Exome Sequencing Fails to Identify the Genetic Cause of Aicardi Syndrome.
Lund, Caroline; Striano, Pasquale; Sorte, Hanne Sørmo; Parisi, Pasquale; Iacomino, Michele; Sheng, Ying; Vigeland, Magnus D; Øye, Anne-Marte; Møller, Rikke Steensbjerre; Selmer, Kaja K; Zara, Federico
2016-09-01
Aicardi syndrome (AS) is a well-characterized neurodevelopmental disorder with an unknown etiology. In this study, we performed whole-exome sequencing in 11 female patients with the diagnosis of AS, in order to identify the disease-causing gene. In particular, we focused on detecting variants in the X chromosome, including the analysis of variants with a low number of sequencing reads, in case of somatic mosaicism. For 2 of the patients, we also sequenced the exome of the parents to search for de novo mutations. We did not identify any genetic variants likely to be damaging. Only one single missense variant was identified by the de novo analyses of the 2 trios, and this was considered benign. The failure to identify a disease gene in this study may be due to technical limitations of our study design, including the possibility that the genetic aberration leading to AS is situated in a non-exonic region or that the mutation is somatic and not detectable by our approach. Alternatively, it is possible that AS is genetically heterogeneous and that 11 patients are not sufficient to reveal the causative genes. Future studies of AS should consider designs where also non-exonic regions are explored and apply a sequencing depth so that also low-grade somatic mosaicism can be detected.
Genetic mapping and exome sequencing identify variants associated with five novel diseases.
Directory of Open Access Journals (Sweden)
Erik G Puffenberger
Full Text Available The Clinic for Special Children (CSC has integrated biochemical and molecular methods into a rural pediatric practice serving Old Order Amish and Mennonite (Plain children. Among the Plain people, we have used single nucleotide polymorphism (SNP microarrays to genetically map recessive disorders to large autozygous haplotype blocks (mean = 4.4 Mb that contain many genes (mean = 79. For some, uninformative mapping or large gene lists preclude disease-gene identification by Sanger sequencing. Seven such conditions were selected for exome sequencing at the Broad Institute; all had been previously mapped at the CSC using low density SNP microarrays coupled with autozygosity and linkage analyses. Using between 1 and 5 patient samples per disorder, we identified sequence variants in the known disease-causing genes SLC6A3 and FLVCR1, and present evidence to strongly support the pathogenicity of variants identified in TUBGCP6, BRAT1, SNIP1, CRADD, and HARS. Our results reveal the power of coupling new genotyping technologies to population-specific genetic knowledge and robust clinical data.
DEFF Research Database (Denmark)
Ren, Shancheng; Wei, Gong-Hong; Liu, Dongbing
2018-01-01
BACKGROUND: Global disparities in prostate cancer (PCa) incidence highlight the urgent need to identify genomic abnormalities in prostate tumors in different ethnic populations including Asian men. OBJECTIVE: To systematically explore the genomic complexity and define disease-driven genetic......-scale and comprehensive genomic data of prostate cancer from Asian population. Identification of these genetic alterations may help advance prostate cancer diagnosis, prognosis, and treatment....... alterations in PCa. DESIGN, SETTING, AND PARTICIPANTS: The study sequenced whole-genome and transcriptome of tumor-benign paired tissues from 65 treatment-naive Chinese PCa patients. Subsequent targeted deep sequencing of 293 PCa-relevant genes was performed in another cohort of 145 prostate tumors. OUTCOME...
Whole-exome sequencing identified a variant in EFTUD2 gene in establishing a genetic diagnosis.
Rengasamy Venugopalan, S; Farrow, E G; Lypka, M
2017-06-01
Craniofacial anomalies are complex and have an overlapping phenotype. Mandibulofacial Dysostosis and Oculo-Auriculo-Vertebral Spectrum are conditions that share common craniofacial phenotype and present a challenge in arriving at a diagnosis. In this report, we present a case of female proband who was given a differential diagnosis of Treacher Collins syndrome or Hemifacial Microsomia without certainty. Prior genetic testing reported negative for 22q deletion and FGFR screenings. The objective of this study was to demonstrate the critical role of whole-exome sequencing in establishing a genetic diagnosis of the proband. The participants were 14½-year-old affected female proband/parent trio. Proband/parent trio were enrolled in the study. Surgical tissue sample from the proband and parental blood samples were collected and prepared for whole-exome sequencing. Illumina HiSeq 2500 instrument was used for sequencing (125 nucleotide reads/84X coverage). Analyses of variants were performed using custom-developed software, RUNES and VIKING. Variant analyses following whole-exome sequencing identified a heterozygous de novo pathogenic variant, c.259C>T (p.Gln87*), in EFTUD2 (NM_004247.3) gene in the proband. Previous studies have reported that the variants in EFTUD2 gene were associated with Mandibulofacial Dysostosis with Microcephaly. Patients with facial asymmetry, micrognathia, choanal atresia and microcephaly should be analyzed for variants in EFTUD2 gene. Next-generation sequencing techniques, such as whole-exome sequencing offer great promise to improve the understanding of etiologies of sporadic genetic diseases. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Liu, Yong; Cao, Yu; Li, Yaxiong; Lei, Dongyun; Li, Lin; Hou, Zong Liu; Han, Shen; Meng, Mingyao; Shi, Jianlin; Zhang, Yayong; Wang, Yi; Niu, Zhaoyi; Xie, Yanhua; Xiao, Benshan; Wang, Yuanfei; Li, Xiao; Yang, Lirong; Wang, Wenju; Jiang, Lihong
2018-03-05
BACKGROUND Recently, mutations in several genes have been described to be associated with sporadic ASD, but some genetic variants remain to be identified. The aim of this study was to use whole-exome sequencing (WES) combined with bioinformatics analysis to identify novel genetic variants in cases of sporadic congenital ASD, followed by validation by Sanger sequencing. MATERIAL AND METHODS Five Han patients with secundum ASD were recruited, and their tissue samples were analyzed by WES, followed by verification by Sanger sequencing of tissue and blood samples. Further evaluation using blood samples included 452 additional patients with sporadic secundum ASD (212 male and 240 female patients) and 519 healthy subjects (252 male and 267 female subjects) for further verification by a multiplexed MassARRAY system. Bioinformatic analyses were performed to identify novel genetic variants associated with sporadic ASD. RESULTS From five patients with sporadic ASD, a total of 181,762 genomic variants in 33 exon loci, validated by Sanger sequencing, were selected and underwent MassARRAY analysis in 452 patients with ASD and 519 healthy subjects. Three loci with high mutation frequencies, the 138665410 FOXL2 gene variant, the 23862952 MYH6 gene variant, and the 71098693 HYDIN gene variant were found to be significantly associated with sporadic ASD (PASD (PASD, and supported the use of WES and bioinformatics analysis to identify disease-associated mutations.
Chen, Jun; Källman, Thomas; Ma, Xiao-Fei; Zaina, Giusi; Morgante, Michele; Lascoux, Martin
2016-07-07
The joint inference of selection and past demography remain a costly and demanding task. We used next generation sequencing of two pools of 48 Norway spruce mother trees, one corresponding to the Fennoscandian domain, and the other to the Alpine domain, to assess nucleotide polymorphism at 88 nuclear genes. These genes are candidate genes for phenological traits, and most belong to the photoperiod pathway. Estimates of population genetic summary statistics from the pooled data are similar to previous estimates, suggesting that pooled sequencing is reliable. The nonsynonymous SNPs tended to have both lower frequency differences and lower FST values between the two domains than silent ones. These results suggest the presence of purifying selection. The divergence between the two domains based on synonymous changes was around 5 million yr, a time similar to a recent phylogenetic estimate of 6 million yr, but much larger than earlier estimates based on isozymes. Two approaches, one of them novel and that considers both FST and difference in allele frequencies between the two domains, were used to identify SNPs potentially under diversifying selection. SNPs from around 20 genes were detected, including genes previously identified as main target for selection, such as PaPRR3 and PaGI. Copyright © 2016 Chen et al.
Cui, Junjie; Luo, Shaobo; Niu, Yu; Huang, Rukui; Wen, Qingfang; Su, Jianwen; Miao, Nansheng; He, Weiming; Dong, Zhensheng; Cheng, Jiaowen; Hu, Kailin
2018-01-01
Genetic mapping is a basic tool necessary for anchoring assembled scaffold sequences and for identifying QTLs controlling important traits. Though bitter gourd (Momordica charantia) is both consumed and used as a medicinal, research on its genomics and genetic mapping is severely limited. Here, we report the construction of a restriction site associated DNA (RAD)-based genetic map for bitter gourd using an F2 mapping population comprising 423 individuals derived from two cultivated inbred lines, the gynoecious line ‘K44’ and the monoecious line ‘Dali-11.’ This map comprised 1,009 SNP markers and spanned a total genetic distance of 2,203.95 cM across the 11 linkage groups. It anchored a total of 113 assembled scaffolds that covered about 251.32 Mb (85.48%) of the 294.01 Mb assembled genome. In addition, three horticulturally important traits including sex expression, fruit epidermal structure, and immature fruit color were evaluated using a combination of qualitative and quantitative data. As a result, we identified three QTL/gene loci responsible for these traits in three environments. The QTL/gene gy/fffn/ffn, controlling sex expression involved in gynoecy, first female flower node, and female flower number was detected in the reported region. Particularly, two QTLs/genes, Fwa/Wr and w, were found to be responsible for fruit epidermal structure and white immature fruit color, respectively. This RAD-based genetic map promotes the assembly of the bitter gourd genome and the identified genetic loci will accelerate the cloning of relevant genes in the future. PMID:29706980
Directory of Open Access Journals (Sweden)
Junjie Cui
2018-04-01
Full Text Available Genetic mapping is a basic tool necessary for anchoring assembled scaffold sequences and for identifying QTLs controlling important traits. Though bitter gourd (Momordica charantia is both consumed and used as a medicinal, research on its genomics and genetic mapping is severely limited. Here, we report the construction of a restriction site associated DNA (RAD-based genetic map for bitter gourd using an F2 mapping population comprising 423 individuals derived from two cultivated inbred lines, the gynoecious line ‘K44’ and the monoecious line ‘Dali-11.’ This map comprised 1,009 SNP markers and spanned a total genetic distance of 2,203.95 cM across the 11 linkage groups. It anchored a total of 113 assembled scaffolds that covered about 251.32 Mb (85.48% of the 294.01 Mb assembled genome. In addition, three horticulturally important traits including sex expression, fruit epidermal structure, and immature fruit color were evaluated using a combination of qualitative and quantitative data. As a result, we identified three QTL/gene loci responsible for these traits in three environments. The QTL/gene gy/fffn/ffn, controlling sex expression involved in gynoecy, first female flower node, and female flower number was detected in the reported region. Particularly, two QTLs/genes, Fwa/Wr and w, were found to be responsible for fruit epidermal structure and white immature fruit color, respectively. This RAD-based genetic map promotes the assembly of the bitter gourd genome and the identified genetic loci will accelerate the cloning of relevant genes in the future.
Whole-genome sequencing and genetic variant analysis of a Quarter Horse mare.
Doan, Ryan; Cohen, Noah D; Sawyer, Jason; Ghaffari, Noushin; Johnson, Charlie D; Dindot, Scott V
2012-01-01
BACKGROUND: The catalog of genetic variants in the horse genome originates from a few select animals, the majority originating from the Thoroughbred mare used for the equine genome sequencing project. The purpose of this study was to identify genetic variants, including single nucleotide polymorphisms (SNPs), insertion/deletion polymorphisms (INDELs), and copy number variants (CNVs) in the genome of an individual Quarter Horse mare sequenced by next-generation sequencing. RESULTS: Using massively parallel paired-end sequencing, we generated 59.6 Gb of DNA sequence from a Quarter Horse mare resulting in an average of 24.7X sequence coverage. Reads were mapped to approximately 97% of the reference Thoroughbred genome. Unmapped reads were de novo assembled resulting in 19.1 Mb of new genomic sequence in the horse. Using a stringent filtering method, we identified 3.1 million SNPs, 193 thousand INDELs, and 282 CNVs. Genetic variants were annotated to determine their impact on gene structure and function. Additionally, we genotyped this Quarter Horse for mutations of known diseases and for variants associated with particular traits. Functional clustering analysis of genetic variants revealed that most of the genetic variation in the horse's genome was enriched in sensory perception, signal transduction, and immunity and defense pathways. CONCLUSIONS: This is the first sequencing of a horse genome by next-generation sequencing and the first genomic sequence of an individual Quarter Horse mare. We have increased the catalog of genetic variants for use in equine genomics by the addition of novel SNPs, INDELs, and CNVs. The genetic variants described here will be a useful resource for future studies of genetic variation regulating performance traits and diseases in equids.
Whole-genome sequencing and genetic variant analysis of a Quarter Horse mare.
Doan, Ryan
2012-02-17
BACKGROUND: The catalog of genetic variants in the horse genome originates from a few select animals, the majority originating from the Thoroughbred mare used for the equine genome sequencing project. The purpose of this study was to identify genetic variants, including single nucleotide polymorphisms (SNPs), insertion/deletion polymorphisms (INDELs), and copy number variants (CNVs) in the genome of an individual Quarter Horse mare sequenced by next-generation sequencing. RESULTS: Using massively parallel paired-end sequencing, we generated 59.6 Gb of DNA sequence from a Quarter Horse mare resulting in an average of 24.7X sequence coverage. Reads were mapped to approximately 97% of the reference Thoroughbred genome. Unmapped reads were de novo assembled resulting in 19.1 Mb of new genomic sequence in the horse. Using a stringent filtering method, we identified 3.1 million SNPs, 193 thousand INDELs, and 282 CNVs. Genetic variants were annotated to determine their impact on gene structure and function. Additionally, we genotyped this Quarter Horse for mutations of known diseases and for variants associated with particular traits. Functional clustering analysis of genetic variants revealed that most of the genetic variation in the horse\\'s genome was enriched in sensory perception, signal transduction, and immunity and defense pathways. CONCLUSIONS: This is the first sequencing of a horse genome by next-generation sequencing and the first genomic sequence of an individual Quarter Horse mare. We have increased the catalog of genetic variants for use in equine genomics by the addition of novel SNPs, INDELs, and CNVs. The genetic variants described here will be a useful resource for future studies of genetic variation regulating performance traits and diseases in equids.
Whole Exome Sequencing Reveals Genetic Predisposition in a Large Family with Retinitis Pigmentosa
Directory of Open Access Journals (Sweden)
Juan Wu
2014-01-01
Full Text Available Next-generation sequencing has become more widely used to reveal genetic defect in monogenic disorders. Retinitis pigmentosa (RP, the leading cause of hereditary blindness worldwide, has been attributed to more than 67 disease-causing genes. Due to the extreme genetic heterogeneity, using general molecular screening alone is inadequate for identifying genetic predispositions in susceptible individuals. In order to identify underlying mutation rapidly, we utilized next-generation sequencing in a four-generation Chinese family with RP. Two affected patients and an unaffected sibling were subjected to whole exome sequencing. Through bioinformatics analysis and direct sequencing confirmation, we identified p.R135W transition in the rhodopsin gene. The mutation was subsequently confirmed to cosegregate with the disease in the family. In this study, our results suggest that whole exome sequencing is a robust method in diagnosing familial hereditary disease.
Exome sequencing and genetic testing for MODY.
Directory of Open Access Journals (Sweden)
Stefan Johansson
Full Text Available Genetic testing for monogenic diabetes is important for patient care. Given the extensive genetic and clinical heterogeneity of diabetes, exome sequencing might provide additional diagnostic potential when standard Sanger sequencing-based diagnostics is inconclusive.The aim of the study was to examine the performance of exome sequencing for a molecular diagnosis of MODY in patients who have undergone conventional diagnostic sequencing of candidate genes with negative results.We performed exome enrichment followed by high-throughput sequencing in nine patients with suspected MODY. They were Sanger sequencing-negative for mutations in the HNF1A, HNF4A, GCK, HNF1B and INS genes. We excluded common, non-coding and synonymous gene variants, and performed in-depth analysis on filtered sequence variants in a pre-defined set of 111 genes implicated in glucose metabolism.On average, we obtained 45 X median coverage of the entire targeted exome and found 199 rare coding variants per individual. We identified 0-4 rare non-synonymous and nonsense variants per individual in our a priori list of 111 candidate genes. Three of the variants were considered pathogenic (in ABCC8, HNF4A and PPARG, respectively, thus exome sequencing led to a genetic diagnosis in at least three of the nine patients. Approximately 91% of known heterozygous SNPs in the target exomes were detected, but we also found low coverage in some key diabetes genes using our current exome sequencing approach. Novel variants in the genes ARAP1, GLIS3, MADD, NOTCH2 and WFS1 need further investigation to reveal their possible role in diabetes.Our results demonstrate that exome sequencing can improve molecular diagnostics of MODY when used as a complement to Sanger sequencing. However, improvements will be needed, especially concerning coverage, before the full potential of exome sequencing can be realized.
Zhang, Guoyu; Ren, Yi; Sun, Honghe; Guo, Shaogui; Zhang, Fan; Zhang, Jie; Zhang, Haiying; Jia, Zhangcai; Fei, Zhangjun; Xu, Yong; Li, Haizhen
2015-12-24
Pumpkin (Cucurbita maxima Duch.) is an economically important crop belonging to the Cucurbitaceae family. However, very few genomic and genetic resources are available for this species. As part of our ongoing efforts to sequence the pumpkin genome, high-density genetic map is essential for anchoring and orienting the assembled scaffolds. In addition, a saturated genetic map can facilitate quantitative trait locus (QTL) mapping. A set of 186 F2 plants derived from the cross of pumpkin inbred lines Rimu and SQ026 were genotyped using the genotyping-by-sequencing approach. Using the SNPs we identified, a high-density genetic map containing 458 bin-markers was constructed, spanning a total genetic distance of 2,566.8 cM across the 20 linkage groups of C. maxima with a mean marker density of 5.60 cM. Using this map we were able to anchor 58 assembled scaffolds that covered about 194.5 Mb (71.7%) of the 271.4 Mb assembled pumpkin genome, of which 44 (183.0 Mb; 67.4%) were oriented. Furthermore, the high-density genetic map was used to identify genomic regions highly associated with an important agronomic trait, dwarf vine. Three QTLs on linkage groups (LGs) 1, 3 and 4, respectively, were recovered. One QTL, qCmB2, which was located in an interval of 0.42 Mb on LG 3, explained 21.4% phenotypic variations. Within qCmB2, one gene, Cma_004516, encoding the gibberellin (GA) 20-oxidase in the GA biosynthesis pathway, had a 1249-bp deletion in its promoter in bush type lines, and its expression level was significantly increased during the vine growth and higher in vine type lines than bush type lines, supporting Cma_004516 as a possible candidate gene controlling vine growth in pumpkin. A high-density pumpkin genetic map was constructed, which was used to successfully anchor and orient the assembled genome scaffolds, and to identify QTLs highly associated with pumpkin vine length. The map provided a valuable resource for gene cloning and marker assisted breeding in pumpkin and
Exome sequencing identifies ZNF644 mutations in high myopia.
Directory of Open Access Journals (Sweden)
Yi Shi
2011-06-01
Full Text Available Myopia is the most common ocular disorder worldwide, and high myopia in particular is one of the leading causes of blindness. Genetic factors play a critical role in the development of myopia, especially high myopia. Recently, the exome sequencing approach has been successfully used for the disease gene identification of Mendelian disorders. Here we show a successful application of exome sequencing to identify a gene for an autosomal dominant disorder, and we have identified a gene potentially responsible for high myopia in a monogenic form. We captured exomes of two affected individuals from a Han Chinese family with high myopia and performed sequencing analysis by a second-generation sequencer with a mean coverage of 30× and sufficient depth to call variants at ∼97% of each targeted exome. The shared genetic variants of these two affected individuals in the family being studied were filtered against the 1000 Genomes Project and the dbSNP131 database. A mutation A672G in zinc finger protein 644 isoform 1 (ZNF644 was identified as being related to the phenotype of this family. After we performed sequencing analysis of the exons in the ZNF644 gene in 300 sporadic cases of high myopia, we identified an additional five mutations (I587V, R680G, C699Y, 3'UTR+12 C>G, and 3'UTR+592 G>A in 11 different patients. All these mutations were absent in 600 normal controls. The ZNF644 gene was expressed in human retinal and retinal pigment epithelium (RPE. Given that ZNF644 is predicted to be a transcription factor that may regulate genes involved in eye development, mutation may cause the axial elongation of eyeball found in high myopia patients. Our results suggest that ZNF644 might be a causal gene for high myopia in a monogenic form.
Directory of Open Access Journals (Sweden)
Chuphong Thongnak
2018-01-01
Full Text Available Autism spectrum disorder (ASD has a strong genetic basis, although the genetics of autism is complex and it is unclear. Genetic testing such as microarray or sequencing was widely used to identify autism markers, but they are unsuccessful in several cases. The objective of this study is to identify causative variants of autism in two Thai families by using whole-exome sequencing technique. Whole-exome sequencing was performed with autism-affected children from two unrelated families. Each sample was sequenced on SOLiD 5500xl Genetic Analyzer system followed by combined bioinformatics pipeline including annotation and filtering process to identify candidate variants. Candidate variants were validated, and the segregation study with other family members was performed using Sanger sequencing. This study identified a possible causative variant for ASD, c.2951G>A, in the FGD6 gene. We demonstrated the potential for ASD genetic variants associated with ASD using whole-exome sequencing and a bioinformatics filtering procedure. These techniques could be useful in identifying possible causative ASD variants, especially in cases in which variants cannot be identified by other techniques.
Genomic multiple sequence alignments: refinement using a genetic algorithm
Directory of Open Access Journals (Sweden)
Lefkowitz Elliot J
2005-08-01
Full Text Available Abstract Background Genomic sequence data cannot be fully appreciated in isolation. Comparative genomics – the practice of comparing genomic sequences from different species – plays an increasingly important role in understanding the genotypic differences between species that result in phenotypic differences as well as in revealing patterns of evolutionary relationships. One of the major challenges in comparative genomics is producing a high-quality alignment between two or more related genomic sequences. In recent years, a number of tools have been developed for aligning large genomic sequences. Most utilize heuristic strategies to identify a series of strong sequence similarities, which are then used as anchors to align the regions between the anchor points. The resulting alignment is globally correct, but in many cases is suboptimal locally. We describe a new program, GenAlignRefine, which improves the overall quality of global multiple alignments by using a genetic algorithm to improve local regions of alignment. Regions of low quality are identified, realigned using the program T-Coffee, and then refined using a genetic algorithm. Because a better COFFEE (Consistency based Objective Function For alignmEnt Evaluation score generally reflects greater alignment quality, the algorithm searches for an alignment that yields a better COFFEE score. To improve the intrinsic slowness of the genetic algorithm, GenAlignRefine was implemented as a parallel, cluster-based program. Results We tested the GenAlignRefine algorithm by running it on a Linux cluster to refine sequences from a simulation, as well as refine a multiple alignment of 15 Orthopoxvirus genomic sequences approximately 260,000 nucleotides in length that initially had been aligned by Multi-LAGAN. It took approximately 150 minutes for a 40-processor Linux cluster to optimize some 200 fuzzy (poorly aligned regions of the orthopoxvirus alignment. Overall sequence identity increased only
Whole-exome sequencing identifies USH2A mutations in a pseudo-dominant Usher syndrome family.
Zheng, Sui-Lian; Zhang, Hong-Liang; Lin, Zhen-Lang; Kang, Qian-Yan
2015-10-01
Usher syndrome (USH) is an autosomal recessive (AR) multi-sensory degenerative disorder leading to deaf-blindness. USH is clinically subdivided into three subclasses, and 10 genes have been identified thus far. Clinical and genetic heterogeneities in USH make a precise diagnosis difficult. A dominant‑like USH family in successive generations was identified, and the present study aimed to determine the genetic predisposition of this family. Whole‑exome sequencing was performed in two affected patients and an unaffected relative. Systematic data were analyzed by bioinformatic analysis to remove the candidate mutations via step‑wise filtering. Direct Sanger sequencing and co‑segregation analysis were performed in the pedigree. One novel and two known mutations in the USH2A gene were identified, and were further confirmed by direct sequencing and co‑segregation analysis. The affected mother carried compound mutations in the USH2A gene, while the unaffected father carried a heterozygous mutation. The present study demonstrates that whole‑exome sequencing is a robust approach for the molecular diagnosis of disorders with high levels of genetic heterogeneity.
Unique Trichomonas vaginalis gene sequences identified in multinational regions of Northwest China.
Liu, Jun; Feng, Meng; Wang, Xiaolan; Fu, Yongfeng; Ma, Cailing; Cheng, Xunjia
2017-07-24
Trichomonas vaginalis (T. vaginalis) is a flagellated protozoan parasite that infects humans worldwide. This study determined the sequence of the 18S ribosomal RNA gene of T. vaginalis infecting both females and males in Xinjiang, China. Samples from 73 females and 28 males were collected and confirmed for infection with T. vaginalis, a total of 110 sequences were identified when the T. vaginalis 18S ribosomal RNA gene was sequenced. These sequences were used to prepare a phylogenetic network. The rooted network comprised three large clades and several independent branches. Most of the Xinjiang sequences were in one group. Preliminary results suggest that Xinjiang T. vaginalis isolates might be genetically unique, as indicated by the sequence of their 18S ribosomal RNA gene. Low migration rate of local people in this province may contribute to a genetic conservativeness of T. vaginalis. The unique genetic feature of our isolates may suggest a different clinical presentation of trichomoniasis, including metronidazole susceptibility, T. vaginalis virus or Mycoplasma co-infection characteristics. The transmission and evolution of Xinjiang T. vaginalis is of interest and should be studied further. More attention should be given to T. vaginalis infection in both females and males in Xinjiang.
Identifying transposon insertions and their effects from RNA-sequencing data.
de Ruiter, Julian R; Kas, Sjors M; Schut, Eva; Adams, David J; Koudijs, Marco J; Wessels, Lodewyk F A; Jonkers, Jos
2017-07-07
Insertional mutagenesis using engineered transposons is a potent forward genetic screening technique used to identify cancer genes in mouse model systems. In the analysis of these screens, transposon insertion sites are typically identified by targeted DNA-sequencing and subsequently assigned to predicted target genes using heuristics. As such, these approaches provide no direct evidence that insertions actually affect their predicted targets or how transcripts of these genes are affected. To address this, we developed IM-Fusion, an approach that identifies insertion sites from gene-transposon fusions in standard single- and paired-end RNA-sequencing data. We demonstrate IM-Fusion on two separate transposon screens of 123 mammary tumors and 20 B-cell acute lymphoblastic leukemias, respectively. We show that IM-Fusion accurately identifies transposon insertions and their true target genes. Furthermore, by combining the identified insertion sites with expression quantification, we show that we can determine the effect of a transposon insertion on its target gene(s) and prioritize insertions that have a significant effect on expression. We expect that IM-Fusion will significantly enhance the accuracy of cancer gene discovery in forward genetic screens and provide initial insight into the biological effects of insertions on candidate cancer genes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Modeling genetic imprinting effects of DNA sequences with multilocus polymorphism data
Directory of Open Access Journals (Sweden)
Staud Roland
2009-08-01
Full Text Available Abstract Single nucleotide polymorphisms (SNPs represent the most widespread type of DNA sequence variation in the human genome and they have recently emerged as valuable genetic markers for revealing the genetic architecture of complex traits in terms of nucleotide combination and sequence. Here, we extend an algorithmic model for the haplotype analysis of SNPs to estimate the effects of genetic imprinting expressed at the DNA sequence level. The model provides a general procedure for identifying the number and types of optimal DNA sequence variants that are expressed differently due to their parental origin. The model is used to analyze a genetic data set collected from a pain genetics project. We find that DNA haplotype GAC from three SNPs, OPRKG36T (with two alleles G and T, OPRKA843G (with alleles A and G, and OPRKC846T (with alleles C and T, at the kappa-opioid receptor, triggers a significant effect on pain sensitivity, but with expression significantly depending on the parent from which it is inherited (p = 0.008. With a tremendous advance in SNP identification and automated screening, the model founded on haplotype discovery and statistical inference may provide a useful tool for genetic analysis of any quantitative trait with complex inheritance.
Genetic diagnosis of Mendelian disorders via RNA sequencing.
Kremer, Laura S; Bader, Daniel M; Mertes, Christian; Kopajtich, Robert; Pichler, Garwin; Iuso, Arcangela; Haack, Tobias B; Graf, Elisabeth; Schwarzmayr, Thomas; Terrile, Caterina; Koňaříková, Eliška; Repp, Birgit; Kastenmüller, Gabi; Adamski, Jerzy; Lichtner, Peter; Leonhardt, Christoph; Funalot, Benoit; Donati, Alice; Tiranti, Valeria; Lombes, Anne; Jardel, Claude; Gläser, Dieter; Taylor, Robert W; Ghezzi, Daniele; Mayr, Johannes A; Rötig, Agnes; Freisinger, Peter; Distelmaier, Felix; Strom, Tim M; Meitinger, Thomas; Gagneur, Julien; Prokisch, Holger
2017-06-12
Across a variety of Mendelian disorders, ∼50-75% of patients do not receive a genetic diagnosis by exome sequencing indicating disease-causing variants in non-coding regions. Although genome sequencing in principle reveals all genetic variants, their sizeable number and poorer annotation make prioritization challenging. Here, we demonstrate the power of transcriptome sequencing to molecularly diagnose 10% (5 of 48) of mitochondriopathy patients and identify candidate genes for the remainder. We find a median of one aberrantly expressed gene, five aberrant splicing events and six mono-allelically expressed rare variants in patient-derived fibroblasts and establish disease-causing roles for each kind. Private exons often arise from cryptic splice sites providing an important clue for variant prioritization. One such event is found in the complex I assembly factor TIMMDC1 establishing a novel disease-associated gene. In conclusion, our study expands the diagnostic tools for detecting non-exonic variants and provides examples of intronic loss-of-function variants with pathological relevance.
Exome Sequencing Fails to Identify the Genetic Cause of Aicardi Syndrome
DEFF Research Database (Denmark)
Lund, Caroline; Striano, Pasquale; Sorte, Hanne Sørmo
2016-01-01
Aicardi syndrome (AS) is a well-characterized neurodevelopmental disorder with an unknown etiology. In this study, we performed whole-exome sequencing in 11 female patients with the diagnosis of AS, in order to identify the disease-causing gene. In particular, we focused on detecting variants in ...
The genetic basis of DOORS syndrome : an exome-sequencing study
Campeau, Philippe M.; Kasperaviciute, Dalia; Lu, James T.; Burrage, Lindsay C.; Kim, Choel; Hori, Mutsuki; Powell, Berkley R.; Stewart, Fiona; Felix, Temis Maria; van den Ende, Jenneke; Wisniewska, Marzena; Kayserili, Huelya; Rump, Patrick; Nampoothiri, Sheela; Aftimos, Salim; Mey, Antje; Nair, Lal D. V.; Begleiter, Michael L.; De Bie, Isabelle; Meenakshi, Girish; Murray, Mitzi L.; Repetto, Gabriela M.; Golabi, Mahin; Blair, Edward; Male, Alison; Giuliano, Fabienne; Kariminejad, Ariana; Newman, William G.; Bhaskar, Sanjeev S.; Dickerson, Jonathan E.; Kerr, Bronwyn; Banka, Siddharth; Giltay, Jacques C.; Wieczorek, Dagmar; Tostevin, Anna; Wiszniewska, Joanna; Cheung, Sau Wai; Hennekam, Raoul C.; Gibbs, Richard A.; Lee, Brendan H.; Sisodiya, Sanjay M.
Background Deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures (DOORS) syndrome is a rare autosomal recessive disorder of unknown cause. We aimed to identify the genetic basis of this syndrome by sequencing most coding exons in affected individuals. Methods Through a search
The genetic basis of DOORS syndrome: an exome-sequencing study
Campeau, Philippe M.; Kasperaviciute, Dalia; Lu, James T.; Burrage, Lindsay C.; Kim, Choel; Hori, Mutsuki; Powell, Berkley R.; Stewart, Fiona; Félix, Têmis Maria; van den Ende, Jenneke; Wisniewska, Marzena; Kayserili, Hülya; Rump, Patrick; Nampoothiri, Sheela; Aftimos, Salim; Mey, Antje; Nair, Lal D. V.; Begleiter, Michael L.; de Bie, Isabelle; Meenakshi, Girish; Murray, Mitzi L.; Repetto, Gabriela M.; Golabi, Mahin; Blair, Edward; Male, Alison; Giuliano, Fabienne; Kariminejad, Ariana; Newman, William G.; Bhaskar, Sanjeev S.; Dickerson, Jonathan E.; Kerr, Bronwyn; Banka, Siddharth; Giltay, Jacques C.; Wieczorek, Dagmar; Tostevin, Anna; Wiszniewska, Joanna; Cheung, Sau Wai; Hennekam, Raoul C.; Gibbs, Richard A.; Lee, Brendan H.; Sisodiya, Sanjay M.
2014-01-01
Deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures (DOORS) syndrome is a rare autosomal recessive disorder of unknown cause. We aimed to identify the genetic basis of this syndrome by sequencing most coding exons in affected individuals. Through a search of available case
Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes.
Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich
2012-02-01
The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.
Directory of Open Access Journals (Sweden)
Yukinori Okada
Full Text Available Integrating genetic data from families with highly penetrant forms of disease together with genetic data from outbred populations represents a promising strategy to uncover the complete frequency spectrum of risk alleles for complex traits such as rheumatoid arthritis (RA. Here, we demonstrate that rare, low-frequency and common alleles at one gene locus, phospholipase B1 (PLB1, might contribute to risk of RA in a 4-generation consanguineous pedigree (Middle Eastern ancestry and also in unrelated individuals from the general population (European ancestry. Through identity-by-descent (IBD mapping and whole-exome sequencing, we identified a non-synonymous c.2263G>C (p.G755R mutation at the PLB1 gene on 2q23, which significantly co-segregated with RA in family members with a dominant mode of inheritance (P = 0.009. We further evaluated PLB1 variants and risk of RA using a GWAS meta-analysis of 8,875 RA cases and 29,367 controls of European ancestry. We identified significant contributions of two independent non-coding variants near PLB1 with risk of RA (rs116018341 [MAF = 0.042] and rs116541814 [MAF = 0.021], combined P = 3.2 × 10(-6. Finally, we performed deep exon sequencing of PLB1 in 1,088 RA cases and 1,088 controls (European ancestry, and identified suggestive dispersion of rare protein-coding variant frequencies between cases and controls (P = 0.049 for C-alpha test and P = 0.055 for SKAT. Together, these data suggest that PLB1 is a candidate risk gene for RA. Future studies to characterize the full spectrum of genetic risk in the PLB1 genetic locus are warranted.
Rodriguez-Flores, Juan L.; Fakhro, Khalid; Hackett, Neil R.; Salit, Jacqueline; Fuller, Jennifer; Agosto-Perez, Francisco; Gharbiah, Maey; Malek, Joel A.; Zirie, Mahmoud; Jayyousi, Amin; Badii, Ramin; Al-Marri, Ajayeb Al-Nabet; Chouchane, Lotfi; Stadler, Dora J.; Hunter-Zinck, Haley; Mezey, Jason G.; Crystal, Ronald G.
2013-01-01
Exome sequencing of families of related individuals has been highly successful in identifying genetic polymorphisms responsible for Mendelian disorders. Here, we demonstrate the value of the reverse approach, where we use exome sequencing of a sample of unrelated individuals to analyze allele frequencies of known causal mutations for Mendelian diseases. We sequenced the exomes of 100 individuals representing the three major genetic subgroups of the Qatari population (Q1 Bedouin, Q2 Persian-South Asian, Q3 African) and identified 37 variants in 33 genes with effects on 36 clinically significant Mendelian diseases. These include variants not present in 1000 Genomes and variants at high frequency when compared to 1000 Genomes populations. Several of these Mendelian variants were only segregating in one Qatari subpopulation, where the observed subpopulation specificity trends were confirmed in an independent population of 386 Qataris. Pre-marital genetic screening in Qatar tests for only 4 out of the 37, such that this study provides a set of Mendelian disease variants with potential impact on the epidemiological profile of the population that could be incorporated into the testing program if further experimental and clinical characterization confirms high penetrance. PMID:24123366
High-precision, whole-genome sequencing of laboratory strains facilitates genetic studies.
Directory of Open Access Journals (Sweden)
Anjana Srivatsan
2008-08-01
Full Text Available Whole-genome sequencing is a powerful technique for obtaining the reference sequence information of multiple organisms. Its use can be dramatically expanded to rapidly identify genomic variations, which can be linked with phenotypes to obtain biological insights. We explored these potential applications using the emerging next-generation sequencing platform Solexa Genome Analyzer, and the well-characterized model bacterium Bacillus subtilis. Combining sequencing with experimental verification, we first improved the accuracy of the published sequence of the B. subtilis reference strain 168, then obtained sequences of multiple related laboratory strains and different isolates of each strain. This provides a framework for comparing the divergence between different laboratory strains and between their individual isolates. We also demonstrated the power of Solexa sequencing by using its results to predict a defect in the citrate signal transduction pathway of a common laboratory strain, which we verified experimentally. Finally, we examined the molecular nature of spontaneously generated mutations that suppress the growth defect caused by deletion of the stringent response mediator relA. Using whole-genome sequencing, we rapidly mapped these suppressor mutations to two small homologs of relA. Interestingly, stable suppressor strains had mutations in both genes, with each mutation alone partially relieving the relA growth defect. This supports an intriguing three-locus interaction module that is not easily identifiable through traditional suppressor mapping. We conclude that whole-genome sequencing can drastically accelerate the identification of suppressor mutations and complex genetic interactions, and it can be applied as a standard tool to investigate the genetic traits of model organisms.
Genetic mutation analysis of human gastric adenocarcinomas using ion torrent sequencing platform.
Directory of Open Access Journals (Sweden)
Zhi Xu
Full Text Available Gastric cancer is the one of the major causes of cancer-related death, especially in Asia. Gastric adenocarcinoma, the most common type of gastric cancer, is heterogeneous and its incidence and cause varies widely with geographical regions, gender, ethnicity, and diet. Since unique mutations have been observed in individual human cancer samples, identification and characterization of the molecular alterations underlying individual gastric adenocarcinomas is a critical step for developing more effective, personalized therapies. Until recently, identifying genetic mutations on an individual basis by DNA sequencing remained a daunting task. Recent advances in new next-generation DNA sequencing technologies, such as the semiconductor-based Ion Torrent sequencing platform, makes DNA sequencing cheaper, faster, and more reliable. In this study, we aim to identify genetic mutations in the genes which are targeted by drugs in clinical use or are under development in individual human gastric adenocarcinoma samples using Ion Torrent sequencing. We sequenced 737 loci from 45 cancer-related genes in 238 human gastric adenocarcinoma samples using the Ion Torrent Ampliseq Cancer Panel. The sequencing analysis revealed a high occurrence of mutations along the TP53 locus (9.7% in our sample set. Thus, this study indicates the utility of a cost and time efficient tool such as Ion Torrent sequencing to screen cancer mutations for the development of personalized cancer therapy.
Huang, Xiao-Yan; Zhuang, Hong; Wu, Ji-Hong; Li, Jian-Kang; Hu, Fang-Yuan; Zheng, Yu; Tellier, Laurent Christian Asker M.; Zhang, Sheng-Hai; Gao, Feng-Juan; Zhang, Jian-Guo
2017-01-01
Purpose Familial exudative vitreoretinopathy (FEVR) is a genetically and clinically heterogeneous disease, characterized by failure of vascular development of the peripheral retina. The symptoms of FEVR vary widely among patients in the same family, and even between the two eyes of a given patient. This study was designed to identify the genetic defect in a patient cohort of ten Chinese families with a definitive diagnosis of FEVR. Methods To identify the causative gene, next-generation sequencing (NGS)-based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members by using Sanger sequencing and quantitative real-time PCR (QPCR). Results Of the cohort of ten FEVR families, six pathogenic variants were identified, including four novel and two known heterozygous mutations. Of the variants identified, four were missense variants, and two were novel heterozygous deletion mutations [LRP5, c.4053 DelC (p.Ile1351IlefsX88); TSPAN12, EX8Del]. The two novel heterozygous deletion mutations were not observed in the control subjects and could give rise to a relatively severe FEVR phenotype, which could be explained by the protein function prediction. Conclusions We identified two novel heterozygous deletion mutations [LRP5, c.4053 DelC (p.Ile1351IlefsX88); TSPAN12, EX8Del] using targeted NGS as a causative mutation for FEVR. These genetic deletion variations exhibit a severe form of FEVR, with tractional retinal detachments compared with other known point mutations. The data further enrich the mutation spectrum of FEVR and enhance our understanding of genotype–phenotype correlations to provide useful information for disease diagnosis, prognosis, and effective genetic counseling. PMID:28867931
Molecular defects identified by whole exome sequencing in a child with Fanconi anemia.
Zheng, Zhaojing; Geng, Juan; Yao, Ru-En; Li, Caihua; Ying, Daming; Shen, Yongnian; Ying, Lei; Yu, Yongguo; Fu, Qihua
2013-11-10
Fanconi anemia is a rare genetic disease characterized by bone marrow failure, multiple congenital malformations, and an increased susceptibility to malignancy. At least 15 genes have been identified that are involved in the pathogenesis of Fanconi anemia. However, it is still a challenge to assign the complementation group and to characterize the molecular defects in patients with Fanconi anemia. In the current study, whole exome sequencing was used to identify the affected gene(s) in a boy with Fanconi anemia. A recurring, non-synonymous mutation was found (c.3971C>T, p.P1324L) as well as a novel frameshift mutation (c.989_995del, p.H330LfsX2) in FANCA gene. Our results indicate that whole exome sequencing may be useful in clinical settings for rapid identification of disease-causing mutations in rare genetic disorders such as Fanconi anemia. © 2013 Elsevier B.V. All rights reserved.
Zhou, Qiongqiong; Sun, Wenjuan; Liu, Xiyan; Wang, Xiliang; Xiao, Yuncai; Bi, Dingren; Yin, Jingdong; Shi, Deshi
2016-01-01
Pig liver carboxylesterase (PLE) gene sequences in GenBank are incomplete, which has led to difficulties in studying the genetic structure and regulation mechanisms of gene expression of PLE family genes. The aim of this study was to obtain and analysis of complete gene sequences of PLE family by screening from a Rongchang pig BAC library and third-generation PacBio gene sequencing. After a number of existing incomplete PLE isoform gene sequences were analysed, primers were designed based on conserved regions in PLE exons, and the whole pig genome used as a template for Polymerase chain reaction (PCR) amplification. Specific primers were then selected based on the PCR amplification results. A three-step PCR screening method was used to identify PLE-positive clones by screening a Rongchang pig BAC library and PacBio third-generation sequencing was performed. BLAST comparisons and other bioinformatics methods were applied for sequence analysis. Five PLE-positive BAC clones, designated BAC-10, BAC-70, BAC-75, BAC-119 and BAC-206, were identified. Sequence analysis yielded the complete sequences of four PLE genes, PLE1, PLE-B9, PLE-C4, and PLE-G2. Complete PLE gene sequences were defined as those containing regulatory sequences, exons, and introns. It was found that, not only did the PLE exon sequences of the four genes show a high degree of homology, but also that the intron sequences were highly similar. Additionally, the regulatory region of the genes contained two 720bps reverse complement sequences that may have an important function in the regulation of PLE gene expression. This is the first report to confirm the complete sequences of four PLE genes. In addition, the study demonstrates that each PLE isoform is encoded by a single gene and that the various genes exhibit a high degree of sequence homology, suggesting that the PLE family evolved from a single ancestral gene. Obtaining the complete sequences of these PLE genes provides the necessary foundation for
Yan, Ning; Nie, Hua-Ming; Jiang, Zhong-Rong; Yang, Ai-Guo; Deng, Shi-Jin; Guo, Li; Yu, Hua; Yan, Yu-Bao; Tsering, Dawa; Kong, Wei-Shu; Wang, Ning; Wang, Jia-Hai; Xie, Yue; Fu, Yan; Yang, De-Ying; Wang, Shu-Xian; Gu, Xiao-Bin; Peng, Xue-Rong; Yang, Guang-You
2013-09-01
To analyse genetic variability and population structure, 84 isolates of Echinococcus granulosus (Cestoda: Taeniidae) collected from various host species at different sites of the Tibetan plateau in China were sequenced for the whole mitochondrial nad1 (894 bp) and atp6 (513 bp) genes. The vast majority were classified as G1 genotype (n=82), and two samples from human patients in Sichuan province were identified as G3 genotype. Based on the concatenated sequences of nad1+atp6, 28 different haplotypes (NA1-NA28) were identified. A parsimonious network of the concatenated sequence haplotypes showed star-like features in the overall population, with NA1 as the major haplotype in the population networks. By AMOVA it was shown that variation of E. granulosus within the overall population was the main pattern of the total genetic variability. Neutrality indexes of the concatenated sequence (nad1+atp6) were computed by Tajima's D and Fu's Fs tests and showed high negative values for E. granulosus, indicating significant deviations from neutrality. FST and Nm values suggested that the populations were not genetically differentiated. Copyright © 2013 Elsevier B.V. All rights reserved.
Characterisation of the genetic diversity of Brucella by multilocus sequencing
Directory of Open Access Journals (Sweden)
MacMillan Alastair P
2007-04-01
Full Text Available Abstract Background Brucella species include economically important zoonotic pathogens that can infect a wide range of animals. There are currently six classically recognised species of Brucella although, as yet unnamed, isolates from various marine mammal species have been reported. In order to investigate genetic relationships within the group and identify potential diagnostic markers we have sequenced multiple genetic loci from a large sample of Brucella isolates representing the known diversity of the genus. Results Nine discrete genomic loci corresponding to 4,396 bp of sequence were examined from 160 Brucella isolates. By assigning each distinct allele at a locus an arbitrary numerical designation the population was found to represent 27 distinct sequence types (STs. Diversity at each locus ranged from 1.03–2.45% while overall genetic diversity equated to 1.5%. Most loci examined represent housekeeping gene loci and, in all but one case, the ratio of non-synonymous to synonymous change was substantially Brucella species, B. abortus, B. melitensis, B. ovis and B. neotomae correspond to well-separated clusters. With the exception of biovar 5, B. suis isolates cluster together, although they form a more diverse group than other classical species with a number of distinct STs corresponding to the remaining four biovars. B. canis isolates are located on the same branch very closely related to, but distinguishable from, B. suis biovar 3 and 4 isolates. Marine mammal isolates represent a distinct, though rather weakly supported, cluster within which individual STs display one of three clear host preferences. Conclusion The sequence database provides a powerful dataset for addressing ongoing controversies in Brucella taxonomy and a tool for unambiguously placing atypical, phenotypically discordant or newly emerging Brucella isolates. Furthermore, by using the phylogenetic backbone described here, robust and rationally selected markers for use in
Genetic counselors' views and experiences with the clinical integration of genome sequencing.
Machini, Kalotina; Douglas, Jessica; Braxton, Alicia; Tsipis, Judith; Kramer, Kate
2014-08-01
In recent years, new sequencing technologies known as next generation sequencing (NGS) have provided scientists the ability to rapidly sequence all known coding as well as non-coding sequences in the human genome. As the two emerging approaches, whole exome (WES) and whole genome (WGS) sequencing, have started to be integrated in the clinical arena, we sought to survey health care professionals who are likely to be involved in the implementation process now and/or in the future (e.g., genetic counselors, geneticists and nurse practitioners). Two hundred twenty-one genetic counselors- one third of whom currently offer WES/WGS-participated in an anonymous online survey. The aims of the survey were first, to identify barriers to the implementation of WES/WGS, as perceived by survey participants; second, to provide the first systematic report of current practices regarding the integration of WES/WGS in clinic and/or research across the US and Canada and to illuminate the roles and challenges of genetic counselors participating in this process; and third to evaluate the impact of WES/WGS on patient care. Our results showed that genetic counseling practices with respect to WES/WGS are consistent with the criteria set forth in the ACMG 2012 policy statement, which highlights indications for testing, reporting, and pre/post test considerations. Our respondents described challenges related to offering WES/WGS, which included billing issues, the duration and content of the consent process, result interpretation and disclosure of incidental findings and variants of unknown significance. In addition, respondents indicated that specialty area (i.e., prenatal and cancer), lack of clinical utility of WES/WGS and concerns about interpretation of test results were factors that prevented them from offering this technology to patients. Finally, study participants identified the aspects of their professional training which have been most beneficial in aiding with the integration of
Wang, Q Z; Huang, M; Downie, S R; Chen, Z X
2016-05-23
Invasive plants tend to spread aggressively in new habitats and an understanding of their genetic diversity and population structure is useful for their management. In this study, expressed sequence tag-simple sequence repeat (EST-SSR) markers were developed for the invasive plant species Praxelis clematidea (Asteraceae) from 5548 Stevia rebaudiana (Asteraceae) expressed sequence tags (ESTs). A total of 133 microsatellite-containing ESTs (2.4%) were identified, of which 56 (42.1%) were hexanucleotide repeat motifs and 50 (37.6%) were trinucleotide repeat motifs. Of the 24 primer pairs designed from these 133 ESTs, 7 (29.2%) resulted in significant polymorphisms. The number of alleles per locus ranged from 5 to 9. The relatively high genetic diversity (H = 0.2667, I = 0.4212, and P = 100%) of P. clematidea was related to high gene flow (Nm = 1.4996) among populations. The coefficient of population differentiation (GST = 0.2500) indicated that most genetic variation occurred within populations. A Mantel test suggested that there was significant correlation between genetic distance and geographical distribution (r = 0.3192, P = 0.012). These results further support the transferability of EST-SSR markers between closely related genera of the same family.
Somatic mosaicism of a CDKL5 mutation identified by next-generation sequencing.
Kato, Takeshi; Morisada, Naoya; Nagase, Hiroaki; Nishiyama, Masahiro; Toyoshima, Daisaku; Nakagawa, Taku; Maruyama, Azusa; Fu, Xue Jun; Nozu, Kandai; Wada, Hiroko; Takada, Satoshi; Iijima, Kazumoto
2015-10-01
CDKL5-related encephalopathy is an X-linked dominantly inherited disorder that is characterized by early infantile epileptic encephalopathy or atypical Rett syndrome. We describe a 5-year-old Japanese boy with intractable epilepsy, severe developmental delay, and Rett syndrome-like features. Onset was at 2 months, when his electroencephalogram showed sporadic single poly spikes and diffuse irregular poly spikes. We conducted a genetic analysis using an Illumina® TruSight™ One sequencing panel on a next-generation sequencer. We identified two epilepsy-associated single nucleotide variants in our case: CDKL5 p.Ala40Val and KCNQ2 p.Glu515Asp. CDKL5 p.Ala40Val has been previously reported to be responsible for early infantile epileptic encephalopathy. In our case, the CDKL5 heterozygous mutation showed somatic mosaicism because the boy's karyotype was 46,XY. The KCNQ2 variant p.Glu515Asp is known to cause benign familial neonatal seizures-1, and this variant showed paternal inheritance. Although we believe that the somatic mosaic CDKL5 mutation is mainly responsible for the neurological phenotype in the patient, the KCNQ2 variant might have some neurological effect. Genetic analysis by next-generation sequencing is capable of identifying multiple variants in a patient. Copyright © 2015 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.
Development of Genetic Markers in Eucalyptus Species by Target Enrichment and Exome Sequencing
Dasgupta, Modhumita Ghosh; Dharanishanthi, Veeramuthu; Agarwal, Ishangi; Krutovsky, Konstantin V.
2015-01-01
The advent of next-generation sequencing has facilitated large-scale discovery, validation and assessment of genetic markers for high density genotyping. The present study was undertaken to identify markers in genes supposedly related to wood property traits in three Eucalyptus species. Ninety four genes involved in xylogenesis were selected for hybridization probe based nuclear genomic DNA target enrichment and exome sequencing. Genomic DNA was isolated from the leaf tissues and used for on-array probe hybridization followed by Illumina sequencing. The raw sequence reads were trimmed and high-quality reads were mapped to the E. grandis reference sequence and the presence of single nucleotide variants (SNVs) and insertions/ deletions (InDels) were identified across the three species. The average read coverage was 216X and a total of 2294 SNVs and 479 InDels were discovered in E. camaldulensis, 2383 SNVs and 518 InDels in E. tereticornis, and 1228 SNVs and 409 InDels in E. grandis. Additionally, SNV calling and InDel detection were conducted in pair-wise comparisons of E. tereticornis vs. E. grandis, E. camaldulensis vs. E. tereticornis and E. camaldulensis vs. E. grandis. This study presents an efficient and high throughput method on development of genetic markers for family– based QTL and association analysis in Eucalyptus. PMID:25602379
Development of genetic markers in Eucalyptus species by target enrichment and exome sequencing.
Directory of Open Access Journals (Sweden)
Modhumita Ghosh Dasgupta
Full Text Available The advent of next-generation sequencing has facilitated large-scale discovery, validation and assessment of genetic markers for high density genotyping. The present study was undertaken to identify markers in genes supposedly related to wood property traits in three Eucalyptus species. Ninety four genes involved in xylogenesis were selected for hybridization probe based nuclear genomic DNA target enrichment and exome sequencing. Genomic DNA was isolated from the leaf tissues and used for on-array probe hybridization followed by Illumina sequencing. The raw sequence reads were trimmed and high-quality reads were mapped to the E. grandis reference sequence and the presence of single nucleotide variants (SNVs and insertions/ deletions (InDels were identified across the three species. The average read coverage was 216X and a total of 2294 SNVs and 479 InDels were discovered in E. camaldulensis, 2383 SNVs and 518 InDels in E. tereticornis, and 1228 SNVs and 409 InDels in E. grandis. Additionally, SNV calling and InDel detection were conducted in pair-wise comparisons of E. tereticornis vs. E. grandis, E. camaldulensis vs. E. tereticornis and E. camaldulensis vs. E. grandis. This study presents an efficient and high throughput method on development of genetic markers for family- based QTL and association analysis in Eucalyptus.
Directory of Open Access Journals (Sweden)
Qing-bo Zhao
2018-02-01
Full Text Available The Dongxiang Blue-shelled chicken is one of the most valuable Chinese indigenous poultry breeds. However, compared to the Italian native White Leghorn, although this Chinese breed possesses numerous favorable characteristics, it also exhibits lower growth performance and fertility. Here, we utilized genotyping sequencing data obtained via genome reduction on a sequencing platform to detect 100,114 single nucleotide polymorphisms and perform further biological analysis and functional annotation. We employed cross-population extended haplotype homozygosity, eigenvector decomposition combined with genome-wide association studies (EigenGWAS, and efficient mixed-model association expedited methods to detect areas of the genome that are potential selected regions (PSR in both chicken breeds, and performed gene ontology (GO enrichment and quantitative trait loci (QTL analyses annotating using the Kyoto Encyclopedia of Genes and Genomes. The results of this study revealed a total of 2424 outlier loci (p-value <0.01, of which 2144 occur in the White Leghorn breed and 280 occur in the Dongxiang Blue-shelled chicken. These correspond to 327 and 94 PSRs containing 297 and 54 genes, respectively. The most significantly selected genes in Blue-shelled chicken are TMEM141 and CLIC3, while the SLCO1B3 gene, related to eggshell color, was identified via EigenGWAS. We show that the White Leghorn genes JARID2, RBMS3, GPC3, TRIB2, ROBO1, SAMSN1, OSBP2, and IGFALS are involved in immunity, reproduction, and growth, and thus might represent footprints of the selection process. In contrast, we identified six significantly enriched pathways in the Dongxiang Blue-shelled chicken that are related to amino acid and lipid metabolism as well as signal transduction. Our results also reveal the presence of a GO term associated with cell metabolism that occurs mainly in the White Leghorn breed, while the most significant QTL regions mapped to the Chicken QTL Database (GG_4
Pangrazio, Alessandra; Puddu, Alessandro; Oppo, Manuela; Valentini, Maria; Zammataro, Luca; Vellodi, Ashok; Gener, Blanca; Llano-Rivas, Isabel; Raza, Jamal; Atta, Irum; Vezzoni, Paolo; Superti-Furga, Andrea; Villa, Anna; Sobacchi, Cristina
2014-01-01
Autosomal Recessive Osteopetrosis is a genetic disorder characterized by increased bone density due to lack of resorption by the osteoclasts. Genetic studies have widely unraveled the molecular basis of the most severe forms, while cases of intermediate severity are more difficult to characterize, probably because of a large heterogeneity. Here, we describe the use of exome sequencing in the molecular diagnosis of 2 siblings initially thought to be affected by “intermediate osteopetrosis”, which identified a homozygous mutation in the CTSK gene. Prompted by this finding, we tested by Sanger sequencing 25 additional patients addressed to us for recessive osteopetrosis and found CTSK mutations in 4 of them. In retrospect, their clinical and radiographic features were found to be compatible with, but not typical for, Pycnodysostosis. We sought to identify modifier genes that might have played a role in the clinical manifestation of the disease in these patients, but our results were not informative. In conclusion, we underline the difficulties of differential diagnosis in some patients whose clinical appearance does not fit the classical malignant or benign picture and recommend that CTSK gene be included in the molecular diagnosis of high bone density conditions. PMID:24269275
Targeted exome sequencing identified novel USH2A mutations in Usher syndrome families.
Directory of Open Access Journals (Sweden)
Xiu-Feng Huang
Full Text Available Usher syndrome (USH is a leading cause of deaf-blindness in autosomal recessive trait. Phenotypic and genetic heterogeneities in USH make molecular diagnosis much difficult. This is a pilot study aiming to develop an approach based on next-generation sequencing to determine the genetic defects in patients with USH or allied diseases precisely and effectively. Eight affected patients and twelve unaffected relatives from five unrelated Chinese USH families, including 2 pseudo-dominant ones, were recruited. A total of 144 known genes of inherited retinal diseases were selected for deep exome resequencing. Through systematic data analysis using established bioinformatics pipeline and segregation analysis, a number of genetic variants were released. Eleven mutations, eight of them were novel, in the USH2A gene were identified. Biparental mutations in USH2A were revealed in 2 families with pseudo-dominant inheritance. A proband was found to have triple mutations, two of them were supposed to locate in the same chromosome. In conclusion, this study revealed the genetic defects in the USH2A gene and demonstrated the robustness of targeted exome sequencing to precisely and rapidly determine genetic defects. The methodology provides a reliable strategy for routine gene diagnosis of USH.
Draft genome sequence and genetic transformation of the oleaginous alga Nannochloropis gaditana.
Radakovits, Randor; Jinkerson, Robert E; Fuerstenberg, Susan I; Tae, Hongseok; Settlage, Robert E; Boore, Jeffrey L; Posewitz, Matthew C
2012-02-21
The potential use of algae in biofuels applications is receiving significant attention. However, none of the current algal model species are competitive production strains. Here we present a draft genome sequence and a genetic transformation method for the marine microalga Nannochloropsis gaditana CCMP526. We show that N. gaditana has highly favourable lipid yields, and is a promising production organism. The genome assembly includes nuclear (~29 Mb) and organellar genomes, and contains 9,052 gene models. We define the genes required for glycerolipid biogenesis and detail the differential regulation of genes during nitrogen-limited lipid biosynthesis. Phylogenomic analysis identifies genetic attributes of this organism, including unique stramenopile photosynthesis genes and gene expansions that may explain the distinguishing photoautotrophic phenotypes observed. The availability of a genome sequence and transformation methods will facilitate investigations into N. gaditana lipid biosynthesis and permit genetic engineering strategies to further improve this naturally productive alga.
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes
Hu, H.; Haas, S.A.; Chelly, J.; Van Esch, H.; Raynaud, M.; de Brouwer, A.P.M.; Weinert, S.; Froyen, G.; Frints, S.G.M.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of ...
Directory of Open Access Journals (Sweden)
Butenko Melinka A
2009-10-01
Full Text Available Abstract Background When generating a genetically modified organism (GMO, the primary goal is to give a target organism one or several novel traits by using biotechnology techniques. A GMO will differ from its parental strain in that its pool of transcripts will be altered. Currently, there are no methods that are reliably able to determine if an organism has been genetically altered if the nature of the modification is unknown. Results We show that the concept of computational subtraction can be used to identify transgenic cDNA sequences from genetically modified plants. Our datasets include 454-type sequences from a transgenic line of Arabidopsis thaliana and published EST datasets from commercially relevant species (rice and papaya. Conclusion We believe that computational subtraction represents a powerful new strategy for determining if an organism has been genetically modified as well as to define the nature of the modification. Fewer assumptions have to be made compared to methods currently in use and this is an advantage particularly when working with unknown GMOs.
HIV-1 envelope sequence-based diversity measures for identifying recent infections.
Directory of Open Access Journals (Sweden)
Alexis Kafando
Full Text Available Identifying recent HIV-1 infections is crucial for monitoring HIV-1 incidence and optimizing public health prevention efforts. To identify recent HIV-1 infections, we evaluated and compared the performance of 4 sequence-based diversity measures including percent diversity, percent complexity, Shannon entropy and number of haplotypes targeting 13 genetic segments within the env gene of HIV-1. A total of 597 diagnostic samples obtained in 2013 and 2015 from recently and chronically HIV-1 infected individuals were selected. From the selected samples, 249 (134 from recent versus 115 from chronic infections env coding regions, including V1-C5 of gp120 and the gp41 ectodomain of HIV-1, were successfully amplified and sequenced by next generation sequencing (NGS using the Illumina MiSeq platform. The ability of the four sequence-based diversity measures to correctly identify recent HIV infections was evaluated using the frequency distribution curves, median and interquartile range and area under the curve (AUC of the receiver operating characteristic (ROC. Comparing the median and interquartile range and evaluating the frequency distribution curves associated with the 4 sequence-based diversity measures, we observed that the percent diversity, number of haplotypes and Shannon entropy demonstrated significant potential to discriminate recent from chronic infections (p<0.0001. Using the AUC of ROC analysis, only the Shannon entropy measure within three HIV-1 env segments could accurately identify recent infections at a satisfactory level. The env segments were gp120 C2_1 (AUC = 0.806, gp120 C2_3 (AUC = 0.805 and gp120 V3 (AUC = 0.812. Our results clearly indicate that the Shannon entropy measure represents a useful tool for predicting HIV-1 infection recency.
Directory of Open Access Journals (Sweden)
Paul G. Nevill
2013-05-01
Full Text Available Premise of the study: Microsatellite primers were developed for Eucalyptus victrix (Myrtaceae to evaluate the population and spatial genetic structure of this widespread northwestern Australian riparian tree species, which may be impacted by hydrological changes associated with mining activity. Methods and Results: 454 GS-FLX shotgun sequencing was used to obtain 1895 sequences containing putative microsatellite motifs. Ten polymorphic microsatellite loci were identified and screened for variation in individuals from two populations in the Pilbara region. Observed heterozygosities ranged from 0.44 to 0.91 (mean: 0.66 and the number of alleles per locus ranged from five to 25 (average: 11. Conclusions: These microsatellite loci will be useful in future studies of population and spatial genetic structure in E. victrix, and inform the development of seed sourcing strategies for the species.
Directory of Open Access Journals (Sweden)
Amanda D Barbosa
Full Text Available Infections with Trypanosoma spp. have been associated with poor health and decreased survival of koalas (Phascolarctos cinereus, particularly in the presence of concurrent pathogens such as Chlamydia and koala retrovirus. The present study describes the application of a next-generation sequencing (NGS-based assay to characterise the prevalence and genetic diversity of trypanosome communities in koalas and two native species of ticks (Ixodes holocyclus and I. tasmani removed from koala hosts. Among 168 koalas tested, 32.2% (95% CI: 25.2-39.8% were positive for at least one Trypanosoma sp. Previously described Trypanosoma spp. from koalas were identified, including T. irwini (32.1%, 95% CI: 25.2-39.8%, T. gilletti (25%, 95% CI: 18.7-32.3%, T. copemani (27.4%, 95% CI: 20.8-34.8% and T. vegrandis (10.1%, 95% CI: 6.0-15.7%. Trypanosoma noyesi was detected for the first time in koalas, although at a low prevalence (0.6% 95% CI: 0-3.3%, and a novel species (Trypanosoma sp. AB-2017 was identified at a prevalence of 4.8% (95% CI: 2.1-9.2%. Mixed infections with up to five species were present in 27.4% (95% CI: 21-35% of the koalas, which was significantly higher than the prevalence of single infections 4.8% (95% CI: 2-9%. Overall, a considerably higher proportion (79.7% of the Trypanosoma sequences isolated from koala blood samples were identified as T. irwini, suggesting this is the dominant species. Co-infections involving T. gilletti, T. irwini, T. copemani, T. vegrandis and Trypanosoma sp. AB-2017 were also detected in ticks, with T. gilletti and T. copemani being the dominant species within the invertebrate hosts. Direct Sanger sequencing of Trypanosoma 18S rRNA gene amplicons was also performed and results revealed that this method was only able to identify the genotypes with greater amount of reads (according to NGS within koala samples, which highlights the advantages of NGS in detecting mixed infections. The present study provides new insights
Barbosa, Amanda D; Gofton, Alexander W; Paparini, Andrea; Codello, Annachiara; Greay, Telleasha; Gillett, Amber; Warren, Kristin; Irwin, Peter; Ryan, Una
2017-01-01
Infections with Trypanosoma spp. have been associated with poor health and decreased survival of koalas (Phascolarctos cinereus), particularly in the presence of concurrent pathogens such as Chlamydia and koala retrovirus. The present study describes the application of a next-generation sequencing (NGS)-based assay to characterise the prevalence and genetic diversity of trypanosome communities in koalas and two native species of ticks (Ixodes holocyclus and I. tasmani) removed from koala hosts. Among 168 koalas tested, 32.2% (95% CI: 25.2-39.8%) were positive for at least one Trypanosoma sp. Previously described Trypanosoma spp. from koalas were identified, including T. irwini (32.1%, 95% CI: 25.2-39.8%), T. gilletti (25%, 95% CI: 18.7-32.3%), T. copemani (27.4%, 95% CI: 20.8-34.8%) and T. vegrandis (10.1%, 95% CI: 6.0-15.7%). Trypanosoma noyesi was detected for the first time in koalas, although at a low prevalence (0.6% 95% CI: 0-3.3%), and a novel species (Trypanosoma sp. AB-2017) was identified at a prevalence of 4.8% (95% CI: 2.1-9.2%). Mixed infections with up to five species were present in 27.4% (95% CI: 21-35%) of the koalas, which was significantly higher than the prevalence of single infections 4.8% (95% CI: 2-9%). Overall, a considerably higher proportion (79.7%) of the Trypanosoma sequences isolated from koala blood samples were identified as T. irwini, suggesting this is the dominant species. Co-infections involving T. gilletti, T. irwini, T. copemani, T. vegrandis and Trypanosoma sp. AB-2017 were also detected in ticks, with T. gilletti and T. copemani being the dominant species within the invertebrate hosts. Direct Sanger sequencing of Trypanosoma 18S rRNA gene amplicons was also performed and results revealed that this method was only able to identify the genotypes with greater amount of reads (according to NGS) within koala samples, which highlights the advantages of NGS in detecting mixed infections. The present study provides new insights on the
Exome sequencing identifies three novel candidate genes implicated in intellectual disability.
Directory of Open Access Journals (Sweden)
Zehra Agha
Full Text Available Intellectual disability (ID is a major health problem mostly with an unknown etiology. Recently exome sequencing of individuals with ID identified novel genes implicated in the disease. Therefore the purpose of the present study was to identify the genetic cause of ID in one syndromic and two non-syndromic Pakistani families. Whole exome of three ID probands was sequenced. Missense variations in two plausible novel genes implicated in autosomal recessive ID were identified: lysine (K-specific methyltransferase 2B (KMT2B, zinc finger protein 589 (ZNF589, as well as hedgehog acyltransferase (HHAT with a de novo mutation with autosomal dominant mode of inheritance. The KMT2B recessive variant is the first report of recessive Kleefstra syndrome-like phenotype. Identification of plausible causative mutations for two recessive and a dominant type of ID, in genes not previously implicated in disease, underscores the large genetic heterogeneity of ID. These results also support the viewpoint that large number of ID genes converge on limited number of common networks i.e. ZNF589 belongs to KRAB-domain zinc-finger proteins previously implicated in ID, HHAT is predicted to affect sonic hedgehog, which is involved in several disorders with ID, KMT2B associated with syndromic ID fits the epigenetic module underlying the Kleefstra syndromic spectrum. The association of these novel genes in three different Pakistani ID families highlights the importance of screening these genes in more families with similar phenotypes from different populations to confirm the involvement of these genes in pathogenesis of ID.
Pangrazio, Alessandra; Puddu, Alessandro; Oppo, Manuela; Valentini, Maria; Zammataro, Luca; Vellodi, Ashok; Gener, Blanca; Llano-Rivas, Isabel; Raza, Jamal; Atta, Irum; Vezzoni, Paolo; Superti-Furga, Andrea; Villa, Anna; Sobacchi, Cristina
2014-02-01
Autosomal Recessive Osteopetrosis is a genetic disorder characterized by increased bone density due to lack of resorption by the osteoclasts. Genetic studies have widely unraveled the molecular basis of the most severe forms, while cases of intermediate severity are more difficult to characterize, probably because of a large heterogeneity. Here, we describe the use of exome sequencing in the molecular diagnosis of 2 siblings initially thought to be affected by "intermediate osteopetrosis", which identified a homozygous mutation in the CTSK gene. Prompted by this finding, we tested by Sanger sequencing 25 additional patients addressed to us for recessive osteopetrosis and found CTSK mutations in 4 of them. In retrospect, their clinical and radiographic features were found to be compatible with, but not typical for, Pycnodysostosis. We sought to identify modifier genes that might have played a role in the clinical manifestation of the disease in these patients, but our results were not informative. In conclusion, we underline the difficulties of differential diagnosis in some patients whose clinical appearance does not fit the classical malignant or benign picture and recommend that CTSK gene be included in the molecular diagnosis of high bone density conditions. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Human genome and genetic sequencing research and informed consent
International Nuclear Information System (INIS)
Iwakawa, Mayumi
2003-01-01
On March 29, 2001, the Ethical Guidelines for Human Genome and Genetic Sequencing Research were established. They have intended to serve as ethical guidelines for all human genome and genetic sequencing research practice, for the purpose of upholding respect for human dignity and rights and enforcing use of proper methods in the pursuit of human genome and genetic sequencing research, with the understanding and cooperation of the public. The RadGenomics Project has prepared a research protocol and informed consent document that follow these ethical guidelines. We have endeavored to protect the privacy of individual information, and have established a procedure for examination of research practices by an ethics committee. Here we report our procedure in order to offer this concept to the patients. (authors)
Dilliott, Allison A; Farhan, Sali M K; Ghani, Mahdi; Sato, Christine; Liang, Eric; Zhang, Ming; McIntyre, Adam D; Cao, Henian; Racacho, Lemuel; Robinson, John F; Strong, Michael J; Masellis, Mario; Bulman, Dennis E; Rogaeva, Ekaterina; Lang, Anthony; Tartaglia, Carmela; Finger, Elizabeth; Zinman, Lorne; Turnbull, John; Freedman, Morris; Swartz, Rick; Black, Sandra E; Hegele, Robert A
2018-04-04
Next-generation sequencing (NGS) is quickly revolutionizing how research into the genetic determinants of constitutional disease is performed. The technique is highly efficient with millions of sequencing reads being produced in a short time span and at relatively low cost. Specifically, targeted NGS is able to focus investigations to genomic regions of particular interest based on the disease of study. Not only does this further reduce costs and increase the speed of the process, but it lessens the computational burden that often accompanies NGS. Although targeted NGS is restricted to certain regions of the genome, preventing identification of potential novel loci of interest, it can be an excellent technique when faced with a phenotypically and genetically heterogeneous disease, for which there are previously known genetic associations. Because of the complex nature of the sequencing technique, it is important to closely adhere to protocols and methodologies in order to achieve sequencing reads of high coverage and quality. Further, once sequencing reads are obtained, a sophisticated bioinformatics workflow is utilized to accurately map reads to a reference genome, to call variants, and to ensure the variants pass quality metrics. Variants must also be annotated and curated based on their clinical significance, which can be standardized by applying the American College of Medical Genetics and Genomics Pathogenicity Guidelines. The methods presented herein will display the steps involved in generating and analyzing NGS data from a targeted sequencing panel, using the ONDRISeq neurodegenerative disease panel as a model, to identify variants that may be of clinical significance.
Identifying genetic relatives without compromising privacy.
He, Dan; Furlotte, Nicholas A; Hormozdiari, Farhad; Joo, Jong Wha J; Wadia, Akshay; Ostrovsky, Rafail; Sahai, Amit; Eskin, Eleazar
2014-04-01
The development of high-throughput genomic technologies has impacted many areas of genetic research. While many applications of these technologies focus on the discovery of genes involved in disease from population samples, applications of genomic technologies to an individual's genome or personal genomics have recently gained much interest. One such application is the identification of relatives from genetic data. In this application, genetic information from a set of individuals is collected in a database, and each pair of individuals is compared in order to identify genetic relatives. An inherent issue that arises in the identification of relatives is privacy. In this article, we propose a method for identifying genetic relatives without compromising privacy by taking advantage of novel cryptographic techniques customized for secure and private comparison of genetic information. We demonstrate the utility of these techniques by allowing a pair of individuals to discover whether or not they are related without compromising their genetic information or revealing it to a third party. The idea is that individuals only share enough special-purpose cryptographically protected information with each other to identify whether or not they are relatives, but not enough to expose any information about their genomes. We show in HapMap and 1000 Genomes data that our method can recover first- and second-order genetic relationships and, through simulations, show that our method can identify relationships as distant as third cousins while preserving privacy.
Directory of Open Access Journals (Sweden)
Liang Cheng
Full Text Available The significantly related diseases of sequences could play an important role in understanding the functions of these sequences. In this paper, we introduced BLAT2DOLite, an online system for annotating human genes and diseases and identifying the significant relationships between sequences and diseases. Currently, BLAT2DOLite integrates Entrez Gene database and Disease Ontology Lite (DOLite, which contain loci of gene and relationships between genes and diseases. It utilizes hypergeometric test to calculate P-values between genes and diseases of DOLite. The system can be accessed from: http://123.59.132.21:8080/BLAT2DOLite. The corresponding web service is described in: http://123.59.132.21:8080/BLAT2DOLite/BLAT2DOLiteIDMappingPort?wsdl.
Quantifying population genetic differentiation from next-generation sequencing data
DEFF Research Database (Denmark)
Fumagalli, Matteo; Garrett Vieira, Filipe Jorge; Korneliussen, Thorfinn Sand
2013-01-01
method for quantifying population genetic differentiation from next-generation sequencing data. In addition, we present a strategy to investigate population structure via Principal Components Analysis. Through extensive simulations, we compare the new method herein proposed to approaches based...... on genotype calling and demonstrate a marked improvement in estimation accuracy for a wide range of conditions. We apply the method to a large-scale genomic data set of domesticated and wild silkworms sequenced at low coverage. We find that we can infer the fine-scale genetic structure of the sampled......Over the last few years, new high-throughput DNA sequencing technologies have dramatically increased speed and reduced sequencing costs. However, the use of these sequencing technologies is often challenged by errors and biases associated with the bioinformatical methods used for analyzing the data...
Chaudhary, Sakshi; Mishra, Bharat Kumar; Vivek, Thiruvettai; Magadum, Santoshkumar; Yasin, Jeshima Khan
2016-01-01
Simple Sequence Repeats or microsatellites are resourceful molecular genetic markers. There are only few reports of SSR identification and development in pineapple. Complete genome sequence of pineapple available in the public domain can be used to develop numerous novel SSRs. Therefore, an attempt was made to identify SSRs from genomic, chloroplast, mitochondrial and EST sequences of pineapple which will help in deciphering genetic makeup of its germplasm resources. A total of 359511 SSRs were identified in pineapple (356385 from genome sequence, 45 from chloroplast sequence, 249 in mitochondrial sequence and 2832 from EST sequences). The list of EST-SSR markers and their details are available in the database. PineElm_SSRdb is an open source database available for non-commercial academic purpose at http://app.bioelm.com/ with a mapping tool which can develop circular maps of selected marker set. This database will be of immense use to breeders, researchers and graduates working on Ananas spp. and to others working on cross-species transferability of markers, investigating diversity, mapping and DNA fingerprinting.
Méndez-Vidal, Cristina; González-Del Pozo, María; Vela-Boza, Alicia; Santoyo-López, Javier; López-Domingo, Francisco J; Vázquez-Marouschek, Carmen; Dopazo, Joaquin; Borrego, Salud; Antiñolo, Guillermo
2013-01-01
Retinitis pigmentosa (RP) is an inherited retinal dystrophy characterized by extreme genetic and clinical heterogeneity. Thus, the diagnosis is not always easily performed due to phenotypic and genetic overlap. Current clinical practices have focused on the systematic evaluation of a set of known genes for each phenotype, but this approach may fail in patients with inaccurate diagnosis or infrequent genetic cause. In the present study, we investigated the genetic cause of autosomal recessive RP (arRP) in a Spanish family in which the causal mutation has not yet been identified with primer extension technology and resequencing. We designed a whole-exome sequencing (WES)-based approach using NimbleGen SeqCap EZ Exome V3 sample preparation kit and the SOLiD 5500×l next-generation sequencing platform. We sequenced the exomes of both unaffected parents and two affected siblings. Exome analysis resulted in the identification of 43,204 variants in the index patient. All variants passing filter criteria were validated with Sanger sequencing to confirm familial segregation and absence in the control population. In silico prediction tools were used to determine mutational impact on protein function and the structure of the identified variants. Novel Usher syndrome type 2A (USH2A) compound heterozygous mutations, c.4325T>C (p.F1442S) and c.15188T>G (p.L5063R), located in exons 20 and 70, respectively, were identified as probable causative mutations for RP in this family. Family segregation of the variants showed the presence of both mutations in all affected members and in two siblings who were apparently asymptomatic at the time of family ascertainment. Clinical reassessment confirmed the diagnosis of RP in these patients. Using WES, we identified two heterozygous novel mutations in USH2A as the most likely disease-causing variants in a Spanish family diagnosed with arRP in which the cause of the disease had not yet been identified with commonly used techniques. Our data
Zhao, Yue; Zhang, Hong; Xia, Xue-shan
2015-07-01
Inherited cardiomyopathy is the most common hereditary cardiac disease. It also causes a significant proportion of sudden cardiac deaths in young adults and athletes. So far, approximately one hundred genes have been reported to be involved in cardiomyopathies through different mechanisms. Therefore, the identification of the genetic basis and disease mechanisms of cardiomyopathies are important for establishing a clinical diagnosis and genetic testing. Next-generation semiconductor sequencing (NGSS) technology platform is a high-throughput sequencer capable of analyzing clinically derived genomes with high productivity, sensitivity and specificity. It was launched in 2010 by Life Technologies of USA, and it is based on a high density semiconductor chip, which was covered with tens of thousands of wells. NGSS has been successfully used in candidate gene mutation screening to identify hereditary disease. In this review, we summarize these genetic variations, challenge and application of NGSS in inherited cardiomyopathy, and its value in disease diagnosis, prevention and treatment.
Souto, Cintia P; Mathiasen, Paula; Acosta, María Cristina; Quiroga, María Paula; Vidal-Russell, Romina; Echeverría, Cristian; Premoli, Andrea C
2015-01-01
Conservation planning requires setting priorities at the same spatial scale at which decision-making processes are undertaken considering all levels of biodiversity, but current methods for identifying biodiversity hotspots ignore its genetic component. We developed a fine-scale approach based on the definition of genetic hotspots, which have high genetic diversity and unique variants that represent their evolutionary potential and evolutionary novelties. Our hypothesis is that wide-ranging taxa with similar ecological tolerances, yet of phylogenetically independent lineages, have been and currently are shaped by ecological and evolutionary forces that result in geographically concordant genetic patterns. We mapped previously published genetic diversity and unique variants of biparentally inherited markers and chloroplast sequences for 9 species from 188 and 275 populations, respectively, of the 4 woody dominant families of the austral temperate forest, an area considered a biodiversity hotspot. Spatial distribution patterns of genetic polymorphisms differed among taxa according to their ecological tolerances. Eight genetic hotspots were detected and we recommend conservation actions for some in the southern Coastal Range in Chile. Existing spatially explicit genetic data from multiple populations and species can help to identify biodiversity hotspots and guide conservation actions to establish science-based protected areas that will preserve the evolutionary potential of key habitats and species. © The American Genetic Association 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Browning, Mark
The purpose of the research was to manipulate two aspects of genetics instruction in order to measure their effects on college, introductory biology students' achievement in genetics. One instructional sequence that was used dealt first with monohybrid autosomal inheritance patterns, then sex-linkage. The alternate sequence was the reverse.…
Zhou, Wei; Hu, Yiyi; Sui, Zhenghong; Fu, Feng; Wang, Jinguo; Chang, Lianpeng; Guo, Weihua; Li, Binbin
2013-01-01
Gracilariopsis lemaneiformis has a high economic value and is one of the most important aquaculture species in China. Despite it is economic importance, it has remained largely unstudied at the genomic level. In this study, we conducted a genome survey of Gp. lemaneiformis using next-generation sequencing (NGS) technologies. In total, 18.70 Gb of high-quality sequence data with an estimated genome size of 97 Mb were obtained by HiSeq 2000 sequencing for Gp. lemaneiformis. These reads were assembled into 160,390 contigs with a N50 length of 3.64 kb, which were further assembled into 125,685 scaffolds with a total length of 81.17 Mb. Genome analysis predicted 3490 genes and a GC% content of 48%. The identified genes have an average transcript length of 1,429 bp, an average coding sequence size of 1,369 bp, 1.36 exons per gene, exon length of 1,008 bp, and intron length of 191 bp. From the initial assembled scaffold, transposable elements constituted 54.64% (44.35 Mb) of the genome, and 7737 simple sequence repeats (SSRs) were identified. Among these SSRs, the trinucleotide repeat type was the most abundant (up to 73.20% of total SSRs), followed by the di- (17.41%), tetra- (5.49%), hexa- (2.90%), and penta- (1.00%) nucleotide repeat type. These characteristics suggest that Gp. lemaneiformis is a model organism for genetic study. This is the first report of genome-wide characterization within this taxon.
Sui, Zhenghong; Fu, Feng; Wang, Jinguo; Chang, Lianpeng; Guo, Weihua; Li, Binbin
2013-01-01
Gracilariopsis lemaneiformis has a high economic value and is one of the most important aquaculture species in China. Despite it is economic importance, it has remained largely unstudied at the genomic level. In this study, we conducted a genome survey of Gp. lemaneiformis using next-generation sequencing (NGS) technologies. In total, 18.70 Gb of high-quality sequence data with an estimated genome size of 97 Mb were obtained by HiSeq 2000 sequencing for Gp. lemaneiformis. These reads were assembled into 160,390 contigs with a N50 length of 3.64 kb, which were further assembled into 125,685 scaffolds with a total length of 81.17 Mb. Genome analysis predicted 3490 genes and a GC% content of 48%. The identified genes have an average transcript length of 1,429 bp, an average coding sequence size of 1,369 bp, 1.36 exons per gene, exon length of 1,008 bp, and intron length of 191 bp. From the initial assembled scaffold, transposable elements constituted 54.64% (44.35 Mb) of the genome, and 7737 simple sequence repeats (SSRs) were identified. Among these SSRs, the trinucleotide repeat type was the most abundant (up to 73.20% of total SSRs), followed by the di- (17.41%), tetra- (5.49%), hexa- (2.90%), and penta- (1.00%) nucleotide repeat type. These characteristics suggest that Gp. lemaneiformis is a model organism for genetic study. This is the first report of genome-wide characterization within this taxon. PMID:23875008
Wei, Xiaoming; Sun, Yan; Xie, Jiansheng; Shi, Quan; Qu, Ning; Yang, Guanghui; Cai, Jun; Yang, Yi; Liang, Yu; Wang, Wei; Yi, Xin
2012-11-20
Targeted enrichment and next-generation sequencing (NGS) have been employed for detection of genetic diseases. The purpose of this study was to validate the accuracy and sensitivity of our method for comprehensive mutation detection of hereditary hearing loss, and identify inherited mutations involved in human deafness accurately and economically. To make genetic diagnosis of hereditary hearing loss simple and timesaving, we designed a 0.60 MB array-based chip containing 69 nuclear genes and mitochondrial genome responsible for human deafness and conducted NGS toward ten patients with five known mutations and a Chinese family with hearing loss (never genetically investigated). Ten patients with five known mutations were sequenced using next-generation sequencing to validate the sensitivity of the method. We identified four known mutations in two nuclear deafness causing genes (GJB2 and SLC26A4), one in mitochondrial DNA. We then performed this method to analyze the variants in a Chinese family with hearing loss and identified compound heterozygosity for two novel mutations in gene MYO7A. The compound heterozygosity identified in gene MYO7A causes Usher Syndrome 1B with severe phenotypes. The results support that the combination of enrichment of targeted genes and next-generation sequencing is a valuable molecular diagnostic tool for hereditary deafness and suitable for clinical application. Copyright © 2012 Elsevier B.V. All rights reserved.
