
Sample records for identify duplicate references

  1. Identifying Tracks Duplicates via Neural Network

    CERN Document Server

    Sunjerga, Antonio; CERN. Geneva. EP Department


    The goal of the project is to study feasibility of state of the art machine learning techniques in track reconstruction. Machine learning techniques provide promising ways to speed up the pattern recognition of tracks by adding more intelligence in the algorithms. Implementation of neural network to process of track duplicates identifying will be discussed. Different approaches are shown and results are compared to method that is currently in use.

  2. Genetics Home Reference: 17q12 duplication (United States)

    ... J, Li C, Roeder E, Cox S, Karaviti L, Pearson M, Kang SH, Sahoo T, Lalani SR, Stankiewicz ... genomic disorders from the duplication architecture of the human genome. Nat Genet. 2006 Sep;38(9):1038- ...

  3. Genetics Home Reference: 7q11.23 duplication syndrome (United States)

    ... Duplication Syndrome. 2015 Nov 25. In: Pagon RA, Adam MP, Ardinger HH, Wallace SE, Amemiya A, Bean LJH, Bird TD, Ledbetter N, Mefford HC, Smith RJH, Stephens K, editors. GeneReviews® [Internet]. Seattle (WA): ...

  4. Exploiting a Reference Genome in Terms of Duplications: The Network of Paralogs and Single Copy Genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Mara Sangiovanni


    Full Text Available Arabidopsis thaliana became the model organism for plant studies because of its small diploid genome, rapid lifecycle and short adult size. Its genome was the first among plants to be sequenced, becoming the reference in plant genomics. However, the Arabidopsis genome is characterized by an inherently complex organization, since it has undergone ancient whole genome duplications, followed by gene reduction, diploidization events and extended rearrangements, which relocated and split up the retained portions. These events, together with probable chromosome reductions, dramatically increased the genome complexity, limiting its role as a reference. The identification of paralogs and single copy genes within a highly duplicated genome is a prerequisite to understand its organization and evolution and to improve its exploitation in comparative genomics. This is still controversial, even in the widely studied Arabidopsis genome. This is also due to the lack of a reference bioinformatics pipeline that could exhaustively identify paralogs and singleton genes. We describe here a complete computational strategy to detect both duplicated and single copy genes in a genome, discussing all the methodological issues that may strongly affect the results, their quality and their reliability. This approach was used to analyze the organization of Arabidopsis nuclear protein coding genes, and besides classifying computationally defined paralogs into networks and single copy genes into different classes, it unraveled further intriguing aspects concerning the genome annotation and the gene relationships in this reference plant species. Since our results may be useful for comparative genomics and genome functional analyses, we organized a dedicated web interface to make them accessible to the scientific community.

  5. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution. (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A


    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  6. Applying Information Retrieval Techniques to Detect Duplicates and to Rank References in the Preliminary Phases of Systematic Literature Reviews

    Directory of Open Access Journals (Sweden)

    Ramon Abilio


    Full Text Available Systematic Literature Review (SLR is a means to synthesize relevant and high quality studies related to a specific topic or research questions. In the Primary Selection stage of an SLR, the selection of studies is usually performed manually by reading title, abstract and keywords of each study. In the last years, the number of published scientific studies has grown increasing the effort to perform this sort of reviews. In this paper, we proposed strategies to detect non-papers and duplicated references in results exported by search engines, and strategies to rank the references in decreasing order of importance for an SLR, regarding the terms in the search string. These strategies are based on Information Retrieval techniques. We implemented the strategies and carried out an experimental evaluation of their applicability using two real datasets. As results, the strategy to detect non-papers presented 100% of precision and 50% of recall; the strategy to detect duplicates detected more duplicates than the manual inspection; and one of the strategies to rank relevant references presented 50% of precision and 80% of recall. Therefore, the results show that the proposed strategies can minimize the effort in the Primary Selection stage of an SLR.

  7. Enteric Duplication. (United States)

    Jeziorczak, Paul M; Warner, Brad W


    Enteric duplications have been described throughout the entire gastrointestinal tract. The usual perinatal presentation is an abdominal mass. Duplications associated with the foregut have associated respiratory symptoms, whereas duplications in the midgut and hindgut can present with obstructive symptoms, perforation, nausea, emesis, hemorrhage, or be asymptomatic, and identified as an incidental finding. These are differentiated from other cystic lesions by the presence of a normal gastrointestinal mucosal epithelium. Enteric duplications are located on the mesenteric side of the native structures and are often singular with tubular or cystic characteristics. Management of enteric duplications often requires operative intervention with preservation of the native blood supply and intestine. These procedures are usually very well tolerated with low morbidity.

  8. A rare duplication on chromosome 16p11.2 is identified in patients with psychosis in Alzheimer's disease.

    Directory of Open Access Journals (Sweden)

    Xiaojing Zheng

    Full Text Available Epidemiological and genetic studies suggest that schizophrenia and autism may share genetic links. Besides common single nucleotide polymorphisms, recent data suggest that some rare copy number variants (CNVs are risk factors for both disorders. Because we have previously found that schizophrenia and psychosis in Alzheimer's disease (AD+P share some genetic risk, we investigated whether CNVs reported in schizophrenia and autism are also linked to AD+P. We searched for CNVs associated with AD+P in 7 recurrent CNV regions that have been previously identified across autism and schizophrenia, using the Illumina HumanOmni1-Quad BeadChip. A chromosome 16p11.2 duplication CNV (chr16: 29,554,843-30,105,652 was identified in 2 of 440 AD+P subjects, but not in 136 AD subjects without psychosis, or in 593 AD subjects with intermediate psychosis status, or in 855 non-AD individuals. The frequency of this duplication CNV in AD+P (0.46% was similar to that reported previously in schizophrenia (0.46%. This duplication CNV was further validated using the NanoString nCounter CNV Custom CodeSets. The 16p11.2 duplication has been associated with developmental delay, intellectual disability, behavioral problems, autism, schizophrenia (SCZ, and bipolar disorder. These two AD+P patients had no personal of, nor any identified family history of, SCZ, bipolar disorder and autism. To the best of our knowledge, our case report is the first suggestion that 16p11.2 duplication is also linked to AD+P. Although rare, this CNV may have an important role in the development of psychosis.

  9. Using the National Death Index to Identify Duplicate Cancer Incident Cases in Florida and New York, 1996–2005 (United States)

    Wohler, Brad; Qiao, Baozhen; MacKinnon, Jill A.; Schymura, Maria J.


    Introduction Cancer registries link incidence data to state death certificates to update vital status and identify missing cases; they also link these data to the National Death Index (NDI) to update vital status among patients who leave the state after their diagnosis. This study explored the use of information from NDI linkages to identify potential duplicate cancer cases registered in both Florida and New York. Methods The Florida Cancer Data System (FCDS) and the New York State Cancer Registry (NYSCR) linked incidence data with state and NDI death records from 1996 through 2005. Information for patients whose death occurred in the reciprocal state (the death state) was exchanged. Potential duplicate cases were those that had the same diagnosis and the same or similar diagnosis date. Results NDI identified 4,657 FCDS cancer patients who died in New York and 2,740 NYSCR cancer patients who died in Florida. Matching identified 5,030 cases registered in both states; 508 were death certificate-only (DCO) cases in the death state’s registry, and 3,760 (74.8%) were potential duplicates. Among FCDS and NYSCR patients who died and were registered in the registry of the reciprocal state, more than 50% were registered with the same cancer diagnosis, and approximately 80% had similar diagnosis dates (within 1 year). Conclusion NDI identified DCO cases in the death state’s cancer registry and a large proportion of potential duplicate cases. Standards are needed for assigning primary residence when multiple registries report the same case. The registry initiating the NDI linkage should consider sharing relevant information with death state registries so that these registries can remove erroneous DCO cases from their databases. PMID:25254985

  10. A 15 Mb large paracentric chromosome 21 inversion identified in Czech population through a pair of flanking duplications. (United States)

    Drabova, Jana; Trkova, Marie; Hancarova, Miroslava; Novotna, Drahuse; Hejtmankova, Michaela; Havlovicova, Marketa; Sedlacek, Zdenek


    Inversions are balanced structural chromosome rearrangements, which can influence gene expression and the risk of unbalanced chromosome constitution in offspring. Many examples of inversion polymorphisms exist in human, affecting both heterochromatic regions and euchromatin. We describe a novel, 15 Mb long paracentric inversion, inv(21)(q21.1q22.11), affecting more than a third of human 21q. Despite of its length, the inversion cannot be detected using karyotyping due to similar band patterns on the normal and inverted chromosomes, and is therefore likely to escape attention. Its identification was aided by the repeated observation of the same pair of 150 kb long duplications present in cis on chromosome 21 in three Czech families subjected to microarray analysis. The finding prompted us to hypothesise that this co-occurrence of two remote duplications could be associated with an inversion of the intervening segment, and this speculation turned out to be right. The inversion was confirmed in a series of FISH experiments which also showed that the second copy of each of the duplications was always located at the opposite end of the inversion. The presence of the same pair of duplications in additional individuals reported in public databases indicates that the inversion may also be present in other populations. Three out of the total of about 4000 chromosomes 21 examined in our sample carried the duplications and were inverted, corresponding to carrier frequency of about 1/660. Although the breakpoints affect protein-coding genes, the occurrence of the inversion in normal parents and siblings of our patients and the occurrence of the duplications in unaffected controls in databases indicate that this rare variant is rather non-pathogenic. The inverted segment carried an identical shared haplotype in the three families studied. The haplotypes, however, diverged very rapidly in the flanking regions, possibly pointing to an ancient founder event at the origin of the

  11. Improvements in the Protein Identifier Cross-Reference service. (United States)

    Wein, Samuel P; Côté, Richard G; Dumousseau, Marine; Reisinger, Florian; Hermjakob, Henning; Vizcaíno, Juan A


    The Protein Identifier Cross-Reference (PICR) service is a tool that allows users to map protein identifiers, protein sequences and gene identifiers across over 100 different source databases. PICR takes input through an interactive website as well as Representational State Transfer (REST) and Simple Object Access Protocol (SOAP) services. It returns the results as HTML pages, XLS and CSV files. It has been in production since 2007 and has been recently enhanced to add new functionality and increase the number of databases it covers. Protein subsequences can be Basic Local Alignment Search Tool (BLAST) against the UniProt Knowledgebase (UniProtKB) to provide an entry point to the standard PICR mapping algorithm. In addition, gene identifiers from UniProtKB and Ensembl can now be submitted as input or mapped to as output from PICR. We have also implemented a 'best-guess' mapping algorithm for UniProt. In this article, we describe the usefulness of PICR, how these changes have been implemented, and the corresponding additions to the web services. Finally, we explain that the number of source databases covered by PICR has increased from the initial 73 to the current 102. New resources include several new species-specific Ensembl databases as well as the Ensembl Genome ones. PICR can be accessed at

  12. Endoscopic ultrasonography and rectal duplication cyst in an adult. (United States)

    Castro-Poças, Fernando M; Araújo, Tarcísio P; Silva, Jorge D; Gonçalves, Vicente S


    Rectal duplication cysts account for 4% of all duplications of the alimentary tract. Presentation in adulthood is rare. An asymptomatic 54-year-old man was referred for endoscopic colorectal cancer screening. A bulging mass covered by normal mucosa was identified in the rectum. Endoscopic ultrasonography (EUS) with fine needle aspiration (FNA) was made for a diagnosis of rectal duplication cyst. The patient was operated and the diagnosis was confirmed. The diagnosis of the rectal duplication cyst is a challenge. EUS may have a singular role when identifying a muscular layer, because this is the only absolutely necessary criterion for the diagnosis. FNA by EUS may eventually identify colorectal and/or heterotypic epithelium that are the other diagnostic criteria of the duplication cyst.

  13. Duplicate editorial on duplicate publication. (United States)

    Corson, Stephen L; Decherney, Alan H


    The authors define and discuss the various forms taken by duplicate publications, and provide suggested remedies to help authors, editors, reviewers, and readers avoid this form of internal plagiarism.

  14. Validating fatty acid intake as estimated by an FFQ: how does the 24 h recall perform as reference method compared with the duplicate portion? (United States)

    Trijsburg, Laura; de Vries, Jeanne Hm; Hollman, Peter Ch; Hulshof, Paul Jm; van 't Veer, Pieter; Boshuizen, Hendriek C; Geelen, Anouk


    To compare the performance of the commonly used 24 h recall (24hR) with the more distinct duplicate portion (DP) as reference method for validation of fatty acid intake estimated with an FFQ. Intakes of SFA, MUFA, n-3 fatty acids and linoleic acid (LA) were estimated by chemical analysis of two DP and by on average five 24hR and two FFQ. Plasma n-3 fatty acids and LA were used to objectively compare ranking of individuals based on DP and 24hR. Multivariate measurement error models were used to estimate validity coefficients and attenuation factors for the FFQ with the DP and 24hR as reference methods. Wageningen, the Netherlands. Ninety-two men and 106 women (aged 20-70 years). Validity coefficients for the fatty acid estimates by the FFQ tended to be lower when using the DP as reference method compared with the 24hR. Attenuation factors for the FFQ tended to be slightly higher based on the DP than those based on the 24hR as reference method. Furthermore, when using plasma fatty acids as reference, the DP showed comparable to slightly better ranking of participants according to their intake of n-3 fatty acids (0·33) and n-3:LA (0·34) than the 24hR (0·22 and 0·24, respectively). The 24hR gives only slightly different results compared with the distinctive but less feasible DP, therefore use of the 24hR seems appropriate as the reference method for FFQ validation of fatty acid intake.

  15. Rectal duplication.

    Directory of Open Access Journals (Sweden)

    Kulkarni B


    Full Text Available Duplications of the alimentary tract are of a great rarity, particularly so in the rectum. Because of its rarity, the difficulty of making a correct diagnosis and of selection of proper approach for treatment, this entity bears a special significance. The present case report deals with a female newborn who presented with imperforate anus and a rectovestibular fistula and a mass prolapsing at the introitus. Complete excision of the mass was carried out through the perineal approach and the child then underwent, a PSARP for the correction of the rectal anomaly. Histology confirmed the mass to be a rectal duplication.

  16. Gallbladder duplication

    Directory of Open Access Journals (Sweden)

    Yagan Pillay


    Conclusion: Duplication of the gallbladder is a rare congenital abnormality, which requires special attention to the biliary ductal and arterial anatomy. Laparoscopic cholecystectomy with intraoperative cholangiography is the appropriate treatment in a symptomatic gallbladder. The removal of an asymptomatic double gallbladder remains controversial.

  17. Complete cloacal duplication imaged before and during pregnancy. (United States)

    Ragab, Omar; Landay, Melanie; Shriki, Jabi


    The authors describe a 31 year-old female who presented emergently with abdominal pain and was found at CT to have complete genitourinary duplication including separate urinary bladders, uteri, cervices, and vaginas, and also duplication of the rectum. No etiology for abdominal pain was identified. The patient was referred to urology for further evaluation, and an intravenous urographic study was obtained, which confirmed complete lower urinary tract duplication. The patient presented emergently 9 months later during a subsequent pregnancy for further evaluation of abdominal pain. A second CT scan was ordered to rule out appendicitis. Findings consistent with cloacal duplication were again noted. There was also dilatation of the urinary collecting systems, more prominently on the right side. A Cesarean section was performed and confirmed total genitourinary and rectal duplication.

  18. Point to a Referent, and Say, "What Is This?" Gesture as a Potential Cue to Identify Referents in a Discourse (United States)

    So, Wing Chee; Lim, Jia Yi


    This study explored whether caregivers' gestures followed the discourse-pragmatic principle of information status of referents (given vs. new) and how their children responded to those gestures when identifying referents. Ten Chinese-speaking and eight English-speaking caregivers were videotaped while interacting spontaneously with their children.…

  19. Complete colonic duplication in children. (United States)

    Khaleghnejad Tabari, Ahmad; Mirshemirani, Alireza; Khaleghnejad Tabari, Nasibeh


    Complete colonic duplication is a very rare congenital anomaly that may have different presentations according to its location and size. Complete colonic duplication can occur in 15% of gastrointestinal duplication. We report two cases of complete colonic duplications, and their characteristics. We present two patients with complete colonic duplication with different types and presentations. Case 1: A 2- year old boy presented to the clinic with abdominal protrusion, difficulty to defecate, chronic constipation and mucosal prolaps covered bulging (rectocele) since he was 6 months old. The patient had palpable pelvic mass with doughy consistency. Rectal exam confirmed perirectal mass with soft consistency. The patient underwent a surgical operation that had total tubular colorectal duplication with one blind end and was treated with simple fenestration of distal end, and was discharged without complication. After two years follow up, he had normal defecation and good weight gain. Case 2: A 2 -day old infant was referred with imperforate anus and complete duplication of recto-sigmoid colon, diphallus, double bladder, and hypospadiasis. After clinical and paraclinical investigations, he underwent operations in several stages in different periods, and was discharged without complications. After four years follow up, he led a normal life. The patients with complete duplication have to be examined carefully because of the high incidence of other systemic anomalies. Treatment includes simple resection of distal common wall, fenestration, and repair other associated anomalies.

  20. Co-expression network analysis of duplicate genes in maize (Zea mays L.) reveals no subgenome bias. (United States)

    Li, Lin; Briskine, Roman; Schaefer, Robert; Schnable, Patrick S; Myers, Chad L; Flagel, Lex E; Springer, Nathan M; Muehlbauer, Gary J


    Gene duplication is prevalent in many species and can result in coding and regulatory divergence. Gene duplications can be classified as whole genome duplication (WGD), tandem and inserted (non-syntenic). In maize, WGD resulted in the subgenomes maize1 and maize2, of which maize1 is considered the dominant subgenome. However, the landscape of co-expression network divergence of duplicate genes in maize is still largely uncharacterized. To address the consequence of gene duplication on co-expression network divergence, we developed a gene co-expression network from RNA-seq data derived from 64 different tissues/stages of the maize reference inbred-B73. WGD, tandem and inserted gene duplications exhibited distinct regulatory divergence. Inserted duplicate genes were more likely to be singletons in the co-expression networks, while WGD duplicate genes were likely to be co-expressed with other genes. Tandem duplicate genes were enriched in the co-expression pattern where co-expressed genes were nearly identical for the duplicates in the network. Older gene duplications exhibit more extensive co-expression variation than younger duplications. Overall, non-syntenic genes primarily from inserted duplications show more co-expression divergence. Also, such enlarged co-expression divergence is significantly related to duplication age. Moreover, subgenome dominance was not observed in the co-expression networks - maize1 and maize2 exhibit similar levels of intra subgenome correlations. Intriguingly, the level of inter subgenome co-expression was similar to the level of intra subgenome correlations, and genes from specific subgenomes were not likely to be the enriched in co-expression network modules and the hub genes were not predominantly from any specific subgenomes in maize. Our work provides a comprehensive analysis of maize co-expression network divergence for three different types of gene duplications and identifies potential relationships between duplication types

  1. Identification of approximately duplicate material records in ERP systems (United States)

    Zong, Wei; Wu, Feng; Chu, Lap-Keung; Sculli, Domenic


    The quality of master data is crucial for the accurate functioning of the various modules of an enterprise resource planning (ERP) system. This study addresses specific data problems arising from the generation of approximately duplicate material records in ERP databases. Such problems are mainly due to the firm's lack of unique and global identifiers for the material records, and to the arbitrary assignment of alternative names for the same material by various users. Traditional duplicate detection methods are ineffective in identifying such approximately duplicate material records because these methods typically rely on string comparisons of each field. To address this problem, a machine learning-based framework is developed to recognise semantic similarity between strings and to further identify and reunify approximately duplicate material records - a process referred to as de-duplication in this article. First, the keywords of the material records are extracted to form vectors of discriminating words. Second, a machine learning method using a probabilistic neural network is applied to determine the semantic similarity between these material records. The approach was evaluated using data from a real case study. The test results indicate that the proposed method outperforms traditional algorithms in identifying approximately duplicate material records.

  2. Craniofacial duplication (diprosopus). (United States)

    Turpin, I M; Furnas, D W; Amlie, R N


    No congenital malformation in infants is more profound than anterior craniofacial duplication. The precise term for this rare anomaly is diprosopus, referring to a fetus with a single trunk, normal limbs, and varying degrees of facial duplication. A search of the world literature produced only 16 cases of diprosopus since 1864. Despite the rarity of this anomaly, three such infants were born in the Southern California area during the past year, making this the largest reported series to date. The three infants were born with two distinctly formed faces. Each had four separate eyes, two mouths, two noses, and two ears with a primitive ear or sinus tract at the plane of fusion. In addition, multiple congenital aberrations existed which involved a variety of internal organs. The pathogenesis of diprosopus is not well understood, but environmental stress early in embryologic development has been suggested as a possible factor. The apparent mechanism is a slowing of pregastrulation oxidation with resultant focal developmental arrests.

  3. Array comparative genomic hybridisation analysis of boys with X linked hypopituitarism identifies a 3.9 Mb duplicated critical region at Xq27 containing SOX3.

    NARCIS (Netherlands)

    Solomon, N.M.; Ross, S.; Morgan, T.; Belsky, J.L.; Hol, F.A.; Karnes, P.; Hopwood, N.J.; Myers, S.E.; Tan, A.; Warne, G.L.; Forrest, S.M.; Thomas, P.Q.


    INTRODUCTION: Array comparative genomic hybridisation (array CGH) is a powerful method that detects alteration of gene copy number with greater resolution and efficiency than traditional methods. However, its ability to detect disease causing duplications in constitutional genomic DNA has not been

  4. Signals of historical interlocus gene conversion in human segmental duplications.

    Directory of Open Access Journals (Sweden)

    Beth L Dumont

    Full Text Available Standard methods of DNA sequence analysis assume that sequences evolve independently, yet this assumption may not be appropriate for segmental duplications that exchange variants via interlocus gene conversion (IGC. Here, we use high quality multiple sequence alignments from well-annotated segmental duplications to systematically identify IGC signals in the human reference genome. Our analysis combines two complementary methods: (i a paralog quartet method that uses DNA sequence simulations to identify a statistical excess of sites consistent with inter-paralog exchange, and (ii the alignment-based method implemented in the GENECONV program. One-quarter (25.4% of the paralog families in our analysis harbor clear IGC signals by the quartet approach. Using GENECONV, we identify 1477 gene conversion tracks that cumulatively span 1.54 Mb of the genome. Our analyses confirm the previously reported high rates of IGC in subtelomeric regions and Y-chromosome palindromes, and identify multiple novel IGC hotspots, including the pregnancy specific glycoproteins and the neuroblastoma breakpoint gene families. Although the duplication history of a paralog family is described by a single tree, we show that IGC has introduced incredible site-to-site variation in the evolutionary relationships among paralogs in the human genome. Our findings indicate that IGC has left significant footprints in patterns of sequence diversity across segmental duplications in the human genome, out-pacing the contributions of single base mutation by orders of magnitude. Collectively, the IGC signals we report comprise a catalog that will provide a critical reference for interpreting observed patterns of DNA sequence variation across duplicated genomic regions, including targets of recent adaptive evolution in humans.

  5. The duplicated genes database: identification and functional annotation of co-localised duplicated genes across genomes.

    Directory of Open Access Journals (Sweden)

    Marion Ouedraogo

    Full Text Available BACKGROUND: There has been a surge in studies linking genome structure and gene expression, with special focus on duplicated genes. Although initially duplicated from the same sequence, duplicated genes can diverge strongly over evolution and take on different functions or regulated expression. However, information on the function and expression of duplicated genes remains sparse. Identifying groups of duplicated genes in different genomes and characterizing their expression and function would therefore be of great interest to the research community. The 'Duplicated Genes Database' (DGD was developed for this purpose. METHODOLOGY: Nine species were included in the DGD. For each species, BLAST analyses were conducted on peptide sequences corresponding to the genes mapped on a same chromosome. Groups of duplicated genes were defined based on these pairwise BLAST comparisons and the genomic location of the genes. For each group, Pearson correlations between gene expression data and semantic similarities between functional GO annotations were also computed when the relevant information was available. CONCLUSIONS: The Duplicated Gene Database provides a list of co-localised and duplicated genes for several species with the available gene co-expression level and semantic similarity value of functional annotation. Adding these data to the groups of duplicated genes provides biological information that can prove useful to gene expression analyses. The Duplicated Gene Database can be freely accessed through the DGD website at

  6. Exon duplications in the ATP7A gene

    DEFF Research Database (Denmark)

    Mogensen, Mie; Skjørringe, Tina; Kodama, Hiroko


    the identified duplicated fragments originated from a single or from two different X-chromosomes, polymorphic markers located in the duplicated fragments were analyzed. RESULTS: Partial ATP7A gene duplication was identified in 20 unrelated patients including one patient with Occipital Horn Syndrome (OHS...

  7. Duplication of the oesophagus

    International Nuclear Information System (INIS)

    Lingg, G.; Nebel, G.


    The article reports on the authors' own observation of a patient with duplication of the oesophagus. Basing on this case, the possibilities of the evolutionary origin are discussed briefly. The significance and decisive importance of X-ray film diagnosis in gastro-intestinal duplications is underlined. (orig.) [de

  8. Duplication of the oesophagus

    Energy Technology Data Exchange (ETDEWEB)

    Lingg, G; Nebel, G


    The article reports on the authors' own observation of a patient with duplication of the oesophagus. Basing on this case, the possibilities of the evolutionary origin are discussed briefly. The significance and decisive importance of X-ray film diagnosis in gastro-intestinal duplications is underlined.

  9. Duplication in DNA Sequences (United States)

    Ito, Masami; Kari, Lila; Kincaid, Zachary; Seki, Shinnosuke

    The duplication and repeat-deletion operations are the basis of a formal language theoretic model of errors that can occur during DNA replication. During DNA replication, subsequences of a strand of DNA may be copied several times (resulting in duplications) or skipped (resulting in repeat-deletions). As formal language operations, iterated duplication and repeat-deletion of words and languages have been well studied in the literature. However, little is known about single-step duplications and repeat-deletions. In this paper, we investigate several properties of these operations, including closure properties of language families in the Chomsky hierarchy and equations involving these operations. We also make progress toward a characterization of regular languages that are generated by duplicating a regular language.

  10. Benchmarking road safety performance: Identifying a meaningful reference (best-in-class). (United States)

    Chen, Faan; Wu, Jiaorong; Chen, Xiaohong; Wang, Jianjun; Wang, Di


    For road safety improvement, comparing and benchmarking performance are widely advocated as the emerging and preferred approaches. However, there is currently no universally agreed upon approach for the process of road safety benchmarking, and performing the practice successfully is by no means easy. This is especially true for the two core activities of which: (1) developing a set of road safety performance indicators (SPIs) and combining them into a composite index; and (2) identifying a meaningful reference (best-in-class), one which has already obtained outstanding road safety practices. To this end, a scientific technique that can combine the multi-dimensional safety performance indicators (SPIs) into an overall index, and subsequently can identify the 'best-in-class' is urgently required. In this paper, the Entropy-embedded RSR (Rank-sum ratio), an innovative, scientific and systematic methodology is investigated with the aim of conducting the above two core tasks in an integrative and concise procedure, more specifically in a 'one-stop' way. Using a combination of results from other methods (e.g. the SUNflower approach) and other measures (e.g. Human Development Index) as a relevant reference, a given set of European countries are robustly ranked and grouped into several classes based on the composite Road Safety Index. Within each class the 'best-in-class' is then identified. By benchmarking road safety performance, the results serve to promote best practice, encourage the adoption of successful road safety strategies and measures and, more importantly, inspire the kind of political leadership needed to create a road transport system that maximizes safety. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Current incidence of duplicate publication in otolaryngology. (United States)

    Cheung, Veronique Wan Fook; Lam, Gilbert O A; Wang, Yun Fan; Chadha, Neil K


    Duplicate publication--deemed highly unethical--is the reproduction of substantial content in another article by the same authors. In 1999, Rosenthal et al. identified an 8.5% incidence of duplicate articles in two otolaryngology journals. We explored the current incidence in three otolaryngology journals in North America and Europe. Retrospective literature review. Index articles in 2008 in Archives of Otolaryngology-Head and Neck Surgery, Laryngoscope, and Clinical Otolaryngology were searched using MEDLINE. Potential duplicate publications in 2006 through 2010 were identified using the first, second, and last authors' names. Three authors independently investigated suspected duplicate publications--classifying them by degree of duplication. Of 358 index articles screened, 75 (20.9%) had 119 potential duplicates from 2006 to 2010. Full review of these 119 potential duplicates revealed a total of 40 articles with some form of redundancy (33.6% of the potential duplicates) involving 27 index articles (7.5% of 358 index articles); one (0.8%) "dual" publication (identical or nearly identical data and conclusions to the index article); three (2.5%) "suspected" dual publications (less than 50% new data and same conclusions); and 36 (30.3%) publications with "salami-slicing" (portion of the index article data repeated) were obtained. Further analysis compared the likelihood of duplicate publication by study source and subspecialty within otolaryngology. The incidence of duplicate publication has not significantly changed over 10 years. "Salami-slicing" was a concerning practice, with no cross-referencing in 61% of these cases. Detecting and eliminating redundant publications is a laborious task, but it is essential in upholding the journal quality and research integrity. © 2013 The American Laryngological, Rhinological and Otological Society, Inc.

  12. Typewriting: Toward Duplicating Success (United States)

    Orsborn, Karen J.


    A description of two projects (secretarial handbook and memo pad and personalized stationery) for use in teaching the duplication process that will capture the interests of students in an advanced typewriting class. (HD)

  13. Enteric and rectal duplications and duplication cysts in the adult. (United States)

    Simsek, Abdurrahman; Zeybek, Nazif; Yagci, Gokhan; Kaymakcioglu, Nihat; Tas, Huseyin; Saglam, Mutlu; Cetiner, Sadettin


    Alimentary tract duplication and duplication cysts are rare congenital malformations. The ileum is the most frequently affected site. However, alimentary tract duplication and duplication cysts can occur at any point along the gastrointestinal tract. Early diagnosis and prompt surgical treatment is the best way to prevent associated morbidity. This article presents the cases of three patients admitted to Gulhane Military Medical Academy with signs of acute abdomen, intra-abdominal mass and chronic abdominal pain. These patients were found to have enteric duplication, duplication cyst and/or retro-rectal cyst. The literature on alimentary tract duplications is reviewed.

  14. Genetics Home Reference: MECP2 duplication syndrome (United States)

    ... and Stroke: Seizures and Epilepsy National Institute of Neurological Disorders and Stroke: Spasticity Information Page Educational Resources (6 links) Boston Children's Hospital: Respiratory Distress Boston Children's Hospital: Seizures Centers ...

  15. In silico reversal of repeat-induced point mutation (RIP identifies the origins of repeat families and uncovers obscured duplicated genes

    Directory of Open Access Journals (Sweden)

    Hane James K


    Full Text Available Abstract Background Repeat-induced point mutation (RIP is a fungal genome defence mechanism guarding against transposon invasion. RIP mutates the sequence of repeated DNA and over time renders the affected regions unrecognisable by similarity search tools such as BLAST. Results DeRIP is a new software tool developed to predict the original sequence of a RIP-mutated region prior to the occurrence of RIP. In this study, we apply deRIP to the genome of the wheat pathogen Stagonospora nodorum SN15 and predict the origin of several previously uncharacterised classes of repetitive DNA. Conclusions Five new classes of transposon repeats and four classes of endogenous gene repeats were identified after deRIP. The deRIP process is a new tool for fungal genomics that facilitates the identification and understanding of the role and origin of fungal repetitive DNA. DeRIP is open-source and is available as part of the RIPCAL suite at

  16. The centriole duplication cycle (United States)

    Fırat-Karalar, Elif Nur; Stearns, Tim


    Centrosomes are the main microtubule-organizing centre of animal cells and are important for many critical cellular and developmental processes from cell polarization to cell division. At the core of the centrosome are centrioles, which recruit pericentriolar material to form the centrosome and act as basal bodies to nucleate formation of cilia and flagella. Defects in centriole structure, function and number are associated with a variety of human diseases, including cancer, brain diseases and ciliopathies. In this review, we discuss recent advances in our understanding of how new centrioles are assembled and how centriole number is controlled. We propose a general model for centriole duplication control in which cooperative binding of duplication factors defines a centriole ‘origin of duplication’ that initiates duplication, and passage through mitosis effects changes that license the centriole for a new round of duplication in the next cell cycle. We also focus on variations on the general theme in which many centrioles are created in a single cell cycle, including the specialized structures associated with these variations, the deuterosome in animal cells and the blepharoplast in lower plant cells. PMID:25047614

  17. Narrow, duplicated internal auditory canal

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, T. [Servico de Neurorradiologia, Hospital Garcia de Orta, Avenida Torrado da Silva, 2801-951, Almada (Portugal); Shayestehfar, B. [Department of Radiology, UCLA Oliveview School of Medicine, Los Angeles, California (United States); Lufkin, R. [Department of Radiology, UCLA School of Medicine, Los Angeles, California (United States)


    A narrow internal auditory canal (IAC) constitutes a relative contraindication to cochlear implantation because it is associated with aplasia or hypoplasia of the vestibulocochlear nerve or its cochlear branch. We report an unusual case of a narrow, duplicated IAC, divided by a bony septum into a superior relatively large portion and an inferior stenotic portion, in which we could identify only the facial nerve. This case adds support to the association between a narrow IAC and aplasia or hypoplasia of the vestibulocochlear nerve. The normal facial nerve argues against the hypothesis that the narrow IAC is the result of a primary bony defect which inhibits the growth of the vestibulocochlear nerve. (orig.)

  18. Using the Drosophila Melanogaster Genetics Reference Panel to Identify Toxicity Pathways for Toluene (United States)

    Mechanistic information is needed to link effects of chemicals at molecular targets in high­ throughput screening assays to adverse outcomes in whole organisms. This study was designed to use the Drosophila Genetic Reference Panel (DGRP), a set of genetically well...

  19. Delineating the scientific footprint in technology: Identifying scientific publications within non-patent references.

    NARCIS (Netherlands)

    Callaert, J.; Grouwels, J.; van Looy, Bart


    Indicators based on non-patent references (NPRs) are increasingly being used for measuring and assessing science–technology interactions. But NPRs in patent documents contain noise, as not all of them can be considered ‘scientific’. In this article, we introduce the results of a machine-learning

  20. Pointing and Reference in Sign Language and Spoken Language: Anchoring vs. Identifying (United States)

    Barberà, Gemma; Zwets, Martine


    In both signed and spoken languages, pointing serves to direct an addressee's attention to a particular entity. This entity may be either present or absent in the physical context of the conversation. In this article we focus on pointing directed to nonspeaker/nonaddressee referents in Sign Language of the Netherlands (Nederlandse Gebarentaal,…

  1. Centrioles: duplicating precariously. (United States)

    Pelletier, Laurence


    To assemble a mitotic spindle and accurately segregate chromosomes to progeny, a cell needs to precisely regulate its centrosome number, a feat largely accomplished through the tight control of centriole duplication. Recent work showing that the overexpression of centriolar proteins can lead to the formation of multiple centrioles in the absence of pre-existing centrioles challenges the idea that it is a self-replicating organelle.

  2. Rectal duplication: a case report. (United States)

    Didden, K; Masereel, B; Geyskens, P


    Gastrointestinal tract duplications are uncommon congenital abnormalities, that may occur anywhere along the alimentary tract. Most frequently they occur at the level of the small bowel tract and are symptomatic before the age of two. In our case we report the history of a 68-years old women with a colon duplication, especially a rectal duplication. This is very exceptional.

  3. Embryonic duplications in sheep. (United States)

    Dennis, S M


    Twenty-seven embryonic duplications were examined during a 3-year investigation into the causes of perinatal lamb mortality. Twenty of the 27 were anomalous twins with 19 being conjoined (diplopagus 9 and heteropagus 10). The various duplications were: haloacardius acephalus 1, diprosopus 2, dicephalus 2, dipypus 3, diprosopus dipygus 1, syncephalus dipygus 1, pygopagus parasiticus 1, heteropagus dipygus 3, melodidymus 6, polyury 4, penile duplication 2, and bilateral otognathia 1. Four lambs were living and the time of death of the others was: parturient 8, and post-parturient 15. Average dry weight of the lambs was 3.35 kg (range 1.59 to 5.45 kg). Breed distribution was: Merino 77.8%, Crossbred 14.8%, Dorset Horn 3.7%, and Corriedale 3.7%. The caudal region was involved in 10 of the conjoined twins (52.6%), anterior region in 7 (36.9%), and both anterior and caudal regions in 2 (10.5%). Associated defects were present in 70.4% of the 27 lambs, the most common being atresia ani.

  4. Information Reference Models for European Pork Supply Networks - Identifying Gaps in Information Infrastructures

    DEFF Research Database (Denmark)

    Lehmann, Richard J.; Hermansen, John Erik; Fritz, Melanie


    Several global developments such as diminishing production resources, limits in the availability of water and the growing demand for bio-energy as well as sector-wide crises (e.g. BSE, swine fever, dioxin) have led to a changing attitude of society towards the conse-quences of the food system......‘s activities for social, economic and environmental issues, cap-tured in the term of sustainability. As a consequence, consumers show increasing interest in the characteristics of food, and in turn, on the availability of related information and guaran-tees. The paper introduces different information reference...

  5. Craniofacial duplication: a case report. (United States)

    Suryawanshi, Pradeep; Deshpande, Mandar; Verma, Nitin; Mahendrakar, Vivek; Mahendrakar, Sandhya


    A craniofacial duplication or diprosopus is an unusual variant of conjoined twinning. The reported incidence is one in 180,000-15 million births and 35 cases have been reported till date. The phenotype is wide, with the partial duplication of a few facial structures to complete dicephalus. A complete duplication is associated with a high incidence of anomalies in the central nervous system, cardiovascular system, gastrointestinal system and the respiratory system, whereas no major anomalies are found in the infants with a partial duplication. A term baby with the features of a craniofacial duplication has been described, with the proposed theories on embryogenesis and a brief review of the literature.

  6. Rectal duplication with sciatic hernia. (United States)

    Nosek, Marzena; Golonka, Anna; Kalińska-Lipert, Anita; Nachulewicz, Paweł


    Rectal duplications represent 5% of all duplications in the alimentary tract, and they are very rarely diagnosed during the neonatal period. The authors present the method of investigation and the results of surgical treatment of a full-term neonate with a sciatic hernia containing a rectal duplication. The procedure started with three-port laparoscopy, but excision of the tubular duplication of the rectum was possible only by a transanal endorectal pull-through approach. The sciatic hernia was closed, and plastic sutures on the buttock finished the procedure. The coincidence of sciatic hernia with rectal duplication is extremely rare, and the method of treatment depends exclusively on the anatomical conditions.

  7. Efficacy of the ADEC in Identifying Autism Spectrum Disorder in Clinically Referred Toddlers in the US. (United States)

    Hedley, Darren; Nevill, Rose E; Monroy-Moreno, Yessica; Fields, Natalie; Wilkins, Jonathan; Butter, Eric; Mulick, James A


    The Autism Detection in Early Childhood (ADEC) is a brief, play-based screening tool for the assessment of autism spectrum disorder (ASD) in children aged 12-36 months. We examined the psychometric properties of the ADEC in a clinical sample of toddlers (n = 114) referred to a US pediatric hospital for assessment due to concerns of developmental delay or ASD. The ADEC (cutoff = 11) returned good sensitivity (.93-.94) but poorer specificity (.62-.64) for best estimate clinical diagnosis of ASD, and compared favorably with the ADOS-2. Internal consistency was acceptable, α = .80, and inter-rater reliability was high, ICC = .95. Results support the use of the ADEC as a clinical screen for ASD.

  8. An artificial neural network system to identify alleles in reference electropherograms. (United States)

    Taylor, Duncan; Harrison, Ash; Powers, David


    Electropherograms are produced in great numbers in forensic DNA laboratories as part of everyday criminal casework. Before the results of these electropherograms can be used they must be scrutinised by analysts to determine what the identified data tells them about the underlying DNA sequences and what is purely an artefact of the DNA profiling process. This process of interpreting the electropherograms can be time consuming and is prone to subjective differences between analysts. Recently it was demonstrated that artificial neural networks could be used to classify information within an electropherogram as allelic (i.e. representative of a DNA fragment present in the DNA extract) or as one of several different categories of artefactual fluorescence that arise as a result of generating an electropherogram. We extend that work here to demonstrate a series of algorithms and artificial neural networks that can be used to identify peaks on an electropherogram and classify them. We demonstrate the functioning of the system on several profiles and compare the results to a leading commercial DNA profile reading system. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Genome-wide signatures of 'rearrangement hotspots' within segmental duplications in humans.

    Directory of Open Access Journals (Sweden)

    Mohammed Uddin

    Full Text Available The primary objective of this study was to create a genome-wide high resolution map (i.e., >100 bp of 'rearrangement hotspots' which can facilitate the identification of regions capable of mediating de novo deletions or duplications in humans. A hierarchical method was employed to fragment segmental duplications (SDs into multiple smaller SD units. Combining an end space free pairwise alignment algorithm with a 'seed and extend' approach, we have exhaustively searched 409 million alignments to detect complex structural rearrangements within the reference-guided assembly of the NA18507 human genome (18× coverage, including the previously identified novel 4.8 Mb sequence from de novo assembly within this genome. We have identified 1,963 rearrangement hotspots within SDs which encompass 166 genes and display an enrichment of duplicated gene nucleotide variants (DNVs. These regions are correlated with increased non-allelic homologous recombination (NAHR event frequency which presumably represents the origin of copy number variations (CNVs and pathogenic duplications/deletions. Analysis revealed that 20% of the detected hotspots are clustered within the proximal and distal SD breakpoints flanked by the pathogenic deletions/duplications that have been mapped for 24 NAHR-mediated genomic disorders. FISH Validation of selected complex regions revealed 94% concordance with in silico localization of the highly homologous derivatives. Other results from this study indicate that intra-chromosomal recombination is enhanced in genic compared with agenic duplicated regions, and that gene desert regions comprising SDs may represent reservoirs for creation of novel genes. The generation of genome-wide signatures of 'rearrangement hotspots', which likely serve as templates for NAHR, may provide a powerful approach towards understanding the underlying mutational mechanism(s for development of constitutional and acquired diseases.

  10. Identifying predictors of attitudes towards local onshore wind development with reference to an English case study

    International Nuclear Information System (INIS)

    Jones, Christopher R.; Eiser, J. Richard


    The threats posed by climate change are placing governments under increasing pressure to meet electricity demand from low-carbon sources. In many countries, including the UK, legislation is in place to ensure the continued expansion of renewable energy capacity. Onshore wind turbines are expected to play a key role in achieving these aims. However, despite high levels of public support for onshore wind development in principle, specific projects often experience local opposition. Traditionally this difference in general and specific attitudes has been attributed to NIMBYism (not in my back yard), but evidence is increasingly calling this assumption into question. This study used multiple regression analysis to identify what factors might predict attitudes towards mooted wind development in Sheffield, England. We report on the attitudes of two groups; one group (target) living close to four sites earmarked for development and an unaffected comparison group (comparison). We found little evidence of NIMBYism amongst members of the target group; instead, differences between general and specific attitudes appeared attributable to uncertainty regarding the proposals. The results are discussed with respect to literature highlighting the importance of early, continued and responsive community involvement in combating local opposition and facilitating the deployment of onshore wind turbines.

  11. Functional requirements driving the gene duplication in 12 Drosophila species. (United States)

    Zhong, Yan; Jia, Yanxiao; Gao, Yang; Tian, Dacheng; Yang, Sihai; Zhang, Xiaohui


    Gene duplication supplies the raw materials for novel gene functions and many gene families arisen from duplication experience adaptive evolution. Most studies of young duplicates have focused on mammals, especially humans, whereas reports describing their genome-wide evolutionary patterns across the closely related Drosophila species are rare. The sequenced 12 Drosophila genomes provide the opportunity to address this issue. In our study, 3,647 young duplicate gene families were identified across the 12 Drosophila species and three types of expansions, species-specific, lineage-specific and complex expansions, were detected in these gene families. Our data showed that the species-specific young duplicate genes predominated (86.6%) over the other two types. Interestingly, many independent species-specific expansions in the same gene family have been observed in many species, even including 11 or 12 Drosophila species. Our data also showed that the functional bias observed in these young duplicate genes was mainly related to responses to environmental stimuli and biotic stresses. This study reveals the evolutionary patterns of young duplicates across 12 Drosophila species on a genomic scale. Our results suggest that convergent evolution acts on young duplicate genes after the species differentiation and adaptive evolution may play an important role in duplicate genes for adaption to ecological factors and environmental changes in Drosophila.

  12. MECP2 Duplication Syndrome

    DEFF Research Database (Denmark)

    Signorini, Cinzia; De Felice, Claudio; Leoncini, Silvia


    Rett syndrome (RTT) and MECP2 duplication syndrome (MDS) are neurodevelopmental disorders caused by alterations in the methyl-CpG binding protein 2 (MECP2) gene expression. A relationship between MECP2 loss-of-function mutations and oxidative stress has been previously documented in RTT patients...... and murine models. To date, no data on oxidative stress have been reported for the MECP2 gain-of-function mutations in patients with MDS. In the present work, the pro-oxidant status and oxidative fatty acid damage in MDS was investigated (subjects n = 6) and compared to RTT (subjects n = 24) and healthy...... similar to those observed in RTT patients except for higher plasma F2-isoprostanes levels (P work shows unique data in patients affected by MDS. For the first...

  13. Duplicated middle cerebral artery (United States)

    Perez, Jesus; Machado, Calixto; Scherle, Claudio; Hierro, Daniel


    Duplicated middle cerebral artery (DMCA) is an anomalous vessel arising from the internal carotid artery. The incidence DMCA is relatively law, and an association between this anomaly and cerebral aneurysms has been documented. There is a controversy whether DMCA may have perforating arteries. This is an important fact to consider in aneurysm surgery. We report the case of a 34-year-old black woman who suffered a subarachnoid hemorrhage and the angiography a left DMCA, and an aneurysm in an inferior branch of the main MCA. The DMCA and the MCA had perforating arteries. The aneurysm was clipped without complications. The observation of perforating arteries in our patient confirms that the DMCA may have perforating arteries. This is very important to be considered in cerebral aneurysms surgery. Moreover, the DMCA may potentially serve as a collateral blood supply to the MCA territory in cases of MCA occlusion. PMID:22140405

  14. MicroRNA expression profiling to identify and validate reference genes for relative quantification in colorectal cancer.

    LENUS (Irish Health Repository)

    Chang, Kah Hoong


    BACKGROUND: Advances in high-throughput technologies and bioinformatics have transformed gene expression profiling methodologies. The results of microarray experiments are often validated using reverse transcription quantitative PCR (RT-qPCR), which is the most sensitive and reproducible method to quantify gene expression. Appropriate normalisation of RT-qPCR data using stably expressed reference genes is critical to ensure accurate and reliable results. Mi(cro)RNA expression profiles have been shown to be more accurate in disease classification than mRNA expression profiles. However, few reports detailed a robust identification and validation strategy for suitable reference genes for normalisation in miRNA RT-qPCR studies. METHODS: We adopt and report a systematic approach to identify the most stable reference genes for miRNA expression studies by RT-qPCR in colorectal cancer (CRC). High-throughput miRNA profiling was performed on ten pairs of CRC and normal tissues. By using the mean expression value of all expressed miRNAs, we identified the most stable candidate reference genes for subsequent validation. As such the stability of a panel of miRNAs was examined on 35 tumour and 39 normal tissues. The effects of normalisers on the relative quantity of established oncogenic (miR-21 and miR-31) and tumour suppressor (miR-143 and miR-145) target miRNAs were assessed. RESULTS: In the array experiment, miR-26a, miR-345, miR-425 and miR-454 were identified as having expression profiles closest to the global mean. From a panel of six miRNAs (let-7a, miR-16, miR-26a, miR-345, miR-425 and miR-454) and two small nucleolar RNA genes (RNU48 and Z30), miR-16 and miR-345 were identified as the most stably expressed reference genes. The combined use of miR-16 and miR-345 to normalise expression data enabled detection of a significant dysregulation of all four target miRNAs between tumour and normal colorectal tissue. CONCLUSIONS: Our study demonstrates that the top six most

  15. MicroRNA expression profiling to identify and validate reference genes for relative quantification in colorectal cancer

    LENUS (Irish Health Repository)

    Chang, Kah Hoong


    Abstract Background Advances in high-throughput technologies and bioinformatics have transformed gene expression profiling methodologies. The results of microarray experiments are often validated using reverse transcription quantitative PCR (RT-qPCR), which is the most sensitive and reproducible method to quantify gene expression. Appropriate normalisation of RT-qPCR data using stably expressed reference genes is critical to ensure accurate and reliable results. Mi(cro)RNA expression profiles have been shown to be more accurate in disease classification than mRNA expression profiles. However, few reports detailed a robust identification and validation strategy for suitable reference genes for normalisation in miRNA RT-qPCR studies. Methods We adopt and report a systematic approach to identify the most stable reference genes for miRNA expression studies by RT-qPCR in colorectal cancer (CRC). High-throughput miRNA profiling was performed on ten pairs of CRC and normal tissues. By using the mean expression value of all expressed miRNAs, we identified the most stable candidate reference genes for subsequent validation. As such the stability of a panel of miRNAs was examined on 35 tumour and 39 normal tissues. The effects of normalisers on the relative quantity of established oncogenic (miR-21 and miR-31) and tumour suppressor (miR-143 and miR-145) target miRNAs were assessed. Results In the array experiment, miR-26a, miR-345, miR-425 and miR-454 were identified as having expression profiles closest to the global mean. From a panel of six miRNAs (let-7a, miR-16, miR-26a, miR-345, miR-425 and miR-454) and two small nucleolar RNA genes (RNU48 and Z30), miR-16 and miR-345 were identified as the most stably expressed reference genes. The combined use of miR-16 and miR-345 to normalise expression data enabled detection of a significant dysregulation of all four target miRNAs between tumour and normal colorectal tissue. Conclusions Our study demonstrates that the top six most

  16. Identifying optimal reference genes for the normalization of microRNA expression in cucumber under viral stress (United States)

    Liang, Chaoqiong; Hao, Jianjun; Meng, Yan; Luo, Laixin; Li, Jianqiang


    Cucumber green mottle mosaic virus (CGMMV) is an economically important pathogen and causes significant reduction of both yield and quality of cucumber (Cucumis sativus). Currently, there were no satisfied strategies for controlling the disease. A better understanding of microRNA (miRNA) expression related to the regulation of plant-virus interactions and virus resistance would be of great assistance when developing control strategies for CGMMV. However, accurate expression analysis is highly dependent on robust and reliable reference gene used as an internal control for normalization of miRNA expression. Most commonly used reference genes involved in CGMMV-infected cucumber are not universally expressed depending on tissue types and stages of plant development. It is therefore crucial to identify suitable reference genes in investigating the role of miRNA expression. In this study, seven reference genes, including Actin, Tubulin, EF-1α, 18S rRNA, Ubiquitin, GAPDH and Cyclophilin, were evaluated for the most accurate results in analyses using reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Gene expression was assayed on cucumber leaves, stems and roots that were collected at different days post inoculation with CGMMV. The expression data were analyzed using algorithms including delta-Ct, geNorm, NormFinder, and BestKeeper as well as the comparative tool RefFinder. The reference genes were subsequently validated using miR159. The results showed that EF-1α and GAPDH were the most reliable reference genes for normalizing miRNA expression in leaf, root and stem samples, while Ubiquitin and EF-1α were the most suitable combination overall. PMID:29543906

  17. Colonic duplication in an adult

    International Nuclear Information System (INIS)

    Baro, P.; Dario Casas, J.; Sanchez, D.


    A case of colonic duplication that was diagnosed radiologically in an adult is reported. A long duplicated segment below the normal transverse colon, with a wide anastomosis at the hepatic flexure level, was observed on barium enema. The rarity of this anomaly unassociated with other malformations is emphasized. (orig.)

  18. Supervised Learning for Detection of Duplicates in Genomic Sequence Databases.

    Directory of Open Access Journals (Sweden)

    Qingyu Chen

    Full Text Available First identified as an issue in 1996, duplication in biological databases introduces redundancy and even leads to inconsistency when contradictory information appears. The amount of data makes purely manual de-duplication impractical, and existing automatic systems cannot detect duplicates as precisely as can experts. Supervised learning has the potential to address such problems by building automatic systems that learn from expert curation to detect duplicates precisely and efficiently. While machine learning is a mature approach in other duplicate detection contexts, it has seen only preliminary application in genomic sequence databases.We developed and evaluated a supervised duplicate detection method based on an expert curated dataset of duplicates, containing over one million pairs across five organisms derived from genomic sequence databases. We selected 22 features to represent distinct attributes of the database records, and developed a binary model and a multi-class model. Both models achieve promising performance; under cross-validation, the binary model had over 90% accuracy in each of the five organisms, while the multi-class model maintains high accuracy and is more robust in generalisation. We performed an ablation study to quantify the impact of different sequence record features, finding that features derived from meta-data, sequence identity, and alignment quality impact performance most strongly. The study demonstrates machine learning can be an effective additional tool for de-duplication of genomic sequence databases. All Data are available as described in the supplementary material.

  19. Supervised Learning for Detection of Duplicates in Genomic Sequence Databases. (United States)

    Chen, Qingyu; Zobel, Justin; Zhang, Xiuzhen; Verspoor, Karin


    First identified as an issue in 1996, duplication in biological databases introduces redundancy and even leads to inconsistency when contradictory information appears. The amount of data makes purely manual de-duplication impractical, and existing automatic systems cannot detect duplicates as precisely as can experts. Supervised learning has the potential to address such problems by building automatic systems that learn from expert curation to detect duplicates precisely and efficiently. While machine learning is a mature approach in other duplicate detection contexts, it has seen only preliminary application in genomic sequence databases. We developed and evaluated a supervised duplicate detection method based on an expert curated dataset of duplicates, containing over one million pairs across five organisms derived from genomic sequence databases. We selected 22 features to represent distinct attributes of the database records, and developed a binary model and a multi-class model. Both models achieve promising performance; under cross-validation, the binary model had over 90% accuracy in each of the five organisms, while the multi-class model maintains high accuracy and is more robust in generalisation. We performed an ablation study to quantify the impact of different sequence record features, finding that features derived from meta-data, sequence identity, and alignment quality impact performance most strongly. The study demonstrates machine learning can be an effective additional tool for de-duplication of genomic sequence databases. All Data are available as described in the supplementary material.

  20. Evolution dynamics of a model for gene duplication under adaptive conflict (United States)

    Ancliff, Mark; Park, Jeong-Man


    We present and solve the dynamics of a model for gene duplication showing escape from adaptive conflict. We use a Crow-Kimura quasispecies model of evolution where the fitness landscape is a function of Hamming distances from two reference sequences, which are assumed to optimize two different gene functions, to describe the dynamics of a mixed population of individuals with single and double copies of a pleiotropic gene. The evolution equations are solved through a spin coherent state path integral, and we find two phases: one is an escape from an adaptive conflict phase, where each copy of a duplicated gene evolves toward subfunctionalization, and the other is a duplication loss of function phase, where one copy maintains its pleiotropic form and the other copy undergoes neutral mutation. The phase is determined by a competition between the fitness benefits of subfunctionalization and the greater mutational load associated with maintaining two gene copies. In the escape phase, we find a dynamics of an initial population of single gene sequences only which escape adaptive conflict through gene duplication and find that there are two time regimes: until a time t* single gene sequences dominate, and after t* double gene sequences outgrow single gene sequences. The time t* is identified as the time necessary for subfunctionalization to evolve and spread throughout the double gene sequences, and we show that there is an optimum mutation rate which minimizes this time scale.

  1. Role of computed tomography in oesophageal duplications. Report of two cases; Duplications oesophagiennes: place de la tomodensitometrie

    Energy Technology Data Exchange (ETDEWEB)

    Jouini, S.; Menif, E.; Azaiez, N.; Ben Hajel, H.; Cheikh, I.; Ben Ammar, A.; Sellami, M.; Ben Jaafar, M. [Hopital La Rabta, Tunis (Tunisia)


    The authors present two cases of esophageal duplication: tubular in one case and cystic in the other. This rare anomaly was identified in both cases by CT scan. A review of literature is proposed. (authors). 22 refs., 10 figs.

  2. Partial craniofacial duplication: a review of the literature and case report. (United States)

    Costa, Melinda A; Borzabadi-Farahani, Ali; Lara-Sanchez, Pedro A; Schweitzer, Daniela; Jacobson, Lia; Clarke, Noreen; Hammoudeh, Jeffery; Urata, Mark M; Magee, William P


    Diprosopus (Greek; di-, "two" + prosopon, "face"), or craniofacial duplication, is a rare craniofacial anomaly referring to the complete duplication of facial structures. Partial craniofacial duplication describes a broad spectrum of congenital anomalies, including duplications of the oral cavity. This paper describes a 15 month-old female with a duplicated oral cavity, mandible, and maxilla. A Tessier type 7 cleft, midline meningocele, and duplicated hypophysis were also present. The preoperative evaluation, surgical approach, postoperative results, and a review of the literature are presented. The surgical approach was designed to preserve facial nerve innervation to the reconstructed cheek and mouth. The duplicated mandible and maxilla were excised and the remaining left maxilla was bone grafted. Soft tissue repair included closure of the Tessier type VII cleft. Craniofacial duplication remains a rare entity that is more common in females. The pathophysiology remains incompletely characterized, but is postulated to be due to duplication of the notochord, as well as duplication of mandibular growth centres. While diprosopus is a severe deformity often associated with anencephaly, patients with partial duplication typically benefit from surgical treatment. Managing craniofacial duplication requires a detailed preoperative evaluation as well as a comprehensive, staged treatment plan. Long-term follow up is needed appropriately to address ongoing craniofacial deformity. Published by Elsevier Ltd.

  3. Rectal duplication presenting as colonic subocclusion. (United States)

    Vuilleumier, H; Maternini, M


    Rectal duplication cyst is a rare congenital lesion which is known to be associated with other congenital defects, especially genitourinary and vertebral anomalies. Infections with fistulization, bleeding, and malignant degeneration are the major complications of developmental cysts. The case of an 83-year-old woman referred for acute constipation associated with abdominal distension is reported. CT and MRI showed a large cystic mass of the pelvis with extrinsic compression of the rectum. Surgical excision would have been the treatment of choice. In this case, the patient was unfortunately not eligible for surgery due to her poor general condition but responded well to conservative treatment.

  4. Duplication Cyst of the Sigmoid Colon

    Directory of Open Access Journals (Sweden)

    Bastian Domajnko


    Full Text Available A 21-year-old male with developmental delay presented with abdominal pain of two days' duration. He was afebrile and his abdomen was soft with mild diffuse tenderness. There were no peritoneal signs. Plain x-ray demonstrated a large air-filled structure in the right upper quadrant. Computed tomography of the abdomen revealed a 9×8 cm structure adjacent to the hepatic flexure containing an air-fluid level. It did not contain oral contrast and had no apparent communication with the colon. At operation, the cystic lesion was identified as a duplication cyst of the sigmoid colon that was adherent to the right upper quadrant. The cyst was excised with a segment of the sigmoid colon and a stapled colo-colostomy was performed. Recovery was uneventful. Final pathology was consistent with a duplication cyst of the sigmoid colon. The cyst was attached to the colon but did not communicate with the lumen.

  5. Individual differences in the ability to identify, select and use appropriate frames of reference for perceptuo-motor control. (United States)

    Isableu, B; Ohlmann, T; Cremieux, J; Vuillerme, N; Amblard, B; Gresty, M A


    The causes of the interindividual differences (IDs) in how we perceive and control spatial orientation are poorly understood. Here, we propose that IDs partly reflect preferred modes of spatial referencing and that these preferences or "styles" are maintained from the level of spatial perception to that of motor control. Two groups of experimental subjects, one with high visual field dependency (FD) and one with marked visual field independency (FI) were identified by the Rod and Frame Test, which identifies relative dependency on a visual frame of reference (VFoR). FD and FI subjects were tasked with standing still in conditions of increasing postural difficulty while visual cues of self-orientation (a visual frame tilted in roll) and self-motion (in stroboscopic illumination) were varied and in darkness to assess visual dependency. Postural stability, overall body orientation and modes of segmental stabilization relative to either external (space) or egocentric (adjacent segments) frames of reference in the roll plane were analysed. We hypothesized that a moderate challenge to balance should enhance subjects' reliance on VFoR, particularly in FD subjects, whereas a substantial challenge should constrain subjects to use a somatic-vestibular based FoR to prevent falling in which case IDs would vanish. The results showed that with increasing difficulty, FD subjects became more unstable and more disoriented shown by larger effects of the tilted visual frame on posture. Furthermore, their preference to coalign body/VFoR coordinate systems lead to greater fixation of the head-trunk articulation and stabilization of the hip in space, whereas the head and trunk remained more stabilized in space with the hip fixed on the leg in FI subjects. These results show that FD subjects have difficulties at identifying and/or adopting a more appropriate FoR based on proprioceptive and vestibular cues to regulate the coalignment of posturo/exocentric FoRs. The FI subjects' resistance

  6. Anterior colorectal duplication presenting as rectal prolapse. (United States)

    Ramirez-Resendiz, Amador; Asz, Jose; Medina-Vega, F Antonio; Ortega-Salgado, J Arturo


    Duplications of the gastrointestinal (GI) tract are rare. Only 5% of them are rectal and there are very few reports of rectal prolapse (RP) caused by a duplication. An 11 month-old female presented with a RP caused by a blind-ended anterior tubular colorectal duplication. The duplication was successfully opened and connected to the normal rectum without complications. Although infrequent, a rectal duplication should be considered in the differential diagnosis of RP.

  7. External cystic rectal duplication: an unusual presentation of rectal duplication cyst. (United States)

    Karaman, I; Karaman, A; Arda, N; Cakmak, O


    Duplications of gastrointestinal tract are rare anomalies, and rectal duplications account for five percent of the alimentary tract duplications. We present an unusual case of rectal duplication, which was located externally in a newborn female, and discuss the types of distal hindgut duplications.

  8. Comparing genomes with rearrangements and segmental duplications. (United States)

    Shao, Mingfu; Moret, Bernard M E


    Large-scale evolutionary events such as genomic rearrange.ments and segmental duplications form an important part of the evolution of genomes and are widely studied from both biological and computational perspectives. A basic computational problem is to infer these events in the evolutionary history for given modern genomes, a task for which many algorithms have been proposed under various constraints. Algorithms that can handle both rearrangements and content-modifying events such as duplications and losses remain few and limited in their applicability. We study the comparison of two genomes under a model including general rearrangements (through double-cut-and-join) and segmental duplications. We formulate the comparison as an optimization problem and describe an exact algorithm to solve it by using an integer linear program. We also devise a sufficient condition and an efficient algorithm to identify optimal substructures, which can simplify the problem while preserving optimality. Using the optimal substructures with the integer linear program (ILP) formulation yields a practical and exact algorithm to solve the problem. We then apply our algorithm to assign in-paralogs and orthologs (a necessary step in handling duplications) and compare its performance with that of the state-of-the-art method MSOAR, using both simulations and real data. On simulated datasets, our method outperforms MSOAR by a significant margin, and on five well-annotated species, MSOAR achieves high accuracy, yet our method performs slightly better on each of the 10 pairwise comparisons. © The Author 2015. Published by Oxford University Press.

