Developmental delays in emotion regulation strategies in preschoolers with autism.

Science.gov (United States)

Nuske, Heather J; Hedley, Darren; Woollacott, Alexandra; Thomson, Phoebe; Macari, Suzanne; Dissanayake, Cheryl

2017-11-01

Children with autism spectrum disorder (ASD) commonly present with difficulty regulating negative emotions, which has been found to impact their behavioral and mental health. Little research has documented the strategies that children with ASD use to regulate their emotion to understand whether they use qualitatively different strategies to children without ASD, whether these are developmentally delayed, or both. Forty-four children with ASD and 29 typically-developing children (2-4 years) were given tasks designed to mimic everyday life experiences requiring children to manage low-level stress (e.g., waiting for a snack) and children's emotion regulation strategies were coded. Parents reported on their child's mental health, wellbeing, and self-development. The results suggest differences in using emotion regulation strategies in children with ASD, reflecting a delay, rather than a deviance when compared to those used by children without ASD. Only children with ASD relied on their family members for physical and communicative soothing; the typically developing children relied on people outside of their family for help regulating their emotion. More frequent approach/less frequent avoidance was related to a higher self-evaluation in both groups, but was only additionally related to higher self-recognition and autonomy in the ASD group. These findings help to identify important emotion regulation intervention targets for this population, including supporting communication with people outside of the family and independence. Autism Res 2017, 10: 1808-1822. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. Results suggest that children with autism had more difficulty using communication strategies to manage stress only with people outside the family; they used these strategies with family members as often as children without autism. For all children, more task approach/less avoidance was related to children's higher self-evaluation. These

The Drosophila Perlecan gene trol regulates multiple signaling pathways in different developmental contexts

Directory of Open Access Journals (Sweden)

Perry Trinity L

2007-11-01

Full Text Available Abstract Background Heparan sulfate proteoglycans modulate signaling by a variety of growth factors. The mammalian proteoglycan Perlecan binds and regulates signaling by Sonic Hedgehog, Fibroblast Growth Factors (FGFs, Vascular Endothelial Growth Factor (VEGF and Platelet Derived Growth Factor (PDGF, among others, in contexts ranging from angiogenesis and cardiovascular development to cancer progression. The Drosophila Perlecan homolog trol has been shown to regulate the activity of Hedgehog and Branchless (an FGF homolog to control the onset of stem cell proliferation in the developing brain during first instar. Here we extend analysis of trol mutant phenotypes to show that trol is required for a variety of developmental events and modulates signaling by multiple growth factors in different situations. Results Different mutations in trol allow developmental progression to varying extents, suggesting that trol is involved in multiple cell-fate and patterning decisions. Analysis of the initiation of neuroblast proliferation at second instar demonstrated that trol regulates this event by modulating signaling by Hedgehog and Branchless, as it does during first instar. Trol protein is distributed over the surface of the larval brain, near the regulated neuroblasts that reside on the cortical surface. Mutations in trol also decrease the number of circulating plasmatocytes. This is likely to be due to decreased expression of pointed, the response gene for VEGF/PDGF signaling that is required for plasmatocyte proliferation. Trol is found on plasmatocytes, where it could regulate VEGF/PDGF signaling. Finally, we show that in second instar brains but not third instar brain lobes and eye discs, mutations in trol affect signaling by Decapentaplegic (a Transforming Growth Factor family member, Wingless (a Wnt growth factor and Hedgehog. Conclusion These studies extend the known functions of the Drosophila Perlecan homolog trol in both developmental and

Identifying developmental vascular disruptor compounds using a predictive signature and alternative toxicity models

Science.gov (United States)

Identifying Developmental Vascular Disruptor Compounds Using a Predictive Signature and Alternative Toxicity Models Presenting Author: Tamara Tal Affiliation: U.S. EPA/ORD/ISTD, RTP, NC, USA Chemically induced vascular toxicity during embryonic development can result in a wide...

Driving Skills of Young Adults with Developmental Coordination Disorder: Regulating Speed and Coping with Distraction

Science.gov (United States)

de Oliveira, Rita F.; Wann, John P.

2011-01-01

In two experiments, we used an automatic car simulator to examine the steering control, speed regulation and response to hazards of young adults with developmental coordination disorder (DCD) and limited driving experience. In Experiment 1 participants either used the accelerator pedal to regulate their speed, or used the brake pedal when they…

Exome analysis identified a novel mutation in the RBP4 gene in a consanguineous pedigree with retinal dystrophy and developmental abnormalities.

Directory of Open Access Journals (Sweden)

Catherine Cukras

Full Text Available Retinitis Pigmentosa (RP is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A in the gene encoding retinol binding protein 4 (RBP4. This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5(th decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism.

Exome analysis identified a novel mutation in the RBP4 gene in a consanguineous pedigree with retinal dystrophy and developmental abnormalities.

Science.gov (United States)

Cukras, Catherine; Gaasterland, Terry; Lee, Pauline; Gudiseva, Harini V; Chavali, Venkata R M; Pullakhandam, Raghu; Maranhao, Bruno; Edsall, Lee; Soares, Sandra; Reddy, G Bhanuprakash; Sieving, Paul A; Ayyagari, Radha

2012-01-01

Retinitis Pigmentosa (RP) is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE) atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A) in the gene encoding retinol binding protein 4 (RBP4). This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP) in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5(th) decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism.

Developmentally regulated expression and complex processing of barley pri-microRNAs

Directory of Open Access Journals (Sweden)

Kruszka Katarzyna

2013-01-01

Full Text Available Abstract Background MicroRNAs (miRNAs regulate gene expression via mRNA cleavage or translation inhibition. In spite of barley being a cereal of great economic importance, very little data is available concerning its miRNA biogenesis. There are 69 barley miRNA and 67 pre-miRNA sequences available in the miRBase (release 19. However, no barley pri-miRNA and MIR gene structures have been shown experimentally. In the present paper, we examine the biogenesis of selected barley miRNAs and the developmental regulation of their pri-miRNA processing to learn more about miRNA maturation in barely. Results To investigate the organization of barley microRNA genes, nine microRNAs - 156g, 159b, 166n, 168a-5p/168a-3p, 171e, 397b-3p, 1120, and 1126 - were selected. Two of the studied miRNAs originate from one MIR168a-5p/168a-3p gene. The presence of all miRNAs was confirmed using a Northern blot approach. The miRNAs are encoded by genes with diverse organizations, representing mostly independent transcription units with or without introns. The intron-containing miRNA transcripts undergo complex splicing events to generate various spliced isoforms. We identified miRNAs that were encoded within introns of the noncoding genes MIR156g and MIR1126. Interestingly, the intron that encodes miR156g is spliced less efficiently than the intron encoding miR1126 from their specific precursors. miR397b-3p was detected in barley as a most probable functional miRNA, in contrast to rice where it has been identified as a complementary partner miRNA*. In the case of miR168a-5p/168a-3p, we found the generation of stable, mature molecules from both pre-miRNA arms, confirming evolutionary conservation of the stability of both species, as shown in rice and maize. We suggest that miR1120, located within the 3′ UTR of a protein-coding gene and described as a functional miRNA in wheat, may represent a siRNA generated from a mariner-like transposable element. Conclusions Seven of the

Let-7 microRNAs are developmentally regulated in circulating human erythroid cells

Directory of Open Access Journals (Sweden)

Reed Christopher

2009-11-01

Full Text Available Abstract Background MicroRNAs are ~22nt-long small non-coding RNAs that negatively regulate protein expression through mRNA degradation or translational repression in eukaryotic cells. Based upon their importance in regulating development and terminal differentiation in model systems, erythrocyte microRNA profiles were examined at birth and in adults to determine if changes in their abundance coincide with the developmental phenomenon of hemoglobin switching. Methods Expression profiling of microRNA was performed using total RNA from four adult peripheral blood samples compared to four cord blood samples after depletion of plasma, platelets, and nucleated cells. Labeled RNAs were hybridized to custom spotted arrays containing 474 human microRNA species (miRBase release 9.1. Total RNA from Epstein-Barr virus (EBV-transformed lymphoblastoid cell lines provided a hybridization reference for all samples to generate microRNA abundance profile for each sample. Results Among 206 detected miRNAs, 79% of the microRNAs were present at equivalent levels in both cord and adult cells. By comparison, 37 microRNAs were up-regulated and 4 microRNAs were down-regulated in adult erythroid cells (fold change > 2; p let-7 miRNA family consistently demonstrated increased abundance in the adult samples by array-based analyses that were confirmed by quantitative PCR (4.5 to 18.4 fold increases in 6 of 8 let-7 miRNA. Profiling studies of messenger RNA (mRNA in these cells additionally demonstrated down-regulation of ten let-7 target genes in the adult cells. Conclusion These data suggest that a consistent pattern of up-regulation among let-7 miRNA in circulating erythroid cells occurs in association with hemoglobin switching during the fetal-to-adult developmental transition in humans.

The ribonuclease Dis3 is an essential regulator of the developmental transcriptome

Directory of Open Access Journals (Sweden)

Hou Dezhi

2012-08-01

Full Text Available Abstract Background Dis3 is ribonuclease that acts directly in the processing, turnover, and surveillance of a large number of distinct RNA species. Evolutionarily conserved from eubacteria to eukaryotes and a crucial component of the RNA processing exosome, Dis3 has been shown to be essential in yeast and fly S2 cells. However, it is not known whether Dis3 has essential functions in a metazoan. This study inquires whether Dis3 is required for Drosophila development and viability and how Dis3 regulates the transcriptome in the developing fly. Results Using transgenic flies, we show that Dis3 knock down (Dis3KD retards growth, induces melanotic tumor formation, and ultimately results in 2nd instar larval lethality. In order to determine whether Dis3KD fly phenotypes were a consequence of disrupting developmentally regulated RNA turnover, we performed RNA deep sequencing analysis on total RNA isolated from developmentally staged animals. Bioinformatic analysis of transcripts from Dis3KD flies reveals substantial transcriptomic changes, most notably down-regulation in early expressed RNAs. Finally, gene ontology analysis of this early stage shows that Dis3 regulates transcripts related to extracellular structure and remodelling, neurogenesis, and nucleotide metabolism. Conclusions We conclude that Dis3 is essential for early Drosophila melanogaster development and has specific and important stage-specific roles in regulating RNA metabolism. In showing for the first time that Dis3 is required for the development of a multicellular organism, our work provides mechanistic insight into how Dis3—either independent of or associated with the RNA processing exosome—participates in cell type-specific RNA turnover in metazoan development.

Timing is everything: Reiterative Wnt, BMP and RA signaling regulate developmental competence during endoderm organogenesis.

