords : charge transport in organic semiconductors * time-resolved terahertz spectroscopy Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 6.585, year: 2012

  13. Identifying new physics contributions in the Higgs sector at linear e+ ...

    Indian Academy of Sciences (India)

    . Introduction. Higgs boson discovery will prove to be a crucial ingredient towards understanding the mechanism of electroweak symmetry breaking. Once discovered, a major goal would be to determine its other intrinsic properties, couplings ...

  14. The contribution of parent and youth information to identify mental health disorders or problems in adolescents

    DEFF Research Database (Denmark)

    Aebi, Marcel; Kuhn, Christine; Banaschewski, Tobias

    2017-01-01

    were used to predict any problems/disorders, emotional problems/disorders and behavioural problems/disorders in a community sample (n = 252) and in a clinic sample (n = 95). RESULTS: The findings were strikingly similar in both samples. Parent and youth SDQ scales were related to any problem/disorder......BACKGROUND: Discrepancies between multiple informants often create considerable uncertainties in delivering services to youth. The present study assessed the ability of the parent and youth scales of the Strength and Difficulties Questionnaire (SDQ) to predict mental health problems/disorders....... Youth SDQ symptom and impact had the strongest association with emotional problems/disorder and parent SDQ symptom score were most strongly related to behavioural problems/disorders. Both the SDQ total and the impact scores significantly predicted emotional problems/disorders in males whereas...

  15. Integrin and glycocalyx mediated contributions to cell adhesion identified by single cell force spectroscopy

    International Nuclear Information System (INIS)

    Boettiger, D; Wehrle-Haller, B

    2010-01-01

    The measurement of cell adhesion using single cell force spectroscopy methods was compared with earlier methods for measuring cell adhesion. This comparison provided a means and rationale for separating components of the measurement retract curve that were due to interactions between the substrate and the glycocalyx, and interactions that were due to cell surface integrins binding to a substrate-bound ligand. The glycocalyx adhesion was characterized by multiple jumps with dispersed jump sizes that extended from 5 to 30 μm from the origin. The integrin mediated adhesion was represented by the F max (maximum detachment force), was generally within the first 5 μm and commonly detached with a single rupture cascade. The integrin peak (F max ) increases with time and the rate of increase shows large cell to cell variability with a peak ∼ 50 nN s -1 and an average rate of increase of 75 pN s -1 . This is a measure of the rate of increase in the number of adhesive integrin-ligand bonds/cell as a function of contact time.

  16. Antimicrobial activity of fluoride and its in vivo importance: identification of research questions.

    Science.gov (United States)

    Van Loveren, C

    2001-01-01

    This manuscript discusses the antimicrobial activity of fluoride and its in vivo importance in order to identify research questions. There is a lot of information on mechanisms by which fluoride may interfere with bacterial metabolism and dental plaque acidogenicity. The antimicrobial activity of fluoride products is enhanced when fluoride is associated with antimicrobial cations like Sn(2+) and amine. It is not clear whether the antimicrobial mechanisms of fluoride are operating in vivo or even to what extent antimicrobial activity can contribute to caries prevention. This latter question may be the most important one in research. Copyright 2001 S. Karger AG, Basel.

  17. Contributions to quantum probability

    International Nuclear Information System (INIS)

    Fritz, Tobias

    2010-01-01

    distribution of a quantum-mechanical von Neumann measurement with postselection, given that the scalar product between the initial and the final state is known as well as the success probability of the postselection. An intermediate von Neumann measurement can enhance transition probabilities between states such that the error probability shrinks by a factor of up to 2. Chapter 4: A presentation of the category of stochastic matrices. This chapter gives generators and relations for the strict monoidal category of probabilistic maps on finite cardinals (i.e., stochastic matrices). Chapter 5: Convex Spaces: Definition and Examples. We try to promote convex spaces as an abstract concept of convexity which was introduced by Stone as ''barycentric calculus''. A convex space is a set where one can take convex combinations in a consistent way. By identifying the corresponding Lawvere theory as the category from chapter 4 and using the results obtained there, we give a different proof of a result of Swirszcz which shows that convex spaces can be identified with algebras of a finitary version of the Giry monad. After giving an extensive list of examples of convex sets as they appear throughout mathematics and theoretical physics, we note that there also exist convex spaces that cannot be embedded into a vector space: semilattices are a class of examples of purely combinatorial type. In an information-theoretic interpretation, convex subsets of vector spaces are probabilistic, while semilattices are possibilistic. Convex spaces unify these two concepts. (orig.)

  18. Contributions to quantum probability

    Energy Technology Data Exchange (ETDEWEB)

    Fritz, Tobias

    2010-06-25

    finite set can occur as the outcome distribution of a quantum-mechanical von Neumann measurement with postselection, given that the scalar product between the initial and the final state is known as well as the success probability of the postselection. An intermediate von Neumann measurement can enhance transition probabilities between states such that the error probability shrinks by a factor of up to 2. Chapter 4: A presentation of the category of stochastic matrices. This chapter gives generators and relations for the strict monoidal category of probabilistic maps on finite cardinals (i.e., stochastic matrices). Chapter 5: Convex Spaces: Definition and Examples. We try to promote convex spaces as an abstract concept of convexity which was introduced by Stone as ''barycentric calculus''. A convex space is a set where one can take convex combinations in a consistent way. By identifying the corresponding Lawvere theory as the category from chapter 4 and using the results obtained there, we give a different proof of a result of Swirszcz which shows that convex spaces can be identified with algebras of a finitary version of the Giry monad. After giving an extensive list of examples of convex sets as they appear throughout mathematics and theoretical physics, we note that there also exist convex spaces that cannot be embedded into a vector space: semilattices are a class of examples of purely combinatorial type. In an information-theoretic interpretation, convex subsets of vector spaces are probabilistic, while semilattices are possibilistic. Convex spaces unify these two concepts. (orig.)

  19. Introducing and modeling inefficiency contributions

    DEFF Research Database (Denmark)

    Asmild, Mette; Kronborg, Dorte; Matthews, Kent

    2016-01-01

    -called inefficiency contributions, which are defined as the relative contributions from specific variables to the overall levels of inefficiencies. A statistical model for distinguishing the inefficiency contributions between subgroups is proposed and the method is illustrated on a data set on Chinese banks....

  20. The Importance of Culture in Second and Foreign Language Learning

    Directory of Open Access Journals (Sweden)

    Sheeraz Ali

    2015-06-01

    Full Text Available English has been designated as a source of intercultural communication among the people from diverse linguistic and cultural backgrounds. A range of linguistic and cultural theories contribute meaningful insights on the development of competence in intercultural communication. The speculations suggest the use of communicative strategies focusing on the development of learners’ efficiency in communicating language through cultural context. However, the teaching of culture in communication has not been paid due importance in a number of academic and language settings of Pakistan and Iran. This assignment study indicates problems in view of teaching English as a medium of instruction in public sector colleges of interior Sindh, Pakistan and prescribed textbooks in Iranian schools. It also aims to identify drawbacks and shortcoming in prescribed textbooks for intermediate students at college level and schools. Therefore, the assignment study recommends integration of cultural awareness into a language teaching programme for an overall achievement of competence in intercultural communication.

  1. Dismissal: Important criteria in managerial decision-making

    Directory of Open Access Journals (Sweden)

    Fabricio Stocker

    2018-04-01

    Full Text Available Knowledge about dismissal decision-making, particularly concerning the criteria used by managers in choosing who will be dismissed and why, is scarce. Considering the implications of such decisions for organizations and society, in this paper, we identify the seven most frequently used criteria in dismissal decisions and examine their importance for managers. We collected data through a survey among 385 managers and used the rational ranking and the multicriteria Analytic Hierarchy Process (AHP to analyze them. The results show that commitment, performance records, and trust have the greatest impact on the dismissal decision, whereas interpersonal relationship, growth potential, and professional experience are considered secondary criteria. These results contribute to extending our knowledge about dismissal decisions and showing the most relevant criteria in these choices and the relevance assigned to each of the criteria so that greater transparency can be achieved.

  2. Inequalities in Educational Outcomes: How Important is the Family?

    DEFF Research Database (Denmark)

    Smith, Nina; Bredtmann, Julia

    In this paper, we investigate sibling correlations in educational outcomes, which serve as a broad measure of the importance of family and community background. Making use of rich longitudinal survey and register data for Denmark, our main aim is to identify the parental background characteristics...... that are able to explain the resemblance in educational outcomes among siblings. We find sibling correlations in educational outcomes in the range of 15 to 33 percent, suggesting that up to a third of the variation in educational achievement can be explained by family and community background. Our results...... further reveal that parents' socio-economic background can account for a large part of the sibling correlation. Other family characteristics such as family structure, the incidence of social problems, and parents' educational preferences also play a role, though these factors only contribute to explaining...

  3. Component state-based integrated importance measure for multi-state systems

    International Nuclear Information System (INIS)

    Si, Shubin; Levitin, Gregory; Dui, Hongyan; Sun, Shudong

    2013-01-01

    Importance measures in reliability engineering are used to identify weak components and/or states in contributing to the reliable functioning of a system. Traditionally, importance measures do not consider the possible effect of groups of transition rates among different component states, which, however, has great effect on the component probability distribution and should therefore be taken into consideration. This paper extends the integrated importance measure (IIM) to estimate the effect of a component residing at certain states on the performance of the entire multi-state systems. This generalization of IIM describes in which state it is most worthy to keep the component to provide the desired level of system performance, and which component is the most important to keep in some state and above for improving the performance of the system. An application to an oil transportation system is presented to illustrate the use of the suggested importance measure

  4. Identifying Human Factors Issues in Aircraft Maintenance Operations

    Science.gov (United States)

    Veinott, Elizabeth S.; Kanki, Barbara G.; Shafto, Michael G. (Technical Monitor)

    1995-01-01

    Maintenance operations incidents submitted to the Aviation Safety Reporting System (ASRS) between 1986-1992 were systematically analyzed in order to identify issues relevant to human factors and crew coordination. This exploratory analysis involved 95 ASRS reports which represented a wide range of maintenance incidents. The reports were coded and analyzed according to the type of error (e.g, wrong part, procedural error, non-procedural error), contributing factors (e.g., individual, within-team, cross-team, procedure, tools), result of the error (e.g., aircraft damage or not) as well as the operational impact (e.g., aircraft flown to destination, air return, delay at gate). The main findings indicate that procedural errors were most common (48.4%) and that individual and team actions contributed to the errors in more than 50% of the cases. As for operational results, most errors were either corrected after landing at the destination (51.6%) or required the flight crew to stop enroute (29.5%). Interactions among these variables are also discussed. This analysis is a first step toward developing a taxonomy of crew coordination problems in maintenance. By understanding what variables are important and how they are interrelated, we may develop intervention strategies that are better tailored to the human factor issues involved.

  5. Important Non-Technical Skills in Video-Assisted Thoracoscopic Surgery Lobectomy

    DEFF Research Database (Denmark)

    Gjeraa, Kirsten; Mundt, Anna S.; Spanager, Lene

    2017-01-01

    Background Safety in the operating room is dependent on the team's non-technical skills. The importance of non-technical skills appears to be different for minimally invasive surgery as compared with open surgery. The aim of this study was to identify which non-technical skills are perceived...... with complementary and overlapping scopes of practice between surgical and anesthesia subteams. Conclusions This study identified six non-technical skills that serve as the foundation for shared mental models of the patient, the current situation, and team resources. These findings contribute three important...... by team members to be most important for patient safety, in the setting of video-assisted thoracoscopic surgery (VATS) lobectomy. Methods This was an explorative, semistructured interview-based study with 21 participants from all four thoracic surgery centers in Denmark that perform VATS lobectomy. Data...

  6. Factors Contributing to Personal Commitment in Chinese Interethnic Couples

    Directory of Open Access Journals (Sweden)

    Xinmiao Zhong

    2014-06-01

    Full Text Available Interethnic relationships are increasingly common in many societies, yet interethnic couples have a higher divorce rate compared to intraethnic couples. Given these facts and the dearth of research, this study aimed to identify factors that contribute to couples’ commitment in interethnic relationships. This study investigated the personal commitment of Chinese interethnic couples in the United Kingdom and the United States. Specifically, whether love, dyadic adjustment and “couple cultural identity” (i.e. acculturation to the partner and couple’s similarity on individualism/collectivism would predict personal commitment and whether each variable would account for unique variance in personal commitment of the participants. Thirty-seven Chinese/non-Chinese heterosexual couples participated in the study and significant relationships between love and personal commitment, dyadic adjustment and personal commitment were found. Also, couple cultural identity was important for women’s personal commitment. Multiple regression and structural equation modelling showed that partners in interethnic relationships defined personal commitment in different ways with men emphasizing love and dyadic adjustment, and women emphasizing love and acculturation to their partner. The discovery of the importance of couple cultural identity in contributing to personal commitment, besides love and dyadic adjustment, helps researchers to gain a greater understanding of such relationships and to extend the research on interethnic relationships.

  7. AND/OR Importance Sampling

    OpenAIRE

    Gogate, Vibhav; Dechter, Rina

    2012-01-01

    The paper introduces AND/OR importance sampling for probabilistic graphical models. In contrast to importance sampling, AND/OR importance sampling caches samples in the AND/OR space and then extracts a new sample mean from the stored samples. We prove that AND/OR importance sampling may have lower variance than importance sampling; thereby providing a theoretical justification for preferring it over importance sampling. Our empirical evaluation demonstrates that AND/OR importance sampling is ...

  8. Evaluations and utilizations of risk importances

    International Nuclear Information System (INIS)

    Vesely, W.E.; Davis, T.C.

    1985-08-01

    This report presents approaches for utilizing Probabilistic Risk Analyses (PRA's) to determine risk importances. Risk importances are determined for design features, plant operations, and other factors that can affect risk. PRA's can be used to identify the importances of risk contributors or proposed changes to designs or operations. The objective of this report is to serve as a handbook and guide in evaluating and applying risk importances. The utilization of both qualitative risk importances and quantitative risk importances is described in this report. Qualitative risk importances are based on the logic models in the PRA, while quantitative risk importances are based on the quantitative results of the PRA. Both types of importances are among the most robust and meaningful information a PRA can provide. A wide variety of risk importance evaluations are described including evaluations of the importances of design changes, testing, maintenance, degrading environments, and aging. Specific utilizations are described in inspection and in reliability assurance programs, however the general approaches have widespread applicability. The role of personal computers and decision support programs in applying risk importance evaluations is also described

  9. Near Identifiability of Dynamical Systems

    Science.gov (United States)

    Hadaegh, F. Y.; Bekey, G. A.

    1987-01-01

    Concepts regarding approximate mathematical models treated rigorously. Paper presents new results in analysis of structural identifiability, equivalence, and near equivalence between mathematical models and physical processes they represent. Helps establish rigorous mathematical basis for concepts related to structural identifiability and equivalence revealing fundamental requirements, tacit assumptions, and sources of error. "Structural identifiability," as used by workers in this field, loosely translates as meaning ability to specify unique mathematical model and set of model parameters that accurately predict behavior of corresponding physical system.

  10. Formalized search strategies for human risk contributions

    International Nuclear Information System (INIS)

    Rasmussen, J.; Pedersen, O.M.

    1982-07-01

    For risk management, the results of a probabilistic risk analysis (PRA) as well as the underlying assumptions can be used as references in a closed-loop risk control; and the analyses of operational experiences as a means of feedback. In this context, the need for explicit definition and documentation of the PRA coverage, including the search strategies applied, is discussed and aids are proposed such as plant description in terms of a formal abstraction hierarchy and use of cause-consequence-charts for the documentation of not only the results of PRA but also of its coverage. Typical human risk contributions are described on the basis of general plant design features relevant for risk and accident analysis. With this background, search strategies for human risk contributions are treated: Under the designation ''work analysis'', procedures for the analysis of familiar, well trained, planned tasks are proposed. Strategies for identifying human risk contributions outside this category are outlined. (author)

  11. Importance Sampling for Stochastic Timed Automata

    DEFF Research Database (Denmark)

    Jegourel, Cyrille; Larsen, Kim Guldstrand; Legay, Axel

    2016-01-01

    We present an importance sampling framework that combines symbolic analysis and simulation to estimate the probability of rare reachability properties in stochastic timed automata. By means of symbolic exploration, our framework first identifies states that cannot reach the goal. A state-wise cha......We present an importance sampling framework that combines symbolic analysis and simulation to estimate the probability of rare reachability properties in stochastic timed automata. By means of symbolic exploration, our framework first identifies states that cannot reach the goal. A state...

  12. Acarus of agricultural importance in Colombia

    International Nuclear Information System (INIS)

    Mesa, Nora Cristina

    1999-01-01

    Mite study in Colombia has evidently contributed to the knowledge of the diversity of species. In this field the investigators have also developed studies on evaluation and handling of the phytophagous acarus, the advances have been important in the works on those depredators species. One can affirm that the country has basic and applied information on the acarus, but it is needed to deepen in some topics

  13. ECN contributions to ADTT `96

    Energy Technology Data Exchange (ETDEWEB)

    Koning, A.J.

    1996-07-01

    An outline is presented of the status of nuclear data evaluation for accelerator-driven systems. The international effort consists mainly of measuring, compiling and calculating nuclear data for elements and isotopes relevant for transmutation of radioactive waste (ATW), energy amplification and other accelerator-related nuclear applications. We argue that input for global, macroscopic calculation schemes for hybrid nuclear systems basically should consist of three types of nuclear data: (a) High-energy transport codes for energies above about 150 MeV, (b) neutron and proton transport data files for energies below about 150 MeV and (c) neutron and proton transmutation/activation libraries below about 150 MeV. Our specific contribution to the field concerns (b) and (c). The progress of the evaluation of high-energy nuclear data files for the most important materials and the related compilation of nuclear reaction information is reported. The evaluated data are calculated with the computer codes ECIS95, MINGUS and GNASH and are stored in ENDF6-format. We illustrate the library production with a short outline of the employed physical methods. Finally, we briefly discuss the application of the activation/transmutation library ECNAF96. (orig.).

  14. Climate impacts from import of waste fuels; Klimatpaaverkan fraan import av braennbart avfall

    Energy Technology Data Exchange (ETDEWEB)

    Haraldsson, Maarten; Sundberg, Johan (Profu, Moelndal (Sweden))

    2009-04-15

    Imports of combustible waste has increased in recent years and imported waste has become an increasingly important fuel in the Swedish district heating systems. The projections for the next few years show that the imports can be much higher, partly due to reduced amounts of waste in the wake of economic downturn the world economy, partly because several new incinerators will be put into operation. In a environmental perspective, imports are controversial and it has been proposed that imports should be restricted. This report provides an assessment of the climate impact of importing waste for combustion. The report shows that greenhouse gas emissions due to imports of waste to the Swedish district heating plants in 2007 was reduced by 500 000 tonnes of carbon dioxide. This is equivalent to the emissions from 300 000 Swedes car journeys a year, or 2.5% of the total emission reduction target set by the Government for the non-trading sector until 2020. Imports of wood waste-chips accounts for the largest reduction, but the study shows that imports of other types of waste contribute to a reduction in emissions of greenhouse gases. The reasons for the reduction is that the use of imported waste fuel substitute for other heating and electricity generation, which gives the consequence that emissions are avoided. The largest emission reductions are obtained, however, by the importation of household waste by replacing the alternative waste treatment of the corresponding waste in the country of origin. In the countries from which imports of waste currently takes place there is a lack of treatment capacity for organic waste. The alternative treatment available is primarily deposition. This treatment causes significant emissions of methane, which is a very strong greenhouse gas. The shipment of waste that occur as a result of imports gives a marginal contribution of greenhouse gases, compared against the emission reductions outlined above

  15. Does conservation on farmland contribute to halting the biodiversity decline?

    Science.gov (United States)

    Kleijn, David; Rundlöf, Maj; Scheper, Jeroen; Smith, Henrik G; Tscharntke, Teja

    2011-09-01

    Biodiversity continues to decline, despite the implementation of international conservation conventions and measures. To counteract biodiversity loss, it is pivotal to know how conservation actions affect biodiversity trends. Focussing on European farmland species, we review what is known about the impact of conservation initiatives on biodiversity. We argue that the effects of conservation are a function of conservation-induced ecological contrast, agricultural land-use intensity and landscape context. We find that, to date, only a few studies have linked local conservation effects to national biodiversity trends. It is therefore unknown how the extensive European agri-environmental budget for conservation on farmland contributes to the policy objectives to halt biodiversity decline. Based on this review, we identify new research directions addressing this important knowledge gap. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. How important is importance for prospective memory? A review

    OpenAIRE

    Walter, Stefan; Meier, Beat

    2014-01-01

    Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover...