  9. Radiological findings of male urethral duplication associated with bladder duplication: case report

    International Nuclear Information System (INIS)

    Kim, Hyoung Jung; Lim, Joo Won; Lee, Dong Ho; Ko, Young Tae


    Urethral duplication or accessory urethra is a rare congenital anomaly. Even rarer, is its association with bladder duplication. We report a case of urethral duplication associated with bladder duplication in a seven-year-old boy who underwent retrograde urethrography, sonography and magnetic resonance (MR) imaging. WhiIe retrograde urethrography can demonstrate the extent of the duplicated urethra, MR imaging and sonography can provide detailed information on the anatomy of the adjacent tissues as well as urethral duplication

  10. Evaluation of contrast in duplicated radiographs

    International Nuclear Information System (INIS)

    Thunthy, K.H.; Weinberg, R.


    This investigation evaluated changes in the contrast of duplicated radiographs made at different ultraviolet light exposures. Increasing ultraviolet light exposure had different effects on the duplicates of originals of different background densities. When correctly exposed, a duplicate radiograph enhanced contrast. When originals had the same contrast but different background densities, their duplicates did not have the same contrast. It was not possible to duplicate accurately all the different contrasts measured on an original. It was possible, however, to produce duplicates with all contrasts greater than those of the original

  11. An unusual presentation of a rectal duplication cyst. (United States)

    Jackson, Katharine L; Peche, William J; Rollins, Michael D


    Intestinal duplications are rare developmental anomalies that can occur anywhere along the gastrointestinal tract. Rectal duplication cysts account for approximately 4% of all duplication cysts. They usually present in childhood with symptoms of mass effect, local infection or more rarely with rectal bleeding from ectopic gastric mucosa. A 26year old male presented with a history of bright red blood per rectum. On examination a mucosal defect with an associated cavity adjacent to the rectum was identified. This was confirmed with rigid proctoscopy and CT scan imaging. A complete transanal excision was performed. Rectal duplication cysts are more common in pediatric patients. They more frequently present with symptoms of mass effect or local infection than with rectal bleeding. In adult patients they are a rare cause of rectal bleeding. Definitive treatment is with surgical excision. A transanal, transcoccygeal, posterior sagittal or a combined abdominoperineal approach may be used depending on anatomic characteristics of the duplication cyst. We present a rare case of a rectal duplication cyst presenting in adulthood with rectal bleeding, managed with transanal excision. Published by Elsevier Ltd.

  12. Concomitant urethral triplication, bladder, and colon duplication. (United States)

    Tourchi, Ali; Kajbafzadeh, Abdol-Mohammad; Khakpour, Mahshid; Mohammadi Nejad, Payam; Mousavian, Amir-Abbas; Kalantary, Mahdi


    The concomitant presence of urethral triplication and caudal duplication is extremely rare with no previous reported cases. We report a case of urethral triplication associated with bladder, sigmoid, and rectum duplication. The patient was initially referred with a history of fecaluria and recurrent urinary tract infection. Physical examination revealed 2 meatal opening on the glans penis. Further investigation revealed three distinct urinary streams, two terminating on the glans penis, and one in the rectum in voiding cystourethrography and retrograde urethrography. Computed tomography demonstrated the bladder divided into two compartments by a complete sagittal septum. The patient was managed by the excision of the rectal ending urethra and removal of the bladder sagittal septum during which, two sigmoidal and rectal segments (the right one filled with fecal) were revealed. The right sigmoid and rectum was resected. The two ventral urethras were kept intact. The postoperative course was uneventful. At his 4 month readmission for colostomy closure, the patient reported good urethral voiding with no complication and recurrence of urinary tract infection and the colostomy was closed with no major complication.

  13. Facial duplication: case, review, and embryogenesis. (United States)

    Barr, M


    The craniofacial anatomy of an infant with facial duplication is described. There were four eyes, two noses, two maxillae, and one mandible. Anterior to the single pituitary the brain was duplicated and there was bilateral arhinencephaly. Portions of the brain were extruded into a large frontal encephalocele. Cases of symmetrical facial duplication reported in the literature range from two complete faces on a single head (diprosopus) to simple nasal duplication. The variety of patterns of duplication suggests that the doubling of facial components arises in several different ways: Forking of the notochord, duplication of the prosencephalon, duplication of the olfactory placodes, and duplication of maxillary and/or mandibular growth centers around the margins of the stomatodeal plate. Among reported cases, the female:male ratio is 2:1.

  14. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms. (United States)

    Li, Zhen; Defoort, Jonas; Tasdighian, Setareh; Maere, Steven; Van de Peer, Yves; De Smet, Riet


    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of "gene duplicability" is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. © 2016 American Society of Plant Biologists. All rights reserved.

  15. Biliary tract duplication cyst with gastric heterotopia

    Energy Technology Data Exchange (ETDEWEB)

    Grumbach, K.; Baker, D.H.; Weigert, J.; Altman, R.P.


    Cystic duplications of the biliary tract are rare anomalies, easily mistaken for choledochal cysts. Surgical drainage is the preferred therapy for choledochal cyst, but cystic duplication necessitates surgical excision as duplications may contain heterotopic gastric mucosa leading to peptic ulceration of the biliary tract. We report a case of biliary tract duplication cyst containing heterotopic alimentary mucosa which had initially been diagnosed and surgically treated as a choledochal cyst.

  16. Biliary tract duplication cyst with gastric heterotopia

    International Nuclear Information System (INIS)

    Grumbach, K.; Baker, D.H.; Weigert, J.; Altman, R.P.


    Cystic duplications of the biliary tract are rare anomalies, easily mistaken for choledochal cysts. Surgical drainage is the preferred therapy for choledochal cyst, but cystic duplication necessitates surgical excision as duplications may contain heterotopic gastric mucosa leading to peptic ulceration of the biliary tract. We report a case of biliary tract duplication cyst containing heterotopic alimentary mucosa which had initially been diagnosed and surgically treated as a choledochal cyst. (orig.)

  17. Preliminary experiments of electronic duplication

    International Nuclear Information System (INIS)

    Fay, Bernard


    Systems of electron sputtering (at the unit scale) use as master mask a photocathode with localized emitting zones. Emitted electrons are accelerated and focussed on a silicon substrate covered with an electrosensitive resin. The very high definition associated with electron masking is obtained whatever the complexity of the master mask is, for a printing duration of the order of the minute. This is a duplication method without any contact that prevents the master mask from any mechanical erosion. Alignment of the successive masks is obtained from an electric signal directly usable through an automatic alignment system. Experiments using the apparatus for reproducing masks through an electronic image or ''electronic duplicator'' developed in Thomson-CSF Laboratory at Corbeville, are presented [fr

  18. Noncommunicating Isolated Enteric Duplication Cyst in the ...

    African Journals Online (AJOL)

    Noncommunicating isolated enteric duplications in the abdomen are an extremely rare variant of enteric duplications with their own blood supply. We report a case of a noncommunicating isolated ileal duplication in a 10-month-old boy. He was admitted because of severe abdominal distension and developed irritability ...

  19. Can traditional birth attendants be trained to accurately identify septic infants, initiate antibiotics, and refer in a rural African setting? (United States)

    Gill, Christopher John; MacLeod, William B; Phiri-Mazala, Grace; Guerina, Nicholas G; Mirochnick, Mark; Knapp, Anna B; Hamer, Davidson H


    Neonatal sepsis is a major cause of neonatal mortality. In populations with limited access to health care, early identification of bacterial infections and initiation of antibiotics by community health workers (CHWs) could be lifesaving. It is unknown whether this strategy would be feasible using traditional birth attendants (TBAs), a cadre of CHWs who typically have limited training and educational backgrounds. We analyzed data from the intervention arm of a cluster-randomized trial involving TBAs in Lufwanyama District, Zambia, from June 2006 to November 2008. TBAs followed neonates for signs of potential infection through 28 days of life. If any of 16 criteria were met, TBAs administered oral amoxicillin and facilitated referral to a rural health center. Our analysis included 1,889 neonates with final vital status by day 28. TBAs conducted a median of 2 (interquartile range 2-6) home visits (51.4% in week 1 and 48.2% in weeks 2-4) and referred 208 neonates (11%) for suspected sepsis. Of referred neonates, 176/208 (84.6%) completed their referral. Among neonates given amoxicillin, 171/183 (93.4%) were referred; among referred neonates, 171/208 (82.2%) received amoxicillin. Referral and/or initiation of antibiotics were strongly associated with neonatal death (for referral, relative risk [RR] = 7.93, 95% confidence interval [CI] = 4.4-14.3; for amoxicillin administration, RR = 4.7, 95% CI = 2.4-8.7). Neonates clinically judged to be "extremely sick" by the referring TBA were at greatest risk of death (RR = 8.61, 95% CI = 4.0-18.5). The strategy of administering a first dose of antibiotics and referring based solely on the clinical evaluation of a TBA is feasible and could be effective in reducing neonatal mortality in remote rural settings.

  20. Diagnostic performance of dental students in identifying mandibular condyle fractures by panoramic radiography and the usefulness of reference images

    International Nuclear Information System (INIS)

    Cho, Bong Hae


    The purpose of this study was to evaluate the diagnostic performance of dental students in detection of mandibular condyle fractures and the effectiveness of reference panoramic images. Forty-six undergraduates evaluated 25 panoramic radiographs for condylar fractures and the data were analyzed through receiver operating characteristic (ROC) analysis. After a month, they were divided into two homogeneous groups based on the first results and re-evaluated the images with (group A) or without (group B) reference images. Eight reference images included indications showing either typical condylar fractures or anatomic structures which could be confused with fractures. Paired t-test was used for statistical analysis of the difference between the first and the second evaluations for each group, and student's t-test was used between the two groups in the second evaluation. The intra- and inter-observer agreements were evaluated with Kappa statistics. Intra- and inter-observer agreements were substantial (k=0.66) and moderate (k=0.53), respectively. The area under the ROC curve (Az) in the first evaluation was 0.802. In the second evaluation, it was increased to 0.823 for group A and 0.814 for group B. The difference between the first and second evaluations for group A was statistically significant (p<0.05), however there was no statistically significant difference between the two groups in the second evaluation. Providing reference images to less experienced clinicians would be a good way to improve the diagnostic ability in detecting condylar fracture.

  1. Drosophila duplication hotspots are associated with late-replicating regions of the genome.

    Directory of Open Access Journals (Sweden)

    Margarida Cardoso-Moreira


    Full Text Available Duplications play a significant role in both extremes of the phenotypic spectrum of newly arising mutations: they can have severe deleterious effects (e.g. duplications underlie a variety of diseases but can also be highly advantageous. The phenotypic potential of newly arisen duplications has stimulated wide interest in both the mutational and selective processes shaping these variants in the genome. Here we take advantage of the Drosophila simulans-Drosophila melanogaster genetic system to further our understanding of both processes. Regarding mutational processes, the study of two closely related species allows investigation of the potential existence of shared duplication hotspots, and the similarities and differences between the two genomes can be used to dissect its underlying causes. Regarding selection, the difference in the effective population size between the two species can be leveraged to ask questions about the strength of selection acting on different classes of duplications. In this study, we conducted a survey of duplication polymorphisms in 14 different lines of D. simulans using tiling microarrays and combined it with an analogous survey for the D. melanogaster genome. By integrating the two datasets, we identified duplication hotspots conserved between the two species. However, unlike the duplication hotspots identified in mammalian genomes, Drosophila duplication hotspots are not associated with sequences of high sequence identity capable of mediating non-allelic homologous recombination. Instead, Drosophila duplication hotspots are associated with late-replicating regions of the genome, suggesting a link between DNA replication and duplication rates. We also found evidence supporting a higher effectiveness of selection on duplications in D. simulans than in D. melanogaster. This is also true for duplications segregating at high frequency, where we find evidence in D. simulans that a sizeable fraction of these mutations is

  2. MECP2 duplication phenotype in symptomatic females: report of three further cases


    Novara, Francesca; Simonati, Alessandro; Sicca, Federico; Battini, Roberta; Fiori, Simona; Contaldo, Annarita; Criscuolo, Lucia; Zuffardi, Orsetta; Ciccone, Roberto


    Background Xq28 duplications, including MECP2 (methyl CpG-binding protein 2; OMIM 300005), have been identified in approximately 140 male patients presenting with hypotonia, severe developmental delay/intellectual disability, limited or absent speech and ambulation, and recurrent respiratory infections. Female patients with Xq28 duplication have been rarely reported and are usually asymptomatic. Altogether, only fifteen symptomatic females with Xq28 duplications including MECP2 have been repo...

  3. Detection and correction of false segmental duplications caused by genome mis-assembly (United States)


    Diploid genomes with divergent chromosomes present special problems for assembly software as two copies of especially polymorphic regions may be mistakenly constructed, creating the appearance of a recent segmental duplication. We developed a method for identifying such false duplications and applied it to four vertebrate genomes. For each genome, we corrected mis-assemblies, improved estimates of the amount of duplicated sequence, and recovered polymorphisms between the sequenced chromosomes. PMID:20219098

  4. Rectal duplication cyst in an adult: the laparoscopic approach. (United States)

    Salameh, Jihad R; Votanopoulos, Konstantinos I; Hilal, Raouf E; Essien, Francis A; Williams, Michael D; Barroso, Alberto O; Sweeney, John F; Brunicardi, F Charles


    Rectal duplication cyst (RDC) is a rare congenital anomaly representing 1% to 8% of all intestinal duplications. The case presented here is the first report of the laparoscopic resection of an RDC. We report the case of a 49-year-old white woman in whom a retrorectal cystic mass measuring 5 x 5.3 x 6 cm was diagnosed. The mass was completely resected by means of laparoscopic techniques. Pathologic findings revealed a cystic structure partially lined with squamous as well as respiratory- and gastrointestinal-type epithelium. Muscularis propria was identified in the outer portions of the wall of the specimen. No atypia or malignancy was identified. The overall findings were consistent with an RDC. Laparoscopic resection constitutes an excellent and patient-friendly approach to the management of large adult cystic duplication of the rectum.

  5. Microevolution of Duplications and Deletions and Their Impact on Gene Expression in the Nematode Pristionchus pacificus.

    Directory of Open Access Journals (Sweden)

    Praveen Baskaran

    Full Text Available The evolution of diversity across the animal kingdom has been accompanied by tremendous gene loss and gain. While comparative genomics has been fruitful to characterize differences in gene content across highly diverged species, little is known about the microevolution of structural variations that cause these differences in the first place. In order to investigate the genomic impact of structural variations, we made use of genomic and transcriptomic data from the nematode Pristionchus pacificus, which has been established as a satellite model to Caenorhabditis elegans for comparative biology. We exploit the fact that P. pacificus is a highly diverse species for which various genomic data including the draft genome of a sister species P. exspectatus is available. Based on resequencing coverage data for two natural isolates we identified large (> 2 kb deletions and duplications relative to the reference strain. By restriction to completely syntenic regions between P. pacificus and P. exspectatus, we were able to polarize the comparison and to assess the impact of structural variations on expression levels. We found that while loss of genes correlates with lack of expression, duplication of genes has virtually no effect on gene expression. Further investigating expression of individual copies at sites that segregate between the duplicates, we found in the majority of cases only one of the copies to be expressed. Nevertheless, we still find that certain gene classes are strongly depleted in deletions as well as duplications, suggesting evolutionary constraint acting on synteny. In summary, our results are consistent with a model, where most structural variations are either deleterious or neutral and provide first insights into the microevolution of structural variations in the P. pacificus genome.

  6. How to Identify Negative Attitudes towards Inclusive Education: Critical Discourse Analysis of Russian Transcripts Using Role and Reference Grammar

    Directory of Open Access Journals (Sweden)

    Mariia Rubtcova


    Full Text Available This paper presents the Role and Reference Grammar (RRG analysis that aims to reveal possibilities required for carrying out the interdisciplinary research development within Critical Discourse Analysis (CDA. It takes a closer look at conflicts, considering the example of a conflict situation occurred in reaction to the opening of the inclusive academic programme at one of St. Petersburg’s secondary schools. Role and Reference Grammar application demonstrates that the use of different verb types and macroroles has led to the various interpretations. These findings confirm that RRG could influence the increase of objectivity of the transcript analysis in qualitative social research. RRG provides new information which in combination with other methods can help us to understand the positions of participants involved into conflicts

  7. Appendicular Skeletal Muscle Mass Reference Values and the Peak Muscle Mass to Identify Sarcopenia among Iranian Healthy Population. (United States)

    Shafiee, Gita; Ostovar, Afshin; Heshmat, Ramin; Keshtkar, Abbas Ali; Sharifi, Farshad; Shadman, Zhaleh; Nabipour, Iraj; Soltani, Akbar; Larijani, Bagher


    Sacopenia is a common problem in elderly with the adverse outcomes. The objective of this study was to estimate the peak appendicular skeletal muscle mass (ASM) and age of its attainment by sex among the Iranian population. A total of 691 men and women aged 18-94 years participated in this cross-sectional, population-based study in Bushehr, Iran. ASM was measured by dual X-ray absorptiometry. Cutoff points for men and women were established considering two standard deviations (SDs) below the mean values of the skeletal muscle index (SMI) for young reference groups. The relationship between ASM and age was described by the second-degree regression models. Two SDs below the mean SMIs of reference groups were as cutoff values of low muscle mass in Iranian population. The peak ASM values were 21.35 ± 0.12 Kg and 13.68 ± 0.10 Kg, and the age at peak ASM were 26 (24-28) years and 34 (33-35) years for men and women, respectively. Mean and SD of SMI in those ages were 7.01 ± 0.02 Kg/m 2 and 5.44 ± 0.02 Kg/m 2 among men and women, respectively. Calculated cutoff values of low muscle mass among the Iranian population were 7.0 Kg/m 2 and 5.4 Kg/m 2 among men and women, respectively. Iranian reference values of SMI for both genders were similar to Asia Working Group for Sarcopenia recommendation and lower than the United States and European values. Further studies from different nations and the Middle East countries are needed to obtain reference values for populations, enabling the researchers for comparison and also more valid reports on sarcopenia prevalence.

  8. Diagnostic performance of dental students in identifying mandibular condyle fractures by panoramic radiography and the usefulness of reference images

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Bong Hae [School of Dentistry, Pusan National University, Pusan (Korea, Republic of)


    The purpose of this study was to evaluate the diagnostic performance of dental students in detection of mandibular condyle fractures and the effectiveness of reference panoramic images. Forty-six undergraduates evaluated 25 panoramic radiographs for condylar fractures and the data were analyzed through receiver operating characteristic (ROC) analysis. After a month, they were divided into two homogeneous groups based on the first results and re-evaluated the images with (group A) or without (group B) reference images. Eight reference images included indications showing either typical condylar fractures or anatomic structures which could be confused with fractures. Paired t-test was used for statistical analysis of the difference between the first and the second evaluations for each group, and student's t-test was used between the two groups in the second evaluation. The intra- and inter-observer agreements were evaluated with Kappa statistics. Intra- and inter-observer agreements were substantial (k=0.66) and moderate (k=0.53), respectively. The area under the ROC curve (Az) in the first evaluation was 0.802. In the second evaluation, it was increased to 0.823 for group A and 0.814 for group B. The difference between the first and second evaluations for group A was statistically significant (p<0.05), however there was no statistically significant difference between the two groups in the second evaluation. Providing reference images to less experienced clinicians would be a good way to improve the diagnostic ability in detecting condylar fracture.

  9. Duplicability of self-interacting human genes.

    LENUS (Irish Health Repository)

    Pérez-Bercoff, Asa


    BACKGROUND: There is increasing interest in the evolution of protein-protein interactions because this should ultimately be informative of the patterns of evolution of new protein functions within the cell. One model proposes that the evolution of new protein-protein interactions and protein complexes proceeds through the duplication of self-interacting genes. This model is supported by data from yeast. We examined the relationship between gene duplication and self-interaction in the human genome. RESULTS: We investigated the patterns of self-interaction and duplication among 34808 interactions encoded by 8881 human genes, and show that self-interacting proteins are encoded by genes with higher duplicability than genes whose proteins lack this type of interaction. We show that this result is robust against the system used to define duplicate genes. Finally we compared the presence of self-interactions amongst proteins whose genes have duplicated either through whole-genome duplication (WGD) or small-scale duplication (SSD), and show that the former tend to have more interactions in general. After controlling for age differences between the two sets of duplicates this result can be explained by the time since the gene duplication. CONCLUSIONS: Genes encoding self-interacting proteins tend to have higher duplicability than proteins lacking self-interactions. Moreover these duplicate genes have more often arisen through whole-genome rather than small-scale duplication. Finally, self-interacting WGD genes tend to have more interaction partners in general in the PIN, which can be explained by their overall greater age. This work adds to our growing knowledge of the importance of contextual factors in gene duplicability.

  10. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms[OPEN (United States)

    Li, Zhen; Van de Peer, Yves; De Smet, Riet


    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of “gene duplicability” is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. PMID:26744215

  11. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew


    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  12. Comparative inference of duplicated genes produced by polyploidization in soybean genome. (United States)

    Yang, Yanmei; Wang, Jinpeng; Di, Jianyong


    Soybean (Glycine max) is one of the most important crop plants for providing protein and oil. It is important to investigate soybean genome for its economic and scientific value. Polyploidy is a widespread and recursive phenomenon during plant evolution, and it could generate massive duplicated genes which is an important resource for genetic innovation. Improved sequence alignment criteria and statistical analysis are used to identify and characterize duplicated genes produced by polyploidization in soybean. Based on the collinearity method, duplicated genes by whole genome duplication account for 70.3% in soybean. From the statistical analysis of the molecular distances between duplicated genes, our study indicates that the whole genome duplication event occurred more than once in the genome evolution of soybean, which is often distributed near the ends of chromosomes.

  13. The ethics of scholarly publishing: exploring differences in plagiarism and duplicate publication across nations* (United States)

    Amos, Kathleen A.


    This study explored national differences in plagiarism and duplicate publication in retracted biomedical literature. The national affiliations of authors and reasons for retraction of papers accessible through PubMed that were published from 2008 to 2012 and subsequently retracted were determined in order to identify countries with the largest numbers and highest rates of retraction due to plagiarism and duplicate publication. Authors from more than fifty countries retracted papers. While the United States retracted the most papers, China retracted the most papers for plagiarism and duplicate publication. Rates of plagiarism and duplicate publication were highest in Italy and Finland, respectively. Unethical publishing practices cut across nations. PMID:24860263

  14. The ethics of scholarly publishing: exploring differences in plagiarism and duplicate publication across nations. (United States)

    Amos, Kathleen A


    This study explored national differences in plagiarism and duplicate publication in retracted biomedical literature. The national affiliations of authors and reasons for retraction of papers accessible through PubMed that were published from 2008 to 2012 and subsequently retracted were determined in order to identify countries with the largest numbers and highest rates of retraction due to plagiarism and duplicate publication. Authors from more than fifty countries retracted papers. While the United States retracted the most papers, China retracted the most papers for plagiarism and duplicate publication. Rates of plagiarism and duplicate publication were highest in Italy and Finland, respectively. Unethical publishing practices cut across nations.

  15. Error analysis of filtering operations in pixel-duplicated images of diabetic retinopathy (United States)

    Mehrubeoglu, Mehrube; McLauchlan, Lifford


    In this paper, diabetic retinopathy is chosen for a sample target image to demonstrate the effectiveness of image enlargement through pixel duplication in identifying regions of interest. Pixel duplication is presented as a simpler alternative to data interpolation techniques for detecting small structures in the images. A comparative analysis is performed on different image processing schemes applied to both original and pixel-duplicated images. Structures of interest are detected and and classification parameters optimized for minimum false positive detection in the original and enlarged retinal pictures. The error analysis demonstrates the advantages as well as shortcomings of pixel duplication in image enhancement when spatial averaging operations (smoothing filters) are also applied.

  16. Recurrent duplications of 17q12 associated with variable phenotypes

    DEFF Research Database (Denmark)

    Mitchell, Elyse; Douglas, Andrew; Kjaegaard, Susanne


    The ability to identify the clinical nature of the recurrent duplication of chromosome 17q12 has been limited by its rarity and the diverse range of phenotypes associated with this genomic change. In order to further define the clinical features of affected patients, detailed clinical information......, potentially contributory copy number changes in a subset of patients, including one patient each with 16p11.2 deletion and 15q13.3 deletion. Our data further define and expand the clinical spectrum associated with duplications of 17q12 and provide support for the role of genomic modifiers contributing...... to phenotypic variability....

  17. The sequence and analysis of duplication rich human chromosome 16

    Energy Technology Data Exchange (ETDEWEB)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.


    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  18. The Sequence and Analysis of Duplication Rich Human Chromosome 16 (United States)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.


    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  19. Development of the regional EPR and PACS sharing system on the infrastructure of cloud computing technology controlled by patient identifier cross reference manager. (United States)

    Kondoh, Hiroshi; Teramoto, Kei; Kawai, Tatsurou; Mochida, Maki; Nishimura, Motohiro


    A Newly developed Oshidori-Net2, providing medical professionals with remote access to electronic patient record systems (EPR) and PACSs of four hospitals, of different venders, using cloud computing technology and patient identifier cross reference manager. The operation was started from April 2012. The patients moved to other hospital were applied. Objective is to show the merit and demerit of the new system.

  20. Intragenic duplication: a novel mutational mechanism in hereditary pancreatitis

    DEFF Research Database (Denmark)

    Joergensen, Maiken T; Geisz, Andrea; Brusgaard, Klaus


    In a hereditary pancreatitis family from Denmark, we identified a novel intragenic duplication of 9 nucleotides in exon-2 of the human cationic trypsinogen (PRSS1) gene (c.63_71dup) which at the amino-acid level resulted in the insertion of 3 amino acids within the activation peptide of cationic...

  1. Genetics Home Reference: 16p11.2 duplication (United States)

    ... if a disorder seems to run in my family? What are the different ways in which a genetic condition can be ... Children's Hospital: Autism Spectrum Disorders National Institute on Deafness and Other Communication ...

  2. Genetics Home Reference: 22q11.2 duplication (United States)

    ... 17 [updated 2013 Nov 21]. In: Pagon RA, Adam MP, Ardinger HH, Wallace SE, Amemiya A, Bean LJH, Bird TD, Ledbetter N, Mefford HC, Smith RJH, Stephens K, editors. GeneReviews® [Internet]. Seattle (WA): ...

  3. Identifying Stable Reference Genes for qRT-PCR Normalisation in Gene Expression Studies of Narrow-Leafed Lupin (Lupinus angustifolius L..

    Directory of Open Access Journals (Sweden)

    Candy M Taylor

    Full Text Available Quantitative Reverse Transcription PCR (qRT-PCR is currently one of the most popular, high-throughput and sensitive technologies available for quantifying gene expression. Its accurate application depends heavily upon normalisation of gene-of-interest data with reference genes that are uniformly expressed under experimental conditions. The aim of this study was to provide the first validation of reference genes for Lupinus angustifolius (narrow-leafed lupin, a significant grain legume crop using a selection of seven genes previously trialed as reference genes for the model legume, Medicago truncatula. In a preliminary evaluation, the seven candidate reference genes were assessed on the basis of primer specificity for their respective targeted region, PCR amplification efficiency, and ability to discriminate between cDNA and gDNA. Following this assessment, expression of the three most promising candidates [Ubiquitin C (UBC, Helicase (HEL, and Polypyrimidine tract-binding protein (PTB] was evaluated using the NormFinder and RefFinder statistical algorithms in two narrow-leafed lupin lines, both with and without vernalisation treatment, and across seven organ types (cotyledons, stem, leaves, shoot apical meristem, flowers, pods and roots encompassing three developmental stages. UBC was consistently identified as the most stable candidate and has sufficiently uniform expression that it may be used as a sole reference gene under the experimental conditions tested here. However, as organ type and developmental stage were associated with greater variability in relative expression, it is recommended using UBC and HEL as a pair to achieve optimal normalisation. These results highlight the importance of rigorously assessing candidate reference genes for each species across a diverse range of organs and developmental stages. With emerging technologies, such as RNAseq, and the completion of valuable transcriptome data sets, it is possible that other

  4. Verification and characterization of chromosome duplication in haploid maize. (United States)

    de Oliveira Couto, E G; Resende Von Pinho, E V; Von Pinho, R G; Veiga, A D; de Carvalho, M R; de Oliveira Bustamante, F; Nascimento, M S


    Doubled haploid technology has been used by various private companies. However, information regarding chromosome duplication methodologies, particularly those concerning techniques used to identify duplication in cells, is limited. Thus, we analyzed and characterized artificially doubled haploids using microsatellites molecular markers, pollen viability, and flow cytometry techniques. Evaluated material was obtained using two different chromosome duplication protocols in maize seeds considered haploids, resulting from the cross between the haploid inducer line KEMS and 4 hybrids (GNS 3225, GNS 3032, GNS 3264, and DKB 393). Fourteen days after duplication, plant samples were collected and assessed by flow cytometry. Further, the plants were transplanted to a field, and samples were collected for DNA analyses using microsatellite markers. The tassels were collected during anthesis for pollen viability analyses. Haploid, diploid, and mixoploid individuals were detected using flow cytometry, demonstrating that this technique was efficient for identifying doubled haploids. The microsatellites markers were also efficient for confirming the ploidies preselected by flow cytometry and for identifying homozygous individuals. Pollen viability showed a significant difference between the evaluated ploidies when the Alexander and propionic-carmin stains were used. The viability rates between the plodies analyzed show potential for fertilization.

  5. Different clinical presentations, diagnostic difficulties, and management of cecal duplication. (United States)

    Temiz, Abdulkerim; Oğuzkurt, Pelin; Ezer, Semire Serin; İnce, Emine; Gezer, Hasan Özkan; Hiçsönmez, Akgün


    Cecal duplications (CDs) are very rare, representing 0.4% of all gastrointestinal duplications. This study evaluates the variable clinical presentations, imaging workup, and surgical management of CDs. The records of 7 patients who underwent surgery between April 2001 and December 2011 for CD were retrospectively reviewed. Sex, age, duration of complaints, diagnostic studies, surgical intervention, and pathologic findings were recorded. The median age was 8 months, and mean age was 1.65 ± 2.88 years. Complaints were abdominal pain, rectal bleeding, vomiting, cough and dyspnea, and a prenatally detected cystic mass. The patients were referred with the diagnosis of appendicular abscess, necrotizing enterocolitis, gastrointestinal lymphoma, and intraabdominal cystic mass. Abdominal distention, signs of peritonitis, substernal retraction, fullness at right lower quadrant, and normal findings were detected on physical examination. Diagnostic imaging included plain abdominal radiography (7), ultrasonography (7), computed tomography (3), and magnetic resonance imaging (2). A cystic mass was reported on radiologic studies in 6 patients and appendicular abscess in 1. Cyst and cecum were resected, ileocolostomy was performed in 6 patients, and cyst excision was performed in 1. The diagnosis of duplication cyst was made by pathologic examination in all patients. Cecal duplications may be detected incidentally; however, they may mimic appendicular abscess, a tumor mass, or necrotizing enterocolitis. Whether cystic lesions are symptomatic, they should be excised when detected because of possible complications. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. North Carolina macular dystrophy (MCDR1) caused by a novel tandem duplication of the PRDM13 gene. (United States)

    Bowne, Sara J; Sullivan, Lori S; Wheaton, Dianna K; Locke, Kirsten G; Jones, Kaylie D; Koboldt, Daniel C; Fulton, Robert S; Wilson, Richard K; Blanton, Susan H; Birch, David G; Daiger, Stephen P


    To identify the underlying cause of disease in a large family with North Carolina macular dystrophy (NCMD). A large four-generation family (RFS355) with an autosomal dominant form of NCMD was ascertained. Family members underwent comprehensive visual function evaluations. Blood or saliva from six affected family members and three unaffected spouses was collected and DNA tested for linkage to the MCDR1 locus on chromosome 6q12. Three affected family members and two unaffected spouses underwent whole exome sequencing (WES) and subsequently, custom capture of the linkage region followed by next-generation sequencing (NGS). Standard PCR and dideoxy sequencing were used to further characterize the mutation. Of the 12 eyes examined in six affected individuals, all but two had Gass grade 3 macular degeneration features. Large central excavation of the retinal and choroid layers, referred to as a macular caldera, was seen in an age-independent manner in the grade 3 eyes. The calderas are unique to affected individuals with MCDR1. Genome-wide linkage mapping and haplotype analysis of markers from the chromosome 6q region were consistent with linkage to the MCDR1 locus. Whole exome sequencing and custom-capture NGS failed to reveal any rare coding variants segregating with the phenotype. Analysis of the custom-capture NGS sequencing data for copy number variants uncovered a tandem duplication of approximately 60 kb on chromosome 6q. This region contains two genes, CCNC and PRDM13 . The duplication creates a partial copy of CCNC and a complete copy of PRDM13 . The duplication was found in all affected members of the family and is not present in any unaffected members. The duplication was not seen in 200 ethnically matched normal chromosomes. The cause of disease in the original family with MCDR1 and several others has been recently reported to be dysregulation of the PRDM13 gene, caused by either single base substitutions in a DNase 1 hypersensitive site upstream of the CCNC

  7. Social network analysis of duplicative prescriptions: One-month analysis of medical facilities in Japan. (United States)

    Takahashi, Yoshimitsu; Ishizaki, Tatsuro; Nakayama, Takeo; Kawachi, Ichiro


    Duplicative prescriptions refer to situations in which patients receive medications for the same condition from two or more sources. Health officials in Japan have expressed concern about medical "waste" resulting from this practices. We sought to conduct descriptive analysis of duplicative prescriptions using social network analysis and to report their prevalence across ages. We analyzed a health insurance claims database including 1.24 million people from December 2012. Through social network analysis, we examined the duplicative prescription networks, representing each medical facility as nodes, and individual prescriptions for patients as edges. The prevalence of duplicative prescription for any drug class was strongly correlated with its frequency of prescription (r=0.90). Among patients aged 0-19, cough and colds drugs showed the highest prevalence of duplicative prescriptions (10.8%). Among people aged 65 and over, antihypertensive drugs had the highest frequency of prescriptions, but the prevalence of duplicative prescriptions was low (0.2-0.3%). Social network analysis revealed clusters of facilities connected via duplicative prescriptions, e.g., psychotropic drugs showed clustering due to a few patients receiving drugs from 10 or more facilities. Overall, the prevalence of duplicative prescriptions was quite low - less than 10% - although the extent of the problem varied by drug class and age group. Our approach illustrates the potential utility of using a social network approach to understand these practices. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  8. Bilateral duplication of the internal auditory canal

    International Nuclear Information System (INIS)

    Weon, Young Cheol; Kim, Jae Hyoung; Choi, Sung Kyu; Koo, Ja-Won


    Duplication of the internal auditory canal is an extremely rare temporal bone anomaly that is believed to result from aplasia or hypoplasia of the vestibulocochlear nerve. We report bilateral duplication of the internal auditory canal in a 28-month-old boy with developmental delay and sensorineural hearing loss. (orig.)

  9. Clinical Fact of Rectal Duplication with gastric heterotopy | Atmani ...

    African Journals Online (AJOL)

    Enteric duplication could occur through the entire alimentary tract. A case of rectal duplication cyst with heterotopic gastric mucosa in a chid is described. MRI scan is shown useful in the diagnosis of the duplication. The treatment is the complete local resection of the rectal duplication. Keywords: duplication, rectal, MRI, ...

  10. Evolution of vertebrate central nervous system is accompanied by novel expression changes of duplicate genes. (United States)

    Chen, Yuan; Ding, Yun; Zhang, Zuming; Wang, Wen; Chen, Jun-Yuan; Ueno, Naoto; Mao, Bingyu


    The evolution of the central nervous system (CNS) is one of the most striking changes during the transition from invertebrates to vertebrates. As a major source of genetic novelties, gene duplication might play an important role in the functional innovation of vertebrate CNS. In this study, we focused on a group of CNS-biased genes that duplicated during early vertebrate evolution. We investigated the tempo-spatial expression patterns of 33 duplicate gene families and their orthologs during the embryonic development of the vertebrate Xenopus laevis and the cephalochordate Brachiostoma belcheri. Almost all the identified duplicate genes are differentially expressed in the CNS in Xenopus embryos, and more than 50% and 30% duplicate genes are expressed in the telencephalon and mid-hindbrain boundary, respectively, which are mostly considered as two innovations in the vertebrate CNS. Interestingly, more than 50% of the amphioxus orthologs do not show apparent expression in the CNS in amphioxus embryos as detected by in situ hybridization, indicating that some of the vertebrate CNS-biased duplicate genes might arise from non-CNS genes in invertebrates. Our data accentuate the functional contribution of gene duplication in the CNS evolution of vertebrate and uncover an invertebrate non-CNS history for some vertebrate CNS-biased duplicate genes. Copyright © 2011. Published by Elsevier Ltd.

  11. Role of computed tomography in oesophageal duplications. Report of two cases

    International Nuclear Information System (INIS)

    Jouini, S.; Menif, E.; Azaiez, N.; Ben Hajel, H.; Cheikh, I.; Ben Ammar, A.; Sellami, M.; Ben Jaafar, M.


    The authors present two cases of esophageal duplication: tubular in one case and cystic in the other. This rare anomaly was identified in both cases by CT scan. A review of literature is proposed. (authors). 22 refs., 10 figs

  12. An administrative data validation study of the accuracy of algorithms for identifying rheumatoid arthritis: the influence of the reference standard on algorithm performance. (United States)

    Widdifield, Jessica; Bombardier, Claire; Bernatsky, Sasha; Paterson, J Michael; Green, Diane; Young, Jacqueline; Ivers, Noah; Butt, Debra A; Jaakkimainen, R Liisa; Thorne, J Carter; Tu, Karen


    We have previously validated administrative data algorithms to identify patients with rheumatoid arthritis (RA) using rheumatology clinic records as the reference standard. Here we reassessed the accuracy of the algorithms using primary care records as the reference standard. We performed a retrospective chart abstraction study using a random sample of 7500 adult patients under the care of 83 family physicians contributing to the Electronic Medical Record Administrative data Linked Database (EMRALD) in Ontario, Canada. Using physician-reported diagnoses as the reference standard, we computed and compared the sensitivity, specificity, and predictive values for over 100 administrative data algorithms for RA case ascertainment. We identified 69 patients with RA for a lifetime RA prevalence of 0.9%. All algorithms had excellent specificity (>97%). However, sensitivity varied (75-90%) among physician billing algorithms. Despite the low prevalence of RA, most algorithms had adequate positive predictive value (PPV; 51-83%). The algorithm of "[1 hospitalization RA diagnosis code] or [3 physician RA diagnosis codes with ≥1 by a specialist over 2 years]" had a sensitivity of 78% (95% CI 69-88), specificity of 100% (95% CI 100-100), PPV of 78% (95% CI 69-88) and NPV of 100% (95% CI 100-100). Administrative data algorithms for detecting RA patients achieved a high degree of accuracy amongst the general population. However, results varied slightly from our previous report, which can be attributed to differences in the reference standards with respect to disease prevalence, spectrum of disease, and type of comparator group.

  13. A comprehensive approach to identify reliable reference gene candidates to investigate the link between alcoholism and endocrinology in Sprague-Dawley rats.

    Directory of Open Access Journals (Sweden)

    Faten A Taki

    Full Text Available Gender and hormonal differences are often correlated with alcohol dependence and related complications like addiction and breast cancer. Estrogen (E2 is an important sex hormone because it serves as a key protein involved in organism level signaling pathways. Alcoholism has been reported to affect estrogen receptor signaling; however, identifying the players involved in such multi-faceted syndrome is complex and requires an interdisciplinary approach. In many situations, preliminary investigations included a straight forward, yet informative biotechniques such as gene expression analyses using quantitative real time PCR (qRT-PCR. The validity of qRT-PCR-based conclusions is affected by the choice of reliable internal controls. With this in mind, we compiled a list of 15 commonly used housekeeping genes (HKGs as potential reference gene candidates in rat biological models. A comprehensive comparison among 5 statistical approaches (geNorm, dCt method, NormFinder, BestKeeper, and RefFinder was performed to identify the minimal number as well the most stable reference genes required for reliable normalization in experimental rat groups that comprised sham operated (SO, ovariectomized rats in the absence (OVX or presence of E2 (OVXE2. These rat groups were subdivided into subgroups that received alcohol in liquid diet or isocalroic control liquid diet for 12 weeks. Our results showed that U87, 5S rRNA, GAPDH, and U5a were the most reliable gene candidates for reference genes in heart and brain tissue. However, different gene stability ranking was specific for each tissue input combination. The present preliminary findings highlight the variability in reference gene rankings across different experimental conditions and analytic methods and constitute a fundamental step for gene expression assays.

  14. Independent Origin and Global Distribution of Distinct Plasmodium vivax Duffy Binding Protein Gene Duplications.

    Directory of Open Access Journals (Sweden)

    Jessica B Hostetler


    Full Text Available Plasmodium vivax causes the majority of malaria episodes outside Africa, but remains a relatively understudied pathogen. The pathology of P. vivax infection depends critically on the parasite's ability to recognize and invade human erythrocytes. This invasion process involves an interaction between P. vivax Duffy Binding Protein (PvDBP in merozoites and the Duffy antigen receptor for chemokines (DARC on the erythrocyte surface. Whole-genome sequencing of clinical isolates recently established that some P. vivax genomes contain two copies of the PvDBP gene. The frequency of this duplication is particularly high in Madagascar, where there is also evidence for P. vivax infection in DARC-negative individuals. The functional significance and global prevalence of this duplication, and whether there are other copy number variations at the PvDBP locus, is unknown.Using whole-genome sequencing and PCR to study the PvDBP locus in P. vivax clinical isolates, we found that PvDBP duplication is widespread in Cambodia. The boundaries of the Cambodian PvDBP duplication differ from those previously identified in Madagascar, meaning that current molecular assays were unable to detect it. The Cambodian PvDBP duplication did not associate with parasite density or DARC genotype, and ranged in prevalence from 20% to 38% over four annual transmission seasons in Cambodia. This duplication was also present in P. vivax isolates from Brazil and Ethiopia, but not India.PvDBP duplications are much more widespread and complex than previously thought, and at least two distinct duplications are circulating globally. The same duplication boundaries were identified in parasites from three continents, and were found at high prevalence in human populations where DARC-negativity is essentially absent. It is therefore unlikely that PvDBP duplication is associated with infection of DARC-negative individuals, but functional tests will be required to confirm this hypothesis.

  15. Duplicate Record Elimination in Large Data Files. (United States)


    UNCLASSIFIJED CSTR -445 NL LmEE~hhE - I1.0 . 111112----5 1.~4 __112 ___IL25_ 1.4 111111.6 EI24 COMPUTER SCIENCES DEPARTMENT oUniversity of Wisconsin...we propose a combinatorial model for the use in the analysis of algorithms for duplicate elimination. We contend that this model can serve as a...duplicates in a multiset of records, knowing the size of the multiset and the number of distinct records in it. 3. Algorithms for Duplicate Elimination

  16. A large duplication involving the IHH locus mimics acrocallosal syndrome. (United States)

    Yuksel-Apak, Memnune; Bögershausen, Nina; Pawlik, Barbara; Li, Yun; Apak, Selcuk; Uyguner, Oya; Milz, Esther; Nürnberg, Gudrun; Karaman, Birsen; Gülgören, Ayan; Grzeschik, Karl-Heinz; Nürnberg, Peter; Kayserili, Hülya; Wollnik, Bernd


    Indian hedgehog (Ihh) signaling is a major determinant of various processes during embryonic development and has a pivotal role in embryonic skeletal development. A specific spatial and temporal expression of Ihh within the developing limb buds is essential for accurate digit outgrowth and correct digit number. Although missense mutations in IHH cause brachydactyly type A1, small tandem duplications involving the IHH locus have recently been described in patients with mild syndactyly and craniosynostosis. In contrast, a ∼600-kb deletion 5' of IHH in the doublefoot mouse mutant (Dbf) leads to severe polydactyly without craniosynostosis, but with craniofacial dysmorphism. We now present a patient resembling acrocallosal syndrome (ACS) with extensive polysyndactyly of the hands and feet, craniofacial abnormalities including macrocephaly, agenesis of the corpus callosum, dysplastic and low-set ears, severe hypertelorism and profound psychomotor delay. Single-nucleotide polymorphism (SNP) array copy number analysis identified a ∼900-kb duplication of the IHH locus, which was confirmed by an independent quantitative method. A fetus from a second pregnancy of the mother by a different spouse showed similar craniofacial and limb malformations and the same duplication of the IHH-locus. We defined the exact breakpoints and showed that the duplications are identical tandem duplications in both sibs. No copy number changes were observed in the healthy mother. To our knowledge, this is the first report of a human phenotype similar to the Dbf mutant and strikingly overlapping with ACS that is caused by a copy number variation involving the IHH locus on chromosome 2q35.

  17. Partial Duplication of Chromosome 8p

    African Journals Online (AJOL)


    The partial chromosome 8p duplication is a rare syndrome and is ... abnormality of maternal origin that ... second trimester by vaginal bleeding and ... echocardiography, brain CT scan and. MRI. Fig. 1:Conventional karyotype of case 3 showing.

  18. Case Report Duplication Of Gastrointestinal Tract

    African Journals Online (AJOL)

    duplication (Fig 3). A tragic event occurred intra-operatively when ... Brain damage persisted and all modalities of treatment were terminated upon confirmation of brain death. ... compression, epithelial recanalization, and vascular accidents (6) ...

  19. Rectal duplication cyst in a cat. (United States)

    Kook, Peter H; Hagen, Regine; Willi, Barbara; Ruetten, Maja; Venzin, Claudio


    Enteric duplication is a rare developmental malformation in people, dogs and cats. The purpose of the present report is to describe the first case of a rectal duplication cyst in a 7-year-old domestic shorthair cat presenting for acute constipation and tenesmus. On rectal palpation a spherical mass compressing the lumen of the rectum could be felt in the dorsal wall of the rectum. A computed tomography (CT) scan confirmed the presence of a well demarcated cystic lesion in the pelvic canal, dorsal to the rectum. The cyst was surgically removed via a perineal approach. No communication with the rectal lumen could be demonstrated. Histopathological examination was consistent with a rectal duplication cyst. Clinical signs resolved completely after excision of this conjoined non-communicating cystic rectal duplicate. Copyright © 2010 ISFM and AAFP. Published by Elsevier Ltd. All rights reserved.

  20. [Rectal duplication cyst--case report]. (United States)

    Turyna, R; Horák, L; Kucera, E; Hejda, V; Krofta, L; Feyereisl, J


    The authors demonstrate a rare case of duplication anomaly of the rectum. Case report. Institute for the Care of Mother and Child, Prague. We present a rare case of cystic rectal duplication in adult, completely removed and histologically confirmed. A literature review was summarized. The case was complicated by delay in diagnosis, multiple operations, and by the association with endometriosis, as well. Mentioned anomaly is published in the Czech literature for the very first time.

  1. [Total tubular colonic duplication in a neonate with rectal bleeding: value of the endoscopy in the diagnose and treatment]. (United States)

    Piñera, M J Guirao; Morote, J M Sánchez; Bermejo, J P Hernández; Vallejo, O Girón; Alberca, F; Ruiz, S Chacón; Serradilla, J L Roqués; Carmona, G A Zambudio; Cantó, M A Gutiérrez


    Gastrointestinal duplication is an infrequent congenital abnormality. Colonic and tubular duplications are the least common. In neonates there are few described cases. It's difficult to identify the duplication preoperatively and a standard surgical approach has not been developped. We report a neonate with bleeding of the digestive tube who presented a colonic duplication who required multiple diagnostic test before the diagnosis was made for colonoscopy. Laparotomy showed a total tubular duplication of the right, transverse and left colon with proximal and distal communication. Exclusion of the duplicated segment was performed, but three months after the operation, subocclusion due to stenosis of the colonic distal loop was developed. This finding was confirmed by a second colonoscopy and septum was partially removed. The study implies that CD, though uncommon, should be included in the differential diagnosis of rectal bleeding and the importance of the colonoscopy in the diagnosis and treatment of this malformation.

  2. Recurrent rectal prolapse caused by colonic duplication in a dog. (United States)

    Landon, B P; Abraham, L A; Charles, J A; Edwards, G A


    A 9-month-old female Shar Pei cross-bred dog was presented with a history of recurrent rectal prolapse over 7 months. Repeated reduction and anal purse string sutures and subsequent incisional colopexy failed to prevent recurrent rectal prolapse. Digital rectal examination following reduction of the prolapse identified a faeces-filled sac within the ventral wall of the rectum and an orifice in the ventral colonic wall, cranial to the pubic brim. A ventral, communicating tubular colonic duplication was diagnosed by means of a barium enema. Surgical excision of the duplicated colonic tube was performed via a caudal ventral midline laparotomy. At 20 weeks post-operation, there has been no recurrence of rectal prolapse.

  3. Evolution of Cis-Regulatory Elements and Regulatory Networks in Duplicated Genes of Arabidopsis. (United States)

    Arsovski, Andrej A; Pradinuk, Julian; Guo, Xu Qiu; Wang, Sishuo; Adams, Keith L


    Plant genomes contain large numbers of duplicated genes that contribute to the evolution of new functions. Following duplication, genes can exhibit divergence in their coding sequence and their expression patterns. Changes in the cis-regulatory element landscape can result in changes in gene expression patterns. High-throughput methods developed recently can identify potential cis-regulatory elements on a genome-wide scale. Here, we use a recent comprehensive data set of DNase I sequencing-identified cis-regulatory binding sites (footprints) at single-base-pair resolution to compare binding sites and network connectivity in duplicated gene pairs in Arabidopsis (Arabidopsis thaliana). We found that duplicated gene pairs vary greatly in their cis-regulatory element architecture, resulting in changes in regulatory network connectivity. Whole-genome duplicates (WGDs) have approximately twice as many footprints in their promoters left by potential regulatory proteins than do tandem duplicates (TDs). The WGDs have a greater average number of footprint differences between paralogs than TDs. The footprints, in turn, result in more regulatory network connections between WGDs and other genes, forming denser, more complex regulatory networks than shown by TDs. When comparing regulatory connections between duplicates, WGDs had more pairs in which the two genes are either partially or fully diverged in their network connections, but fewer genes with no network connections than the TDs. There is evidence of younger TDs and WGDs having fewer unique connections compared with older duplicates. This study provides insights into cis-regulatory element evolution and network divergence in duplicated genes. © 2015 American Society of Plant Biologists. All Rights Reserved.

  4. Analyses of Tissue Culture Adaptation of Human Herpesvirus-6A by Whole Genome Deep Sequencing Redefines the Reference Sequence and Identifies Virus Entry Complex Changes. (United States)

    Tweedy, Joshua G; Escriva, Eric; Topf, Maya; Gompels, Ursula A


    Tissue-culture adaptation of viruses can modulate infection. Laboratory passage and bacterial artificial chromosome (BAC)mid cloning of human cytomegalovirus, HCMV, resulted in genomic deletions and rearrangements altering genes encoding the virus entry complex, which affected cellular tropism, virulence, and vaccine development. Here, we analyse these effects on the reference genome for related betaherpesviruses, Roseolovirus, human herpesvirus 6A (HHV-6A) strain U1102. This virus is also naturally "cloned" by germline subtelomeric chromosomal-integration in approximately 1% of human populations, and accurate references are key to understanding pathological relationships between exogenous and endogenous virus. Using whole genome next-generation deep-sequencing Illumina-based methods, we compared the original isolate to tissue-culture passaged and the BACmid-cloned virus. This re-defined the reference genome showing 32 corrections and 5 polymorphisms. Furthermore, minor variant analyses of passaged and BACmid virus identified emerging populations of a further 32 single nucleotide polymorphisms (SNPs) in 10 loci, half non-synonymous indicating cell-culture selection. Analyses of the BAC-virus genome showed deletion of the BAC cassette via loxP recombination removing green fluorescent protein (GFP)-based selection. As shown for HCMV culture effects, select HHV-6A SNPs mapped to genes encoding mediators of virus cellular entry, including virus envelope glycoprotein genes gB and the gH/gL complex. Comparative models suggest stabilisation of the post-fusion conformation. These SNPs are essential to consider in vaccine-design, antimicrobial-resistance, and pathogenesis.

  5. Use of diagnostic imaging in the evaluation of gastrointestinal tract duplications. (United States)

    Laskowska, Katarzyna; Gałązka, Przemysław; Daniluk-Matraś, Irena; Leszczyński, Waldemar; Serafin, Zbigniew


    Gastrointestinal tract duplication is a rare malformation associated with the presence of additional segment of the fetal gut. The aim of this study was to retrospectively review clinical features and imaging findings in intraoperatively confirmed cases of gastrointestinal tract duplication in children. The analysis included own material from the years 2002-2012. The analyzed group included 14 children, among them 8 boys and 6 girls. The youngest patient was diagnosed at the age of three weeks, and the oldest at 12 years of age. The duplication cysts were identified in the esophagus (n=2), stomach (n=5), duodenum (n=1), terminal ileum (n=5), and rectum (n=1). In four cases, the duplication coexisted with other anomalies, such as patent urachus, Meckel's diverticulum, mesenteric cyst, and accessory pancreas. Clinical manifestation of gastrointestinal duplication cysts was variable, and some of them were detected accidently. Thin- or thick-walled cystic structures adjacent to the wall of neighboring gastrointestinal segment were documented on diagnostic imaging. Ultrasound and computed tomography are the methods of choice in the evaluation of gastrointestinal duplication cysts. Apart from the diagnosis of the duplication cyst, an important issue is the detection of concomitant developmental pathologies, including pancreatic heterotopy.

  6. A conserved segmental duplication within ELA. (United States)

    Brinkmeyer-Langford, C L; Murphy, W J; Childers, C P; Skow, L C


    The assembled genomic sequence of the horse major histocompatibility complex (MHC) (equine lymphocyte antigen, ELA) is very similar to the homologous human HLA, with the notable exception of a large segmental duplication at the boundary of ELA class I and class III that is absent in HLA. The segmental duplication consists of a ∼ 710 kb region of at least 11 repeated blocks: 10 blocks each contain an MHC class I-like sequence and the helicase domain portion of a BAT1-like sequence, and the remaining unit contains the full-length BAT1 gene. Similar genomic features were found in other Perissodactyls, indicating an ancient origin, which is consistent with phylogenetic analyses. Reverse-transcriptase PCR (RT-PCR) of mRNA from peripheral white blood cells of healthy and chronically or acutely infected horses detected transcription from predicted open reading frames in several of the duplicated blocks. This duplication is not present in the sequenced MHCs of most other mammals, although a similar feature at the same relative position is present in the feline MHC (FLA). Striking sequence conservation throughout Perissodactyl evolution is consistent with a functional role for at least some of the genes included within this segmental duplication. © 2010 The Authors, Journal compilation © 2010 Stichting International Foundation for Animal Genetics.

  7. Duplication of 7q36.3 encompassing the Sonic Hedgehog (SHH) gene is associated with congenital muscular hypertrophy

    DEFF Research Database (Denmark)

    Kristensen, Lone Krøldrup; Kjaergaard, S; Kirchhoff, Marianne


    with muscular hypertrophy and mildly retarded psychomotor development. Array-CGH identified a small duplication of 7q36.3 including the Sonic Hedgehog (SHH) gene in both the aborted foetus and the live born male sib. Neither of the parents carried the 7q36.3 duplication. The consequences of overexpression...

  8. Near-Duplicate Web Page Detection: An Efficient Approach Using Clustering, Sentence Feature and Fingerprinting

    Directory of Open Access Journals (Sweden)

    J. Prasanna Kumar


    Full Text Available Duplicate and near-duplicate web pages are the chief concerns for web search engines. In reality, they incur enormous space to store the indexes, ultimately slowing down and increasing the cost of serving results. A variety of techniques have been developed to identify pairs of web pages that are aldquo;similarardquo; to each other. The problem of finding near-duplicate web pages has been a subject of research in the database and web-search communities for some years. In order to identify the near duplicate web pages, we make use of sentence level features along with fingerprinting method. When a large number of web documents are in consideration for the detection of web pages, then at first, we use K-mode clustering and subsequently sentence feature and fingerprint comparison is used. Using these steps, we exactly identify the near duplicate web pages in an efficient manner. The experimentation is carried out on the web page collections and the results ensured the efficiency of the proposed approach in detecting the near duplicate web pages.

  9. Duplication of Key Frames of Video Streams in Wireless Networks


    Sagatov, Evgeny S.; Sukhov, Andrei M.


    In this paper technological solutions for improving the quality of video transfer along wireless networks are investigated. Tools have been developed to allow packets to be duplicated with key frames data. In the paper we tested video streams with duplication of all frames, with duplication of key frames, and without duplication. The experiments showed that the best results are obtained by duplication of packages which contain key frames. The paper also provides an overview of the coefficient...

  10. The hidden duplication past of the plant pathogen Phytophthora and its consequences for infection

    Directory of Open Access Journals (Sweden)

    Martens Cindy


    Full Text Available Abstract Background Oomycetes of the genus Phytophthora are pathogens that infect a wide range of plant species. For dicot hosts such as tomato, potato and soybean, Phytophthora is even the most important pathogen. Previous analyses of Phytophthora genomes uncovered many genes, large gene families and large genome sizes that can partially be explained by significant repeat expansion patterns. Results Analysis of the complete genomes of three different Phytophthora species, using a newly developed approach, unveiled a large number of small duplicated blocks, mainly consisting of two or three consecutive genes. Further analysis of these duplicated genes and comparison with the known gene and genome duplication history of ten other eukaryotes including parasites, algae, plants, fungi, vertebrates and invertebrates, suggests that the ancestor of P. infestans, P. sojae and P. ramorum most likely underwent a whole genome duplication (WGD. Genes that have survived in duplicate are mainly genes that are known to be preferentially retained following WGDs, but also genes important for pathogenicity and infection of the different hosts seem to have been retained in excess. As a result, the WGD might have contributed to the evolutionary and pathogenic success of Phytophthora. Conclusions The fact that we find many small blocks of duplicated genes indicates that the genomes of Phytophthora species have been heavily rearranged following the WGD. Most likely, the high repeat content in these genomes have played an important role in this rearrangement process. As a consequence, the paucity of retained larger duplicated blocks has greatly complicated previous attempts to detect remnants of a large-scale duplication event in Phytophthora. However, as we show here, our newly developed strategy to identify very small duplicated blocks might be a useful approach to uncover ancient polyploidy events, in particular for heavily rearranged genomes.

  11. A case report of Ileal duplication

    Energy Technology Data Exchange (ETDEWEB)

    Oh, K K; Suh, J H; Choi, B S [Yonsei University College of Medicine, Seoul (Korea, Republic of)


    Since Frankel reported the congenital anomalous intestinal duplication incidentally during autopsy in 1883, about 228 cases has been reported on the literatures. In our severance hospital, one case of ileal duplication was found, and was confirmed by pathology and surgery. This patient of duplication usually reveals the symptoms of abnormal distension, pain and palpable abdominal mass, and sometimes the symptoms of intestinal obstruction. On x-ray flate abdomen, huge occupying mass displaces intestinal gas pattern to left side. Barium enema study reveals elongation and displacement of ileum by large extrinsic mass. And cecum is also displaced upward. On the IVP, this extrinsic mass is not related to kidneys. Also, the literature was reviewed.

  12. [Intestinal volvulus due to yeyunal duplication]. (United States)

    Rodríguez Iglesias, P; Carazo Palacios, M E; Lluna González, J; Ibáñez Pradas, V; Rodríguez Caraballo, L


    Duplications of the alimentary tract are congenital malformations. The ileum is the most commonly affected organ. A lot of duplications are incidentally diagnosed but most of patients present a combination of pain or complications such as obstructive symptoms, intestinal intussusception, perforation or volvulus. We report the case of a 6-years-old girl, with intermittent abdominal pain and vomits for two months long. Laboratory work was completely normal and in the radiology analysis (abdominal sonography and magnetic resonance) a cystic image with intestinal volvulus was observed. The patient underwent laparotomy, Ladd's procedure was done and the cyst was resected. In conclusion, if a patient is admitted with abdominal pain and obstructive symptoms, it is important to consider duplication of the alimentary tract as a possible diagnosis.

  13. Prevalence of lower extremity venous duplication

    Directory of Open Access Journals (Sweden)

    Simpson William


    Full Text Available Purpose: This retrospective study was performed to determine the prevalence of lower extremity venous duplication using duplex ultrasound in the patient population of a large urban medical center. Materials and Methods: The reports of all lower extremity venous ultrasound examinations performed at our institution between January 1, 2002 and December 31, 2002 were reviewed. Ultrasound examinations that were performed for purposes other than the detection of lower extremity deep vein thrombosis were excluded. The prevalence of duplication and its specific location were recorded. In addition, the prevalence of thrombus and its specific location were also recorded. Results: A total of 3118 exams were performed in 2664 patients. Of the 2664 patients, 2311 had only one examination performed during the study period; 353 patients had more than one examination performed. We found that 10.1% of patients (270/2664 had at least one venous segment duplicated and 5.4% of patients (143/2664 had a thrombus in at least one venous segment. There was a statistically significant difference in the prevalence of both duplication and thrombus with a change in venous segment. Only 0.4% of patients (11/2664 had thrombus within a duplicated segment. Of those who had more than one examination performed, 15.3% (54/353 had the same venous segment(s seen on one examination but not another. Conclusion: Lower extremity venous duplication is a frequent anatomic variant that is seen in 10.1% of patients, but it may not be as common as is generally believed. It can result in a false negative result for deep vein thrombosis.

  14. Single-leg squats identify independent stair negotiation ability in older adults referred for a physiotherapy mobility assessment at a rural hospital. (United States)

    Hockings, Rowena L; Schmidt, David D; Cheung, Christopher W


    To determine whether single-leg squats identify ability to negotiate stairs in older adults at a rural hospital. Cross-sectional analytical study. Acute wards and emergency department of a rural hospital in Australia. A systematic sample of 143 older adults (72 men, 71 women, 80.0 ± 6.8 years) from the emergency department or acute wards of Shoalhaven Hospital referred for a physiotherapy mobility assessment. Ability to complete up to three single-leg squats and negotiate up to three steps were measured. Covariates and demographic variables were collected. The squat test had 86% sensitivity, 100% specificity, 100% positive predictive value, and 49% negative predictive value in correctly identifying stair negotiation ability. Participants who could complete single-leg squats were 57 times more likely to be able to independently negotiate stairs than participants who could not complete squats. Multivariate regression analysis indicated that walker use, pain severity and whether participants lived alone were significant and independent predictors of ability to negotiate stairs independently. Single-leg squats may be an accurate identifier of stair negotiation ability in older adults admitted to the hospital for an acute illness or injury. A traditional stairs assessment would be required if older adults were unable to complete the squat test or had moderate to severe pain, used a walker to ambulate, or did not live alone. The squat test is a potentially more-efficient assessment tool than traditional stair assessments in determining an individual's ability to negotiate stairs and suitability for discharge where poor mobility is a problem. © 2013, Copyright the Authors Journal compilation © 2013, The American Geriatrics Society.