Science.gov (United States)

Rankin, Scott A; McCracken, Kyle W; Luedeke, David M; Han, Lu; Wells, James M; Shannon, John M; Zorn, Aaron M

2018-02-01

A small number of signaling pathways are used repeatedly during organogenesis, and they can have drastically different effects on the same population of cells depending on the embryonic stage. How cellular competence changes over developmental time is not well understood. Here we used Xenopus, mouse, and human pluripotent stem cells to investigate how the temporal sequence of Wnt, BMP, and retinoic acid (RA) signals regulates endoderm developmental competence and organ induction, focusing on respiratory fate. While Nkx2-1+ lung fate is not induced until late somitogenesis stages, here we show that lung competence is restricted by the gastrula stage as a result of Wnt and BMP-dependent anterior-posterior (A-P) patterning. These early Wnt and BMP signals make posterior endoderm refractory to subsequent RA/Wnt/BMP-dependent lung induction. We further mapped how RA modulates the response to Wnt and BMP in a temporal specific manner. In the gastrula RA promotes posterior identity, however in early somite stages of development RA regulates respiratory versus pharyngeal potential in anterior endoderm and midgut versus hindgut potential in posterior endoderm. Together our data suggest a dynamic and conserved response of vertebrate endoderm during organogenesis, wherein early Wnt/BMP/RA impacts how cells respond to later Wnt/BMP/RA signals, illustrating how reiterative combinatorial signaling can regulate both developmental competence and subsequent fate specification. Copyright © 2017 Elsevier Inc. All rights reserved.

The conserved splicing factor SUA controls alternative splicing of the developmental regulator ABI3 in Arabidopsis.

NARCIS (Netherlands)

Sugliani, M.; Brambilla, V.; Clerkx, E.J.M.; Koornneef, M.; Soppe, W.J.J.

2010-01-01

ABSCISIC ACID INSENSITIVE3 (ABI3) is a major regulator of seed maturation in Arabidopsis thaliana. We detected two ABI3 transcripts, ABI3- and ABI3-ß, which encode full-length and truncated proteins, respectively. Alternative splicing of ABI3 is developmentally regulated, and the ABI3-ß transcript

Developmental model of static allometry in holometabolous insects.

Science.gov (United States)

Shingleton, Alexander W; Mirth, Christen K; Bates, Peter W

2008-08-22

The regulation of static allometry is a fundamental developmental process, yet little is understood of the mechanisms that ensure organs scale correctly across a range of body sizes. Recent studies have revealed the physiological and genetic mechanisms that control nutritional variation in the final body and organ size in holometabolous insects. The implications these mechanisms have for the regulation of static allometry is, however, unknown. Here, we formulate a mathematical description of the nutritional control of body and organ size in Drosophila melanogaster and use it to explore how the developmental regulators of size influence static allometry. The model suggests that the slope of nutritional static allometries, the 'allometric coefficient', is controlled by the relative sensitivity of an organ's growth rate to changes in nutrition, and the relative duration of development when nutrition affects an organ's final size. The model also predicts that, in order to maintain correct scaling, sensitivity to changes in nutrition varies among organs, and within organs through time. We present experimental data that support these predictions. By revealing how specific physiological and genetic regulators of size influence allometry, the model serves to identify developmental processes upon which evolution may act to alter scaling relationships.

Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes.

Science.gov (United States)

Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich

2012-02-01

The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.

BMP signaling in the human fetal ovary is developmentally regulated and promotes primordial germ cell apoptosis.

Science.gov (United States)

Childs, Andrew J; Kinnell, Hazel L; Collins, Craig S; Hogg, Kirsten; Bayne, Rosemary A L; Green, Samira J; McNeilly, Alan S; Anderson, Richard A

2010-08-01

Primordial germ cells (PGCs) are the embryonic precursors of gametes in the adult organism, and their development, differentiation, and survival are regulated by a combination of growth factors collectively known as the germ cell niche. Although many candidate niche components have been identified through studies on mouse PGCs, the growth factor composition of the human PGC niche has not been studied extensively. Here we report a detailed analysis of the expression of components of the bone morphogenetic protein (BMP) signaling apparatus in the human fetal ovary, from postmigratory PGC proliferation to the onset of primordial follicle formation. We find developmentally regulated and reciprocal patterns of expression of BMP2 and BMP4 and identify germ cells to be the exclusive targets of ovarian BMP signaling. By establishing long-term cultures of human fetal ovaries in which PGCs are retained within their physiological niche, we find that BMP4 negatively regulates postmigratory PGC numbers in the human fetal ovary by promoting PGC apoptosis. Finally, we report expression of both muscle segment homeobox (MSX)1 and MSX2 in the human fetal ovary and reveal a selective upregulation of MSX2 expression in human fetal ovary in response to BMP4, suggesting this gene may act as a downstream effector of BMP-induced apoptosis in the ovary, as in other systems. These data reveal for the first time growth factor regulation of human PGC development in a physiologically relevant context and have significant implications for the development of cultures systems for the in vitro maturation of germ cells, and their derivation from pluripotent stem cells.

Onto-clust--a methodology for combining clustering analysis and ontological methods for identifying groups of comorbidities for developmental disorders.

Science.gov (United States)

Peleg, Mor; Asbeh, Nuaman; Kuflik, Tsvi; Schertz, Mitchell

2009-02-01

Children with developmental disorders usually exhibit multiple developmental problems (comorbidities). Hence, such diagnosis needs to revolve on developmental disorder groups. Our objective is to systematically identify developmental disorder groups and represent them in an ontology. We developed a methodology that combines two methods (1) a literature-based ontology that we created, which represents developmental disorders and potential developmental disorder groups, and (2) clustering for detecting comorbid developmental disorders in patient data. The ontology is used to interpret and improve clustering results and the clustering results are used to validate the ontology and suggest directions for its development. We evaluated our methodology by applying it to data of 1175 patients from a child development clinic. We demonstrated that the ontology improves clustering results, bringing them closer to an expert generated gold-standard. We have shown that our methodology successfully combines an ontology with a clustering method to support systematic identification and representation of developmental disorder groups.

Postnatal reduction of BDNF regulates the developmental remodeling of taste bud innervation.

Science.gov (United States)

Huang, Tao; Ma, Liqun; Krimm, Robin F

2015-09-15

The refinement of innervation is a common developmental mechanism that serves to increase the specificity of connections following initial innervation. In the peripheral gustatory system, the extent to which innervation is refined and how refinement might be regulated is unclear. The initial innervation of taste buds is controlled by brain-derived neurotrophic factor (BDNF). Following initial innervation, taste receptor cells are added and become newly innervated. The connections between the taste receptor cells and nerve fibers are likely to be specific in order to retain peripheral coding mechanisms. Here, we explored the possibility that the down-regulation of BDNF regulates the refinement of taste bud innervation during postnatal development. An analysis of BDNF expression in Bdnf(lacZ/+) mice and real-time reverse transcription polymerase chain reaction (RT-PCR) revealed that BDNF was down-regulated between postnatal day (P) 5 and P10. This reduction in BDNF expression was due to a loss of precursor/progenitor cells that express BDNF, while the expression of BDNF in the subpopulations of taste receptor cells did not change. Gustatory innervation, which was identified by P2X3 immunohistochemistry, was lost around the perimeter where most progenitor/precursor cells are located. In addition, the density of innervation in the taste bud was reduced between P5 and P10, because taste buds increase in size without increasing innervation. This reduction of innervation density was blocked by the overexpression of BDNF in the precursor/progenitor population of taste bud cells. Together these findings indicate that the process of BDNF restriction to a subpopulation of taste receptor cells between P5 and P10, results in a refinement of gustatory innervation. We speculate that this refinement results in an increased specificity of connections between neurons and taste receptor cells during development. Copyright © 2015 Elsevier Inc. All rights reserved.

Postnatal reduction of BDNF regulates the developmental remodeling of taste bud innervation

Science.gov (United States)

Huang, Tao; Ma, Liqun; Krimm, Robin F

2015-01-01

The refinement of innervation is a common developmental mechanism that serves to increase the specificity of connections following initial innervation. In the peripheral gustatory system, the extent to which innervation is refined and how refinement might be regulated is unclear. The initial innervation of taste buds is controlled by brain-derived neurotrophic factor (BDNF). Following initial innervation, taste receptor cells are added and become newly innervated. The connections between the taste receptor cells and nerve fibers are likely to be specific in order to retain peripheral coding mechanisms. Here, we explored the possibility that the down-regulation of BDNF regulates the refinement of taste bud innervation during postnatal development. An analysis of BDNF expression in BdnflacZ/+ mice and real-time reverse transcription polymerase chain reaction (RT-PCR) revealed that BDNF was down-regulated between postnatal day (P) 5 and P10. This reduction in BDNF expression was due to a loss of precursor/progenitor cells that express BDNF, while the expression of BDNF in the subpopulations of taste receptor cells did not change. Gustatory innervation, which was identified by P2X3 immunohistochemistry, was lost around the perimeter where most progenitor/precursor cells are located. In addition, the density of innervation in the taste bud was reduced between P5 and P10, because taste buds increase in size without increasing innervation. This reduction of innervation density was blocked by the overexpression of BDNF in the precursor/progenitor population of taste bud cells. Together these findings indicate that the process of BDNF restriction to a subpopulation of taste receptor cells between P5 and P10, results in a refinement of gustatory innervation. We speculate that this refinement results in an increased specificity of connections between neurons and taste receptor cells during development. PMID:26164656

Developmental Regulation with Progressive Vision Loss: Use of Control Strategies and Affective Well-Being

Science.gov (United States)

Schilling, Oliver K.; Wahl, Hans-Werner; Boerner, Kathrin; Horowitz, Amy; Reinhardt, Joann P.; Cimarolli, Verena R.; Brennan-Ing, Mark; Heckhausen, Jutta

2016-01-01

The present study addresses older adults' developmental regulation when faced with progressive and irreversible vision loss. We used the motivational theory of life span development as a conceptual framework and examined changes in older adults' striving for control over everyday goal achievement, and their association with affective well-being,…

Apoplastic and intracellular plant sugars regulate developmental transitions in witches’ broom disease of cacao

Science.gov (United States)

Barau, Joan; Grandis, Adriana; Carvalho, Vinicius Miessler de Andrade; Teixeira, Gleidson Silva; Zaparoli, Gustavo Henrique Alcalá; do Rio, Maria Carolina Scatolin; Rincones, Johana; Buckeridge, Marcos Silveira; Pereira, Gonçalo Amarante Guimarães

2015-01-01

Witches’ broom disease (WBD) of cacao differs from other typical hemibiotrophic plant diseases by its unusually long biotrophic phase. Plant carbon sources have been proposed to regulate WBD developmental transitions; however, nothing is known about their availability at the plant–fungus interface, the apoplastic fluid of cacao. Data are provided supporting a role for the dynamics of soluble carbon in the apoplastic fluid in prompting the end of the biotrophic phase of infection. Carbon depletion and the consequent fungal sensing of starvation were identified as key signalling factors at the apoplast. MpNEP2, a fungal effector of host necrosis, was found to be up-regulated in an autophagic-like response to carbon starvation in vitro. In addition, the in vivo artificial manipulation of carbon availability in the apoplastic fluid considerably modulated both its expression and plant necrosis rate. Strikingly, infected cacao tissues accumulated intracellular hexoses, and showed stunted photosynthesis and the up-regulation of senescence markers immediately prior to the transition to the necrotrophic phase. These opposite findings of carbon depletion and accumulation in different host cell compartments are discussed within the frame of WBD development. A model is suggested to explain phase transition as a synergic outcome of fungal-related factors released upon sensing of extracellular carbon starvation, and an early senescence of infected tissues probably triggered by intracellular sugar accumulation. PMID:25540440

Comparative genomic analysis of Drosophila melanogaster and vector mosquito developmental genes.