  17. Gray literature: An important resource in systematic reviews.

    Science.gov (United States)

    Paez, Arsenio

    2017-08-01

    Systematic reviews aide the analysis and dissemination of evidence, using rigorous and transparent methods to generate empirically attained answers to focused research questions. Identifying all evidence relevant to the research questions is an essential component, and challenge, of systematic reviews. Gray literature, or evidence not published in commercial publications, can make important contributions to a systematic review. Gray literature can include academic papers, including theses and dissertations, research and committee reports, government reports, conference papers, and ongoing research, among others. It may provide data not found within commercially published literature, providing an important forum for disseminating studies with null or negative results that might not otherwise be disseminated. Gray literature may thusly reduce publication bias, increase reviews' comprehensiveness and timeliness, and foster a balanced picture of available evidence. Gray literature's diverse formats and audiences can present a significant challenge in a systematic search for evidence. However, the benefits of including gray literature may far outweigh the cost in time and resource needed to search for it, and it is important for it to be included in a systematic review or review of evidence. A carefully thought out gray literature search strategy may be an invaluable component of a systematic review. This narrative review provides guidance about the benefits of including gray literature in a systematic review, and sources for searching through gray literature. An illustrative example of a search for evidence within gray literature sources is presented to highlight the potential contributions of such a search to a systematic review. Benefits and challenges of gray literature search methods are discussed, and recommendations made. © 2017 Chinese Cochrane Center, West China Hospital of Sichuan University and John Wiley & Sons Australia, Ltd.

  18. Grey literature: An important resource in systematic reviews.

    Science.gov (United States)

    Paez, Arsenio

    2017-12-21

    Systematic reviews aid the analysis and dissemination of evidence, using rigorous and transparent methods to generate empirically attained answers to focused research questions. Identifying all evidence relevant to the research questions is an essential component, and challenge, of systematic reviews. Grey literature, or evidence not published in commercial publications, can make important contributions to a systematic review. Grey literature can include academic papers, including theses and dissertations, research and committee reports, government reports, conference papers, and ongoing research, among others. It may provide data not found within commercially published literature, providing an important forum for disseminating studies with null or negative results that might not otherwise be disseminated. Grey literature may thusly reduce publication bias, increase reviews' comprehensiveness and timeliness and foster a balanced picture of available evidence. Grey literature's diverse formats and audiences can present a significant challenge in a systematic search for evidence. However, the benefits of including grey literature may far outweigh the cost in time and resource needed to search for it, and it is important for it to be included in a systematic review or review of evidence. A carefully thought out grey literature search strategy may be an invaluable component of a systematic review. This narrative review provides guidance about the benefits of including grey literature in a systematic review, and sources for searching through grey literature. An illustrative example of a search for evidence within grey literature sources is presented to highlight the potential contributions of such a search to a systematic review. Benefits and challenges of grey literature search methods are discussed, and recommendations made. © 2017 Chinese Cochrane Center, West China Hospital of Sichuan University and John Wiley & Sons Australia, Ltd.

  19. Nutrient composition of important fish species in Bangladesh and potential contribution to recommended nutrient intakes

    DEFF Research Database (Denmark)

    Bogard, Jessica R.; Thilsted, Shakuntala H.; Marks, Geoffrey C.

    2015-01-01

    Fish, in Bangladesh where malnutrition remains a significant development challenge, is an irreplaceable animal-source food in the diet of millions. However, existing data on the nutrient composition of fish do not reflect the large diversity available and have focused on only a few select nutrien...... indigenous species, which should guide policy and programmes to improve food and nutrition security in Bangladesh....

  20. Importance of the correlation contribution for local hybrid functionals: range separation and self-interaction corrections.

    Science.gov (United States)

    Arbuznikov, Alexei V; Kaupp, Martin

    2012-01-07

    Local hybrid functionals with their position-dependent exact-exchange admixture are a conceptually simple and promising extension of the concept of a hybrid functional. Local hybrids based on a simple mixing of the local spin density approximation (LSDA) with exact exchange have been shown to be successful for thermochemistry, reaction barriers, and a range of other properties. So far, the combination of this generation of local hybrids with an LSDA correlation functional has been found to give the most favorable results for atomization energies, for a range of local mixing functions (LMFs) governing the exact-exchange admixture. Here, we show that the choice of correlation functional to be used with local hybrid exchange crucially influences the parameterization also of the exchange part as well as the overall performance. A novel ansatz for the correlation part of local hybrids is suggested based on (i) range-separation of LSDA correlation into short-range (SR) and long-range (LR) parts, and (ii) partial or full elimination of the one-electron self-correlation from the SR part. It is shown that such modified correlation functionals allow overall larger exact exchange admixture in thermochemically competitive local hybrids than before. This results in improvements for reaction barriers and for other properties crucially influenced by self-interaction errors, as demonstrated by a number of examples. Based on the range-separation approach, a fresh view on the breakdown of the correlation energy into dynamical and non-dynamical parts is suggested.

  1. Students lead the library the importance of student contributions to the academic library

    CERN Document Server

    Arnold-Garza, Sara

    2017-01-01

    In six parts-Students as Employees, Students as Curators, Students as Ambassadors, the Library as Client, Student Groups as Library Leaders, and Students as Library Designers-Students Lead the Library provides case studies of programs and initiatives that seek student input, assistance, and leadership in the academic library. Through the library, students can develop leadership skills, cultivate high levels of engagement, and offer peer learning opportunities. Through the students, libraries can create participatory design processes, enhancement and transformation of the library's core functions, and expressed library value for stakeholders.

  2. The Importance of Turkish and US Relations: Contributing for Joint Objectives of a Secure Middle East

    Science.gov (United States)

    2017-03-31

    As a Muslim-majority country that is transitioning from being a secular democratic state toward its Islamic roots, a member of NATO, and a long...being a secular democratic state toward its Islamic roots, a member of NATO, and a long-standing US ally, Turkey is pivotal to the US strategy to shape...productive country needed education, so Kemal advocated a unified school system with secular, Turkish language schools.2 Under Mustafa Kemal’s leadership

  3. Important variations in parvalbumin content in common fish species: a factor possibly contributing to variable allergenicity.

    Science.gov (United States)

    Kuehn, A; Scheuermann, T; Hilger, C; Hentges, F

    2010-01-01

    Although 95% of fish-allergic patients are sensitized to the major fish allergen parvalbumin, clinical reactions to different fish species vary considerably in symptoms, intensity and frequency in allergic subjects. This study aimed at the quantification of parvalbumin levels in salmon, trout, cod, carp, mackerel, herring, redfish and tuna. Fish muscle extracts were separated by SDS-PAGE and parvalbumin content was estimated by densitometric band quantification. Individual antisera were raised in BALB/c mice against parvalbumins purified from seven fish species. Parvalbumin content was quantified in fish (raw/processed) and skin prick test (SPT) solutions by ELISA using the corresponding anti-serum for detection and the purified parvalbumins as standards. Using SDS-PAGE scanning, parvalbumin contents were 2 mg for cod, carp, redfish and herring. Using ELISA, parvalbumin content ranged from 2.5 mg per gram raw muscle for carp, herring and redfish. The parvalbumin content of processed samples (cooked/commercial) was 20-60% lower. Allergen content in SPT samples ranged from 20 to 70 μg parvalbumin/ml of extract. No parvalbumin was found in tuna SPT solution. The parvalbumin content of most commonly consumed fish species varies considerably. Differences range from severalfold to one hundredfold. This has to be taken into account when designing food challenge tests and advising fish-allergic patients. Copyright © 2010 S. Karger AG, Basel.

  4. Protecting important sites for biodiversity contributes to meeting global conservation targets

    DEFF Research Database (Denmark)

    Butchart, Stuart H. M.; Scharlemann, Jörn P.W.; Evans, Mike I.

    2012-01-01

    Protected areas (PAs) are a cornerstone of conservation efforts and now cover nearly 13% of the world's land surface, with the world's governments committed to expand this to 17%. However, as biodiversity continues to decline, the effectiveness of PAs in reducing the extinction risk of species re...

  5. [Contribution of nested PCR in the diagnosis of imported malaria in southern Algeria].

    Science.gov (United States)

    Bouiba, L; Gassen, B; Gasmi, M; Hammadi, D; Harrat, Z

    2016-12-01

    The nested PCR was used to estimate its inputs in malaria diagnosis and in the performance of the microscope operators involved in the surveillance of malaria in remote areas of South Algeria. For the period 2010 to 2015, 112 patients (93 febrile and 19 asymptomatic) coming from sub-Saharan Africa were tested for malaria in the hospital of Tamanrasset. One part of the blood taken from fingertip was used for blood smears and the second part was absorbed in filter paper for molecular diagnosis. Overall, the infection was detected by nested PCR in 63 samples versus 53 by direct examination. In addition, 11 mixed infections and 6 positive asymptomatic cases not detected by microscopy were diagnosed by PCR. Moreover, two negative samples in nested PCR were tested positive by direct examination. The molecular tool is more sensitive than the direct examination in detecting infra-microscopic parasitaemia and mixed infections...

  6. Contributions to the quality control of two crops of economic importance : hops and yerba mate

    NARCIS (Netherlands)

    Wilson, Erica Georgina

    2012-01-01

    Quality control of plants is essential and at the same time very challenging.In this thesis, studies involving quality issues of two plants used in the production of two popular beverages, hops (in beer) and Ilex paraguariensis (yerba mate) were undertaken. Hops are used as bittering agents and to

  7. [E-Learning--an important contribution to general medical training and continuing education?].

    Science.gov (United States)

    Ruf, D; Berner, M M; Kriston, L; Härter, M

    2008-09-01

    There is increasing activity in the development of e-learning modules for general medical training and continuing education. One of the central advantages of e-learning is flexibility regarding time and place of its use. The quality of the available e-learning opportunities varies quite considerably. For users it is often not easy to assess the quality of e-learning modules or to find offers of high quality. This could be a reason for the fact that despite the huge number of e-learning modules still only few students and physicians are using them. This is although e-learning has proven to be as effective as and even more efficient than learning in the classroom or with paper-based materials. This article summarizes the different models of e-learning, how and where to find offers of high quality, advantages of using e-learning, and the effectiveness and efficiency of such offers. In addition problems of e-learning and possibilities to overcome these problems are shown.

  8. Rheumatoid arthritis: identifying and characterising polymorphisms using rat models

    Science.gov (United States)

    2016-01-01

    ABSTRACT Rheumatoid arthritis is a chronic inflammatory joint disorder characterised by erosive inflammation of the articular cartilage and by destruction of the synovial joints. It is regulated by both genetic and environmental factors, and, currently, there is no preventative treatment or cure for this disease. Genome-wide association studies have identified ∼100 new loci associated with rheumatoid arthritis, in addition to the already known locus within the major histocompatibility complex II region. However, together, these loci account for only a modest fraction of the genetic variance associated with this disease and very little is known about the pathogenic roles of most of the risk loci identified. Here, we discuss how rat models of rheumatoid arthritis are being used to detect quantitative trait loci that regulate different arthritic traits by genetic linkage analysis and to positionally clone the underlying causative genes using congenic strains. By isolating specific loci on a fixed genetic background, congenic strains overcome the challenges of genetic heterogeneity and environmental interactions associated with human studies. Most importantly, congenic strains allow functional experimental studies be performed to investigate the pathological consequences of natural genetic polymorphisms, as illustrated by the discovery of several major disease genes that contribute to arthritis in rats. We discuss how these advances have provided new biological insights into arthritis in humans. PMID:27736747

  9. Leading change: 1--identifying the issue.

    Science.gov (United States)

    Kerridge, Joanna

    To enable sustainable change, nurses need to take the lead in managing it. Recent national initiatives have emphasised the importance of frontline staff in service improvement. The ability to influence and manage change has been identified as an essential skill for delivering new models of care. This article is the first in a three-part series designed to help nurses at all levels develop the knowledge and skills they will need to initiate and manage change. This article focuses on identifying what needs to be changed and why.

  10. The NOAA Dataset Identifier Project

    Science.gov (United States)

    de la Beaujardiere, J.; Mccullough, H.; Casey, K. S.

    2013-12-01

    The US National Oceanic and Atmospheric Administration (NOAA) initiated a project in 2013 to assign persistent identifiers to datasets archived at NOAA and to create informational landing pages about those datasets. The goals of this project are to enable the citation of datasets used in products and results in order to help provide credit to data producers, to support traceability and reproducibility, and to enable tracking of data usage and impact. A secondary goal is to encourage the submission of datasets for long-term preservation, because only archived datasets will be eligible for a NOAA-issued identifier. A team was formed with representatives from the National Geophysical, Oceanographic, and Climatic Data Centers (NGDC, NODC, NCDC) to resolve questions including which identifier scheme to use (answer: Digital Object Identifier - DOI), whether or not to embed semantics in identifiers (no), the level of granularity at which to assign identifiers (as coarsely as reasonable), how to handle ongoing time-series data (do not break into chunks), creation mechanism for the landing page (stylesheet from formal metadata record preferred), and others. Decisions made and implementation experience gained will inform the writing of a Data Citation Procedural Directive to be issued by the Environmental Data Management Committee in 2014. Several identifiers have been issued as of July 2013, with more on the way. NOAA is now reporting the number as a metric to federal Open Government initiatives. This paper will provide further details and status of the project.

  11. Modeling and analysis of solar wind generated contributions to the near-Earth magnetic field

    DEFF Research Database (Denmark)

    Vennerstrøm, Susanne; Moretto, T.; Rastatter, L.

    2006-01-01

    Solar wind generated magnetic disturbances are currently one of the major obstacles for improving the accuracy in the determination of the magnetic field due to sources internal to the Earth. In the present study a global MHD model of solar wind magnetosphere interaction is used to obtain...... a physically consistent, divergence-free model of ionospheric, field-aligned and magnetospheric currents in a realistic magnetospheric geometry. The magnetic field near the Earth due to these currents is analyzed by estimating and comparing the contributions from the various parts of the system, with the aim...... of identifying the most important aspects of the solar wind disturbances in an internal field modeling context. The contribution from the distant magnetospheric currents is found to consist of two, mainly opposing, contributions from respectively the dayside magnetopause currents and the cross-tail current...

  12. Identifying and evaluating E-procurement in supply chain risk by Fuzzy MADM

    Directory of Open Access Journals (Sweden)

    Mostafa Memarzade

    2012-08-01

    Full Text Available E-procurement risks has emerged as an important issue for researchers and practitioners because mitigating supply chain risk helps improve firms’ as well as supply chains’ performance. E-marketplaces have been steadily growing and there have been significant interest in e-business research. There are different risks and uncertainties involved with E-marketplaces, which jeopardizes the sector but we have had a large amount of hype and the business still continue to grow. The primary aim of this study is to identify E-procurement risks and evaluate them using a fuzzy AHP framework. We contribute E-procurement risk by identifying 13 critical criteria and determine four important ones including the extent of acceptable information, interrelationship risk, lack of honesty in relationships and product quality and safety for evaluating suppliers’ risk.

  13. 75 FR 34388 - Employee Contribution Elections and Contribution Allocations

    Science.gov (United States)

    2010-06-17

    ... contributions equal to 3 percent of the employee's basic pay will be deducted from his or her pay and... employees who are rehired after a separation in service of 31 or more calendar days and who are eligible to participate in the TSP will automatically have 3 percent of their basic pay contributed to the TSP, unless...

  14. Yesterday's dinner, tomorrow's weather, today's news? US newspaper coverage of food system contributions to climate change.

    Science.gov (United States)

    Neff, Roni A; Chan, Iris L; Smith, Katherine Clegg

    2009-07-01

    There is strong evidence that what we eat and how it is produced affects climate change. The present paper examines coverage of food system contributions to climate change in top US newspapers. Using a sample of sixteen leading US newspapers from September 2005 to January 2008, two coders identified 'food and climate change' and 'climate change' articles based on specified criteria. Analyses examined variation across time and newspaper, the level of content relevant to food systems' contributions to climate change, and how such content was framed. There were 4582 'climate change' articles in these newspapers during this period. Of these, 2.4% mentioned food or agriculture contributions, with 0.4% coded as substantially focused on the issue and 0.5% mentioning food animal contributions. The level of content on food contributions to climate change increased across time. Articles initially addressed the issue primarily in individual terms, expanding to address business and government responsibility more in later articles. US newspaper coverage of food systems' effects on climate change during the study period increased, but still did not reflect the increasingly solid evidence of the importance of these effects. Increased coverage may lead to responses by individuals, industry and government. Based on co-benefits with nutritional public health messages and climate change's food security threats, the public health nutrition community has an important role to play in elaborating and disseminating information about food and climate change for the US media.

  15. Identifying Bitcoin users by transaction behavior

    Science.gov (United States)

    Monaco, John V.

    2015-05-01

    Digital currencies, such as Bitcoin, offer convenience and security to criminals operating in the black marketplace. Some Bitcoin marketplaces, such as Silk Road, even claim anonymity. This claim contradicts the findings in this work, where long term transactional behavior is used to identify and verify account holders. Transaction timestamps and network properties observed over time contribute to this finding. The timestamp of each transaction is the result of many factors: the desire purchase an item, daily schedule and activities, as well as hardware and network latency. Dynamic network properties of the transaction, such as coin flow and the number of edge outputs and inputs, contribute further to reveal account identity. In this paper, we propose a novel methodology for identifying and verifying Bitcoin users based on the observation of Bitcoin transactions over time. The behavior we attempt to quantify roughly occurs in the social band of Newell's time scale. A subset of the Blockchain 230686 is taken, selecting users that initiated between 100 and 1000 unique transactions per month for at least 6 different months. This dataset shows evidence of being nonrandom and nonlinear, thus a dynamical systems approach is taken. Classification and authentication accuracies are obtained under various representations of the monthly Bitcoin samples: outgoing transactions, as well as both outgoing and incoming transactions are considered, along with the timing and dynamic network properties of transaction sequences. The most appropriate representations of monthly Bitcoin samples are proposed. Results show an inherent lack of anonymity by exploiting patterns in long-term transactional behavior.

  16. Identifying organic nitrogen compounds in Rocky Mountain National Park aerosols

    Science.gov (United States)

    Beem, K. B.; Desyaterik, Y.; Ozel, M. Z.; Hamilton, J. F.; Collett, J. L.