Thaker, Vidhu V; Esteves, Kristyn M; Towne, Meghan C; Brownstein, Catherine A; James, Philip M; Crowley, Laura; Hirschhorn, Joel N; Elsea, Sarah H; Beggs, Alan H; Picker, Jonathan; Agrawal, Pankaj B
2015-05-01
The current obesity epidemic is attributed to complex interactions between genetic and environmental factors. However, a limited number of cases, especially those with early-onset severe obesity, are linked to single gene defects. Rapid-onset obesity with hypothalamic dysfunction, hypoventilation and autonomic dysregulation (ROHHAD) is one of the syndromes that presents with abrupt-onset extreme weight gain with an unknown genetic basis. To identify the underlying genetic etiology in a child with morbid early-onset obesity, hypoventilation, and autonomic and behavioral disturbances who was clinically diagnosed with ROHHAD syndrome. Design/Setting/Intervention: The index patient was evaluated at an academic medical center. Whole-exome sequencing was performed on the proband and his parents. Genetic variants were validated by Sanger sequencing. We identified a novel de novo nonsense mutation, c.3265 C>T (p.R1089X), in the retinoic acid-induced 1 (RAI1) gene in the proband. Mutations in the RAI1 gene are known to cause Smith-Magenis syndrome (SMS). On further evaluation, his clinical features were not typical of either SMS or ROHHAD syndrome. This study identifies a de novo RAI1 mutation in a child with morbid obesity and a clinical diagnosis of ROHHAD syndrome. Although extreme early-onset obesity, autonomic disturbances, and hypoventilation are present in ROHHAD, several of the clinical findings are consistent with SMS. This case highlights the challenges in the diagnosis of ROHHAD syndrome and its potential overlap with SMS. We also propose RAI1 as a candidate gene for children with morbid obesity.
Directory of Open Access Journals (Sweden)
Arehart Eric
2009-03-01
Full Text Available Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194. We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI database (n = 29967 and a control set of sequences (coding region not associated with SNP sites randomly selected from the NCBI database (n = 29967. We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p Conclusion The present study represents the first use of this computational methodology for modeling nonlinear patterns in molecular genetics. MDR was able to identify distinct nucleotide patterning around sites of mutations dependent upon the observed nucleotide change. We discovered one flanking region set that included five nucleotides clustered around a specific type of SNP site. Based on the strongly associated patterns identified in
Next generation sequencing and its applications in forensic genetics.
Børsting, Claus; Morling, Niels
2015-09-01
It has been almost a decade since the first next generation sequencing (NGS) technologies emerged and quickly changed the way genetic research is conducted. Today, full genomes are mapped and published almost weekly and with ever increasing speed and decreasing costs. NGS methods and platforms have matured during the last 10 years, and the quality of the sequences has reached a level where NGS is used in clinical diagnostics of humans. Forensic genetic laboratories have also explored NGS technologies and especially in the last year, there has been a small explosion in the number of scientific articles and presentations at conferences with forensic aspects of NGS. These contributions have demonstrated that NGS offers new possibilities for forensic genetic case work. More information may be obtained from unique samples in a single experiment by analyzing combinations of markers (STRs, SNPs, insertion/deletions, mRNA) that cannot be analyzed simultaneously with the standard PCR-CE methods used today. The true variation in core forensic STR loci has been uncovered, and previously unknown STR alleles have been discovered. The detailed sequence information may aid mixture interpretation and will increase the statistical weight of the evidence. In this review, we will give an introduction to NGS and single-molecule sequencing, and we will discuss the possible applications of NGS in forensic genetics. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.
Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.
Eltaher, Shamseldeen; Sallam, Ahmed; Belamkar, Vikas; Emara, Hamdy A; Nower, Ahmed A; Salem, Khaled F M; Poland, Jesse; Baenziger, Peter S
2018-01-01
The availability of information on the genetic diversity and population structure in wheat ( Triticum aestivum L.) breeding lines will help wheat breeders to better use their genetic resources and manage genetic variation in their breeding program. The recent advances in sequencing technology provide the opportunity to identify tens or hundreds of thousands of single nucleotide polymorphism (SNPs) in large genome species (e.g., wheat). These SNPs can be utilized for understanding genetic diversity and performing genome wide association studies (GWAS) for complex traits. In this study, the genetic diversity and population structure were investigated in a set of 230 genotypes (F 3:6 ) derived from various crosses as a prerequisite for GWAS and genomic selection. Genotyping-by-sequencing provided 25,566 high-quality SNPs. The polymorphism information content (PIC) across chromosomes ranged from 0.09 to 0.37 with an average of 0.23. The distribution of SNPs markers on the 21 chromosomes ranged from 319 on chromosome 3D to 2,370 on chromosome 3B. The analysis of population structure revealed three subpopulations (G1, G2, and G3). Analysis of molecular variance identified 8% variance among and 92% within subpopulations. Of the three subpopulations, G2 had the highest level of genetic diversity based on three genetic diversity indices: Shannon's information index ( I ) = 0.494, diversity index ( h ) = 0.328 and unbiased diversity index (uh) = 0.331, while G3 had lowest level of genetic diversity ( I = 0.348, h = 0.226 and uh = 0.236). This high genetic diversity identified among the subpopulations can be used to develop new wheat cultivars.
Directory of Open Access Journals (Sweden)
Maleeha Maria
Full Text Available Homozygosity mapping has facilitated the identification of the genetic causes underlying inherited diseases, particularly in consanguineous families with multiple affected individuals. This knowledge has also resulted in a mutation dataset that can be used in a cost and time effective manner to screen frequent population-specific genetic variations associated with diseases such as inherited retinal disease (IRD.We genetically screened 13 families from a cohort of 81 Pakistani IRD families diagnosed with Leber congenital amaurosis (LCA, retinitis pigmentosa (RP, congenital stationary night blindness (CSNB, or cone dystrophy (CD. We employed genome-wide single nucleotide polymorphism (SNP array analysis to identify homozygous regions shared by affected individuals and performed Sanger sequencing of IRD-associated genes located in the sizeable homozygous regions. In addition, based on population specific mutation data we performed targeted Sanger sequencing (TSS of frequent variants in AIPL1, CEP290, CRB1, GUCY2D, LCA5, RPGRIP1 and TULP1, in probands from 28 LCA families.Homozygosity mapping and Sanger sequencing of IRD-associated genes revealed the underlying mutations in 10 families. TSS revealed causative variants in three families. In these 13 families four novel mutations were identified in CNGA1, CNGB1, GUCY2D, and RPGRIP1.Homozygosity mapping and TSS revealed the underlying genetic cause in 13 IRD families, which is useful for genetic counseling as well as therapeutic interventions that are likely to become available in the near future.
Screening for genetically modified organisms sequences in food ...
African Journals Online (AJOL)
We used the Allin 2.0 GMO screening system from Biosmart, Switzerland to screen for the presence of genetically modified food sequences in maize meal samples, fresh fruit and vegetables from some retailers around Gaborone, Botswana. The Allin 2.0 is a multiplex PCR system for the detection of genetically modified ...
Directory of Open Access Journals (Sweden)
Steven N Hart
Full Text Available BACKGROUND: Structural variation (SV represents a significant, yet poorly understood contribution to an individual's genetic makeup. Advanced next-generation sequencing technologies are widely used to discover such variations, but there is no single detection tool that is considered a community standard. In an attempt to fulfil this need, we developed an algorithm, SoftSearch, for discovering structural variant breakpoints in Illumina paired-end next-generation sequencing data. SoftSearch combines multiple strategies for detecting SV including split-read, discordant read-pair, and unmated pairs. Co-localized split-reads and discordant read pairs are used to refine the breakpoints. RESULTS: We developed and validated SoftSearch using real and synthetic datasets. SoftSearch's key features are 1 not requiring secondary (or exhaustive primary alignment, 2 portability into established sequencing workflows, and 3 is applicable to any DNA-sequencing experiment (e.g. whole genome, exome, custom capture, etc.. SoftSearch identifies breakpoints from a small number of soft-clipped bases from split reads and a few discordant read-pairs which on their own would not be sufficient to make an SV call. CONCLUSIONS: We show that SoftSearch can identify more true SVs by combining multiple sequence features. SoftSearch was able to call clinically relevant SVs in the BRCA2 gene not reported by other tools while offering significantly improved overall performance.
Langlais, David; Fodil, Nassima; Gros, Philippe
2017-04-26
Genome technologies have defined a complex genetic architecture in major infectious, inflammatory, and autoimmune disorders. High density marker arrays and Immunochips have powered genome-wide association studies (GWAS) that have mapped nearly 450 genetic risk loci in 22 major inflammatory diseases, including a core of common genes that play a central role in pathological inflammation. Whole-exome and whole-genome sequencing have identified more than 265 genes in which mutations cause primary immunodeficiencies and rare forms of severe inflammatory bowel disease. Combined analysis of inflammatory disease GWAS and primary immunodeficiencies point to shared proteins and pathways that are required for immune cell development and protection against infections and are also associated with pathological inflammation. Finally, sequencing of chromatin immunoprecipitates containing specific transcription factors, with parallel RNA sequencing, has charted epigenetic regulation of gene expression by proinflammatory transcription factors in immune cells, providing complementary information to characterize morbid genes at infectious and inflammatory disease loci.
Screening of whole genome sequences identified high-impact variants for stallion fertility.
Schrimpf, Rahel; Gottschalk, Maren; Metzger, Julia; Martinsson, Gunilla; Sieme, Harald; Distl, Ottmar
2016-04-14
g.37455302G>A in NOTCH1 with the de-regressed estimated breeding values of the paternal component of the pregnancy rate per estrus (EBV-PAT). For 9 high-impact variants within the genes CFTR, OVGP1, FBXO43, TSSK6, PKD1, FOXP1, TCP11, SPATA31E1 and NOTCH1 (g.37453246G>C) absence of the homozygous mutant genotype in the validation sample of all 337 fertile stallions was obvious. Therefore, these variants were considered as potentially deleterious factors for stallion fertility. In conclusion, this study revealed 17 genetic variants with a predicted high damaging effect on protein structure and missing homozygous mutant genotype. The g.37455302G>A NOTCH1 variant was identified as a significant stallion fertility locus in Hanoverian stallions and further 9 candidate fertility loci with missing homozygous mutant genotypes were validated in a panel including 19 horse breeds. To our knowledge this is the first study in horses using next generation sequencing data to uncover strong candidate factors for stallion fertility.
Directory of Open Access Journals (Sweden)
Martin Mascher
Full Text Available The rapid development of next-generation sequencing platforms has enabled the use of sequencing for routine genotyping across a range of genetics studies and breeding applications. Genotyping-by-sequencing (GBS, a low-cost, reduced representation sequencing method, is becoming a common approach for whole-genome marker profiling in many species. With quickly developing sequencing technologies, adapting current GBS methodologies to new platforms will leverage these advancements for future studies. To test new semiconductor sequencing platforms for GBS, we genotyped a barley recombinant inbred line (RIL population. Based on a previous GBS approach, we designed bar code and adapter sets for the Ion Torrent platforms. Four sets of 24-plex libraries were constructed consisting of 94 RILs and the two parents and sequenced on two Ion platforms. In parallel, a 96-plex library of the same RILs was sequenced on the Illumina HiSeq 2000. We applied two different computational pipelines to analyze sequencing data; the reference-independent TASSEL pipeline and a reference-based pipeline using SAMtools. Sequence contigs positioned on the integrated physical and genetic map were used for read mapping and variant calling. We found high agreement in genotype calls between the different platforms and high concordance between genetic and reference-based marker order. There was, however, paucity in the number of SNP that were jointly discovered by the different pipelines indicating a strong effect of alignment and filtering parameters on SNP discovery. We show the utility of the current barley genome assembly as a framework for developing very low-cost genetic maps, facilitating high resolution genetic mapping and negating the need for developing de novo genetic maps for future studies in barley. Through demonstration of GBS on semiconductor sequencing platforms, we conclude that the GBS approach is amenable to a range of platforms and can easily be modified as new
Dog Y chromosomal DNA sequence: identification, sequencing and SNP discovery
Directory of Open Access Journals (Sweden)
Kirkness Ewen
2006-10-01
Full Text Available Abstract Background Population genetic studies of dogs have so far mainly been based on analysis of mitochondrial DNA, describing only the history of female dogs. To get a picture of the male history, as well as a second independent marker, there is a need for studies of biallelic Y-chromosome polymorphisms. However, there are no biallelic polymorphisms reported, and only 3200 bp of non-repetitive dog Y-chromosome sequence deposited in GenBank, necessitating the identification of dog Y chromosome sequence and the search for polymorphisms therein. The genome has been only partially sequenced for one male dog, disallowing mapping of the sequence into specific chromosomes. However, by comparing the male genome sequence to the complete female dog genome sequence, candidate Y-chromosome sequence may be identified by exclusion. Results The male dog genome sequence was analysed by Blast search against the human genome to identify sequences with a best match to the human Y chromosome and to the female dog genome to identify those absent in the female genome. Candidate sequences were then tested for male specificity by PCR of five male and five female dogs. 32 sequences from the male genome, with a total length of 24 kbp, were identified as male specific, based on a match to the human Y chromosome, absence in the female dog genome and male specific PCR results. 14437 bp were then sequenced for 10 male dogs originating from Europe, Southwest Asia, Siberia, East Asia, Africa and America. Nine haplotypes were found, which were defined by 14 substitutions. The genetic distance between the haplotypes indicates that they originate from at least five wolf haplotypes. There was no obvious trend in the geographic distribution of the haplotypes. Conclusion We have identified 24159 bp of dog Y-chromosome sequence to be used for population genetic studies. We sequenced 14437 bp in a worldwide collection of dogs, identifying 14 SNPs for future SNP analyses, and
Forward Genetics by Sequencing EMS Variation-Induced Inbred Lines
Directory of Open Access Journals (Sweden)
Charles Addo-Quaye
2017-02-01
Full Text Available In order to leverage novel sequencing techniques for cloning genes in eukaryotic organisms with complex genomes, the false positive rate of variant discovery must be controlled for by experimental design and informatics. We sequenced five lines from three pedigrees of ethyl methanesulfonate (EMS-mutagenized Sorghum bicolor, including a pedigree segregating a recessive dwarf mutant. Comparing the sequences of the lines, we were able to identify and eliminate error-prone positions. One genomic region contained EMS mutant alleles in dwarfs that were homozygous reference sequences in wild-type siblings and heterozygous in segregating families. This region contained a single nonsynonymous change that cosegregated with dwarfism in a validation population and caused a premature stop codon in the Sorghum ortholog encoding the gibberellic acid (GA biosynthetic enzyme ent-kaurene oxidase. Application of exogenous GA rescued the mutant phenotype. Our method for mapping did not require outcrossing and introduced no segregation variance. This enables work when line crossing is complicated by life history, permitting gene discovery outside of genetic models. This inverts the historical approach of first using recombination to define a locus and then sequencing genes. Our formally identical approach first sequences all the genes and then seeks cosegregation with the trait. Mutagenized lines lacking obvious phenotypic alterations are available for an extension of this approach: mapping with a known marker set in a line that is phenotypically identical to starting material for EMS mutant generation.
Johnson, Jennifer L; Wittgenstein, Helena; Mitchell, Sharon E; Hyma, Katie E; Temnykh, Svetlana V; Kharlamova, Anastasiya V; Gulevich, Rimma G; Vladimirova, Anastasiya V; Fong, Hiu Wa Flora; Acland, Gregory M; Trut, Lyudmila N; Kukekova, Anna V
2015-01-01
The silver fox (Vulpes vulpes) offers a novel model for studying the genetics of social behavior and animal domestication. Selection of foxes, separately, for tame and for aggressive behavior has yielded two strains with markedly different, genetically determined, behavioral phenotypes. Tame strain foxes are eager to establish human contact while foxes from the aggressive strain are aggressive and difficult to handle. These strains have been maintained as separate outbred lines for over 40 generations but their genetic structure has not been previously investigated. We applied a genotyping-by-sequencing (GBS) approach to provide insights into the genetic composition of these fox populations. Sequence analysis of EcoT22I genomic libraries of tame and aggressive foxes identified 48,294 high quality SNPs. Population structure analysis revealed genetic divergence between the two strains and more diversity in the aggressive strain than in the tame one. Significant differences in allele frequency between the strains were identified for 68 SNPs. Three of these SNPs were located on fox chromosome 14 within an interval of a previously identified behavioral QTL, further supporting the importance of this region for behavior. The GBS SNP data confirmed that significant genetic diversity has been preserved in both fox populations despite many years of selective breeding. Analysis of SNP allele frequencies in the two populations identified several regions of genetic divergence between the tame and aggressive foxes, some of which may represent targets of selection for behavior. The GBS protocol used in this study significantly expanded genomic resources for the fox, and can be adapted for SNP discovery and genotyping in other canid species.
Directory of Open Access Journals (Sweden)
Pazos-Navarro María
2011-12-01
Full Text Available Abstract Background Bituminaria bituminosa is a perennial legume species from the Canary Islands and Mediterranean region that has potential as a drought-tolerant pasture species and as a source of pharmaceutical compounds. Three botanical varieties have previously been identified in this species: albomarginata, bituminosa and crassiuscula. B. bituminosa can be considered a genomic 'orphan' species with very few genomic resources available. New DNA sequencing technologies provide an opportunity to develop high quality molecular markers for such orphan species. Results 432,306 mRNA molecules were sampled from a leaf transcriptome of a single B. bituminosa plant using Roche 454 pyrosequencing, resulting in an average read length of 345 bp (149.1 Mbp in total. Sequences were assembled into 3,838 isotigs/contigs representing putatively unique gene transcripts. Gene ontology descriptors were identified for 3,419 sequences. Raw sequence reads containing simple sequence repeat (SSR motifs were identified, and 240 primer pairs flanking these motifs were designed. Of 87 primer pairs developed this way, 75 (86.2% successfully amplified primarily single fragments by PCR. Fragment analysis using 20 primer pairs in 79 accessions of B. bituminosa detected 130 alleles at 21 SSR loci. Genetic diversity analyses confirmed that variation at these SSR loci accurately reflected known taxonomic relationships in original collections of B. bituminosa and provided additional evidence that a division of the botanical variety bituminosa into two according to geographical origin (Mediterranean region and Canary Islands may be appropriate. Evidence of cross-pollination was also found between botanical varieties within a B. bituminosa breeding programme. Conclusions B. bituminosa can no longer be considered a genomic orphan species, having now a large (albeit incomplete repertoire of expressed gene sequences that can serve as a resource for future genetic studies. This
Increasing the reach of forensic genetics with massively parallel sequencing.
Budowle, Bruce; Schmedes, Sarah E; Wendt, Frank R
2017-09-01
The field of forensic genetics has made great strides in the analysis of biological evidence related to criminal and civil matters. More so, the discipline has set a standard of performance and quality in the forensic sciences. The advent of massively parallel sequencing will allow the field to expand its capabilities substantially. This review describes the salient features of massively parallel sequencing and how it can impact forensic genetics. The features of this technology offer increased number and types of genetic markers that can be analyzed, higher throughput of samples, and the capability of targeting different organisms, all by one unifying methodology. While there are many applications, three are described where massively parallel sequencing will have immediate impact: molecular autopsy, microbial forensics and differentiation of monozygotic twins. The intent of this review is to expose the forensic science community to the potential enhancements that have or are soon to arrive and demonstrate the continued expansion the field of forensic genetics and its service in the investigation of legal matters.
DEFF Research Database (Denmark)
Als, Thomas Damm; Lescai, Francesco; Dahl, Hans
to map risk variants involved in complex traits. We aim at utilizing samples of cases and controls of the isolated population of the Faroe Islands to conduct whole-genome-sequence analysis in order to identify rare genetic variants associated with schizophrenia. We will search for rare genetic variants...... of developing SZ. However, these studies are designed to examining only “the common variant” proportion of the genomic landscape of SZ. Due to increased genetic drift during founding and potential bottlenecks, followed by population expansion, isolated populations may be particularly useful in identifying rare...... disease variants, that may appear at higher frequencies and/or within a more clearly distinct haplotype structure compared to outbred populations. Small isolated populations also typically show reduced phenotypic, genetic and environmental heterogeneity, thus making them advantageous in studies aiming...
Liu, Y T; Chen, R K; Lin, S J; Chen, Y C; Chin, S W; Chen, F C; Lee, C Y
2014-04-08
The Orchidaceae is one of the largest and most diverse families of flowering plants. The Dendrobium genus has high economic potential as ornamental plants and for medicinal purposes. In addition, the species of this genus are able to produce large crops. However, many Dendrobium varieties are very similar in outward appearance, making it difficult to distinguish one species from another. This study demonstrated that the 12 Dendrobium species used in this study may be divided into 2 groups by internal transcribed spacer (ITS) sequence analysis. Red and yellow flowers may also be used to separate these species into 2 main groups. In particular, the deciduous characteristic is associated with the ITS genetic diversity of the A group. Of 53 designed simple sequence repeat (SSR) primer pairs, 7 pairs were polymorphic for polymerase chain reaction products that were amplified from a specific band. The results of this study demonstrate that these 7 SSR primer pairs may potentially be used to identify Dendrobium species and their progeny in future studies.
Reddy, Ramesh; Fahiminiya, Somayyeh; El Zir, Elie; Mansour, Ahmad; Megarbane, Andre; Majewski, Jacek; Slim, Rima
2014-01-01
Usher syndrome (USH) is a genetically heterogeneous condition with ten disease-causing genes. The spectrum of genes and mutations causing USH in the Lebanese and Middle Eastern populations has not been described. Consequently, diagnostic approaches designed to screen for previously reported mutations were unlikely to identify the mutations in 11 unrelated families, eight of Lebanese and three of Middle Eastern origins. In addition, six of the ten USH genes consist of more than 20 exons, each, which made mutational analysis by Sanger sequencing of PCR-amplified exons from genomic DNA tedious and costly. The study was aimed at the identification of USH causing genes and mutations in 11 unrelated families with USH type I or II. Whole exome sequencing followed by expanded familial validation by Sanger sequencing. We identified disease-causing mutations in all the analyzed patients in four USH genes, MYO7A, USH2A, GPR98 and CDH23. Eleven of the mutations were novel and protein truncating, including a complex rearrangement in GPR98. Our data highlight the genetic diversity of Usher syndrome in the Lebanese population and the time and cost-effectiveness of whole exome sequencing approach for mutation analysis of genetically heterogeneous conditions caused by large genes.
Directory of Open Access Journals (Sweden)
Ramesh Reddy
Full Text Available Usher syndrome (USH is a genetically heterogeneous condition with ten disease-causing genes. The spectrum of genes and mutations causing USH in the Lebanese and Middle Eastern populations has not been described. Consequently, diagnostic approaches designed to screen for previously reported mutations were unlikely to identify the mutations in 11 unrelated families, eight of Lebanese and three of Middle Eastern origins. In addition, six of the ten USH genes consist of more than 20 exons, each, which made mutational analysis by Sanger sequencing of PCR-amplified exons from genomic DNA tedious and costly. The study was aimed at the identification of USH causing genes and mutations in 11 unrelated families with USH type I or II.Whole exome sequencing followed by expanded familial validation by Sanger sequencing.We identified disease-causing mutations in all the analyzed patients in four USH genes, MYO7A, USH2A, GPR98 and CDH23. Eleven of the mutations were novel and protein truncating, including a complex rearrangement in GPR98.Our data highlight the genetic diversity of Usher syndrome in the Lebanese population and the time and cost-effectiveness of whole exome sequencing approach for mutation analysis of genetically heterogeneous conditions caused by large genes.
Reddy, Ramesh; Fahiminiya, Somayyeh; El Zir, Elie; Mansour, Ahmad; Megarbane, Andre; Majewski, Jacek; Slim, Rima
2014-01-01
Background Usher syndrome (USH) is a genetically heterogeneous condition with ten disease-causing genes. The spectrum of genes and mutations causing USH in the Lebanese and Middle Eastern populations has not been described. Consequently, diagnostic approaches designed to screen for previously reported mutations were unlikely to identify the mutations in 11 unrelated families, eight of Lebanese and three of Middle Eastern origins. In addition, six of the ten USH genes consist of more than 20 exons, each, which made mutational analysis by Sanger sequencing of PCR-amplified exons from genomic DNA tedious and costly. The study was aimed at the identification of USH causing genes and mutations in 11 unrelated families with USH type I or II. Methods Whole exome sequencing followed by expanded familial validation by Sanger sequencing. Results We identified disease-causing mutations in all the analyzed patients in four USH genes, MYO7A, USH2A, GPR98 and CDH23. Eleven of the mutations were novel and protein truncating, including a complex rearrangement in GPR98. Conclusion Our data highlight the genetic diversity of Usher syndrome in the Lebanese population and the time and cost-effectiveness of whole exome sequencing approach for mutation analysis of genetically heterogeneous conditions caused by large genes. PMID:25211151
SeqAnt: A web service to rapidly identify and annotate DNA sequence variations
Directory of Open Access Journals (Sweden)
Patel Viren
2010-09-01
Full Text Available Abstract Background The enormous throughput and low cost of second-generation sequencing platforms now allow research and clinical geneticists to routinely perform single experiments that identify tens of thousands to millions of variant sites. Existing methods to annotate variant sites using information from publicly available databases via web browsers are too slow to be useful for the large sequencing datasets being routinely generated by geneticists. Because sequence annotation of variant sites is required before functional characterization can proceed, the lack of a high-throughput pipeline to efficiently annotate variant sites can act as a significant bottleneck in genetics research. Results SeqAnt (Sequence Annotator is an open source web service and software package that rapidly annotates DNA sequence variants and identifies recessive or compound heterozygous loci in human, mouse, fly, and worm genome sequencing experiments. Variants are characterized with respect to their functional type, frequency, and evolutionary conservation. Annotated variants can be viewed on a web browser, downloaded in a tab-delimited text file, or directly uploaded in a BED format to the UCSC genome browser. To demonstrate the speed of SeqAnt, we annotated a series of publicly available datasets that ranged in size from 37 to 3,439,107 variant sites. The total time to completely annotate these data completely ranged from 0.17 seconds to 28 minutes 49.8 seconds. Conclusion SeqAnt is an open source web service and software package that overcomes a critical bottleneck facing research and clinical geneticists using second-generation sequencing platforms. SeqAnt will prove especially useful for those investigators who lack dedicated bioinformatics personnel or infrastructure in their laboratories.
International Nuclear Information System (INIS)
Qurainy, F.A.; Gaafar, A.R.Z.
2014-01-01
Assessment and knowledge of the genetic diversity and variation within and between populations of rare and endangered plants is very important for effective conservation. Intergenic spacer sequences variation of psbA-trnH locus of chloroplast genome was assessed within Breonadia salicina (Rubiaceae), a critically endangered and endemic plant species to South western part of Kingdom of Saudi Arabia. The obtained sequence data from 19 individuals in three populations revealed nine haplotypes. The aligned sequences obtained from the overall Saudi accessions extended to 355 bp, revealing nine haplotypes. A high level of haplotype diversity (Hd = 0.842) and low level of nucleotide diversity (Pi = 0.0058) were detected. Consistently, both hierarchical analysis of molecular variance (AMOVA) and constructed neighbor-joining tree indicated null genetic differentiation among populations. This level of differentiation between populations or between regions in psbA-trnH sequences may be due to effects of the abundance of ancestral haplotype sharing and the presence of private haplotypes fixed for each population. Furthermore, the results revealed almost the same level of genetic diversity in comparison with Yemeni accessions, in which Saudi accessions were sharing three haplotypes from the four haplotypes found in Yemeni accessions. (author)
Liu, Lin; Wang, Hong-Dan; Cui, Cun-Ying; Qin, Yun-Yun; Fan, Tai-Bing; Peng, Bang-Tian; Zhang, Lian-Zhong; Wang, Cheng-Zeng
2017-12-05
Tetralogy of Fallot is the most common cyanotic congenital heart disease. However, its pathogenesis remains to be clarified. The purpose of this study was to identify the genetic variants in Tetralogy of Fallot by whole exome sequencing. Whole exome sequencing was performed among eight small families with Tetralogy of Fallot. Differential single nucleotide polymorphisms and small InDels were found by alignment within families and between families and then were verified by Sanger sequencing. Tetralogy of Fallot-related genes were determined by analysis using Gene Ontology /pathway, Online Mendelian Inheritance in Man, PubMed and other databases. A total of sixteen differential single nucleotide polymorphisms loci and eight differential small InDels were discovered. The sixteen differential single nucleotide polymorphisms loci were located on Chr 1, 2, 4, 5, 11, 12, 15, 22 and X. Among the sixteen single nucleotide polymorphisms loci, six has not been reported. The eight differential small InDels were located on Chr 2, 4, 9, 12, 17, 19 and X, whereas of the eight differential small InDels, two has not been reported. Analysis using Gene Ontology /pathway, Online Mendelian Inheritance in Man, PubMed and other databases revealed that PEX5 , NACA , ATXN2 , CELA1 , PCDHB4 and CTBP1 were associated with Tetralogy of Fallot. Our findings identify PEX5 , NACA , ATXN2 , CELA1 , PCDHB4 and CTBP1 mutations as underlying genetic causes of isolated tetralogy of Fallot.
Identifying tagging SNPs for African specific genetic variation from the African Diaspora Genome.
Johnston, Henry Richard; Hu, Yi-Juan; Gao, Jingjing; O'Connor, Timothy D; Abecasis, Gonçalo R; Wojcik, Genevieve L; Gignoux, Christopher R; Gourraud, Pierre-Antoine; Lizee, Antoine; Hansen, Mark; Genuario, Rob; Bullis, Dave; Lawley, Cindy; Kenny, Eimear E; Bustamante, Carlos; Beaty, Terri H; Mathias, Rasika A; Barnes, Kathleen C; Qin, Zhaohui S
2017-04-21
A primary goal of The Consortium on Asthma among African-ancestry Populations in the Americas (CAAPA) is to develop an 'African Diaspora Power Chip' (ADPC), a genotyping array consisting of tagging SNPs, useful in comprehensively identifying African specific genetic variation. This array is designed based on the novel variation identified in 642 CAAPA samples of African ancestry with high coverage whole genome sequence data (~30× depth). This novel variation extends the pattern of variation catalogued in the 1000 Genomes and Exome Sequencing Projects to a spectrum of populations representing the wide range of West African genomic diversity. These individuals from CAAPA also comprise a large swath of the African Diaspora population and incorporate historical genetic diversity covering nearly the entire Atlantic coast of the Americas. Here we show the results of designing and producing such a microchip array. This novel array covers African specific variation far better than other commercially available arrays, and will enable better GWAS analyses for researchers with individuals of African descent in their study populations. A recent study cataloging variation in continental African populations suggests this type of African-specific genotyping array is both necessary and valuable for facilitating large-scale GWAS in populations of African ancestry.
Mallett, Andrew J; McCarthy, Hugh J; Ho, Gladys; Holman, Katherine; Farnsworth, Elizabeth; Patel, Chirag; Fletcher, Jeffery T; Mallawaarachchi, Amali; Quinlan, Catherine; Bennetts, Bruce; Alexander, Stephen I
2017-12-01
Inherited kidney disease encompasses a broad range of disorders, with both multiple genes contributing to specific phenotypes and single gene defects having multiple clinical presentations. Advances in sequencing capacity may allow a genetic diagnosis for familial renal disease, by testing the increasing number of known causative genes. However, there has been limited translation of research findings of causative genes into clinical settings. Here, we report the results of a national accredited diagnostic genetic service for familial renal disease. An expert multidisciplinary team developed a targeted exomic sequencing approach with ten curated multigene panels (207 genes) and variant assessment individualized to the patient's phenotype. A genetic diagnosis (pathogenic genetic variant[s]) was identified in 58 of 135 families referred in two years. The genetic diagnosis rate was similar between families with a pediatric versus adult proband (46% vs 40%), although significant differences were found in certain panels such as atypical hemolytic uremic syndrome (88% vs 17%). High diagnostic rates were found for Alport syndrome (22 of 27) and tubular disorders (8 of 10), whereas the monogenic diagnostic rate for congenital anomalies of the kidney and urinary tract was one of 13. Quality reporting was aided by a strong clinical renal and genetic multidisciplinary committee review. Importantly, for a diagnostic service, few variants of uncertain significance were found with this targeted, phenotype-based approach. Thus, use of targeted massively parallel sequencing approaches in inherited kidney disease has a significant capacity to diagnose the underlying genetic disorder across most renal phenotypes. Copyright © 2017 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.
Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire
2012-01-01
Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr. PMID:22210604
Using "Arabidopsis" Genetic Sequences to Teach Bioinformatics
Zhang, Xiaorong
2009-01-01
This article describes a new approach to teaching bioinformatics using "Arabidopsis" genetic sequences. Several open-ended and inquiry-based laboratory exercises have been designed to help students grasp key concepts and gain practical skills in bioinformatics, using "Arabidopsis" leucine-rich repeat receptor-like kinase (LRR…
Mahato, Ajay Kumar; Sharma, Nimisha; Singh, Akshay; Srivastav, Manish; Jaiprakash; Singh, Sanjay Kumar; Singh, Anand Kumar; Sharma, Tilak Raj; Singh, Nagendra Kumar
2016-01-01
Mango (Mangifera indica L.) is called "king of fruits" due to its sweetness, richness of taste, diversity, large production volume and a variety of end usage. Despite its huge economic importance genomic resources in mango are scarce and genetics of useful horticultural traits are poorly understood. Here we generated deep coverage leaf RNA sequence data for mango parental varieties 'Neelam', 'Dashehari' and their hybrid 'Amrapali' using next generation sequencing technologies. De-novo sequence assembly generated 27,528, 20,771 and 35,182 transcripts for the three genotypes, respectively. The transcripts were further assembled into a non-redundant set of 70,057 unigenes that were used for SSR and SNP identification and annotation. Total 5,465 SSR loci were identified in 4,912 unigenes with 288 type I SSR (n ≥ 20 bp). One hundred type I SSR markers were randomly selected of which 43 yielded PCR amplicons of expected size in the first round of validation and were designated as validated genic-SSR markers. Further, 22,306 SNPs were identified by aligning high quality sequence reads of the three mango varieties to the reference unigene set, revealing significantly enhanced SNP heterozygosity in the hybrid Amrapali. The present study on leaf RNA sequencing of mango varieties and their hybrid provides useful genomic resource for genetic improvement of mango.
Lea, Amanda J.
2015-01-01
Identifying sources of variation in DNA methylation levels is important for understanding gene regulation. Recently, bisulfite sequencing has become a popular tool for investigating DNA methylation levels. However, modeling bisulfite sequencing data is complicated by dramatic variation in coverage across sites and individual samples, and because of the computational challenges of controlling for genetic covariance in count data. To address these challenges, we present a binomial mixed model and an efficient, sampling-based algorithm (MACAU: Mixed model association for count data via data augmentation) for approximate parameter estimation and p-value computation. This framework allows us to simultaneously account for both the over-dispersed, count-based nature of bisulfite sequencing data, as well as genetic relatedness among individuals. Using simulations and two real data sets (whole genome bisulfite sequencing (WGBS) data from Arabidopsis thaliana and reduced representation bisulfite sequencing (RRBS) data from baboons), we show that our method provides well-calibrated test statistics in the presence of population structure. Further, it improves power to detect differentially methylated sites: in the RRBS data set, MACAU detected 1.6-fold more age-associated CpG sites than a beta-binomial model (the next best approach). Changes in these sites are consistent with known age-related shifts in DNA methylation levels, and are enriched near genes that are differentially expressed with age in the same population. Taken together, our results indicate that MACAU is an efficient, effective tool for analyzing bisulfite sequencing data, with particular salience to analyses of structured populations. MACAU is freely available at www.xzlab.org/software.html. PMID:26599596
Allele Re-sequencing Technologies
DEFF Research Database (Denmark)
Byrne, Stephen; Farrell, Jacqueline Danielle; Asp, Torben
2013-01-01
The development of next-generation sequencing technologies has made sequencing an affordable approach for detection of genetic variations associated with various traits. However, the cost of whole genome re-sequencing still remains too high to be feasible for many plant species with large...... alternative to whole genome re-sequencing to identify causative genetic variations in plants. One challenge, however, will be efficient bioinformatics strategies for data handling and analysis from the increasing amount of sequence information....
Next generation sequencing and its applications in forensic genetics
DEFF Research Database (Denmark)
Børsting, Claus; Morling, Niels
2015-01-01
articles and presentations at conferences with forensic aspects of NGS. These contributions have demonstrated that NGS offers new possibilities for forensic genetic case work. More information may be obtained from unique samples in a single experiment by analyzing combinations of markers (STRs, SNPs......It has been almost a decade since the first next generation sequencing (NGS) technologies emerged and quickly changed the way genetic research is conducted. Today, full genomes are mapped and published almost weekly and with ever increasing speed and decreasing costs. NGS methods and platforms have...... matured during the last 10 years, and the quality of the sequences has reached a level where NGS is used in clinical diagnostics of humans. Forensic genetic laboratories have also explored NGS technologies and especially in the last year, there has been a small explosion in the number of scientific...
Han, Yuepeng; Chagné, David; Gasic, Ksenija; Rikkerink, Erik H A; Beever, Jonathan E; Gardiner, Susan E; Korban, Schuyler S
2009-03-01
A genome-wide BAC physical map of the apple, Malus x domestica Borkh., has been recently developed. Here, we report on integrating the physical and genetic maps of the apple using a SNP-based approach in conjunction with bin mapping. Briefly, BAC clones located at ends of BAC contigs were selected, and sequenced at both ends. The BAC end sequences (BESs) were used to identify candidate SNPs. Subsequently, these candidate SNPs were genetically mapped using a bin mapping strategy for the purpose of mapping the physical onto the genetic map. Using this approach, 52 (23%) out of 228 BESs tested were successfully exploited to develop SNPs. These SNPs anchored 51 contigs, spanning approximately 37 Mb in cumulative physical length, onto 14 linkage groups. The reliability of the integration of the physical and genetic maps using this SNP-based strategy is described, and the results confirm the feasibility of this approach to construct an integrated physical and genetic maps for apple.
Park, Doori; Park, Su-Hyun; Ban, Yong Wook; Kim, Youn Shic; Park, Kyoung-Cheul; Kim, Nam-Soo; Kim, Ju-Kon; Choi, Ik-Young
2017-08-15
Genetically modified crops (GM crops) have been developed to improve the agricultural traits of modern crop cultivars. Safety assessments of GM crops are of paramount importance in research at developmental stages and before releasing transgenic plants into the marketplace. Sequencing technology is developing rapidly, with higher output and labor efficiencies, and will eventually replace existing methods for the molecular characterization of genetically modified organisms. To detect the transgenic insertion locations in the three GM rice gnomes, Illumina sequencing reads are mapped and classified to the rice genome and plasmid sequence. The both mapped reads are classified to characterize the junction site between plant and transgene sequence by sequence alignment. Herein, we present a next generation sequencing (NGS)-based molecular characterization method, using transgenic rice plants SNU-Bt9-5, SNU-Bt9-30, and SNU-Bt9-109. Specifically, using bioinformatics tools, we detected the precise insertion locations and copy numbers of transfer DNA, genetic rearrangements, and the absence of backbone sequences, which were equivalent to results obtained from Southern blot analyses. NGS methods have been suggested as an effective means of characterizing and detecting transgenic insertion locations in genomes. Our results demonstrate the use of a combination of NGS technology and bioinformatics approaches that offers cost- and time-effective methods for assessing the safety of transgenic plants.
Nanayakkara, Shanika; Senevirathna, S T M L D; Parahitiyawa, Nipuna B; Abeysekera, Tilak; Chandrajith, Rohana; Ratnatunga, Neelakanthi; Hitomi, Toshiaki; Kobayashi, Hatasu; Harada, Kouji H; Koizumi, Akio
2015-09-01
The familial clustering observed in chronic kidney disease of uncertain etiology (CKDu) characterized by tubulointerstitial damages in the North Central Region of Sri Lanka strongly suggests the involvement of genetic factors in its pathogenesis. The objective of the present study is to use whole-exome sequencing to identify the genetic variants associated with CKDu. Whole-exome sequencing of eight CKDu cases and eight controls was performed, followed by direct sequencing of candidate loci in 301 CKDu cases and 276 controls. Association study revealed rs34970857 (c.658G > A/p.V220M) located in the KCNA10 gene encoding a voltage-gated K channel as the most promising SNP with the highest odds ratio of 1.74. Four rare variants were identified in gene encoding Laminin beta2 (LAMB2) which is known to cause congenital nephrotic syndrome. Three out of four variants in LAMB2 were novel variants found exclusively in cases. Genetic investigations provide strong evidence on the presence of genetic susceptibility for CKDu. Possibility of presence of several rare variants associated with CKDu in this population is also suggested.
Kraljić, K.; Strüngmann, L.; Fimmel, E.; Gumbel, M.
2018-01-01
The genetic code is degenerated and it is assumed that redundancy provides error detection and correction mechanisms in the translation process. However, the biological meaning of the code's structure is still under current research. This paper presents a Genetic Code Analysis Toolkit (GCAT) which provides workflows and algorithms for the analysis of the structure of nucleotide sequences. In particular, sets or sequences of codons can be transformed and tested for circularity, comma-freeness, dichotomic partitions and others. GCAT comes with a fertile editor custom-built to work with the genetic code and a batch mode for multi-sequence processing. With the ability to read FASTA files or load sequences from GenBank, the tool can be used for the mathematical and statistical analysis of existing sequence data. GCAT is Java-based and provides a plug-in concept for extensibility. Availability: Open source Homepage:http://www.gcat.bio/
Directory of Open Access Journals (Sweden)
Sarver Aaron L
2012-06-01
Full Text Available Abstract Background Next generation sequencing approaches applied to the analyses of transposon insertion junction fragments generated in high throughput forward genetic screens has created the need for clear informatics and statistical approaches to deal with the massive amount of data currently being generated. Previous approaches utilized to 1 map junction fragments within the genome and 2 identify Common Insertion Sites (CISs within the genome are not practical due to the volume of data generated by current sequencing technologies. Previous approaches applied to this problem also required significant manual annotation. Results We describe Transposon Annotation Poisson Distribution Association Network Connectivity Environment (TAPDANCE software, which automates the identification of CISs within transposon junction fragment insertion data. Starting with barcoded sequence data, the software identifies and trims sequences and maps putative genomic sequence to a reference genome using the bowtie short read mapper. Poisson distribution statistics are then applied to assess and rank genomic regions showing significant enrichment for transposon insertion. Novel methods of counting insertions are used to ensure that the results presented have the expected characteristics of informative CISs. A persistent mySQL database is generated and utilized to keep track of sequences, mappings and common insertion sites. Additionally, associations between phenotypes and CISs are also identified using Fisher’s exact test with multiple testing correction. In a case study using previously published data we show that the TAPDANCE software identifies CISs as previously described, prioritizes them based on p-value, allows holistic visualization of the data within genome browser software and identifies relationships present in the structure of the data. Conclusions The TAPDANCE process is fully automated, performs similarly to previous labor intensive approaches
Exome sequencing in 53 sporadic cases of schizophrenia identifies 18 putative candidate genes.
Directory of Open Access Journals (Sweden)
Michel Guipponi
Full Text Available Schizophrenia (SCZ is a severe, debilitating mental illness which has a significant genetic component. The identification of genetic factors related to SCZ has been challenging and these factors remain largely unknown. To evaluate the contribution of de novo variants (DNVs to SCZ, we sequenced the exomes of 53 individuals with sporadic SCZ and of their non-affected parents. We identified 49 DNVs, 18 of which were predicted to alter gene function, including 13 damaging missense mutations, 2 conserved splice site mutations, 2 nonsense mutations, and 1 frameshift deletion. The average number of exonic DNV per proband was 0.88, which corresponds to an exonic point mutation rate of 1.7×10(-8 per nucleotide per generation. The non-synonymous-to-synonymous mutation ratio of 2.06 did not differ from neutral expectations. Overall, this study provides a list of 18 putative candidate genes for sporadic SCZ, and when combined with the results of similar reports, identifies a second proband carrying a non-synonymous DNV in the RGS12 gene.
Identifying structural variants using linked-read sequencing data.
Elyanow, Rebecca; Wu, Hsin-Ta; Raphael, Benjamin J
2017-11-03
Structural variation, including large deletions, duplications, inversions, translocations, and other rearrangements, is common in human and cancer genomes. A number of methods have been developed to identify structural variants from Illumina short-read sequencing data. However, reliable identification of structural variants remains challenging because many variants have breakpoints in repetitive regions of the genome and thus are difficult to identify with short reads. The recently developed linked-read sequencing technology from 10X Genomics combines a novel barcoding strategy with Illumina sequencing. This technology labels all reads that originate from a small number (~5-10) DNA molecules ~50Kbp in length with the same molecular barcode. These barcoded reads contain long-range sequence information that is advantageous for identification of structural variants. We present Novel Adjacency Identification with Barcoded Reads (NAIBR), an algorithm to identify structural variants in linked-read sequencing data. NAIBR predicts novel adjacencies in a individual genome resulting from structural variants using a probabilistic model that combines multiple signals in barcoded reads. We show that NAIBR outperforms several existing methods for structural variant identification - including two recent methods that also analyze linked-reads - on simulated sequencing data and 10X whole-genome sequencing data from the NA12878 human genome and the HCC1954 breast cancer cell line. Several of the novel somatic structural variants identified in HCC1954 overlap known cancer genes. Software is available at compbio.cs.brown.edu/software. braphael@princeton.edu. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Directory of Open Access Journals (Sweden)
Iksoo Huh
Full Text Available Recent advances in genotyping methodologies have allowed genome-wide association studies (GWAS to accurately identify genetic variants that associate with common or pathological complex traits. Although most GWAS have focused on associations with single genetic variants, joint identification of multiple genetic variants, and how they interact, is essential for understanding the genetic architecture of complex phenotypic traits. Here, we propose an efficient stepwise method based on the Cochran-Mantel-Haenszel test (for stratified categorical data to identify causal joint multiple genetic variants in GWAS. This method combines the CMH statistic with a stepwise procedure to detect multiple genetic variants associated with specific categorical traits, using a series of associated I × J contingency tables and a null hypothesis of no phenotype association. Through a new stratification scheme based on the sum of minor allele count criteria, we make the method more feasible for GWAS data having sample sizes of several thousands. We also examine the properties of the proposed stepwise method via simulation studies, and show that the stepwise CMH test performs better than other existing methods (e.g., logistic regression and detection of associations by Markov blanket for identifying multiple genetic variants. Finally, we apply the proposed approach to two genomic sequencing datasets to detect linked genetic variants associated with bipolar disorder and obesity, respectively.
Sequence-Based Introgression Mapping Identifies Candidate White Mold Tolerance Genes in Common Bean
Directory of Open Access Journals (Sweden)
Sujan Mamidi
2016-07-01
Full Text Available White mold, caused by the necrotrophic fungus (Lib. de Bary, is a major disease of common bean ( L.. WM7.1 and WM8.3 are two quantitative trait loci (QTL with major effects on tolerance to the pathogen. Advanced backcross populations segregating individually for either of the two QTL, and a recombinant inbred (RI population segregating for both QTL were used to fine map and confirm the genetic location of the QTL. The QTL intervals were physically mapped using the reference common bean genome sequence, and the physical intervals for each QTL were further confirmed by sequence-based introgression mapping. Using whole-genome sequence data from susceptible and tolerant DNA pools, introgressed regions were identified as those with significantly higher numbers of single-nucleotide polymorphisms (SNPs relative to the whole genome. By combining the QTL and SNP data, WM7.1 was located to a 660-kb region that contained 41 gene models on the proximal end of chromosome Pv07, while the WM8.3 introgression was narrowed to a 1.36-Mb region containing 70 gene models. The most polymorphic candidate gene in the WM7.1 region encodes a BEACH-domain protein associated with apoptosis. Within the WM8.3 interval, a receptor-like protein with the potential to recognize pathogen effectors was the most polymorphic gene. The use of gene and sequence-based mapping identified two candidate genes whose putative functions are consistent with the current model of pathogenicity.
Wong, Lai-Ping; Lai, Jason Kuan-Han; Saw, Woei-Yuh; Ong, Rick Twee-Hee; Cheng, Anthony Youzhi; Pillai, Nisha Esakimuthu; Liu, Xuanyao; Xu, Wenting; Chen, Peng; Foo, Jia-Nee; Tan, Linda Wei-Lin; Koo, Seok-Hwee; Soong, Richie; Wenk, Markus Rene; Lim, Wei-Yen; Khor, Chiea-Chuen; Little, Peter; Chia, Kee-Seng; Teo, Yik-Ying
2014-05-01
South Asia possesses a significant amount of genetic diversity due to considerable intergroup differences in culture and language. There have been numerous reports on the genetic structure of Asian Indians, although these have mostly relied on genotyping microarrays or targeted sequencing of the mitochondria and Y chromosomes. Asian Indians in Singapore are primarily descendants of immigrants from Dravidian-language-speaking states in south India, and 38 individuals from the general population underwent deep whole-genome sequencing with a target coverage of 30X as part of the Singapore Sequencing Indian Project (SSIP). The genetic structure and diversity of these samples were compared against samples from the Singapore Sequencing Malay Project and populations in Phase 1 of the 1,000 Genomes Project (1 KGP). SSIP samples exhibited greater intra-population genetic diversity and possessed higher heterozygous-to-homozygous genotype ratio than other Asian populations. When compared against a panel of well-defined Asian Indians, the genetic makeup of the SSIP samples was closely related to South Indians. However, even though the SSIP samples clustered distinctly from the Europeans in the global population structure analysis with autosomal SNPs, eight samples were assigned to mitochondrial haplogroups that were predominantly present in Europeans and possessed higher European admixture than the remaining samples. An analysis of the relative relatedness between SSIP with two archaic hominins (Denisovan, Neanderthal) identified higher ancient admixture in East Asian populations than in SSIP. The data resource for these samples is publicly available and is expected to serve as a valuable complement to the South Asian samples in Phase 3 of 1 KGP.
Mahato, Ajay Kumar; Sharma, Nimisha; Singh, Akshay; Srivastav, Manish; Jaiprakash; Singh, Sanjay Kumar; Singh, Anand Kumar; Sharma, Tilak Raj; Singh, Nagendra Kumar
2016-01-01
Mango (Mangifera indica L.) is called “king of fruits” due to its sweetness, richness of taste, diversity, large production volume and a variety of end usage. Despite its huge economic importance genomic resources in mango are scarce and genetics of useful horticultural traits are poorly understood. Here we generated deep coverage leaf RNA sequence data for mango parental varieties ‘Neelam’, ‘Dashehari’ and their hybrid ‘Amrapali’ using next generation sequencing technologies. De-novo sequence assembly generated 27,528, 20,771 and 35,182 transcripts for the three genotypes, respectively. The transcripts were further assembled into a non-redundant set of 70,057 unigenes that were used for SSR and SNP identification and annotation. Total 5,465 SSR loci were identified in 4,912 unigenes with 288 type I SSR (n ≥ 20 bp). One hundred type I SSR markers were randomly selected of which 43 yielded PCR amplicons of expected size in the first round of validation and were designated as validated genic-SSR markers. Further, 22,306 SNPs were identified by aligning high quality sequence reads of the three mango varieties to the reference unigene set, revealing significantly enhanced SNP heterozygosity in the hybrid Amrapali. The present study on leaf RNA sequencing of mango varieties and their hybrid provides useful genomic resource for genetic improvement of mango. PMID:27736892
Exome Sequencing in Suspected Monogenic Dyslipidemias
Stitziel, Nathan O.; Peloso, Gina M.; Abifadel, Marianne; Cefalu, Angelo B.; Fouchier, Sigrid; Motazacker, M. Mahdi; Tada, Hayato; Larach, Daniel B.; Awan, Zuhier; Haller, Jorge F.; Pullinger, Clive R.; Varret, Mathilde; Rabès, Jean-Pierre; Noto, Davide; Tarugi, Patrizia; Kawashiri, Masa-aki; Nohara, Atsushi; Yamagishi, Masakazu; Risman, Marjorie; Deo, Rahul; Ruel, Isabelle; Shendure, Jay; Nickerson, Deborah A.; Wilson, James G.; Rich, Stephen S.; Gupta, Namrata; Farlow, Deborah N.; Neale, Benjamin M.; Daly, Mark J.; Kane, John P.; Freeman, Mason W.; Genest, Jacques; Rader, Daniel J.; Mabuchi, Hiroshi; Kastelein, John J.P.; Hovingh, G. Kees; Averna, Maurizio R.; Gabriel, Stacey; Boileau, Catherine; Kathiresan, Sekar
2015-01-01
Background Exome sequencing is a promising tool for gene mapping in Mendelian disorders. We utilized this technique in an attempt to identify novel genes underlying monogenic dyslipidemias. Methods and Results We performed exome sequencing on 213 selected family members from 41 kindreds with suspected Mendelian inheritance of extreme levels of low-density lipoprotein (LDL) cholesterol (after candidate gene sequencing excluded known genetic causes for high LDL cholesterol families) or high-density lipoprotein (HDL) cholesterol. We used standard analytic approaches to identify candidate variants and also assigned a polygenic score to each individual in order to account for their burden of common genetic variants known to influence lipid levels. In nine families, we identified likely pathogenic variants in known lipid genes (ABCA1, APOB, APOE, LDLR, LIPA, and PCSK9); however, we were unable to identify obvious genetic etiologies in the remaining 32 families despite follow-up analyses. We identified three factors that limited novel gene discovery: (1) imperfect sequencing coverage across the exome hid potentially causal variants; (2) large numbers of shared rare alleles within families obfuscated causal variant identification; and (3) individuals from 15% of families carried a significant burden of common lipid-related alleles, suggesting complex inheritance can masquerade as monogenic disease. Conclusions We identified the genetic basis of disease in nine of 41 families; however, none of these represented novel gene discoveries. Our results highlight the promise and limitations of exome sequencing as a discovery technique in suspected monogenic dyslipidemias. Considering the confounders identified may inform the design of future exome sequencing studies. PMID:25632026
Simple sequence repeat marker development and genetic mapping ...
Indian Academy of Sciences (India)
polymorphic SSR (simple sequence repeats) markers from libraries enriched for GA, CAA and AAT repeats, as well as 6 ... ers for quinoa was the development of a genetic linkage map ...... Weber J. L. 1990 Informativeness of human (dC-dA)n.
Energy Technology Data Exchange (ETDEWEB)
Faulon, Jean-Loup Michel; Heffelfinger, Grant S.
2009-06-01
A novel experimental and computational technique based on multiple enzymatic digestion of a protein or protein mixture that reconstructs protein sequences from sequences of overlapping peptides is described in this SAND report. This approach, analogous to shotgun sequencing of DNA, is to be used to sequence alternative spliced proteins, to identify post-translational modifications, and to sequence genetically engineered proteins.
Directory of Open Access Journals (Sweden)
Lai-Ping Wong
2014-05-01
Full Text Available South Asia possesses a significant amount of genetic diversity due to considerable intergroup differences in culture and language. There have been numerous reports on the genetic structure of Asian Indians, although these have mostly relied on genotyping microarrays or targeted sequencing of the mitochondria and Y chromosomes. Asian Indians in Singapore are primarily descendants of immigrants from Dravidian-language-speaking states in south India, and 38 individuals from the general population underwent deep whole-genome sequencing with a target coverage of 30X as part of the Singapore Sequencing Indian Project (SSIP. The genetic structure and diversity of these samples were compared against samples from the Singapore Sequencing Malay Project and populations in Phase 1 of the 1,000 Genomes Project (1 KGP. SSIP samples exhibited greater intra-population genetic diversity and possessed higher heterozygous-to-homozygous genotype ratio than other Asian populations. When compared against a panel of well-defined Asian Indians, the genetic makeup of the SSIP samples was closely related to South Indians. However, even though the SSIP samples clustered distinctly from the Europeans in the global population structure analysis with autosomal SNPs, eight samples were assigned to mitochondrial haplogroups that were predominantly present in Europeans and possessed higher European admixture than the remaining samples. An analysis of the relative relatedness between SSIP with two archaic hominins (Denisovan, Neanderthal identified higher ancient admixture in East Asian populations than in SSIP. The data resource for these samples is publicly available and is expected to serve as a valuable complement to the South Asian samples in Phase 3 of 1 KGP.
Directory of Open Access Journals (Sweden)
Chen-Chi Wu
Full Text Available Despite the clinical utility of genetic diagnosis to address idiopathic sensorineural hearing impairment (SNHI, the current strategy for screening mutations via Sanger sequencing suffers from the limitation that only a limited number of DNA fragments associated with common deafness mutations can be genotyped. Consequently, a definitive genetic diagnosis cannot be achieved in many families with discernible family history. To investigate the diagnostic utility of massively parallel sequencing (MPS, we applied the MPS technique to 12 multiplex families with idiopathic SNHI in which common deafness mutations had previously been ruled out. NimbleGen sequence capture array was designed to target all protein coding sequences (CDSs and 100 bp of the flanking sequence of 80 common deafness genes. We performed MPS on the Illumina HiSeq2000, and applied BWA, SAMtools, Picard, GATK, Variant Tools, ANNOVAR, and IGV for bioinformatics analyses. Initial data filtering with allele frequencies (0.95 prioritized 5 indels (insertions/deletions and 36 missense variants in the 12 multiplex families. After further validation by Sanger sequencing, segregation pattern, and evolutionary conservation of amino acid residues, we identified 4 variants in 4 different genes, which might lead to SNHI in 4 families compatible with autosomal dominant inheritance. These included GJB2 p.R75Q, MYO7A p.T381M, KCNQ4 p.S680F, and MYH9 p.E1256K. Among them, KCNQ4 p.S680F and MYH9 p.E1256K were novel. In conclusion, MPS allows genetic diagnosis in multiplex families with idiopathic SNHI by detecting mutations in relatively uncommon deafness genes.
Martin, Michael D; Jay, Flora; Castellano, Sergi; Slatkin, Montgomery
2017-08-01
We develop and evaluate methods for inferring relatedness among individuals from low-coverage DNA sequences of their genomes, with particular emphasis on sequences obtained from fossil remains. We suggest the major factors complicating the determination of relatedness among ancient individuals are sequencing depth, the number of overlapping sites, the sequencing error rate and the presence of contamination from present-day genetic sources. We develop a theoretical model that facilitates the exploration of these factors and their relative effects, via measurement of pairwise genetic distances, without calling genotypes, and determine the power to infer relatedness under various scenarios of varying sequencing depth, present-day contamination and sequencing error. The model is validated by a simulation study as well as the analysis of aligned sequences from present-day human genomes. We then apply the method to the recently published genome sequences of ancient Europeans, developing a statistical treatment to determine confidence in assigned relatedness that is, in some cases, more precise than previously reported. As the majority of ancient specimens are from animals, this method would be applicable to investigate kinship in nonhuman remains. The developed software grups (Genetic Relatedness Using Pedigree Simulations) is implemented in Python and freely available. © 2017 John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Takahashi, N.; Takahashi, Y.; Blumberg, B.S.; Putnam, F.W.
1987-01-01
The structural changes in four genetic variants of human serum albumin were analyzed by tandem high-pressure liquid chromatography (HPLC) of the tryptic peptides, HPLC mapping and isoelectric focusing of the CNBr fragments, and amino acid sequence analysis of the purified peptides. Lysine-372 of normal (common) albumin A was changed to glutamic acid both in albumin Naskapi, a widespread polymorphic variant of North American Indians, and in albumin Mersin found in Eti Turks. The two variants also exhibited anomalous migration in NaDodSO 4 /PAGE, which is attributed to a conformational change. The identity of albumins Naskapi and Mersin may have originated through descent from a common mid-Asiatic founder of the two migrating ethnic groups, or it may represent identical but independent mutations of the albumin gene. In albumin Adana, from Eti Turks, the substitution site was not identified but was localized to the region from positions 447 through 548. The substitution of aspartic acid-550 by glycine was found in albumin Mexico-2 from four individuals of the Pima tribe. Although only single-point substitutions have been found in these and in certain other genetic variants of human albumin, five differences exist in the amino acid sequences inferred from cDNA sequences by workers in three other laboratories. However, our results on albumin A and on 14 different genetic variants accord with the amino acid sequence of albumin deduced from the genomic sequence. The apparent amino acid substitutions inferred from comparison of individual cDNA sequences probably reflect artifacts in cloning or in cDNA sequence analysis rather than polymorphism of the coding sections of the albumin gene
Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder
Yuen, Ryan K C; Merico, Daniele; Bookman, Matt; Howe, Jennifer L.; Thiruvahindrapuram, Bhooma; Patel, Rohan V.; Whitney, Joe; Deflaux, Nicole; Bingham, Jonathan; Wang, Zhuozhi; Pellecchia, Giovanna; Buchanan, Janet A.; Walker, Susan; Marshall, Christian R.; Uddin, Mohammed; Zarrei, Mehdi; Deneault, Eric; D'Abate, Lia; Chan, Ada J S; Koyanagi, Stephanie; Paton, Tara; Pereira, Sergio L.; Hoang, Ny; Engchuan, Worrawat; Higginbotham, Edward J.; Ho, Karen; Lamoureux, Sylvia; Li, Weili; MacDonald, Jeffrey R.; Nalpathamkalam, Thomas; Sung, Wilson W L; Tsoi, Fiona J.; Wei, John; Xu, Lizhen; Tasse, Anne Marie; Kirby, Emily; Van Etten, William; Twigger, Simon; Roberts, Wendy; Drmic, Irene; Jilderda, Sanne; Modi, Bonnie Mackinnon; Kellam, Barbara; Szego, Michael; Cytrynbaum, Cheryl; Weksberg, Rosanna; Zwaigenbaum, Lonnie; Woodbury-Smith, Marc; Brian, Jessica; Senman, Lili; Iaboni, Alana; Doyle-Thomas, Krissy; Thompson, Ann; Chrysler, Christina; Leef, Jonathan; Savion-Lemieux, Tal; Smith, Isabel M.; Liu, Xudong; Nicolson, Rob; Seifer, Vicki; Fedele, Angie; Cook, Edwin H.; Dager, Stephen; Estes, Annette; Gallagher, Louise; Malow, Beth A.; Parr, Jeremy R.; Spence, Sarah J.; Vorstman, Jacob; Frey, Brendan J.; Robinson, James T.; Strug, Lisa J.; Fernandez, Bridget A.; Elsabbagh, Mayada; Carter, Melissa T.; Hallmayer, Joachim; Knoppers, Bartha M.; Anagnostou, Evdokia; Szatmari, Peter; Ring, Robert H.; Glazer, David; Pletcher, Mathew T.; Scherer, Stephen W.
2017-01-01
We are performing whole-genome sequencing of families with autism spectrum disorder (ASD) to build a resource (MSSNG) for subcategorizing the phenotypes and underlying genetic factors involved. Here we report sequencing of 5,205 samples from families with ASD, accompanied by clinical information,
Hunt, Paul
2010-09-16
Background: Classical and quantitative linkage analyses of genetic crosses have traditionally been used to map genes of interest, such as those conferring chloroquine or quinine resistance in malaria parasites. Next-generation sequencing technologies now present the possibility of determining genome-wide genetic variation at single base-pair resolution. Here, we combine in vivo experimental evolution, a rapid genetic strategy and whole genome re-sequencing to identify the precise genetic basis of artemisinin resistance in a lineage of the rodent malaria parasite, Plasmodium chabaudi. Such genetic markers will further the investigation of resistance and its control in natural infections of the human malaria, P. falciparum.Results: A lineage of isogenic in vivo drug-selected mutant P. chabaudi parasites was investigated. By measuring the artemisinin responses of these clones, the appearance of an in vivo artemisinin resistance phenotype within the lineage was defined. The underlying genetic locus was mapped to a region of chromosome 2 by Linkage Group Selection in two different genetic crosses. Whole-genome deep coverage short-read re-sequencing (IlluminaSolexa) defined the point mutations, insertions, deletions and copy-number variations arising in the lineage. Eight point mutations arise within the mutant lineage, only one of which appears on chromosome 2. This missense mutation arises contemporaneously with artemisinin resistance and maps to a gene encoding a de-ubiquitinating enzyme.Conclusions: This integrated approach facilitates the rapid identification of mutations conferring selectable phenotypes, without prior knowledge of biological and molecular mechanisms. For malaria, this model can identify candidate genes before resistant parasites are commonly observed in natural human malaria populations. 2010 Hunt et al; licensee BioMed Central Ltd.
A High Resolution Genetic Map Anchoring Scaffolds of the Sequenced Watermelon Genome
Kou, Qinghe; Jiang, Jiao; Guo, Shaogui; Zhang, Haiying; Hou, Wenju; Zou, Xiaohua; Sun, Honghe; Gong, Guoyi; Levi, Amnon; Xu, Yong
2012-01-01
As part of our ongoing efforts to sequence and map the watermelon (Citrullus spp.) genome, we have constructed a high density genetic linkage map. The map positioned 234 watermelon genome sequence scaffolds (an average size of 1.41 Mb) that cover about 330 Mb and account for 93.5% of the 353 Mb of the assembled genomic sequences of the elite Chinese watermelon line 97103 (Citrullus lanatus var. lanatus). The genetic map was constructed using an F8 population of 103 recombinant inbred lines (RILs). The RILs are derived from a cross between the line 97103 and the United States Plant Introduction (PI) 296341-FR (C. lanatus var. citroides) that contains resistance to fusarium wilt (races 0, 1, and 2). The genetic map consists of eleven linkage groups that include 698 simple sequence repeat (SSR), 219 insertion-deletion (InDel) and 36 structure variation (SV) markers and spans ∼800 cM with a mean marker interval of 0.8 cM. Using fluorescent in situ hybridization (FISH) with 11 BACs that produced chromosome-specifc signals, we have depicted watermelon chromosomes that correspond to the eleven linkage groups constructed in this study. The high resolution genetic map developed here should be a useful platform for the assembly of the watermelon genome, for the development of sequence-based markers used in breeding programs, and for the identification of genes associated with important agricultural traits. PMID:22247776
Colorectal Cancer Genetic Heterogeneity Delineated by Multi-Region Sequencing.
Directory of Open Access Journals (Sweden)
You-Wang Lu
Full Text Available Intratumor heterogeneity (ITH leads to an underestimation of the mutational landscape portrayed by a single needle biopsy and consequently affects treatment precision. The extent of colorectal cancer (CRC genetic ITH is not well understood in Chinese patients. Thus, we conducted deep sequencing by using the OncoGxOne™ Plus panel, targeting 333 cancer-specific genes in multi-region biopsies of primary and liver metastatic tumors from three Chinese CRC patients. We determined that the extent of ITH varied among the three cases. On average, 65% of all the mutations detected were common within individual tumors. KMT2C aberrations and the NCOR1 mutation were the only ubiquitous events. Subsequent phylogenetic analysis showed that the tumors evolved in a branched manner. Comparison of the primary and metastatic tumors revealed that PPP2R1A (E370X, SETD2 (I1608V, SMAD4 (G382T, and AR splicing site mutations may be specific to liver metastatic cancer. These mutations might contribute to the initiation and progression of distant metastasis. Collectively, our analysis identified a substantial level of genetic ITH in CRC, which should be considered for personalized therapeutic strategies.
Zhang, Tifu; Gu, Minfeng; Liu, Yuhe; Lv, Yuanda; Zhou, Ling; Lu, Haiyan; Liang, Shuaiqiang; Bao, Huabin; Zhao, Han
2017-09-05
Quinoa (Chenopodium quinoa Willd.) is a balanced nutritional crop, but its breeding improvement has been limited by the lack of information on its genetics and genomics. Therefore, it is necessary to obtain knowledge on genomic variation, population structure, and genetic diversity and to develop novel Insertion/Deletion (InDel) markers for quinoa by whole-genome re-sequencing. We re-sequenced 11 quinoa accessions and obtained a coverage depth between approximately 7× to 23× the quinoa genome. Based on the 1453-megabase (Mb) assembly from the reference accession Riobamba, 8,441,022 filtered bi-allelic single nucleotide polymorphisms (SNPs) and 842,783 filtered InDels were identified, with an estimated SNP and InDel density of 5.81 and 0.58 per kilobase (kb). From the genomic InDel variations, 85 dimorphic InDel markers were newly developed and validated. Together with the 62 simple sequence repeat (SSR) markers reported, a total of 147 markers were used for genotyping the 129 quinoa accessions. Molecular grouping analysis showed classification into two major groups, the Andean highland (composed of the northern and southern highland subgroups) and Chilean coastal, based on combined STRUCTURE, phylogenetic tree and PCA (Principle Component Analysis) analyses. Further analysis of the genetic diversity exhibited a decreasing tendency from the Chilean coast group to the Andean highland group, and the gene flow between subgroups was more frequent than that between the two subgroups and the Chilean coastal group. The majority of the variations (approximately 70%) were found through an analysis of molecular variation (AMOVA) due to the diversity between the groups. This was congruent with the observation of a highly significant F ST value (0.705) between the groups, demonstrating significant genetic differentiation between the Andean highland type of quinoa and the Chilean coastal type. Moreover, a core set of 16 quinoa germplasms that capture all 362 alleles was
Next-generation sequencing for genetic testing of familial colorectal cancer syndromes.
Simbolo, Michele; Mafficini, Andrea; Agostini, Marco; Pedrazzani, Corrado; Bedin, Chiara; Urso, Emanuele D; Nitti, Donato; Turri, Giona; Scardoni, Maria; Fassan, Matteo; Scarpa, Aldo
2015-01-01
Genetic screening in families with high risk to develop colorectal cancer (CRC) prevents incurable disease and permits personalized therapeutic and follow-up strategies. The advancement of next-generation sequencing (NGS) technologies has revolutionized the throughput of DNA sequencing. A series of 16 probands for either familial adenomatous polyposis (FAP; 8 cases) or hereditary nonpolyposis colorectal cancer (HNPCC; 8 cases) were investigated for intragenic mutations in five CRC familial syndromes-associated genes (APC, MUTYH, MLH1, MSH2, MSH6) applying both a custom multigene Ion AmpliSeq NGS panel and conventional Sanger sequencing. Fourteen pathogenic variants were detected in 13/16 FAP/HNPCC probands (81.3 %); one FAP proband presented two co-existing pathogenic variants, one in APC and one in MUTYH. Thirteen of these 14 pathogenic variants were detected by both NGS and Sanger, while one MSH2 mutation (L280FfsX3) was identified only by Sanger sequencing. This is due to a limitation of the NGS approach in resolving sequences close or within homopolymeric stretches of DNA. To evaluate the performance of our NGS custom panel we assessed its capability to resolve the DNA sequences corresponding to 2225 pathogenic variants reported in the COSMIC database for APC, MUTYH, MLH1, MSH2, MSH6. Our NGS custom panel resolves the sequences where 2108 (94.7 %) of these variants occur. The remaining 117 mutations reside inside or in close proximity to homopolymer stretches; of these 27 (1.2 %) are imprecisely identified by the software but can be resolved by visual inspection of the region, while the remaining 90 variants (4.0 %) are blind spots. In summary, our custom panel would miss 4 % (90/2225) of pathogenic variants that would need a small set of Sanger sequencing reactions to be solved. The multiplex NGS approach has the advantage of analyzing multiple genes in multiple samples simultaneously, requiring only a reduced number of Sanger sequences to resolve
Chintalapudi, Sumana R; Maria, Doaa; Di Wang, Xiang; Bailey, Jessica N Cooke; Hysi, Pirro G; Wiggs, Janey L; Williams, Robert W; Jablonski, Monica M
2017-11-24
Glaucoma is a multi-factorial blinding disease in which genetic factors play an important role. Elevated intraocular pressure is a highly heritable risk factor for primary open angle glaucoma and currently the only target for glaucoma therapy. Our study helps to better understand underlying genetic and molecular mechanisms that regulate intraocular pressure, and identifies a new candidate gene, Cacna2d1, that modulates intraocular pressure and a promising therapeutic, pregabalin, which binds to CACNA2D1 protein and lowers intraocular pressure significantly. Because our study utilizes a genetically diverse population of mice with known sequence variants, we are able to determine that the intraocular pressure-lowering effect of pregabalin is dependent on the Cacna2d1 haplotype. Using human genome-wide association study (GWAS) data, evidence for association of a CACNA2D1 single-nucleotide polymorphism and primary open angle glaucoma is found. Importantly, these results demonstrate that our systems genetics approach represents an efficient method to identify genetic variation that can guide the selection of therapeutic targets.
JRC GMO-Amplicons: a collection of nucleic acid sequences related to genetically modified organisms.
Petrillo, Mauro; Angers-Loustau, Alexandre; Henriksson, Peter; Bonfini, Laura; Patak, Alex; Kreysa, Joachim
2015-01-01
The DNA target sequence is the key element in designing detection methods for genetically modified organisms (GMOs). Unfortunately this information is frequently lacking, especially for unauthorized GMOs. In addition, patent sequences are generally poorly annotated, buried in complex and extensive documentation and hard to link to the corresponding GM event. Here, we present the JRC GMO-Amplicons, a database of amplicons collected by screening public nucleotide sequence databanks by in silico determination of PCR amplification with reference methods for GMO analysis. The European Union Reference Laboratory for Genetically Modified Food and Feed (EU-RL GMFF) provides these methods in the GMOMETHODS database to support enforcement of EU legislation and GM food/feed control. The JRC GMO-Amplicons database is composed of more than 240 000 amplicons, which can be easily accessed and screened through a web interface. To our knowledge, this is the first attempt at pooling and collecting publicly available sequences related to GMOs in food and feed. The JRC GMO-Amplicons supports control laboratories in the design and assessment of GMO methods, providing inter-alia in silico prediction of primers specificity and GM targets coverage. The new tool can assist the laboratories in the analysis of complex issues, such as the detection and identification of unauthorized GMOs. Notably, the JRC GMO-Amplicons database allows the retrieval and characterization of GMO-related sequences included in patents documentation. Finally, it can help annotating poorly described GM sequences and identifying new relevant GMO-related sequences in public databases. The JRC GMO-Amplicons is freely accessible through a web-based portal that is hosted on the EU-RL GMFF website. Database URL: http://gmo-crl.jrc.ec.europa.eu/jrcgmoamplicons/. © The Author(s) 2015. Published by Oxford University Press.
A weighted U-statistic for genetic association analyses of sequencing data.
Wei, Changshuai; Li, Ming; He, Zihuai; Vsevolozhskaya, Olga; Schaid, Daniel J; Lu, Qing
2014-12-01
With advancements in next-generation sequencing technology, a massive amount of sequencing data is generated, which offers a great opportunity to comprehensively investigate the role of rare variants in the genetic etiology of complex diseases. Nevertheless, the high-dimensional sequencing data poses a great challenge for statistical analysis. The association analyses based on traditional statistical methods suffer substantial power loss because of the low frequency of genetic variants and the extremely high dimensionality of the data. We developed a Weighted U Sequencing test, referred to as WU-SEQ, for the high-dimensional association analysis of sequencing data. Based on a nonparametric U-statistic, WU-SEQ makes no assumption of the underlying disease model and phenotype distribution, and can be applied to a variety of phenotypes. Through simulation studies and an empirical study, we showed that WU-SEQ outperformed a commonly used sequence kernel association test (SKAT) method when the underlying assumptions were violated (e.g., the phenotype followed a heavy-tailed distribution). Even when the assumptions were satisfied, WU-SEQ still attained comparable performance to SKAT. Finally, we applied WU-SEQ to sequencing data from the Dallas Heart Study (DHS), and detected an association between ANGPTL 4 and very low density lipoprotein cholesterol. © 2014 WILEY PERIODICALS, INC.
Wang, Xia; Wang, Hui; Cao, Ming; Li, Zhe; Chen, Xianfeng; Patenia, Claire; Gore, Athurva; Abboud, Emad B.; Al-Rajhi, Ali A.; Lewis, Richard A.; Lupski, James R.; Mardon, Graeme; Zhang, Kun; Muzny, Donna; Gibbs, Richard A.
2011-01-01
It has been well documented that mutations in the same retinal disease gene can result in different clinical phenotypes due to difference in the mutant allele and/or genetic background. To evaluate this, a set of consanguineous patient families with Leber congenital amaurosis (LCA) that do not carry mutations in known LCA disease genes was characterized through homozygosity mapping followed by targeted exon/whole-exome sequencing to identify genetic variations. Among these families, a total o...
Liang, Chanjuan; van Dijk, Jeroen P; Scholtens, Ingrid M J; Staats, Martijn; Prins, Theo W; Voorhuijzen, Marleen M; da Silva, Andrea M; Arisi, Ana Carolina Maisonnave; den Dunnen, Johan T; Kok, Esther J
2014-04-01
The growing number of biotech crops with novel genetic elements increasingly complicates the detection of genetically modified organisms (GMOs) in food and feed samples using conventional screening methods. Unauthorized GMOs (UGMOs) in food and feed are currently identified through combining GMO element screening with sequencing the DNA flanking these elements. In this study, a specific and sensitive qPCR assay was developed for vip3A element detection based on the vip3Aa20 coding sequences of the recently marketed MIR162 maize and COT102 cotton. Furthermore, SiteFinding-PCR in combination with Sanger, Illumina or Pacific BioSciences (PacBio) sequencing was performed targeting the flanking DNA of the vip3Aa20 element in MIR162. De novo assembly and Basic Local Alignment Search Tool searches were used to mimic UGMO identification. PacBio data resulted in relatively long contigs in the upstream (1,326 nucleotides (nt); 95 % identity) and downstream (1,135 nt; 92 % identity) regions, whereas Illumina data resulted in two smaller contigs of 858 and 1,038 nt with higher sequence identity (>99 % identity). Both approaches outperformed Sanger sequencing, underlining the potential for next-generation sequencing in UGMO identification.
Zhu, Huayu; Song, Pengyao; Koo, Dal-Hoe; Guo, Luqin; Li, Yanman; Sun, Shouru; Weng, Yiqun; Yang, Luming
2016-08-05
Microsatellite markers are one of the most informative and versatile DNA-based markers used in plant genetic research, but their development has traditionally been difficult and costly. The whole genome sequencing with next-generation sequencing (NGS) technologies provides large amounts of sequence data to develop numerous microsatellite markers at whole genome scale. SSR markers have great advantage in cross-species comparisons and allow investigation of karyotype and genome evolution through highly efficient computation approaches such as in silico PCR. Here we described genome wide development and characterization of SSR markers in the watermelon (Citrullus lanatus) genome, which were then use in comparative analysis with two other important crop species in the Cucurbitaceae family: cucumber (Cucumis sativus L.) and melon (Cucumis melo L.). We further applied these markers in evaluating the genetic diversity and population structure in watermelon germplasm collections. A total of 39,523 microsatellite loci were identified from the watermelon draft genome with an overall density of 111 SSRs/Mbp, and 32,869 SSR primers were designed with suitable flanking sequences. The dinucleotide SSRs were the most common type representing 34.09 % of the total SSR loci and the AT-rich motifs were the most abundant in all nucleotide repeat types. In silico PCR analysis identified 832 and 925 SSR markers with each having a single amplicon in the cucumber and melon draft genome, respectively. Comparative analysis with these cross-species SSR markers revealed complicated mosaic patterns of syntenic blocks among the genomes of three species. In addition, genetic diversity analysis of 134 watermelon accessions with 32 highly informative SSR loci placed these lines into two groups with all accessions of C.lanatus var. citorides and three accessions of C. colocynthis clustered in one group and all accessions of C. lanatus var. lanatus and the remaining accessions of C. colocynthis
Directory of Open Access Journals (Sweden)
Devier Benjamin
2007-08-01
Full Text Available Abstract Background The basidiomycete fungus Microbotryum violaceum is responsible for the anther-smut disease in many plants of the Caryophyllaceae family and is a model in genetics and evolutionary biology. Infection is initiated by dikaryotic hyphae produced after the conjugation of two haploid sporidia of opposite mating type. This study describes M. violaceum ESTs corresponding to nuclear genes expressed during conjugation and early hyphal production. Results A normalized cDNA library generated 24,128 sequences, which were assembled into 7,765 unique genes; 25.2% of them displayed significant similarity to annotated proteins from other organisms, 74.3% a weak similarity to the same set of known proteins, and 0.5% were orphans. We identified putative pheromone receptors and genes that in other fungi are involved in the mating process. We also identified many sequences similar to genes known to be involved in pathogenicity in other fungi. The M. violaceum EST database, MICROBASE, is available on the Web and provides access to the sequences, assembled contigs, annotations and programs to compare similarities against MICROBASE. Conclusion This study provides a basis for cloning the mating type locus, for further investigation of pathogenicity genes in the anther smut fungi, and for comparative genomics.
Poulter, James A; El-Sayed, Walid; Shore, Roger C; Kirkham, Jennifer; Inglehearn, Chris F; Mighell, Alan J
2014-01-01
The conventional approach to identifying the defective gene in a family with an inherited disease is to find the disease locus through family studies. However, the rapid development and decreasing cost of next generation sequencing facilitates a more direct approach. Here, we report the identification of a frameshift mutation in LAMB3 as a cause of dominant hypoplastic amelogenesis imperfecta (AI). Whole-exome sequencing of three affected family members and subsequent filtering of shared variants, without prior genetic linkage, sufficed to identify the pathogenic variant. Simultaneous analysis of multiple family members confirms segregation, enhancing the power to filter the genetic variation found and leading to rapid identification of the pathogenic variant. LAMB3 encodes a subunit of Laminin-5, one of a family of basement membrane proteins with essential functions in cell growth, movement and adhesion. Homozygous LAMB3 mutations cause junctional epidermolysis bullosa (JEB) and enamel defects are seen in JEB cases. However, to our knowledge, this is the first report of dominant AI due to a LAMB3 mutation in the absence of JEB.
Systems genetics of complex diseases using RNA-sequencing methods
DEFF Research Database (Denmark)
Mazzoni, Gianluca; Kogelman, Lisette; Suravajhala, Prashanth
2015-01-01
Next generation sequencing technologies have enabled the generation of huge quantities of biological data, and nowadays extensive datasets at different ‘omics levels have been generated. Systems genetics is a powerful approach that allows to integrate different ‘omics level and understand the bio...