Directory of Open Access Journals (Sweden)

Susanta K Behura

Full Text Available Genome sequencing projects have presented the opportunity for analysis of developmental genes in three vector mosquito species: Aedes aegypti, Culex quinquefasciatus, and Anopheles gambiae. A comparative genomic analysis of developmental genes in Drosophila melanogaster and these three important vectors of human disease was performed in this investigation. While the study was comprehensive, special emphasis centered on genes that 1 are components of developmental signaling pathways, 2 regulate fundamental developmental processes, 3 are critical for the development of tissues of vector importance, 4 function in developmental processes known to have diverged within insects, and 5 encode microRNAs (miRNAs that regulate developmental transcripts in Drosophila. While most fruit fly developmental genes are conserved in the three vector mosquito species, several genes known to be critical for Drosophila development were not identified in one or more mosquito genomes. In other cases, mosquito lineage-specific gene gains with respect to D. melanogaster were noted. Sequence analyses also revealed that numerous repetitive sequences are a common structural feature of Drosophila and mosquito developmental genes. Finally, analysis of predicted miRNA binding sites in fruit fly and mosquito developmental genes suggests that the repertoire of developmental genes targeted by miRNAs is species-specific. The results of this study provide insight into the evolution of developmental genes and processes in dipterans and other arthropods, serve as a resource for those pursuing analysis of mosquito development, and will promote the design and refinement of functional analysis experiments.

Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae

Directory of Open Access Journals (Sweden)

Seong Hwan Park

2013-01-01

Full Text Available Identifying species of insects used to estimate postmortem interval (PMI is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science.

Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae)

Science.gov (United States)

Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon

2013-01-01

Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044

Apoplastic and intracellular plant sugars regulate developmental transitions in witches' broom disease of cacao.

Science.gov (United States)

Barau, Joan; Grandis, Adriana; Carvalho, Vinicius Miessler de Andrade; Teixeira, Gleidson Silva; Zaparoli, Gustavo Henrique Alcalá; do Rio, Maria Carolina Scatolin; Rincones, Johana; Buckeridge, Marcos Silveira; Pereira, Gonçalo Amarante Guimarães

2015-03-01

Witches' broom disease (WBD) of cacao differs from other typical hemibiotrophic plant diseases by its unusually long biotrophic phase. Plant carbon sources have been proposed to regulate WBD developmental transitions; however, nothing is known about their availability at the plant-fungus interface, the apoplastic fluid of cacao. Data are provided supporting a role for the dynamics of soluble carbon in the apoplastic fluid in prompting the end of the biotrophic phase of infection. Carbon depletion and the consequent fungal sensing of starvation were identified as key signalling factors at the apoplast. MpNEP2, a fungal effector of host necrosis, was found to be up-regulated in an autophagic-like response to carbon starvation in vitro. In addition, the in vivo artificial manipulation of carbon availability in the apoplastic fluid considerably modulated both its expression and plant necrosis rate. Strikingly, infected cacao tissues accumulated intracellular hexoses, and showed stunted photosynthesis and the up-regulation of senescence markers immediately prior to the transition to the necrotrophic phase. These opposite findings of carbon depletion and accumulation in different host cell compartments are discussed within the frame of WBD development. A model is suggested to explain phase transition as a synergic outcome of fungal-related factors released upon sensing of extracellular carbon starvation, and an early senescence of infected tissues probably triggered by intracellular sugar accumulation. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Developmental Science: Past, Present, and Future

Science.gov (United States)

Lerner, Richard M.

2012-01-01

The goal of developmental science is to describe, explain, and optimize intraindividual changes in adaptive developmental regulations and, as well, interindividual differences in such relations, across life. The history of developmental science is reviewed and its current foci, which are framed by relational developmental systems models that…

Developmental consequences of early parenting experiences: self-recognition and self-regulation in three cultural communities.

Science.gov (United States)

Keller, Heidi; Yovsi, Relindis; Borke, Joern; Kärtner, Joscha; Jensen, Henning; Papaligoura, Zaira

2004-01-01

This study relates parenting of 3-month-old children to children's self-recognition and self-regulation at 18 to 20 months. As hypothesized, observational data revealed differences in the sociocultural orientations of the 3 cultural samples' parenting styles and in toddlers' development of self-recognition and self-regulation. Children of Cameroonian Nso farmers who experience a proximal parenting style develop self-regulation earlier, children of Greek urban middle-class families who experience a distal parenting style develop self-recognition earlier, and children of Costa Rican middle-class families who experience aspects of both distal and proximal parenting styles fall between the other 2 groups on both self-regulation and self-recognition. Results are discussed with respect to their implications for culturally informed developmental pathways.

Suppression subtractive hybridization and comparative expression analysis to identify developmentally regulated genes in filamentous fungi.

Science.gov (United States)

Gesing, Stefan; Schindler, Daniel; Nowrousian, Minou

2013-09-01

Ascomycetes differentiate four major morphological types of fruiting bodies (apothecia, perithecia, pseudothecia and cleistothecia) that are derived from an ancestral fruiting body. Thus, fruiting body differentiation is most likely controlled by a set of common core genes. One way to identify such genes is to search for genes with evolutionary conserved expression patterns. Using suppression subtractive hybridization (SSH), we selected differentially expressed transcripts in Pyronema confluens (Pezizales) by comparing two cDNA libraries specific for sexual and for vegetative development, respectively. The expression patterns of selected genes from both libraries were verified by quantitative real time PCR. Expression of several corresponding homologous genes was found to be conserved in two members of the Sordariales (Sordaria macrospora and Neurospora crassa), a derived group of ascomycetes that is only distantly related to the Pezizales. Knockout studies with N. crassa orthologues of differentially regulated genes revealed a functional role during fruiting body development for the gene NCU05079, encoding a putative MFS peptide transporter. These data indicate conserved gene expression patterns and a functional role of the corresponding genes during fruiting body development; such genes are candidates of choice for further functional analysis. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Specific microRNAs Regulate Heat Stress Responses in Caenorhabditis elegans

DEFF Research Database (Denmark)

Nehammer, Camilla; Podolska, Agnieszka; Mackowiak, Sebastian D

2015-01-01

have identified additional functions for already known players (mir-71 and mir-239) as well as identifying mir-80 and the mir-229 mir-64-66 cluster as important regulators of the heat stress response in C. elegans. These findings uncover an additional layer of complexity to the regulation of stress...... to heat stress in Caenorhabditis elegans and show that a discrete subset of miRNAs is thermoregulated. Using in-depth phenotypic analyses of miRNA deletion mutant strains we reveal multiple developmental and post-developmental survival and behavioral functions for specific miRNAs during heat stress. We...

Dynamic regulation of mRNA and miRNA associated with the developmental stages of skin pigmentation in Japanese ornamental carp.

Science.gov (United States)

Tian, Xue; Pang, Xiaolei; Wang, Liangyan; Li, Mengrong; Dong, Chuanju; Ma, Xiao; Wang, Lei; Song, Dongying; Feng, Jianxin; Xu, Peng; Li, Xuejun

2018-04-20

The Japanese ornamental carp (Cyprinus carpio var. Koi) is famous for multifarious colors and patterns, making it commonly culture and trade across the world. Although functional genes and inheritance of color traits have been commonly studied, seldom attentions were focused on the genetic regulation during the developmental process of pigmentation. To better understand the mechanism of skin color development, we observed the morphogenesis of pigment cells during the post-embryonic stages and analysed the temporal expression pattern of mRNAs/miRNAs profiles in four distinct developmental stages. 59 and 103 differentially expressed genes/miRNAs (DEGs/DEMs) associated with pigmentation and skin were identified, including pax7, mitf, tyr, tyrp1, etc., and the highest DEGs were detected at 11 days post hatching (dph). In addition, the functional characteristics of mRNAs/miRNAs associated with pteridine and carotenoid pathway were also examined. Furthermore, 65 miRNA-mRNA interaction pairs related to pigmentation, pteridines and carotenoids metabolism were detected between different stages. Interestingly, the largest pairs appeared in the transition from 11 dph to 48 dph, which had the similar trend with DEGs further manifesting the importance of 11 dph. This study produced a comprehensive programme of DEGs/DEMs during color development, which will provide resources to understand the regulation mechanism in color formation. The understanding of genetic basis in color formation might promote the production and breeding of the Koi carp. Copyright © 2017. Published by Elsevier B.V.

Light-regulated leaf expansion in two Populus species: dependence on developmentally controlled ion transport.

Science.gov (United States)

Stiles, Kari A; Van Volkenburgh, Elizabeth

2002-07-01

Leaf growth responses to light have been compared in two species of Populus, P. deltoides and P. trichocarpa. These species differ markedly in morphology, anatomy, and dependence on light during leaf expansion. Light stimulates the growth rate and acidification of cell walls in P. trichocarpa but not in P. deltoides, whereas leaves of P. deltoides maintain growth in the dark. Light-induced growth is promoted in P. deltoides when cells are provided 50-100 mM KCl. In both species, light initially depolarizes, then hyperpolarizes mesophyll plasma membranes. However, in the dark, the resting E(m) of mesophyll cells in P. deltoides, but not in P. trichocarpa, is relatively insensitive to decade changes in external [K+]. Results suggest that light-stimulated leaf growth depends on developmentally regulated cellular mechanisms controlling ion fluxes across the plasma membrane. These developmental differences underlie species-level differences in growth and physiological responses to the photoenvironment.

Identification, functional characterization and developmental regulation of sesquiterpene synthases from sunflower capitate glandular trichomes

Directory of Open Access Journals (Sweden)

Ro Dae-Kyun

2009-07-01

Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes

Identifying the Physical Fitness, Anthropometric and Athletic Movement Qualities Discriminant of Developmental Level in Elite Junior Australian Football: Implications for the Development of Talent.