    2010-12-01

    Nitrogen deposition is an important issue in Rocky Mountain National Park (RMNP). While inorganic nitrogen contributions to the ecosystems in this area have been studied, the sources of organic nitrogen are still largely unknown. To better understand the potential sources of organic nitrogen, filter samples were collected and analyzed for organic nitrogen species. Samples were collected in RMNP using a Thermo Fisher Scientific TSP (total suspended particulate) high-volume sampler with a PM2.5 impactor plate from April - November of 2008. The samples presented the opportunity to compare two different methods for identification of individual organic nitrogen species. The first type of analysis was performed with a comprehensive two dimensional gas chromatography (GCxGC) system using a nitrogen chemiluminescence detector (NCD). The filter samples were spiked with propanil in dichloromethane to use as an internal standard and were then extracted in water followed by solid phase extraction. The GCxGC system was comprised of a volatility based separation (DB5 column) followed by a polarity based separation (RXI-17 column). A NCD was used to specifically detect nitrogen compounds and remove the complex background matrix. Individual standards were used to identify peaks by comparing retention times. This method has the added benefit of an equimolar response for nitrogen so only a single calibration is needed for all species. In the second analysis, a portion of the same filter samples were extracted in DI water and analyzed with liquid chromatography coupled with mass spectroscopy (LC/MS). The separation was performed using a C18 column and a water-methanol gradient elution. Electrospray ionization into a time of flight mass spectrometer was used for detection. High accuracy mass measurement allowed unambiguous assignments of elemental composition of resulting ions. Positive and negative polarities were used since amines tend to show up in positive mode and nitrates in

  17. Identifying variables that influence manufacturing product quality

    Directory of Open Access Journals (Sweden)

    Marek Krynke

    2014-10-01

    Full Text Available In the article a risk analysis of the production process of selected products in a plant producing votive candles was conducted. The Pareto-Lorenz diagram and FMEA method were used which indicated the most important areas affecting the production of selected elements of candles. The synthesis of intangible factors affecting production in the audited company was also carried out with particular emphasis on the operation of the production system. The factors determining the validity of studies was examined, describing the principle of BOST 14 Toyota management. The most important areas of the company were identified, positively affecting the production process.

  18. Microplastics as contaminants in commercially important seafood species.

    Science.gov (United States)

    Santillo, David; Miller, Kathryn; Johnston, Paul

    2017-05-01

    The ingestion of microplastic fragments, spheres, and fibers by marine mollusks, crustaceans, and fish, including a number of commercially important species, appears to be a widespread and pervasive phenomenon. Evidence is also growing for direct impacts of microplastic ingestion on physiology, reproductive success and survival of exposed marine organisms, and transfer through food webs, although the ecological implications are not yet known. Concerns also remain over the capacity for microplastics to act as vectors for harmful chemical pollutants, including plastic additives and persistent organic pollutants, although their contribution must be evaluated alongside other known sources. The potential for humans, as top predators, to consume microplastics as contaminants in seafood is very real, and its implications for health need to be considered. An urgent need also exists to extend the geographical scope of studies of microplastic contamination in seafood species to currently underrepresented areas, and to finalize and adopt standardized methods and quality-assurance protocols for the isolation, identification, and quantification of microplastic contaminants from biological tissues. Such developments would enable more robust investigation of spatial and temporal trends, thereby contributing further evidence as a sound basis for regulatory controls. Despite the existence of considerable uncertainties and unknowns, there is already a compelling case for urgent actions to identify, control, and, where possible, eliminate key sources of both primary and secondary microplastics before they reach the marine environment. Integr Environ Assess Manag 2017;13:516-521. © 2017 SETAC. © 2017 SETAC.

  19. IDENTIFYING COLLISIONAL FAMILIES IN THE KUIPER BELT

    International Nuclear Information System (INIS)

    Marcus, Robert A.; Ragozzine, Darin; Murray-Clay, Ruth A.; Holman, Matthew J.

    2011-01-01

    The identification and characterization of numerous collisional families-clusters of bodies with a common collisional origin-in the asteroid belt has added greatly to the understanding of asteroid belt formation and evolution. More recent study has also led to an appreciation of physical processes that had previously been neglected (e.g., the Yarkovsky effect). Collisions have certainly played an important role in the evolution of the Kuiper Belt as well, though only one collisional family has been identified in that region to date, around the dwarf planet Haumea. In this paper, we combine insights into collisional families from numerical simulations with the current observational constraints on the dynamical structure of the Kuiper Belt to investigate the ideal sizes and locations for identifying collisional families. We find that larger progenitors (r ∼ 500 km) result in more easily identifiable families, given the difficulty in identifying fragments of smaller progenitors in magnitude-limited surveys, despite their larger spread and less frequent occurrence. However, even these families do not stand out well from the background. Identifying families as statistical overdensities is much easier than characterizing families by distinguishing individual members from interlopers. Such identification seems promising, provided the background population is well known. In either case, families will also be much easier to study where the background population is small, i.e., at high inclinations. Overall, our results indicate that entirely different techniques for identifying families will be needed for the Kuiper Belt, and we provide some suggestions.

  20. Distributed design approach in persistent identifiers systems

    Science.gov (United States)

    Golodoniuc, Pavel; Car, Nicholas; Klump, Jens

    2017-04-01

    The need to identify both digital and physical objects is ubiquitous in our society. Past and present persistent identifier (PID) systems, of which there is a great variety in terms of technical and social implementations, have evolved with the advent of the Internet, which has allowed for globally unique and globally resolvable identifiers. PID systems have catered for identifier uniqueness, integrity, persistence, and trustworthiness, regardless of the identifier's application domain, the scope of which has expanded significantly in the past two decades. Since many PID systems have been largely conceived and developed by small communities, or even a single organisation, they have faced challenges in gaining widespread adoption and, most importantly, the ability to survive change of technology. This has left a legacy of identifiers that still exist and are being used but which have lost their resolution service. We believe that one of the causes of once successful PID systems fading is their reliance on a centralised technical infrastructure or a governing authority. Golodoniuc et al. (2016) proposed an approach to the development of PID systems that combines the use of (a) the Handle system, as a distributed system for the registration and first-degree resolution of persistent identifiers, and (b) the PID Service (Golodoniuc et al., 2015), to enable fine-grained resolution to different information object representations. The proposed approach solved the problem of guaranteed first-degree resolution of identifiers, but left fine-grained resolution and information delivery under the control of a single authoritative source, posing risk to the long-term availability of information resources. Herein, we develop these approaches further and explore the potential of large-scale decentralisation at all levels: (i) persistent identifiers and information resources registration; (ii) identifier resolution; and (iii) data delivery. To achieve large-scale decentralisation

  1. Cognitive science contributions to decision science.

    Science.gov (United States)

    Busemeyer, Jerome R

    2015-02-01

    This article briefly reviews the history and interplay between decision theory, behavioral decision-making research, and cognitive psychology. The review reveals the increasingly important impact that psychology and cognitive science have on decision science. One of the main contributions of cognitive science to decision science is the development of dynamic models that describe the cognitive processes that underlay the evolution of preferences during deliberation phase of making a decision. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Human Resource Development's Contribution to Continuous Improvement

    DEFF Research Database (Denmark)

    Jørgensen, Frances; Hyland, Paul

    2007-01-01

    Continuous Improvement (CI) is an approach to organizational change that requires active involvement of skilled and motivated employees, which implies an important role for HRD practitioners. The findings from a literature review and a survey of 168 Danish manufacturing companies indicate however...... that HRD is rarely integrated with CI. The paper contributes by offering a model that depicts how HR and HRD functions could be exploited to support successful CI development and implementation....

  3. Estimation of minimum sample size for identification of the most important features: a case study providing a qualitative B2B sales data set

    Directory of Open Access Journals (Sweden)

    Marko Bohanec

    2017-01-01

    Full Text Available An important task in machine learning is to reduce data set dimensionality, which in turn contributes to reducing computational load and data collection costs, while improving human understanding and interpretation of models. We introduce an operational guideline for determining the minimum number of instances sufficient to identify correct ranks of features with the highest impact. We conduct tests based on qualitative B2B sales forecasting data. The results show that a relatively small instance subset is sufficient for identifying the most important features when rank is not important.

  4. The contribution of fusion to sustainable development

    International Nuclear Information System (INIS)

    Ward, D.J.

    2007-01-01

    The world demand for energy is projected to more than double over the next 50 years, indeed this will be essential to bring much of the world out of poverty. At the same time there is increasing pressure to substantially reduce atmospheric pollution, most notably of carbon dioxide. Together, these conflicting goals drive a need to produce enormous amounts of non-carbon energy supply, much greater than our total present energy supply. This presents a huge challenge. As one of very few options for large-scale, non-carbon future supply of energy, fusion has the potential to make an important contribution to sustained energy supplies. Fusion's advantages of large fuel reserves, low atmospheric emissions and high levels of safety make it an important consideration in future energy strategies. Conceptual designs of fusion power plants have been optimised against safety and environmental criteria; the results are described here and the outcomes compared with other energy sources. To make a contribution to sustainable development, fusion must be economically viable in a future energy market. The calculated costs of electricity from fusion show that, particularly in an energy market where environmental constraints are playing an increasing role, fusion can make an important contribution

  5. Revisiting the importance of childhood activity | van Rensburg ...

    African Journals Online (AJOL)

    intensity exercise every day of the week. This article highlights the importance of formalised paediatric exercise programmes in disease prevention and health promotion. A healthy and happy adolescent population ultimately contributes to an ...

  6. 158 economic importance of farmed parkland products to livelihood

    African Journals Online (AJOL)

    Tersor

    42.5% opined that contribution of parkland products was high to their livelihood sustenance. The other ..... mg/kg, which also helps inlow blood pressure, enhance immunity ... social importance as alkaloids, essential oils and phenolics derived ...

  7. EVALUATION OF SIGNIFICANT ANTHROPOGENIC SOURCES OF RADIATIVELY IMPORTANT TRACE GASES

    Science.gov (United States)

    The report is an initial evaluation of significant anthropogenic sources of radiatively important trace gases. missions of greenhouse gases from human activities--including fossil fuel combustion, industrial/agricultural activities, and transportation--contribute to the increasin...

  8. Important Issues in Ecotoxicological Investigations Using Earthworms.

    Science.gov (United States)

    Velki, Mirna; Ečimović, Sandra

    The importance and beneficial effects of earthworms on soil structure and quality is well-established. In addition, earthworms have proved to be important model organisms for investigation of pollutant effects on soil ecosystems. In ecotoxicological investigations effects of various pollutants on earthworms were assessed. But some important issues regarding the effects of pollutants on earthworms still need to be comprehensively addressed. In this review several issues relevant to soil ecotoxicological investigations using earthworms are emphasized and guidelines that should be adopted in ecotoxicological investigations using earthworms are given. The inclusion of these guidelines in ecotoxicological studies will contribute to the better quantification of impacts of pollutants and will allow more accurate prediction of the real field effects of pollutants to earthworms.

  9. Aspects of signaling hazards and of identifying opportunities in crisis situations

    Directory of Open Access Journals (Sweden)

    Ion IMBRESCU

    2012-12-01

    Full Text Available This present research attempts to highlight some causes that have led to the current crisis, the role and importance of signals in anticipating events that characterize a situation of crisis, the need for interpreting these signals not only based on the economic theory but also on interdisciplinary methods and theories. The threats that may occur in situations of crisis should be identified properly, as well as opportunities, in order that the measures that are to be taken at macroeconomic level could be imbedded in the economic policies so as to contribute to improving the macroeconomic decisions and to successfully achieve the objectives already set.

  10. Identifying tier one key suppliers.

    Science.gov (United States)

    Wicks, Steve

    2013-01-01

    In today's global marketplace, businesses are becoming increasingly reliant on suppliers for the provision of key processes, activities, products and services in support of their strategic business goals. The result is that now, more than ever, the failure of a key supplier has potential to damage reputation, productivity, compliance and financial performance seriously. Yet despite this, there is no recognised standard or guidance for identifying a tier one key supplier base and, up to now, there has been little or no research on how to do so effectively. This paper outlines the key findings of a BCI-sponsored research project to investigate good practice in identifying tier one key suppliers, and suggests a scalable framework process model and risk matrix tool to help businesses effectively identify their tier one key supplier base.

  11. Identifying the core competencies of mental health telephone triage.

    Science.gov (United States)

    Sands, Natisha; Elsom, Stephen; Gerdtz, Marie; Henderson, Kathryn; Keppich-Arnold, Sandra; Droste, Nicolas; Prematunga, Roshani K; Wereta, Zewdu W

    2013-11-01

    The primary aim of this study was to identify the core competencies of mental health telephone triage, including key role tasks, skills, knowledge and responsibilities, in which clinicians are required to be competent to perform safe and effective triage. Recent global trends indicate an increased reliance on telephone-based health services to facilitate access to health care across large populations. The trend towards telephone-based health services has also extended to mental health settings, evidenced by the growing number of mental health telephone triage services providing 24-hour access to specialist mental health assessment and treatment. Mental health telephone triage services are critical to the early identification of mental health problems and the provision of timely, appropriate interventions. In spite of the rapid growth in mental health telephone triage and the important role these services play in the assessment and management of mental illness and related risks, there has been very little research investigating this area of practice. An observational design was employed to address the research aims. Structured observations (using dual wireless headphones) were undertaken on 197 occasions of mental health telephone triage over a three-month period from January to March 2011. The research identified seven core areas of mental health telephone triage practice in which clinicians are required to be competent in to perform effective mental health telephone triage, including opening the call; performing mental status examination; risk assessment; planning and action; termination of call; referral and reporting; and documentation. The findings of this research contribute to the evidence base for mental health telephone triage by articulating the core competencies for practice. The mental health telephone triage competencies identified in this research may be used to define an evidence-based framework for mental health telephone triage practice that aims to

  12. Persistent Identifiers, Discoverability and Open Science (Communication)

    Science.gov (United States)

    Murphy, Fiona; Lehnert, Kerstin; Hanson, Brooks

    2016-04-01

    Early in 2016, the American Geophysical Union announced it was incorporating ORCIDs into its submission workflows. This was accompanied by a strong statement supporting the use of other persistent identifiers - such as IGSNs, and the CrossRef open registry 'funding data'. This was partly in response to funders' desire to track and manage their outputs. However the more compelling argument, and the reason why the AGU has also signed up to the Center for Open Science's Transparency and Openness Promotion (TOP) Guidelines (http://cos.io/top), is that ultimately science and scientists will be the richer for these initiatives due to increased opportunities for interoperability, reproduceability and accreditation. The AGU has appealed to the wider community to engage with these initiatives, recognising that - unlike the introduction of Digital Object Identifiers (DOIs) for articles by CrossRef - full, enriched use of persistent identifiers throughout the scientific process requires buy-in from a range of scholarly communications stakeholders. At the same time, across the general research landscape, initiatives such as Project CRediT (contributor roles taxonomy), Publons (reviewer acknowledgements) and the forthcoming CrossRef DOI Event Tracker are contributing to our understanding and accreditation of contributions and impact. More specifically for earth science and scientists, the cross-functional Coalition for Publishing Data in the Earth and Space Sciences (COPDESS) was formed in October 2014 and is working to 'provide an organizational framework for Earth and space science publishers and data facilities to jointly implement and promote common policies and procedures for the publication and citation of data across Earth Science journals'. Clearly, the judicious integration of standards, registries and persistent identifiers such as ORCIDs and International Geo Sample Numbers (IGSNs) to the research and research output processes is key to the success of this venture

  13. Football refereeing: Identifying innovative methods

    Directory of Open Access Journals (Sweden)

    Reza MohammadKazemi

    2014-08-01

    Full Text Available The aim of the present study is to identify the potentials innovation in football industry. Data were collected from 10 national and international referees, assistant referees and referees’ supervisors in Iran. In this study, technological innovations are identified that assist better refereeing performances. The analysis revealed a significant relationship between using new technologies and referees ‘performance. The results indicate that elite referees, assistant referees and supervisors agreed to use new technological innovations during the game. According to their comments, this kind of technology causes the referees’ performance development.

  14. The importance of theories of knowledge

    DEFF Research Database (Denmark)

    Hjørland, Birger

    2011-01-01

    fruitful improvements for research in information seeking, browsing, and related phenomena. It is part of my ongoing publication of articles about philosophical issues in IS and it is intended to be accompanied by analyses of other examples of contributions to core issues in IS. Although it is mainly...... and should not be understood as random exploratory processes, but rather it should be seen as a kind of orienting strategy governed by people’s metatheories or “paradigms.” Information professionals should know how different metatheories are distributed in the information ecology and, thus, be able to help......The study on information science (IS) by Bates (2007) is an important contribution to the literature on browsing in IS. It is explicitly based on “behavioural science.” I use this article as the point of departure for demonstrating how more social and interpretative understandings may provide...

  15. Identifying public expectations of genetic biobanks.

    Science.gov (United States)

    Critchley, Christine; Nicol, Dianne; McWhirter, Rebekah

    2017-08-01

    Understanding public priorities for biobanks is vital for maximising utility and efficiency of genetic research and maintaining respect for donors. This research directly assessed the relative importance the public place on different expectations of biobanks. Quantitative and qualitative results from a national sample of 800 Australians revealed that the majority attributed more importance to protecting privacy and ethical conduct than maximising new healthcare benefits, which was in turn viewed as more important than obtaining specific consent, benefit sharing, collaborating and sharing data. A latent class analysis identified two distinct classes displaying different patterns of expectations. One placed higher priority on behaviours that respect the donor ( n = 623), the other on accelerating science ( n = 278). Additional expectations derived from qualitative data included the need for biobanks to be transparent and to prioritise their research focus, educate the public and address commercialisation.

  16. Importance measures and resource allocation

    International Nuclear Information System (INIS)

    Guey, C.N.; Morgan, T.; Hughes, E.A.

    1987-01-01

    This paper discusses various importance measures and their practical relevance to allocating resources. The characteristics of importance measures are illustrated through simple examples. Important factors associated with effectively allocating resources to improve plant system performance or to prevent system degradation are discussed. It is concluded that importance measures are only indicative of and not equal to the risk significance of a component, system, or event. A decision framework is suggested to provide a comprehensive basis for resource allocation

  17. Import-Export Business Plan

    OpenAIRE

    Asad, Muhammad

    2014-01-01

    Import export businesses, also known as international trading, are one of the hottest commercial trends of this decade. Since the owner of an import export enterprise, can work as a distributor by focusing on exporting and importing goods and services that cannot be obtained on national soil. With a rapidly growing population of about 150 million, Pakistan is a major country, recognized by the international community, and is one of the most important actors in the Islamic world. Based on its ...