Directory of Open Access Journals (Sweden)
Tatyana Victorovna Kozhanova
2017-08-01
Full Text Available Epilepsy is the most common serious neurological disorder, and there is a genetic basis in almost 50% of people with epilepsy. The diagnosis of genetic epilepsies makes to estimate reasons of seizures in the patient. Last decade has shown tremendous growth in gene sequencing technologies, which have made genetic tests available. The aim is to show significance of targeted exome sequencing and methods of data analysis in the diagnosis of hereditary syndromes leading to the development of epileptic encephalopathy. We examined 27 patients with с early EE (resistant to antiepileptic drugs, psychomotor and speech development delay in the psycho-neurological department. Targeted exome sequencing was performed for patients without a previously identified molecular diagnosis using 454 Sequencing GS Junior sequencer (Roche and IlluminaNextSeq 500 platform. As a result of the analysis, specific epilepsy genetic variants were diagnosed in 27 patients. The greatest number of cases was due to mutations in the SCN1A gene (7/27. The structure of mutations for other genes (mutations with a minor allele frequency of less than 0,5% are presented: ALDH7A1 (n=1, CACNA1C (n=1, CDKL5 (n=1, CNTNAP2 (n=2, DLGAP2 (n=2, DOCK7 (n=2, GRIN2B (n=2, HCN1 (n=1, NRXN1 (n=3, PCDH19 (n=1, RNASEH2B (n=2, SLC2A1 (n=1, UBE3A (n=1. The use of the exome sequencing in the genetic practice allows to significantly improve the effectiveness of medical genetic counseling, as it made possible to diagnose certain variants of genetically heterogeneous groups of diseases with similar of clinical manifestations.
Identifying Corneal Infections in Formalin-Fixed Specimens Using Next Generation Sequencing.
Li, Zhigang; Breitwieser, Florian P; Lu, Jennifer; Jun, Albert S; Asnaghi, Laura; Salzberg, Steven L; Eberhart, Charles G
2018-01-01
We test the ability of next-generation sequencing, combined with computational analysis, to identify a range of organisms causing infectious keratitis. This retrospective study evaluated 16 cases of infectious keratitis and four control corneas in formalin-fixed tissues from the pathology laboratory. Infectious cases also were analyzed in the microbiology laboratory using culture, polymerase chain reaction, and direct staining. Classified sequence reads were analyzed with two different metagenomics classification engines, Kraken and Centrifuge, and visualized using the Pavian software tool. Sequencing generated 20 to 46 million reads per sample. On average, 96% of the reads were classified as human, 0.3% corresponded to known vectors or contaminant sequences, 1.7% represented microbial sequences, and 2.4% could not be classified. The two computational strategies successfully identified the fungal, bacterial, and amoebal pathogens in most patients, including all four bacterial and mycobacterial cases, five of six fungal cases, three of three Acanthamoeba cases, and one of three herpetic keratitis cases. In several cases, additional potential pathogens also were identified. In one case with cytomegalovirus identified by Kraken and Centrifuge, the virus was confirmed by direct testing, while two where Staphylococcus aureus or cytomegalovirus were identified by Centrifuge but not Kraken could not be confirmed. Confirmation was not attempted for an additional three potential pathogens identified by Kraken and 11 identified by Centrifuge. Next generation sequencing combined with computational analysis can identify a wide range of pathogens in formalin-fixed corneal specimens, with potential applications in clinical diagnostics and research.
Genetic signatures of adaptation revealed from transcriptome sequencing of Arctic and red foxes.
Kumar, Vikas; Kutschera, Verena E; Nilsson, Maria A; Janke, Axel
2015-08-07
The genus Vulpes (true foxes) comprises numerous species that inhabit a wide range of habitats and climatic conditions, including one species, the Arctic fox (Vulpes lagopus) which is adapted to the arctic region. A close relative to the Arctic fox, the red fox (Vulpes vulpes), occurs in subarctic to subtropical habitats. To study the genetic basis of their adaptations to different environments, transcriptome sequences from two Arctic foxes and one red fox individual were generated and analyzed for signatures of positive selection. In addition, the data allowed for a phylogenetic analysis and divergence time estimate between the two fox species. The de novo assembly of reads resulted in more than 160,000 contigs/transcripts per individual. Approximately 17,000 homologous genes were identified using human and the non-redundant databases. Positive selection analyses revealed several genes involved in various metabolic and molecular processes such as energy metabolism, cardiac gene regulation, apoptosis and blood coagulation to be under positive selection in foxes. Branch site tests identified four genes to be under positive selection in the Arctic fox transcriptome, two of which are fat metabolism genes. In the red fox transcriptome eight genes are under positive selection, including molecular process genes, notably genes involved in ATP metabolism. Analysis of the three transcriptomes and five Sanger re-sequenced genes in additional individuals identified a lower genetic variability within Arctic foxes compared to red foxes, which is consistent with distribution range differences and demographic responses to past climatic fluctuations. A phylogenomic analysis estimated that the Arctic and red fox lineages diverged about three million years ago. Transcriptome data are an economic way to generate genomic resources for evolutionary studies. Despite not representing an entire genome, this transcriptome analysis identified numerous genes that are relevant to arctic
DEFF Research Database (Denmark)
Grarup, Niels; Sulem, Patrick; Sandholt, Camilla H
2013-01-01
of the underlying biology of human traits and diseases. Here, we used a large Icelandic whole genome sequence dataset combined with Danish exome sequence data to gain insight into the genetic architecture of serum levels of vitamin B12 (B12) and folate. Up to 22.9 million sequence variants were analyzed in combined...... in serum B12 or folate levels do not modify the risk of developing these conditions. Yet, the study demonstrates the value of combining whole genome and exome sequencing approaches to ascertain the genetic and molecular architectures underlying quantitative trait associations....
Diagnostics of Primary Immunodeficiencies through Next Generation Sequencing
Directory of Open Access Journals (Sweden)
Vera Gallo
2016-11-01
Full Text Available Background: Recently, a growing number of novel genetic defects underlying primary immunodeficiencies (PID have been identified, increasing the number of PID up to more than 250 well-defined forms. Next-generation sequencing (NGS technologies and proper filtering strategies greatly contributed to this rapid evolution, providing the possibility to rapidly and simultaneously analyze large numbers of genes or the whole exome. Objective: To evaluate the role of targeted next-generation sequencing and whole exome sequencing in the diagnosis of a case series, characterized by complex or atypical clinical features suggesting a PID, difficult to diagnose using the current diagnostic procedures.Methods: We retrospectively analyzed genetic variants identified through targeted next-generation sequencing or whole exome sequencing in 45 patients with complex PID of unknown etiology. Results: 40 variants were identified using targeted next-generation sequencing, while 5 were identified using whole exome sequencing. Newly identified genetic variants were classified into 4 groups: I variations associated with a well-defined PID; II variations associated with atypical features of a well-defined PID; III functionally relevant variations potentially involved in the immunological features; IV non-diagnostic genotype, in whom the link with phenotype is missing. We reached a conclusive genetic diagnosis in 7/45 patients (~16%. Among them, 4 patients presented with a typical well-defined PID. In the remaining 3 cases, mutations were associated with unexpected clinical features, expanding the phenotypic spectrum of typical PIDs. In addition, we identified 31 variants in 10 patients with complex phenotype, individually not causative per se of the disorder.Conclusion: NGS technologies represent a cost-effective and rapid first-line genetic approaches for the evaluation of complex PIDs. Whole exome sequencing, despite a moderate higher cost compared to targeted, is
Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder
Yuen, Ryan KC; Merico, Daniele; Bookman, Matt; Howe, Jennifer L; Thiruvahindrapuram, Bhooma; Patel, Rohan V; Whitney, Joe; Deflaux, Nicole; Bingham, Jonathan; Wang, Zhuozhi; Pellecchia, Giovanna; Buchanan, Janet A; Walker, Susan; Marshall, Christian R; Uddin, Mohammed; Zarrei, Mehdi; Deneault, Eric; D’Abate, Lia; Chan, Ada JS; Koyanagi, Stephanie; Paton, Tara; Pereira, Sergio L; Hoang, Ny; Engchuan, Worrawat; Higginbotham, Edward J; Ho, Karen; Lamoureux, Sylvia; Li, Weili; MacDonald, Jeffrey R; Nalpathamkalam, Thomas; Sung, Wilson WL; Tsoi, Fiona J; Wei, John; Xu, Lizhen; Tasse, Anne-Marie; Kirby, Emily; Van Etten, William; Twigger, Simon; Roberts, Wendy; Drmic, Irene; Jilderda, Sanne; Modi, Bonnie MacKinnon; Kellam, Barbara; Szego, Michael; Cytrynbaum, Cheryl; Weksberg, Rosanna; Zwaigenbaum, Lonnie; Woodbury-Smith, Marc; Brian, Jessica; Senman, Lili; Iaboni, Alana; Doyle-Thomas, Krissy; Thompson, Ann; Chrysler, Christina; Leef, Jonathan; Savion-Lemieux, Tal; Smith, Isabel M; Liu, Xudong; Nicolson, Rob; Seifer, Vicki; Fedele, Angie; Cook, Edwin H; Dager, Stephen; Estes, Annette; Gallagher, Louise; Malow, Beth A; Parr, Jeremy R; Spence, Sarah J; Vorstman, Jacob; Frey, Brendan J; Robinson, James T; Strug, Lisa J; Fernandez, Bridget A; Elsabbagh, Mayada; Carter, Melissa T; Hallmayer, Joachim; Knoppers, Bartha M; Anagnostou, Evdokia; Szatmari, Peter; Ring, Robert H; Glazer, David; Pletcher, Mathew T; Scherer, Stephen W
2017-01-01
We are performing whole genome sequencing (WGS) of families with Autism Spectrum Disorder (ASD) to build a resource, named MSSNG, to enable the sub-categorization of phenotypes and underlying genetic factors involved. Here, we report WGS of 5,205 samples from families with ASD, accompanied by clinical information, creating a database accessible in a cloud platform, and through an internet portal with controlled access. We found an average of 73.8 de novo single nucleotide variants and 12.6 de novo insertion/deletions (indels) or copy number variations (CNVs) per ASD subject. We identified 18 new candidate ASD-risk genes such as MED13 and PHF3, and found that participants bearing mutations in susceptibility genes had significantly lower adaptive ability (p=6×10−4). In 294/2,620 (11.2%) of ASD cases, a molecular basis could be determined and 7.2% of these carried CNV/chromosomal abnormalities, emphasizing the importance of detecting all forms of genetic variation as diagnostic and therapeutic targets in ASD. PMID:28263302
Keel, B N; Nonneman, D J; Rohrer, G A
2017-08-01
Genetic variants detected from sequence have been used to successfully identify causal variants and map complex traits in several organisms. High and moderate impact variants, those expected to alter or disrupt the protein coded by a gene and those that regulate protein production, likely have a more significant effect on phenotypic variation than do other types of genetic variants. Hence, a comprehensive list of these functional variants would be of considerable interest in swine genomic studies, particularly those targeting fertility and production traits. Whole-genome sequence was obtained from 72 of the founders of an intensely phenotyped experimental swine herd at the U.S. Meat Animal Research Center (USMARC). These animals included all 24 of the founding boars (12 Duroc and 12 Landrace) and 48 Yorkshire-Landrace composite sows. Sequence reads were mapped to the Sscrofa10.2 genome build, resulting in a mean of 6.1 fold (×) coverage per genome. A total of 22 342 915 high confidence SNPs were identified from the sequenced genomes. These included 21 million previously reported SNPs and 79% of the 62 163 SNPs on the PorcineSNP60 BeadChip assay. Variation was detected in the coding sequence or untranslated regions (UTRs) of 87.8% of the genes in the porcine genome: loss-of-function variants were predicted in 504 genes, 10 202 genes contained nonsynonymous variants, 10 773 had variation in UTRs and 13 010 genes contained synonymous variants. Approximately 139 000 SNPs were classified as loss-of-function, nonsynonymous or regulatory, which suggests that over 99% of the variation detected in our pigs could potentially be ignored, allowing us to focus on a much smaller number of functional SNPs during future analyses. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.
Directory of Open Access Journals (Sweden)
Yun Wang
Full Text Available Retinitis pigmentosa (RP is a heterogeneous group of progressive retinal degenerations characterized by pigmentation and atrophy in the mid-periphery of the retina. Twenty two subjects from a four-generation Chinese family with RP and thin cornea, congenital cataract and high myopia is reported in this study. All family members underwent complete ophthalmologic examinations. Patients of the family presented with bone spicule-shaped pigment deposits in retina, retinal vascular attenuation, retinal and choroidal dystrophy, as well as punctate opacity of the lens, reduced cornea thickness and high myopia. Peripheral venous blood was obtained from all patients and their family members for genetic analysis. After mutation analysis in a few known RP candidate genes, exome sequencing was used to analyze the exomes of 3 patients III2, III4, III6 and the unaffected mother II2. A total of 34,693 variations shared by 3 patients were subjected to several filtering steps against existing variation databases. Identified variations were verified in the rest family members by PCR and Sanger sequencing. Compound heterozygous c.802-8_810del17insGC and c.1091-2A>G mutations of the CYP4V2 gene, known as genetic defects for Bietti crystalline corneoretinal dystrophy, were identified as causative mutations for RP of this family.
Jazayeri, Roshanak; Hu, Hao; Fattahi, Zohreh; Musante, Luciana; Abedini, Seyedeh Sedigheh; Hosseini, Masoumeh; Wienker, Thomas F; Ropers, Hans Hilger; Najmabadi, Hossein; Kahrizi, Kimia
2015-10-01
Intellectual disability (ID) is a neuro-developmental disorder which causes considerable socio-economic problems. Some ID individuals are also affected by ataxia, and the condition includes different mutations affecting several genes. We used whole exome sequencing (WES) in combination with homozygosity mapping (HM) to identify the genetic defects in five consanguineous families among our cohort study, with two affected children with ID and ataxia as major clinical symptoms. We identified three novel candidate genes, RIPPLY1, MRPL10, SNX14, and a new mutation in known gene SURF1. All are autosomal genes, except RIPPLY1, which is located on the X chromosome. Two are housekeeping genes, implicated in transcription and translation regulation and intracellular trafficking, and two encode mitochondrial proteins. The pathogenesis of these variants was evaluated by mutation classification, bioinformatic methods, review of medical and biological relevance, co-segregation studies in the particular family, and a normal population study. Linkage analysis and exome sequencing of a small number of affected family members is a powerful new technique which can be used to decrease the number of candidate genes in heterogenic disorders such as ID, and may even identify the responsible gene(s).
Milosevic Feenstra, Jelena D; Nivarthi, Harini; Gisslinger, Heinz; Leroy, Emilie; Rumi, Elisa; Chachoua, Ilyas; Bagienski, Klaudia; Kubesova, Blanka; Pietra, Daniela; Gisslinger, Bettina; Milanesi, Chiara; Jäger, Roland; Chen, Doris; Berg, Tiina; Schalling, Martin; Schuster, Michael; Bock, Christoph; Constantinescu, Stefan N; Cazzola, Mario; Kralovics, Robert
2016-01-21
Essential thrombocythemia (ET) and primary myelofibrosis (PMF) are chronic diseases characterized by clonal hematopoiesis and hyperproliferation of terminally differentiated myeloid cells. The disease is driven by somatic mutations in exon 9 of CALR or exon 10 of MPL or JAK2-V617F in >90% of the cases, whereas the remaining cases are termed "triple negative." We aimed to identify the disease-causing mutations in the triple-negative cases of ET and PMF by applying whole-exome sequencing (WES) on paired tumor and control samples from 8 patients. We found evidence of clonal hematopoiesis in 5 of 8 studied cases based on clonality analysis and presence of somatic genetic aberrations. WES identified somatic mutations in 3 of 8 cases. We did not detect any novel recurrent somatic mutations. In 3 patients with clonal hematopoiesis analyzed by WES, we identified a somatic MPL-S204P, a germline MPL-V285E mutation, and a germline JAK2-G571S variant. We performed Sanger sequencing of the entire coding region of MPL in 62, and of JAK2 in 49 additional triple-negative cases of ET or PMF. New somatic (T119I, S204F, E230G, Y591D) and 1 germline (R321W) MPL mutation were detected. All of the identified MPL mutations were gain-of-function when analyzed in functional assays. JAK2 variants were identified in 5 of 57 triple-negative cases analyzed by WES and Sanger sequencing combined. We could demonstrate that JAK2-V625F and JAK2-F556V are gain-of-function mutations. Our results suggest that triple-negative cases of ET and PMF do not represent a homogenous disease entity. Cases with polyclonal hematopoiesis might represent hereditary disorders. © 2016 by The American Society of Hematology.
Shavrukov, Yuri; Suchecki, Radoslaw; Eliby, Serik; Abugalieva, Aigul; Kenebayev, Serik; Langridge, Peter
2014-09-28
New SNP marker platforms offer the opportunity to investigate the relationships between wheat cultivars from different regions and assess the mechanism and processes that have led to adaptation to particular production environments. Wheat breeding has a long history in Kazakhstan and the aim of this study was to explore the relationship between key varieties from Kazakhstan and germplasm from breeding programs for other regions. The study revealed 5,898 polymorphic markers amongst ten cultivars, of which 2,730 were mapped in the consensus genetic map. Mapped SNP markers were distributed almost equally across the A and B genomes, with between 279 and 484 markers assigned to each chromosome. Marker coverage was approximately 10-fold lower in the D genome. There were 863 SNP markers identified as unique to specific cultivars, and clusters of these markers (regions containing more than three closely mapped unique SNPs) showed specific patterns on the consensus genetic map for each cultivar. Significant intra-varietal genetic polymorphism was identified in three cultivars (Tzelinnaya 3C, Kazakhstanskaya rannespelaya and Kazakhstanskaya 15). Phylogenetic analysis based on inter-varietal polymorphism showed that the very old cultivar Erythrospermum 841 was the most genetically distinct from the other nine cultivars from Kazakhstan, falling in a clade together with the American cultivar Sonora and genotypes from Central and South Asia. The modern cultivar Kazakhstanskaya 19 also fell into a separate clade, together with the American cultivar Thatcher. The remaining eight cultivars shared a single sub-clade but were categorised into four clusters. The accumulated data for SNP marker polymorphisms amongst bread wheat genotypes from Kazakhstan may be used for studying genetic diversity in bread wheat, with potential application for marker-assisted selection and the preparation of a set of genotype-specific markers.
Burrell, A Millie; Pepper, Alan E; Hodnett, George; Goolsby, John A; Overholt, William A; Racelis, Alexis E; Diaz, Rodrigo; Klein, Patricia E
2015-05-01
Imperata cylindrica (Cogongrass, Speargrass) is a diploid C4 grass that is a noxious weed in 73 countries and constitutes a significant threat to global biodiversity and sustainable agriculture. We used a cost-effective genotyping-by-sequencing (GBS) approach to identify the reproductive system, genetic diversity and geographic origins of invasions in the south-eastern United States. In this work, we demonstrated the advantage of employing the closely related, fully sequenced crop species Sorghum bicolor (L.) Moench as a proxy reference genome to identify a set of 2320 informative single nucleotide and insertion-deletion polymorphisms. Genetic analyses identified four clonal lineages of cogongrass and one clonal lineage of Imperata brasiliensis Trin. in the United States. Each lineage was highly homogeneous, and we found no evidence of hybridization among the different lineages, despite geographical overlap. We found evidence that at least three of these lineages showed clonal reproduction prior to introduction to the United States. These results indicate that cogongrass has limited evolutionary potential to adapt to novel environments and further suggest that upon arrival to its invaded range, this species did not require local adaptation through hybridization/introgression or selection of favourable alleles from a broad genetic base. Thus, cogongrass presents a clear case of broad invasive success, across a diversity of environments, in a clonal organism with limited genetic diversity. © 2015 John Wiley & Sons Ltd.
2018-01-01
Background The Hungarian draft is a horse breed with a recent mixed ancestry created in the 1920s by crossing local mares with draught horses imported from France and Belgium. The interest in its conservation and characterization has increased over the last few years. The aim of this work is to contribute to the characterization of the endangered Hungarian heavy draft horse populations in order to obtain useful information to implement conservation strategies for these genetic stocks. Methods To genetically characterize the breed and to set up the basis for a conservation program, in the present study a hypervariable region of the mitochrondial DNA (D-loop) was used to assess genetic diversity in Hungarian draft horses. Two hundred and eighty five sequences obtained in our laboratory and 419 downloaded sequences available from Genbank were analyzed. Results One hundred and sixty-four haplotypes and thirty-six polymorphic sites were observed. High haplotype and nucleotide diversity values (Hd = 0.954 ± 0.004; π = 0.028 ± 0.0004) were identified in Hungarian population, although they were higher within than among the different populations (Hd = 0.972 ± 0.002; π = 0.03097 ± 0.002). Fourteen of the previously observed seventeen haplogroups were detected. Discussion Our samples showed a large intra- and interbreed variation. There was no clear clustering on the median joining network figure. The overall information collected in this work led us to consider that the genetic scenario observed for Hungarian draft breed is more likely the result of contributions from ‘ancestrally’ different genetic backgrounds. This study could contribute to the development of a breeding plan for Hungarian draft horses and help to formulate a genetic conservation plan, avoiding inbreeding while. PMID:29404201
Directory of Open Access Journals (Sweden)
Nedenia Bonvino Stafuzza
Full Text Available Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose, Gyr, Girolando and Holstein (dairy production. A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs and 3,828,041 insertions/deletions (InDels were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs.
Going forward with genetics: recent technological advances and forward genetics in mice.
Moresco, Eva Marie Y; Li, Xiaohong; Beutler, Bruce
2013-05-01
Forward genetic analysis is an unbiased approach for identifying genes essential to defined biological phenomena. When applied to mice, it is one of the most powerful methods to facilitate understanding of the genetic basis of human biology and disease. The speed at which disease-causing mutations can be identified in mutagenized mice has been markedly increased by recent advances in DNA sequencing technology. Creating and analyzing mutant phenotypes may therefore become rate-limiting in forward genetic experimentation. We review the forward genetic approach and its future in the context of recent technological advances, in particular massively parallel DNA sequencing, induced pluripotent stem cells, and haploid embryonic stem cells. Copyright © 2013 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.
Method of detecting genetic deletions identified with chromosomal abnormalities
Energy Technology Data Exchange (ETDEWEB)
Gray, Joe W; Pinkel, Daniel; Tkachuk, Douglas
2013-11-26
Methods and compositions for staining based upon nucleic acid sequence that employ nucleic acid probes are provided. Said methods produce staining patterns that can be tailored for specific cytogenetic analyzes. Said probes are appropriate for in situ hybridization and stain both interphase and metaphase chromosomal material with reliable signals. The nucleic acids probes are typically of a complexity greater tha 50 kb, the complexity depending upon the cytogenetic application. Methods and reagents are provided for the detection of genetic rearrangements. Probes and test kits are provided for use in detecting genetic rearrangements, particlularly for use in tumor cytogenetics, in the detection of disease related loci, specifically cancer, such as chronic myelogenous leukemia (CML) and for biological dosimetry. Methods and reagents are described for cytogenetic research, for the differentiation of cytogenetically similar ut genetically different diseases, and for many prognostic and diagnostic applications.
2012-01-01
Background Apple is an economically important fruit crop worldwide. Developing a genetic linkage map is a critical step towards mapping and cloning of genes responsible for important horticultural traits in apple. To facilitate linkage map construction, we surveyed and characterized the distribution and frequency of perfect microsatellites in assembled contig sequences of the apple genome. Results A total of 28,538 SSRs have been identified in the apple genome, with an overall density of 40.8 SSRs per Mb. Di-nucleotide repeats are the most frequent microsatellites in the apple genome, accounting for 71.9% of all microsatellites. AT/TA repeats are the most frequent in genomic regions, accounting for 38.3% of all the G-SSRs, while AG/GA dimers prevail in transcribed sequences, and account for 59.4% of all EST-SSRs. A total set of 310 SSRs is selected to amplify eight apple genotypes. Of these, 245 (79.0%) are found to be polymorphic among cultivars and wild species tested. AG/GA motifs in genomic regions have detected more alleles and higher PIC values than AT/TA or AC/CA motifs. Moreover, AG/GA repeats are more variable than any other dimers in apple, and should be preferentially selected for studies, such as genetic diversity and linkage map construction. A total of 54 newly developed apple SSRs have been genetically mapped. Interestingly, clustering of markers with distorted segregation is observed on linkage groups 1, 2, 10, 15, and 16. A QTL responsible for malic acid content of apple fruits is detected on linkage group 8, and accounts for ~13.5% of the observed phenotypic variation. Conclusions This study demonstrates that di-nucleotide repeats are prevalent in the apple genome and that AT/TA and AG/GA repeats are the most frequent in genomic and transcribed sequences of apple, respectively. All SSR motifs identified in this study as well as those newly mapped SSRs will serve as valuable resources for pursuing apple genetic studies, aiding the apple breeding
Close Sequence Comparisons are Sufficient to Identify Humancis-Regulatory Elements
Energy Technology Data Exchange (ETDEWEB)
Prabhakar, Shyam; Poulin, Francis; Shoukry, Malak; Afzal, Veena; Rubin, Edward M.; Couronne, Olivier; Pennacchio, Len A.
2005-12-01
Cross-species DNA sequence comparison is the primary method used to identify functional noncoding elements in human and other large genomes. However, little is known about the relative merits of evolutionarily close and distant sequence comparisons, due to the lack of a universal metric for sequence conservation, and also the paucity of empirically defined benchmark sets of cis-regulatory elements. To address this problem, we developed a general-purpose algorithm (Gumby) that detects slowly-evolving regions in primate, mammalian and more distant comparisons without requiring adjustment of parameters, and ranks conserved elements by P-value using Karlin-Altschul statistics. We benchmarked Gumby predictions against previously identified cis-regulatory elements at diverse genomic loci, and also tested numerous extremely conserved human-rodent sequences for transcriptional enhancer activity using reporter-gene assays in transgenic mice. Human regulatory elements were identified with acceptable sensitivity and specificity by comparison with 1-5 other eutherian mammals or 6 other simian primates. More distant comparisons (marsupial, avian, amphibian and fish) failed to identify many of the empirically defined functional noncoding elements. We derived an intuitive relationship between ancient and recent noncoding sequence conservation from whole genome comparative analysis, which explains some of these findings. Lastly, we determined that, in addition to strength of conservation, genomic location and/or density of surrounding conserved elements must also be considered in selecting candidate enhancers for testing at embryonic time points.
Genetic basis of arrhythmogenic cardiomyopathy.
Karmouch, Jennifer; Protonotarios, Alexandros; Syrris, Petros
2018-05-01
To date 16 genes have been associated with arrhythmogenic cardiomyopathy (ACM). Mutations in these genes can lead to a broad spectrum of phenotypic expression ranging from disease affecting predominantly the right or left ventricle, to biventricular subtypes. Understanding the genetic causes of ACM is important in diagnosis and management of the disorder. This review summarizes recent advances in molecular genetics and discusses the application of next-generation sequencing technology in genetic testing in ACM. Use of next-generation sequencing methods has resulted in the identification of novel causative variants and genes for ACM. The involvement of filamin C in ACM demonstrates the genetic overlap between ACM and other types of cardiomyopathy. Putative pathogenic variants have been detected in cadherin 2 gene, a protein involved in cell adhesion. Large genomic rearrangements in desmosome genes have been systematically investigated in a cohort of ACM patients. Recent studies have identified novel causes of ACM providing new insights into the genetic spectrum of the disease and highlighting an overlapping phenotype between ACM and dilated cardiomyopathy. Next-generation sequencing is a useful tool for research and genetic diagnostic screening but interpretation of identified sequence variants requires caution and should be performed in specialized centres.
Using inter simple sequence repeat (ISSR) markers to study genetic ...
African Journals Online (AJOL)
enoh
2012-04-10
Apr 10, 2012 ... Genetic relationships among the cultivars was assessed by using six inter simple sequence ... polymorphism breeders of this species in order to find the ..... well as the high level of heterozygosity due to the cross- pollinating ...
Choi, H.K.; Kim, D.; Uhm, T.; Limpens, E.H.M.; Lim, H.; Mun, J.H.; Kalo, P.; Penmetsa, R.V.; Seres, A.; Kulikova, O.; Roe, B.A.; Bisseling, T.; Kiss, G.B.; Cook, D.R.
2004-01-01
A core genetic map of the legume Medicago truncatula has been established by analyzing the segregation of 288 sequence-characterized genetic markers in an E, population composed of 93 individuals. These molecular markers correspond to 141 ESTs, 80 BAC end sequence tags, and 67 resistance gene
Gene Unprediction with Spurio: A tool to identify spurious protein sequences.
Höps, Wolfram; Jeffryes, Matt; Bateman, Alex
2018-01-01
We now have access to the sequences of tens of millions of proteins. These protein sequences are essential for modern molecular biology and computational biology. The vast majority of protein sequences are derived from gene prediction tools and have no experimental supporting evidence for their translation. Despite the increasing accuracy of gene prediction tools there likely exists a large number of spurious protein predictions in the sequence databases. We have developed the Spurio tool to help identify spurious protein predictions in prokaryotes. Spurio searches the query protein sequence against a prokaryotic nucleotide database using tblastn and identifies homologous sequences. The tblastn matches are used to score the query sequence's likelihood of being a spurious protein prediction using a Gaussian process model. The most informative feature is the appearance of stop codons within the presumed translation of homologous DNA sequences. Benchmarking shows that the Spurio tool is able to distinguish spurious from true proteins. However, transposon proteins are prone to be predicted as spurious because of the frequency of degraded homologs found in the DNA sequence databases. Our initial experiments suggest that less than 1% of the proteins in the UniProtKB sequence database are likely to be spurious and that Spurio is able to identify over 60 times more spurious proteins than the AntiFam resource. The Spurio software and source code is available under an MIT license at the following URL: https://bitbucket.org/bateman-group/spurio.
Genomic view of bipolar disorder revealed by whole genome sequencing in a genetic isolate.
Directory of Open Access Journals (Sweden)
Benjamin Georgi
2014-03-01
Full Text Available Bipolar disorder is a common, heritable mental illness characterized by recurrent episodes of mania and depression. Despite considerable effort to elucidate the genetic underpinnings of bipolar disorder, causative genetic risk factors remain elusive. We conducted a comprehensive genomic analysis of bipolar disorder in a large Old Order Amish pedigree. Microsatellite genotypes and high-density SNP-array genotypes of 388 family members were combined with whole genome sequence data for 50 of these subjects, comprising 18 parent-child trios. This study design permitted evaluation of candidate variants within the context of haplotype structure by resolving the phase in sequenced parent-child trios and by imputation of variants into multiple unsequenced siblings. Non-parametric and parametric linkage analysis of the entire pedigree as well as on smaller clusters of families identified several nominally significant linkage peaks, each of which included dozens of predicted deleterious variants. Close inspection of exonic and regulatory variants in genes under the linkage peaks using family-based association tests revealed additional credible candidate genes for functional studies and further replication in population-based cohorts. However, despite the in-depth genomic characterization of this unique, large and multigenerational pedigree from a genetic isolate, there was no convergence of evidence implicating a particular set of risk loci or common pathways. The striking haplotype and locus heterogeneity we observed has profound implications for the design of studies of bipolar and other related disorders.
Genomic View of Bipolar Disorder Revealed by Whole Genome Sequencing in a Genetic Isolate
Georgi, Benjamin; Craig, David; Kember, Rachel L.; Liu, Wencheng; Lindquist, Ingrid; Nasser, Sara; Brown, Christopher; Egeland, Janice A.; Paul, Steven M.; Bućan, Maja
2014-01-01
Bipolar disorder is a common, heritable mental illness characterized by recurrent episodes of mania and depression. Despite considerable effort to elucidate the genetic underpinnings of bipolar disorder, causative genetic risk factors remain elusive. We conducted a comprehensive genomic analysis of bipolar disorder in a large Old Order Amish pedigree. Microsatellite genotypes and high-density SNP-array genotypes of 388 family members were combined with whole genome sequence data for 50 of these subjects, comprising 18 parent-child trios. This study design permitted evaluation of candidate variants within the context of haplotype structure by resolving the phase in sequenced parent-child trios and by imputation of variants into multiple unsequenced siblings. Non-parametric and parametric linkage analysis of the entire pedigree as well as on smaller clusters of families identified several nominally significant linkage peaks, each of which included dozens of predicted deleterious variants. Close inspection of exonic and regulatory variants in genes under the linkage peaks using family-based association tests revealed additional credible candidate genes for functional studies and further replication in population-based cohorts. However, despite the in-depth genomic characterization of this unique, large and multigenerational pedigree from a genetic isolate, there was no convergence of evidence implicating a particular set of risk loci or common pathways. The striking haplotype and locus heterogeneity we observed has profound implications for the design of studies of bipolar and other related disorders. PMID:24625924
Human genetics as a tool to identify progranulin regulators.
Nicholson, Alexandra M; Finch, NiCole A; Rademakers, Rosa
2011-11-01
Frontotemporal lobar degeneration (FTLD) is a common neurodegenerative disorder that predominantly affects individuals under the age of 65. It is known that the most common pathological subtype is FTLD with TAR DNA-binding protein 43 inclusions (FTLD-TDP). FTLD has a strong genetic component with about 50% of cases having a positive family history. Mutations identified in the progranulin gene (GRN) have been shown to cause FTLD-TDP as a result of progranulin haploinsufficiency. These findings suggest a progranulin-dependent mechanism in this pathological FTLD subtype. Thus, identifying regulators of progranulin levels is essential for new therapies and treatments for FTLD and related disorders. In this review, we discuss the role of genetic studies in identifying progranulin regulators, beginning with the discovery of pathogenic GRN mutations and additional GRN risk variants. We also cover more recent genetic advances, including the detection of variants in the transmembrane protein 106 B gene that increase FTLD-TDP risk presumably by modulating progranulin levels and the identification of a potential progranulin receptor, sortilin. This review highlights the importance of genetic studies in the context of FTLD and further emphasizes the need for future genetic and cell biology research to continue the effort in finding a cure for progranulin-related diseases.
Adam, Shelin; Friedman, Jan M
2017-12-01
Genome-wide (exome or whole genome) sequencing with appropriate genetic counseling should be considered for any patient with a suspected Mendelian disease that has not been identified by conventional testing. Clinical genome-wide sequencing provides a powerful and effective means of identifying specific genetic causes of serious disease and improving clinical care. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Niko eBeerenwinkel
2012-09-01
Full Text Available Many viruses, including the clinically relevant RNA viruses HIV and HCV, exist in large populations and display high genetic heterogeneity within and between infected hosts. Assessing intra-patient viral genetic diversity is essential for understanding the evolutionary dynamics of viruses, for designing effective vaccines, and for the success of antiviral therapy. Next-generation sequencing technologies allow the rapid and cost-effective acquisition of thousands to millions of short DNA sequences from a single sample. However, this approach entails several challenges in experimental design and computational data analysis. Here, we review the entire process of inferring viral diversity from sample collection to computing measures of genetic diversity. We discuss sample preparation, including reverse transcription and amplification, and the effect of experimental conditions on diversity estimates due to in vitro base substitutions, insertions, deletions, and recombination. The use of different next-generation sequencing platforms and their sequencing error profiles are compared in the context of various applications of diversity estimation, ranging from the detection of single nucleotide variants to the reconstruction of whole-genome haplotypes. We describe the statistical and computational challenges arising from these technical artifacts, and we review existing approaches, including available software, for their solution. Finally, we discuss open problems, and highlight successful biomedical applications and potential future clinical use of next-generation sequencing to estimate viral diversity.
Zhang, Tianxiao; Hou, Liping; Chen, David T; McMahon, Francis J; Wang, Jen-Chyong; Rice, John P
2018-03-01
Bipolar disorder is a mental illness with lifetime prevalence of about 1%. Previous genetic studies have identified multiple chromosomal linkage regions and candidate genes that might be associated with bipolar disorder. The present study aimed to identify potential susceptibility variants for bipolar disorder using 6 related case samples from a four-generation family. A combination of exome sequencing and linkage analysis was performed to identify potential susceptibility variants for bipolar disorder. Our study identified a list of five potential candidate genes for bipolar disorder. Among these five genes, GRID1(Glutamate Receptor Delta-1 Subunit), which was previously reported to be associated with several psychiatric disorders and brain related traits, is particularly interesting. Variants with functional significance in this gene were identified from two cousins in our bipolar disorder pedigree. Our findings suggest a potential role for these genes and the related rare variants in the onset and development of bipolar disorder in this one family. Additional research is needed to replicate these findings and evaluate their patho-biological significance. Copyright © 2017 Elsevier B.V. All rights reserved.
Yu, Long-Xi; Liu, Xinchun; Boge, William; Liu, Xiang-Ping
2016-01-01
Salinity is one of major abiotic stresses limiting alfalfa (Medicago sativa L.) production in the arid and semi-arid regions in US and other counties. In this study, we used a diverse panel of alfalfa accessions previously described by Zhang et al. (2015) to identify molecular markers associated with salt tolerance during germination using genome-wide association study (GWAS) and genotyping-by-sequencing (GBS). Phenotyping was done by germinating alfalfa seeds under different levels of salt stress. Phenotypic data of adjusted germination rates and SNP markers generated by GBS were used for marker-trait association. Thirty six markers were significantly associated with salt tolerance in at least one level of salt treatments. Alignment of sequence tags to the Medicago truncatula genome revealed genetic locations of the markers on all chromosomes except chromosome 3. Most significant markers were found on chromosomes 1, 2, and 4. BLAST search using the flanking sequences of significant markers identified 14 putative candidate genes linked to 23 significant markers. Most of them were repeatedly identified in two or three salt treatments. Several loci identified in the present study had similar genetic locations to the reported QTL associated with salt tolerance in M. truncatula. A locus identified on chromosome 6 by this study overlapped with that by drought in our previous study. To our knowledge, this is the first report on mapping loci associated with salt tolerance during germination in autotetraploid alfalfa. Further investigation on these loci and their linked genes would provide insight into understanding molecular mechanisms by which salt and drought stresses affect alfalfa growth. Functional markers closely linked to the resistance loci would be useful for MAS to improve alfalfa cultivars with enhanced resistance to drought and salt stresses. PMID:27446182
Sequence analysis of the its-2 region: a tool to identify strains of Scenedesmus (Chlorophyceae)
Van Hannen, E.J.; Lürling, M.; Van Donk, E.
2000-01-01
The genetic distances between several strains of Senedesmus obliquus (Turp,) Kutz,, S, acutus Hortobagyi, and S, naegelii Chod. calculated from ITS-2 sequences were found to be smaller than the genetic distances within other strains of Scenedesmus-that is, in S, acuminatus (Lagerh,) Chod, and S,
DEFF Research Database (Denmark)
Mourier, Tobias; Mollerup, Sarah; Vinner, Lasse
2015-01-01
From Illumina sequencing of DNA from brain and liver tissue from the lion, Panthera leo, and tumor samples from the pike-perch, Sander lucioperca, we obtained two assembled sequence contigs with similarity to known retroviruses. Phylogenetic analyses suggest that the pike-perch retrovirus belongs...... to the epsilonretroviruses, and the lion retrovirus to the gammaretroviruses. To determine if these novel retroviral sequences originate from an endogenous retrovirus or from a recently integrated exogenous retrovirus, we assessed the genetic diversity of the parental sequences from which the short Illumina reads...
Holst-Jensen, Arne; Spilsberg, Bjørn; Arulandhu, Alfred J; Kok, Esther; Shi, Jianxin; Zel, Jana
2016-07-01
The emergence of high-throughput, massive or next-generation sequencing technologies has created a completely new foundation for molecular analyses. Various selective enrichment processes are commonly applied to facilitate detection of predefined (known) targets. Such approaches, however, inevitably introduce a bias and are prone to miss unknown targets. Here we review the application of high-throughput sequencing technologies and the preparation of fit-for-purpose whole genome shotgun sequencing libraries for the detection and characterization of genetically modified and derived products. The potential impact of these new sequencing technologies for the characterization, breeding selection, risk assessment, and traceability of genetically modified organisms and genetically modified products is yet to be fully acknowledged. The published literature is reviewed, and the prospects for future developments and use of the new sequencing technologies for these purposes are discussed.
Directory of Open Access Journals (Sweden)
Yu-Nong Gong
Full Text Available Forty-two cytopathic effect (CPE-positive isolates were collected from 2008 to 2012. All isolates could not be identified for known viral pathogens by routine diagnostic assays. They were pooled into 8 groups of 5-6 isolates to reduce the sequencing cost. Next-generation sequencing (NGS was conducted for each group of mixed samples, and the proposed data analysis pipeline was used to identify viral pathogens in these mixed samples. Polymerase chain reaction (PCR or enzyme-linked immunosorbent assay (ELISA was individually conducted for each of these 42 isolates depending on the predicted viral types in each group. Two isolates remained unknown after these tests. Moreover, iteration mapping was implemented for each of these 2 isolates, and predicted human parechovirus (HPeV in both. In summary, our NGS pipeline detected the following viruses among the 42 isolates: 29 human rhinoviruses (HRVs, 10 HPeVs, 1 human adenovirus (HAdV, 1 echovirus and 1 rotavirus. We then focused on the 10 identified Taiwanese HPeVs because of their reported clinical significance over HRVs. Their genomes were assembled and their genetic diversity was explored. One novel 6-bp deletion was found in one HPeV-1 virus. In terms of nucleotide heterogeneity, 64 genetic variants were detected from these HPeVs using the mapped NGS reads. Most importantly, a recombination event was found between our HPeV-3 and a known HPeV-4 strain in the database. Similar event was detected in the other HPeV-3 strains in the same clade of the phylogenetic tree. These findings demonstrated that the proposed NGS data analysis pipeline identified unknown viruses from the mixed clinical samples, revealed their genetic identity and variants, and characterized their genetic features in terms of viral evolution.
Directory of Open Access Journals (Sweden)
Wang Nian
2012-08-01
Full Text Available Abstract Background Genetic mapping and QTL detection are powerful methodologies in plant improvement and breeding. Construction of a high-density and high-quality genetic map would be of great benefit in the production of superior grapes to meet human demand. High throughput and low cost of the recently developed next generation sequencing (NGS technology have resulted in its wide application in genome research. Sequencing restriction-site associated DNA (RAD might be an efficient strategy to simplify genotyping. Combining NGS with RAD has proven to be powerful for single nucleotide polymorphism (SNP marker development. Results An F1 population of 100 individual plants was developed. In-silico digestion-site prediction was used to select an appropriate restriction enzyme for construction of a RAD sequencing library. Next generation RAD sequencing was applied to genotype the F1 population and its parents. Applying a cluster strategy for SNP modulation, a total of 1,814 high-quality SNP markers were developed: 1,121 of these were mapped to the female genetic map, 759 to the male map, and 1,646 to the integrated map. A comparison of the genetic maps to the published Vitis vinifera genome revealed both conservation and variations. Conclusions The applicability of next generation RAD sequencing for genotyping a grape F1 population was demonstrated, leading to the successful development of a genetic map with high density and quality using our designed SNP markers. Detailed analysis revealed that this newly developed genetic map can be used for a variety of genome investigations, such as QTL detection, sequence assembly and genome comparison.
Next Generation Sequencing Methods for Diagnosis of Epilepsy Syndromes
Directory of Open Access Journals (Sweden)
Paul Dunn
2018-02-01
Full Text Available Epilepsy is a neurological disorder characterized by an increased predisposition for seizures. Although this definition suggests that it is a single disorder, epilepsy encompasses a group of disorders with diverse aetiologies and outcomes. A genetic basis for epilepsy syndromes has been postulated for several decades, with several mutations in specific genes identified that have increased our understanding of the genetic influence on epilepsies. With 70-80% of epilepsy cases identified to have a genetic cause, there are now hundreds of genes identified to be associated with epilepsy syndromes which can be analyzed using next generation sequencing (NGS techniques such as targeted gene panels, whole exome sequencing (WES and whole genome sequencing (WGS. For effective use of these methodologies, diagnostic laboratories and clinicians require information on the relevant workflows including analysis and sequencing depth to understand the specific clinical application and diagnostic capabilities of these gene sequencing techniques. As epilepsy is a complex disorder, the differences associated with each technique influence the ability to form a diagnosis along with an accurate detection of the genetic etiology of the disorder. In addition, for diagnostic testing, an important parameter is the cost-effectiveness and the specific diagnostic outcome of each technique. Here, we review these commonly used NGS techniques to determine their suitability for application to epilepsy genetic diagnostic testing.
Directory of Open Access Journals (Sweden)
Nuno D Pires
2016-01-01
Full Text Available Embryonic development requires a correct balancing of maternal and paternal genetic information. This balance is mediated by genomic imprinting, an epigenetic mechanism that leads to parent-of-origin-dependent gene expression. The parental conflict (or kinship theory proposes that imprinting can evolve due to a conflict between maternal and paternal alleles over resource allocation during seed development. One assumption of this theory is that paternal alleles can regulate seed growth; however, paternal effects on seed size are often very low or non-existent. We demonstrate that there is a pool of cryptic genetic variation in the paternal control of Arabidopsis thaliana seed development. Such cryptic variation can be exposed in seeds that maternally inherit a medea mutation, suggesting that MEA acts as a maternal buffer of paternal effects. Genetic mapping using recombinant inbred lines, and a novel method for the mapping of parent-of-origin effects using whole-genome sequencing of segregant bulks, indicate that there are at least six loci with small, paternal effects on seed development. Together, our analyses reveal the existence of a pool of hidden genetic variation on the paternal control of seed development that is likely shaped by parental conflict.
Willems, Sander; Fraiture, Marie-Alice; Deforce, Dieter; De Keersmaecker, Sigrid C J; De Loose, Marc; Ruttink, Tom; Herman, Philippe; Van Nieuwerburgh, Filip; Roosens, Nancy
2016-02-01
Because the number and diversity of genetically modified (GM) crops has significantly increased, their analysis based on real-time PCR (qPCR) methods is becoming increasingly complex and laborious. While several pioneers already investigated Next Generation Sequencing (NGS) as an alternative to qPCR, its practical use has not been assessed for routine analysis. In this study a statistical framework was developed to predict the number of NGS reads needed to detect transgene sequences, to prove their integration into the host genome and to identify the specific transgene event in a sample with known composition. This framework was validated by applying it to experimental data from food matrices composed of pure GM rice, processed GM rice (noodles) or a 10% GM/non-GM rice mixture, revealing some influential factors. Finally, feasibility of NGS for routine analysis of GM crops was investigated by applying the framework to samples commonly encountered in routine analysis of GM crops. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
Peixoto-Junior, R F; Creste, S; Landell, M G A; Nunes, D S; Sanguino, A; Campos, M F; Vencovsky, R; Tambarussi, E V; Figueira, A
2014-09-26
Brown rust (causal agent Puccinia melanocephala) is an important sugarcane disease that is responsible for large losses in yield worldwide. Despite its importance, little is known regarding the genetic diversity of this pathogen in the main Brazilian sugarcane cultivation areas. In this study, we characterized the genetic diversity of 34 P. melanocephala isolates from 4 Brazilian states using loci identified from an enriched simple sequence repeat (SSR) library. The aggressiveness of 3 isolates from major sugarcane cultivation areas was evaluated by inoculating an intermediately resistant and a susceptible cultivar. From the enriched library, 16 SSR-specific primers were developed, which produced scorable alleles. Of these, 4 loci were polymorphic and 12 were monomorphic for all isolates evaluated. The molecular characterization of the 34 isolates of P. melanocephala conducted using 16 SSR loci revealed the existence of low genetic variability among the isolates. The average estimated genetic distance was 0.12. Phenetic analysis based on Nei's genetic distance clustered the isolates into 2 major groups. Groups I and II included 18 and 14 isolates, respectively, and both groups contained isolates from all 4 geographic regions studied. Two isolates did not cluster with these groups. It was not possible to obtain clusters according to location or state of origin. Analysis of disease severity data revealed that the isolates did not show significant differences in aggressiveness between regions.
Bergner, Amanda L; Bollinger, Juli; Raraigh, Karen S; Tichnell, Crystal; Murray, Brittney; Blout, Carrie Lynn; Telegrafi, Aida Bytyci; James, Cynthia A
2014-11-01
Genomic sequencing technology is increasingly used in genetic research. Studies of informed consent for exome and genome sequencing (ES/GS) research have largely involved hypothetical scenarios or healthy individuals enrolling in population-based studies. Studies have yet to explore the consent experiences of adults with inherited disease. We conducted a qualitative interview study of 15 adults recently enrolled in a large-scale ES/GS study (11 affected adults, four parents of affected children). Our study had two goals: (1) to explore three theoretical barriers to consent for ES/GS research (interpretive/technical complexity, possibility of incidental findings, and risks of loss of privacy); and (2) to explore how interviewees experienced the consent process. Interviewees could articulate study goals and processes, describe incidental findings, discuss risks of privacy loss, and reflect on their consent experience. Few expected the study would identify the genetic cause of their condition. All elected to receive incidental findings. Interviewees acknowledged paying little attention to potential implications of incidental findings in light of more pressing goals of supporting research regarding their own medical conditions. Interviewees suggested that experience living with a genetic condition prepared them to adjust to incidental findings. Interviewees also expressed little concern about loss of confidentiality of study data. Some experienced the consent process as very long. None desired reconsent prior to return of study results. Families with inherited disease likely would benefit from a consent process in which study risks and benefits were discussed in the context of prior experiences with genetic research and genetic disease. © 2014 Wiley Periodicals, Inc.
Next-generation sequencing identifies transportin 3 as the causative gene for LGMD1F.
Directory of Open Access Journals (Sweden)
Annalaura Torella
Full Text Available Limb-girdle muscular dystrophies (LGMD are genetically and clinically heterogeneous conditions. We investigated a large family with autosomal dominant transmission pattern, previously classified as LGMD1F and mapped to chromosome 7q32. Affected members are characterized by muscle weakness affecting earlier the pelvic girdle and the ileopsoas muscles. We sequenced the whole exome of four family members and identified a shared heterozygous frame-shift variant in the Transportin 3 (TNPO3 gene, encoding a member of the importin-β super-family. The TNPO3 gene is mapped within the LGMD1F critical interval and its 923-amino acid human gene product is also expressed in skeletal muscle. In addition, we identified an isolated case of LGMD with a new missense mutation in the same gene. We localized the mutant TNPO3 around the nucleus, but not inside. The involvement of gene related to the nuclear transport suggests a novel disease mechanism leading to muscular dystrophy.
The Matrix Method of Representation, Analysis and Classification of Long Genetic Sequences
Directory of Open Access Journals (Sweden)
Ivan V. Stepanyan
2017-01-01
Full Text Available The article is devoted to a matrix method of comparative analysis of long nucleotide sequences by means of presenting each sequence in the form of three digital binary sequences. This method uses a set of symmetries of biochemical attributes of nucleotides. It also uses the possibility of presentation of every whole set of N-mers as one of the members of a Kronecker family of genetic matrices. With this method, a long nucleotide sequence can be visually represented as an individual fractal-like mosaic or another regular mosaic of binary type. In contrast to natural nucleotide sequences, artificial random sequences give non-regular patterns. Examples of binary mosaics of long nucleotide sequences are shown, including cases of human chromosomes and penicillins. The obtained results are then discussed.
Kiel, Mark J; Velusamy, Thirunavukkarasu; Betz, Bryan L; Zhao, Lili; Weigelin, Helmut G; Chiang, Mark Y; Huebner-Chan, David R; Bailey, Nathanael G; Yang, David T; Bhagat, Govind; Miranda, Roberto N; Bahler, David W; Medeiros, L Jeffrey; Lim, Megan S; Elenitoba-Johnson, Kojo S J
2012-08-27
Splenic marginal zone lymphoma (SMZL), the most common primary lymphoma of spleen, is poorly understood at the genetic level. In this study, using whole-genome DNA sequencing (WGS) and confirmation by Sanger sequencing, we observed mutations identified in several genes not previously known to be recurrently altered in SMZL. In particular, we identified recurrent somatic gain-of-function mutations in NOTCH2, a gene encoding a protein required for marginal zone B cell development, in 25 of 99 (∼25%) cases of SMZL and in 1 of 19 (∼5%) cases of nonsplenic MZLs. These mutations clustered near the C-terminal proline/glutamate/serine/threonine (PEST)-rich domain, resulting in protein truncation or, rarely, were nonsynonymous substitutions affecting the extracellular heterodimerization domain (HD). NOTCH2 mutations were not present in other B cell lymphomas and leukemias, such as chronic lymphocytic leukemia/small lymphocytic lymphoma (CLL/SLL; n = 15), mantle cell lymphoma (MCL; n = 15), low-grade follicular lymphoma (FL; n = 44), hairy cell leukemia (HCL; n = 15), and reactive lymphoid hyperplasia (n = 14). NOTCH2 mutations were associated with adverse clinical outcomes (relapse, histological transformation, and/or death) among SMZL patients (P = 0.002). These results suggest that NOTCH2 mutations play a role in the pathogenesis and progression of SMZL and are associated with a poor prognosis.
Vissers, Lisenka E L M; van Nimwegen, Kirsten J M; Schieving, Jolanda H; Kamsteeg, Erik-Jan; Kleefstra, Tjitske; Yntema, Helger G; Pfundt, Rolph; van der Wilt, Gert Jan; Krabbenborg, Lotte; Brunner, Han G; van der Burg, Simone; Grutters, Janneke; Veltman, Joris A; Willemsen, Michèl A A P
2017-09-01
Implementation of novel genetic diagnostic tests is generally driven by technological advances because they promise shorter turnaround times and/or higher diagnostic yields. Other aspects, including impact on clinical management or cost-effectiveness, are often not assessed in detail prior to implementation. We studied the clinical utility of whole-exome sequencing (WES) in complex pediatric neurology in terms of diagnostic yield and costs. We analyzed 150 patients (and their parents) presenting with complex neurological disorders of suspected genetic origin. In a parallel study, all patients received both the standard diagnostic workup (e.g., cerebral imaging, muscle biopsies or lumbar punctures, and sequential gene-by-gene-based testing) and WES simultaneously. Our unique study design allowed direct comparison of diagnostic yield of both trajectories and provided insight into the economic implications of implementing WES in this diagnostic trajectory. We showed that WES identified significantly more conclusive diagnoses (29.3%) than the standard care pathway (7.3%) without incurring higher costs. Exploratory analysis of WES as a first-tier diagnostic test indicates that WES may even be cost-saving, depending on the extent of other tests being omitted. Our data support such a use of WES in pediatric neurology for disorders of presumed genetic origin.Genet Med advance online publication 23 March 2017.
Human genetics and genomics a decade after the release of the draft sequence of the human genome
2011-01-01
Substantial progress has been made in human genetics and genomics research over the past ten years since the publication of the draft sequence of the human genome in 2001. Findings emanating directly from the Human Genome Project, together with those from follow-on studies, have had an enormous impact on our understanding of the architecture and function of the human genome. Major developments have been made in cataloguing genetic variation, the International HapMap Project, and with respect to advances in genotyping technologies. These developments are vital for the emergence of genome-wide association studies in the investigation of complex diseases and traits. In parallel, the advent of high-throughput sequencing technologies has ushered in the 'personal genome sequencing' era for both normal and cancer genomes, and made possible large-scale genome sequencing studies such as the 1000 Genomes Project and the International Cancer Genome Consortium. The high-throughput sequencing and sequence-capture technologies are also providing new opportunities to study Mendelian disorders through exome sequencing and whole-genome sequencing. This paper reviews these major developments in human genetics and genomics over the past decade. PMID:22155605
Spotin, Adel; Mahami-Oskouei, Mahmoud; Harandi, Majid Fasihi; Baratchian, Mehdi; Bordbar, Ali; Ahmadpour, Ehsan; Ebrahimi, Sahar
2017-01-01
To investigate the genetic variability and population structure of Echinococcus granulosus complex, 79 isolates were sequenced from different host species covering human, dog, camel, goat, sheep and cattle as of various geographical sub-populations of Iran (Northwestern, Northern, and Southeastern). In addition, 36 sequences of other geographical populations (Western, Southeastern and Central Iran), were directly retrieved from GenBank database for the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene. The confirmed isolates were grouped as G1 genotype (n=92), G6 genotype (n=14), G3 genotype (n=8) and G2 genotype (n=1). 50 unique haplotypes were identified based on the analyzed sequences of cox1. A parsimonious network of the sequence haplotypes displayed star-like features in the overall population containing IR23 (22: 19.1%) as the most common haplotype. According to the analysis of molecular variance (AMOVA) test, the high value of haplotype diversity of E. granulosus complex was shown the total genetic variability within populations while nucleotide diversity was low in all populations. Neutrality indices of the cox1 (Tajima's D and Fu's Fs tests) were shown negative values in Western-Northwestern, Northern and Southeastern populations which indicating significant divergence from neutrality and positive but not significant in Central isolates. A pairwise fixation index (Fst) as a degree of gene flow was generally low value for all populations (0.00647-0.15198). The statistically Fst values indicate that Echinococcus sensu stricto (genotype G1-G3) populations are not genetically well differentiated in various geographical regions of Iran. To appraise the hypothetical evolutionary scenario, further study is needed to analyze concatenated mitogenomes and as well a panel of single locus nuclear markers should be considered in wider areas of Iran and neighboring countries. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Bernd Timmermann
Full Text Available BACKGROUND: Colorectal cancer (CRC is with approximately 1 million cases the third most common cancer worldwide. Extensive research is ongoing to decipher the underlying genetic patterns with the hope to improve early cancer diagnosis and treatment. In this direction, the recent progress in next generation sequencing technologies has revolutionized the field of cancer genomics. However, one caveat of these studies remains the large amount of genetic variations identified and their interpretation. METHODOLOGY/PRINCIPAL FINDINGS: Here we present the first work on whole exome NGS of primary colon cancers. We performed 454 whole exome pyrosequencing of tumor as well as adjacent not affected normal colonic tissue from microsatellite stable (MSS and microsatellite instable (MSI colon cancer patients and identified more than 50,000 small nucleotide variations for each tissue. According to predictions based on MSS and MSI pathomechanisms we identified eight times more somatic non-synonymous variations in MSI cancers than in MSS and we were able to reproduce the result in four additional CRCs. Our bioinformatics filtering approach narrowed down the rate of most significant mutations to 359 for MSI and 45 for MSS CRCs with predicted altered protein functions. In both CRCs, MSI and MSS, we found somatic mutations in the intracellular kinase domain of bone morphogenetic protein receptor 1A, BMPR1A, a gene where so far germline mutations are associated with juvenile polyposis syndrome, and show that the mutations functionally impair the protein function. CONCLUSIONS/SIGNIFICANCE: We conclude that with deep sequencing of tumor exomes one may be able to predict the microsatellite status of CRC and in addition identify potentially clinically relevant mutations.
Identifying future research needs in landscape genetics: Where to from here?
Niko Balkenhol; Felix Gugerli; Sam A. Cushman; Lisette P. Waits; Aurelie Coulon; J. W. Arntzen; Rolf Holderegger; Helene H. Wagner
2009-01-01
Landscape genetics is an emerging interdisciplinary field that combines methods and concepts from population genetics, landscape ecology, and spatial statistics. The interest in landscape genetics is steadily increasing, and the field is evolving rapidly. We here outline four major challenges for future landscape genetic research that were identified during an...
Directory of Open Access Journals (Sweden)
Binhua Liang
Full Text Available BACKGROUND: Pyrosequencing technology has the potential to rapidly sequence HIV-1 viral quasispecies without requiring the traditional approach of cloning. In this study, we investigated the utility of ultra-deep pyrosequencing to characterize genetic diversity of the HIV-1 gag quasispecies and assessed the possible contribution of pyrosequencing technology in studying HIV-1 biology and evolution. METHODOLOGY/PRINCIPAL FINDINGS: HIV-1 gag gene was amplified from 96 patients using nested PCR. The PCR products were cloned and sequenced using capillary based Sanger fluorescent dideoxy termination sequencing. The same PCR products were also directly sequenced using the 454 pyrosequencing technology. The two sequencing methods were evaluated for their ability to characterize quasispecies variation, and to reveal sites under host immune pressure for their putative functional significance. A total of 14,034 variations were identified by 454 pyrosequencing versus 3,632 variations by Sanger clone-based (SCB sequencing. 11,050 of these variations were detected only by pyrosequencing. These undetected variations were located in the HIV-1 Gag region which is known to contain putative cytotoxic T lymphocyte (CTL and neutralizing antibody epitopes, and sites related to virus assembly and packaging. Analysis of the positively selected sites derived by the two sequencing methods identified several differences. All of them were located within the CTL epitope regions. CONCLUSIONS/SIGNIFICANCE: Ultra-deep pyrosequencing has proven to be a powerful tool for characterization of HIV-1 genetic diversity with enhanced sensitivity, efficiency, and accuracy. It also improved reliability of downstream evolutionary and functional analysis of HIV-1 quasispecies.
Choe, Se-Eun; Nguyen, Thuy Thi-Dieu; Kang, Tae-Gyu; Kweon, Chang-Hee; Kang, Seung-Won
2011-09-01
Nuclear ribosomal DNA sequence of the second internal transcribed spacer (ITS-2) has been used efficiently to identify the liver fluke species collected from different hosts and various geographic regions. ITS-2 sequences of 19 Fasciola samples collected from Korean native cattle were determined and compared. Sequence comparison including ITS-2 sequences of isolates from this study and reference sequences from Fasciola hepatica and Fasciola gigantica and intermediate Fasciola in Genbank revealed seven identical variable sites of investigated isolates. Among 19 samples, 12 individuals had ITS-2 sequences completely identical to that of pure F. hepatica, five possessed the sequences identical to F. gigantica type, whereas two shared the sequence of both F. hepatica and F. gigantica. No variations in length and nucleotide composition of ITS-2 sequence were observed within isolates that belonged to F. hepatica or F. gigantica. At the position of 218, five Fasciola containing a single-base substitution (C>T) formed a distinct branch inside the F. gigantica-type group which was similar to those of Asian-origin isolates. The phylogenetic tree of the Fasciola spp. based on complete ITS-2 sequences from this study and other representative isolates in different locations clearly showed that pure F. hepatica, F. gigantica type and intermediate Fasciola were observed. The result also provided additional genetic evidence for the existence of three forms of Fasciola isolated from native cattle in Korea by genetic approach using ITS-2 sequence.
Directory of Open Access Journals (Sweden)
Romain Basmaci
Full Text Available BACKGROUND: Kingella kingae, a normal component of the upper respiratory flora, is being increasingly recognized as an important invasive pathogen in young children. Genetic diversity of this species has not been studied. METHODS: We analyzed 103 strains from different countries and clinical origins by a new multilocus sequence-typing (MLST schema. Putative virulence gene rtxA, encoding an RTX toxin, was also sequenced, and experimental virulence of representative strains was assessed in a juvenile-rat model. RESULTS: Thirty-six sequence-types (ST and nine ST-complexes (STc were detected. The main STc 6, 14 and 23 comprised 23, 17 and 20 strains respectively, and were internationally distributed. rtxA sequencing results were mostly congruent with MLST, and showed horizontal transfer events. Of interest, all members of the distantly related ST-6 (n = 22 and ST-5 (n = 4 harboured a 33 bp duplication or triplication in their rtxA sequence, suggesting that this genetic trait arose through selective advantage. The animal model revealed significant differences in virulence among strains of the species. CONCLUSION: MLST analysis reveals international spread of ST-complexes and will help to decipher acquisition and evolution of virulence traits and diversity of pathogenicity among K. kingae strains, for which an experimental animal model is now available.
Ou, Hong-Yu; Kuang, Shan N.; He, Xinyi; Molgora, Brenda M.; Ewing, Peter J.; Deng, Zixin; Osby, Melanie; Chen, Wangxue; Xu, H. Howard
2015-01-01
Acinetobacter baumannii is an important human pathogen due to its multi-drug resistance. In this study, the genome of an ST10 outbreak A. baumannii isolate LAC-4 was completely sequenced to better understand its epidemiology, antibiotic resistance genetic determinants and potential virulence factors. Compared with 20 other complete genomes of A. baumannii, LAC-4 genome harbors at least 12 copies of five distinct insertion sequences. It contains 12 and 14 copies of two novel IS elements, ISAba25 and ISAba26, respectively. Additionally, three novel composite transposons were identified: Tn6250, Tn6251 and Tn6252, two of which contain resistance genes. The antibiotic resistance genetic determinants on the LAC-4 genome correlate well with observed antimicrobial susceptibility patterns. Moreover, twelve genomic islands (GI) were identified in LAC-4 genome. Among them, the 33.4-kb GI12 contains a large number of genes which constitute the K (capsule) locus. LAC-4 harbors several unique putative virulence factor loci. Furthermore, LAC-4 and all 19 other outbreak isolates were found to harbor a heme oxygenase gene (hemO)-containing gene cluster. The sequencing of the first complete genome of an ST10 A. baumannii clinical strain should accelerate our understanding of the epidemiology, mechanisms of resistance and virulence of A. baumannii. PMID:25728466
Aflitos, S.A.; Schijlen, E.G.W.M.; Jong, de J.H.S.G.M.; Ridder, de D.; Smit, S.; Finkers, H.J.; Bakker, F.T.; Geest, van de H.C.; Lintel Hekkert, te B.; Haarst, van J.C.; Smits, L.W.M.; Koops, A.J.; Sanchez-Perez, M.J.; Heusden, van A.W.; Visser, R.G.F.; Schranz, M.E.; Peters, S.A.
2014-01-01
We explored genetic variation by sequencing a selection of 84 tomato accessions and related wild species representative for the Lycopersicon, Arcanum, Eriopersicon, and Neolycopersicon groups which has yielded a huge amount of precious data on sequence diversity in the tomato clade. Three new
Aflitos, S.; Schijlen, E.; de Jong, H.; de Ridder, D.; Smit, S.; Finkers, R.; Wang, J.; Zhang, G.; Li, N.; Mao, L.; Bakker, F.; Dirks, R.; Breit, T.; Gravendeel, B.; Huits, H.; Struss, D.; Swanson-Wagner, R.; van Leeuwen, H.; van Ham, R.C.H.J.; Fito, L.; Guignier, L.; Sevilla, M.; Ellul, P.; Ganko, E.; Kapur, A.; Reclus, E.; de Geus, B.; van de Geest, H.; te Lintel Hekkert, B.; van Haarst, J.; Smits, L.; Koops, A.; Sanchez-Perez, G.; van Heusden, A.W.; Visser, R.; Quan, Z.; Min, J.; Liao, L.; Wang, X.; Wang, G.; Yue, Z.; Yang, X.; Xu, N.; Schranz, E.; Smets, E.; Vos, R.; Rauwerda, J.; Ursem, R.; Schuit, C.; Kerns, M.; van den Berg, J.; Vriezen, W.; Janssen, A.; Datema, E.; Jahrman, T.; Moquet, F.; Bonnet, J.; Peters, S.
2014-01-01
We explored genetic variation by sequencing a selection of 84 tomato accessions and related wild species representative of the Lycopersicon, Arcanum, Eriopersicon and Neolycopersicon groups, which has yielded a huge amount of precious data on sequence diversity in the tomato clade. Three new
2013-01-01
Inherited retinal degenerative diseases (RDDs) display wide variation in their mode of inheritance, underlying genetic defects, age of onset, and phenotypic severity. Molecular mechanisms have not been delineated for many retinal diseases, and treatment options are limited. In most instances, genotype-phenotype correlations have not been elucidated because of extensive clinical and genetic heterogeneity. Next-generation sequencing (NGS) methods, including exome, genome, transcriptome and epigenome sequencing, provide novel avenues towards achieving comprehensive understanding of the genetic architecture of RDDs. Whole-exome sequencing (WES) has already revealed several new RDD genes, whereas RNA-Seq and ChIP-Seq analyses are expected to uncover novel aspects of gene regulation and biological networks that are involved in retinal development, aging and disease. In this review, we focus on the genetic characterization of retinal and macular degeneration using NGS technology and discuss the basic framework for further investigations. We also examine the challenges of NGS application in clinical diagnosis and management. PMID:24112618
Next-generation sequencing in schizophrenia and other neuropsychiatric disorders.
Schreiber, Matthew; Dorschner, Michael; Tsuang, Debby
2013-10-01
Schizophrenia is a debilitating lifelong illness that lacks a cure and poses a worldwide public health burden. The disease is characterized by a heterogeneous clinical and genetic presentation that complicates research efforts to identify causative genetic variations. This review examines the potential of current findings in schizophrenia and in other related neuropsychiatric disorders for application in next-generation technologies, particularly whole-exome sequencing (WES) and whole-genome sequencing (WGS). These approaches may lead to the discovery of underlying genetic factors for schizophrenia and may thereby identify and target novel therapeutic targets for this devastating disorder. © 2013 Wiley Periodicals, Inc.
Barry, Elizabeth G; Witherspoon, David J; Lampe, David J
2004-02-01
Transposons of the mariner family are widespread in animal genomes and have apparently infected them by horizontal transfer. Most species carry only old defective copies of particular mariner transposons that have diverged greatly from their active horizontally transferred ancestor, while a few contain young, very similar, and active copies. We report here the use of a whole-genome screen in bacteria to isolate somewhat diverged Famar1 copies from the European earwig, Forficula auricularia, that encode functional transposases. Functional and nonfunctional coding sequences of Famar1 and nonfunctional copies of Ammar1 from the European honey bee, Apis mellifera, were sequenced to examine their molecular evolution. No selection for sequence conservation was detected in any clade of a tree derived from these sequences, not even on branches leading to functional copies. This agrees with the current model for mariner transposon evolution that expects neutral evolution within particular hosts, with selection for function occurring only upon horizontal transfer to a new host. Our results further suggest that mariners are not finely tuned genetic entities and that a greater amount of sequence diversification than had previously been appreciated can occur in functional copies in a single host lineage. Finally, this method of isolating active copies can be used to isolate other novel active transposons without resorting to reconstruction of ancestral sequences.
Riera, Marina; Wert, Ana; Nieto, Isabel; Pomares, Esther
2017-11-01
Microphthalmia and anophthalmia (MA) are congenital eye abnormalities that show an extremely high clinical and genetic complexity. In this study, we evaluated the implementation of whole exome sequencing (WES) for the genetic analysis of MA patients. This approach was used to investigate three unrelated families in which previous single-gene analyses failed to identify the molecular cause. A total of 47 genes previously associated with nonsyndromic MA were included in our panel. WES was performed in one affected patient from each family using the AmpliSeq TM Exome technology and the Ion Proton TM platform. A novel heterozygous OTX2 missense mutation was identified in a patient showing bilateral anophthalmia who inherited the variant from a parent who was a carrier, but showed no sign of the condition. We also describe a new PAX6 missense variant in an autosomal-dominant pedigree affected by mild bilateral microphthalmia showing high intrafamiliar variability, with germline mosaicism determined to be the most plausible molecular cause of the disease. Finally, a heterozygous missense mutation in RBP4 was found to be responsible in an isolated case of bilateral complex microphthalmia. This study highlights that panel-based WES is a reliable and effective strategy for the genetic diagnosis of MA. Furthermore, using this technique, the mutational spectrum of these diseases was broadened, with novel variants identified in each of the OTX2, PAX6, and RBP4 genes. Moreover, we report new cases of reduced penetrance, mosaicism, and variable phenotypic expressivity associated with MA, further demonstrating the heterogeneity of such disorders. © 2017 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.
Tang, Jinsong; Fan, Yu; Li, Hong; Xiang, Qun; Zhang, Deng-Feng; Li, Zongchang; He, Ying; Liao, Yanhui; Wang, Ya; He, Fan; Zhang, Fengyu; Shugart, Yin Yao; Liu, Chunyu; Tang, Yanqing; Chan, Raymond C K; Wang, Chuan-Yue; Yao, Yong-Gang; Chen, Xiaogang
2017-06-20
Schizophrenia is a common disorder with a high heritability, but its genetic architecture is still elusive. We implemented whole-genome sequencing (WGS) analysis of 8 families with monozygotic (MZ) twin pairs discordant for schizophrenia to assess potential association of de novo mutations (DNMs) or inherited variants with susceptibility to schizophrenia. Eight non-synonymous DNMs (including one splicing site) were identified and shared by twins, which were either located in previously reported schizophrenia risk genes (p.V24689I mutation in TTN, p.S2506T mutation in GCN1L1, IVS3+1G > T in DOCK1) or had a benign to damaging effect according to in silico prediction analysis. By searching the inherited rare damaging or loss-of-function (LOF) variants and common susceptible alleles from three classes of schizophrenia candidate genes, we were able to distill genetic alterations in several schizophrenia risk genes, including GAD1, PLXNA2, RELN and FEZ1. Four inherited copy number variations (CNVs; including a large deletion at 16p13.11) implicated for schizophrenia were identified in four families, respectively. Most of families carried both missense DNMs and inherited risk variants, which might suggest that DNMs, inherited rare damaging variants and common risk alleles together conferred to schizophrenia susceptibility. Our results support that schizophrenia is caused by a combination of multiple genetic factors, with each DNM/variant showing a relatively small effect size. Copyright © 2017 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. All rights reserved.
Li, Zhongshan; Liu, Zhenwei; Jiang, Yi; Chen, Denghui; Ran, Xia; Sun, Zhong Sheng; Wu, Jinyu
2017-01-01
Exome sequencing has been widely used to identify the genetic variants underlying human genetic disorders for clinical diagnoses, but the identification of pathogenic sequence variants among the huge amounts of benign ones is complicated and challenging. Here, we describe a new Web server named mirVAFC for pathogenic sequence variants prioritizations from clinical exome sequencing (CES) variant data of single individual or family. The mirVAFC is able to comprehensively annotate sequence variants, filter out most irrelevant variants using custom criteria, classify variants into different categories as for estimated pathogenicity, and lastly provide pathogenic variants prioritizations based on classifications and mutation effects. Case studies using different types of datasets for different diseases from publication and our in-house data have revealed that mirVAFC can efficiently identify the right pathogenic candidates as in original work in each case. Overall, the Web server mirVAFC is specifically developed for pathogenic sequence variant identifications from family-based CES variants using classification-based prioritizations. The mirVAFC Web server is freely accessible at https://www.wzgenomics.cn/mirVAFC/. © 2016 WILEY PERIODICALS, INC.
DEFF Research Database (Denmark)
Djémié, Tania; Weckhuysen, Sarah; von Spiczak, Sarah
2016-01-01
BACKGROUND: Sanger sequencing, still the standard technique for genetic testing in most diagnostic laboratories and until recently widely used in research, is gradually being complemented by next-generation sequencing (NGS). No single mutation detection technique is however perfect in identifying...
Huang, Chunqiong; Liu, Guodao; Bai, Changjun; Wang, Wenqiang
2014-10-21
Although Cynodon dactylon (C. dactylon) is widely distributed in China, information on its genetic diversity within the germplasm pool is limited. The objective of this study was to reveal the genetic variation and relationships of 430 C. dactylon accessions collected from 22 Chinese provinces using sequence-related amplified polymorphism (SRAP) markers. Fifteen primer pairs were used to amplify specific C. dactylon genomic sequences. A total of 481 SRAP fragments were generated, with fragment sizes ranging from 260-1800 base pairs (bp). Genetic similarity coefficients (GSC) among the 430 accessions averaged 0.72 and ranged from 0.53-0.96. Cluster analysis conducted by two methods, namely the unweighted pair-group method with arithmetic averages (UPGMA) and principle coordinate analysis (PCoA), separated the accessions into eight distinct groups. Our findings verify that Chinese C. dactylon germplasms have rich genetic diversity, which is an excellent basis for C. dactylon breeding for new cultivars.
Genetic Screens in Yeast to Identify BRCA1 Modifiers
National Research Council Canada - National Science Library
Plon, Sharon E
2004-01-01
.... The yeast RAD9 protein has similar functions and sequence motifs as BRCA1 and we proposed to identify candidate modifier loci by identifying haploinsufficient mutations at a second locus that alters...
Shahin, A.; Smulders, M.J.M.; Tuyl, van J.M.; Arens, P.F.P.; Bakker, F.T.
2014-01-01
Next Generation Sequencing (NGS) may enable estimating relationships among genotypes using allelic variation of multiple nuclear genes simultaneously. We explored the potential and caveats of this strategy in four genetically distant Lilium cultivars to estimate their genetic divergence from
Systems Genetics Analysis to Identify the Genetic Modulation of a Glaucoma-Associated Gene.
Chintalapudi, Sumana R; Jablonski, Monica M
2017-01-01
Loss of retinal ganglion cells (RGCs) is one of the hallmarks of retinal neurodegenerative diseases, glaucoma being one of the most common. Recently, γ-synuclein (SNCG) was shown to be highly expressed in the somas and axons of RGCs. In various mouse models of glaucoma, downregulation of Sncg gene expression correlates with RGC loss. To investigate the regulation of Sncg in RGCs, we used a systems genetics approach to identify a gene that modulates the expression of Sncg, followed by confirmatory studies in both healthy and diseased retinas. We found that chromosome 1 harbors an eQTL that modulates the expression of Sncg in the mouse retina and identified Pfdn2 as the candidate upstream modulator of Sncg expression. Downregulation of Pfdn2 in enriched RGCs causes a concomitant reduction in Sncg. In this chapter, we describe our strategy and methods for identifying and confirming a genetic modulation of a glaucoma-associated gene. A similar method can be applied to other genes expressed in other tissues.
Clinical Whole-Exome Sequencing for the Diagnosis of Mendelian Disorders
Yang, Yaping; Muzny, Donna M.; Reid, Jeffrey G.; Bainbridge, Matthew N.; Willis, Alecia; Ward, Patricia A.; Braxton, Alicia; Beuten, Joke; Xia, Fan; Niu, Zhiyv; Hardison, Matthew; Person, Richard; Bekheirnia, Mir Reza; Leduc, Magalie S.; Kirby, Amelia; Pham, Peter; Scull, Jennifer; Wang, Min; Ding, Yan; Plon, Sharon E.; Lupski, James R.; Beaudet, Arthur L.; Gibbs, Richard A.; Eng, Christine M.
2014-01-01
BACKGROUND Whole-exome sequencing is a diagnostic approach for the identification of molecular defects in patients with suspected genetic disorders. METHODS We developed technical, bioinformatic, interpretive, and validation pipelines for whole-exome sequencing in a certified clinical laboratory to identify sequence variants underlying disease phenotypes in patients. RESULTS We present data on the first 250 probands for whom referring physicians ordered whole-exome sequencing. Patients presented with a range of phenotypes suggesting potential genetic causes. Approximately 80% were children with neurologic pheno-types. Insurance coverage was similar to that for established genetic tests. We identified 86 mutated alleles that were highly likely to be causative in 62 of the 250 patients, achieving a 25% molecular diagnostic rate (95% confidence interval, 20 to 31). Among the 62 patients, 33 had autosomal dominant disease, 16 had auto-somal recessive disease, and 9 had X-linked disease. A total of 4 probands received two nonoverlapping molecular diagnoses, which potentially challenged the clinical diagnosis that had been made on the basis of history and physical examination. A total of 83% of the autosomal dominant mutant alleles and 40% of the X-linked mutant alleles occurred de novo. Recurrent clinical phenotypes occurred in patients with mutations that were highly likely to be causative in the same genes and in different genes responsible for genetically heterogeneous disorders. CONCLUSIONS Whole-exome sequencing identified the underlying genetic defect in 25% of consecutive patients referred for evaluation of a possible genetic condition. (Funded by the National Human Genome Research Institute.) PMID:24088041
Use of Whole Genome Sequencing for Diagnosis and Discovery in the Cancer Genetics Clinic
Directory of Open Access Journals (Sweden)
Samantha B. Foley
2015-01-01
Full Text Available Despite the potential of whole-genome sequencing (WGS to improve patient diagnosis and care, the empirical value of WGS in the cancer genetics clinic is unknown. We performed WGS on members of two cohorts of cancer genetics patients: those with BRCA1/2 mutations (n = 176 and those without (n = 82. Initial analysis of potentially pathogenic variants (PPVs, defined as nonsynonymous variants with allele frequency < 1% in ESP6500 in 163 clinically-relevant genes suggested that WGS will provide useful clinical results. This is despite the fact that a majority of PPVs were novel missense variants likely to be classified as variants of unknown significance (VUS. Furthermore, previously reported pathogenic missense variants did not always associate with their predicted diseases in our patients. This suggests that the clinical use of WGS will require large-scale efforts to consolidate WGS and patient data to improve accuracy of interpretation of rare variants. While loss-of-function (LoF variants represented only a small fraction of PPVs, WGS identified additional cancer risk LoF PPVs in patients with known BRCA1/2 mutations and led to cancer risk diagnoses in 21% of non-BRCA cancer genetics patients after expanding our analysis to 3209 ClinVar genes. These data illustrate how WGS can be used to improve our ability to discover patients' cancer genetic risks.
Directory of Open Access Journals (Sweden)
Roghayeh Najafzadeh
2014-01-01
Full Text Available Iran is one of the chief origins of subgenus Cerasus germplasm. In this study, the genetic variation of new Iranian sour cherries (which had such superior growth characteristics and fruit quality as to be considered for the introduction of new cultivars was investigated and identified using 23 intersimple sequence repeat (ISSR markers. Results indicated a high level of polymorphism of the genotypes based on these markers. According to these results, primers tested in this study specially ISSR-4, ISSR-6, ISSR-13, ISSR-14, ISSR-16, and ISSR-19 produced good and various levels of amplifications which can be effectively used in genetic studies of the sour cherry. The genetic similarity among genotypes showed a high diversity among the genotypes. Cluster analysis separated improved cultivars from promising Iranian genotypes, and the PCoA supported the cluster analysis results. Since the Iranian genotypes were superior to the improved cultivars and were separated from them in most groups, these genotypes can be considered as distinct genotypes for further evaluations in the framework of breeding programs and new cultivar identification in cherries. Results also confirmed that ISSR is a reliable DNA marker that can be used for exact genetic studies and in sour cherry breeding programs.
Amemiya, Kenji; Hirotsu, Yosuke; Goto, Taichiro; Nakagomi, Hiroshi; Mochizuki, Hitoshi; Oyama, Toshio; Omata, Masao
2016-12-01
Identifying genetic alterations in tumors is critical for molecular targeting of therapy. In the clinical setting, formalin-fixed paraffin-embedded (FFPE) tissue is usually employed for genetic analysis. However, DNA extracted from FFPE tissue is often not suitable for analysis because of its low levels and poor quality. Additionally, FFPE sample preparation is time-consuming. To provide early treatment for cancer patients, a more rapid and robust method is required for precision medicine. We present a simple method for genetic analysis, called touch imprint cytology combined with massively paralleled sequencing (touch imprint cytology [TIC]-seq), to detect somatic mutations in tumors. We prepared FFPE tissues and TIC specimens from tumors in nine lung cancer patients and one patient with breast cancer. We found that the quality and quantity of TIC DNA was higher than that of FFPE DNA, which requires microdissection to enrich DNA from target tissues. Targeted sequencing using a next-generation sequencer obtained sufficient sequence data using TIC DNA. Most (92%) somatic mutations in lung primary tumors were found to be consistent between TIC and FFPE DNA. We also applied TIC DNA to primary and metastatic tumor tissues to analyze tumor heterogeneity in a breast cancer patient, and showed that common and distinct mutations among primary and metastatic sites could be classified into two distinct histological subtypes. TIC-seq is an alternative and feasible method to analyze genomic alterations in tumors by simply touching the cut surface of specimens to slides. © 2016 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.
Kinoti, Wycliff M; Constable, Fiona E; Nancarrow, Narelle; Plummer, Kim M; Rodoni, Brendan
2017-01-01
PCR amplicon next generation sequencing (NGS) analysis offers a broadly applicable and targeted approach to detect populations of both high- or low-frequency virus variants in one or more plant samples. In this study, amplicon NGS was used to explore the diversity of the tripartite genome virus, Prunus necrotic ringspot virus (PNRSV) from 53 PNRSV-infected trees using amplicons from conserved gene regions of each of PNRSV RNA1, RNA2 and RNA3. Sequencing of the amplicons from 53 PNRSV-infected trees revealed differing levels of polymorphism across the three different components of the PNRSV genome with a total number of 5040, 2083 and 5486 sequence variants observed for RNA1, RNA2 and RNA3 respectively. The RNA2 had the lowest diversity of sequences compared to RNA1 and RNA3, reflecting the lack of flexibility tolerated by the replicase gene that is encoded by this RNA component. Distinct PNRSV phylo-groups, consisting of closely related clusters of sequence variants, were observed in each of PNRSV RNA1, RNA2 and RNA3. Most plant samples had a single phylo-group for each RNA component. Haplotype network analysis showed that smaller clusters of PNRSV sequence variants were genetically connected to the largest sequence variant cluster within a phylo-group of each RNA component. Some plant samples had sequence variants occurring in multiple PNRSV phylo-groups in at least one of each RNA and these phylo-groups formed distinct clades that represent PNRSV genetic strains. Variants within the same phylo-group of each Prunus plant sample had ≥97% similarity and phylo-groups within a Prunus plant sample and between samples had less ≤97% similarity. Based on the analysis of diversity, a definition of a PNRSV genetic strain was proposed. The proposed definition was applied to determine the number of PNRSV genetic strains in each of the plant samples and the complexity in defining genetic strains in multipartite genome viruses was explored.