Science.gov (United States)

Gaudion, Sarah L; Doma, Kenji; Sinclair, Wade; Banyard, Harry G; Woods, Carl T

2017-07-01

Gaudion, SL, Doma, K, Sinclair, W, Banyard, HG, and Woods, CT. Identifying the physical fitness, anthropometric and athletic movement qualities discriminant of developmental level in elite junior Australian football: implications for the development of talent. J Strength Cond Res 31(7): 1830-1839, 2017-This study aimed to identify the physical fitness, anthropometric and athletic movement qualities discriminant of developmental level in elite junior Australian football (AF). From a total of 77 players, 2 groups were defined according to their developmental level; under 16 (U16) (n = 40, 15.6 to 15.9 years), and U18 (n = 37, 17.1 to 17.9 years). Players performed a test battery consisting of 7 physical fitness assessments, 2 anthropometric measurements, and a fundamental athletic movement assessment. A multivariate analysis of variance tested the main effect of developmental level (2 levels: U16 and U18) on the assessment criterions, whilst binary logistic regression models and receiver operating characteristic (ROC) curves were built to identify the qualities most discriminant of developmental level. A significant effect of developmental level was evident on 9 of the assessments (d = 0.27-0.88; p ≤ 0.05). However, it was a combination of body mass, dynamic vertical jump height (nondominant leg), repeat sprint time, and the score on the 20-m multistage fitness test that provided the greatest association with developmental level (Akaike's information criterion = 80.84). The ROC curve was maximized with a combined score of 180.7, successfully discriminating 89 and 60% of the U18 and U16 players, respectively (area under the curve = 79.3%). These results indicate that there are distinctive physical fitness and anthropometric qualities discriminant of developmental level within the junior AF talent pathway. Coaches should consider these differences when designing training interventions at the U16 level to assist with the development of prospective U18 AF players.

Identifying the Correlates and Barriers of Future Planning among Parents of Individuals with Intellectual and Developmental Disabilities

Science.gov (United States)

Burke, Meghan; Arnold, Catherine; Owen, Aleksa

2018-01-01

Although individuals with intellectual and developmental disabilities (IDD) are living longer lives, fewer than half of parents of individuals with IDD conduct future planning. The correlates and barriers to future planning must be identified to develop targeted interventions to facilitate future planning. In this study, 388 parents of individuals…

Parents' evaluation of developmental status: how well do parents' concerns identify children with behavioral and emotional problems?

Science.gov (United States)

Glascoe, Frances Page

2003-03-01

This study was undertaken to determine which parental concerns are most associated with significant behavioral/emotional problems and the extent to which parents' concerns can be depended on in the detection of mental health problems. An additional goal is to view how well a recently published screening test relying on parents' concerns, Parents' Evaluation of Developmental Status (PEDS), detects behavioral and emotional problems. Subjects were a national sample of 472 parents and their children (21 months to 8 years old) who were participants in 1 of 2 test standardization and validation studies. Sites included various pediatric settings, public schools, and Head Start programs in 5 diverse geographic locations. Subjects were representative of U.S. demographics in terms of ethnicity, parental level of education, gender, and socioeconomic status. At each site, psychological examiners, educational diagnosticians, or school psychologists recruited families, and obtained informed consent. Examiners disseminated a demographics questionnaire (in English or Spanish) and a developmental screening test that relies on parents' concerns (PEDS). Examiners were blinded to PEDS' scoring and interpretation administered either by interview or in writing, the Eyberg Child Behavior Inventory (ECBI) or the Possible Problems Checklist (PPC), a subtest of the Child Development Inventory that includes items measuring emotional well-being and behavioral self-control. PEDS was used to sort children into risk for developmental disabilities according to various types of parental concern. Those identified as having high or moderate risk were nominated for diagnostic testing or screening followed by developmental and mental health services when indicated. Because their emotional and behavioral needs would have been identified and addressed, these groups were removed from the analysis (N = 177). Of the 295 children who would not have been nominated for further scrutiny on PEDS due to their

Regulation of Life Cycle Checkpoints and Developmental Activation of Infective Larvae in Strongyloides stercoralis by Dafachronic Acid.

Directory of Open Access Journals (Sweden)

Mennatallah M Y Albarqi

2016-01-01

Full Text Available The complex life cycle of the parasitic nematode Strongyloides stercoralis leads to either developmental arrest of infectious third-stage larvae (iL3 or growth to reproductive adults. In the free-living nematode Caenorhabditis elegans, analogous determination between dauer arrest and reproductive growth is governed by dafachronic acids (DAs, a class of steroid hormones that are ligands for the nuclear hormone receptor DAF-12. Biosynthesis of DAs requires the cytochrome P450 (CYP DAF-9. We tested the hypothesis that DAs also regulate S. stercoralis development via DAF-12 signaling at three points. First, we found that 1 μM Δ7-DA stimulated 100% of post-parasitic first-stage larvae (L1s to develop to free-living adults instead of iL3 at 37°C, while 69.4±12.0% (SD of post-parasitic L1s developed to iL3 in controls. Second, we found that 1 μM Δ7-DA prevented post-free-living iL3 arrest and stimulated 85.2±16.9% of larvae to develop to free-living rhabditiform third- and fourth-stages, compared to 0% in the control. This induction required 24-48 hours of Δ7-DA exposure. Third, we found that the CYP inhibitor ketoconazole prevented iL3 feeding in host-like conditions, with only 5.6±2.9% of iL3 feeding in 40 μM ketoconazole, compared to 98.8±0.4% in the positive control. This inhibition was partially rescued by Δ7-DA, with 71.2±16.4% of iL3 feeding in 400 nM Δ7-DA and 35 μM ketoconazole, providing the first evidence of endogenous DA production in S. stercoralis. We then characterized the 26 CYP-encoding genes in S. stercoralis and identified a homolog with sequence and developmental regulation similar to DAF-9. Overall, these data demonstrate that DAF-12 signaling regulates S. stercoralis development, showing that in the post-parasitic generation, loss of DAF-12 signaling favors iL3 arrest, while increased DAF-12 signaling favors reproductive development; that in the post-free-living generation, absence of DAF-12 signaling is crucial for

A single cis element maintains repression of the key developmental regulator Gata2.

Directory of Open Access Journals (Sweden)

Jonathan W Snow

2010-09-01

Full Text Available In development, lineage-restricted transcription factors simultaneously promote differentiation while repressing alternative fates. Molecular dissection of this process has been challenging as transcription factor loci are regulated by many trans-acting factors functioning through dispersed cis elements. It is not understood whether these elements function collectively to confer transcriptional regulation, or individually to control specific aspects of activation or repression, such as initiation versus maintenance. Here, we have analyzed cis element regulation of the critical hematopoietic factor Gata2, which is expressed in early precursors and repressed as GATA-1 levels rise during terminal differentiation. We engineered mice lacking a single cis element -1.8 kb upstream of the Gata2 transcriptional start site. Although Gata2 is normally repressed in late-stage erythroblasts, the -1.8 kb mutation unexpectedly resulted in reactivated Gata2 transcription, blocked differentiation, and an aberrant lineage-specific gene expression pattern. Our findings demonstrate that the -1.8 kb site selectively maintains repression, confers a specific histone modification pattern and expels RNA Polymerase II from the locus. These studies reveal how an individual cis element establishes a normal developmental program via regulating specific steps in the mechanism by which a critical transcription factor is repressed.

Identifying Gender-Specific Developmental Trajectories of Nonviolent and Violent Delinquency from Adolescence to Young Adulthood

Science.gov (United States)

Zheng, Yao; Cleveland, H. Harrington

2013-01-01

Most research examining gender differences in developmental trajectories of antisocial behavior does not consider subtypes of antisocial behavior and is difficult to generalize due to small nonrepresentative samples. The current study investigated gender difference in developmental trajectories from adolescence to young adulthood while addressing those limitations. Analyses were limited to respondents ages 15 and 16 in wave 1 (16–17 in wave 2, and 21–22 in wave 3) of the National Longitudinal Study of Adolescent Health (n = 6244, 49.5% males). Self-report nonviolent and violent delinquencies were simultaneously entered into latent class analysis. Four latent classes were identified: low, desister, decliner, and chronic (male-only). In addition to finding a male-specific chronic class, gender differences included differences in levels of nonviolent and violent delinquency between synonymous classes of males and females, and differences in prevalence of classes across genders. Neighborhood disadvantage and family support predicted trajectories. PMID:23375843

Mas-allatotropin in the developing antennal lobe of the sphinx moth Manduca sexta: distribution, time course, developmental regulation, and colocalization with other neuropeptides.

Science.gov (United States)

Utz, Sandra; Huetteroth, Wolf; Vömel, Matthias; Schachtner, Joachim

2008-01-01

The paired antennal lobes (ALs) of the sphinx moth Manduca sexta serve as a well-established model for studying development of the primary integration centers for odor information in the brain. To further reveal the role of neuropeptides during AL development, we have analyzed cellular distribution, developmental time course, and regulation of the neuropeptide M. sexta allatotropin (Mas-AT). On the basis of morphology and appearance during AL formation, seven major types of Mas-AT-immunoreactive (ir) cells could be distinguished. Mas-AT-ir cells are identified as local, projection, and centrifugal neurons, which are either persisting larval or newly added adult-specific neurons. Complementary immunostaining with antisera against two other neuropeptide families (A-type allatostatins, RFamides) revealed colocalization within three of the Mas-AT-ir cell types. On the basis of this neurochemistry, the most prominent type of Mas-AT-ir neurons, the local AT neurons (LATn), could be divided in three subpopulations. The appearance of the Mas-AT-ir cell types occurring during metamorphosis parallels the rising titer of the developmental hormone 20-hydroxyecdysone (20E). Artificially shifting the 20E titer to an earlier developmental time point resulted in the precocious occurrence of Mas-AT immunostaining. This result supports the hypothesis that the pupal rise of 20E is causative for Mas-AT expression during AL development. Comparing localization and developmental time course of Mas-AT and other neuropeptides with the time course of AL formation suggests various functions for these neuropeptides during development, including an involvement in the formation of the olfactory glomeruli.

Identification and Transcription Profiling of NDUFS8 in Aedes taeniorhynchus (Diptera: Culicidae): Developmental Regulation and Environmental Response

Science.gov (United States)

2014-12-18

Identification and transcription profiling of NDUFS8 in Aedes taeniorhynchus (Diptera: Culicidae): developmental regulation and environmental response...7205 Email lmzhao@ufl.edu Abstract: The cDNA of a NADH dehydrogenase-ubiquinone Fe-S protein 8 subunit (NDUFS8) gene from Aedes (Ochlerotatus...information useful for developing dsRNA pesticide for mosquito control. Keywords: Aedes taeniorhynchus, AetNDUFS8, mRNA expression, development

Developmental control of hypoxia during bud burst in grapevine.

Science.gov (United States)

Meitha, Karlia; Agudelo-Romero, Patricia; Signorelli, Santiago; Gibbs, Daniel J; Considine, John A; Foyer, Christine H; Considine, Michael J

2018-05-01

Dormant or quiescent buds of woody perennials are often dense and in the case of grapevine (Vitis vinifera L.) have a low tissue oxygen status. The precise timing of the decision to resume growth is difficult to predict, but once committed, the increase in tissue oxygen status is rapid and developmentally regulated. Here, we show that more than a third of the grapevine homologues of widely conserved hypoxia-responsive genes and nearly a fifth of all grapevine genes possessing a plant hypoxia-responsive promoter element were differentially regulated during bud burst, in apparent harmony with resumption of meristem identity and cell-cycle gene regulation. We then investigated the molecular and biochemical properties of the grapevine ERF-VII homologues, which in other species are oxygen labile and function in transcriptional regulation of hypoxia-responsive genes. Each of the 3 VvERF-VIIs were substrates for oxygen-dependent proteolysis in vitro, as a function of the N-terminal cysteine. Collectively, these data support an important developmental function of oxygen-dependent signalling in determining the timing and effective coordination bud burst in grapevine. In addition, novel regulators, including GASA-, TCP-, MYB3R-, PLT-, and WUS-like transcription factors, were identified as hallmarks of the orderly and functional resumption of growth following quiescence in buds. © 2018 John Wiley & Sons Ltd.