  15. Acute abdominal pain presenting as a rare appendiceal duplication: a case report

    Directory of Open Access Journals (Sweden)

    Mahmood Ali


    Full Text Available Abstract Introduction Appendiceal duplication is a rare anomaly that can manifest as right lower quadrant pain. There are several variations described for this condition. We recommend aggressive operative management should this anatomical variation present in the presence of acute appendicitis. Case presentation We report the case of a 15-year-old African American girl who presented to our hospital with right lower quadrant pain and was subsequently found to have appendiceal duplication. Conclusion There are two categorical systems that have described and stratified appendiceal duplication. Both classification systems have been outlined and referenced in this case report. A computed tomography scan has been included to provide a visual aid to help identify true vermiform appendiceal duplication. The presence of this anatomical abnormality is not a reason for surgical intervention; however, should this be found in the setting of acute appendicitis, aggressive resection of both appendices is mandatory.

  16. Constitutional Tandem Duplication of 9q34 that Truncates EHMT1 in a Child with Ganglioglioma (United States)

    Cheung, Hannah C.; Yatsenko, Svetlana A.; Kadapakkam, Meena; Legay, Hélène; Su, Jack; Lupski, James R.; Plon, Sharon E.


    Point mutations of EHMT1 or deletions and duplications of chromosome 9q34.3 are found in patients with variable neurologic and developmental disorders. Here, we present a child with congenital cataract, developmental and speech delay who developed a metastatic ganglioglioma with progression to anaplastic astrocytoma. Molecular analysis identified a novel constitutional tandem duplication in 9q34.3 with breakpoints in intron 1 of TRAF2 and intron 16 of EHMT1 generating a fusion transcript predicted to encode a truncated form of EHMT1. The ganglioglioma showed complex chromosomal aberrations with further duplication of the dup9q34. Thus, this unique tandem 9q34.3 duplication may impact brain tumor formation. PMID:21681934

  17. Retroperitoneal duplication cyst with a fistulous tract to the vagina: a case report. (United States)

    Filmar, Gilad A; Lotze, Peter M; Fisher, Hilaire W


    To describe a rare case of a retroperitoneal duplication cyst that fistulized to the vagina. Case description and discussion of a patient found to have an intestinal duplication cyst. A patient presented for a laparoscopic hysterectomy because of menorrhagia and a fibroid uterus. She also complained of recurrent urinary tract infections (UTIs) and a vaginal discharge. A retroperitoneal intestinal duplication cyst that fistulized to the vagina and caused her recurrent UTIs was identified. Surgical resection of the cyst resolved her complaint of recurrent UTIs. Retroperitoneal intestinal duplication cysts are rare congenital anomalies with vague clinical manifestations. The finding of a fistulous communication to the vagina originating from such a structure can be associated with recurrent UTIs.

  18. Prenatal diagnosis of foetuses with congenital abnormalities and duplication of the MECP2 region. (United States)

    Fu, Fang; Liu, Huan-ling; Li, Ru; Han, Jin; Yang, Xin; Min, Pan; Zhen, Li; Zhang, Yong-ling; Xie, Gui-e; Lei, Ting-ying; Li, Yan; Li, Jian; Li, Dong-zhi; Liao, Can


    MECP2 duplication results in a well-recognised syndrome in 100% of affected male children; this syndrome is characterised by severe neurodevelopmental disabilities and recurrent infections. However, no sonographic findings have been reported for affected foetuses, and prenatal molecular diagnosis has not been possible for this disease due to lack of prenatal clinical presentation. In this study, we identified a small duplication comprising the MECP2 and L1CAM genes in the Xq28 region in a patient from a family with severe X-linked mental retardation and in a prenatal foetus with brain structural abnormalities. Using high-resolution chromosome microarray analysis (CMA) to screen 108 foetuses with congenital structural abnormalities, we identified additional three foetuses with the MECP2 duplication. Our study indicates that ventriculomegaly, hydrocephalus, agenesis of the corpus callosum, choroid plexus cysts, foetal growth restriction and hydronephrosis might be common ultrasound findings in prenatal foetuses with the MECP2 duplication and provides the first set of prenatal cases with MECP2 duplication, the ultrasonographic phenotype described in these patients will help to recognise the foetuses with possible MECP2 duplication and prompt the appropriate molecular testing. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Multiple independent origins of mitochondrial control region duplications in the order Psittaciformes (United States)

    Schirtzinger, Erin E.; Tavares, Erika S.; Gonzales, Lauren A.; Eberhard, Jessica R.; Miyaki, Cristina Y.; Sanchez, Juan J.; Hernandez, Alexis; Müeller, Heinrich; Graves, Gary R.; Fleischer, Robert C.; Wright, Timothy F.


    Mitochondrial genomes are generally thought to be under selection for compactness, due to their small size, consistent gene content, and a lack of introns or intergenic spacers. As more animal mitochondrial genomes are fully sequenced, rearrangements and partial duplications are being identified with increasing frequency, particularly in birds (Class Aves). In this study, we investigate the evolutionary history of mitochondrial control region states within the avian order Psittaciformes (parrots and cockatoos). To this aim, we reconstructed a comprehensive multi-locus phylogeny of parrots, used PCR of three diagnostic fragments to classify the mitochondrial control region state as single or duplicated, and mapped these states onto the phylogeny. We further sequenced 44 selected species to validate these inferences of control region state. Ancestral state reconstruction using a range of weighting schemes identified six independent origins of mitochondrial control region duplications within Psittaciformes. Analysis of sequence data showed that varying levels of mitochondrial gene and tRNA homology and degradation were present within a given clade exhibiting duplications. Levels of divergence between control regions within an individual varied from 0–10.9% with the differences occurring mainly between 51 and 225 nucleotides 3′ of the goose hairpin in domain I. Further investigations into the fates of duplicated mitochondrial genes, the potential costs and benefits of having a second control region, and the complex relationship between evolutionary rates, selection, and time since duplication are needed to fully explain these patterns in the mitochondrial genome. PMID:22543055

  20. The prevalence of gene duplications and their ancient origin in Rhodobacter sphaeroides 2.4.1

    Directory of Open Access Journals (Sweden)

    Cho Hyuk


    Full Text Available Abstract Background Rhodobacter sphaeroides 2.4.1 is a metabolically versatile organism that belongs to α-3 subdivision of Proteobacteria. The present study was to identify the extent, history, and role of gene duplications in R. sphaeroides 2.4.1, an organism that possesses two chromosomes. Results A protein similarity search (BLASTP identified 1247 orfs (~29.4% of the total protein coding orfs that are present in 2 or more copies, 37.5% (234 gene-pairs of which exist in duplicate copies. The distribution of the duplicate gene-pairs in all Clusters of Orthologous Groups (COGs differed significantly when compared to the COG distribution across the whole genome. Location plots revealed clusters of gene duplications that possessed the same COG classification. Phylogenetic analyses were performed to determine a tree topology predicting either a Type-A or Type-B phylogenetic relationship. A Type-A phylogenetic relationship shows that a copy of the protein-pair matches more with an ortholog from a species closely related to R. sphaeroides while a Type-B relationship predicts the highest match between both copies of the R. sphaeroides protein-pair. The results revealed that ~77% of the proteins exhibited a Type-A phylogenetic relationship demonstrating the ancient origin of these gene duplications. Additional analyses on three other strains of R. sphaeroides revealed varying levels of gene loss and retention in these strains. Also, analyses on common gene pairs among the four strains revealed that these genes experience similar functional constraints and undergo purifying selection. Conclusions Although the results suggest that the level of gene duplication in organisms with complex genome structuring (more than one chromosome seems to be not markedly different from that in organisms with only a single chromosome, these duplications may have aided in genome reorganization in this group of eubacteria prior to the formation of R. sphaeroides as gene

  1. Incorporation of unique molecular identifiers in TruSeq adapters improves the accuracy of quantitative sequencing. (United States)

    Hong, Jungeui; Gresham, David


    Quantitative analysis of next-generation sequencing (NGS) data requires discriminating duplicate reads generated by PCR from identical molecules that are of unique origin. Typically, PCR duplicates are identified as sequence reads that align to the same genomic coordinates using reference-based alignment. However, identical molecules can be independently generated during library preparation. Misidentification of these molecules as PCR duplicates can introduce unforeseen biases during analyses. Here, we developed a cost-effective sequencing adapter design by modifying Illumina TruSeq adapters to incorporate a unique molecular identifier (UMI) while maintaining the capacity to undertake multiplexed, single-index sequencing. Incorporation of UMIs into TruSeq adapters (TrUMIseq adapters) enables identification of bona fide PCR duplicates as identically mapped reads with identical UMIs. Using TrUMIseq adapters, we show that accurate removal of PCR duplicates results in improved accuracy of both allele frequency (AF) estimation in heterogeneous populations using DNA sequencing and gene expression quantification using RNA-Seq.

  2. Translocations used to generate chromosome segment duplications ...

    Indian Academy of Sciences (India)

    a duplication (Dp) of the translocated segment and four inviable (white, W) ascospores with .... of this work, namely, the definition of breakpoint junction sequences of 12 ..... then our results would place supercontig 10.9 in distal. LG VIR. A third ...

  3. Incomplete urethral duplication in an adult male.

    LENUS (Irish Health Repository)

    Davis, N F


    Urethral duplication is a rare congenital anomaly with less than 200 cases reported. It predominantly occurs in males and is nearly always diagnosed in childhood or adolescence. It is defined as a complete second passage from the bladder to the dorsum of the penis or as an accessory pathway that ends blindly on the dorsal or ventral surface.

  4. 20 CFR 410.705 - Duplicate claims. (United States)


    ... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Duplicate claims. 410.705 Section 410.705 Employees' Benefits SOCIAL SECURITY ADMINISTRATION FEDERAL COAL MINE HEALTH AND SAFETY ACT OF 1969, TITLE IV-BLACK LUNG BENEFITS (1969- ) Rules for the Review of Denied and Pending Claims Under the Black Lung...

  5. Bladder exstrophy associated with complete urethral duplication ...

    African Journals Online (AJOL)

    J.E. Mensah · Case report. Bladder exstrophy associated with complete urethral duplication: Bladder can be augmented with dorsal urethral mucosa. J.E. Mensaha,∗. , K.N. Ampadua, M.Y. Kyeia, B. Edusieb.

  6. The Clinical Utility of ASRS-v1.1 for Identifying ADHD in Alcoholics Using PRISM as the Reference Standard. (United States)

    Reyes, Maria M; Schneekloth, Terry D; Hitschfeld, Mario J; Geske, Jennifer R; Atkinson, David L; Karpyak, Victor M


    The objective was to assess the clinical utility of the Adult ADHD Self-Report Scale (ASRS-v1.1) in identifying ADHD in alcoholics using the Psychiatric Research Interview for Substance and Mental Disorders (PRISM) as the diagnostic "gold standard." We performed a secondary analysis of data from 379 treatment-seeking alcoholics who completed the ASRS-v1.1 and the ADHD module of the PRISM. Data analysis included descriptive statistics. The prevalence of ADHD was 7.7% (95% CI = [5.4, 10.8]). The positive predictive value (PPV) of the ASRS-v1.1 was 18.1% (95% CI = [12.4, 25.7]) and the negative predictive value (NPV) was 97.6% (95% CI = [94.9, 98.9]). The ASRS-v1.1 demonstrated a sensitivity of 79.3% (95% CI = [61.6, 90.2]) and a specificity of 70.3% (95% CI = [65.3, 74.8]). The ASRS-v1.1 demonstrated acceptable sensitivity and specificity in a sample of treatment-seeking alcoholics when compared with the PRISM as the reference standard for ADHD diagnosis. © The Author(s) 2016.

  7. A salmonid EST genomic study: genes, duplications, phylogeny and microarrays

    Directory of Open Access Journals (Sweden)

    Brahmbhatt Sonal


    Full Text Available Abstract Background Salmonids are of interest because of their relatively recent genome duplication, and their extensive use in wild fisheries and aquaculture. A comprehensive gene list and a comparison of genes in some of the different species provide valuable genomic information for one of the most widely studied groups of fish. Results 298,304 expressed sequence tags (ESTs from Atlantic salmon (69% of the total, 11,664 chinook, 10,813 sockeye, 10,051 brook trout, 10,975 grayling, 8,630 lake whitefish, and 3,624 northern pike ESTs were obtained in this study and have been deposited into the public databases. Contigs were built and putative full-length Atlantic salmon clones have been identified. A database containing ESTs, assemblies, consensus sequences, open reading frames, gene predictions and putative annotation is available. The overall similarity between Atlantic salmon ESTs and those of rainbow trout, chinook, sockeye, brook trout, grayling, lake whitefish, northern pike and rainbow smelt is 93.4, 94.2, 94.6, 94.4, 92.5, 91.7, 89.6, and 86.2% respectively. An analysis of 78 transcript sets show Salmo as a sister group to Oncorhynchus and Salvelinus within Salmoninae, and Thymallinae as a sister group to Salmoninae and Coregoninae within Salmonidae. Extensive gene duplication is consistent with a genome duplication in the common ancestor of salmonids. Using all of the available EST data, a new expanded salmonid cDNA microarray of 32,000 features was created. Cross-species hybridizations to this cDNA microarray indicate that this resource will be useful for studies of all 68 salmonid species. Conclusion An extensive collection and analysis of salmonid RNA putative transcripts indicate that Pacific salmon, Atlantic salmon and charr are 94–96% similar while the more distant whitefish, grayling, pike and smelt are 93, 92, 89 and 86% similar to salmon. The salmonid transcriptome reveals a complex history of gene duplication that is

  8. Rectal duplication cyst presenting as rectal prolapse in an infant

    Directory of Open Access Journals (Sweden)

    Maher Zaiem


    Full Text Available Rectal duplication is a rare variety of gastrointestinal duplication. It accounts 4% of the total gastrointestinal duplications.In this paper, we are reporting a case of an 8 months old male who presented with rectal prolapse. Digital rectal examination revealed a soft mass bulging through the posterior wall of rectum. Computed tomography (CT scan showed a cystic mass compressing the posterior wall of the rectum. The mass was excised using a Muscle Complex Saving Posterior Sagittal approach (MCS-PSA. The pathology report confirmed the diagnosis of the rectal duplication cyst. The postoperative recovery was uneventful. Keywords: Intestinal duplication, Cystic rectal duplication, Rectal prolapse

  9. 10p Duplication characterized by fluorescence in situ hybridization

    Energy Technology Data Exchange (ETDEWEB)

    Wiktor, A.; Feldman, G.L.; Van Dyke, D.L.; Kratkoczki, P.; Ditmars, D.M. Jr. [Henry Ford Hospital, Detroit, MI (United States)


    We describe a patient with severe failure to thrive, mild-moderate developmental delay, cleft lip and palate, and other anomalies. Routine cytogenetic analysis documented a de novo chromosome rearrangement involving chromosome 4, but the origin of the derived material was unknown. Using chromosome specific painting probes, the karyotype was defined as 46,XY,der(4)t(4;10)(q35;p11.23). Characterization of the dup(10p) by fluorescence in situ hybridization (FISH) analysis provides another example of the usefulness of this technology in identifying small deletions, duplications, or supernumerary marker chromosomes. 19 refs., 4 figs.

  10. Intragenic Duplication A Novel Mutational Mechanism in Hereditary Pancreatitis

    DEFF Research Database (Denmark)

    Joergensen, M. T.; Geisz, A.; Brusgaard, K.


    OBJECTIVES: In a hereditary pancreatitis family from Denmark, we identified a novel intragenic duplication of 9 nucleotides in exon-2 of the human cationic trypsinogen (PRSS1) gene (c.63_71dup) which at the amino-acid level resulted in the insertion of 3 amino acids within the activation peptide...... pancreatitis. The accelerated activation of p.K23_I24insIDK by cathepsin B is a unique biochemical property not found in any other pancreatitis-associated trypsinogen mutant. In contrast, the robust autoactivation of the novel mutant confirms the notion that increased autoactivation is a disease......-relevant mechanism in hereditary pancreatitis....

  11. Duplicating Research Success at Xerox (United States)

    Hays, Dan A.


    The genesis of Xerox is rooted in the invention of xerography by physicist Chester Carlson in 1938. The initial research by Carlson can be viewed as the first of four successful xerographic research eras that have contributed to the growth of Xerox. The second era began in 1944 when Carlson established a working relationship with Battelle Memorial Institute in Columbus, OH. Due to many research advances at Battelle, the Haloid Corporation in Rochester, NY acquired a license to the xerographic process in 1947. The name of the company was changed to Xerox Corporation in 1961 following the wide market acceptance of the legendary Xerox 914 copier. Rapid revenue growth of Xerox in the mid-'60s provided the foundation for a third successful research era in the '70s and '80s. A research center was established in Webster, NY for the purpose of improving the design of xerographic subsystems and materials. These research efforts contributed to the commercial success of the DocuTech family of digital production printers. The fourth successful research era was initiated in the '90s with the objective of identifying a high-speed color xerographic printing process. A number of research advances contributed to the design of a 100 page per minute printer recently introduced as the Xerox DocuColor iGen3 Digital Production Press. To illustrate the role of research in enabling these waves of successful xerographic products, the physics of photoreceptors, light exposure and development subsystems will be discussed. Since the annual worldwide revenue of the xerographic industry exceeds 100 billion dollars, the economic return on Carlson's initial research investment in the mid-'30s is astronomical. The future for xerography remains promising since the technology enables high-speed digital printing of high-quality color documents with variable information.

  12. Our experience with unusual gastrointestinal tract duplications in infants

    Directory of Open Access Journals (Sweden)

    Bilal Mirza


    Full Text Available Background: Classical duplications may present along any part of gastrointestinal tract (GIT from mouth to anus. Atypical or unusual rare varieties of GIT duplications may also occur, but with different anatomical features. Materials and Methods: We reviewed our 5-year record (February 2008-January 2013 to describe clinical profile of unusual GIT duplications in neonates and small infants. Results: Three patients with atypical variety of GIT duplications were managed in our department during this tenure. Two were females and one male. Age was ranged between 11 days and 2 months. All patients presented with massive abdominal distension causing respiratory embarrassment in two of them. In all patients, the pre-operative differential diagnoses also included GIT duplication cysts. Computerized tomography (CT scan showed single huge cyst in one and multiple cysts in two patients. In one patient the CT scan also depicted a thoracic cyst in relation to posterior mediastinum. At operation, one patient had colonic tubular duplication cyst along with another isolated duplication cyst, the second case had a tubular duplication cyst of ileum with its segmental dilatation, and in the third case two isolated duplications were found. Duplication cysts were excised along with mucosal stripping in one patient, cyst excision and intestinal resection and anastomosis in one patient, and only cysts excision in one. All patients did well post-operatively. Conclusion: We presented unusual GIT duplications. These duplications are managed on similar lines as classical duplications with good prognosis when dealt early.

  13. A Retrospective Study of the Incidence of Missed Opportunities in Identifying, Managing and Referring At-Risk of Overweight and Overweight Children and Adolescents in an Outpatient Primary Care Setting

    National Research Council Canada - National Science Library

    Quirke, Amy


    A descriptive study of the incidence of missed opportunities in identifying, managing and referring children and adolescents at-risk of overweight and overweight were conducted using a retrospective...

  14. MSOAR 2.0: Incorporating tandem duplications into ortholog assignment based on genome rearrangement

    Directory of Open Access Journals (Sweden)

    Zhang Liqing


    Full Text Available Abstract Background Ortholog assignment is a critical and fundamental problem in comparative genomics, since orthologs are considered to be functional counterparts in different species and can be used to infer molecular functions of one species from those of other species. MSOAR is a recently developed high-throughput system for assigning one-to-one orthologs between closely related species on a genome scale. It attempts to reconstruct the evolutionary history of input genomes in terms of genome rearrangement and gene duplication events. It assumes that a gene duplication event inserts a duplicated gene into the genome of interest at a random location (i.e., the random duplication model. However, in practice, biologists believe that genes are often duplicated by tandem duplications, where a duplicated gene is located next to the original copy (i.e., the tandem duplication model. Results In this paper, we develop MSOAR 2.0, an improved system for one-to-one ortholog assignment. For a pair of input genomes, the system first focuses on the tandemly duplicated genes of each genome and tries to identify among them those that were duplicated after the speciation (i.e., the so-called inparalogs, using a simple phylogenetic tree reconciliation method. For each such set of tandemly duplicated inparalogs, all but one gene will be deleted from the concerned genome (because they cannot possibly appear in any one-to-one ortholog pairs, and MSOAR is invoked. Using both simulated and real data experiments, we show that MSOAR 2.0 is able to achieve a better sensitivity and specificity than MSOAR. In comparison with the well-known genome-scale ortholog assignment tool InParanoid, Ensembl ortholog database, and the orthology information extracted from the well-known whole-genome multiple alignment program MultiZ, MSOAR 2.0 shows the highest sensitivity. Although the specificity of MSOAR 2.0 is slightly worse than that of InParanoid in the real data experiments

  15. Using reference nutrient density goals with food balance sheet data to identify likely micronutrient deficits for fortification planning in countries in the Western Pacific region. (United States)

    Gibson, Rosalind S; Cavalli-Sforza, Tommaso


    Collection of nationwide food consumption data at the individual level is the preferred option for planning fortification programs. However, such data are seldom collected in low-income countries. In contrast, Food Balance Sheets (FBS), published annually for approximately 180 countries, may provide a source of national data for program planning. To explore the use of micronutrient densities from FBS data to identify likely deficits for eight micronutrients in national diets. Micronutrient densities in the daily available food supply per capita were calculated from the micronutrient contents of 95 food commodities in 17 Western Pacific Region countries. Densities were compared with reference nutrient density goals developed to ensure that at least 95% of individuals, irrespective of life-stage group, are likely to have adequate intakes. Of the eight micronutrients, Cambodia and Korea D.P.R. had likely deficits for six; China, Fiji, Kiribati, Korea Republic, Lao P.D.R., Philippines, Solomon Islands, Vanuatu, and Viet Nam had likely deficits for five; Brunei Darussalam, Malaysia, Mongolia, New Zealand, and Papua New Guinea had likely deficits for four; and New Caledonia had likely deficits for three. The most frequent deficits were for iron, zinc, and calcium (all countries), followed by vitamin B2 and vitamin A (n = 13), vitamin B1 (n = 2), and vitamin B12 (n = 1). The nutrient density approach could be applied to FBS data for ranking countries according to likely micronutrient deficits, but it provides no information on distribution of nutrient supply for fortification program planning. The approach described here could be applied to data from Household Consumption and Expenditures Surveys (HCES) to characterize households at greatest risk.

  16. NASAwide electronic publishing system: Electronic printing and duplicating, stage-2 evaluation report (GSFC) (United States)

    Tuey, Richard C.; Lane, Robert; Hart, Susan V.


    The NASA Scientific and Technical Information Office was assigned the responsibility to continue with the expansion of the NASAwide networked electronic duplicating effort by including the Goddard Space Flight Center (GSFC) as an additional node to the existing configuration of networked electronic duplicating systems within NASA. The subject of this report is the evaluation of a networked electronic duplicating system which meets the duplicating requirements and expands electronic publishing capabilities without increasing current operating costs. This report continues the evaluation reported in 'NASA Electronic Publishing System - Electronic Printing and Duplicating Evaluation Report' (NASA TM-106242) and 'NASA Electronic Publishing System - Stage 1 Evaluation Report' (NASA TM-106510). This report differs from the previous reports through the inclusion of an external networked desktop editing, archival, and publishing functionality which did not exist with the previous networked electronic duplicating system. Additionally, a two-phase approach to the evaluation was undertaken; the first was a paper study justifying a 90-day, on-site evaluation, and the second phase was to validate, during the 90-day evaluation, the cost benefits and productivity increases that could be achieved in an operational mode. A benchmark of the functionality of the networked electronic publishing system and external networked desktop editing, archival, and publishing system was performed under a simulated daily production environment. This report can be used to guide others in determining the most cost effective duplicating/publishing alternative through the use of cost/benefit analysis and return on investment techniques. A treatise on the use of these techniques can be found by referring to 'NASA Electronic Publishing System -Cost/Benefit Methodology' (NASA TM-106662).

  17. Presentation and Surgical Management of Duodenal Duplication in Adults

    Directory of Open Access Journals (Sweden)

    Caroline C. Jadlowiec


    Full Text Available Duodenal duplications in adults are exceedingly rare and their diagnosis remains difficult as symptoms are largely nonspecific. Clinical presentations include pancreatitis, biliary obstruction, gastrointestinal bleeding from ectopic gastric mucosa, and malignancy. A case of duodenal duplication in a 59-year-old female is presented, and her treatment course is reviewed with description of combined surgical and endoscopic approach to repair, along with a review of historic and current recommendations for management. Traditionally, gastrointestinal duplications have been treated with surgical resection; however, for duodenal duplications, the anatomic proximity to the biliopancreatic ampulla makes surgical management challenging. Recently, advances in endoscopy have improved the clinical success of cystic intraluminal duodenal duplications. Despite these advances, surgical resection is still recommended for extraluminal tubular duplications although combined techniques may be necessary for long tubular duplications. For duodenal duplications, a combined approach of partial excision combined with mucosal stripping may offer advantage.

  18. Duplication of the transverse colon in an adult: case report and review. (United States)

    Banchini, Filippo; Delfanti, Rocco; Begnini, Evelina; Tripodi, Maria Candida; Capelli, Patrizio


    Tubular duplication of the colon is very rare especially in adulthood, because it is frequently symptomatic earlier in newborn life, so only few cases are reported in literature. Several theories are proposed to explain the onset and the evolution of gut malformations as the aberrant lumen recanalization or the diverticular theory, the alteration of the lateral closure of the embryonal disk or finally the dorsal protrusion of the yolk-sac for herniation or adhesion to the ectoderm for an abnormality of the longitudinal line, but none clarifies the exact genesis of duplication. We present a case of "Y-shaped" tubular duplication of the transverse colon in a 21-year-old adult, with a history of chronic pain and constipation, referred to our department for abdominal pain with retrosternal irradiation, treated with the resection of the aberrant bowel.

  19. Clinical and molecular characterization of duplications encompassing the human SHOX gene reveal a variable effect on stature. (United States)

    Thomas, N Simon; Harvey, John F; Bunyan, David J; Rankin, Julia; Grigelioniene, Giedre; Bruno, Damien L; Tan, Tiong Y; Tomkins, Susan; Hastings, Robert


    Deletions of the SHOX gene are well documented and cause disproportionate short stature and variable skeletal abnormalities. In contrast interstitial SHOX duplications limited to PAR1 appear to be very rare and the clinical significance of the only case report in the literature is unclear. Mapping of this duplication has now shown that it includes the entire SHOX gene but little flanking sequence and so will not encompass any of the long-range enhancers required for SHOX transcription. We now describe the clinical and molecular characterization of three additional cases. The duplications all included the SHOX coding sequence but varied in the amount of flanking sequence involved. The probands were ascertained for a variety of reasons: hypotonia and features of Asperger syndrome, Leri-Weill dyschondrosteosis (LWD), and a family history of cleft palate. However, the presence of a duplication did not correlate with any of these features or with evidence of skeletal abnormality. Remarkably, the proband with LWD had inherited both a SHOX deletion and a duplication. The effect of the duplications on stature was variable: height appeared to be elevated in some carriers, particularly in those with the largest duplications, but was still within the normal range. SHOX duplications are likely to be under ascertained and more cases need to be identified and characterized in detail in order to accurately determine their phenotypic consequences.

  20. Duplication of the Left Vertebral Artery Origin: A Case Report

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Sang Wook; Park, Dong Woo; Park, Choong Ki; Lee, Young Jun [Dept. of Radiology, College of Medicine, Hanyang University, Hanyang University Guri Hospital, Guri (Korea, Republic of)


    Duplication of vertebral arteries is a very rare but clinically important condition. A duplicated vertebral artery origin can influence hemodynamics, pathogenesis of vascular lesions and treatment options. In cases of vertebral artery duplication, the vertebral arteries generally enter the transverse foramen higher up than normal. Awareness of these vertebral artery variants before procedures, such as neurointervention or surgery, may be beneficial. Here, we describe a case of a 51-year-old female patient with left vertebral artery duplication which was detected incidentally.

  1. Duplication of the Left Vertebral Artery Origin: A Case Report

    International Nuclear Information System (INIS)

    Shin, Sang Wook; Park, Dong Woo; Park, Choong Ki; Lee, Young Jun


    Duplication of vertebral arteries is a very rare but clinically important condition. A duplicated vertebral artery origin can influence hemodynamics, pathogenesis of vascular lesions and treatment options. In cases of vertebral artery duplication, the vertebral arteries generally enter the transverse foramen higher up than normal. Awareness of these vertebral artery variants before procedures, such as neurointervention or surgery, may be beneficial. Here, we describe a case of a 51-year-old female patient with left vertebral artery duplication which was detected incidentally.

  2. [Colonic duplication revealed by intestinal obstruction due to fecal impaction]. (United States)

    Azahouani, A; Hida, M; Benhaddou, H


    Colonic duplications are very rare in children. With rectal duplications, they are the rarest locations of alimentary tract duplications, most often diagnosed in the first years of life. We report an unusual case of colic duplication with fecal impaction in a 9-month-old boy revealed by intestinal obstruction. We discuss the main diagnostic and therapeutic aspects of this malformation. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  3. Cosmic abundances: The impact of stellar duplicity


    Jorissen, A.; Van Eck, S.


    The mass-transfer scenario links chemical peculiarities with stellar duplicity for an increasing number of stellar classes (classical and dwarf barium stars, subgiant and giant CH stars, S stars without technetium, yellow symbiotic stars, WIRRING stars, Abell-35-like nuclei of planetary nebulae...). Despite these successes, the mass-transfer scenario still faces several problems: What is the mass-transfer mode? Why orbital elements of dwarf barium stars do not fully match those of the classic...

  4. Anterior rectal duplication: a diagnostic challenge. (United States)

    Amjadi, K; Poenaru, D; Soboleski, D; Hurlbut, D; Kamal, I


    The authors present an anterior rectal cyst in a 14-month-old girl. This rare variant of rectal duplications presented with recurrent urinary infections. The diagnosis was challenging in view of the multiple differential diagnoses to be considered. Magnetic resonance imaging appeared to be the most accurate preoperative investigation. The cyst was removed uneventfully by partial excision and mucosal ablation. An awareness of this variant can lead to early diagnosis and curative resection.

  5. Single quadrature duplication and transparent taps

    International Nuclear Information System (INIS)

    Kim, Ajung


    The concept of single quadrature duplication, which is the process of producing two outputs with the same homodyne detecting statistics as an input, is addressed. This device has important potential application to optical communications as a transparent optical tap in a local area network environment. The characteristics of the device are examined, and a realization scheme employing a coupler and phase-sensitive amplifiers is proposed

  6. Duplication of the pituitary gland - plus syndrome

    International Nuclear Information System (INIS)

    Sen, Debraj; Arora, Vijinder


    Duplication of the pituitary gland (DPG) is a very rare developmental anomaly that is often associated with other anomalies – the DPG-plus syndrome and occurs due to splitting of the rostral notochord and prechordal plate during blastogenesis. DPG with the constellation of associated anomalies as in our patient has not been reported previously. This article illustrates the importance of imaging the brain in all patients with obvious midline facial anomalies and the complementary role of MRI and CT in such cases

  7. Finding all sorting tandem duplication random loss operations

    DEFF Research Database (Denmark)

    Bernt, Matthias; Chen, Kuan Yu; Chen, Ming Chiang


    A tandem duplication random loss (TDRL) operation duplicates a contiguous segment of genes, followed by the random loss of one copy of each of the duplicated genes. Although the importance of this operation is founded by several recent biological studies, it has been investigated only rarely from...

  8. Origin of the duplicated regions in the yeast genomes

    DEFF Research Database (Denmark)

    Piskur, Jure


    The genome of Saccharomyces cerevisiae contains several duplicated regions. The recent sequencing results of several yeast species suggest that the duplicated regions found in the modern Saccharomyces species are probably the result of a single gross duplication, as well as a series of sporadic...

  9. Effect of Duplicate Genes on Mouse Genetic Robustness: An Update

    Directory of Open Access Journals (Sweden)

    Zhixi Su


    Full Text Available In contrast to S. cerevisiae and C. elegans, analyses based on the current knockout (KO mouse phenotypes led to the conclusion that duplicate genes had almost no role in mouse genetic robustness. It has been suggested that the bias of mouse KO database toward ancient duplicates may possibly cause this knockout duplicate puzzle, that is, a very similar proportion of essential genes (PE between duplicate genes and singletons. In this paper, we conducted an extensive and careful analysis for the mouse KO phenotype data and corroborated a strong effect of duplicate genes on mouse genetics robustness. Moreover, the effect of duplicate genes on mouse genetic robustness is duplication-age dependent, which holds after ruling out the potential confounding effect from coding-sequence conservation, protein-protein connectivity, functional bias, or the bias of duplicates generated by whole genome duplication (WGD. Our findings suggest that two factors, the sampling bias toward ancient duplicates and very ancient duplicates with a proportion of essential genes higher than that of singletons, have caused the mouse knockout duplicate puzzle; meanwhile, the effect of genetic buffering may be correlated with sequence conservation as well as protein-protein interactivity.

  10. Asterless licenses daughter centrioles to duplicate for the first time in Drosophila embryos. (United States)

    Novak, Zsofia A; Conduit, Paul T; Wainman, Alan; Raff, Jordan W


    Centrioles form centrosomes and cilia, and defects in any of these three organelles are associated with human disease [1]. Centrioles duplicate once per cell cycle, when a mother centriole assembles an adjacent daughter during S phase. Daughter centrioles cannot support the assembly of another daughter until they mature into mothers during the next cell cycle [2-5]. The molecular nature of this daughter-to-mother transition remains mysterious. Pioneering studies in C. elegans identified a set of core proteins essential for centriole duplication [6-12], and a similar set have now been identified in other species [10, 13-18]. The protein kinase ZYG-1/Sak/Plk4 recruits the inner centriole cartwheel components SAS-6 and SAS-5/Ana2/STIL, which then recruit SAS-4/CPAP, which in turn helps assemble the outer centriole microtubules [19, 20]. In flies and humans, the Asterless/Cep152 protein interacts with Sak/Plk4 and Sas-4/CPAP and is required for centriole duplication, although its precise role in the assembly pathway is unclear [21-24]. Here, we show that Asl is not incorporated into daughter centrioles as they assemble during S phase but is only incorporated once mother and daughter separate at the end of mitosis. The initial incorporation of Asterless (Asl) is irreversible, requires DSas-4, and, crucially, is essential for daughter centrioles to mature into mothers that can support centriole duplication. We therefore propose a "dual-licensing" model of centriole duplication, in which Asl incorporation provides a permanent primary license to allow new centrioles to duplicate for the first time, while centriole disengagement provides a reduplication license to allow mother centrioles to duplicate again. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  11. STRIDE: Species Tree Root Inference from Gene Duplication Events. (United States)

    Emms, David M; Kelly, Steven


    The correct interpretation of any phylogenetic tree is dependent on that tree being correctly rooted. We present STRIDE, a fast, effective, and outgroup-free method for identification of gene duplication events and species tree root inference in large-scale molecular phylogenetic analyses. STRIDE identifies sets of well-supported in-group gene duplication events from a set of unrooted gene trees, and analyses these events to infer a probability distribution over an unrooted species tree for the location of its root. We show that STRIDE correctly identifies the root of the species tree in multiple large-scale molecular phylogenetic data sets spanning a wide range of timescales and taxonomic groups. We demonstrate that the novel probability model implemented in STRIDE can accurately represent the ambiguity in species tree root assignment for data sets where information is limited. Furthermore, application of STRIDE to outgroup-free inference of the origin of the eukaryotic tree resulted in a root probability distribution that provides additional support for leading hypotheses for the origin of the eukaryotes. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  12. Dietary intakes of pesticides based on community duplicate diet samples. (United States)

    Melnyk, Lisa Jo; Xue, Jianping; Brown, G Gordon; McCombs, Michelle; Nishioka, Marcia; Michael, Larry C


    The calculation of dietary intake of selected pesticides was accomplished using food samples collected from individual representatives of a defined demographic community using a community duplicate diet approach. A community of nine participants was identified in Apopka, FL from which intake assessments of organophosphate (OP) and pyrethroid pesticides were made. From these nine participants, sixty-seven individual samples were collected and subsequently analyzed by gas chromatography/mass spectrometry. Measured concentrations were used to estimate dietary intakes for individuals and for the community. Individual intakes of total OP and pyrethroid pesticides ranged from 6.7 to 996 ng and 1.2 to 16,000 ng, respectively. The community intake was 256 ng for OPs and 3430 ng for pyrethroid pesticides. The most commonly detected pesticide was permethrin, but the highest overall intake was of bifenthrin followed by esfenvalerate. These data indicate that the community in Apopka, FL, as represented by the nine individuals, was potentially exposed to both OP and pyrethroid pesticides at levels consistent with a dietary model and other field studies in which standard duplicate diet samples were collected. Higher levels of pyrethroid pesticides were measured than OPs, which is consistent with decreased usage of OPs. The diversity of pyrethroid pesticides detected in food samples was greater than expected. Continually changing pesticide usage patterns need to be considered when determining analytes of interest for large scale epidemiology studies. The Community Duplicate Diet Methodology is a tool for researchers to meet emerging exposure measurement needs that will lead to more accurate assessments of intake which may enhance decisions for chemical regulation. Successfully determining the intake of pesticides through the dietary route will allow for accurate assessments of pesticide exposures to a community of individuals, thereby significantly enhancing the research benefit

  13. Laparoscopic excision of a newborn rectal duplication cyst. (United States)

    Hartin, Charles W; Lau, Stanley T; Escobar, Mauricio A; Glick, Philip L


    Congenital rectal duplication cyst is a rare entity treated with surgical excision. Without treatment, a rectal duplication cyst may cause a variety of complications, most notably, transforming into a malignancy. We report on a 7-week-old girl who was found to have a rectal duplication cyst. The rectal duplication cyst was successfully excised laparoscopically. Rectal duplication cysts are rare alimentary tract anomalies generally discovered during childhood. Complications include symptoms arising from the cyst and the possibility of malignant degeneration. They are typically managed by surgical excision.

  14. Surgical management of complete penile duplication accompanied by multiple anomalies. (United States)

    Karaca, Irfan; Turk, Erdal; Ucan, A Basak; Yayla, Derya; Itirli, Gulcin; Ercal, Derya


    Diphallus (penile duplication) is very rare and seen once every 5.5 million births. It can be isolated, but is usually accompanied by other congenital anomalies. Previous studies have reported many concurrent anomalies, such as bladder extrophy, cloacal extrophy, duplicated bladder, scrotal abnormalities, hypospadias, separated symphysis pubis, intestinal anomalies and imperforate anus; no penile duplication case accompanied by omphalocele has been reported. We present the surgical management of a patient with multiple anomalies, including complete penile duplication, hypo-gastric omphalocele and extrophic rectal duplication.

  15. Perforated ileal duplication cyst with haemorrhagic pseudocyst formation

    International Nuclear Information System (INIS)

    Hwang, Im Kyung; Kim, Bong Soo; Kim, Heung Chul; Lee, In Sun; Hwang, Woo Chul; Namkung, Sook


    Duplication cysts of the gastrointestinal tract are rare congenital abnormalities. Ectopic gastric mucosa, which can be found in duplications, may cause peptic ulceration, gastrointestinal bleeding or perforation. We report a 1-year-old boy with a perforated ileal duplication cyst with haemorrhagic pseudocyst formation caused by peptic ulceration of the duplication cyst. It presented a snowman-like appearance consisting of a small, thick-walled, true enteric cyst and a large, thin-walled haemorrhagic pseudocyst on US and CT. It is an unusual manifestation of a duplication cyst, which has not been reported in the English language literature. (orig.)

  16. The odds of duplicate gene persistence after polyploidization

    Directory of Open Access Journals (Sweden)

    Chain Frédéric JJ


    Full Text Available Abstract Background Gene duplication is an important biological phenomenon associated with genomic redundancy, degeneration, specialization, innovation, and speciation. After duplication, both copies continue functioning when natural selection favors duplicated protein function or expression, or when mutations make them functionally distinct before one copy is silenced. Results Here we quantify the degree to which genetic parameters related to gene expression, molecular evolution, and gene structure in a diploid frog - Silurana tropicalis - influence the odds of functional persistence of orthologous duplicate genes in a closely related tetraploid species - Xenopus laevis. Using public databases and 454 pyrosequencing, we obtained genetic and expression data from S. tropicalis orthologs of 3,387 X. laevis paralogs and 4,746 X. laevis singletons - the most comprehensive dataset for African clawed frogs yet analyzed. Using logistic regression, we demonstrate that the most important predictors of the odds of duplicate gene persistence in the tetraploid species are the total gene expression level and evenness of expression across tissues and development in the diploid species. Slow protein evolution and information density (fewer exons, shorter introns in the diploid are also positively correlated with duplicate gene persistence in the tetraploid. Conclusions Our findings suggest that a combination of factors contribute to duplicate gene persistence following whole genome duplication, but that the total expression level and evenness of expression across tissues and through development before duplication are most important. We speculate that these parameters are useful predictors of duplicate gene longevity after whole genome duplication in other taxa.

  17. Gene duplications in prokaryotes can be associated with environmental adaptation. (United States)

    Bratlie, Marit S; Johansen, Jostein; Sherman, Brad T; Huang, Da Wei; Lempicki, Richard A; Drabløs, Finn


    Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive advantage to the organism. Paralogs and singletons dominate

  18. Gene duplications in prokaryotes can be associated with environmental adaptation

    Directory of Open Access Journals (Sweden)

    Lempicki Richard A


    Full Text Available Abstract Background Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Results Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Conclusions Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive


    Directory of Open Access Journals (Sweden)

    José Manuel Cabrera Delgado


    Full Text Available This article provides a first approach from the point of view of jurisprudence, to the recurring problem of concurrency sanctions in cases where further intervention of the courts has become necessary for administrative action. In this regard, the main judgments of both the Constitutional Court and the Supreme Court is, that have shaped the decisions that must be applied from the administrative level, in particular by educational inspectors, when it is foreseeable that it can produce a duplication of disciplinary procedures in the two areas, penal and administrative.

  20. Duplication of the pituitary gland - plus syndrome

    Directory of Open Access Journals (Sweden)

    Debraj Sen


    Full Text Available Duplication of the pituitary gland (DPG is a very rare developmental anomaly that is often associated with other anomalies - the DPG-plus syndrome and occurs due to splitting of the rostral notochord and prechordal plate during blastogenesis. DPG with the constellation of associated anomalies as in our patient has not been reported previously. This article illustrates the importance of imaging the brain in all patients with obvious midline facial anomalies and the complementary role of MRI and CT in such cases.

  1. A novel duplication polymorphism in the FANCA promoter and its association with breast and ovarian cancer

    International Nuclear Information System (INIS)

    Thompson, Ella; Dragovic, Rebecca L; Stephenson, Sally-Anne; Eccles, Diana M; Campbell, Ian G; Dobrovic, Alexander


    The FANCA gene is one of the genes in which mutations lead to Fanconi anaemia, a rare autosomal recessive disorder characterised by congenital abnormalities, bone marrow failure, and predisposition to malignancy. FANCA is also a potential breast and ovarian cancer susceptibility gene. A novel allele was identified which has a tandem duplication of a 13 base pair sequence in the promoter region. We screened germline DNA from 352 breast cancer patients, 390 ovarian cancer patients and 256 normal controls to determine if the presence of either of these two alleles was associated with an increased risk of breast or ovarian cancer. The duplication allele had a frequency of 0.34 in the normal controls. There was a non-significant decrease in the frequency of the duplication allele in breast cancer patients. The frequency of the duplication allele was significantly decreased in ovarian cancer patients. However, when malignant and benign tumours were considered separately, the decrease was only significant in benign tumours. The allele with the tandem duplication does not appear to modify breast cancer risk but may act as a low penetrance protective allele for ovarian cancer

  2. Sas-4 proteins are required during basal body duplication in Paramecium (United States)

    Gogendeau, Delphine; Hurbain, Ilse; Raposo, Graca; Cohen, Jean; Koll, France; Basto, Renata


    Centrioles and basal bodies are structurally related organelles composed of nine microtubule (MT) triplets. Studies performed in Caenorhabditis elegans embryos have shown that centriole duplication takes place in sequential way, in which different proteins are recruited in a specific order to assemble a procentriole. ZYG-1 initiates centriole duplication by triggering the recruitment of a complex of SAS-5 and SAS-6, which then recruits the final player, SAS-4, to allow the incorporation of MT singlets. It is thought that a similar mechanism (that also involves additional proteins) is present in other animal cells, but it remains to be investigated whether the same players and their ascribed functions are conserved during basal body duplication in cells that exclusively contain basal bodies. To investigate this question, we have used the multiciliated protist Paramecium tetraurelia. Here we show that in the absence of PtSas4, two types of defects in basal body duplication can be identified. In the majority of cases, the germinative disk and cartwheel, the first structures assembled during duplication, are not detected. In addition, if daughter basal bodies were formed, they invariably had defects in MT recruitment. Our results suggest that PtSas4 has a broader function than its animal orthologues. PMID:21289083

  3. A novel duplication polymorphism in the FANCA promoter and its association with breast and ovarian cancer. (United States)

    Thompson, Ella; Dragovic, Rebecca L; Stephenson, Sally-Anne; Eccles, Diana M; Campbell, Ian G; Dobrovic, Alexander


    The FANCA gene is one of the genes in which mutations lead to Fanconi anaemia, a rare autosomal recessive disorder characterised by congenital abnormalities, bone marrow failure, and predisposition to malignancy. FANCA is also a potential breast and ovarian cancer susceptibility gene. A novel allele was identified which has a tandem duplication of a 13 base pair sequence in the promoter region. We screened germline DNA from 352 breast cancer patients, 390 ovarian cancer patients and 256 normal controls to determine if the presence of either of these two alleles was associated with an increased risk of breast or ovarian cancer. The duplication allele had a frequency of 0.34 in the normal controls. There was a non-significant decrease in the frequency of the duplication allele in breast cancer patients. The frequency of the duplication allele was significantly decreased in ovarian cancer patients. However, when malignant and benign tumours were considered separately, the decrease was only significant in benign tumours. The allele with the tandem duplication does not appear to modify breast cancer risk but may act as a low penetrance protective allele for ovarian cancer.

  4. A novel duplication polymorphism in the FANCA promoter and its association with breast and ovarian cancer

    Directory of Open Access Journals (Sweden)

    Campbell Ian G


    Full Text Available Abstract The FANCA gene is one of the genes in which mutations lead to Fanconi anaemia, a rare autosomal recessive disorder characterised by congenital abnormalities, bone marrow failure, and predisposition to malignancy. FANCA is also a potential breast and ovarian cancer susceptibility gene. A novel allele was identified which has a tandem duplication of a 13 base pair sequence in the promoter region. Methods We screened germline DNA from 352 breast cancer patients, 390 ovarian cancer patients and 256 normal controls to determine if the presence of either of these two alleles was associated with an increased risk of breast or ovarian cancer. Results The duplication allele had a frequency of 0.34 in the normal controls. There was a non-significant decrease in the frequency of the duplication allele in breast cancer patients. The frequency of the duplication allele was significantly decreased in ovarian cancer patients. However, when malignant and benign tumours were considered separately, the decrease was only significant in benign tumours. Conclusion The allele with the tandem duplication does not appear to modify breast cancer risk but may act as a low penetrance protective allele for ovarian cancer.

  5. An unusual, duplicate origin of the anterior choroidal artery with aneurysm: a case report. (United States)

    Chenin, Louis; Chivot, Cyril; Toussaint, Patrick; Deramond, Hervé; Peltier, Johann


    Aneurysms of the anterior choroidal artery (AChoA) are rare and often difficult to treat. Variations may be present and must be identified prior to treatment. We report a unique case of a ruptured aneurysm located at the origin of a duplicate branch of the AChoA. A 56-year-old male was admitted to our university hospital for coma. A brain CT scan showed a subarachnoid hemorrhage, and CT angiography revealed a duplication of the right AChoA, with an aneurysm located at the branch's origin. We decided to embolize this aneurysm. Four weeks later, our patient was able to transfer to the rehabilitation unit. To the best of our knowledge, this is one of the first descriptions of an aneurysm located at the origin of a duplicate branch of the AChoA.

  6. Use of negative contrast computed tomography for diagnosis of a colonic duplication in a dog. (United States)

    de Battisti, A; Harran, N; Chanoit, G; Warren-Smith, C


    A 24-week-old dog was presented with recurrent rectal prolapse because of colonic duplication. Colonic duplication is an extremely uncommon congenital abnormality, with only six cases reported in veterinary medicine, one diagnosed at necropsy and five after barium enema, colonoscopy, abdominal ultrasound, exploratory laparotomy either alone or in combination. In this case, these techniques failed to identify the abnormality and diagnosis was ultimately achieved via negative contrast computed tomography. The evaluation generated by the computed tomography images allowed a refined surgical approach. To the authors' knowledge, negative contrast computed tomography has not yet been reported in the veterinary literature to diagnose gastrointestinal pathologies. Colonic duplication in this case was treated by removal of the intercolonic septum via colotomy. © 2013 British Small Animal Veterinary Association.

  7. Dealing with duplicate regulations and conflicting jurisdictions

    International Nuclear Information System (INIS)

    Aamodt, P.L.


    There are a number of situations where mixed wastes are regulated by dual regulations and regulators. This presentation attempts to show where such duplication exists and how it evolved historically through legislative actions. The presentation includes a discussion of strategies that have been used to deal with the problems that result from duplicate regulations and jurisdictional conflicts. The RCRA and AEA regulations are really more similar than dissimilar. There are significant issues that must be worked through with the regulators. It is most important to work with your regulators early in process. The following are suggestions for dealing with the regulators. (1) Know the regulations in advance of discussions. (2) Begin dialogue with the regulator(s) as early as possible and get to know the people you will be dealing with -- and let them know you. (3) Explain the technical/regulatory issues/problems that you face at your facility in sufficient detail that they are clearly understood, and work with the regulator(s) to reasonably address them in the language/requirements of the permit. (4) Always attempt to comply with the regulations first before going in with a variance request -- document your efforts, and be honest with your assessment of issues. (5) Don't be adversarial -- remember that the regulator has the same objectives as you do. 1 tab

  8. Chromosome duplication in Lolium multiflorum Lam.

    Directory of Open Access Journals (Sweden)

    Roselaine Cristina Pereira


    Full Text Available Artificial chromosome duplication of diploid genotypes of Lolium multiflorum (2n=2x=14 is worthy to breeding, and aims to increase the expression of traits with agronomic interest. The purpose of this study was to obtain polyploid plants of L. multiflorum from local diploid populations in order to exploit adaptation and future verification of the effects of polyploidy in agronomic traits. Seedlings were immersed in different colchicine solutions for an exposure time of 3h and 24h. Ploidy determination was made by the DNA content and certified by chromosomes counts. The plants confirmed as tetraploids were placed in a greenhouse, and, at flowering, pollen viability was evaluated, and seeds were harvested to assess the stability of the progenies. The percentage of polyploids obtained was 20%. Pollen viability of the tetraploids generated ranged from 58% to 69%. The tetraploid plants obtained in the experiment generated 164 progenies, of which 109 presented DNA content compatible with the tetraploid level, showing stability of chromosome duplication in the filial generation.

  9. Duplication of the pituitary gland associated with multiple blastogenesis defects: Duplication of the pituitary gland (DPG)-plus syndrome. Case report and review of literature. (United States)

    Manjila, Sunil; Miller, Erin A; Vadera, Sumeet; Goel, Rishi K; Khan, Fahd R; Crowe, Carol; Geertman, Robert T


    Duplication of the pituitary gland (DPG) is a rare craniofacial developmental anomaly occurring during blastogenesis with postulated etiology such as incomplete twinning, teratogens, median cleft face syndrome or splitting of the notochord. The complex craniocaudal spectrum of blastogenesis defects associated with DPG is examined with an illustrative case. We report for the first time in the medical literature some unique associations with DPG, such as a clival encephalocele, third cerebral peduncle, duplicate odontoid process and a double tongue with independent volitional control. This patient also has the previously reported common associations such as duplicated sella, cleft palate, hypertelorism, callosal agenesis, hypothalamic enlargement, nasopharyngeal teratoma, fenestrated basilar artery and supernumerary teeth. This study also reviews 37 cases of DPG identified through MEDLINE literature search from 1880 to 2011. It provides a detailed analysis of the current case through physical examination and imaging. The authors propose that the developmental deformities associated with duplication of pituitary gland (DPG) occur as part of a developmental continuum, not as chance associations. Considering the fact that DPG is uniquely and certainly present throughout the spectrum of these blastogenesis defects, we suggest the term DPG-plus syndrome.

  10. A duplication of the mouth associated with a dysontogenic cyst: a case report and discussion of theories of origin. (United States)

    Mews, Lorissa; Isaac, Andre; Leonard, Norma; Lacson, Atilano G; AlQudehy, Zeinab Ali; El-Hakim, Hamdy


    IMPORTANCE Diprosopus is a medical condition that refers to full or partial craniofacial duplication. A particular subset of this condition, duplication of the mouth, is an exceedingly rare condition, with 7 reported cases in the medical literature. The embryogenesis and mechanism of disease are not well understood. The objective of this report was to describe a case of partial facial duplication with a discussion of the previous literature, leading to a proposed theory of embryogenesis for this rare anomaly. OBSERVATIONS We present a rare case of duplication of the mouth associated with an intraoral dysontogenic cyst, which presented with upper airway obstruction. The diagnostic and management strategies are discussed, as well as the histopathological features and theories of embryogenesis. CONCLUSIONS AND RELEVANCE On the basis of our findings, we propose the mechanism of origin for duplication of the mouth to be duplication of the first branchial arch. This case offers a deeper understanding of the mechanism of this disease than previously reported. Additional basic science and clinical research is needed to corroborate this theory.

  11. Method for linking a media work to perform an action, involves linking an electronic media work with a reference electronic media work identifier associated with a reference electronic media work using an approximate neighbor search

    DEFF Research Database (Denmark)


    A computer-implemented method including the steps of: receiving, by a computer system including at least one computer, a media work uploaded from a first electronic device; receiving, by the computer system from a second electronic device, a tag associated with the media work having a media work...... identifier; storing, by the computer system, the media work identifier and the associated tag; obtaining, by the computer system from a third electronic device, a query related to the associated tag; correlating, by the computer system, the query with associated information related to an action...... to be performed; and providing, from the computer system to the third electronic device, the associated information to be used in performing the action....

  12. Cholecystitis of a duplicated gallbladder complicated by a cholecystoenteric fistula

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Brady K. [University of Rochester Medical Center, Department of Imaging Sciences, Rochester, NY (United States); Chess, Mitchell A. [University of Rochester Medical Center, Department of Imaging Sciences, Rochester, NY (United States); Advanced Imaging, Batavia, NY (United States)


    Gallbladder duplications are uncommon anatomic variants that are sometimes mistaken for other entities on imaging. We present a surgically confirmed case of cholecystitis in a ductular-type duplicated gallbladder complicated by the formation of an inflammatory fistula to the adjacent duodenum. Both US and magnetic resonance cholangiopancreatography were performed preoperatively, in addition to intraoperative cholangiography, which confirmed the presence of a duplicated gallbladder. (orig.)

  13. Spinal Accessory Nerve Duplication: A Case Report and Literature Review


    Papagianni, Eleni; Kosmidou, Panagiota; Fergadaki, Sotiria; Pallantzas, Athanasios; Skandalakis, Panagiotis; Filippou, Dimitrios


    Aim of the present study is to expand our knowledge of the anatomy of the 11th cranial nerve and discuss the clinical importance and literature pertaining to accessory nerve duplication. We present one case of duplicated spinal accessory nerve in a patient undergoing neck dissection for oral cavity cancer. The literature review confirms the extremely rare diagnosis of a duplicated accessory nerve. Its clinical implication is of great importance. From this finding, a further extension to our k...

  14. Duplication of the Portal Vein: A Case Report

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sang Won; Shin, Hyeong Cheol; Jou, Sung Shick; Han, Jong Kyu; Kim, Il Young [Soonchunhyang University Cheonan Hospital, Cheonan (Korea, Republic of)


    The duplication of the portal vein is an uncommon congenital anomaly. To date, only four cases have been reported in the medical literature. This anomaly can cause portal hypertension in pediatric patients. In addition, duplication of the portal vein has various patterns of connection with a splenic vein or mesenteric veins, and it can lie anterior or posterior to the duodenum. We report the MDCT findings of an adult patient with duplication of the portal vein that was found incidentally

  15. Two sequence-ready contigs spanning the two copies of a 200-kb duplication on human 21q: partial sequence and polymorphisms. (United States)

    Potier, M; Dutriaux, A; Orti, R; Groet, J; Gibelin, N; Karadima, G; Lutfalla, G; Lynn, A; Van Broeckhoven, C; Chakravarti, A; Petersen, M; Nizetic, D; Delabar, J; Rossier, J


    Physical mapping across a duplication can be a tour de force if the region is larger than the size of a bacterial clone. This was the case of the 170- to 275-kb duplication present on the long arm of chromosome 21 in normal human at 21q11.1 (proximal region) and at 21q22.1 (distal region), which we described previously. We have constructed sequence-ready contigs of the two copies of the duplication of which all the clones are genuine representatives of one copy or the other. This required the identification of four duplicon polymorphisms that are copy-specific and nonallelic variations in the sequence of the STSs. Thirteen STSs were mapped inside the duplicated region and 5 outside but close to the boundaries. Among these STSs 10 were end clones from YACs, PACs, or cosmids, and the average interval between two markers in the duplicated region was 16 kb. Eight PACs and cosmids showing minimal overlaps were selected in both copies of the duplication. Comparative sequence analysis along the duplication showed three single-basepair changes between the two copies over 659 bp sequenced (4 STSs), suggesting that the duplication is recent (less than 4 mya). Two CpG islands were located in the duplication, but no genes were identified after a 36-kb cosmid from the proximal copy of the duplication was sequenced. The homology of this chromosome 21 duplicated region with the pericentromeric regions of chromosomes 13, 2, and 18 suggests that the mechanism involved is probably similar to pericentromeric-directed mechanisms described in interchromosomal duplications. Copyright 1998 Academic Press.

  16. Enterprise Reference Library (United States)

    Bickham, Grandin; Saile, Lynn; Havelka, Jacque; Fitts, Mary


    Introduction: Johnson Space Center (JSC) offers two extensive libraries that contain journals, research literature and electronic resources. Searching capabilities are available to those individuals residing onsite or through a librarian s search. Many individuals have rich collections of references, but no mechanisms to share reference libraries across researchers, projects, or directorates exist. Likewise, information regarding which references are provided to which individuals is not available, resulting in duplicate requests, redundant labor costs and associated copying fees. In addition, this tends to limit collaboration between colleagues and promotes the establishment of individual, unshared silos of information The Integrated Medical Model (IMM) team has utilized a centralized reference management tool during the development, test, and operational phases of this project. The Enterprise Reference Library project expands the capabilities developed for IMM to address the above issues and enhance collaboration across JSC. Method: After significant market analysis for a multi-user reference management tool, no available commercial tool was found to meet this need, so a software program was built around a commercial tool, Reference Manager 12 by The Thomson Corporation. A use case approach guided the requirements development phase. The premise of the design is that individuals use their own reference management software and export to SharePoint when their library is incorporated into the Enterprise Reference Library. This results in a searchable user-specific library application. An accompanying share folder will warehouse the electronic full-text articles, which allows the global user community to access full -text articles. Discussion: An enterprise reference library solution can provide a multidisciplinary collection of full text articles. This approach improves efficiency in obtaining and storing reference material while greatly reducing labor, purchasing and

  17. Long segment ileal duplication with extensive gastric heterotopia

    Directory of Open Access Journals (Sweden)

    Jacob Sunitha


    Full Text Available Duplications of the alimentary tract are rare congenital anomalies which can be found at all levels of the alimentary tract. Majority of the duplications present as spherical cysts and usually range from a few millimeters to less than ten centimeters in size. Duplications produce complications such as intestinal obstruction or hemorrhage. A two-month-old infant presented with recurrent episodes of bleeding per rectum. Laparotomy revealed a giant ileal duplicated bowel segment which exhibited extensive gastric heterotopia with focal ulceration.

  18. Chromosomal duplication strains of Aspergillus nidulans and their instability

    International Nuclear Information System (INIS)

    Azevedo, J.L. de; Almeida Okino, L.M. de


    Strains of Aspergillus nidulans with chromosomal duplication were obtained after gamma irradiation followed by crossing of the translocated strains with normal strains. From 20 analysed colonies, 12 have shown translocations induced by irradiation. Segregants from four of these translocation strains crossed to normal strains have shown to be unstable although presenting normal morphology. Two segregants were genetically analysed. The first one has shown a duplication of part of linkage groups VIII and the second one presented a duplication of a segment of linkage group V. These new duplication strains in A. nidulans open new perspectives of a more detailed study of the instability phenomenon in this fungus. (Author) [pt

  19. Duodenal duplication cyst extending into the posterior mediastinum

    Directory of Open Access Journals (Sweden)

    Tuzun Sefa


    Conclusion: Duodenal and the other intestinal duplication cysts should be considered in the differential diagnosis of oral contrast enhanced intrathoracic lesions in thorocoabdominal computerised tomography imaging.

  20. Measurement of the IgG2 response to Pneumococcal capsular polysaccharides may identify an antibody deficiency in individuals referred for immunological investigation. (United States)

    Parker, Antony; Irure Ventura, Juan; Sims, Dawn; Echeverría de Carlos, Ainara; Gómez de la Torre, Ricardo; Tricas Aizpún, Lourdes; Ocejo-Vinyals, J Gonzalo; López-Hoyos, Marcos; Wallis, Gregg; Harding, Stephen


    IgG2 is the most efficient subclass for providing protection against pneumococcal pathogens. We hypothesised that some individuals may be unable to mount an effective pneumococcal capsular polysaccharide (PCP) IgG2 response despite having a normal PCP IgG concentration (PCP IgG2 deficient). The median pre-vaccination PCP IgG2 concentration was significantly lower in individuals referred for immunological investigation compared to healthy controls (2.8 mg/L range, 95% CI 1.1-88 vs. 29.5mg/L, 95% CI 13.5-90, p = 0.0002). PCP IgG:IgG2 ratios were significantly higher for the referral population than for healthy controls suggesting the increased production of PCP specific subclasses other than IgG2. The percentage of individuals with PCP IgG2 deficiency was significantly higher in referral groups compared to controls (31% vs. 5%; p = 0.0009) and in an individual with PCP IgG2 deficiency, the balance of PCP specific IgG subclass antibodies post vaccination changed from IgG2>IgG1>IgG3>IgG4 to IgG1>IgG3>IgG2>IgG4. The median PCP IgG2 concentration in those with PCP IgG2 deficiency was significantly lower in the referral groups compared to controls (7.8 mg/L, 95% CI 1.1-12 vs. 12.7 mg/L, 95% CI 11.8-13.1; p = 0.006). The data suggests a defect in the production PCP IgG2 may be present in individuals with normal PCP IgG referred for immunological investigation.

  1. The Centrosome and Its Duplication Cycle (United States)

    Fu, Jingyan; Hagan, Iain M.; Glover, David M.