Directory of Open Access Journals (Sweden)
Wycliff M Kinoti
Full Text Available PCR amplicon next generation sequencing (NGS analysis offers a broadly applicable and targeted approach to detect populations of both high- or low-frequency virus variants in one or more plant samples. In this study, amplicon NGS was used to explore the diversity of the tripartite genome virus, Prunus necrotic ringspot virus (PNRSV from 53 PNRSV-infected trees using amplicons from conserved gene regions of each of PNRSV RNA1, RNA2 and RNA3. Sequencing of the amplicons from 53 PNRSV-infected trees revealed differing levels of polymorphism across the three different components of the PNRSV genome with a total number of 5040, 2083 and 5486 sequence variants observed for RNA1, RNA2 and RNA3 respectively. The RNA2 had the lowest diversity of sequences compared to RNA1 and RNA3, reflecting the lack of flexibility tolerated by the replicase gene that is encoded by this RNA component. Distinct PNRSV phylo-groups, consisting of closely related clusters of sequence variants, were observed in each of PNRSV RNA1, RNA2 and RNA3. Most plant samples had a single phylo-group for each RNA component. Haplotype network analysis showed that smaller clusters of PNRSV sequence variants were genetically connected to the largest sequence variant cluster within a phylo-group of each RNA component. Some plant samples had sequence variants occurring in multiple PNRSV phylo-groups in at least one of each RNA and these phylo-groups formed distinct clades that represent PNRSV genetic strains. Variants within the same phylo-group of each Prunus plant sample had ≥97% similarity and phylo-groups within a Prunus plant sample and between samples had less ≤97% similarity. Based on the analysis of diversity, a definition of a PNRSV genetic strain was proposed. The proposed definition was applied to determine the number of PNRSV genetic strains in each of the plant samples and the complexity in defining genetic strains in multipartite genome viruses was explored.
Directory of Open Access Journals (Sweden)
Donna S Mackay
Full Text Available Primary open-angle glaucoma (POAG is a clinically important and genetically heterogeneous cause of progressive vision loss as a result of retinal ganglion cell death. Here we have utilized trio-based, whole-exome sequencing to identify the genetic defect underlying an autosomal dominant form of adult-onset POAG segregating in an African-American family. Exome sequencing identified a novel missense variant (c.418C>T, p.Arg140Trp in exon-5 of the gene coding for epidermal growth factor (EGF containing fibulin-like extracellular matrix protein 1 (EFEMP1 that co-segregated with disease in the family. Linkage and haplotype analyses with microsatellite markers indicated that the disease interval overlapped a known POAG locus (GLC1H on chromosome 2p. The p.Arg140Trp substitution was predicted in silico to have damaging effects on protein function and transient expression studies in cultured cells revealed that the Trp140-mutant protein exhibited increased intracellular accumulation compared with wild-type EFEMP1. In situ hybridization of the mouse eye with oligonucleotide probes detected the highest levels of EFEMP1 transcripts in the ciliary body, cornea, inner nuclear layer of the retina, and the optic nerve head. The recent finding that a common variant near EFEMP1 was associated with optic nerve-head morphology supports the possibility that the EFEMP1 variant identified in this POAG family may be pathogenic.
Genotyping-By-Sequencing for Plant Genetic Diversity Analysis: A Lab Guide for SNP Genotyping
Directory of Open Access Journals (Sweden)
Gregory W. Peterson
2014-10-01
Full Text Available Genotyping-by-sequencing (GBS has recently emerged as a promising genomic approach for exploring plant genetic diversity on a genome-wide scale. However, many uncertainties and challenges remain in the application of GBS, particularly in non-model species. Here, we present a GBS protocol we developed and use for plant genetic diversity analysis. It uses two restriction enzymes to reduce genome complexity, applies Illumina multiplexing indexes for barcoding and has a custom bioinformatics pipeline for genotyping. This genetic diversity-focused GBS (gd-GBS protocol can serve as an easy-to-follow lab guide to assist a researcher through every step of a GBS application with five main components: sample preparation, library assembly, sequencing, SNP calling and diversity analysis. Specifically, in this presentation, we provide a brief overview of the GBS approach, describe the gd-GBS procedures, illustrate it with an application to analyze genetic diversity in 20 flax (Linum usitatissimum L. accessions and discuss related issues in GBS application. Following these lab bench procedures and using the custom bioinformatics pipeline, one could generate genome-wide SNP genotype data for a conventional genetic diversity analysis of a non-model plant species.
Identifying novel genes for atherosclerosis through mouse-human comparative genetics
Wang, XS; Ishimori, N; Korstanje, R; Rollins, J; Paigen, B
Susceptibility to atherosclerosis is determined by both environmental and genetic factors. Its genetic determinants have been studied by use of quantitative- trait - locus ( QTL) analysis. So far, 21 atherosclerosis QTLs have been identified in the mouse: 7 in a high- fat - diet model only, 9 in a
Ping, Zheng; Siegal, Gene P.; Almeida, Jonas S.; Schnitt, Stuart J.; Shen, Dejun
2014-01-01
Background: Genetics and genomics have radically altered our understanding of breast cancer progression. However, the genomic basis of various histopathologic features of breast cancer is not yet well-defined. Materials and Methods: The Cancer Genome Atlas (TCGA) is an international database containing a large collection of human cancer genome sequencing data. cBioPortal is a web tool developed for mining these sequencing data. We performed mining of TCGA sequencing data in an attempt to characterize the genomic features correlated with breast cancer histopathology. We first assessed the quality of the TCGA data using a group of genes with known alterations in various cancers. Both genome-wide gene mutation and copy number changes as well as a group of genes with a high frequency of genetic changes were then correlated with various histopathologic features of invasive breast cancer. Results: Validation of TCGA data using a group of genes with known alterations in breast cancer suggests that the TCGA has accurately documented the genomic abnormalities of multiple malignancies. Further analysis of TCGA breast cancer sequencing data shows that accumulation of specific genomic defects is associated with higher tumor grade, larger tumor size and receptor negativity. Distinct groups of genomic changes were found to be associated with the different grades of invasive ductal carcinoma. The mutator role of the TP53 gene was validated by genomic sequencing data of invasive breast cancer and TP53 mutation was found to play a critical role in defining high tumor grade. Conclusions: Data mining of the TCGA genome sequencing data is an innovative and reliable method to help characterize the genomic abnormalities associated with histopathologic features of invasive breast cancer. PMID:24672738
Directory of Open Access Journals (Sweden)
Zheng Ping
2014-01-01
Full Text Available Background: Genetics and genomics have radically altered our understanding of breast cancer progression. However, the genomic basis of various histopathologic features of breast cancer is not yet well-defined. Materials and Methods: The Cancer Genome Atlas (TCGA is an international database containing a large collection of human cancer genome sequencing data. cBioPortal is a web tool developed for mining these sequencing data. We performed mining of TCGA sequencing data in an attempt to characterize the genomic features correlated with breast cancer histopathology. We first assessed the quality of the TCGA data using a group of genes with known alterations in various cancers. Both genome-wide gene mutation and copy number changes as well as a group of genes with a high frequency of genetic changes were then correlated with various histopathologic features of invasive breast cancer. Results: Validation of TCGA data using a group of genes with known alterations in breast cancer suggests that the TCGA has accurately documented the genomic abnormalities of multiple malignancies. Further analysis of TCGA breast cancer sequencing data shows that accumulation of specific genomic defects is associated with higher tumor grade, larger tumor size and receptor negativity. Distinct groups of genomic changes were found to be associated with the different grades of invasive ductal carcinoma. The mutator role of the TP53 gene was validated by genomic sequencing data of invasive breast cancer and TP53 mutation was found to play a critical role in defining high tumor grade. Conclusions: Data mining of the TCGA genome sequencing data is an innovative and reliable method to help characterize the genomic abnormalities associated with histopathologic features of invasive breast cancer.
DNA enrichment approaches to identify unauthorized genetically modified organisms (GMOs).
Arulandhu, Alfred J; van Dijk, Jeroen P; Dobnik, David; Holst-Jensen, Arne; Shi, Jianxin; Zel, Jana; Kok, Esther J
2016-07-01
With the increased global production of different genetically modified (GM) plant varieties, chances increase that unauthorized GM organisms (UGMOs) may enter the food chain. At the same time, the detection of UGMOs is a challenging task because of the limited sequence information that will generally be available. PCR-based methods are available to detect and quantify known UGMOs in specific cases. If this approach is not feasible, DNA enrichment of the unknown adjacent sequences of known GMO elements is one way to detect the presence of UGMOs in a food or feed product. These enrichment approaches are also known as chromosome walking or gene walking (GW). In recent years, enrichment approaches have been coupled with next generation sequencing (NGS) analysis and implemented in, amongst others, the medical and microbiological fields. The present review will provide an overview of these approaches and an evaluation of their applicability in the identification of UGMOs in complex food or feed samples.
Directory of Open Access Journals (Sweden)
Sebastian Ocklenburg
2017-05-01
Full Text Available Handedness is the most pronounced behavioral asymmetry in humans. Genome-wide association studies have largely failed to identify genetic loci associated with phenotypic variance in handedness, supporting the idea that the trait is determined by a multitude of small, possibly interacting genetic and non-genetic influences. However, these studies typically are not capable of detecting influences of rare mutations on handedness. Here, we used whole exome sequencing in a Turkish family with history of consanguinity and overrepresentation of left-handedness and performed quantitative trait analysis with handedness lateralization quotient as a phenotype. While rare variants on different loci showed significant association with the phenotype, none was functionally relevant for handedness. This finding was further confirmed by gene ontology group analysis. Taken together, our results add further evidence to the suggestion that there is no major gene or mutation that causes left-handedness.
Directory of Open Access Journals (Sweden)
Shanshan Xu
2017-10-01
Full Text Available Abstract Background Noonan syndrome (NS and Noonan syndrome with multiple lentigines (NSML are autosomal dominant developmental disorders. NS and NSML are caused by abnormalities in genes that encode proteins related to the RAS-MAPK pathway, including PTPN11, RAF1, BRAF, and MAP2K. In this study, we diagnosed ten NS or NSML patients via targeted sequencing or whole exome sequencing (TS/WES. Methods TS/WES was performed to identify mutations in ten Chinese patients who exhibited the following manifestations: potential facial dysmorphisms, short stature, congenital heart defects, and developmental delay. Sanger sequencing was used to confirm the suspected pathological variants in the patients and their family members. Results TS/WES revealed three mutations in the PTPN11 gene, three mutations in RAF1 gene, and four mutations in BRAF gene in the NS and NSML patients who were previously diagnosed based on the abovementioned clinical features. All the identified mutations were determined to be de novo mutations. However, two patients who carried the same mutation in the RAF1 gene presented different clinical features. One patient with multiple lentigines was diagnosed with NSML, while the other patient without lentigines was diagnosed with NS. In addition, a patient who carried a hotspot mutation in the BRAF gene was diagnosed with NS instead of cardiofaciocutaneous syndrome (CFCS. Conclusions TS/WES has emerged as a useful tool for definitive diagnosis and accurate genetic counseling of atypical cases. In this study, we analyzed ten Chinese patients diagnosed with NS and related disorders and identified their correspondingPTPN11, RAF1, and BRAF mutations. Among the target genes, BRAF showed the same degree of correlation with NS incidence as that of PTPN11 or RAF1.
King, Brian R; Aburdene, Maurice; Thompson, Alex; Warres, Zach
2014-01-01
Digital signal processing (DSP) techniques for biological sequence analysis continue to grow in popularity due to the inherent digital nature of these sequences. DSP methods have demonstrated early success for detection of coding regions in a gene. Recently, these methods are being used to establish DNA gene similarity. We present the inter-coefficient difference (ICD) transformation, a novel extension of the discrete Fourier transformation, which can be applied to any DNA sequence. The ICD method is a mathematical, alignment-free DNA comparison method that generates a genetic signature for any DNA sequence that is used to generate relative measures of similarity among DNA sequences. We demonstrate our method on a set of insulin genes obtained from an evolutionarily wide range of species, and on a set of avian influenza viral sequences, which represents a set of highly similar sequences. We compare phylogenetic trees generated using our technique against trees generated using traditional alignment techniques for similarity and demonstrate that the ICD method produces a highly accurate tree without requiring an alignment prior to establishing sequence similarity.
DEFF Research Database (Denmark)
Sørensen, Peter; de los Campos, Gustavo; Morgante, Fabio
2015-01-01
and others more volatile performance. Understanding the mechanisms responsible for environmental variability not only informs medical questions but is relevant in evolution and in agricultural science. In this work fully sequenced inbred lines of Drosophila melanogaster were analyzed to study the nature...... of genetic control of environmental variance for two quantitative traits: starvation resistance (SR) and startle response (SL). The evidence for genetic control of environmental variance is compelling for both traits. Sequence information is incorporated in random regression models to study the underlying...... genetic signals, which are shown to be different in the two traits. Genomic variance in sexual dimorphism was found for SR but not for SL. Indeed, the proportion of variance captured by sequence information and the contribution to this variance from four chromosome segments differ between sexes in SR...
Li, Jun; Guo, Xian-Guang; Wang, Yue-Zhao
2010-08-01
A 838 bp fragment of mtDNA ND4-tRNALeu gene was sequenced for 66 individuals from five populations (DB: Dabancheng, TU: Turpan, SS: Shanshan, HL: Liushuquan, HD: East district of Hami) of Phrynocephalus axillaris distributed in east of Xinjiang Uygur Autonomous Region. Seventeen haplotypes were identified from 29 nucleotide polymorphic sites in the aligned 838 bp sequence. Excluding DB, there were relatively high haplotype diversity [(0.600+/-0.113)oscillation since Pleistocene and genetic drift.
Contig Maps and Genomic Sequencing Identify Candidate Genes in the Usher 1C Locus
Higgins, Michael J.; Day, Colleen D.; Smilinich, Nancy J.; Ni, L.; Cooper, Paul R.; Nowak, Norma J.; Davies, Chris; de Jong, Pieter J.; Hejtmancik, Fielding; Evans, Glen A.; Smith, Richard J.H.; Shows, Thomas B.
1998-01-01
Usher syndrome 1C (USH1C) is a congenital condition manifesting profound hearing loss, the absence of vestibular function, and eventual retinal degeneration. The USH1C locus has been mapped genetically to a 2- to 3-cM interval in 11p14–15.1 between D11S899 and D11S861. In an effort to identify the USH1C disease gene we have isolated the region between these markers in yeast artificial chromosomes (YACs) using a combination of STS content mapping and Alu–PCR hybridization. The YAC contig is ∼3.5 Mb and has located several other loci within this interval, resulting in the order CEN-LDHA-SAA1-TPH-D11S1310-(D11S1888/KCNC1)-MYOD1-D11S902D11S921-D11S1890-TEL. Subsequent haplotyping and homozygosity analysis refined the location of the disease gene to a 400-kb interval between D11S902 and D11S1890 with all affected individuals being homozygous for the internal marker D11S921. To facilitate gene identification, the critical region has been converted into P1 artificial chromosome (PAC) clones using sequence-tagged sites (STSs) mapped to the YAC contig, Alu–PCR products generated from the YACs, and PAC end probes. A contig of >50 PAC clones has been assembled between D11S1310 and D11S1890, confirming the order of markers used in haplotyping. Three PAC clones representing nearly two-thirds of the USH1C critical region have been sequenced. PowerBLAST analysis identified six clusters of expressed sequence tags (ESTs), two known genes (BIR,SUR1) mapped previously to this region, and a previously characterized but unmapped gene NEFA (DNA binding/EF hand/acidic amino-acid-rich). GRAIL analysis identified 11 CpG islands and 73 exons of excellent quality. These data allowed the construction of a transcription map for the USH1C critical region, consisting of three known genes and six or more novel transcripts. Based on their map location, these loci represent candidate disease loci for USH1C. The NEFA gene was assessed as the USH1C locus by the sequencing of an amplified NEFA
Prijović, M; Skaljac, M; Drobnjaković, T; Zanić, K; Perić, P; Marčić, D; Puizina, J
2014-06-01
The greenhouse whitefly Trialeurodes vaporariorum Westwood, 1856 (Hemiptera: Aleyrodidae) is an invasive and highly polyphagous phloem-feeding pest of vegetables and ornamentals. Trialeurodes vaporariorum causes serious damage due to direct feeding and transmits several important plant viruses. Excessive use of insecticides has resulted in significantly reduced levels of susceptibility of various T. vaporariorum populations. To determine the genetic variability within and among populations of T. vaporariorum from Serbia and to explore their genetic relatedness with other T. vaporariorum populations, we analysed the mitochondrial cytochrome c oxidase I (COI) sequences of 16 populations from Serbia and six neighbouring countries: Montenegro (three populations), Macedonia (one population) and Croatia (two populations), for a total of 198 analysed specimens. A low overall level of sequence divergence and only five variable nucleotides and six haplotypes were found. The most frequent haplotype, H1, was identified in all Serbian populations and in all specimens from distant localities in Croatia and Macedonia. The COI sequence data that was retrieved from GenBank and the data from our study indicated that H1 is the most globally widespread T. vaporariorum haplotype. A lack of spatial genetic structure among the studied T. vaporariorum populations, as well as two demographic tests that we performed (Tajima's D value and Fu's Fs statistics), indicate a recent colonisation event and population growth. Phylogenetic analyses of the COI haplotypes in this study and other T. vaporariorum haplotypes that were retrieved from GenBank were performed using Bayesian inference and median-joining (MJ) network analysis. Two major haplogroups with only a single unique nucleotide difference were found: haplogroup 1 (containing the five Serbian haplotypes and those previously identified in India, China, the Netherlands, the United Kingdom, Morocco, Reunion and the USA) and haplogroup 3
Wang, Kai; Yuen, Siu Tsan; Xu, Jiangchun; Lee, Siu Po; Yan, Helen H N; Shi, Stephanie T; Siu, Hoi Cheong; Deng, Shibing; Chu, Kent Man; Law, Simon; Chan, Kok Hoe; Chan, Annie S Y; Tsui, Wai Yin; Ho, Siu Lun; Chan, Anthony K W; Man, Jonathan L K; Foglizzo, Valentina; Ng, Man Kin; Chan, April S; Ching, Yick Pang; Cheng, Grace H W; Xie, Tao; Fernandez, Julio; Li, Vivian S W; Clevers, Hans; Rejto, Paul A; Mao, Mao; Leung, Suet Yi
Gastric cancer is a heterogeneous disease with diverse molecular and histological subtypes. We performed whole-genome sequencing in 100 tumor-normal pairs, along with DNA copy number, gene expression and methylation profiling, for integrative genomic analysis. We found subtype-specific genetic and
Jeong, Hyeonsoo; Song, Ki-Duk; Seo, Minseok; Caetano-Anollés, Kelsey; Kim, Jaemin; Kwak, Woori; Oh, Jae-Don; Kim, EuiSoo; Jeong, Dong Kee; Cho, Seoae; Kim, Heebal; Lee, Hak-Kyo
2015-08-20
Natural and artificial selection following domestication has led to the existence of more than a hundred pig breeds, as well as incredible variation in phenotypic traits. Berkshire pigs are regarded as having superior meat quality compared to other breeds. As the meat production industry seeks selective breeding approaches to improve profitable traits such as meat quality, information about genetic determinants of these traits is in high demand. However, most of the studies have been performed using trained sensory panel analysis without investigating the underlying genetic factors. Here we investigate the relationship between genomic composition and this phenotypic trait by scanning for signatures of positive selection in whole-genome sequencing data. We generated genomes of 10 Berkshire pigs at a total of 100.6 coverage depth, using the Illumina Hiseq2000 platform. Along with the genomes of 11 Landrace and 13 Yorkshire pigs, we identified genomic variants of 18.9 million SNVs and 3.4 million Indels in the mapped regions. We identified several associated genes related to lipid metabolism, intramuscular fatty acid deposition, and muscle fiber type which attribute to pork quality (TG, FABP1, AKIRIN2, GLP2R, TGFBR3, JPH3, ICAM2, and ERN1) by applying between population statistical tests (XP-EHH and XP-CLR). A statistical enrichment test was also conducted to detect breed specific genetic variation. In addition, de novo short sequence read assembly strategy identified several candidate genes (SLC25A14, IGF1, PI4KA, CACNA1A) as also contributing to lipid metabolism. Results revealed several candidate genes involved in Berkshire meat quality; most of these genes are involved in lipid metabolism and intramuscular fat deposition. These results can provide a basis for future research on the genomic characteristics of Berkshire pigs.
Going Forward with Genetics: Recent Technological Advances and Forward Genetics in Mice
Moresco, Eva Marie Y.; Li, Xiaohong; Beutler, Bruce
2013-01-01
Forward genetic analysis is an unbiased approach for identifying genes essential to defined biological phenomena. When applied to mice, it is one of the most powerful methods to facilitate understanding of the genetic basis of human biology and disease. The speed at which disease-causing mutations can be identified in mutagenized mice has been markedly increased by recent advances in DNA sequencing technology. Creating and analyzing mutant phenotypes may therefore become rate-limiting in forw...
DEFF Research Database (Denmark)
Huang, Mingtao; Bai, Yunpeng; Sjostrom, Staffan L.
2015-01-01
There is an increasing demand for biotech-based production of recombinant proteins for use as pharmaceuticals in the food and feed industry and in industrial applications. Yeast Saccharomyces cerevisiae is among preferred cell factories for recombinant protein production, and there is increasing...... interest in improving its protein secretion capacity. Due to the complexity of the secretory machinery in eukaryotic cells, it is difficult to apply rational engineering for construction of improved strains. Here we used high-throughput microfluidics for the screening of yeast libraries, generated by UV...... mutagenesis. Several screening and sorting rounds resulted in the selection of eight yeast clones with significantly improved secretion of recombinant a-amylase. Efficient secretion was genetically stable in the selected clones. We performed whole-genome sequencing of the eight clones and identified 330...
Silva, A V C; Nascimento, A L S; Vitória, M F; Rabbani, A R C; Soares, A N R; Lédo, A S
2017-02-23
Banana (Musa spp) is a fruit species frequently cultivated and consumed worldwide. Molecular markers are important for estimating genetic diversity in germplasm and between genotypes in breeding programs. The objective of this study was to analyze the genetic diversity of 21 banana genotypes (FHIA 23, PA42-44, Maçã, Pacovan Ken, Bucaneiro, YB42-47, Grand Naine, Tropical, FHIA 18, PA94-01, YB42-17, Enxerto, Japira, Pacovã, Prata-Anã, Maravilha, PV79-34, Caipira, Princesa, Garantida, and Thap Maeo), by using inter-simple sequence repeat (ISSR) markers. Material was generated from the banana breeding program of Embrapa Cassava & Fruits and evaluated at Embrapa Coastal Tablelands. The 12 primers used in this study generated 97.5% polymorphism. Four clusters were identified among the different genotypes studied, and the sum of the first two principal components was 48.91%. From the Unweighted Pair Group Method using Arithmetic averages (UPGMA) dendrogram, it was possible to identify two main clusters and subclusters. Two genotypes (Garantida and Thap Maeo) remained isolated from the others, both in the UPGMA clustering and in the principal cordinate analysis (PCoA). Using ISSR markers, we could analyze the genetic diversity of the studied material and state that these markers were efficient at detecting sufficient polymorphism to estimate the genetic variability in banana genotypes.
Directory of Open Access Journals (Sweden)
Janice L Farlow
Full Text Available Genetic risk factors for intracranial aneurysm (IA are not yet fully understood. Genomewide association studies have been successful at identifying common variants; however, the role of rare variation in IA susceptibility has not been fully explored. In this study, we report the use of whole exome sequencing (WES in seven densely-affected families (45 individuals recruited as part of the Familial Intracranial Aneurysm study. WES variants were prioritized by functional prediction, frequency, predicted pathogenicity, and segregation within families. Using these criteria, 68 variants in 68 genes were prioritized across the seven families. Of the genes that were expressed in IA tissue, one gene (TMEM132B was differentially expressed in aneurysmal samples (n=44 as compared to control samples (n=16 (false discovery rate adjusted p-value=0.023. We demonstrate that sequencing of densely affected families permits exploration of the role of rare variants in a relatively common disease such as IA, although there are important study design considerations for applying sequencing to complex disorders. In this study, we explore methods of WES variant prioritization, including the incorporation of unaffected individuals, multipoint linkage analysis, biological pathway information, and transcriptome profiling. Further studies are needed to validate and characterize the set of variants and genes identified in this study.
Directory of Open Access Journals (Sweden)
Paula Paulo
2018-04-01
Full Text Available Considering that mutations in known prostate cancer (PrCa predisposition genes, including those responsible for hereditary breast/ovarian cancer and Lynch syndromes, explain less than 5% of early-onset/familial PrCa, we have sequenced 94 genes associated with cancer predisposition using next generation sequencing (NGS in a series of 121 PrCa patients. We found monoallelic truncating/functionally deleterious mutations in seven genes, including ATM and CHEK2, which have previously been associated with PrCa predisposition, and five new candidate PrCa associated genes involved in cancer predisposing recessive disorders, namely RAD51C, FANCD2, FANCI, CEP57 and RECQL4. Furthermore, using in silico pathogenicity prediction of missense variants among 18 genes associated with breast/ovarian cancer and/or Lynch syndrome, followed by KASP genotyping in 710 healthy controls, we identified "likely pathogenic" missense variants in ATM, BRIP1, CHEK2 and TP53. In conclusion, this study has identified putative PrCa predisposing germline mutations in 14.9% of early-onset/familial PrCa patients. Further data will be necessary to confirm the genetic heterogeneity of inherited PrCa predisposition hinted in this study.
A novel, privacy-preserving cryptographic approach for sharing sequencing data
Cassa, Christopher A; Miller, Rachel A; Mandl, Kenneth D
2013-01-01
Objective DNA samples are often processed and sequenced in facilities external to the point of collection. These samples are routinely labeled with patient identifiers or pseudonyms, allowing for potential linkage to identity and private clinical information if intercepted during transmission. We present a cryptographic scheme to securely transmit externally generated sequence data which does not require any patient identifiers, public key infrastructure, or the transmission of passwords. Materials and methods This novel encryption scheme cryptographically protects participant sequence data using a shared secret key that is derived from a unique subset of an individual’s genetic sequence. This scheme requires access to a subset of an individual’s genetic sequence to acquire full access to the transmitted sequence data, which helps to prevent sample mismatch. Results We validate that the proposed encryption scheme is robust to sequencing errors, population uniqueness, and sibling disambiguation, and provides sufficient cryptographic key space. Discussion Access to a set of an individual’s genotypes and a mutually agreed cryptographic seed is needed to unlock the full sequence, which provides additional sample authentication and authorization security. We present modest fixed and marginal costs to implement this transmission architecture. Conclusions It is possible for genomics researchers who sequence participant samples externally to protect the transmission of sequence data using unique features of an individual’s genetic sequence. PMID:23125421
Liu, Xueying; Teng, Zhonghua; Wang, Jinxia; Wu, Tiantian; Zhang, Zhiqin; Deng, Xianping; Fang, Xiaomei; Tan, Zhaoyun; Ali, Iftikhar; Liu, Dexin; Zhang, Jian; Liu, Dajun; Liu, Fang; Zhang, Zhengsheng
2017-12-01
Cotton is a significant commercial crop that plays an indispensable role in many domains. Constructing high-density genetic maps and identifying stable quantitative trait locus (QTL) controlling agronomic traits are necessary prerequisites for marker-assisted selection (MAS). A total of 14,899 SSR primer pairs designed from the genome sequence of G. raimondii were screened for polymorphic markers between mapping parents CCRI 35 and Yumian 1, and 712 SSR markers showing polymorphism were used to genotype 180 lines from a (CCRI 35 × Yumian 1) recombinant inbred line (RIL) population. Genetic linkage analysis was conducted on 726 loci obtained from the 712 polymorphic SSR markers, along with 1379 SSR loci obtained in our previous study, and a high-density genetic map with 2051 loci was constructed, which spanned 3508.29 cM with an average distance of 1.71 cM between adjacent markers. Marker orders on the linkage map are highly consistent with the corresponding physical orders on a G. hirsutum genome sequence. Based on fiber quality and yield component trait data collected from six environments, 113 QTLs were identified through two analytical methods. Among these 113 QTLs, 50 were considered stable (detected in multiple environments or for which phenotypic variance explained by additive effect was greater than environment effect), and 18 of these 50 were identified with stability by both methods. These 18 QTLs, including eleven for fiber quality and seven for yield component traits, could be priorities for MAS.
Directory of Open Access Journals (Sweden)
Rini Widayanti
2013-07-01
Full Text Available In a conservation effort, the identification of Tarsier species, on the bases of the morphological andmolecular characteristic is necessary. Up to now, the identification of the animals were based on themorphology and vocalizations, which is extremely difficult to identify each, tarsier species. The objective ofthis research was to study the genetic diversity on ATP6 gene of Tarsius sp. Based on sequencing of PCRproduct using primer ATP6F and ATP6R with 681 nts. PCR product. The sequence of ATP6 fragmentswere aligned with other primates from Gene bank with aid of software Clustal W, and were analyzed usingMEGA program version 4.0. Three different nucleotide sites were found (nucleotide no. 288, 321 and 367.The genetic distance based on nucleotide ATP6 sequence calculated using Kimura 2-parameter modelindicated that the smallest genetic distance 0%, biggest 0.8% and average 0, 2%. The phylogenetic treeusing neighbor joining method based on the sequence of nucleotide ATP6 gene could not be used todifferentiate among T. Dianae (from Central Sulawesi, T. Spectrum (from North Sulawesi, T. bancanus(from lampung, South Sumatera and T.bancanus from West Kalimantan.
Isolation and molecular genetic characterization of a yeast strain ...
African Journals Online (AJOL)
The yeast was identified by molecular genetics technique based on sequence analysis of the variable D1/D2 domain of the large subunit (26S) ribosomal DNA. Subsequent 26S rRNA gene sequencing showed 100% base sequence homology and it was identified as Candida viswanathii. The degradation of PAHs
Oyler-McCance, Sara J.; Valdez, Ernest W.; O'Shea, Thomas J.; Fike, Jennifer A.
2013-01-01
Emballonura semicaudata occurs in the southwestern Pacific and populations on many islands have declined or disappeared. One subspecies (E. semicaudata rotensis) occurs in the Northern Mariana Islands, where it has been extirpated from all but 1 island (Aguiguan). We assessed genetic similarity between the last population of E. s. rotensis and 2 other subspecies, and examined genetic diversity on Aguiguan. We sampled 12 E. s. rotensis, sequenced them at 3 mitochondrial loci, and compared them with published sequences from 2 other subspecies. All 12 E. s. rotensis had identical sequences in each of the 3 regions. Using cytochrome-b (Cytb) data E. s. rotensis was sister to E. s. palauensis in a clade separate from E. s. semicaudata. 12S ribosomal RNA (12S) sequences grouped all E. s. semicaudata in 1 clade with E. s. rotensis in a clade by itself. Genetic distances among the 3 subspecies at Cytb were smallest between E. s. palauensis and E. s. rotensis. Distance between E. s. semicaudata and the other 2 subspecies was not different from the distance between E. s. semicaudata and the full species E. raffrayana. A similar relationship was found using the 12S data. These distances are larger than those typically reported for mammalian subspecies using Cytb sequence and within the range of sister species.
Directory of Open Access Journals (Sweden)
Xu Xiangming
2010-12-01
Full Text Available Abstract Background Determining the position and order of contigs and scaffolds from a genome assembly within an organism's genome remains a technical challenge in a majority of sequencing projects. In order to exploit contemporary technologies for DNA sequencing, we developed a strategy for whole genome single nucleotide polymorphism sequencing allowing the positioning of sequence contigs onto a linkage map using the bin mapping method. Results The strategy was tested on a draft genome of the fungal pathogen Venturia inaequalis, the causal agent of apple scab, and further validated using sequence contigs derived from the diploid plant genome Fragaria vesca. Using our novel method we were able to anchor 70% and 92% of sequences assemblies for V. inaequalis and F. vesca, respectively, to genetic linkage maps. Conclusions We demonstrated the utility of this approach by accurately determining the bin map positions of the majority of the large sequence contigs from each genome sequence and validated our method by mapping single sequence repeat markers derived from sequence contigs on a full mapping population.
MULTILOCUS SEQUENCE TYPING OF BRUCELLA ISOLATES FROM THAILAND.
Chawjiraphan, Wireeya; Sonthayanon, Piengchan; Chanket, Phanita; Benjathummarak, Surachet; Kerdsin, Anusak; Kalambhaheti, Thareerat
2016-11-01
Although brucellosis outbreaks in Thailand are rare, they cause abortions and infertility in animals, resulting in significant economic loss. Because Brucella spp display > 90% DNA homology, multilocus sequence typing (MLST) was employed to categorize local Brucella isolates into sequence types (STs) and to determine their genetic relatedness. Brucella samples were isolated from vaginal secretion of cows and goats, and from blood cultures of infected individuals. Brucella species were determined by multiplex PCR of eight loci, in addition to MLST based on partial DNA sequences of nine house-keeping genes. MLST analysis of 36 isolates revealed 78 distinct novel allele types and 34 novel STs, while two isolates possessed the known ST8. Sequence alignments identified polymorphic sites in each allele, ranging from 2-6%, while overall genetic diversity was 3.6%. MLST analysis of the 36 Brucella isolates classified them into three species, namely, B. melitensis, B. abortus and B. suis, in agreement with multiplex PCR results. Genetic relatedness among ST members of B. melitensis and B. abortus determined by eBURST program revealed ST2 as founder of B. abortus isolates and ST8 the founder of B. melitensis isolates. ST 36, 41 and 50 of Thai Brucella isolates were identified as single locus variants of clonal cluster (CC) 8, while the majority of STs were diverse. The genetic diversity and relatedness identified using MLST revealed hitherto unexpected diversity among Thai Brucella isolates. Genetic classification of isolates could reveal the route of brucellosis transmission among humans and farm animals and also reveal their relationship with other isolates in the region and other parts of the world.
Tools for analyzing genetic variants from sequencing data Case study: short tandem repeats
Gymrek, Melissa
2016-01-01
This was presented as a BitesizeBio Webinar entitled "Tools for analyzing genetic variants from sequencing data Case study: short tandem repeats"Accompanying scripts can be accessed on github:https://github.com/mgymrek/mgymrek-bitesizebio-webinar
DEFF Research Database (Denmark)
Xu, Yanwen; Chen, Shengpei; Yin, Xuyang
2015-01-01
for a β-thalassemia-carrier couple to have a healthy second baby. We carried out sequencing for single blastomere cells and the family trio and further developed the analysis pipeline, including recovery of the missing alleles, removal of the majority of errors, and phasing of the embryonic genome...... leukocyte antigen matching tests. CONCLUSIONS: This retrospective study in a β-thalassemia family demonstrates a method for embryo genome recovery through single-cell sequencing, which permits detection of genetic variations in preimplantation genetic diagnosis. It shows the potential of single...
Faucon, Frederic; Dusfour, Isabelle; Gaude, Thierry; Navratil, Vincent; Boyer, Frederic; Chandre, Fabrice; Sirisopa, Patcharawan; Thanispong, Kanutcharee; Juntarajumnong, Waraporn; Poupardin, Rodolphe; Chareonviriyaphap, Theeraphap; Girod, Romain; Corbel, Vincent; Reynaud, Stephane; David, Jean-Philippe
2015-01-01
The capacity of mosquitoes to resist insecticides threatens the control of diseases such as dengue and malaria. Until alternative control tools are implemented, characterizing resistance mechanisms is crucial for managing resistance in natural populations. Insecticide biodegradation by detoxification enzymes is a common resistance mechanism; however, the genomic changes underlying this mechanism have rarely been identified, precluding individual resistance genotyping. In particular, the role of copy number variations (CNVs) and polymorphisms of detoxification enzymes have never been investigated at the genome level, although they can represent robust markers of metabolic resistance. In this context, we combined target enrichment with high-throughput sequencing for conducting the first comprehensive screening of gene amplifications and polymorphisms associated with insecticide resistance in mosquitoes. More than 760 candidate genes were captured and deep sequenced in several populations of the dengue mosquito Ae. aegypti displaying distinct genetic backgrounds and contrasted resistance levels to the insecticide deltamethrin. CNV analysis identified 41 gene amplifications associated with resistance, most affecting cytochrome P450s overtranscribed in resistant populations. Polymorphism analysis detected more than 30,000 variants and strong selection footprints in specific genomic regions. Combining Bayesian and allele frequency filtering approaches identified 55 nonsynonymous variants strongly associated with resistance. Both CNVs and polymorphisms were conserved within regions but differed across continents, confirming that genomic changes underlying metabolic resistance to insecticides are not universal. By identifying novel DNA markers of insecticide resistance, this study opens the way for tracking down metabolic changes developed by mosquitoes to resist insecticides within and among populations. PMID:26206155
Directory of Open Access Journals (Sweden)
Martin Darren P
2009-04-01
Full Text Available Abstract Background Recombination has a profound impact on the evolution of viruses, but characterizing recombination patterns in molecular sequences remains a challenging endeavor. Despite its importance in molecular evolutionary studies, identifying the sequences that exhibit such patterns has received comparatively less attention in the recombination detection framework. Here, we extend a quartet-mapping based recombination detection method to enable identification of recombinant sequences without prior specifications of either query and reference sequences. Through simulations we evaluate different recombinant identification statistics and significance tests. We compare the quartet approach with triplet-based methods that employ additional heuristic tests to identify parental and recombinant sequences. Results Analysis of phylogenetic simulations reveal that identifying the descendents of relatively old recombination events is a challenging task for all methods available, and that quartet scanning performs relatively well compared to the triplet based methods. The use of quartet scanning is further demonstrated by analyzing both well-established and putative HIV-1 recombinant strains. In agreement with recent findings, we provide evidence that the presumed circulating recombinant CRF02_AG is a 'pure' lineage, whereas the presumed parental lineage subtype G has a recombinant origin. We also demonstrate HIV-1 intrasubtype recombination, confirm the hybrid origin of SIV in chimpanzees and further disentangle the recombinant history of SIV lineages in a primate immunodeficiency virus data set. Conclusion Quartet scanning makes a valuable addition to triplet-based methods for identifying recombinant sequences without prior specifications of either query and reference sequences. The new method is available in the VisRD v.3.0 package http://www.cmp.uea.ac.uk/~vlm/visrd.
Khanshour, Anas M; Cothran, Ernest Gus
2013-09-13
Maternal inheritance is an essential point in Arabian horse population genetics and strains classification. The mitochondrial DNA (mtDNA) sequencing is a highly informative tool to investigate maternal lineages. We sequenced the whole mtDNA D-loop of 251 Arabian horses to study the genetic diversity and phylogenetic relationships of Arabian populations and to examine the traditional strain classification system that depends on maternal family lines using native Arabian horses from the Middle East. The variability in the upstream region of the D-loop revealed additional differences among the haplotypes that had identical sequences in the hypervariable region 1 (HVR1). While the American-Arabians showed relatively low diversity, the Syrian population was the most variable and contained a very rare and old haplogroup. The Middle Eastern horses had major genetic contributions to the Western horses and there was no clear pattern of differentiation among all tested populations. Our results also showed that several individuals from different strains shared a single haplotype, and individuals from a single strain were represented in clearly separated haplogroups. The whole mtDNA D-loop sequence was more powerful for analysis of the maternal genetic diversity in the Arabian horses than using just the HVR1. Native populations from the Middle East, such as Syrians, could be suggested as a hot spot of genetic diversity and may help in understanding the evolution history of the Arabian horse breed. Most importantly, there was no evidence that the Arabian horse breed has clear subdivisions depending on the traditional maternal based strain classification system.
Directory of Open Access Journals (Sweden)
Ella R Thompson
2012-09-01
Full Text Available Despite intensive efforts using linkage and candidate gene approaches, the genetic etiology for the majority of families with a multi-generational breast cancer predisposition is unknown. In this study, we used whole-exome sequencing of thirty-three individuals from 15 breast cancer families to identify potential predisposing genes. Our analysis identified families with heterozygous, deleterious mutations in the DNA repair genes FANCC and BLM, which are responsible for the autosomal recessive disorders Fanconi Anemia and Bloom syndrome. In total, screening of all exons in these genes in 438 breast cancer families identified three with truncating mutations in FANCC and two with truncating mutations in BLM. Additional screening of FANCC mutation hotspot exons identified one pathogenic mutation among an additional 957 breast cancer families. Importantly, none of the deleterious mutations were identified among 464 healthy controls and are not reported in the 1,000 Genomes data. Given the rarity of Fanconi Anemia and Bloom syndrome disorders among Caucasian populations, the finding of multiple deleterious mutations in these critical DNA repair genes among high-risk breast cancer families is intriguing and suggestive of a predisposing role. Our data demonstrate the utility of intra-family exome-sequencing approaches to uncover cancer predisposition genes, but highlight the major challenge of definitively validating candidates where the incidence of sporadic disease is high, germline mutations are not fully penetrant, and individual predisposition genes may only account for a tiny proportion of breast cancer families.
Unique genetic loci identified for emotional behavior in control and chronic stress conditions.
Directory of Open Access Journals (Sweden)
Kimberly AK Carhuatanta
2014-10-01
Full Text Available An individual’s genetic background affects their emotional behavior and response to stress. Although studies have been conducted to identify genetic predictors for emotional behavior or stress response, it remains unknown how prior stress history alters the interaction between an individual’s genome and their emotional behavior. Therefore, the purpose of this study is to identify chromosomal regions that affect emotional behavior and are sensitive to stress exposure. We utilized the BXD behavioral genetics mouse model to identify chromosomal regions that predict fear learning and emotional behavior following exposure to a control or chronic stress environment. 62 BXD recombinant inbred strains and C57BL/6 and DBA/2 parental strains underwent behavioral testing including a classical fear conditioning paradigm and the elevated plus maze. Distinct quantitative trait loci (QTLs were identified for emotional learning, anxiety and locomotion in control and chronic stress populations. Candidate genes, including those with already known functions in learning and stress were found to reside within the identified QTLs. Our data suggest that chronic stress history reveals novel genetic predictors of emotional behavior.
Institute of Scientific and Technical Information of China (English)
Jinsong Tang; Fan He; Fengyu Zhang; Yin Yao Shugart; Chunyu Liu; Yanqing Tang; Raymond C.K.Chan; Chuan-Yue Wang; Yong-Gang Yao; Xiaogang Chen; Yu Fan; Hong Li; Qun Xiang; Deng-Feng Zhang; Zongchang Li; Ying He; Yanhui Liao; Ya Wang
2017-01-01
Schizophrenia is a common disorder with a high heritability,but its genetic architecture is still elusive.We implemented whole-genome sequencing (WGS) analysis of 8 families with monozygotic (MZ) twin pairs discordant for schizophrenia to assess potential association of de novo mutations (DNMs) or inherited variants with susceptibility to schizophrenia.Eight non-synonymous DNMs (including one splicing site) were identified and shared by twins,which were either located in previously reported schizophrenia risk genes (p.V24689I mutation in TTN,p.S2506T mutation in GCN1L1,IVS3+1G > T in DOCK1) or had a benign to damaging effect according to in silico prediction analysis.By searching the inherited rare damaging or loss-of-function (LOF) variants and common susceptible alleles from three classes of schizophrenia candidate genes,we were able to distill genetic alterations in several schizophrenia risk genes,including GAD1,PLXNA2,RELN and FEZ1.Four inherited copy number variations (CNVs;including a large deletion at 16p13.11) implicated for schizophrenia were identified in four families,respectively.Most of families carried both missense DNMs and inherited risk variants,which might suggest that DNMs,inherited rare damaging variants and common risk alleles together conferred to schizophrenia susceptibility.Our results support that schizophrenia is caused by a combination of multiple genetic factors,with each DNM/variant showing a relatively small effect size.
Ishida, M; Cullup, T; Boustred, C; James, C; Docker, J; English, C; Lench, N; Copp, A J; Moore, G E; Greene, N D E; Stanier, P
2018-04-01
Neural tube defects (NTDs) affecting the brain (anencephaly) are lethal before or at birth, whereas lower spinal defects (spina bifida) may lead to lifelong neurological handicap. Collectively, NTDs rank among the most common birth defects worldwide. This study focuses on anencephaly, which despite having a similar frequency to spina bifida and being the most common type of NTD observed in mouse models, has had more limited inclusion in genetic studies. A genetic influence is strongly implicated in determining risk of NTDs and a molecular diagnosis is of fundamental importance to families both in terms of understanding the origin of the condition and for managing future pregnancies. Here we used a custom panel of 191 NTD candidate genes to screen 90 patients with cranial NTDs (n = 85 anencephaly and n = 5 craniorachischisis) with a targeted exome sequencing platform. After filtering and comparing to our in-house control exome database (N = 509), we identified 397 rare variants (minor allele frequency, MAF < 1%), 21 of which were previously unreported and predicted damaging. This included 1 frameshift (PDGFRA), 2 stop-gained (MAT1A; NOS2) and 18 missense variations. Together with evidence for oligogenic inheritance, this study provides new information on the possible genetic causation of anencephaly. © 2017 The Authors. Clinical Genetics published by John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
An, Hye Suck; Lee, Jang Wook; Hong, Seong Wan
2012-01-01
The small abalone, Haliotis diversicolor supertexta, of the family Haliotidae, is one of the most important species of marine shellfish in eastern Asia. Over the past few decades, this species has drastically declined in Korea. Thus, hatchery-bred seeds have been released into natural coastal areas to compensate for the reduced fishery resources. However, information on the genetic background of the small abalone is scarce. In this study, 20 polymorphic microsatellite DNA markers were identified using next-generation sequencing techniques and used to compare allelic variation between wild and released abalone populations in Korea. Using high-throughput genomic sequencing, a total of 1516 (2.26%; average length of 385 bp) reads containing simple sequence repeats were obtained from 86,011 raw reads. Among the 99 loci screened, 28 amplified successfully, and 20 were polymorphic. When comparing allelic variation between wild and released abalone populations, a total of 243 different alleles were observed, with 18.7 alleles per locus. High genetic diversity (mean heterozygosity = 0.81; mean allelic number = 15.5) was observed in both populations. A statistical analysis of the fixation index (F(ST)) and analysis of molecular variance (AMOVA) indicated limited genetic differences between the two populations (F(ST) = 0.002, p > 0.05). Although no significant reductions in the genetic diversity were found in the released population compared with the wild population (p > 0.05), the genetic diversity parameters revealed that the seeds released for stock abundance had a different genetic composition. These differences are likely a result of hatchery selection and inbreeding. Additionally, all the primer pair sets were effectively amplified in another congeneric species, H. diversicolor diversicolor, indicating that these primers are useful for both abalone species. These microsatellite loci may be valuable for future aquaculture and population genetic studies aimed at
An Exome Sequencing Study to Assess the Role of Rare Genetic Variation in Pulmonary Fibrosis.
Petrovski, Slavé; Todd, Jamie L; Durheim, Michael T; Wang, Quanli; Chien, Jason W; Kelly, Fran L; Frankel, Courtney; Mebane, Caroline M; Ren, Zhong; Bridgers, Joshua; Urban, Thomas J; Malone, Colin D; Finlen Copeland, Ashley; Brinkley, Christie; Allen, Andrew S; O'Riordan, Thomas; McHutchison, John G; Palmer, Scott M; Goldstein, David B
2017-07-01
Idiopathic pulmonary fibrosis (IPF) is an increasingly recognized, often fatal lung disease of unknown etiology. The aim of this study was to use whole-exome sequencing to improve understanding of the genetic architecture of pulmonary fibrosis. We performed a case-control exome-wide collapsing analysis including 262 unrelated individuals with pulmonary fibrosis clinically classified as IPF according to American Thoracic Society/European Respiratory Society/Japanese Respiratory Society/Latin American Thoracic Association guidelines (81.3%), usual interstitial pneumonia secondary to autoimmune conditions (11.5%), or fibrosing nonspecific interstitial pneumonia (7.2%). The majority (87%) of case subjects reported no family history of pulmonary fibrosis. We searched 18,668 protein-coding genes for an excess of rare deleterious genetic variation using whole-exome sequence data from 262 case subjects with pulmonary fibrosis and 4,141 control subjects drawn from among a set of individuals of European ancestry. Comparing genetic variation across 18,668 protein-coding genes, we found a study-wide significant (P RTEL1, and PARN. A model qualifying ultrarare, deleterious, nonsynonymous variants implicated TERT and RTEL1, and a model specifically qualifying loss-of-function variants implicated RTEL1 and PARN. A subanalysis of 186 case subjects with sporadic IPF confirmed TERT, RTEL1, and PARN as study-wide significant contributors to sporadic IPF. Collectively, 11.3% of case subjects with sporadic IPF carried a qualifying variant in one of these three genes compared with the 0.3% carrier rate observed among control subjects (odds ratio, 47.7; 95% confidence interval, 21.5-111.6; P = 5.5 × 10 -22 ). We identified TERT, RTEL1, and PARN-three telomere-related genes previously implicated in familial pulmonary fibrosis-as significant contributors to sporadic IPF. These results support the idea that telomere dysfunction is involved in IPF pathogenesis.
Lowenstein, Jacob H.; Amato, George; Kolokotronis, Sergios-Orestis
2009-01-01
Background The use of DNA barcodes for the identification of described species is one of the least controversial and most promising applications of barcoding. There is no consensus, however, as to what constitutes an appropriate identification standard and most barcoding efforts simply attempt to pair a query sequence with reference sequences and deem identification successful if it falls within the bounds of some pre-established cutoffs using genetic distance. Since the Renaissance, however, most biological classification schemes have relied on the use of diagnostic characters to identify and place species. Methodology/Principal Findings Here we developed a cytochrome c oxidase subunit I character-based key for the identification of all tuna species of the genus Thunnus, and compared its performance with distance-based measures for identification of 68 samples of tuna sushi purchased from 31 restaurants in Manhattan (New York City) and Denver, Colorado. Both the character-based key and GenBank BLAST successfully identified 100% of the tuna samples, while the Barcode of Life Database (BOLD) as well as genetic distance thresholds, and neighbor-joining phylogenetic tree building performed poorly in terms of species identification. A piece of tuna sushi has the potential to be an endangered species, a fraud, or a health hazard. All three of these cases were uncovered in this study. Nineteen restaurant establishments were unable to clarify or misrepresented what species they sold. Five out of nine samples sold as a variant of “white tuna” were not albacore (T. alalunga), but escolar (Lepidocybium flavorunneum), a gempylid species banned for sale in Italy and Japan due to health concerns. Nineteen samples were northern bluefin tuna (T. thynnus) or the critically endangered southern bluefin tuna (T. maccoyii), though nine restaurants that sold these species did not state these species on their menus. Conclusions/Significance The Convention on International Trade
Directory of Open Access Journals (Sweden)
Jo Nishino
2013-01-01
Full Text Available There has been recent success in identifying disease-causing variants in Mendelian disorders by exome sequencing followed by simple filtering techniques. Studies generally assume complete or high penetrance. However, there are likely many failed and unpublished studies due in part to incomplete penetrance or phenocopy. In this study, the expected number of candidate single-nucleotide variants (SNVs in exome data for autosomal dominant or recessive Mendelian disorders was investigated under the assumption of “no genetic heterogeneity.” All variants were assumed to be under the “null model,” and sample allele frequencies were modeled using a standard population genetics theory. To investigate the properties of pedigree data, full-sibs were considered in addition to unrelated individuals. In both cases, particularly regarding full-sibs, the number of SNVs remained very high without controls. The high efficacy of controls was also confirmed. When controls were used with a relatively large total sample size (e.g., N=20, 50, filtering incorporating of incomplete penetrance and phenocopy efficiently reduced the number of candidate SNVs. This suggests that filtering is useful when an assumption of no “genetic heterogeneity” is appropriate and could provide general guidelines for sample size determination.
Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth
2015-01-01
Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.
Jóri, Balazs; Kamps, Rick; Xanthoulea, Sofia; Delvoux, Bert; Blok, Marinus J; Van de Vijver, Koen K; de Koning, Bart; Oei, Felicia Trups; Tops, Carli M; Speel, Ernst Jm; Kruitwagen, Roy F; Gomez-Garcia, Encarna B; Romano, Andrea
2015-12-01
The risk to develop colorectal and endometrial cancers among subjects testing positive for a pathogenic Lynch syndrome mutation varies, making the risk prediction difficult. Genetic risk modifiers alter the risk conferred by inherited Lynch syndrome mutations, and their identification can improve genetic counseling. We aimed at identifying rare genetic modifiers of the risk of Lynch syndrome endometrial cancer. A family based approach was used to assess the presence of genetic risk modifiers among 35 Lynch syndrome mutation carriers having either a poor clinical phenotype (early age of endometrial cancer diagnosis or multiple cancers) or a neutral clinical phenotype. Putative genetic risk modifiers were identified by Next Generation Sequencing among a panel of 154 genes involved in endometrial physiology and carcinogenesis. A simple pipeline, based on an allele frequency lower than 0.001 and on predicted non-conservative amino-acid substitutions returned 54 variants that were considered putative risk modifiers. The presence of two or more risk modifying variants in women carrying a pathogenic Lynch syndrome mutation was associated with a poor clinical phenotype. A gene-panel is proposed that comprehends genes that can carry variants with putative modifying effects on the risk of Lynch syndrome endometrial cancer. Validation in further studies is warranted before considering the possible use of this tool in genetic counseling.
Bousfiha, Amale; Bakhchane, Amina; Charoute, Hicham; Detsouli, Mustapha; Rouba, Hassan; Charif, Majida; Lenaers, Guy; Barakat, Abdelhamid
2017-10-01
In the present work, we identified two novel compound heterozygote mutations in the GPR98 (G protein-coupled receptor 98) gene causing Usher syndrome. Whole-exome sequencing was performed to study the genetic causes of Usher syndrome in a Moroccan family with three affected siblings. We identify two novel compound heterozygote mutations (c.1054C > A, c.16544delT) in the GPR98 gene in the three affected siblings carrying post-linguale bilateral moderate hearing loss with normal vestibular functions and before installing visual disturbances. This is the first time that mutations in the GPR98 gene are described in the Moroccan deaf patients.
Ito, Katsura; Nishikawa, Hiroshi; Shimada, Takuji; Ogawa, Kohei; Minamiya, Yukio; Tomoda, Masafumi; Nakahira, Kengo; Kodama, Rika; Fukuda, Tatsuya; Arakawa, Ryo
2011-01-01
Pilophorus typicus (Distant) (Heteroptera: Miridae) is a predatory bug occurring in East, Southeast, and South Asia. Because the active stages of P. typicus prey on various agricultural pest insects and mites, this species is a candidate insect as an indigenous natural enemy for use in biological control programs. However, the mass releasing of introduced natural enemies into agricultural fields may incur the risk of affecting the genetic integrity of species through hybridization with a local population. To clarify the genetic characteristics of the Japanese populations of P. typicus two portions of the mitochondrial DNA, the cytochrome oxidase subunit I (COI) (534 bp) and the cytochrome B (cytB) (217 bp) genes, were sequenced for 64 individuals collected from 55 localities in a wide range of Japan. Totals of 18 and 10 haplotypes were identified for the COI and cytB sequences, respectively (25 haplotypes over regions). Phylogenetic analysis using the maximum likelihood method revealed the existence of two genetically distinct groups in P. typicus in Japan. These groups were distributed in different geographic ranges: one occurred mainly from the Pacific coastal areas of the Kii Peninsula, the Shikoku Island, and the Ryukyu Islands; whereas the other occurred from the northern Kyushu district to the Kanto and Hokuriku districts of mainland Japan. However, both haplotypes were found in a single locality of the southern coast of the Shikoku Island. COI phylogeny incorporating other Pilophorus species revealed that these groups were only recently differentiated. Therefore, use of a certain population of P. typicus across its distribution range should be done with caution because genetic hybridization may occur.
Characterizing leader sequences of CRISPR loci
DEFF Research Database (Denmark)
Alkhnbashi, Omer; Shah, Shiraz Ali; Garrett, Roger Antony
2016-01-01
The CRISPR-Cas system is an adaptive immune system in many archaea and bacteria, which provides resistance against invading genetic elements. The first phase of CRISPR-Cas immunity is called adaptation, in which small DNA fragments are excised from genetic elements and are inserted into a CRISPR...... array generally adjacent to its so called leader sequence at one end of the array. It has been shown that transcription initiation and adaptation signals of the CRISPR array are located within the leader. However, apart from promoters, there is very little knowledge of sequence or structural motifs...... sequences by focusing on the consensus repeat of the adjacent CRISPR array and weak upstream conservation signals. We applied our tool to the analysis of a comprehensive genomic database and identified several characteristic properties of leader sequences specific to archaea and bacteria, ranging from...
Draft genome sequences of seven isolates of Phytophthora ramorum EU2 from Northern Ireland
Directory of Open Access Journals (Sweden)
Lourdes de la Mata Saez
2015-12-01
Full Text Available Here we present draft-quality genome sequence assemblies for the oomycete Phytophthora ramorum genetic lineage EU2. We sequenced genomes of seven isolates collected in Northern Ireland between 2010 and 2012. Multiple genome sequences from P. ramorum EU2 will be valuable for identifying genetic variation within the clonal lineage that can be useful for tracking its spread.
Ortuño, Francisco M; Valenzuela, Olga; Rojas, Fernando; Pomares, Hector; Florido, Javier P; Urquiza, Jose M; Rojas, Ignacio
2013-09-01
Multiple sequence alignments (MSAs) are widely used approaches in bioinformatics to carry out other tasks such as structure predictions, biological function analyses or phylogenetic modeling. However, current tools usually provide partially optimal alignments, as each one is focused on specific biological features. Thus, the same set of sequences can produce different alignments, above all when sequences are less similar. Consequently, researchers and biologists do not agree about which is the most suitable way to evaluate MSAs. Recent evaluations tend to use more complex scores including further biological features. Among them, 3D structures are increasingly being used to evaluate alignments. Because structures are more conserved in proteins than sequences, scores with structural information are better suited to evaluate more distant relationships between sequences. The proposed multiobjective algorithm, based on the non-dominated sorting genetic algorithm, aims to jointly optimize three objectives: STRIKE score, non-gaps percentage and totally conserved columns. It was significantly assessed on the BAliBASE benchmark according to the Kruskal-Wallis test (P algorithm also outperforms other aligners, such as ClustalW, Multiple Sequence Alignment Genetic Algorithm (MSA-GA), PRRP, DIALIGN, Hidden Markov Model Training (HMMT), Pattern-Induced Multi-sequence Alignment (PIMA), MULTIALIGN, Sequence Alignment Genetic Algorithm (SAGA), PILEUP, Rubber Band Technique Genetic Algorithm (RBT-GA) and Vertical Decomposition Genetic Algorithm (VDGA), according to the Wilcoxon signed-rank test (P 0.05) with the advantage of being able to use less structures. Structural information is included within the objective function to evaluate more accurately the obtained alignments. The source code is available at http://www.ugr.es/~fortuno/MOSAStrE/MO-SAStrE.zip.
Development of microsatellite markers for identifying Brazilian coffee arabica varieties
Vieira, E.S.N.; Pinho, Von E.V.R.; Carvalho, M.G.G.; Esselink, G.; Vosman, B.
2010-01-01
Microsatellite markers, also known as SSRs (Simple Sequence Repeats), have proved to be excellent tools for identifying variety and determining genetic relationships. A set of 127 SSR markers was used to analyze genetic similarity in twenty five Coffea arabica varieties. These were composed of
Directory of Open Access Journals (Sweden)
Marco Ventura
2009-12-01
Full Text Available Bifidobacteria, one of the relatively dominant components of the human intestinal microbiota, are considered one of the key groups of beneficial intestinal bacteria (probiotic bacteria. However, in addition to health-promoting taxa, the genus Bifidobacterium also includes Bifidobacterium dentium, an opportunistic cariogenic pathogen. The genetic basis for the ability of B. dentium to survive in the oral cavity and contribute to caries development is not understood. The genome of B. dentium Bd1, a strain isolated from dental caries, was sequenced to completion to uncover a single circular 2,636,368 base pair chromosome with 2,143 predicted open reading frames. Annotation of the genome sequence revealed multiple ways in which B. dentium has adapted to the oral environment through specialized nutrient acquisition, defences against antimicrobials, and gene products that increase fitness and competitiveness within the oral niche. B. dentium Bd1 was shown to metabolize a wide variety of carbohydrates, consistent with genome-based predictions, while colonization and persistence factors implicated in tissue adhesion, acid tolerance, and the metabolism of human saliva-derived compounds were also identified. Global transcriptome analysis demonstrated that many of the genes encoding these predicted traits are highly expressed under relevant physiological conditions. This is the first report to identify, through various genomic approaches, specific genetic adaptations of a Bifidobacterium taxon, Bifidobacterium dentium Bd1, to a lifestyle as a cariogenic microorganism in the oral cavity. In silico analysis and comparative genomic hybridization experiments clearly reveal a high level of genome conservation among various B. dentium strains. The data indicate that the genome of this opportunistic cariogen has evolved through a very limited number of horizontal gene acquisition events, highlighting the narrow boundaries that separate commensals from
Directory of Open Access Journals (Sweden)
Vijay P Bondre
2016-01-01
Interpretation & conclusions: Our results showed that the full-length genome sequence generated from an Indian HSV-1 isolate shared close genetic relationship with the American KOS and Chinese CR38 strains which belonged to the Asian genetic lineage. Recombination analysis of Indian isolate demonstrated multiple recombination crossover points throughout the genome. This full-length genome sequence amplified from the Indian isolate would be helpful to study HSV evolution, genetic basis of differential pathogenesis, host-virus interactions and viral factors contributing towards differential clinical outcome in human infections.
RNA-ID, a Powerful Tool for Identifying and Characterizing Regulatory Sequences.
Brule, C E; Dean, K M; Grayhack, E J
2016-01-01
The identification and analysis of sequences that regulate gene expression is critical because regulated gene expression underlies biology. RNA-ID is an efficient and sensitive method to discover and investigate regulatory sequences in the yeast Saccharomyces cerevisiae, using fluorescence-based assays to detect green fluorescent protein (GFP) relative to a red fluorescent protein (RFP) control in individual cells. Putative regulatory sequences can be inserted either in-frame or upstream of a superfolder GFP fusion protein whose expression, like that of RFP, is driven by the bidirectional GAL1,10 promoter. In this chapter, we describe the methodology to identify and study cis-regulatory sequences in the RNA-ID system, explaining features and variations of the RNA-ID reporter, as well as some applications of this system. We describe in detail the methods to analyze a single regulatory sequence, from construction of a single GFP variant to assay of variants by flow cytometry, as well as modifications required to screen libraries of different strains simultaneously. We also describe subsequent analyses of regulatory sequences. © 2016 Elsevier Inc. All rights reserved.
Experience of targeted Usher exome sequencing as a clinical test
Besnard, Thomas; García-García, Gema; Baux, David; Vaché, Christel; Faugère, Valérie; Larrieu, Lise; Léonard, Susana; Millan, Jose M; Malcolm, Sue; Claustres, Mireille; Roux, Anne-Françoise
2014-01-01
We show that massively parallel targeted sequencing of 19 genes provides a new and reliable strategy for molecular diagnosis of Usher syndrome (USH) and nonsyndromic deafness, particularly appropriate for these disorders characterized by a high clinical and genetic heterogeneity and a complex structure of several of the genes involved. A series of 71 patients including Usher patients previously screened by Sanger sequencing plus newly referred patients was studied. Ninety-eight percent of the variants previously identified by Sanger sequencing were found by next-generation sequencing (NGS). NGS proved to be efficient as it offers analysis of all relevant genes which is laborious to reach with Sanger sequencing. Among the 13 newly referred Usher patients, both mutations in the same gene were identified in 77% of cases (10 patients) and one candidate pathogenic variant in two additional patients. This work can be considered as pilot for implementing NGS for genetically heterogeneous diseases in clinical service. PMID:24498627
Genetic Screens in Yeast to Identify BRCA1 Modifiers
National Research Council Canada - National Science Library
Plon, Sharon E
2005-01-01
.... The yeast RAD9 protein has similar functions and sequence motifs as BRCA1 and we proposed to identify haploinsufficient mutations at a second locus that alters the chromosome loss rate of our rad9-/- diploid strains...
Natural history bycatch: a pipeline for identifying metagenomic sequences in RADseq data
Directory of Open Access Journals (Sweden)
Iris Holmes
2018-04-01
Full Text Available Background Reduced representation genomic datasets are increasingly becoming available from a variety of organisms. These datasets do not target specific genes, and so may contain sequences from parasites and other organisms present in the target tissue sample. In this paper, we demonstrate that (1 RADseq datasets can be used for exploratory analysis of tissue-specific metagenomes, and (2 tissue collections house complete metagenomic communities, which can be investigated and quantified by a variety of techniques. Methods We present an exploratory method for mining metagenomic “bycatch” sequences from a range of host tissue types. We use a combination of the pyRAD assembly pipeline, NCBI’s blastn software, and custom R scripts to isolate metagenomic sequences from RADseq type datasets. Results When we focus on sequences that align with existing references in NCBI’s GenBank, we find that between three and five percent of identifiable double-digest restriction site associated DNA (ddRAD sequences from host tissue samples are from phyla to contain known blood parasites. In addition to tissue samples, we examine ddRAD sequences from metagenomic DNA extracted snake and lizard hind-gut samples. We find that the sequences recovered from these samples match with expected bacterial and eukaryotic gut microbiome phyla. Discussion Our results suggest that (1 museum tissue banks originally collected for host DNA archiving are also preserving valuable parasite and microbiome communities, (2 that publicly available RADseq datasets may include metagenomic sequences that could be explored, and (3 that restriction site approaches are a useful exploratory technique to identify microbiome lineages that could be missed by primer-based approaches.
Stroke genetics: prospects for personalized medicine
Directory of Open Access Journals (Sweden)
Markus Hugh S
2012-09-01
Full Text Available Abstract Epidemiologic evidence supports a genetic predisposition to stroke. Recent advances, primarily using the genome-wide association study approach, are transforming what we know about the genetics of multifactorial stroke, and are identifying novel stroke genes. The current findings are consistent with different stroke subtypes having different genetic architecture. These discoveries may identify novel pathways involved in stroke pathogenesis, and suggest new treatment approaches. However, the already identified genetic variants explain only a small proportion of overall stroke risk, and therefore are not currently useful in predicting risk for the individual patient. Such risk prediction may become a reality as identification of a greater number of stroke risk variants that explain the majority of genetic risk proceeds, and perhaps when information on rare variants, identified by whole-genome sequencing, is also incorporated into risk algorithms. Pharmacogenomics may offer the potential for earlier implementation of 'personalized genetic' medicine. Genetic variants affecting clopidogrel and warfarin metabolism may identify non-responders and reduce side-effects, but these approaches have not yet been widely adopted in clinical practice.
DeWoody, J.; Viger, M.; Lakatos, F.; Tuba, K.; Taylor, G.; Smulders, M.J.M.
2013-01-01
Identifying genetic sequences underlying insect associations on forest trees will improve the understanding of community genetics on a broad scale. We tested for genomic regions associated with insects in hybrid poplar using quantitative trait loci (QTL) analyses conducted on data from a common
Oyebola, Kolapo M; Idowu, Emmanuel T; Olukosi, Yetunde A; Awolola, Taiwo S; Amambua-Ngwa, Alfred
2017-06-29
The burden of falciparum malaria is especially high in sub-Saharan Africa. Differences in pressure from host immunity and antimalarial drugs lead to adaptive changes responsible for high level of genetic variations within and between the parasite populations. Population-specific genetic studies to survey for genes under positive or balancing selection resulting from drug pressure or host immunity will allow for refinement of interventions. We performed a pooled sequencing (pool-seq) of the genomes of 100 Plasmodium falciparum isolates from Nigeria. We explored allele-frequency based neutrality test (Tajima's D) and integrated haplotype score (iHS) to identify genes under selection. Fourteen shared iHS regions that had at least 2 SNPs with a score > 2.5 were identified. These regions code for genes that were likely to have been under strong directional selection. Two of these genes were the chloroquine resistance transporter (CRT) on chromosome 7 and the multidrug resistance 1 (MDR1) on chromosome 5. There was a weak signature of selection in the dihydrofolate reductase (DHFR) gene on chromosome 4 and MDR5 genes on chromosome 13, with only 2 and 3 SNPs respectively identified within the iHS window. We observed strong selection pressure attributable to continued chloroquine and sulfadoxine-pyrimethamine use despite their official proscription for the treatment of uncomplicated malaria. There was also a major selective sweep on chromosome 6 which had 32 SNPs within the shared iHS region. Tajima's D of circumsporozoite protein (CSP), erythrocyte-binding antigen (EBA-175), merozoite surface proteins - MSP3 and MSP7, merozoite surface protein duffy binding-like (MSPDBL2) and serine repeat antigen (SERA-5) were 1.38, 1.29, 0.73, 0.84 and 0.21, respectively. We have demonstrated the use of pool-seq to understand genomic patterns of selection and variability in P. falciparum from Nigeria, which bears the highest burden of infections. This investigation identified known
Qu, Ling-Hui; Jin, Xin; Xu, Hai-Wei; Li, Shi-Ying; Yin, Zheng-Qin
2015-02-01
Usher syndrome (USH) is the most common cause of combined blindness and deafness inherited in an autosomal recessive mode. Molecular diagnosis is of great significance in revealing the molecular pathogenesis and aiding the clinical diagnosis of this disease. However, molecular diagnosis remains a challenge due to high phenotypic and genetic heterogeneity in USH. This study explored an approach for detecting disease-causing genetic mutations in candidate genes in five index cases from unrelated USH families based on targeted next-generation sequencing (NGS) technology. Through systematic data analysis using an established bioinformatics pipeline and segregation analysis, 10 pathogenic mutations in the USH disease genes were identified in the five USH families. Six of these mutations were novel: c.4398G > A and EX38-49del in MYO7A, c.988_989delAT in USH1C, c.15104_15105delCA and c.6875_6876insG in USH2A. All novel variations segregated with the disease phenotypes in their respective families and were absent from ethnically matched control individuals. This study expanded the mutation spectrum of USH and revealed the genotype-phenotype relationships of the novel USH mutations in Chinese patients. Moreover, this study proved that targeted NGS is an accurate and effective method for detecting genetic mutations related to USH. The identification of pathogenic mutations is of great significance for elucidating the underlying pathophysiology of USH.
Jiménez, Cristina; Jara-Acevedo, María; Corchete, Luis A; Castillo, David; Ordóñez, Gonzalo R; Sarasquete, María E; Puig, Noemí; Martínez-López, Joaquín; Prieto-Conde, María I; García-Álvarez, María; Chillón, María C; Balanzategui, Ana; Alcoceba, Miguel; Oriol, Albert; Rosiñol, Laura; Palomera, Luis; Teruel, Ana I; Lahuerta, Juan J; Bladé, Joan; Mateos, María V; Orfão, Alberto; San Miguel, Jesús F; González, Marcos; Gutiérrez, Norma C; García-Sanz, Ramón
2017-01-01
Identification and characterization of genetic alterations are essential for diagnosis of multiple myeloma and may guide therapeutic decisions. Currently, genomic analysis of myeloma to cover the diverse range of alterations with prognostic impact requires fluorescence in situ hybridization (FISH), single nucleotide polymorphism arrays, and sequencing techniques, which are costly and labor intensive and require large numbers of plasma cells. To overcome these limitations, we designed a targeted-capture next-generation sequencing approach for one-step identification of IGH translocations, V(D)J clonal rearrangements, the IgH isotype, and somatic mutations to rapidly identify risk groups and specific targetable molecular lesions. Forty-eight newly diagnosed myeloma patients were tested with the panel, which included IGH and six genes that are recurrently mutated in myeloma: NRAS, KRAS, HRAS, TP53, MYC, and BRAF. We identified 14 of 17 IGH translocations previously detected by FISH and three confirmed translocations not detected by FISH, with the additional advantage of breakpoint identification, which can be used as a target for evaluating minimal residual disease. IgH subclass and V(D)J rearrangements were identified in 77% and 65% of patients, respectively. Mutation analysis revealed the presence of missense protein-coding alterations in at least one of the evaluating genes in 16 of 48 patients (33%). This method may represent a time- and cost-effective diagnostic method for the molecular characterization of multiple myeloma. Copyright © 2017 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Hua Dong
2015-12-01
Full Text Available Interaction between HBV and host genome integrations in hepatocellular carcinoma (HCC development is a complex process and the mechanism is still unclear. Here we described in details the quality controls and data mining of aCGH and transcriptome sequencing data on 50 HCC samples from the Chinese patients, published by Dong et al. (2015 (GEO#: GSE65486. In additional to the HBV-MLL4 integration discovered, we also investigated the genetic aberrations of HBV and host genes as well as their genetic interactions. We reported human genome copy number changes and frequent transcriptome variations (e.g. TP53, CTNNB1 mutation, especially MLL family mutations in this cohort of the patients. For HBV genotype C, we identified a novel linkage disequilibrium region covering HBV replication regulatory elements, including basal core promoter, DR1, epsilon and poly-A regions, which is associated with HBV core antigen over-expression and almost exclusive to HBV-MLL4 integration.
Exome sequencing identifies SUCO mutations in mesial temporal lobe epilepsy.
Sha, Zhiqiang; Sha, Longze; Li, Wenting; Dou, Wanchen; Shen, Yan; Wu, Liwen; Xu, Qi
2015-03-30
Mesial temporal lobe epilepsy (mTLE) is the main type and most common medically intractable form of epilepsy. Severity of disease-based stratified samples may help identify new disease-associated mutant genes. We analyzed mRNA expression profiles from patient hippocampal tissue. Three of the seven patients had severe mTLE with generalized-onset convulsions and consciousness loss that occurred over many years. We found that compared with other groups, patients with severe mTLE were classified into a distinct group. Whole-exome sequencing and Sanger sequencing validation in all seven patients identified three novel SUN domain-containing ossification factor (SUCO) mutations in severely affected patients. Furthermore, SUCO knock down significantly reduced dendritic length in vitro. Our results indicate that mTLE defects may affect neuronal development, and suggest that neurons have abnormal development due to lack of SUCO, which may be a generalized-onset epilepsy-related gene. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Sakthivelkumar, S; Ramaraj, P; Veeramani, V; Janarthanan, S
2015-09-01
The basis of the present study was to distinguish the existence of any genetic variability among populations of Culex quinquefasciatus which would be a valuable tool in the management of mosquito control programmes. In the present study, population of Cx. quinquefasciatus collected at different locations in Tamil Nadu were analyzed for their genetic variation based on 28S rDNA D2 region nucleotide sequences. A high degree of genetic polymorphism was detected in the sequences of D2 region of 28S rDNA on the predicted secondary structures in spite of high nucleotide sequence similarity. The findings based on secondary structure using rDNA sequences suggested the existence of a complex genotypic diversity of Cx. quinquefasciatus population collected at different locations of Tamil Nadu, India. This complexity in genetic diversity in a single mosquito population collected at different locations is considered an important issue towards their influence and nature of vector potential of these mosquitoes.
Shaik, Razia S; Zhu, Xiaocheng; Clements, David R; Weston, Leslie A
2016-01-01
Part of the challenge in dealing with invasive plant species is that they seldom represent a uniform, static entity. Often, an accurate understanding of the history of plant introduction and knowledge of the real levels of genetic diversity present in species and populations of importance is lacking. Currently, the role of genetic diversity in promoting the successful establishment of invasive plants is not well defined. Genetic profiling of invasive plants should enhance our understanding of the dynamics of colonization in the invaded range. Recent advances in DNA sequencing technology have greatly facilitated the rapid and complete assessment of plant population genetics. Here, we apply our current understanding of the genetics and ecophysiology of plant invasions to recent work on Australian plant invaders from the Cucurbitaceae and Boraginaceae. The Cucurbitaceae study showed that both prickly paddy melon ( Cucumis myriocarpus ) and camel melon ( Citrullus lanatus ) were represented by only a single genotype in Australia, implying that each was probably introduced as a single introduction event. In contrast, a third invasive melon, Citrullus colocynthis , possessed a moderate level of genetic diversity in Australia and was potentially introduced to the continent at least twice. The Boraginaceae study demonstrated the value of comparing two similar congeneric species; one, Echium plantagineum , is highly invasive and genetically diverse, whereas the other, Echium vulgare , exhibits less genetic diversity and occupies a more limited ecological niche. Sequence analysis provided precise identification of invasive plant species, as well as information on genetic diversity and phylogeographic history. Improved sequencing technologies will continue to allow greater resolution of genetic relationships among invasive plant populations, thereby potentially improving our ability to predict the impact of these relationships upon future spread and better manage invaders
Promises, pitfalls and practicalities of prenatal whole exome sequencing.
Best, Sunayna; Wou, Karen; Vora, Neeta; Van der Veyver, Ignatia B; Wapner, Ronald; Chitty, Lyn S
2018-01-01
Prenatal genetic diagnosis provides information for pregnancy and perinatal decision-making and management. In several small series, prenatal whole exome sequencing (WES) approaches have identified genetic diagnoses when conventional tests (karyotype and microarray) were not diagnostic. Here, we review published prenatal WES studies and recent conference abstracts. Thirty-one studies were identified, with diagnostic rates in series of five or more fetuses varying between 6.2% and 80%. Differences in inclusion criteria and trio versus singleton approaches to sequencing largely account for the wide range of diagnostic rates. The data suggest that diagnostic yields will be greater in fetuses with multiple anomalies or in cases preselected following genetic review. Beyond its ability to improve diagnostic rates, we explore the potential of WES to improve understanding of prenatal presentations of genetic disorders and lethal fetal syndromes. We discuss prenatal phenotyping limitations, counselling challenges regarding variants of uncertain significance, incidental and secondary findings, and technical problems in WES. We review the practical, ethical, social and economic issues that must be considered before prenatal WES could become part of routine testing. Finally, we reflect upon the potential future of prenatal genetic diagnosis, including a move towards whole genome sequencing and non-invasive whole exome and whole genome testing. © 2017 John Wiley & Sons, Ltd. © 2017 John Wiley & Sons, Ltd.
Zignol, Matteo; Cabibbe, Andrea Maurizio; Dean, Anna S; Glaziou, Philippe; Alikhanova, Natavan; Ama, Cecilia; Andres, Sönke; Barbova, Anna; Borbe-Reyes, Angeli; Chin, Daniel P; Cirillo, Daniela Maria; Colvin, Charlotte; Dadu, Andrei; Dreyer, Andries; Driesen, Michèle; Gilpin, Christopher; Hasan, Rumina; Hasan, Zahra; Hoffner, Sven; Hussain, Alamdar; Ismail, Nazir; Kamal, S M Mostofa; Khanzada, Faisal Masood; Kimerling, Michael; Kohl, Thomas Andreas; Mansjö, Mikael; Miotto, Paolo; Mukadi, Ya Diul; Mvusi, Lindiwe; Niemann, Stefan; Omar, Shaheed V; Rigouts, Leen; Schito, Marco; Sela, Ivita; Seyfaddinova, Mehriban; Skenders, Girts; Skrahina, Alena; Tahseen, Sabira; Wells, William A; Zhurilo, Alexander; Weyer, Karin; Floyd, Katherine; Raviglione, Mario C
2018-03-21
In many countries, regular monitoring of the emergence of resistance to anti-tuberculosis drugs is hampered by the limitations of phenotypic testing for drug susceptibility. We therefore evaluated the use of genetic sequencing for surveillance of drug resistance in tuberculosis. Population-level surveys were done in hospitals and clinics in seven countries (Azerbaijan, Bangladesh, Belarus, Pakistan, Philippines, South Africa, and Ukraine) to evaluate the use of genetic sequencing to estimate the resistance of Mycobacterium tuberculosis isolates to rifampicin, isoniazid, ofloxacin, moxifloxacin, pyrazinamide, kanamycin, amikacin, and capreomycin. For each drug, we assessed the accuracy of genetic sequencing by a comparison of the adjusted prevalence of resistance, measured by genetic sequencing, with the true prevalence of resistance, determined by phenotypic testing. Isolates were taken from 7094 patients with tuberculosis who were enrolled in the study between November, 2009, and May, 2014. In all tuberculosis cases, the overall pooled sensitivity values for predicting resistance by genetic sequencing were 91% (95% CI 87-94) for rpoB (rifampicin resistance), 86% (74-93) for katG, inhA, and fabG promoter combined (isoniazid resistance), 54% (39-68) for pncA (pyrazinamide resistance), 85% (77-91) for gyrA and gyrB combined (ofloxacin resistance), and 88% (81-92) for gyrA and gyrB combined (moxifloxacin resistance). For nearly all drugs and in most settings, there was a large overlap in the estimated prevalence of drug resistance by genetic sequencing and the estimated prevalence by phenotypic testing. Genetic sequencing can be a valuable tool for surveillance of drug resistance, providing new opportunities to monitor drug resistance in tuberculosis in resource-poor countries. Before its widespread adoption for surveillance purposes, there is a need to standardise DNA extraction methods, recording and reporting nomenclature, and data interpretation. Bill & Melinda
Cheng, Keding; Chui, Huixia; Domish, Larissa; Sloan, Angela; Hernandez, Drexler; McCorrister, Stuart; Robinson, Alyssia; Walker, Matthew; Peterson, Lorea A M; Majcher, Miles; Ratnam, Sam; Haldane, David J M; Bekal, Sadjia; Wylie, John; Chui, Linda; Tyler, Shaun; Xu, Bianli; Reimer, Aleisha; Nadon, Celine; Knox, J David; Wang, Gehua
2016-08-01
Mass spectrometry-based phenotypic H-antigen typing (MS-H) combined with whole-genome-sequencing-based genetic identification of H antigens, O antigens, and toxins (WGS-HOT) was used to type 60 clinical Escherichia coli isolates, 43 of which were previously identified as nonmotile, H type undetermined, or O rough by serotyping or having shown discordant MS-H and serotyping results. Whole-genome sequencing confirmed that MS-H was able to provide more accurate data regarding H antigen expression than serotyping. Further, enhanced and more confident O antigen identification resulted from gene cluster based typing in combination with conventional typing based on the gene pair comprising wzx and wzy and that comprising wzm and wzt The O antigen was identified in 94.6% of the isolates when the two genetic O typing approaches (gene pair and gene cluster) were used in conjunction, in comparison to 78.6% when the gene pair database was used alone. In addition, 98.2% of the isolates showed the existence of genes for various toxins and/or virulence factors, among which verotoxins (Shiga toxin 1 and/or Shiga toxin 2) were 100% concordant with conventional PCR based testing results. With more applications of mass spectrometry and whole-genome sequencing in clinical microbiology laboratories, this combined phenotypic and genetic typing platform (MS-H plus WGS-HOT) should be ideal for pathogenic E. coli typing. Copyright © 2016 Cheng et al.