Developmental regulation of voltage-sensitive sodium channels in rat skeletal muscle

International Nuclear Information System (INIS)

Sherman, S.J.

1985-01-01

The developmental regulation of the voltage-sensitive Na + channel in rat skeletal muscle was studied in vivo and in vitro. In triceps surae muscle developing in vivo the development of TTX-sensitive Na + channel occurred primarily during the first three postnatal weeks as determined by the specific binding of [ 3 H]saxitoxin. This development proceeded in two separate phases. The first phase occurs independently of continuing motor neuron innervation and accounts for 60% of the adult density of TTX-sensitive Na + channels. The second phase, which begins about day 11, requires innervation. Muscle cells in primary culture were found to have both TTX-sensitive and insensitive Na + channels. The development of the TTX-sensitive channel, in vitro, paralleled the initial innervation-independent phase of development observed in vivo. The density of TTX-sensitive Na + channels in cultured muscle cells was regulated by electrical activity and cytosolic Ca ++ levels. Pharmacological blockade of the spontaneous electrical activity present in these cells lead to a nearly 2-fold increase in the surface density of TTX-sensitive channels. The turnover time of the TTX-sensitive Na + channel was measured by blocking the incorporation of newly synthesized channels with tunicamycin, an inhibitor of N-linked protein glycosylation. The regulation of channel density by electrical activity, cytosolic Ca ++ levels, and agents affecting cyclic neucleotide levels had no effect on the turnover time of the TTX-sensitive Na + channel, indicating that these regulatory agents instead affect the synthesis of the channel

Developmental transitions in Arabidopsis are regulated by antisense RNAs resulting from bidirectionally transcribed genes.

Science.gov (United States)

Krzyczmonik, Katarzyna; Wroblewska-Swiniarska, Agata; Swiezewski, Szymon

2017-07-03

Transcription terminators are DNA elements located at the 3' end of genes that ensure efficient cleavage of nascent RNA generating the 3' end of mRNA, as well as facilitating disengagement of elongating DNA-dependent RNA polymerase II. Surprisingly, terminators are also a potent source of antisense transcription. We have recently described an Arabidopsis antisense transcript originating from the 3' end of a master regulator of Arabidopsis thaliana seed dormancy DOG1. In this review, we discuss the broader implications of our discovery in light of recent developments in yeast and Arabidopsis. We show that, surprisingly, the key features of terminators that give rise to antisense transcription are preserved between Arabidopsis and yeast, suggesting a conserved mechanism. We also compare our discovery to known antisense-based regulatory mechanisms, highlighting the link between antisense-based gene expression regulation and major developmental transitions in plants.

Ultraconservation identifies a small subset of extremely constrained developmental enhancers

Energy Technology Data Exchange (ETDEWEB)

Pennacchio, Len A.; Visel, Axel; Prabhakar, Shyam; Akiyama, Jennifer A.; Shoukry, Malak; Lewis, Keith D.; Holt, Amy; Plajzer-Frick, Ingrid; Afzal, Veena; Rubin, Edward M.; Pennacchio, Len A.

2007-10-01

While experimental studies have suggested that non-coding ultraconserved DNA elements are central nodes in the regulatory circuitry that specifies mammalian embryonic development, the possible functional relevance of their>200bp of perfect sequence conservation between human-mouse-rat remains obscure 1,2. Here we have compared the in vivo enhancer activity of a genome-wide set of 231 non-exonic sequences with ultraconserved cores to that of 206 sequences that are under equivalently severe human-rodent constraint (ultra-like), but lack perfect sequence conservation. In transgenic mouse assays, 50percent of the ultraconserved and 50percent of the ultra-like conserved elements reproducibly functioned as tissue-specific enhancers at embryonic day 11.5. In this in vivo assay, we observed that ultraconserved enhancers and constrained non-ultraconserved enhancers targeted expression to a similar spectrum of tissues with a particular enrichment in the developing central nervous system. A human genome-wide comparative screen uncovered ~;;2,600 non-coding elements that evolved under ultra-like human-rodent constraint and are similarly enriched near transcriptional regulators and developmental genes as the much smaller number of ultraconserved elements. These data indicate that ultraconserved elements possessing absolute human-rodent sequence conservation are not distinct from other non-coding elements that are under comparable purifying selection in mammals and suggest they are principal constituents of the cis-regulatory framework of mammalian development.

Regulatory RNA at the root of animals: dynamic expression of developmental lincRNAs in the calcisponge Sycon ciliatum.

Science.gov (United States)

Bråte, Jon; Adamski, Marcin; Neumann, Ralf S; Shalchian-Tabrizi, Kamran; Adamska, Maja

2015-12-22

Long non-coding RNAs (lncRNAs) play important regulatory roles during animal development, and it has been hypothesized that an RNA-based gene regulation was important for the evolution of developmental complexity in animals. However, most studies of lncRNA gene regulation have been performed using model animal species, and very little is known about this type of gene regulation in non-bilaterians. We have therefore analysed RNA-Seq data derived from a comprehensive set of embryogenesis stages in the calcareous sponge Sycon ciliatum and identified hundreds of developmentally expressed intergenic lncRNAs (lincRNAs) in this species. In situ hybridization of selected lincRNAs revealed dynamic spatial and temporal expression during embryonic development. More than 600 lincRNAs constitute integral parts of differentially expressed gene modules, which also contain known developmental regulatory genes, e.g. transcription factors and signalling molecules. This study provides insights into the non-coding gene repertoire of one of the earliest evolved animal lineages, and suggests that RNA-based gene regulation was probably present in the last common ancestor of animals. © 2015 The Authors.

I. DEVELOPMENTAL METHODOLOGY AS A CENTRAL SUBDISCIPLINE OF DEVELOPMENTAL SCIENCE.

Science.gov (United States)

Card, Noel A

2017-06-01

This first chapter introduces the main goals of the monograph and previews the remaining chapters. The goals of this monograph are to provide summaries of our current understanding of advanced developmental methodologies, provide information that can advance our understanding of human development, identify shortcomings in our understanding of developmental methodology, and serve as a flagpost for organizing developmental methodology as a subdiscipline within the broader field of developmental science. The remaining chapters in this monograph address issues in design (sampling and big data), longitudinal data analysis, and issues of replication and research accumulation. The final chapter describes the history of developmental methodology, considers how the previous chapters in this monograph fit within this subdiscipline, and offers recommendations for further advancement. © 2017 The Society for Research in Child Development, Inc.

Developmental changes in the metabolic network of snapdragon flowers.

Directory of Open Access Journals (Sweden)

Joëlle K Muhlemann

Full Text Available Evolutionary and reproductive success of angiosperms, the most diverse group of land plants, relies on visual and olfactory cues for pollinator attraction. Previous work has focused on elucidating the developmental regulation of pathways leading to the formation of pollinator-attracting secondary metabolites such as scent compounds and flower pigments. However, to date little is known about how flowers control their entire metabolic network to achieve the highly regulated production of metabolites attracting pollinators. Integrative analysis of transcripts and metabolites in snapdragon sepals and petals over flower development performed in this study revealed a profound developmental remodeling of gene expression and metabolite profiles in petals, but not in sepals. Genes up-regulated during petal development were enriched in functions related to secondary metabolism, fatty acid catabolism, and amino acid transport, whereas down-regulated genes were enriched in processes involved in cell growth, cell wall formation, and fatty acid biosynthesis. The levels of transcripts and metabolites in pathways leading to scent formation were coordinately up-regulated during petal development, implying transcriptional induction of metabolic pathways preceding scent formation. Developmental gene expression patterns in the pathways involved in scent production were different from those of glycolysis and the pentose phosphate pathway, highlighting distinct developmental regulation of secondary metabolism and primary metabolic pathways feeding into it.

Citrus fruit flavor and aroma biosynthesis: isolation, functional characterization, and developmental regulation of Cstps1, a key gene in the production of the sesquiterpene aroma compound valencene.

Science.gov (United States)

Sharon-Asa, Liat; Shalit, Moshe; Frydman, Ahuva; Bar, Einat; Holland, Doron; Or, Etti; Lavi, Uri; Lewinsohn, Efraim; Eyal, Yoram

2003-12-01

Citrus fruits possess unique aromas rarely found in other fruit species. While fruit flavor is composed of complex combinations of soluble and volatile compounds, several low-abundance sesquiterpenes, such as valencene, nootkatone, alpha-sinensal, and beta-sinensal, stand out in citrus as important flavor and aroma compounds. The profile of terpenoid volatiles in various citrus species and their importance as aroma compounds have been studied in detail, but much is still lacking in our understanding of the physiological, biochemical, and genetic regulation of their production. Here, we report on the isolation, functional expression, and developmental regulation of Cstps1, a sesquiterpene synthase-encoding gene, involved in citrus aroma formation. The recombinant enzyme encoded by Cstps1 was shown to convert farnesyl diphosphate to a single sesquiterpene product identified as valencene by gas chromatography-mass spectrometry (GC-MS). Phylogenetic analysis of plant terpene synthase genes localized Cstps1 to the group of angiosperm sesquiterpene synthases. Within this group, Cstps1 belongs to a subgroup of citrus sesquiterpene synthases. Cstps1 was found to be developmentally regulated: transcript was found to accumulate only towards fruit maturation, corresponding well with the timing of valencene accumulation in fruit. Although citrus fruits are non-climacteric, valencene accumulation and Cstps1 expression were found to be responsive to ethylene, providing further evidence for the role of ethylene in the final stages of citrus fruit ripening. Isolation of the gene encoding valencene synthase provides a tool for an in-depth study of the regulation of aroma compound biosynthesis in citrus and for metabolic engineering for fruit flavor characteristics.

Interpersonal Stress Regulation and the Development of Anxiety Disorders: An Attachment-Based Developmental Framework

Science.gov (United States)

Nolte, Tobias; Guiney, Jo; Fonagy, Peter; Mayes, Linda C.; Luyten, Patrick

2011-01-01

Anxiety disorders represent a common but often debilitating form of psychopathology in both children and adults. While there is a growing understanding of the etiology and maintenance of these disorders across various research domains, only recently have integrative accounts been proposed. While classical attachment history has been a traditional core construct in psychological models of anxiety, contemporary attachment theory has the potential to integrate neurobiological and behavioral findings within a multidisciplinary developmental framework. The current paper proposes a modern attachment theory-based developmental model grounded in relevant literature from multiple disciplines including social neuroscience, genetics, neuroendocrinology, and the study of family factors involved in the development of anxiety disorders. Recent accounts of stress regulation have highlighted the interplay between stress, anxiety, and activation of the attachment system. This interplay directly affects the development of social–cognitive and mentalizing capacities that are acquired in the interpersonal context of early attachment relationships. Early attachment experiences are conceptualized as the key organizer of a complex interplay between genetic, environmental, and epigenetic contributions to the development of anxiety disorders – a multifactorial etiology resulting from dysfunctional co-regulation of fear and stress states. These risk-conferring processes are characterized by hyperactivation strategies in the face of anxiety. The cumulative allostatic load and subsequent “wear and tear” effects associated with hyperactivation strategies converge on the neural pathways of anxiety and stress. Attachment experiences further influence the development of anxiety as potential moderators of risk factors, differentially impacting on genetic vulnerability and relevant neurobiological pathways. Implications for further research and potential treatments are outlined. PMID

Characterization of cucurbita maxima phloem serpin-1 (CmPS-1). A developmentally regulated elastase inhibitor.