    The centrosome was discovered in the late 19th century when mitosis was first described. Long recognized as a key organelle of the spindle pole, its core component, the centriole, was realized more than 50 or so years later also to comprise the basal body of the cilium. Here, we chart the more recent acquisition of a molecular understanding of centrosome structure and function. The strategies for gaining such knowledge were quickly developed in the yeasts to decipher the structure and function of their distinctive spindle pole bodies. Only within the past decade have studies with model eukaryotes and cultured cells brought a similar degree of sophistication to our understanding of the centrosome duplication cycle and the multiple roles of this organelle and its component parts in cell division and signaling. Now as we begin to understand these functions in the context of development, the way is being opened up for studies of the roles of centrosomes in human disease. PMID:25646378

  2. Biased exonization of transposed elements in duplicated genes: A lesson from the TIF-IA gene

    Directory of Open Access Journals (Sweden)

    Shomron Noam


    Full Text Available Abstract Background Gene duplication and exonization of intronic transposed elements are two mechanisms that enhance genomic diversity. We examined whether there is less selection against exonization of transposed elements in duplicated genes than in single-copy genes. Results Genome-wide analysis of exonization of transposed elements revealed a higher rate of exonization within duplicated genes relative to single-copy genes. The gene for TIF-IA, an RNA polymerase I transcription initiation factor, underwent a humanoid-specific triplication, all three copies of the gene are active transcriptionally, although only one copy retains the ability to generate the TIF-IA protein. Prior to TIF-IA triplication, an Alu element was inserted into the first intron. In one of the non-protein coding copies, this Alu is exonized. We identified a single point mutation leading to exonization in one of the gene duplicates. When this mutation was introduced into the TIF-IA coding copy, exonization was activated and the level of the protein-coding mRNA was reduced substantially. A very low level of exonization was detected in normal human cells. However, this exonization was abundant in most leukemia cell lines evaluated, although the genomic sequence is unchanged in these cancerous cells compared to normal cells. Conclusion The definition of the Alu element within the TIF-IA gene as an exon is restricted to certain types of cancers; the element is not exonized in normal human cells. These results further our understanding of the delicate interplay between gene duplication and alternative splicing and of the molecular evolutionary mechanisms leading to genetic innovations. This implies the existence of purifying selection against exonization in single copy genes, with duplicate genes free from such constrains.

  3. MicroRNA Expression Profiling to Identify and Validate Reference Genes for the Relative Quantification of microRNA in Rectal Cancer

    DEFF Research Database (Denmark)

    Eriksen, Anne Haahr Mellergaard; Andersen, Rikke Fredslund; Pallisgaard, Niels


    the miRNA profiling experiment, miR-645, miR-193a-5p, miR-27a and let-7g were identified as stably expressed, both in malignant and stromal tissue. In addition, NormFinder confirmed high expression stability for the four miRNAs. In the RT-qPCR based validation experiments, no significant difference...... management. Real-time quantitative polymerase chain reaction (RT-qPCR) is commonly used, when measuring miRNA expression. Appropriate normalisation of RT-qPCR data is important to ensure reliable results. The aim of the present study was to identify stably expressed miRNAs applicable as normaliser candidates...... in future studies of miRNA expression in rectal cancer.MATERIALS AND METHODS: We performed high-throughput miRNA profiling (OpenArray®) on ten pairs of laser micro-dissected rectal cancer tissue and adjacent stroma. A global mean expression normalisation strategy was applied to identify the most stably...

  4. DB2: a probabilistic approach for accurate detection of tandem duplication breakpoints using paired-end reads. (United States)

    Yavaş, Gökhan; Koyutürk, Mehmet; Gould, Meetha P; McMahon, Sarah; LaFramboise, Thomas


    With the advent of paired-end high throughput sequencing, it is now possible to identify various types of structural variation on a genome-wide scale. Although many methods have been proposed for structural variation detection, most do not provide precise boundaries for identified variants. In this paper, we propose a new method, Distribution Based detection of Duplication Boundaries (DB2), for accurate detection of tandem duplication breakpoints, an important class of structural variation, with high precision and recall. Our computational experiments on simulated data show that DB2 outperforms state-of-the-art methods in terms of finding breakpoints of tandem duplications, with a higher positive predictive value (precision) in calling the duplications' presence. In particular, DB2's prediction of tandem duplications is correct 99% of the time even for very noisy data, while narrowing down the space of possible breakpoints within a margin of 15 to 20 bps on the average. Most of the existing methods provide boundaries in ranges that extend to hundreds of bases with lower precision values. Our method is also highly robust to varying properties of the sequencing library and to the sizes of the tandem duplications, as shown by its stable precision, recall and mean boundary mismatch performance. We demonstrate our method's efficacy using both simulated paired-end reads, and those generated from a melanoma sample and two ovarian cancer samples. Newly discovered tandem duplications are validated using PCR and Sanger sequencing. Our method, DB2, uses discordantly aligned reads, taking into account the distribution of fragment length to predict tandem duplications along with their breakpoints on a donor genome. The proposed method fine tunes the breakpoint calls by applying a novel probabilistic framework that incorporates the empirical fragment length distribution to score each feasible breakpoint. DB2 is implemented in Java programming language and is freely available

  5. Reciprocal duplication of the Williams-Beuren syndrome deletion on chromosome 7q11.23 is associated with schizophrenia. (United States)

    Mulle, Jennifer Gladys; Pulver, Ann E; McGrath, John A; Wolyniec, Paula S; Dodd, Anne F; Cutler, David J; Sebat, Jonathan; Malhotra, Dheeraj; Nestadt, Gerald; Conrad, Donald F; Hurles, Matthew; Barnes, Chris P; Ikeda, Masashi; Iwata, Nakao; Levinson, Douglas F; Gejman, Pablo V; Sanders, Alan R; Duan, Jubao; Mitchell, Adele A; Peter, Inga; Sklar, Pamela; O'Dushlaine, Colm T; Grozeva, Detelina; O'Donovan, Michael C; Owen, Michael J; Hultman, Christina M; Kähler, Anna K; Sullivan, Patrick F; Kirov, George; Warren, Stephen T


    Several copy number variants (CNVs) have been implicated as susceptibility factors for schizophrenia (SZ). Some of these same CNVs also increase risk for autism spectrum disorders, suggesting an etiologic overlap between these conditions. Recently, de novo duplications of a region on chromosome 7q11.23 were associated with autism spectrum disorders. The reciprocal deletion of this region causes Williams-Beuren syndrome. We assayed an Ashkenazi Jewish cohort of 554 SZ cases and 1014 controls for genome-wide CNV. An excess of large rare and de novo CNVs were observed, including a 1.4 Mb duplication on chromosome 7q11.23 identified in two unrelated patients. To test whether this 7q11.23 duplication is also associated with SZ, we obtained data for 14,387 SZ cases and 28,139 controls from seven additional studies with high-resolution genome-wide CNV detection. We performed a meta-analysis, correcting for study population of origin, to assess whether the duplication is associated with SZ. We found duplications at 7q11.23 in 11 of 14,387 SZ cases with only 1 in 28,139 control subjects (unadjusted odds ratio 21.52, 95% confidence interval: 3.13-922.6, p value 5.5 × 10(-5); adjusted odds ratio 10.8, 95% confidence interval: 1.46-79.62, p value .007). Of three SZ duplication carriers with detailed retrospective data, all showed social anxiety and language delay premorbid to SZ onset, consistent with both human studies and animal models of the 7q11.23 duplication. We have identified a new CNV associated with SZ. Reciprocal duplication of the Williams-Beuren syndrome deletion at chromosome 7q11.23 confers an approximately tenfold increase in risk for SZ. Copyright © 2014 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  6. Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family

    Directory of Open Access Journals (Sweden)

    Bowerman Bruce


    Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456

  7. Dynamic Delayed Duplicate Detection for External Memory Model Checking

    DEFF Research Database (Denmark)

    Evangelista, Sami


    Duplicate detection is an expensive operation of disk-based model checkers. It consists of comparing some potentially new states, the candidate states, to previous visited states. We propose a new approach to this technique called dynamic delayed duplicate detection. This one exploits some typical...

  8. Double-blind ureteral duplication: report of two cases

    International Nuclear Information System (INIS)

    Choi, Ja-Young; Kim, Seung Hyup; Kim, Sun Ho


    Blind ending of ureteral duplication is one of the most rare anomalies of the upper urinary tract. We report two cases of ureteral duplication with a blind ending both superiorly and inferiorly, and with no definite communication with the urinary tract. (orig.)

  9. Female Urethral Duplication: Rare Anomaly with Unusual Presentation

    African Journals Online (AJOL)

    UD is classified according to plane (frontal or sagittal) of duplication into different types: (1) Double urethra and double bladder, (2) double urethra with single bladder,. (3) accessory urethra posterior to the normal channel,. (4) double proximal urethra and single distal urethra, and. (5) single proximal urethra and duplicated ...

  10. A rare case of congenital Y-type urethral duplication

    Directory of Open Access Journals (Sweden)

    Charu Tiwari


    Full Text Available Duplication of urethra is a rare congenital anomaly. We report a case of Y-type of urethral duplication with the accessory urethra arising from posterior urethra and opening in the perineum. The orthotopic urethra was normal. The accessory urethral tract was cored, transfixed and divided. At 1 year of follow-up, the patient has no urinary complaints

  11. 10 CFR 7.21 - Cost of duplication of documents. (United States)


    ... 10 Energy 1 2010-01-01 2010-01-01 false Cost of duplication of documents. 7.21 Section 7.21 Energy NUCLEAR REGULATORY COMMISSION ADVISORY COMMITTEES § 7.21 Cost of duplication of documents. Copies of the records, reports, transcripts, minutes, appendices, working papers, drafts, studies, agenda, or other...

  12. Ruptured rectal duplication with urogenital abnormality: Unusual presentation

    Directory of Open Access Journals (Sweden)

    Shailesh Solanki


    Full Text Available Rectal duplication (RD accounts for 5% of alimentary tract duplication. A varied presentation and associated anomalies have been described in the literature. Antenatal rupture of the RD is very rare. We present an unusual case of a ruptured RD associated with urogenital abnormalities in newborn male. We are discussing diagnosis, embryology, management and literature review of ruptured RD.

  13. Rectal Duplication%直肠重复畸形

    Institute of Scientific and Technical Information of China (English)

    张道荣; 牟弦琴; 李振东; 李恭才; 王修忠; 代蕊霜


    @@ 我们两院近10年来共收治先天性直肠重复畸形17例(其中河北医学院11例,西安医学院6例).均经手术及病理证实.现总结如下:临床资料本组男性6例,女性11例,最小年龄4天,最大年龄14岁.%This paper reports 17 cases of rectal duplication. There were 6 males and 11rectal duplications were divided into three bordered by a common wall.9 patients in this series were found to have this condition.a rectovestitubular fistula.B.Pararectal duplication.The duplicated bowel lies near elliptical in shape and filled with fluid.In Complicated rectal duplication.The dupticated bowel is located at the perineum near the abnormal anus and is usually associated with hypospadia.Two cases were of this type.between the duplicated bowel and normal rectum must be partially resected at the distal end.The rectovestitubular fistula should be repaired at the same time.Pararectal duplication can be completely resected.resect the duplicated bowel from perineum but leave the genital anomaly for later treatment.

  14. Rectosigmoid tubular duplication presenting as perineal sepsis in a neonate. (United States)

    Zhang, Zhibo; Huang, Ying; Wang, Dajia; Su, Pengjun


    Tubular rectal duplication is a very rare congenital anomaly. We report a case of tubular rectal duplication in a newborn baby who presented with perianal sepsis. The diagnosis was confirmed by barium enema, magnetic resonance imaging, and at operation. We performed total mucosectomy through a posterior sagittal incision combined with laparotomy. The patient was doing quite well at 17-month follow-up examination.

  15. Rectal duplication cyst: a combined abdominal and endoanal operative approach. (United States)

    Rees, Clare M; Woodward, Mark; Grier, David; Cusick, Eleri


    Rectal duplication cysts are rare, comprising duplications. Early excision is the treatment of choice and a number of surgical approaches have been described. We present a 3-week-old infant with a 3 cm cyst that was excised using a previously unreported combined abdominal and endoanal approach.

  16. Ruptured rectal duplication with urogenital abnormality: Unusual presentation. (United States)

    Solanki, Shailesh; Babu, M Narendra; Jadhav, Vinay; Shankar, Gowri; Santhanakrishnan, Ramesh


    Rectal duplication (RD) accounts for 5% of alimentary tract duplication. A varied presentation and associated anomalies have been described in the literature. Antenatal rupture of the RD is very rare. We present an unusual case of a ruptured RD associated with urogenital abnormalities in newborn male. We are discussing diagnosis, embryology, management and literature review of ruptured RD.

  17. Dynamic Delayed Duplicate Detection for External Memory Model Checking

    DEFF Research Database (Denmark)

    Evangelista, Sami


    Duplicate detection is an expensive operation of disk-based model checkers. It consists of comparing some potentially new states, the candidate states, to previous visited states. We propose a new approach to this technique called dynamic delayed duplicate detection. This one exploits some typica...... significantly better than some previously published algorithms....

  18. Hypospadiac Duplication of Anterior Urethra-a Rare Congenital Anomaly. (United States)

    Goyal, Bhawana; Gupta, Suresh; Goyal, Parag


    Duplication of the urethra is a complex and rarely seen congenital anomaly with three anatomic variants: epispadiac (dorsal), hypospadiac (ventral), and Y-type. We report here a case of hypospadiac duplication of anterior urethra with dorsal blind ending urethra in a 9-year-old boy who presented with complaint of passing urine from the ventral aspect of penis.

  19. 40 CFR 25.13 - Coordination and non-duplication. (United States)


    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Coordination and non-duplication. 25.13 Section 25.13 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GENERAL PUBLIC PARTICIPATION IN... ACT § 25.13 Coordination and non-duplication. The public participation activities and materials that...

  20. Rectal duplication cyst in adults treated with transanal endoscopic microsurgery. (United States)

    Ben-Ishay, O; Person, B; Eran, B; Hershkovitz, D; Duek, D Simon


    Rectal duplication cyst is a rare entity that accounts for approximately 4% of all alimentary tract duplications. To the best of our knowledge, the presented cases are the first reports in the English literature of rectal duplication cyst resection by transanal endoscopic microsurgery. We present two patients; both are 41-year-old women with a palpable rectal mass. Workup revealed a submucosal posterior mass that was then resected by transanal endoscopic microsurgery. The pathology report described cystic lesions with squamous and columnar epithelium and segments of smooth muscle. These findings were compatible with rectal duplication cyst. Our limited experience showed good results with minimal morbidity and mortality for resection of rectal duplication cysts of limited size with no evidence of malignancy.

  1. Somatic mosaicism of an intragenic FANCB duplication in both fibroblast and peripheral blood cells observed in a Fanconi anemia patient leads to milder phenotype. (United States)

    Asur, Rajalakshmi S; Kimble, Danielle C; Lach, Francis P; Jung, Moonjung; Donovan, Frank X; Kamat, Aparna; Noonan, Raymond J; Thomas, James W; Park, Morgan; Chines, Peter; Vlachos, Adrianna; Auerbach, Arleen D; Smogorzewska, Agata; Chandrasekharappa, Settara C


    Fanconi anemia (FA) is a rare disorder characterized by congenital malformations, progressive bone marrow failure, and predisposition to cancer. Patients harboring X-linked FANCB pathogenic variants usually present with severe congenital malformations resembling VACTERL syndrome with hydrocephalus. We employed the diepoxybutane (DEB) test for FA diagnosis, arrayCGH for detection of duplication, targeted capture and next-gen sequencing for defining the duplication breakpoint, PacBio sequencing of full-length FANCB aberrant transcript, FANCD2 ubiquitination and foci formation assays for the evaluation of FANCB protein function by viral transduction of FANCB-null cells with lentiviral FANCB WT and mutant expression constructs, and droplet digital PCR for quantitation of the duplication in the genomic DNA and cDNA. We describe here an FA-B patient with a mild phenotype. The DEB diagnostic test for FA revealed somatic mosaicism. We identified a 9154 bp intragenic duplication in FANCB, covering the first coding exon 3 and the flanking regions. A four bp homology (GTAG) present at both ends of the breakpoint is consistent with microhomology-mediated duplication mechanism. The duplicated allele gives rise to an aberrant transcript containing exon 3 duplication, predicted to introduce a stop codon in FANCB protein (p.A319*). Duplication levels in the peripheral blood DNA declined from 93% to 7.9% in the span of eleven years. Moreover, the patient fibroblasts have shown 8% of wild-type (WT) allele and his carrier mother showed higher than expected levels of WT allele (79% vs. 50%) in peripheral blood, suggesting that the duplication was highly unstable. Unlike sequence point variants, intragenic duplications are difficult to precisely define, accurately quantify, and may be very unstable, challenging the proper diagnosis. The reversion of genomic duplication to the WT allele results in somatic mosaicism and may explain the relatively milder phenotype displayed by the FA

  2. A Case of Duplicated Right Vertebral Artery. (United States)

    Motomura, Mayuko; Watanabe, Koichi; Tabira, Yoko; Iwanaga, Joe; Matsuuchi, Wakako; Yoshida, Daichi; Saga, Tsuyoshi; Yamaki, Koh-Ichi


    We encountered a case of duplicated right vertebral artery during an anatomical dissection course for medical students in 2015. Two vertebral arteries were found in the right neck of a 91-year-old female cadaver. The proximal leg of the arteries arose from the area between the right subclavian artery and the right common carotid artery that diverged from the brachiocephalic artery. The distal leg arose from the right subclavian artery as expected. The proximal leg entered the transverse foramen of the fourth cervical vertebra and the distal leg entered the transverse foramen of the sixth cervical vertebra. The two right vertebral arteries joined to form one artery just after the origin of the right vertebral artery of the brachiocephalic artery entered the transverse foramen of the fourth cervical vertebra. This artery then traveled up in the transverse foramina and became the basilar artery, joining with the left vertebral artery. We discuss the embryological origin of this case and review previously reported cases.

  3. Protein Phosphatase 1 Down Regulates ZYG-1 Levels to Limit Centriole Duplication.

    Directory of Open Access Journals (Sweden)

    Nina Peel


    Full Text Available In humans perturbations of centriole number are associated with tumorigenesis and microcephaly, therefore appropriate regulation of centriole duplication is critical. The C. elegans homolog of Plk4, ZYG-1, is required for centriole duplication, but our understanding of how ZYG-1 levels are regulated remains incomplete. We have identified the two PP1 orthologs, GSP-1 and GSP-2, and their regulators I-2SZY-2 and SDS-22 as key regulators of ZYG-1 protein levels. We find that down-regulation of PP1 activity either directly, or by mutation of szy-2 or sds-22 can rescue the loss of centriole duplication associated with a zyg-1 hypomorphic allele. Suppression is achieved through an increase in ZYG-1 levels, and our data indicate that PP1 normally regulates ZYG-1 through a post-translational mechanism. While moderate inhibition of PP1 activity can restore centriole duplication to a zyg-1 mutant, strong inhibition of PP1 in a wild-type background leads to centriole amplification via the production of more than one daughter centriole. Our results thus define a new pathway that limits the number of daughter centrioles produced each cycle.

  4. The natural history of class I primate alcohol dehydrogenases includes gene duplication, gene loss, and gene conversion.

    Directory of Open Access Journals (Sweden)

    Matthew A Carrigan

    Full Text Available Gene duplication is a source of molecular innovation throughout evolution. However, even with massive amounts of genome sequence data, correlating gene duplication with speciation and other events in natural history can be difficult. This is especially true in its most interesting cases, where rapid and multiple duplications are likely to reflect adaptation to rapidly changing environments and life styles. This may be so for Class I of alcohol dehydrogenases (ADH1s, where multiple duplications occurred in primate lineages in Old and New World monkeys (OWMs and NWMs and hominoids.To build a preferred model for the natural history of ADH1s, we determined the sequences of nine new ADH1 genes, finding for the first time multiple paralogs in various prosimians (lemurs, strepsirhines. Database mining then identified novel ADH1 paralogs in both macaque (an OWM and marmoset (a NWM. These were used with the previously identified human paralogs to resolve controversies relating to dates of duplication and gene conversion in the ADH1 family. Central to these controversies are differences in the topologies of trees generated from exonic (coding sequences and intronic sequences.We provide evidence that gene conversions are the primary source of difference, using molecular clock dating of duplications and analyses of microinsertions and deletions (micro-indels. The tree topology inferred from intron sequences appear to more correctly represent the natural history of ADH1s, with the ADH1 paralogs in platyrrhines (NWMs and catarrhines (OWMs and hominoids having arisen by duplications shortly predating the divergence of OWMs and NWMs. We also conclude that paralogs in lemurs arose independently. Finally, we identify errors in database interpretation as the source of controversies concerning gene conversion. These analyses provide a model for the natural history of ADH1s that posits four ADH1 paralogs in the ancestor of Catarrhine and Platyrrhine primates

  5. Transcriptome analysis reveals the time of the fourth round of genome duplication in common carp (Cyprinus carpio) (United States)


    Background Common carp (Cyprinus carpio) is thought to have undergone one extra round of genome duplication compared to zebrafish. Transcriptome analysis has been used to study the existence and timing of genome duplication in species for which genome sequences are incomplete. Large-scale transcriptome data for the common carp genome should help reveal the timing of the additional duplication event. Results We have sequenced the transcriptome of common carp using 454 pyrosequencing. After assembling the 454 contigs and the published common carp sequences together, we obtained 49,669 contigs and identified genes using homology searches and an ab initio method. We identified 4,651 orthologous pairs between common carp and zebrafish and found 129,984 paralogous pairs within the common carp. An estimation of the synonymous substitution rate in the orthologous pairs indicated that common carp and zebrafish diverged 120 million years ago (MYA). We identified one round of genome duplication in common carp and estimated that it had occurred 5.6 to 11.3 MYA. In zebrafish, no genome duplication event after speciation was observed, suggesting that, compared to zebrafish, common carp had undergone an additional genome duplication event. We annotated the common carp contigs with Gene Ontology terms and KEGG pathways. Compared with zebrafish gene annotations, we found that a set of biological processes and pathways were enriched in common carp. Conclusions The assembled contigs helped us to estimate the time of the fourth-round of genome duplication in common carp. The resource that we have built as part of this study will help advance functional genomics and genome annotation studies in the future. PMID:22424280

  6. Considerations for reference pump curves

    International Nuclear Information System (INIS)

    Stockton, N.B.


    This paper examines problems associated with inservice testing (IST) of pumps to assess their hydraulic performance using reference pump curves to establish acceptance criteria. Safety-related pumps at nuclear power plants are tested under the American Society of Mechanical Engineers (ASME) Boiler and Pressure Vessel Code (the Code), Section 11. The Code requires testing pumps at specific reference points of differential pressure or flow rate that can be readily duplicated during subsequent tests. There are many cases where test conditions cannot be duplicated. For some pumps, such as service water or component cooling pumps, the flow rate at any time depends on plant conditions and the arrangement of multiple independent and constantly changing loads. System conditions cannot be controlled to duplicate a specific reference value. In these cases, utilities frequently request to use pump curves for comparison of test data for acceptance. There is no prescribed method for developing a pump reference curve. The methods vary and may yield substantially different results. Some results are conservative when compared to the Code requirements; some are not. The errors associated with different curve testing techniques should be understood and controlled within reasonable bounds. Manufacturer's pump curves, in general, are not sufficiently accurate to use as reference pump curves for IST. Testing using reference curves generated with polynomial least squares fits over limited ranges of pump operation, cubic spline interpolation, or cubic spline least squares fits can provide a measure of pump hydraulic performance that is at least as accurate as the Code required method. Regardless of the test method, error can be reduced by using more accurate instruments, by correcting for systematic errors, by increasing the number of data points, and by taking repetitive measurements at each data point

  7. Rare copy number variants identified in prune belly syndrome. (United States)

    Boghossian, Nansi S; Sicko, Robert J; Giannakou, Andreas; Dimopoulos, Aggeliki; Caggana, Michele; Tsai, Michael Y; Yeung, Edwina H; Pankratz, Nathan; Cole, Benjamin R; Romitti, Paul A; Browne, Marilyn L; Fan, Ruzong; Liu, Aiyi; Kay, Denise M; Mills, James L


    Prune belly syndrome (PBS), also known as Eagle-Barrett syndrome, is a rare congenital disorder characterized by absence or hypoplasia of the abdominal wall musculature, urinary tract anomalies, and cryptorchidism in males. The etiology of PBS is largely unresolved, but genetic factors are implicated given its recurrence in families. We examined cases of PBS to identify novel pathogenic copy number variants (CNVs). A total of 34 cases (30 males and 4 females) with PBS identified from all live births in New York State (1998-2005) were genotyped using Illumina HumanOmni2.5 microarrays. CNVs were prioritized if they were absent from in-house controls, encompassed ≥10 consecutive probes, were ≥20 Kb in size, had ≤20% overlap with common variants in population reference controls, and had ≤20% overlap with any variant previously detected in other birth defect phenotypes screened in our laboratory. We identified 17 candidate autosomal CNVs; 10 cases each had one CNV and four cases each had two CNVs. The CNVs included a 158 Kb duplication at 4q22 that overlaps the BMPR1B gene; duplications of different sizes carried by two cases in the intron of STIM1 gene; a 67 Kb duplication 202 Kb downstream of the NOG gene, and a 1.34 Mb deletion including the MYOCD gene. The identified rare CNVs spanned genes involved in mesodermal, muscle, and urinary tract development and differentiation, which might help in elucidating the genetic contribution to PBS. We did not have parental DNA and cannot identify whether these CNVs were de novo or inherited. Further research on these CNVs, particularly BMP signaling is warranted to elucidate the pathogenesis of PBS. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  8. Evaluating the effectiveness of a training program that builds teachers' capability to identify and appropriately refer middle and high school students with mental health problems in Brazil: an exploratory study. (United States)

    Vieira, Marlene A; Gadelha, Ary A; Moriyama, Taís S; Bressan, Rodrigo A; Bordin, Isabel A


    In Brazil, like many countries, there has been a failure to identify mental health problems (MHP) in young people and refer them to appropriate care and support. The school environment provides an ideal setting to do this. Therefore, effective programs need to be developed to train teachers to identify and appropriately refer children with possible MHP. We aimed to evaluate teachers' ability to identify and appropriately refer students with possible MHP, and the effectiveness of a psychoeducational strategy to build teachers' capability in this area. To meet the first objective, we conducted a case-control study using a student sample. To meet the second, we employed longitudinal design with repeated measures before and after introducing the psychoeducational strategy using a teacher sample. In the case control study, the Youth Self-Report was used to investigate internalizing and externalizing problems. Before training, teachers selected 26 students who they thought were likely to have MHP. Twenty-six non-selected students acted as controls and were matched by gender, age and grade. The underlying principle was that if teachers could identify abnormal behaviors among their actual students, those with some MHP would likely be among the case group and those without among the control group. In the longitudinal study, 32 teachers were asked to evaluate six vignettes that highlighted behaviors indicating a high risk for psychosis, depression, conduct disorder, hyperactivity, mania, and normal adolescent behavior. We calculated the rates of correct answers for identifying the existence of some MHP and the need for referral before and after training; teachers were not asked to identify the individual conditions. Teachers were already able to identify the most symptomatic students, who had both internalizing and externalizing problems, as possibly having MHP, but teachers had difficulty in identifying students with internalizing problems alone. At least 50.0% of teachers

  9. Annelid Distal-less/Dlx duplications reveal varied post-duplication fates

    Directory of Open Access Journals (Sweden)

    Korchagina Natalia


    Full Text Available Abstract Background Dlx (Distal-less genes have various developmental roles and are widespread throughout the animal kingdom, usually occurring as single copy genes in non-chordates and as multiple copies in most chordate genomes. While the genomic arrangement and function of these genes is well known in vertebrates and arthropods, information about Dlx genes in other organisms is scarce. We investigate the presence of Dlx genes in several annelid species and examine Dlx gene expression in the polychaete Pomatoceros lamarckii. Results Two Dlx genes are present in P. lamarckii, Capitella teleta and Helobdella robusta. The C. teleta Dlx genes are closely linked in an inverted tail-to-tail orientation, reminiscent of the arrangement of vertebrate Dlx pairs, and gene conversion appears to have had a role in their evolution. The H. robusta Dlx genes, however, are not on the same genomic scaffold and display divergent sequences, while, if the P. lamarckii genes are linked in a tail-to-tail orientation they are a minimum of 41 kilobases apart and show no sign of gene conversion. No expression in P. lamarckii appendage development has been observed, which conflicts with the supposed conserved role of these genes in animal appendage development. These Dlx duplications do not appear to be annelid-wide, as the polychaete Platynereis dumerilii likely possesses only one Dlx gene. Conclusions On the basis of the currently accepted annelid phylogeny, we hypothesise that one Dlx duplication occurred in the annelid lineage after the divergence of P. dumerilii from the other lineages and these duplicates then had varied evolutionary fates in different species. We also propose that the ancestral role of Dlx genes is not related to appendage development.

  10. Gastric duplication cyst: A cause of rectal bleeding in a young child. (United States)

    Surridge, Clare A; Goodier, Matthew D


    Gastric duplication cysts are an uncommon congenital anomaly and rectal bleeding is a rare presentation of a complicated gastric duplication cyst. This case report describes the radiological findings in a child with a complicated gastric duplication cyst.

  11. Gastric duplication cyst: A cause of rectal bleeding in a young child

    Directory of Open Access Journals (Sweden)

    Clare A Surridge


    Full Text Available Gastric duplication cysts are an uncommon congenital anomaly and rectal bleeding is a rare presentation of a complicated gastric duplication cyst. This case report describes the radiological findings in a child with a complicated gastric duplication cyst.

  12. Are duplicated genes responsible for anthracnose resistance in common bean? (United States)

    Costa, Larissa Carvalho; Nalin, Rafael Storto; Ramalho, Magno Antonio Patto; de Souza, Elaine Aparecida


    The race 65 of Colletotrichum lindemuthianum, etiologic agent of anthracnose in common bean, is distributed worldwide, having great importance in breeding programs for anthracnose resistance. Several resistance alleles have been identified promoting resistance to this race. However, the variability that has been detected within race has made it difficult to obtain cultivars with durable resistance, because cultivars may have different reactions to each strain of race 65. Thus, this work aimed at studying the resistance inheritance of common bean lines to different strains of C. lindemuthianum, race 65. We used six C. lindemuthianum strains previously characterized as belonging to the race 65 through the international set of differential cultivars of anthracnose and nine commercial cultivars, adapted to the Brazilian growing conditions and with potential ability to discriminate the variability within this race. To obtain information on the resistance inheritance related to nine commercial cultivars to six strains of race 65, these cultivars were crossed two by two in all possible combinations, resulting in 36 hybrids. Segregation in the F2 generations revealed that the resistance to each strain is conditioned by two independent genes with the same function, suggesting that they are duplicated genes, where the dominant allele promotes resistance. These results indicate that the specificity between host resistance genes and pathogen avirulence genes is not limited to races, it also occurs within strains of the same race. Further research may be carried out in order to establish if the alleles identified in these cultivars are different from those described in the literature.

  13. Colonic duplications: Clinical presentation and radiologic features of five cases

    International Nuclear Information System (INIS)

    Blickman, J.G.; Rieu, P.H.M.; Buonomo, C.; Hoogeveen, Y.L.; Boetes, C.


    Diagnosis of colonic duplication can pose a potential problem even for those familiar with gastro-intestinal tract duplications in general but unaware of the condition due to its rarity and its apparently bimodal clinical presentation. In this report of five cases of surgically proven pediatric colonic duplication, we illustrate how the condition manifests clinically and describe the imaging features in an attempt to illustrate this bimodal presentation of the condition. The possible etiology, associated congenital anomalies and modes of clinical presentation are reviewed based on literature review as well as on our own experience

  14. Partial duplication of head--a rare congenital anomaly. (United States)

    Hemachandran, Manikkapurath; Radotra, Bishan Dass


    Duplication of notochord results in rare congenital anomalies like double headed monsters, with or without trunk/limb duplication, depending upon the extent of notochordal abnormality. Here we describe the morphological abnormalities in a case of partial duplication of cranial structures with fusion of the two. Autopsy findings suggest that the bifurcation of the neural tube took place around 4th to 6th week of gestation. There are only few reports in English literature describing the autopsy findings of such an anomaly, which is termed as Diprosopus triophthalmus in the modern literature.

  15. Early vertebrate chromosome duplications and the evolution of the neuropeptide Y receptor gene regions

    Directory of Open Access Journals (Sweden)

    Brenner Sydney


    Full Text Available Abstract Background One of the many gene families that expanded in early vertebrate evolution is the neuropeptide (NPY receptor family of G-protein coupled receptors. Earlier work by our lab suggested that several of the NPY receptor genes found in extant vertebrates resulted from two genome duplications before the origin of jawed vertebrates (gnathostomes and one additional genome duplication in the actinopterygian lineage, based on their location on chromosomes sharing several gene families. In this study we have investigated, in five vertebrate genomes, 45 gene families with members close to the NPY receptor genes in the compact genomes of the teleost fishes Tetraodon nigroviridis and Takifugu rubripes. These correspond to Homo sapiens chromosomes 4, 5, 8 and 10. Results Chromosome regions with conserved synteny were identified and confirmed by phylogenetic analyses in H. sapiens, M. musculus, D. rerio, T. rubripes and T. nigroviridis. 26 gene families, including the NPY receptor genes, (plus 3 described recently by other labs showed a tree topology consistent with duplications in early vertebrate evolution and in the actinopterygian lineage, thereby supporting expansion through block duplications. Eight gene families had complications that precluded analysis (such as short sequence length or variable number of repeated domains and another eight families did not support block duplications (because the paralogs in these families seem to have originated in another time window than the proposed genome duplication events. RT-PCR carried out with several tissues in T. rubripes revealed that all five NPY receptors were expressed in the brain and subtypes Y2, Y4 and Y8 were also expressed in peripheral organs. Conclusion We conclude that the phylogenetic analyses and chromosomal locations of these gene families support duplications of large blocks of genes or even entire chromosomes. Thus, these results are consistent with two early vertebrate

  16. Assessing duplication and loss of APETALA1/FRUITFULL homologs in Ranunculales (United States)

    Pabón-Mora, Natalia; Hidalgo, Oriane; Gleissberg, Stefan; Litt, Amy


    Gene duplication and loss provide raw material for evolutionary change within organismal lineages as functional diversification of gene copies provide a mechanism for phenotypic variation. Here we focus on the APETALA1/FRUITFULL MADS-box gene lineage evolution. AP1/FUL genes are angiosperm-specific and have undergone several duplications. By far the most significant one is the core-eudicot duplication resulting in the euAP1 and euFUL clades. Functional characterization of several euAP1 and euFUL genes has shown that both function in proper floral meristem identity, and axillary meristem repression. Independently, euAP1 genes function in floral meristem and sepal identity, whereas euFUL genes control phase transition, cauline leaf growth, compound leaf morphogenesis and fruit development. Significant functional variation has been detected in the function of pre-duplication basal-eudicot FUL-like genes, but the underlying mechanisms for change have not been identified. FUL-like genes in the Papaveraceae encode all functions reported for euAP1 and euFUL genes, whereas FUL-like genes in Aquilegia (Ranunculaceae) function in inflorescence development and leaf complexity, but not in flower or fruit development. Here we isolated FUL-like genes across the Ranunculales and used phylogenetic approaches to analyze their evolutionary history. We identified an early duplication resulting in the RanFL1 and RanFL2 clades. RanFL1 genes were present in all the families sampled and are mostly under strong negative selection in the MADS, I and K domains. RanFL2 genes were only identified from Eupteleaceae, Papaveraceae s.l., Menispermaceae and Ranunculaceae and show relaxed purifying selection at the I and K domains. We discuss how asymmetric sequence diversification, new motifs, differences in codon substitutions and likely protein-protein interactions resulting from this Ranunculiid-specific duplication can help explain the functional differences among basal-eudicot FUL-like genes

  17. p53 protects against genome instability following centriole duplication failure (United States)

    Lambrus, Bramwell G.; Uetake, Yumi; Clutario, Kevin M.; Daggubati, Vikas; Snyder, Michael; Sluder, Greenfield


    Centriole function has been difficult to study because of a lack of specific tools that allow persistent and reversible centriole depletion. Here we combined gene targeting with an auxin-inducible degradation system to achieve rapid, titratable, and reversible control of Polo-like kinase 4 (Plk4), a master regulator of centriole biogenesis. Depletion of Plk4 led to a failure of centriole duplication that produced an irreversible cell cycle arrest within a few divisions. This arrest was not a result of a prolonged mitosis, chromosome segregation errors, or cytokinesis failure. Depleting p53 allowed cells that fail centriole duplication to proliferate indefinitely. Washout of auxin and restoration of endogenous Plk4 levels in cells that lack centrioles led to the penetrant formation of de novo centrioles that gained the ability to organize microtubules and duplicate. In summary, we uncover a p53-dependent surveillance mechanism that protects against genome instability by preventing cell growth after centriole duplication failure. PMID:26150389

  18. Obstetric significance of fetal craniofacial duplication. A case report. (United States)

    Chervenak, F A; Pinto, M M; Heller, C I; Norooz, H


    Craniofacial duplication (diprosopus) is a rare form of conjoined twins. Whenever fetal hydrocephalus is diagnosed, a careful search for other anomalies, such as diprosopus, is mandatory. The obstetric management depends upon the time of the diagnosis.

  19. The duplication 17p13.3 phenotype

    DEFF Research Database (Denmark)

    Curry, Cynthia J; Rosenfeld, Jill A; Grant, Erica


    . Older patients were often overweight. Three variant phenotypes included cleft lip/palate (CLP), split hand/foot with long bone deficiency (SHFLD), and a connective tissue phenotype resembling Marfan syndrome. The duplications in patients with clefts appear to disrupt ABR, while the SHFLD phenotype......Chromosome 17p13.3 is a gene rich region that when deleted is associated with the well-known Miller-Dieker syndrome. A recently described duplication syndrome involving this region has been associated with intellectual impairment, autism and occasional brain MRI abnormalities. We report 34...... was associated with duplication of BHLHA9 as noted in two recent reports. The connective tissue phenotype did not have a convincing critical region. Our experience with this large cohort expands knowledge of this diverse duplication syndrome....

  20. Sorting by Cuts, Joins, and Whole Chromosome Duplications. (United States)

    Zeira, Ron; Shamir, Ron


    Genome rearrangement problems have been extensively studied due to their importance in biology. Most studied models assumed a single copy per gene. However, in reality, duplicated genes are common, most notably in cancer. In this study, we make a step toward handling duplicated genes by considering a model that allows the atomic operations of cut, join, and whole chromosome duplication. Given two linear genomes, [Formula: see text] with one copy per gene and [Formula: see text] with two copies per gene, we give a linear time algorithm for computing a shortest sequence of operations transforming [Formula: see text] into [Formula: see text] such that all intermediate genomes are linear. We also show that computing an optimal sequence with fewest duplications is NP-hard.

  1. Endorectal magnetic resonance imaging of a rectal duplication cyst. (United States)

    Beattie, C H; Garvey, C J; Hershman, M J


    A case of a duplication cyst of the rectum is presented. This case highlights the potential role of endoluminal magnetic resonance imaging in the diagnosis of this uncommon condition. Alternative imaging modalities and differential diagnoses are discussed.

  2. Immunohistochemical findings in rectal duplication mimicking rectal prolapse. (United States)

    Cortese, M G; Pucci, A; Macchieraldo, R; Sacco Casamassima, M G; Canavese, F


    Alimentary tract duplications represent rare anomalies, with only 5 % occurring in the rectum. The variety in clinical presentation may lead to a delay in diagnosis or to incorrect and multiple surgical procedures. We report the clinical, histological and immunohistochemical characteristics of a rectal duplication occurring in a 3-month-old male with an unusual clinical presentation. Using routine histology and immunohistochemistry, the rectal duplication showed the diffuse presence of gastric mucosa with a characteristic immunophenotype (i.e., diffuse cytokeratin 7 positivity and scattered chromogranin immunoreactivity). As far as we know, this is the first report showing an immunohistochemical differentiation pattern of gastric lining in a rectal duplication. Our results, showing the presence of gastric mucosa, are suggestive of a possible origin from the embryonic foregut.

  3. Duplicate laboratory test reduction using a clinical decision support tool. (United States)

    Procop, Gary W; Yerian, Lisa M; Wyllie, Robert; Harrison, A Marc; Kottke-Marchant, Kandice


    Duplicate laboratory tests that are unwarranted increase unnecessary phlebotomy, which contributes to iatrogenic anemia, decreased patient satisfaction, and increased health care costs. We employed a clinical decision support tool (CDST) to block unnecessary duplicate test orders during the computerized physician order entry (CPOE) process. We assessed laboratory cost savings after 2 years and searched for untoward patient events associated with this intervention. This CDST blocked 11,790 unnecessary duplicate test orders in these 2 years, which resulted in a cost savings of $183,586. There were no untoward effects reported associated with this intervention. The movement to CPOE affords real-time interaction between the laboratory and the physician through CDSTs that signal duplicate orders. These interactions save health care dollars and should also increase patient satisfaction and well-being.

  4. Noncommunicating isolated enteric duplication cyst in the abdomen ...

    African Journals Online (AJOL)

    ... Surgery 2013, 9:124–126. Keywords: abdomen, children, duplication, isolated, noncommunicating. Department of Pediatric Surgery, Seoul National University College of Medicine, .... M Abdominal pain, anorexia, fever. Ileum. Respiratory.

  5. Clinical features of SMARCA2 duplication overlap with Coffin-Siris syndrome. (United States)

    Miyake, Noriko; Abdel-Salam, Ghada; Yamagata, Takanori; Eid, Maha M; Osaka, Hitoshi; Okamoto, Nobuhiko; Mohamed, Amal M; Ikeda, Takahiro; Afifi, Hanan H; Piard, Juliette; van Maldergem, Lionel; Mizuguchi, Takeshi; Miyatake, Satoko; Tsurusaki, Yoshinori; Matsumoto, Naomichi


    Coffin-Siris syndrome is a rare congenital malformation and intellectual disability syndrome. Mutations in at least seven genes have been identified. Here, we performed copy number analysis in 37 patients with features of CSS in whom no causative mutations were identified by exome sequencing. We identified a patient with a 9p24.3-p22.2 duplication and another patient with the chromosome der(6)t(6;9)(p25;p21)mat. Both patients share a duplicated 15.8-Mb region containing 46 protein coding genes, including SMARCA2. Dominant negative effects of SMARCA2 mutations may contribute to Nicolaides-Baraitser syndrome. We conclude that their features better resemble Coffin-Siris syndrome, rather than Nicolaides-Baraitser syndrome and that these features likely arise from SMARCA2 over-dosage. Pure 9p duplications (not caused by unbalanced translocations) are rare. Copy number analysis in patients with features that overlap with Coffin-Siris syndrome is recommended to further determine their genetic aspects. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  6. Rectal duplication cyst successfully treated by laparoscopic total mesorectal excision using the prolapsing technique. (United States)

    Akahane, K; Uehara, K; Yoshioka, Y; Koide, F; Ebata, T; Yokoyama, Y; Igami, T; Sugawara, G; Takahashi, Y; Fukaya, M; Itatsu, K; Nakamura, M; Goto, H; Nagino, M


    Congenital alimentary tract duplication is a rare disease. It most frequently occurs in the ileum, with the rectum being the rarest site. Herein, we report a 38-year-old woman who was referred to our hospital because of severe anal pain. On digital examination, a smooth, round, rubbery mass was palpable; it was located 5 cm from the anal verge in the posterior rectal wall. A CT scan demonstrated a 5-cm cystic lesion located anterior to the sacrum that was displacing the rectum anteriorly. Spontaneous remission of the tumor was evident; however, after 5 months of follow-up, the patient experienced the same severe anal pain. MRI demonstrated a recurrent cystic lesion. To prevent further complications and to confirm or deny malignancy, laparoscopic total mesorectal excision using the prolapsing technique was performed. Pathologically, the cystic lesion was diagnosed as a rectal duplication cyst. This is the first report of a rectal duplication cyst successfully treated by laparoscopic total mesorectal excision. © 2011 Japan Society for Endoscopic Surgery, Asia Endosurgery Task Force and Blackwell Publishing Asia Pty Ltd.

  7. Duplicate Health Insurance Coverage: Determinants of Variation Across States


    Luft, Harold S.; Maerki, Susan C.


    Although it is recognized that many people have duplicate private health insurance coverage, either through separate purchase or as health benefits in multi-earner families, there has been little analysis of the factors determining duplicate coverage rates. A new data source, the Survey of Income and Education, offers a comparison with the only previous source of state level data, the estimates from the Health Insurance Association of America. The R2 between the two sets is only .3 and certai...

  8. Familial partial duplication (1)(p21p31)

    Energy Technology Data Exchange (ETDEWEB)

    Hoechstetter, L.; Soukup, S.; Schorry, E.K. [Children`s Hospital Research Foundation, Cincinnati, OH (United States)


    A partial duplication (1)(p21p31), resulting from a maternal direct insertion (13,1) (q22p21p31), was found in a 30-year-old woman with mental retardation, cleft palate, and multiple minor anomalies. Two other affected and deceased relatives were presumed to have the same chromosome imbalance. Duplication 1p cases are reviewed. 8 refs., 5 figs., 1 tab.

  9. Malrotation with midgut volvulus associated with perforated ileal duplication

    Directory of Open Access Journals (Sweden)

    Anand Pandey


    Full Text Available Duplication of the alimentary tract is an important surgical condition. It may occur anywhere in the gastrointestinal tract. An important complication of this entity is perforation of the normal or abnormal gut. Malrotation with midgut volvulus can be a surgical emergency. We present a patient, who presented as malrotation with midgut volvulus associated with perforated ileal duplication. The patient was successfully managed.

  10. Duplicate retention in signalling proteins and constraints from network dynamics. (United States)

    Soyer, O S; Creevey, C J


    Duplications are a major driving force behind evolution. Most duplicates are believed to fix through genetic drift, but it is not clear whether this process affects all duplications equally or whether there are certain gene families that are expected to show neutral expansions under certain circumstances. Here, we analyse the neutrality of duplications in different functional classes of signalling proteins based on their effects on response dynamics. We find that duplications involving intermediary proteins in a signalling network are neutral more often than those involving receptors. Although the fraction of neutral duplications in all functional classes increase with decreasing population size and selective pressure on dynamics, this effect is most pronounced for receptors, indicating a possible expansion of receptors in species with small population size. In line with such an expectation, we found a statistically significant increase in the number of receptors as a fraction of genome size in eukaryotes compared with prokaryotes. Although not confirmative, these results indicate that neutral processes can be a significant factor in shaping signalling networks and affect proteins from different functional classes differently. © 2010 The Authors. Journal Compilation © 2010 European Society For Evolutionary Biology.

  11. Maintenance and Loss of Duplicated Genes by Dosage Subfunctionalization. (United States)

    Gout, Jean-Francois; Lynch, Michael


    Whole-genome duplications (WGDs) have contributed to gene-repertoire enrichment in many eukaryotic lineages. However, most duplicated genes are eventually lost and it is still unclear why some duplicated genes are evolutionary successful whereas others quickly turn to pseudogenes. Here, we show that dosage constraints are major factors opposing post-WGD gene loss in several Paramecium species that share a common ancestral WGD. We propose a model where a majority of WGD-derived duplicates preserve their ancestral function and are retained to produce enough of the proteins performing this same ancestral function. Under this model, the expression level of individual duplicated genes can evolve neutrally as long as they maintain a roughly constant summed expression, and this allows random genetic drift toward uneven contributions of the two copies to total expression. Our analysis suggests that once a high level of imbalance is reached, which can require substantial lengths of time, the copy with the lowest expression level contributes a small enough fraction of the total expression that selection no longer opposes its loss. Extension of our analysis to yeast species sharing a common ancestral WGD yields similar results, suggesting that duplicated-gene retention for dosage constraints followed by divergence in expression level and eventual deterministic gene loss might be a universal feature of post-WGD evolution. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail:

  12. Endoscopic Decompression and Marsupialization of A Duodenal Duplication Cyst

    Directory of Open Access Journals (Sweden)

    Eliza I-Lin Sin


    Full Text Available Introduction: Duodenal duplication cysts are rare congenital foregut anomalies, accounting for 2%–12% of all gastrointestinal tract duplications. Surgical excision entails risk of injury to the pancreaticobiliary structures due to proximity or communication with the cyst. We present a case of duodenal duplication cyst in a 3 year-old boy who successfully underwent endoscopic decompression. Case report: AT is a young boy who first presented at 15 months of age with abdominal pain. There was one subsequent episode of pancreatitis. Ultrasonography showed the typical double wall sign of a duplication cyst and magnetic resonance cholangio-pancreatography showed a large 5 cm cyst postero-medial to the second part of the duodenum, communicating with the pancreaticobiliary system and causing dilatation of the proximal duodenum. He subsequently underwent successful endoscopic ultrasound guided decompression at 3 years of age under general anesthesia, and had an uneventful postoperative recovery. Conclusion: Endoscopic ultrasound guided assessment and treatment of gastrointestinal duplication cysts is increasingly reported in adults. To the best of our knowledge, only one case of endoscopic treatment of duodenal duplication cyst, in an older child, has been reported thus far in the paediatric literature. In this paper, we review the current literature and discuss the therapeutic options of this rare condition.

  13. Profiling of gene duplication patterns of sequenced teleost genomes: evidence for rapid lineage-specific genome expansion mediated by recent tandem duplications. (United States)

    Lu, Jianguo; Peatman, Eric; Tang, Haibao; Lewis, Joshua; Liu, Zhanjiang


    Gene duplication has had a major impact on genome evolution. Localized (or tandem) duplication resulting from unequal crossing over and whole genome duplication are believed to be the two dominant mechanisms contributing to vertebrate genome evolution. While much scrutiny has been directed toward discerning patterns indicative of whole-genome duplication events in teleost species, less attention has been paid to the continuous nature of gene duplications and their impact on the size, gene content, functional diversity, and overall architecture of teleost genomes. Here, using a Markov clustering algorithm directed approach we catalogue and analyze patterns of gene duplication in the four model teleost species with chromosomal coordinates: zebrafish, medaka, stickleback, and Tetraodon. Our analyses based on set size, duplication type, synonymous substitution rate (Ks), and gene ontology emphasize shared and lineage-specific patterns of genome evolution via gene duplication. Most strikingly, our analyses highlight the extraordinary duplication and retention rate of recent duplicates in zebrafish and their likely role in the structural and functional expansion of the zebrafish genome. We find that the zebrafish genome is remarkable in its large number of duplicated genes, small duplicate set size, biased Ks distribution toward minimal mutational divergence, and proportion of tandem and intra-chromosomal duplicates when compared with the other teleost model genomes. The observed gene duplication patterns have played significant roles in shaping the architecture of teleost genomes and appear to have contributed to the recent functional diversification and divergence of important physiological processes in zebrafish. We have analyzed gene duplication patterns and duplication types among the available teleost genomes and found that a large number of genes were tandemly and intrachromosomally duplicated, suggesting their origin of independent and continuous duplication

  14. Gene duplication and divergence affecting drug content in Cannabis sativa. (United States)

    Weiblen, George D; Wenger, Jonathan P; Craft, Kathleen J; ElSohly, Mahmoud A; Mehmedic, Zlatko; Treiber, Erin L; Marks, M David


    Cannabis sativa is an economically important source of durable fibers, nutritious seeds, and psychoactive drugs but few economic plants are so poorly understood genetically. Marijuana and hemp were crossed to evaluate competing models of cannabinoid inheritance and to explain the predominance of tetrahydrocannabinolic acid (THCA) in marijuana compared with cannabidiolic acid (CBDA) in hemp. Individuals in the resulting F2 population were assessed for differential expression of cannabinoid synthase genes and were used in linkage mapping. Genetic markers associated with divergent cannabinoid phenotypes were identified. Although phenotypic segregation and a major quantitative trait locus (QTL) for the THCA/CBDA ratio were consistent with a simple model of codominant alleles at a single locus, the diversity of THCA and CBDA synthase sequences observed in the mapping population, the position of enzyme coding loci on the map, and patterns of expression suggest multiple linked loci. Phylogenetic analysis further suggests a history of duplication and divergence affecting drug content. Marijuana is distinguished from hemp by a nonfunctional CBDA synthase that appears to have been positively selected to enhance psychoactivity. An unlinked QTL for cannabinoid quantity may also have played a role in the recent escalation of drug potency. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  15. Detection and analysis of ancient segmental duplications in mammalian genomes. (United States)

    Pu, Lianrong; Lin, Yu; Pevzner, Pavel A


    Although segmental duplications (SDs) represent hotbeds for genomic rearrangements and emergence of new genes, there are still no easy-to-use tools for identifying SDs. Moreover, while most previous studies focused on recently emerged SDs, detection of ancient SDs remains an open problem. We developed an SDquest algorithm for SD finding and applied it to analyzing SDs in human, gorilla, and mouse genomes. Our results demonstrate that previous studies missed many SDs in these genomes and show that SDs account for at least 6.05% of the human genome (version hg19), a 17% increase as compared to the previous estimate. Moreover, SDquest classified 6.42% of the latest GRCh38 version of the human genome as SDs, a large increase as compared to previous studies. We thus propose to re-evaluate evolution of SDs based on their accurate representation across multiple genomes. Toward this goal, we analyzed the complex mosaic structure of SDs and decomposed mosaic SDs into elementary SDs, a prerequisite for follow-up evolutionary analysis. We also introduced the concept of the breakpoint graph of mosaic SDs that revealed SD hotspots and suggested that some SDs may have originated from circular extrachromosomal DNA (ecDNA), not unlike ecDNA that contributes to accelerated evolution in cancer. © 2018 Pu et al.; Published by Cold Spring Harbor Laboratory Press.

  16. Testing Hypotheses on Risk Factors for Scientific Misconduct via Matched-Control Analysis of Papers Containing Problematic Image Duplications. (United States)

    Fanelli, Daniele; Costas, Rodrigo; Fang, Ferric C; Casadevall, Arturo; Bik, Elisabeth M


    It is commonly hypothesized that scientists are more likely to engage in data falsification and fabrication when they are subject to pressures to publish, when they are not restrained by forms of social control, when they work in countries lacking policies to tackle scientific misconduct, and when they are male. Evidence to test these hypotheses, however, is inconclusive due to the difficulties of obtaining unbiased data. Here we report a pre-registered test of these four hypotheses, conducted on papers that were identified in a previous study as containing problematic image duplications through a systematic screening of the journal PLoS ONE. Image duplications were classified into three categories based on their complexity, with category 1 being most likely to reflect unintentional error and category 3 being most likely to reflect intentional fabrication. We tested multiple parameters connected to the hypotheses above with a matched-control paradigm, by collecting two controls for each paper containing duplications. Category 1 duplications were mostly not associated with any of the parameters tested, as was predicted based on the assumption that these duplications were mostly not due to misconduct. Categories 2 and 3, however, exhibited numerous statistically significant associations. Results of univariable and multivariable analyses support the hypotheses that academic culture, peer control, cash-based publication incentives and national misconduct policies might affect scientific integrity. No clear support was found for the "pressures to publish" hypothesis. Female authors were found to be equally likely to publish duplicated images compared to males. Country-level parameters generally exhibited stronger effects than individual-level parameters, because developing countries were significantly more likely to produce problematic image duplications. This suggests that promoting good research practices in all countries should be a priority for the international

  17. Dissecting a hidden gene duplication: the Arabidopsis thaliana SEC10 locus.

    Directory of Open Access Journals (Sweden)

    Nemanja Vukašinović

    Full Text Available Repetitive sequences present a challenge for genome sequence assembly, and highly similar segmental duplications may disappear from assembled genome sequences. Having found a surprising lack of observable phenotypic deviations and non-Mendelian segregation in Arabidopsis thaliana mutants in SEC10, a gene encoding a core subunit of the exocyst tethering complex, we examined whether this could be explained by a hidden gene duplication. Re-sequencing and manual assembly of the Arabidopsis thaliana SEC10 (At5g12370 locus revealed that this locus, comprising a single gene in the reference genome assembly, indeed contains two paralogous genes in tandem, SEC10a and SEC10b, and that a sequence segment of 7 kb in length is missing from the reference genome sequence. Differences between the two paralogs are concentrated in non-coding regions, while the predicted protein sequences exhibit 99% identity, differing only by substitution of five amino acid residues and an indel of four residues. Both SEC10 genes are expressed, although varying transcript levels suggest differential regulation. Homozygous T-DNA insertion mutants in either paralog exhibit a wild-type phenotype, consistent with proposed extensive functional redundancy of the two genes. By these observations we demonstrate that recently duplicated genes may remain hidden even in well-characterized genomes, such as that of A. thaliana. Moreover, we show that the use of the existing A. thaliana reference genome sequence as a guide for sequence assembly of new Arabidopsis accessions or related species has at least in some cases led to error propagation.

  18. Plk4-dependent phosphorylation of STIL is required for centriole duplication

    Directory of Open Access Journals (Sweden)

    Anne-Sophie Kratz


    Full Text Available Duplication of centrioles, namely the formation of a procentriole next to the parental centriole, is regulated by the polo-like kinase Plk4. Only a few other proteins, including STIL (SCL/TAL1 interrupting locus, SIL and Sas-6, are required for the early step of centriole biogenesis. Following Plk4 activation, STIL and Sas-6 accumulate at the cartwheel structure at the initial stage of the centriole assembly process. Here, we show that STIL interacts with Plk4 in vivo. A STIL fragment harboring both the coiled-coil domain and the STAN motif shows the strongest binding affinity to Plk4. Furthermore, we find that STIL is phosphorylated by Plk4. We identified Plk4-specific phosphorylation sites within the C-terminal domain of STIL and show that phosphorylation of STIL by Plk4 is required to trigger centriole duplication.

  19. A Korean boy with 46,XX testicular disorder of sex development caused by SOX9 duplication. (United States)

    Lee, Gyung Min; Ko, Jung Min; Shin, Choong Ho; Yang, Sei Won


    The 46,XX testicular disorder of sex development (DSD), also known as 46,XX male syndrome, is a rare form of DSD and clinical phenotype shows complete sex reversal from female to male. The sex-determining region Y (SRY) gene can be identified in most 46,XX testicular DSD patients; however, approximately 20% of patients with 46,XX testicular DSD are SRY-negative. The SRY-box 9 (SOX9) gene has several important functions during testis development and differentiation in males, and overexpression of SOX9 leads to the male development of 46,XX gonads in the absence of SRY. In addition, SOX9 duplication has been found to be a rare cause of 46,XX testicular DSD in humans. Here, we report a 4.2-year-old SRY-negative 46,XX boy with complete sex reversal caused by SOX9 duplication for the first time in Korea. He showed normal external and internal male genitalia except for small testes. Fluorescence in situ hybridization and polymerase chain reaction (PCR) analyses failed to detect the presence of SRY, and SOX9 intragenic mutation was not identified by direct sequencing analysis. Therefore, we performed real-time PCR analyses with specific primer pairs, and duplication of the SOX9 gene was revealed. Although SRY-negative 46,XX testicular DSD is a rare condition, an effort to make an accurate diagnosis is important for the provision of proper genetic counseling and for guiding patients in their long-term management.

  20. A duplicated PLP gene causing Pelizaeus-Merzbacher disease detected by comparative multiplex PCR

    Energy Technology Data Exchange (ETDEWEB)

    Inoue, K.; Sugiyama, N.; Kawanishi, C. [Yokohama City Univ., Yokohama (Japan)] [and others


    Pelizaeus-Merzbacher disease (PMD) is an X-linked dysmyelinating disorder caused by abnormalities in the proteolipid protein (PLP) gene, which is essential for oligodendrocyte differentiation and CNS myelin formation. Although linkage analysis has shown the homogeneity at the PLP locus in patients with PMD, exonic mutations in the PLP gene have been identified in only 10% - 25% of all cases, which suggests the presence of other genetic aberrations, including gene duplication. In this study, we examined five families with PMD not carrying exonic mutations in PLP gene, using comparative multiplex PCR (CM-PCR) as a semiquantitative assay of gene dosage. PLP gene duplications were identified in four families by CM-PCR and confirmed in three families by densitometric RFLP analysis. Because a homologous myelin protein gene, PMP22, is duplicated in the majority of patients with Charcot-Marie-Tooth 1A, PLP gene overdosage may be an important genetic abnormality in PMD and affect myelin formation. 38 ref., 5 figs., 2 tabs.

  1. Pelvicalyceal system duplication with ectopic ureter – diagnostic difficulties associated with the imaging procedure. Two cases report

    Directory of Open Access Journals (Sweden)

    Agnieszka Pukajło-Marczyk


    Full Text Available Urinary tract abnormalities are the most frequently occurring developmental anomaly in children. Pelvicalyceal system duplication is one of them and signifies the existence of two urine diverting separate systems. This anomaly occurs in 10% of population, usually in girls, and is associated with complete or partial ureter duplication. The frequency of total ureter duplication, which in 20–40% of patients is found as bilateral, is 1:125 children (0.8% of the population. The most frequent malformation is asymptomatic, diagnosed coincidentally casually and does not require any treatment. In some patients with pelvicalyceal system duplication, vesicoureteral reflux (VUR and ectopic ureter may coexist. Malposition of ureter’s orifice into the bladder predispose to urinary retention, development of hydronephrosis and urinary tract infection (UTI. Ectopic ureterocele is recognized in 6–20% of children with recurrent UTI. The reason why children are referred to the hospital is UTI or hydronephrosis revealed by ultrasound imaging. When the ultrasound image of pelvicalyceal system duplication is ambiguous, micturating cystourethrography (MCU and scintigraphy become the primary diagnostic procedure, or urography – in more complicated cases. In the case of ectopic ureter, the danger of inappropriate catheterization, i.e. directly into its lumen, may occur. Though very rare, this may cause some diagnostic difficulties and lead to injury of the urinary tract. For this reason, we want to further discuss this complication following a diagnostic procedure on the example of two cases of pelvicalyceal system duplication with ectopic ureter.

  2. Laparoscopic pyeloplasty for ureteropelvic junction obstruction of the lower moiety in a completely duplicated collecting system: a case report

    Directory of Open Access Journals (Sweden)

    Stravodimos Konstantinos G


    Full Text Available Abstract Introduction There are only a few reports on laparoscopic pyeloplasty in kidney abnormalities and only one case for laparoscopic pyeloplasty in a duplicated system. Increasing experience in laparoscopic techniques allows proper treatment of such anomalies. However, its feasibility in difficult cases with altered kidney anatomy such as that of duplicated renal pelvis still needs to be addressed. Case presentation We present a case of a 22-year-old white Caucasian female patient with ureteropelvic junction obstruction of the lower ureter of a completely duplicated system that was managed with laparoscopic pyeloplasty. Crossing vessels were identified and transposed. The procedure was carried out successfully and the patient's symptoms subsided. Follow-up studies demonstrated complete resolution of the obstruction. Conclusion Since laparoscopic pyeloplasty is still an evolving procedure, its feasibility in complex cases of kidney anatomic abnormalities is herein further justified.