Directory of Open Access Journals (Sweden)
King Graham J
2010-10-01
Full Text Available Abstract Background The Multinational Brassica rapa Genome Sequencing Project (BrGSP has developed valuable genomic resources, including BAC libraries, BAC-end sequences, genetic and physical maps, and seed BAC sequences for Brassica rapa. An integrated linkage map between the amphidiploid B. napus and diploid B. rapa will facilitate the rapid transfer of these valuable resources from B. rapa to B. napus (Oilseed rape, Canola. Results In this study, we identified over 23,000 simple sequence repeats (SSRs from 536 sequenced BACs. 890 SSR markers (designated as BrGMS were developed and used for the construction of an integrated linkage map for the A genome in B. rapa and B. napus. Two hundred and nineteen BrGMS markers were integrated to an existing B. napus linkage map (BnaNZDH. Among these mapped BrGMS markers, 168 were only distributed on the A genome linkage groups (LGs, 18 distrubuted both on the A and C genome LGs, and 33 only distributed on the C genome LGs. Most of the A genome LGs in B. napus were collinear with the homoeologous LGs in B. rapa, although minor inversions or rearrangements occurred on A2 and A9. The mapping of these BAC-specific SSR markers enabled assignment of 161 sequenced B. rapa BACs, as well as the associated BAC contigs to the A genome LGs of B. napus. Conclusion The genetic mapping of SSR markers derived from sequenced BACs in B. rapa enabled direct links to be established between the B. napus linkage map and a B. rapa physical map, and thus the assignment of B. rapa BACs and the associated BAC contigs to the B. napus linkage map. This integrated genetic linkage map will facilitate exploitation of the B. rapa annotated genomic resources for gene tagging and map-based cloning in B. napus, and for comparative analysis of the A genome within Brassica species.
Unique genetic loci identified for emotional behavior in control and chronic stress conditions
Carhuatanta, Kimberly A. K.; Shea, Chloe J. A.; Herman, James P.; Jankord, Ryan
2014-01-01
An individual's genetic background affects their emotional behavior and response to stress. Although studies have been conducted to identify genetic predictors for emotional behavior or stress response, it remains unknown how prior stress history alters the interaction between an individual's genome and their emotional behavior. Therefore, the purpose of this study is to identify chromosomal regions that affect emotional behavior and are sensitive to stress exposure. We utilized the BXD behav...
Oosumi, Teruko; Ruiz-Rojas, Juan Jairo; Veilleux, Richard E; Dickerman, Allan; Shulaev, Vladimir
2010-09-01
Reverse genetics is used for functional genomics research in model plants. To establish a model system for the systematic reverse genetics research in the Rosaceae family, we analyzed genomic DNA flanking the T-DNA insertions in 191 transgenic plants of the diploid strawberry, Fragaria vesca. One hundred and seventy-six T-DNA flanking sequences were amplified from the right border (RB) and 37 from the left border (LB) by thermal asymmetric interlaced PCR. Analysis of the T-DNA nick positions revealed that T-DNA was most frequently nicked at the cleavage sites. Analysis of 11 T-DNA integration sites indicated that T-DNA was integrated into the F. vesca genome by illegitimate recombination, as reported in other model plants: Arabidopsis, rice and tobacco. First, deletion of DNA was found at T-DNA integration target sites in all transgenic plants tested. Second, microsimilarities of a few base pairs between the left and/or right ends of the T-DNA and genomic sites were found in all transgenic plants tested. Finally, filler DNA was identified in four break-points. Out of 191 transgenic plants, T-DNA flanking sequences of 79 plants (41%) showed significant similarity to genes, elements or proteins of other plant species and 67 (35%) of the sequences are still unknown strawberry gene fragments. T-DNA flanking sequences of 126 plants (66%) showed homology to plant ESTs. This is the first report of T-DNA integration in a sizeable population of a rosaceous species. We have shown in this paper that T-DNA integration in strawberry is not random but directed by sequence microsimilarities in the host genome.
Simple sequence repeat (SSR)-based genetic variability among ...
African Journals Online (AJOL)
The objective of this study was to compare if simple sequence repeat (SSR) markers could correctly identify peanut genotypes with difference in specific leaf weight (SLW) and relative water content (RWC). Four peanut genotypes and two water regimes (FC and 1/3 available water; 1/3 AW) were arranged in factorial ...
Genetic Barrier to Direct Acting Antivirals in HCV Sequences Deposited in the European Databank.
Directory of Open Access Journals (Sweden)
Dimas Alexandre Kliemann
Full Text Available Development of resistance results from mutations in the viral genome, and the presence of selective drug pressure leads to the emergence of a resistant virus population. The aim of this study was to analyze the impact of genetic variability on the genetic barrier to drug resistance to DAAs.The genetic barrier was quantified based on the number and type of nucleotide mutations required to impart resistance, considering full-length HCV NS3, NS5A and NS5B regions segregated by genotype into subtypes 1a, 1b, 2a, 2b and 3a. This study analyzeds 789 NS3 sequences, 708 sequences and 536 NS5B sequences deposited in the European Hepatitis C Virus Database, in the following resistance-associated positions: NS3: F43/I/L/S/V, Q80K/R, R155K/G, A156G/S/T and D168A/C/E/G/H/N/T/V/Y; NS5A: L/M28A/T/V, Q30E/H/R, L31F/I/M/V, H58D or P58S and Y93C/F/H/N/S; NS5B: S282P/R/T, C316H/N/Y, S368T, Y448C/H, S556G/R, D559R.Variants that require only one transversion in NS3 were found in 4 positions and include F43S, R80K, R155K/G and A156T. The genetic barrier to resistance shows subtypic differences at position 155 of the NS3 gene where a single transition is necessary in subtype 1a. In the NS5A gene, 5 positions where only one nucleotide change can confer resistance were found, such as L31M which requires one transversion in all subtypes, except in 0.28% of 1b sequences; and R30H, generated by a single transition, which was found in 10.25% of the sequences of genotype 1b. Other subtypic differences were observed at position 58, where resistance is less likely in genotype 1a because a transversion is required to create the variant 58S. For the NS5B inhibitors, the genetic barrier at positions conferring resistance was nearly identical in subtypes 1a and 1b, and single transitions or transversions were necessary in 5 positions to generate a drug-resistant variant of HCV. The positions C316Y and S556D required only one transition in all genotypes, Y448H and S556 G
Mizas, Ch; Sirakoulis, G Ch; Mardiris, V; Karafyllidis, I; Glykos, N; Sandaltzopoulos, R
2008-04-01
Change of DNA sequence that fuels evolution is, to a certain extent, a deterministic process because mutagenesis does not occur in an absolutely random manner. So far, it has not been possible to decipher the rules that govern DNA sequence evolution due to the extreme complexity of the entire process. In our attempt to approach this issue we focus solely on the mechanisms of mutagenesis and deliberately disregard the role of natural selection. Hence, in this analysis, evolution refers to the accumulation of genetic alterations that originate from mutations and are transmitted through generations without being subjected to natural selection. We have developed a software tool that allows modelling of a DNA sequence as a one-dimensional cellular automaton (CA) with four states per cell which correspond to the four DNA bases, i.e. A, C, T and G. The four states are represented by numbers of the quaternary number system. Moreover, we have developed genetic algorithms (GAs) in order to determine the rules of CA evolution that simulate the DNA evolution process. Linear evolution rules were considered and square matrices were used to represent them. If DNA sequences of different evolution steps are available, our approach allows the determination of the underlying evolution rule(s). Conversely, once the evolution rules are deciphered, our tool may reconstruct the DNA sequence in any previous evolution step for which the exact sequence information was unknown. The developed tool may be used to test various parameters that could influence evolution. We describe a paradigm relying on the assumption that mutagenesis is governed by a near-neighbour-dependent mechanism. Based on the satisfactory performance of our system in the deliberately simplified example, we propose that our approach could offer a starting point for future attempts to understand the mechanisms that govern evolution. The developed software is open-source and has a user-friendly graphical input interface.
Directory of Open Access Journals (Sweden)
Hong Liu
Full Text Available As a genetic disorder of abnormal pigmentation, the molecular basis of dyschromatosis universalis hereditaria (DUH had remained unclear until recently when ABCB6 was reported as a causative gene of DUH.We performed genome-wide linkage scan using Illumina Human 660W-Quad BeadChip and exome sequencing analyses using Agilent SureSelect Human All Exon Kits in a multiplex Chinese DUH family to identify the pathogenic mutations and verified the candidate mutations using Sanger sequencing. Quantitative RT-PCR and Immunohistochemistry was performed to verify the expression of the pathogenic gene, Zebrafish was also used to confirm the functional role of ABCB6 in melanocytes and pigmentation.Genome-wide linkage (assuming autosomal dominant inheritance mode and exome sequencing analyses identified ABCB6 as the disease candidate gene by discovering a coding mutation (c.1358C>T; p.Ala453Val that co-segregates with the disease phenotype. Further mutation analysis of ABCB6 in four other DUH families and two sporadic cases by Sanger sequencing confirmed the mutation (c.1358C>T; p.Ala453Val and discovered a second, co-segregating coding mutation (c.964A>C; p.Ser322Lys in one of the four families. Both mutations were heterozygous in DUH patients and not present in the 1000 Genome Project and dbSNP database as well as 1,516 unrelated Chinese healthy controls. Expression analysis in human skin and mutagenesis interrogation in zebrafish confirmed the functional role of ABCB6 in melanocytes and pigmentation. Given the involvement of ABCB6 mutations in coloboma, we performed ophthalmological examination of the DUH carriers of ABCB6 mutations and found ocular abnormalities in them.Our study has advanced our understanding of DUH pathogenesis and revealed the shared pathological mechanism between pigmentary DUH and ocular coloboma.
In silico detection of sequence variations modifying transcriptional regulation.
Directory of Open Access Journals (Sweden)
Malin C Andersen
2008-01-01
Full Text Available Identification of functional genetic variation associated with increased susceptibility to complex diseases can elucidate genes and underlying biochemical mechanisms linked to disease onset and progression. For genes linked to genetic diseases, most identified causal mutations alter an encoded protein sequence. Technological advances for measuring RNA abundance suggest that a significant number of undiscovered causal mutations may alter the regulation of gene transcription. However, it remains a challenge to separate causal genetic variations from linked neutral variations. Here we present an in silico driven approach to identify possible genetic variation in regulatory sequences. The approach combines phylogenetic footprinting and transcription factor binding site prediction to identify variation in candidate cis-regulatory elements. The bioinformatics approach has been tested on a set of SNPs that are reported to have a regulatory function, as well as background SNPs. In the absence of additional information about an analyzed gene, the poor specificity of binding site prediction is prohibitive to its application. However, when additional data is available that can give guidance on which transcription factor is involved in the regulation of the gene, the in silico binding site prediction improves the selection of candidate regulatory polymorphisms for further analyses. The bioinformatics software generated for the analysis has been implemented as a Web-based application system entitled RAVEN (regulatory analysis of variation in enhancers. The RAVEN system is available at http://www.cisreg.ca for all researchers interested in the detection and characterization of regulatory sequence variation.
In Silico Detection of Sequence Variations Modifying Transcriptional Regulation
Andersen, Malin C; Engström, Pär G; Lithwick, Stuart; Arenillas, David; Eriksson, Per; Lenhard, Boris; Wasserman, Wyeth W; Odeberg, Jacob
2008-01-01
Identification of functional genetic variation associated with increased susceptibility to complex diseases can elucidate genes and underlying biochemical mechanisms linked to disease onset and progression. For genes linked to genetic diseases, most identified causal mutations alter an encoded protein sequence. Technological advances for measuring RNA abundance suggest that a significant number of undiscovered causal mutations may alter the regulation of gene transcription. However, it remains a challenge to separate causal genetic variations from linked neutral variations. Here we present an in silico driven approach to identify possible genetic variation in regulatory sequences. The approach combines phylogenetic footprinting and transcription factor binding site prediction to identify variation in candidate cis-regulatory elements. The bioinformatics approach has been tested on a set of SNPs that are reported to have a regulatory function, as well as background SNPs. In the absence of additional information about an analyzed gene, the poor specificity of binding site prediction is prohibitive to its application. However, when additional data is available that can give guidance on which transcription factor is involved in the regulation of the gene, the in silico binding site prediction improves the selection of candidate regulatory polymorphisms for further analyses. The bioinformatics software generated for the analysis has been implemented as a Web-based application system entitled RAVEN (regulatory analysis of variation in enhancers). The RAVEN system is available at http://www.cisreg.ca for all researchers interested in the detection and characterization of regulatory sequence variation. PMID:18208319
Crauwels, Sam; Zhu, Bo; Steensels, Jan; Busschaert, Pieter; De Samblanx, Gorik; Marchal, Kathleen; Willems, Kris A; Verstrepen, Kevin J; Lievens, Bart
2014-07-01
Brettanomyces yeasts, with the species Brettanomyces (Dekkera) bruxellensis being the most important one, are generally reported to be spoilage yeasts in the beer and wine industry due to the production of phenolic off flavors. However, B. bruxellensis is also known to be a beneficial contributor in certain fermentation processes, such as the production of certain specialty beers. Nevertheless, despite its economic importance, Brettanomyces yeasts remain poorly understood at the genetic and genomic levels. In this study, the genetic relationship between more than 50 Brettanomyces strains from all presently known species and from several sources was studied using a combination of DNA fingerprinting techniques. This revealed an intriguing correlation between the B. bruxellensis fingerprints and the respective isolation source. To further explore this relationship, we sequenced a (beneficial) beer isolate of B. bruxellensis (VIB X9085; ST05.12/22) and compared its genome sequence with the genome sequences of two wine spoilage strains (AWRI 1499 and CBS 2499). ST05.12/22 was found to be substantially different from both wine strains, especially at the level of single nucleotide polymorphisms (SNPs). In addition, there were major differences in the genome structures between the strains investigated, including the presence of large duplications and deletions. Gene content analysis revealed the presence of 20 genes which were present in both wine strains but absent in the beer strain, including many genes involved in carbon and nitrogen metabolism, and vice versa, no genes that were missing in both AWRI 1499 and CBS 2499 were found in ST05.12/22. Together, this study provides tools to discriminate Brettanomyces strains and provides a first glimpse at the genetic diversity and genome plasticity of B. bruxellensis. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Nemati, Sara; Fazaeli, Asghar; Hajjaran, Homa; Khamesipour, Ali; Anbaran, Mohsen Falahati; Bozorgomid, Arezoo; Zarei, Fatah
2017-08-01
Despite the broad distribution of leishmaniasis among Iranians and animals across the country, little is known about the genetic characteristics of the causative agents. Applying both HSP70 PCR-RFLP and sequence analyses, this study aimed to evaluate the genetic diversity and phylogenetic relationships among Leishmania spp. isolated from Iranian endemic foci and available reference strains. A total of 36 Leishmania isolates from almost all districts across the country were genetically analyzed for the HSP70 gene using both PCR-RFLP and sequence analysis. The original HSP70 gene sequences were aligned along with homologous Leishmania sequences retrieved from NCBI, and subjected to the phylogenetic analysis. Basic parameters of genetic diversity were also estimated. The HSP70 PCR-RFLP presented 3 different electrophoretic patterns, with no further intraspecific variation, corresponding to 3 Leishmania species available in the country, L. tropica, L. major, and L. infantum. Phylogenetic analyses presented 5 major clades, corresponding to 5 species complexes. Iranian lineages, including L. major, L. tropica, and L. infantum, were distributed among 3 complexes L. major, L. tropica, and L. donovani. However, within the L. major and L. donovani species complexes, the HSP70 phylogeny was not able to distinguish clearly between the L. major and L. turanica isolates, and between the L. infantum, L. donovani, and L. chagasi isolates, respectively. Our results indicated that both HSP70 PCR-RFLP and sequence analyses are medically applicable tools for identification of Leishmania species in Iranian patients. However, the reduced genetic diversity of the target gene makes it inevitable that its phylogeny only resolves the major groups, namely, the species complexes.
Directory of Open Access Journals (Sweden)
Juan Téllez-Sosa
Full Text Available BACKGROUND: Influenza viruses display a high mutation rate and complex evolutionary patterns. Next-generation sequencing (NGS has been widely used for qualitative and semi-quantitative assessment of genetic diversity in complex biological samples. The "deep sequencing" approach, enabled by the enormous throughput of current NGS platforms, allows the identification of rare genetic viral variants in targeted genetic regions, but is usually limited to a small number of samples. METHODOLOGY AND PRINCIPAL FINDINGS: We designed a proof-of-principle study to test whether redistributing sequencing throughput from a high depth-small sample number towards a low depth-large sample number approach is feasible and contributes to influenza epidemiological surveillance. Using 454-Roche sequencing, we sequenced at a rather low depth, a 307 bp amplicon of the neuraminidase gene of the Influenza A(H1N1 pandemic (A(H1N1pdm virus from cDNA amplicons pooled in 48 barcoded libraries obtained from nasal swab samples of infected patients (n = 299 taken from May to November, 2009 pandemic period in Mexico. This approach revealed that during the transition from the first (May-July to second wave (September-November of the pandemic, the initial genetic variants were replaced by the N248D mutation in the NA gene, and enabled the establishment of temporal and geographic associations with genetic diversity and the identification of mutations associated with oseltamivir resistance. CONCLUSIONS: NGS sequencing of a short amplicon from the NA gene at low sequencing depth allowed genetic screening of a large number of samples, providing insights to viral genetic diversity dynamics and the identification of genetic variants associated with oseltamivir resistance. Further research is needed to explain the observed replacement of the genetic variants seen during the second wave. As sequencing throughput rises and library multiplexing and automation improves, we foresee that
Sharma, Anshul; Kaur, Jasmine; Lee, Sulhee; Park, Young-Seo
2018-06-01
In the present study, 35 Leuconostoc mesenteroides strains isolated from vegetables and food products from South Korea were studied by multilocus sequence typing (MLST) of seven housekeeping genes (atpA, groEL, gyrB, pheS, pyrG, rpoA, and uvrC). The fragment sizes of the seven amplified housekeeping genes ranged in length from 366 to 1414 bp. Sequence analysis indicated 27 different sequence types (STs) with 25 of them being represented by a single strain indicating high genetic diversity, whereas the remaining 2 were characterized by five strains each. In total, 220 polymorphic nucleotide sites were detected among seven housekeeping genes. The phylogenetic analysis based on the STs of the seven loci indicated that the 35 strains belonged to two major groups, A (28 strains) and B (7 strains). Split decomposition analysis showed that intraspecies recombination played a role in generating diversity among strains. The minimum spanning tree showed that the evolution of the STs was not correlated with food source. This study signifies that the multilocus sequence typing is a valuable tool to access the genetic diversity among L. mesenteroides strains from South Korea and can be used further to monitor the evolutionary changes.
Somatic Genetic Variation in Solid Pseudopapillary Tumor of the Pancreas by Whole Exome Sequencing
Directory of Open Access Journals (Sweden)
Meng Guo
2017-01-01
Full Text Available Solid pseudopapillary tumor of the pancreas (SPT is a rare pancreatic disease with a unique clinical manifestation. Although CTNNB1 gene mutations had been universally reported, genetic variation profiles of SPT are largely unidentified. We conducted whole exome sequencing in nine SPT patients to probe the SPT-specific insertions and deletions (indels and single nucleotide polymorphisms (SNPs. In total, 54 SNPs and 41 indels of prominent variations were demonstrated through parallel exome sequencing. We detected that CTNNB1 mutations presented throughout all patients studied (100%, and a higher count of SNPs was particularly detected in patients with older age, larger tumor, and metastatic disease. By aggregating 95 detected variation events and viewing the interconnections among each of the genes with variations, CTNNB1 was identified as the core portion in the network, which might collaborate with other events such as variations of USP9X, EP400, HTT, MED12, and PKD1 to regulate tumorigenesis. Pathway analysis showed that the events involved in other cancers had the potential to influence the progression of the SNPs count. Our study revealed an insight into the variation of the gene encoding region underlying solid-pseudopapillary neoplasm tumorigenesis. The detection of these variations might partly reflect the potential molecular mechanism.
Monden, Yuki; Yamamoto, Ayaka; Shindo, Akiko; Tahara, Makoto
2014-10-01
In many crop species, DNA fingerprinting is required for the precise identification of cultivars to protect the rights of breeders. Many families of retrotransposons have multiple copies throughout the eukaryotic genome and their integrated copies are inherited genetically. Thus, their insertion polymorphisms among cultivars are useful for DNA fingerprinting. In this study, we conducted a DNA fingerprinting based on the insertion polymorphisms of active retrotransposon families (Rtsp-1 and LIb) in sweet potato. Using 38 cultivars, we identified 2,024 insertion sites in the two families with an Illumina MiSeq sequencing platform. Of these insertion sites, 91.4% appeared to be polymorphic among the cultivars and 376 cultivar-specific insertion sites were identified, which were converted directly into cultivar-specific sequence-characterized amplified region (SCAR) markers. A phylogenetic tree was constructed using these insertion sites, which corresponded well with known pedigree information, thereby indicating their suitability for genetic diversity studies. Thus, the genome-wide comparative analysis of active retrotransposon insertion sites using the bench-top MiSeq sequencing platform is highly effective for DNA fingerprinting without any requirement for whole genome sequence information. This approach may facilitate the development of practical polymerase chain reaction-based cultivar diagnostic system and could also be applied to the determination of genetic relationships. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Benmansour, A.; Bascuro, B.; Monnier, A.F.; Vende, P.; Winton, J.R.; de Kinkelin, P.
1997-01-01
To evaluate the genetic diversity of viral haemorrhagic septicaemia virus (VHSV), the sequence of the glycoprotein genes (G) of 11 North American and European isolates were determined. Comparison with the G protein of representative members of the family Rhabdoviridae suggested that VHSV was a different virus species from infectious haemorrhagic necrosis virus (IHNV) and Hirame rhabdovirus (HIRRV). At a higher taxonomic level, VHSV, IHNV and HIRRV formed a group which was genetically closest to the genus Lyssavirus. Compared with each other, the G genes of VHSV displayed a dissimilar overall genetic diversity which correlated with differences in geographical origin. The multiple sequence alignment of the complete G protein, showed that the divergent positions were not uniformly distributed along the sequence. A central region (amino acid position 245-300) accumulated substitutions and appeared to be highly variable. The genetic heterogeneity within a single isolate was high, with an apparent internal mutation frequency of 1.2 x 10(-3) per nucleotide site, attesting the quasispecies nature of the viral population. The phylogeny separated VHSV strains according to the major geographical area of isolation: genotype I for continental Europe, genotype II for the British Isles, and genotype III for North America. Isolates from continental Europe exhibited the highest genetic variability, with sub-groups correlated partially with the serological classification. Neither neutralizing polyclonal sera, nor monoclonal antibodies, were able to discriminate between the genotypes. The overall structure of the phylogenetic tree suggests that VHSV genetic diversity and evolution fit within the model of random change and positive selection operating on quasispecies.
Sorghum is the second cereal crop to have a full genome completely sequenced (Nature (2009), 457:551). This achievement is widely recognized as a scientific milestone for grass genetics and genomics in general. However, the true worth of genetic information lies in translating the sequence informa...
Sequence imputation of HPV16 genomes for genetic association studies.
Directory of Open Access Journals (Sweden)
Benjamin Smith
Full Text Available Human Papillomavirus type 16 (HPV16 causes over half of all cervical cancer and some HPV16 variants are more oncogenic than others. The genetic basis for the extraordinary oncogenic properties of HPV16 compared to other HPVs is unknown. In addition, we neither know which nucleotides vary across and within HPV types and lineages, nor which of the single nucleotide polymorphisms (SNPs determine oncogenicity.A reference set of 62 HPV16 complete genome sequences was established and used to examine patterns of evolutionary relatedness amongst variants using a pairwise identity heatmap and HPV16 phylogeny. A BLAST-based algorithm was developed to impute complete genome data from partial sequence information using the reference database. To interrogate the oncogenic risk of determined and imputed HPV16 SNPs, odds-ratios for each SNP were calculated in a case-control viral genome-wide association study (VWAS using biopsy confirmed high-grade cervix neoplasia and self-limited HPV16 infections from Guanacaste, Costa Rica.HPV16 variants display evolutionarily stable lineages that contain conserved diagnostic SNPs. The imputation algorithm indicated that an average of 97.5±1.03% of SNPs could be accurately imputed. The VWAS revealed specific HPV16 viral SNPs associated with variant lineages and elevated odds ratios; however, individual causal SNPs could not be distinguished with certainty due to the nature of HPV evolution.Conserved and lineage-specific SNPs can be imputed with a high degree of accuracy from limited viral polymorphic data due to the lack of recombination and the stochastic mechanism of variation accumulation in the HPV genome. However, to determine the role of novel variants or non-lineage-specific SNPs by VWAS will require direct sequence analysis. The investigation of patterns of genetic variation and the identification of diagnostic SNPs for lineages of HPV16 variants provides a valuable resource for future studies of HPV16
Greiner, Stephan; Wang, Xi; Herrmann, Reinhold G; Rauwolf, Uwe; Mayer, Klaus; Haberer, Georg; Meurer, Jörg
2008-09-01
A unique combination of genetic features and a rich stock of information make the flowering plant genus Oenothera an appealing model to explore the molecular basis of speciation processes including nucleus-organelle coevolution. From representative species, we have recently reported complete nucleotide sequences of the 5 basic and genetically distinguishable plastid chromosomes of subsection Oenothera (I-V). In nature, Oenothera plastid genomes are associated with 6 distinct, either homozygous or heterozygous, diploid nuclear genotypes of the 3 basic genomes A, B, or C. Artificially produced plastome-genome combinations that do not occur naturally often display interspecific plastome-genome incompatibility (PGI). In this study, we compare formal genetic data available from all 30 plastome-genome combinations with sequence differences between the plastomes to uncover potential determinants for interspecific PGI. Consistent with an active role in speciation, a remarkable number of genes have high Ka/Ks ratios. Different from the Solanacean cybrid model Atropa/tobacco, RNA editing seems not to be relevant for PGIs in Oenothera. However, predominantly sequence polymorphisms in intergenic segments are proposed as possible sources for PGI. A single locus, the bidirectional promoter region between psbB and clpP, is suggested to contribute to compartmental PGI in the interspecific AB hybrid containing plastome I (AB-I), consistent with its perturbed photosystem II activity.
Genetic profiles of cervical tumors by high-throughput sequencing for personalized medical care
International Nuclear Information System (INIS)
Muller, Etienne; Brault, Baptiste; Holmes, Allyson; Legros, Angelina; Jeannot, Emmanuelle; Campitelli, Maura; Rousselin, Antoine; Goardon, Nicolas; Frébourg, Thierry; Krieger, Sophie; Crouet, Hubert; Nicolas, Alain; Sastre, Xavier; Vaur, Dominique; Castéra, Laurent
2015-01-01
Cancer treatment is facing major evolution since the advent of targeted therapies. Building genetic profiles could predict sensitivity or resistance to these therapies and highlight disease-specific abnormalities, supporting personalized patient care. In the context of biomedical research and clinical diagnosis, our laboratory has developed an oncogenic panel comprised of 226 genes and a dedicated bioinformatic pipeline to explore somatic mutations in cervical carcinomas, using high-throughput sequencing. Twenty-nine tumors were sequenced for exons within 226 genes. The automated pipeline used includes a database and a filtration system dedicated to identifying mutations of interest and excluding false positive and germline mutations. One-hundred and seventy-six total mutational events were found among the 29 tumors. Our cervical tumor mutational landscape shows that most mutations are found in PIK3CA (E545K, E542K) and KRAS (G12D, G13D) and others in FBXW7 (R465C, R505G, R479Q). Mutations have also been found in ALK (V1149L, A1266T) and EGFR (T259M). These results showed that 48% of patients display at least one deleterious mutation in genes that have been already targeted by the Food and Drug Administration approved therapies. Considering deleterious mutations, 59% of patients could be eligible for clinical trials. Sequencing hundreds of genes in a clinical context has become feasible, in terms of time and cost. In the near future, such an analysis could be a part of a battery of examinations along the diagnosis and treatment of cancer, helping to detect sensitivity or resistance to targeted therapies and allow advancements towards personalized oncology
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics. SANG-HAK LEE. Articles written in Journal of Genetics. Volume 96 Issue 6 December 2017 pp 1041-1046 Research article. Genome-based exome sequencing analysis identifies GYG1, DIS3L and DDRGK1 are associated with myocardial infarction in Koreans · JI-YOUNG LEE ...
kmer-SVM: a web server for identifying predictive regulatory sequence features in genomic data sets
Fletez-Brant, Christopher; Lee, Dongwon; McCallion, Andrew S.; Beer, Michael A.
2013-01-01
Massively parallel sequencing technologies have made the generation of genomic data sets a routine component of many biological investigations. For example, Chromatin immunoprecipitation followed by sequence assays detect genomic regions bound (directly or indirectly) by specific factors, and DNase-seq identifies regions of open chromatin. A major bottleneck in the interpretation of these data is the identification of the underlying DNA sequence code that defines, and ultimately facilitates prediction of, these transcription factor (TF) bound or open chromatin regions. We have recently developed a novel computational methodology, which uses a support vector machine (SVM) with kmer sequence features (kmer-SVM) to identify predictive combinations of short transcription factor-binding sites, which determine the tissue specificity of these genomic assays (Lee, Karchin and Beer, Discriminative prediction of mammalian enhancers from DNA sequence. Genome Res. 2011; 21:2167–80). This regulatory information can (i) give confidence in genomic experiments by recovering previously known binding sites, and (ii) reveal novel sequence features for subsequent experimental testing of cooperative mechanisms. Here, we describe the development and implementation of a web server to allow the broader research community to independently apply our kmer-SVM to analyze and interpret their genomic datasets. We analyze five recently published data sets and demonstrate how this tool identifies accessory factors and repressive sequence elements. kmer-SVM is available at http://kmersvm.beerlab.org. PMID:23771147
Lim, Byung Chan; Lee, Seungbok; Shin, Jong-Yeon; Kim, Jong-Il; Hwang, Hee; Kim, Ki Joong; Hwang, Yong Seung; Seo, Jeong-Sun; Chae, Jong Hee
2011-11-01
Duchenne muscular dystrophy or Becker muscular dystrophy might be a suitable candidate disease for application of next-generation sequencing in the genetic diagnosis because the complex mutational spectrum and the large size of the dystrophin gene require two or more analytical methods and have a high cost. The authors tested whether large deletions/duplications or small mutations, such as point mutations or short insertions/deletions of the dystrophin gene, could be predicted accurately in a single platform using next-generation sequencing technology. A custom solution-based target enrichment kit was designed to capture whole genomic regions of the dystrophin gene and other muscular-dystrophy-related genes. A multiplexing strategy, wherein four differently bar-coded samples were captured and sequenced together in a single lane of the Illumina Genome Analyser, was applied. The study subjects were 25 16 with deficient dystrophin expression without a large deletion/duplication and 9 with a known large deletion/duplication. Nearly 100% of the exonic region of the dystrophin gene was covered by at least eight reads with a mean read depth of 107. Pathogenic small mutations were identified in 15 of the 16 patients without a large deletion/duplication. Using these 16 patients as the standard, the authors' method accurately predicted the deleted or duplicated exons in the 9 patients with known mutations. Inclusion of non-coding regions and paired-end sequence analysis enabled accurate identification by increasing the read depth and providing information about the breakpoint junction. The current method has an advantage for the genetic diagnosis of Duchenne muscular dystrophy and Becker muscular dystrophy wherein a comprehensive mutational search may be feasible using a single platform.
Directory of Open Access Journals (Sweden)
Alexander H. Li
2017-10-01
Full Text Available Abstract Background Left-sided lesions (LSLs account for an important fraction of severe congenital cardiovascular malformations (CVMs. The genetic contributions to LSLs are complex, and the mutations that cause these malformations span several diverse biological signaling pathways: TGFB, NOTCH, SHH, and more. Here, we use whole exome sequence data generated in 342 LSL cases to identify likely damaging variants in putative candidate CVM genes. Methods Using a series of bioinformatics filters, we focused on genes harboring population-rare, putative loss-of-function (LOF, and predicted damaging variants in 1760 CVM candidate genes constructed a priori from the literature and model organism databases. Gene variants that were not observed in a comparably sequenced control dataset of 5492 samples without severe CVM were then subjected to targeted validation in cases and parents. Whole exome sequencing data from 4593 individuals referred for clinical sequencing were used to bolster evidence for the role of candidate genes in CVMs and LSLs. Results Our analyses revealed 28 candidate variants in 27 genes, including 17 genes not previously associated with a human CVM disorder, and revealed diverse patterns of inheritance among LOF carriers, including 9 confirmed de novo variants in both novel and newly described human CVM candidate genes (ACVR1, JARID2, NR2F2, PLRG1, SMURF1 as well as established syndromic CVM genes (KMT2D, NF1, TBX20, ZEB2. We also identified two genes (DNAH5, OFD1 with evidence of recessive and hemizygous inheritance patterns, respectively. Within our clinical cohort, we also observed heterozygous LOF variants in JARID2 and SMAD1 in individuals with cardiac phenotypes, and collectively, carriers of LOF variants in our candidate genes had a four times higher odds of having CVM (odds ratio = 4.0, 95% confidence interval 2.5–6.5. Conclusions Our analytical strategy highlights the utility of bioinformatic resources, including human
Kelly Ivors; Matteo Garbelotto; Ineke De Vries; Peter Bonants
2006-01-01
Investigating the population genetics of Phytophthora ramorum, the causal agent of sudden oak death (SOD), is critical to understanding the biology and epidemiology of this important phytopathogen. Raw sequence data (445,000 reads) of P. ramorum was provided by the Joint Genome Institute. Our objective was to develop and utilize...
Directory of Open Access Journals (Sweden)
Xiaochen Yang
Full Text Available The genetic etiology of hereditary breast cancer has not been fully elucidated. Although germline mutations of high-penetrance genes such as BRCA1/2 are implicated in development of hereditary breast cancers, at least half of all breast cancer families are not linked to these genes. To identify a comprehensive spectrum of genetic factors for hereditary breast cancer in a Chinese population, we performed an analysis of germline mutations in 2,165 coding exons of 152 genes associated with hereditary cancer using next-generation sequencing (NGS in 99 breast cancer patients from families of cancer patients regardless of cancer types. Forty-two deleterious germline mutations were identified in 21 genes of 34 patients, including 18 (18.2% BRCA1 or BRCA2 mutations, 3 (3% TP53 mutations, 5 (5.1% DNA mismatch repair gene mutations, 1 (1% CDH1 mutation, 6 (6.1% Fanconi anemia pathway gene mutations, and 9 (9.1% mutations in other genes. Of seven patients who carried mutations in more than one gene, 4 were BRCA1/2 mutation carriers, and their average onset age was much younger than patients with only BRCA1/2 mutations. Almost all identified high-penetrance gene mutations in those families fulfill the typical phenotypes of hereditary cancer syndromes listed in the National Comprehensive Cancer Network (NCCN guidelines, except two TP53 and three mismatch repair gene mutations. Furthermore, functional studies of MSH3 germline mutations confirmed the association between MSH3 mutation and tumorigenesis, and segregation analysis suggested antagonism between BRCA1 and MSH3. We also identified a lot of low-penetrance gene mutations. Although the clinical significance of those newly identified low-penetrance gene mutations has not been fully appreciated yet, these new findings do provide valuable epidemiological information for the future studies. Together, these findings highlight the importance of genetic testing based on NCCN guidelines and a multi-gene analysis
A ripple-spreading genetic algorithm for the aircraft sequencing problem.
Hu, Xiao-Bing; Di Paolo, Ezequiel A
2011-01-01
When genetic algorithms (GAs) are applied to combinatorial problems, permutation representations are usually adopted. As a result, such GAs are often confronted with feasibility and memory-efficiency problems. With the aircraft sequencing problem (ASP) as a study case, this paper reports on a novel binary-representation-based GA scheme for combinatorial problems. Unlike existing GAs for the ASP, which typically use permutation representations based on aircraft landing order, the new GA introduces a novel ripple-spreading model which transforms the original landing-order-based ASP solutions into value-based ones. In the new scheme, arriving aircraft are projected as points into an artificial space. A deterministic method inspired by the natural phenomenon of ripple-spreading on liquid surfaces is developed, which uses a few parameters as input to connect points on this space to form a landing sequence. A traditional GA, free of feasibility and memory-efficiency problems, can then be used to evolve the ripple-spreading related parameters in order to find an optimal sequence. Since the ripple-spreading model is the centerpiece of the new algorithm, it is called the ripple-spreading GA (RSGA). The advantages of the proposed RSGA are illustrated by extensive comparative studies for the case of the ASP.
Extended exome sequencing identifies BACH2 as a novel major risk locus for Addison's disease.
Eriksson, D; Bianchi, M; Landegren, N; Nordin, J; Dalin, F; Mathioudaki, A; Eriksson, G N; Hultin-Rosenberg, L; Dahlqvist, J; Zetterqvist, H; Karlsson, Å; Hallgren, Å; Farias, F H G; Murén, E; Ahlgren, K M; Lobell, A; Andersson, G; Tandre, K; Dahlqvist, S R; Söderkvist, P; Rönnblom, L; Hulting, A-L; Wahlberg, J; Ekwall, O; Dahlqvist, P; Meadows, J R S; Bensing, S; Lindblad-Toh, K; Kämpe, O; Pielberg, G R
2016-12-01
Autoimmune disease is one of the leading causes of morbidity and mortality worldwide. In Addison's disease, the adrenal glands are targeted by destructive autoimmunity. Despite being the most common cause of primary adrenal failure, little is known about its aetiology. To understand the genetic background of Addison's disease, we utilized the extensively characterized patients of the Swedish Addison Registry. We developed an extended exome capture array comprising a selected set of 1853 genes and their potential regulatory elements, for the purpose of sequencing 479 patients with Addison's disease and 1394 controls. We identified BACH2 (rs62408233-A, OR = 2.01 (1.71-2.37), P = 1.66 × 10 -15 , MAF 0.46/0.29 in cases/controls) as a novel gene associated with Addison's disease development. We also confirmed the previously known associations with the HLA complex. Whilst BACH2 has been previously reported to associate with organ-specific autoimmune diseases co-inherited with Addison's disease, we have identified BACH2 as a major risk locus in Addison's disease, independent of concomitant autoimmune diseases. Our results may enable future research towards preventive disease treatment. © 2016 The Authors. Journal of Internal Medicine published by John Wiley & Sons Ltd on behalf of Association for Publication of The Journal of Internal Medicine.
Next-Generation Sequencing: From Understanding Biology to Personalized Medicine
Directory of Open Access Journals (Sweden)
Benjamin Meder
2013-03-01
Full Text Available Within just a few years, the new methods for high-throughput next-generation sequencing have generated completely novel insights into the heritability and pathophysiology of human disease. In this review, we wish to highlight the benefits of the current state-of-the-art sequencing technologies for genetic and epigenetic research. We illustrate how these technologies help to constantly improve our understanding of genetic mechanisms in biological systems and summarize the progress made so far. This can be exemplified by the case of heritable heart muscle diseases, so-called cardiomyopathies. Here, next-generation sequencing is able to identify novel disease genes, and first clinical applications demonstrate the successful translation of this technology into personalized patient care.
Miller, Mark P.; Knaus, Brian J.; Mullins, Thomas D.; Haig, Susan M.
2013-01-01
SSR_pipeline is a flexible set of programs designed to efficiently identify simple sequence repeats (e.g., microsatellites) from paired-end high-throughput Illumina DNA sequencing data. The program suite contains 3 analysis modules along with a fourth control module that can automate analyses of large volumes of data. The modules are used to 1) identify the subset of paired-end sequences that pass Illumina quality standards, 2) align paired-end reads into a single composite DNA sequence, and 3) identify sequences that possess microsatellites (both simple and compound) conforming to user-specified parameters. The microsatellite search algorithm is extremely efficient, and we have used it to identify repeats with motifs from 2 to 25bp in length. Each of the 3 analysis modules can also be used independently to provide greater flexibility or to work with FASTQ or FASTA files generated from other sequencing platforms (Roche 454, Ion Torrent, etc.). We demonstrate use of the program with data from the brine fly Ephydra packardi (Diptera: Ephydridae) and provide empirical timing benchmarks to illustrate program performance on a common desktop computer environment. We further show that the Illumina platform is capable of identifying large numbers of microsatellites, even when using unenriched sample libraries and a very small percentage of the sequencing capacity from a single DNA sequencing run. All modules from SSR_pipeline are implemented in the Python programming language and can therefore be used from nearly any computer operating system (Linux, Macintosh, and Windows).
Miller, Mark P; Knaus, Brian J; Mullins, Thomas D; Haig, Susan M
2013-01-01
SSR_pipeline is a flexible set of programs designed to efficiently identify simple sequence repeats (e.g., microsatellites) from paired-end high-throughput Illumina DNA sequencing data. The program suite contains 3 analysis modules along with a fourth control module that can automate analyses of large volumes of data. The modules are used to 1) identify the subset of paired-end sequences that pass Illumina quality standards, 2) align paired-end reads into a single composite DNA sequence, and 3) identify sequences that possess microsatellites (both simple and compound) conforming to user-specified parameters. The microsatellite search algorithm is extremely efficient, and we have used it to identify repeats with motifs from 2 to 25 bp in length. Each of the 3 analysis modules can also be used independently to provide greater flexibility or to work with FASTQ or FASTA files generated from other sequencing platforms (Roche 454, Ion Torrent, etc.). We demonstrate use of the program with data from the brine fly Ephydra packardi (Diptera: Ephydridae) and provide empirical timing benchmarks to illustrate program performance on a common desktop computer environment. We further show that the Illumina platform is capable of identifying large numbers of microsatellites, even when using unenriched sample libraries and a very small percentage of the sequencing capacity from a single DNA sequencing run. All modules from SSR_pipeline are implemented in the Python programming language and can therefore be used from nearly any computer operating system (Linux, Macintosh, and Windows).
Chassaing, Nicolas; Vigouroux, Adeline; Calvas, Patrick
2009-06-01
Microphthalmia and anophthalmia are at the severe end of the spectrum of abnormalities in ocular development. A few genes (SOX2, OTX2, RAX, and CHX10) have been implicated in isolated micro/anophthalmia, but causative mutations of these genes explain less than a quarter of these developmental defects. A specifically conserved SOX2/OTX2-mediated RAX expression regulatory sequence has recently been identified. We postulated that mutations in this sequence could lead to micro/anophthalmia, and thus we performed molecular screening of this regulatory element in patients suffering from micro/anophthalmia. Fifty-one patients suffering from nonsyndromic microphthalmia (n = 40) or anophthalmia (n = 11) were included in this study after negative molecular screening for SOX2, OTX2, RAX, and CHX10 mutations. Mutation screening of the RAX regulatory sequence was performed by direct sequencing for these patients. No mutations were identified in the highly conserved RAX regulatory sequence in any of the 51 patients. Mutations in the newly identified RAX regulatory sequence do not represent a frequent cause of nonsyndromic micro/anophthalmia.
Directory of Open Access Journals (Sweden)
Yongheng Duan
2017-08-01
Full Text Available Abstract X-linked intellectual disability (XLID has been associated with various genes. Diagnosis of XLID, especially for non-syndromic ones (NS-XLID, is often hampered by the heterogeneity of this disease. Here we report the case of a Chinese family in which three males suffer from intellectual disability (ID. The three patients shared the same phenotype: no typical clinical manifestation other than IQ score ≤ 70. For a genetic diagnosis for this family we carried out whole exome sequencing on the proband, and validated 16 variants of interest in the genomic DNA of all the family members. A missense mutation (c.710G > T, which mapped to exon 6 of the Rab GDP-Dissociation Inhibitor 1 (GDI1 gene, was found segregating with the ID phenotype, and this mutation changes the 237th position in the guanosine diphosphate dissociation inhibitor (GDI protein from glycine to valine (p. Gly237Val. Through molecular dynamics simulations we found that this substitution results in a conformational change of GDI, possibly affecting the Rab-binding capacity of this protein. In conclusion, our study identified a novel GDI1 mutation that is possibly NS-XLID causative, and showed that whole exome sequencing provides advantages for detecting novel ID-associated variants and can greatly facilitate the genetic diagnosis of the disease.
Wang, Zan; Yu, Guohui; Shi, Binbin; Wang, Xuemin; Qiang, Haiping; Gao, Hongwen
2014-01-01
Sufficient codominant genetic markers are needed for various genetic investigations in alfalfa since the species is an outcrossing autotetraploid. With the newly developed next generation sequencing technology, a large amount of transcribed sequences of alfalfa have been generated and are available for identifying SSR markers by data mining. A total of 54,278 alfalfa non-redundant unigenes were assembled through the Illumina HiSeqTM 2000 sequencing technology. Based on 3,903 unigene sequences, 4,493 SSRs were identified. Tri-nucleotide repeats (56.71%) were the most abundant motif class while AG/CT (21.7%), AGG/CCT (19.8%), AAC/GTT (10.3%), ATC/ATG (8.8%), and ACC/GGT (6.3%) were the subsequent top five nucleotide repeat motifs. Eight hundred and thirty- seven EST-SSR primer pairs were successfully designed. Of these, 527 (63%) primer pairs yielded clear and scored PCR products and 372 (70.6%) exhibited polymorphisms. High transferability was observed for ssp falcata at 99.2% (523) and 71.7% (378) in M. truncatula. In addition, 313 of 527 SSR marker sequences were in silico mapped onto the eight M. truncatula chromosomes. Thirty-six polymorphic SSR primer pairs were used in the genetic relatedness analysis of 30 Chinese alfalfa cultivated accessions generating a total of 199 scored alleles. The mean observed heterozygosity and polymorphic information content were 0.767 and 0.635, respectively. The codominant markers not only enriched the current resources of molecular markers in alfalfa, but also would facilitate targeted investigations in marker-trait association, QTL mapping, and genetic diversity analysis in alfalfa. PMID:24642969
Guenni, K; Aouadi, M; Chatti, K; Salhi-Hannachi, A
2016-10-17
Sequence-related amplified polymorphism (SRAP) markers preferentially amplify open reading frames and were used to study the genetic diversity of Tunisian pistachio. In the present study, 43 Pistacia vera accessions were screened using seven SRAP primer pairs. A total of 78 markers was revealed (95.12%) with an average polymorphic information content of 0.850. The results suggest that there is strong genetic differentiation, which characterizes the local resources (G ST = 0.307). High gene flow (N m = 1.127) among groups was explained by the exchange of plant material among regions. Analysis of molecular variance revealed significant differences within groups and showed that 73.88% of the total genetic diversity occurred within groups, whereas the remaining 26.12% occurred among groups. Bayesian clustering and principal component analysis identified three pools, El Guettar, Pollenizers, and the rest of the pistachios belonging to the Gabès, Kasserine, and Sfax localities. Bayesian analysis revealed that El Guettar and male genotypes were assigned with more than 80% probability. The BayeScan method proposed that locus 59 (F13-R9) could be used in the development of sex-linked SCAR markers from SRAP since it is a commonly detected locus in comparisons involving the Pollenizers group. This is the first application of SRAP markers for the assessment of genetic diversity in Tunisian germplasm of P. vera. Such information will be useful to define conservation strategies and improvement programs for this species.
Liao, Jing; Chao, Zhi; Zhang, Liang
2013-11-01
To identify the common snakes in medicated liquor of Guangdong using COI barcode sequence,and to test the feasibility. The COI barcode sequences of collected medicinal snakes were amplified and sequenced. The sequences combined with the data from GenBank were analyzed for divergence and building a neighbor-joining(NJ) tree with MEGA 5.0. The genetic distance and NJ tree demonstrated that there were 241 variable sites in these species, and the average (A + T) content of 56.2% was higher than the average (G + C) content of 43.7%. The maximum interspecific genetic distance was 0.2568, and the minimum was 0. 1519. In the NJ tree,each species formed a monophyletic clade with bootstrap supports of 100%. DNA barcoding identification method based on the COI sequence is accurate and can be applied to identify the common medicinal snakes.
The utility of Next Generation Sequencing for molecular diagnostics in Rett syndrome.
Vidal, Silvia; Brandi, Núria; Pacheco, Paola; Gerotina, Edgar; Blasco, Laura; Trotta, Jean-Rémi; Derdak, Sophia; Del Mar O'Callaghan, Maria; Garcia-Cazorla, Àngels; Pineda, Mercè; Armstrong, Judith
2017-09-25
Rett syndrome (RTT) is an early-onset neurodevelopmental disorder that almost exclusively affects girls and is totally disabling. Three genes have been identified that cause RTT: MECP2, CDKL5 and FOXG1. However, the etiology of some of RTT patients still remains unknown. Recently, next generation sequencing (NGS) has promoted genetic diagnoses because of the quickness and affordability of the method. To evaluate the usefulness of NGS in genetic diagnosis, we present the genetic study of RTT-like patients using different techniques based on this technology. We studied 1577 patients with RTT-like clinical diagnoses and reviewed patients who were previously studied and thought to have RTT genes by Sanger sequencing. Genetically, 477 of 1577 patients with a RTT-like suspicion have been diagnosed. Positive results were found in 30% by Sanger sequencing, 23% with a custom panel, 24% with a commercial panel and 32% with whole exome sequencing. A genetic study using NGS allows the study of a larger number of genes associated with RTT-like symptoms simultaneously, providing genetic study of a wider group of patients as well as significantly reducing the response time and cost of the study.
DEFF Research Database (Denmark)
Thirstrup, Janne Pia; Ruiz-Gonzalez, Aritz; Pujolar, José Martin
2015-01-01
Feral American mink populations (Neovison vison), derived from mink farms, are widespread in Europe. In this study we investigated genetic diversity and genetic differentiation between feral and farm mink using a panel of genetic markers (194 SNP) generated from RAD sequencing data. Sampling incl...
Directory of Open Access Journals (Sweden)
Zhang Guojie
2011-07-01
Full Text Available Abstract The recent publication of the draft genome sequences of the Neanderthal and a ~50,000-year-old archaic hominin from Denisova Cave in southern Siberia has ushered in a new age in molecular archaeology. We previously cross-compared the human, chimpanzee and Neanderthal genome sequences with respect to a set of disease-causing/disease-associated missense and regulatory mutations (Human Gene Mutation Database and succeeded in identifying genetic variants which, although apparently pathogenic in humans, may represent a 'compensated' wild-type state in at least one of the other two species. Here, in an attempt to identify further 'potentially compensated mutations' (PCMs of interest, we have compared our dataset of disease-causing/disease-associated mutations with their corresponding nucleotide positions in the Denisovan hominin, Neanderthal and chimpanzee genomes. Of the 15 human putatively disease-causing mutations that were found to be compensated in chimpanzee, Denisovan or Neanderthal, only a solitary F5 variant (Val1736Met was specific to the Denisovan. In humans, this missense mutation is associated with activated protein C resistance and an increased risk of thromboembolism and recurrent miscarriage. It is unclear at this juncture whether this variant was indeed a PCM in the Denisovan or whether it could instead have been associated with disease in this ancient hominin.
Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao
2005-01-01
AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039
Shen, Changbing; Gao, Jing; Sheng, Yujun; Dou, Jinfa; Zhou, Fusheng; Zheng, Xiaodong; Ko, Randy; Tang, Xianfa; Zhu, Caihong; Yin, Xianyong; Sun, Liangdan; Cui, Yong; Zhang, Xuejun
2016-01-01
Vitiligo is an autoimmune disease with a strong genetic component, characterized by areas of depigmented skin resulting from loss of epidermal melanocytes. Genetic factors are known to play key roles in vitiligo through discoveries in association studies and family studies. Previously, vitiligo susceptibility genes were mainly revealed through linkage analysis and candidate gene studies. Recently, our understanding of the genetic basis of vitiligo has been rapidly advancing through genome-wide association study (GWAS). More than 40 robust susceptible loci have been identified and confirmed to be associated with vitiligo by using GWAS. Most of these associated genes participate in important pathways involved in the pathogenesis of vitiligo. Many susceptible loci with unknown functions in the pathogenesis of vitiligo have also been identified, indicating that additional molecular mechanisms may contribute to the risk of developing vitiligo. In this review, we summarize the key loci that are of genome-wide significance, which have been shown to influence vitiligo risk. These genetic loci may help build the foundation for genetic diagnosis and personalize treatment for patients with vitiligo in the future. However, substantial additional studies, including gene-targeted and functional studies, are required to confirm the causality of the genetic variants and their biological relevance in the development of vitiligo. PMID:26870082
Directory of Open Access Journals (Sweden)
Seong Wan Hong
2012-08-01
Full Text Available The small abalone, Haliotis diversicolor supertexta, of the family Haliotidae, is one of the most important species of marine shellfish in eastern Asia. Over the past few decades, this species has drastically declined in Korea. Thus, hatchery-bred seeds have been released into natural coastal areas to compensate for the reduced fishery resources. However, information on the genetic background of the small abalone is scarce. In this study, 20 polymorphic microsatellite DNA markers were identified using next-generation sequencing techniques and used to compare allelic variation between wild and released abalone populations in Korea. Using high-throughput genomic sequencing, a total of 1516 (2.26%; average length of 385 bp reads containing simple sequence repeats were obtained from 86,011 raw reads. Among the 99 loci screened, 28 amplified successfully, and 20 were polymorphic. When comparing allelic variation between wild and released abalone populations, a total of 243 different alleles were observed, with 18.7 alleles per locus. High genetic diversity (mean heterozygosity = 0.81; mean allelic number = 15.5 was observed in both populations. A statistical analysis of the fixation index (FST and analysis of molecular variance (AMOVA indicated limited genetic differences between the two populations (FST = 0.002, p > 0.05. Although no significant reductions in the genetic diversity were found in the released population compared with the wild population (p > 0.05, the genetic diversity parameters revealed that the seeds released for stock abundance had a different genetic composition. These differences are likely a result of hatchery selection and inbreeding. Additionally, all the primer pair sets were effectively amplified in another congeneric species, H. diversicolor diversicolor, indicating that these primers are useful for both abalone species. These microsatellite loci
Directory of Open Access Journals (Sweden)
Valente eAritua
2015-10-01
Full Text Available Common bacterial blight is a devastating seed-borne disease of common beans that also occurs on other legume species including lablab and Lima beans. We sequenced and analysed the genomes of 26 isolates of Xanthomonas axonopodis pv. phaseoli and X. fuscans subsp. fuscans, the causative agents of this disease, collected over four decades and six continents. This revealed considerable genetic variation within both taxa, encompassing both single-nucleotide variants and differences in gene content, that could be exploited for tracking pathogen spread. The bacterial isolate from Lima bean fell within the previously described Genetic Lineage 1, along with the pathovar type isolate (NCPPB 3035. The isolates from lablab represent a new, previously unknown genetic lineage closely related to strains of X. axonopodis pv. glycines. Finally, we identified more than 100 genes that appear to have been recently acquired by Xanthomonas axonopodis pv. phaseoli from X. fuscans subsp. fuscans.
Identifying Interacting Genetic Variations by Fish-Swarm Logic Regression
Yang, Aiyuan; Yan, Chunxia; Zhu, Feng; Zhao, Zhongmeng; Cao, Zhi
2013-01-01
Understanding associations between genotypes and complex traits is a fundamental problem in human genetics. A major open problem in mapping phenotypes is that of identifying a set of interacting genetic variants, which might contribute to complex traits. Logic regression (LR) is a powerful multivariant association tool. Several LR-based approaches have been successfully applied to different datasets. However, these approaches are not adequate with regard to accuracy and efficiency. In this paper, we propose a new LR-based approach, called fish-swarm logic regression (FSLR), which improves the logic regression process by incorporating swarm optimization. In our approach, a school of fish agents are conducted in parallel. Each fish agent holds a regression model, while the school searches for better models through various preset behaviors. A swarm algorithm improves the accuracy and the efficiency by speeding up the convergence and preventing it from dropping into local optimums. We apply our approach on a real screening dataset and a series of simulation scenarios. Compared to three existing LR-based approaches, our approach outperforms them by having lower type I and type II error rates, being able to identify more preset causal sites, and performing at faster speeds. PMID:23984382
Identifying Interacting Genetic Variations by Fish-Swarm Logic Regression
Directory of Open Access Journals (Sweden)
Xuanping Zhang
2013-01-01
Full Text Available Understanding associations between genotypes and complex traits is a fundamental problem in human genetics. A major open problem in mapping phenotypes is that of identifying a set of interacting genetic variants, which might contribute to complex traits. Logic regression (LR is a powerful multivariant association tool. Several LR-based approaches have been successfully applied to different datasets. However, these approaches are not adequate with regard to accuracy and efficiency. In this paper, we propose a new LR-based approach, called fish-swarm logic regression (FSLR, which improves the logic regression process by incorporating swarm optimization. In our approach, a school of fish agents are conducted in parallel. Each fish agent holds a regression model, while the school searches for better models through various preset behaviors. A swarm algorithm improves the accuracy and the efficiency by speeding up the convergence and preventing it from dropping into local optimums. We apply our approach on a real screening dataset and a series of simulation scenarios. Compared to three existing LR-based approaches, our approach outperforms them by having lower type I and type II error rates, being able to identify more preset causal sites, and performing at faster speeds.
Reference genome sequence of the model plant Setaria.
Bennetzen, Jeffrey L; Schmutz, Jeremy; Wang, Hao; Percifield, Ryan; Hawkins, Jennifer; Pontaroli, Ana C; Estep, Matt; Feng, Liang; Vaughn, Justin N; Grimwood, Jane; Jenkins, Jerry; Barry, Kerrie; Lindquist, Erika; Hellsten, Uffe; Deshpande, Shweta; Wang, Xuewen; Wu, Xiaomei; Mitros, Therese; Triplett, Jimmy; Yang, Xiaohan; Ye, Chu-Yu; Mauro-Herrera, Margarita; Wang, Lin; Li, Pinghua; Sharma, Manoj; Sharma, Rita; Ronald, Pamela C; Panaud, Olivier; Kellogg, Elizabeth A; Brutnell, Thomas P; Doust, Andrew N; Tuskan, Gerald A; Rokhsar, Daniel; Devos, Katrien M
2012-05-13
We generated a high-quality reference genome sequence for foxtail millet (Setaria italica). The ∼400-Mb assembly covers ∼80% of the genome and >95% of the gene space. The assembly was anchored to a 992-locus genetic map and was annotated by comparison with >1.3 million expressed sequence tag reads. We produced more than 580 million RNA-Seq reads to facilitate expression analyses. We also sequenced Setaria viridis, the ancestral wild relative of S. italica, and identified regions of differential single-nucleotide polymorphism density, distribution of transposable elements, small RNA content, chromosomal rearrangement and segregation distortion. The genus Setaria includes natural and cultivated species that demonstrate a wide capacity for adaptation. The genetic basis of this adaptation was investigated by comparing five sequenced grass genomes. We also used the diploid Setaria genome to evaluate the ongoing genome assembly of a related polyploid, switchgrass (Panicum virgatum).
Reference genome sequence of the model plant Setaria
Energy Technology Data Exchange (ETDEWEB)
Bennetzen, Jeffrey L [ORNL; Schmutz, Jeremy [Hudson Alpha Institute of Biotechnology; Wang, Hao [University of Georgia, Athens, GA; Percifield, Ryan [University of Georgia, Athens, GA; Hawkins, Jennifer [University of Georgia, Athens, GA; Pontaroli, Ana C. [University of Georgia, Athens, GA; Estep, Matt [University of Georgia, Athens, GA; Feng, Liang [University of Georgia, Athens, GA; Vaughn, Justin N [ORNL; Grimwood, Jane [Hudson Alpha Institute of Biotechnology; Jenkins, Jerry [Hudson Alpha Institute of Biotechnology; Barry, Kerrie [U.S. Department of Energy, Joint Genome Institute; Lindquist, Erika [U.S. Department of Energy, Joint Genome Institute; Hellsten, Uffe [U.S. Department of Energy, Joint Genome Institute; Deshpande, Shweta [U.S. Department of Energy, Joint Genome Institute; Wang, Xuewen [University of Georgia, Athens, GA; Wu, Xiaomei [University of Georgia, Athens, GA; Mitros, Therese [University of California, Berkeley; Triplett, Jimmy [University of Missouri, St. Louis; Yang, Xiaohan [ORNL; Ye, Chuyu [ORNL; Mauro-Herrera, Margarita [Oklahoma State University; Wang, Lin [Cornell University; Li, Pinghua [Cornell University; Sharma, Manoj [University of California, Davis; Sharma, Rita [University of California, Davis; Ronald, Pamela [University of California, Davis; Panaud, Olivier [Universite de Perpignan, Perpignan, France; Kellogg, Elizabeth A. [University of Missouri, St. Louis; Brutnell, Thomas P. [Cornell University; Doust, Andrew N. [Oklahoma State University; Tuskan, Gerald A [ORNL; Rokhsar, Daniel [U.S. Department of Energy, Joint Genome Institute; Devos, Katrien M [ORNL
2012-01-01
We generated a high-quality reference genome sequence for foxtail millet (Setaria italica). The ~400-Mb assembly covers ~80% of the genome and >95% of the gene space. The assembly was anchored to a 992-locus genetic map and was annotated by comparison with >1.3 million expressed sequence tag reads. We produced more than 580 million RNA-Seq reads to facilitate expression analyses. We also sequenced Setaria viridis, the ancestral wild relative of S. italica, and identified regions of differential single-nucleotide polymorphism density, distribution of transposable elements, small RNA content, chromosomal rearrangement and segregation distortion. The genus Setaria includes natural and cultivated species that demonstrate a wide capacity for adaptation. The genetic basis of this adaptation was investigated by comparing five sequenced grass genomes. We also used the diploid Setaria genome to evaluate the ongoing genome assembly of a related polyploid, switchgrass (Panicum virgatum).
Reference genome sequence of the model plant Setaria
Energy Technology Data Exchange (ETDEWEB)
Bennetzen, Jeffrey L [ORNL; Yang, Xiaohan [ORNL; Ye, Chuyu [ORNL; Tuskan, Gerald A [ORNL
2012-01-01
We generated a high-quality reference genome sequence for foxtail millet (Setaria italica). The {approx}400-Mb assembly covers {approx}80% of the genome and >95% of the gene space. The assembly was anchored to a 992-locus genetic map and was annotated by comparison with >1.3 million expressed sequence tag reads. We produced more than 580 million RNA-Seq reads to facilitate expression analyses. We also sequenced Setaria viridis, the ancestral wild relative of S. italica, and identified regions of differential single-nucleotide polymorphism density, distribution of transposable elements, small RNA content, chromosomal rearrangement and segregation distortion. The genus Setaria includes natural and cultivated species that demonstrate a wide capacity for adaptation. The genetic basis of this adaptation was investigated by comparing five sequenced grass genomes. We also used the diploid Setaria genome to evaluate the ongoing genome assembly of a related polyploid, switchgrass (Panicum virgatum).
Song, Qinxin; Wei, Guijiang; Zhou, Guohua
2014-07-01
A portable bioluminescence analyser for detecting the DNA sequence of genetically modified organisms (GMOs) was developed by using a photodiode (PD) array. Pyrosequencing on eight genes (zSSIIb, Bt11 and Bt176 gene of genetically modified maize; Lectin, 35S-CTP4, CP4EPSPS, CaMV35S promoter and NOS terminator of the genetically modified Roundup ready soya) was successfully detected with this instrument. The corresponding limit of detection (LOD) was 0.01% with 35 PCR cycles. The maize and soya available from three different provenances in China were detected. The results indicate that pyrosequencing using the small size of the detector is a simple, inexpensive, and reliable way in a farm/field test of GMO analysis. Copyright © 2014 Elsevier Ltd. All rights reserved.
Anantaphruti, Malinee Thairungroj; Thaenkham, Urusa; Watthanakulpanich, Dorn; Phuphisut, Orawan; Maipanich, Wanna; Yoonuan, Tippayarat; Nuamtanong, Supaporn; Pubampen, Somjit; Sanguankiat, Surapol
2013-02-01
Twelve 924 bp cytochrome c oxidase subunit 1 (cox1) mitochondrial DNA sequences from Taenia asiatica isolates from Thailand were aligned and compared with multiple sequence isolates from Thailand and 6 other countries from the GenBank database. The genetic divergence of T. asiatica was also compared with Taenia saginata database sequences from 6 different countries in Asia, including Thailand, and 3 countries from other continents. The results showed that there were minor genetic variations within T. asiatica species, while high intraspecies variation was found in T. saginata. There were only 2 haplotypes and 1 polymorphic site found in T. asiatica, but 8 haplotypes and 9 polymorphic sites in T. saginata. Haplotype diversity was very low, 0.067, in T. asiatica and high, 0.700, in T. saginata. The very low genetic diversity suggested that T. asiatica may be at a risk due to the loss of potential adaptive alleles, resulting in reduced viability and decreased responses to environmental changes, which may endanger the species.
Directory of Open Access Journals (Sweden)
Manjunatha N Belaganahalli
Full Text Available Eubenangee virus has previously been identified as the cause of Tammar sudden death syndrome (TSDS. Eubenangee virus (EUBV, Tilligery virus (TILV, Pata virus (PATAV and Ngoupe virus (NGOV are currently all classified within the Eubenangee virus species of the genus Orbivirus, family Reoviridae. Full genome sequencing confirmed that EUBV and TILV (both of which are from Australia show high levels of aa sequence identity (>92% in the conserved polymerase VP1(Pol, sub-core VP3(T2 and outer core VP7(T13 proteins, and are therefore appropriately classified within the same virus species. However, they show much lower amino acid (aa identity levels in their larger outer-capsid protein VP2 (<53%, consistent with membership of two different serotypes - EUBV-1 and EUBV-2 (respectively. In contrast PATAV showed significantly lower levels of aa sequence identity with either EUBV or TILV (with <71% in VP1(Pol and VP3(T2, and <57% aa identity in VP7(T13 consistent with membership of a distinct virus species. A proposal has therefore been sent to the Reoviridae Study Group of ICTV to recognise 'Pata virus' as a new Orbivirus species, with the PATAV isolate as serotype 1 (PATAV-1. Amongst the other orbiviruses, PATAV shows closest relationships to Epizootic Haemorrhagic Disease virus (EHDV, with 80.7%, 72.4% and 66.9% aa identity in VP3(T2, VP1(Pol, and VP7(T13 respectively. Although Ngoupe virus was not available for these studies, like PATAV it was isolated in Central Africa, and therefore seems likely to also belong to the new species, possibly as a distinct 'type'. The data presented will facilitate diagnostic assay design and the identification of additional isolates of these viruses.
Impact of exome sequencing in inflammatory bowel disease
Cardinale, Christopher J; Kelsen, Judith R; Baldassano, Robert N; Hakonarson, Hakon
2013-01-01
Approaches to understanding the genetic contribution to inflammatory bowel disease (IBD) have continuously evolved from family- and population-based epidemiology, to linkage analysis, and most recently, to genome-wide association studies (GWAS). The next stage in this evolution seems to be the sequencing of the exome, that is, the regions of the human genome which encode proteins. The GWAS approach has been very fruitful in identifying at least 163 loci as being associated with IBD, and now, exome sequencing promises to take our genetic understanding to the next level. In this review we will discuss the possible contributions that can be made by an exome sequencing approach both at the individual patient level to aid with disease diagnosis and future therapies, as well as in advancing knowledge of the pathogenesis of IBD. PMID:24187447
Sigrist, M S; Pinheiro, J B; Filho, J A Azevedo; Zucchi, M I
2011-03-09
Turmeric (Curcuma longa) is a triploid, vegetatively propagated crop introduced early during the colonization of Brazil. Turmeric rhizomes are ground into a powder used as a natural dye in the food industry, although recent research suggests a greater potential for the development of drugs and cosmetics. In Brazil, little is known about the genetic variability available for crop improvement. We examined the genetic diversity among turmeric accessions from a Brazilian germplasm collection comprising 39 accessions collected from the States of Goiás, Mato Grosso do Sul, Minas Gerais, São Paulo, and Pará. For comparison, 18 additional genotypes were analyzed, including samples from India and Puerto Rico. Total DNA was extracted from lyophilized leaf tissue and genetic analysis was performed using 17 microsatellite markers (single-sequence repeats). Shannon-Weiner indexes ranged from 0.017 (Minas Gerais) to 0.316 (São Paulo). Analyses of molecular variance (AMOVA) demonstrated major differences between countries (63.4%) and that most of the genetic diversity in Brazil is found within states (75.3%). Genotypes from São Paulo State were the most divergent and potentially useful for crop improvement. Structure analysis indicated two main groups of accessions. These results can help target future collecting efforts for introduction of new materials needed to develop more productive and better adapted cultivars.
Exome sequencing identifies highly recurrent MED12 somatic mutations in breast fibroadenoma.
Lim, Weng Khong; Ong, Choon Kiat; Tan, Jing; Thike, Aye Aye; Ng, Cedric Chuan Young; Rajasegaran, Vikneswari; Myint, Swe Swe; Nagarajan, Sanjanaa; Nasir, Nur Diyana Md; McPherson, John R; Cutcutache, Ioana; Poore, Gregory; Tay, Su Ting; Ooi, Wei Siong; Tan, Veronique Kiak Mien; Hartman, Mikael; Ong, Kong Wee; Tan, Benita K T; Rozen, Steven G; Tan, Puay Hoon; Tan, Patrick; Teh, Bin Tean
2014-08-01
Fibroadenomas are the most common breast tumors in women under 30 (refs. 1,2). Exome sequencing of eight fibroadenomas with matching whole-blood samples revealed recurrent somatic mutations solely in MED12, which encodes a Mediator complex subunit. Targeted sequencing of an additional 90 fibroadenomas confirmed highly frequent MED12 exon 2 mutations (58/98, 59%) that are probably somatic, with 71% of mutations occurring in codon 44. Using laser capture microdissection, we show that MED12 fibroadenoma mutations are present in stromal but not epithelial mammary cells. Expression profiling of MED12-mutated and wild-type fibroadenomas revealed that MED12 mutations are associated with dysregulated estrogen signaling and extracellular matrix organization. The fibroadenoma MED12 mutation spectrum is nearly identical to that of previously reported MED12 lesions in uterine leiomyoma but not those of other tumors. Benign tumors of the breast and uterus, both of which are key target tissues of estrogen, may thus share a common genetic basis underpinned by highly frequent and specific MED12 mutations.
Xue, J J; Xue, J F; Xue, H Q; Guo, Y Y; Liu, Y; Ouyang, N
2016-09-19
Albinism is a diverse group of hypopigmentary disorders caused by multiple-genetic defects. The genetic diagnosis of patients affected with albinism by Sanger sequencing is often complex, expensive, and time-consuming. In this study, we performed targeted next-generation sequencing to screen for 16 genes in a patient with albinism, and identified 21 genetic variants, including 19 known single nucleotide polymorphisms, one novel missense mutation (c.1456 G>A), and one disease-causing mutation (c.478 G>C). The novel mutation was not observed in 100 controls, and was predicted to be a damaging mutation by SIFT and Polyphen. Thus, we identified a novel mutation in SLC45A2 in a Chinese family, expanding the mutational spectrum of albinism. Our results also demonstrate that targeted next-generation sequencing is an effective genetic test for albinism.
Hong, Jungeui; Gresham, David
2017-11-01
Quantitative analysis of next-generation sequencing (NGS) data requires discriminating duplicate reads generated by PCR from identical molecules that are of unique origin. Typically, PCR duplicates are identified as sequence reads that align to the same genomic coordinates using reference-based alignment. However, identical molecules can be independently generated during library preparation. Misidentification of these molecules as PCR duplicates can introduce unforeseen biases during analyses. Here, we developed a cost-effective sequencing adapter design by modifying Illumina TruSeq adapters to incorporate a unique molecular identifier (UMI) while maintaining the capacity to undertake multiplexed, single-index sequencing. Incorporation of UMIs into TruSeq adapters (TrUMIseq adapters) enables identification of bona fide PCR duplicates as identically mapped reads with identical UMIs. Using TrUMIseq adapters, we show that accurate removal of PCR duplicates results in improved accuracy of both allele frequency (AF) estimation in heterogeneous populations using DNA sequencing and gene expression quantification using RNA-Seq.
Directory of Open Access Journals (Sweden)
Monika Sharma
Full Text Available The genetic diversity and population genetics of the Echinococcus granulosus sensu stricto complex were investigated based on sequencing of mitochondrial DNA (mtDNA. Total 81 isolates of hydatid cyst collected from ungulate animals from different geographical areas of North India were identified by sequencing of cytochrome c oxidase subunit1 (coxi gene. Three genotypes belonging to E. granulosus sensu stricto complex were identified (G1, G2 and G3 genotypes. Further the nucleotide sequences (retrieved from GenBank for the coxi gene from seven populations of E. granulosus sensu stricto complex covering 6 continents, were compared with sequences of isolates analysed in this study. Molecular diversity indices represent overall high mitochondrial DNA diversity for these populations, but low nucleotide diversity between haplotypes. The neutrality tests were used to analyze signatures of historical demographic events. The Tajima's D test and Fu's FS test showed negative value, indicating deviations from neutrality and both suggested recent population expansion for the populations. Pairwise fixation index was significant for pairwise comparison of different populations (except between South America and East Asia, Middle East and Europe, South America and Europe, Africa and Australia, indicating genetic differentiation among populations. Based on the findings of the present study and those from earlier studies, we hypothesize that demographic expansion occurred in E. granulosus after the introduction of founder haplotype particular by anthropogenic movements.
Genetic diversity of mtDNA D-loop sequences in four native Chinese chicken breeds.
Guo, H W; Li, C; Wang, X N; Li, Z J; Sun, G R; Li, G X; Liu, X J; Kang, X T; Han, R L
2017-10-01
1. To explore the genetic diversity of Chinese indigenous chicken breeds, a 585 bp fragment of the mitochondrial DNA (mtDNA) region was sequenced in 102 birds from the Xichuan black-bone chicken, Yunyang black-bone chicken and Lushi chicken. In addition, 30 mtDNA D-loop sequences of Silkie fowls were downloaded from NCBI. The mtDNA D-loop sequence polymorphism and maternal origin of 4 chicken breeds were analysed in this study. 2. The results showed that a total of 33 mutation sites and 28 haplotypes were detected in the 4 chicken breeds. The haplotype diversity and nucleotide diversity of these 4 native breeds were 0.916 ± 0.014 and 0.012 ± 0.002, respectively. Three clusters were formed in 4 Chinese native chickens and 12 reference breeds. Both the Xichuan black-bone chicken and Yunyang black-bone chicken were grouped into one cluster. Four haplogroups (A, B, C and E) emerged in the median-joining network in these breeds. 3. It was concluded that these 4 Chinese chicken breeds had high genetic diversity. The phylogenetic tree and median network profiles showed that Chinese native chickens and its neighbouring countries had at least two maternal origins, one from Yunnan, China and another from Southeast Asia or its surrounding area.
Tsangaras, Kyriakos; Mayer, Jens; Alquezar-Planas, David E; Greenwood, Alex D
2015-11-24
Transcriptome analysis of polar bear (Ursus maritimus) tissues identified sequences with similarity to Porcine Endogenous Retroviruses (PERV). Based on these sequences, four proviral copies and 15 solo long terminal repeats (LTRs) of a newly described endogenous retrovirus were characterized from the polar bear draft genome sequence. Closely related sequences were identified by PCR analysis of brown bear (Ursus arctos) and black bear (Ursus americanus) but were absent in non-Ursinae bear species. The virus was therefore designated UrsusERV. Two distinct groups of LTRs were observed including a recombinant ERV that contained one LTR belonging to each group indicating that genomic invasions by at least two UrsusERV variants have recently occurred. Age estimates based on proviral LTR divergence and conservation of integration sites among ursids suggest the viral group is only a few million years old. The youngest provirus was polar bear specific, had intact open reading frames (ORFs) and could potentially encode functional proteins. Phylogenetic analyses of UrsusERV consensus protein sequences suggest that it is part of a pig, gibbon and koala retrovirus clade. The young age estimates and lineage specificity of the virus suggests UrsusERV is a recent cross species transmission from an unknown reservoir and places the viral group among the youngest of ERVs identified in mammals.
Tsangaras, Kyriakos; Mayer, Jens; Alquezar-Planas, David E.; Greenwood, Alex D.
2015-01-01
Transcriptome analysis of polar bear (Ursus maritimus) tissues identified sequences with similarity to Porcine Endogenous Retroviruses (PERV). Based on these sequences, four proviral copies and 15 solo long terminal repeats (LTRs) of a newly described endogenous retrovirus were characterized from the polar bear draft genome sequence. Closely related sequences were identified by PCR analysis of brown bear (Ursus arctos) and black bear (Ursus americanus) but were absent in non-Ursinae bear species. The virus was therefore designated UrsusERV. Two distinct groups of LTRs were observed including a recombinant ERV that contained one LTR belonging to each group indicating that genomic invasions by at least two UrsusERV variants have recently occurred. Age estimates based on proviral LTR divergence and conservation of integration sites among ursids suggest the viral group is only a few million years old. The youngest provirus was polar bear specific, had intact open reading frames (ORFs) and could potentially encode functional proteins. Phylogenetic analyses of UrsusERV consensus protein sequences suggest that it is part of a pig, gibbon and koala retrovirus clade. The young age estimates and lineage specificity of the virus suggests UrsusERV is a recent cross species transmission from an unknown reservoir and places the viral group among the youngest of ERVs identified in mammals. PMID:26610552
Griffin, Matt J.; Quiniou, Sylvie M.; Cody, Theresa; Tabuchi, Maki; Ware, Cynthia; Cipriano, Rocco C.; Mauel, Michael J.; Soto, Esteban
2013-01-01
Edwardsiella tarda, a Gram-negative member of the family Enterobacteriaceae, has been implicated in significant losses in aquaculture facilities worldwide. Here, we assessed the intra-specific variability of E. tarda isolates from 4 different fish species in the eastern United States. Repetitive sequence mediated PCR (rep-PCR) using 4 different primer sets (ERIC I & II, ERIC II, BOX, and GTG5) and multi-locus sequence analysis of 16S SSU rDNA, groEl, gyrA, gyrB, pho, pgi, pgm, and rpoA gene fragments identified two distinct genotypes of E. tarda (DNA group I; DNA group II). Isolates that fell into DNA group II demonstrated more similarity to E. ictaluri than DNA group I, which contained the reference E. tarda strain (ATCC #15947). Conventional PCR analysis using published E. tarda-specific primer sets yielded variable results, with several primer sets producing no observable amplification of target DNA from some isolates. Fluorometric determination of G + C content demonstrated 56.4% G + C content for DNA group I, 60.2% for DNA group II, and 58.4% for E. ictaluri. Surprisingly, these isolates were indistinguishable using conventional biochemical techniques, with all isolates demonstrating phenotypic characteristics consistent with E. tarda. Analysis using two commercial test kits identified multiple phenotypes, although no single metabolic characteristic could reliably discriminate between genetic groups. Additionally, anti-microbial susceptibility and fatty acid profiles did not demonstrate remarkable differences between groups. The significant genetic variation (<90% similarity at gyrA, gyrB, pho, phi and pgm; <40% similarity by rep-PCR) between these groups suggests organisms from DNA group II may represent an unrecognized, genetically distinct taxa of Edwardsiella that is phenotypically indistinguishable from E. tarda.
Identifying public expectations of genetic biobanks.
Critchley, Christine; Nicol, Dianne; McWhirter, Rebekah
2017-08-01
Understanding public priorities for biobanks is vital for maximising utility and efficiency of genetic research and maintaining respect for donors. This research directly assessed the relative importance the public place on different expectations of biobanks. Quantitative and qualitative results from a national sample of 800 Australians revealed that the majority attributed more importance to protecting privacy and ethical conduct than maximising new healthcare benefits, which was in turn viewed as more important than obtaining specific consent, benefit sharing, collaborating and sharing data. A latent class analysis identified two distinct classes displaying different patterns of expectations. One placed higher priority on behaviours that respect the donor ( n = 623), the other on accelerating science ( n = 278). Additional expectations derived from qualitative data included the need for biobanks to be transparent and to prioritise their research focus, educate the public and address commercialisation.
Gomez-Valero, Laura; Rusniok, Christophe; Rolando, Monica; Neou, Mario; Dervins-Ravault, Delphine; Demirtas, Jasmin; Rouy, Zoe; Moore, Robert J; Chen, Honglei; Petty, Nicola K; Jarraud, Sophie; Etienne, Jerome; Steinert, Michael; Heuner, Klaus; Gribaldo, Simonetta; Médigue, Claudine; Glöckner, Gernot; Hartland, Elizabeth L; Buchrieser, Carmen
2014-01-01
The genus Legionella comprises over 60 species. However, L. pneumophila and L. longbeachae alone cause over 95% of Legionnaires’ disease. To identify the genetic bases underlying the different capacities to cause disease we sequenced and compared the genomes of L. micdadei, L. hackeliae and L. fallonii (LLAP10), which are all rarely isolated from humans. We show that these Legionella species possess different virulence capacities in amoeba and macrophages, correlating with their occurrence in humans. Our comparative analysis of 11 Legionella genomes belonging to five species reveals highly heterogeneous genome content with over 60% representing species-specific genes; these comprise a complete prophage in L. micdadei, the first ever identified in a Legionella genome. Mobile elements are abundant in Legionella genomes; many encode type IV secretion systems for conjugative transfer, pointing to their importance for adaptation of the genus. The Dot/Icm secretion system is conserved, although the core set of substrates is small, as only 24 out of over 300 described Dot/Icm effector genes are present in all Legionella species. We also identified new eukaryotic motifs including thaumatin, synaptobrevin or clathrin/coatomer adaptine like domains. Legionella genomes are highly dynamic due to a large mobilome mainly comprising type IV secretion systems, while a minority of core substrates is shared among the diverse species. Eukaryotic like proteins and motifs remain a hallmark of the genus Legionella. Key factors such as proteins involved in oxygen binding, iron storage, host membrane transport and certain Dot/Icm substrates are specific features of disease-related strains.
Directory of Open Access Journals (Sweden)
Hengxing Ba
2017-09-01
Full Text Available Sika deer are an economically valuable species owing to their use in traditional Chinese medicine, particularly their velvet antlers. Sika deer in northeast China are mostly farmed in enclosure. Therefore, genetic management of farmed sika deer would benefit from detailed knowledge of their genetic diversity. In this study, we generated over 1.45 billion high-quality paired-end reads (288 Gbp across 42 unrelated individuals using double-digest restriction site-associated DNA sequencing (ddRAD-seq. A total of 96,188 (29.63% putative biallelic SNP loci were identified with an average sequencing depth of 23×. Based on the analysis, we found that the majority of the loci had a deficit of heterozygotes (FIS >0 and low values of Hobs, which could be due to inbreeding and Wahlund effects. We also developed a collection of high-quality SNP probes that will likely be useful in a variety of applications in genotyping for cervid species in the future.
Ba, Hengxing; Jia, Boyin; Wang, Guiwu; Yang, Yifeng; Kedem, Gilead; Li, Chunyi
2017-09-07
Sika deer are an economically valuable species owing to their use in traditional Chinese medicine, particularly their velvet antlers. Sika deer in northeast China are mostly farmed in enclosure. Therefore, genetic management of farmed sika deer would benefit from detailed knowledge of their genetic diversity. In this study, we generated over 1.45 billion high-quality paired-end reads (288 Gbp) across 42 unrelated individuals using double-digest restriction site-associated DNA sequencing (ddRAD-seq). A total of 96,188 (29.63%) putative biallelic SNP loci were identified with an average sequencing depth of 23×. Based on the analysis, we found that the majority of the loci had a deficit of heterozygotes (F IS >0) and low values of H obs , which could be due to inbreeding and Wahlund effects. We also developed a collection of high-quality SNP probes that will likely be useful in a variety of applications in genotyping for cervid species in the future. Copyright © 2017 Ba et al.