  18. Website Policies / Important Links | DOepatents

    Science.gov (United States)

    Links Website Policies / Important Links Javascript Not Enabled OSTI Security Website Policies and first) Publication Date (oldest first) Close Clear All Find DOepatents Website Policies / Important Important Links Some links on this page may take you to non-federal websites. Their policies may differ from

  19. Waste Management in Industrial Construction: Investigating Contributions from Industrial Ecology

    Directory of Open Access Journals (Sweden)

    Larissa A. R. U. Freitas

    2017-07-01

    Full Text Available The need for effective construction waste management is growing in importance, due to the increasing generation of construction waste and to its adverse impacts on the environment. However, despite the numerous studies on construction waste management, recovery of construction waste through Industrial Symbiosis and the adoption of other inter-firm practices, comprised within Industrial Ecology field of study, have not been fully explored. The present research aims to investigate Industrial Ecology contributions to waste management in industrial construction. The waste management strategies adopted in two industrial construction projects in Brazil are analyzed. The main waste streams generated are identified, recycling and landfilling diversion rates are presented and waste recovery through Industrial Symbiosis is discussed. A SWOT analysis was carried out. Results demonstrate that 9% of the waste produced in one of the projects was recovered through Industrial Symbiosis, while in the other project, waste recovery through Industrial Symbiosis achieved the rate of 30%. These data reveal Industrial Symbiosis’ potential to reduce landfilling of industrial construction wastes, contributing to waste recovery in construction. In addition, results show that industrial construction projects can benefit from the following synergies common in Industrial Ecology place-based approaches: centralized waste management service, shared waste management infrastructure and administrative simplification.

  20. SOCIODEMOGRAPHIC DATA USED FOR IDENTIFYING ...

    Science.gov (United States)

    Due to unique social and demographic characteristics, various segments of the population may experience exposures different from those of the general population, which, in many cases, may be greater. When risk assessments do not characterize subsets of the general population, the populations that may experience the greatest risk remain unidentified. When such populations are not identified, the social and demographic data relevant to these populations is not considered when preparing exposure estimates, which can underestimate exposure and risk estimates for at-risk populations. Thus, it is necessary for risk or exposure assessors characterizing a diverse population, to first identify and then enumerate certain groups within the general population who are at risk for greater contaminant exposures. The document entitled Sociodemographic Data Used for Identifying Potentially Highly Exposed Populations (also referred to as the Highly Exposed Populations document), assists assessors in identifying and enumerating potentially highly exposed populations. This document presents data relating to factors which potentially impact an individual or group's exposure to environmental contaminants based on activity patterns (how time is spent), microenvironments (locations where time is spent), and other socio-demographic data such as age, gender, race and economic status. Populations potentially more exposed to various chemicals of concern, relative to the general population

  1. SNP interaction pattern identifier (SIPI)

    DEFF Research Database (Denmark)

    Lin, Hui Yi; Chen, Dung Tsa; Huang, Po Yu

    2017-01-01

    Motivation: Testing SNP-SNP interactions is considered as a key for overcoming bottlenecks of genetic association studies. However, related statistical methods for testing SNP-SNP interactions are underdeveloped. Results: We propose the SNP Interaction Pattern Identifier (SIPI), which tests 45...

  2. Identifying the Gifted Child Humorist.

    Science.gov (United States)

    Fern, Tami L.

    1991-01-01

    This study attempted to identify gifted child humorists among 1,204 children in grades 3-6. Final identification of 13 gifted child humorists was determined through application of such criteria as funniness, originality, and exemplary performance or product. The influence of intelligence, development, social factors, sex differences, family…

  3. Identifying high-risk medication

    DEFF Research Database (Denmark)

    Sædder, Eva; Brock, Birgitte; Nielsen, Lars Peter

    2014-01-01

    salicylic acid, and beta-blockers; 30 drugs or drug classes caused 82 % of all serious MEs. The top ten drugs involved in fatal events accounted for 73 % of all drugs identified. CONCLUSION: Increasing focus on seven drugs/drug classes can potentially reduce hospitalizations, extended hospitalizations...

  4. Adaptive Importance Sampling with a Rapidly Varying Importance Function

    International Nuclear Information System (INIS)

    Booth, Thomas E.

    2000-01-01

    It is known well that zero-variance Monte Carlo solutions are possible if an exact importance function is available to bias the random walks. Monte Carlo can be used to estimate the importance function. This estimated importance function then can be used to bias a subsequent Monte Carlo calculation that estimates an even better importance function; this iterative process is called adaptive importance sampling.To obtain the importance function, one can expand the importance function in a basis such as the Legendre polynomials and make Monte Carlo estimates of the expansion coefficients. For simple problems, Legendre expansions of order 10 to 15 are able to represent the importance function well enough to reduce the error geometrically by ten orders of magnitude or more. The more complicated problems are addressed in which the importance function cannot be represented well by Legendre expansions of order 10 to 15. In particular, a problem with a cross-section notch and a problem with a discontinuous cross section are considered

  5. Identifying the factors underlying discontinuation of triptans.

    Science.gov (United States)

    Wells, Rebecca E; Markowitz, Shira Y; Baron, Eric P; Hentz, Joseph G; Kalidas, Kavita; Mathew, Paul G; Halker, Rashmi; Dodick, David W; Schwedt, Todd J

    2014-02-01

    .3, 3.8]). Having a triptan prescribed by a specialist and using at least 1 other abortive medication with the triptan were associated with a decreased likelihood of triptan discontinuation (0.41, [0.2-0.7] and 0.44 [0.3, 0.8], respectively). As expected, discontinuation was most correlated with lack of efficacy, but other important factors associated with those who had discontinued use included greater migraine-related disability, depression, and the use of opioids for migraine attacks. Compared with patients who had discontinued triptans, current triptan users felt more: educated about their triptan, control over their migraine attacks, and confidence in their prescribing provider. Current triptan users had their triptan prescribed by a specialist and used other abortive medications with their triptan more often compared with patients who had discontinued triptans. Given the cross-sectional nature of this study, we cannot determine if these factors contributed to triptan discontinuation or reflect the impact of such discontinuation. Interventions that address modifiable risk factors for triptan discontinuation may decrease the likelihood of triptan discontinuation and thus improve overall migraine control. Because lack of efficacy was most strongly associated with triptan discontinuation, future research should determine why triptans are effective for some patients but not others. © 2013 American Headache Society.

  6. ECN contributions to GLOBAL `95

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-06-01

    This report contains the 9 contributions of the Netherlands Energy Research Foundation ECN to the international conference on evaluation of emerging nuclear fuel cycle systems, GLOBAL `95, held in Versailles, France, on September 11-14, 1995. (orig./GL).

  7. Uncapacitated facility location problems: contributions

    Directory of Open Access Journals (Sweden)

    Galvão Roberto Diéguez

    2004-01-01

    Full Text Available The objective of the present paper is to review my personal contributions in the field of uncapacitated facility location problems. These contributions took place throughout my academic career, from the time I was a Ph.D. student at Imperial College to the present day. They cover approximately 30 years, from 1973 to 2003; they address: algorithms developed for the p-median problem and for a general formulation of uncapacitated location problems; the study of dynamic location models; covering and hierarchical location problems; queuing-based probabilistic location models. The contributions encompass theoretical developments, computational algorithms and practical applications. All work took place in an academic environment, with the invaluable collaboration of colleagues (both in Brazil and abroad and research students at COPPE. Each section in the paper is dedicated to a topic that involves a personal contribution. Every one of them is placed within the context of the existing literature.

  8. ECN contributions to GLOBAL '95

    International Nuclear Information System (INIS)

    1995-06-01

    This report contains the 9 contributions of the Netherlands Energy Research Foundation ECN to the international conference on evaluation of emerging nuclear fuel cycle systems, GLOBAL '95, held in Versailles, France, on September 11-14, 1995. (orig./GL)

  9. [Mycoviruses and importance in mycology].

    Science.gov (United States)

    Keçeli, Sema Aşkın

    2017-10-01

    Opportunistic fungal infections like invasive candidiasis and aspergillozis have high mortality rate particularly in immunosupressive patients. The rate of therapy success with antifungal agents is usually low. Although immunotherapy methods have been developed to increase the host response against antifungals, there has been a need for new antifungal therapeutic agents in the treatment of invasive aspergillozis and other opportunistic fungal infections. Mycoviruses are the viruses that specifically infect fungi. The use of mycoviruses in the treatment of invasive fungal infections has not been suggested yet. However, as mentioned in this review, the researches about the use of mycoviruses as a therapeutic agent have been still carried on. Mycoviruses have no infectivity as free particules. Many of them have RNA genome. They are classified as: Fungi containing "double stranded (ds) RNA, ds DNA or single stranded RNA". Although most of them are found in plant pathogenic fungi, they are also found in human pathogenic fungi. In most of the mycoviruses identified up to now, dsRNA genome are present. Mycoviruses that can be pathogenic for human and carrying dsRNA genome have been classified as Partitiviridae, Totiviridae, Chrysoviridae, Reoviridae and Hypoviridae. A part of mycoviruses may not cause any sign of infection in fungal host. The other part of mycoviruses causes hypovirulence or lethal effect. When hypovirulence occured in fungi, the observed effects are the decrease in pigmentation, mycelium formation, asexual sporulation, growing rate and the loss of fertility. The transfer of mycovirus to fungi may occur by intracellular or extracellular way. The transfer of genetic content to fungi occurs in two way: transformation and transfection. In both ways, there is a need for a spheroblast that has no cell wall. There are various scenarios about mycoviruses for the their use in the treatment. In the first scenario, the transfer of selective mycovirus is ensured by

  10. [Breastfeeding: the importance of intervening].

    Science.gov (United States)

    Aguiar, Hélder; Silva, Ana Isabel

    2011-12-01

    Breast milk is considered by the WHO the ideal food for the first months of life. Although health professionals are aware of recommendations, high rates of drop-outs have been identified in Portugal. A false notion of hypogalactia is the major factor for early termination, which is allied to the technical difficulties of the feeding. Health professionals, often lacking training in the area, may have difficulty in reassuring mothers in these situations. In Portugal, at the 3rd month, most mothers stop breastfeeding by indication of their medical assistant. Gather evidence about the advantages of breast-feeding compared to artificial milk, and establish useful strategies in clinical practice to avoid early withdrawal. A survey was conducted for articles from the last six years in the major sites of evidence-based medicine and reference sites (Pubmed, Cochrane, National Guideline Clearinghouse, Tripdatabase, WHO). Breast-feeding is clearly associated with benefits to the infant, including significant protective effects for gastrointestinal infections (64%), middle ear (23- 50%), severe respiratory infections (73%) and for acute lymphocytic leukemia (19%) and sudden death syndrome in infants (36%). We also found long-term benefits, such as for obesity (7-24%) and other cardiovascular risk factors in adulthood. The mother also benefits from its protective effect for cancers of the breast and ovary, and diabetes mellitus type 2 as also, proportionate to the duration of breastfeeding. Health professionals have an important role in the initiation and continuation of breastfeeding. The notion of its advantages, the communication prior to delivery, accessibility support and training in technical aspects of correct picks are the proven strategies for evidence explored in the article. Breast milk contains several unique and exclusive elements, orchestrators of its health benefits. Postnatal period is critical to the development of neuro--hypothalamic circuits involved in

  11. Forest habitat conservation in Africa using commercially important insects.

    Science.gov (United States)

    Raina, Suresh Kumar; Kioko, Esther; Zethner, Ole; Wren, Susie

    2011-01-01

    African forests, which host some of the world's richest biodiversity, are rapidly diminishing. The loss of flora and fauna includes economically and socially important insects. Honey bees and silk moths, grouped under commercial insects, are the source for insect-based enterprises that provide income to forest-edge communities to manage the ecosystem. However, to date, research output does not adequately quantify the impact of such enterprises on buffering forest ecosystems and communities from climate change effects. Although diseases/pests of honey bees and silk moths in Africa have risen to epidemic levels, there is a dearth of practical research that can be utilized in developing effective control mechanisms that support the proliferation of these commercial insects as pollinators of agricultural and forest ecosystems. This review highlights the critical role of commercial insects within the environmental complexity of African forest ecosystems, in modern agroindustry, and with respect to its potential contribution to poverty alleviation and pollination services. It identifies significant research gaps that exist in understanding how insects can be utilized as ecosystem health indicators and nurtured as integral tools for important socioeconomic and industrial gains.

  12. Importance of flexible bronchoscopy in decannulation of tracheostomy patients

    Directory of Open Access Journals (Sweden)

    Leonardo Brand Rodrigues

    Full Text Available OBJECTIVE: To evaluate the importance of flexible bronchoscopy in tracheostomy patients in the process of decannulation to assess the incidence and types of laryngotracheal injury and compare the presence of such lesions with clinical criteria used for decannulation. METHODS: We studied 51 tracheostomized patients aged between 19 and 87 years, with tracheal stent for a mean of 46 ± 28 days and with clinical criteria for decannulation. They were submitted to tracheostomy tube occlusion tolerance testfor 24 hours, and then to flexible bronchoscopy. We described and classified the diagnosed laryngotracheal changes. We compared the clinical criteria for decannulation indication with the bronchoscopy-diagnosed laryngotracheal injuries that contraindicated decannulation. We identified the factors that could interfere in decannulation and evaluated the importance of bronchoscopy as part of the process. RESULTS: Forty (80.4% patients had laryngotracheal alterations. Of the 40 patients considered clinically fit to decannulation, eight (20% (p = 0.0007 presented with laryngotracheal injuries at bronchoscopy that contraindicated the procedure. The most frequent laryngeal alteration was vocal cords lesion, in 15 (29% individuals, and granuloma, the most prevalent tracheal lesion, in 14 (27.5% patients. CONCLUSION: flexible bronchoscopy showed a large number of laryngotracheal injuries, the most frequent being the vocal cords injury in the larynx and the granuloma in the trachea, which contributed to increase the decannulation procedure safety.

  13. Walter Isard's Contributions to Environmental Economics and Ecological Economics

    NARCIS (Netherlands)

    Rose, Adam; Folmer, Henk; Nijkamp, Peter

    This article summarizes Walter Isard's important contributions to environmental economics and ecological economics. The former is the traditional field that incorporates some limited aspects of the environment into neoclassical economic theory, while the latter is a more comprehensive integration of

  14. Understanding How Components of Organisations Contribute to Attacks

    DEFF Research Database (Denmark)

    Gu, Min; Aslanyan, Zaruhi; Probst, Christian W.

    2016-01-01

    Attacks on organisations today explore many different layers, including buildings infrastructure, IT infrastructure, and human factor – the physical, virtual, and social layer. Identifying possible attacks, understanding their impact, and attributing their origin and contributing factors is diffi......Attacks on organisations today explore many different layers, including buildings infrastructure, IT infrastructure, and human factor – the physical, virtual, and social layer. Identifying possible attacks, understanding their impact, and attributing their origin and contributing factors...... is difficult. Recently, system models have been used for automatically identifying possible attacks on the modelled organisation. The generated attacks consider all three layers, making the contribution of building infrastructure, computer infrastructure, and humans (insiders and outsiders) explicit. However......, this contribution is only visible in the attack trees as part of the performed steps; it cannot be mapped back to the model directly since the actions usually involve several elements (attacker and targeted actor or asset). Especially for large attack trees, understanding the relations between several model...

  15. Machine learning for identifying botnet network traffic

    DEFF Research Database (Denmark)

    Stevanovic, Matija; Pedersen, Jens Myrup

    2013-01-01

    . Due to promise of non-invasive and resilient detection, botnet detection based on network traffic analysis has drawn a special attention of the research community. Furthermore, many authors have turned their attention to the use of machine learning algorithms as the mean of inferring botnet......-related knowledge from the monitored traffic. This paper presents a review of contemporary botnet detection methods that use machine learning as a tool of identifying botnet-related traffic. The main goal of the paper is to provide a comprehensive overview on the field by summarizing current scientific efforts....... The contribution of the paper is three-fold. First, the paper provides a detailed insight on the existing detection methods by investigating which bot-related heuristic were assumed by the detection systems and how different machine learning techniques were adapted in order to capture botnet-related knowledge...

  16. Keeping quality of imported dried fish

    OpenAIRE

    Goonewardene, I.S.R.; Etoh, S.

    1980-01-01

    All imported salted, dried fish samples tested had a salt content below 30% and above 12% and hence met requirements of the proposed standard. Also samples without quality cut tested had a greater salt content than that with quality cut. This indicates that salt contributes to protecting dried fish and hence may be endorsed by sensory evaluation to a certain extent. Samples with quality cut had more moisture than that without quality cut. But all samples with and without quality cut had a moi...

  17. The GMOS contributions to GEOSS

    Directory of Open Access Journals (Sweden)

    Pirrone N.

    2013-04-01

    Full Text Available The Group on Earth Observations (GEO is coordinating efforts to build a Global Earth Observation System of Systems (GEOSS. GEOSS is aimed at providing decision-support tools to a wide variety of users. These tools are addressed toward nine social benefit areas (SBAs that are of critical importance to society. These nine areas are addressed through the GEOSS Common Infrastructure. To support the implementation of the GEOSS Work Plan, two tasks within the Health SBA have been launched: i HE-02-C1: the Global Mercury Observation System and ii HE-02-C2: the Global Monitoring of Persistent Organic Pollutants, Emerging Contaminants and Global Change Indicators. The task HE-02-C1aims to: Increase the availability of Earth observation and information needed to both track pollutants and anticipate changes to the environment. Harmonize standard operating procedures for monitoring pollutants and their compounds in air, water, soil, sediments, vegetation and biota. Understand the temporal and spatial patterns of pollutant transport, deposition to, and evasion from, terrestrial and aquatic ecosystems. Support the validation of regional and global atmospheric pollutant models for use in evaluating different policy options. Evaluate the effectiveness of international efforts to reduce pollutant releases. The overarching goal of HE-02-C1 is the development of a global observation system for mercury, realized by harmonizing standard operating procedures for monitoring mercury and its compounds in air, precipitation samples, surface water, soil, sediments, vegetation and biota. The sharing of data from this network, which allows access to data that is comparable, long-term, and from a large number of ground-based and off-shore sites, will help us understand temporal and spatial patterns of mercury transport and deposition to, and evasion from, terrestrial and aquatic ecosystems. The data produced (at 40 ground-based sites, off-shore locations throughout the

  18. Factors contributing to nurse job satisfaction in the acute hospital setting: a review of recent literature.

    Science.gov (United States)

    Hayes, Bronwyn; Bonner, Ann; Pryor, Julie

    2010-10-01

    To explore and discuss from recent literature the common factors contributing to nurse job satisfaction in the acute hospital setting. Nursing dissatisfaction is linked to high rates of nurses leaving the profession, poor morale, poor patient outcomes and increased financial expenditure. Understanding factors that contribute to job satisfaction could increase nurse retention. A literature search from January 2004 to March 2009 was conducted using the keywords nursing, (dis)satisfaction, job (dis)satisfaction to identify factors contributing to satisfaction for nurses working in acute hospital settings. This review identified 44 factors in three clusters (intra-, inter- and extra-personal). Job satisfaction for nurses in acute hospitals can be influenced by a combination of any or all of these factors. Important factors included coping strategies, autonomy, co-worker interaction, direct patient care, organizational policies, resource adequacy and educational opportunities. Research suggests that job satisfaction is a complex and multifactorial phenomenon. Collaboration between individual nurses, their managers and others is crucial to increase nursing satisfaction with their job. Recognition and regular reviewing by nurse managers of factors that contribute to job satisfaction for nurses working in acute care areas is pivotal to the retention of valued staff. © 2010 The Authors. Journal compilation © 2010 Blackwell Publishing Ltd.

  19. Device for identifying fuel assembly

    International Nuclear Information System (INIS)

    Imai, Tetsuo; Miyazawa, Tatsuo.