Science.gov (United States)

Yoo, B C; Aoki, K; Xiang, Y; Campbell, L R; Hull, R J; Xoconostle-Cázares, B; Monzer, J; Lee, J Y; Ullman, D E; Lucas, W J

2000-11-10

We report on the molecular, biochemical, and functional characterization of Cucurbita maxima phloem serpin-1 (CmPS-1), a novel 42-kDa serine proteinase inhibitor that is developmentally regulated and has anti-elastase properties. CmPS-1 was purified to near homogeneity from C. maxima (pumpkin) phloem exudate and, based on microsequence analysis, the cDNA encoding CmPS-1 was cloned. The association rate constant (k(a)) of phloem-purified and recombinant His(6)-tagged CmPS-1 for elastase was 3.5 +/- 1.6 x 10(5) and 2.7 +/- 0.4 x 10(5) m(-)(1) s(-)(1), respectively. The fraction of complex-forming CmPS-1, X(inh), was estimated at 79%. CmPS-1 displayed no detectable inhibitory properties against chymotrypsin, trypsin, or thrombin. The elastase cleavage sites within the reactive center loop of CmPS-1 were determined to be Val(347)-Gly(348) and Val(350)-Ser(351) with a 3:2 molar ratio. In vivo feeding assays conducted with the piercing-sucking aphid, Myzus persicae, established a close correlation between the developmentally regulated increase in CmPS-1 within the phloem sap and the reduced ability of these insects to survive and reproduce on C. maxima. However, in vitro feeding experiments, using purified phloem CmPS-1, failed to demonstrate a direct effect on aphid survival. Likely roles of this novel phloem serpin in defense against insects/pathogens are discussed.

Developmental toxicology: adequacy of current methods.

Science.gov (United States)

Peters, P W

1998-01-01

Toxicology embraces several disciplines such as carcinogenicity, mutagenicity and reproductive toxicity. Reproductive toxicology is concerned with possible effects of substances on the reproductive process, i.e. on sexual organs and their functions, endocrine regulation, fertilization, transport of the fertilized ovum, implantation, and embryonic, fetal and postnatal development, until the end-differentiation of the organs is achieved. Reproductive toxicology is divided into areas related to male and female fertility, and developmental toxicology. Developmental toxicology can be further broken down into prenatal and postnatal toxicology. Today, much new information is available about the origins of developmental disorders resulting from chemical exposure. While these findings seem to promise important new developments in methodology and research, there is a danger of losing sight of the precepts and principles established in the light of existing knowledge. There is also a danger that we may fail to correct shortcomings in our existing procedures and practice. The aim of this presentation is to emphasize the importance of testing substances for their impact in advance of their use and to underline that we must use the best existing tools for carrying out risk assessments. Moreover, it needs to be stressed that there are many substances that are never assessed with respect to reproductive and developmental toxicity. Similarly, our programmes for post-marketing surveillance with respect to developmental toxicology are grossly inadequate. Our ability to identify risks to normal development and reproduction would be much improved, first if a number of straightforward precepts were always followed and second, if we had a clearer understanding of what we mean by risk and acceptable levels of risk in the context of development. Other aims of this paper are: to stress the complexity of the different stages of normal prenatal development; to note the principles that are

Mustn1: A Developmentally Regulated Pan-Musculoskeletal Cell Marker and Regulatory Gene

Directory of Open Access Journals (Sweden)

Michael Hadjiargyrou

2018-01-01

Full Text Available The Mustn1 gene encodes a small nuclear protein (~9.6 kDa that does not belong to any known family. Its genomic organization consists of three exons interspersed by two introns and it is highly homologous across vertebrate species. Promoter analyses revealed that its expression is regulated by the AP family of transcription factors, especially c-Fos, Fra-2 and JunD. Mustn1 is predominantly expressed in the major tissues of the musculoskeletal system: bone, cartilage, skeletal muscle and tendon. Its expression has been associated with normal embryonic development, postnatal growth, exercise, and regeneration of bone and skeletal muscle. Moreover, its expression has also been detected in various musculoskeletal pathologies, including arthritis, Duchenne muscular dystrophy, other skeletal muscle myopathies, clubfoot and diabetes associated muscle pathology. In vitro and in vivo functional perturbation revealed that Mustn1 is a key regulatory molecule in myogenic and chondrogenic lineages. This comprehensive review summarizes our current knowledge of Mustn1 and proposes that it is a new developmentally regulated pan-musculoskeletal marker as well as a key regulatory protein for cell differentiation and tissue growth.

[Diagnostic evaluation of the developmental level in children identified at risk of delay through the Child Development Evaluation Test].

Science.gov (United States)

Rizzoli-Córdoba, Antonio; Campos-Maldonado, Martha Carmen; Vélez-Andrade, Víctor Hugo; Delgado-Ginebra, Ismael; Baqueiro-Hernández, César Iván; Villasís-Keever, Miguel Ángel; Reyes-Morales, Hortensia; Ojeda-Lara, Lucía; Davis-Martínez, Erika Berenice; O'Shea-Cuevas, Gabriel; Aceves-Villagrán, Daniel; Carrasco-Mendoza, Joaquín; Villagrán-Muñoz, Víctor Manuel; Halley-Castillo, Elizabeth; Sidonio-Aguayo, Beatriz; Palma-Tavera, Josuha Alexander; Muñoz-Hernández, Onofre

The Child Development Evaluation (or CDE Test) was developed in Mexico as a screening tool for child developmental problems. It yields three possible results: normal, slow development or risk of delay. The modified version was elaborated using the information obtained during the validation study but its properties according to the base population are not known. The objective of this work was to establish diagnostic confirmation of developmental delay in children 16- to 59-months of age previously identified as having risk of delay through the CDE Test in primary care facilities. A population-based cross-sectional study was conducted in one Mexican state. CDE test was administered to 11,455 children 16- to 59-months of age from December/2013 to March/2014. The eligible population represented the 6.2% of the children (n=714) who were identified at risk of delay through the CDE Test. For inclusion in the study, a block randomization stratified by sex and age group was performed. Each participant included in the study had a diagnostic evaluation using the Battelle Development Inventory, 2 nd edition. From the 355 participants included with risk of delay, 65.9% were male and 80.2% were from rural areas; 6.5% were false positives (Total Development Quotient ˃90) and 6.8% did not have any domain with delay (Domain Developmental Quotient <80). The proportion of delay for each domain was as follows: communication 82.5%; cognitive 80.8%; social-personal 33.8%; motor 55.5%; and adaptive 41.7%. There were significant differences in the percentages of delay both by age and by domain/subdomain evaluated. In 93.2% of the participants, developmental delay was corroborated in at least one domain evaluated. Copyright © 2015 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.

CFP1 Regulates Histone H3K4 Trimethylation and Developmental Potential in Mouse Oocytes

Directory of Open Access Journals (Sweden)

Chao Yu

2017-08-01

Full Text Available Trimethylation of histone H3 at lysine-4 (H3K4me3 is associated with eukaryotic gene promoters and poises their transcriptional activation during development. To examine the in vivo function of H3K4me3 in the absence of DNA replication, we deleted CXXC finger protein 1 (CFP1, the DNA-binding subunit of the SETD1 histone H3K4 methyltransferase, in developing oocytes. We find that CFP1 is required for H3K4me3 accumulation and the deposition of histone variants onto chromatin during oocyte maturation. Decreased H3K4me3 in oocytes caused global downregulation of transcription activity. Oocytes lacking CFP1 failed to complete maturation and were unable to gain developmental competence after fertilization, due to defects in cytoplasmic lattice formation, meiotic division, and maternal-zygotic transition. Our study highlights the importance of H3K4me3 in continuous histone replacement for transcriptional regulation, chromatin remodeling, and normal developmental progression in a non-replicative system.

Interpersonal stress regulation and the development of anxiety disorders: an attachment-based developmental framework

Directory of Open Access Journals (Sweden)

Tobias eNolte

2011-09-01

Full Text Available Anxiety disorders represent a common but often debilitating form of psychopathology in both children and adults. While there is a growing understanding of the aetiology and maintainance of these disorders across various research domains, only recently have integrative accounts been proposed. While classical attachment history has been a traditional core construct in psychological models of anxiety, contemporary attachment theory has the potential to integrate neurobiological and behavioral findings within a multidisciplinary developmental framework.The current paper proposes a modern attachment theory-based developmental model grounded in relevant literature from multiple disciplines including social neuroscience, genetics, neuroendocrinology, and the study of family factors involved in the development of anxiety disorders. Recent accounts of stress regulation have highlighted the interplay between stress, anxiety and activation of the attachment system. This interplay directly affects the development of social cognitive and mentalizing capacities that are acquired in the interpersonal context of early attachment relationships. Early attachment experiences are conceptualised as the key organiser of a complex interplay between genetic, environmental and epigentic contributions to the development of anxiety disorders – a multifactorial aetiology resulting from dysfunctional co-regulation of fear and stress states. These risk-conferring processes are characterised by hyperactivation strategies in the face of anxiety.In the model, the cumulative allostatic load and subsequent wear and tear effects associated with hyperactivation strategies converge on the neural pathways of anxiety and stress. Attachment experiences further influence the development of anxiety as potential moderators of risk factors, differentially impacting on genetic vulnerability and relevant neurobiological pathways. Implications for further research and potential treatments

Transcriptomic analysis in the developing zebrafish embryo after compound exposure: Individual gene expression and pathway regulation

Energy Technology Data Exchange (ETDEWEB)

Hermsen, Sanne A.B., E-mail: Sanne.Hermsen@rivm.nl [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Department of Toxicogenomics, Maastricht University, P.O. Box 616, 6200 MD, Maastricht (Netherlands); Institute for Risk Assessment Sciences (IRAS), Utrecht University, P.O. Box 80.178, 3508 TD, Utrecht (Netherlands); Pronk, Tessa E. [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Department of Toxicogenomics, Maastricht University, P.O. Box 616, 6200 MD, Maastricht (Netherlands); Brandhof, Evert-Jan van den [Centre for Environmental Quality, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Ven, Leo T.M. van der [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Piersma, Aldert H. [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Institute for Risk Assessment Sciences (IRAS), Utrecht University, P.O. Box 80.178, 3508 TD, Utrecht (Netherlands)

2013-10-01

The zebrafish embryotoxicity test is a promising alternative assay for developmental toxicity. Classically, morphological assessment of the embryos is applied to evaluate the effects of compound exposure. However, by applying differential gene expression analysis the sensitivity and predictability of the test may be increased. For defining gene expression signatures of developmental toxicity, we explored the possibility of using gene expression signatures of compound exposures based on commonly expressed individual genes as well as based on regulated gene pathways. Four developmental toxic compounds were tested in concentration-response design, caffeine, carbamazepine, retinoic acid and valproic acid, and two non-embryotoxic compounds, D-mannitol and saccharin, were included. With transcriptomic analyses we were able to identify commonly expressed genes, which were mostly development related, after exposure to the embryotoxicants. We also identified gene pathways regulated by the embryotoxicants, suggestive of their modes of action. Furthermore, whereas pathways may be regulated by all compounds, individual gene expression within these pathways can differ for each compound. Overall, the present study suggests that the use of individual gene expression signatures as well as pathway regulation may be useful starting points for defining gene biomarkers for predicting embryotoxicity. - Highlights: • The zebrafish embryotoxicity test in combination with transcriptomics was used. • We explored two approaches of defining gene biomarkers for developmental toxicity. • Four compounds in concentration-response design were tested. • We identified commonly expressed individual genes as well as regulated gene pathways. • Both approaches seem suitable starting points for defining gene biomarkers.