Currás-Freixes, Maria; Piñeiro-Yañez, Elena; Montero-Conde, Cristina; Apellániz-Ruiz, María; Calsina, Bruna; Mancikova, Veronika; Remacha, Laura; Richter, Susan; Ercolino, Tonino; Rogowski-Lehmann, Natalie; Deutschbein, Timo; Calatayud, María; Guadalix, Sonsoles; Álvarez-Escolá, Cristina; Lamas, Cristina; Aller, Javier; Sastre-Marcos, Julia; Lázaro, Conxi; Galofré, Juan C.; Patiño-García, Ana; Meoro-Avilés, Amparo; Balmaña-Gelpi, Judith; De Miguel-Novoa, Paz; Balbín, Milagros; Matías-Guiu, Xavier; Letón, Rocío; Inglada-Pérez, Lucía; Torres-Pérez, Rafael; Roldán-Romero, Juan M.; Rodríguez-Antona, Cristina; Fliedner, Stephanie M J; Opocher, Giuseppe; Pacak, Karel; Korpershoek, Esther; de Krijger, Ronald R.; Vroonen, Laurent; Mannelli, Massimo; Fassnacht, Martin; Beuschlein, Felix; Eisenhofer, Graeme; Cascón, Alberto; Al-Shahrour, Fátima; Robledo, Mercedes
2017-01-01
Genetic diagnosis is recommended for all pheochromocytoma and paraganglioma (PPGL) cases, as driver mutations are identified in approximately 80% of the cases. As the list of related genes expands, genetic diagnosis becomes more time-consuming, and targeted next-generation sequencing (NGS) has
Zhang, Xue-Cheng; Millet, Yves; Ausubel, Frederick M; Borowsky, Mark
2014-10-01
Forward genetic analysis using ethyl methanesulfonate (EMS) mutagenesis has proven to be a powerful tool in biological research, but identification and cloning of causal mutations by conventional genetic mapping approaches is a painstaking process. Recent advances in next-gen sequencing have greatly invigorated the process of identifying EMS-induced mutations corresponding to a specific phenotype in model genetic hosts, including the plant Arabidopsis thaliana and the nematode Caenorhabditis elegans. Next-gen sequencing of bulked F2 mutant recombinants produces a wealth of high-resolution genetic data, provides enhanced delimitation of the genomic location of mutations, and greatly reduces hands-on time while maintaining high accuracy and reproducibility. In this unit, a detailed procedure to simultaneously map and identify EMS mutations in Arabidopsis is described. Copyright © 2014 John Wiley & Sons, Inc.
Population genomics of parallel adaptation in threespine stickleback using sequenced RAD tags.
Directory of Open Access Journals (Sweden)
Paul A Hohenlohe
2010-02-01
Full Text Available Next-generation sequencing technology provides novel opportunities for gathering genome-scale sequence data in natural populations, laying the empirical foundation for the evolving field of population genomics. Here we conducted a genome scan of nucleotide diversity and differentiation in natural populations of threespine stickleback (Gasterosteus aculeatus. We used Illumina-sequenced RAD tags to identify and type over 45,000 single nucleotide polymorphisms (SNPs in each of 100 individuals from two oceanic and three freshwater populations. Overall estimates of genetic diversity and differentiation among populations confirm the biogeographic hypothesis that large panmictic oceanic populations have repeatedly given rise to phenotypically divergent freshwater populations. Genomic regions exhibiting signatures of both balancing and divergent selection were remarkably consistent across multiple, independently derived populations, indicating that replicate parallel phenotypic evolution in stickleback may be occurring through extensive, parallel genetic evolution at a genome-wide scale. Some of these genomic regions co-localize with previously identified QTL for stickleback phenotypic variation identified using laboratory mapping crosses. In addition, we have identified several novel regions showing parallel differentiation across independent populations. Annotation of these regions revealed numerous genes that are candidates for stickleback phenotypic evolution and will form the basis of future genetic analyses in this and other organisms. This study represents the first high-density SNP-based genome scan of genetic diversity and differentiation for populations of threespine stickleback in the wild. These data illustrate the complementary nature of laboratory crosses and population genomic scans by confirming the adaptive significance of previously identified genomic regions, elucidating the particular evolutionary and demographic history of such
Cyclic Concatenated Genetic Encoder: A mathematical proposal for biological inferences.
Duarte-González, M E; Echeverri, O Y; Guevara, J M; Palazzo, R
2018-01-01
The organization of the genetic information and its ability to be conserved and translated to proteins with low error rates have been the subject of study by scientists from different disciplines. Recently, it has been proposed that living organisms display an intra-cellular transmission system of genetic information, similar to a model of digital communication system, in which there is the ability to detect and correct errors. In this work, the concept of Concatenated Genetic Encoder is introduced and applied to the analysis of protein sequences as a tool for exploring evolutionary relationships. For such purposes Error Correcting Codes (ECCs) are used to represent proteins. A methodology for representing or identifying proteins by use of BCH codes over ℤ 20 and F 4 ×ℤ 5 is proposed and cytochrome b6-f complex subunit 6-OS sequences, corresponding to different plants species, are analyzed according to the proposed methodology and results are contrasted to phylogenetic and taxonomic analyses. Through the analyses, it was observed that using BCH codes only some sequences are identified, all of which differ in one amino acid from the original sequence. In addition, mathematical relationships among identified sequences are established by considering minimal polynomials, where such sequences showed a close relationship as revealed in the phylogenetic reconstruction. Results, here shown, point out that communication theory may provide biology of interesting and useful tools to identify biological relationships among proteins, however the proposed methodology needs to be improved and rigorously tested in order to become into an applicable tool for biological analysis. Copyright © 2017 Elsevier B.V. All rights reserved.
Ginther, C; Corach, D; Penacino, G A; Rey, J A; Carnese, F R; Hutz, M H; Anderson, A; Just, J; Salzano, F M; King, M C
1993-01-01
DNA samples from 60 Mapuche Indians, representing 39 maternal lineages, were genetically characterized for (1) nucleotide sequences of the mtDNA control region; (2) presence or absence of a nine base duplication in mtDNA region V; (3) HLA loci DRB1 and DQA1; (4) variation at three nuclear genes with short tandem repeats; and (5) variation at the polymorphic marker D2S44. The genetic profile of the Mapuche population was compared to other Amerinds and to worldwide populations. Two highly polymorphic portions of the mtDNA control region, comprising 650 nucleotides, were amplified by the polymerase chain reaction (PCR) and directly sequenced. The 39 maternal lineages were defined by two or three generation families identified by the Mapuches. These 39 lineages included 19 different mtDNA sequences that could be grouped into four classes. The same classes of sequences appear in other Amerinds from North, Central, and South American populations separated by thousands of miles, suggesting that the origin of the mtDNA patterns predates the migration to the Americas. The mtDNA sequence similarity between Amerind populations suggests that the migration throughout the Americas occurred rapidly relative to the mtDNA mutation rate. HLA DRB1 alleles 1602 and 1402 were frequent among the Mapuches. These alleles also occur at high frequency among other Amerinds in North and South America, but not among Spanish, Chinese or African-American populations. The high frequency of these alleles throughout the Americas, and their specificity to the Americas, supports the hypothesis that Mapuches and other Amerind groups are closely related.(ABSTRACT TRUNCATED AT 250 WORDS)
Applying Next Generation Sequencing to Skeletal Development and Disease
Bowen, Margot Elizabeth
2013-01-01
Next Generation Sequencing (NGS) technologies have dramatically increased the throughput and lowered the cost of DNA sequencing. In this thesis, I apply these technologies to unresolved questions in skeletal development and disease. Firstly, I use targeted re-sequencing of genomic DNA to identify the genetic cause of the cartilage tumor syndrome, metachondromatosis (MC). I show that the majority of MC patients carry heterozygous loss-of-function mutations in the PTPN11 gene, which encodes a p...
van Rheenen, Wouter; Shatunov, Aleksey; Dekker, Annelot M; McLaughlin, Russell L; Diekstra, Frank P; Pulit, Sara L; van der Spek, Rick A A; Võsa, Urmo; de Jong, Simone; Robinson, Matthew R; Yang, Jian; Fogh, Isabella; van Doormaal, Perry Tc; Tazelaar, Gijs H P; Koppers, Max; Blokhuis, Anna M; Sproviero, William; Jones, Ashley R; Kenna, Kevin P; van Eijk, Kristel R; Harschnitz, Oliver; Schellevis, Raymond D; Brands, William J; Medic, Jelena; Menelaou, Androniki; Vajda, Alice; Ticozzi, Nicola; Lin, Kuang; Rogelj, Boris; Vrabec, Katarina; Ravnik-Glavač, Metka; Koritnik, Blaž; Zidar, Janez; Leonardis, Lea; Grošelj, Leja Dolenc; Millecamps, Stéphanie; Salachas, François; Meininger, Vincent; de Carvalho, Mamede; Pinto, Susana; Mora, Jesus S; Rojas-García, Ricardo; Polak, Meraida; Chandran, Siddharthan; Colville, Shuna; Swingler, Robert; Morrison, Karen E; Shaw, Pamela J; Hardy, John; Orrell, Richard W; Pittman, Alan; Sidle, Katie; Fratta, Pietro; Malaspina, Andrea; Topp, Simon; Petri, Susanne; Abdulla, Susanne; Drepper, Carsten; Sendtner, Michael; Meyer, Thomas; Ophoff, Roel A.; Staats, Kim A; Wiedau-Pazos, Martina; Lomen-Hoerth, Catherine; Van Deerlin, Vivianna M; Trojanowski, John Q; Elman, Lauren; McCluskey, Leo; Basak, A Nazli; Tunca, Ceren; Hamzeiy, Hamid; Parman, Yesim; Meitinger, Thomas; Lichtner, Peter; Radivojkov-Blagojevic, Milena; Andres, Christian R; Maurel, Cindy; Bensimon, Gilbert; Landwehrmeyer, Bernhard; Brice, Alexis; Payan, Christine A M; Saker-Delye, Safaa; Dürr, Alexandra; Wood, Nicholas W; Tittmann, Lukas; Lieb, Wolfgang; Franke, Andre; Rietschel, Marcella; Cichon, Sven; Nöthen, Markus M; Amouyel, Philippe; Tzourio, Christophe; Dartigues, Jean-François; Uitterlinden, Andre G; Rivadeneira, Fernando; Estrada, Karol; Hofman, Albert; Curtis, Charles; Blauw, Hylke M; van der Kooi, Anneke J; de Visser, Marianne; Goris, An; Weber, Markus; Shaw, Christopher E; Smith, Bradley N; Pansarasa, Orietta; Cereda, Cristina; Del Bo, Roberto; Comi, Giacomo P; D'Alfonso, Sandra; Bertolin, Cinzia; Sorarù, Gianni; Mazzini, Letizia; Pensato, Viviana; Gellera, Cinzia; Tiloca, Cinzia; Ratti, Antonia; Calvo, Andrea; Moglia, Cristina; Brunetti, Maura; Arcuti, Simona; Capozzo, Rosa; Zecca, Chiara; Lunetta, Christian; Penco, Silvana; Riva, Nilo; Padovani, Alessandro; Filosto, Massimiliano; Muller, Bernard; Stuit, Robbert Jan; Blair, Ian; Zhang, Katharine; McCann, Emily P; Fifita, Jennifer A; Nicholson, Garth A; Rowe, Dominic B; Pamphlett, Roger; Kiernan, Matthew C; Grosskreutz, Julian; Witte, Otto W; Ringer, Thomas; Prell, Tino; Stubendorff, Beatrice; Kurth, Ingo; Hübner, Christian A; Leigh, P Nigel; Casale, Federico; Chio, Adriano; Beghi, Ettore; Pupillo, Elisabetta; Tortelli, Rosanna; Logroscino, Giancarlo; Powell, John; Ludolph, Albert C; Weishaupt, Jochen H; Robberecht, Wim; Van Damme, Philip; Franke, Lude; Pers, Tune H; Brown, Robert H; Glass, Jonathan D; Landers, John E; Hardiman, Orla; Andersen, Peter M; Corcia, Philippe; Vourc'h, Patrick; Silani, Vincenzo; Wray, Naomi R; Visscher, Peter M; de Bakker, Paul I W; van Es, Michael A; Pasterkamp, R Jeroen; Lewis, Cathryn M; Breen, Gerome; Al-Chalabi, Ammar; van den Berg, Leonard H; Veldink, Jan H
To elucidate the genetic architecture of amyotrophic lateral sclerosis (ALS) and find associated loci, we assembled a custom imputation reference panel from whole-genome-sequenced patients with ALS and matched controls (n = 1,861). Through imputation and mixed-model association analysis in 12,577
van Rheenen, Wouter; Shatunov, Aleksey; Dekker, Annelot M.; McLaughlin, Russell L.; Diekstra, Frank P.; Pulit, Sara L.; van der Spek, Rick A. A.; Võsa, Urmo; de Jong, Simone; Robinson, Matthew R.; Yang, Jian; Fogh, Isabella; van Doormaal, Perry Tc; Tazelaar, Gijs H. P.; Koppers, Max; Blokhuis, Anna M.; Sproviero, William; Jones, Ashley R.; Kenna, Kevin P.; van Eijk, Kristel R.; Harschnitz, Oliver; Schellevis, Raymond D.; Brands, William J.; Medic, Jelena; Menelaou, Androniki; Vajda, Alice; Ticozzi, Nicola; Lin, Kuang; Rogelj, Boris; Vrabec, Katarina; Ravnik-Glavač, Metka; Koritnik, Blaž; Zidar, Janez; Leonardis, Lea; Grošelj, Leja Dolenc; Millecamps, Stéphanie; Salachas, François; Meininger, Vincent; de Carvalho, Mamede; Pinto, Susana; Mora, Jesus S.; Rojas-García, Ricardo; Polak, Meraida; Chandran, Siddharthan; Colville, Shuna; Swingler, Robert; Morrison, Karen E.; Shaw, Pamela J.; Hardy, John; Orrell, Richard W.; Pittman, Alan; Sidle, Katie; Fratta, Pietro; Malaspina, Andrea; Topp, Simon; Petri, Susanne; Abdulla, Susanne; Drepper, Carsten; Sendtner, Michael; Meyer, Thomas; Ophoff, Roel A.; Staats, Kim A.; Wiedau-Pazos, Martina; Lomen-Hoerth, Catherine; van Deerlin, Vivianna M.; Trojanowski, John Q.; Elman, Lauren; McCluskey, Leo; Basak, A. Nazli; Tunca, Ceren; Hamzeiy, Hamid; Parman, Yesim; Meitinger, Thomas; Lichtner, Peter; Radivojkov-Blagojevic, Milena; Andres, Christian R.; Maurel, Cindy; Bensimon, Gilbert; Landwehrmeyer, Bernhard; Brice, Alexis; Payan, Christine A. M.; Saker-Delye, Safaa; Dürr, Alexandra; Wood, Nicholas W.; Tittmann, Lukas; Lieb, Wolfgang; Franke, Andre; Rietschel, Marcella; Cichon, Sven; Nöthen, Markus M.; Amouyel, Philippe; Tzourio, Christophe; Dartigues, Jean-François; Uitterlinden, Andre G.; Rivadeneira, Fernando; Estrada, Karol; Hofman, Albert; Curtis, Charles; Blauw, Hylke M.; van der Kooi, Anneke J.; de Visser, Marianne; Goris, An; Weber, Markus; Shaw, Christopher E.; Smith, Bradley N.; Pansarasa, Orietta; Cereda, Cristina; del Bo, Roberto; Comi, Giacomo P.; D'alfonso, Sandra; Bertolin, Cinzia; Sorarù, Gianni; Mazzini, Letizia; Pensato, Viviana; Gellera, Cinzia; Tiloca, Cinzia; Ratti, Antonia; Calvo, Andrea; Moglia, Cristina; Brunetti, Maura; Arcuti, Simona; Capozzo, Rosa; Zecca, Chiara; Lunetta, Christian; Penco, Silvana; Riva, Nilo; Padovani, Alessandro; Filosto, Massimiliano; Muller, Bernard; Stuit, Robbert Jan; Blair, Ian; Zhang, Katharine; McCann, Emily P.; Fifita, Jennifer A.; Nicholson, Garth A.; Rowe, Dominic B.; Pamphlett, Roger; Kiernan, Matthew C.; Grosskreutz, Julian; Witte, Otto W.; Ringer, Thomas; Prell, Tino; Stubendorff, Beatrice; Kurth, Ingo; Hübner, Christian A.; Leigh, P. Nigel; Casale, Federico; Chio, Adriano; Beghi, Ettore; Pupillo, Elisabetta; Tortelli, Rosanna; Logroscino, Giancarlo; Powell, John; Ludolph, Albert C.; Weishaupt, Jochen H.; Robberecht, Wim; van Damme, Philip; Franke, Lude; Pers, Tune H.; Brown, Robert H.; Glass, Jonathan D.; Landers, John E.; Hardiman, Orla; Andersen, Peter M.; Corcia, Philippe; Vourc'h, Patrick; Silani, Vincenzo; Wray, Naomi R.; Visscher, Peter M.; de Bakker, Paul I. W.; van Es, Michael A.; Pasterkamp, R. Jeroen; Lewis, Cathryn M.; Breen, Gerome; Al-Chalabi, Ammar; van den Berg, Leonard H.; Veldink, Jan H.
2016-01-01
To elucidate the genetic architecture of amyotrophic lateral sclerosis (ALS) and find associated loci, we assembled a custom imputation reference panel from whole-genome-sequenced patients with ALS and matched controls (n = 1,861). Through imputation and mixed-model association analysis in 12,577
Marangi, Giuseppe; Traynor, Bryan J.
2018-01-01
The genetic architecture of amyotrophic lateral sclerosis (ALS) is being increasingly understood. In this far-reaching review, we examine what is currently known about ALS genetics and how these genes were initially identified. We also discuss the various types of mutations that might underlie this fatal neurodegenerative condition and outline some of the strategies that might be useful in untangling them. These include expansions of short repeat sequences, common and low-frequency genetic variations, de novo mutations, epigenetic changes, somatic mutations, epistasis, oligogenic and polygenic hypotheses. PMID:25316630
Directory of Open Access Journals (Sweden)
Symen Ligthart
Full Text Available Pleiotropic genetic variants have independent effects on different phenotypes. C-reactive protein (CRP is associated with several cardiometabolic phenotypes. Shared genetic backgrounds may partially underlie these associations. We conducted a genome-wide analysis to identify the shared genetic background of inflammation and cardiometabolic phenotypes using published genome-wide association studies (GWAS. We also evaluated whether the pleiotropic effects of such loci were biological or mediated in nature. First, we examined whether 283 common variants identified for 10 cardiometabolic phenotypes in GWAS are associated with CRP level. Second, we tested whether 18 variants identified for serum CRP are associated with 10 cardiometabolic phenotypes. We used a Bonferroni corrected p-value of 1.1×10-04 (0.05/463 as a threshold of significance. We evaluated the independent pleiotropic effect on both phenotypes using individual level data from the Women Genome Health Study. Evaluating the genetic overlap between inflammation and cardiometabolic phenotypes, we found 13 pleiotropic regions. Additional analyses showed that 6 regions (APOC1, HNF1A, IL6R, PPP1R3B, HNF4A and IL1F10 appeared to have a pleiotropic effect on CRP independent of the effects on the cardiometabolic phenotypes. These included loci where individuals carrying the risk allele for CRP encounter higher lipid levels and risk of type 2 diabetes. In addition, 5 regions (GCKR, PABPC4, BCL7B, FTO and TMEM18 had an effect on CRP largely mediated through the cardiometabolic phenotypes. In conclusion, our results show genetic pleiotropy among inflammation and cardiometabolic phenotypes. In addition to reverse causation, our data suggests that pleiotropic genetic variants partially underlie the association between CRP and cardiometabolic phenotypes.
Reliable Detection of Herpes Simplex Virus Sequence Variation by High-Throughput Resequencing.
Morse, Alison M; Calabro, Kaitlyn R; Fear, Justin M; Bloom, David C; McIntyre, Lauren M
2017-08-16
High-throughput sequencing (HTS) has resulted in data for a number of herpes simplex virus (HSV) laboratory strains and clinical isolates. The knowledge of these sequences has been critical for investigating viral pathogenicity. However, the assembly of complete herpesviral genomes, including HSV, is complicated due to the existence of large repeat regions and arrays of smaller reiterated sequences that are commonly found in these genomes. In addition, the inherent genetic variation in populations of isolates for viruses and other microorganisms presents an additional challenge to many existing HTS sequence assembly pipelines. Here, we evaluate two approaches for the identification of genetic variants in HSV1 strains using Illumina short read sequencing data. The first, a reference-based approach, identifies variants from reads aligned to a reference sequence and the second, a de novo assembly approach, identifies variants from reads aligned to de novo assembled consensus sequences. Of critical importance for both approaches is the reduction in the number of low complexity regions through the construction of a non-redundant reference genome. We compared variants identified in the two methods. Our results indicate that approximately 85% of variants are identified regardless of the approach. The reference-based approach to variant discovery captures an additional 15% representing variants divergent from the HSV1 reference possibly due to viral passage. Reference-based approaches are significantly less labor-intensive and identify variants across the genome where de novo assembly-based approaches are limited to regions where contigs have been successfully assembled. In addition, regions of poor quality assembly can lead to false variant identification in de novo consensus sequences. For viruses with a well-assembled reference genome, a reference-based approach is recommended.
2012-01-01
Background Cotton is the world’s most important natural textile fiber and a significant oilseed crop. Decoding cotton genomes will provide the ultimate reference and resource for research and utilization of the species. Integration of high-density genetic maps with genomic sequence information will largely accelerate the process of whole-genome assembly in cotton. Results In this paper, we update a high-density interspecific genetic linkage map of allotetraploid cultivated cotton. An additional 1,167 marker loci have been added to our previously published map of 2,247 loci. Three new marker types, InDel (insertion-deletion) and SNP (single nucleotide polymorphism) developed from gene information, and REMAP (retrotransposon-microsatellite amplified polymorphism), were used to increase map density. The updated map consists of 3,414 loci in 26 linkage groups covering 3,667.62 cM with an average inter-locus distance of 1.08 cM. Furthermore, genome-wide sequence analysis was finished using 3,324 informative sequence-based markers and publicly-available Gossypium DNA sequence information. A total of 413,113 EST and 195 BAC sequences were physically anchored and clustered by 3,324 sequence-based markers. Of these, 14,243 ESTs and 188 BACs from different species of Gossypium were clustered and specifically anchored to the high-density genetic map. A total of 2,748 candidate unigenes from 2,111 ESTs clusters and 63 BACs were mined for functional annotation and classification. The 337 ESTs/genes related to fiber quality traits were integrated with 132 previously reported cotton fiber quality quantitative trait loci, which demonstrated the important roles in fiber quality of these genes. Higher-level sequence conservation between different cotton species and between the A- and D-subgenomes in tetraploid cotton was found, indicating a common evolutionary origin for orthologous and paralogous loci in Gossypium. Conclusion This study will serve as a valuable genomic resource
Molecular sequence data of hepatitis B virus and genetic diversity after vaccination.
van Ballegooijen, W Marijn; van Houdt, Robin; Bruisten, Sylvia M; Boot, Hein J; Coutinho, Roel A; Wallinga, Jacco
2009-12-15
The effect of vaccination programs on transmission of infectious disease is usually assessed by monitoring programs that rely on notifications of symptomatic illness. For monitoring of infectious diseases with a high proportion of asymptomatic cases or a low reporting rate, molecular sequence data combined with modern coalescent-based techniques offer a complementary tool to assess transmission. Here, the authors investigate the added value of using viral sequence data to monitor a vaccination program that was started in 1998 and was targeted against hepatitis B virus in men who have sex with men in Amsterdam, the Netherlands. The incidence in this target group, as estimated from the notifications of acute infections with hepatitis B virus, was low; therefore, there was insufficient power to show a significant change in incidence. In contrast, the genetic diversity, as estimated from the viral sequence collected from the target group, revealed a marked decrease after vaccination was introduced. Taken together, the findings suggest that introduction of vaccination coincided with a change in the target group toward behavior with a higher risk of infection. The authors argue that molecular sequence data provide a powerful additional monitoring instrument, next to conventional case registration, for assessing the impact of vaccination.
Identification of a Flavivirus Sequence in a Marine Arthropod.
Directory of Open Access Journals (Sweden)
Michael J Conway
Full Text Available Phylogenetic analysis has yet to uncover the early origins of flaviviruses. In this study, I mined a database of expressed sequence tags in order to discover novel flavivirus sequences. Flavivirus sequences were identified in a pool of mRNA extracted from the sea spider Endeis spinosa (Pycnogonida, Pantopoda. Reconstruction of the translated sequences and BLAST analysis matched the sequence to the flavivirus NS5 gene. Additional sequences corresponding to envelope and the NS5 MTase domain were also identified. Phylogenetic analysis of homologous NS5 sequences revealed that Endeis spinosa NS5 (ESNS5 is likely related to classical insect-specific flaviviruses. It is unclear if ESNS5 represents genetic material from an active viral infection or an integrated viral genome. These data raise the possibility that classical insect-specific flaviviruses and perhaps medically relevant flaviviruses, evolved from progenitors that infected marine arthropods.
Molecular mechanisms of the genetic risk factors in pathogenesis of Alzheimer disease.
Kanatsu, Kunihiko; Tomita, Taisuke
2017-01-01
Alzheimer disease (AD) is a neurodegenerative disease characterized by the extensive deposition of senile plaques and neurofibrillary tangles. Until recently, only the APOE gene had been known as a genetic risk factor for late-onset AD (LOAD), which accounts for more than 95% of all AD cases. However, in addition to this well-established genetic risk factor, genome-wide association studies have identified several single nucleotide polymorphisms as genetic risk factors of LOAD, such as PICALM and BIN1 . In addition, whole genome sequencing and exome sequencing have identified rare variants associated with LOAD, including TREM2 . We review the recent findings related to the molecular mechanisms by which these genetic risk factors contribute to AD, and our perspectives regarding the etiology of AD for the development of therapeutic agents.
DEFF Research Database (Denmark)
Christophersen, Ingrid E; Olesen, Morten S; Liang, Bo
2012-01-01
AimsGenetic factors may be important in the development of atrial fibrillation (AF) in the young. KCNA5 encodes the potassium channel a-subunit K(V)1.5, which underlies the voltage-gated atrial-specific potassium current I(Kur). KCNAB2 encodes K(V)ß2, a ß-subunit of K(V)1.5, which increases I......(Kur). Three studies have identified loss-of-function mutations in KCNA5 in patients with idiopathic AF. We hypothesized that early-onset lone AF is associated with high prevalence of genetic variants in KCNA5 and KCNAB2.Methods and resultsThe coding sequences of KCNA5 and KCNAB2 were sequenced in 307 patients...
DEFF Research Database (Denmark)
Snabel, V.; Miterpakova, M.; D'Amelio, S.
2006-01-01
Nucleotide sequencing of the mitochondrial cytochrome c oxidase subunit 1 (CO1) gene and isoenzyme analysis were used to survey the genetic variability in Echinococcus multilocularis populations from Slovakia. A sample of 12 isolates acquired from 10 different districts from red foxes exhibited......) in the CO1 fragment. These data, along with the recently gathered data from French isolates, are indicative of a genetically unique population occurring in Central and Western Europe. Electrophoretic examination of enzymes produced by 14 gene loci revealed intraspecific polymorphism only with the glucose...... between the species were obtained by isoenzyme analysis. Fixed genetic differences between the species were detected in the glucose-phosphate isomerase, esterase and aldolase systems, and partial differences were detected in four additional systems....
Mapping autonomously replicating sequence elements in a 73-kb ...
Indian Academy of Sciences (India)
Autonomously replicating sequence (ARS) elements are the genetic determinants of replication origin function in yeasts. They can be easily identified as the plasmids containing them transform yeast cells at a high frequency. As the first step towards identifying all potential replication origins in a 73-kb region of the long arm ...
Identifying driver mutations in sequenced cancer genomes
DEFF Research Database (Denmark)
Raphael, Benjamin J; Dobson, Jason R; Oesper, Layla
2014-01-01
High-throughput DNA sequencing is revolutionizing the study of cancer and enabling the measurement of the somatic mutations that drive cancer development. However, the resulting sequencing datasets are large and complex, obscuring the clinically important mutations in a background of errors, nois...... patterns of mutual exclusivity. These techniques, coupled with advances in high-throughput DNA sequencing, are enabling precision medicine approaches to the diagnosis and treatment of cancer....
Directory of Open Access Journals (Sweden)
Lv Liu
2018-01-01
Full Text Available Primary ciliary dyskinesia (PCD is a clinical rare peculiar disorder, mainly featured by respiratory infection, tympanitis, nasosinusitis, and male infertility. Previous study demonstrated it is an autosomal recessive disease and by 2017 almost 40 pathologic genes have been identified. Among them are the leucine-rich repeat- (LRR- containing 6 (LRRC6 codes for a 463-amino-acid cytoplasmic protein, expressed distinctively in motile cilia cells, including the testis cells and the respiratory epithelial cells. In this study, we applied whole-exome sequencing combined with PCD-known genes filtering to explore the genetic lesion of a PCD patient. A novel compound heterozygous mutation in LRRC6 (c.183T>G/p.N61K; c.179-1G>A was identified and coseparated in this family. The missense mutation (c.183T>G/p.N61K may lead to a substitution of asparagine by lysine at position 61 in exon 3 of LRRC6. The splice site mutation (c.179-1G>A may cause a premature stop codon in exon 4 and decrease the mRNA levels of LRRC6. Both mutations were not present in our 200 local controls, dbSNP, and 1000 genomes. Three bioinformatics programs also predicted that both mutations are deleterious. Our study not only further supported the importance of LRRC6 in PCD, but also expanded the spectrum of LRRC6 mutations and will contribute to the genetic diagnosis and counseling of PCD patients.
Directory of Open Access Journals (Sweden)
Bingfu Guo
2016-07-01
Full Text Available Molecular characterization of sequences flanking exogenous fragment insertions is essential for safety assessment and labeling of genetically modified organisms (GMO. In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS method. About 21 Gb sequence data (~21× coverage for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundary of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of the genomic insertion site of the G2-EPSPS and GAT transgenes will facilitate the use of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS is a cost-effective and rapid method of identifying sites of T-DNA insertions and flanking sequences in soybean.
Directory of Open Access Journals (Sweden)
Gina M. Zastrow-Hayes
2015-03-01
Full Text Available Molecular characterization of events is an integral part of the advancement process during genetically modified (GM crop product development. Assessment of these events is traditionally accomplished by polymerase chain reaction (PCR and Southern blot analyses. Southern blot analysis can be time-consuming and comparatively expensive and does not provide sequence-level detail. We have developed a sequence-based application, Southern-by-Sequencing (SbS, utilizing sequence capture coupled with next-generation sequencing (NGS technology to replace Southern blot analysis for event selection in a high-throughput molecular characterization environment. SbS is accomplished by hybridizing indexed and pooled whole-genome DNA libraries from GM plants to biotinylated probes designed to target the sequence of transformation plasmids used to generate events within the pool. This sequence capture process enriches the sequence data obtained for targeted regions of interest (transformation plasmid DNA. Taking advantage of the DNA adjacent to the targeted bases (referred to as next-to-target sequence that accompanies the targeted transformation plasmid sequence, the data analysis detects plasmid-to-genome and plasmid-to-plasmid junctions introduced during insertion into the plant genome. Analysis of these junction sequences provides sequence-level information as to the following: the number of insertion loci including detection of unlinked, independently segregating, small DNA fragments; copy number; rearrangements, truncations, or deletions of the intended insertion DNA; and the presence of transformation plasmid backbone sequences. This molecular evidence from SbS analysis is used to characterize and select GM plants meeting optimal molecular characterization criteria. SbS technology has proven to be a robust event screening tool for use in a high-throughput molecular characterization environment.
Keskin, Emre; Atar, Hasan Huseyin
2012-04-01
Mitochondrial DNA sequence variation in 655 bpfragments of the cytochrome oxidase c subunit I gene, known as the DNA barcode, of European anchovy (Engraulis encrasicolus) was evaluated by analyzing 1529 individuals representing 16 populations from the Black Sea, through the Marmara Sea and the Aegean Sea to the Mediterranean Sea. A total of 19 (2.9%) variable sites were found among individuals, and these defined 10 genetically diverged populations with an overall mean distance of 1.2%. The highest nucleotide divergence was found between samples of eastern Mediterranean and northern Aegean (2.2%). Evolutionary history analysis among 16 populations clustered the Mediterranean Sea clades in one main branch and the other clades in another branch. Diverging pattern of the European anchovy populations correlated with geographic dispersion supports the genetic structuring through the Black Sea-Marmara Sea-Aegean Sea-Mediterranean Sea quad.
Deep sequencing of uveal melanoma identifies a recurrent mutation in PLCB4
DEFF Research Database (Denmark)
Johansson, Peter; Aoude, Lauren G; Wadt, Karin
2016-01-01
Next generation sequencing of uveal melanoma (UM) samples has identified a number of recurrent oncogenic or loss-of-function mutations in key driver genes including: GNAQ, GNA11, EIF1AX, SF3B1 and BAP1. To search for additional driver mutations in this tumor type we carried out whole......, instead, a BRCA mutation signature predominated. In addition to mutations in the known UM driver genes, we found a recurrent mutation in PLCB4 (c.G1888T, p.D630Y, NM_000933), which was validated using Sanger sequencing. The identical mutation was also found in published UM sequence data (1 of 56 tumors......-genome or whole-exome sequencing of 28 tumors or primary cell lines. These samples have a low mutation burden, with a mean of 10.6 protein changing mutations per sample (range 0 to 53). As expected for these sun-shielded melanomas the mutation spectrum was not consistent with an ultraviolet radiation signature...
Genetic variants responsible for susceptibility to obesity and its comorbidities among Hispanic children have not been identified. The VIVA LA FAMILIA Study was designed to genetically map childhood obesity and associated biological processes in the Hispanic population. A genome-wide association stu...
Exploring Genetic Suppression Interactions on a Global Scale
van Leeuwen, Jolanda; Pons, Carles; Mellor, Joseph C.; Yamaguchi, Takafumi N.; Friesen, Helena; Koschwanez, John; Ušaj, Mojca Mattiazzi; Pechlaner, Maria; Takar, Mehmet; Ušaj, Matej; VanderSluis, Benjamin; Andrusiak, Kerry; Bansal, Pritpal; Baryshnikova, Anastasia; Boone, Claire
2016-01-01
Genetic suppression occurs when the phenotypic defects caused by a mutation in a particular gene are rescued by a mutation in a second gene. To explore the principles of genetic suppression, we examined both literature-curated and unbiased experimental data, involving systematic genetic mapping and whole-genome sequencing, to generate a large-scale suppression network among yeast genes. Most suppression pairs identified novel relationships among functionally related genes, providing new insig...
Genetic determinants of heart failure: facts and numbers.
Czepluch, Frauke S; Wollnik, Bernd; Hasenfuß, Gerd
2018-06-01
The relevance of gene mutations leading to heart diseases and hence heart failure has become evident. The risk for and the course of heart failure depends on genomic variants and mutations underlying the so-called genetic predisposition. Genetic contribution to heart failure is highly heterogenous and complex. For any patient with a likely inherited heart failure syndrome, genetic counselling is recommended and important. In the last few years, novel sequencing technologies (named next-generation sequencing - NGS) have dramatically improved the availability of molecular testing, the efficiency of genetic analyses, and moreover reduced the cost for genetic testing. Due to this development, genetic testing has become increasingly accessible and NGS-based sequencing is now applied in clinical routine diagnostics. One of the most common reasons of heart failure are cardiomyopathies such as the dilated or the hypertrophic cardiomyopathy. Nearly 100 disease-associated genes have been identified for cardiomyopathies. The knowledge of a pathogenic mutation can be used for genetic counselling, risk and prognosis determination, therapy guidance and hence for a more effective treatment. Besides, family cascade screening for a known familial, pathogenic mutation can lead to an early diagnosis in affected individuals. At that timepoint, a preventative intervention could be used to avoid or delay disease onset or delay disease progression. Understanding the cellular basis of genetic heart failure syndromes in more detail may provide new insights into the molecular biology of physiological and impaired cardiac (cell) function. As our understanding of the molecular and genetic pathophysiology of heart failure will increase, this might help to identify novel therapeutic targets and may lead to the development of new and specific treatment options in patients with heart failure. © 2018 The Authors. ESC Heart Failure published by John Wiley & Sons Ltd on behalf of the European
Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S
2017-11-01
Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.
An update on the genetics of hyperuricaemia and gout.
Major, Tanya J; Dalbeth, Nicola; Stahl, Eli A; Merriman, Tony R
2018-06-01
A central aspect of the pathogenesis of gout is elevated urate concentrations, which lead to the formation of monosodium urate crystals. The clinical features of gout result from an individual's immune response to these deposited crystals. Genome-wide association studies (GWAS) have confirmed the importance of urate excretion in the control of serum urate levels and the risk of gout and have identified the kidneys, the gut and the liver as sites of urate regulation. The genetic contribution to the progression from hyperuricaemia to gout remains relatively poorly understood, although genes encoding proteins that are involved in the NLRP3 (NOD-, LRR- and pyrin domain-containing 3) inflammasome pathway play a part. Genome-wide and targeted sequencing is beginning to identify uncommon population-specific variants that are associated with urate levels and gout. Mendelian randomization studies using urate-associated genetic variants as unconfounded surrogates for lifelong urate exposure have not supported claims that urate is causal for metabolic conditions that are comorbidities of hyperuricaemia and gout. Genetic studies have also identified genetic variants that predict responsiveness to therapies (for example, urate-lowering drugs) for treatment of hyperuricaemia. Future research should focus on large GWAS (that include asymptomatic hyperuricaemic individuals) and on increasing the use of whole-genome sequencing data to identify uncommon genetic variants with increased penetrance that might provide opportunities for clinical translation.
Directory of Open Access Journals (Sweden)
Doori Park
2015-09-01
Full Text Available Molecular characterization technology in genetically modified organisms, in addition to how transgenic biotechnologies are developed now require full transparency to assess the risk to living modified and non-modified organisms. Next generation sequencing (NGS methodology is suggested as an effective means in genome characterization and detection of transgenic insertion locations. In the present study, we applied NGS to insert transgenic loci, specifically the epidermal growth factor (EGF in genetically modified rice cells. A total of 29.3 Gb (~72× coverage was sequenced with a 2 × 150 bp paired end method by Illumina HiSeq2500, which was consecutively mapped to the rice genome and T-vector sequence. The compatible pairs of reads were successfully mapped to 10 loci on the rice chromosome and vector sequences were validated to the insertion location by polymerase chain reaction (PCR amplification. The EGF transgenic site was confirmed only on chromosome 4 by PCR. Results of this study demonstrated the success of NGS data to characterize the rice genome. Bioinformatics analyses must be developed in association with NGS data to identify highly accurate transgenic sites.
Zoledziewska, Magdalena; Mulas, Antonella; Pistis, Giorgio; Steri, Maristella; Danjou, Fabrice; Kwong, Alan; Ortega del Vecchyo, Vicente Diego; Chiang, Charleston W. K.; Bragg-Gresham, Jennifer; Pitzalis, Maristella; Nagaraja, Ramaiah; Tarrier, Brendan; Brennan, Christine; Uzzau, Sergio; Fuchsberger, Christian; Atzeni, Rossano; Reinier, Frederic; Berutti, Riccardo; Huang, Jie; Timpson, Nicholas J; Toniolo, Daniela; Gasparini, Paolo; Malerba, Giovanni; Dedoussis, George; Zeggini, Eleftheria; Soranzo, Nicole; Jones, Chris; Lyons, Robert; Angius, Andrea; Kang, Hyun M.; Novembre, John; Sanna, Serena; Schlessinger, David; Cucca, Francesco; Abecasis, Gonçalo R
2015-01-01
We report ~17.6M genetic variants from whole-genome sequencing of 2,120 Sardinians; 22% are absent from prior sequencing-based compilations and enriched for predicted functional consequence. Furthermore, ~76K variants common in our sample (frequency >5%) are rare elsewhere (Genomes Project). We assessed the impact of these variants on circulating lipid levels and five inflammatory biomarkers. Fourteen signals, including two major new loci, were observed for lipid levels, and 19, including two novel loci, for inflammatory markers. New associations would be missed in analyses based on 1000 Genomes data, underlining the advantages of large-scale sequencing in this founder population. PMID:26366554
Functional DNA: Teaching Infinite Series through Genetic Analogy
Kowalski, R. Travis
2011-01-01
This article presents an extended analogy that connects infinite sequences and series to the science of genetics, by identifying power series as "DNA for a function." This analogy allows standard topics such as convergence tests or Taylor approximations to be recast in a "forensic" light as mathematical analogs of genetic concepts such as DNA…
Directory of Open Access Journals (Sweden)
Shafipour1, M.
2014-11-01
Full Text Available The identification of Mycobacteria in the species level has great medical importance. Biochemical tests are laborious and time-consuming, so new techniques could be used to identify the species. This research aimed to the comparison of biochemical and sequencing 16S rDNA gene methods to identify nontuberculous Mycobacteria in patients suspected to tuberculosis in Golestan province which is the most prevalent region of tuberculosis in Iran. Among 3336 patients suspected to tuberculosis referred to hospitals and health care centres in Golestan province during 2010-2011, 319 (9.56% culture positive cases were collected. Identification of species by using biochemical tests was done. On the samples recognized as nontuberculous Mycobacteria, after DNA extraction by boiling, 16S rDNA PCR was done and their sequencing were identified by NCBI BLAST. Of the 319 positive samples in Golestan Province, 300 cases were M.tuberculosis and 19 cases (5.01% were identified as nontuberculous Mycobacteria by biochemical tests. 15 out of 19 nontuberculous Mycobacteria were identified by PCR and sequencing method as similar by biochemical methods (similarity rate: 78.9%. But after PCR, 1 case known as M.simiae by biochemical test was identified as M. lentiflavum and 3 other cases were identified as Nocardia. Biochemical methods corresponded to the 16S rDNA PCR and sequencing in 78.9% of cases. However, in identification of M. lentiflavum and Nocaria sp. the molecular method is better than biochemical methods.
Lange, Leslie A.; Hu, Youna; Zhang, He; Xue, Chenyi; Schmidt, Ellen M.; Tang, Zheng-Zheng; Bizon, Chris; Lange, Ethan M.; Smith, Joshua D.; Turner, Emily H.; Jun, Goo; Kang, Hyun Min; Peloso, Gina; Auer, Paul; Li, Kuo-ping; Flannick, Jason; Zhang, Ji; Fuchsberger, Christian; Gaulton, Kyle; Lindgren, Cecilia; Locke, Adam; Manning, Alisa; Sim, Xueling; Rivas, Manuel A.; Holmen, Oddgeir L.; Gottesman, Omri; Lu, Yingchang; Ruderfer, Douglas; Stahl, Eli A.; Duan, Qing; Li, Yun; Durda, Peter; Jiao, Shuo; Isaacs, Aaron; Hofman, Albert; Bis, Joshua C.; Correa, Adolfo; Griswold, Michael E.; Jakobsdottir, Johanna; Smith, Albert V.; Schreiner, Pamela J.; Feitosa, Mary F.; Zhang, Qunyuan; Huffman, Jennifer E.; Crosby, Jacy; Wassel, Christina L.; Do, Ron; Franceschini, Nora; Martin, Lisa W.; Robinson, Jennifer G.; Assimes, Themistocles L.; Crosslin, David R.; Rosenthal, Elisabeth A.; Tsai, Michael; Rieder, Mark J.; Farlow, Deborah N.; Folsom, Aaron R.; Lumley, Thomas; Fox, Ervin R.; Carlson, Christopher S.; Peters, Ulrike; Jackson, Rebecca D.; van Duijn, Cornelia M.; Uitterlinden, André G.; Levy, Daniel; Rotter, Jerome I.; Taylor, Herman A.; Gudnason, Vilmundur; Siscovick, David S.; Fornage, Myriam; Borecki, Ingrid B.; Hayward, Caroline; Rudan, Igor; Chen, Y. Eugene; Bottinger, Erwin P.; Loos, Ruth J.F.; Sætrom, Pål; Hveem, Kristian; Boehnke, Michael; Groop, Leif; McCarthy, Mark; Meitinger, Thomas; Ballantyne, Christie M.; Gabriel, Stacey B.; O’Donnell, Christopher J.; Post, Wendy S.; North, Kari E.; Reiner, Alexander P.; Boerwinkle, Eric; Psaty, Bruce M.; Altshuler, David; Kathiresan, Sekar; Lin, Dan-Yu; Jarvik, Gail P.; Cupples, L. Adrienne; Kooperberg, Charles; Wilson, James G.; Nickerson, Deborah A.; Abecasis, Goncalo R.; Rich, Stephen S.; Tracy, Russell P.; Willer, Cristen J.; Gabriel, Stacey B.; Altshuler, David M.; Abecasis, Gonçalo R.; Allayee, Hooman; Cresci, Sharon; Daly, Mark J.; de Bakker, Paul I.W.; DePristo, Mark A.; Do, Ron; Donnelly, Peter; Farlow, Deborah N.; Fennell, Tim; Garimella, Kiran; Hazen, Stanley L.; Hu, Youna; Jordan, Daniel M.; Jun, Goo; Kathiresan, Sekar; Kang, Hyun Min; Kiezun, Adam; Lettre, Guillaume; Li, Bingshan; Li, Mingyao; Newton-Cheh, Christopher H.; Padmanabhan, Sandosh; Peloso, Gina; Pulit, Sara; Rader, Daniel J.; Reich, David; Reilly, Muredach P.; Rivas, Manuel A.; Schwartz, Steve; Scott, Laura; Siscovick, David S.; Spertus, John A.; Stitziel, Nathaniel O.; Stoletzki, Nina; Sunyaev, Shamil R.; Voight, Benjamin F.; Willer, Cristen J.; Rich, Stephen S.; Akylbekova, Ermeg; Atwood, Larry D.; Ballantyne, Christie M.; Barbalic, Maja; Barr, R. Graham; Benjamin, Emelia J.; Bis, Joshua; Boerwinkle, Eric; Bowden, Donald W.; Brody, Jennifer; Budoff, Matthew; Burke, Greg; Buxbaum, Sarah; Carr, Jeff; Chen, Donna T.; Chen, Ida Y.; Chen, Wei-Min; Concannon, Pat; Crosby, Jacy; Cupples, L. Adrienne; D’Agostino, Ralph; DeStefano, Anita L.; Dreisbach, Albert; Dupuis, Josée; Durda, J. Peter; Ellis, Jaclyn; Folsom, Aaron R.; Fornage, Myriam; Fox, Caroline S.; Fox, Ervin; Funari, Vincent; Ganesh, Santhi K.; Gardin, Julius; Goff, David; Gordon, Ora; Grody, Wayne; Gross, Myron; Guo, Xiuqing; Hall, Ira M.; Heard-Costa, Nancy L.; Heckbert, Susan R.; Heintz, Nicholas; Herrington, David M.; Hickson, DeMarc; Huang, Jie; Hwang, Shih-Jen; Jacobs, David R.; Jenny, Nancy S.; Johnson, Andrew D.; Johnson, Craig W.; Kawut, Steven; Kronmal, Richard; Kurz, Raluca; Lange, Ethan M.; Lange, Leslie A.; Larson, Martin G.; Lawson, Mark; Lewis, Cora E.; Levy, Daniel; Li, Dalin; Lin, Honghuang; Liu, Chunyu; Liu, Jiankang; Liu, Kiang; Liu, Xiaoming; Liu, Yongmei; Longstreth, William T.; Loria, Cay; Lumley, Thomas; Lunetta, Kathryn; Mackey, Aaron J.; Mackey, Rachel; Manichaikul, Ani; Maxwell, Taylor; McKnight, Barbara; Meigs, James B.; Morrison, Alanna C.; Musani, Solomon K.; Mychaleckyj, Josyf C.; Nettleton, Jennifer A.; North, Kari; O’Donnell, Christopher J.; O’Leary, Daniel; Ong, Frank; Palmas, Walter; Pankow, James S.; Pankratz, Nathan D.; Paul, Shom; Perez, Marco; Person, Sharina D.; Polak, Joseph; Post, Wendy S.; Psaty, Bruce M.; Quinlan, Aaron R.; Raffel, Leslie J.; Ramachandran, Vasan S.; Reiner, Alexander P.; Rice, Kenneth; Rotter, Jerome I.; Sanders, Jill P.; Schreiner, Pamela; Seshadri, Sudha; Shea, Steve; Sidney, Stephen; Silverstein, Kevin; Smith, Nicholas L.; Sotoodehnia, Nona; Srinivasan, Asoke; Taylor, Herman A.; Taylor, Kent; Thomas, Fridtjof; Tracy, Russell P.; Tsai, Michael Y.; Volcik, Kelly A.; Wassel, Chrstina L.; Watson, Karol; Wei, Gina; White, Wendy; Wiggins, Kerri L.; Wilk, Jemma B.; Williams, O. Dale; Wilson, Gregory; Wilson, James G.; Wolf, Phillip; Zakai, Neil A.; Hardy, John; Meschia, James F.; Nalls, Michael; Singleton, Andrew; Worrall, Brad; Bamshad, Michael J.; Barnes, Kathleen C.; Abdulhamid, Ibrahim; Accurso, Frank; Anbar, Ran; Beaty, Terri; Bigham, Abigail; Black, Phillip; Bleecker, Eugene; Buckingham, Kati; Cairns, Anne Marie; Caplan, Daniel; Chatfield, Barbara; Chidekel, Aaron; Cho, Michael; Christiani, David C.; Crapo, James D.; Crouch, Julia; Daley, Denise; Dang, Anthony; Dang, Hong; De Paula, Alicia; DeCelie-Germana, Joan; Drumm, Allen DozorMitch; Dyson, Maynard; Emerson, Julia; Emond, Mary J.; Ferkol, Thomas; Fink, Robert; Foster, Cassandra; Froh, Deborah; Gao, Li; Gershan, William; Gibson, Ronald L.; Godwin, Elizabeth; Gondor, Magdalen; Gutierrez, Hector; Hansel, Nadia N.; Hassoun, Paul M.; Hiatt, Peter; Hokanson, John E.; Howenstine, Michelle; Hummer, Laura K.; Kanga, Jamshed; Kim, Yoonhee; Knowles, Michael R.; Konstan, Michael; Lahiri, Thomas; Laird, Nan; Lange, Christoph; Lin, Lin; Lin, Xihong; Louie, Tin L.; Lynch, David; Make, Barry; Martin, Thomas R.; Mathai, Steve C.; Mathias, Rasika A.; McNamara, John; McNamara, Sharon; Meyers, Deborah; Millard, Susan; Mogayzel, Peter; Moss, Richard; Murray, Tanda; Nielson, Dennis; Noyes, Blakeslee; O’Neal, Wanda; Orenstein, David; O’Sullivan, Brian; Pace, Rhonda; Pare, Peter; Parker, H. Worth; Passero, Mary Ann; Perkett, Elizabeth; Prestridge, Adrienne; Rafaels, Nicholas M.; Ramsey, Bonnie; Regan, Elizabeth; Ren, Clement; Retsch-Bogart, George; Rock, Michael; Rosen, Antony; Rosenfeld, Margaret; Ruczinski, Ingo; Sanford, Andrew; Schaeffer, David; Sell, Cindy; Sheehan, Daniel; Silverman, Edwin K.; Sin, Don; Spencer, Terry; Stonebraker, Jackie; Tabor, Holly K.; Varlotta, Laurie; Vergara, Candelaria I.; Weiss, Robert; Wigley, Fred; Wise, Robert A.; Wright, Fred A.; Wurfel, Mark M.; Zanni, Robert; Zou, Fei; Nickerson, Deborah A.; Rieder, Mark J.; Green, Phil; Shendure, Jay; Akey, Joshua M.; Bustamante, Carlos D.; Crosslin, David R.; Eichler, Evan E.; Fox, P. Keolu; Fu, Wenqing; Gordon, Adam; Gravel, Simon; Jarvik, Gail P.; Johnsen, Jill M.; Kan, Mengyuan; Kenny, Eimear E.; Kidd, Jeffrey M.; Lara-Garduno, Fremiet; Leal, Suzanne M.; Liu, Dajiang J.; McGee, Sean; O’Connor, Timothy D.; Paeper, Bryan; Robertson, Peggy D.; Smith, Joshua D.; Staples, Jeffrey C.; Tennessen, Jacob A.; Turner, Emily H.; Wang, Gao; Yi, Qian; Jackson, Rebecca; Peters, Ulrike; Carlson, Christopher S.; Anderson, Garnet; Anton-Culver, Hoda; Assimes, Themistocles L.; Auer, Paul L.; Beresford, Shirley; Bizon, Chris; Black, Henry; Brunner, Robert; Brzyski, Robert; Burwen, Dale; Caan, Bette; Carty, Cara L.; Chlebowski, Rowan; Cummings, Steven; Curb, J. David; Eaton, Charles B.; Ford, Leslie; Franceschini, Nora; Fullerton, Stephanie M.; Gass, Margery; Geller, Nancy; Heiss, Gerardo; Howard, Barbara V.; Hsu, Li; Hutter, Carolyn M.; Ioannidis, John; Jiao, Shuo; Johnson, Karen C.; Kooperberg, Charles; Kuller, Lewis; LaCroix, Andrea; Lakshminarayan, Kamakshi; Lane, Dorothy; Lasser, Norman; LeBlanc, Erin; Li, Kuo-Ping; Limacher, Marian; Lin, Dan-Yu; Logsdon, Benjamin A.; Ludlam, Shari; Manson, JoAnn E.; Margolis, Karen; Martin, Lisa; McGowan, Joan; Monda, Keri L.; Kotchen, Jane Morley; Nathan, Lauren; Ockene, Judith; O’Sullivan, Mary Jo; Phillips, Lawrence S.; Prentice, Ross L.; Robbins, John; Robinson, Jennifer G.; Rossouw, Jacques E.; Sangi-Haghpeykar, Haleh; Sarto, Gloria E.; Shumaker, Sally; Simon, Michael S.; Stefanick, Marcia L.; Stein, Evan; Tang, Hua; Taylor, Kira C.; Thomson, Cynthia A.; Thornton, Timothy A.; Van Horn, Linda; Vitolins, Mara; Wactawski-Wende, Jean; Wallace, Robert; Wassertheil-Smoller, Sylvia; Zeng, Donglin; Applebaum-Bowden, Deborah; Feolo, Michael; Gan, Weiniu; Paltoo, Dina N.; Sholinsky, Phyliss; Sturcke, Anne
2014-01-01
Elevated low-density lipoprotein cholesterol (LDL-C) is a treatable, heritable risk factor for cardiovascular disease. Genome-wide association studies (GWASs) have identified 157 variants associated with lipid levels but are not well suited to assess the impact of rare and low-frequency variants. To determine whether rare or low-frequency coding variants are associated with LDL-C, we exome sequenced 2,005 individuals, including 554 individuals selected for extreme LDL-C (>98th or <2nd percentile). Follow-up analyses included sequencing of 1,302 additional individuals and genotype-based analysis of 52,221 individuals. We observed significant evidence of association between LDL-C and the burden of rare or low-frequency variants in PNPLA5, encoding a phospholipase-domain-containing protein, and both known and previously unidentified variants in PCSK9, LDLR and APOB, three known lipid-related genes. The effect sizes for the burden of rare variants for each associated gene were substantially higher than those observed for individual SNPs identified from GWASs. We replicated the PNPLA5 signal in an independent large-scale sequencing study of 2,084 individuals. In conclusion, this large whole-exome-sequencing study for LDL-C identified a gene not known to be implicated in LDL-C and provides unique insight into the design and analysis of similar experiments. PMID:24507775
Use of Targeted Exome Sequencing for Molecular Diagnosis of Skeletal Disorders
Polla, Daniel L.; Cardoso, Maria T. O.; Silva, Mayara C. B.; Cardoso, Isabela C. C.; Medina, Cristina T. N.; Araujo, Rosenelle; Fernandes, Camila C.; Reis, Alessandra M. M.; de Andrade, Rosangela V.; Pereira, Rinaldo W.; Pogue, Robert
2015-01-01
Genetic disorders of the skeleton comprise a large group of more than 450 clinically distinct and genetically heterogeneous diseases associated with mutations in more than 300 genes. Achieving a definitive diagnosis is complicated due to the genetic heterogeneity of these disorders, their individual rarity and their diverse radiographic presentations. We used targeted exome sequencing and designed a 1.4Mb panel for simultaneous testing of more than 4,800 exons in 309 genes involved in skeletal disorders. DNA from 69 individuals from 66 families with a known or suspected clinical diagnosis of a skeletal disorder was analyzed. Of 36 cases with a specific clinical hypothesis with a known genetic basis, mutations were identified for eight cases (22%). Of 20 cases with a suspected skeletal disorder but without a specific diagnosis, four causative mutations were identified. Also included were 11 cases with a specific skeletal disorder but for which there was at the time no known associated gene. For these cases, one mutation was identified in a known skeletal disease genes, and re-evaluation of the clinical phenotype in this case changed the diagnoses from osteodysplasia syndrome to Apert syndrome. These results suggest that the NGS panel provides a fast, accurate and cost-effective molecular diagnostic tool for identifying mutations in a highly genetically heterogeneous set of disorders such as genetic skeletal disorders. The data also stress the importance of a thorough clinical evaluation before DNA sequencing. The strategy should be applicable to other groups of disorders in which the molecular basis is largely known. PMID:26380986
Directory of Open Access Journals (Sweden)
Kyriakos Tsangaras
2015-11-01
Full Text Available Transcriptome analysis of polar bear (Ursus maritimus tissues identified sequences with similarity to Porcine Endogenous Retroviruses (PERV. Based on these sequences, four proviral copies and 15 solo long terminal repeats (LTRs of a newly described endogenous retrovirus were characterized from the polar bear draft genome sequence. Closely related sequences were identified by PCR analysis of brown bear (Ursus arctos and black bear (Ursus americanus but were absent in non-Ursinae bear species. The virus was therefore designated UrsusERV. Two distinct groups of LTRs were observed including a recombinant ERV that contained one LTR belonging to each group indicating that genomic invasions by at least two UrsusERV variants have recently occurred. Age estimates based on proviral LTR divergence and conservation of integration sites among ursids suggest the viral group is only a few million years old. The youngest provirus was polar bear specific, had intact open reading frames (ORFs and could potentially encode functional proteins. Phylogenetic analyses of UrsusERV consensus protein sequences suggest that it is part of a pig, gibbon and koala retrovirus clade. The young age estimates and lineage specificity of the virus suggests UrsusERV is a recent cross species transmission from an unknown reservoir and places the viral group among the youngest of ERVs identified in mammals.
Rebello, George; Ramesar, Rajkumar; Vorster, Alvera; Roberts, Lisa; Ehrenreich, Liezle; Oppon, Ekow; Gama, Dumisani; Bardien, Soraya; Greenberg, Jacquie; Bonapace, Giuseppe; Waheed, Abdul; Shah, Gul N.; Sly, William S.
2004-01-01
Genetic and physical mapping of the RP17 locus on 17q identified a 3.6-megabase candidate region that includes the gene encoding carbonic anhydrase IV (CA4), a glycosylphosphatidylinositol-anchored protein that is highly expressed in the choriocapillaris of the human eye. By sequencing candidate genes in this region, we identified a mutation that causes replacement of an arginine with a tryptophan (R14W) in the signal sequence of the CA4 gene at position -5 relative to the signal sequence cleavage site. This mutation was found to cosegregate with the disease phenotype in two large families and was not found in 36 unaffected family members or 100 controls. Expression of the mutant cDNA in COS-7 cells produced several findings, suggesting a mechanism by which the mutation can explain the autosomal dominant disease. In transfected COS-7 cells, the R14W mutation (i) reduced the steady-state level of carbonic anhydrase IV activity expressed by 28% due to a combination of decreased synthesis and accelerated turnover; (ii) led to up-regulation of immunoglobulin-binding protein, double-stranded RNA-regulated protein kinase-like ER kinase, and CCAAT/enhancer-binding protein homologous protein, markers of the unfolded protein response and endoplasmic reticulum stress; and (iii) induced apoptosis, as evidenced by annexin V binding and terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling staining, in most cells expressing the mutant, but not the WT, protein. We suggest that a high level of expression of the mutant allele in the endothelial cells of the choriocapillaris leads to apoptosis, leading in turn to ischemia in the overlying retina and producing autosomal dominant retinitis pigmentosa. PMID:15090652
Buján, Noemí; Balboa, Sabela; L Romalde, Jesús; E Toranzo, Alicia; Magariños, Beatriz
2018-05-08
At present, the genus Edwardsiella compiles five species: E. tarda, E. hoshinae, E. ictaluri, E. piscicida and E. anguillarum. Some species of this genus such us E. ictaluri and E. piscicida are important pathogens of numerous fish species. With the description of the two latter species, the phylogeny of Edwardsiella became more complicated. With the aim to clarify the relationships among all species in the genus, a multilocus sequence typing (MLST) approach was developed and applied to characterize 56 isolates and 6 reference strains belonging to the five Edwardsiella species. Moreover, several analyses based on the MLST scheme were performed to investigate the evolution within the genus, as well as the influence of recombination and mutation in the speciation. Edwardsiella isolates presented a high genetic variability reflected in the fourteen sequence types (ST) represented by a single isolates out of eighteen total ST. Mutation events were considerably more frequent than recombination, although both approximately equal influenced the genetic diversification. However, the speciation among species occurred mostly by recombination. Edwardsiella genus displays a non-clonal population structure with some degree of geographical isolation followed by a population expansion of E. piscicida. A database from this study was created and hosted on pubmlst.org (http://pubmlst.org/edwardsiella/). Copyright © 2018 Elsevier Inc. All rights reserved.
Systems genetics identifies a convergent gene network for cognition and neurodevelopmental disease.
Johnson, Michael R; Shkura, Kirill; Langley, Sarah R; Delahaye-Duriez, Andree; Srivastava, Prashant; Hill, W David; Rackham, Owen J L; Davies, Gail; Harris, Sarah E; Moreno-Moral, Aida; Rotival, Maxime; Speed, Doug; Petrovski, Slavé; Katz, Anaïs; Hayward, Caroline; Porteous, David J; Smith, Blair H; Padmanabhan, Sandosh; Hocking, Lynne J; Starr, John M; Liewald, David C; Visconti, Alessia; Falchi, Mario; Bottolo, Leonardo; Rossetti, Tiziana; Danis, Bénédicte; Mazzuferi, Manuela; Foerch, Patrik; Grote, Alexander; Helmstaedter, Christoph; Becker, Albert J; Kaminski, Rafal M; Deary, Ian J; Petretto, Enrico
2016-02-01
Genetic determinants of cognition are poorly characterized, and their relationship to genes that confer risk for neurodevelopmental disease is unclear. Here we performed a systems-level analysis of genome-wide gene expression data to infer gene-regulatory networks conserved across species and brain regions. Two of these networks, M1 and M3, showed replicable enrichment for common genetic variants underlying healthy human cognitive abilities, including memory. Using exome sequence data from 6,871 trios, we found that M3 genes were also enriched for mutations ascertained from patients with neurodevelopmental disease generally, and intellectual disability and epileptic encephalopathy in particular. M3 consists of 150 genes whose expression is tightly developmentally regulated, but which are collectively poorly annotated for known functional pathways. These results illustrate how systems-level analyses can reveal previously unappreciated relationships between neurodevelopmental disease-associated genes in the developed human brain, and provide empirical support for a convergent gene-regulatory network influencing cognition and neurodevelopmental disease.
Human Genome Sequencing in Health and Disease
Gonzaga-Jauregui, Claudia; Lupski, James R.; Gibbs, Richard A.
2013-01-01
Following the “finished,” euchromatic, haploid human reference genome sequence, the rapid development of novel, faster, and cheaper sequencing technologies is making possible the era of personalized human genomics. Personal diploid human genome sequences have been generated, and each has contributed to our better understanding of variation in the human genome. We have consequently begun to appreciate the vastness of individual genetic variation from single nucleotide to structural variants. Translation of genome-scale variation into medically useful information is, however, in its infancy. This review summarizes the initial steps undertaken in clinical implementation of personal genome information, and describes the application of whole-genome and exome sequencing to identify the cause of genetic diseases and to suggest adjuvant therapies. Better analysis tools and a deeper understanding of the biology of our genome are necessary in order to decipher, interpret, and optimize clinical utility of what the variation in the human genome can teach us. Personal genome sequencing may eventually become an instrument of common medical practice, providing information that assists in the formulation of a differential diagnosis. We outline herein some of the remaining challenges. PMID:22248320
Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G
2008-04-01
The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.
Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.
2008-01-01
The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283
Prasad, Megana K; Geoffroy, Véronique; Vicaire, Serge; Jost, Bernard; Dumas, Michael; Le Gras, Stéphanie; Switala, Marzena; Gasse, Barbara; Laugel-Haushalter, Virginie; Paschaki, Marie; Leheup, Bruno; Droz, Dominique; Dalstein, Amelie; Loing, Adeline; Grollemund, Bruno; Muller-Bolla, Michèle; Lopez-Cazaux, Séréna; Minoux, Maryline; Jung, Sophie; Obry, Frédéric; Vogt, Vincent; Davideau, Jean-Luc; Davit-Beal, Tiphaine; Kaiser, Anne-Sophie; Moog, Ute; Richard, Béatrice; Morrier, Jean-Jacques; Duprez, Jean-Pierre; Odent, Sylvie; Bailleul-Forestier, Isabelle; Rousset, Monique Marie; Merametdijan, Laure; Toutain, Annick; Joseph, Clara; Giuliano, Fabienne; Dahlet, Jean-Christophe; Courval, Aymeric; El Alloussi, Mustapha; Laouina, Samir; Soskin, Sylvie; Guffon, Nathalie; Dieux, Anne; Doray, Bérénice; Feierabend, Stephanie; Ginglinger, Emmanuelle; Fournier, Benjamin; de la Dure Molla, Muriel; Alembik, Yves; Tardieu, Corinne; Clauss, François; Berdal, Ariane; Stoetzel, Corinne; Manière, Marie Cécile; Dollfus, Hélène; Bloch-Zupan, Agnès
2016-01-01
Background Orodental diseases include several clinically and genetically heterogeneous disorders that can present in isolation or as part of a genetic syndrome. Due to the vast number of genes implicated in these disorders, establishing a molecular diagnosis can be challenging. We aimed to develop a targeted next-generation sequencing (NGS) assay to diagnose mutations and potentially identify novel genes mutated in this group of disorders. Methods We designed an NGS gene panel that targets 585 known and candidate genes in orodental disease. We screened a cohort of 101 unrelated patients without a molecular diagnosis referred to the Reference Centre for Oro-Dental Manifestations of Rare Diseases, Strasbourg, France, for a variety of orodental disorders including isolated and syndromic amelogenesis imperfecta (AI), isolated and syndromic selective tooth agenesis (STHAG), isolated and syndromic dentinogenesis imperfecta, isolated dentin dysplasia, otodental dysplasia and primary failure of tooth eruption. Results We discovered 21 novel pathogenic variants and identified the causative mutation in 39 unrelated patients in known genes (overall diagnostic rate: 39%). Among the largest subcohorts of patients with isolated AI (50 unrelated patients) and isolated STHAG (21 unrelated patients), we had a definitive diagnosis in 14 (27%) and 15 cases (71%), respectively. Surprisingly, COL17A1 mutations accounted for the majority of autosomal-dominant AI cases. Conclusions We have developed a novel targeted NGS assay for the efficient molecular diagnosis of a wide variety of orodental diseases. Furthermore, our panel will contribute to better understanding the contribution of these genes to orodental disease. Trial registration numbers NCT01746121 and NCT02397824. PMID:26502894
Genetic diversity of Entamoeba: Novel ribosomal lineages from cockroaches.
Directory of Open Access Journals (Sweden)
Tetsuro Kawano
Full Text Available Our current taxonomic perspective on Entamoeba is largely based on small-subunit ribosomal RNA genes (SSU rDNA from Entamoeba species identified in vertebrate hosts with minor exceptions such as E. moshkovskii from sewage water and E. marina from marine sediment. Other Entamoeba species have also been morphologically identified and described from non-vertebrate species such as insects; however, their genetic diversity remains unknown. In order to further disclose the diversity of the genus, we investigated Entamoeba spp. in the intestines of three cockroach species: Periplaneta americana, Blaptica dubia, and Gromphadorhina oblongonota. We obtained 134 Entamoeba SSU rDNA sequences from 186 cockroaches by direct nested PCR using the DNA extracts of intestines from cockroaches, followed by scrutinized BLASTn screening and phylogenetic analyses. All the sequences identified in this study were distinct from those reported from known Entamoeba species, and considered as novel Entamoeba ribosomal lineages. Furthermore, they were positioned at the base of the clade of known Entamoeba species and displayed remarkable degree of genetic diversity comprising nine major groups in the three cockroach species. This is the first report of the diversity of SSU rDNA sequences from Entamoeba in non-vertebrate host species, and should help to understand the genetic diversity of the genus Entamoeba.
Exact association test for small size sequencing data.
Lee, Joowon; Lee, Seungyeoun; Jang, Jin-Young; Park, Taesung
2018-04-20
Recent statistical methods for next generation sequencing (NGS) data have been successfully applied to identifying rare genetic variants associated with certain diseases. However, most commonly used methods (e.g., burden tests and variance-component tests) rely on large sample sizes. Notwithstanding, due to its-still high cost, NGS data is generally restricted to small sample sizes, that cannot be analyzed by most existing methods. In this work, we propose a new exact association test for sequencing data that does not require a large sample approximation, which is applicable to both common and rare variants. Our method, based on the Generalized Cochran-Mantel-Haenszel (GCMH) statistic, was applied to NGS datasets from intraductal papillary mucinous neoplasm (IPMN) patients. IPMN is a unique pancreatic cancer subtype that can turn into an invasive and hard-to-treat metastatic disease. Application of our method to IPMN data successfully identified susceptible genes associated with progression of IPMN to pancreatic cancer. Our method is expected to identify disease-associated genetic variants more successfully, and corresponding signal pathways, improving our understanding of specific disease's etiology and prognosis.
Directory of Open Access Journals (Sweden)
Michael V Zaragoza
Full Text Available The goals are to understand the primary genetic mechanisms that cause Sick Sinus Syndrome and to identify potential modifiers that may result in intrafamilial variability within a multigenerational family. The proband is a 63-year-old male with a family history of individuals (>10 with sinus node dysfunction, ventricular arrhythmia, cardiomyopathy, heart failure, and sudden death. We used exome sequencing of a single individual to identify a novel LMNA mutation and demonstrated the importance of Sanger validation and family studies when evaluating candidates. After initial single-gene studies were negative, we conducted exome sequencing for the proband which produced 9 gigabases of sequencing data. Bioinformatics analysis showed 94% of the reads mapped to the reference and identified 128,563 unique variants with 108,795 (85% located in 16,319 genes of 19,056 target genes. We discovered multiple variants in known arrhythmia, cardiomyopathy, or ion channel associated genes that may serve as potential modifiers in disease expression. To identify candidate mutations, we focused on ~2,000 variants located in 237 genes of 283 known arrhythmia, cardiomyopathy, or ion channel associated genes. We filtered the candidates to 41 variants in 33 genes using zygosity, protein impact, database searches, and clinical association. Only 21 of 41 (51% variants were validated by Sanger sequencing. We selected nine confirmed variants with minor allele frequencies G, a novel heterozygous splice-site mutation as the primary mutation with rare or novel variants in HCN4, MYBPC3, PKP4, TMPO, TTN, DMPK and KCNJ10 as potential modifiers and a mechanism consistent with haploinsufficiency.
Directory of Open Access Journals (Sweden)
Seanna Hewitt
Full Text Available Identification of genetic polymorphisms and subsequent development of molecular markers is important for marker assisted breeding of superior cultivars of economically important species. Sweet cherry (Prunus avium L. is an economically important non-climacteric tree fruit crop in the Rosaceae family and has undergone a genetic bottleneck due to breeding, resulting in limited genetic diversity in the germplasm that is utilized for breeding new cultivars. Therefore, it is critical to recognize the best platforms for identifying genome-wide polymorphisms that can help identify, and consequently preserve, the diversity in a genetically constrained species. For the identification of polymorphisms in five closely related genotypes of sweet cherry, a gel-based approach (TRAP, reduced representation sequencing (TRAPseq, a 6k cherry SNParray, and whole genome sequencing (WGS approaches were evaluated in the identification of genome-wide polymorphisms in sweet cherry cultivars. All platforms facilitated detection of polymorphisms among the genotypes with variable efficiency. In assessing multiple SNP detection platforms, this study has demonstrated that a combination of appropriate approaches is necessary for efficient polymorphism identification, especially between closely related cultivars of a species. The information generated in this study provides a valuable resource for future genetic and genomic studies in sweet cherry, and the insights gained from the evaluation of multiple approaches can be utilized for other closely related species with limited genetic diversity in the breeding germplasm. Keywords: Polymorphisms, Prunus avium, Next-generation sequencing, Target region amplification polymorphism (TRAP, Genetic diversity, SNParray, Reduced representation sequencing, Whole genome sequencing (WGS
Shu, Hai-Rong; Bi, Huai; Pan, Yang-Chun; Xu, Hang-Yu; Song, Jian-Xin; Hu, Jie
2015-09-16
Usher syndrome (USH) is an autosomal recessive disorder characterized by hearing impairment and vision dysfunction due to retinitis pigmentosa. Phenotypic and genetic heterogeneities of this disease make it impractical to obtain a genetic diagnosis by conventional Sanger sequencing. In this study, we applied a next-generation sequencing approach to detect genetic abnormalities in patients with USH. Two unrelated Chinese families were recruited, consisting of two USH afflicted patients and four unaffected relatives. We selected 199 genes related to inherited retinal diseases as targets for deep exome sequencing. Through systematic data analysis using an established bioinformatics pipeline, all variants that passed filter criteria were validated by Sanger sequencing and co-segregation analysis. A homozygous frameshift mutation (c.4382delA, p.T1462Lfs*2) was revealed in exon20 of gene USH2A in the F1 family. Two compound heterozygous mutations, IVS47 + 1G > A and c.13156A > T (p.I4386F), located in intron 48 and exon 63 respectively, of USH2A, were identified as causative mutations for the F2 family. Of note, the missense mutation c.13156A > T has not been reported so far. In conclusion, targeted exome sequencing precisely and rapidly identified the genetic defects in two Chinese USH families and this technique can be applied as a routine examination for these disorders with significant clinical and genetic heterogeneity.
The rapid evolution of molecular genetic diagnostics in neuromuscular diseases.
Volk, Alexander E; Kubisch, Christian
2017-10-01
The development of massively parallel sequencing (MPS) has revolutionized molecular genetic diagnostics in monogenic disorders. The present review gives a brief overview of different MPS-based approaches used in clinical diagnostics of neuromuscular disorders (NMDs) and highlights their advantages and limitations. MPS-based approaches like gene panel sequencing, (whole) exome sequencing, (whole) genome sequencing, and RNA sequencing have been used to identify the genetic cause in NMDs. Although gene panel sequencing has evolved as a standard test for heterogeneous diseases, it is still debated, mainly because of financial issues and unsolved problems of variant interpretation, whether genome sequencing (and to a lesser extent also exome sequencing) of single patients can already be regarded as routine diagnostics. However, it has been shown that the inclusion of parents and additional family members often leads to a substantial increase in the diagnostic yield in exome-wide/genome-wide MPS approaches. In addition, MPS-based RNA sequencing just enters the research and diagnostic scene. Next-generation sequencing increasingly enables the detection of the genetic cause in highly heterogeneous diseases like NMDs in an efficient and affordable way. Gene panel sequencing and family-based exome sequencing have been proven as potent and cost-efficient diagnostic tools. Although clinical validation and interpretation of genome sequencing is still challenging, diagnostic RNA sequencing represents a promising tool to bypass some hurdles of diagnostics using genomic DNA.
Pinzón, Jorge H C
2013-04-05
Aim: Using high-resolution genetic markers on samples gathered from across their wide distributional range, we endeavoured to delimit species diversity in reef-building Pocillopora corals. They are common, ecologically important, and widespread throughout the Indo-Pacific, but their phenotypic plasticity in response to environmental conditions and their nearly featureless microskeletal structures confound taxonomic assignments and limit an understanding of their ecology and evolution. Location: Indo-Pacific, Red Sea, Arabian/Persian Gulf. Methods: Sequence analysis of nuclear ribosomal (internal transcribed spacer 2, ITS2) and mitochondrial (open reading frame) loci were combined with population genetic data (seven microsatellite loci) for Pocillopora samples collected throughout the Indo-Pacific, Red Sea and Arabian Gulf, in order to assess the evolutionary divergence, reproductive isolation, frequency of hybridization and geographical distributions of the genus. Results: Between five and eight genetically distinct lineages comparable to species were identified with minimal or no hybridization between them. Colony morphology was generally incongruent with genetics across the full range of sampling, and the total number of species is apparently consistent with lower estimates from competing morphologically based hypotheses (about seven or eight taxa). The most commonly occurring genetic lineages were widely distributed and exhibited high dispersal and gene flow, factors that have probably minimized allopatric speciation. Uniquely among scleractinian genera, this genus contains a monophyletic group of broadcast spawners that evolved recently from an ancestral brooder. Main conclusions: The delineation of species diversity guided by genetics fundamentally advances our understanding of Pocillopora geographical distributions, ecology and evolution. Because traditional diagnostic features of colony and branch morphology are proving to be of limited utility, the
Pinzó n, Jorge H C; Sampayo, Eugenia M.; Cox, Evelyn F.; Chauka, Leonard J.; Chen, Chaolun Allen; Voolstra, Christian R.; LaJeunesse, Todd C.
2013-01-01
Aim: Using high-resolution genetic markers on samples gathered from across their wide distributional range, we endeavoured to delimit species diversity in reef-building Pocillopora corals. They are common, ecologically important, and widespread throughout the Indo-Pacific, but their phenotypic plasticity in response to environmental conditions and their nearly featureless microskeletal structures confound taxonomic assignments and limit an understanding of their ecology and evolution. Location: Indo-Pacific, Red Sea, Arabian/Persian Gulf. Methods: Sequence analysis of nuclear ribosomal (internal transcribed spacer 2, ITS2) and mitochondrial (open reading frame) loci were combined with population genetic data (seven microsatellite loci) for Pocillopora samples collected throughout the Indo-Pacific, Red Sea and Arabian Gulf, in order to assess the evolutionary divergence, reproductive isolation, frequency of hybridization and geographical distributions of the genus. Results: Between five and eight genetically distinct lineages comparable to species were identified with minimal or no hybridization between them. Colony morphology was generally incongruent with genetics across the full range of sampling, and the total number of species is apparently consistent with lower estimates from competing morphologically based hypotheses (about seven or eight taxa). The most commonly occurring genetic lineages were widely distributed and exhibited high dispersal and gene flow, factors that have probably minimized allopatric speciation. Uniquely among scleractinian genera, this genus contains a monophyletic group of broadcast spawners that evolved recently from an ancestral brooder. Main conclusions: The delineation of species diversity guided by genetics fundamentally advances our understanding of Pocillopora geographical distributions, ecology and evolution. Because traditional diagnostic features of colony and branch morphology are proving to be of limited utility, the
DNA barcoding as a means for identifying medicinal plants of Pakistan
International Nuclear Information System (INIS)
Schori, M.; Showalter, A.M.
2011-01-01
DNA barcoding involves the generation of DNA sequencing data from particular genetic regions in an organism and the use of these sequence data to identify or 'barcode' that organism and distinguish it from other species. Here, DNA barcoding is being used to identify several medicinal plants found in Pakistan and distinguished them from other similar species. Several challenges to the successful implementation of plant DNA barcoding are presented and discussed. Despite these challenges, DNA barcoding has the potential to uniquely identify medicinal plants and provide quality control and standardization of the plant material supplied to the pharmaceutical industry. (author)
Genetic Diversity and Phylogenetic Evolution of Tibetan Sheep Based on mtDNA D-Loop Sequences.
Directory of Open Access Journals (Sweden)
Jianbin Liu
Full Text Available The molecular and population genetic evidence of the phylogenetic status of the Tibetan sheep (Ovis aries is not well understood, and little is known about this species' genetic diversity. This knowledge gap is partly due to the difficulty of sample collection. This is the first work to address this question. Here, the genetic diversity and phylogenetic relationship of 636 individual Tibetan sheep from fifteen populations were assessed using 642 complete sequences of the mitochondrial DNA D-loop. Samples were collected from the Qinghai-Tibetan Plateau area in China, and reference data were obtained from the six reference breed sequences available in GenBank. The length of the sequences varied considerably, between 1031 and 1259 bp. The haplotype diversity and nucleotide diversity were 0.992±0.010 and 0.019±0.001, respectively. The average number of nucleotide differences was 19.635. The mean nucleotide composition of the 350 haplotypes was 32.961% A, 29.708% T, 22.892% C, 14.439% G, 62.669% A+T, and 37.331% G+C. Phylogenetic analysis showed that all four previously defined haplogroups (A, B, C, and D were found in the 636 individuals of the fifteen Tibetan sheep populations but that only the D haplogroup was found in Linzhou sheep. Further, the clustering analysis divided the fifteen Tibetan sheep populations into at least two clusters. The estimation of the demographic parameters from the mismatch analyses showed that haplogroups A, B, and C had at least one demographic expansion in Tibetan sheep. These results contribute to the knowledge of Tibetan sheep populations and will help inform future conservation programs about the Tibetan sheep native to the Qinghai-Tibetan Plateau.
Lau, Allison N; Peng, Lei; Goto, Hiroki; Chemnick, Leona; Ryder, Oliver A; Makova, Kateryna D
2009-01-01
Despite their ability to interbreed and produce fertile offspring, there is continued disagreement about the genetic relationship of the domestic horse (Equus caballus) to its endangered wild relative, Przewalski's horse (Equus przewalskii). Analyses have differed as to whether or not Przewalski's horse is placed phylogenetically as a separate sister group to domestic horses. Because Przewalski's horse and domestic horse are so closely related, genetic data can also be used to infer domestication-specific differences between the two. To investigate the genetic relationship of Przewalski's horse to the domestic horse and to address whether evolution of the domestic horse is driven by males or females, five homologous introns (a total of approximately 3 kb) were sequenced on the X and Y chromosomes in two Przewalski's horses and three breeds of domestic horses: Arabian horse, Mongolian domestic horse, and Dartmoor pony. Five autosomal introns (a total of approximately 6 kb) were sequenced for these horses as well. The sequences of sex chromosomal and autosomal introns were used to determine nucleotide diversity and the forces driving evolution in these species. As a result, X chromosomal and autosomal data do not place Przewalski's horses in a separate clade within phylogenetic trees for horses, suggesting a close relationship between domestic and Przewalski's horses. It was also found that there was a lack of nucleotide diversity on the Y chromosome and higher nucleotide diversity than expected on the X chromosome in domestic horses as compared with the Y chromosome and autosomes. This supports the hypothesis that very few male horses along with numerous female horses founded the various domestic horse breeds. Patterns of nucleotide diversity among different types of chromosomes were distinct for Przewalski's in contrast to domestic horses, supporting unique evolutionary histories of the two species.
Functional brain activation differences in stuttering identified with a rapid fMRI sequence
Kraft, Shelly Jo; Choo, Ai Leen; Sharma, Harish; Ambrose, Nicoline G.
2011-01-01
The purpose of this study was to investigate whether brain activity related to the presence of stuttering can be identified with rapid functional MRI (fMRI) sequences that involved overt and covert speech processing tasks. The long-term goal is to develop sensitive fMRI approaches with developmentally appropriate tasks to identify deviant speech motor and auditory brain activity in children who stutter closer to the age at which recovery from stuttering is documented. Rapid sequences may be preferred for individuals or populations who do not tolerate long scanning sessions. In this report, we document the application of a picture naming and phoneme monitoring task in three minute fMRI sequences with adults who stutter (AWS). If relevant brain differences are found in AWS with these approaches that conform to previous reports, then these approaches can be extended to younger populations. Pairwise contrasts of brain BOLD activity between AWS and normally fluent adults indicated the AWS showed higher BOLD activity in the right inferior frontal gyrus (IFG), right temporal lobe and sensorimotor cortices during picture naming and and higher activity in the right IFG during phoneme monitoring. The right lateralized pattern of BOLD activity together with higher activity in sensorimotor cortices is consistent with previous reports, which indicates rapid fMRI sequences can be considered for investigating stuttering in younger participants. PMID:22133409
The molecular genetic makeup of acute lymphoblastic leukemia.