    1982-01-01

    Purpose: To accurately identify a symbol printed on a hanging tool at the upper part of a fuel assembly. Constitution: Optical fibers are bundled to prepare a detector which is disposed at a predetermined position on a hanging tool. This position is set by a guide. Thus, the light emitted from an illumination lamp arrives at the bottom of a groove printed on the upper surface of the tool, and is divided into a weak light reflected upwardly and a strong light reflected on the surface lower than the groove. When these lights are received by the optical fibers, the fibers corresponding to the grooved position become dark, and the fibers corresponding to the ungrooved position become bright. Since the fuel assembly is identified by the dark and bright of the optical fibers as symbols, different machining can be performed every fuel assembly on the upper surface of the tool. (Yoshihara, H.)

  20. Identifying patient risks during hospitalization

    Directory of Open Access Journals (Sweden)

    Lucélia Ferreira Lima

    2008-12-01

    Full Text Available Objective: To identify the risks reported at a public institution andto know the main patient risks from the nursing staff point of view.Methods: A retrospective, descriptive and exploratory study. Thesurvey was developed at a hospital in the city of Taboão da Serra, SãoPaulo, Brazil. The study included all nurses working in care areas whoagreed to participate in the study. At the same time, sentinel eventsoccurring in the period from July 2006 to July 2007 were identified.Results: There were 440 sentinel events reported, and the main risksincluded patient falls, medication errors and pressure ulcers. Sixty-fivenurses were interviewed. They also reported patient falls, medicationerrors and pressure ulcers as the main risks. Conclusions: Riskassessment and implementation of effective preventive actions arenecessary to ensure patient’s safety. Involvement of a multidisciplinaryteam is one of the steps for a successful process.

  1. Identifying High Performance ERP Projects

    OpenAIRE

    Stensrud, Erik; Myrtveit, Ingunn

    2002-01-01

    Learning from high performance projects is crucial for software process improvement. Therefore, we need to identify outstanding projects that may serve as role models. It is common to measure productivity as an indicator of performance. It is vital that productivity measurements deal correctly with variable returns to scale and multivariate data. Software projects generally exhibit variable returns to scale, and the output from ERP projects is multivariate. We propose to use Data Envelopment ...

  2. How People Interpret Healthy Eating: Contributions of Qualitative Research

    Science.gov (United States)

    Bisogni, Carole A.; Jastran, Margaret; Seligson, Marc; Thompson, Alyssa

    2012-01-01

    Objective: To identify how qualitative research has contributed to understanding the ways people in developed countries interpret healthy eating. Design: Bibliographic database searches identified reports of qualitative, empirical studies published in English, peer-reviewed journals since 1995. Data Analysis: Authors coded, discussed, recoded, and…

  3. Rural Women's Perceptions About Cancer Disparities and Contributing Factors: a Call to Communication.

    Science.gov (United States)

    Molina, Yamile; Zimmermann, Kristine; Carnahan, Leslie R; Paulsey, Ellen; Bigman, Cabral A; Khare, Manorama M; Zahnd, Whitney; Jenkins, Wiley D

    2017-02-27

    Rural cancer disparities are increasingly documented in the USA. Research has identified and begun to address rural residents' cancer knowledge and behaviors, especially among women. Little, however, is known about rural female residents' awareness of cancer inequities and perceived contributing factors affecting them and their families. The purpose of this study was to address these gaps in the literature via a secondary analysis of qualitative needs assessment in Illinois' rural southernmost seven counties, a geographic region with relatively high rates of cancer incidence, morbidity, and mortality. A convenience sample of 202 rural adult female residents was recruited and participated in 26 focus groups, with 3-13 women per group. Inductive content analysis, guided by the principle of constant comparison, was used to analyze the qualitative data. Most respondents indicated their awareness of disproportionate cancer burden in their communities. Individual-level behaviors and environmental toxins were identified as contributing factors. Interestingly, however, environmental toxins were more often discussed as factors contributing to geographic differences, whereas individual-level behaviors were noted as important for overall cancer prevention and control. This study provides important insight into female rural residents' perspectives and offers novel venues for educational programs and research in the context of communication to eliminate disparities.

  4. Modeling secondary accidents identified by traffic shock waves.

    Science.gov (United States)

    Junhua, Wang; Boya, Liu; Lanfang, Zhang; Ragland, David R

    2016-02-01

    The high potential for occurrence and the negative consequences of secondary accidents make them an issue of great concern affecting freeway safety. Using accident records from a three-year period together with California interstate freeway loop data, a dynamic method for more accurate classification based on the traffic shock wave detecting method was used to identify secondary accidents. Spatio-temporal gaps between the primary and secondary accident were proven be fit via a mixture of Weibull and normal distribution. A logistic regression model was developed to investigate major factors contributing to secondary accident occurrence. Traffic shock wave speed and volume at the occurrence of a primary accident were explicitly considered in the model, as a secondary accident is defined as an accident that occurs within the spatio-temporal impact scope of the primary accident. Results show that the shock waves originating in the wake of a primary accident have a more significant impact on the likelihood of a secondary accident occurrence than the effects of traffic volume. Primary accidents with long durations can significantly increase the possibility of secondary accidents. Unsafe speed and weather are other factors contributing to secondary crash occurrence. It is strongly suggested that when police or rescue personnel arrive at the scene of an accident, they should not suddenly block, decrease, or unblock the traffic flow, but instead endeavor to control traffic in a smooth and controlled manner. Also it is important to reduce accident processing time to reduce the risk of secondary accident. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Sources and contributions of wood smoke during winter in London

    Science.gov (United States)

    Crilley, Leigh; Bloss, William; Yin, Jianxin; Beddows, David; Harrison, Roy; Zotter, Peter; Prevot, Andre; Green, David

    2014-05-01

    Determining the contribution of wood smoke in large urban centres such as London is becoming increasingly important with the changing nature of domestic heating partly due to the installation of biomass burning heaters to meet renewable energy targets imposed by the EU and also a rise in so-called recreational burning for aesthetic reasons (Fuller et al., 2013). Recent work in large urban centres (London, Paris and Berlin) has demonstrated an increase in the contribution of wood smoke to ambient particles during winter that can at times exceed traffic emissions. In Europe, biomass burning has been identified as a major cause of exceedances of European air quality limits during winter (Fuller et al., 2013). In light of the changing nature of emissions in urban areas there is a need for on-going measurements to assess the impact of biomass burning in cities like London. Therefore we aimed to determine quantitatively the contribution of biomass burning in London and surrounding rural areas. We also aimed to determine whether local emissions or regional sources were the main source of biomass burning in London. Sources of wood smoke during winter in London were investigated at an urban background site (North Kensington) and two surrounding rural sites (Harwell and Detling) by analysing selected wood smoke chemical tracers. Concentrations of levoglucosan, elemental carbon (EC), organic carbon (OC) and K+ were generally well correlated, indicating a similar source of these species at the three sites. Based on the conversion factor for levoglucosan, mean wood smoke mass at Detling, North Kensington and Harwell was 0.78, 0.87 and 1.0 µg m-3, respectively. At all the sites, biomass burning was found to be a source of OC and EC, with the largest source of OC and EC found to be secondary organic aerosols and traffic emissions, respectively. Peaks in levoglucosan concentrations at the sites were observed to coincide with low ambient temperature, suggesting domestic heating as

  6. Factors contributing to the waste generation in building projects of Pakistan

    International Nuclear Information System (INIS)

    Memon, N.A.; Memon, F.A.

    2016-01-01

    Generation of construction waste is a worldwide issue that concerns not only governments but also the building actors involved in construction industry. For developing countries like Pakistan, rising levels of waste generation, due to the rapid growth of towns and cities have become critical issue. Therefore this study is aimed to detect the factors, which are the main causes of construction waste generation. Questionnaire survey has been conducted to achieve this task and RIW (Relative Importance Weight) method has been used to analyze the results of this study. The important factors contributing to the generation of construction as identified in this study are: frequent changes/ revision in design during construction process; poor scheduling; unavailability of storage; poor workmanship; poor layout; inefficient planning and scheduling of resources and lack of coordination among supervision staff deployed at site. Based on the identified factors, the study also has presented some suggestions for the reduction of construction waste in building construction projects of Pakistan. (author)

  7. Phenomena and parameters important to burnup credit

    International Nuclear Information System (INIS)

    Parks, C.V.; Dehart, M.D.; Wagner, J.C.

    2001-01-01

    Since the mid-1980s, a significant number of studies have been directed at understanding the phenomena and parameters important to implementation of burnup credit in out-of-reactor applications involving pressurized-water- reactor (PWR) spent fuel. The efforts directed at burnup credit involving boiling-water-reactor (BWR) spent fuel have been more limited. This paper reviews the knowledge and experience gained from work performed in the United States and other countries in the study of burnup credit. Relevant physics and analysis phenomenon are identified, and an assessment of their importance to burnup credit implementation for transport and dry cask storage is given. (author)

  8. A novel data mining method to identify assay-specific signatures in functional genomic studies

    Directory of Open Access Journals (Sweden)

    Guidarelli Jack W

    2006-08-01

    Full Text Available Abstract Background: The highly dimensional data produced by functional genomic (FG studies makes it difficult to visualize relationships between gene products and experimental conditions (i.e., assays. Although dimensionality reduction methods such as principal component analysis (PCA have been very useful, their application to identify assay-specific signatures has been limited by the lack of appropriate methodologies. This article proposes a new and powerful PCA-based method for the identification of assay-specific gene signatures in FG studies. Results: The proposed method (PM is unique for several reasons. First, it is the only one, to our knowledge, that uses gene contribution, a product of the loading and expression level, to obtain assay signatures. The PM develops and exploits two types of assay-specific contribution plots, which are new to the application of PCA in the FG area. The first type plots the assay-specific gene contribution against the given order of the genes and reveals variations in distribution between assay-specific gene signatures as well as outliers within assay groups indicating the degree of importance of the most dominant genes. The second type plots the contribution of each gene in ascending or descending order against a constantly increasing index. This type of plots reveals assay-specific gene signatures defined by the inflection points in the curve. In addition, sharp regions within the signature define the genes that contribute the most to the signature. We proposed and used the curvature as an appropriate metric to characterize these sharp regions, thus identifying the subset of genes contributing the most to the signature. Finally, the PM uses the full dataset to determine the final gene signature, thus eliminating the chance of gene exclusion by poor screening in earlier steps. The strengths of the PM are demonstrated using a simulation study, and two studies of real DNA microarray data – a study of

  9. Cellular signaling identifiability analysis: a case study.

    Science.gov (United States)

    Roper, Ryan T; Pia Saccomani, Maria; Vicini, Paolo

    2010-05-21

    Two primary purposes for mathematical modeling in cell biology are (1) simulation for making predictions of experimental outcomes and (2) parameter estimation for drawing inferences from experimental data about unobserved aspects of biological systems. While the former purpose has become common in the biological sciences, the latter is less common, particularly when studying cellular and subcellular phenomena such as signaling-the focus of the current study. Data are difficult to obtain at this level. Therefore, even models of only modest complexity can contain parameters for which the available data are insufficient for estimation. In the present study, we use a set of published cellular signaling models to address issues related to global parameter identifiability. That is, we address the following question: assuming known time courses for some model variables, which parameters is it theoretically impossible to estimate, even with continuous, noise-free data? Following an introduction to this problem and its relevance, we perform a full identifiability analysis on a set of cellular signaling models using DAISY (Differential Algebra for the Identifiability of SYstems). We use our analysis to bring to light important issues related to parameter identifiability in ordinary differential equation (ODE) models. We contend that this is, as of yet, an under-appreciated issue in biological modeling and, more particularly, cell biology. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  10. Contributions of Literature to Social Psychology

    Directory of Open Access Journals (Sweden)

    Anastasio Ovejero

    2012-11-01

    Full Text Available There are two main kind of psychology: a intuitive psychology, and an academic and professional psychology. These two psychologies are different, but they can make important reciprocals contributions. And the best of the intuitive psychology, that in my opinion is in the literature and overall in the romance, can be very useful for professional psychologists. The main end of this paper is to show how the social psychologists can learn from the intuitive psychology of the great romances. This contribution of the romance to the social psychology is, at least, at these two levels. At the level of construction of the subjectivity and the modern subject and the, therefore, of the psychology’s arise, and at the level of some concrete subjects studied by the psychologists (romantic love, jealousy, infidelity, compunction, emotions, vengeance, human relations…

  11. Bicycling-related accidents and factors contributing to injury

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez Perez, L.M.; Wideberg, J.; Gonzalez Perez-Somarriba, B.

    2016-07-01

    Objective: This study was conducted to find the epidemiological characteristics of bicycling-related maxillofacial fractures in a defined population, and identify factors contributing to injury. Methodology: A prospective study was carried out involving patients presenting with maxillofacial fractures sustained in bicycling-related accidents. Results: Between 908 of all cycling accidents attending for medical treatment, 122 patients (13% of all cycling accidents) were admitted with facial fractures between 2007 and 2014. Male and female ratio was 2.6:1, and the mean age was 29.4 years (standard deviation: 12.8, range: 12-79 years). Causes of injury included collisions (63%) and accidental falls (37%). The fracture patterns seen were mandibular (49%), zygomatic (32%), orbital (13%), nasal (7%), maxillary (2%), and frontal (2%). Condylar fractures were the most common of the mandibular fractures (63%). The most frequently observed concomitant lesions were orthopedic injuries. Conclusions: Bicycling-related maxillofacial injuries are common and therefore important to identify in order to design a sustainable transport system and for units that provide assistance to traffic accident victims. Missed diagnosis or delayed treatment can lead to facial deformities and functional problems. Wearing protective helmets and the improvement of the helmets design is one aspect that would be of interest for the prevention of injuries. Keywords: Cycling; bicycle-related trauma; maxillofacial fractures; risk factors; helmets. (Author)

  12. Rural wireless networking in developing countries: ICTP contribution

    International Nuclear Information System (INIS)

    Zennaro, Marco; Struzak, Ryszard; Radicella, Sandro M.

    2007-07-01

    Access to knowledge has become a cornerstone of progress for individuals and for nations. Internet as a cost-effective channel for the dissemination of knowledge and services is a paramount in our days. High-speed (broadband) Internet access can contribute to economic growth and is increasingly being recognized as a policy objective in most countries. It has been accepted that information and communication technologies (ICT) create basic infrastructure, as necessary to economic and social development as postal services, banks, medical centres and schools. However, in 48 of 71 developing countries, only less than 1 per cent of enterprises had broadband Internet connection, according to the UN Information Economy Report 2006. In the past, voice telephony has been the main option for rural and remote areas. Today, e-mail, e-commerce, tele-education, tele-health, and tele-medicine, multimedia services have become as important as the voice connectivity, maybe even more important. Training has been identified as a fundamental factor for the sustainability of ICT development and ICTP has been playing a leading role here, in collaboration with other entities. Without any doubts, universities and research centres are the most appropriate places to start the development and to disseminate knowledge necessary to assure sustainable access to the global information infrastructures in rural areas. It is hoped that ICTP's assistance will continue to contribute to foster the necessary local capacities in this field. In addition to the development of human resources and the dissemination of low-cost technology, scientists from Developing Counties need to make their voices heard in the policy, regulatory and business circles and the ICTP Associates have a role to play here. (author)

  13. Resistance Training: Identifying Best Practices?

    Science.gov (United States)

    2010-02-18

    were too small to be important. That argument would be particularly powerful when coupled with the knowledge that training effects increase with...interpretation of those facts convert the evidence to reliable scientific knowledge (Ziman, 1978). No single meta-analysis is likely to establish a...Wisloff, U. (1999). Maximal strength training improves work economy in trained female cross-country skiers . Med Sci Sports Exerc, 31, 870- 877

  14. PARALLEL IMPORT: REALITY FOR RUSSIA

    Directory of Open Access Journals (Sweden)

    Т. А. Сухопарова

    2014-01-01

    Full Text Available Problem of parallel import is urgent question at now. Parallel import legalization in Russia is expedient. Such statement based on opposite experts opinion analysis. At the same time it’s necessary to negative consequences consider of this decision and to apply remedies to its minimization.Purchase on Elibrary.ru > Buy now

  15. What's important to a game?

    DEFF Research Database (Denmark)

    Debus, Michael S.; Grabarczyk, Pawel

    2017-01-01

    , as well as visual representation, of the model suggests an equal importance of these three dimensions. We claim that such symmetry is unattainable. Through the exploration of the three dimensions relationships to one another, we will show that the mechanical system has a higher importance to games than...

  16. Sparse Linear Identifiable Multivariate Modeling

    DEFF Research Database (Denmark)

    Henao, Ricardo; Winther, Ole

    2011-01-01

    and bench-marked on artificial and real biological data sets. SLIM is closest in spirit to LiNGAM (Shimizu et al., 2006), but differs substantially in inference, Bayesian network structure learning and model comparison. Experimentally, SLIM performs equally well or better than LiNGAM with comparable......In this paper we consider sparse and identifiable linear latent variable (factor) and linear Bayesian network models for parsimonious analysis of multivariate data. We propose a computationally efficient method for joint parameter and model inference, and model comparison. It consists of a fully...

  17. Identifying flares in rheumatoid arthritis

    DEFF Research Database (Denmark)

    Bykerk, Vivian P; Bingham, Clifton O; Choy, Ernest H

    2016-01-01

    to flare, with escalation planned in 61%. CONCLUSIONS: Flares are common in rheumatoid arthritis (RA) and are often preceded by treatment reductions. Patient/MD/DAS agreement of flare status is highest in patients worsening from R/LDA. OMERACT RA flare questions can discriminate between patients with...... Set. METHODS: Candidate flare questions and legacy measures were administered at consecutive visits to Canadian Early Arthritis Cohort (CATCH) patients between November 2011 and November 2014. The American College of Rheumatology (ACR) core set indicators were recorded. Concordance to identify flares...

  18. IDENTIFYING COMPETENCIES OF VOLUNTEER BOARD MEMBERS OF COMMUNITY SPORTS CLUBS

    OpenAIRE

    A. BALDUCK; A. VAN ROSSEM; M. BUELENS

    2009-01-01

    This study contributes to the emerging empirical studies on roles and responsibilities of boards in nonprofit organizations by identifying competencies of volunteer board members. We identified how two types of constituents—volunteer board members and sports members—perceived competencies of volunteer board members in community sports clubs. We used the repertory grid technique to draw cognitive maps and to reveal the perceived reality of these constituents. Our results suggest that constitue...

  19. Enhancing importance-performance analysis

    DEFF Research Database (Denmark)

    Eskildsen, Jacob Kjær; Kristensen, Kai

    2006-01-01

    Purpose: The interpretation of the importance/performance map is based on an assumption of independence between importance and performance but many studies question the validity of this assumption. The aim of this research is to develop a new typology for job satisfaction attributes as well...... as a new importance/performance map that can be an aid for organizations when they prioritize their improvement actions based on a job satisfaction study. Design/methodology/approach: A typology for possible relationships between importance and performance in job satisfaction studies is developed based...... on theoretical considerations. This typology is then applied and validated on approximately 10,000 responses from the European Employee Index 2002. Ultimately a new importance/performance map for priority setting in job satisfaction studies is developed based on the new typology for possible relationships...