  3. Laparoscopic pyeloplasty for ureteropelvic junction obstruction of the lower moiety in a completely duplicated collecting system: a case report (United States)

    Stravodimos, Konstantinos G; Anastasiou, Ioannis; Adamakis, Ioannis; Kapetanakis, Theodoros; Koritsiadis, Georgios; Constantinides, Constantinos


    Introduction There are only a few reports on laparoscopic pyeloplasty in kidney abnormalities and only one case for laparoscopic pyeloplasty in a duplicated system. Increasing experience in laparoscopic techniques allows proper treatment of such anomalies. However, its feasibility in difficult cases with altered kidney anatomy such as that of duplicated renal pelvis still needs to be addressed. Case presentation We present a case of a 22-year-old white Caucasian female patient with ureteropelvic junction obstruction of the lower ureter of a completely duplicated system that was managed with laparoscopic pyeloplasty. Crossing vessels were identified and transposed. The procedure was carried out successfully and the patient's symptoms subsided. Follow-up studies demonstrated complete resolution of the obstruction. Conclusion Since laparoscopic pyeloplasty is still an evolving procedure, its feasibility in complex cases of kidney anatomic abnormalities is herein further justified. PMID:18945370

  4. Intussusception due to a cecal duplication cyst: a rare cause of acute abdomen. Case report. (United States)

    Corroppolo, M; Zampieri, N; Erculiani, E; Cecchetto, M; Camoglio, F S


    Duplications of the alimentary tract are rare congenital anomalies. The ileum is the most common site, whereas rectal, duodenal, gastric and cecal duplications are extremely rare. Duplication cysts of the cecum, in a neonate, are even rarer, with only 19 cases reported in medical literature to date. We report a case of intestinal intussusception due to a cecal duplication cyst.

  5. Clinical and molecular evaluation of SHOX/PAR1 duplications in Leri-Weill dyschondrosteosis (LWD) and idiopathic short stature (ISS). (United States)

    Benito-Sanz, S; Barroso, E; Heine-Suñer, D; Hisado-Oliva, A; Romanelli, V; Rosell, J; Aragones, A; Caimari, M; Argente, J; Ross, J L; Zinn, A R; Gracia, R; Lapunzina, P; Campos-Barros, A; Heath, K E


    Léri-Weill dyschondrosteosis (LWD) is a skeletal dysplasia characterized by disproportionate short stature and the Madelung deformity of the forearm. SHOX mutations and pseudoautosomal region 1 deletions encompassing SHOX or its enhancers have been identified in approximately 60% of LWD and approximately 15% of idiopathic short stature (ISS) individuals. Recently SHOX duplications have been described in LWD/ISS but also in individuals with other clinical manifestations, thus questioning their pathogenicity. The objective of the study was to investigate the pathogenicity of SHOX duplications in LWD and ISS. Multiplex ligation-dependent probe amplification is routinely used in our unit to analyze for SHOX/pseudoautosomal region 1 copy number changes in LWD/ISS referrals. Quantitative PCR, microsatellite marker, and fluorescence in situ hybridization analysis were undertaken to confirm all identified duplications. During the routine analysis of 122 LWD and 613 ISS referrals, a total of four complete and 10 partial SHOX duplications or multiple copy number (n > 3) as well as one duplication of the SHOX 5' flanking region were identified in nine LWD and six ISS cases. Partial SHOX duplications appeared to have a more deleterious effect on skeletal dysplasia and height gain than complete SHOX duplications. Importantly, no increase in SHOX copy number was identified in 340 individuals with normal stature or 104 overgrowth referrals. MLPA analysis of SHOX/PAR1 led to the identification of partial and complete SHOX duplications or multiple copies associated with LWD or ISS, suggesting that they may represent an additional class of mutations implicated in the molecular etiology of these clinical entities.

  6. Growth references

    NARCIS (Netherlands)

    Buuren, S. van


    A growth reference describes the variation of an anthropometric measurement within a group of individuals. A reference is a tool for grouping and analyzing data and provides a common basis for comparing populations.1 A well known type of reference is the age-conditional growth diagram. The

  7. Diprosopus (partially duplicated head) associated with anencephaly: a case report. (United States)

    al Muti Zaitoun, A; Chang, J; Booker, M


    Craniofacial duplication (diprosopus) is a rare form of conjoined twin. A 16 year old mother with a twin pregnancy delivered one normally formed baby boy and one diprosopus male. The malformed baby was 33 weeks of gestation with a single trunk, normal limbs and various degrees of facial duplication. Of the following structures there were two of each: noses, eyes, ears (and one dimple), mouths, tongues and, with bilateral central cleft lips and cleft palates. This was associated with holoprosencephaly and craniorachischisis. Internal organs showed no duplication. There were multiple congenital anomalies including diaphragmatic hernia, small lungs, two lobes of the right lung, ventricular septal defect, small adrenal gland and small left kidney with short ureter. The body also had a short neck, small chest cavities and kyphosis. X-ray revealed duplication of the vertebral column. The case presented here represents a type II of diprosopia of Rating (1933) and is the least common type reported. We also reviewed 22 recently reported cases of diprosopus. In addition to facial duplication, anencephaly, neural tube defect and cardiac malformations represent the more common congenital abnormalities associated with diprosopus. The pathogenesis of diprosopus is not well understood. Factors that play a role in diprosopus are probably similar to those factors (genetic, environmental and abnormal placental circulation) which affect monozoygotic twins as observed in this case report. Early ultrasonography diagnosis of diprosopus permits one to consider a vaginal therapeutic abortion.

  8. [Anterior rectal duplication in adult patient: a case report]. (United States)

    Rodríguez-Cabrera, J; Villanueva-Sáenz, E; Bolaños-Badillo, L E


    To report a case of rectal duplication in the adult and make a literature review. The intestinal duplications are injuries of congenital origin that can exist from the base of the tongue to the anal verge, being the most frequent site at level of terminal ileum (22%) and at the rectal level in 5% To date approximately exist 80 reports in world-wide Literature generally in the pediatric population being little frequent in the adult age. Its presentation could be tubular or cystic. The recommended treatment is the surgical resection generally in block with coloanal anastomosis. A case review of rectal duplication in the adult and the conducted treatment. The case of a patient appears with diagnose of rectal duplication with tubular type,whose main symptom was constipation and fecal impactation. In the exploration was detect double rectal lumen (anterior and posterior) that it above initiates by of the anorectal ring with fibrous ulcer of fibrinoid aspect of 3 approx cm of length x 1 cm wide, at level of the septum that separates both rectal lumina. The rectal duplication is a rare pathology in the adult nevertheless is due to suspect before the existence of alterations in the mechanics of the defecation, rectal prolapse and rectal bleeding,the election treatment is a protectomy with colonic pouch in "J" and coloanal anastomosis.

  9. Penile Duplication and Two Anal Openings; Report of a Very Rare Case


    Bakheet, Mohamed Abdel Al M.; Refaei, Mohammad


    Background Penile duplication (diphallus) is an extremely rare disorder. It is almost always associated with other malformations like double bladder, exstrophy of the cloacae, imperforate anus, duplication of the rectosigmoid and vertebral deformities. Meanwhile anal canal duplication, the most distal and least common duplication of the digestive tube and is a very rare congenital malformation. Case Presentation A 21 days old Egyptian neonate is reported with complete penile duplication and t...

  10. Evolutionary patterns of RNA-based duplication in non-mammalian chordates.

    Directory of Open Access Journals (Sweden)

    Ming Chen

    Full Text Available The role of RNA-based duplication, or retroposition, in the evolution of new gene functions in mammals, plants, and Drosophila has been widely reported. However, little is known about RNA-based duplication in non-mammalian chordates. In this study, we screened ten non-mammalian chordate genomes for retrocopies and investigated their evolutionary patterns. We identified numerous retrocopies in these species. Examination of the age distribution of these retrocopies revealed no burst of young retrocopies in ancient chordate species. Upon comparing these non-mammalian chordate species to the mammalian species, we observed that a larger fraction of the non-mammalian retrocopies was under strong evolutionary constraints than mammalian retrocopies are, as evidenced by signals of purifying selection and expression profiles. For the Western clawed frog, Medaka, and Sea squirt, many retrogenes have evolved gonad and brain expression patterns, similar to what was observed in human. Testing of retrogene movement in the Medaka genome, where the nascent sex chrosomes have been well assembled, did not reveal any significant gene movement. Taken together, our analyses demonstrate that RNA-based duplication generates many functional genes and can make a significant contribution to the evolution of non-mammalian genomes.

  11. Passive Forensics for Region Duplication Image Forgery Based on Harris Feature Points and Local Binary Patterns

    Directory of Open Access Journals (Sweden)

    Jie Zhao


    Full Text Available Nowadays the demand for identifying the authenticity of an image is much increased since advanced image editing software packages are widely used. Region duplication forgery is one of the most common and immediate tampering attacks which are frequently used. Several methods to expose this forgery have been developed to detect and locate the tampered region, while most methods do fail when the duplicated region undergoes rotation or flipping before being pasted. In this paper, an efficient method based on Harris feature points and local binary patterns is proposed. First, the image is filtered with a pixelwise adaptive Wiener method, and then dense Harris feature points are employed in order to obtain a sufficient number of feature points with approximately uniform distribution. Feature vectors for a circle patch around each feature point are extracted using local binary pattern operators, and the similar Harris points are matched based on their representation feature vectors using the BBF algorithm. Finally, RANSAC algorithm is employed to eliminate the possible erroneous matches. Experiment results demonstrate that the proposed method can effectively detect region duplication forgery, even when an image was distorted by rotation, flipping, blurring, AWGN, JPEG compression, and their mixed operations, especially resistant to the forgery with the flat area of little visual structures.

  12. Discovery of previously unidentified genomic disorders from the duplication architecture of the human genome. (United States)

    Sharp, Andrew J; Hansen, Sierra; Selzer, Rebecca R; Cheng, Ze; Regan, Regina; Hurst, Jane A; Stewart, Helen; Price, Sue M; Blair, Edward; Hennekam, Raoul C; Fitzpatrick, Carrie A; Segraves, Rick; Richmond, Todd A; Guiver, Cheryl; Albertson, Donna G; Pinkel, Daniel; Eis, Peggy S; Schwartz, Stuart; Knight, Samantha J L; Eichler, Evan E


    Genomic disorders are characterized by the presence of flanking segmental duplications that predispose these regions to recurrent rearrangement. Based on the duplication architecture of the genome, we investigated 130 regions that we hypothesized as candidates for previously undescribed genomic disorders. We tested 290 individuals with mental retardation by BAC array comparative genomic hybridization and identified 16 pathogenic rearrangements, including de novo microdeletions of 17q21.31 found in four individuals. Using oligonucleotide arrays, we refined the breakpoints of this microdeletion, defining a 478-kb critical region containing six genes that were deleted in all four individuals. We mapped the breakpoints of this deletion and of four other pathogenic rearrangements in 1q21.1, 15q13, 15q24 and 17q12 to flanking segmental duplications, suggesting that these are also sites of recurrent rearrangement. In common with the 17q21.31 deletion, these breakpoint regions are sites of copy number polymorphism in controls, indicating that these may be inherently unstable genomic regions.

  13. Increments and duplication events of enzymes and transcription factors influence metabolic and regulatory diversity in prokaryotes.

    Directory of Open Access Journals (Sweden)

    Mario Alberto Martínez-Núñez

    Full Text Available In this work, the content of enzymes and DNA-binding transcription factors (TFs in 794 non-redundant prokaryotic genomes was evaluated. The identification of enzymes was based on annotations deposited in the KEGG database as well as in databases of functional domains (COG and PFAM and structural domains (Superfamily. For identifications of the TFs, hidden Markov profiles were constructed based on well-known transcriptional regulatory families. From these analyses, we obtained diverse and interesting results, such as the negative rate of incremental changes in the number of detected enzymes with respect to the genome size. On the contrary, for TFs the rate incremented as the complexity of genome increased. This inverse related performance shapes the diversity of metabolic and regulatory networks and impacts the availability of enzymes and TFs. Furthermore, the intersection of the derivatives between enzymes and TFs was identified at 9,659 genes, after this point, the regulatory complexity grows faster than metabolic complexity. In addition, TFs have a low number of duplications, in contrast to the apparent high number of duplications associated with enzymes. Despite the greater number of duplicated enzymes versus TFs, the increment by which duplicates appear is higher in TFs. A lower proportion of enzymes among archaeal genomes (22% than in the bacterial ones (27% was also found. This low proportion might be compensated by the interconnection between the metabolic pathways in Archaea. A similar proportion was also found for the archaeal TFs, for which the formation of regulatory complexes has been proposed. Finally, an enrichment of multifunctional enzymes in Bacteria, as a mechanism of ecological adaptation, was detected.

  14. A single enhancer regulating the differential expression of duplicated red-sensitive opsin genes in zebrafish.

    Directory of Open Access Journals (Sweden)

    Taro Tsujimura


    Full Text Available A fundamental step in the evolution of the visual system is the gene duplication of visual opsins and differentiation between the duplicates in absorption spectra and expression pattern in the retina. However, our understanding of the mechanism of expression differentiation is far behind that of spectral tuning of opsins. Zebrafish (Danio rerio have two red-sensitive cone opsin genes, LWS-1 and LWS-2. These genes are arrayed in a tail-to-head manner, in this order, and are both expressed in the long member of double cones (LDCs in the retina. Expression of the longer-wave sensitive LWS-1 occurs later in development and is thus confined to the peripheral, especially ventral-nasal region of the adult retina, whereas expression of LWS-2 occurs earlier and is confined to the central region of the adult retina, shifted slightly to the dorsal-temporal region. In this study, we employed a transgenic reporter assay using fluorescent proteins and P1-artificial chromosome (PAC clones encompassing the two genes and identified a 0.6-kb "LWS-activating region" (LAR upstream of LWS-1, which regulates expression of both genes. Under the 2.6-kb flanking upstream region containing the LAR, the expression pattern of LWS-1 was recapitulated by the fluorescent reporter. On the other hand, when LAR was directly conjugated to the LWS-2 upstream region, the reporter was expressed in the LDCs but also across the entire outer nuclear layer. Deletion of LAR from the PAC clones drastically lowered the reporter expression of the two genes. These results suggest that LAR regulates both LWS-1 and LWS-2 by enhancing their expression and that interaction of LAR with the promoters is competitive between the two genes in a developmentally restricted manner. Sharing a regulatory region between duplicated genes could be a general way to facilitate the expression differentiation in duplicated visual opsins.

  15. Divergence of gene body DNA methylation and evolution of plant duplicate genes.

    Directory of Open Access Journals (Sweden)

    Jun Wang

    Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.

  16. Duplication and relocation of the functional DPY19L2 gene within low copy repeats

    Directory of Open Access Journals (Sweden)

    Cheung Joseph


    Full Text Available Abstract Background Low copy repeats (LCRs are thought to play an important role in recent gene evolution, especially when they facilitate gene duplications. Duplicate genes are fundamental to adaptive evolution, providing substrates for the development of new or shared gene functions. Moreover, silencing of duplicate genes can have an indirect effect on adaptive evolution by causing genomic relocation of functional genes. These changes are theorized to have been a major factor in speciation. Results Here we present a novel example showing functional gene relocation within a LCR. We characterize the genomic structure and gene content of eight related LCRs on human Chromosomes 7 and 12. Two members of a novel transmembrane gene family, DPY19L, were identified in these regions, along with six transcribed pseudogenes. One of these genes, DPY19L2, is found on Chromosome 12 and is not syntenic with its mouse orthologue. Instead, the human locus syntenic to mouse Dpy19l2 contains a pseudogene, DPY19L2P1. This indicates that the ancestral copy of this gene has been silenced, while the descendant copy has remained active. Thus, the functional copy of this gene has been relocated to a new genomic locus. We then describe the expansion and evolution of the DPY19L gene family from a single gene found in invertebrate animals. Ancient duplications have led to multiple homologues in different lineages, with three in fish, frogs and birds and four in mammals. Conclusion Our results show that the DPY19L family has expanded throughout the vertebrate lineage and has undergone recent primate-specific evolution within LCRs.

  17. Enteric Duplication Cysts in Children: A Clinicopathological Dilemma. (United States)

    Sharma, Sonam; Yadav, Amit K; Mandal, Ashish K; Zaheer, Sufian; Yadav, Devendra K; Samie, Amat


    Enteric duplication cysts are rare and uncommon congenital malformations formed during the embryonic period of the development of human digestive system and are mainly encountered during infancy or early childhood, but seldom in adults. The clinical presentation is extremely variable depending upon its size, location and type. We present six cases of enteric duplication cysts with diverse clinico-pathological features. This study was carried out in the Department of Pathology and Department of Paediatric Surgery, Vardhman Mahavir Medical College and Safdarjung Hospital, New Delhi, India for a period of 2 years (January 2013 - December 2014). We retrospectively analyzed six patients of enteric duplication cysts based on data obtained, which consisted of patient's age, sex, clinical presentation, radiological features, operative findings and histopathology report. The data collected was analyzed by descriptive statistics. Six children between age range of 3 days to 10 years had enteric duplication cysts. Two had ileal and one each were of pyloroduodenal, colonic and rectal duplication cyst. In one patient a presumptive diagnosis of enteric duplication cyst was made. Radiology played an important contributory role in diagnosis of these cysts in all the patients but histopathology proved to be gold standard for its confirmation. All these patients were managed by surgical excision. The postoperative and follow up period in all the cases was uneventful. It is important to be aware and make a definitive diagnosis of this rare congenital anomaly as they can present in various clinical forms and can cause significant morbidity and even mortality if left untreated by causing life threatening complications.

  18. A retroperitoneal foregut duplication cyst: a case report

    International Nuclear Information System (INIS)

    Kim, Yong Woon; Lee, Jin Hee; Byun, Kyung Hwan; Kim, Byung Ki; Sohn, Kyung Sik; Kee, Se Kook; Jeon, Jin Min; Yun, Young Kook


    Retroperitoneal foregut duplication cyst is an extremely rare congenital malformation. Pathologically, this lesion contains both gastric mucosa and respiratory type mucosa; radiologically, it is often challenging to differentiate it from the other cystic neoplasms that present a similar appearance. We report on a case of retroperitoneal foregut duplication cyst that was lined by both gastric and pseudostratified ciliated columnar epithelium, and it was also accompanied by a pancreatic pseudocyst. Initially, it presented with peripancreatic and intrapancreatic cystic masses in an asymptomatic 30-year-old man, and this man has since undergone surgical resection

  19. Urethral duplication with unusual cause of bladder outlet obstruction

    Directory of Open Access Journals (Sweden)

    Vivek Venkatramani


    Full Text Available A 12-year-old boy presented with poor flow and recurrent urinary tract infections following hypospadias repair at the age of 3 years. The evaluation revealed urethral duplication with a hypoplastic dorsal urethra and patent ventral urethra. He also had duplication of the bladder neck, and on voiding cystourethrogram the ventral bladder neck appeared hypoplastic and compressed by the dorsal bladder neck during voiding. The possibility of functional obstruction of the ventral urethra by the occluded dorsal urethra was suspected, and he underwent a successful urethro-urethrostomy.

  20. Ruptured rectal duplication cyst with classical bladder exstrophy. (United States)

    Gupta, Rahul K; Oak, Sanjay; Parelkar, Sandesh V; Sanghvi, Beejal; Kaltari, Deepak K; Prakash, Advait; Patil, Rajashekhar; Bachani, Mitesh


    A newborn boy was brought to us, 2 hours after birth, with a mucosal-lined left hemiperineal lesion associated with classical bladder exstrophy and an anterolaterally displaced anus. Perineal anatomy was restored by excising the mucosa lined lesion. The bladder closure for classical bladder exstrophy was done at the same time. Histologically, gastric, respiratory, and small intestinal epithelia were present in the mucosa. A rectal duplication cyst that had ruptured in utero through the hemiperineum could explain the anomaly. The association of classical bladder exstrophy with ruptured rectal duplication cyst has never previously been described in the literature. Copyright 2010 Elsevier Inc. All rights reserved.

  1. Duplication of the Hindgut and Lower Urinary. Tract. Case Report

    International Nuclear Information System (INIS)

    Garcia, Vanessa; Tamayo, Margarita; Montoya, Claudia; Acosta, Federico; Cano, Julian; Mejia, Francisco


    A 13 year female consulted to Heatup Pad's surgery department with a history of pelvic malformations since she was born and complaining about a colostomy done five years ago. On clinical examination an anal fistula was seen as well as perineal organs duplicated including: vulva - four labia, clitoris, vaginal canal, urethra, also double gluteal cleft. Several diagnostic modalities were performed (voiding cystourethrography, urodynamic, renal scan, CT and MRI) having a diagnosis of complete duplication of the hindgut and lower urinary tract, a rare congenital anomaly that has fewer than 50 cases reported in the literature. During hospitalization she underwent successful abdominopelvic surgical Correction.

  2. Incomplete urethral duplication with cyst formation in a dog

    International Nuclear Information System (INIS)

    Duffey, M.H.; Barnhart, M.D.; Barthez, P.Y.; Smeak, D.D.


    Incomplete urethral duplication with cyst formation was diagnosed in a dog that had soft, fluctuant, subcutaneous swellings in the ventral perineal and penile areas and a history of nocturia and incontinence during recumbency that were unresponsive to treatment with antibiotics. Retrograde urethrocystography, voiding urethrography, double-contrast cystography, radiography after direct administration of contrast medium into cystic structures, and excretory urography were performed to evaluate the urinary tract. Communication between the cysts and the urethra was demonstrated radiographically only after intralesional injection of contrast medium. Nocturia and incontinence resolved after surgical removal of the urethral duplication and cysts. The dog was clinically normal 1 year after surgery

  3. X-linked congenital ptosis and associated intellectual disability, short stature, microcephaly, cleft palate, digital and genital abnormalities define novel Xq25q26 duplication syndrome

    DEFF Research Database (Denmark)

    Møller, R S; Jensen, L R; Maas, S M


    , hypogonadism and feeding difficulties. Female carriers are often phenotypically normal or show a similar but milder phenotype, as in most cases the X-chromosome harbouring the duplication is subject to inactivation. Xq28, which includes MECP2 is the major locus for submicroscopic X-chromosome duplications......, whereas duplications in Xq25 and Xq26 have been reported in only a few cases. Using genome-wide array platforms we identified overlapping interstitial Xq25q26 duplications ranging from 0.2 to 4.76 Mb in eight unrelated families with in total five affected males and seven affected females. All affected...... males shared a common phenotype with intrauterine- and postnatal growth retardation and feeding difficulties in childhood. Three had microcephaly and two out of five suffered from epilepsy. In addition, three males had a distinct facial appearance with congenital bilateral ptosis and large protruding...

  4. Characterization of the past and current duplication activities in the human 22q11.2 region

    Directory of Open Access Journals (Sweden)

    Morrow Bernice


    Full Text Available Abstract Background Segmental duplications (SDs on 22q11.2 (LCR22, serve as substrates for meiotic non-allelic homologous recombination (NAHR events resulting in several clinically significant genomic disorders. Results To understand the duplication activity leading to the complicated SD structure of this region, we have applied the A-Bruijn graph algorithm to decompose the 22q11.2 SDs to 523 fundamental duplication sequences, termed subunits. Cross-species syntenic analysis of primate genomes demonstrates that many of these LCR22 subunits emerged very recently, especially those implicated in human genomic disorders. Some subunits have expanded more actively than others, and young Alu SINEs, are associated much more frequently with duplicated sequences that have undergone active expansion, confirming their role in mediating recombination events. Many copy number variations (CNVs exist on 22q11.2, some flanked by SDs. Interestingly, two chromosome breakpoints for 13 CNVs (mean length 65 kb are located in paralogous subunits, providing direct evidence that SD subunits could contribute to CNV formation. Sequence analysis of PACs or BACs identified extra CNVs, specifically, 10 insertions and 18 deletions within 22q11.2; four were more than 10 kb in size and most contained young AluYs at their breakpoints. Conclusions Our study indicates that AluYs are implicated in the past and current duplication events, and moreover suggests that DNA rearrangements in 22q11.2 genomic disorders perhaps do not occur randomly but involve both actively expanded duplication subunits and Alu elements.

  5. [Reference citation]. (United States)

    Brkić, Silvija


    Scientific and professional papers represent the information basis for scientific research and professional work. References important for the paper should be cited within the text, and listed at the end of the paper. This paper deals with different styles of reference citation. Special emphasis was placed on the Vancouver Style for reference citation in biomedical journals established by the International Committee of Medical Journal Editors. It includes original samples for citing various types of articles, both printed and electronic, as well as recommendations related to reference citation in accordance with the methodology and ethics of scientific research and guidelines for preparing manuscripts for publication.

  6. A new resource for characterizing X-linked genes in Drosophila melanogaster: systematic coverage and subdivision of the X chromosome with nested, Y-linked duplications. (United States)

    Cook, R Kimberley; Deal, Megan E; Deal, Jennifer A; Garton, Russell D; Brown, C Adam; Ward, Megan E; Andrade, Rachel S; Spana, Eric P; Kaufman, Thomas C; Cook, Kevin R


    Interchromosomal duplications are especially important for the study of X-linked genes. Males inheriting a mutation in a vital X-linked gene cannot survive unless there is a wild-type copy of the gene duplicated elsewhere in the genome. Rescuing the lethality of an X-linked mutation with a duplication allows the mutation to be used experimentally in complementation tests and other genetic crosses and it maps the mutated gene to a defined chromosomal region. Duplications can also be used to screen for dosage-dependent enhancers and suppressors of mutant phenotypes as a way to identify genes involved in the same biological process. We describe an ongoing project in Drosophila melanogaster to generate comprehensive coverage and extensive breakpoint subdivision of the X chromosome with megabase-scale X segments borne on Y chromosomes. The in vivo method involves the creation of X inversions on attached-XY chromosomes by FLP-FRT site-specific recombination technology followed by irradiation to induce large internal X deletions. The resulting chromosomes consist of the X tip, a medial X segment placed near the tip by an inversion, and a full Y. A nested set of medial duplicated segments is derived from each inversion precursor. We have constructed a set of inversions on attached-XY chromosomes that enable us to isolate nested duplicated segments from all X regions. To date, our screens have provided a minimum of 78% X coverage with duplication breakpoints spaced a median of nine genes apart. These duplication chromosomes will be valuable resources for rescuing and mapping X-linked mutations and identifying dosage-dependent modifiers of mutant phenotypes.

  7. Genome Mutational and Transcriptional Hotspots Are Traps for Duplicated Genes and Sources of Adaptations. (United States)

    Fares, Mario A; Sabater-Muñoz, Beatriz; Toft, Christina


    Gene duplication generates new genetic material, which has been shown to lead to major innovations in unicellular and multicellular organisms. A whole-genome duplication occurred in the ancestor of Saccharomyces yeast species but 92% of duplicates returned to single-copy genes shortly after duplication. The persisting duplicated genes in Saccharomyces led to the origin of major metabolic innovations, which have been the source of the unique biotechnological capabilities in the Baker's yeast Saccharomyces cerevisiae. What factors have determined the fate of duplicated genes remains unknown. Here, we report the first demonstration that the local genome mutation and transcription rates determine the fate of duplicates. We show, for the first time, a preferential location of duplicated genes in the mutational and transcriptional hotspots of S. cerevisiae genome. The mechanism of duplication matters, with whole-genome duplicates exhibiting different preservation trends compared to small-scale duplicates. Genome mutational and transcriptional hotspots are rich in duplicates with large repetitive promoter elements. Saccharomyces cerevisiae shows more tolerance to deleterious mutations in duplicates with repetitive promoter elements, which in turn exhibit higher transcriptional plasticity against environmental perturbations. Our data demonstrate that the genome traps duplicates through the accelerated regulatory and functional divergence of their gene copies providing a source of novel adaptations in yeast. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  8. Reference Assessment (United States)

    Bivens-Tatum, Wayne


    This article presents interesting articles that explore several different areas of reference assessment, including practical case studies and theoretical articles that address a range of issues such as librarian behavior, patron satisfaction, virtual reference, or evaluation design. They include: (1) "Evaluating the Quality of a Chat Service"…

  9. Duplication of lower lip and mandible--a rare diprosopus. (United States)

    Suhaili, D N Pengiran; Somasundaram, S; Lau, S H; Ajura, A J; Roslan, A R; Ramli, R


    Diprosopus or duplication of the lower lip and mandible is a very rare congenital anomaly. We report this unusual case occurring in a girl who presented to our hospital at the age of 4 months. Surgery and problems related to this anomaly are discussed. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  10. Exposing region duplication through local geometrical color invariant features (United States)

    Gong, Jiachang; Guo, Jichang


    Many advanced image-processing softwares are available for tampering images. How to determine the authenticity of an image has become an urgent problem. Copy-move is one of the most common image forgery operations. Many methods have been proposed for copy-move forgery detection (CMFD). However, most of these methods are designed for grayscale images without any color information used. They are usually not suitable when the duplicated regions have little structure or have undergone various transforms. We propose a CMFD method using local geometrical color invariant features to detect duplicated regions. The method starts by calculating the color gradient of the inspected image. Then, we directly take the color gradient as the input for scale invariant features transform (SIFT) to extract color-SIFT descriptors. Finally, keypoints are matched and clustered before their geometrical relationship is estimated to expose the duplicated regions. We evaluate the detection performance and computational complexity of the proposed method together with several popular CMFD methods on a public database. Experimental results demonstrate the efficacy of the proposed method in detecting duplicated regions with various transforms and poor structure.

  11. Recombination facilitates neofunctionalization of duplicate genes via originalization

    Directory of Open Access Journals (Sweden)

    Huang Ren


    Full Text Available Abstract Background Recently originalization was proposed to be an effective way of duplicate-gene preservation, in which recombination provokes the high frequency of original (or wild-type allele on both duplicated loci. Because the high frequency of wild-type allele might drive the arising and accumulating of advantageous mutation, it is hypothesized that recombination might enlarge the probability of neofunctionalization (Pneo of duplicate genes. In this article this hypothesis has been tested theoretically. Results Results show that through originalization recombination might not only shorten mean time to neofunctionalizaiton, but also enlarge Pneo. Conclusions Therefore, recombination might facilitate neofunctionalization via originalization. Several extensive applications of these results on genomic evolution have been discussed: 1. Time to nonfunctionalization can be much longer than a few million generations expected before; 2. Homogenization on duplicated loci results from not only gene conversion, but also originalization; 3. Although the rate of advantageous mutation is much small compared with that of degenerative mutation, Pneo cannot be expected to be small.

  12. Antegrade pyelography in ureteric duplications with obstructed upper segments

    International Nuclear Information System (INIS)

    Macpherson, R.I.; Kaufman, J.M.


    Percutaneous puncture under fluoroscopic control followed by antegrade pyelography was employed in three children, two of them neonates, suspected of having complete duplication of the ureter with obstructed upper segments on the basis of the excretory pyelographic and ultrasonographic findings. This simple, uncomplicated and definitive method confirmed the diagnosis and demonstrated the course, termination and effects of the dilated ectopic ureter

  13. Cryptorchidism due to chromosome 5q inversion duplication. (United States)

    Dutta, M K; Gundgurthi, A; Garg, M K; Pakhetr, R


    We present a 15 year old boy who was born out of a non consanguineous marriage, and presented with bilateral cryptorchidism, mental retardation, facial dysmorphism, hypergonadotrophic hypogonadism with failure of anatomical and biochemical localisation of testes. Karyotype analysis showed 46 XY with inverted duplication on chromosome 5q22-31.

  14. Association of anorectal malformation with anal and rectal duplication

    Directory of Open Access Journals (Sweden)

    Karla A. Santos-Jasso


    We present three cases of rectal duplications with anorectal malforma- tion with recto-perineal fistula and colonic duplication. Two of them with delayed diagnosis and bowel obstruction, treated with laparotomy, colostomy and side-to-side anastomosis of the proximal colonic duplica- tion; in the third case the diagnosis of the colonic and rectal duplication was made during a colostomy opening. For definitive correction, the three patients underwent abdomino-perineal approach and side-to-side anastomosis of the rectal duplication, placement of the rectum within the muscle complex, and later on colostomy closure. In a fourth patient with anorectal malformation and colostomy after birth, the perineal electro-stimulation showed two muscle complexes. A posterior sagittal approach in both showed two separate blind rectal pouches; an end- to-side anastomosis of the dilated rectum was made, and the muscle complex with stronger contraction was used for the anoplasty. The posterior sagittal approach is the best surgical option to preserve the muscle complex, with a better prognosis for rectal continence.

  15. Obscure bleeding colonic duplication responds to proton pump inhibitor therapy. (United States)

    Jacques, Jérémie; Projetti, Fabrice; Legros, Romain; Valgueblasse, Virginie; Sarabi, Matthieu; Carrier, Paul; Fredon, Fabien; Bouvier, Stéphane; Loustaud-Ratti, Véronique; Sautereau, Denis


    We report the case of a 17-year-old male admitted to our academic hospital with massive rectal bleeding. Since childhood he had reported recurrent gastrointestinal bleeding and had two exploratory laparotomies 5 and 2 years previously. An emergency abdominal computed tomography scan, gastroscopy and colonoscopy, performed after hemodynamic stabilization, were considered normal. High-dose intravenous proton pump inhibitor (PPI) therapy was initiated and bleeding stopped spontaneously. Two other massive rectal bleeds occurred 8 h after each cessation of PPI which led to a hemostatic laparotomy after negative gastroscopy and small bowel capsule endoscopy. This showed long tubular duplication of the right colon, with fresh blood in the duplicated colon. Obscure lower gastrointestinal bleeding is a difficult medical situation and potentially life-threatening. The presence of ulcerated ectopic gastric mucosa in the colonic duplication explains the partial efficacy of PPI therapy. Obscure gastrointestinal bleeding responding to empiric anti-acid therapy should probably evoke the diagnosis of bleeding ectopic gastric mucosa such as Meckel's diverticulum or gastrointestinal duplication, and gastroenterologists should be aware of this potential medical situation.

  16. Duplication of the urethra with communication to the rectum

    International Nuclear Information System (INIS)

    Bruce, R.; Alton, D.


    The posterior channel of duplicated urethrae usually follows a straight course to end in the perineum just inside the anal verge. This unique urethra dipped into the perineum and then turned cephalad to enter the rectum above the anus. Delineation of the course of the urethra simplified management by assisting the urologist to convert the rectal passage to a hypospadiac urethra. (orig.)

  17. Cystic rectal duplication: a rare cause of neonatal intestinal obstruction. (United States)

    Mboyo, A; Monek, O; Massicot, R; Martin, L; Destuynder, O; Lemouel, A; Aubert, D


    A case of cystic rectal duplication revealed on day 2 of life by a low intestinal occluding syndrome is reported. Radiologic imaging (ultrasonography, cystography, rectography) showed a large, retrorectal liquid formation in the pelvis and abdomen, with pelvic compression of the terminal alimentary canal and lower urinary tract. Magnetic resonance imaging demonstrated a liquid formation with clearly defined edges and no medullary involvement, thus ruling out the possibility of a previous meningeal hernia. Biological markers were within normal limits. On day 4, a 9 x 6-cm cystic rectal duplication was removed, followed by a temporary colostomy. Pathologic examination demonstrated typical rectal architecture with ciliated cells. Radiologic and clinical findings at 2-month follow-up were reassuring. This case report is exceptional for the following reasons: (1) As a rule, rectal duplications are relatively rare (70 cases reported in the literature); (2) The means of disclosing a neonatal rectal duplication is unusual (4 cases reported in the literature); (3) The volume of the malformation was considerable; and (4) Heterotopic ciliated epithelium was present.

  18. Type IIA2 urethral duplication: report of an unusual case

    African Journals Online (AJOL)

    ultrasonography (US) showed left-sided hydroureterone- phrosis with a distended thick-walled bladder. US showed the right testis to be enlarged with increased vascularity suggestive of epididymo-orchitis. A retrograde urethro- gram showed a sagittal duplication of urethra, with the narrow dorsal urethra originating from the ...

  19. 48 CFR 1352.231-71 - Duplication of effort. (United States)


    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Duplication of effort. 1352.231-71 Section 1352.231-71 Federal Acquisition Regulations System DEPARTMENT OF COMMERCE CLAUSES... benefit of the Government, and not incidental to any other work, pursuit, research, or purpose of the...

  20. The functions of word duplication in Indonesian languages

    NARCIS (Netherlands)

    Gonda, J.


    Abstract In this paper, which is not intended to give an exhaustive collection of word-types, the author tries to review and to systematize a number of the most characteristic meanings of duplication (and reduplication) in Indonesian languages and to look more closely into some aspects of these

  1. Alimentary tract duplications in children: Report of 16 years′ experience

    Directory of Open Access Journals (Sweden)

    Mohamed Zouari


    Full Text Available Background: Alimentary tract duplications (ATDs are a rare condition in children, characterised by a large pathogenic, clinical, and histological polymorphism. Surgical observation and pathologic evaluation of the resected specimens are the only way to confirm the diagnosis. In this study, we want to analyse the anatomical, clinical and therapeutic aspects of this entity. Patients and Methods: A total of 12 cases of ATD were diagnosed over a 16-year period at paediatric surgery department. The diagnosis was evoked on clinical and radiological data. Histological study of the resected specimens confirmed the diagnosis in all cases. Results: The mean age of patients at diagnosis was 41 months with a peak of incidence at the 1 st year of life (42%. Out of a total 12 cases, 10 were girls and 2 were boys. Abdominal pain and vomiting were the most frequent presenting features. Ultrasonography, tomodensitometry and magnetic resonance imaging were useful for diagnosis. ATDs were localised on the oesophagus in one case, the stomach in one case, the duodenum in four cases, the ileum in five cases, and the colon in one case. All these duplications were cystic, with three communicating duplications. All patients underwent surgery, and resection procedure was chosen according to duplication type and site. Histological study confirmed the diagnosis in all cases. Conclusion: ATDs are a rare condition in children. Diagnosis relies on histology, and treatment can only be by means of surgery. The outcome after surgery is generally favourable. Diagnosis and precocious surgery of ATDs can warn serious complications.

  2. “Clavicular duplication causing thoracic outlet obstruction”: Unique ...

    African Journals Online (AJOL)

    A 22‑year‑old female student reported with features of neurogenic thoracic outlet syndrome mainly involving C8‑T1 components of the brachial plexus, seemingly originating from involvement in costo‑clavicular space. Radiograph of the shoulder revealed clavicular duplication. Neuro‑physiological studies corroborated the ...

  3. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    Based on whole-genome analysis of Arabidopsis thaliana, there is compelling evidence that angiosperms underwent two whole-genome duplication events early during their evolutionary history. Recent studies have shown that these events were crucial for creation of many important developmental and regulatory genes ...

  4. Gene duplication, modularity and adaptation in the evolution of the aflatoxin gene cluster

    Directory of Open Access Journals (Sweden)

    Jakobek Judy L


    Full Text Available Abstract Background The biosynthesis of aflatoxin (AF involves over 20 enzymatic reactions in a complex polyketide pathway that converts acetate and malonate to the intermediates sterigmatocystin (ST and O-methylsterigmatocystin (OMST, the respective penultimate and ultimate precursors of AF. Although these precursors are chemically and structurally very similar, their accumulation differs at the species level for Aspergilli. Notable examples are A. nidulans that synthesizes only ST, A. flavus that makes predominantly AF, and A. parasiticus that generally produces either AF or OMST. Whether these differences are important in the evolutionary/ecological processes of species adaptation and diversification is unknown. Equally unknown are the specific genomic mechanisms responsible for ordering and clustering of genes in the AF pathway of Aspergillus. Results To elucidate the mechanisms that have driven formation of these clusters, we performed systematic searches of aflatoxin cluster homologs across five Aspergillus genomes. We found a high level of gene duplication and identified seven modules consisting of highly correlated gene pairs (aflA/aflB, aflR/aflS, aflX/aflY, aflF/aflE, aflT/aflQ, aflC/aflW, and aflG/aflL. With the exception of A. nomius, contrasts of mean Ka/Ks values across all cluster genes showed significant differences in selective pressure between section Flavi and non-section Flavi species. A. nomius mean Ka/Ks values were more similar to partial clusters in A. fumigatus and A. terreus. Overall, mean Ka/Ks values were significantly higher for section Flavi than for non-section Flavi species. Conclusion Our results implicate several genomic mechanisms in the evolution of ST, OMST and AF cluster genes. Gene modules may arise from duplications of a single gene, whereby the function of the pre-duplication gene is retained in the copy (aflF/aflE or the copies may partition the ancestral function (aflA/aflB. In some gene modules, the


    Directory of Open Access Journals (Sweden)

    Khlestkina E.


    Full Text Available Gene duplication followed by subfunctionalization and neofunctionalization is of a great evolutionary importance. In plant genomes, duplicated genes may result from either polyploidization (homoeologous genes or segmental chromosome duplications (paralogous genes. In allohexaploid wheat Triticum aestivum L. (2n=6x=42, genome BBAADD, both homoeologous and paralogous copies were found for the regulatory gene Myc encoding MYC-like transcriptional factor in the biosynthesis of flavonoid pigments, anthocyanins, and for the structural gene F3h encoding one of the key enzymes of flavonoid biosynthesis, flavanone 3-hydroxylase. From the 5 copies (3 homoeologous and 2 paralogous of the Myc gene found in T. aestivum, only one plays a regulatory role in anthocyanin biosynthesis, interacting complementary with another transcriptional factor (MYB-like to confer purple pigmentation of grain pericarp in wheat. The role and functionality of the other 4 copies of the Myc gene remain unknown. From the 4 functional copies of the F3h gene in T. aestivum, three homoeologues have similar function. They are expressed in wheat organs colored with anthocyanins or in the endosperm, participating there in biosynthesis of uncolored flavonoid substances. The fourth copy (the B-genomic paralogue is transcribed neither in wheat organs colored with anthocyanins nor in seeds, however, it’s expression has been noticed in roots of aluminium-stressed plants, where the three homoeologous copies are not active. Functional diversification of the duplicated flavonoid biosynthesis genes in wheat may be a reason for maintenance of the duplicated copies and preventing them from pseudogenization.The study was supported by RFBR (11-04-92707. We also thank Ms. Galina Generalova for technical assistance.

  6. Distribution of shortest path lengths in a class of node duplication network models (United States)

    Steinbock, Chanania; Biham, Ofer; Katzav, Eytan


    We present analytical results for the distribution of shortest path lengths (DSPL) in a network growth model which evolves by node duplication (ND). The model captures essential properties of the structure and growth dynamics of social networks, acquaintance networks, and scientific citation networks, where duplication mechanisms play a major role. Starting from an initial seed network, at each time step a random node, referred to as a mother node, is selected for duplication. Its daughter node is added to the network, forming a link to the mother node, and with probability p to each one of its neighbors. The degree distribution of the resulting network turns out to follow a power-law distribution, thus the ND network is a scale-free network. To calculate the DSPL we derive a master equation for the time evolution of the probability Pt(L =ℓ ) , ℓ =1 ,2 ,⋯ , where L is the distance between a pair of nodes and t is the time. Finding an exact analytical solution of the master equation, we obtain a closed form expression for Pt(L =ℓ ) . The mean distance 〈L〉 t and the diameter Δt are found to scale like lnt , namely, the ND network is a small-world network. The variance of the DSPL is also found to scale like lnt . Interestingly, the mean distance and the diameter exhibit properties of a small-world network, rather than the ultrasmall-world network behavior observed in other scale-free networks, in which 〈L〉 t˜lnlnt .

  7. Recent references

    International Nuclear Information System (INIS)

    Ramavataram, S.


    In support of a continuing program of systematic evaluation of nuclear structure data, the National Nuclear Data Center maintains a complete computer file of references to the nuclear physics literature. Each reference is tagged by a keyword string, which indicates the kinds of data contained in the article. This master file of Nuclear Structure References (NSR) contains complete keyword indexes to literature published since 1969, with partial indexing of older references. Any reader who finds errors in the keyword descriptions is urged to report them to the National Nuclear Data Center so that the master NSR file can be corrected. In 1966, the first collection of Recent References was published as a separate issue of Nuclear Data Sheets. Every four months since 1970, a similar indexed bibliography to new nuclear experiments has been prepared from additions to the NSR file and published. Beginning in 1978, Recent References was cumulated annually, with the third issue completely superseding the two issues previously published during a given year. Due to publication policy changes, cumulation of Recent Reference was discontinued in 1986. The volume and issue number of all the cumulative issues published to date are given. NNDC will continue to respond to individual requests for special bibliographies on nuclear physics topics, in addition to those easily obtained from Recent References. If the required information is available from the keyword string, a reference list can be prepared automatically from the computer files. This service can be provided on request, in exchange for the timely communication of new nuclear physics results (e.g., preprints). A current copy of the NSR file may also be obtained in a standard format on magnetic tape from NNDC. Requests for special searches of the NSR file may also be directed to the National Nuclear Data Center

  8. Evaluation of unique identifiers used for citation linking [version 1; referees: 1 approved, 2 approved with reservations

    Directory of Open Access Journals (Sweden)

    Heidi Holst Madsen


    Full Text Available Unique identifiers (UID are seen as an effective tool to create links between identical publications in databases or identify duplicates in a database. The purpose of the present study is to investigate how well UIDs work for citation linking. We have two objectives: Explore the coverage, precision, and characteristics of publications matched versus not matched with UIDs as the match key.   Illustrate how publication sets formed by using UIDs as the match key may affect the bibliometric indicators: Number of publications, number of citations and the average number of citations per publication.   The objectives are addressed in a literature review and a case study. The literature review shows that only a few studies evaluate how well UIDs work as a match key. From the literature we identify four error types: Duplicate digital object identifiers (DOI, incorrect DOIs in reference lists and databases, DOIs not registered by the database where a bibliometric analysis is performed, and erroneous optical or special character recognition.   The case study explores the use of UIDs in the integration between the databases Pure and SciVal. Specifically journal publications in English are matched between the two databases. We find all error types except erroneous optical or special character recognition in our publication sets. In particular the duplicate DOIs constitute a problem for the calculation of bibliometric indicators as both keeping the duplicates to improve the reliability of citation counts and deleting them to improve the reliability of publication counts will distort the calculation of average number of citations per publication.   The use of UIDs as a match key in citation linking is implemented in many settings, and the availability of UIDs may become critical for the inclusion of a publication or a database in a bibliometric analysis.

  9. Duplications involving a conserved regulatory element downstream of BMP2 are associated with brachydactyly type A2

    DEFF Research Database (Denmark)

    Dathe, Katarina; Kjaer, Klaus W; Brehm, Anja


    Autosomal-dominant brachydactyly type A2 (BDA2), a limb malformation characterized by hypoplastic middle phalanges of the second and fifth fingers, has been shown to be due to mutations in the Bone morphogenetic protein receptor 1B (BMPR1B) or in its ligand Growth and differentiation factor 5 (GDF5......). A linkage analysis performed in a mutation-negative family identified a novel locus for BDA2 on chromosome 20p12.3 that incorporates the gene for Bone morphogenetic protein 2 (BMP2). No point mutation was identified in BMP2, so a high-density array CGH analysis covering the critical interval...... within the identified duplication. Our results reveal an additional functional mechanism for the pathogenesis of BDA2, which is duplication of a regulatory element that affects the expression of BMP2 in the developing limb....

  10. Identification of a rare 17p13.3 duplication including the BHLHA9 and YWHAE genes in a family with developmental delay and behavioural problems

    Directory of Open Access Journals (Sweden)

    Capra Valeria


    Full Text Available Abstract Background Deletions and duplications of the PAFAH1B1 and YWHAE genes in 17p13.3 are associated with different clinical phenotypes. In particular, deletion of PAFAH1B1 causes isolated lissencephaly while deletions involving both PAFAH1B1 and YWHAE cause Miller-Dieker syndrome. Isolated duplications of PAFAH1B1 have been associated with mild developmental delay and hypotonia, while isolated duplications of YWHAE have been associated with autism. In particular, different dysmorphic features associated with PAFAH1B1 or YWHAE duplication have suggested the need to classify the patient clinical features in two groups according to which gene is involved in the chromosomal duplication. Methods We analyze the proband and his family by classical cytogenetic and array-CGH analyses. The putative rearrangement was confirmed by fluorescence in situ hybridization. Results We have identified a family segregating a 17p13.3 duplication extending 329.5 kilobases by FISH and array-CGH involving the YWHAE gene, but not PAFAH1B1, affected by a mild dysmorphic phenotype with associated autism and mental retardation. We propose that BHLHA9, YWHAE, and CRK genes contribute to the phenotype of our patient. The small chromosomal duplication was inherited from his mother who was affected by a bipolar and borderline disorder and was alcohol addicted. Conclusions We report an additional familial case of small 17p13.3 chromosomal duplication including only BHLHA9, YWHAE, and CRK genes. Our observation and further cases with similar microduplications are expected to be diagnosed, and will help better characterise the clinical spectrum of phenotypes associated with 17p13.3 microduplications.

  11. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Directory of Open Access Journals (Sweden)

    Amanda L. Pendleton


    Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  12. Duplications and losses in gene families of rust pathogens highlight putative effectors. (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M


    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  13. Basal View Reference Photographs for Nasolabial Appearance Rating in Unilateral Cleft Lip and Palate. (United States)

    Rubin, Marcie S; Lowe, Kristen M; Clouston, Sean; Shetye, Pradip R; Warren, Stephen M; Grayson, Barry H


    The Asher-McDade system is a 5-point ordinal scale frequently used to rate the components of nasolabial appearance, including nasal form and nasal symmetry, in unilateral cleft lip and palate. Although reference photographs illustrating this scale have been identified for the frontal and right profile view, no reference photographs exist for the basal view. The aim of this study was to identify reference photographs for nasal form and nasal symmetry from the basal view to illustrate this scale and facilitate its use. Four raters assessed nasolabial appearance (form and symmetry) on basal view photographs of 50 children (average age 8 years) with a repaired cleft lip. Intraclass correlation coefficients show fair to moderate inter-rater reliability. Cronbach α indicated strong agreement between raters (0.77 nasal form; 0.78 nasal symmetry; 0.80 overall), along with low duplicate measurement error and strong internal consistency between the measures. The photographs with the highest agreement among raters were selected to illustrate each point on the 5-point scale for nasal form and for nasal symmetry, resulting in the selection of 10 reference photographs. The basal view reference photograph set developed from this study may complement existing reference photograph sets for other views and facilitate rating tasks.

  14. Discovery of previously unidentified genomic disorders from the duplication architecture of the human genome

    NARCIS (Netherlands)

    Sharp, Andrew J.; Hansen, Sierra; Selzer, Rebecca R.; Cheng, Ze; Regan, Regina; Hurst, Jane A.; Stewart, Helen; Price, Sue M.; Blair, Edward; Hennekam, Raoul C.; Fitzpatrick, Carrie A.; Segraves, Rick; Richmond, Todd A.; Guiver, Cheryl; Albertson, Donna G.; Pinkel, Daniel; Eis, Peggy S.; Schwartz, Stuart; Knight, Samantha J. L.; Eichler, Evan E.


    Genomic disorders are characterized by the presence of flanking segmental duplications that predispose these regions to recurrent rearrangement. Based on the duplication architecture of the genome, we investigated 130 regions that we hypothesized as candidates for previously undescribed genomic

  15. Efficient Algorithms for Analyzing Segmental Duplications, Deletions, and Inversions in Genomes (United States)

    Kahn, Crystal L.; Mozes, Shay; Raphael, Benjamin J.

    Segmental duplications, or low-copy repeats, are common in mammalian genomes. In the human genome, most segmental duplications are mosaics consisting of pieces of multiple other segmental duplications. This complex genomic organization complicates analysis of the evolutionary history of these sequences. Earlier, we introduced a genomic distance, called duplication distance, that computes the most parsimonious way to build a target string by repeatedly copying substrings of a source string. We also showed how to use this distance to describe the formation of segmental duplications according to a two-step model that has been proposed to explain human segmental duplications. Here we describe polynomial-time exact algorithms for several extensions of duplication distance including models that allow certain types of substring deletions and inversions. These extensions will permit more biologically realistic analyses of segmental duplications in genomes.

  16. Laparoscopic excision of an ascending colon duplication cyst in an adolescent

    Directory of Open Access Journals (Sweden)

    Heather R. Nolan


    Full Text Available Colonic intestinal duplications are infrequent and rarely present past early childhood. We present the case of a large, ascending colon duplication in a 17-year-old boy resected using minimally invasive techniques. This appears to be the first reported case of a laparoscopic en-bloc ascending colon duplication resection in an adolescent. The diagnosis and management of colonic duplications are discussed.

  17. Rectal duplications accompanying rectovestibular fistula: report of two cases. (United States)

    Pampal, Arzu; Ozbayoglu, Asli; Kaya, Cem; Pehlivan, Yildiz; Poyraz, Aylar; Ozen, I Onur; Percin, Ferda E; Demirogullari, Billur


    Rectal duplication (RD) cysts are rare congenital anomalies that can be diagnosed with the presence of another opening in the perineum. They seldom accompany anorectal malformations (ARM). Two cases of RD accompanying ARM at opposite ends of the phenotypic spectrum, are described. A 3-month-old baby and a 2-year-old girl with ARM were scheduled for posterior sagittal anorectoplasty. The infant had an orifice at the anal dimple and the other had an orifice at the vestibulum posterior to the rectovestibular fistula. The infant presented with no other anomalies whereas the older one presented with an unusual coexistence of caudal duplication and caudal regression syndromes. Perioperatively both orifices were found to be related to retrorectal cysts, and were excised. Clinicians should always be alert when dealing with complex malformations. Because these malformations have variable anatomical and clinical presentations, they can represent a diagnostic and therapeutic challenge. © 2013 The Authors. Pediatrics International © 2013 Japan Pediatric Society.

  18. Reversion in variants from a duplication strain of Aspergillus nidulans

    International Nuclear Information System (INIS)

    Menezes, E.M.; Azevedo, J.L.


    Strains of Aspergillus nidulans with a chromosome segment in duplicate, one in normal position and one translocated to another chromosome, are unstable at mitosis. In addition to variants which result from deletions in either of the duplicate segments, which usually have improved morphology, they produce variants with deteriorated morphology. Three deteriorated variants reverted frequently to parental type morphology, both spontaneously and after ultra-violet treatment. Of six reversions analysed genetically, five were due to suppressors and one was probably due to back mutation. The suppressors segregated as single genes and were not linked to the mutation which they suppress. The instability of these so-called 'deteriorated' variants is discussed in relation to mitotic instability phenomena in A. nidulans. (orig.) [de

  19. Duplication of the glans penis manifested at puberty. (United States)

    Gentileschi, S; Bracaglia, R; Seccia, A; Farallo, E


    We report the case of a complete duplication of the glans, with prepuce and a blind end urethra just proximal to the dorsal aspect of the balanopreputial fold. The malformation was not evident at birth and during childhood, and became manifest only at puberty, with the growth of the external genitalia. It was not associated with other urinary malformations. Surgical excision was easy and uneventful.

  20. Delusion of fetal duplication in a Capgras patient. (United States)

    Silva, J A; Leong, G B; Longhitano, M; Botello, T E


    A case of Capgras syndrome in a pregnant patient is described. In addition to perceiving living family members as impostors, she believed that there was a double or twin of her fetus. She conceptualized her "twins" differently than the way she viewed doubles of family members. Her fetus may represent the youngest "person" to have been duplicated. The relationship of Capgras syndrome to misidentification phenomena is discussed.

  1. Grebe syndrome with bilateral fibular hemimelia and thumb duplication

    International Nuclear Information System (INIS)

    Rao, Narasimha; Joseph, Benjamin


    Grebe syndrome is a rare recessively inherited form of short-limbed dwarfism. Among the skeletal anomalies reported in the past, complete fibular hemimelia and thumb duplication have not been documented. We report a case of Grebe syndrome with these associated anomalies and review the various skeletal anomalies reported in the literature related to this syndrome. Awareness of the skeletal anomalies that can occur in this syndrome should enable an accurate diagnosis. (orig.)

  2. Grebe syndrome with bilateral fibular hemimelia and thumb duplication

    Energy Technology Data Exchange (ETDEWEB)

    Rao, Narasimha; Joseph, Benjamin [Department of Orthopaedics, Kasturba Medical College, Karnataka State (India)


    Grebe syndrome is a rare recessively inherited form of short-limbed dwarfism. Among the skeletal anomalies reported in the past, complete fibular hemimelia and thumb duplication have not been documented. We report a case of Grebe syndrome with these associated anomalies and review the various skeletal anomalies reported in the literature related to this syndrome. Awareness of the skeletal anomalies that can occur in this syndrome should enable an accurate diagnosis. (orig.)

  3. Efficient image duplicated region detection model using sequential block clustering

    Czech Academy of Sciences Publication Activity Database

    Sekeh, M. A.; Maarof, M. A.; Rohani, M. F.; Mahdian, Babak


    Roč. 10, č. 1 (2013), s. 73-84 ISSN 1742-2876 Institutional support: RVO:67985556 Keywords : Image forensic * Copy–paste forgery * Local block matching Subject RIV: IN - Informatics, Computer Science Impact factor: 0.986, year: 2013 image duplicated region detection model using sequential block clustering.pdf

  4. Whole Genome and Tandem Duplicate Retention facilitated Glucosinolate Pathway Diversification in the Mustard Family.

    NARCIS (Netherlands)

    Hofberger, J.A.; Lyons, E.; Edger, P.P.; Pires, J.C.; Schranz, M.E.


    Plants share a common history of successive whole genome duplication (WGD) events retaining genomic patterns of duplicate gene copies (ohnologs) organized in conserved syntenic blocks. Duplication was often proposed to affect the origin of novel traits during evolution. However, genetic evidence

  5. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation

    NARCIS (Netherlands)

    Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes.

  6. Adenocarcinoma within a rectal duplication cyst: case report and literature review. (United States)

    Michael, D; Cohen, C R; Northover, J M


    Intestinal duplications are uncommon but recognised developmental anomalies. Duplications of the rectum are the most uncommon of these anomalies. They may present with perianal fistulae, bleeding, a pelvic mass or symptoms produced by a mass, or, rarely, malignant change. We present a case of an adenocarcinoma within a rectal duplication cyst which was initially thought to be inoperable but was treated by radical surgery.

  7. Cep63 and cep152 cooperate to ensure centriole duplication.

    Directory of Open Access Journals (Sweden)

    Nicola J Brown

    Full Text Available Centrosomes consist of two centrioles embedded in pericentriolar material and function as the main microtubule organising centres in dividing animal cells. They ensure proper formation and orientation of the mitotic spindle and are therefore essential for the maintenance of genome stability. Centrosome function is crucial during embryonic development, highlighted by the discovery of mutations in genes encoding centrosome or spindle pole proteins that cause autosomal recessive primary microcephaly, including Cep63 and Cep152. In this study we show that Cep63 functions to ensure that centriole duplication occurs reliably in dividing mammalian cells. We show that the interaction between Cep63 and Cep152 can occur independently of centrosome localisation and that the two proteins are dependent on one another for centrosomal localisation. Further, both mouse and human Cep63 and Cep152 cooperate to ensure efficient centriole duplication by promoting the accumulation of essential centriole duplication factors upstream of SAS-6 recruitment and procentriole formation. These observations describe the requirement for Cep63 in maintaining centriole number in dividing mammalian cells and further establish the order of events in centriole formation.

  8. Operative correction and follow-up of craniofacial duplication. (United States)

    Kotrikova, Bibiana; Hassfeld, Stefan; Steiner, Hans H; Hähnel, Stefan; Krempien, Robert; Mühling, Joachim


    Anterior craniofacial duplication (diprosopus) is an extremely rare form of conjoined twins. The children share a single trunk with normal extremities and varying degrees of facial malformation. Duplication of specific structures, such as the nose (diprosopus dirrhinus), eyes (diprosopus tetraophthalmus), and ears, is possible. The authors present a case of partial facial duplication (diprosopus dirrhinus) in a male infant. The clinical and radiographic findings and the surgical correction and follow-up are described. In a single surgical session, the authors were able to achieve not only a functionally but also an aesthetically acceptable result. In the postoperative course, the child showed nearly normal growth and satisfactory psychosocial and motor development. However, 40 months postoperatively, we noticed a tendency of the orbitae to diverge (i.e., toward hypertelorism). The surgical management of complex craniofacial malformations such as diprosopus needs a precise morphologic analysis of the patient's deformity followed by a clear treatment plan. A staged reconstructive approach is carried out to coincide with facial growth patterns and brain and eye function. If the interorbital distance in our patient increases progressively, a second operation for reduction of the interorbital distance may be necessary.

  9. Using sea urchin gametes and zygotes to investigate centrosome duplication. (United States)

    Sluder, Greenfield


    Centriole structure and function in the sea urchin zygote parallel those in mammalian somatic cells. Here, I briefly introduce the properties and attributes of the sea urchin system that make it an attractive platform for the study of centrosome and centriole duplication. These attributes apply to all echinoderms readily available from commercial suppliers: sea urchins, sand dollars, and starfish. I list some of the practical aspects of the system that make it a cost- and time-effective system for experimental work and then list properties that are a "tool kit" that can be used to conduct studies that would not be practical, or in some cases not possible, with mammalian somatic cells. Since centrioles organize and localize the pericentriolar material that nucleates the astral arrays of microtubules (Bobinnec et al. in J Cell Biol 143(6):1575-1589, 1998), the pattern of aster duplication over several cell cycles can be used as a reliable measure for centriole duplication (Sluder and Rieder in J Cell Biol 100(3):887-896, 1985). Descriptions of the methods my laboratory has used to handle and image echinoderm zygotes are reviewed in Sluder et al. (Methods Cell Biol 61:439-472, 1999). Also included is a bibliography of papers that describe additional methods.

  10. The detection of large deletions or duplications in genomic DNA. (United States)

    Armour, J A L; Barton, D E; Cockburn, D J; Taylor, G R


    While methods for the detection of point mutations and small insertions or deletions in genomic DNA are well established, the detection of larger (>100 bp) genomic duplications or deletions can be more difficult. Most mutation scanning methods use PCR as a first step, but the subsequent analyses are usually qualitative rather than quantitative. Gene dosage methods based on PCR need to be quantitative (i.e., they should report molar quantities of starting material) or semi-quantitative (i.e., they should report gene dosage relative to an internal standard). Without some sort of quantitation, heterozygous deletions and duplications may be overlooked and therefore be under-ascertained. Gene dosage methods provide the additional benefit of reporting allele drop-out in the PCR. This could impact on SNP surveys, where large-scale genotyping may miss null alleles. Here we review recent developments in techniques for the detection of this type of mutation and compare their relative strengths and weaknesses. We emphasize that comprehensive mutation analysis should include scanning for large insertions and deletions and duplications. Copyright 2002 Wiley-Liss, Inc.

  11. Williams Syndrome and 15q Duplication: Coincidence versus Association. (United States)

    Khokhar, Aditi; Agarwal, Swashti; Perez-Colon, Sheila


    Williams syndrome is a multisystem disorder caused by contiguous gene deletion in 7q11.23, commonly associated with distinctive facial features, supravalvular aortic stenosis, short stature, idiopathic hypercalcemia, developmental delay, joint laxity, and a friendly personality. The clinical features of 15q11q13 duplication syndrome include autism, mental retardation, ataxia, seizures, developmental delay, and behavioral problems. We report a rare case of a girl with genetically confirmed Williams syndrome and coexisting 15q duplication syndrome. The patient underwent treatment for central precocious puberty and later presented with primary amenorrhea. The karyotype revealed 47,XX,+mar. FISH analysis for the marker chromosome showed partial trisomy/tetrasomy for proximal chromosome 15q (15p13q13). FISH using an ELN -specific probe demonstrated a deletion in the Williams syndrome critical region in 7q11.23. To our knowledge, a coexistence of Williams syndrome and 15q duplication syndrome has not been reported in the literature. Our patient had early pubertal development, which has been described in some patients with Williams syndrome. However, years later after discontinuing gonadotropin-releasing hormone analogue treatment, she developed primary amenorrhea.