Mullighan, Charles G
2012-01-01
Genomic profiling has transformed our understanding of the genetic basis of acute lymphoblastic leukemia (ALL). Recent years have seen a shift from microarray analysis and candidate gene sequencing to next-generation sequencing. Together, these approaches have shown that many ALL subtypes are characterized by constellations of structural rearrangements, submicroscopic DNA copy number alterations, and sequence mutations, several of which have clear implications for risk stratification and targeted therapeutic intervention. Mutations in genes regulating lymphoid development are a hallmark of ALL, and alterations of the lymphoid transcription factor gene IKZF1 (IKAROS) are associated with a high risk of treatment failure in B-ALL. Approximately 20% of B-ALL cases harbor genetic alterations that activate kinase signaling that may be amenable to treatment with tyrosine kinase inhibitors, including rearrangements of the cytokine receptor gene CRLF2; rearrangements of ABL1, JAK2, and PDGFRB; and mutations of JAK1 and JAK2. Whole-genome sequencing has also identified novel targets of mutation in aggressive T-lineage ALL, including hematopoietic regulators (ETV6 and RUNX1), tyrosine kinases, and epigenetic regulators. Challenges for the future are to comprehensively identify and experimentally validate all genetic alterations driving leukemogenesis and treatment failure in childhood and adult ALL and to implement genomic profiling into the clinical setting to guide risk stratification and targeted therapy.
Kuznedelov, K D; Timoshkin, O A; Goldman, E
1997-01-01
Polymerase chain reaction (PCR) and direct sequencing of small ribosomal RNA genes were used for analysis of genetic differences among Asiatic species of freshwater triclad genus Bdellocephala. Representatives of four species and four subspecies of this genus were used to establish homology between nucleotides in the 5'-end portion of small ribosomal RNA gene sequences. Within 552 nucleotide sites of aligned sequences compared, six variable base positions were discovered, dividing Bdellocephala into five different genotypes. Sequence data allow to distinguish two groups of these genotypes. One of them unites species from Kamchatka and Japan, another one unites Baikalian taxa. Agreement between available morphological, cytological and sequence data is discussed.
Huang, Xiaoyan; Tian, Mao; Li, Jiankang; Cui, Ling; Li, Min; Zhang, Jianguo
2017-11-01
Norrie disease (ND) is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. We identified a novel missense variant (c.314C>A) located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.
Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease
Directory of Open Access Journals (Sweden)
Xiaoyan Huang
2017-01-01
Full Text Available Purpose: Norrie disease (ND is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. Methods: To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. Results: We identified a novel missense variant (c.314C>A located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. Conclusion: c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.
Comprehensive Genetic Database of Expressed Sequence Tags for Coccolithophorids
Ranji, Mohammad; Hadaegh, Ahmad R.
Coccolithophorids are unicellular, marine, golden-brown, single-celled algae (Haptophyta) commonly found in near-surface waters in patchy distributions. They belong to the Phytoplankton family that is known to be responsible for much of the earth reproduction. Phytoplankton, just like plants live based on the energy obtained by Photosynthesis which produces oxygen. Substantial amount of oxygen in the earth's atmosphere is produced by Phytoplankton through Photosynthesis. The single-celled Emiliana Huxleyi is the most commonly known specie of Coccolithophorids and is known for extracting bicarbonate (HCO3) from its environment and producing calcium carbonate to form Coccoliths. Coccolithophorids are one of the world's primary producers, contributing about 15% of the average oceanic phytoplankton biomass to the oceans. They produce elaborate, minute calcite platelets (Coccoliths), covering the cell to form a Coccosphere and supplying up to 60% of the bulk pelagic calcite deposited on the sea floors. In order to understand the genetics of Coccolithophorid and the complexities of their biochemical reactions, we decided to build a database to store a complete profile of these organisms' genomes. Although a variety of such databases currently exist, (http://www.geneservice.co.uk/home/) none have yet been developed to comprehensively address the sequencing efforts underway by the Coccolithophorid research community. This database is called CocooExpress and is available to public (http://bioinfo.csusm.edu) for both data queries and sequence contribution.
Xu, Yao; Jiang, Yu; Shi, Tao; Cai, Hanfang; Lan, Xianyong; Zhao, Xin; Plath, Martin; Chen, Hong
2017-01-01
Whole-genome sequencing provides a powerful tool to obtain more genetic variability that could produce a range of benefits for cattle breeding industry. Nanyang (Bos indicus) and Qinchuan (Bos taurus) are two important Chinese indigenous cattle breeds with distinct phenotypes. To identify the genetic characteristics responsible for variation in phenotypes between the two breeds, in the present study, we for the first time sequenced the genomes of four Nanyang and four Qinchuan cattle with 10 ...
Genetic signatures of adaptation revealed from transcriptome sequencing of Arctic and red foxes
Kumar, Vikas; Kutschera, Verena E.; Nilsson, Maria A.; Janke, Axel
2015-01-01
Background The genus Vulpes (true foxes) comprises numerous species that inhabit a wide range of habitats and climatic conditions, including one species, the Arctic fox (Vulpes lagopus) which is adapted to the arctic region. A close relative to the Arctic fox, the red fox (Vulpes vulpes), occurs in subarctic to subtropical habitats. To study the genetic basis of their adaptations to different environments, transcriptome sequences from two Arctic foxes and one red fox individual were generated...
Zhang, F; Ge, Y Y; Wang, W Y; Shen, X L; Yu, X Y
2012-12-03
Conventional hybridization and selection techniques have aided the development of new ornamental crop cultivars. However, little information is available on the genetic divergence of bromeliad hybrids. In the present study, we investigated the genetic variability in interspecific hybrids of Aechmea gomosepala and A. recurvata var. recurvata using inflorescence characteristics and sequence-related amplified polymorphism (SRAP) markers. The morphological analysis showed that the putative hybrids were intermediate between both parental species with respect to inflorescence characteristics. The 16 SRAP primer combinations yield 265 bands, among which 154 (57.72%) were polymorphic. The genetic similarity was an average of 0.59 and ranged from 0.21 to 0.87, indicating moderate genetic divergence among the hybrids. The unweighted pair group method with arithmetic average (UPGMA)-based cluster analysis distinguished the hybrids from their parents with a genetic distance coefficient of 0.54. The cophenetic correlation was 0.93, indicating a good fit between the dendrogram and the original distance matrix. The two-dimensional plot from the principal coordinate analysis showed that the hybrids were intermediately dispersed between both parents, corresponding to the results of the UPGMA cluster and the morphological analysis. These results suggest that SRAP markers could help to identify breeders, characterize F(1) hybrids of bromeliads at an early stage, and expedite genetic improvement of bromeliad cultivars.
Apellániz-Ruiz, Maria; Tejero, Héctor; Inglada-Pérez, Lucía; Sánchez-Barroso, Lara; Gutiérrez-Gutiérrez, Gerardo; Calvo, Isabel; Castelo, Beatriz; Redondo, Andrés; García-Donás, Jesus; Romero-Laorden, Nuria; Sereno, Maria; Merino, María; Currás-Freixes, Maria; Montero-Conde, Cristina; Mancikova, Veronika
2017-01-01
PURPOSE: Neuropathy is the dose limiting toxicity of paclitaxel and a major cause for decreased quality of life. Genetic factors have been shown to contribute to paclitaxel neuropathy susceptibility; however, the major causes for inter-individual differences remain unexplained. In this study we identified genetic markers associated with paclitaxel-induced neuropathy through massive sequencing of candidate genes. EXPERIMENTAL DESIGN: We sequenced the coding region of 4 EPHA genes, 5 genes invo...
DEFF Research Database (Denmark)
Bothwell, H.; Bisbing, S.; Therkildsen, Nina Overgaard
2013-01-01
It is generally accepted that most plant populations are locally adapted. Yet, understanding how environmental forces give rise to adaptive genetic variation is a challenge in conservation genetics and crucial to the preservation of species under rapidly changing climatic conditions. Environmental...... loci, we compared outlier locus detection methods with a recently-developed landscape genetic approach. We analyzed 157 loci from samples of the alpine herb Gentiana nivalis collected across the European Alps. Principle coordinates of neighbor matrices (PCNM), eigenvectors that quantify multi...... variables identified eight more potentially adaptive loci than models run without spatial variables. 3) When compared to outlier detection methods, the landscape genetic approach detected four of the same loci plus 11 additional loci. 4) Temperature, precipitation, and solar radiation were the three major...
Diagnosis of Lynch Syndrome: Genetic Testing Identifies a Potentially Deadly Hereditary Disease
... of Lynch Syndrome Follow us A Diagnosis of Lynch Syndrome Genetic testing identifies a potentially deadly hereditary disease ... helped Jack learn what was wrong. Jack had Lynch Syndrome—an inherited disorder. Lynch Syndrome increases the risk ...
Pitfalls in genetic testing : the story of missed SCN1A mutations
Djémié, Tania; Weckhuysen, Sarah; von Spiczak, Sarah; Carvill, Gemma L; Jaehn, Johanna; Anttonen, Anna-Kaisa; Brilstra, Eva; Caglayan, Hande S; de Kovel, Carolien G; Depienne, Christel; Gaily, Eija; Gennaro, Elena; Giraldez, Beatriz G; Gormley, Padhraig; Guerrero-López, Rosa; Guerrini, Renzo; Hämäläinen, Eija; Hartmann, Corinna; Hernandez-Hernandez, Laura; Hjalgrim, Helle; Koeleman, Bobby P C; Leguern, Eric; Lehesjoki, Anna-Elina; Lemke, Johannes R; Leu, Costin; Marini, Carla; McMahon, Jacinta M; Mei, Davide; Møller, Rikke S; Muhle, Hiltrud; Myers, Candace T; Nava, Caroline; Serratosa, Jose M; Sisodiya, Sanjay M; Stephani, Ulrich; Striano, Pasquale; van Kempen, Marjan J A; Verbeek, Nienke E; Usluer, Sunay; Zara, Federico; Palotie, Aarno; Mefford, Heather C; Scheffer, Ingrid E; De Jonghe, Peter; Helbig, Ingo; Suls, Arvid
BACKGROUND: Sanger sequencing, still the standard technique for genetic testing in most diagnostic laboratories and until recently widely used in research, is gradually being complemented by next-generation sequencing (NGS). No single mutation detection technique is however perfect in identifying
Biesecker, Barbara B; Lewis, Katie L; Umstead, Kendall L; Johnston, Jennifer J; Turbitt, Erin; Fishler, Kristen P; Patton, John H; Miller, Ilana M; Heidlebaugh, Alexis R; Biesecker, Leslie G
2018-03-01
A critical bottleneck in clinical genomics is the mismatch between large volumes of results and the availability of knowledgeable professionals to return them. To test whether a web-based platform is noninferior to a genetic counselor for educating patients about their carrier results from exome sequencing. A randomized noninferiority trial conducted in a longitudinal sequencing cohort at the National Institutes of Health from February 5, 2014, to December 16, 2016, was used to compare the web-based platform with a genetic counselor. Among the 571 eligible participants, 1 to 7 heterozygous variants were identified in genes that cause a phenotype that is recessively inherited. Surveys were administered after cohort enrollment, immediately following trial education, and 1 month and 6 months later to primarily healthy postreproductive participants who expressed interest in learning their carrier results. Both intention-to-treat and per-protocol analyses were applied. A web-based platform that integrated education on carrier results with personal test results was designed to directly parallel disclosure education by a genetic counselor. The sessions took a mean (SD) time of 21 (10.6), and 27 (9.3) minutes, respectively. The primary outcomes and noninferiority margins (δNI) were knowledge (0 to 8, δNI = -1), test-specific distress (0 to 30, δNI = +1), and decisional conflict (15 to 75, δNI = +6). After 462 participants (80.9%) provided consent and were randomized, all but 3 participants (n = 459) completed surveys following education and counseling; 398 (86.1%) completed 1-month surveys and 392 (84.8%) completed 6-month surveys. Participants were predominantly well-educated, non-Hispanic white, married parents; mean (SD) age was 63 (63.1) years and 246 (53.6%) were men. The web platform was noninferior to the genetic counselor on outcomes assessed at 1 and 6 months: knowledge (mean group difference, -0.18; lower limit of 97.5% CI, -0.63;
Valdisser, Paula Arielle M R; Pappas, Georgios J; de Menezes, Ivandilson P P; Müller, Bárbara S F; Pereira, Wendell J; Narciso, Marcelo G; Brondani, Claudio; Souza, Thiago L P O; Borba, Tereza C O; Vianello, Rosana P
2016-06-01
Researchers have made great advances into the development and application of genomic approaches for common beans, creating opportunities to driving more real and applicable strategies for sustainable management of the genetic resource towards plant breeding. This work provides useful polymorphic single-nucleotide polymorphisms (SNPs) for high-throughput common bean genotyping developed by RAD (restriction site-associated DNA) sequencing. The RAD tags were generated from DNA pooled from 12 common bean genotypes, including breeding lines of different gene pools and market classes. The aligned sequences identified 23,748 putative RAD-SNPs, of which 3357 were adequate for genotyping; 1032 RAD-SNPs with the highest ADT (assay design tool) score are presented in this article. The RAD-SNPs were structurally annotated in different coding (47.00 %) and non-coding (53.00 %) sequence components of genes. A subset of 384 RAD-SNPs with broad genome distribution was used to genotype a diverse panel of 95 common bean germplasms and revealed a successful amplification rate of 96.6 %, showing 73 % of polymorphic SNPs within the Andean group and 83 % in the Mesoamerican group. A slightly increased He (0.161, n = 21) value was estimated for the Andean gene pool, compared to the Mesoamerican group (0.156, n = 74). For the linkage disequilibrium (LD) analysis, from a group of 580 SNPs (289 RAD-SNPs and 291 BARC-SNPs) genotyped for the same set of genotypes, 70.2 % were in LD, decreasing to 0.10 %in the Andean group and 0.77 % in the Mesoamerican group. Haplotype patterns spanning 310 Mb of the genome (60 %) were characterized in samples from different origins. However, the haplotype frameworks were under-represented for the Andean (7.85 %) and Mesoamerican (5.55 %) gene pools separately. In conclusion, RAD sequencing allowed the discovery of hundreds of useful SNPs for broad genetic analysis of common bean germplasm. From now, this approach provides an excellent panel
Black, PA
2015-10-24
Background Whole genome sequencing has revolutionised the interrogation of mycobacterial genomes. Recent studies have reported conflicting findings on the genomic stability of Mycobacterium tuberculosis during the evolution of drug resistance. In an age where whole genome sequencing is increasingly relied upon for defining the structure of bacterial genomes, it is important to investigate the reliability of next generation sequencing to identify clonal variants present in a minor percentage of the population. This study aimed to define a reliable cut-off for identification of low frequency sequence variants and to subsequently investigate genetic heterogeneity and the evolution of drug resistance in M. tuberculosis. Methods Genomic DNA was isolated from single colonies from 14 rifampicin mono-resistant M. tuberculosis isolates, as well as the primary cultures and follow up MDR cultures from two of these patients. The whole genomes of the M. tuberculosis isolates were sequenced using either the Illumina MiSeq or Illumina HiSeq platforms. Sequences were analysed with an in-house pipeline. Results Using next-generation sequencing in combination with Sanger sequencing and statistical analysis we defined a read frequency cut-off of 30 % to identify low frequency M. tuberculosis variants with high confidence. Using this cut-off we demonstrated a high rate of genetic diversity between single colonies isolated from one population, showing that by using the current sequencing technology, single colonies are not a true reflection of the genetic diversity within a whole population and vice versa. We further showed that numerous heterogeneous variants emerge and then disappear during the evolution of isoniazid resistance within individual patients. Our findings allowed us to formulate a model for the selective bottleneck which occurs during the course of infection, acting as a genomic purification event. Conclusions Our study demonstrated true levels of genetic diversity
Directory of Open Access Journals (Sweden)
David G Ashbrook
2015-07-01
Full Text Available Bipolar disorder (BD is a significant neuropsychiatric disorder with a lifetime prevalence of ~1%. To identify genetic variants underlying BD genome-wide association studies (GWAS have been carried out. While many variants of small effect associated with BD have been identified few have yet been confirmed, partly because of the low power of GWAS due to multiple comparisons being made. Complementary mapping studies using murine models have identified genetic variants for behavioral traits linked to BD, often with high power, but these identified regions often contain too many genes for clear identification of candidate genes. In the current study we have aligned human BD GWAS results and mouse linkage studies to help define and evaluate candidate genes linked to BD, seeking to use the power of the mouse mapping with the precision of GWAS. We use quantitative trait mapping for open field test and elevated zero maze data in the largest mammalian model system, the BXD recombinant inbred mouse population, to identify genomic regions associated with these BD-like phenotypes. We then investigate these regions in whole genome data from the Psychiatric Genomics Consortium’s bipolar disorder GWAS to identify candidate genes associated with BD. Finally we establish the biological relevance and pathways of these genes in a comprehensive systems genetics analysis.We identify four genes associated with both mouse anxiety and human BD. While TNR is a novel candidate for BD, we can confirm previously suggested associations with CMYA5, MCTP1 and RXRG. A cross-species, systems genetics analysis shows that MCTP1, RXRG and TNR coexpress with genes linked to psychiatric disorders and identify the striatum as a potential site of action. CMYA5, MCTP1, RXRG and TNR are associated with mouse anxiety and human BD. We hypothesize that MCTP1, RXRG and TNR influence intercellular signaling in the striatum.
Bakar, Mohamad-Azam Akmal Abu; Rovie-Ryan, Jeffrine Japning; Ampeng, Ahmad; Yaakop, Salmah; Nor, Shukor Md; Md-Zain, Badrul Munir
2018-04-01
Mousedeer is one of the primitive mammals that can be found mainly in Southeast-Asia region. There are two species of mousedeer in Malaysia which are Tragulus kanchil and Tragulus napu. Both species can be distinguish by size, coat coloration, and throat pattern but clear diagnosis still cannot be found. The objective of the study is to show the genetic distance relationship between T. kanchil and T. napu and their population based on mitochondrial DNA (mtDNA) cytochrome oxidase I (COI) and D-loop region. There are 42 sample of mousedeer were used in this study collected by PERHILITAN from different locality. Another 29 D-loop sequence were retrieved from Genbank for comparative analysis. All sample were amplified using universal primer and species-specific primer for COI and D-loop genes via PCR process. The amplified sequences were analyzed to determine genetic distance of T. kanchil and T. napu. From the analysis, the average genetic distance between T. kanchil and T. napu based on locus COI and D-loop were 0.145 and 0.128 respectively. The genetic distance between populations of T. kanchil based on locus COI was between 0.003-0.013. For locus D-loop, genetic distance analysis showed distance in relationship between west-coast populations to east-coast population of T. kanchil. COI and D-loop mtDNA region provided a clear picture on the relationship within the mousedeer species. Last but not least, conservation effort toward protecting this species can be done by study the molecular genetics and prevent the extinction of this species.
Kim, Daniel Seung; Burt, Amber A; Ranchalis, Jane E; Wilmot, Beth; Smith, Joshua D; Patterson, Karynne E; Coe, Bradley P; Li, Yatong K; Bamshad, Michael J; Nikolas, Molly; Eichler, Evan E; Swanson, James M; Nigg, Joel T; Nickerson, Deborah A; Jarvik, Gail P
2017-06-01
Attention-Deficit Hyperactivity Disorder (ADHD) has high heritability; however, studies of common variation account for ADHD variance. Using data from affected participants without a family history of ADHD, we sought to identify de novo variants that could account for sporadic ADHD. Considering a total of 128 families, two analyses were conducted in parallel: first, in 11 unaffected parent/affected proband trios (or quads with the addition of an unaffected sibling) we completed exome sequencing. Six de novo missense variants at highly conserved bases were identified and validated from four of the 11 families: the brain-expressed genes TBC1D9, DAGLA, QARS, CSMD2, TRPM2, and WDR83. Separately, in 117 unrelated probands with sporadic ADHD, we sequenced a panel of 26 genes implicated in intellectual disability (ID) and autism spectrum disorder (ASD) to evaluate whether variation in ASD/ID-associated genes were also present in participants with ADHD. Only one putative deleterious variant (Gln600STOP) in CHD1L was identified; this was found in a single proband. Notably, no other nonsense, splice, frameshift, or highly conserved missense variants in the 26 gene panel were identified and validated. These data suggest that de novo variant analysis in families with independently adjudicated sporadic ADHD diagnosis can identify novel genes implicated in ADHD pathogenesis. Moreover, that only one of the 128 cases (0.8%, 11 exome, and 117 MIP sequenced participants) had putative deleterious variants within our data in 26 genes related to ID and ASD suggests significant independence in the genetic pathogenesis of ADHD as compared to ASD and ID phenotypes. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Whole-exome sequencing for diagnosis of hereditary ichthyosis.
Sitek, J C; Kulseth, M A; Rypdal, K B; Skodje, T; Sheng, Y; Retterstøl, L
2018-02-14
Hereditary ichthyosis constitutes a diverse group of cornification disorders. Identification of the molecular cause facilitates optimal patient care. We wanted to estimate the diagnostic yield of applying whole-exome sequencing (WES) in the routine genetic workup of inherited ichthyosis. During a 3-year-period, all ichthyosis patients, except X-linked and mild vulgar ichthyosis, consecutively admitted to a university hospital clinic were offered WES with subsequent analysis of ichthyosis-related genes as a first-line genetic investigation. Clinical and molecular data have been collected retrospectively. Genetic variants causative for the ichthyosis were identified in 27 of 34 investigated patients (79.4%). In all, 31 causative mutations across 13 genes were disclosed, including 12 novel variants. TGM1 was the most frequently mutated gene, accounting for 43.7% of patients suffering from autosomal recessive congenital ichthyosis (ARCI). Whole-exome sequencing appears an effective tool in disclosing the molecular cause of patients with hereditary ichthyosis seen in clinical practice and should be considered a first-tier genetic test in these patients. © 2018 European Academy of Dermatology and Venereology.
Xie, Zeyi; Zhou, Zhilin; Li, Hongmin; Yu, Jingjing; Jiang, Jiaojiao; Tang, Zhonghou; Ma, Daifu; Zhang, Baohong; Han, Yonghua; Li, Zongyun
2018-05-21
Sweetpotato (Ipomoea batatas L.) is a globally important economic food crop. It belongs to Convolvulaceae family and origins in the tropics; however, sweetpotato is sensitive to cold stress during storage. In this study, we performed transcriptome sequencing to investigate the sweetpotato response to chilling stress during storage. A total of 110,110 unigenes were generated via high-throughput sequencing. Differentially expressed genes (DEGs) analysis showed that 18,681 genes were up-regulated and 21,983 genes were down-regulated in low temperature condition. Many DEGs were related to the cell membrane system, antioxidant enzymes, carbohydrate metabolism, and hormone metabolism, which are potentially associated with sweetpotato resistance to low temperature. The existence of DEGs suggests a molecular basis for the biochemical and physiological consequences of sweetpotato in low temperature storage conditions. Our analysis will provide a new target for enhancement of sweetpotato cold stress tolerance in postharvest storage through genetic manipulation. Copyright © 2018. Published by Elsevier Inc.
[Identification of a repetitive sequence element for DNA fingerprinting in Phytophthora sojae].
Yin, Lihua; Wang, Qinhu; Ning, Feng; Zhu, Xiaoying; Zuo, Yuhu; Shan, Weixing
2010-04-01
Establishment of DNA fingerprinting in Phytophthora sojae and an analysis of genetic relationship of Heilongjiang and Xinjiang populations. Bioinformatics tools were used to search repetitive sequences in P. sojae and Southern blot analysis was employed for DNA fingerprinting analysis of P. sojae populations from Heilongjiang and Xinjiang using the identified repetitive sequence. A moderately repetitive sequence was identified and designated as PS1227. Southern blot analysis indicated 34 distinct bands ranging in size from 1.5 kb-23 kb, of which 21 were polymorphic among 49 isolates examined. Analysis of single-zoospore progenies showed that the PS1227 fingerprint pattern was mitotically stable. DNA fingerprinting showed that the P. sojae isolates HP4002, SY6 and GJ0105 of Heilongjiang are genetically identical to DW303, 71228 and 71222 of Xinjiang, respectively. A moderately repetitive sequence designated PS1227 which will be useful for epidemiology and population biology studies of P. sojae was obtained, and a PS1227-based DNA fingerprinting analysis provided molecular evidence that P. sojae in Xinjiang was likely introduced from Heilongjiang.
Novel genetic loci underlying human intracranial volume identified through genome-wide association
Adams, Hieab HH; Hibar, Derrek P; Chouraki, Vincent; Stein, Jason L; Nyquist, Paul A; Rentería, Miguel E; Trompet, Stella; Arias-Vasquez, Alejandro; Seshadri, Sudha; Desrivières, Sylvane; Beecham, Ashley H; Jahanshad, Neda; Wittfeld, Katharina; Van der Lee, Sven J; Abramovic, Lucija; Alhusaini, Saud; Amin, Najaf; Andersson, Micael; Arfanakis, Konstantinos; Aribisala, Benjamin S; Armstrong, Nicola J; Athanasiu, Lavinia; Axelsson, Tomas; Beiser, Alexa; Bernard, Manon; Bis, Joshua C; Blanken, Laura ME; Blanton, Susan H; Bohlken, Marc M; Boks, Marco P; Bralten, Janita; Brickman, Adam M; Carmichael, Owen; Chakravarty, M Mallar; Chauhan, Ganesh; Chen, Qiang; Ching, Christopher RK; Cuellar-Partida, Gabriel; Den Braber, Anouk; Doan, Nhat Trung; Ehrlich, Stefan; Filippi, Irina; Ge, Tian; Giddaluru, Sudheer; Goldman, Aaron L; Gottesman, Rebecca F; Greven, Corina U; Grimm, Oliver; Griswold, Michael E; Guadalupe, Tulio; Hass, Johanna; Haukvik, Unn K; Hilal, Saima; Hofer, Edith; Hoehn, David; Holmes, Avram J; Hoogman, Martine; Janowitz, Deborah; Jia, Tianye; Kasperaviciute, Dalia; Kim, Sungeun; Klein, Marieke; Kraemer, Bernd; Lee, Phil H; Liao, Jiemin; Liewald, David CM; Lopez, Lorna M; Luciano, Michelle; Macare, Christine; Marquand, Andre; Matarin, Mar; Mather, Karen A; Mattheisen, Manuel; Mazoyer, Bernard; McKay, David R; McWhirter, Rebekah; Milaneschi, Yuri; Mirza-Schreiber, Nazanin; Muetzel, Ryan L; Maniega, Susana Muñoz; Nho, Kwangsik; Nugent, Allison C; Olde Loohuis, Loes M; Oosterlaan, Jaap; Papmeyer, Martina; Pappa, Irene; Pirpamer, Lukas; Pudas, Sara; Pütz, Benno; Rajan, Kumar B; Ramasamy, Adaikalavan; Richards, Jennifer S; Risacher, Shannon L; Roiz-Santiañez, Roberto; Rommelse, Nanda; Rose, Emma J; Royle, Natalie A; Rundek, Tatjana; Sämann, Philipp G; Satizabal, Claudia L; Schmaal, Lianne; Schork, Andrew J; Shen, Li; Shin, Jean; Shumskaya, Elena; Smith, Albert V; Sprooten, Emma; Strike, Lachlan T; Teumer, Alexander; Thomson, Russell; Tordesillas-Gutierrez, Diana; Toro, Roberto; Trabzuni, Daniah; Vaidya, Dhananjay; Van der Grond, Jeroen; Van der Meer, Dennis; Van Donkelaar, Marjolein MJ; Van Eijk, Kristel R; Van Erp, Theo GM; Van Rooij, Daan; Walton, Esther; Westlye, Lars T; Whelan, Christopher D; Windham, Beverly G; Winkler, Anderson M; Woldehawariat, Girma; Wolf, Christiane; Wolfers, Thomas; Xu, Bing; Yanek, Lisa R; Yang, Jingyun; Zijdenbos, Alex; Zwiers, Marcel P; Agartz, Ingrid; Aggarwal, Neelum T; Almasy, Laura; Ames, David; Amouyel, Philippe; Andreassen, Ole A; Arepalli, Sampath; Assareh, Amelia A; Barral, Sandra; Bastin, Mark E; Becker, Diane M; Becker, James T; Bennett, David A; Blangero, John; van Bokhoven, Hans; Boomsma, Dorret I; Brodaty, Henry; Brouwer, Rachel M; Brunner, Han G; Buckner, Randy L; Buitelaar, Jan K; Bulayeva, Kazima B; Cahn, Wiepke; Calhoun, Vince D; Cannon, Dara M; Cavalleri, Gianpiero L; Chen, Christopher; Cheng, Ching-Yu; Cichon, Sven; Cookson, Mark R; Corvin, Aiden; Crespo-Facorro, Benedicto; Curran, Joanne E; Czisch, Michael; Dale, Anders M; Davies, Gareth E; De Geus, Eco JC; De Jager, Philip L; de Zubicaray, Greig I; Delanty, Norman; Depondt, Chantal; DeStefano, Anita L; Dillman, Allissa; Djurovic, Srdjan; Donohoe, Gary; Drevets, Wayne C; Duggirala, Ravi; Dyer, Thomas D; Erk, Susanne; Espeseth, Thomas; Evans, Denis A; Fedko, Iryna O; Fernández, Guillén; Ferrucci, Luigi; Fisher, Simon E; Fleischman, Debra A; Ford, Ian; Foroud, Tatiana M; Fox, Peter T; Francks, Clyde; Fukunaga, Masaki; Gibbs, J Raphael; Glahn, David C; Gollub, Randy L; Göring, Harald HH; Grabe, Hans J; Green, Robert C; Gruber, Oliver; Gudnason, Vilmundur; Guelfi, Sebastian; Hansell, Narelle K; Hardy, John; Hartman, Catharina A; Hashimoto, Ryota; Hegenscheid, Katrin; Heinz, Andreas; Le Hellard, Stephanie; Hernandez, Dena G; Heslenfeld, Dirk J; Ho, Beng-Choon; Hoekstra, Pieter J; Hoffmann, Wolfgang; Hofman, Albert; Holsboer, Florian; Homuth, Georg; Hosten, Norbert; Hottenga, Jouke-Jan; Hulshoff Pol, Hilleke E; Ikeda, Masashi; Ikram, M Kamran; Jack, Clifford R; Jenkinson, Mark; Johnson, Robert; Jönsson, Erik G; Jukema, J Wouter; Kahn, René S; Kanai, Ryota; Kloszewska, Iwona; Knopman, David S; Kochunov, Peter; Kwok, John B; Lawrie, Stephen M; Lemaître, Hervé; Liu, Xinmin; Longo, Dan L; Longstreth, WT; Lopez, Oscar L; Lovestone, Simon; Martinez, Oliver; Martinot, Jean-Luc; Mattay, Venkata S; McDonald, Colm; McIntosh, Andrew M; McMahon, Katie L; McMahon, Francis J; Mecocci, Patrizia; Melle, Ingrid; Meyer-Lindenberg, Andreas; Mohnke, Sebastian; Montgomery, Grant W; Morris, Derek W; Mosley, Thomas H; Mühleisen, Thomas W; Müller-Myhsok, Bertram; Nalls, Michael A; Nauck, Matthias; Nichols, Thomas E; Niessen, Wiro J; Nöthen, Markus M; Nyberg, Lars; Ohi, Kazutaka; Olvera, Rene L; Ophoff, Roel A; Pandolfo, Massimo; Paus, Tomas; Pausova, Zdenka; Penninx, Brenda WJH; Pike, G Bruce; Potkin, Steven G; Psaty, Bruce M; Reppermund, Simone; Rietschel, Marcella; Roffman, Joshua L; Romanczuk-Seiferth, Nina; Rotter, Jerome I; Ryten, Mina; Sacco, Ralph L; Sachdev, Perminder S; Saykin, Andrew J; Schmidt, Reinhold; Schofield, Peter R; Sigurdsson, Sigurdur; Simmons, Andy; Singleton, Andrew; Sisodiya, Sanjay M; Smith, Colin; Smoller, Jordan W; Soininen, Hilkka; Srikanth, Velandai; Steen, Vidar M; Stott, David J; Sussmann, Jessika E; Thalamuthu, Anbupalam; Tiemeier, Henning; Toga, Arthur W; Traynor, Bryan J; Troncoso, Juan; Turner, Jessica A; Tzourio, Christophe; Uitterlinden, Andre G; Valdés Hernández, Maria C; Van der Brug, Marcel; Van der Lugt, Aad; Van der Wee, Nic JA; Van Duijn, Cornelia M; Van Haren, Neeltje EM; Van 't Ent, Dennis; Van Tol, Marie-Jose; Vardarajan, Badri N; Veltman, Dick J; Vernooij, Meike W; Völzke, Henry; Walter, Henrik; Wardlaw, Joanna M; Wassink, Thomas H; Weale, Michael E; Weinberger, Daniel R; Weiner, Michael W; Wen, Wei; Westman, Eric; White, Tonya; Wong, Tien Y; Wright, Clinton B; Zielke, H Ronald; Zonderman, Alan B; Deary, Ian J; DeCarli, Charles; Schmidt, Helena; Martin, Nicholas G; De Craen, Anton JM; Wright, Margaret J; Launer, Lenore J; Schumann, Gunter; Fornage, Myriam; Franke, Barbara; Debette, Stéphanie; Medland, Sarah E; Ikram, M Arfan; Thompson, Paul M
2016-01-01
Intracranial volume reflects the maximally attained brain size during development, and remains stable with loss of tissue in late life. It is highly heritable, but the underlying genes remain largely undetermined. In a genome-wide association study of 32,438 adults, we discovered five novel loci for intracranial volume and confirmed two known signals. Four of the loci are also associated with adult human stature, but these remained associated with intracranial volume after adjusting for height. We found a high genetic correlation with child head circumference (ρgenetic=0.748), which indicated a similar genetic background and allowed for the identification of four additional loci through meta-analysis (Ncombined = 37,345). Variants for intracranial volume were also related to childhood and adult cognitive function, Parkinson’s disease, and enriched near genes involved in growth pathways including PI3K–AKT signaling. These findings identify biological underpinnings of intracranial volume and provide genetic support for theories on brain reserve and brain overgrowth. PMID:27694991
International Nuclear Information System (INIS)
Lakhssassi, K.; González-Recio, O.
2017-01-01
Haplotypes from sequencing data may improve the prediction accuracy in genomic evaluations as haplotypes are in stronger linkage disequilibrium with quantitative trait loci than markers from SNP chips. This study focuses first, on the creation of haplotypes in a population sample of 450 Holstein animals, with full-sequence data from the 1000 bull genomes project; and second, on incorporating them into the whole genome prediction model. In total, 38,319,258 SNPs (and indels) from Next Generation Sequencing were included in the analysis. After filtering variants with minor allele frequency (MAF< 0.025) 13,912,326 SNPs were available for the haplotypes extraction with findhap.f90. The number of SNPs in the haploblocks was on average 924 SNP (166,552 bp). Unique haplotypes were around 97% in all chromosomes and were ignored leaving 153,428 haplotypes. Estimated haplotypes had a large contribution to the total variance of genomic estimated breeding values for kilogram of protein, Global Type Index, Somatic Cell Score and Days Open (between 32 and 99.9%). Haploblocks containing haplotypes with large effects were selected by filtering for each trait, haplotypes whose effect was larger/lower than the mean plus/minus 3 times the standard deviation (SD) and 1 SD above the mean of the haplotypes effect distribution. Results showed that filtering by 3 SD would not be enough to capture a large proportion of genetic variance, whereas filtering by 1 SD could be useful but model convergence should be considered. Additionally, sequence haplotypes were able to capture additional genetic variance to the polygenic effect for traits undergoing lower selection intensity like fertility and health traits.
Energy Technology Data Exchange (ETDEWEB)
Lakhssassi, K.; González-Recio, O.
2017-07-01
Haplotypes from sequencing data may improve the prediction accuracy in genomic evaluations as haplotypes are in stronger linkage disequilibrium with quantitative trait loci than markers from SNP chips. This study focuses first, on the creation of haplotypes in a population sample of 450 Holstein animals, with full-sequence data from the 1000 bull genomes project; and second, on incorporating them into the whole genome prediction model. In total, 38,319,258 SNPs (and indels) from Next Generation Sequencing were included in the analysis. After filtering variants with minor allele frequency (MAF< 0.025) 13,912,326 SNPs were available for the haplotypes extraction with findhap.f90. The number of SNPs in the haploblocks was on average 924 SNP (166,552 bp). Unique haplotypes were around 97% in all chromosomes and were ignored leaving 153,428 haplotypes. Estimated haplotypes had a large contribution to the total variance of genomic estimated breeding values for kilogram of protein, Global Type Index, Somatic Cell Score and Days Open (between 32 and 99.9%). Haploblocks containing haplotypes with large effects were selected by filtering for each trait, haplotypes whose effect was larger/lower than the mean plus/minus 3 times the standard deviation (SD) and 1 SD above the mean of the haplotypes effect distribution. Results showed that filtering by 3 SD would not be enough to capture a large proportion of genetic variance, whereas filtering by 1 SD could be useful but model convergence should be considered. Additionally, sequence haplotypes were able to capture additional genetic variance to the polygenic effect for traits undergoing lower selection intensity like fertility and health traits.
Exome sequencing of a multigenerational human pedigree.
Directory of Open Access Journals (Sweden)
Dale J Hedges
2009-12-01
Full Text Available Over the next few years, the efficient use of next-generation sequencing (NGS in human genetics research will depend heavily upon the effective mechanisms for the selective enrichment of genomic regions of interest. Recently, comprehensive exome capture arrays have become available for targeting approximately 33 Mb or approximately 180,000 coding exons across the human genome. Selective genomic enrichment of the human exome offers an attractive option for new experimental designs aiming to quickly identify potential disease-associated genetic variants, especially in family-based studies. We have evaluated a 2.1 M feature human exome capture array on eight individuals from a three-generation family pedigree. We were able to cover up to 98% of the targeted bases at a long-read sequence read depth of > or = 3, 86% at a read depth of > or = 10, and over 50% of all targets were covered with > or = 20 reads. We identified up to 14,284 SNPs and small indels per individual exome, with up to 1,679 of these representing putative novel polymorphisms. Applying the conservative genotype calling approach HCDiff, the average rate of detection of a variant allele based on Illumina 1 M BeadChips genotypes was 95.2% at > or = 10x sequence. Further, we propose an advantageous genotype calling strategy for low covered targets that empirically determines cut-off thresholds at a given coverage depth based on existing genotype data. Application of this method was able to detect >99% of SNPs covered > or = 8x. Our results offer guidance for "real-world" applications in human genetics and provide further evidence that microarray-based exome capture is an efficient and reliable method to enrich for chromosomal regions of interest in next-generation sequencing experiments.
Directory of Open Access Journals (Sweden)
Sean E Schneider
Full Text Available We show here that 105 regions in two Lepidoptera genomes appear to derive from horizontally transferred wasp DNA. We experimentally verified the presence of two of these sequences in a diverse set of silkworm (Bombyx mori genomes. We hypothesize that these horizontal transfers are made possible by the unusual strategy many parasitoid wasps employ of injecting hosts with endosymbiotic polydnaviruses to minimize the host's defense response. Because these virus-like particles deliver wasp DNA to the cells of the host, there has been much interest in whether genetic information can be permanently transferred from the wasp to the host. Two transferred sequences code for a BEN domain, known to be associated with polydnaviruses and transcriptional regulation. These findings represent the first documented cases of horizontal transfer of genes between two organisms by a polydnavirus. This presents an interesting evolutionary paradigm in which host species can acquire new sequences from parasitoid wasps that attack them. Hymenoptera and Lepidoptera diverged ∼300 MYA, making this type of event a source of novel sequences for recipient species. Unlike many other cases of horizontal transfer between two eukaryote species, these sequence transfers can be explained without the need to invoke the sequences 'hitchhiking' on a third organism (e.g. retrovirus capable of independent reproduction. The cellular machinery necessary for the transfer is contained entirely in the wasp genome. The work presented here is the first such discovery of what is likely to be a broader phenomenon among species affected by these wasps.
Sheehan, Vivien A; Crosby, Jacy R; Sabo, Aniko; Mortier, Nicole A; Howard, Thad A; Muzny, Donna M; Dugan-Perez, Shannon; Aygun, Banu; Nottage, Kerri A; Boerwinkle, Eric; Gibbs, Richard A; Ware, Russell E; Flanagan, Jonathan M
2014-01-01
Hydroxyurea has proven efficacy in children and adults with sickle cell anemia (SCA), but with considerable inter-individual variability in the amount of fetal hemoglobin (HbF) produced. Sibling and twin studies indicate that some of that drug response variation is heritable. To test the hypothesis that genetic modifiers influence pharmacological induction of HbF, we investigated phenotype-genotype associations using whole exome sequencing of children with SCA treated prospectively with hydroxyurea to maximum tolerated dose (MTD). We analyzed 171 unrelated patients enrolled in two prospective clinical trials, all treated with dose escalation to MTD. We examined two MTD drug response phenotypes: HbF (final %HbF minus baseline %HbF), and final %HbF. Analyzing individual genetic variants, we identified multiple low frequency and common variants associated with HbF induction by hydroxyurea. A validation cohort of 130 pediatric sickle cell patients treated to MTD with hydroxyurea was genotyped for 13 non-synonymous variants with the strongest association with HbF response to hydroxyurea in the discovery cohort. A coding variant in Spalt-like transcription factor, or SALL2, was associated with higher final HbF in this second independent replication sample and SALL2 represents an outstanding novel candidate gene for further investigation. These findings may help focus future functional studies and provide new insights into the pharmacological HbF upregulation by hydroxyurea in patients with SCA.
Xu, Xiao; Sun, Xin; Hu, Xue-Song; Zhuang, Yan; Liu, Yue-Chen; Meng, Hao; Miao, Lin; Yu, He; Luo, Shu-Jin
2016-08-25
Domestic cats exhibit abundant variations in tail morphology and serve as an excellent model to study the development and evolution of vertebrate tails. Cats with shortened and kinked tails were first recorded in the Malayan archipelago by Charles Darwin in 1868 and remain quite common today in Southeast and East Asia. To elucidate the genetic basis of short tails in Asian cats, we built a pedigree of 13 cats segregating at the trait with a founder from southern China and performed linkage mapping based on whole genome sequencing data from the pedigree. The short-tailed trait was mapped to a 5.6 Mb region of Chr E1, within which the substitution c. 5T > C in the somite segmentation-related gene HES7 was identified as the causal mutation resulting in a missense change (p.V2A). Validation in 245 unrelated cats confirmed the correlation between HES7-c. 5T > C and Chinese short-tailed feral cats as well as the Japanese Bobtail breed, indicating a common genetic basis of the two. In addition, some of our sampled kinked-tailed cats could not be explained by either HES7 or the Manx-related T-box, suggesting at least three independent events in the evolution of domestic cats giving rise to short-tailed traits.
Deelen, Patrick; Zhernakova, Daria V.; de Haan, Mark; van der Sijde, Marijke; Bonder, Marc Jan; Karjalainen, Juha; van der Velde, K. Joeri; Abbott, Kristin M.; Fu, Jingyuan; Wijmenga, Cisca; Sinke, Richard J.; Swertz, Morris A.; Franke, Lude
2015-01-01
Background: RNA-sequencing (RNA-seq) is a powerful technique for the identification of genetic variants that affect gene-expression levels, either through expression quantitative trait locus (eQTL) mapping or through allele-specific expression (ASE) analysis. Given increasing numbers of RNA-seq
Evolutionary analysis of hepatitis C virus gene sequences from 1953
Gray, Rebecca R.; Tanaka, Yasuhito; Takebe, Yutaka; Magiorkinis, Gkikas; Buskell, Zelma; Seeff, Leonard; Alter, Harvey J.; Pybus, Oliver G.
2013-01-01
Reconstructing the transmission history of infectious diseases in the absence of medical or epidemiological records often relies on the evolutionary analysis of pathogen genetic sequences. The precision of evolutionary estimates of epidemic history can be increased by the inclusion of sequences derived from ‘archived’ samples that are genetically distinct from contemporary strains. Historical sequences are especially valuable for viral pathogens that circulated for many years before being formally identified, including HIV and the hepatitis C virus (HCV). However, surprisingly few HCV isolates sampled before discovery of the virus in 1989 are currently available. Here, we report and analyse two HCV subgenomic sequences obtained from infected individuals in 1953, which represent the oldest genetic evidence of HCV infection. The pairwise genetic diversity between the two sequences indicates a substantial period of HCV transmission prior to the 1950s, and their inclusion in evolutionary analyses provides new estimates of the common ancestor of HCV in the USA. To explore and validate the evolutionary information provided by these sequences, we used a new phylogenetic molecular clock method to estimate the date of sampling of the archived strains, plus the dates of four more contemporary reference genomes. Despite the short fragments available, we conclude that the archived sequences are consistent with a proposed sampling date of 1953, although statistical uncertainty is large. Our cross-validation analyses suggest that the bias and low statistical power observed here likely arise from a combination of high evolutionary rate heterogeneity and an unstructured, star-like phylogeny. We expect that attempts to date other historical viruses under similar circumstances will meet similar problems. PMID:23938759
Directory of Open Access Journals (Sweden)
Nian-Zhang Zhang
2014-01-01
Full Text Available Genetic diversity of T. gondii is a concern of many studies, due to the biological and epidemiological diversity of this parasite. The present study examined sequence variation in rhoptry protein 17 (ROP17 gene among T. gondii isolates from different hosts and geographical regions. The rop17 gene was amplified and sequenced from 10 T. gondii strains, and phylogenetic relationship among these T. gondii strains was reconstructed using maximum parsimony (MP, neighbor-joining (NJ, and maximum likelihood (ML analyses. The partial rop17 gene sequences were 1375 bp in length and A+T contents varied from 49.45% to 50.11% among all examined T. gondii strains. Sequence analysis identified 33 variable nucleotide positions (2.1%, 16 of which were identified as transitions. Phylogeny reconstruction based on rop17 gene data revealed two major clusters which could readily distinguish Type I and Type II strains. Analyses of sequence variations in nucleotides and amino acids among these strains revealed high ratio of nonsynonymous to synonymous polymorphisms (>1, indicating that rop17 shows signs of positive selection. This study demonstrated the existence of slightly high sequence variability in the rop17 gene sequences among T. gondii strains from different hosts and geographical regions, suggesting that rop17 gene may represent a new genetic marker for population genetic studies of T. gondii isolates.
Genetic population structure of marine viral haemorrhagic septicaemia virus (VHSV)
DEFF Research Database (Denmark)
Snow, M.; Bain, N.; Black, J.
2004-01-01
The nucleotide sequences of a specific region of the nucleoprotein gene were compared in order to investigate the genetic population structure of marine viral haemorrhagic septicaemia virus (VHSV). Analysis of the sequence from 128 isolates of diverse geographic and host origin renders this the m......The nucleotide sequences of a specific region of the nucleoprotein gene were compared in order to investigate the genetic population structure of marine viral haemorrhagic septicaemia virus (VHSV). Analysis of the sequence from 128 isolates of diverse geographic and host origin renders...... this the most comprehensive molecular epidemiological study of marine VHSV conducted to date. Phylogenetic analysis of nucleoprotein gene sequences confirmed the existence of the 4 major genotypes previously identified based on N- and subsequent G-gene based analyses. The range of Genotype I included subgroups...... of isolates associated with rainbow trout aquaculture (Genotype la) and those from the Baltic marine environment (Genotype Ib) to emphasise the relatively close genetic relationship between these isolates. The existence of an additional genotype circulating within the Baltic Sea (Genotype II) was also...
Bernard, Guillaume; Chan, Cheong Xin; Ragan, Mark A
2016-07-01
Alignment-free (AF) approaches have recently been highlighted as alternatives to methods based on multiple sequence alignment in phylogenetic inference. However, the sensitivity of AF methods to genome-scale evolutionary scenarios is little known. Here, using simulated microbial genome data we systematically assess the sensitivity of nine AF methods to three important evolutionary scenarios: sequence divergence, lateral genetic transfer (LGT) and genome rearrangement. Among these, AF methods are most sensitive to the extent of sequence divergence, less sensitive to low and moderate frequencies of LGT, and most robust against genome rearrangement. We describe the application of AF methods to three well-studied empirical genome datasets, and introduce a new application of the jackknife to assess node support. Our results demonstrate that AF phylogenomics is computationally scalable to multi-genome data and can generate biologically meaningful phylogenies and insights into microbial evolution.
Redberg, G.L.; Hibbett, D.S.; Ammirati, J.F.; Rodriguez, R.J.
2003-01-01
The genetic diversity and phylogeny of Bridgeoporus nobilissimus have been analyzed. DNA was extracted from spores collected from individual fruiting bodies representing six geographically distinct populations in Oregon and Washington. Spore samples collected contained low levels of bacteria, yeast and a filamentous fungal species. Using taxon-specific PCR primers, it was possible to discriminate among rDNA from bacteria, yeast, a filamentous associate and B. nobilissimus. Nuclear rDNA internal transcribed spacer (ITS) region sequences of B. nobilissimus were compared among individuals representing six populations and were found to have less than 2% variation. These sequences also were used to design dual and nested PCR primers for B. nobilissimus-specific amplification. Mitochondrial small-subunit rDNA sequences were used in a phylogenetic analysis that placed B. nobilissimus in the hymenochaetoid clade, where it was associated with Oxyporus and Schizopora.
Ma, S J; Sa, K J; Hong, T K; Lee, J K
2017-09-21
In this study, 21 simple sequence repeat (SSR) markers were used to evaluate the genetic diversity and population structure among 77 Perilla accessions from high-latitude and middle-latitude areas of China. Ninety-five alleles were identified with an average of 4.52 alleles per locus. The average polymorphic information content (PIC) and genetic diversity values were 0.346 and 0.372, respectively. The level of genetic diversity and PIC value for cultivated accessions of Perilla frutescens var. frutescens from middle-latitude areas were higher than accessions from high-latitude areas. Based on the dendrogram of unweighted pair group method with arithmetic mean (UPGMA), all accessions were classified into four major groups with a genetic similarity of 46%. All accessions of the cultivated var. frutescens were discriminated from the cultivated P. frutescens var. crispa. Furthermore, most accessions of the cultivated var. frutescens collected in high-latitude and middle-latitude areas were distinguished depending on their geographical location. However, the geographical locations of several accessions of the cultivated var. frutescens have no relation with their positions in the UPGMA dendrogram and population structure. This result implies that the diffusion of accessions of the cultivated Perilla crop in the northern areas of China might be through multiple routes. On the population structure analysis, 77 Perilla accessions were divided into Group I, Group II, and an admixed group based on a membership probability threshold of 0.8. Finally, the findings in this study can provide useful theoretical knowledge for further study on the population structure and genetic diversity of Perilla and benefit for Perilla crop breeding and germplasm conservation.
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes
Hu, H; Haas, S.A.; Chelly, J.; Esch, H. Van; Raynaud, M.; Brouwer, A.P. de; Weinert, S.; Froyen, G.; Frints, S.G.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.; Jensen, C.; Hambrock, M.; Fischer, U.; Langnick, C.; Feldkamp, M.; Wissink-Lindhout, W.; Lebrun, N.; Castelnau, L.; Rucci, J.; Montjean, R.; Dorseuil, O.; Billuart, P.; Stuhlmann, T.; Shaw, M.; Corbett, M.A.; Gardner, A.; Willis-Owen, S.; Tan, C.; Friend, K.L.; Belet, S.; Roozendaal, K.E. van; Jimenez-Pocquet, M.; Moizard, M.P.; Ronce, N.; Sun, R.; O'Keeffe, S.; Chenna, R.; Bommel, A. van; Goke, J.; Hackett, A.; Field, M.; Christie, L.; Boyle, J.; Haan, E.; Nelson, J.; Turner, G.; Baynam, G.; Gillessen-Kaesbach, G.; Muller, U.; Steinberger, D.; Budny, B.; Badura-Stronka, M.; Latos-Bielenska, A.; Ousager, L.B.; Wieacker, P.; Rodriguez Criado, G.; Bondeson, M.L.; Anneren, G.; Dufke, A.; Cohen, M.; Maldergem, L. Van; Vincent-Delorme, C.; Echenne, B.; Simon-Bouy, B.; Kleefstra, T.; Willemsen, M.H.; Fryns, J.P.; Devriendt, K.; Ullmann, R.; Vingron, M.; Wrogemann, K.; Wienker, T.F.; Tzschach, A.; Bokhoven, H. van; Gecz, J.; Jentsch, T.J.; Chen, W.; Ropers, H.H.; Kalscheuer, V.M.
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes
DEFF Research Database (Denmark)
Hu, H; Haas, S A; Chelly, J
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes...
Directory of Open Access Journals (Sweden)
Xin Cai
Full Text Available Lung cancer is the most common malignancy and the leading cause of cancer deaths worldwide. While smoking is by far the leading cause of lung cancer, other environmental and genetic factors influence the development and progression of the cancer. Since unique mutations patterns have been observed in individual cancer samples, identification and characterization of the distinctive lung cancer molecular profile is essential for developing more effective, tailored therapies. Until recently, personalized DNA sequencing to identify genetic mutations in cancer was impractical and expensive. The recent technological advancements in next-generation DNA sequencing, such as the semiconductor-based Ion Torrent sequencing platform, has made DNA sequencing cost and time effective with more reliable results. Using the Ion Torrent Ampliseq Cancer Panel, we sequenced 737 loci from 45 cancer-related genes to identify genetic mutations in 76 human lung cancer samples. The sequencing analysis revealed missense mutations in KRAS, EGFR, and TP53 genes in the breast cancer samples of various histologic types. Thus, this study demonstrates the necessity of sequencing individual human cancers in order to develop personalized drugs or combination therapies to effectively target individual, breast cancer-specific mutations.
Shamblin, Brian M.; Bagley, Dean A.; Ehrhart, Llewellyn M.; Desjardin, Nicole A.; Martin, R. Erik; Hart, Kristen M.; Naro-Maciel, Eugenia; Rusenko, Kirt; Stiner, John C.; Sobel, Debra; Johnson, Chris; Wilmers, Thomas; Wright, Laura J.; Nairn, Campbell J.
2014-01-01
Green turtle (Chelonia mydas) nesting has increased dramatically in Florida over the past two decades, ranking the Florida nesting aggregation among the largest in the Greater Caribbean region. Individual beaches that comprise several hundred kilometers of Florida’s east coast and Keys support tens to thousands of nests annually. These beaches encompass natural to highly developed habitats, and the degree of demographic partitioning among rookeries was previously unresolved. We characterized the genetic structure of ten Florida rookeries from Cape Canaveral to the Dry Tortugas through analysis of 817 base pair mitochondrial DNA (mtDNA) control region sequences from 485 nesting turtles. Two common haplotypes, CM-A1.1 and CM-A3.1, accounted for 87 % of samples, and the haplotype frequencies were strongly partitioned by latitude along Florida’s Atlantic coast. Most genetic structure occurred between rookeries on either side of an apparent genetic break in the vicinity of the St. Lucie Inlet that separates Hutchinson Island and Jupiter Island, representing the finest scale at which mtDNA structure has been documented in marine turtle rookeries. Florida and Caribbean scale analyses of population structure support recognition of at least two management units: central eastern Florida and southern Florida. More thorough sampling and deeper sequencing are necessary to better characterize connectivity among Florida green turtle rookeries as well as between the Florida nesting aggregation and others in the Greater Caribbean region.
Computational approaches to identify functional genetic variants in cancer genomes
DEFF Research Database (Denmark)
Gonzalez-Perez, Abel; Mustonen, Ville; Reva, Boris
2013-01-01
The International Cancer Genome Consortium (ICGC) aims to catalog genomic abnormalities in tumors from 50 different cancer types. Genome sequencing reveals hundreds to thousands of somatic mutations in each tumor but only a minority of these drive tumor progression. We present the result of discu......The International Cancer Genome Consortium (ICGC) aims to catalog genomic abnormalities in tumors from 50 different cancer types. Genome sequencing reveals hundreds to thousands of somatic mutations in each tumor but only a minority of these drive tumor progression. We present the result...... of discussions within the ICGC on how to address the challenge of identifying mutations that contribute to oncogenesis, tumor maintenance or response to therapy, and recommend computational techniques to annotate somatic variants and predict their impact on cancer phenotype....
Aswad, Amr; Katzourakis, Aris
2014-01-01
Herpesviridae is a diverse family of large and complex pathogens whose genomes are extremely difficult to sequence. This is particularly true for clinical samples, and if the virus, host, or both genomes are being sequenced for the first time. Although herpesviruses are known to occasionally integrate in host genomes, and can also be inherited in a Mendelian fashion, they are notably absent from the genomic fossil record comprised of endogenous viral elements (EVEs). Here, we combine paleovirological and metagenomic approaches to both explore the constituent viral diversity of mammalian genomes and search for endogenous herpesviruses. We describe the first endogenous herpesvirus from the genome of the Philippine tarsier, belonging to the Roseolovirus genus, and characterize its highly defective genome that is integrated and flanked by unambiguous host DNA. From a draft assembly of the aye-aye genome, we use bioinformatic tools to reveal over 100,000 bp of a novel rhadinovirus that is the first lemur gammaherpesvirus, closely related to Kaposi's sarcoma-associated virus. We also identify 58 genes of Pan paniscus lymphocryptovirus 1, the bonobo equivalent of human Epstein-Barr virus. For each of the viruses, we postulate gene function via comparative analysis to known viral relatives. Most notably, the evidence from gene content and phylogenetics suggests that the aye-aye sequences represent the most basal known rhadinovirus, and indicates that tumorigenic herpesviruses have been infecting primates since their emergence in the late Cretaceous. Overall, these data show that a genomic fossil record of herpesviruses exists despite their extremely large genomes, and expands the known diversity of Herpesviridae, which will aid the characterization of pathogenesis. Our analytical approach illustrates the benefit of intersecting evolutionary approaches with metagenomics, genetics and paleovirology. PMID:24945689
Insertion sequences enrichment in extreme Red sea brine pool vent
Elbehery, Ali H. A.
2016-12-03
Mobile genetic elements are major agents of genome diversification and evolution. Limited studies addressed their characteristics, including abundance, and role in extreme habitats. One of the rare natural habitats exposed to multiple-extreme conditions, including high temperature, salinity and concentration of heavy metals, are the Red Sea brine pools. We assessed the abundance and distribution of different mobile genetic elements in four Red Sea brine pools including the world’s largest known multiple-extreme deep-sea environment, the Red Sea Atlantis II Deep. We report a gradient in the abundance of mobile genetic elements, dramatically increasing in the harshest environment of the pool. Additionally, we identified a strong association between the abundance of insertion sequences and extreme conditions, being highest in the harshest and deepest layer of the Red Sea Atlantis II Deep. Our comparative analyses of mobile genetic elements in secluded, extreme and relatively non-extreme environments, suggest that insertion sequences predominantly contribute to polyextremophiles genome plasticity.
Whole-genome sequencing identifies recurrent mutations in chronic lymphocytic leukaemia
Puente, Xose S.; Pinyol, Magda; Quesada, Víctor; Conde, Laura; Ordóñez, Gonzalo R.; Villamor, Neus; Escaramis, Georgia; Jares, Pedro; Beà, Sílvia; González-Díaz, Marcos; Bassaganyas, Laia; Baumann, Tycho; Juan, Manel; López-Guerra, Mónica; Colomer, Dolors; Tubío, José M. C.; López, Cristina; Navarro, Alba; Tornador, Cristian; Aymerich, Marta; Rozman, María; Hernández, Jesús M.; Puente, Diana A.; Freije, José M. P.; Velasco, Gloria; Gutiérrez-Fernández, Ana; Costa, Dolors; Carrió, Anna; Guijarro, Sara; Enjuanes, Anna; Hernández, Lluís; Yagüe, Jordi; Nicolás, Pilar; Romeo-Casabona, Carlos M.; Himmelbauer, Heinz; Castillo, Ester; Dohm, Juliane C.; de Sanjosé, Silvia; Piris, Miguel A.; de Alava, Enrique; Miguel, Jesús San; Royo, Romina; Gelpí, Josep L.; Torrents, David; Orozco, Modesto; Pisano, David G.; Valencia, Alfonso; Guigó, Roderic; Bayés, Mónica; Heath, Simon; Gut, Marta; Klatt, Peter; Marshall, John; Raine, Keiran; Stebbings, Lucy A.; Futreal, P. Andrew; Stratton, Michael R.; Campbell, Peter J.; Gut, Ivo; López-Guillermo, Armando; Estivill, Xavier; Montserrat, Emili; López-Otín, Carlos; Campo, Elías
2012-01-01
Chronic lymphocytic leukaemia (CLL), the most frequent leukaemia in adults in Western countries, is a heterogeneous disease with variable clinical presentation and evolution1,2. Two major molecular subtypes can be distinguished, characterized respectively by a high or low number of somatic hypermutations in the variable region of immunoglobulin genes3,4. The molecular changes leading to the pathogenesis of the disease are still poorly understood. Here we performed whole-genome sequencing of four cases of CLL and identified 46 somatic mutations that potentially affect gene function. Further analysis of these mutations in 363 patients with CLL identified four genes that are recurrently mutated: notch 1 (NOTCH1), exportin 1 (XPO1), myeloid differentiation primary response gene 88 (MYD88) and kelch-like 6 (KLHL6). Mutations in MYD88 and KLHL6 are predominant in cases of CLL with mutated immunoglobulin genes, whereas NOTCH1 and XPO1 mutations are mainly detected in patients with unmutated immunoglobulins. The patterns of somatic mutation, supported by functional and clinical analyses, strongly indicate that the recurrent NOTCH1, MYD88 and XPO1 mutations are oncogenic changes that contribute to the clinical evolution of the disease. To our knowledge, this is the first comprehensive analysis of CLL combining whole-genome sequencing with clinical characteristics and clinical outcomes. It highlights the usefulness of this approach for the identification of clinically relevant mutations in cancer. PMID:21642962
Directory of Open Access Journals (Sweden)
Ali Saber
Full Text Available ALK-break positive non-small cell lung cancer (NSCLC patients initially respond to crizotinib, but resistance occurs inevitably. In this study we aimed to identify fusion genes in crizotinib resistant tumor samples. Re-biopsies of three patients were subjected to paired-end RNA sequencing to identify fusion genes using deFuse and EricScript. The IGV browser was used to determine presence of known resistance-associated mutations. Sanger sequencing was used to validate fusion genes and digital droplet PCR to validate mutations. ALK fusion genes were detected in all three patients with EML4 being the fusion partner. One patient had no additional fusion genes. Another patient had one additional fusion gene, but without a predicted open reading frame (ORF. The third patient had three additional fusion genes, of which two were derived from the same chromosomal region as the EML4-ALK. A predicted ORF was identified only in the CLIP4-VSNL1 fusion product. The fusion genes validated in the post-treatment sample were also present in the biopsy before crizotinib. ALK mutations (p.C1156Y and p.G1269A detected in the re-biopsies of two patients, were not detected in pre-treatment biopsies. In conclusion, fusion genes identified in our study are unlikely to be involved in crizotinib resistance based on presence in pre-treatment biopsies. The detection of ALK mutations in post-treatment tumor samples of two patients underlines their role in crizotinib resistance.
Gene discovery by chemical mutagenesis and whole-genome sequencing in Dictyostelium.
Li, Cheng-Lin Frank; Santhanam, Balaji; Webb, Amanda Nicole; Zupan, Blaž; Shaulsky, Gad
2016-09-01
Whole-genome sequencing is a useful approach for identification of chemical-induced lesions, but previous applications involved tedious genetic mapping to pinpoint the causative mutations. We propose that saturation mutagenesis under low mutagenic loads, followed by whole-genome sequencing, should allow direct implication of genes by identifying multiple independent alleles of each relevant gene. We tested the hypothesis by performing three genetic screens with chemical mutagenesis in the social soil amoeba Dictyostelium discoideum Through genome sequencing, we successfully identified mutant genes with multiple alleles in near-saturation screens, including resistance to intense illumination and strong suppressors of defects in an allorecognition pathway. We tested the causality of the mutations by comparison to published data and by direct complementation tests, finding both dominant and recessive causative mutations. Therefore, our strategy provides a cost- and time-efficient approach to gene discovery by integrating chemical mutagenesis and whole-genome sequencing. The method should be applicable to many microbial systems, and it is expected to revolutionize the field of functional genomics in Dictyostelium by greatly expanding the mutation spectrum relative to other common mutagenesis methods. © 2016 Li et al.; Published by Cold Spring Harbor Laboratory Press.
Pinzón, Jorge H; LaJeunesse, Todd C
2011-01-01
Stony corals in the genus Pocillopora are among the most common and widely distributed of Indo-Pacific corals and, as such, are often the subject of physiological and ecological research. In the far Tropical Eastern Pacific (TEP), they are major constituents of shallow coral communities, exhibiting considerable variability in colony shape and branch morphology and marked differences in response to thermal stress. Numerous intermediates occur between morphospecies that may relate to extensive hybridization. The diversity of the Pocillopora genus in the TEP was analysed genetically using nuclear ribosomal (ITS2) and mitochondrial (ORF) sequences, and population genetic markers (seven microsatellite loci). The resident dinoflagellate endosymbiont (Symbiodinium sp.) in each sample was also characterized using sequences of the internal transcribed spacer 2 (ITS2) rDNA and the noncoding region of the chloroplast psbA minicircle. From these analyses, three symbiotically distinct, reproductively isolated, nonhybridizing, evolutionarily divergent animal lineages were identified. Designated types 1, 2 and 3, these groupings were incongruent with traditional morphospecies classification. Type 1 was abundant and widespread throughout the TEP; type 2 was restricted to the Clipperton Atoll; and type 3 was found only in Panama and the Galapagos Islands. Each type harboured a different Symbiodinium'species lineage' in Clade C, and only type 1 associated with the 'stress-tolerant'Symbiodinium glynni (D1). The accurate delineation of species and implementation of a proper taxonomy may profoundly improve our assessment of Pocillopora's reproductive biology, biogeographic distributions, and resilience to climate warming, information that must be considered when planning for the conservation of reef corals. © 2010 Blackwell Publishing Ltd.
Characterizing genetic syndromes involved in cancer and radiogenic cancer risk
International Nuclear Information System (INIS)
Unrau, P.; Doerffer, K.
1998-01-01
The COG project 2806A (1995), reviewed the On-line Mendelian Inheritance in Man (OMIM) database of genetic syndromes to identify those syndromes, genes, and DNA sequences implicated in some way in the cancer process, and especially in radiogenic cancer risk. The current report describes a recent update of the survey in light of two years of further progress in the Human Genome project, and is intended to supply a comprehensive list of those genetic syndromes, genes, DNA sequences and map locations that define genes likely to be involved in cancer risk. Of the 8203 syndromes in OMIM in 1997 June, 814 are associated, even if marginally, with cancer. Of the 814 syndromes so linked, 672 have been mapped to a chromosome, and 476 have been mapped to a chromosome and had a DNA sequence associated with their messenger RNA (or cDNA) sequences. In addition, 35 syndromes have sequences not associated with map locations, and the remaining 107 have neither been mapped nor sequenced. We supply the list of the various genetic syndromes sorted by chromosome location and by OMIM descriptor, together with all the associated but unmapped and unsequenced syndromes. (author)
Characterizing genetic syndromes involved in cancer and radiogenic cancer risk
Energy Technology Data Exchange (ETDEWEB)
Unrau, P; Doerffer, K
1998-01-01
The COG project 2806A (1995), reviewed the On-line Mendelian Inheritance in Man (OMIM) database of genetic syndromes to identify those syndromes, genes, and DNA sequences implicated in some way in the cancer process, and especially in radiogenic cancer risk. The current report describes a recent update of the survey in light of two years of further progress in the Human Genome project, and is intended to supply a comprehensive list of those genetic syndromes, genes, DNA sequences and map locations that define genes likely to be involved in cancer risk. Of the 8203 syndromes in OMIM in 1997 June, 814 are associated, even if marginally, with cancer. Of the 814 syndromes so linked, 672 have been mapped to a chromosome, and 476 have been mapped to a chromosome and had a DNA sequence associated with their messenger RNA (or cDNA) sequences. In addition, 35 syndromes have sequences not associated with map locations, and the remaining 107 have neither been mapped nor sequenced. We supply the list of the various genetic syndromes sorted by chromosome location and by OMIM descriptor, together with all the associated but unmapped and unsequenced syndromes. (author) 1 tab., 4 figs.
Eisenberger, Tobias; Slim, Rima; Mansour, Ahmad; Nauck, Markus; Nürnberg, Gudrun; Nürnberg, Peter; Decker, Christian; Dafinger, Claudia; Ebermann, Inga; Bergmann, Carsten; Bolz, Hanno Jörn
2012-09-02
Usher syndrome (USH) is an autosomal recessive genetically heterogeneous disorder with congenital sensorineural hearing impairment and retinitis pigmentosa (RP). We have identified a consanguineous Lebanese family with two affected members displaying progressive hearing loss, RP and cataracts, therefore clinically diagnosed as USH type 3 (USH3). Our study was aimed at the identification of the causative mutation in this USH3-like family. Candidate loci were identified using genomewide SNP-array-based homozygosity mapping followed by targeted enrichment and next-generation sequencing. Using a capture array targeting the three identified homozygosity-by-descent regions on chromosomes 1q43-q44, 20p13-p12.2 and 20p11.23-q12, we identified a homozygous nonsense mutation, p.Arg65X, in ABHD12 segregating with the phenotype. Mutations of ABHD12, an enzyme hydrolyzing an endocannabinoid lipid transmitter, cause PHARC (polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and early-onset cataract). After the identification of the ABHD12 mutation in this family, one patient underwent neurological examination which revealed ataxia, but no polyneuropathy. ABHD12 is not known to be related to the USH protein interactome. The phenotype of our patient represents a variant of PHARC, an entity that should be taken into account as differential diagnosis for USH3. Our study demonstrates the potential of comprehensive genetic analysis for improving the clinical diagnosis.
Weerakkody, Ruwan A; Vandrovcova, Jana; Kanonidou, Christina; Mueller, Michael; Gampawar, Piyush; Ibrahim, Yousef; Norsworthy, Penny; Biggs, Jennifer; Abdullah, Abdulshakur; Ross, David; Black, Holly A; Ferguson, David; Cheshire, Nicholas J; Kazkaz, Hanadi; Grahame, Rodney; Ghali, Neeti; Vandersteen, Anthony; Pope, F Michael; Aitman, Timothy J
2016-11-01
Ehlers-Danlos syndrome (EDS) comprises a group of overlapping hereditary disorders of connective tissue with significant morbidity and mortality, including major vascular complications. We sought to identify the diagnostic utility of a next-generation sequencing (NGS) panel in a mixed EDS cohort. We developed and applied PCR-based NGS assays for targeted, unbiased sequencing of 12 collagen and aortopathy genes to a cohort of 177 unrelated EDS patients. Variants were scored blind to previous genetic testing and then compared with results of previous Sanger sequencing. Twenty-eight pathogenic variants in COL5A1/2, COL3A1, FBN1, and COL1A1 and four likely pathogenic variants in COL1A1, TGFBR1/2, and SMAD3 were identified by the NGS assays. These included all previously detected single-nucleotide and other short pathogenic variants in these genes, and seven newly detected pathogenic or likely pathogenic variants leading to clinically significant diagnostic revisions. Twenty-two variants of uncertain significance were identified, seven of which were in aortopathy genes and required clinical follow-up. Unbiased NGS-based sequencing made new molecular diagnoses outside the expected EDS genotype-phenotype relationship and identified previously undetected clinically actionable variants in aortopathy susceptibility genes. These data may be of value in guiding future clinical pathways for genetic diagnosis in EDS.Genet Med 18 11, 1119-1127.
2016-07-01
tsc1 and tsc2 loss of function mutations in Schizosaccharomyces pombe. Northeast Regional Yeast Meeting, June 16-17, University at Buffalo, The State...AWARD NUMBER: W81XWH-14-1-0169 TITLE: Using Genetic Buffering Relationships Identified in Fission Yeast To Elucidate the Molecular Pathology of...SUBTITLE Using Genetic Buffering Relationships Identified in Fission 5a. CONTRACT NUMBER W81XWH-14-1-0169 Yeast to Elucidate the Molecular Pathology
Shapiro, Lucy; Chatterjee, Sumana; Ramadan, Dina G; Davies, Kate M; Savage, Martin O; Metherell, Louise A; Storr, Helen L
2017-12-01
GH insensitivity (GHI) is characterised by short stature, IGF-1 deficiency and normal/elevated serum GH. IGF-1 insensitivity results in pre- and post-natal growth failure with normal/high IGF-1 levels. The prevalence of genetic defects is unknown. To identify the underlying genetic diagnoses in a paediatric cohort with GH or IGF-1 insensitivity using candidate gene (CGS) and whole-exome sequencing (WES) and assess factors associated with the discovery of a genetic defect. We undertook a prospective study of 132 patients with short stature and suspected GH or IGF-1 insensitivity referred to our centre for genetic analysis. 107 (96 GHI, 88 probands; 11 IGF-1 insensitivity, 9 probands) underwent CGS. WES was performed in those with no defined genetic aetiology following CGS. A genetic diagnosis was discovered 38/107 (36%) patients (32% probands) by CGS. WES revealed 11 patients with genetic variants in genes known to cause short stature. A further 2 patients had hypomethylation in the H19/IGF2 region or mUPD7 consistent with Silver-Russell Syndrome (total with genetic diagnosis 51/107, 48% or 41/97, 42% probands). WES also identified homozygous putative variants in FANCA and PHKB in 2 patients. Low height SDS and consanguinity were highly predictive for identifying a genetic defect. Comprehensive genetic testing confirms the genetic heterogeneity of GH/IGF-1 insensitivity and successfully identified the genetic aetiology in a significant proportion of cases. WES is rapid and may isolate genetic variants that have been missed by traditional clinically driven genetic testing. This emphasises the benefits of specialist diagnostic centres. © 2017 European Society of Endocrinology.
Genetic screens to identify new Notch pathway mutants in Drosophila.
Giagtzoglou, Nikolaos
2014-01-01
Notch signaling controls a wide range of developmental processes, including proliferation, apoptosis, and cell fate specification during both development and adult tissue homeostasis. The functional versatility of the Notch signaling pathway is tightly linked with the complexity of its regulation in different cellular contexts. To unravel the complexity of Notch signaling, it is important to identify the different components of the Notch signaling pathway. A powerful strategy to accomplish this task is based on genetic screens. Given that the developmental context of signaling is important, these screens should be customized to specific cell populations or tissues. Here, I describe how to perform F1 clonal forward genetic screens in Drosophila to identify novel components of the Notch signaling pathway. These screens combine a classical EMS (ethyl methanesulfonate) chemical mutagenesis protocol along with clonal analysis via FRT-mediated mitotic recombination. These F1 clonal screens allow rapid phenotypic screening within clones of mutant cells induced at specific developmental stages and in tissues of interest, bypassing the pleiotropic effects of isolated mutations. More importantly, since EMS mutations have been notoriously difficult to map to specific genes in the past, I briefly discuss mapping methods that allow rapid identification of the causative mutations.
Liu, Shi; Gao, Peng; Zhu, Qianglong; Luan, Feishi; Davis, Angela R; Wang, Xiaolu
2016-03-01
Cleaved amplified polymorphic sequence (CAPS) markers are useful tools for detecting single nucleotide polymorphisms (SNPs). This study detected and converted SNP sites into CAPS markers based on high-throughput re-sequencing data in watermelon, for linkage map construction and quantitative trait locus (QTL) analysis. Two inbred lines, Cream of Saskatchewan (COS) and LSW-177 had been re-sequenced and analyzed by Perl self-compiled script for CAPS marker development. 88.7% and 78.5% of the assembled sequences of the two parental materials could map to the reference watermelon genome, respectively. Comparative assembled genome data analysis provided 225,693 and 19,268 SNPs and indels between the two materials. 532 pairs of CAPS markers were designed with 16 restriction enzymes, among which 271 pairs of primers gave distinct bands of the expected length and polymorphic bands, via PCR and enzyme digestion, with a polymorphic rate of 50.94%. Using the new CAPS markers, an initial CAPS-based genetic linkage map was constructed with the F2 population, spanning 1836.51 cM with 11 linkage groups and 301 markers. 12 QTLs were detected related to fruit flesh color, length, width, shape index, and brix content. These newly CAPS markers will be a valuable resource for breeding programs and genetic studies of watermelon.
Clinical exome sequencing reports: current informatics practice and future opportunities.
Swaminathan, Rajeswari; Huang, Yungui; Astbury, Caroline; Fitzgerald-Butt, Sara; Miller, Katherine; Cole, Justin; Bartlett, Christopher; Lin, Simon
2017-11-01
The increased adoption of clinical whole exome sequencing (WES) has improved the diagnostic yield for patients with complex genetic conditions. However, the informatics practice for handling information contained in whole exome reports is still in its infancy, as evidenced by the lack of a common vocabulary within clinical sequencing reports generated across genetic laboratories. Genetic testing results are mostly transmitted using portable document format, which can make secondary analysis and data extraction challenging. This paper reviews a sample of clinical exome reports generated by Clinical Laboratory Improvement Amendments-certified genetic testing laboratories at tertiary-care facilities to assess and identify common data elements. Like structured radiology reports, which enable faster information retrieval and reuse, structuring genetic information within clinical WES reports would help facilitate integration of genetic information into electronic health records and enable retrospective research on the clinical utility of WES. We identify elements listed as mandatory according to practice guidelines but are currently missing from some of the clinical reports, which might help to organize the data when stored within structured databases. We also highlight elements, such as patient consent, that, although they do not appear within any of the current reports, may help in interpreting some of the information within the reports. Integrating genetic and clinical information would assist the adoption of personalized medicine for improved patient care and outcomes. © The Author 2017. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Rapid and Accurate Sequencing of Enterovirus Genomes Using MinION Nanopore Sequencer.
Wang, Ji; Ke, Yue Hua; Zhang, Yong; Huang, Ke Qiang; Wang, Lei; Shen, Xin Xin; Dong, Xiao Ping; Xu, Wen Bo; Ma, Xue Jun
2017-10-01
Knowledge of an enterovirus genome sequence is very important in epidemiological investigation to identify transmission patterns and ascertain the extent of an outbreak. The MinION sequencer is increasingly used to sequence various viral pathogens in many clinical situations because of its long reads, portability, real-time accessibility of sequenced data, and very low initial costs. However, information is lacking on MinION sequencing of enterovirus genomes. In this proof-of-concept study using Enterovirus 71 (EV71) and Coxsackievirus A16 (CA16) strains as examples, we established an amplicon-based whole genome sequencing method using MinION. We explored the accuracy, minimum sequencing time, discrimination and high-throughput sequencing ability of MinION, and compared its performance with Sanger sequencing. Within the first minute (min) of sequencing, the accuracy of MinION was 98.5% for the single EV71 strain and 94.12%-97.33% for 10 genetically-related CA16 strains. In as little as 14 min, 99% identity was reached for the single EV71 strain, and in 17 min (on average), 99% identity was achieved for 10 CA16 strains in a single run. MinION is suitable for whole genome sequencing of enteroviruses with sufficient accuracy and fine discrimination and has the potential as a fast, reliable and convenient method for routine use. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.
Chang, Lixian; Yuan, Weiping; Zeng, Huimin; Zhou, Quanquan; Wei, Wei; Zhou, Jianfeng; Li, Miaomiao; Wang, Xiaomin; Xu, Mingjiang; Yang, Fengchun; Yang, Yungui; Cheng, Tao; Zhu, Xiaofan
2014-05-15
Fanconi anemia (FA) is a rare inherited genetic syndrome with highly variable clinical manifestations. Fifteen genetic subtypes of FA have been identified. Traditional complementation tests for grouping studies have been used generally in FA patients and in stepwise methods to identify the FA type, which can result in incomplete genetic information from FA patients. We diagnosed five pediatric patients with FA based on clinical manifestations, and we performed exome sequencing of peripheral blood specimens from these patients and their family members. The related sequencing data were then analyzed by bioinformatics, and the FANC gene mutations identified by exome sequencing were confirmed by PCR re-sequencing. Homozygous and compound heterozygous mutations of FANC genes were identified in all of the patients. The FA subtypes of the patients included FANCA, FANCM and FANCD2. Interestingly, four FA patients harbored multiple mutations in at least two FA genes, and some of these mutations have not been previously reported. These patients' clinical manifestations were vastly different from each other, as were their treatment responses to androstanazol and prednisone. This finding suggests that heterozygous mutation(s) in FA genes could also have diverse biological and/or pathophysiological effects on FA patients or FA gene carriers. Interestingly, we were not able to identify de novo mutations in the genes implicated in DNA repair pathways when the sequencing data of patients were compared with those of their parents. Our results indicate that Chinese FA patients and carriers might have higher and more complex mutation rates in FANC genes than have been conventionally recognized. Testing of the fifteen FANC genes in FA patients and their family members should be a regular clinical practice to determine the optimal care for the individual patient, to counsel the family and to obtain a better understanding of FA pathophysiology.
MetaPhinder-Identifying Bacteriophage Sequences in Metagenomic Data Sets
DEFF Research Database (Denmark)
Jurtz, Vanessa Isabell; Villarroel, Julia; Lund, Ole
2016-01-01
genome structure of many bacteriophages. The method is demonstrated to outperform both BLAST methods based on single hits and methods based on k-mer comparisons. MetaPhinder is available as a web service at the Center for Genomic Epidemiology https://cge.cbs.dtu.dk/services/MetaPhinder/, while the source...... and understand them. Here we present MetaPhinder, a method to identify assembled genomic fragments (i.e. contigs) of phage origin in metage-nomic data sets. The method is based on a comparison to a database of whole genome bacteriophage sequences, integrating hits to multiple genomes to accomodate for the mosaic...... code can be downloaded from https://bitbucket.org/genomicepidemiology/metaphinder or https://github.com/vanessajurtz/MetaPhinder....
Aflitos, Saulo; Schijlen, Elio; de Jong, Hans; de Ridder, Dick; Smit, Sandra; Finkers, Richard; Wang, Jun; Zhang, Gengyun; Li, Ning; Mao, Likai; Bakker, Freek; Dirks, Rob; Breit, Timo; Gravendeel, Barbara; Huits, Henk; Struss, Darush; Swanson-Wagner, Ruth; van Leeuwen, Hans; van Ham, Roeland C H J; Fito, Laia; Guignier, Laëtitia; Sevilla, Myrna; Ellul, Philippe; Ganko, Eric; Kapur, Arvind; Reclus, Emannuel; de Geus, Bernard; van de Geest, Henri; Te Lintel Hekkert, Bas; van Haarst, Jan; Smits, Lars; Koops, Andries; Sanchez-Perez, Gabino; van Heusden, Adriaan W; Visser, Richard; Quan, Zhiwu; Min, Jiumeng; Liao, Li; Wang, Xiaoli; Wang, Guangbiao; Yue, Zhen; Yang, Xinhua; Xu, Na; Schranz, Eric; Smets, Erik; Vos, Rutger; Rauwerda, Johan; Ursem, Remco; Schuit, Cees; Kerns, Mike; van den Berg, Jan; Vriezen, Wim; Janssen, Antoine; Datema, Erwin; Jahrman, Torben; Moquet, Frederic; Bonnet, Julien; Peters, Sander
2014-10-01
We explored genetic variation by sequencing a selection of 84 tomato accessions and related wild species representative of the Lycopersicon, Arcanum, Eriopersicon and Neolycopersicon groups, which has yielded a huge amount of precious data on sequence diversity in the tomato clade. Three new reference genomes were reconstructed to support our comparative genome analyses. Comparative sequence alignment revealed group-, species- and accession-specific polymorphisms, explaining characteristic fruit traits and growth habits in the various cultivars. Using gene models from the annotated Heinz 1706 reference genome, we observed differences in the ratio between non-synonymous and synonymous SNPs (dN/dS) in fruit diversification and plant growth genes compared to a random set of genes, indicating positive selection and differences in selection pressure between crop accessions and wild species. In wild species, the number of single-nucleotide polymorphisms (SNPs) exceeds 10 million, i.e. 20-fold higher than found in most of the crop accessions, indicating dramatic genetic erosion of crop and heirloom tomatoes. In addition, the highest levels of heterozygosity were found for allogamous self-incompatible wild species, while facultative and autogamous self-compatible species display a lower heterozygosity level. Using whole-genome SNP information for maximum-likelihood analysis, we achieved complete tree resolution, whereas maximum-likelihood trees based on SNPs from ten fruit and growth genes show incomplete resolution for the crop accessions, partly due to the effect of heterozygous SNPs. Finally, results suggest that phylogenetic relationships are correlated with habitat, indicating the occurrence of geographical races within these groups, which is of practical importance for Solanum genome evolution studies. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.