  20. Identifying and managing stress among teachers in secondary schools

    Directory of Open Access Journals (Sweden)

    Magda Lužar

    2012-02-01

    Full Text Available RQ: Is stress among teachers present or not, what are the relationships between the causes of stress, identifying stress and stress management and the impact on the quality of education.Purpose: The purpose and the focus of the research is to determine the presence of stress or stress load with teachers at the vocational secondary school; the purpose was to also determine the largest causes, how to recognize and control them.Method: By reading the literature, answers were found that stress is present everywhere in our life and there are many causes for them. The aim of research study is achieved by doing a qualitative study in vocational secondary schools where teachers are participants in the interview.Results: All eight of the interview participants responded that stress is present. As a reason for stress, five of the participants stated that the reason was due to changes at work, poor discipline of students, and poor teacher student relationships. With two participants, an important cause of stress is talking with parents about problematic students. Three participants identified stress as irritability and agitation, five participants as being tired and low concentration in equal ratios. They control stress with sports or talking in equal ratios.Organization: The contribution of the research study is importantfor management as answers on possible reasons for frequent sick leaves may be determined in a given period of the school year and leads to reflection of any possible preventive measures to reduce stress activity.Company: The findings of the research study are important for society as a whole. Stress experienced by secondary school teachers are seen as fatigue, irritability and agitation that consequently can lead towards poor quality of teaching and thus long-term impact on the whole environment.Originality: The research was conducted in four vocational secondary schools, i.e., mechanical engineering, civil engineering, electric, and

  1. Identifying Relevant Studies in Software Engineering

    DEFF Research Database (Denmark)

    Zhang, He; Ali Babar, Muhammad; Tell, Paolo

    2011-01-01

    Context: Systematic literature review (SLR) has become an important research methodology in software engineering since the introduction of evidence-based software engineering (EBSE) in 2004. One critical step in applying this methodology is to design and execute appropriate and effective search....... Objective: The main objective of the research reported in this paper is to improve the search step of undertaking SLRs in software engineering (SE) by devising and evaluating systematic and practical approaches to identifying relevant studies in SE. Method: We have systematically selected and analytically...

  2. Identifying Phase Space Boundaries with Voronoi Tessellations

    CERN Document Server

    Debnath, Dipsikha; Kilic, Can; Kim, Doojin; Matchev, Konstantin T.; Yang, Yuan-Pao

    2016-11-24

    Determining the masses of new physics particles appearing in decay chains is an important and longstanding problem in high energy phenomenology. Recently it has been shown that these mass measurements can be improved by utilizing the boundary of the allowed region in the fully differentiable phase space in its full dimensionality. Here we show that the practical challenge of identifying this boundary can be solved using techniques based on the geometric properties of the cells resulting from Voronoi tessellations of the relevant data. The robust detection of such phase space boundaries in the data could also be used to corroborate a new physics discovery based on a cut-and-count analysis.

  3. Subject Matter Expert Workshop to Identify Cybersecurity ...

    Science.gov (United States)

    Report In recognition of the growing need to better address cyber risk and cyber management, the U.S. Environmental Protection Agency’s (EPA) National Homeland Security Research Center (NHSRC) held a Subject Matter Expert Workshop to Identify Cybersecurity Research Gaps and Needs of the Nation’s Water and Wastewater Systems Sector on March 30th and 31st, 2016, at the Ronald Reagan Building in Washington, D.C. The workshop was designed to create a forum for subject matter experts (SMEs) to exchange ideas and address important cybersecurity challenges facing the water sector.

  4. A ‘rare biosphere’ microorganism contributes to sulfate reduction in a peatland

    Science.gov (United States)

    Pester, Michael; Bittner, Norbert; Deevong, Pinsurang; Wagner, Michael; Loy, Alexander

    2015-01-01

    Methane emission from peatlands contributes substantially to global warming but is significantly reduced by sulfate reduction, which is fuelled by globally increasing aerial sulfur pollution. However, the biology behind sulfate reduction in terrestrial ecosystems is not well understood and the key players for this process as well as their abundance remained unidentified. Comparative 16S rRNA gene stable isotope probing in the presence and absence of sulfate indicated that a Desulfosporosinus species, which constitutes only 0.006% of the total microbial community 16S rRNA genes, is an important sulfate reducer in a long-term experimental peatland field site. Parallel stable isotope probing using dsrAB [encoding subunit A and B of the dissimilatory (bi)sulfite reductase] identified no additional sulfate reducers under the conditions tested. For the identified Desulfosporosinus species a high cell-specific sulfate reduction rate of up to 341 fmol SO42− cell−1 day−1 was estimated. Thus, the small Desulfosporosinus population has the potential to reduce sulfate in situ at a rate of 4.0–36.8 nmol (g soil w. wt.)−1 day−1, sufficient to account for a considerable part of sulfate reduction in the peat soil. Modeling of sulfate diffusion to such highly active cells identified no limitation in sulfate supply even at bulk concentrations as low as 10 μM. Collectively, these data show that the identified Desulfosporosinus species, despite being a member of the ‘rare biosphere’, contributes to an important biogeochemical process that diverts the carbon flow in peatlands from methane to CO2 and, thus, alters their contribution to global warming. PMID:20535221

  5. Biological factors contributing to bark and ambrosia beetle species diversification.

    Science.gov (United States)

    Gohli, Jostein; Kirkendall, Lawrence R; Smith, Sarah M; Cognato, Anthony I; Hulcr, Jiri; Jordal, Bjarte H

    2017-05-01

    The study of species diversification can identify the processes that shape patterns of species richness across the tree of life. Here, we perform comparative analyses of species diversification using a large dataset of bark beetles. Three examined covariates-permanent inbreeding (sibling mating), fungus farming, and major host type-represent a range of factors that may be important for speciation. We studied the association of these covariates with species diversification while controlling for evolutionary lag on adaptation. All three covariates were significantly associated with diversification, but fungus farming showed conflicting patterns between different analyses. Genera that exhibited interspecific variation in host type had higher rates of species diversification, which may suggest that host switching is a driver of species diversification or that certain host types or forest compositions facilitate colonization and thus allopatric speciation. Because permanent inbreeding is thought to facilitate dispersal, the positive association between permanent inbreeding and diversification rates suggests that dispersal ability may contribute to species richness. Bark beetles are ecologically unique; however, our results indicate that their impressive species diversity is largely driven by mechanisms shown to be important for many organism groups. © 2017 The Author(s). Evolution © 2017 The Society for the Study of Evolution.

  6. Contribution of proteomics to the study of plant pathogenic fungi.

    Science.gov (United States)

    Gonzalez-Fernandez, Raquel; Jorrin-Novo, Jesus V

    2012-01-01

    Phytopathogenic fungi are one of the most damaging plant parasitic organisms, and can cause serious diseases and important yield losses in crops. The study of the biology of these microorganisms and the interaction with their hosts has experienced great advances in recent years due to the development of moderm, holistic and high-throughput -omic techniques, together with the increasing number of genome sequencing projects and the development of mutants and reverse genetics tools. We highlight among these -omic techniques the importance of proteomics, which has become a relevant tool in plant-fungus pathosystem research. Proteomics intends to identify gene products with a key role in pathogenicity and virulence. These studies would help in the search of key protein targets and in the development of agrochemicals, which may open new ways for crop disease diagnosis and protection. In this review, we made an overview on the contribution of proteomics to the knowledge of life cycle, infection mechanisms, and virulence of the plant pathogenic fungi. Data from current, innovative literature, according to both methodological and experimental systems, were summarized and discussed. Specific sections were devoted to the most studied fungal phytopathogens: Botrytis cinerea, Sclerotinia sclerotiorum, and Fusarium graminearum.

  7. Contribution of safety issues to public perceptions of energy systems

    International Nuclear Information System (INIS)

    Otway, H.J.; Thomas, K.

    1978-01-01

    Public opposition is an important consideration for those responsible for energy planning; however, the formulation of socially viable policies requires an understanding of the reasons for this opposition. An attitude model was applied to identify the underlying determinants of public perceptions of five energy systems: nuclear, coal, oil, solar and hydro. Empirical results (heterogeneous sample of the general public, N = 224) are reported in which these energy systems were found to be perceived in terms of four basic dimensions: psychological aspects; economic benefits; socio-political implications; environmental and physical safety issues. For the total sample, safety issues made an appreciable contribution to attitudes toward all of the systems except nuclear energy, where it was not significant. A differential analysis of two sub-samples, those respondents PRO and CON nuclear energy, showed that benefits and safety issues were important determinants of PRO attitudes while CON attitudes were primarily due to psychological aspects and concerns about personal and political power. The role of technical information in the formation of public attitudes toward technological policies is discussed

  8. The Contribution of Fusion to Sustainable Development

    International Nuclear Information System (INIS)

    Ward, D.

    2006-01-01

    The world demand for energy is projected to more than double over the next 50 years, indeed this will be essential to bring much of the world out of poverty. At the same time there is increasing pressure to substantially reduce atmospheric pollution, most notably of carbon dioxide. Together, these conflicting goals drive a need to produce enormous amounts of non-carbon energy supply, much greater than our total present energy supply. This presents an enormous challenge. As one of very few options for large-scale, non-carbon future supply of energy, fusion has the potential to make an important contribution to sustained energy supplies. Fusion's advantages of large fuel reserves, low atmospheric emissions and high levels of safety make it an important consideration in future energy strategies. - Fuel supplies are sufficient for at least thousands of years, and probably up to millions of years, of energy use. - Atmospheric emissions of CO 2 are very low and minor emissions of other pollutants are less harmful than those from most existing energy sources. - Hazards to the public will be very low because of the high levels of passive safety. - Waste materials will require little, or no, use of repository storage. Conceptual designs of fusion power plants have been optimised against safety and environmental criteria. The optimum designs vary both with the assessed progress in the development programme and according to the weight given to different criteria. The impact of this weighting on design, and the comparison of the outcomes with other energy sources, is described. To make a contribution to sustainable development, fusion must also be economically viable to enter the energy market. The calculated cost of electricity from fusion and other technologies, both new and existing, show that, particularly in an energy market where environmental constraints are playing an increasing role, fusion can make an important contribution. (author)

  9. French contributions to electron microscopic radioautography

    International Nuclear Information System (INIS)

    Droz, B.

    1994-01-01

    The radio autographic contributions carried out by electron microscopists took a part to improve the methodology and to extend applications to major biological problems. As underlined by CP Leblonc radioautography has clarified the importance of renewing systems; one may truly say that radioautography has introduced the time dimension in histology. The sites of biosynthesis of different substances have been located on the sub cellar scale, and it is now possible to analyse the molecular migrations within cells. The development of in situ hybridization and of receptors binding sites at the ultrastructural level has enlarged the application field of electron microscope radioautography. 64 refs., 2 figs

  10. Capitalizing the contribution of the nuclear industry

    International Nuclear Information System (INIS)

    Donnadieu, G.

    1984-01-01

    The main contributions of the French nuclear industry to the country, and ways to make the most of them are presented. The advantages acquired include the nuclear power stations built; mastering of the combustion cycle; a powerful, well structured nuclear construction industry; and a nuclear-industrial complex giving France an important industrial potential. It is recommended that the industrial and research effort be maintained. The proposed strategy consists of defining an electronuclear program and associated economic development program and sticking to them; promoting exports; possibly merging certain industrial capacities; and strengthening the national position and independence concerning the fuel cycle [fr

  11. [Contribution of animal experimentation to pharmacology].

    Science.gov (United States)

    Sassard, Jean; Hamon, Michel; Galibert, Francis

    2009-11-01

    Animal experimentation is of considerable importance in pharmacology and cannot yet be avoided when studying complex, highly integrated physiological functions. The use of animals has been drastically reduced in the classical phases of pharmacological research, for example when comparing several compounds belonging to the same pharmacological class. However, animal experiments remain crucial for generating and validating new therapeutic concepts. Three examples of such research, conducted in strict ethical conditions, will be used to illustrate the different ways in which animal experimentation has contributed to human therapeutics.

  12. Persistent Identifiers as Boundary Objects

    Science.gov (United States)

    Parsons, M. A.; Fox, P. A.

    2017-12-01

    In 1989, Leigh Star and Jim Griesemer defined the seminal concept of `boundary objects'. These `objects' are what Latour calls `immutable mobiles' that enable communication and collaboration across difference by helping meaning to be understood in different contexts. As Star notes, they are a sort of arrangement that allow different groups to work together without (a priori) consensus. Part of the idea is to recognize and allow for the `interpretive flexibility' that is central to much of the `constructivist' approach in the sociology of science. Persistent Identifiers (PIDs) can clearly act as boundary objects, but people do not usually assume that they enable interpretive flexibility. After all, they are meant to be unambiguous, machine-interpretable identifiers of defined artifacts. In this paper, we argue that PIDs can fill at least two roles: 1) That of the standardized form, where there is strong agreement on what is being represented and how and 2) that of the idealized type, a more conceptual concept that allows many different representations. We further argue that these seemingly abstract conceptions actually help us implement PIDs more effectively to link data, publications, various other artifacts, and especially people. Considering PIDs as boundary objects can help us address issues such as what level of granularity is necessary for PIDs, what metadata should be directly associated with PIDs, and what purpose is the PID serving (reference, provenance, credit, etc.). In short, sociological theory can improve data sharing standards and their implementation in a way that enables broad interdisciplinary data sharing and reuse. We will illustrate this with several specific examples of Earth science data.

  13. Contributing Chemistry and Compelling Physics

    Directory of Open Access Journals (Sweden)

    Editorial

    2013-04-01

    transplantation for haematological disorders and malignancies. With these two original research articles throwing a light upon the influence of various factors on stem cell proliferation, homing and engraftment, the article by Telpalo-Carpio et al has attempted to provide a general scenario of the state of the art in the Induced Pluripotent Stem (iPS cells generation, giving a glimpse of the most important and promising emerging de-differentiation technologies of the various research groups all over the world who are extensively researching on this ‘most sought after cell type’. Though all ideas and innovations may not turn out to yield successful solutions and all researches may not end up in positive outcome, the article by Terunuma et al which provides an in-sight into the in vitro expansion of patients’ immune cells such as NK cells, and T cells using chemically synthesized culture media without any feeder layers, whose clinical outcome in tackling several tumours with long term follow-up is something really a tonic of encouragement to scientists. Contribution of chemical moieties having been studied and translated to clinical applications, the physical forces' real worth have not yet been explored to the fullest. Time has come to dig, hig or boson them! References: Engler AJ, Sen S, Sweeney HL, Discher DE. Matrix elasticity directs stem cell lineage specification. Cell. 2006 Aug 25;126(4:677-89. Adams DS. A new tool for tissue engineers: ions as regulators of morphogenesis during development and regeneration. Tissue Eng Part A. 2008 Sep;14(9:1461-8.

  14. BIOELECTRICAL IMPEDANCE VECTOR ANALYSIS IDENTIFIES SARCOPENIA IN NURSING HOME RESIDENTS

    Science.gov (United States)

    Loss of muscle mass and water shifts between body compartments are contributing factors to frailty in the elderly. The body composition changes are especially pronounced in institutionalized elderly. We investigated the ability of single-frequency bioelectrical impedance analysis (BIA) to identify b...

  15. Nuclear Import and Export of the Thyroid Hormone Receptor.

    Science.gov (United States)

    Zhang, Jibo; Roggero, Vincent R; Allison, Lizabeth A

    2018-01-01

    The thyroid hormone receptors, TRα1 and TRβ1, are members of the nuclear receptor superfamily that forms one of the most abundant classes of transcription factors in multicellular organisms. Although primarily localized to the nucleus, TRα1 and TRβ1 shuttle rapidly between the nucleus and cytoplasm. The fine balance between nuclear import and export of TRs has emerged as a critical control point for modulating thyroid hormone-responsive gene expression. Mutagenesis studies have defined two nuclear localization signal (NLS) motifs that direct nuclear import of TRα1: NLS-1 in the hinge domain and NLS-2 in the N-terminal A/B domain. Three nuclear export signal (NES) motifs reside in the ligand-binding domain. A combined approach of shRNA-mediated knockdown and coimmunoprecipitation assays revealed that nuclear entry of TRα1 is facilitated by importin 7, likely through interactions with NLS-2, and importin β1 and the adapter importin α1 interacting with both NLS-1 and NLS-2. Interestingly, TRβ1 lacks NLS-2 and nuclear import depends solely on the importin α1/β1 heterodimer. Heterokaryon and fluorescence recovery after photobleaching shuttling assays identified multiple exportins that play a role in nuclear export of TRα1, including CRM1 (exportin 1), and exportins 4, 5, and 7. Even single amino acid changes in TRs dramatically alter their intracellular distribution patterns. We conclude that mutations within NLS and NES motifs affect nuclear shuttling activity, and propose that TR mislocalization contributes to the development of some types of cancer and Resistance to Thyroid Hormone syndrome. © 2018 Elsevier Inc. All rights reserved.

  16. A decision-oriented measure of uncertainty importance for use in PSA

    International Nuclear Information System (INIS)

    Poern, Kurt

    1997-01-01

    For the interpretation of the results of probabilistic risk assessments it is important to have measures which identify the basic events that contribute most to the frequency of the top event but also to identify basic events that are the main contributors to the uncertainty in this frequency. Both types of measures, often called Importance Measure and Measure of Uncertainty Importance, respectively, have been the subject of interest for many researchers in the reliability field. The most frequent mode of uncertainty analysis in connection with probabilistic risk assessment has been to propagate the uncertainty of all model parameters up to an uncertainty distribution for the top event frequency. Various uncertainty importance measures have been proposed in order to point out the parameters that in some sense are the main contributors to the top event distribution. The new measure of uncertainty importance suggested here goes a step further in that it has been developed within a decision theory framework, thereby providing an indication of on what basic event it would be most valuable, from the decision-making point of view, to procure more information

  17. Radiative Importance of Aerosol-Cloud Interaction

    Science.gov (United States)

    Tsay, Si-Chee

    1999-01-01

    even greater consequences. Presently we know that through the use of fossil fuel and land-use changes we have increased the concentration of greenhouse gases in the atmosphere. In parallel, we have seen a modest increase of global temperature in the last century. These two observations have been linked as cause and effect by climate models, but this connection is still experimentally not verified. The spatial and seasonal distribution of aerosol forcing is different from that of greenhouse gases, thus generating a different spatial fingerprint of climate change. This fingerprint was suggested as a method to identify the response of the climate system to anthropogenic forcing of greenhouse gases and aerosol. The aerosol fingerprint may be the only way to firmly establish the presence (or absence) of human impact on climate. Aerosol-cloud interaction through the indirect effect will be an important component of establishing this fingerprint.