  12. A case report of Chinese brothers with inherited MECP2-containing duplication: autism and intellectual disability, but not seizures or respiratory infections. (United States)

    Xu, Xiu; Xu, Qiong; Zhang, Ying; Zhang, Xiaodi; Cheng, Tianlin; Wu, Bingbing; Ding, Yanhua; Lu, Ping; Zheng, Jingjing; Zhang, Min; Qiu, Zilong; Yu, Xiang


    Autistic spectrum disorders (ASDs) are a family of neurodevelopmental disorders with strong genetic components. Recent studies have shown that copy number variations in dosage sensitive genes can contribute significantly to these disorders. One such gene is the transcription factor MECP2, whose loss of function in females results in Rett syndrome, while its duplication in males results in developmental delay and autism. Here, we identified a Chinese family with two brothers both inheriting a 2.2 Mb MECP2-containing duplication (151,369,305 - 153,589,577) from their mother. In addition, both brothers also had a 213.7 kb duplication on Chromosome 2, inherited from their father. The older brother also carried a 48.4 kb duplication on Chromosome 2 inherited from the mother, and a 8.2 kb deletion at 11q13.5 inherited from the father. Based on the published literature, MECP2 is the most autism-associated gene among the identified CNVs. Consistently, the boys displayed clinical features in common with other patients carrying MECP2 duplications, including intellectual disability, autism, lack of speech, slight hypotonia and unsteadiness of movement. They also had slight dysmorphic features including a depressed nose bridge, large ears and midface hypoplasia. Interestingly, they did not exhibit other clinical features commonly observed in American-European patients with MECP2 duplication, including recurrent respiratory infections and epilepsy. To our knowledge, this is the first identification and characterization of Chinese Han patients with MECP2-containing duplications. Further cases are required to determine if the above described clinical differences are due to individual variations or related to the genetic background of the patients.

  13. A case report of Chinese brothers with inherited MECP2-containing duplication: autism and intellectual disability, but not seizures or respiratory infections

    Directory of Open Access Journals (Sweden)

    Xu Xiu


    Full Text Available Abstract Background Autistic spectrum disorders (ASDs are a family of neurodevelopmental disorders with strong genetic components. Recent studies have shown that copy number variations in dosage sensitive genes can contribute significantly to these disorders. One such gene is the transcription factor MECP2, whose loss of function in females results in Rett syndrome, while its duplication in males results in developmental delay and autism. Case presentation Here, we identified a Chinese family with two brothers both inheriting a 2.2 Mb MECP2-containing duplication (151,369,305 – 153,589,577 from their mother. In addition, both brothers also had a 213.7 kb duplication on Chromosome 2, inherited from their father. The older brother also carried a 48.4 kb duplication on Chromosome 2 inherited from the mother, and a 8.2 kb deletion at 11q13.5 inherited from the father. Based on the published literature, MECP2 is the most autism-associated gene among the identified CNVs. Consistently, the boys displayed clinical features in common with other patients carrying MECP2 duplications, including intellectual disability, autism, lack of speech, slight hypotonia and unsteadiness of movement. They also had slight dysmorphic features including a depressed nose bridge, large ears and midface hypoplasia. Interestingly, they did not exhibit other clinical features commonly observed in American-European patients with MECP2 duplication, including recurrent respiratory infections and epilepsy. Conclusions To our knowledge, this is the first identification and characterization of Chinese Han patients with MECP2-containing duplications. Further cases are required to determine if the above described clinical differences are due to individual variations or related to the genetic background of the patients.

  14. A genome-wide RNAi screen to dissect centriole duplication and centrosome maturation in Drosophila.

    Directory of Open Access Journals (Sweden)

    Jeroen Dobbelaere


    Full Text Available Centrosomes comprise a pair of centrioles surrounded by an amorphous pericentriolar material (PCM. Here, we have performed a microscopy-based genome-wide RNA interference (RNAi screen in Drosophila cells to identify proteins required for centriole duplication and mitotic PCM recruitment. We analysed 92% of the Drosophila genome (13,059 genes and identified 32 genes involved in centrosome function. An extensive series of secondary screens classified these genes into four categories: (1 nine are required for centriole duplication, (2 11 are required for centrosome maturation, (3 nine are required for both functions, and (4 three genes regulate centrosome separation. These 32 hits include several new centrosomal components, some of which have human homologs. In addition, we find that the individual depletion of only two proteins, Polo and Centrosomin (Cnn can completely block centrosome maturation. Cnn is phosphorylated during mitosis in a Polo-dependent manner, suggesting that the Polo-dependent phosphorylation of Cnn initiates centrosome maturation in flies.

  15. Step-by-Step robotic heminephrectomy for duplicated renal collecting system

    Directory of Open Access Journals (Sweden)

    Homayoun Zargar


    Full Text Available Introduction A duplicated renal collecting system is a relatively common congenital anomaly rarely presenting in adults. Aim In this video we demonstrate our step-by-step technique of Robotic heminephrectomy in a patient with non-functioning upper pole moiety. Materials and Methods Following cystoscopy and ureteral catheter insertion the patient was placed in 600 modified flank position with the ipsilateral arm positioned at the side of the patient. A straight-line, three arm robotic port configuration was employed. The robot was docked at a 90-degree angle, perpendicular to the patient. Following mobilization the colon and identifying both ureters of the duplicated system, the ureters were followed cephalically toward, hilar vessels where the hilar anatomy was identified. The nonfunctioning pole vasculature was ligated using hem-o-lok clips. The ureter was sharply divided and the proximal ureteral stump was passed posterior the renal hilum. Ureteral stump was used as for retraction and heminephrectomy is completed along the line demarcating the upper and lower pole moieties. Renorrhaphy was performed using 0-Vicryl suture with a CT-1 needle. The nonfunctioning pole ureter was then dissected caudally toward the bladder hiatus, ligated using clips, and transected. Results The operating time was 240 minutes and blood loss was 100 cc. There was no complication post-operatively. Conclusions Wrist articulation and degree of freedom offered by robotic platform facilitates successful performance of minimally invasive heminephrectomy in the setting of an atrophic and symptomatic renal segment.

  16. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah


    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  17. Conservation, duplication, and loss of the Tor signaling pathway in the fungal kingdom

    Directory of Open Access Journals (Sweden)

    Heitman Joseph


    Full Text Available Abstract Background The nutrient-sensing Tor pathway governs cell growth and is conserved in nearly all eukaryotic organisms from unicellular yeasts to multicellular organisms, including humans. Tor is the target of the immunosuppressive drug rapamycin, which in complex with the prolyl isomerase FKBP12 inhibits Tor functions. Rapamycin is a gold standard drug for organ transplant recipients that was approved by the FDA in 1999 and is finding additional clinical indications as a chemotherapeutic and antiproliferative agent. Capitalizing on the plethora of recently sequenced genomes we have conducted comparative genomic studies to annotate the Tor pathway throughout the fungal kingdom and related unicellular opisthokonts, including Monosiga brevicollis, Salpingoeca rosetta, and Capsaspora owczarzaki. Results Interestingly, the Tor signaling cascade is absent in three microsporidian species with available genome sequences, the only known instance of a eukaryotic group lacking this conserved pathway. The microsporidia are obligate intracellular pathogens with highly reduced genomes, and we hypothesize that they lost the Tor pathway as they adapted and streamlined their genomes for intracellular growth in a nutrient-rich environment. Two TOR paralogs are present in several fungal species as a result of either a whole genome duplication or independent gene/segmental duplication events. One such event was identified in the amphibian pathogen Batrachochytrium dendrobatidis, a chytrid responsible for worldwide global amphibian declines and extinctions. Conclusions The repeated independent duplications of the TOR gene in the fungal kingdom might reflect selective pressure acting upon this kinase that populates two proteinaceous complexes with different cellular roles. These comparative genomic analyses illustrate the evolutionary trajectory of a central nutrient-sensing cascade that enables diverse eukaryotic organisms to respond to their natural

  18. Recent Duplication and Functional Divergence in Parasitic Nematode Levamisole-Sensitive Acetylcholine Receptors.

    Directory of Open Access Journals (Sweden)

    Thomas B Duguet


    Full Text Available Helminth parasites rely on fast-synaptic transmission in their neuromusculature to experience the outside world and respond to it. Acetylcholine plays a pivotal role in this and its receptors are targeted by a wide variety of both natural and synthetic compounds used in human health and for the control of parasitic disease. The model, Caenorhabditis elegans is characterized by a large number of acetylcholine receptor subunit genes, a feature shared across the nematodes. This dynamic family is characterized by both gene duplication and loss between species. The pentameric levamisole-sensitive acetylcholine receptor has been characterized from C. elegans, comprised of five different subunits. More recently, cognate receptors have been reconstituted from multiple parasitic nematodes that are found to vary in subunit composition. In order to understand the implications of receptor composition change and the origins of potentially novel drug targets, we investigated a specific example of subunit duplication based on analysis of genome data for 25 species from the 50 helminth genome initiative. We found multiple independent duplications of the unc-29, acetylcholine receptor subunit, where codon substitution rate analysis identified positive, directional selection acting on amino acid positions associated with subunit assembly. Characterization of four gene copies from a model parasitic nematode, Haemonchus contortus, demonstrated that each copy has acquired unique functional characteristics based on phenotype rescue of transgenic C. elegans and electrophysiology of receptors reconstituted in Xenopus oocytes. We found evidence that a specific incompatibility has evolved for two subunits co-expressed in muscle. We demonstrated that functional divergence of acetylcholine receptors, driven by directional selection, can occur more rapidly than previously thought and may be mediated by alteration of receptor assembly. This phenomenon is common among the

  19. Molecular evolution of a Y chromosome to autosome gene duplication in Drosophila. (United States)

    Dyer, Kelly A; White, Brooke E; Bray, Michael J; Piqué, Daniel G; Betancourt, Andrea J


    In contrast to the rest of the genome, the Y chromosome is restricted to males and lacks recombination. As a result, Y chromosomes are unable to respond efficiently to selection, and newly formed Y chromosomes degenerate until few genes remain. The rapid loss of genes from newly formed Y chromosomes has been well studied, but gene loss from highly degenerate Y chromosomes has only recently received attention. Here, we identify and characterize a Y to autosome duplication of the male fertility gene kl-5 that occurred during the evolution of the testacea group species of Drosophila. The duplication was likely DNA based, as other Y-linked genes remain on the Y chromosome, the locations of introns are conserved, and expression analyses suggest that regulatory elements remain linked. Genetic mapping reveals that the autosomal copy of kl-5 resides on the dot chromosome, a tiny autosome with strongly suppressed recombination. Molecular evolutionary analyses show that autosomal copies of kl-5 have reduced polymorphism and little recombination. Importantly, the rate of protein evolution of kl-5 has increased significantly in lineages where it is on the dot versus Y linked. Further analyses suggest this pattern is a consequence of relaxed purifying selection, rather than adaptive evolution. Thus, although the initial fixation of the kl-5 duplication may have been advantageous, slightly deleterious mutations have accumulated in the dot-linked copies of kl-5 faster than in the Y-linked copies. Because the dot chromosome contains seven times more genes than the Y and is exposed to selection in both males and females, these results suggest that the dot suffers the deleterious effects of genetic linkage to more selective targets compared with the Y chromosome. Thus, a highly degenerate Y chromosome may not be the worst environment in the genome, as is generally thought, but may in fact be protected from the accumulation of deleterious mutations relative to other nonrecombining

  20. Adenocarcinoma arising in rectal duplication cyst: case report and review of the literature. (United States)

    Shivnani, Anand T; Small, William; Benson, Al; Rao, Sambasiva; Talamonti, Mark S


    Duplication cyst of the gastrointestinal (GI) tract is a rare congenital anomaly, and rectal duplication cysts comprise a small fraction these cases. Most patients present for the first time in adulthood, and the origin of rectal duplication cysts is unclear. Prior series document malignant transformation in approximately 20 per cent of cases. The following case report describes a carcinoma arising in a rectal duplication cyst. Given the lack of data demonstrating adequate control for patients with adenocarcinoma arising in a rectal duplication cyst and our experience with this patient, we recommend all patients undergo multidisciplinary evaluation prior to any therapy.

  1. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes. (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C; Fan, Chuanzhu


    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. © 2016 American Society of Plant Biologists. All rights reserved.

  2. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes1[OPEN (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C.; Fan, Chuanzhu


    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella. Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. PMID:27485883

  3. Evolution of the duplicated intracellular lipid-binding protein genes of teleost fishes. (United States)

    Venkatachalam, Ananda B; Parmar, Manoj B; Wright, Jonathan M


    Increasing organismal complexity during the evolution of life has been attributed to the duplication of genes and entire genomes. More recently, theoretical models have been proposed that postulate the fate of duplicated genes, among them the duplication-degeneration-complementation (DDC) model. In the DDC model, the common fate of a duplicated gene is lost from the genome owing to nonfunctionalization. Duplicated genes are retained in the genome either by subfunctionalization, where the functions of the ancestral gene are sub-divided between the sister duplicate genes, or by neofunctionalization, where one of the duplicate genes acquires a new function. Both processes occur either by loss or gain of regulatory elements in the promoters of duplicated genes. Here, we review the genomic organization, evolution, and transcriptional regulation of the multigene family of intracellular lipid-binding protein (iLBP) genes from teleost fishes. Teleost fishes possess many copies of iLBP genes owing to a whole genome duplication (WGD) early in the teleost fish radiation. Moreover, the retention of duplicated iLBP genes is substantially higher than the retention of all other genes duplicated in the teleost genome. The fatty acid-binding protein genes, a subfamily of the iLBP multigene family in zebrafish, are differentially regulated by peroxisome proliferator-activated receptor (PPAR) isoforms, which may account for the retention of iLBP genes in the zebrafish genome by the process of subfunctionalization of cis-acting regulatory elements in iLBP gene promoters.

  4. Bias and efficiency loss in regression estimates due to duplicated observations: a Monte Carlo simulation

    Directory of Open Access Journals (Sweden)

    Francesco Sarracino


    Full Text Available Recent studies documented that survey data contain duplicate records. We assess how duplicate records affect regression estimates, and we evaluate the effectiveness of solutions to deal with duplicate records. Results show that the chances of obtaining unbiased estimates when data contain 40 doublets (about 5% of the sample range between 3.5% and 11.5% depending on the distribution of duplicates. If 7 quintuplets are present in the data (2% of the sample, then the probability of obtaining biased estimates ranges between 11% and 20%. Weighting the duplicate records by the inverse of their multiplicity, or dropping superfluous duplicates outperform other solutions in all considered scenarios. Our results illustrate the risk of using data in presence of duplicate records and call for further research on strategies to analyze affected data.

  5. Germline or somatic GPR101 duplication leads to X-linked acrogigantism: a clinico-pathological and genetic study. (United States)

    Iacovazzo, Donato; Caswell, Richard; Bunce, Benjamin; Jose, Sian; Yuan, Bo; Hernández-Ramírez, Laura C; Kapur, Sonal; Caimari, Francisca; Evanson, Jane; Ferraù, Francesco; Dang, Mary N; Gabrovska, Plamena; Larkin, Sarah J; Ansorge, Olaf; Rodd, Celia; Vance, Mary L; Ramírez-Renteria, Claudia; Mercado, Moisés; Goldstone, Anthony P; Buchfelder, Michael; Burren, Christine P; Gurlek, Alper; Dutta, Pinaki; Choong, Catherine S; Cheetham, Timothy; Trivellin, Giampaolo; Stratakis, Constantine A; Lopes, Maria-Beatriz; Grossman, Ashley B; Trouillas, Jacqueline; Lupski, James R; Ellard, Sian; Sampson, Julian R; Roncaroli, Federico; Korbonits, Márta


    Non-syndromic pituitary gigantism can result from AIP mutations or the recently identified Xq26.3 microduplication causing X-linked acrogigantism (XLAG). Within Xq26.3, GPR101 is believed to be the causative gene, and the c.924G > C (p.E308D) variant in this orphan G protein-coupled receptor has been suggested to play a role in the pathogenesis of acromegaly.We studied 153 patients (58 females and 95 males) with pituitary gigantism. AIP mutation-negative cases were screened for GPR101 duplication through copy number variation droplet digital PCR and high-density aCGH. The genetic, clinical and histopathological features of XLAG patients were studied in detail. 395 peripheral blood and 193 pituitary tumor DNA samples from acromegaly patients were tested for GPR101 variants.We identified 12 patients (10 females and 2 males; 7.8 %) with XLAG. In one subject, the duplicated region only contained GPR101, but not the other three genes in found to be duplicated in the previously reported patients, defining a new smallest region of overlap of duplications. While females presented with germline mutations, the two male patients harbored the mutation in a mosaic state. Nine patients had pituitary adenomas, while three had hyperplasia. The comparison of the features of XLAG, AIP-positive and GPR101&AIP-negative patients revealed significant differences in sex distribution, age at onset, height, prolactin co-secretion and histological features. The pathological features of XLAG-related adenomas were remarkably similar. These tumors had a sinusoidal and lobular architecture. Sparsely and densely granulated somatotrophs were admixed with lactotrophs; follicle-like structures and calcifications were commonly observed. Patients with sporadic of familial acromegaly did not have an increased prevalence of the c.924G > C (p.E308D) GPR101 variant compared to public databases.In conclusion, XLAG can result from germline or somatic duplication of GPR101. Duplication of GPR101

  6. Stabilization of cartwheel-less centrioles for duplication requires CEP295-mediated centriole to centrosome conversion (United States)

    Izquierdo, Denisse; Wang, Won-Jing; Uryu, Kunihiro; Tsou, Meng-Fu Bryan


    SUMMARY Vertebrate centrioles lose their geometric scaffold, the cartwheel, during mitosis, concurrently with gaining the ability to recruit the pericentriolar material (PCM) and thereby function as the centrosome. Cartwheel removal has recently been implicated in centriole duplication, but whether “cartwheel-less” centrioles are intrinsically stable, or must be maintained through other modifications remains unclear. Here, we identify a newborn centriole-enriched protein, KIAA1731/CEP295, specifically mediating centriole-to-centrosome conversion but dispensable for cartwheel removal. In the absence of CEP295, centrioles form in S/G2 phase, and lose their associated cartwheel in mitosis, but cannot be converted to centrosomes, uncoupling the two events. Strikingly, centrioles devoid of both the PCM and cartwheel progressively lose centriolar components, whereas centrioles associating with either the cartwheel or PCM alone can exist stably. Thus, cartwheel removal can have grave repercussions to centriole stability, and centriole-to-centrosome conversion mediated by CEP295 must occur in parallel to maintain cartwheel-less centrioles for duplication. PMID:25131205

  7. Gene duplication and adaptive evolution of digestive proteases in Drosophila arizonae female reproductive tracts.

    Directory of Open Access Journals (Sweden)

    Erin S Kelleher


    Full Text Available It frequently has been postulated that intersexual coevolution between the male ejaculate and the female reproductive tract is a driving force in the rapid evolution of reproductive proteins. The dearth of research on female tracts, however, presents a major obstacle to empirical tests of this hypothesis. Here, we employ a comparative EST approach to identify 241 candidate female reproductive proteins in Drosophila arizonae, a repleta group species in which physiological ejaculate-female coevolution has been documented. Thirty-one of these proteins exhibit elevated amino acid substitution rates, making them candidates for molecular coevolution with the male ejaculate. Strikingly, we also discovered 12 unique digestive proteases whose expression is specific to the D. arizonae lower female reproductive tract. These enzymes belong to classes most commonly found in the gastrointestinal tracts of a diverse array of organisms. We show that these proteases are associated with recent, lineage-specific gene duplications in the Drosophila repleta species group, and exhibit strong signatures of positive selection. Observation of adaptive evolution in several female reproductive tract proteins indicates they are active players in the evolution of reproductive tract interactions. Additionally, pervasive gene duplication, adaptive evolution, and rapid acquisition of a novel digestive function by the female reproductive tract points to a novel coevolutionary mechanism of ejaculate-female interaction.

  8. Duplication of an upstream silencer of FZP increases grain yield in rice. (United States)

    Bai, Xufeng; Huang, Yong; Hu, Yong; Liu, Haiyang; Zhang, Bo; Smaczniak, Cezary; Hu, Gang; Han, Zhongmin; Xing, Yongzhong


    Transcriptional silencer and copy number variants (CNVs) are associated with gene expression. However, their roles in generating phenotypes have not been well studied. Here we identified a rice quantitative trait locus, SGDP7 (Small Grain and Dense Panicle 7). SGDP7 is identical to FZP (FRIZZY PANICLE), which represses the formation of axillary meristems. The causal mutation of SGDP7 is an 18-bp fragment, named CNV-18bp, which was inserted ~5.3 kb upstream of FZP and resulted in a tandem duplication in the cultivar Chuan 7. The CNV-18bp duplication repressed FZP expression, prolonged the panicle branching period and increased grain yield by more than 15% through substantially increasing the number of spikelets per panicle (SPP) and slightly decreasing the 1,000-grain weight (TGW). The transcription repressor OsBZR1 binds the CGTG motifs in CNV-18bp and thereby represses FZP expression, indicating that CNV-18bp is the upstream silencer of FZP. These findings showed that the silencer CNVs coordinate a trade-off between SPP and TGW by fine-tuning FZP expression, and balancing the trade-off could enhance yield potential.

  9. Independent Evolution of Winner Traits without Whole Genome Duplication in Dekkera Yeasts.

    Directory of Open Access Journals (Sweden)

    Yi-Cheng Guo

    Full Text Available Dekkera yeasts have often been considered as alternative sources of ethanol production that could compete with S. cerevisiae. The two lineages of yeasts independently evolved traits that include high glucose and ethanol tolerance, aerobic fermentation, and a rapid ethanol fermentation rate. The Saccharomyces yeasts attained these traits mainly through whole genome duplication approximately 100 million years ago (Mya. However, the Dekkera yeasts, which were separated from S. cerevisiae approximately 200 Mya, did not undergo whole genome duplication (WGD but still occupy a niche similar to S. cerevisiae. Upon analysis of two Dekkera yeasts and five closely related non-WGD yeasts, we found that a massive loss of cis-regulatory elements occurred in an ancestor of the Dekkera yeasts, which led to improved mitochondrial functions similar to the S. cerevisiae yeasts. The evolutionary analysis indicated that genes involved in the transcription and translation process exhibited faster evolution in the Dekkera yeasts. We detected 90 positively selected genes, suggesting that the Dekkera yeasts evolved an efficient translation system to facilitate adaptive evolution. Moreover, we identified that 12 vacuolar H+-ATPase (V-ATPase function genes that were under positive selection, which assists in developing tolerance to high alcohol and high sugar stress. We also revealed that the enzyme PGK1 is responsible for the increased rate of glycolysis in the Dekkera yeasts. These results provide important insights to understand the independent adaptive evolution of the Dekkera yeasts and provide tools for genetic modification promoting industrial usage.

  10. On Computing Breakpoint Distances for Genomes with Duplicate Genes. (United States)

    Shao, Mingfu; Moret, Bernard M E


    A fundamental problem in comparative genomics is to compute the distance between two genomes in terms of its higher level organization (given by genes or syntenic blocks). For two genomes without duplicate genes, we can easily define (and almost always efficiently compute) a variety of distance measures, but the problem is NP-hard under most models when genomes contain duplicate genes. To tackle duplicate genes, three formulations (exemplar, maximum matching, and any matching) have been proposed, all of which aim to build a matching between homologous genes so as to minimize some distance measure. Of the many distance measures, the breakpoint distance (the number of nonconserved adjacencies) was the first one to be studied and remains of significant interest because of its simplicity and model-free property. The three breakpoint distance problems corresponding to the three formulations have been widely studied. Although we provided last year a solution for the exemplar problem that runs very fast on full genomes, computing optimal solutions for the other two problems has remained challenging. In this article, we describe very fast, exact algorithms for these two problems. Our algorithms rely on a compact integer-linear program that we further simplify by developing an algorithm to remove variables, based on new results on the structure of adjacencies and matchings. Through extensive experiments using both simulations and biological data sets, we show that our algorithms run very fast (in seconds) on mammalian genomes and scale well beyond. We also apply these algorithms (as well as the classic orthology tool MSOAR) to create orthology assignment, then compare their quality in terms of both accuracy and coverage. We find that our algorithm for the "any matching" formulation significantly outperforms other methods in terms of accuracy while achieving nearly maximum coverage.

  11. Enhancement of RNA synthesis by promoter duplication in tombusviruses

    International Nuclear Information System (INIS)

    Panavas, T.; Panaviene, Z.; Pogany, J.; Nagy, P.D.


    Replication of tombusviruses, small plus-strand RNA viruses of plants, is regulated by cis-acting elements present in the viral RNA. The role of cis-acting elements can be studied in vitro by using a partially purified RNA-dependent RNA polymerase (RdRp) preparation obtained from tombusvirus-infected plants , Virology 276, 279- 288). Here, we demonstrate that the minus-strand RNA of tombusviruses contains, in addition to the 3'-terminal minimal plus-strand initiation promoter, a second cis-acting element, termed the promoter proximal enhancer (PPE). The PPE element enhanced RNA synthesis by almost threefold from the adjacent minimal promoter in the in vitro assay. The sequence of the PPE element is 70% similar to the minimal promoter, suggesting that sequence duplication of the minimal promoter may have been the mechanism leading to the generation of the PPE. Consistent with this proposal, replacement of the PPE element with the minimal promoter, which resulted in a perfectly duplicated promoter region, preserved its enhancer-like function. In contrast, mutagenesis of the PPE element or its replacement with an artificial G/C-rich sequence abolished its stimulative effect on initiation of RNA synthesis in vitro. In vivo experiments are also consistent with the role of the PPE element in enhancement of tombusvirus replication. Sequence comparison of several tombusviruses and related carmoviruses further supports the finding that duplication of minimal promoter sequences may have been an important mechanism during the evolution of cis-acting elements in tombusviruses and related RNA viruses

  12. Evolutionary diversification of plant shikimate kinase gene duplicates.

    Directory of Open Access Journals (Sweden)

    Geoffrey Fucile


    Full Text Available Shikimate kinase (SK; EC catalyzes the fifth reaction of the shikimate pathway, which directs carbon from the central metabolism pool to a broad range of secondary metabolites involved in plant development, growth, and stress responses. In this study, we demonstrate the role of plant SK gene duplicate evolution in the diversification of metabolic regulation and the acquisition of novel and physiologically essential function. Phylogenetic analysis of plant SK homologs resolves an orthologous cluster of plant SKs and two functionally distinct orthologous clusters. These previously undescribed genes, shikimate kinase-like 1 (SKL1 and -2 (SKL2, do not encode SK activity, are present in all major plant lineages, and apparently evolved under positive selection following SK gene duplication over 400 MYA. This is supported by functional assays using recombinant SK, SKL1, and SKL2 from Arabidopsis thaliana (At and evolutionary analyses of the diversification of SK-catalytic and -substrate binding sites based on theoretical structure models. AtSKL1 mutants yield albino and novel variegated phenotypes, which indicate SKL1 is required for chloroplast biogenesis. Extant SKL2 sequences show a strong genetic signature of positive selection, which is enriched in a protein-protein interaction module not found in other SK homologs. We also report the first kinetic characterization of plant SKs and show that gene expression diversification among the AtSK inparalogs is correlated with developmental processes and stress responses. This study examines the functional diversification of ancient and recent plant SK gene duplicates and highlights the utility of SKs as scaffolds for functional innovation.

  13. Duplicated facial nerve trunk with a first branchial cleft cyst. (United States)

    Hinson, Drew; Poteet, Perry; Bower, Charles


    First branchial cleft anomalies are rare and their various anatomical relationships to the facial nerve have been described. We encountered a 15-year-old female with a type II first branchial cleft cyst presenting as a right neck mass that we found during surgical excision to transverse two main facial nerve trunks. To our knowledge, this is the first reported case of a first branchial cleft anomaly in conjunction with a duplicated facial nerve trunk. © 2013 The American Laryngological, Rhinological and Otological Society, Inc.

  14. Urethral Triplication Without Bladder Duplication: Endourologic Diagnosis and Management (United States)

    Ortiz, Ruben; Burgos, Laura; Angulo, Jose Maria


    Abstract Urethral triplication is a rare congenital anomaly of the lower urinary system, with urethra ending in glans. At the beginning of toilet training, urine output was observed along the rectum. Rigid cystoscopy shows a perineal urethra starting in the posterior urethra. Subsequently, flexible cystoscopy showed entry of epispadic urethra in the bladder immediately superior to the bladder neck. It was running parallel to primary urethra. Then, we observed two most frequent types of urethral duplication in the sagittal plane in a single patient. PMID:29675475

  15. Bionic Duplication of Fresh Navodon septentrionalis Fish Surface Structures

    Directory of Open Access Journals (Sweden)

    Bing Qu


    Full Text Available Biomimetic superhydrophobic surface was fabricated by replicating topography of the fresh fish skin surface of Navodon septentrionalis with polydimethylsiloxane (PDMS elastomer. A two-step replicating method was developed to make the surface structure of the fresh fish skin be replicated with high fidelity. After duplication, it was found that the static contact angle of the replica was as large as 173°. Theoretic analysis based on Young's and Cassie-Baxter (C-B model was performed to explain the relationship between structure and hydrophobicity.

  16. Tracheal Atresia with Segmental Esophageal Duplication: An Unusual Anatomic Arrangement. (United States)

    Gaerty, Kirsten; Thomas, Joseph T; Petersen, Scott; Tan, Edwin; Kumar, Sailesh; Gardener, Glenn; Armes, Jane


    An unusual anatomic configuration of segmental tracheal agenesis/atresia with esophageal duplication on autopsy in a fetus that demised in utero at 29 weeks is reported. The mother was scanned initially for a cardiac anomaly at 20 weeks and on follow-up scan at 27 weeks had polyhydramnios and underwent amnioreduction. The final autopsy diagnosis was vertebral, ano-rectal, cardiac, tracheoesophageal, renal, and limb malformations (VACTERL). We discuss the autopsy findings along with the embryological mechanisms and compare the configuration with Floyd's classification for tracheal agenesis. The difficulties in prenatal diagnosis are discussed.

  17. Esophageal carcinoma originating in a duplication cyst: case report

    Directory of Open Access Journals (Sweden)

    Pimenta Amadeu P. A.


    Full Text Available The authors present the case report of a 61-year-old man, admitted with middle third squamous cell esophageal carcinoma. He was submitted to a curative gastroesophageal resection via a medium laparotomy and a right thoracotomy. An intrathoracic esophagogastric anastomosis was performed. The pathological analysis of the surgical specimen revealed a squamous cell carcinoma clearly originating from the epithelial lining of an esophageal duplication cyst. Immunohistochemitry showed p 53 staining of the tumor cells. The patient at 11 month follow up was asymptomatic.

  18. A case report of two male siblings with autism and duplication of Xq13-q21, a region including three genes predisposing for autism. (United States)

    Wentz, Elisabet; Vujic, Mihailo; Kärrstedt, Ewa-Lotta; Erlandsson, Anna; Gillberg, Christopher


    Autism spectrum disorder, severe behaviour problems and duplication of the Xq12 to Xq13 region have recently been described in three male relatives. To describe the psychiatric comorbidity and dysmorphic features, including craniosynostosis, of two male siblings with autism and duplication of the Xq13 to Xq21 region, and attempt to narrow down the number of duplicated genes proposed to be leading to global developmental delay and autism. We performed DNA sequencing of certain exons of the TWIST1 gene, the FGFR2 gene and the FGFR3 gene. We also performed microarray analysis of the DNA. In addition to autism, the two male siblings exhibited severe learning disability, self-injurious behaviour, temper tantrums and hyperactivity, and had no communicative language. Chromosomal analyses were normal. Neither of the two siblings showed mutations of the sequenced exons known to produce craniosynostosis. The microarray analysis detected an extra copy of a region on the long arm of chromosome X, chromosome band Xq13.1-q21.1. Comparison of our two cases with previously described patients allowed us to identify three genes predisposing for autism in the duplicated chromosomal region. Sagittal craniosynostosis is also a new finding linked to the duplication.

  19. 19q12q13.2 duplication syndrome: neuropsychiatric long-term follow-up of a new case and literature update

    Directory of Open Access Journals (Sweden)

    Nacinovich R


    Full Text Available Renata Nacinovich,1,2 Nicoletta Villa,3 Fiorenza Broggi,1,2 Cristina Tavaniello,1 Monica Bomba,1 Donatella Conconi,2 Serena Redaelli,2 Elena Sala,3 Marialuisa Lavitrano,2 Francesca Neri1,2 1Childhood and Adolescence Neuropsychiatric Unit, San Gerardo Hospital, 2School of Medicine and Surgery, University of Milano Bicocca, 3Medical Genetics Laboratory, Clinical Pathology Department, San Gerardo Hospital, Monza, Italy Abstract: Genetic syndromes are well characterized by the phenotypic point of view, but little is known about their progression and patients’ quality of life. We report a 10-year neuropsychiatric follow-up of a boy with duplication of chromosome 19. Cytogenetic investigation was requested at the age of 5 years for psychomotor and speech delay. The genomic study identified an 8.17 Mb duplication on chromosome 19q12q13.2. We propose that the long-term follow-up of our patient would help to delineate the neuropsychiatric phenotype associated with 19q duplication. This study could be a model for further long-term research in the neuropsychiatric follow-up of patients with 19q duplication syndrome. Keywords: 19q duplication, neuropsychiatric follow-up, array-CGH

  20. The large soybean (Glycine max) WRKY TF family expanded by segmental duplication events and subsequent divergent selection among subgroups. (United States)

    Yin, Guangjun; Xu, Hongliang; Xiao, Shuyang; Qin, Yajuan; Li, Yaxuan; Yan, Yueming; Hu, Yingkao


    WRKY genes encode one of the most abundant groups of transcription factors in higher plants, and its members regulate important biological process such as growth, development, and responses to biotic and abiotic stresses. Although the soybean genome sequence has been published, functional studies on soybean genes still lag behind those of other species. We identified a total of 133 WRKY members in the soybean genome. According to structural features of their encoded proteins and to the phylogenetic tree, the soybean WRKY family could be classified into three groups (groups I, II, and III). A majority of WRKY genes (76.7%; 102 of 133) were segmentally duplicated and 13.5% (18 of 133) of the genes were tandemly duplicated. This pattern was not apparent in Arabidopsis or rice. The transcriptome atlas revealed notable differential expression in either transcript abundance or in expression patterns under normal growth conditions, which indicated wide functional divergence in this family. Furthermore, some critical amino acids were detected using DIVERGE v2.0 in specific comparisons, suggesting that these sites have contributed to functional divergence among groups or subgroups. In addition, site model and branch-site model analyses of positive Darwinian selection (PDS) showed that different selection regimes could have affected the evolution of these groups. Sites with high probabilities of having been under PDS were found in groups I, II c, II e, and III. Together, these results contribute to a detailed understanding of the molecular evolution of the WRKY gene family in soybean. In this work, all the WRKY genes, which were generated mainly through segmental duplication, were identified in the soybean genome. Moreover, differential expression and functional divergence of the duplicated WRKY genes were two major features of this family throughout their evolutionary history. Positive selection analysis revealed that the different groups have different evolutionary rates

  1. Method of duplicating film using the CR system. Evaluation of detectability in a simulated nodule

    International Nuclear Information System (INIS)

    Fukuyama, Atsushi; Ando, Satoshi; Maeda, Kayoko; Ida, Kazushi; Suzuki, Tomoaki; Fukuyama, Kouichi; Hasegawa, Takeo


    Since film processors used for screen-film systems have been decreasing recently, it is becoming difficult to develop duplicating film (Dup film) used conventionally. The purpose of this study was to evaluate the usefulness of the method of duplicating film using a computed radiography (CR) system. The process of duplicating film using CR is to eliminate energy accumulated on the imaging plate (IP) using white light, to accumulate energy on the whole surface, and to place the original film in piles. After an exposure of white light, duplicated films can be obtained by CR system. In order to evaluate the reproducibiliy of our system, duplicated films were read by experienced observers and receiver operating characteristic (ROC) analysis was carried out. Observers read 50 images with a simulated nodule and 50 images without a simulated nodule. The average Az values were 0.94 for the original films, 0.91 for films duplicated using Dup film, and 0.90 for films duplicated using the CR system. When the two-tailed paired-T test was performed for each result, there were no statistically significant differences at p<0.05. The detectability of a simulated nodule for films duplicated using the CR system did not differ from the detectability of films duplicated using Dup film. This method may be a reasonable substitute for the conventional duplication system. (author)

  2. Recurrent Gene Duplication Leads to Diverse Repertoires of Centromeric Histones in Drosophila Species. (United States)

    Kursel, Lisa E; Malik, Harmit S


    Despite their essential role in the process of chromosome segregation in most eukaryotes, centromeric histones show remarkable evolutionary lability. Not only have they been lost in multiple insect lineages, but they have also undergone gene duplication in multiple plant lineages. Based on detailed study of a handful of model organisms including Drosophila melanogaster, centromeric histone duplication is considered to be rare in animals. Using a detailed phylogenomic study, we find that Cid, the centromeric histone gene, has undergone at least four independent gene duplications during Drosophila evolution. We find duplicate Cid genes in D. eugracilis (Cid2), in the montium species subgroup (Cid3, Cid4) and in the entire Drosophila subgenus (Cid5). We show that Cid3, Cid4, and Cid5 all localize to centromeres in their respective species. Some Cid duplicates are primarily expressed in the male germline. With rare exceptions, Cid duplicates have been strictly retained after birth, suggesting that they perform nonredundant centromeric functions, independent from the ancestral Cid. Indeed, each duplicate encodes a distinct N-terminal tail, which may provide the basis for distinct protein-protein interactions. Finally, we show some Cid duplicates evolve under positive selection whereas others do not. Taken together, our results support the hypothesis that Drosophila Cid duplicates have subfunctionalized. Thus, these gene duplications provide an unprecedented opportunity to dissect the multiple roles of centromeric histones. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. Targeted tandem duplication of a large chromosomal segment in Aspergillus oryzae. (United States)

    Takahashi, Tadashi; Sato, Atsushi; Ogawa, Masahiro; Hanya, Yoshiki; Oguma, Tetsuya


    We describe here the first successful construction of a targeted tandem duplication of a large chromosomal segment in Aspergillus oryzae. The targeted tandem chromosomal duplication was achieved by using strains that had a 5'-deleted pyrG upstream of the region targeted for tandem chromosomal duplication and a 3'-deleted pyrG downstream of the target region. Consequently,strains bearing a 210-kb targeted tandem chromosomal duplication near the centromeric region of chromosome 8 and strains bearing a targeted tandem chromosomal duplication of a 700-kb region of chromosome 2 were successfully constructed. The strains bearing the tandem chromosomal duplication were efficiently obtained from the regenerated protoplast of the parental strains. However, the generation of the chromosomal duplication did not depend on the introduction of double-stranded breaks(DSBs) by I-SceI. The chromosomal duplications of these strains were stably maintained after five generations of culture under nonselective conditions. The strains bearing the tandem chromosomal duplication in the 700-kb region of chromosome 2 showed highly increased protease activity in solid-state culture, indicating that the duplication of large chromosomal segments could be a useful new breeding technology and gene analysis method.

  4. A survey of innovation through duplication in the reduced genomes of twelve parasites.

    Directory of Open Access Journals (Sweden)

    Jeremy D DeBarry

    Full Text Available We characterize the prevalence, distribution, divergence, and putative functions of detectable two-copy paralogs and segmental duplications in the Apicomplexa, a phylum of parasitic protists. Apicomplexans are mostly obligate intracellular parasites responsible for human and animal diseases (e.g. malaria and toxoplasmosis. Gene loss is a major force in the phylum. Genomes are small and protein-encoding gene repertoires are reduced. Despite this genomic streamlining, duplications and gene family amplifications are present. The potential for innovation introduced by duplications is of particular interest. We compared genomes of twelve apicomplexans across four lineages and used orthology and genome cartography to map distributions of duplications against genome architectures. Segmental duplications appear limited to five species. Where present, they correspond to regions enriched for multi-copy and species-specific genes, pointing toward roles in adaptation and innovation. We found a phylum-wide association of duplications with dynamic chromosome regions and syntenic breakpoints. Trends in the distribution of duplicated genes indicate that recent, species-specific duplicates are often tandem while most others have been dispersed by genome rearrangements. These trends show a relationship between genome architecture and gene duplication. Functional analysis reveals: proteases, which are vital to a parasitic lifecycle, to be prominent in putative recent duplications; a pair of paralogous genes in Toxoplasma gondii previously shown to produce the rate-limiting step in dopamine synthesis in mammalian cells, a possible link to the modification of host behavior; and phylum-wide differences in expression and subcellular localization, indicative of modes of divergence. We have uncovered trends in multiple modes of duplicate divergence including sequence, intron content, expression, subcellular localization, and functions of putative recent duplicates that

  5. Partial facial duplication (diprosopus) in a goat kid. (United States)

    Mukaratirwa, S; Sayi, S T


    The anatomical and clinical features of a live-born diprosopic goat kid are described. The kid had two faces with two eyes each, two complete oral cavities and nostrils and two ears. Caudal to the neck, the kid grossly appeared normal. Both mouths of the kid showed synchronous suckling motions. Elevated respiratory and heart rates were recorded and the temperature was subnormal. Radiological examination showed a single trunk and vertebral column, normal limbs, two sets of jaws, three orbits, and contrast radiography revealed a single patent oesophagus. There was maxillary and mandibular duplication resulting in two faces. There was a cleft palate. The oropharyngeal regions of each face merged to form a single laryngopharynx and oesophagus. There was a single brain with hypoplasia of the cerebellum. The left and right cerebral hemispheres were fused rostrally, and there was duplication of the optic chiasma and the pituitary gland. The olfactory tract was absent and the superficial origins of most of the cranial nerves were not discernible.

  6. Partial facial duplication (diprosopus in a goat kid : clinical communication

    Directory of Open Access Journals (Sweden)

    S. Mukaratirwa


    Full Text Available The anatomical and clinical features of a live-born diprosopic goat kid are described. The kid had two faces with two eyes each, two complete oral cavities and nostrils and two ears. Caudal to the neck, the kid grossly appeared normal. Both mouths of the kid showed synchronous suckling motions. Elevated respiratory and heart rates were recorded and the temperature was subnormal. Radiological examination showed a single trunk and vertebral column, normal limbs, two sets of jaws, three orbits, and contrast radiography revealed a single patent oesophagus. There was maxillary and mandibular duplication resulting in two faces. There was a cleft palate. The oropharyngeal regions of each face merged to form a single laryngopharynx and oesophagus. There was a single brain with hypoplasia of the cerebellum. The left and right cerebral hemispheres were fused rostrally, and there was duplication of the optic chiasma and the pituitary gland. The olfactory tract was absent and the superficial origins of most of the cranial nerves were not discernible.

  7. Rapid diagnosis of aneuploidy using segmental duplication quantitative fluorescent PCR.

    Directory of Open Access Journals (Sweden)

    Xiangdong Kong

    Full Text Available The aim of this study was use a simple and rapid procedure, called segmental duplication quantitative fluorescent polymerase chain reaction (SD-QF-PCR, for the prenatal diagnosis of fetal chromosomal aneuploidies. This method is based on the co-amplification of segmental duplications located on two different chromosomes using a single pair of fluorescent primers. The PCR products of different sizes were subsequently analyzed through capillary electrophoresis, and the aneuploidies were determined based on the relative dosage between the two chromosomes. Each primer set, containing five pairs of primers, was designed to simultaneously detect aneuploidies located on chromosomes 21, 18, 13, X and Y in a single reaction. We applied these two primer sets to DNA samples isolated from individuals with trisomy 21 (n = 36; trisomy 18 (n = 6; trisomy 13 (n = 4; 45, X (n = 5; 47, XXX (n = 3; 48, XXYY (n = 2; and unaffected controls (n = 40. We evaluated the performance of this method using the karyotyping results. A correct and unambiguous diagnosis with 100% sensitivity and 100% specificity, was achieved for clinical samples examined. Thus, the present study demonstrates that SD-QF-PCR is a robust, rapid and sensitive method for the diagnosis of common aneuploidies, and these analyses can be performed in less than 4 hours for a single sample, providing a competitive alternative for routine use.

  8. Enteric duplication in children: clinical presentation and outcome. (United States)

    Rasool, Naima; Safdar, Chaudhry Aqeel; Ahmad, Asrar; Kanwal, Shehla


    Enteric duplication (ED) is an anomaly with varied presentations and possible involvement of the alimentary tract. Once diagnosed, resection of the lesion and the involved part of the gut is usually required. The aim of this study was to evaluate the clinical presentations, diagnostic investigations, management and outcomes of patients with ED. This was a descriptive case study conducted at the Department of Paediatric Surgery, Military Hospital, Rawalpindi, Pakistan, from January 2005 to January 2011. The medical records of all patients diagnosed with ED were retrospectively analysed with respect to age, presentation, investigations, site and type of lesion, surgical procedures, histological findings and complications. A total of nine patients were managed during the study period. The patients' ages ranged from three months to five years. Four out of nine EDs were rectal duplications. Three EDs were of the cystic type, five were of the tubular type and one was a complex mixed anomaly. Patients presented with varied symptoms, with the two most common being the presence of an abdominal mass and bleeding per rectum. Diagnosis was mainly achieved based on magnetic resonance imaging and computed tomography, although Meckel's scan provided accurate diagnosis in three of the nine patients. All the cysts were resected without any major complications, and patients were event-free during the five-year follow-up. EDs should be kept in mind when examining patients with an abdominal mass and bleeding per rectum. Meckel's scan can provide accurate diagnosis of EDs with bleeding. Prompt diagnosis and management results in satisfactory outcomes.

  9. Motion analysis for duplicate frame removal in wireless capsule endoscope (United States)

    Lee, Hyun-Gyu; Choi, Min-Kook; Lee, Sang-Chul


    Wireless capsule endoscopy (WCE) has been intensively researched recently due to its convenience for diagnosis and extended detection coverage of some diseases. Typically, a full recording covering entire human digestive system requires about 8 to 12 hours for a patient carrying a capsule endoscope and a portable image receiver/recorder unit, which produces 120,000 image frames on average. In spite of the benefits of close examination, WCE based test has a barrier for quick diagnosis such that a trained diagnostician must examine a huge amount of images for close investigation, normally over 2 hours. The main purpose of our work is to present a novel machine vision approach to reduce diagnosis time by automatically detecting duplicated recordings caused by backward camera movement, typically containing redundant information, in small intestine. The developed technique could be integrated with a visualization tool which supports intelligent inspection method, such as automatic play speed control. Our experimental result shows high accuracy of the technique by detecting 989 duplicate image frames out of 10,000, equivalently to 9.9% data reduction, in a WCE video from a real human subject. With some selected parameters, we achieved the correct detection ratio of 92.85% and the false detection ratio of 13.57%.

  10. Characterization of a complex rearrangement involving duplication and deletion of 9p in an infant with craniofacial dysmorphism and cardiac anomalies

    Directory of Open Access Journals (Sweden)

    Di Bartolo Daniel L


    Full Text Available Abstract Partial duplication and partial deletion of the short arm of chromosome 9 have each been reported in the literature as clinically recognizable syndromes. We present clinical, cytogenetic, and molecular findings on a five-week-old female infant with concomitant duplication and terminal deletion of the short arm of chromosome 9. To our knowledge ten such cases have previously been reported. Conventional cytogenetic analysis identified additional material on chromosome 9 at band p23. FISH analysis aided in determining the additional material consisted of an inverted duplication with a terminal deletion of the short arm. Microarray analysis confirmed this interpretation and further characterized the abnormality as a duplication of about 32.7 Mb, from 9p23 to 9p11.2, and a terminal deletion of about 11.5 Mb, from 9p24.3 to 9p23. The infant displayed characteristic features of Duplication 9p Syndrome (hypotonia, bulbous nose, single transverse palmar crease, cranial anomalies, as well as features associated with Deletion 9p Syndrome (flat nasal bridge, long philtrum, cardiac anomalies despite the deletion being distal to the reported critical region for this syndrome. This case suggests that there are genes or regulatory elements that lie outside of the reported critical region responsible for certain phenotypic features associated with Deletion 9p Syndrome. It also underscores the importance of utilizing array technology to precisely define abnormalities involving the short arm of 9p in order to further refine genotype/phenotype associations and to identify additional cases of duplication/deletion.

  11. Colonic duplication in adults: Report of two cases presenting with rectal bleeding

    Institute of Scientific and Technical Information of China (English)

    C Fotiadis; M Genetzakis; I Papandreou; EP Misiakos; E Agapitos; GC Zografos


    Gastrointestinal duplication is an uncommon congenital abnormality in two-thirds of cases manifesting before the age of 2 years. Ileal duplication is common while colonic duplication, either cystic or tubular, is a rather unusual clinical entity that remains asymptomatic and undiagnosed in most cases. Mostly occurring in pediatric patients,colonic duplication is encountered in adults only in a few cases. This study reports two cases of colonic duplication in adults. Both cases presented with rectal bleeding on admission. The study was focused on clinical, imaging,histological, and therapeutical aspects of the presenting cases. Gastrografin enema established the diagnosis in both cases. The cystic structure and the adjacent part of the colon were excised en-block. The study implies that colonic duplication, though uncommon, should be included in the differential diagnosis of rectal bleeding.

  12. Colonic duplication in adults: report of two cases presenting with rectal bleeding. (United States)

    Fotiadis, C; Genetzakis, M; Papandreou, I; Misiakos, E P; Agapitos, E; Zografos, G C


    Gastrointestinal duplication is an uncommon congenital abnormality in two-thirds of cases manifesting before the age of 2 years. Ileal duplication is common while colonic duplication, either cystic or tubular, is a rather unusual clinical entity that remains asymptomatic and undiagnosed in most cases. Mostly occurring in pediatric patients, colonic duplication is encountered in adults only in a few cases. This study reports two cases of colonic duplication in adults. Both cases presented with rectal bleeding on admission. The study was focused on clinical, imaging, histological, and therapeutical aspects of the presenting cases. Gastrografin enema established the diagnosis in both cases. The cystic structure and the adjacent part of the colon were excised en-block. The study implies that colonic duplication, though uncommon, should be included in the differential diagnosis of rectal bleeding.

  13. Transposition of the great arteries - a phenotype associated with 16p11.2 duplications? (United States)

    Karunanithi, Zarmiga; Vestergaard, Else Marie; Lauridsen, Mette H


    Genetic analyses of patients with transposition of the great arteries have identified rare copy number variations, suggesting that they may be significant to the aetiology of the disease. This paper reports the identification of a 16p11.2 microduplication, a variation that has yet to be reported in association with transposition of the great arteries. The 16p11.2 microduplication is associated with autism spectrum disorder and developmental delay, but with highly variable phenotypic effects. Autism and attention deficit disorders are observed more frequently in children with congenital heart disease than in the general population. Neonatal surgery is proposed as a risk factor, but as yet unidentified genetic abnormalities should also be taken into account. Thus, congenital heart abnormalities may constitute a part of the phenotypic spectrum associated with duplications at 16p11.2. We suggest chromosomal microarray be considered part of the diagnostic work-up in patients with transposition of the great arteries.

  14. mvp - an open-source preprocessor for cleaning duplicate records and missing values in mass spectrometry data. (United States)

    Lee, Geunho; Lee, Hyun Beom; Jung, Byung Hwa; Nam, Hojung


    Mass spectrometry (MS) data are used to analyze biological phenomena based on chemical species. However, these data often contain unexpected duplicate records and missing values due to technical or biological factors. These 'dirty data' problems increase the difficulty of performing MS analyses because they lead to performance degradation when statistical or machine-learning tests are applied to the data. Thus, we have developed missing values preprocessor (mvp), an open-source software for preprocessing data that might include duplicate records and missing values. mvp uses the property of MS data in which identical chemical species present the same or similar values for key identifiers, such as the mass-to-charge ratio and intensity signal, and forms cliques via graph theory to process dirty data. We evaluated the validity of the mvp process via quantitative and qualitative analyses and compared the results from a statistical test that analyzed the original and mvp-applied data. This analysis showed that using mvp reduces problems associated with duplicate records and missing values. We also examined the effects of using unprocessed data in statistical tests and examined the improved statistical test results obtained with data preprocessed using mvp.

  15. Development of genome- and transcriptome-derived microsatellites in related species of snapping shrimps with highly duplicated genomes. (United States)

    Gaynor, Kaitlyn M; Solomon, Joseph W; Siller, Stefanie; Jessell, Linnet; Duffy, J Emmett; Rubenstein, Dustin R


    Molecular markers are powerful tools for studying patterns of relatedness and parentage within populations and for making inferences about social evolution. However, the development of molecular markers for simultaneous study of multiple species presents challenges, particularly when species exhibit genome duplication or polyploidy. We developed microsatellite markers for Synalpheus shrimp, a genus in which species exhibit not only great variation in social organization, but also interspecific variation in genome size and partial genome duplication. From the four primary clades within Synalpheus, we identified microsatellites in the genomes of four species and in the consensus transcriptome of two species. Ultimately, we designed and tested primers for 143 microsatellite markers across 25 species. Although the majority of markers were disomic, many markers were polysomic for certain species. Surprisingly, we found no relationship between genome size and the number of polysomic markers. As expected, markers developed for a given species amplified better for closely related species than for more distant relatives. Finally, the markers developed from the transcriptome were more likely to work successfully and to be disomic than those developed from the genome, suggesting that consensus transcriptomes are likely to be conserved across species. Our findings suggest that the transcriptome, particularly consensus sequences from multiple species, can be a valuable source of molecular markers for taxa with complex, duplicated genomes. © 2017 John Wiley & Sons Ltd.

  16. Duplication of the vertebral artery: report of two cases and review of the literature

    International Nuclear Information System (INIS)

    Goddard, A.J.P.; Annesley-Williams, D.; Guthrie, J.A.; Weston, M.


    Duplication of the vertebral artery is rare. We report two cases in which it was an incidental finding. In the first, duplication of the right vertebral artery was demonstrated by magnetic resonance angiography (MRA) and conventional angiography. The second patient had duplication of the right vertebral artery demonstrated by MRA. We discuss the origin of this abnormality, its radiological implications and its potential clinical significance are discussed. (orig.)

  17. Craniofacial duplication (diprosopus): CT, MR imaging, and MR angiography findings case report. (United States)

    Hähnel, Stefan; Schramm, Peter; Hassfeld, Stefan; Steiner, Hans H; Seitz, Angelika


    Diprosopus is one of the rarest malformations in humans. In addition to the facial structures, the cerebral frontal lobes were duplicated in this case. Three pairs of anterior cerebral arteries were detected, and the rostral parts of the superior sagittal sinus were duplicated. Computed tomography, magnetic resonance (MR) imaging, and MR angiography allowed study of the degree of duplicative changes in diprosopus, especially for planning cosmetic correction. Copyright RSNA, 2002

  18. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation


    Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.


    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and ada...

  19. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation.


    Thomas D Cuypers; Paulien Hogeweg


    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and ada...

  20. Phylogenetic detection of numerous gene duplications shared by animals, fungi and plants


    Zhou, Xiaofan; Lin, Zhenguo; Ma, Hong


    Background Gene duplication is considered a major driving force for evolution of genetic novelty, thereby facilitating functional divergence and organismal diversity, including the process of speciation. Animals, fungi and plants are major eukaryotic kingdoms and the divergences between them are some of the most significant evolutionary events. Although gene duplications in each lineage have been studied extensively in various contexts, the extent of gene duplication prior to the split of pla...

  1. Gastric Duplication Cyst: A Rare Congenital Disease Often Misdiagnosed in Adults

    Directory of Open Access Journals (Sweden)

    Jessica Falleti


    Full Text Available Gastrointestinal duplication is a rare congenital disease which affected more commonly the ileum, while the stomach is rarely involved. Generally diagnosed in paediatric or young age, it could be difficult to suspect a gastrointestinal duplication in adults. Herein, we report a 55-year-old male with a gastric duplication cyst found on routinely checkup for chronic hepatitis and first misdiagnosed as a gastrointestinal stromal tumor (GIST; we also discuss its embryology.

  2. Duplicated Enhancer Region Increases Expression of CTSB and Segregates with Keratolytic Winter Erythema in South African and Norwegian Families. (United States)

    Ngcungcu, Thandiswa; Oti, Martin; Sitek, Jan C; Haukanes, Bjørn I; Linghu, Bolan; Bruccoleri, Robert; Stokowy, Tomasz; Oakeley, Edward J; Yang, Fan; Zhu, Jiang; Sultan, Marc; Schalkwijk, Joost; van Vlijmen-Willems, Ivonne M J J; von der Lippe, Charlotte; Brunner, Han G; Ersland, Kari M; Grayson, Wayne; Buechmann-Moller, Stine; Sundnes, Olav; Nirmala, Nanguneri; Morgan, Thomas M; van Bokhoven, Hans; Steen, Vidar M; Hull, Peter R; Szustakowski, Joseph; Staedtler, Frank; Zhou, Huiqing; Fiskerstrand, Torunn; Ramsay, Michele


    Keratolytic winter erythema (KWE) is a rare autosomal-dominant skin disorder characterized by recurrent episodes of palmoplantar erythema and epidermal peeling. KWE was previously mapped to 8p23.1-p22 (KWE critical region) in South African families. Using targeted resequencing of the KWE critical region in five South African families and SNP array and whole-genome sequencing in two Norwegian families, we identified two overlapping tandem duplications of 7.67 kb (South Africans) and 15.93 kb (Norwegians). The duplications segregated with the disease and were located upstream of CTSB, a gene encoding cathepsin B, a cysteine protease involved in keratinocyte homeostasis. Included in the 2.62 kb overlapping region of these duplications is an enhancer element that is active in epidermal keratinocytes. The activity of this enhancer correlated with CTSB expression in normal differentiating keratinocytes and other cell lines, but not with FDFT1 or NEIL2 expression. Gene expression (qPCR) analysis and immunohistochemistry of the palmar epidermis demonstrated significantly increased expression of CTSB, as well as stronger staining of cathepsin B in the stratum granulosum of affected individuals than in that of control individuals. Analysis of higher-order chromatin structure data and RNA polymerase II ChIA-PET data from MCF-7 cells did not suggest remote effects of the enhancer. In conclusion, KWE in South African and Norwegian families is caused by tandem duplications in a non-coding genomic region containing an active enhancer element for CTSB, resulting in upregulation of this gene in affected individuals. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  3. Urethral duplication II-A Y type with rectal urethra: ASTRA approach and tunica vaginalis flap for first stage repair. (United States)

    Macedo, Antonio; Rondon, Atila; Bacelar, Herick; Ottoni, Sergio; Liguori, Riberto; Garrone, Gilmar; Ortiz, Valdemar


    Urethral duplication is a rare congenital anomaly affecting mainly boys. Generally, the duplication develops on the sagittal plane; the accessory urethra may run dorsally or ventrally to the orthotopic one. We present a patient with urethral duplication in which the orthotopic urethra was patent in the penile segment but atresic in the bulbar and prostatic segment. The patient had urinary flow from the rectum and the ectopic urethra could be well identified by anal examination. Age at surgery was 13 months. The procedure consisted of an ASTRA (anterior sagittal trans-ano-rectal) approach for dividing the urethra and rectum and was successful to move the urethra up to the perineal area. The rectum was reconstructed and the patient placed into a lithotomy position. A urethral catheter inserted in the penile urethra oriented us were the atresic urethra in bulbar area started. The scrotum was opened in the middle and the distance between the two urethral stumps proximal and distal defined the extension of no urethral tissue that consisted of 5 cm. We opened the right scrotal space and a tunica vaginalis flap was obtained and attached to the bulbar tissue for a two-stage urethroplasty strategy. Patient had a nice healing and the tunica vaginalis was nicely incorporated to the adjacent tissue, having the two urethral stumps well delineated. ASTRA approach in combination with a two-stage urethroplasty with tunica vaginalis dorsal flap proved to be an excellent combination for a rare case of urethral Y duplication having the main urethra into the rectum.

  4. Urethral duplication II-A Y type with rectal urethra: ASTRA approach and tunica vaginalis flap for first stage repair

    Directory of Open Access Journals (Sweden)

    Antonio Macedo Jr


    Full Text Available INTRODUCTION: Urethral duplication is a rare congenital anomaly affecting mainly boys. Generally, the duplication develops on the sagittal plane; the accessory urethra may run dorsally or ventrally to the orthotopic one. We present a patient with urethral duplication in which the orthotopic urethra was patent in the penile segment but atresic in the bulbar and prostatic segment. The patient had urinary flow from the rectum and the ectopic urethra could be well identified by anal examination. MATERIALS AND METHODS: Age at surgery was 13 months. The procedure consisted of an ASTRA (anterior sagittal trans-ano-rectal approach for dividing the urethra and rectum and was successful to move the urethra up to the perineal area. The rectum was reconstructed and the patient placed into a lithotomy position. A urethral catheter inserted in the penile urethra oriented us were the atresic urethra in bulbar area started. The scrotum was opened in the middle and the distance between the two urethral stumps proximal and distal defined the extension of no urethral tissue that consisted of 5 cm. We opened the right scrotal space and a tunica vaginalis flap was obtained and attached to the bulbar tissue for a two-stage urethroplasty strategy. RESULTS: Patient had a nice healing and the tunica vaginalis was nicely incorporated to the adjacent tissue, having the two urethral stumps well delineated. CONCLUSIONS: ASTRA approach in combination with a two-stage urethroplasty with tunica vaginalis dorsal flap proved to be an excellent combination for a rare case of urethral Y duplication having the main urethra into the rectum.

  5. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Yong Guo

    Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  6. De novo duplication of 17p13.1-p13.2 in a patient with intellectual disability and obesity. (United States)

    Kuroda, Yukiko; Ohashi, Ikuko; Tominaga, Makiko; Saito, Toshiyuki; Nagai, Jun-Ichi; Ida, Kazumi; Naruto, Takuya; Masuno, Mitsuo; Kurosawa, Kenji


    17p13.1 Deletion encompassing TP53 has been described as a syndrome characterized by intellectual disability and dysmorphic features. Only one case with a 17p13.1 duplication encompassing TP53 has been reported in a patient with intellectual disability, seizures, obesity, and diabetes mellitus. Here, we present a patient with a 17p13.1 duplication who exhibited obesity and intellectual disability, similar to the previous report. The 9-year-old proposita was referred for the evaluation of intellectual disability and obesity. She also exhibited insulin resistance and liver dysfunction. She had wide palpebral fissures, upturned nostrils, a long mandible, short and slender fingers, and skin hyperpigmentation. Array comparative genomic hybridization (array CGH) detected a 3.2 Mb duplication of 17p13.1-p13.2 encompassing TP53, FXR2, NLGN2, and SLC2A4, which encodes the insulin-responsive glucose transporter 4 (GLUT4) associated with insulin-stimulated glucose uptake in adipocytes and muscle. We suggest that 17p13.1 duplication may represent a clinically recognizable condition characterized partially by a characteristic facial phenotype, developmental delay, and obesity. © 2014 Wiley Periodicals, Inc.