Sahl, Jason W.; Gillece, John D.; Schupp, James M.; Waddell, Victor G.; Driebe, Elizabeth M.; Engelthaler, David M.; Keim, Paul
2013-01-01
Acinetobacter baumannii is an emergent and global nosocomial pathogen. In addition to A. baumannii, other Acinetobacter species, especially those in the Acinetobacter calcoaceticus-baumannii (Acb) complex, have also been associated with serious human infection. Although mechanisms of attachment, persistence on abiotic surfaces, and pathogenesis in A. baumannii have been identified, the genetic mechanisms that explain the emergence of A. baumannii as the most widespread and virulent Acinetobacter species are not fully understood. Recent whole genome sequencing has provided insight into the phylogenetic structure of the genus Acinetobacter. However, a global comparison of genomic features between Acinetobacter spp. has not been described in the literature. In this study, 136 Acinetobacter genomes, including 67 sequenced in this study, were compared to identify the acquisition and loss of genes in the expansion of the Acinetobacter genus. A whole genome phylogeny confirmed that A. baumannii is a monophyletic clade and that the larger Acb complex is also a well-supported monophyletic group. The whole genome phylogeny provided the framework for a global genomic comparison based on a blast score ratio (BSR) analysis. The BSR analysis demonstrated that specific genes have been both lost and acquired in the evolution of A. baumannii. In addition, several genes associated with A. baumannii pathogenesis were found to be more conserved in the Acb complex, and especially in A. baumannii, than in other Acinetobacter genomes; until recently, a global analysis of the distribution and conservation of virulence factors across the genus was not possible. The results demonstrate that the acquisition of specific virulence factors has likely contributed to the widespread persistence and virulence of A. baumannii. The identification of novel features associated with transcriptional regulation and acquired by clades in the Acb complex presents targets for better understanding the
Directory of Open Access Journals (Sweden)
Lei Pan
2017-09-01
Full Text Available Cowpea [Vigna unguiculata (L. Walp.] is an annual legume of economic importance and widely grown in the semi-arid tropics. However, high-density genetic maps of cowpea are still lacking. Here, we identified 34,868 SNPs (single nucleotide polymorphisms that were distributed in the cowpea genome based on the RAD sequencing (restriction-site associated DNA sequencing technique using a population of 170 individuals (two cowpea parents and 168 F2:3 progenies. Of these, 17,996 reliable SNPs were allotted to 11 consensus linkage groups (LGs. The length of the genetic map was 1,194.25 cM in total with a mean distance of 0.066 cM/SNP marker locus. Using this map and the F2:3 population, combined with the CIM (composite interval mapping method, eleven quantitative trait loci (QTL of yield-related trait were detected on seven LGs (LG4, 5, 6, 7, 9, 10, and 11 in cowpea. These QTL explained 0.05–17.32% of the total phenotypic variation. Among these, four QTL were for pod length, four QTL for thousand-grain weight (TGW, two QTL for grain number per pod, and one QTL for carpopodium length. Our results will provide a foundation for understanding genes related to grain yield in the cowpea and genus Vigna.
Targeted next generation sequencing of parotid gland cancer uncovers genetic heterogeneity.
Grünewald, Inga; Vollbrecht, Claudia; Meinrath, Jeannine; Meyer, Moritz F; Heukamp, Lukas C; Drebber, Uta; Quaas, Alexander; Beutner, Dirk; Hüttenbrink, Karl-Bernd; Wardelmann, Eva; Hartmann, Wolfgang; Büttner, Reinhard; Odenthal, Margarete; Stenner, Markus
2015-07-20
Salivary gland cancer represents a heterogeneous group of malignant tumors. Due to their low incidence and the existence of multiple morphologically defined subtypes, these tumors are still poorly understood with regard to their molecular pathogenesis and therapeutically relevant genetic alterations.Performing a systematic and comprehensive study covering 13 subtypes of salivary gland cancer, next generation sequencing was done on 84 tissue samples of parotid gland cancer using multiplex PCR for enrichment of cancer related gene loci covering hotspots of 46 cancer genes.Mutations were identified in 22 different genes. The most frequent alterations affected TP53, followed by RAS genes, PIK3CA, SMAD4 and members of the ERB family. HRAS mutations accounted for more than 90% of RAS mutations, occurring especially in epithelial-myoepithelial carcinomas and salivary duct carcinomas. Additional mutations in PIK3CA also affected particularly epithelial-myoepithelial carcinomas and salivary duct carcinomas, occurring simultaneously with HRAS mutations in almost all cases, pointing to an unknown and therapeutically relevant molecular constellation. Interestingly, 14% of tumors revealed mutations in surface growth factor receptor genes including ALK, HER2, ERBB4, FGFR, cMET and RET, which might prove to be targetable by new therapeutic agents. 6% of tumors revealed mutations in SMAD4.In summary, our data provide novel insight into the fundamental molecular heterogeneity of salivary gland cancer, relevant in terms of tumor classification and the establishment of targeted therapeutic concepts.
Nallaseth, Ferez Soli
The Y-chromosome presents a unique cytogenetic framework for the evolution of nucleotide sequences. Alignment of nine Y-chromosomal fragments in their increasing Y-specific/non Y-specific (male/female) sequence divergence ratios was directly and inversely related to their interspersion on these two respective genomic fractions. Sequence analysis confirmed a direct relationship between divergence ratios and the Alu, LINE-1, Satellite and their derivative oligonucleotide contents. Thus their relocation on the Y-chromosome is followed by sequence divergence rather than the well documented concerted evolution of these non-coding progenitor repeated sequences. Five of the nine Y-chromosomal fragments are non-pseudoautosomal and transcribed into heterogeneous PolyA^+ RNA and thus can be retrotransposed. Evolutionary and computer analysis identified homologous oligonucleotide tracts in several human loci suggesting common and random mechanistic origins. Dysgenic genomes represent the accelerated evolution driving sequence divergence (McClintock, 1984). Sex reversal and sterility characterizing dysgenesis occurs in C57BL/6JY ^{rm Pos} but not in 129/SvY^{rm Pos} derivative strains. High frequency, random, multi-locus deletion products of the feral Y^{ rm Pos}-chromosome are generated in the germlines of F1(C57BL/6J X 129/SvY^{ rm Pos})(male) and C57BL/6JY ^{rm Pos}(male) but not in 129/SvY^{rm Pos}(male). Equal, 10^{-1}, 10^ {-2}, and 0 copies (relative to males) of Y^{rm Pos}-specific deletion products respectively characterize C57BL/6JY ^{rm Pos} (HC), (LC), (T) and (F) females. The testes determining loci of inactive Y^{rm Pos}-chromosomes in C57BL/6JY^{rm Pos} HC females are the preferentially deleted/rearranged Y ^{rm Pos}-sequences. Disruption of regulation of plasma testosterone and hepatic MUP-A mRNA levels, TRD of a 4.7 Kbp EcoR1 fragment suggest disruption of autosomal/X-chromosomal sequences. These data and the highly repeated progenitor (Alu, GATA, LINE-1
Genetic Stratification in Myeloid Diseases: From Risk Assessment to Clinical Decision Support Tool
Directory of Open Access Journals (Sweden)
Yishai Ofran
2014-10-01
Full Text Available Genetic aberrations have become a dominant factor in the stratification of myeloid malignancies. Cytogenetic and a few mutation studies are the backbone of risk assessment models of myeloid malignancies which are a major consideration in clinical decisions, especially patient assignment for allogeneic stem cell transplantation. Progress in our understanding of the genetic basis of the pathogenesis of myeloid malignancies and the growing capabilities of mass sequencing may add new roles for the clinical usage of genetic data. A few recently identified mutations recognized to be associated with specific diseases or clinical scenarios may soon become part of the diagnostic criteria of such conditions. Mutational studies may also advance our capabilities for a more efficient patient selection process, assigning the most effective therapy at the best timing for each patient. The clinical utility of genetic data is anticipated to advance further with the adoption of deep sequencing and next-generation sequencing techniques. We herein suggest some future potential applications of sequential genetic data to identify pending deteriorations at time points which are the best for aggressive interventions such as allogeneic stem cell transplantation. Genetics is moving from being mostly a prognostic factor to becoming a multitasking decision support tool for hematologists. Physicians must pay attention to advances in molecular hematology as it will soon be accessible and influential for most of our patients.
Novel expressed sequences identified in a model of androgen independent prostate cancer
Directory of Open Access Journals (Sweden)
Jones Steven JM
2007-01-01
Full Text Available Abstract Background Prostate cancer is the most frequently diagnosed cancer in American men, and few effective treatment options are available to patients who develop hormone-refractory prostate cancer. The molecular changes that occur to allow prostate cells to proliferate in the absence of androgens are not fully understood. Results Subtractive hybridization experiments performed with samples from an in vivo model of hormonal progression identified 25 expressed sequences representing novel human transcripts. Intriguingly, these 25 sequences have small open-reading frames and are not highly conserved through evolution, suggesting many of these novel expressed sequences may be derived from untranslated regions of novel transcripts or from non-coding transcripts. Examination of a large metalibrary of human Serial Analysis of Gene Expression (SAGE tags demonstrated that only three of these novel sequences had been previously detected. RT-PCR experiments confirmed that the 6 sequences tested were expressed in specific human tissues, as well as in clinical samples of prostate cancer. Further RT-PCR experiments for five of these fragments indicated they originated from large untranslated regions of unannotated transcripts. Conclusion This study underlines the value of using complementary techniques in the annotation of the human genome. The tissue-specific expression of 4 of the 6 clones tested indicates the expression of these novel transcripts is tightly regulated, and future work will determine the possible role(s these novel transcripts may play in the progression of prostate cancer.
Guelly, Christian; Zhu, Peng-Peng; Leonardis, Lea; Papić, Lea; Zidar, Janez; Schabhüttl, Maria; Strohmaier, Heimo; Weis, Joachim; Strom, Tim M; Baets, Jonathan; Willems, Jan; De Jonghe, Peter; Reilly, Mary M; Fröhlich, Eleonore; Hatz, Martina; Trajanoski, Slave; Pieber, Thomas R; Janecke, Andreas R; Blackstone, Craig; Auer-Grumbach, Michaela
2011-01-07
Hereditary sensory neuropathy type I (HSN I) is an axonal form of autosomal-dominant hereditary motor and sensory neuropathy distinguished by prominent sensory loss that leads to painless injuries. Unrecognized, these can result in delayed wound healing and osteomyelitis, necessitating distal amputations. To elucidate the genetic basis of an HSN I subtype in a family in which mutations in the few known HSN I genes had been excluded, we employed massive parallel exon sequencing of the 14.3 Mb disease interval on chromosome 14q. We detected a missense mutation (c.1065C>A, p.Asn355Lys) in atlastin-1 (ATL1), a gene that is known to be mutated in early-onset hereditary spastic paraplegia SPG3A and that encodes the large dynamin-related GTPase atlastin-1. The mutant protein exhibited reduced GTPase activity and prominently disrupted ER network morphology when expressed in COS7 cells, strongly supporting pathogenicity. An expanded screen in 115 additional HSN I patients identified two further dominant ATL1 mutations (c.196G>C [p.Glu66Gln] and c.976 delG [p.Val326TrpfsX8]). This study highlights an unexpected major role for atlastin-1 in the function of sensory neurons and identifies HSN I and SPG3A as allelic disorders.
Directory of Open Access Journals (Sweden)
Oussama Ahrazem
2012-05-01
Full Text Available Eight Pinus nigra Arn. populations from Southern Spain and Northern Morocco were examined using inter-simple sequence repeat markers to characterize the genetic variability amongst populations. Pair-wise population genetic distance ranged from 0.031 to 0.283, with a mean of 0.150 between populations. The highest inter-population average distance was between PaCU from Cuenca and YeCA from Cazorla, while the lowest distance was between TaMO from Morocco and MA Sierra Mágina populations. Analysis of molecular variance (AMOVA and Nei’s genetic diversity analyses revealed higher genetic variation within the same population than among different populations. Genetic differentiation (Gst was 0.233. Cuenca showed the highest Nei’s genetic diversity followed by the Moroccan region, Sierra Mágina, and Cazorla region. However, clustering of populations was not in accordance with their geographical locations. Principal component analysis showed the presence of two major groups—Group 1 contained all populations from Cuenca while Group 2 contained populations from Cazorla, Sierra Mágina and Morocco—while Bayesian analysis revealed the presence of three clusters. The low genetic diversity observed in PaCU and YeCA is probably a consequence of inappropriate management since no estimation of genetic variability was performed before the silvicultural treatments. Data indicates that the inter-simple sequence repeat (ISSR method is sufficiently informative and powerful to assess genetic variability among populations of P. nigra.
Sun, Hokeun; Wang, Shuang
2014-08-15
Existing association methods for rare variants from sequencing data have focused on aggregating variants in a gene or a genetic region because of the fact that analysing individual rare variants is underpowered. However, these existing rare variant detection methods are not able to identify which rare variants in a gene or a genetic region of all variants are associated with the complex diseases or traits. Once phenotypic associations of a gene or a genetic region are identified, the natural next step in the association study with sequencing data is to locate the susceptible rare variants within the gene or the genetic region. In this article, we propose a power set-based statistical selection procedure that is able to identify the locations of the potentially susceptible rare variants within a disease-related gene or a genetic region. The selection performance of the proposed selection procedure was evaluated through simulation studies, where we demonstrated the feasibility and superior power over several comparable existing methods. In particular, the proposed method is able to handle the mixed effects when both risk and protective variants are present in a gene or a genetic region. The proposed selection procedure was also applied to the sequence data on the ANGPTL gene family from the Dallas Heart Study to identify potentially susceptible rare variants within the trait-related genes. An R package 'rvsel' can be downloaded from http://www.columbia.edu/∼sw2206/ and http://statsun.pusan.ac.kr. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Single Nucleotide Polymorphism Markers for Genetic Mapping in Drosophila melanogaster
Hoskins, Roger A.; Phan, Alexander C.; Naeemuddin, Mohammed; Mapa, Felipa A.; Ruddy, David A.; Ryan, Jessica J.; Young, Lynn M.; Wells, Trent; Kopczynski, Casey; Ellis, Michael C.
2001-01-01
For nearly a century, genetic analysis in Drosophila melanogaster has been a powerful tool for analyzing gene function, yet Drosophila lacks the molecular genetic mapping tools that recently have revolutionized human, mouse, and plant genetics. Here, we describe the systematic characterization of a dense set of molecular markers in Drosophila by using a sequence tagged site-based physical map of the genome. We identify 474 biallelic markers in standard laboratory strains of Drosophila that sp...
Bos taurus strain:dairy beef (cattle): 1000 Bull Genomes Run 2, Bovine Whole Genome Sequence
Bouwman, A.C.; Daetwyler, H.D.; Chamberlain, Amanda J.; Ponce, Carla Hurtado; Sargolzaei, Mehdi; Schenkel, Flavio S.; Sahana, Goutam; Govignon-Gion, Armelle; Boitard, Simon; Dolezal, Marlies; Pausch, Hubert; Brøndum, Rasmus F.; Bowman, Phil J.; Thomsen, Bo; Guldbrandtsen, Bernt; Lund, Mogens S.; Servin, Bertrand; Garrick, Dorian J.; Reecy, James M.; Vilkki, Johanna; Bagnato, Alessandro; Wang, Min; Hoff, Jesse L.; Schnabel, Robert D.; Taylor, Jeremy F.; Vinkhuyzen, Anna A.E.; Panitz, Frank; Bendixen, Christian; Holm, Lars-Erik; Gredler, Birgit; Hozé, Chris; Boussaha, Mekki; Sanchez, Marie Pierre; Rocha, Dominique; Capitan, Aurelien; Tribout, Thierry; Barbat, Anne; Croiseau, Pascal; Drögemüller, Cord; Jagannathan, Vidhya; Vander Jagt, Christy; Crowley, John J.; Bieber, Anna; Purfield, Deirdre C.; Berry, Donagh P.; Emmerling, Reiner; Götz, Kay Uwe; Frischknecht, Mirjam; Russ, Ingolf; Sölkner, Johann; Tassell, van Curtis P.; Fries, Ruedi; Stothard, Paul; Veerkamp, R.F.; Boichard, Didier; Goddard, Mike E.; Hayes, Ben J.
2014-01-01
Whole genome sequence data (BAM format) of 234 bovine individuals aligned to UMD3.1. The aim of the study was to identify genetic variants (SNPs and indels) for downstream analysis such as imputation, GWAS, and detection of lethal recessives. Additional sequences for later 1000 bull genomes runs can
Clinical neurogenetics: recent advances in the genetics of epilepsy.
Coorg, Rohini; Weisenberg, Judith L Z; Wong, Michael
2013-11-01
Epilepsy represents a diverse group of disorders with primary and secondary genetic etiologies, as well as non-genetic causes. As more causative genes are identified, genetic testing is becoming increasingly important in the evaluation and management of epilepsy. This article outlines the clinical approach to epilepsy patients, with emphasis on genetic testing. Specific targeted tests are available for numerous individual genetic causes of epilepsy. Broader screening tests, such as chromosome microarray analysis and whole exome sequencing, have also been developed. As a standardized protocol for genetic testing has not been established, individualized diagnostic approaches to epilepsy patients should be used. Copyright © 2013 Elsevier Inc. All rights reserved.
Romero-Hidalgo, Sandra; Ochoa-Leyva, Adrián; Garcíarrubio, Alejandro; Acuña-Alonzo, Victor; Antúnez-Argüelles, Erika; Balcazar-Quintero, Martha; Barquera-Lozano, Rodrigo; Carnevale, Alessandra; Cornejo-Granados, Fernanda; Fernández-López, Juan Carlos; García-Herrera, Rodrigo; García-Ortíz, Humberto; Granados-Silvestre, Ángeles; Granados, Julio; Guerrero-Romero, Fernando
2017-01-01
Understanding the genetic structure of Native American populations is important to clarify their diversity, demographic history, and to identify genetic factors relevant for biomedical traits. Here, we show a demographic history reconstruction from 12 Native American whole genomes belonging to six distinct ethnic groups representing the three main described genetic clusters of Mexico (Northern, Southern, and Maya). Effective population size estimates of all Native American groups remained bel...
Directory of Open Access Journals (Sweden)
Danilo Licastro
Full Text Available Usher syndrome (USH is a clinically and genetically heterogeneous disorder characterized by visual and hearing impairments. Clinically, it is subdivided into three subclasses with nine genes identified so far. In the present study, we investigated whether the currently available Next Generation Sequencing (NGS technologies are already suitable for molecular diagnostics of USH. We analyzed a total of 12 patients, most of which were negative for previously described mutations in known USH genes upon primer extension-based microarray genotyping. We enriched the NGS template either by whole exome capture or by Long-PCR of the known USH genes. The main NGS sequencing platforms were used: SOLiD for whole exome sequencing, Illumina (Genome Analyzer II and Roche 454 (GS FLX for the Long-PCR sequencing. Long-PCR targeting was more efficient with up to 94% of USH gene regions displaying an overall coverage higher than 25×, whereas whole exome sequencing yielded a similar coverage for only 50% of those regions. Overall this integrated analysis led to the identification of 11 novel sequence variations in USH genes (2 homozygous and 9 heterozygous out of 18 detected. However, at least two cases were not genetically solved. Our result highlights the current limitations in the diagnostic use of NGS for USH patients. The limit for whole exome sequencing is linked to the need of a strong coverage and to the correct interpretation of sequence variations with a non obvious, pathogenic role, whereas the targeted approach suffers from the high genetic heterogeneity of USH that may be also caused by the presence of additional causative genes yet to be identified.
Licastro, Danilo; Mutarelli, Margherita; Peluso, Ivana; Neveling, Kornelia; Wieskamp, Nienke; Rispoli, Rossella; Vozzi, Diego; Athanasakis, Emmanouil; D'Eustacchio, Angela; Pizzo, Mariateresa; D'Amico, Francesca; Ziviello, Carmela; Simonelli, Francesca; Fabretto, Antonella; Scheffer, Hans; Gasparini, Paolo; Banfi, Sandro; Nigro, Vincenzo
2012-01-01
Usher syndrome (USH) is a clinically and genetically heterogeneous disorder characterized by visual and hearing impairments. Clinically, it is subdivided into three subclasses with nine genes identified so far. In the present study, we investigated whether the currently available Next Generation Sequencing (NGS) technologies are already suitable for molecular diagnostics of USH. We analyzed a total of 12 patients, most of which were negative for previously described mutations in known USH genes upon primer extension-based microarray genotyping. We enriched the NGS template either by whole exome capture or by Long-PCR of the known USH genes. The main NGS sequencing platforms were used: SOLiD for whole exome sequencing, Illumina (Genome Analyzer II) and Roche 454 (GS FLX) for the Long-PCR sequencing. Long-PCR targeting was more efficient with up to 94% of USH gene regions displaying an overall coverage higher than 25×, whereas whole exome sequencing yielded a similar coverage for only 50% of those regions. Overall this integrated analysis led to the identification of 11 novel sequence variations in USH genes (2 homozygous and 9 heterozygous) out of 18 detected. However, at least two cases were not genetically solved. Our result highlights the current limitations in the diagnostic use of NGS for USH patients. The limit for whole exome sequencing is linked to the need of a strong coverage and to the correct interpretation of sequence variations with a non obvious, pathogenic role, whereas the targeted approach suffers from the high genetic heterogeneity of USH that may be also caused by the presence of additional causative genes yet to be identified. PMID:22952768
A Systematic Bayesian Integration of Epidemiological and Genetic Data
Lau, Max S. Y.; Marion, Glenn; Streftaris, George; Gibson, Gavin
2015-01-01
Genetic sequence data on pathogens have great potential to inform inference of their transmission dynamics ultimately leading to better disease control. Where genetic change and disease transmission occur on comparable timescales additional information can be inferred via the joint analysis of such genetic sequence data and epidemiological observations based on clinical symptoms and diagnostic tests. Although recently introduced approaches represent substantial progress, for computational reasons they approximate genuine joint inference of disease dynamics and genetic change in the pathogen population, capturing partially the joint epidemiological-evolutionary dynamics. Improved methods are needed to fully integrate such genetic data with epidemiological observations, for achieving a more robust inference of the transmission tree and other key epidemiological parameters such as latent periods. Here, building on current literature, a novel Bayesian framework is proposed that infers simultaneously and explicitly the transmission tree and unobserved transmitted pathogen sequences. Our framework facilitates the use of realistic likelihood functions and enables systematic and genuine joint inference of the epidemiological-evolutionary process from partially observed outbreaks. Using simulated data it is shown that this approach is able to infer accurately joint epidemiological-evolutionary dynamics, even when pathogen sequences and epidemiological data are incomplete, and when sequences are available for only a fraction of exposures. These results also characterise and quantify the value of incomplete and partial sequence data, which has important implications for sampling design, and demonstrate the abilities of the introduced method to identify multiple clusters within an outbreak. The framework is used to analyse an outbreak of foot-and-mouth disease in the UK, enhancing current understanding of its transmission dynamics and evolutionary process. PMID:26599399
Thoendel, Matthew; Jeraldo, Patricio; Greenwood-Quaintance, Kerryl E; Chia, Nicholas; Abdel, Matthew P; Steckelberg, James M; Osmon, Douglas R; Patel, Robin
2017-07-15
Defining the microbial etiology of culture-negative prosthetic joint infection (PJI) can be challenging. Metagenomic shotgun sequencing is a new tool to identify organisms undetected by conventional methods. We present a case where metagenomics was used to identify Mycoplasma salivarium as a novel PJI pathogen in a patient with hypogammaglobulinemia. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
Tanase, Koji; Nishitani, Chikako; Hirakawa, Hideki; Isobe, Sachiko; Tabata, Satoshi; Ohmiya, Akemi; Onozaki, Takashi
2012-07-02
Carnation (Dianthus caryophyllus L.), in the family Caryophyllaceae, can be found in a wide range of colors and is a model system for studies of flower senescence. In addition, it is one of the most important flowers in the global floriculture industry. However, few genomics resources, such as sequences and markers are available for carnation or other members of the Caryophyllaceae. To increase our understanding of the genetic control of important characters in carnation, we generated an expressed sequence tag (EST) database for a carnation cultivar important in horticulture by high-throughput sequencing using 454 pyrosequencing technology. We constructed a normalized cDNA library and a 3'-UTR library of carnation, obtaining a total of 1,162,126 high-quality reads. These reads were assembled into 300,740 unigenes consisting of 37,844 contigs and 262,896 singlets. The contigs were searched against an Arabidopsis sequence database, and 61.8% (23,380) of them had at least one BLASTX hit. These contigs were also annotated with Gene Ontology (GO) and were found to cover a broad range of GO categories. Furthermore, we identified 17,362 potential simple sequence repeats (SSRs) in 14,291 of the unigenes. We focused on gene discovery in the areas of flower color and ethylene biosynthesis. Transcripts were identified for almost every gene involved in flower chlorophyll and carotenoid metabolism and in anthocyanin biosynthesis. Transcripts were also identified for every step in the ethylene biosynthesis pathway. We present the first large-scale sequence data set for carnation, generated using next-generation sequencing technology. The large EST database generated from these sequences is an informative resource for identifying genes involved in various biological processes in carnation and provides an EST resource for understanding the genetic diversity of this plant.
Directory of Open Access Journals (Sweden)
Tanase Koji
2012-07-01
Full Text Available Abstract Background Carnation (Dianthus caryophyllus L., in the family Caryophyllaceae, can be found in a wide range of colors and is a model system for studies of flower senescence. In addition, it is one of the most important flowers in the global floriculture industry. However, few genomics resources, such as sequences and markers are available for carnation or other members of the Caryophyllaceae. To increase our understanding of the genetic control of important characters in carnation, we generated an expressed sequence tag (EST database for a carnation cultivar important in horticulture by high-throughput sequencing using 454 pyrosequencing technology. Results We constructed a normalized cDNA library and a 3’-UTR library of carnation, obtaining a total of 1,162,126 high-quality reads. These reads were assembled into 300,740 unigenes consisting of 37,844 contigs and 262,896 singlets. The contigs were searched against an Arabidopsis sequence database, and 61.8% (23,380 of them had at least one BLASTX hit. These contigs were also annotated with Gene Ontology (GO and were found to cover a broad range of GO categories. Furthermore, we identified 17,362 potential simple sequence repeats (SSRs in 14,291 of the unigenes. We focused on gene discovery in the areas of flower color and ethylene biosynthesis. Transcripts were identified for almost every gene involved in flower chlorophyll and carotenoid metabolism and in anthocyanin biosynthesis. Transcripts were also identified for every step in the ethylene biosynthesis pathway. Conclusions We present the first large-scale sequence data set for carnation, generated using next-generation sequencing technology. The large EST database generated from these sequences is an informative resource for identifying genes involved in various biological processes in carnation and provides an EST resource for understanding the genetic diversity of this plant.
Whole-exome sequencing and high throughput genotyping identified KCNJ11 as the thirteenth MODY gene.
Bonnefond, Amélie; Philippe, Julien; Durand, Emmanuelle; Dechaume, Aurélie; Huyvaert, Marlène; Montagne, Louise; Marre, Michel; Balkau, Beverley; Fajardy, Isabelle; Vambergue, Anne; Vatin, Vincent; Delplanque, Jérôme; Le Guilcher, David; De Graeve, Franck; Lecoeur, Cécile; Sand, Olivier; Vaxillaire, Martine; Froguel, Philippe
2012-01-01
Maturity-onset of the young (MODY) is a clinically heterogeneous form of diabetes characterized by an autosomal-dominant mode of inheritance, an onset before the age of 25 years, and a primary defect in the pancreatic beta-cell function. Approximately 30% of MODY families remain genetically unexplained (MODY-X). Here, we aimed to use whole-exome sequencing (WES) in a four-generation MODY-X family to identify a new susceptibility gene for MODY. WES (Agilent-SureSelect capture/Illumina-GAIIx sequencing) was performed in three affected and one non-affected relatives in the MODY-X family. We then performed a high-throughput multiplex genotyping (Illumina-GoldenGate assay) of the putative causal mutations in the whole family and in 406 controls. A linkage analysis was also carried out. By focusing on variants of interest (i.e. gains of stop codon, frameshift, non-synonymous and splice-site variants not reported in dbSNP130) present in the three affected relatives and not present in the control, we found 69 mutations. However, as WES was not uniform between samples, a total of 324 mutations had to be assessed in the whole family and in controls. Only one mutation (p.Glu227Lys in KCNJ11) co-segregated with diabetes in the family (with a LOD-score of 3.68). No KCNJ11 mutation was found in 25 other MODY-X unrelated subjects. Beyond neonatal diabetes mellitus (NDM), KCNJ11 is also a MODY gene ('MODY13'), confirming the wide spectrum of diabetes related phenotypes due to mutations in NDM genes (i.e. KCNJ11, ABCC8 and INS). Therefore, the molecular diagnosis of MODY should include KCNJ11 as affected carriers can be ideally treated with oral sulfonylureas.
Whole-exome sequencing and high throughput genotyping identified KCNJ11 as the thirteenth MODY gene.
Directory of Open Access Journals (Sweden)
Amélie Bonnefond
Full Text Available BACKGROUND: Maturity-onset of the young (MODY is a clinically heterogeneous form of diabetes characterized by an autosomal-dominant mode of inheritance, an onset before the age of 25 years, and a primary defect in the pancreatic beta-cell function. Approximately 30% of MODY families remain genetically unexplained (MODY-X. Here, we aimed to use whole-exome sequencing (WES in a four-generation MODY-X family to identify a new susceptibility gene for MODY. METHODOLOGY: WES (Agilent-SureSelect capture/Illumina-GAIIx sequencing was performed in three affected and one non-affected relatives in the MODY-X family. We then performed a high-throughput multiplex genotyping (Illumina-GoldenGate assay of the putative causal mutations in the whole family and in 406 controls. A linkage analysis was also carried out. PRINCIPAL FINDINGS: By focusing on variants of interest (i.e. gains of stop codon, frameshift, non-synonymous and splice-site variants not reported in dbSNP130 present in the three affected relatives and not present in the control, we found 69 mutations. However, as WES was not uniform between samples, a total of 324 mutations had to be assessed in the whole family and in controls. Only one mutation (p.Glu227Lys in KCNJ11 co-segregated with diabetes in the family (with a LOD-score of 3.68. No KCNJ11 mutation was found in 25 other MODY-X unrelated subjects. CONCLUSIONS/SIGNIFICANCE: Beyond neonatal diabetes mellitus (NDM, KCNJ11 is also a MODY gene ('MODY13', confirming the wide spectrum of diabetes related phenotypes due to mutations in NDM genes (i.e. KCNJ11, ABCC8 and INS. Therefore, the molecular diagnosis of MODY should include KCNJ11 as affected carriers can be ideally treated with oral sulfonylureas.
Parker, Jennifer K.; Havird, Justin C.; De La Fuente, Leonardo
2012-01-01
Isolates of the plant pathogen Xylella fastidiosa are genetically very similar, but studies on their biological traits have indicated differences in virulence and infection symptomatology. Taxonomic analyses have identified several subspecies, and phylogenetic analyses of housekeeping genes have shown broad host-based genetic differences; however, results are still inconclusive for genetic differentiation of isolates within subspecies. This study employs multilocus sequence analysis of enviro...
Application of Next Generation Sequencing on Genetic Testing
DEFF Research Database (Denmark)
Li, Jian
The discovery of genetic factors behind increasing number of human diseases and the growth of education of genetic knowledge to the public make demands for genetic testing increase rapidly. However, traditional genetic testing methods cannot meet all kinds of the requirements. Next generation seq...
Carty, Cara L; Keene, Keith L; Cheng, Yu-Ching; Meschia, James F; Chen, Wei-Min; Nalls, Mike; Bis, Joshua C; Kittner, Steven J; Rich, Stephen S; Tajuddin, Salman; Zonderman, Alan B; Evans, Michele K; Langefeld, Carl D; Gottesman, Rebecca; Mosley, Thomas H; Shahar, Eyal; Woo, Daniel; Yaffe, Kristine; Liu, Yongmei; Sale, Michèle M; Dichgans, Martin; Malik, Rainer; Longstreth, W T; Mitchell, Braxton D; Psaty, Bruce M; Kooperberg, Charles; Reiner, Alexander; Worrall, Bradford B; Fornage, Myriam
2015-08-01
The majority of genome-wide association studies (GWAS) of stroke have focused on European-ancestry populations; however, none has been conducted in African Americans, despite the disproportionately high burden of stroke in this population. The Consortium of Minority Population Genome-Wide Association Studies of Stroke (COMPASS) was established to identify stroke susceptibility loci in minority populations. Using METAL, we conducted meta-analyses of GWAS in 14 746 African Americans (1365 ischemic and 1592 total stroke cases) from COMPASS, and tested genetic variants with Pstroke genetic studies in European-ancestry populations. We also evaluated stroke loci previously identified in European-ancestry populations. The 15q21.3 locus linked with lipid levels and hypertension was associated with total stroke (rs4471613; P=3.9×10(-8)) in African Americans. Nominal associations (Pstroke were observed for 18 variants in or near genes implicated in cell cycle/mRNA presplicing (PTPRG, CDC5L), platelet function (HPS4), blood-brain barrier permeability (CLDN17), immune response (ELTD1, WDFY4, and IL1F10-IL1RN), and histone modification (HDAC9). Two of these loci achieved nominal significance in METASTROKE: 5q35.2 (P=0.03), and 1p31.1 (P=0.018). Four of 7 previously reported ischemic stroke loci (PITX2, HDAC9, CDKN2A/CDKN2B, and ZFHX3) were nominally associated (Pstroke in COMPASS. We identified a novel genetic variant associated with total stroke in African Americans and found that ischemic stroke loci identified in European-ancestry populations may also be relevant for African Americans. Our findings support investigation of diverse populations to identify and characterize genetic risk factors, and the importance of shared genetic risk across populations. © 2015 American Heart Association, Inc.
Predicting effects of noncoding variants with deep learning-based sequence model.
Zhou, Jian; Troyanskaya, Olga G
2015-10-01
Identifying functional effects of noncoding variants is a major challenge in human genetics. To predict the noncoding-variant effects de novo from sequence, we developed a deep learning-based algorithmic framework, DeepSEA (http://deepsea.princeton.edu/), that directly learns a regulatory sequence code from large-scale chromatin-profiling data, enabling prediction of chromatin effects of sequence alterations with single-nucleotide sensitivity. We further used this capability to improve prioritization of functional variants including expression quantitative trait loci (eQTLs) and disease-associated variants.
Ito, Masaoki; Miyata, Yoshihiro; Hirano, Shoko; Kimura, Shingo; Irisuna, Fumiko; Ikeda, Kyoko; Kushitani, Kei; Tsutani, Yasuhiro; Ueda, Daisuke; Tsubokawa, Norifumi; Takeshima, Yukio; Okada, Morihito
2017-12-12
Small cell lung cancer (SCLC) and large cell neuroendocrine carcinoma (LCNEC) of the lung are classified as variants of endocrine carcinoma and subdivided into pure or combined type. Clinical benefit of target therapy has not been established in these tumors. This study aimed to compare genetic and clinicopathological features between SCLC and LCNEC or pure and combined types, and explore the possibility of target therapy using next-generation sequencing. In 13 SCLC and 22 LCNEC cases, 72 point mutations, 19 deletions, and 3 insertions were detected. As therapeutically targetable variants, mutations in EGFR (L858R), KRAS (G12D, G12A, G12V), and PIK3CA (E545K) were detected in 5 cases. The case harboring EGFR mutation showed response to EGFR-tyrosine kinase inhibitor. However, there are no clinicopathological features associated with therapeutically targetable cases. And there was no significant genetic feature between SCLC and LCNEC or pure and combined types. In conclusion, although patients with SCLC and LCNEC may benefit from target therapy, they were not identifiable by clinicopathologic background. And there was not significant genetic difference between SCLC and LCNEC, including between pure and combined types. Classifying SCLC and LCNEC in same category is reasonable. However, distinguishing the pure type from combined type was not validated. Comprehensive genetic analysis should be performed to detect targetable variants in any type of SCLC and LCNEC.
Genetics of nonsyndromic obesity.
Lee, Yung Seng
2013-12-01
Common obesity is widely regarded as a complex, multifactorial trait influenced by the 'obesogenic' environment, sedentary behavior, and genetic susceptibility contributed by common and rare genetic variants. This review describes the recent advances in understanding the role of genetics in obesity. New susceptibility loci and genetic variants are being uncovered, but the collective effect is relatively small and could not explain most of the BMI heritability. Yet-to-be identified common and rare variants, epistasis, and heritable epigenetic changes may account for part of the 'missing heritability'. Evidence is emerging about the role of epigenetics in determining obesity susceptibility, mediating developmental plasticity, which confers obesity risk from early life experiences. Genetic prediction scores derived from selected genetic variants, and also differential DNA methylation levels and methylation scores, have been shown to correlate with measures of obesity and response to weight loss intervention. Genetic variants, which confer susceptibility to obesity-related morbidities like nonalcoholic fatty liver disease, were also discovered recently. We can expect discovery of more rare genetic variants with the advent of whole exome and genome sequencing, and also greater understanding of epigenetic mechanisms by which environment influences genetic expression and which mediate the gene-environment interaction.
Directory of Open Access Journals (Sweden)
Michelle Klein Sercundes
2016-03-01
Full Text Available Abstract Phylogenies within Toxoplasmatinae have been widely investigated with different molecular markers. Here, we studied molecular phylogenies of the Toxoplasmatinae subfamily based on apicoplast and mitochondrial genes. Partial sequences of apicoplast genes coding for caseinolytic protease (clpC and beta subunit of RNA polymerase (rpoB, and mitochondrial gene coding for cytochrome B (cytB were analyzed. Laboratory-adapted strains of the closely related parasites Sarcocystis falcatula and Sarcocystis neurona were investigated, along with Neospora caninum, Neospora hughesi, Toxoplasma gondii (strains RH, CTG and PTG, Besnoitia akodoni, Hammondia hammondiand two genetically divergent lineages of Hammondia heydorni. The molecular analysis based on organellar genes did not clearly differentiate between N. caninum and N. hughesi, but the two lineages of H. heydorni were confirmed. Slight differences between the strains of S. falcatula and S. neurona were encountered in all markers. In conclusion, congruent phylogenies were inferred from the three different genes and they might be used for screening undescribed sarcocystid parasites in order to ascertain their phylogenetic relationships with organisms of the family Sarcocystidae. The evolutionary studies based on organelar genes confirm that the genusHammondia is paraphyletic. The primers used for amplification of clpC and rpoB were able to amplify genetic sequences of organisms of the genus Sarcocystisand organisms of the subfamily Toxoplasmatinae as well.
Drong, Alexander W; Abbott, James; Wahl, Simone; Tan, Sian-Tsung; Scott, William R; Campanella, Gianluca; Chadeau-Hyam, Marc; Afzal, Uzma; Ahluwalia, Tarunveer S; Bonder, Marc Jan; Chen, Peng; Dehghan, Abbas; Edwards, Todd L; Esko, Tõnu; Go, Min Jin; Harris, Sarah E; Hartiala, Jaana; Kasela, Silva; Kasturiratne, Anuradhani; Khor, Chiea-Chuen; Kleber, Marcus E; Li, Huaixing; Yu Mok, Zuan; Nakatochi, Masahiro; Sapari, Nur Sabrina; Saxena, Richa; Stewart, Alexandre F R; Stolk, Lisette; Tabara, Yasuharu; Teh, Ai Ling; Wu, Ying; Wu, Jer-Yuarn; Zhang, Yi; Aits, Imke; Da Silva Couto Alves, Alexessander; Das, Shikta; Dorajoo, Rajkumar; Hopewell, Jemma C; Kim, Yun Kyoung; Koivula, Robert W; Luan, Jian’an; Lyytikäinen, Leo-Pekka; Nguyen, Quang N; Pereira, Mark A; Postmus, Iris; Raitakari, Olli T; Bryan, Molly Scannell; Scott, Robert A; Sorice, Rossella; Tragante, Vinicius; Traglia, Michela; White, Jon; Yamamoto, Ken; Zhang, Yonghong; Adair, Linda S; Ahmed, Alauddin; Akiyama, Koichi; Asif, Rasheed; Aung, Tin; Barroso, Inês; Bjonnes, Andrew; Braun, Timothy R; Cai, Hui; Chang, Li-Ching; Chen, Chien-Hsiun; Cheng, Ching-Yu; Chong, Yap-Seng; Collins, Rory; Courtney, Regina; Davies, Gail; Delgado, Graciela; Do, Loi D; Doevendans, Pieter A; Gansevoort, Ron T; Gao, Yu-Tang; Grammer, Tanja B; Grarup, Niels; Grewal, Jagvir; Gu, Dongfeng; Wander, Gurpreet S; Hartikainen, Anna-Liisa; Hazen, Stanley L; He, Jing; Heng, Chew-Kiat; Hixson, James E; Hofman, Albert; Hsu, Chris; Huang, Wei; Husemoen, Lise L N; Hwang, Joo-Yeon; Ichihara, Sahoko; Igase, Michiya; Isono, Masato; Justesen, Johanne M; Katsuya, Tomohiro; Kibriya, Muhammad G; Kim, Young Jin; Kishimoto, Miyako; Koh, Woon-Puay; Kohara, Katsuhiko; Kumari, Meena; Kwek, Kenneth; Lee, Nanette R; Lee, Jeannette; Liao, Jiemin; Lieb, Wolfgang; Liewald, David C M; Matsubara, Tatsuaki; Matsushita, Yumi; Meitinger, Thomas; Mihailov, Evelin; Milani, Lili; Mills, Rebecca; Mononen, Nina; Müller-Nurasyid, Martina; Nabika, Toru; Nakashima, Eitaro; Ng, Hong Kiat; Nikus, Kjell; Nutile, Teresa; Ohkubo, Takayoshi; Ohnaka, Keizo; Parish, Sarah; Paternoster, Lavinia; Peng, Hao; Peters, Annette; Pham, Son T; Pinidiyapathirage, Mohitha J; Rahman, Mahfuzar; Rakugi, Hiromi; Rolandsson, Olov; Ann Rozario, Michelle; Ruggiero, Daniela; Sala, Cinzia F; Sarju, Ralhan; Shimokawa, Kazuro; Snieder, Harold; Sparsø, Thomas; Spiering, Wilko; Starr, John M; Stott, David J; Stram, Daniel O; Sugiyama, Takao; Szymczak, Silke; Tang, W H Wilson; Tong, Lin; Trompet, Stella; Turjanmaa, Väinö; Ueshima, Hirotsugu; Uitterlinden, André G; Umemura, Satoshi; Vaarasmaki, Marja; van Dam, Rob M; van Gilst, Wiek H; van Veldhuisen, Dirk J; Viikari, Jorma S; Waldenberger, Melanie; Wang, Yiqin; Wang, Aili; Wilson, Rory; Wong, Tien-Yin; Xiang, Yong-Bing; Yamaguchi, Shuhei; Ye, Xingwang; Young, Robin D; Young, Terri L; Yuan, Jian-Min; Zhou, Xueya; Asselbergs, Folkert W; Ciullo, Marina; Clarke, Robert; Deloukas, Panos; Franke, Andre; Franks, Paul W; Franks, Steve; Friedlander, Yechiel; Gross, Myron D; Guo, Zhirong; Hansen, Torben; Jarvelin, Marjo-Riitta; Jørgensen, Torben; Jukema, J Wouter; kähönen, Mika; Kajio, Hiroshi; Kivimaki, Mika; Lee, Jong-Young; Lehtimäki, Terho; Linneberg, Allan; Miki, Tetsuro; Pedersen, Oluf; Samani, Nilesh J; Sørensen, Thorkild I A; Takayanagi, Ryoichi; Toniolo, Daniela; Ahsan, Habibul; Allayee, Hooman; Chen, Yuan-Tsong; Danesh, John; Deary, Ian J; Franco, Oscar H; Franke, Lude; Heijman, Bastiaan T; Holbrook, Joanna D; Isaacs, Aaron; Kim, Bong-Jo; Lin, Xu; Liu, Jianjun; März, Winfried; Metspalu, Andres; Mohlke, Karen L; Sanghera, Dharambir K; Shu, Xiao-Ou; van Meurs, Joyce B J; Vithana, Eranga; Wickremasinghe, Ananda R; Wijmenga, Cisca; Wolffenbuttel, Bruce H W; Yokota, Mitsuhiro; Zheng, Wei; Zhu, Dingliang; Vineis, Paolo; Kyrtopoulos, Soterios A; Kleinjans, Jos C S; McCarthy, Mark I; Soong, Richie; Gieger, Christian; Scott, James
2016-01-01
We carried out a trans-ancestry genome-wide association and replication study of blood pressure phenotypes among up to 320,251 individuals of East Asian, European and South Asian ancestry. We find genetic variants at 12 new loci to be associated with blood pressure (P = 3.9 × 10−11 to 5.0 × 10−21). The sentinel blood pressure SNPs are enriched for association with DNA methylation at multiple nearby CpG sites, suggesting that, at some of the loci identified, DNA methylation may lie on the regulatory pathway linking sequence variation to blood pressure. The sentinel SNPs at the 12 new loci point to genes involved in vascular smooth muscle (IGFBP3, KCNK3, PDE3A and PRDM6) and renal (ARHGAP24, OSR1, SLC22A7 and TBX2) function. The new and known genetic variants predict increased left ventricular mass, circulating levels of NT-proBNP, and cardiovascular and all-cause mortality (P = 0.04 to 8.6 × 10−6). Our results provide new evidence for the role of DNA methylation in blood pressure regulation. PMID:26390057
Buti, Matteo; Sargent, Daniel J; Mhelembe, Khethani G; Delfino, Pietro; Tobutt, Kenneth R; Velasco, Riccardo
2016-05-11
The Rosaceae family encompasses numerous genera exhibiting morphological diversification in fruit types and plant habit as well as a wide variety of chromosome numbers. Comparative genomics between various Rosaceous genera has led to the hypothesis that the ancestral genome of the family contained nine chromosomes, however, the synteny studies performed in the Rosaceae to date encompass species with base chromosome numbers x = 7 (Fragaria), x = 8 (Prunus), and x = 17 (Malus), and no study has included species from one of the many Rosaceous genera containing a base chromosome number of x = 9. A genetic linkage map of the species Physocarpus opulifolius (x = 9) was populated with sequence characterised SNP markers using genotyping by sequencing. This allowed for the first time, the extent of the genome diversification of a Rosaceous genus with a base chromosome number of x = 9 to be performed. Orthologous loci distributed throughout the nine chromosomes of Physocarpus and the eight chromosomes of Prunus were identified which permitted a meaningful comparison of the genomes of these two genera to be made. The study revealed a high level of macro-synteny between the two genomes, and relatively few chromosomal rearrangements, as has been observed in studies of other Rosaceous genomes, lending further support for a relatively simple model of genomic evolution in Rosaceae.
Intra-species sequence comparisons for annotating genomes
Energy Technology Data Exchange (ETDEWEB)
Boffelli, Dario; Weer, Claire V.; Weng, Li; Lewis, Keith D.; Shoukry, Malak I.; Pachter, Lior; Keys, David N.; Rubin, Edward M.
2004-07-15
Analysis of sequence variation among members of a single species offers a potential approach to identify functional DNA elements responsible for biological features unique to that species. Due to its high rate of allelic polymorphism and ease of genetic manipulability, we chose the sea squirt, Ciona intestinalis, to explore intra-species sequence comparisons for genome annotation. A large number of C. intestinalis specimens were collected from four continents and a set of genomic intervals amplified, resequenced and analyzed to determine the mutation rates at each nucleotide in the sequence. We found that regions with low mutation rates efficiently demarcated functionally constrained sequences: these include a set of noncoding elements, which we showed in C intestinalis transgenic assays to act as tissue-specific enhancers, as well as the location of coding sequences. This illustrates that comparisons of multiple members of a species can be used for genome annotation, suggesting a path for the annotation of the sequenced genomes of organisms occupying uncharacterized phylogenetic branches of the animal kingdom and raises the possibility that the resequencing of a large number of Homo sapiens individuals might be used to annotate the human genome and identify sequences defining traits unique to our species. The sequence data from this study has been submitted to GenBank under accession nos. AY667278-AY667407.
Genetic diversity studies in pea (Pisum sativum L.) using simple sequence repeat markers.
Kumari, P; Basal, N; Singh, A K; Rai, V P; Srivastava, C P; Singh, P K
2013-03-13
The genetic diversity among 28 pea (Pisum sativum L.) genotypes was analyzed using 32 simple sequence repeat markers. A total of 44 polymorphic bands, with an average of 2.1 bands per primer, were obtained. The polymorphism information content ranged from 0.657 to 0.309 with an average of 0.493. The variation in genetic diversity among these cultivars ranged from 0.11 to 0.73. Cluster analysis based on Jaccard's similarity coefficient using the unweighted pair-group method with arithmetic mean (UPGMA) revealed 2 distinct clusters, I and II, comprising 6 and 22 genotypes, respectively. Cluster II was further differentiated into 2 subclusters, IIA and IIB, with 12 and 10 genotypes, respectively. Principal component (PC) analysis revealed results similar to those of UPGMA. The first, second, and third PCs contributed 21.6, 16.1, and 14.0% of the variation, respectively; cumulative variation of the first 3 PCs was 51.7%.
Baldwin, Philip R; Curtis, Kaylah N; Patriquin, Michelle A; Wolf, Varina; Viswanath, Humsini; Shaw, Chad; Sakai, Yasunari; Salas, Ramiro
2016-05-01
Exome sequencing and copy number variation analyses continue to provide novel insight to the biological bases of autism spectrum disorder (ASD). The growing speed at which massive genetic data are produced causes serious lags in analysis and interpretation of the data. Thus, there is a need to develop systematic genetic data mining processes that facilitate efficient analysis of large datasets. We report a new genetic data mining system, ProcessGeneLists and integrated a list of ASD-related genes with currently available resources in gene expression and functional connectivity of the human brain. Our data-mining program successfully identified three primary regions of interest (ROIs) in the mouse brain: inferior colliculus, ventral posterior complex of the thalamus (VPC), and parafascicular nucleus (PFn). To understand its pathogenic relevance in ASD, we examined the resting state functional connectivity (RSFC) of the homologous ROIs in human brain with other brain regions that were previously implicated in the neuro-psychiatric features of ASD. Among them, the RSFC of the VPC with the medial frontal gyrus (MFG) was significantly more anticorrelated, whereas the RSFC of the PN with the globus pallidus was significantly increased in children with ASD compared with healthy children. Moreover, greater values of RSFC between VPC and MFG were correlated with severity index and repetitive behaviors in children with ASD. No significant RSFC differences were detected in adults with ASD. Together, these data demonstrate the utility of our data-mining program through identifying the aberrant connectivity of thalamo-cortical circuits in children with ASD. Autism Res 2016, 9: 553-562. © 2015 International Society for Autism Research, Wiley Periodicals, Inc. © 2015 International Society for Autism Research, Wiley Periodicals, Inc.
Genetic Modifiers of Sickle Cell Disease
Steinberg, Martin H.; Sebastiani, Paola
2015-01-01
Sickle cell anemia is associated with unusual clinical heterogeneity for a Mendelian disorder. Fetal hemoglobin concentration and coincident ∝ thalassemia, both which directly affect the sickle erythrocyte, are the major modulators of the phenotype of disease. Understanding the genetics underlying the heritable subphenotypes of sickle cell anemia would be prognostically useful, could inform personalized therapeutics, and might help the discovery of new “druggable” pathophysiologic targets. Genotype-phenotype association studies have been used to identify novel genetic modifiers. In the future, whole genome sequencing with its promise of discovering hitherto unsuspected variants could add to our understanding of the genetic modifiers of this disease. PMID:22641398
Beaumont, R.N. (Robin N.); N.M. Warrington (Nicole); A. Cavadino (Alana); A.W.R. Tyrrell; M. Nodzenski (Michael); M. Horikoshi (Momoko); F. Geller (Frank); R. Myhre (Ronny); R.C. Richmond (Rebecca C.); Paternoster, L. (Lavinia); J.P. Bradfield (Jonathan); E. Kreiner-Møller (Eskil); V. Huikari (Ville); S. Metrustry (Sarah); K.L. Lunetta (Kathryn); J.N. Painter (Jodie N.); J.J. Hottenga (Jouke Jan); C. Allard (Catherine); S.J. Barton (Sheila J.); Espinosa, A. (Ana); J.A. Marsh (Julie); C. Potter (Catherine); Zhang, G. (Ge); W.Q. Ang (Wei); D. Berry (Diane); L. Bouchard (Luigi); S. Das (Shikta); H. Hakonarson (Hakon); J. Heikkinen (Jani); Helgeland, Ø. (Øyvind); B. Hocher (Berthold); A. Hofman (Albert); H.M. Inskip (Hazel); S.E. Jones (Samuel E.); M. Kogevinas (Manolis); P.A. Lind (Penelope); L. Marullo (Letizia); S.E. Medland (Sarah Elizabeth); Murray, A. (Anna); Murray, J.C. (Jeffrey C.); Njølstad, P.R. (Pa l R.); C. Nohr (Christian); C. Reichetzeder (Christoph); S.M. Ring (Susan); K.S. Ruth (Katherine S.); L. Santa-Marina (Loreto); D.M. Scholtens (Denise M.); Sebert, S. (Sylvain); V. Sengpiel (Verena); Tuke, M.A. (Marcus A.); Vaudel, M. (Marc); M.N. Weedon (Michael); G.A.H.M. Willemsen (Gonneke); Wood, A.R. (Andrew R.); Yaghootkar, H. (Hanieh); Muglia, L.J. (Louis J.); M. Bartels (Meike); C.L. Relton (Caroline); C.E. Pennell (Craig); L. Chatzi (Leda); Estivill, X. (Xavier); Holloway, J.W. (John W.); D.I. Boomsma (Dorret); Montgomery, G.W. (Grant W.); J. Murabito (Joanne); T.D. Spector (Timothy); Power, C. (Christine); Järvelin, M.-R. (Marjo-Ritta); Bisgaard, H. (Hans); Grant, S.F.A. (Struan F.A.); Sørensen, T.I.A. (Thorkild I.A.); Jaddoe, V.W. (Vincent W.); B. Jacobsson (Bo); Melbye, M. (Mads); McCarthy, M.I. (Mark I.); A.T. Hattersley (Andrew); Hayes, M.G. (M. Geoffrey); T.M. Frayling (Timothy); M.-F. Hivert (Marie-France); J.F. Felix (Janine); Hyppönen, E. (Elina); Lowe, W.L. (William L.); Evans, D.M. (David M.); Lawlor, D.A. (Debbie A.); B. Feenstra (Bjarke); R.M. Freathy (Rachel)
2018-01-01
textabstractGenome-wide association studies of birth weight have focused on fetal genetics, whereas relatively little is known about the role of maternal genetic variation. We aimed to identify maternal genetic variants associated with birth weight that could highlight potentially relevant maternal
Giampietro, Philip F; Armstrong, Linlea; Stoddard, Alex; Blank, Robert D; Livingston, Janet; Raggio, Cathy L; Rasmussen, Kristen; Pickart, Michael; Lorier, Rachel; Turner, Amy; Sund, Sarah; Sobrera, Nara; Neptune, Enid; Sweetser, David; Santiago-Cornier, Alberto; Broeckel, Ulrich
2015-01-01
We report on a father and his two daughters diagnosed with Klippel-Feil syndrome (KFS) but with craniofacial differences (zygomatic and mandibular hypoplasia and cleft palate) and external ear abnormalities suggestive of Treacher Collins syndrome (TCS). The diagnosis of KFS was favored, given that the neck anomalies were the predominant manifestations, and that the diagnosis predated later recognition of the association between spinal segmentation abnormalities and TCS. Genetic heterogeneity and the rarity of large families with KFS have limited the ability to identify mutations by traditional methods. Whole exome sequencing identified a nonsynonymous mutation in POLR1D (subunit of RNA polymerase I and II): exon2:c.T332C:p.L111P. Mutations in POLR1D are present in about 5% of individuals diagnosed with TCS. We propose that this mutation is causal in this family, suggesting a pathogenetic link between KFS and TCS. © 2014 Wiley Periodicals, Inc.
Xu, Dongdong; Li, Sanlei; Lou, Bao; Zhang, Yurong; Zhan, Wei; Shi, Huilai
2012-07-01
Japanese flounder is one of the most important commercial species in China; however, information on the genetic background of natural populations in China seas is scarce. The lack of genetic data has hampered fishery management and aquaculture development programs for this species. In the present study, we have analyzed the genetic diversity in natural populations of Japanese flounder sampled from the Yellow Sea (Qingdao population, QD) and East China Sea (Zhoushan population, ZS) using 10 polymorphic microsatellite loci and cytochrome c oxidase subunit I (COI) sequencing data. A total of 68 different alleles were observed over 10 microsatellite loci. The total number of alleles per locus ranged from 2 to 9, and the number of genotypes per locus ranged from 3 to 45. The observed heterozygosity and expected heterozygosity in QD were 0.733 and 0.779, respectively, and in ZS the heterozygosity values were 0.708 and 0.783, respectively. Significant departures from Hardy-Weinberg equilibrium were observed in 7 of the 10 microsatellite loci in each of the two populations. The COI sequencing analysis revealed 25 polymorphic sites and 15 haplotypes in the two populations. The haplotype diversity and nucleotide diversity in the QD population were 0.746±0.072 8 and 0.003 34±0.001 03 respectively, and in ZS population the genetic diversity values were 0.712±0.047 0 and 0.003 18±0.000 49, respectively. The microsatellite data ( F st =0.048 7, P <0.001) and mitochondrial DNA data ( F st =0.128, P <0.001) both revealed significant genetic differentiation between the two populations. The information on the genetic variation and differentiation in Japanese flounder obtained in this study could be used to set up suitable guidelines for the management and conservation of this species, as well as for managing artificial selection programs. In future studies, more geographically diverse stocks should be used to obtain a deeper understanding of the population structure of Japanese
Regularized rare variant enrichment analysis for case-control exome sequencing data.
Larson, Nicholas B; Schaid, Daniel J
2014-02-01
Rare variants have recently garnered an immense amount of attention in genetic association analysis. However, unlike methods traditionally used for single marker analysis in GWAS, rare variant analysis often requires some method of aggregation, since single marker approaches are poorly powered for typical sequencing study sample sizes. Advancements in sequencing technologies have rendered next-generation sequencing platforms a realistic alternative to traditional genotyping arrays. Exome sequencing in particular not only provides base-level resolution of genetic coding regions, but also a natural paradigm for aggregation via genes and exons. Here, we propose the use of penalized regression in combination with variant aggregation measures to identify rare variant enrichment in exome sequencing data. In contrast to marginal gene-level testing, we simultaneously evaluate the effects of rare variants in multiple genes, focusing on gene-based least absolute shrinkage and selection operator (LASSO) and exon-based sparse group LASSO models. By using gene membership as a grouping variable, the sparse group LASSO can be used as a gene-centric analysis of rare variants while also providing a penalized approach toward identifying specific regions of interest. We apply extensive simulations to evaluate the performance of these approaches with respect to specificity and sensitivity, comparing these results to multiple competing marginal testing methods. Finally, we discuss our findings and outline future research. © 2013 WILEY PERIODICALS, INC.
Ramos, Antonio M.; Crooijmans, Richard P. M. A.; Affara, Nabeel A.; Amaral, Andreia J.; Archibald, Alan L.; Beever, Jonathan E.; Bendixen, Christian; Churcher, Carol; Clark, Richard; Dehais, Patrick; Hansen, Mark S.; Hedegaard, Jakob; Hu, Zhi-Liang; Kerstens, Hindrik H.; Law, Andy S.; Megens, Hendrik-Jan; Milan, Denis; Nonneman, Danny J.; Rohrer, Gary A.; Rothschild, Max F.; Smith, Tim P. L.; Schnabel, Robert D.; Van Tassell, Curt P.; Taylor, Jeremy F.; Wiedmann, Ralph T.; Schook, Lawrence B.; Groenen, Martien A. M.
2009-01-01
Background The dissection of complex traits of economic importance to the pig industry requires the availability of a significant number of genetic markers, such as single nucleotide polymorphisms (SNPs). This study was conducted to discover several hundreds of thousands of porcine SNPs using next generation sequencing technologies and use these SNPs, as well as others from different public sources, to design a high-density SNP genotyping assay. Methodology/Principal Findings A total of 19 reduced representation libraries derived from four swine breeds (Duroc, Landrace, Large White, Pietrain) and a Wild Boar population and three restriction enzymes (AluI, HaeIII and MspI) were sequenced using Illumina's Genome Analyzer (GA). The SNP discovery effort resulted in the de novo identification of over 372K SNPs. More than 549K SNPs were used to design the Illumina Porcine 60K+SNP iSelect Beadchip, now commercially available as the PorcineSNP60. A total of 64,232 SNPs were included on the Beadchip. Results from genotyping the 158 individuals used for sequencing showed a high overall SNP call rate (97.5%). Of the 62,621 loci that could be reliably scored, 58,994 were polymorphic yielding a SNP conversion success rate of 94%. The average minor allele frequency (MAF) for all scorable SNPs was 0.274. Conclusions/Significance Overall, the results of this study indicate the utility of using next generation sequencing technologies to identify large numbers of reliable SNPs. In addition, the validation of the PorcineSNP60 Beadchip demonstrated that the assay is an excellent tool that will likely be used in a variety of future studies in pigs. PMID:19654876
The genome sequence of a widespread apex Predator, the golden eagle (Aquila chrysaetos)
Jacqueline M. Doyle; Todd E. Katzner; Peter H. Bloom; Yanzhu Ji; Bhagya K. Wijayawardena; J. Andrew DeWoody; Ludovic. Orlando
2014-01-01
Biologists routinely use molecular markers to identify conservation units, to quantify genetic connectivity, to estimate population sizes, and to identify targets of selection. Many imperiled eagle populations require such efforts and would benefit from enhanced genomic resources. We sequenced, assembled, and annotated the first eagle genome using DNA from a male...
Sequence-length variation of mtDNA HVS-I C-stretch in Chinese ethnic groups.
Chen, Feng; Dang, Yong-hui; Yan, Chun-xia; Liu, Yan-ling; Deng, Ya-jun; Fulton, David J R; Chen, Teng
2009-10-01
The purpose of this study was to investigate mitochondrial DNA (mtDNA) hypervariable segment-I (HVS-I) C-stretch variations and explore the significance of these variations in forensic and population genetics studies. The C-stretch sequence variation was studied in 919 unrelated individuals from 8 Chinese ethnic groups using both direct and clone sequencing approaches. Thirty eight C-stretch haplotypes were identified, and some novel and population specific haplotypes were also detected. The C-stretch genetic diversity (GD) values were relatively high, and probability (P) values were low. Additionally, C-stretch length heteroplasmy was observed in approximately 9% of individuals studied. There was a significant correlation (r=-0.961, Ppopulations. The results from the Fst and dA genetic distance matrix, neighbor-joining tree, and principal component map also suggest that C-stretch could be used as a reliable genetic marker in population genetics.
A complete mitochondrial genome sequence from a mesolithic wild aurochs (Bos primigenius.
Directory of Open Access Journals (Sweden)
Ceiridwen J Edwards
Full Text Available BACKGROUND: The derivation of domestic cattle from the extinct wild aurochs (Bos primigenius has been well-documented by archaeological and genetic studies. Genetic studies point towards the Neolithic Near East as the centre of origin for Bos taurus, with some lines of evidence suggesting possible, albeit rare, genetic contributions from locally domesticated wild aurochsen across Eurasia. Inferences from these investigations have been based largely on the analysis of partial mitochondrial DNA sequences generated from modern animals, with limited sequence data from ancient aurochsen samples. Recent developments in DNA sequencing technologies, however, are affording new opportunities for the examination of genetic material retrieved from extinct species, providing new insight into their evolutionary history. Here we present DNA sequence analysis of the first complete mitochondrial genome (16,338 base pairs from an archaeologically-verified and exceptionally-well preserved aurochs bone sample. METHODOLOGY: DNA extracts were generated from an aurochs humerus bone sample recovered from a cave site located in Derbyshire, England and radiocarbon-dated to 6,738+/-68 calibrated years before present. These extracts were prepared for both Sanger and next generation DNA sequencing technologies (Illumina Genome Analyzer. In total, 289.9 megabases (22.48% of the post-filtered DNA sequences generated using the Illumina Genome Analyzer from this sample mapped with confidence to the bovine genome. A consensus B. primigenius mitochondrial genome sequence was constructed and was analysed alongside all available complete bovine mitochondrial genome sequences. CONCLUSIONS: For all nucleotide positions where both Sanger and Illumina Genome Analyzer sequencing methods gave high-confidence calls, no discrepancies were observed. Sequence analysis reveals evidence of heteroplasmy in this sample and places this mitochondrial genome sequence securely within a previously
A complete mitochondrial genome sequence from a mesolithic wild aurochs (Bos primigenius).
LENUS (Irish Health Repository)
Edwards, Ceiridwen J
2010-01-01
BACKGROUND: The derivation of domestic cattle from the extinct wild aurochs (Bos primigenius) has been well-documented by archaeological and genetic studies. Genetic studies point towards the Neolithic Near East as the centre of origin for Bos taurus, with some lines of evidence suggesting possible, albeit rare, genetic contributions from locally domesticated wild aurochsen across Eurasia. Inferences from these investigations have been based largely on the analysis of partial mitochondrial DNA sequences generated from modern animals, with limited sequence data from ancient aurochsen samples. Recent developments in DNA sequencing technologies, however, are affording new opportunities for the examination of genetic material retrieved from extinct species, providing new insight into their evolutionary history. Here we present DNA sequence analysis of the first complete mitochondrial genome (16,338 base pairs) from an archaeologically-verified and exceptionally-well preserved aurochs bone sample. METHODOLOGY: DNA extracts were generated from an aurochs humerus bone sample recovered from a cave site located in Derbyshire, England and radiocarbon-dated to 6,738+\\/-68 calibrated years before present. These extracts were prepared for both Sanger and next generation DNA sequencing technologies (Illumina Genome Analyzer). In total, 289.9 megabases (22.48%) of the post-filtered DNA sequences generated using the Illumina Genome Analyzer from this sample mapped with confidence to the bovine genome. A consensus B. primigenius mitochondrial genome sequence was constructed and was analysed alongside all available complete bovine mitochondrial genome sequences. CONCLUSIONS: For all nucleotide positions where both Sanger and Illumina Genome Analyzer sequencing methods gave high-confidence calls, no discrepancies were observed. Sequence analysis reveals evidence of heteroplasmy in this sample and places this mitochondrial genome sequence securely within a previously identified
Exploring genetic suppression interactions on a global scale.
van Leeuwen, Jolanda; Pons, Carles; Mellor, Joseph C; Yamaguchi, Takafumi N; Friesen, Helena; Koschwanez, John; Ušaj, Mojca Mattiazzi; Pechlaner, Maria; Takar, Mehmet; Ušaj, Matej; VanderSluis, Benjamin; Andrusiak, Kerry; Bansal, Pritpal; Baryshnikova, Anastasia; Boone, Claire E; Cao, Jessica; Cote, Atina; Gebbia, Marinella; Horecka, Gene; Horecka, Ira; Kuzmin, Elena; Legro, Nicole; Liang, Wendy; van Lieshout, Natascha; McNee, Margaret; San Luis, Bryan-Joseph; Shaeri, Fatemeh; Shuteriqi, Ermira; Sun, Song; Yang, Lu; Youn, Ji-Young; Yuen, Michael; Costanzo, Michael; Gingras, Anne-Claude; Aloy, Patrick; Oostenbrink, Chris; Murray, Andrew; Graham, Todd R; Myers, Chad L; Andrews, Brenda J; Roth, Frederick P; Boone, Charles
2016-11-04
Genetic suppression occurs when the phenotypic defects caused by a mutation in a particular gene are rescued by a mutation in a second gene. To explore the principles of genetic suppression, we examined both literature-curated and unbiased experimental data, involving systematic genetic mapping and whole-genome sequencing, to generate a large-scale suppression network among yeast genes. Most suppression pairs identified novel relationships among functionally related genes, providing new insights into the functional wiring diagram of the cell. In addition to suppressor mutations, we identified frequent secondary mutations,in a subset of genes, that likely cause a delay in the onset of stationary phase, which appears to promote their enrichment within a propagating population. These findings allow us to formulate and quantify general mechanisms of genetic suppression. Copyright © 2016, American Association for the Advancement of Science.
Next-generation sequencing technology for genetics and genomics of sorghum
DEFF Research Database (Denmark)
Luo, Hong; Mocoeur, Anne Raymonde Joelle; Jing, Hai-Chun
2014-01-01
and grain sorghum. NGS has also been used to examine the transcriptomes of sorghum under various stress conditions. Besides identifying interesting transcriptonal adpatation to stress conditions, these study show that sugar could potentially act as an osmitic adjusting factor via transcriptional regulation....... Furthermore, miRNAs are found to be important adaptation to both biotic and abiotic stresses in sorghum. We discuss the use of NGS for further genetic improvement and breeding in sorghum....
2012-01-01
Background Usher syndrome (USH) is an autosomal recessive genetically heterogeneous disorder with congenital sensorineural hearing impairment and retinitis pigmentosa (RP). We have identified a consanguineous Lebanese family with two affected members displaying progressive hearing loss, RP and cataracts, therefore clinically diagnosed as USH type 3 (USH3). Our study was aimed at the identification of the causative mutation in this USH3-like family. Methods Candidate loci were identified using genomewide SNP-array-based homozygosity mapping followed by targeted enrichment and next-generation sequencing. Results Using a capture array targeting the three identified homozygosity-by-descent regions on chromosomes 1q43-q44, 20p13-p12.2 and 20p11.23-q12, we identified a homozygous nonsense mutation, p.Arg65X, in ABHD12 segregating with the phenotype. Conclusion Mutations of ABHD12, an enzyme hydrolyzing an endocannabinoid lipid transmitter, cause PHARC (polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and early-onset cataract). After the identification of the ABHD12 mutation in this family, one patient underwent neurological examination which revealed ataxia, but no polyneuropathy. ABHD12 is not known to be related to the USH protein interactome. The phenotype of our patient represents a variant of PHARC, an entity that should be taken into account as differential diagnosis for USH3. Our study demonstrates the potential of comprehensive genetic analysis for improving the clinical diagnosis. PMID:22938382
Directory of Open Access Journals (Sweden)
Eisenberger Tobias
2012-09-01
Full Text Available Abstract Background Usher syndrome (USH is an autosomal recessive genetically heterogeneous disorder with congenital sensorineural hearing impairment and retinitis pigmentosa (RP. We have identified a consanguineous Lebanese family with two affected members displaying progressive hearing loss, RP and cataracts, therefore clinically diagnosed as USH type 3 (USH3. Our study was aimed at the identification of the causative mutation in this USH3-like family. Methods Candidate loci were identified using genomewide SNP-array-based homozygosity mapping followed by targeted enrichment and next-generation sequencing. Results Using a capture array targeting the three identified homozygosity-by-descent regions on chromosomes 1q43-q44, 20p13-p12.2 and 20p11.23-q12, we identified a homozygous nonsense mutation, p.Arg65X, in ABHD12 segregating with the phenotype. Conclusion Mutations of ABHD12, an enzyme hydrolyzing an endocannabinoid lipid transmitter, cause PHARC (polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and early-onset cataract. After the identification of the ABHD12 mutation in this family, one patient underwent neurological examination which revealed ataxia, but no polyneuropathy. ABHD12 is not known to be related to the USH protein interactome. The phenotype of our patient represents a variant of PHARC, an entity that should be taken into account as differential diagnosis for USH3. Our study demonstrates the potential of comprehensive genetic analysis for improving the clinical diagnosis.
Flanking sequence determination and event-specific detection of genetically modified wheat B73-6-1.
Xu, Junyi; Cao, Jijuan; Cao, Dongmei; Zhao, Tongtong; Huang, Xin; Zhang, Piqiao; Luan, Fengxia
2013-05-01
In order to establish a specific identification method for genetically modified (GM) wheat, exogenous insert DNA and flanking sequence between exogenous fragment and recombinant chromosome of GM wheat B73-6-1 were successfully acquired by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. Newly acquired exogenous fragment covered the full-length sequence of transformed genes such as transformed plasmid and corresponding functional genes including marker uidA, herbicide-resistant bar, ubiquitin promoter, and high-molecular-weight gluten subunit. The flanking sequence between insert DNA revealed high similarity with Triticum turgidum A gene (GenBank: AY494981.1). A specific PCR detection method for GM wheat B73-6-1 was established on the basis of primers designed according to the flanking sequence. This specific PCR method was validated by GM wheat, GM corn, GM soybean, GM rice, and non-GM wheat. The specifically amplified target band was observed only in GM wheat B73-6-1. This method is of high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of GM wheat B73-6-1.
Directory of Open Access Journals (Sweden)
Qin Ping Zhao
Full Text Available BACKGROUND: Oncomelania hupensis is the unique intermediate host of Schistosoma japonicum, which causes schistosomiasis endemic in the Far East, and especially in mainland China. O. hupensis largely determines the parasite's geographical range. How O. hupensis's genetic diversity is distributed geographically in mainland China has never been well examined with DNA sequence data. METHODOLOGY/PRINCIPAL FINDINGS: In this study we investigate the genetic variation among O. hupensis from different geographical origins using the combined complete internal transcribed spacer 1 (ITS1 and ITS2 regions of nuclear ribosomal DNA. 165 O. hupensis isolates were obtained in 29 localities from 7 provinces across mainland China: lake/marshland and hill regions in Anhui, Hubei, Hunan, Jiangxi and Jiangsu provinces, located along the middle and lower reaches of Yangtze River, and mountainous regions in Sichuan and Yunnan provinces. Phylogenetic and haplotype network analyses showed distinct genetic diversity and no shared haplotypes between populations from lake/marshland regions of the middle and lower reaches of the Yangtze River and populations from mountainous regions of Sichuan and Yunnan provinces. The genetic distance between these two groups is up to 0.81 based on Fst, and branch time was estimated as 2-6 Ma. As revealed in the phylogenetic tree, snails from Sichuan and Yunnan provinces were also clustered separately. Geographical separation appears to be an important factor accounting for the diversification of the two groups of O. hupensis in mainland China, and probably for the separate clades between snails from Sichuan and Yunnan provinces. In lake/marshland and hill regions along the middle and lower reaches of the Yangtze River, three clades were identified in the phylogenetic tree, but without any obvious clustering of snails from different provinces. CONCLUSIONS: O. hupensis in mainland China may have considerable genetic diversity, and a more
Directory of Open Access Journals (Sweden)
Ratan Chopra
2016-12-01
Full Text Available To test the hypothesis that the cultivated peanut species possesses almost no molecular variability, we sequenced a diverse panel of 22 Arachis accessions representing Arachis hypogaea botanical classes, A-, B-, and K- genome diploids, a synthetic amphidiploid, and a tetraploid wild species. RNASeq was performed on pools of three tissues, and de novo assembly was performed. Realignment of individual accession reads to transcripts of the cultivar OLin identified 306,820 biallelic SNPs. Among 10 naturally occurring tetraploid accessions, 40,382 unique homozygous SNPs were identified in 14,719 contigs. In eight diploid accessions, 291,115 unique SNPs were identified in 26,320 contigs. The average SNP rate among the 10 cultivated tetraploids was 0.5, and among eight diploids was 9.2 per 1000 bp. Diversity analysis indicated grouping of diploids according to genome classification, and cultivated tetraploids by subspecies. Cluster analysis of variants indicated that sequences of B genome species were the most similar to the tetraploids, and the next closest diploid accession belonged to the A genome species. A subset of 66 SNPs selected from the dataset was validated; of 782 SNP calls, 636 (81.32% were confirmed using an allele-specific discrimination assay. We conclude that substantial genetic variability exists among wild species. Additionally, significant but lesser variability at the molecular level occurs among accessions of the cultivated species. This survey is the first to report significant SNP level diversity among transcripts, and may explain some of the phenotypic differences observed in germplasm surveys. Understanding SNP variants in the Arachis accessions will benefit in developing markers for selection.
Cousseau, L; Husemann, M; Foppen, R; Vangestel, C; Lens, L
2016-01-01
Dutch house sparrow (Passer domesticus) densities dropped by nearly 50% since the early 1980s, and similar collapses in population sizes have been reported across Europe. Whether, and to what extent, such relatively recent demographic changes are accompanied by concomitant shifts in the genetic population structure of this species needs further investigation. Therefore, we here explore temporal shifts in genetic diversity, genetic structure and effective sizes of seven Dutch house sparrow populations. To allow the most powerful statistical inference, historical populations were resampled at identical locations and each individual bird was genotyped using nine polymorphic microsatellites. Although the demographic history was not reflected by a reduction in genetic diversity, levels of genetic differentiation increased over time, and the original, panmictic population (inferred from the museum samples) diverged into two distinct genetic clusters. Reductions in census size were supported by a substantial reduction in effective population size, although to a smaller extent. As most studies of contemporary house sparrow populations have been unable to identify genetic signatures of recent population declines, results of this study underpin the importance of longitudinal genetic surveys to unravel cryptic genetic patterns. PMID:27273323
Bioinformatics analysis and genetic diversity of the poliovirus.
Liu, Yanhan; Ma, Tengfei; Liu, Jianzhu; Zhao, Xiaona; Cheng, Ziqiang; Guo, Huijun; Wang, Shujing; Xu, Ruixue
2014-12-01
Poliomyelitis, a disease which can manifest as muscle paralysis, is caused by the poliovirus, which is a human enterovirus and member of the family Picornaviridae that usually transmits by the faecal-oral route. The viruses of the OPV (oral poliovirus attenuated-live vaccine) strains can mutate in the human intestine during replication and some of these mutations can lead to the recovery of serious neurovirulence. Informatics research of the poliovirus genome can be used to explain further the characteristics of this virus. In this study, sequences from 100 poliovirus isolates were acquired from GenBank. To determine the evolutionary relationship between the strains, we compared and analysed the sequences of the complete poliovirus genome and the VP1 region. The reconstructed phylogenetic trees for the complete sequences and the VP1 sequences were both divided into two branches, indicating that the genetic relationships of the whole poliovirus genome and the VP1 sequences are very similar. This branching indicates that the virulence and pathogenicity of poliomyelitis may be associated with the VP1 region. Sequence alignment of the VP1 region revealed numerous mutation sites in which mutation rates of >30 % were detected. In a group of strains recorded in the USA, mutation sites and mutation types were the same and this may be associated with their distribution in the evolutionary tree and their genetic relationship. In conclusion, the genetic evolutionary relationships of poliovirus isolate sequences are determined to a great extent by the VP1 protein, and poliovirus strains located on the same branch of the phylogenetic tree contain the same mutation spots and mutation types. Hence, the genetic characteristics of the VP1 region in the poliovirus genome should be analysed to identify the transmission route of poliovirus and provide the basis of viral immunity development. © 2014 The Authors.
Ge, Y; Li, X; Yang, X X; Cui, C S; Qu, S P
2015-05-22
Cucurbita maxima is one of the most widely cultivated vegetables in China and exhibits distinct morphological characteristics. In this study, genetic linkage analysis with 57 simple-sequence repeats, 21 amplified fragment length polymorphisms, 3 random-amplified polymorphic DNA, and one morphological marker revealed 20 genetic linkage groups of C. maxima covering a genetic distance of 991.5 cM with an average of 12.1 cM between adjacent markers. Genetic linkage analysis identified the simple-sequence repeat marker 'PU078072' 5.9 cM away from the locus 'Rc', which controls rind color. The genetic map in the present study will be useful for better mapping, tagging, and cloning of quantitative trait loci/gene(s) affecting economically important traits and for breeding new varieties of C. maxima through marker-assisted selection.
Siew, Ging Yang; Ng, Wei Lun; Tan, Sheau Wei; Alitheen, Noorjahan Banu; Tan, Soon Guan; Yeap, Swee Keong
2018-01-01
Durian ( Durio zibethinus ) is one of the most popular tropical fruits in Asia. To date, 126 durian types have been registered with the Department of Agriculture in Malaysia based on phenotypic characteristics. Classification based on morphology is convenient, easy, and fast but it suffers from phenotypic plasticity as a direct result of environmental factors and age. To overcome the limitation of morphological classification, there is a need to carry out genetic characterization of the various durian types. Such data is important for the evaluation and management of durian genetic resources in producing countries. In this study, simple sequence repeat (SSR) markers were used to study the genetic variation in 27 durian types from the germplasm collection of Universiti Putra Malaysia. Based on DNA sequences deposited in Genbank, seven pairs of primers were successfully designed to amplify SSR regions in the durian DNA samples. High levels of variation among the 27 durian types were observed (expected heterozygosity, H E = 0.35). The DNA fingerprinting power of SSR markers revealed by the combined probability of identity (PI) of all loci was 2.3×10 -3 . Unique DNA fingerprints were generated for 21 out of 27 durian types using five polymorphic SSR markers (the other two SSR markers were monomorphic). We further tested the utility of these markers by evaluating the clonal status of shared durian types from different germplasm collection sites, and found that some were not clones. The findings in this preliminary study not only shows the feasibility of using SSR markers for DNA fingerprinting of durian types, but also challenges the current classification of durian types, e.g., on whether the different types should be called "clones", "varieties", or "cultivars". Such matters have a direct impact on the regulation and management of durian genetic resources in the region.
Goudie, Catherine; Coltin, Hallie; Witkowski, Leora; Mourad, Stephanie; Malkin, David; Foulkes, William D
2017-08-01
Identifying cancer predisposition syndromes in children with tumors is crucial, yet few clinical guidelines exist to identify children at high risk of having germline mutations. The McGill Interactive Pediatric OncoGenetic Guidelines project aims to create a validated pediatric guideline in the form of a smartphone/tablet application using algorithms to process clinical data and help determine whether to refer a child for genetic assessment. This paper discusses the initial stages of the project, focusing on its overall structure, the methodology underpinning the algorithms, and the upcoming algorithm validation process. © 2017 Wiley Periodicals, Inc.
Mutation Detection in Patients with Retinal Dystrophies Using Targeted Next Generation Sequencing.
Directory of Open Access Journals (Sweden)
Nicole Weisschuh
Full Text Available Retinal dystrophies (RD constitute a group of blinding diseases that are characterized by clinical variability and pronounced genetic heterogeneity. The different nonsyndromic and syndromic forms of RD can be attributed to mutations in more than 200 genes. Consequently, next generation sequencing (NGS technologies are among the most promising approaches to identify mutations in RD. We screened a large cohort of patients comprising 89 independent cases and families with various subforms of RD applying different NGS platforms. While mutation screening in 50 cases was performed using a RD gene capture panel, 47 cases were analyzed using whole exome sequencing. One family was analyzed using whole genome sequencing. A detection rate of 61% was achieved including mutations in 34 known and two novel RD genes. A total of 69 distinct mutations were identified, including 39 novel mutations. Notably, genetic findings in several families were not consistent with the initial clinical diagnosis. Clinical reassessment resulted in refinement of the clinical diagnosis in some of these families and confirmed the broad clinical spectrum associated with mutations in RD genes.