  18. Identifying influential spreaders in interconnected networks

    International Nuclear Information System (INIS)

    Zhao, Dawei; Li, Lixiang; Huo, Yujia; Yang, Yixian; Li, Shudong

    2014-01-01

    Identifying the most influential spreaders in spreading dynamics is of the utmost importance for various purposes for understanding or controlling these processes. The existing relevant works are limited to a single network. Most real networks are actually not isolated, but typically coupled and affected by others. The properties of epidemic spreading have recently been found to have some significant differences in interconnected networks from those in a single network. In this paper, we focus on identifying the influential spreaders in interconnected networks. We find that the well-known k-shell index loses effectiveness; some insignificant spreaders in a single network become the influential spreaders in the whole interconnected networks while some influential spreaders become no longer important. The simulation results show that the spreading capabilities of the nodes not only depend on their influence for the network topology, but also are dramatically influenced by the spreading rate. Based on this perception, a novel index is proposed for measuring the influential spreaders in interconnected networks. We then support the efficiency of this index with numerical simulations. (paper)

  19. Identifying Key Attributes for Protein Beverages.

    Science.gov (United States)

    Oltman, A E; Lopetcharat, K; Bastian, E; Drake, M A

    2015-06-01

    This study identified key attributes of protein beverages and evaluated effects of priming on liking of protein beverages. An adaptive choice-based conjoint study was conducted along with Kano analysis to gain insight on protein beverage consumers (n = 432). Attributes evaluated included label claim, protein type, amount of protein, carbohydrates, sweeteners, and metabolic benefits. Utility scores for levels and importance scores for attributes were determined. Subsequently, two pairs of clear acidic whey protein beverages were manufactured that differed by age of protein source or the amount of whey protein per serving. Beverages were evaluated by 151 consumers on two occasions with or without priming statements. One priming statement declared "great flavor," the other priming statement declared 20 g protein per serving. A two way analysis of variance was applied to discern the role of each priming statement. The most important attribute for protein beverages was sweetener type, followed by amount of protein, followed by type of protein followed by label claim. Beverages with whey protein, naturally sweetened, reduced sugar and ≥15 g protein per serving were most desired. Three consumer clusters were identified, differentiated by their preferences for protein type, sweetener and amount of protein. Priming statements positively impacted concept liking (P 0.05). Consistent with trained panel profiles of increased cardboard flavor with higher protein content, consumers liked beverages with 10 g protein more than beverages with 20 g protein (6.8 compared with 5.7, P appeal. © 2015 Institute of Food Technologists®

  20. Anesthesiology leadership rounding: identifying opportunities for improvement.

    Science.gov (United States)

    Gravenstein, Dietrich; Ford, Susan; Enneking, F Kayser

    2012-01-01

    Rounding that includes participation of individuals with authority to implement changes has been advocated as important to the transformation of an institution into a high-quality and safe organization. We describe a Department of Anesthesiology's experience with leadership rounding. The Department Chair or other senior faculty designate, a quality coordinator, up to four residents, the ward charge nurse, and patient nurses participated in rounds at bedsides. During a 23-month period, 14 significant opportunities to improve care were identified. Nurses identified 5 of these opportunities, primary team physicians 2, the rounding team 4, and patients or their family members another 3. The anesthesiology service had sole or shared responsibility for 10 improvements. A variety of organizations track specific measures across all phases of the patient experience to gauge quality of care. Chart auditing tools for detecting threats to safety are often used. These measures and tools missed opportunities for improvement that were discovered only through rounding. We conclude that the introduction of leadership rounding by an anesthesiology service can identify opportunities for improving quality that are not captured by conventional efforts.

  1. Health Care Ergonomics: Contributions of Thomas Waters.

    Science.gov (United States)

    Poole Wilson, Tiffany; Davis, Kermit G

    2016-08-01

    The aim of this study was to assess the contributions of Thomas Waters's work in the field of health care ergonomics and beyond. Waters's research of safe patient handling with a focus on reducing musculoskeletal disorders (MSDs) in health care workers contributed to current studies and prevention strategies. He worked with several groups to share his research and assist in developing safe patient handling guidelines and curriculum for nursing students and health care workers. The citations of articles that were published by Waters in health care ergonomics were evaluated for quality and themes of conclusions. Quality was assessed using the Mixed Methods Appraisal Tool and centrality to original research rating. Themes were documented by the type of population the citing articles were investigating. In total, 266 articles that referenced the top seven cited articles were evaluated. More than 95% of them were rated either medium or high quality. The important themes of these citing articles were as follows: (a) Safe patient handling is effective in reducing MSDs in health care workers. (b) Shift work has negative impact on nurses. (c) There is no safe way to manually lift a patient. (d) Nurse curriculums should contain safe patient handling. The research of Waters has contributed significantly to the health care ergonomics and beyond. His work, in combination with other pioneers in the field, has generated multiple initiatives, such as a standard safe patient-handling curriculum and safe patient-handling programs. © 2016, Human Factors and Ergonomics Society.

  2. Steponas Kolupaila's contribution to hydrological science development

    Science.gov (United States)

    Valiuškevičius, Gintaras

    2017-08-01

    Steponas Kolupaila (1892-1964) was an important figure in 20th century hydrology and one of the pioneers of scientific water gauging in Europe. His research on the reliability of hydrological data and measurement methods was particularly important and contributed to the development of empirical hydrological calculation methods. Kolupaila was one of the first who standardised water-gauging methods internationally. He created several original hydrological and hydraulic calculation methods (his discharge assessment method for winter period was particularly significant). His innate abilities and frequent travel made Kolupaila a universal specialist in various fields and an active public figure. He revealed his multilayered scientific and cultural experiences in his most famous book, Bibliography of Hydrometry. This book introduced the unique European hydrological-measurement and computation methods to the community of world hydrologists at that time and allowed the development and adaptation of these methods across the world.

  3. Creativity in Gifted Education: Contributions from Vygotsky and Piaget

    Science.gov (United States)

    Stoltz, Tania; Piske, Fernanda Hellen Ribeiro; de Fátima Quintal de Freitas, Maria; D'Aroz, Marlene Schüssler; Machado, Járci Maria

    2015-01-01

    This research aims to highlight the importance of developing creativity in the school environment by promoting quality education to gifted students, with contributions from Vygotsky and Piaget. For Vygotsky creativity is inherent in the human condition, and it is the most important activity because it is the expression of consciousness, thought…

  4. RECOVIR Software for Identifying Viruses

    Science.gov (United States)

    Chakravarty, Sugoto; Fox, George E.; Zhu, Dianhui

    2013-01-01

    Most single-stranded RNA (ssRNA) viruses mutate rapidly to generate a large number of strains with highly divergent capsid sequences. Determining the capsid residues or nucleotides that uniquely characterize these strains is critical in understanding the strain diversity of these viruses. RECOVIR (an acronym for "recognize viruses") software predicts the strains of some ssRNA viruses from their limited sequence data. Novel phylogenetic-tree-based databases of protein or nucleic acid residues that uniquely characterize these virus strains are created. Strains of input virus sequences (partial or complete) are predicted through residue-wise comparisons with the databases. RECOVIR uses unique characterizing residues to identify automatically strains of partial or complete capsid sequences of picorna and caliciviruses, two of the most highly diverse ssRNA virus families. Partition-wise comparisons of the database residues with the corresponding residues of more than 300 complete and partial sequences of these viruses resulted in correct strain identification for all of these sequences. This study shows the feasibility of creating databases of hitherto unknown residues uniquely characterizing the capsid sequences of two of the most highly divergent ssRNA virus families. These databases enable automated strain identification from partial or complete capsid sequences of these human and animal pathogens.

  5. Dynamically consistent oil import tariffs

    International Nuclear Information System (INIS)

    Karp, L.; Newbery, D.M.

    1992-01-01

    The standard theory of optimal tariffs considers tariffs on perishable goods produced abroad under static conditions, in which tariffs affect prices only in that period. Oil and other exhaustable resources do not fit this model, for current tariffs affect the amount of oil imported, which will affect the remaining stock and hence its future price. The problem of choosing a dynamically consistent oil import tariff when suppliers are competitive but importers have market power is considered. The open-loop Nash tariff is solved for the standard competitive case in which the oil price is arbitraged, and it was found that the resulting tariff rises at the rate of interest. This tariff was found to have an equilibrium that in general is dynamically inconsistent. Nevertheless, it is shown that necessary and sufficient conditions exist under which the tariff satisfies the weaker condition of time consistency. A dynamically consistent tariff is obtained by assuming that all agents condition their current decisions on the remaining stock of the resource, in contrast to open-loop strategies. For the natural case in which all agents choose their actions simultaneously in each period, the dynamically consistent tariff was characterized, and found to differ markedly from the time-inconsistent open-loop tariff. It was shown that if importers do not have overwhelming market power, then the time path of the world price is insensitive to the ability to commit, as is the level of wealth achieved by the importer. 26 refs., 4 figs

  6. Identifying the source, transport path and sinks of sewage derived organic matter

    International Nuclear Information System (INIS)

    Mudge, Stephen M.; Duce, Caroline E.

    2005-01-01

    Since sewage discharges can significantly contribute to the contaminant loadings in coastal areas, it is important to identify sources, pathways and environmental sinks. Sterol and fatty alcohol biomarkers were quantified in source materials, suspended sediments and settling matter from the Ria Formosa Lagoon. Simple ratios between key biomarkers including 5β-coprostanol, cholesterol and epi-coprostanol were able to identify the sewage sources and effected deposition sites. Multivariate methods (PCA) were used to identify co-varying sites. PLS analysis using the sewage discharge as the signature indicated ∼ 25% of the variance in the sites could be predicted by the sewage signature. A new source of sewage derived organic matter was found with a high sewage predictable signature. The suspended sediments had relatively low sewage signatures as the material was diluted with other organic matter from in situ production. From a management viewpoint, PLS provides a useful tool in identifying the pathways and accumulation sites for such contaminants. - Multivariate statistical analysis was used to identify pathways and accumulation sites for contaminants in coastal waters

  7. Sensory profile and contribution of major components of aroma in dry red wine quality

    Directory of Open Access Journals (Sweden)

    Luisa Costa de Oliveira

    2012-11-01

    Full Text Available This study aimed to determine the sensory profile and main volatile compounds of a set of commercial wines from two major wine regions in Brazil. A total of 28 descriptors were selected by quantitative descriptive analysis, and “red”, “violet”, “pungent aroma”, “vinegary aroma” and “softness” were the most important descriptors in sample discrimination (p<=0.05. 42 volatile aroma compounds were considered relevant for the evaluation of red wine samples. Several acetates and esters that contribute to the pleasant aroma in wines were found in the samples, but other undesirable compounds were also identified: acetic acid and octanoic acid may have contributed to the vinegary and sulphur odors perceived by a trained team.

  8. Geometrical contributions to the exchange constants: Free electrons with spin-orbit interaction

    Science.gov (United States)

    Freimuth, Frank; Blügel, Stefan; Mokrousov, Yuriy

    2017-05-01

    Using thermal quantum field theory, we derive an expression for the exchange constant that resembles Fukuyama's formula for orbital magnetic susceptibility (OMS). Guided by this formal analogy between the exchange constant and OMS, we identify a contribution to the exchange constant that arises from the geometrical properties of the band structure in mixed phase space. We compute the exchange constants for free electrons and show that the geometrical contribution is generally important. Our formalism allows us to study the exchange constants in the presence of spin-orbit interaction. Thereby, we find sizable differences between the exchange constants of helical and cycloidal spin spirals. Furthermore, we discuss how to calculate the exchange constants based on a gauge-field approach in the case of the Rashba model with an additional exchange splitting, and we show that the exchange constants obtained from this gauge-field approach are in perfect agreement with those obtained from the quantum field theoretical method.

  9. Gallium interstitial contributions to diffusion in gallium arsenide

    Science.gov (United States)

    Schick, Joseph T.; Morgan, Caroline G.

    2011-09-01

    A new diffusion path is identified for gallium interstitials, which involves lower barriers than the barriers for previously identified diffusion paths [K. Levasseur-Smith and N. Mousseau, J. Appl. Phys. 103, 113502 (2008), P. A. Schultz and O. A. von Lilienfeld, Modelling and Simulation in Materials Science and Engineering 17, 084007 (2009)] for the charge states which dominate diffusion over most of the available range of Fermi energies. This path passes through the ⟨110⟩ gallium-gallium split interstitial configuration, and has a particularly low diffusion barrier of 0.35 eV for diffusion in the neutral charge state. As a part of this work, the character of the charge states for the gallium interstitials which are most important for diffusion is investigated, and it is shown that the last electron bound to the neutral interstitial occupies a shallow hydrogenic bound state composed of conduction band states for the hexagonal interstitial and both tetrahedral interstitials. How to properly account for the contributions of such interstitials is discussed for density-functional calculations with a k-point mesh not including the conduction band edge point. Diffusion barriers for gallium interstitials are calculated in all the charge states which can be important for a Fermi level anywhere in the gap, q = 0, +1, +2, and +3, for diffusion via the ⟨110⟩ gallium-gallium split interstitial configuration and via the hexagonal interstitial configuration. The lowest activation enthalpies over most of the available range of Fermi energies are found to correspond to diffusion in the neutral or singly positive state via the ⟨110⟩ gallium-gallium split interstitial configuration. It is shown that several different charge states and diffusion paths contribute significantly for Fermi levels within 0.2 eV above the valence band edge, which may help to explain some of the difficulties [H. Bracht and S. Brotzmann, Phys. Rev. B 71, 115216 (2005)] which have been

  10. Total organic carbon, an important tool in an holistic approach to hydrocarbon source fingerprinting

    Energy Technology Data Exchange (ETDEWEB)

    Boehm, P.D.; Burns, W.A.; Page, D.S.; Bence, A.E.; Mankiewicz, P.J.; Brown, J.S.; Douglas, G.S. [Battelle Member Inst., Waltham, MA (United States)

    2002-07-01

    The identification and allocation of multiple hydrocarbon sources in marine sediments is best achieved using an holistic approach. Total organic carbon (TOC) is one important tool that can constrain the contributions of specific sources and rule out incorrect source allocations in cases where inputs are dominated by fossil organic carbon. In a study of the benthic sediments from Prince William Sound (PWS) and the Gulf of Alaska (GOA), we find excellent agreement between measured TOC and TOC calculated from hydrocarbon fingerprint matches of polycyclic aromatic hydrocarbons (PAH) and chemical biomarkers. Confirmation by two such independent source indicators (TOC and fingerprint matches) provides evidence that source allocations determined by the fingerprint matches are robust and that the major TOC sources have been correctly identified. Fingerprint matches quantify the hydrocarbon contributions of various sources to the benthic sediments and the degree of hydrocarbon winnowing by waves and currents. TOC contents are then calculated using source allocation results from fingerprint matches and the TOCs of contributing sources. Comparisons of the actual sediment TOC values and those calculated from source allocation support our earlier published findings that the natural petrogenic hydrocarbon background in sediments in this area comes from eroding Tertiary shales and associated oil seeps along the northern GOA coast and exclude thermally mature area coals from being important contributors to the PWS background due to their high TOC content.

  11. A contribution Monte Carlo method

    International Nuclear Information System (INIS)

    Aboughantous, C.H.

    1994-01-01

    A Contribution Monte Carlo method is developed and successfully applied to a sample deep-penetration shielding problem. The random walk is simulated in most of its parts as in conventional Monte Carlo methods. The probability density functions (pdf's) are expressed in terms of spherical harmonics and are continuous functions in direction cosine and azimuthal angle variables as well as in position coordinates; the energy is discretized in the multigroup approximation. The transport pdf is an unusual exponential kernel strongly dependent on the incident and emergent directions and energies and on the position of the collision site. The method produces the same results obtained with the deterministic method with a very small standard deviation, with as little as 1,000 Contribution particles in both analog and nonabsorption biasing modes and with only a few minutes CPU time

  12. HOW IMPORTANT ARE REMITTANCES FLOWS FOR ROMANIA?

    Directory of Open Access Journals (Sweden)

    Dan\tFlorin\tHREBAN

    2015-12-01

    Full Text Available By all analyses, the remittances flows describe a trend of significant growth worldwide, over the past two decades, currently representing an extremely important component of capital for the poor and developing countries. Compared to other capital flows (foreign direct investment, development aid or other types of private capital, the remittances size is positioned, generally, only behind FDI, causing direct and indirect socio-economic effects, far more profound than other types of capital. Moreover, studies show that remittances flows tend to a much greater stability over time as compared to other balance of payments flows, especially the exports and the private capital. Romania is an important recipient economy. If in 2000, the value of the entries was 96 million USD, in 2008, the amounts remitted from abroad reached a peak of over 9.2 billion USD, after which, during the global economic crisis, they declined, reaching a value of 3.5 billion USD, in 2013. Over the years, along with FDI, the capital flows from remittances have significantly contributed to the economic growth and to the increase of the welfare of an important part of the population by improving economic and social status. However, how important have the remittances flows proved to be for the economy as a whole? Is there any influence of these amounts on the inflation, labour market, education, or entrepreneurship? How much is Romania losing by dispatching such an important part of its population to work abroad, and how much does it earn from the money remitted home?

  13. Uma avaliação das contribuições de Stiglitz à teoria dos mercados financeiros An evaluation of Stiglitz's contributions to the theory of the financial markets

    OpenAIRE

    Dante Mendes Aldrighi

    2006-01-01

    The objective and originality of this paper lie in identifying Stiglitz's main theoretical contributions to Financial Economics and in briefly portraying the contemporary economic thought out of which these contributions emerged as well as in suggesting their connections with the subsequent economic thought. Grounded on a detailed analysis of Stiglitz's works on finance, his most important theoretical findings are singled out and gathered into four issues: (1) the conditions under which the M...

  14. Identifying Core Concepts of Cybersecurity: Results of Two Delphi Processes

    Science.gov (United States)

    Parekh, Geet; DeLatte, David; Herman, Geoffrey L.; Oliva, Linda; Phatak, Dhananjay; Scheponik, Travis; Sherman, Alan T.

    2018-01-01

    This paper presents and analyzes results of two Delphi processes that polled cybersecurity experts to rate cybersecurity topics based on importance, difficulty, and timelessness. These ratings can be used to identify core concepts--cross-cutting ideas that connect knowledge in the discipline. The first Delphi process identified core concepts that…

  15. The contribution of human agricultural activities to increasing evapotranspiration is significantly greater than climate change effect over Heihe agricultural region.

    Science.gov (United States)

    Zou, Minzhong; Niu, Jun; Kang, Shaozhong; Li, Xiaolin; Lu, Hongna

    2017-08-18

    Evapotranspiration (ET) is a major component linking the water, energy, and carbon cycles. Understanding changes in ET and the relative contribution rates of human activity and of climate change at the basin scale is important for sound water resources management. In this study, changes in ET in the Heihe agricultural region in northwest China during 1984-2014 were examined using remotely-sensed ET data with the Soil and Water Assessment Tool (SWAT). Correlation analysis identified the dominant factors that influence change in ET per unit area and those that influence change in total ET. Factor analysis identified the relative contribution rates of the dominant factors in each case. The results show that human activity, which includes factors for agronomy and irrigation, and climate change, including factors for precipitation and relative humidity, both contribute to increases in ET per unit area at rates of 60.93% and 28.01%, respectively. Human activity, including the same factors, and climate change, including factors for relative humidity and wind speed, contribute to increases in total ET at rates of 53.86% and 35.68%, respectively. Overall, in the Heihe agricultural region, the contribution of human agricultural activities to increased ET was significantly greater than that of climate change.

  16. The Signal Importance of Noise

    Science.gov (United States)

    Macy, Michael; Tsvetkova, Milena

    2015-01-01

    Noise is widely regarded as a residual category--the unexplained variance in a linear model or the random disturbance of a predictable pattern. Accordingly, formal models often impose the simplifying assumption that the world is noise-free and social dynamics are deterministic. Where noise is assigned causal importance, it is often assumed to be a…

  17. Observing Two Important Teaching Variables.

    Science.gov (United States)

    Gustafson, John A.

    1986-01-01

    Two behaviors essential to good teaching, teacher expectation and teacher flexibility, have been incorporated into the observation system used in the student teacher program at the University of New Mexico. The importance of these behaviors in teaching and in evaluating student teachers is discussed. (MT)

  18. The importance of board independence

    NARCIS (Netherlands)

    Zijl, N.J.M.