  7. Network topologies and convergent aetiologies arising from deletions and duplications observed in individuals with autism. (United States)

    Noh, Hyun Ji; Ponting, Chris P; Boulding, Hannah C; Meader, Stephen; Betancur, Catalina; Buxbaum, Joseph D; Pinto, Dalila; Marshall, Christian R; Lionel, Anath C; Scherer, Stephen W; Webber, Caleb


    Autism Spectrum Disorders (ASD) are highly heritable and characterised by impairments in social interaction and communication, and restricted and repetitive behaviours. Considering four sets of de novo copy number variants (CNVs) identified in 181 individuals with autism and exploiting mouse functional genomics and known protein-protein interactions, we identified a large and significantly interconnected interaction network. This network contains 187 genes affected by CNVs drawn from 45% of the patients we considered and 22 genes previously implicated in ASD, of which 192 form a single interconnected cluster. On average, those patients with copy number changed genes from this network possess changes in 3 network genes, suggesting that epistasis mediated through the network is extensive. Correspondingly, genes that are highly connected within the network, and thus whose copy number change is predicted by the network to be more phenotypically consequential, are significantly enriched among patients that possess only a single ASD-associated network copy number changed gene (p = 0.002). Strikingly, deleted or disrupted genes from the network are significantly enriched in GO-annotated positive regulators (2.3-fold enrichment, corrected p = 2×10(-5)), whereas duplicated genes are significantly enriched in GO-annotated negative regulators (2.2-fold enrichment, corrected p = 0.005). The direction of copy change is highly informative in the context of the network, providing the means through which perturbations arising from distinct deletions or duplications can yield a common outcome. These findings reveal an extensive ASD-associated molecular network, whose topology indicates ASD-relevant mutational deleteriousness and that mechanistically details how convergent aetiologies can result extensively from CNVs affecting pathways causally implicated in ASD.

  8. Slipins: ancient origin, duplication and diversification of the stomatin protein family

    Directory of Open Access Journals (Sweden)

    Young J Peter W


    Full Text Available Abstract Background Stomatin is a membrane protein that was first isolated from human red blood cells. Since then, a number of stomatin-like proteins have been identified in all three domains of life. The conservation among these proteins is remarkable, with bacterial and human homologs sharing 50 % identity. Despite being associated with a variety of diseases such as cancer, kidney failure and anaemia, precise functions of these proteins remain unclear. Results We have constructed a comprehensive phylogeny of all 'stomatin-like' sequences that share a 150 amino acid domain. We show these proteins comprise an ancient family that arose early in prokaryotic evolution, and we propose a new nomenclature that reflects their phylogeny, based on the name "slipin" (stomatin-like protein. Within prokaryotes there are two distinct subfamilies that account for the two different origins of the eight eukaryotic stomatin subfamilies, one of which gave rise to eukaryotic SLP-2, renamed here "paraslipin". This was apparently acquired through the mitochondrial endosymbiosis and is widely distributed amongst the major kingdoms. The other prokaryotic subfamily gave rise to the ancestor of the remaining seven eukaryotic subfamilies. The highly diverged "alloslipin" subfamily is represented only by fungal, viral and ciliate sequences. The remaining six subfamilies, collectively termed "slipins", are confined to metazoa. Protostome stomatin, as well as a newly reported arthropod subfamily slipin-4, are restricted to invertebrate groups, whilst slipin-1 (previously SLP-1 is present in nematodes and higher metazoa. In vertebrates, the stomatin family expanded considerably, with at least two duplication events giving rise to podocin and slipin-3 subfamilies (previously SLP-3, with the retained ancestral sequence giving rise to vertebrate stomatin. Conclusion Stomatin-like proteins have their origin in an ancient duplication event that occurred early on in the evolution

  9. Wide rectal duplication cyst in an adult resected by anterior approach: efficacy and recurrence. (United States)

    Ceriotti, Michela; Saccomani, Giorgia; Lacelli, Francesca; Saccomani, Giovanni E


    Alimentary tract duplications are uncommon congenital abnormalities usually diagnosed and treated in childhood. Rectal involvement is extremely rare. We report the case of a 22-year-old female who presented with chronic abdominal and perianal pain; feeling of rectal fullness. Workup revealed a rectal duplication cyst. The patient underwent a complete transabdominal excision of the cyst: an hybrid laparoscopic and laparotomic technique was adopted. The hybrid isolated anterior abdominal approach is safe and feasible even for the treatment of wide rectal duplication cysts. Real recurrence in rectal duplication cysts is uncommon when the first operation was performed with radical intent.

  10. Single-copy genes define a conserved order between rice and wheat for understanding differences caused by duplication, deletion, and transposition of genes. (United States)

    Singh, Nagendra K; Dalal, Vivek; Batra, Kamlesh; Singh, Binay K; Chitra, G; Singh, Archana; Ghazi, Irfan A; Yadav, Mahavir; Pandit, Awadhesh; Dixit, Rekha; Singh, Pradeep K; Singh, Harvinder; Koundal, Kirpa R; Gaikwad, Kishor; Mohapatra, Trilochan; Sharma, Tilak R


    The high-quality rice genome sequence is serving as a reference for comparative genome analysis in crop plants, especially cereals. However, early comparisons with bread wheat showed complex patterns of conserved synteny (gene content) and colinearity (gene order). Here, we show the presence of ancient duplicated segments in the progenitor of wheat, which were first identified in the rice genome. We also show that single-copy (SC) rice genes, those representing unique matches with wheat expressed sequence tag (EST) unigene contigs in the whole rice genome, show more than twice the proportion of genes mapping to syntenic wheat chromosome as compared to the multicopy (MC) or duplicated rice genes. While 58.7% of the 1,244 mapped SC rice genes were located in single syntenic wheat chromosome groups, the remaining 41.3% were distributed randomly to the other six non-syntenic wheat groups. This could only be explained by a background dispersal of genes in the genome through transposition or other unknown mechanism. The breakdown of rice-wheat synteny due to such transpositions was much greater near the wheat centromeres. Furthermore, the SC rice genes revealed a conserved primordial gene order that gives clues to the origin of rice and wheat chromosomes from a common ancestor through polyploidy, aneuploidy, centromeric fusions, and translocations. Apart from the bin-mapped wheat EST contigs, we also compared 56,298 predicted rice genes with 39,813 wheat EST contigs assembled from 409,765 EST sequences and identified 7,241 SC rice gene homologs of wheat. Based on the conserved colinearity of 1,063 mapped SC rice genes across the bins of individual wheat chromosomes, we predicted the wheat bin location of 6,178 unmapped SC rice gene homologs and validated the location of 213 of these in the telomeric bins of 21 wheat chromosomes with 35.4% initial success. This opens up the possibility of directed mapping of a large number of conserved SC rice gene homologs in wheat

  11. Delusional misidentifications and duplications: right brain lesions, left brain delusions. (United States)

    Devinsky, Orrin


    When the delusional misidentification syndromes reduplicative paramnesia and Capgras syndromes result from neurologic disease, lesions are usually bifrontal and/or right hemispheric. The related disorders of confabulation and anosognosis share overlapping mechanisms and anatomic pathology. A dual mechanism is postulated for the delusional misidentification syndromes: negative effects from right hemisphere and frontal lobe dysfunction as well as positive effects from release (i.e., overactivity) of preserved left hemisphere areas. Negative effects of right hemisphere injury impair self-monitoring, ego boundaries, and attaching emotional valence and familiarity to stimuli. The unchecked left hemisphere unleashes a creative narrator from the monitoring of self, memory, and reality by the frontal and right hemisphere areas, leading to excessive and false explanations. Further, the left hemisphere's cognitive style of categorization, often into dual categories, leads it to invent a duplicate or impostor to resolve conflicting information. Delusions result from right hemisphere lesions. But it is the left hemisphere that is deluded.

  12. On face antimagic labeling of double duplication of graphs (United States)

    Shobana, L.; Kuppan, R.


    A Labeling of a plane graph G is called d-antimagic if every numbers, the set of s-sided face weights is Ws={as,as+d,as+2d,...,as+(fs-1)d} for some integers as and d (as>0,d≥0),where fs is the number of s-sided faces. We allow differentsets ws of different s.In this paper, we proved the existence of face antimagic labeling of types (1,0,0),(1,0,1),(1,1,0),(0,1,1) and (1,1,1) of double duplication of all vertices by edges of a cycle graph Cn: n≥3 and a tree of order n.

  13. Bibliographic review of intestinal duplication in the pediatric patient

    International Nuclear Information System (INIS)

    Molina Campos, Cesar


    An exhaustive bibliographical review was carried out on all the clinical, diagnostic and therapeutic aspects related to intestinal duplication, to update the concepts that are exposed in the literature. An observational and descriptive study of the literature found was carried out, using as source the articles found in the National Library of Health and Social Security (BINAS) and on the Internet, in addition to the official textbook of the pediatric surgery graduate in Costa Rica. A study of updating of the clinical findings, approach and therapeutic of the pathology was carried out. A protocolization of all diagnosis, can be considered as a valuable tool to help make this diagnosis as expeditious and accurate as possible, in order to provide adequate and safe treatment to the patient, significantly reducing the risks and morbidity in surgery as definitive treatment [es

  14. Oculocutaneous albinism in a patient with 17p13.2-pter duplication - a review on the molecular syndromology of 17p13 duplication. (United States)

    Kucharczyk, Marzena; Jezela-Stanek, Aleksandra; Gieruszczak-Bialek, Dorota; Kugaudo, Monika; Cieslikowska, Agata; Pelc, Magdalena; Krajewska-Walasek, Malgorzata


    Chromosomal duplications involving 17p13.3 have recently been defined as a new distinctive syndrome with several diagnosed patients. Some variation is known to occur in the breakpoints of the duplicated region and, consequently, in the phenotype as well. We report on a patient, the fifth to our knowledge, a 4-year-old girl with a pure de novo subtelomeric 17p13.2-pter duplication. She presents all of the facial features described so far for this duplication and in addition, a unilateral palmar transversal crease and oculocutaneous albinism which has not been reported previously. A detailed molecular description of the reported aberration and correlation with the observed phenotypical features based on a literature review. We discuss the possible molecular etiology of albinism in regard to the mode of inheritance. The new data provided here may be useful for further genotype correlations in syndromes with oculocutaneous albinism, especially of autosomal dominant inheritance.

  15. Multigeneration Inheritance through Fertile XX Carriers of an NR0B1 (DAX1 Locus Duplication in a Kindred of Females with Isolated XY Gonadal Dysgenesis

    Directory of Open Access Journals (Sweden)

    Michela Barbaro


    Full Text Available A 160 kb minimal common region in Xp21 has been determined as the cause of XY gonadal dysgenesis, if duplicated. The region contains the MAGEB genes and the NR0B1 gene; this is the candidate for gonadal dysgenesis if overexpressed. Most patients present gonadal dysgenesis within a more complex phenotype. However, few independent cases have recently been described presenting with isolated XY gonadal dysgenesis caused by relatively small NR0B1 locus duplications. We have identified another NR0B1 duplication in two sisters with isolated XY gonadal dysgenesis with an X-linked inheritance pattern. We performed X-inactivation studies in three fertile female carriers of three different small NR0B1 locus duplications identified by our group. The carrier mothers did not show obvious skewing of X-chromosome inactivation, suggesting that NR0B1 overexpression does not impair ovarian function. We furthermore emphasize the importance to investigate the NR0B1 locus also in patients with isolated XY gonadal dysgenesis.

  16. Syntenic block overlap multiplicities with a panel of reference genomes provide a signature of ancient polyploidization events. (United States)

    Zheng, Chunfang; Santos Muñoz, Daniella; Albert, Victor A; Sankoff, David


    Following whole genome duplication (WGD), there is a compact distribution of gene similarities within the genome reflecting duplicate pairs of all the genes in the genome. With time, the distribution broadens and loses volume due to variable decay of duplicate gene similarity and to the process of duplicate gene loss. If there are two WGD, the older one becomes so reduced and broad that it merges with the tail of the distributions resulting from more recent events, and it becomes difficult to distinguish them. The goal of this paper is to advance statistical methods of identifying, or at least counting, the WGD events in the lineage of a given genome. For a set of 15 angiosperm genomes, we analyze all 15 × 14 = 210 ordered pairs of target genome versus reference genome, using SynMap to find syntenic blocks. We consider all sets of B ≥ 2 syntenic blocks in the target genome that overlap in the reference genome as evidence of WGD activity in the target, whether it be one event or several. We hypothesize that in fitting an exponential function to the tail of the empirical distribution f (B) of block multiplicities, the size of the exponent will reflect the amount of WGD in the history of the target genome. By amalgamating the results from all reference genomes, a range of values of SynMap parameters, and alternative cutoff points for the tail, we find a clear pattern whereby multiple-WGD core eudicots have the smallest (negative) exponents, followed by core eudicots with only the single "γ" triplication in their history, followed by a non-core eudicot with a single WGD, followed by the monocots, with a basal angiosperm, the WGD-free Amborella having the largest exponent. The hypothesis that the exponent of the fit to the tail of the multiplicity distribution is a signature of the amount of WGD is verified, but there is also a clear complicating factor in the monocot clade, where a history of multiple WGD is not reflected in a small exponent.

  17. Systematic review of serum steroid reference intervals developed using mass spectrometry. (United States)

    Tavita, Nevada; Greaves, Ronda F


    The aim of this study was to perform a systematic review of the published literature to determine the available serum/plasma steroid reference intervals generated by mass spectrometry (MS) methods across all age groups in healthy subjects and to suggest recommendations to achieve common MS based reference intervals for serum steroids. MEDLINE, EMBASE and PubMed databases were used to conduct a comprehensive search for English language, MS-based reference interval studies for serum/plasma steroids. Selection of steroids to include was based on those listed in the Royal College of Pathologists of Australasia Quality Assurance Programs, Chemical Pathology, Endocrine Program. This methodology has been registered onto the PROSPERO International prospective register of systematic reviews (ID number: CRD42015029637). After accounting for duplicates, a total of 60 manuscripts were identified through the search strategy. Following critical evaluation, a total of 16 studies were selected. Of the 16 studies, 12 reported reference intervals for testosterone, 11 for 17 hydroxy-progesterone, nine for androstenedione, six for cortisol, three for progesterone, two for dihydrotestosterone and only one for aldosterone and dehydroepiandrosterone sulphate. No studies established MS-based reference intervals for oestradiol. As far as we are aware, this report provides the first comparison of the peer reviewed literature for serum/plasma steroid reference intervals generated by MS-based methods. The reference intervals based on these published studies can be used to inform the process to develop common reference intervals, and agreed reporting units for mass spectrometry based steroid methods. Copyright © 2017 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  18. Children with 7q11.23 Duplication Syndrome: Psychological Characteristics (United States)

    Mervis, Carolyn B.; Klein-Tasman, Bonita P.; Huffman, Myra J.; Velleman, Shelley L.; Pitts, C. Holley; Henderson, Danielle R.; Woodruff-Borden, Janet; Morris, Colleen A.; Osborne, Lucy R.


    To begin to delineate the psychological characteristics associated with classic 7q11.23 duplication syndrome (duplication of the classic Williams syndrome region; hereafter classic Dup7), we tested 63 children with classic Dup7 aged 4–17 years. Sixteen toddlers aged 18–45 months with classic Dup7 and 12 adults identified by cascade testing also were assessed. For the child group, median General Conceptual Ability (similar to IQ) on the Differential Ability Scales-II was 85.0 (low average), with a range from severe disability to high average ability. Median reading and mathematics achievement standard scores were at the low average to average level, with a range from severe impairment to high average or superior ability. Adaptive behavior was considerably more limited; median Scales of Independent Behavior—Revised Broad Independence standard score was 62.0 (mild impairment), with a range from severe adaptive impairment to average adaptive ability. Anxiety disorders were common, with 50.0% of children diagnosed with Social Phobia, 29.0% with Selective Mutism, 12.9% with Separation Anxiety Disorder, and 53.2% with Specific Phobia. In addition, 35.5% were diagnosed with Attention Deficit/Hyperactivity Disorder and 24.2% with Oppositional Defiant Disorder or Disruptive Behavior Disorder-Not Otherwise Specified. 33.3% of the children screened positive for a possible Autism Spectrum Disorder and 82.3% were diagnosed with Speech Sound Disorder. We compare these findings to previously reported results for children with Williams syndrome and argue that genotype/phenotype studies involving the Williams syndrome region offer important opportunities to understand the contribution of genes in this region to common disorders affecting the general population. PMID:25900101

  19. Pseudohypoparathyroidism type Ib associated with novel duplications in the GNAS locus.

    Directory of Open Access Journals (Sweden)

    Gustavo Perez-Nanclares

    Full Text Available Pseudohypoparathyroidism type 1b (PHP-Ib is characterized by renal resistance to PTH (and, sometimes, a mild resistance to TSH and absence of any features of Albright's hereditary osteodystrophy. Patients with PHP-Ib suffer of defects in the methylation pattern of the complex GNAS locus. PHP-Ib can be either sporadic or inherited in an autosomal dominant pattern. Whereas familial PHP-Ib is well characterized at the molecular level, the genetic cause of sporadic PHP-Ib cases remains elusive, although some molecular mechanisms have been associated with this subtype.The aim of the study was to investigate the molecular and imprinting defects in the GNAS locus in two unrelated patients with PHP-Ib.We have analyzed the GNAS locus by direct sequencing, Methylation-Specific Multiplex Ligation-dependent Probe Amplification, microsatellites, Quantitative Multiplex PCR of Short Fluorescent fragments and array-Comparative Genomic Hybridization studies in order to characterize two unrelated families with clinical features of PHP-Ib.We identified two duplications in the GNAS region in two patients with PHP-Ib: one of them, comprising ∼ 320 kb, occurred 'de novo' in the patient, whereas the other one, of ∼ 179 kb in length, was inherited from the maternal allele. In both cases, no other known genetic cause was observed.In this article, we describe the to-our-knowledge biggest duplications reported so far in the GNAS region. Both are associated to PHP-Ib, one of them occurring 'de novo' and the other one being maternally inherited.

  20. A Quantitative Electrophysiological Biomarker of Duplication 15q11.2-q13.1 Syndrome.

    Directory of Open Access Journals (Sweden)

    Joel Frohlich

    Full Text Available Duplications of 15q11.2-q13.1 (Dup15q syndrome are highly penetrant for autism spectrum disorder (ASD. A distinct electrophysiological (EEG pattern characterized by excessive activity in the beta band has been noted in clinical reports. We asked whether EEG power in the beta band, as well as in other frequency bands, distinguished children with Dup15q syndrome from those with non-syndromic ASD and then examined the clinical correlates of this electrophysiological biomarker in Dup15q syndrome.In the first study, we recorded spontaneous EEG from children with Dup15q syndrome (n = 11, age-and-IQ-matched children with ASD (n = 10 and age-matched typically developing (TD children (n = 9 and computed relative power in 6 frequency bands for 9 regions of interest (ROIs. Group comparisons were made using a repeated measures analysis of variance. In the second study, we recorded spontaneous EEG from a larger cohort of individuals with Dup15q syndrome (n = 27 across two sites and examined age, epilepsy, and duplication type as predictors of beta power using simple linear regressions.In the first study, spontaneous beta1 (12-20 Hz and beta2 (20-30 Hz power were significantly higher in Dup15q syndrome compared with both comparison groups, while delta (1-4 Hz was significantly lower than both comparison groups. Effect sizes in all three frequency bands were large (|d| > 1. In the second study, we found that beta2 power was significantly related to epilepsy diagnosis in Dup15q syndrome.Here, we have identified an electrophysiological biomarker of Dup15q syndrome that may facilitate clinical stratification, treatment monitoring, and measurement of target engagement for future clinical trials. Future work will investigate the genetic and neural underpinnings of this electrophysiological signature as well as the functional consequences of excessive beta oscillations in Dup15q syndrome.

  1. Children with 7q11.23 duplication syndrome: psychological characteristics. (United States)

    Mervis, Carolyn B; Klein-Tasman, Bonita P; Huffman, Myra J; Velleman, Shelley L; Pitts, C Holley; Henderson, Danielle R; Woodruff-Borden, Janet; Morris, Colleen A; Osborne, Lucy R


    To begin to delineate the psychological characteristics associated with classic 7q11.23 duplication syndrome (duplication of the classic Williams syndrome region; hereafter classic Dup7), we tested 63 children with classic Dup7 aged 4-17 years. Sixteen toddlers aged 18-45 months with classic Dup7 and 12 adults identified by cascade testing also were assessed. For the child group, median General Conceptual Ability (similar to IQ) on the Differential Ability Scales-II was 85.0 (low average), with a range from severe disability to high average ability. Median reading and mathematics achievement standard scores were at the low average to average level, with a range from severe impairment to high average or superior ability. Adaptive behavior was considerably more limited; median Scales of Independent Behavior-Revised Broad Independence standard score was 62.0 (mild impairment), with a range from severe adaptive impairment to average adaptive ability. Anxiety disorders were common, with 50.0% of children diagnosed with Social Phobia, 29.0% with Selective Mutism, 12.9% with Separation Anxiety Disorder, and 53.2% with Specific Phobia. In addition, 35.5% were diagnosed with Attention Deficit/Hyperactivity Disorder and 24.2% with Oppositional Defiant Disorder or Disruptive Behavior Disorder-Not Otherwise Specified. 33.3% of the children screened positive for a possible Autism Spectrum Disorder and 82.3% were diagnosed with Speech Sound Disorder. We compare these findings to previously reported results for children with Williams syndrome and argue that genotype/phenotype studies involving the Williams syndrome region offer important opportunities to understand the contribution of genes in this region to common disorders affecting the general population. © 2015 Wiley Periodicals, Inc.

  2. AluY-mediated germline deletion, duplication and somatic stem cell reversion in UBE2T defines a new subtype of Fanconi anemia. (United States)

    Virts, Elizabeth L; Jankowska, Anna; Mackay, Craig; Glaas, Marcel F; Wiek, Constanze; Kelich, Stephanie L; Lottmann, Nadine; Kennedy, Felicia M; Marchal, Christophe; Lehnert, Erik; Scharf, Rüdiger E; Dufour, Carlo; Lanciotti, Marina; Farruggia, Piero; Santoro, Alessandra; Savasan, Süreyya; Scheckenbach, Kathrin; Schipper, Jörg; Wagenmann, Martin; Lewis, Todd; Leffak, Michael; Farlow, Janice L; Foroud, Tatiana M; Honisch, Ellen; Niederacher, Dieter; Chakraborty, Sujata C; Vance, Gail H; Pruss, Dmitry; Timms, Kirsten M; Lanchbury, Jerry S; Alpi, Arno F; Hanenberg, Helmut


    Fanconi anemia (FA) is a rare inherited disorder clinically characterized by congenital malformations, progressive bone marrow failure and cancer susceptibility. At the cellular level, FA is associated with hypersensitivity to DNA-crosslinking genotoxins. Eight of 17 known FA genes assemble the FA E3 ligase complex, which catalyzes monoubiquitination of FANCD2 and is essential for replicative DNA crosslink repair. Here, we identify the first FA patient with biallelic germline mutations in the ubiquitin E2 conjugase UBE2T. Both mutations were aluY-mediated: a paternal deletion and maternal duplication of exons 2-6. These loss-of-function mutations in UBE2T induced a cellular phenotype similar to biallelic defects in early FA genes with the absence of FANCD2 monoubiquitination. The maternal duplication produced a mutant mRNA that could encode a functional protein but was degraded by nonsense-mediated mRNA decay. In the patient's hematopoietic stem cells, the maternal allele with the duplication of exons 2-6 spontaneously reverted to a wild-type allele by monoallelic recombination at the duplicated aluY repeat, thereby preventing bone marrow failure. Analysis of germline DNA of 814 normal individuals and 850 breast cancer patients for deletion or duplication of UBE2T exons 2-6 identified the deletion in only two controls, suggesting aluY-mediated recombinations within the UBE2T locus are rare and not associated with an increased breast cancer risk. Finally, a loss-of-function germline mutation in UBE2T was detected in a high-risk breast cancer patient with wild-type BRCA1/2. Cumulatively, we identified UBE2T as a bona fide FA gene (FANCT) that also may be a rare cancer susceptibility gene. © The Author 2015. Published by Oxford University Press.

  3. Antenatal diagnosis of complete facial duplication--a case report of a rare craniofacial defect. (United States)

    Rai, V S; Gaffney, G; Manning, N; Pirrone, P G; Chamberlain, P F


    We report a case of the prenatal sonographic detection of facial duplication, the diprosopus abnormality, in a twin pregnancy. The characteristic sonographic features of the condition include duplication of eyes, mouth, nose and both mid- and anterior intracranial structures. A heart-shaped abnormality of the cranial vault should prompt more detailed examination for other supportive features of this rare condition.

  4. Gene duplication, tissue-specific gene expression and sexual conflict in stalk-eyed flies (Diopsidae). (United States)

    Baker, Richard H; Narechania, Apurva; Johns, Philip M; Wilkinson, Gerald S


    Gene duplication provides an essential source of novel genetic material to facilitate rapid morphological evolution. Traits involved in reproduction and sexual dimorphism represent some of the fastest evolving traits in nature, and gene duplication is intricately involved in the origin and evolution of these traits. Here, we review genomic research on stalk-eyed flies (Diopsidae) that has been used to examine the extent of gene duplication and its role in the genetic architecture of sexual dimorphism. Stalk-eyed flies are remarkable because of the elongation of the head into long stalks, with the eyes and antenna laterally displaced at the ends of these stalks. Many species are strongly sexually dimorphic for eyespan, and these flies have become a model system for studying sexual selection. Using both expressed sequence tag and next-generation sequencing, we have established an extensive database of gene expression in the developing eye-antennal imaginal disc, the adult head and testes. Duplicated genes exhibit narrower expression patterns than non-duplicated genes, and the testes, in particular, provide an abundant source of gene duplication. Within somatic tissue, duplicated genes are more likely to be differentially expressed between the sexes, suggesting gene duplication may provide a mechanism for resolving sexual conflict.

  5. Megalourethra with Y-Type Duplication of Urethra Presented as Perianal Fistula: A Rare Case Report

    Directory of Open Access Journals (Sweden)

    Shashi Verma


    Full Text Available Megalourethra with Y-type duplication is an extremely rare anomaly. We report here one such case, diagnosed with retrograde urethrogram, which was done from both penile meatus and perianal opening simultaneously. Patient was successfully treated by laser optical internal urethrotomy (OIU, excision of duplicated urethra, and reduction urethroplasty in a single stage.

  6. Incidentally found rectal duplication during surgery for rectovestibular fistula and its management. (United States)

    Balaji, Dhiraj K; Basavaraju, Mamatha


    Association of rectal duplication with rectovestibular fistula is rare. A 3-month-old patient underwent primary posterior sagittal anorectoplasty (PSARP) for rectovestibular fistula. During surgery the patient was found to have a rectal duplication (RD). We managed the case by excising the common wall and fenestrating the two lumens together and completed the PSARP.

  7. A rare association of rectal and genitourinary duplication and anorectal malformation

    Institute of Scientific and Technical Information of China (English)

    王俊; 施诚仁; 余世耀; 吴燕; 徐长辉


    @@ It is very rare to see multiple malformations occurring in both the urogenital and digestive systems in a case of congenital anorectal malformation. In this particular care, an imperforated anus occurred with other multiple malformations, including a double kidney, urethral duplication and rectal duplication, etc.

  8. Incidentally found rectal duplication during surgery for rectovestibular fistula and its management

    Directory of Open Access Journals (Sweden)

    Dhiraj K Balaji


    Full Text Available Association of rectal duplication with rectovestibular fistula is rare. A 3-month-old patient underwent primary posterior sagittal anorectoplasty (PSARP for rectovestibular fistula. During surgery the patient was found to have a rectal duplication (RD. We managed the case by excising the common wall and fenestrating the two lumens together and completed the PSARP.

  9. Tail-like Congenital Duplication of Lower Extremity (Extra Leg or ...

    African Journals Online (AJOL)


    Jan 1, 2018 ... ABSTRACT. BACKGROUND: Congenital duplication of lower extremity, either complete or incomplete is extremely rare. Only 26 cases had been reported till 2010, of which only 5 cases had feature of complete duplication. Theories have been proposed that the cause of this abnormality includes maternal ...

  10. Intestinal Duplication Cyst presenting as Volvulus: A rare case report with Review of Literatures

    Directory of Open Access Journals (Sweden)

    Prasan Kumar Hota


    Full Text Available Intestinal duplication cyst is a rare congenital anomaly occurring any where along the alimentary tract, from mouth to anus. They can present with numerous complications like perforation, bleeding or intestinal obstruction. We report a rare case  of intestinal duplication cyst of ileum with acute intestinal obstruction due to volvulus with review of literature.

  11. Duplication and Diversification of the Hypoxia-Inducible IGFBP-1 Gene in Zebrafish

    DEFF Research Database (Denmark)

    Kamei, Hiroyasu; Lu, Ling; Jiao, Shuang


    Background: Gene duplication is the primary force of new gene evolution. Deciphering whether a pair of duplicated genes has evolved divergent functions is often challenging. The zebrafish is uniquely positioned to provide insight into the process of functional gene evolution due to its amenabilit...

  12. 46 CFR Sec. 5 - Responsibility for duplicating copies of NSA-WORKSMALREP Contract. (United States)


    ... 46 Shipping 8 2010-10-01 2010-10-01 false Responsibility for duplicating copies of NSA-WORKSMALREP Contract. Sec. 5 Section 5 Shipping MARITIME ADMINISTRATION, DEPARTMENT OF TRANSPORTATION A-NATIONAL... INDIVIDUAL CONTRACT FOR MINOR REPAIRS-NSA-WORKSMALREP Sec. 5 Responsibility for duplicating copies of NSA...

  13. Microarray Analysis of Copy Number Variants on the Human Y Chromosome Reveals Novel and Frequent Duplications Overrepresented in Specific Haplogroups.

    Directory of Open Access Journals (Sweden)

    Martin M Johansson

    Full Text Available The human Y chromosome is almost always excluded from genome-wide investigations of copy number variants (CNVs due to its highly repetitive structure. This chromosome should not be forgotten, not only for its well-known relevance in male fertility, but also for its involvement in clinical phenotypes such as cancers, heart failure and sex specific effects on brain and behaviour.We analysed Y chromosome data from Affymetrix 6.0 SNP arrays and found that the signal intensities for most of 8179 SNP/CN probes in the male specific region (MSY discriminated between a male, background signals in a female and an isodicentric male containing a large deletion of the q-arm and a duplication of the p-arm of the Y chromosome. Therefore, this SNP/CN platform is suitable for identification of gain and loss of Y chromosome sequences. In a set of 1718 males, we found 25 different CNV patterns, many of which are novel. We confirmed some of these variants by PCR or qPCR. The total frequency of individuals with CNVs was 14.7%, including 9.5% with duplications, 4.5% with deletions and 0.7% exhibiting both. Hence, a novel observation is that the frequency of duplications was more than twice the frequency of deletions. Another striking result was that 10 of the 25 detected variants were significantly overrepresented in one or more haplogroups, demonstrating the importance to control for haplogroups in genome-wide investigations to avoid stratification. NO-M214(xM175 individuals presented the highest percentage (95% of CNVs. If they were not counted, 12.4% of the rest included CNVs, and the difference between duplications (8.9% and deletions (2.8% was even larger.Our results demonstrate that currently available genome-wide SNP platforms can be used to identify duplications and deletions in the human Y chromosome. Future association studies of the full spectrum of Y chromosome variants will demonstrate the potential involvement of gain or loss of Y chromosome sequence in

  14. Rectal duplication in an adult: unusual cause of a buttock mass. Report of a case. (United States)

    Monek, O; Martin, L; Heyd, B; Mantion, G


    Duplications of the rectum are extremely rare embryologic events, with almost 70 cases reported in the world literature. We report on a 39-year-old female patient with a duplication of the rectum. Physical examination showed a left buttock mass; rectal examination revealed the presence of a painless mass compressing the rectum posterolaterally, confirmed by computerized tomography. The patient was operated on with a abdominal then a sacrococcygeal approach. After a complete excision, the postoperative course was unremarkable. Histology revealed a rectal duplication lined with heterotopic cylindric ciliated epithelium. This case shows that the diagnosis of rectal duplication is difficult and can be confused with other types of anorectal pathology. The presence of heterotopic ciliated epithelium has rarely been described. Complete excision of the duplication should be possible in most cases using a transcoccygeal, transanal, or abdominoperineal approach, depending on anatomic considerations.

  15. Large tubular colonic duplication in an adult treated with a small midline incision (United States)

    Yong, Yuen Geng; Jung, Kyung Uk; Cho, Yong Beom; Yun, Seong Hyeon; Kim, Hee Cheol; Lee, Woo Yong


    Tubular colonic duplication presenting in adults is rare and difficult to diagnose preoperatively. Only a few cases have been reported in the literature. We report a case of a 29-year-old lady presenting with a long history of chronic constipation, abdominal mass and repeated episodes of abdominal pain. The abdominal-pelvic computed tomography scan showed segmental bowel wall thickening thought to be small bowel, and dilatation with stasis of intraluminal content. The provisional diagnosis was small bowel duplication. She was scheduled for single port laparoscopic resection. However, a T-shaped tubular colonic duplication at sigmoid colon was found intraoperatively. Resection of the large T-shaped tubular colonic duplication containing multiple impacted large fecaloma and primary anastomosis was performed. There was no perioperative complication. We report, herein, the case of a T-shaped tubular colonic duplication at sigmoid colon in an adult who was successfully treated through mini-laparotomy assisted by single port laparoscopic surgery. PMID:22403754

  16. Duplicated collecting system of a kidney complicated with hydronephrosis - diagnostic methods review: A case report

    International Nuclear Information System (INIS)

    Osmanski, P.; Plucinska, I.; Calka, K.; Kedzierski, B.; Jazwiec, P.


    Duplicated collecting system of a kidney occurs in 1.7-4.2% of the population. It is a complex, unilateral or bilateral, congenital abnormality of the pyelocalyceal system and the ureter. The 2 ureters fuse to form a single ureteral orifice or empty separately into the bladder (ureter duplex). Duplicated collecting systems with complete ureteric duplication may lead to developing vesicoureteral reflux, hydronephrosis, and urinary infection. This article presents a case of a 49-year-old woman with duplicated collecting system and hydronephrosis in the upper pole. The anomaly was diagnosed using urography, ultrasonography and computed tomography examination.The best method for diagnostics of the duplicated pyelocalyceal system complicated by hydronephrosis is computed tomography examination, especially multislice computed tomography. The authors present also the options for therapy (author)

  17. Gene duplication, silencing and expression alteration govern the molecular evolution of PRC2 genes in plants. (United States)

    Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira


    PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.

  18. A role for gene duplication and natural variation of gene expression in the evolution of metabolism.

    Directory of Open Access Journals (Sweden)

    Daniel J Kliebenstein

    Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.

  19. Evolution of stress-regulated gene expression in duplicate genes of Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Cheng Zou


    Full Text Available Due to the selection pressure imposed by highly variable environmental conditions, stress sensing and regulatory response mechanisms in plants are expected to evolve rapidly. One potential source of innovation in plant stress response mechanisms is gene duplication. In this study, we examined the evolution of stress-regulated gene expression among duplicated genes in the model plant Arabidopsis thaliana. Key to this analysis was reconstructing the putative ancestral stress regulation pattern. By comparing the expression patterns of duplicated genes with the patterns of their ancestors, duplicated genes likely lost and gained stress responses at a rapid rate initially, but the rate is close to zero when the synonymous substitution rate (a proxy for time is > approximately 0.8. When considering duplicated gene pairs, we found that partitioning of putative ancestral stress responses occurred more frequently compared to cases of parallel retention and loss. Furthermore, the pattern of stress response partitioning was extremely asymmetric. An analysis of putative cis-acting DNA regulatory elements in the promoters of the duplicated stress-regulated genes indicated that the asymmetric partitioning of ancestral stress responses are likely due, at least in part, to differential loss of DNA regulatory elements; the duplicated genes losing most of their stress responses were those that had lost more of the putative cis-acting elements. Finally, duplicate genes that lost most or all of the ancestral responses are more likely to have gained responses to other stresses. Therefore, the retention of duplicates that inherit few or no functions seems to be coupled to neofunctionalization. Taken together, our findings provide new insight into the patterns of evolutionary changes in gene stress responses after duplication and lay the foundation for testing the adaptive significance of stress regulatory changes under highly variable biotic and abiotic environments.

  20. A 20 bp Duplication in Exon 2 of the Aristaless-Like Homeobox 4 Gene (ALX4 Is the Candidate Causative Mutation for Tibial Hemimelia Syndrome in Galloway Cattle.

    Directory of Open Access Journals (Sweden)

    Bertram Brenig

    Full Text Available Aristaless-like homeobox 4 (ALX4 gene is an important transcription regulator in skull and limb development. In humans and mice ALX4 mutations or loss of function result in a number of skeletal and organ malformations, including polydactyly, tibial hemimelia, omphalocele, biparietal foramina, impaired mammary epithelial morphogenesis, alopecia, coronal craniosynostosis, hypertelorism, depressed nasal bridge and ridge, bifid nasal tip, hypogonadism, and body agenesis. Here we show that a complex skeletal malformation of the hind limb in Galloway cattle together with other developmental anomalies is a recessive autosomal disorder most likely caused by a duplication of 20 bp in exon 2 of the bovine ALX4 gene. A second duplication of 34 bp in exon 4 of the same gene has no known effect, although both duplications result in a frameshift and premature stop codon leading to a truncated protein. Genotyping of 1,688 Black/Red/Belted/Riggit Galloway (GA and 289 White Galloway (WGA cattle showed that the duplication in exon 2 has allele frequencies of 1% in GA and 6% in WGA and the duplication in exon 4 has frequencies of 23% in GA and 38% in WGA. Both duplications were not detected in 876 randomly selected German Holstein Friesian and 86 cattle of 21 other breeds. Hence, we have identified a candidate causative mutation for tibial hemimelia syndrome in Galloway cattle and selection against this mutation can be used to eliminate the mutant allele from the breed.

  1. Identifying Knowledge and Communication

    Directory of Open Access Journals (Sweden)

    Eduardo Coutinho Lourenço de Lima


    Full Text Available In this paper, I discuss how the principle of identifying knowledge which Strawson advances in ‘Singular Terms and Predication’ (1961, and in ‘Identifying Reference and Truth-Values’ (1964 turns out to constrain communication. The principle states that a speaker’s use of a referring expression should invoke identifying knowledge on the part of the hearer, if the hearer is to understand what the speaker is saying, and also that, in so referring, speakers are attentive to hearers’ epistemic states. In contrasting it with Russell’s Principle (Evans 1982, as well as with the principle of identifying descriptions (Donnellan 1970, I try to show that the principle of identifying knowledge, ultimately a condition for understanding, makes sense only in a situation of conversation. This allows me to conclude that the cooperative feature of communication (Grice 1975 and reference (Clark andWilkes-Gibbs 1986 holds also at the understanding level. Finally, I discuss where Strawson’s views seem to be unsatisfactory, and suggest how they might be improved.

  2. Nutritional evaluation of working Malay women in Kuala Lumpur as studied by total food duplicate method. (United States)

    Shimbo, S; Moon, C S; Zhang, Z W; Watanabe, T; Ismail, N H; Ali, R M; Noor, I; Nakatsuka, H; Ikeda, M


    Nutrient intake was surveyed by the total food duplicate method in 49 adult ethnically Malay women (at the ages of 18 to 47 years and mostly at 30-39 years) working in Kuala Lumpur, Malaysia. Simultaneously, hematological examinations, serum biochemistry, anthropometry and clinical examination were conducted. Nutrient intakes were estimated in reference to the weight of each food item and the standard food composition tables. Lunch was the most substantial meal of the day with rice as a staple food. Compared with the Recommended Dietary Allowance (RDA) values, daily intakes of energy (1,917 kcal as an arithmetic mean), protein (62.2 g), vitamin B1 (0.83 mg) and vitamin B2 (1.18 mg) were sufficient, but intakes of minerals [i.e., calcium (347.8 mg) and iron (12.5 mg)] and some vitamins [i.e., vitamin A (equivalent to 627 micrograms retinol) and niacin (7.84 mg)] were less than RDA. When evaluated on an individual basis, the prevalence of those who took less than 80% RDA was highest for iron (92%), followed by niacin (80%), calcium (57%) and vitamin A (57%). The presence of 7 hypohemoglobinemia cases may be related to the insufficient iron intake. Overweight cases (14 women) were also detected, the prevalence of which increased at advanced ages. Lipid intake was rather high (28% of total food on energy basis), for which the major source was plants with limited contribution from fish/shellfish.

  3. Homozygous 16p13.11 duplication associated with mild intellectual disability and urinary tract malformations in two siblings born from consanguineous parents. (United States)

    Houcinat, N; Llanas, B; Moutton, S; Toutain, J; Cailley, D; Arveiler, B; Combe, C; Lacombe, D; Rooryck, C


    The use of array-comparative genomic hybridization (array-CGH) in routine clinical work has allowed the identification of many new copy number variations (CNV). The 16p13.11 duplication has been implicated in various congenital anomalies and neurodevelopmental disorders, but it has also been identified in healthy individuals. We report a clinical observation of two brothers from related parents each carrying a homozygous 16p13.11 duplication. The propositus had mild intellectual disability and posterior urethral valves with chronic renal disease. His brother was considered a healthy child with only learning disabilities and poor academic performances. However, a routine medical examination at 25-years-old revealed a mild chronic renal disease and ureteropelvic junction obstruction. Furthermore, the father presented with a unilateral renal agenesis, thus it seemed that a "congenital anomalies of kidney and urinary tract" (CAKUT) phenotype segregated in this family. This may be related to the duplication, but we cannot exclude the involvement of additional genetic or non-genetic factors in the urological phenotype. Several cohort studies showed association between this chromosomal imbalance and different clinical manifestations, but rarely with CAKUT. The duplication reported here was similar to the larger one of 3.4 Mb previously described versus the more common of 1.6 Mb. It encompassed at least 11 known genes, including the five ohnologs previously identified. Our observation, in addition to expanding the clinical spectrum of the duplication provides further support to understanding the underlying pathogenic mechanism. © 2015 Wiley Periodicals, Inc.

  4. The Orthology Clause in the Next Generation Sequencing Era: Novel Reference Genes Identified by RNA-seq in Humans Improve Normalization of Neonatal Equine Ovary RT-qPCR Data.

    Directory of Open Access Journals (Sweden)

    Dragos Scarlet

    Full Text Available Vertebrate evolution is accompanied by a substantial conservation of transcriptional programs with more than a third of unique orthologous genes showing constrained levels of expression. Moreover, there are genes and exons exhibiting excellent expression stability according to RNA-seq data across a panel of eighteen tissues including the ovary (Human Body Map 2.0.We hypothesized that orthologs of these exons would also be highly uniformly expressed across neonatal ovaries of the horse, which would render them appropriate reference genes (RGs for normalization of reverse transcription quantitative PCR (RT-qPCR data in this context. The expression stability of eleven novel RGs (C1orf43, CHMP2A, EMC7, GPI, PSMB2, PSMB4, RAB7A, REEP5, SNRPD3, VCP and VPS29 was assessed by RT-qPCR in ovaries of seven neonatal fillies and compared to that of the expressed repetitive element ERE-B, two universal (OAZ1 and RPS29 and four traditional RGs (ACTB, GAPDH, UBB and B2M. Expression stability analyzed with the software tool RefFinder top ranked the normalization factor constituted of the genes SNRPD3 and VCP, a gene pair that is not co-expressed according to COEXPRESdb and GeneMANIA. The traditional RGs GAPDH, B2M, ACTB and UBB were only ranked 3rd and 12th to 14th, respectively.The functional diversity of the novel RGs likely facilitates expression studies over a wide range of physiological and pathological contexts related to the neonatal equine ovary. In addition, this study augments the potential for RT-qPCR-based profiling of human samples by introducing seven new human RG assays (C1orf43, CHMP2A, EMC7, GPI, RAB7A, VPS29 and UBB.

  5. The Prevalence of Inappropriate Image Duplication in Biomedical Research Publications (United States)

    Casadevall, Arturo; Fang, Ferric C.


    ABSTRACT Inaccurate data in scientific papers can result from honest error or intentional falsification. This study attempted to determine the percentage of published papers that contain inappropriate image duplication, a specific type of inaccurate data. The images from a total of 20,621 papers published in 40 scientific journals from 1995 to 2014 were visually screened. Overall, 3.8% of published papers contained problematic figures, with at least half exhibiting features suggestive of deliberate manipulation. The prevalence of papers with problematic images has risen markedly during the past decade. Additional papers written by authors of papers with problematic images had an increased likelihood of containing problematic images as well. As this analysis focused only on one type of data, it is likely that the actual prevalence of inaccurate data in the published literature is higher. The marked variation in the frequency of problematic images among journals suggests that journal practices, such as prepublication image screening, influence the quality of the scientific literature. PMID:27273827

  6. Conjoined twin piglets with duplicated cranial and caudal axes. (United States)

    McManus, C A; Partlow, G D; Fisher, K R


    Twins with doubling of the cranial and caudal poles, yet having a single thorax, are rare. One set of diprosopus, dipygus porcine conjoined twins was studied. In addition to the conjoining anomaly, these twins also exhibited ambiguous internal reproductive features. The twins had two snouts, three eyes, a single thorax, and were duplicated from the umbilicus caudally. Radiography indicated a single vertebral column in the cervical region. The vertebral columns were separate caudally from this point. There was a total of six limbs--one pair of forelimbs and two pairs of hindlimbs. Many medial structures failed to develop in these twins. Medial cranial nerves V-XII were absent or displaced although apparently normal laterally. The medial palates were present but shortened, whereas the medial mandibular rami had folded back on themselves rostrally to form a midline mass between the two chins. Each twin had only one lateral kidney and one lateral testis. Medial scrotal sacs were present but devoid of a testis. There was a midline, "uterine"-like structure which crossed between the twins. However, histological analysis of this structure revealed it to be dysplastic testicular tissue. The relationship between the abnormal reproductive features in these twins and the conjoining is unclear. The anatomy of these twins, in addition to the literature reviewed, illustrates the internal anatomical heterogeneity of grossly similar conjoined twins. A review of the literature also suggests that conjoined twinning may be more common in swine than was previously suspected.

  7. Duplicate Address Detection Table in IPv6 Mobile Networks (United States)

    Alisherov, Farkhod; Kim, Taihoon

    In IP networks, each computer or communication equipment needs an IP address. To supply enough IP addresses, the new Internet protocol IPv6 is used in next generatoion mobile communication. Although IPv6 improves the existing IPv4 Internet protocol, Duplicate Address Detection (DAD) mechanism may consume resources and suffer from long delay. DAD is used to ensure whether the IP address is unique or not. When a mobile node performs an inter-domain handoff, it will first generate a new IP and perform a DAD procedure. The DAD procedure not only wastes time but also increases the signaling load on Internet. In this paper, the author proposes a new DAD mechanism to speed up the DAD procedure. A DAD table is created in access or mobility routers in IP networks and record all IP addresses of the area. When a new IP address needs to perform DAD, it can just search in the DAD table to confirm the uniqueness of the address.

  8. Differential retention of metabolic genes following whole-genome duplication. (United States)

    Gout, Jean-François; Duret, Laurent; Kahn, Daniel


    Classical studies in Metabolic Control Theory have shown that metabolic fluxes usually exhibit little sensitivity to changes in individual enzyme activity, yet remain sensitive to global changes of all enzymes in a pathway. Therefore, little selective pressure is expected on the dosage or expression of individual metabolic genes, yet entire pathways should still be constrained. However, a direct estimate of this selective pressure had not been evaluated. Whole-genome duplications (WGDs) offer a good opportunity to address this question by analyzing the fates of metabolic genes during the massive gene losses that follow. Here, we take advantage of the successive rounds of WGD that occurred in the Paramecium lineage. We show that metabolic genes exhibit different gene retention patterns than nonmetabolic genes. Contrary to what was expected for individual genes, metabolic genes appeared more retained than other genes after the recent WGD, which was best explained by selection for gene expression operating on entire pathways. Metabolic genes also tend to be less retained when present at high copy number before WGD, contrary to other genes that show a positive correlation between gene retention and preduplication copy number. This is rationalized on the basis of the classical concave relationship relating metabolic fluxes with enzyme expression.

  9. A Rare de novo Interstitial Duplication at 4p15.2 in a Boy with Severe Congenital Heart Defects, Limb Anomalies, Hypogonadism, and Global Developmental Delay. (United States)

    Liang, Liyang; Xie, Yingjun; Shen, Yiping; Yin, Qibin; Yuan, Haiming


    Proximal 4p deletion syndrome is a relatively rare genetic condition characterized by dysmorphic facial features, limb anomalies, minor congenital heart defects, hypogonadism, cafe-au-lait spots, developmental delay, tall and thin habitus, and intellectual disability. At present, over 20 cases of this syndrome have been published. However, duplication of the same region in proximal 4p has never been reported. Here, we describe a 2-year-5-month-old boy with severe congenital heart defects, limb anomalies, hypogonadism, distinctive facial features, pre- and postnatal developmental delay, and mild cognitive impairments. A de novo 4.5-Mb interstitial duplication at 4p15.2p15.1 was detected by chromosomal microarray analysis. Next-generation sequencing was employed and confirmed the duplication, but revealed no additional pathogenic variants. Several candidate genes in this interval responsible for the complex clinical phenotype were identified, such as RBPJ, STIM2, CCKAR, and LGI2. The results suggest a novel contiguous gene duplication syndrome. © 2016 S. Karger AG, Basel.

  10. Predictability in Pathological Gambling? Applying the Duplication of Purchase Law to the Understanding of Cross-Purchases Between Regular and Pathological Gamblers. (United States)

    Lam, Desmond; Mizerski, Richard


    The objective of this study is to explore the gambling participations and game purchase duplication of light regular, heavy regular and pathological gamblers by applying the Duplication of Purchase Law. Current study uses data collected by the Australian Productivity Commission for eight different types of games. Key behavioral statistics on light regular, heavy regular, and pathological gamblers were computed and compared. The key finding is that pathological gambling, just like regular gambling, follows the Duplication of Purchase Law, which states that the dominant factor of purchase duplication between two brands is their market shares. This means that gambling between any two games at pathological level, like any regular consumer purchases, exhibits "law-like" regularity based on the pathological gamblers' participation rate of each game. Additionally, pathological gamblers tend to gamble more frequently across all games except lotteries and instant as well as make greater cross-purchases compared to heavy regular gamblers. A better understanding of the behavioral traits between regular (particularly heavy regular) and pathological gamblers can be useful to public policy makers and social marketers in order to more accurately identify such gamblers and better manage the negative impacts of gambling.

  11. Study of duplication 24bp of ARX gene among patients presenting a Mental Retardation with a syndromic and non syndromic forms

    International Nuclear Information System (INIS)

    Essouissi, Imen


    Mental Retardation (MR) is the most frequent handicap. It touches 3% of the general population. The genetic causes of this handicap account for 40% of these cases. ARX gene (Aristaless related homeobox gene) belongs to the family of the genes homeobox located in Xp22.1. It is considered as the most frequently muted gene after the FMR1 gene. It is implicated in various forms of syndromic and nonsyndromic MR. Several types of mutation were identified on the level of this gene, including deletions/insertions, duplications, missense and nonsense mutations, responsible for a wide spectrum of phenotypes. The goal of this work is to seek the most frequent change of gene ARX: duplication 24pb (at the origin of an expansion of the field poly has protein ARX in the position 144-155AA) among Tunisian boys presenting in particular family forms of non specific MR, sporadic forms of non specific MR like certain patients presenting a West syndrome.To prove the duplication of 24 Pb, we used in this work the Pcr technique. The change of duplication 24pb was not found in our series, this could be explained by the low number of cases family studied (38 families) and by the absence of connection studies accusing a mode of transmission related to X chromosome in particular for the sporadic cases. (Author)

  12. Molecular archaeology of Flaviviridae untranslated regions: duplicated RNA structures in the replication enhancer of flaviviruses and pestiviruses emerged via convergent evolution.

    Directory of Open Access Journals (Sweden)

    Dmitri J Gritsun

    Full Text Available RNA secondary structures in the 3'untranslated regions (3'UTR of the viruses of the family Flaviviridae, previously identified as essential (promoters or beneficial (enhancers for replication, have been analysed. Duplicated enhancer elements are revealed as a global feature in the evolution of the 3'UTR of distantly related viruses within the genera Flavivirus and Pestivirus. For the flaviviruses, duplicated structures occur in the 3'UTR of all four distantly related ecological virus subgroups (tick-borne, mosquito-borne, no known vector and insect-specific flaviviruses (ISFV. RNA structural differences distinguish tick-borne flaviviruses with discrete pathogenetic characteristics. For Aedes- and Culex-associated ISFV, secondary RNA structures with different conformations display numerous short ssRNA direct repeats, exposed as loops and bulges. Long quadruplicate regions comprise almost the entire 3'UTR of Culex-associated ISFV. Extended duplicated sequence and associated RNA structures were also discovered in the 3'UTR of pestiviruses. In both the Flavivirus and Pestivirus genera, duplicated RNA structures were localized to the enhancer regions of the 3'UTR suggesting an adaptive role predominantly in wild-type viruses. We propose sequence reiteration might act as a scaffold for dimerization of proteins involved in assembly of viral replicase complexes. Numerous nucleotide repeats exposed as loops/bulges might also interfere with host immune responses acting as a molecular sponge to sequester key host proteins or microRNAs.

  13. Molecular Archaeology of Flaviviridae Untranslated Regions: Duplicated RNA Structures in the Replication Enhancer of Flaviviruses and Pestiviruses Emerged via Convergent Evolution (United States)

    Gritsun, Dmitri J.; Jones, Ian M.; Gould, Ernest A.; Gritsun, Tamara S.


    RNA secondary structures in the 3′untranslated regions (3′UTR) of the viruses of the family Flaviviridae, previously identified as essential (promoters) or beneficial (enhancers) for replication, have been analysed. Duplicated enhancer elements are revealed as a global feature in the evolution of the 3′UTR of distantly related viruses within the genera Flavivirus and Pestivirus. For the flaviviruses, duplicated structures occur in the 3′UTR of all four distantly related ecological virus subgroups (tick-borne, mosquito-borne, no known vector and insect-specific flaviviruses (ISFV). RNA structural differences distinguish tick-borne flaviviruses with discrete pathogenetic characteristics. For Aedes- and Culex-associated ISFV, secondary RNA structures with different conformations display numerous short ssRNA direct repeats, exposed as loops and bulges. Long quadruplicate regions comprise almost the entire 3′UTR of Culex-associated ISFV. Extended duplicated sequence and associated RNA structures were also discovered in the 3′UTR of pestiviruses. In both the Flavivirus and Pestivirus genera, duplicated RNA structures were localized to the enhancer regions of the 3′UTR suggesting an adaptive role predominantly in wild-type viruses. We propose sequence reiteration might act as a scaffold for dimerization of proteins involved in assembly of viral replicase complexes. Numerous nucleotide repeats exposed as loops/bulges might also interfere with host immune responses acting as a molecular sponge to sequester key host proteins or microRNAs. PMID:24647143

  14. Screening for duplications, deletions and a common intronic mutation detects 35% of second mutations in patients with USH2A monoallelic mutations on Sanger sequencing. (United States)

    Steele-Stallard, Heather B; Le Quesne Stabej, Polona; Lenassi, Eva; Luxon, Linda M; Claustres, Mireille; Roux, Anne-Francoise; Webster, Andrew R; Bitner-Glindzicz, Maria


    Usher Syndrome is the leading cause of inherited deaf-blindness. It is divided into three subtypes, of which the most common is Usher type 2, and the USH2A gene accounts for 75-80% of cases. Despite recent sequencing strategies, in our cohort a significant proportion of individuals with Usher type 2 have just one heterozygous disease-causing mutation in USH2A, or no convincing disease-causing mutations across nine Usher genes. The purpose of this study was to improve the molecular diagnosis in these families by screening USH2A for duplications, heterozygous deletions and a common pathogenic deep intronic variant USH2A: c.7595-2144A>G. Forty-nine Usher type 2 or atypical Usher families who had missing mutations (mono-allelic USH2A or no mutations following Sanger sequencing of nine Usher genes) were screened for duplications/deletions using the USH2A SALSA MLPA reagent kit (MRC-Holland). Identification of USH2A: c.7595-2144A>G was achieved by Sanger sequencing. Mutations were confirmed by a combination of reverse transcription PCR using RNA extracted from nasal epithelial cells or fibroblasts, and by array comparative genomic hybridisation with sequencing across the genomic breakpoints. Eight mutations were identified in 23 Usher type 2 families (35%) with one previously identified heterozygous disease-causing mutation in USH2A. These consisted of five heterozygous deletions, one duplication, and two heterozygous instances of the pathogenic variant USH2A: c.7595-2144A>G. No variants were found in the 15 Usher type 2 families with no previously identified disease-causing mutations. In 11 atypical families, none of whom had any previously identified convincing disease-causing mutations, the mutation USH2A: c.7595-2144A>G was identified in a heterozygous state in one family. All five deletions and the heterozygous duplication we report here are novel. This is the first time that a duplication in USH2A has been reported as a cause of Usher syndrome. We found that 8 of

  15. Determination of the full-genome sequence of hepatitis E virus (HEV) SAAS-FX17 and use as a reference to identify putative HEV genotype 4 virulence determinants. (United States)

    Zhu, Yumin; Yu, Xiaoming; Huang, Fenfen; Yu, Ruisong; Dong, Shijuan; Si, Fusheng; Zhang, Yuanshu; Li, Zhen


    Four major genotypes of hepatitis E virus (HEV), the causative agent of hepatitis E, have so far been recognized. While genotypes 3 and 4 are both zoonotic, the disease symptoms caused by the latter tend to be more severe. To examine if specific nucleotide/amino acid variations between genotypes 3 and 4 play a role in determining the severity of hepatitis E disease, the complete genome of one swine HEV genotype 4 isolate, SAAS-FX17, was determined and compared with other genotype 4 and genotype 3 genomes to identify putative HEV genotype 4 virulence determinants. A total of 42 conformable nt/aa variations between genotype 3 and 4 HEVs were detected, of which 19 were proposed to be potential disease severity determinants for genotype 4 strains. One potential determinant was located in each of the 5'-UTR and 3'-UTR, 3 and 12 within ORF1 and ORF2 respectively, and 2 in the junction region.

  16. Pattern of Duplicate Presentations at National Hematology-Oncology Meetings: Influence of the Pharmaceutical Industry. (United States)

    Ramchandren, Radhakrishnan; Schiffer, Charles A


    The major large US hematology-oncology meetings sponsored by the American Society of Hematology (ASH) and American Society of Clinical Oncology (ASCO) have specific guidelines in place discouraging submission of scientific information presented previously at other meetings. Nonetheless, duplicate submissions are frequent. The incidence and motivations for duplicate hematologic presentations and the influence of the pharmaceutical industry on this process have not been thoroughly analyzed. Therefore, were viewed four consecutive ASH and ASCO meetings to assess the frequency of duplicate abstract presentations. All abstracts presented at ASCO2010 in the area of malignant hematology were compared with abstracts from ASCO and ASH 2009 and ASH 2010, and funding sources were reviewed. More than half (54%) of all abstracts submitted to ASCO 2010 acknowledged pharmaceutical company support. Almost one third (31%) of ASCO 2010 abstracts were resubmitted in the 2-year time period, and it was notable that a high fraction (75%) of these duplicate abstracts had pharmaceutical industry sponsorship, compared with 42% of the abstracts that were submitted only once. Despite current guidelines prohibiting duplicate abstract presentation, a substantial proportion (31%) of abstracts at large international hematology-oncology meetings are duplicative, with potential negative consequences. In addition, a disproportionate percentage of the duplicate abstracts rely on pharmaceutical industry support (75%), suggesting that marketing strategies may be a motivation for some of these repetitive submissions.

  17. [Partial facial duplication (a rare diprosopus): Case report and review of the literature]. (United States)

    Es-Seddiki, A; Rkain, M; Ayyad, A; Nkhili, H; Amrani, R; Benajiba, N


    Diprosopus, or partial facial duplication, is a very rare congenital abnormality. It is a rare form of conjoined twins. Partial facial duplication may be symmetric or not and may involve the nose, the maxilla, the mandible, the palate, the tongue and the mouth. A male newborn springing from inbred parents was admitted at his first day of life for facial deformity. He presented with hypertelorism, 2 eyes, a tendency to nose duplication (flatted large nose, 2 columellae, 2 lateral nostrils separated in the midline by a third deformed hole), two mouths and a duplicated maxilla. Laboratory tests were normal. The cranio-facial CT confirmed the maxillary duplication. This type of cranio-facial duplication is a rare entity with about 35 reported cases in the literature. Our patient was similar to a rare case of living diprosopus reported by Stiehm in 1972. Diprosopus is often associated with abnormalities of the gastrointestinal tract, the central nervous system, the cardiovascular and respiratory systems and with a high incidence of cleft lip and palate. Surgical treatment consists in the resection of the duplicated components. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  18. Horizontal transfer, not duplication, drives the expansion of protein families in prokaryotes.

    Directory of Open Access Journals (Sweden)

    Todd J Treangen


    Full Text Available Gene duplication followed by neo- or sub-functionalization deeply impacts the evolution of protein families and is regarded as the main source of adaptive functional novelty in eukaryotes. While there is ample evidence of adaptive gene duplication in prokaryotes, it is not clear whether duplication outweighs the contribution of horizontal gene transfer in the expansion of protein families. We analyzed closely related prokaryote strains or species with small genomes (Helicobacter, Neisseria, Streptococcus, Sulfolobus, average-sized genomes (Bacillus, Enterobacteriaceae, and large genomes (Pseudomonas, Bradyrhizobiaceae to untangle the effects of duplication and horizontal transfer. After removing the effects of transposable elements and phages, we show that the vast majority of expansions of protein families are due to transfer, even among large genomes. Transferred genes--xenologs--persist longer in prokaryotic lineages possibly due to a higher/longer adaptive role. On the other hand, duplicated genes--paralogs--are expressed more, and, when persistent, they evolve slower. This suggests that gene transfer and gene duplication have very different roles in shaping the evolution of biological systems: transfer allows the acquisition of new functions and duplication leads to higher gene dosage. Accordingly, we show that paralogs share most protein-protein interactions and genetic regulators, whereas xenologs share very few of them. Prokaryotes invented most of life's biochemical diversity. Therefore, the study of the evolution of biology systems should explicitly account for the predominant role of horizontal gene transfer in the diversification of protein families.

  19. Penile duplication and two anal openings; report of a very rare case. (United States)

    Bakheet, Mohamed Abdel Al M; Refaei, Mohammad


    Penile duplication (diphallus) is an extremely rare disorder. It is almost always associated with other malformations like double bladder, exstrophy of the cloacae, imperforate anus, duplication of the rectosigmoid and vertebral deformities. Meanwhile anal canal duplication, the most distal and least common duplication of the digestive tube and is a very rare congenital malformation. A 21 days old Egyptian neonate is reported with complete penile duplication and two scrotums with each one carrying two palpable testes. Both penises have normal shaft with normally located meatus. Clear urine voids from both meati spontaneously. The child had also a fold of redundant skin about 4×5 cm at the anal region in which two separate anal openings are present. In rectal examination we found two normal anuses passing stool spontaneously. Ascending (voiding) cystourethrography revealed two penises with two separate meatuses and one bladder from which the two urethras go out separately. Intravenous pyelogram (IVP) revealed two normal kidneys and ureters. Barium study revealed duplication of rectum and colon, otherwise normal GIT. In our review of the literature, we did not come across any other case of this variety of the penile duplication and congenital presence of two anuses. Unfortunately the patient expired before any surgical correction.

  20. Craniofacial Duplication (Diprosopus) in the Cat — Case Report and Review of the Literature

    International Nuclear Information System (INIS)

    Sekeles, E.; Aharon, D.C.; Fass, U.