Developmental programming: impact of prenatal testosterone excess on pre- and postnatal gonadotropin regulation in sheep.

Science.gov (United States)

Manikkam, Mohan; Thompson, Robert C; Herkimer, Carol; Welch, Kathleen B; Flak, Jonathan; Karsch, Fred J; Padmanabhan, Vasantha

2008-04-01

The goal of this study was to explore mechanisms that mediate hypersecretion of LH and progressive loss of cyclicity in female sheep exposed during fetal life to excess testosterone. Our working hypothesis was that prenatal testosterone excess, by its androgenic action, amplifies GnRH-induced LH (but not FSH) secretion and, thus, hypersecretion of LH in adulthood, and that this results from altered developmental gene expression of GnRH and estradiol (E2) receptors, gonadotropin subunits, and paracrine factors that differentially regulate LH and FSH synthesis. We observed that, relative to controls, females exposed during fetal life to excess testosterone, as well as the nor-aromatizable androgen dihydrotestosterone, exhibited enhanced LH but not FSH responses to intermittent delivery of GnRH boluses under conditions in which endogenous LH (GnRH) pulses were suppressed. Luteinizing hormone hypersecretion was more evident in adults than in prepubertal females, and it was associated with development of acyclicity. Measurement of pituitary mRNA concentrations revealed that prenatal testosterone excess induced developmental changes in gene expression of pituitary GnRH and E2 receptors and paracrine modulators of LH and FSH synthesis in a manner consistent with subsequent amplification of LH release. Together, this series of studies suggests that prenatal testosterone excess, by its androgenic action, amplifies GnRH-induced LH response, leading to LH hypersecretion and acyclicity in adulthood, and that this programming involves developmental changes in expression of pituitary genes involved in LH and FSH release.

Transcriptome profiles of embryos before and after cleavage in Eriocheir sinensis: identification of developmental genes at the earliest stages

Science.gov (United States)

Hui, Min; Cui, Zhaoxia; Liu, Yuan; Song, Chengwen

2017-07-01

In crab, embryogenesis is a complicated developmental program marked by a series of critical events. RNA-Sequencing technology offers developmental biologists a way to identify many more developmental genes than ever before. Here, we present a comprehensive analysis of the transcriptomes of Eriocheir sinensis oosperms (Os) and embryos at the 2-4 cell stage (Cs), which are separated by a cleavage event. A total of 18 923 unigenes were identified, and 403 genes matched with gene ontology (GO) terms related to developmental processes. In total, 432 differentially expressed genes (DEGs) were detected between the two stages. Nine DEGs were specifically expressed at only one stage. These DEGs may be relevant to stage-specific molecular events during development. A number of DEGs related to `hedgehog signaling pathway', `Wnt signaling pathway' `germplasm', `nervous system', `sensory perception' and `segment polarity' were identified as being up-regulated at the Cs stage. The results suggest that these embryonic developmental events begin before the early cleavage event in crabs, and that many of the genes expressed in the two transcriptomes might be maternal genes. Our study provides ample information for further research on the molecular mechanisms underlying crab development.

Initiating a Developmental Motor Skills Program for Identified Primary Students.

Science.gov (United States)

Harville, Valerie Terrill

A physical education specialist at an elementary school in one of the fastest growing sections of the country developed and implemented a developmental motor skills program for primary school students. The program focused on: (1) developing a method of referring students for testing; (2) providing a specialized motor diagnostic test; (3) improving…

Developmental and visual input-dependent regulation of the CB1 cannabinoid receptor in the mouse visual cortex.

Directory of Open Access Journals (Sweden)

Taisuke Yoneda

Full Text Available The mammalian visual system exhibits significant experience-induced plasticity in the early postnatal period. While physiological studies have revealed the contribution of the CB1 cannabinoid receptor (CB1 to developmental plasticity in the primary visual cortex (V1, it remains unknown whether the expression and localization of CB1 is regulated during development or by visual experience. To explore a possible role of the endocannabinoid system in visual cortical plasticity, we examined the expression of CB1 in the visual cortex of mice. We found intense CB1 immunoreactivity in layers II/III and VI. CB1 mainly localized at vesicular GABA transporter-positive inhibitory nerve terminals. The amount of CB1 protein increased throughout development, and the specific laminar pattern of CB1 appeared at P20 and remained until adulthood. Dark rearing from birth to P30 decreased the amount of CB1 protein in V1 and altered the synaptic localization of CB1 in the deep layer. Dark rearing until P50, however, did not influence the expression of CB1. Brief monocular deprivation for 2 days upregulated the localization of CB1 at inhibitory nerve terminals in the deep layer. Taken together, the expression and the localization of CB1 are developmentally regulated, and both parameters are influenced by visual experience.

A study looking at the effectiveness of developmental screening in identifying learning disabilities in early childhood.

Science.gov (United States)

Flanagan, O; Nualláin, S O

2001-05-01

This is a retrospective study of children under six years of age referred to the Brothers of Charity Early Intervention Services in County Galway, a service that caters for children under 6 years with learning disabilities. The aim in doing this study was to assess the value of routine developmental screening in identifying children with learning difficulties. This study also investigates the patterns and sources of referral to the remedial services provided by the Brothers of Charity and highlights possible avoidable delays in referral. The results showed that many children were referred for remedial services late. The reasons for late referral included late identification of some children with problems, insufficient co-ordination of community-based services and a lack of awareness of the importance of early intervention in some cases. As some communication disorders such as autism, autistic spectrum disorders and specific language delay may not express themselves until the later part of the second year of life, the 18-24 month developmental assessment is of vital importance. However identification of these disorders can present difficulties and may call for additional training for professionals involved in the developmental screening of children in that age group. The interval between initial identification and referral for remedial care in many cases was more than twelve months. We propose that, in order to minimize this time, children requiring a more in-depth assessment should be assessed by a community-based multidisciplinary team, enabling integrated assessment by the different disciplines and thus speedier referral to remedial services.

On the developmental and environmental regulation of secondary metabolism in Vaccinium spp. berries

Directory of Open Access Journals (Sweden)

Katja eKarppinen

2016-05-01

Full Text Available Secondary metabolites have important defense and signaling roles, and they contribute to the overall quality of developing and ripening fruits. Blueberries, bilberries, cranberries and other Vaccinium berries are fleshy berry fruits recognized for the high levels of bioactive compounds, especially anthocyanin pigments. Besides anthocyanins and other products of the phenylpropanoid and flavonoid pathways, these berries also contain other metabolites of interest, such as carotenoid derivatives, vitamins and flavor compounds. Recently, new information has been achieved on the mechanisms related with developmental, environmental and genetic factors involved in the regulation of secondary metabolism in Vaccinium fruits. Especially light conditions and temperature are demonstrated to have a prominent role on the composition of phenolic compounds. The present review focuses on the studies on mechanisms associated with the regulation of key secondary metabolites, mainly phenolic compounds, in Vaccinium berries. The advances in the research concerning biosynthesis of phenolic compounds in Vaccinium species, including specific studies with mutant genotypes in addition to controlled and field experiments on the genotype x environment (GxE interaction, are discussed. The recently published Vaccinium transcriptome and genome databases provide new tools for the studies on the metabolic routes.

Identifying state resources and support programs on e-government websites for persons with intellectual and developmental disabilities.

Science.gov (United States)

Fisher, Kathleen M; Peterson, Justin D; Albert, Jon D

2015-01-01

This descriptive cross-sectional study identified resources and programs that are available nationwide on the Internet to support individuals and families with intellectual and developmental disabilities (I/DD), with a focus on intellectual disability. This evaluation included easily identifiable information on specific resources and highlighted unique programs found in individual states that were linked from e-government websites. Researchers documented the ease of access and available information for all 50 states and the District of Columbia. A number of disparities and areas for improvement were recorded for states and I/DD websites. The researchers conclude that a number of additional health and support services will be needed to address the growing needs of this vulnerable population.

Ecdysone Control of Developmental Transitions

DEFF Research Database (Denmark)

Rewitz, Kim; Yamanaka, Naoki; O'Connor, Michael B.

2013-01-01

The steroid hormone ecdysone is the central regulator of insect developmental transitions. Recent new advances in our understanding of ecdysone action have relied heavily on the application of Drosophila melanogaster molecular genetic tools to study insect metamorphosis. In this review, we focus...... on three major aspects of Drosophila ecdysone biology: (a) factors that regulate the timing of ecdysone release, (b) molecular basis of stage- and tissue-specific responses to ecdysone, and (c) feedback regulation and coordination of ecdysone signaling....

Risk factors of ophthalmic disorders in children with developmental delay

DEFF Research Database (Denmark)

Sandfeld, L.N.; Jensen, H.; Skov, L.

2008-01-01

PURPOSE: To identify diagnoses that increase the risk of ophthalmic disorders in developmentally delayed children. METHODS: A cross-sectional study of 1126 Danish children with developmental delay (IQ Udgivelsesdato: 2008/12......PURPOSE: To identify diagnoses that increase the risk of ophthalmic disorders in developmentally delayed children. METHODS: A cross-sectional study of 1126 Danish children with developmental delay (IQ Udgivelsesdato: 2008/12...

Functional Analysis of Developmentally Regulated Genes chs7 and sec22 in the Ascomycete Sordaria macrospora.