    2012-01-01

    Although the attributed importance of board independence is high, a clear definition of independence does not exist. Furthermore, the aim and consequences of independence are the subject of discussion and empirical evidence about the impact of independence is weak and disputable. Despite this lack

  19. Hydrogen peroxide: importance and determination

    OpenAIRE

    Mattos, Ivanildo Luiz de; Shiraishi, Karina Antonelli; Braz, Alexandre Delphini; Fernandes, João Roberto

    2003-01-01

    A brief discussion about the hydrogen peroxide importance and its determination is presented. It was emphasized some consideration of the H2O2 as reagent (separated or combined), uses and methods of analysis (techniques, detection limits, linear response intervals, sensor specifications). Moreover, it was presented several applications, such as in environmental, pharmaceutical, medicine and food samples.

  20. The Importance of Prior Knowledge.

    Science.gov (United States)

    Cleary, Linda Miller

    1989-01-01

    Recounts a college English teacher's experience of reading and rereading Noam Chomsky, building up a greater store of prior knowledge. Argues that Frank Smith provides a theory for the importance of prior knowledge and Chomsky's work provided a personal example with which to interpret and integrate that theory. (RS)

  1. Important projects of the Division

    International Nuclear Information System (INIS)

    2008-01-01

    In this chapter important projects of the Division for Radiation Safety, NPP Decommissioning and Radwaste Management of the VUJE, a. s. are presented. Division for Radiation Safety, NPP Decommissioning and Radwaste Management has successfully carried out variety of significant projects. The most significant projects that were realised, are implemented and possible future projects are introduced in the following part of presentation.

  2. Import market penetration in services

    OpenAIRE

    Langhammer, Rolf J.

    1991-01-01

    The EC-1992 programme foresees the complete liberalization of trade in services among member countries. To what extent has import market penetration in the Community already begun in selected service industries? Which EC member countries have been the forerunners to date? The following paper uses a new data base released recently by EUROSTAT in an attempt to answer these and other related questions.

  3. The Strategic Importance of Balochistan

    Science.gov (United States)

    2011-06-01

    projects require augmentation from skilled Punjabi labor. Militarily, it is important from a logistical standpoint as it provides a...Balochistan to a newly independent Greater Balochistan, but also their Pashtun regions need to join Afghanistan, leaving the Punjabi and Sindhi regions to

  4. Obesity and Lifespan Health—Importance of the Fetal Environment

    Directory of Open Access Journals (Sweden)

    Alice F. Tarantal

    2014-04-01

    Full Text Available A marked increase in the frequency of obesity at the population level has resulted in an increasing number of obese women entering pregnancy. The increasing realization of the importance of the fetal environment in relation to chronic disease across the lifespan has focused attention on the role of maternal obesity in fetal development. Previous studies have demonstrated that obesity during adolescence and adulthood can be traced back to fetal and early childhood exposures. This review focuses on factors that contribute to early developmental events, such as epigenetic modifications, the potential for an increase in inflammatory burden, early developmental programming changes such as the variable development of white versus brown adipose tissue, and alterations in organ ontogeny. We hypothesize that these mechanisms promote an unfavorable fetal environment and can have a long-standing impact, with early manifestations of chronic disease that can result in an increased demand for future health care. In order to identify appropriate preventive measures, attention needs to be placed both on reducing maternal obesity as well as understanding the molecular, cellular, and epigenetic mechanisms that may be responsible for the prenatal onset of chronic disease.

  5. Organisational factors important to the safe operation of NPPs

    International Nuclear Information System (INIS)

    Frischknecht, Albert; Baumont, Genevieve

    2000-01-01

    The purpose of this paper is to present the achievements of a group of human factor specialists known as Expanded Task Force on Human Factors (ETF). ETF is part of the Principal Working Group No.1 (PWG1) on 'Operating Experience and Human Factors' of the Committee on Nuclear Safety Installations (CSNI) of the OECD Nuclear Energy Agency (NEA). Today, as shown by incident analysis, technology is so far developed that human behaviour and organisational deficiencies can contribute to a major part of the root causes of incidents in nuclear power plants. The influence of the organisation on the safe behaviour and performance of individuals is recognised as a relevant issue for the safety of nuclear power plants (NPPs). The need for an up-to-date basis of knowledge in this area was recognised by CSNI and therefore the ETF organised a workshop, in Switzerland, in 1998, on Organisational Factors. During the workshop, different aspects of organisational influences on the safe operation of NPPs were discussed and twelve important organisational factors concerning safety related activities in a NPP were identified. The result of the workshop is summarised in a state-of-the-art Report (SOAR) 'Identification and Assessment of Organisational Factors Related to the Safety of NPPs' issued by the OECD/NEA. The present paper gives an overview on the main findings of the workshop and conclusions concerning the evaluation of organisational factors. (author)

  6. THE USE OF IMPORTANCE-PERFORMANCE ANALYSIS TO MEASURE THE SATISFACTION OF TRAVEL AGENCY FRANCHISEES

    Directory of Open Access Journals (Sweden)

    José M. Ramírez-Hurtado

    2017-02-01

    Full Text Available This study contributes to the limited literature on the satisfaction of travel agency franchisees. Specifically, it aims to identify strengths and weaknesses of the system from the perspective of the franchisee. This study would enable franchisors to identify areas in which franchisees are less satisfied. If franchisees are satisfied with numerous aspects that influence the franchisor-franchisee relationship, the latter may have a high degree of loyalty towards their franchisors and this would benefit the entire network. This article uses a variant of the classic importance-performance model from Martilla and James (1977 and others (Ábalo, Varela, & Rial, 2006; Picón, Varela, & Braña, 2011. The results show that the attributes travel agency franchisees feel more dissatisfied with are: chain advertising, ongoing support from franchisors, the initial franchisor support, delivery from the franchisors, and training provided by franchisors.

  7. Environmental certification for more sustainable imports

    International Nuclear Information System (INIS)

    Henry, Lucile; Monnoyer-Smith, Laurence; Demeulenaere, Laurence

    2017-12-01

    As France imports high quantities of products which have environmental impacts abroad due to extraction, transformations, and transports of used materials, and which are not visible for consumers, environmental certification could be a mean to reduce these impacts as it would allow consumers to identify the less polluting products, and incite producers to put such products on the market. After having discussed these issues, the author outlines key factors of success for such a certification, briefly identifies required adjustments at the technical level (requirement level, cost anticipation), and at the social and political level. She also evokes accompanying measures, and outlines that environmental certification is only a tool among others such as partnership agreements currently being negotiated between the European Union and other countries, or a combination of certification and cooperation with extracting countries (as practiced by Germany)

  8. Identification of the human factors contributing to maintenance failures in a petroleum operation.

    Science.gov (United States)

    Antonovsky, Ari; Pollock, Clare; Straker, Leon

    2014-03-01

    This research aimed to identify the most frequently occurring human factors contributing to maintenance-related failures within a petroleum industry organization. Commonality between failures will assist in understanding reliability in maintenance processes, thereby preventing accidents in high-hazard domains. Methods exist for understanding the human factors contributing to accidents. Their application in a maintenance context mainly has been advanced in aviation and nuclear power. Maintenance in the petroleum industry provides a different context for investigating the role that human factors play in influencing outcomes. It is therefore worth investigating the contributing human factors to improve our understanding of both human factors in reliability and the factors specific to this domain. Detailed analyses were conducted of maintenance-related failures (N = 38) in a petroleum company using structured interviews with maintenance technicians. The interview structure was based on the Human Factor Investigation Tool (HFIT), which in turn was based on Rasmussen's model of human malfunction. A mean of 9.5 factors per incident was identified across the cases investigated.The three most frequent human factors contributing to the maintenance failures were found to be assumption (79% of cases), design and maintenance (71%), and communication (66%). HFIT proved to be a useful instrument for identifying the pattern of human factors that recurred most frequently in maintenance-related failures. The high frequency of failures attributed to assumptions and communication demonstrated the importance of problem-solving abilities and organizational communication in a domain where maintenance personnel have a high degree of autonomy and a wide geographical distribution.

  9. Importance and functions of European grasslands.

    Science.gov (United States)

    Carlier, L; De Vliegher, A; Van Cleemput, O; Boeckx, P

    2005-01-01

    The European agricultural policy is not simple and needs to accommodate also social and environmental requirements. Grassland will continue to be an important form of land use in Europe, but with increased diversity in management objectives and systems used. Besides its role as basic nutrient for herbivores and ruminants grasslands have opportunities for adding value by exploiting positive health characteristics in animal products from grassland and through the delivery of environmental benefits. In fact grasslands contribute to a high degree to the struggle against erosion and to the regularizing of water regimes, to the purification of fertilizers and pesticides and to biodiversity. Finally they have aesthetic role and recreational function as far as they provide public access that other agricultural uses do not allow. But even for grassland it is very difficult to create a good frame for its different tasks (1) the provision of forage for livestock, (2) protection and conservation of soil and water resources, (3) furnishing a habitat for wildlife, both flora and fauna and (4) contribution to the attractiveness of the landscape. Nevertheless it is the only crop, able to fulfil so many tasks and to fit so many requirements.

  10. Important Features of Sustainable Aggregate Resource Management

    Directory of Open Access Journals (Sweden)

    Slavko V. Šolar

    2004-06-01

    Full Text Available Every society, whether developed, developing or in a phase of renewal following governmental change, requires stable, adequate and secure supplies of natural resources. In the latter case, there could be significant need for construction materials for rebuilding infrastructure, industrial capacity, and housing. It is essential that these large-volume materials be provided in a rational manner that maximizes their societal contribution and minimizes environmental impacts. We describe an approach to resource management based on the principles of sustainable development. Sustainable Aggregate Resource Management offers a way of addressing the conflicting needs and interests of environmental, economic, and social systems. Sustainability is an ethics based concept that utilizes science and democratic processes to reach acceptable agreements and tradeoffs among interests, while acknowledging the fundamental importance of the environment and social goods. We discuss the features of sustainable aggregate resource management.

  11. Important features of Sustainable Aggregate Resource Management

    Science.gov (United States)

    Solar, Slavko V.; Shields, Deborah J.; Langer, William H.

    2004-01-01

    Every society, whether developed, developing or in a phase of renewal following governmental change, requires stable, adequate and secure supplies of natural resources. In the latter case, there could be significant need for construction materials for rebuilding infrastructure, industrial capacity, and housing. It is essential that these large-volume materials be provided in a rational manner that maximizes their societal contribution and minimizes environmental impacts. We describe an approach to resource management based on the principles of sustainable developed. Sustainable Aggregate Resource Management offers a way of addressing the conflicting needs and interests of environmental, economic, and social systems. Sustainability is an ethics based concept that utilizes science and democratic processes to reach acceptable agreements and tradeoffs among interests, while acknowledging the fundamental importance of the environment and social goods. We discuss the features of sustainable aggregate resource management.

  12. The importance of hydropower in Austria

    International Nuclear Information System (INIS)

    Kobau, R.; Pirker, O.; Spolwind, R.; Weiss, B.

    2009-01-01

    This article discusses the importance of hydropower-based power generation in Austria as a clean and emission-free source of electricity. The contribution made to total electricity generation is examined and figures are quoted. Hydropower is provided from both storage dams and run-of-river power stations such as those on the river Danube. The use of the various types of hydropower in connection with their economic optimisation, for example for the supply of valuable peak power, is discussed. The promotion of hydropower within the scope of European climate-protection efforts is examined. Projects concerning the augmentation of hydropower capacities are discussed and three exemplary projects are briefly described. Finally, the situation in Austria is compared with that to be found in neighbouring Switzerland.

  13. The United Nations and Global Public Goods: Historical Contributions and Future Challenges.

    Directory of Open Access Journals (Sweden)

    Bruce Jenks

    2012-03-01

    Full Text Available Published by Palgrave MacmillanThis chapter explores the thesis that the United Nations’ (UN most important contribution to the production of global public goods has been its role in creating the space and capacity to generate shared values. Starting with the UN Charter itself, the chapter traces the evolution of this contribution through different historical phases. It analyses the impact of globalisation on the role of the UN; in particular it identifies the quality of porousness as a product of globalisation which is critical to understanding the current challenges faced by the UN as well as central to the global public goods agenda. Through this lens the author briefly reviews the evolution of the UN’s role in the fields of peace and security, human rights and development cooperation. He concludes by identifying eight levers for change that will determine the UN’s ability to contribute significantly to the global public goods: the generation of norms and shared values, the quality of leadership, improved governance, innovative financing, institutional realignment, the further consolidation of legal instruments, focus, and the power of networks.

  14. Innovation Networks: the Contribution of Partnerships to Innovative Performance of Firms in the Brazilian Electrical-Electronics Industry

    Directory of Open Access Journals (Sweden)

    Silvye Ane Massaini

    2015-01-01

    Full Text Available Innovation networks have been identified in the literature as a way to complement firms’ innovative capabilities through collaboration with other partners. To provide empirical evidence for this assertion, this paper investigates the contribution of partners established in innovation networks for innovative performance of firms in the Brazilian electricalelectronics industry. For this purpose, we carried out an exploratory and descriptive survey among 185 companies. The data were analyzed using structural equation modeling (SEM. As the main findings, we observed that the establishment of collaborative relationships with customers, competitors and universities/research institutions can contribute to organizational and process innovation. However, despite obtaining some significant results concerning the contribution of different partners in the network, electrical-electronics industry companies also attach great importance to internal activities to develop their innovations.

  15. Assessing vulnerability to drought: identifying underlying factors across Europe

    Science.gov (United States)

    Urquijo, Julia; Gonzalez Tánago, Itziar; Ballesteros, Mario; De Stefano, Lucia

    2015-04-01

    Drought is considered one of the most severe and damaging natural hazards in terms of people and sectors affected and associated losses. Drought is a normal and recurrent climatic phenomenon that occurs worldwide, although its spatial and temporal characteristics vary significantly among climates. In the case of Europe, in the last thirty years, the region has suffered several drought events that have caused estimated economic damages over a €100 billion and have affected almost 20% of its territory and population. In recent years, there has been a growing awareness among experts and authorities of the need to shift from a reactive crisis approach to a drought risk management approach, as well as of the importance of designing and implementing policies, strategies and plans at country and river basin levels to deal with drought. The identification of whom and what is vulnerable to drought is a central aspect of drought risk mitigation and planning and several authors agree that societal vulnerability often determines drought risk more than the actual precipitation shortfalls. The final aim of a drought vulnerability assessment is to identify the underlying sources of drought impact, in order to develop policy options that help to enhance coping capacity and therefore to prevent drought impact. This study identifies and maps factors underlying vulnerability to drought across Europe. The identification of factors influencing vulnerability starts from the analysis of past drought impacts in four European socioeconomic sectors. This analysis, along with an extensive literature review, led to the selection of vulnerability factors that are both relevant and adequate for the European context. Adopting the IPCC model, vulnerability factors were grouped to describe exposure, sensitivity and adaptive capacity. The aggregation of these components has resulted in the mapping of vulnerability to drought across Europe at NUTS02 level. Final results have been compared with

  16. Contribution of tropical cyclones to global rainfall

    Science.gov (United States)

    Khouakhi, Abdou; Villarini, Gabriele; Vecchi, Gabriel; Smith, James

    2016-04-01

    patterns using the POT approach to identify extremes. The fractional contributions decrease as we move inland from the coast. Moreover, the relationship between TC-induced extreme rainfall and the El Niño-Southern Oscillation is also examined using logistic and Poisson regression. Results indicate that TC-induced extreme rainfall tends to occur more frequently in Australia and along the U.S. East Coast during La Niña, and along eastern Asia and northwestern Pacific islands during El Niño.

  17. Biologically important radiation damage in DNA

    International Nuclear Information System (INIS)

    Ward, J.F.

    1994-01-01

    Most DNA damage by the hydroxyl radical is confined to the bases, and this base damage represents an important component of locally multiply demanded sites (LMOS). The yields of the major damaged bases have been determined by gas chromatography mass spectrometry. For our propose, it was necessary to convert a known fraction of these damaged bases to strand breaks and then assay these labile sites as the increase in strand break yield over the normally observed level. Three potential agents by which this strategy of conversion of base damage to strand break could be implemented were identified in the original application: 1, Sl nuclease; 2, piperidine; and 3, base damage specific enzymes

  18. Identifying health disparities across the tobacco continuum.

    Science.gov (United States)

    Fagan, Pebbles; Moolchan, Eric T; Lawrence, Deirdre; Fernander, Anita; Ponder, Paris K

    2007-10-01

    Few frameworks have addressed work-force diversity, inequities and inequalities as part of a comprehensive approach to eliminating tobacco-related health disparities. This paper summarizes the literature and describes the known disparities that exist along the tobacco disease continuum for minority racial and ethnic groups, those living in poverty, those with low education and blue-collar and service workers. The paper also discusses how work-force diversity, inequities in research practice and knowledge allocation and inequalities in access to and quality of health care are fundamental to addressing disparities in health. We examined the available scientific literature and existing public health reports to identify disparities across the tobacco disease continuum by minority racial/ethnic group, poverty status, education level and occupation. Results indicate that differences in risk indicators along the tobacco disease continuum do not explain fully tobacco-related cancer consequences among some minority racial/ethnic groups, particularly among the aggregate groups, blacks/African Americans and American Indians/Alaska Natives. The lack of within-race/ethnic group data and its interactions with socio-economic factors across the life-span contribute to the inconsistency we observe in the disease causal paradigm. More comprehensive models are needed to understand the relationships among disparities, social context, diversity, inequalities and inequities. A systematic approach will also help researchers, practitioners, advocates and policy makers determine critical points for interventions, the types of studies and programs needed and integrative approaches needed to eliminate tobacco-related disparities.

  19. Ebola Virus Infection Modelling and Identifiability Problems

    Directory of Open Access Journals (Sweden)

    Van-Kinh eNguyen

    2015-04-01

    Full Text Available The recent outbreaks of Ebola virus (EBOV infections have underlined the impact of the virus as a major threat for human health. Due to the high biosafety classification of EBOV (level 4, basic research is very limited. Therefore, the development of new avenues of thinking to advance quantitative comprehension of the virus and its interaction with the host cells is urgently neededto tackle this lethal disease. Mathematical modelling of the EBOV dynamics can be instrumental to interpret Ebola infection kinetics on quantitative grounds. To the best of our knowledge, a mathematical modelling approach to unravel the interaction between EBOV and the host cells isstill missing. In this paper, a mathematical model based on differential equations is used to represent the basic interactions between EBOV and wild-type Vero cells in vitro. Parameter sets that represent infectivity of pathogens are estimated for EBOV infection and compared with influenza virus infection kinetics. The average infecting time of wild-type Vero cells in EBOV is slower than in influenza infection. Simulation results suggest that the slow infecting time of EBOV could be compensated by its efficient replication. This study reveals several identifiability problems and what kind of experiments are necessary to advance the quantification of EBOV infection. A first mathematical approach of EBOV dynamics and the estimation of standard parametersin viral infections kinetics is the key contribution of this work, paving the way for future modelling work on EBOV infection.

  20. A new uncertainty importance measure

    International Nuclear Information System (INIS)

    Borgonovo, E.

    2007-01-01

    Uncertainty in parameters is present in many risk assessment problems and leads to uncertainty in model predictions. In this work, we introduce a global sensitivity indicator which looks at the influence of input uncertainty on the entire output distribution without reference to a specific moment of the output (moment independence) and which can be defined also in the presence of correlations among the parameters. We discuss its mathematical properties and highlight the differences between the present indicator, variance-based uncertainty importance measures and a moment independent sensitivity indicator previously introduced in the literature. Numerical results are discussed with application to the probabilistic risk assessment model on which Iman [A matrix-based approach to uncertainty and sensitivity analysis for fault trees. Risk Anal 1987;7(1):22-33] first introduced uncertainty importance measures