    A kitten displaying the features of symmetrical partial duplication of the head (diprosopus) is described. The morphological description of this double monster is compared to three previous similar cases. All four cases were similar in that duplication of the orbits and eyes were not completed and fission of the oral and nasal cavities and their contents were partial. Furthermore, the central nervous systems were duplicated as far caudal as the brain stem. Present case displayed cleft palate in the two faces, a feature that was not described earlier. Though diprosopus is a rare anomaly in cats, it is more common than in the dog, pig and sheep. In cattle, anterior duplications are one of the largest groups of congenital anomalies. Based on generally accepted considerations concerning the mechanism behind the formation of monozyous twins, conjoined twins and anterior duplications, integrated with experimental data on induction of duplications in animals, an hypothesis is proposed for early embryonic fission. It suggests a constant cleaving factor active along the median plane with affinity to midline structures. Its temporal relations with the developing embryo, especially in susceptible species, decide the degree and type of duplication

  1. Multidetector row computed tomography and ultrasound characteristics of caudal vena cava duplication in dogs. (United States)

    Bertolini, Giovanna; Diana, Alessia; Cipone, Mario; Drigo, Michele; Caldin, Marco


    Caudal vena cava duplication has been rarely reported in small animals. The purpose of this retrospective study was to describe characteristics of duplicated caudal vena cava in a large group of dogs. Computed tomography (CT) and ultrasound databases from two hospitals were searched for canine reports having the diagnosis "double caudal vena cava." One observer reviewed CT images for 71 dogs and two observers reviewed ultrasound images for 21 dogs. In all CT cases, the duplication comprised two vessels that were bilaterally symmetrical and approximately the same calibre (similar to Type I complete duplication in humans). In all ultrasound cases, the duplicated caudal vena cava appeared as a distinct vessel running on the left side of the abdominal segment of the descending aorta and extending from the left common iliac vein to the left renal vein. The prevalence of caudal vena cava duplication was 0.46% for canine ultrasound studies and 2.08% for canine CT studies performed at these hospitals. Median body weight for affected dogs was significantly lower than that of unaffected dogs (P dogs, caudal vena cava duplication should be differentiated from other vascular anomalies when planning surgeries and for avoiding misdiagnoses. © 2014 American College of Veterinary Radiology.

  2. The evolutionary duplication and probable demise of an endodermal GATA factor in Caenorhabditis elegans. (United States)

    Fukushige, Tetsunari; Goszczynski, Barbara; Tian, Helen; McGhee, James D


    WGATAR sequences); ELT-4 protein neither enhanced nor inhibited the strong sequence-specific binding of the ELT-2 protein. Whereas ELT-2 protein is a strong transcriptional activator in yeast, ELT-4 protein has no such activity under similar conditions, nor does it influence the transcriptional activity of coexpressed ELT-2 protein. Although an elt-2 homolog was easily identified in the genomic sequence of the related nematode C. briggsae, no elt-4 homolog could be identified. Analysis of the changes in silent third codon positions within the DNA-binding domains indicates that elt-4 arose as a duplication of elt-2, some 25-55 MYA. Thus, elt-4 has survived far longer than the average duplicated gene in C. elegans, even though no obvious biological function could be detected. elt-4 provides an interesting example of a tandemly duplicated gene that may originally have been the same size as elt-2 but has gradually been whittled down to its present size of little more than a zinc finger. Although elt-4 must confer (or must have conferred) some selective advantage to C. elegans, we suggest that its ultimate evolutionary fate will be disappearance from the C. elegans genome.

  3. Antisense-induced exon skipping for duplications in Duchenne muscular dystrophy

    Directory of Open Access Journals (Sweden)

    van Ommen Gert-Jan B


    Full Text Available Abstract Background Antisense-mediated exon skipping is currently one of the most promising therapeutic approaches for Duchenne muscular dystrophy (DMD. Using antisense oligonucleotides (AONs targeting specific exons the DMD reading frame is restored and partially functional dystrophins are produced. Following proof of concept in cultured muscle cells from patients with various deletions and point mutations, we now focus on single and multiple exon duplications. These mutations are in principle ideal targets for this approach since the specific skipping of duplicated exons would generate original, full-length transcripts. Methods Cultured muscle cells from DMD patients carrying duplications were transfected with AONs targeting the duplicated exons, and the dystrophin RNA and protein were analyzed. Results For two brothers with an exon 44 duplication, skipping was, even at suboptimal transfection conditions, so efficient that both exons 44 were skipped, thus generating, once more, an out-of-frame transcript. In such cases, one may resort to multi-exon skipping to restore the reading frame, as is shown here by inducing skipping of exon 43 and both exons 44. By contrast, in cells from a patient with an exon 45 duplication we were able to induce single exon 45 skipping, which allowed restoration of wild type dystrophin. The correction of a larger duplication (involving exons 52 to 62, by combinations of AONs targeting the outer exons, appeared problematic due to inefficient skipping and mistargeting of original instead of duplicated exons. Conclusion The correction of DMD duplications by exon skipping depends on the specific exons targeted. Its options vary from the ideal one, restoring for the first time the true, wild type dystrophin, to requiring more 'classical' skipping strategies, while the correction of multi-exon deletions may need the design of tailored approaches.

  4. Comparative study of human mitochondrial proteome reveals extensive protein subcellular relocalization after gene duplications

    Directory of Open Access Journals (Sweden)

    Huang Yong


    Full Text Available Abstract Background Gene and genome duplication is the principle creative force in evolution. Recently, protein subcellular relocalization, or neolocalization was proposed as one of the mechanisms responsible for the retention of duplicated genes. This hypothesis received support from the analysis of yeast genomes, but has not been tested thoroughly on animal genomes. In order to evaluate the importance of subcellular relocalizations for retention of duplicated genes in animal genomes, we systematically analyzed nuclear encoded mitochondrial proteins in the human genome by reconstructing phylogenies of mitochondrial multigene families. Results The 456 human mitochondrial proteins selected for this study were clustered into 305 gene families including 92 multigene families. Among the multigene families, 59 (64% consisted of both mitochondrial and cytosolic (non-mitochondrial proteins (mt-cy families while the remaining 33 (36% were composed of mitochondrial proteins (mt-mt families. Phylogenetic analyses of mt-cy families revealed three different scenarios of their neolocalization following gene duplication: 1 relocalization from mitochondria to cytosol, 2 from cytosol to mitochondria and 3 multiple subcellular relocalizations. The neolocalizations were most commonly enabled by the gain or loss of N-terminal mitochondrial targeting signals. The majority of detected subcellular relocalization events occurred early in animal evolution, preceding the evolution of tetrapods. Mt-mt protein families showed a somewhat different pattern, where gene duplication occurred more evenly in time. However, for both types of protein families, most duplication events appear to roughly coincide with two rounds of genome duplications early in vertebrate evolution. Finally, we evaluated the effects of inaccurate and incomplete annotation of mitochondrial proteins and found that our conclusion of the importance of subcellular relocalization after gene duplication on

  5. Duplication at Xq28 involving IKBKG is associated with progressive macrocephaly, recurrent infections, ectodermal dysplasia, benign tumors, and neuropathy

    NARCIS (Netherlands)

    Asbeck, E. Van; Ramalingam, A.; Dvorak, C.; Chen, T.J.; Morava, E.


    Duplications on Xq28 are common, although quite variable in size, but usually include the MECP2 gene. Here, we present a patient with a unique, small, 167-kb duplication at Xq28, not including MECP2. The most important gene in the duplicated region was IKBKG, mutations in which can cause a variety

  6. Caudal Duplication Syndrome: the Vital Role of a Multidisciplinary Approach and Staged Correction (United States)

    Samuk, Inbal; Levitt, Marc; Dlugy, Elena; Kravarusic, Dragan; Ben-Meir, David; Rajz, Gustavo; Konen, Osnat; Freud, Enrique


    Caudal duplication syndrome is a rare entity that describes the association between congenital anomalies involving caudal structures and may have a wide spectrum of clinical manifestations. A full-term male presented with combination of anomalies including anorectal malformation, duplication of the colon and lower urinary tract, split of the lower spine, and lipomyelomeningocele with tethering of the cord. We report this exceptional case of caudal duplication syndrome with special emphasis on surgical strategy and approach combining all disciplines involved. The purpose of this report is to present the pathology, assessment, and management strategy of this complex case. PMID:28018799

  7. Giant T-shaped duplication of the transverse colon. A case report. (United States)

    Trotovsek, Blaz; Hribernik, Marija; Gvardijancic, Diana; Jelenc, Franc


    A case of long diverticular colonic duplication producing acute abdominal pain in a 6-year-old girl is presented. Physical examination showed no signs of acute abdomen at the initial presentation. After a pain-free interval, there was a sudden onset of severe abdominal pain and a large tumor in the lower abdomen was observed. A plain x-ray showed an enormously dilated colonic pouch filled with gas. Excision of the T-shaped duplication and small part of the transverse colon was successful. Because of extensive fibrotic changes in the colon near the opening of duplication, a resection margin of at least 2 cm is recommended.

  8. Caudal Duplication Syndrome: the Vital Role of a Multidisciplinary Approach and Staged Correction. (United States)

    Samuk, Inbal; Levitt, Marc; Dlugy, Elena; Kravarusic, Dragan; Ben-Meir, David; Rajz, Gustavo; Konen, Osnat; Freud, Enrique


    Caudal duplication syndrome is a rare entity that describes the association between congenital anomalies involving caudal structures and may have a wide spectrum of clinical manifestations. A full-term male presented with combination of anomalies including anorectal malformation, duplication of the colon and lower urinary tract, split of the lower spine, and lipomyelomeningocele with tethering of the cord. We report this exceptional case of caudal duplication syndrome with special emphasis on surgical strategy and approach combining all disciplines involved. The purpose of this report is to present the pathology, assessment, and management strategy of this complex case.

  9. Duplication of the pituitary gland in a newborn with median cleft face syndrome and nasal teratoma

    Energy Technology Data Exchange (ETDEWEB)

    Hamon-Kerautret, M.; Ares, G.S.; Demondion, X.; Pruvo, J.P. [Service de Neuroradiologie, Hopital Roger Salengro, CHRU Lille (France); Rouland, V. [Service de Neonatologie, Hopital Roger Salengro, CHRU Lille (France); Francke, J.P. [Departement d`Anatomie, Faculte de Medicine, Universite de Lille (France)


    A newborn suffered immediate neonatal respiratory distress because of an obstructive, soft-tissue nasal mass. Clinical examination revealed a cleft palate with a protruding polypoid mass. CT and MRI showed a heterogeneous nasopharyngeal mass and associated intracranial abnormalities - duplication of the hypophysis and hypoplasia of the corpus callosum. Duplication of the hypophysis is a very rare malformation, only 13 cases having been previously described. The suggested pathogenesis is duplication of the prechordal plate and anterior end of the notochord during early embryological development. (orig.) With 2 figs., 3 refs.

  10. Duplication of the pituitary gland in a newborn with median cleft face syndrome and nasal teratoma

    International Nuclear Information System (INIS)

    Hamon-Kerautret, M.; Ares, G.S.; Demondion, X.; Pruvo, J.P.; Rouland, V.; Francke, J.P.


    A newborn suffered immediate neonatal respiratory distress because of an obstructive, soft-tissue nasal mass. Clinical examination revealed a cleft palate with a protruding polypoid mass. CT and MRI showed a heterogeneous nasopharyngeal mass and associated intracranial abnormalities - duplication of the hypophysis and hypoplasia of the corpus callosum. Duplication of the hypophysis is a very rare malformation, only 13 cases having been previously described. The suggested pathogenesis is duplication of the prechordal plate and anterior end of the notochord during early embryological development. (orig.)

  11. A case of asymptomatic ileal duplication cyst associated with acute appendicitis

    Directory of Open Access Journals (Sweden)

    Hülya İpek


    Full Text Available Duplications of the alimentary tract are infrequent anomalies. They are most frequently located in the terminal ileum, and majority of them became symptomatic before the age of 2. Presenting symptoms may include abdominal mass, intestinal obstruction, intussusception, rectal bleeding, and abdominal pain. Preoperative diagnosis is usually difficult, intra-abdominal duplications are usually diagnosed during surgical explorations of above complications. We presented a 12-year-old girl with asymptomatic ileal duplication cyst associated with non-complicated acute appendicitis, whose imaging studies at admission were compatible with complicated perforated appendicitis.

  12. Scintigraphic detection of 'yo-yo' phenomenon in incomplete ureteric duplication

    International Nuclear Information System (INIS)

    Chu, Winnie C.W.; Chan, Kam-wing; Metreweli, Constantine


    'Yo-yo' reflux in an incompletely duplicated renal system was demonstrated on 99m Tc-mercaptoacetyltriglycine (MAG3) renal scintigraphy in a 7-year-old girl presenting with low-grade fever and pyelonephritis. Incomplete duplication and a bifid renal pelvis, which may be seen in up to 4% of the North American population, occasionally causes symptoms because of recurrent urinary tract infection or loin pain. 99m Tc-MAG3 renal scintigraphy can demonstrate 'yo-yo' reflux in patients with incomplete renal duplication and should be considered in cases with unexplained loin pain, even if 99m Tc-dimercaptosuccinic acid (DMSA) renal scintigraphy is normal. (orig.)

  13. Molecular cytogenetic characterization and origin of two de novo duplication 9p cases. (United States)

    Tsezou, A; Kitsiou, S; Galla, A; Petersen, M B; Karadima, G; Syrrou, M; Sahlèn, S; Blennow, E


    We report on two additional cases with duplication of 9p, minor with facial anomalies and developmental delay. Using fluorescence in situ hybridization and single-copy probes, we showed that the first case was a direct duplication, whereas the second case was inverted. The extent of the direct duplication was defined as 9p12 --> p24 by microdissection and microcloning of the aberrant chromosome and subsequent chromosome-specific comparative genomic hybridization. DNA polymorphism analysis with eight microsatellite markers revealed that the origin of the dup(9p) was maternal in the first case, whereas it was paternal in the second. Copyright 2000 Wiley-Liss, Inc.

  14. Anal canal duplication and triplication: a rare entity with different presentations. (United States)

    Palazon, P; Julia, V; Saura, L; de Haro, I; Bejarano, M; Rovira, C; Tarrado, X


    Anal canal duplication (ACD) is the rarest of gastrointestinal duplications. Few cases have been reported. Most cases present as an opening in the midline, posterior to the normal anus. The aim of our revision is to contribute with eight new cases, some of them with unusual presentations: five presented as the typical form, one with a perianal nodule, and two presented as two separate orifices (anal canal triplication). Complete excision was performed in all patients with no complications. ACD is the most distal and the least frequent digestive duplication. Its treatment should be surgical excision, to avoid complications such as abscess, fistulization, or malignization. Anal canal triplication has never been described before.

  15. Can the US shale revolution be duplicated in Europe?

    International Nuclear Information System (INIS)

    Saussay, Aurelien


    Over the past decade, the rapid increase in shale gas and shale oil production in the United States has profoundly changed energy markets in North America, and has led to a significant decrease in American natural gas prices. The possible existence of large shale deposits in Europe, mainly in France, Poland and the United Kingdom, has fostered speculation on whether the 'shale revolution', and its accompanying macro-economic impacts, could be duplicated in Europe. However, a number of uncertainties, notably geological, technological and regulatory, make this possibility unclear. We present a techno-economic model, SHERPA (Shale Exploitation and Recovery Projection and Analysis), to analyze the main determinants of the profitability of shale wells and plays. We calibrate our model using production data from the leading American shale plays. We use SHERPA to estimate three shale gas production scenarios exploring different sets of geological and technical hypotheses for the largest potential holder of shale gas deposits in Europe, France. Even considering that the geology of the potential French shale deposits is favorable to commercial extraction, we find that under assumptions calibrated on U.S. production data, natural gas could be produced at a high breakeven price of $8.6 per MMBtu, and over a 45 year time-frame have a net present value of $19.6 billion - less than 1% of 2012 French GDP. However, the specificities of the European context, notably high deposit depth and stricter environmental regulations, could increase drilling costs and further decrease this low profitability. We find that a 40% premium over American drilling costs would make shale gas extraction uneconomical. Absent extreme well productivity, it appears very difficult for shale gas extraction to have an impact on European energy markets comparable to the American shale revolution. (author)

  16. An LMNB1 Duplication Caused Adult-Onset Autosomal Dominant Leukodystrophy in Chinese Family: Clinical Manifestations, Neuroradiology and Genetic Diagnosis

    Directory of Open Access Journals (Sweden)

    Yi Dai


    Full Text Available Autosomal dominant adult-onset demyelinating leukodystrophy (ADLD is a very rare neurological disorder featured with late onset, slowly progressive central nervous system demyelination. Duplication or over expression of the lamin B1 (LMNB1 gene causes ADLD. In this study, we undertook a comprehensive clinical evaluation and genetic detection for a Chinese family with ADLD. The proband is a 52-year old man manifested with autonomic abnormalities, pyramidal tract dysfunction. MRI brain scan identified bilateral symmetric white matter (WM hyper-intensities in periventricular and semi-oval WM, cerebral peduncles and middle cerebellar peduncles. The proband has a positive autosomal dominant family history with similar clinical manifestations with a trend of genetic anticipation. In order to understand the genetic cause of the disease in this family, target exome capture based next generation sequencing has been done, but no causative variants or possibly pathogenic variants has been identified. However, Multiplex ligand-dependent probe amplification (MLPA showed whole duplication of LMNB1 gene which is co-segregated with the disease phenotype in this family. This is the first genetically confirmed LMNB1 associated ADLD pedigree from China.

  17. The presence of two rare genomic syndromes, 1q21 deletion and Xq28 duplication, segregating independently in a family with intellectual disability. (United States)

    Ha, Kyungsoo; Shen, Yiping; Graves, Tyler; Kim, Cheol-Hee; Kim, Hyung-Goo


    1q21 microdeletion syndrome is a rare contiguous gene deletion disorder with de novo or autosomal dominant inheritance patterns and its phenotypic features include intellectual disability, distinctive facial dysmorphism, microcephaly, cardiac abnormalities, and cataracts. MECP2 duplication syndrome is an X-linked recessive neurodevelopmental disorder characterized by intellectual disability, global developmental delay, and other neurological complications including late-onset seizures. Previously, these two different genetic syndromes have not been reported segregating independently in a same family. Here we describe two siblings carrying either a chromosome 1q21 microdeletion or a chromosome Xq28 duplication. Using a comparative genomic hybridization (CGH) array, we identified a 1.24 Mb heterozygous deletion at 1q21 resulting in the loss of 9 genes in a girl with learning disability, hypothyroidism, short stature, sensory integration disorder, and soft dysmorphic features including cupped ears and a unilateral ear pit. We also characterized a 508 kb Xq28 duplication encompassing MECP2 in her younger brother with hypotonia, poor speech, cognitive and motor impairment. The parental CGH and quantitative PCR (qPCR) analyses revealed that the 1q21 deletion in the elder sister is de novo , but the Xq28 duplication in the younger brother was originally inherited from the maternal grandmother through the mother, both of whom are asymptomatic carriers. RT-qPCR assays revealed that the affected brother has almost double the amount of MECP2 mRNA expression compared to other family members of both genders including maternal grandmother and mother who have the same Xq28 duplication with no phenotype. This suggests the X chromosome with an Xq28 duplication in the carrier females is preferentially silenced. From our understanding, this would be the first report showing the independent segregation of two genetically unrelated syndromes, 1q21 microdeletion and Xq28 duplication

  18. Adaptations to High Salt in a Halophilic Protist: Differential Expression and Gene Acquisitions through Duplications and Gene Transfers (United States)

    Harding, Tommy; Roger, Andrew J.; Simpson, Alastair G. B.


    The capacity of halophiles to thrive in extreme hypersaline habitats derives partly from the tight regulation of ion homeostasis, the salt-dependent adjustment of plasma membrane fluidity, and the increased capability to manage oxidative stress. Halophilic bacteria, and archaea have been intensively studied, and substantial research has been conducted on halophilic fungi, and the green alga Dunaliella. By contrast, there have been very few investigations of halophiles that are phagotrophic protists, i.e., protozoa. To gather fundamental knowledge about salt adaptation in these organisms, we studied the transcriptome-level response of Halocafeteria seosinensis (Stramenopiles) grown under contrasting salinities. We provided further evolutionary context to our analysis by identifying genes that underwent recent duplications. Genes that were highly responsive to salinity variations were involved in stress response (e.g., chaperones), ion homeostasis (e.g., Na+/H+ transporter), metabolism and transport of lipids (e.g., sterol biosynthetic genes), carbohydrate metabolism (e.g., glycosidases), and signal transduction pathways (e.g., transcription factors). A significantly high proportion (43%) of duplicated genes were also differentially expressed, accentuating the importance of gene expansion in adaptation by H. seosinensis to high salt environments. Furthermore, we found two genes that were lateral acquisitions from bacteria, and were also highly up-regulated and highly expressed at high salt, suggesting that this evolutionary mechanism could also have facilitated adaptation to high salt. We propose that a transition toward high-salt adaptation in the ancestors of H. seosinensis required the acquisition of new genes via duplication, and some lateral gene transfers (LGTs), as well as the alteration of transcriptional programs, leading to increased stress resistance, proper establishment of ion gradients, and modification of cell structure properties like membrane

  19. An ancient history of gene duplications, fusions and losses in the evolution of APOBEC3 mutators in mammals (United States)


    Background The APOBEC3 (A3) genes play a key role in innate antiviral defense in mammals by introducing directed mutations in the DNA. The human genome encodes for seven A3 genes, with multiple splice alternatives. Different A3 proteins display different substrate specificity, but the very basic question on how discerning self from non-self still remains unresolved. Further, the expression of A3 activity/ies shapes the way both viral and host genomes evolve. Results We present here a detailed temporal analysis of the origin and expansion of the A3 repertoire in mammals. Our data support an evolutionary scenario where the genome of the mammalian ancestor encoded for at least one ancestral A3 gene, and where the genome of the ancestor of placental mammals (and possibly of the ancestor of all mammals) already encoded for an A3Z1-A3Z2-A3Z3 arrangement. Duplication events of the A3 genes have occurred independently in different lineages: humans, cats and horses. In all of them, gene duplication has resulted in changes in enzyme activity and/or substrate specificity, in a paradigmatic example of convergent adaptive evolution at the genomic level. Finally, our results show that evolutionary rates for the three A3Z1, A3Z2 and A3Z3 motifs have significantly decreased in the last 100 Mya. The analysis constitutes a textbook example of the evolution of a gene locus by duplication and sub/neofunctionalization in the context of virus-host arms race. Conclusions Our results provide a time framework for identifying ancestral and derived genomic arrangements in the APOBEC loci, and to date the expansion of this gene family for different lineages through time, as a response to changes in viral/retroviral/retrotransposon pressure. PMID:22640020

  20. Adaptations to High Salt in a Halophilic Protist: Differential Expression and Gene Acquisitions through Duplications and Gene Transfers

    Directory of Open Access Journals (Sweden)

    Tommy Harding


    Full Text Available The capacity of halophiles to thrive in extreme hypersaline habitats derives partly from the tight regulation of ion homeostasis, the salt-dependent adjustment of plasma membrane fluidity, and the increased capability to manage oxidative stress. Halophilic bacteria, and archaea have been intensively studied, and substantial research has been conducted on halophilic fungi, and the green alga Dunaliella. By contrast, there have been very few investigations of halophiles that are phagotrophic protists, i.e., protozoa. To gather fundamental knowledge about salt adaptation in these organisms, we studied the transcriptome-level response of Halocafeteria seosinensis (Stramenopiles grown under contrasting salinities. We provided further evolutionary context to our analysis by identifying genes that underwent recent duplications. Genes that were highly responsive to salinity variations were involved in stress response (e.g., chaperones, ion homeostasis (e.g., Na+/H+ transporter, metabolism and transport of lipids (e.g., sterol biosynthetic genes, carbohydrate metabolism (e.g., glycosidases, and signal transduction pathways (e.g., transcription factors. A significantly high proportion (43% of duplicated genes were also differentially expressed, accentuating the importance of gene expansion in adaptation by H. seosinensis to high salt environments. Furthermore, we found two genes that were lateral acquisitions from bacteria, and were also highly up-regulated and highly expressed at high salt, suggesting that this evolutionary mechanism could also have facilitated adaptation to high salt. We propose that a transition toward high-salt adaptation in the ancestors of H. seosinensis required the acquisition of new genes via duplication, and some lateral gene transfers (LGTs, as well as the alteration of transcriptional programs, leading to increased stress resistance, proper establishment of ion gradients, and modification of cell structure properties like

  1. A case report of Chinese brothers with inherited MECP2-containing duplication: autism and intellectual disability, but not seizures or respiratory infections


    Xu, Xiu; Xu, Qiong; Zhang, Ying; Zhang, Xiaodi; Cheng, Tianlin; Wu, Bingbing; Ding, Yanhua; Lu, Ping; Zheng, Jingjing; Zhang, Min; Qiu, Zilong; Yu, Xiang


    Abstract Background Autistic spectrum disorders (ASDs) are a family of neurodevelopmental disorders with strong genetic components. Recent studies have shown that copy number variations in dosage sensitive genes can contribute significantly to these disorders. One such gene is the transcription factor MECP2, whose loss of function in females results in Rett syndrome, while its duplication in males results in developmental delay and autism. Case presentation Here, we identified a Chinese famil...

  2. Craniofacial duplication (diprosopus): report of a case with a review of the literature. (United States)

    Amr, S S; Hammouri, M F


    A case of craniofacial duplication (diprosopus) is presented. Details on this rare form of conjoined twins are described, and the proposed theories of its embryogenesis are discussed with brief review of the pertinent literature.

  3. MLL duplication in a pediatric patient with B-cell lymphoblastic lymphoma. (United States)

    Mater, David Van; Goodman, Barbara K; Wang, Endi; Gaca, Ana M; Wechsler, Daniel S


    Lymphoblastic lymphoma is the second most common type of non-Hodgkin lymphoma seen in children. Approximately, 90% of lymphoblastic lymphomas arise from T cells, with the remaining 10% being B-cell-lineage derived. Although T-cell lymphoblastic lymphoma most frequently occurs in the anterior mediastinum (thymus), B-cell lymphoblastic lymphoma (B-LBL) predominates in extranodal sites such as skin and bone. Here, we describe a pediatric B-LBL patient who presented with extensive abdominal involvement and whose lymphoma cells displayed segmental duplication of the mixed lineage leukemia (MLL) gene. MLL duplication/amplification has been described primarily in acute myeloid leukemia and myelodysplastic syndrome with no published reports of discrete MLL duplication/amplification events in B-LBL. The MLL gene duplication noted in this case may represent a novel mechanism for tumorigenesis in B-LBL.

  4. 48 CFR 1852.208-81 - Restrictions on Printing and Duplicating. (United States)


    ..., presswork, duplicating, silk screen processes, binding, microform, and the end items of such processes and... one sheet, size 8-1/2×11 inches (215×280 mm), one side only, and one color ink. (d) This clause does...

  5. Bilateral inferior vena cava filter insertion in a patient with duplication of the infrarenal vena cava.

    LENUS (Irish Health Repository)

    Leong, S


    BACKGROUND: Inferior vena cava (IVC) filter insertion is a commonly performed procedure for indications such as recurrent pulmonary emboli or contraindication to anticoagulation. Symptomatic duplication of the IVC is exceedingly rare with only a handful of cases being described in the literature. AIM: We report an unusual case of a patient with symptomatic duplication of the IVC. RESULT: A 53-year-old woman presented at our hospital for resection of a cerebral metastasis from a non-small cell lung cancer following a recent diagnosis of bilateral lower limb deep venous thrombosis. This required perioperative reversal of anticoagulation and IVC filter insertion. Conventional venography performed during filter insertion documented the existence of a duplicated IVC. CONCLUSION: We present a case of a symptomatic duplication of the IVC requiring filter insertion. We review the developmental anatomy of the IVC along with the diagnostic findings and management strategies available.

  6. Epicardial oesophageal duplication with hiatal hernia in a case of Turner's syndrome

    International Nuclear Information System (INIS)

    Tamburrini, O.; Cigliano, S.; Esposito, G.; Cucchiara, S.


    The authors of this paper report the first case of epicardial oesophageal duplication causing hiatal hernia in a patient afflicted with Turner's syndrome, and they discuss its possible etiology. (orig.)

  7. Neutral and Non-Neutral Evolution of Duplicated Genes with Gene Conversion

    Directory of Open Access Journals (Sweden)

    Jeffrey A. Fawcett


    Full Text Available Gene conversion is one of the major mutational mechanisms involved in the DNA sequence evolution of duplicated genes. It contributes to create unique patters of DNA polymorphism within species and divergence between species. A typical pattern is so-called concerted evolution, in which the divergence between duplicates is maintained low for a long time because of frequent exchanges of DNA fragments. In addition, gene conversion affects the DNA evolution of duplicates in various ways especially when selection operates. Here, we review theoretical models to understand the evolution of duplicates in both neutral and non-neutral cases. We also explain how these theories contribute to interpreting real polymorphism and divergence data by using some intriguing examples.

  8. 9 CFR 201.28 - Duplicates of bonds or equivalents to be filed with Regional Supervisors. (United States)


    ... duplicates of all endorsements, amendments, riders, indemnity agreements, and other attachments thereto, and photographically reproduced copies of any letter of credit or amendment thereto, shall be filed with the Regional...

  9. Circular DNA Intermediate in the Duplication of Nile Tilapia vasa Genes (United States)

    Fujimura, Koji; Conte, Matthew A.; Kocher, Thomas D.


    vasa is a highly conserved RNA helicase involved in animal germ cell development. Among vertebrate species, it is typically present as a single copy per genome. Here we report the isolation and sequencing of BAC clones for Nile tilapia vasa genes. Contrary to a previous report that Nile tilapia have a single copy of the vasa gene, we find evidence for at least three vasa gene loci. The vasa gene locus was duplicated from the original site and integrated into two distant novel sites. For one of these insertions we find evidence that the duplication was mediated by a circular DNA intermediate. This mechanism of gene duplication may explain the origin of isolated gene duplicates during the evolution of fish genomes. These data provide a foundation for studying the role of multiple vasa genes in the development of tilapia gonads, and will contribute to investigations of the molecular mechanisms of sex determination and evolution in cichlid fishes. PMID:22216289

  10. Duplicate Recording of Contracts in the Mechanization of Contract Administration Services System

    National Research Council Canada - National Science Library

    Lane, F


    ... in more than one of the system's data bases. We also evaluated whether the Mechanization of Contract Administration Services system had adequate controls to detect and prevent duplicate contract payments, and whether database errors...

  11. Volvulus U-Shaped transverse colonic duplication: Report of a case and literature review

    Directory of Open Access Journals (Sweden)

    Ruankha Bilommi


    Full Text Available Tubular duplication of the colon is very rare especially in adulthood, because it is frequently symptomatic earlier in newborn life, so only few cases are reported in literature. Several theories are proposed to explain the onset and the evolution of gut malformations as the aberrant lumen recanalization or the diverticular theory, the alteration of the lateral closure of the embryonal disk or finally the dorsal protrusion of the yolk-sac for herniation or adhesion to the ectoderm for an abnormality of the longitudinal line, but none clarifies the exact genesis of duplication [1–3]. U Shaped transverse colonic duplication with volvulus has never been reported before and very rare in condition in gastrointestinal duplication.

  12. Array comparative genomic hybridization analysis of a familial duplication of chromosome 13q: A recognizable syndrome

    NARCIS (Netherlands)

    Mathijssen, Inge B.; Hoovers, Jan M. N.; Mul, Adri N. P. M.; Man, Hai-Yen; Ket, Jan L.; Hennekam, Raoul C. M.


    We report on a family with six persons in three generations who have mild mental retardation, behavioral problems, seizures, hearing loss, strabismus, dental anomalies, hypermobility, juvenile hallux valgus, and mild dysmorphic features. Classical cytogenetic analysis showed a partial duplication of

  13. The fate of the duplicated androgen receptor in fishes: a late neofunctionalization event?

    Directory of Open Access Journals (Sweden)

    Haendler Bernard


    Full Text Available Abstract Background Based on the observation of an increased number of paralogous genes in teleost fishes compared with other vertebrates and on the conserved synteny between duplicated copies, it has been shown that a whole genome duplication (WGD occurred during the evolution of Actinopterygian fish. Comparative phylogenetic dating of this duplication event suggests that it occurred early on, specifically in teleosts. It has been proposed that this event might have facilitated the evolutionary radiation and the phenotypic diversification of the teleost fish, notably by allowing the sub- or neo-functionalization of many duplicated genes. Results In this paper, we studied in a wide range of Actinopterygians the duplication and fate of the androgen receptor (AR, NR3C4, a nuclear receptor known to play a key role in sex-determination in vertebrates. The pattern of AR gene duplication is consistent with an early WGD event: it has been duplicated into two genes AR-A and AR-B after the split of the Acipenseriformes from the lineage leading to teleost fish but before the divergence of Osteoglossiformes. Genomic and syntenic analyses in addition to lack of PCR amplification show that one of the duplicated copies, AR-B, was lost in several basal Clupeocephala such as Cypriniformes (including the model species zebrafish, Siluriformes, Characiformes and Salmoniformes. Interestingly, we also found that, in basal teleost fish (Osteoglossiformes and Anguilliformes, the two copies remain very similar, whereas, specifically in Percomorphs, one of the copies, AR-B, has accumulated substitutions in both the ligand binding domain (LBD and the DNA binding domain (DBD. Conclusion The comparison of the mutations present in these divergent AR-B with those known in human to be implicated in complete, partial or mild androgen insensitivity syndrome suggests that the existence of two distinct AR duplicates may be correlated to specific functional differences that may be

  14. The conversion of centrioles to centrosomes: essential coupling of duplication with segregation


    Wang, Won-Jing; Soni, Rajesh Kumar; Uryu, Kunihiro; Bryan Tsou, Meng-Fu


    Centrioles are self-reproducing organelles that form the core structure of centrosomes or microtubule-organizing centers (MTOCs). However, whether duplication and MTOC organization reflect innate activities of centrioles or activities acquired conditionally is unclear. In this paper, we show that newly formed full-length centrioles had no inherent capacity to duplicate or to organize pericentriolar material (PCM) but acquired both after mitosis through a Plk1-dependent modification that occur...

  15. Extreme fenestration of the basilar artery associated with cleft palate, nasopharyngeal mature teratoma, and hypophyseal duplication

    Energy Technology Data Exchange (ETDEWEB)

    Uchino, A.; Sawada, A.; Takase, Y.; Kudo, S. [Department of Radiology, Saga Medical School, 5-1-1, Nabeshima, Saga 849-8501 (Japan); Fujita, I. [Department of Pediatrics, Saga Medical School, 5-1-1, Nabeshima, Saga 849-8501 (Japan)


    The authors present the case of a newborn girl with extreme fenestration of the basilar artery. This anomaly was found incidentally during MR imaging study for cleft palate and nasopharyngeal teratoma. Magnetic resonance angiography showed a totally duplicated basilar artery with connections at the proximal and distal ends of the artery, suggesting an extreme fenestration. Duplicated pituitary gland was also found on MR imaging. (orig.)

  16. Extreme fenestration of the basilar artery associated with cleft palate, nasopharyngeal mature teratoma, and hypophyseal duplication

    International Nuclear Information System (INIS)

    Uchino, A.; Sawada, A.; Takase, Y.; Kudo, S.; Fujita, I.


    The authors present the case of a newborn girl with extreme fenestration of the basilar artery. This anomaly was found incidentally during MR imaging study for cleft palate and nasopharyngeal teratoma. Magnetic resonance angiography showed a totally duplicated basilar artery with connections at the proximal and distal ends of the artery, suggesting an extreme fenestration. Duplicated pituitary gland was also found on MR imaging. (orig.)

  17. Intestinal duplication and retroperitoneal teratoma in child hoof: a case report

    International Nuclear Information System (INIS)

    Atzingen, Augusto Castelli Von; Bazzano, Felix Carlos Ocariz; Tiburzio, Nicolas Biagione; Grande, Rogerio Mendes; Juntolli Netto, Joao Diniz


    The authors present a case of intestinal duplication and retroperitoneal teratoma in a 7-year-old patient with evident mass and abdominal pain to explain; that it was submitted to study conventional X-ray, ultrasonography, computed tomography and subsequent exploiting laparotomia. The anatomopathological study verified intestinal duplication and ripe teratoma. In the existent medical literature it was not found any similar case. (author)

  18. Duodenal duplication cyst and pancreas divisum causing acute pancreatitis in an adult male


    Redondo-Cerezo, Eduardo; Pleguezuelo-Díaz, Julio; de Hierro, Mercedes López; Macias-Sánchez, José F; Ubiña, Cristina Viñolo; Martín-Rodríguez, María Del Mar; Teresa-Galván, Javier De


    Duodenal duplication cysts are rare congenital abnormalities which are more commonly diagnosed in infancy and childhood. However, in rare cases, these lesions can remain asymptomatic until adulthood. The combination of duplication cyst and pancreas divisum is extremely rare and both conditions have been linked with acute recurrent pancreatitis. We present the case of a 37 years-old patient who presented with repeated episodes of acute pancreatitis. By means of magnetic resonance imaging and e...

  19. Duplication of the cervical esophagus: a case report and review of the literature

    International Nuclear Information System (INIS)

    Wootton-Gorges, Sandra L.; Eckel, Gregory M.; Poulos, Nicholas D.; Kappler, Sherri; Milstein, Jay M.


    This report describes a newborn with a cervical esophageal duplication cyst, a rare developmental anomaly of the neck. Only a few cases of this cystic entity have been described in the literature to date. This case is unique in that the patient had an air-fluid level within the lesion as a result of communication of the duplication cyst with the native esophagus. (orig.)

  20. Perineal mass protrusion with rectal mucosa: a rectal duplication that underwent exstrophy. (United States)

    Sun, Junjie; Vongphet, Soulithone; Zhang, Zhichong; Mo, Jiacong


    We present a rare case of a male neonate with a perineal mass with rectal mucosa, diagnosed as an exstrophic duplication of the rectum. It was accompanied by a cord that was deeply invested in the pelvic diaphragm and was composed of smooth muscle, fibrous tissue, and some rectal glands. The association of exstrophic rectal duplication with a bifid scrotum, hypospadias, and normal anus has not been described previously in the literature. Copyright © 2011 Elsevier Inc. All rights reserved.

  1. Diphallus with Imperforate Anus and Complete Duplication of Recto-Sigmoid Colon and Lower Urinary Tract


    Mirshemirani, Alireza; Roshanzamir, Fatollah; Shayeghi, Shahnaz; Mohajerzadeh, Leily; Hasas-yeganeh, Shaghayegh


    Background:Diphallus is a rare anomaly and accompanying anomalies vary from bifid scrotum, bladder exstrophy, imperforate anus and colo-rectal anomaly such as duplication, and other associated anomalies. Case Presentation:A 2-day old infant is reported with imperforate anus and complete duplication of recto-sigmoid colon, rectal pouch, doubling of the genitalia with completely formed penis (diphallus), double bladder, urethra and hypospadias. No family history of abnormalities was noted. The ...

  2. Completely Isolated Retroperitoneal Enteric Duplication Cyst with Adenocarcinoma Transformation Managed with Robotic Radical Nephrectomy


    Faraj, Kassem; Edwards, Luke; Gupta, Alia; Seifman, Brian


    Abstract Background: Enteric duplication cysts are congenital malformations that typically affect children in infancy, but can also affect adults. Rarely, these cysts can be complicated by malignancy. We present the first case of retroperitoneal duplication cyst that was complicated by malignancy transformation and managed by robot-assisted excision. Case presentation: A 64-year-old female with a history of a left-sided renal cyst presented with a 4-month history of abdominal pain and fatigue...

  3. A Retroperitoneal Isolated Enteric Duplication Cyst Mimicking a Teratoma: A Case Report and Literature Review

    Directory of Open Access Journals (Sweden)

    Daichi Momosaka


    Full Text Available Enteric duplication cysts lacking anatomic association with the gastrointestinal tract are called isolated enteric duplication cysts (IEDCs. We present an atypical case of a retroperitoneal IEDC with a tortuous tubular complex shape that enfolded the surrounding retroperitoneal fat and mimicked a retroperitoneal teratoma. Multiplanar reconstruction images should be used to evaluate such a lesion correctly. A tortuous tubular complex shape could be a key finding to differentiate from other retroperitoneal cysts.

  4. De novo 12q22.q23.3 duplication associated with temporal lobe epilepsy. (United States)

    Stella Vari, Maria; Traverso, Monica; Bellini, Tommaso; Madia, Francesca; Pinto, Francesca; Striano, Pasquale; Minetti, Carlo; Zara, Federico


    The Publisher regrets that this article is an accidental duplication of an article that has already been published in Seizure 50 (2017) 80-82, The duplicate article has therefore been withdrawn. The full Elsevier Policy on Article Withdrawal can be found at Copyright © 2018 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

  5. Partial duplication of the APBA2 gene in chromosome 15q13 corresponds to duplicon structures

    Directory of Open Access Journals (Sweden)

    Kesterson Robert A


    Full Text Available Abstract Background Chromosomal abnormalities affecting human chromosome 15q11-q13 underlie multiple genomic disorders caused by deletion, duplication and triplication of intervals in this region. These events are mediated by highly homologous segments of DNA, or duplicons, that facilitate mispairing and unequal cross-over in meiosis. The gene encoding an amyloid precursor protein-binding protein (APBA2 was previously mapped to the distal portion of the interval commonly deleted in Prader-Willi and Angelman syndromes and duplicated in cases of autism. Results We show that this gene actually maps to a more telomeric location and is partially duplicated within the broader region. Two highly homologous copies of an interval containing a large 5' exon and downstream sequence are located ~5 Mb distal to the intact locus. The duplicated copies, containing the first coding exon of APBA2, can be distinguished by single nucleotide sequence differences and are transcriptionally inactive. Adjacent to APBA2 maps a gene termed KIAA0574. The protein encoded by this gene is weakly homologous to a protein termed X123 that in turn maps adjacent to APBA1 on 9q21.12; APBA1 is highly homologous to APBA2 in the C-terminal region and is distinguished from APBA2 by the N-terminal region encoded by this duplicated exon. Conclusion The duplication of APBA2 sequences in this region adds to a complex picture of different low copy repeats present across this region and elsewhere on the chromosome.

  6. Restriction and Recruitment—Gene Duplication and the Origin and Evolution of Snake Venom Toxins (United States)

    Hargreaves, Adam D.; Swain, Martin T.; Hegarty, Matthew J.; Logan, Darren W.; Mulley, John F.


    Snake venom has been hypothesized to have originated and diversified through a process that involves duplication of genes encoding body proteins with subsequent recruitment of the copy to the venom gland, where natural selection acts to develop or increase toxicity. However, gene duplication is known to be a rare event in vertebrate genomes, and the recruitment of duplicated genes to a novel expression domain (neofunctionalization) is an even rarer process that requires the evolution of novel combinations of transcription factor binding sites in upstream regulatory regions. Therefore, although this hypothesis concerning the evolution of snake venom is very unlikely and should be regarded with caution, it is nonetheless often assumed to be established fact, hindering research into the true origins of snake venom toxins. To critically evaluate this hypothesis, we have generated transcriptomic data for body tissues and salivary and venom glands from five species of venomous and nonvenomous reptiles. Our comparative transcriptomic analysis of these data reveals that snake venom does not evolve through the hypothesized process of duplication and recruitment of genes encoding body proteins. Indeed, our results show that many proposed venom toxins are in fact expressed in a wide variety of body tissues, including the salivary gland of nonvenomous reptiles and that these genes have therefore been restricted to the venom gland following duplication, not recruited. Thus, snake venom evolves through the duplication and subfunctionalization of genes encoding existing salivary proteins. These results highlight the danger of the elegant and intuitive “just-so story” in evolutionary biology. PMID:25079342

  7. "Tandem duplication-random loss" is not a real feature of oyster mitochondrial genomes

    Directory of Open Access Journals (Sweden)

    Zhang Guofan


    Full Text Available Abstract Duplications and rearrangements of coding genes are major themes in the evolution of mitochondrial genomes, bearing important consequences in the function of mitochondria and the fitness of organisms. Yu et al. (BMC Genomics 2008, 9:477 reported the complete mt genome sequence of the oyster Crassostrea hongkongensis (16,475 bp and found that a DNA segment containing four tRNA genes (trnK1, trnC, trnQ1 and trnN, a duplicated (rrnS and a split rRNA gene (rrnL5' was absent compared with that of two other Crassostrea species. It was suggested that the absence was a novel case of "tandem duplication-random loss" with evolutionary significance. We independently sequenced the complete mt genome of three C. hongkongensis individuals, all of which were 18,622 bp and contained the segment that was missing in Yu et al.'s sequence. Further, we designed primers, verified sequences and demonstrated that the sequence loss in Yu et al.'s study was an artifact caused by placing primers in a duplicated region. The duplication and split of ribosomal RNA genes are unique for Crassostrea oysters and not lost in C. hongkongensis. Our study highlights the need for caution when amplifying and sequencing through duplicated regions of the genome.

  8. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation. (United States)

    Cuypers, Thomas D; Hogeweg, Paulien


    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and adaptation remains unknown. Here, we study the duplicate retention pattern postWGD, by letting virtual cells adapt to environmental changes. The virtual cells have structured genomes that encode a regulatory network and simple metabolism. Populations are under selection for homeostasis and evolve by point mutations, small indels and WGD. After populations had initially adapted fully to fluctuating resource conditions re-adaptation to a broad range of novel environments was studied by tracking mutations in the line of descent. WGD was established in a minority (≈30%) of lineages, yet, these were significantly more successful at re-adaptation. Unexpectedly, WGD lineages conserved more seemingly redundant genes, yet had higher per gene mutation rates. While WGD duplicates of all functional classes were significantly over-retained compared to a model of neutral losses, duplicate retention was clearly biased towards highly connected TFs. Importantly, no subfunctionalization occurred in conserved pairs, strongly suggesting that dosage balance shaped retention. Meanwhile, singles diverged significantly. WGD, therefore, is a powerful mechanism to cope with environmental change, allowing conservation of a core machinery, while adapting the peripheral network to accommodate change.

  9. Processes of fungal proteome evolution and gain of function: gene duplication and domain rearrangement

    International Nuclear Information System (INIS)

    Cohen-Gihon, Inbar; Nussinov, Ruth; Sharan, Roded


    During evolution, organisms have gained functional complexity mainly by modifying and improving existing functioning systems rather than creating new ones ab initio. Here we explore the interplay between two processes which during evolution have had major roles in the acquisition of new functions: gene duplication and protein domain rearrangements. We consider four possible evolutionary scenarios: gene families that have undergone none of these event types; only gene duplication; only domain rearrangement, or both events. We characterize each of the four evolutionary scenarios by functional attributes. Our analysis of ten fungal genomes indicates that at least for the fungi clade, species significantly appear to gain complexity by gene duplication accompanied by the expansion of existing domain architectures via rearrangements. We show that paralogs gaining new domain architectures via duplication tend to adopt new functions compared to paralogs that preserve their domain architectures. We conclude that evolution of protein families through gene duplication and domain rearrangement is correlated with their functional properties. We suggest that in general, new functions are acquired via the integration of gene duplication and domain rearrangements rather than each process acting independently

  10. Duplication of SOX9 associated with 46,XX ovotesticular disorder of sex development. (United States)

    López-Hernández, Berenice; Méndez, Juan Pablo; Coral-Vázquez, Ramón Mauricio; Benítez-Granados, Jesús; Zenteno, Juan Carlos; Villegas-Ruiz, Vanessa; Calzada-León, Raúl; Soderlund, Daniela; Canto, Patricia


    The purpose of the present study was to investigate whether ten unrelated SRY-negative individuals with this sex differentiation disorder presented a double dose of SOX9 as the cause of their disease. Ten unrelated SRY-negative 46,XX ovotesticular disorder of sexual development (DSD) subjects were molecularly studied. Multiplex-ligation dependent probe amplification (MLPA) and quantitative real-time PCR analysis (qRT-PCR) for SOX9 were performed. The MLPA analysis demonstrated that one patient presented a heterozygous duplication of the entire SOX9 coding region (above 1.3 value of peak ratio), as well as at least a ~ 483 kb upstream duplication. Moreover, no duplication of other SOX9 probes was observed corresponding to the region between -1007 and -1500 kb upstream. A qRT-PCR analysis showed a duplication of at least -581 kb upstream and ~1.63 kb of the coding region that encompasses exon 3. The limits of the duplication were mapped approximately from ~71539762 to 72122741 of Chr17. No molecular abnormalities were found in the remaining nine patients. This study is thought to be the first report regarding a duplication of SOX9 that is associated with the presence of 46,XX ovotesticular DSD, encompassing at least -581 kb upstream, and the almost entire coding region of the gene. Copyright © 2018 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

  11. Incidence of Data Duplications in a Randomly Selected Pool of Life Science Publications. (United States)

    Oksvold, Morten P


    Since the solution to many public health problems depends on research, it is critical for the progress and well-being for the patients that we can trust the scientific literature. Misconduct and poor laboratory practice in science threatens the scientific progress, leads to loss of productivity and increased healthcare costs, and endangers lives of patients. Data duplication may represent one of challenges related to these problems. In order to estimate the frequency of data duplication in life science literature, a systematic screen through 120 original scientific articles published in three different cancer related journals [journal impact factor (IF) 20] was completed. The study revealed a surprisingly high proportion of articles containing data duplication. For the IF 20 journals, 25% of the articles were found to contain data duplications. The IF 5-10 journal showed a comparable proportion (22.5%). The proportion of articles containing duplicated data was comparable between the three journals and no significant correlation to journal IF was found. The editorial offices representing the journals included in this study and the individual authors of the detected articles were contacted to clarify the individual cases. The editorial offices did not reply and only 1 out of 29 cases were apparently clarified by the authors, although no supporting data was supplied. This study questions the reliability of life science literature, it illustrates that data duplications are widespread and independent of journal impact factor and call for a reform of the current peer review and retraction process of scientific publishing.

  12. Altered serotonin, dopamine and norepinepherine levels in 15q duplication and Angelman syndrome mouse models.

    Directory of Open Access Journals (Sweden)

    M Febin Farook

    Full Text Available Childhood neurodevelopmental disorders like Angelman syndrome and autism may be the result of underlying defects in neuronal plasticity and ongoing problems with synaptic signaling. Some of these defects may be due to abnormal monoamine levels in different regions of the brain. Ube3a, a gene that causes Angelman syndrome (AS when maternally deleted and is associated with autism when maternally duplicated has recently been shown to regulate monoamine synthesis in the Drosophila brain. Therefore, we examined monoamine levels in striatum, ventral midbrain, frontal cerebral cortex, cerebellar cortex and hippocampus in Ube3a deficient and Ube3a duplication animals. We found that serotonin (5HT, a monoamine affected in autism, was elevated in the striatum and cortex of AS mice. Dopamine levels were almost uniformly elevated compared to control littermates in the striatum, midbrain and frontal cortex regardless of genotype in Ube3a deficient and Ube3a duplication animals. In the duplication 15q autism mouse model, paternal but not maternal duplication animals showed a decrease in 5HT levels when compared to their wild type littermates, in accordance with previously published data. However, maternal duplication animals show no significant changes in 5HT levels throughout the brain. These abnormal monoamine levels could be responsible for many of the behavioral abnormalities observed in both AS and autism, but further investigation is required to determine if any of these changes are purely dependent on Ube3a levels in the brain.

  13. Duplicate study on the dietary intake of PCDD/F by small children from Germany

    International Nuclear Information System (INIS)

    Wittsiepe, J.; Schrey, P.; Schmidt, E.; Wilhelm, M.


    The dietary intake of polychlorinated dibenzo-p-dioxins and dibenzofurans (PCDD/F) by 42 small children at the age of 14 to 47 months was measured by the duplicate method. The children were living in urban or rural areas of Northrhine-Westphalia, Germany, and had different food consumption behaviour. The duplicates were collected over a period of seven days between May and September 1998. The PCDD/F-levels in the food duplicates were in the range of 39.2 to 325 pg I-TEq/kg dry weight (median: 90.7; arithmetic mean: 96.6). The doses were between 0.681 and 5.43 pg I-TEq/(kg body weight day) with a median of 1.56 and an arithmetric mean of 1.60. The aspired limit of 1 pg I-TEq/(kg body weight . day) was exceeded by most children. Food duplicates of children living in an urban industrialized area with food consumption including products from the family owned vegetable gardens or the surrounding area and/or products from domestic animals showed no statistically significant different PCDD/F-concentrations, calculated as I-TEq, than food duplicates of children living in a rural area with similar food consumption behavior or than food duplicates of children consuming exclusively food from the supermarket. The same was observed for the calculated intake rates of PCDD/F. Efforts to reduce the contamination of food with PCDD/F should be continued. (orig.) [de

  14. Reducing and Sustaining Duplicate Medical Record Creation by Usability Testing and System Redesign. (United States)

    Khunlertkit, Adjhaporn; Dorissaint, Leonard; Chen, Allen; Paine, Lori; Pronovost, Peter J


    Duplicate medical record creation is a common and consequential health care systems error often caused by poor search system usability and inappropriate user training. We conducted two phases of scenario-based usability testing with patient registrars working in areas at risk of generating duplicate medical records. Phase 1 evaluated the existing search system, which led to system redesigns. Phase 2 tested the redesigned system to mitigate potential errors before health system-wide implementation. To evaluate system effectiveness, we compared the monthly potential duplicate medical record rates for preimplementation and postimplementation months. The existing system could not effectively handle a misspelling, which led to failed search and duplicate medical record creation. Using the existing system, 96% of registrars found commonly spelled patient names whereas only 69% successfully found complicated names. Registrars lacked knowledge and usage of a phonetic matching function to assist in misspelling. The new system consistently captured the correct patient regardless of misspelling, but search returned more potential matches, resulting in, on average, 4 seconds longer to select common names. Potential monthly duplicate medical record rate reduced by 38%, from 4% to 2.3% after implementation of the new system, and has sustained at an average of 2.5% for 2 years. Usability testing was an effective method to reveal problems and aid system redesign to deliver a more user friendly system, hence reducing the potential for medical record duplication. Greater standards for usability would ensure that these improvements can be realized before rather than after exposing patients to risks.

  15. Duplication of the dystroglycan gene in most branches of teleost fish

    Directory of Open Access Journals (Sweden)

    Giardina Bruno


    Full Text Available Abstract Background The dystroglycan (DG complex is a major non-integrin cell adhesion system whose multiple biological roles involve, among others, skeletal muscle stability, embryonic development and synapse maturation. DG is composed of two subunits: α-DG, extracellular and highly glycosylated, and the transmembrane β-DG, linking the cytoskeleton to the surrounding basement membrane in a wide variety of tissues. A single copy of the DG gene (DAG1 has been identified so far in humans and other mammals, encoding for a precursor protein which is post-translationally cleaved to liberate the two DG subunits. Similarly, D. rerio (zebrafish seems to have a single copy of DAG1, whose removal was shown to cause a severe dystrophic phenotype in adult animals, although it is known that during evolution, due to a whole genome duplication (WGD event, many teleost fish acquired multiple copies of several genes (paralogues. Results Data mining of pufferfish (T. nigroviridis and T. rubripes and other teleost fish (O. latipes and G. aculeatus available nucleotide sequences revealed the presence of two functional paralogous DG sequences. RT-PCR analysis proved that both the DG sequences are transcribed in T. nigroviridis. One of the two DG sequences harbours an additional mini-intronic sequence, 137 bp long, interrupting the uncomplicated exon-intron-exon pattern displayed by DAG1 in mammals and D. rerio. A similar scenario emerged also in D. labrax (sea bass, from whose genome we have cloned and sequenced a new DG sequence that also harbours a shorter additional intronic sequence of 116 bp. Western blot analysis confirmed the presence of DG protein products in all the species analysed including two teleost Antarctic species (T. bernacchii and C. hamatus. Conclusion Our evolutionary analysis has shown that the whole-genome duplication event in the Class Actinopterygii (ray-finned fish involved also DAG1. We unravelled new important molecular genetic details

  16. Gene duplication, loss and selection in the evolution of saxitoxin biosynthesis in alveolates. (United States)

    Murray, Shauna A; Diwan, Rutuja; Orr, Russell J S; Kohli, Gurjeet S; John, Uwe


    A group of marine dinoflagellates (Alveolata, Eukaryota), consisting of ∼10 species of the genus Alexandrium, Gymnodinium catenatum and Pyrodinium bahamense, produce the toxin saxitoxin and its analogues (STX), which can accumulate in shellfish, leading to ecosystem and human health impacts. The genes, sxt, putatively involved in STX biosynthesis, have recently been identified, however, the evolution of these genes within dinoflagellates is not clear. There are two reasons for this: uncertainty over the phylogeny of dinoflagellates; and that the sxt genes of many species of Alexandrium and other dinoflagellate genera are not known. Here, we determined the phylogeny of STX-producing and other dinoflagellates based on a concatenated eight-gene alignment. We determined the presence, diversity and phylogeny of sxtA, domains A1 and A4 and sxtG in 52 strains of Alexandrium, and a further 43 species of dinoflagellates and thirteen other alveolates. We confirmed the presence and high sequence conservation of sxtA, domain A4, in 40 strains (35 Alexandrium, 1 Pyrodinium, 4 Gymnodinium) of 8 species of STX-producing dinoflagellates, and absence from non-producing species. We found three paralogs of sxtA, domain A1, and a widespread distribution of sxtA1 in non-STX producing dinoflagellates, indicating duplication events in the evolution of this gene. One paralog, clade 2, of sxtA1 may be particularly related to STX biosynthesis. Similarly, sxtG appears to be generally restricted to STX-producing species, while three amidinotransferase gene paralogs were found in dinoflagellates. We investigated the role of positive (diversifying) selection following duplication in sxtA1 and sxtG, and found negative selection in clades of sxtG and sxtA1, clade 2, suggesting they were functionally constrained. Significant episodic diversifying selection was found in some strains in clade 3 of sxtA1, a clade that may not be involved in STX biosynthesis, indicating pressure for diversification

  17. Warfarin and Rivaroxaban Duplication: A Case Report and Medication Error Analysis. (United States)

    Fusco, Julie A; Paulus, Eric J; Shubat, Alexandra R; Miah, Sharminara


    A 62-year-old African American man received unintentional duplicate anticoagulation therapy with warfarin 5 mg and rivaroxaban 20 mg daily for the treatment of recurrent pulmonary embolism. The patient presented to the anticoagulation clinic 6 days after hospital discharge with an International Normalized Ratio (INR) of 2.3 and he was instructed to continue warfarin 5 mg daily. Seven days later, he returned to the clinic with an INR >8.0 using a point-of-care device. He denied any signs or symptoms of bleeding. During the interview, he reported starting a new medication for neuropathy 5 days earlier. The clinical pharmacist contacted the dispensing pharmacy and determined rivaroxaban 20 mg was the new medication. The patient denied receiving new prescription counseling at the dispensing pharmacy. Because rivaroxaban can falsely elevate INR results, the actual INR value was unknown. To minimize the risk for recurrent venous thromboembolism, vitamin K was not administered and no warfarin doses were held. Rather, the patient was instructed to stop rivaroxaban and reduce the warfarin dose. Five days later, the patient returned with an INR of 4.3. He still had not experienced any signs or symptoms of bleeding. The patient was quickly stabilized on a warfarin maintenance dose of 22.5 mg weekly. The anticoagulation clinic pharmacist notified management at the clinic and at the dispensing pharmacy in an effort to identify process errors and prevent additional incidents.

  18. XX male sex reversal with genital abnormalities associated with a de novo SOX3 gene duplication. (United States)

    Moalem, Sharon; Babul-Hirji, Riyana; Stavropolous, Dmitri J; Wherrett, Diane; Bägli, Darius J; Thomas, Paul; Chitayat, David


    Differentiation of the bipotential gonad into testis is initiated by the Y chromosome-linked gene SRY (Sex-determining Region Y) through upregulation of its autosomal direct target gene SOX9 (Sry-related HMG box-containing gene 9). Sequence and chromosome homology studies have shown that SRY most probably evolved from SOX3, which in humans is located at Xq27.1. Mutations causing SOX3 loss-of-function do not affect the sex determination in mice or humans. However, transgenic mouse studies have shown that ectopic expression of Sox3 in the bipotential gonad results in upregulation of Sox9, resulting in testicular induction and XX male sex reversal. However, the mechanism by which these rearrangements cause sex reversal and the frequency with which they are associated with disorders of sex development remains unclear. Rearrangements of the SOX3 locus were identified recently in three cases of human XX male sex reversal. We report on a case of XX male sex reversal associated with a novel de novo duplication of the SOX3 gene. These data provide additional evidence that SOX3 gain-of-function in the XX bipotential gonad causes XX male sex reversal and further support the hypothesis that SOX3 is the evolutionary antecedent of SRY. Copyright © 2012 Wiley Periodicals, Inc.

  19. Structure and vascular tissue expression of duplicated TERMINAL EAR1-like paralogues in poplar. (United States)

    Charon, Céline; Vivancos, Julien; Mazubert, Christelle; Paquet, Nicolas; Pilate, Gilles; Dron, Michel


    TERMINAL EAR1-like (TEL) genes encode putative RNA-binding proteins only found in land plants. Previous studies suggested that they may regulate tissue and organ initiation in Poaceae. Two TEL genes were identified in both Populus trichocarpa and the hybrid aspen Populus tremula x P. alba, named, respectively, PoptrTEL1-2 and PtaTEL1-2. The analysis of the organisation around the PoptrTEL genes in the P. trichocarpa genome and the estimation of the synonymous substitution rate for PtaTEL1-2 genes indicate that the paralogous link between these two Populus TEL genes probably results from the Salicoid large-scale gene-duplication event. Phylogenetic analyses confirmed their orthology link with the other TEL genes. The expression pattern of both PtaTEL genes appeared to be restricted to the mother cells of the plant body: leaf founder cells, leaf primordia, axillary buds and root differentiating tissues, as well as to mother cells of vascular tissues. Most interestingly, PtaTEL1-2 transcripts were found in differentiating cells of secondary xylem and phloem, but probably not in the cambium itself. Taken together, these results indicate specific expression of the TEL genes in differentiating cells controlling tissue and organ development in Populus (and other Angiosperm species).

  20. Mimics of Duplication Cysts: Intraperitoneal Nodules in a 14-Year-Old Boy

    Directory of Open Access Journals (Sweden)

    Sara E. Ohanessian


    Full Text Available Hemangiomas are the most common primary hepatic tumors, but there are few reports of their occurrence elsewhere in the abdomen. The concurrent existence of multiple fibrous nodules of the omentum, mesentery, and porta hepatis, along with a gastric hemangioma, in a child raises the question of syndromic association. Our search of the English literature revealed only rare mentions of hemangiomas involving the stomach and mesentery or omentum. These lesions have attracted clinical attention by symptoms of obstruction, gastrointestinal bleeding, intussusception, infection, perforation, or vague abdominal pain. Although some tumors exist unnoticed for many decades and are identified only incidentally, others present emergently and require immediate surgical attention. We report the case of a 14-year-old boy who presented with symptoms similar to those for appendicitis or duplication cyst, who was found to have a torsed gastric hemangioma and multiple benign fibrous nodules in the abdomen. The presence of multiple vascular or fibrous lesions is associated with genetic syndromes that can have lifelong and reproductive repercussions; so it is imperative that these tumors be recognized by diagnosticians.