Science.gov (United States)

Traeger, Stefanie; Nowrousian, Minou

2015-04-14

During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the generation and dispersal of spores. In previous studies, we identified genes with evolutionary conserved expression patterns during fruiting body formation in several fungal species. Here, we present the functional analysis of two developmentally up-regulated genes, chs7 and sec22, in the ascomycete Sordaria macrospora. The genes encode a class VII (division III) chitin synthase and a soluble N-ethylmaleimide-sensitive-factor attachment protein receptor (SNARE) protein, respectively. Deletion mutants of chs7 had normal vegetative growth and were fully fertile but showed sensitivity toward cell wall stress. Deletion of sec22 resulted in a reduced number of ascospores and in defects in ascospore pigmentation and germination, whereas vegetative growth was normal in the mutant. A SEC22-EGFP fusion construct under control of the native sec22 promoter and terminator regions was expressed during different stages of sexual development. Expression of several development-related genes was deregulated in the sec22 mutant, including three genes involved in melanin biosynthesis. Our data indicate that chs7 is dispensable for fruiting body formation in S. macrospora, whereas sec22 is required for ascospore maturation and germination and thus involved in late stages of sexual development. Copyright © 2015 Traeger and Nowrousian.

Abscisic acid induction of vacuolar H+-ATPase activity in mesembryanthemum crystallinum is developmentally regulated

Science.gov (United States)

Barkla; Vera-Estrella; Maldonado-Gama; Pantoja

1999-07-01

Abscisic acid (ABA) has been implicated as a key component in water-deficit-induced responses, including those triggered by drought, NaCl, and low- temperature stress. In this study a role for ABA in mediating the NaCl-stress-induced increases in tonoplast H+-translocating ATPase (V-ATPase) and Na+/H+ antiport activity in Mesembryanthemum crystallinum, leading to vacuolar Na+ sequestration, were investigated. NaCl or ABA treatment of adult M. crystallinum plants induced V-ATPase H+ transport activity, and when applied in combination, an additive effect on V-ATPase stimulation was observed. In contrast, treatment of juvenile plants with ABA did not induce V-ATPase activity, whereas NaCl treatment resulted in a similar response to that observed in adult plants. Na+/H+ antiport activity was induced in both juvenile and adult plants by NaCl, but ABA had no effect at either developmental stage. Results indicate that ABA-induced changes in V-ATPase activity are dependent on the plant reaching its adult phase, whereas NaCl-induced increases in V-ATPase and Na+/H+ antiport activity are independent of plant age. This suggests that ABA-induced V-ATPase activity may be linked to the stress-induced, developmentally programmed switch from C3 metabolism to Crassulacean acid metabolism in adult plants, whereas, vacuolar Na+ sequestration, mediated by the V-ATPase and Na+/H+ antiport, is regulated through ABA-independent pathways.

EMA: a developmentally regulated cell-surface glycoprotein of CNS neurons that is concentrated at the leading edge of growth cones.

Science.gov (United States)

Baumrind, N L; Parkinson, D; Wayne, D B; Heuser, J E; Pearlman, A L

1992-08-01

To identify cell-surface molecules that mediate interactions between neurons and their environment during neural development, we used monoclonal antibody techniques to define a developmentally regulated antigen in the central nervous system of the mouse. The antibody we produced (2A1) immunolabels cells throughout the central nervous system; we analyzed its distribution in the developing cerebral cortex, where it is expressed on cells very soon after they complete mitosis and leave the periventricular proliferative zone. Expression continues into adult life. The antibody also labels the epithelium of the choroid plexus and the renal proximal tubules, but does not label neurons of the peripheral nervous system in the dorsal root ganglia. In dissociated cell culture of embryonic cerebral cortex, 2A1 labels the surface of neurons but not glia. Immunolabeling of neurons in tissue culture is particularly prominent on the edge of growth cones, including filopodia and the leading edge of lamellipodia, when observed with either immunofluorescence or freeze-etch immunoelectron microscopy. Immunopurification with 2A1 of a CHAPS-extracted membrane preparation from brains of neonatal mice produces a broad (32-36 kD) electrophoretic band and a less prominent 70 kD band that are sensitive to N-glycosidase but not endoglycosidase H. Thus the 2A1 antibody recognizes a developmentally regulated, neuronal cell surface glycoprotein (or glycoproteins) with complex N-linked oligosaccharide side chains. We have termed the glycoprotein antigen EMA because of its prominence on the edge membrane of growth cones. EMA is similar to the M6 antigen (Lagenaur et al: J. Neurobiol. 23:71-88, 1992) in apparent molecular weight, distribution in tissue sections, and immunoreactivity on Western blots, suggesting that the two antigens are similar or identical. Expression of EMA is a very early manifestation of neuronal differentiation; its distribution on growth cones suggests a role in mediating the

TFIIS-Dependent Non-coding Transcription Regulates Developmental Genome Rearrangements.

Directory of Open Access Journals (Sweden)

Kamila Maliszewska-Olejniczak

2015-07-01

Full Text Available Because of their nuclear dimorphism, ciliates provide a unique opportunity to study the role of non-coding RNAs (ncRNAs in the communication between germline and somatic lineages. In these unicellular eukaryotes, a new somatic nucleus develops at each sexual cycle from a copy of the zygotic (germline nucleus, while the old somatic nucleus degenerates. In the ciliate Paramecium tetraurelia, the genome is massively rearranged during this process through the reproducible elimination of repeated sequences and the precise excision of over 45,000 short, single-copy Internal Eliminated Sequences (IESs. Different types of ncRNAs resulting from genome-wide transcription were shown to be involved in the epigenetic regulation of genome rearrangements. To understand how ncRNAs are produced from the entire genome, we have focused on a homolog of the TFIIS elongation factor, which regulates RNA polymerase II transcriptional pausing. Six TFIIS-paralogs, representing four distinct families, can be found in P. tetraurelia genome. Using RNA interference, we showed that TFIIS4, which encodes a development-specific TFIIS protein, is essential for the formation of a functional somatic genome. Molecular analyses and high-throughput DNA sequencing upon TFIIS4 RNAi demonstrated that TFIIS4 is involved in all kinds of genome rearrangements, including excision of ~48% of IESs. Localization of a GFP-TFIIS4 fusion revealed that TFIIS4 appears specifically in the new somatic nucleus at an early developmental stage, before IES excision. RT-PCR experiments showed that TFIIS4 is necessary for the synthesis of IES-containing non-coding transcripts. We propose that these IES+ transcripts originate from the developing somatic nucleus and serve as pairing substrates for germline-specific short RNAs that target elimination of their homologous sequences. Our study, therefore, connects the onset of zygotic non coding transcription to the control of genome plasticity in Paramecium

Effect of Developmental Stimulation Program on the Developmental Measures of Toddlers

Directory of Open Access Journals (Sweden)

Elahe Ghayebie

2018-04-01

Full Text Available Background: The variability in the developmental skills is reduced after the first three years of life; therefore, it is necessary to identify and manage early developmental delays. Aim: The aim of this study was to investigate the effect of developmental stimulation program on the developmental measures of the toddlers. Method: The present randomized controlled clinical trial was conducted on 31 toddlers aged 1-3 years residing at Ali Asghar Foster Care Center within 2016-2017. Developmental interventions were carried out based on the modified guidelines of West Virginia Early Learning Standards Framework for eight weeks (three 2-hour sessions a week. The interventions included a range of age- and developmental-specific activities described in the given guidelines. Child development age was measured based on motor dimensions (i.e., gross and fine and language development (i.e., receptive and expressive before and after the intervention. The data were analyzed in SPSS software (version 11 using independent t-test and Chi-square test. Results: The mean ages of the participants in the control and intervention groups were 19.9±5.5 and 20±6.02, respectively (P=0.62. The mean ages of receptive language development (P=0.003, expressive language development (P

An AICD-based functional screen to identify APP metabolism regulators

Directory of Open Access Journals (Sweden)

Lee Jeremy C

2007-08-01

Full Text Available Abstract Background A central event in Alzheimer's disease (AD is the regulated intramembraneous proteolysis of the β-amyloid precursor protein (APP, to generate the β-amyloid (Aβ peptide and the APP intracellular domain (AICD. Aβ is the major component of amyloid plaques and AICD displays transcriptional activation properties. We have taken advantage of AICD transactivation properties to develop a genetic screen to identify regulators of APP metabolism. This screen relies on an APP-Gal4 fusion protein, which upon normal proteolysis, produces AICD-Gal4. Production of AICD-Gal4 induces Gal4-UAS driven luciferase expression. Therefore, when regulators of APP metabolism are modulated, luciferase expression is altered. Results To validate this experimental approach we modulated α-, β-, and γ-secretase levels and activities. Changes in AICD-Gal4 levels as measured by Western blot analysis were strongly and significantly correlated to the observed changes in AICD-Gal4 mediated luciferase activity. To determine if a known regulator of APP trafficking/maturation and Presenilin1 endoproteolysis could be detected using the AICD-Gal4 mediated luciferase assay, we knocked-down Ubiquilin 1 and observed decreased luciferase activity. We confirmed that Ubiquilin 1 modulated AICD-Gal4 levels by Western blot analysis and also observed that Ubiquilin 1 modulated total APP levels, the ratio of mature to immature APP, as well as PS1 endoproteolysis. Conclusion Taken together, we have shown that this screen can identify known APP metabolism regulators that control proteolysis, intracellular trafficking, maturation and levels of APP and its proteolytic products. We demonstrate for the first time that Ubiquilin 1 regulates APP metabolism in the human neuroblastoma cell line, SH-SY5Y.

Human genetics as a tool to identify progranulin regulators.

Science.gov (United States)

Nicholson, Alexandra M; Finch, NiCole A; Rademakers, Rosa

2011-11-01

Frontotemporal lobar degeneration (FTLD) is a common neurodegenerative disorder that predominantly affects individuals under the age of 65. It is known that the most common pathological subtype is FTLD with TAR DNA-binding protein 43 inclusions (FTLD-TDP). FTLD has a strong genetic component with about 50% of cases having a positive family history. Mutations identified in the progranulin gene (GRN) have been shown to cause FTLD-TDP as a result of progranulin haploinsufficiency. These findings suggest a progranulin-dependent mechanism in this pathological FTLD subtype. Thus, identifying regulators of progranulin levels is essential for new therapies and treatments for FTLD and related disorders. In this review, we discuss the role of genetic studies in identifying progranulin regulators, beginning with the discovery of pathogenic GRN mutations and additional GRN risk variants. We also cover more recent genetic advances, including the detection of variants in the transmembrane protein 106 B gene that increase FTLD-TDP risk presumably by modulating progranulin levels and the identification of a potential progranulin receptor, sortilin. This review highlights the importance of genetic studies in the context of FTLD and further emphasizes the need for future genetic and cell biology research to continue the effort in finding a cure for progranulin-related diseases.

Evolutionary and developmental modules.

Science.gov (United States)

Lacquaniti, Francesco; Ivanenko, Yuri P; d'Avella, Andrea; Zelik, Karl E; Zago, Myrka

2013-01-01

The identification of biological modules at the systems level often follows top-down decomposition of a task goal, or bottom-up decomposition of multidimensional data arrays into basic elements or patterns representing shared features. These approaches traditionally have been applied to mature, fully developed systems. Here we review some results from two other perspectives on modularity, namely the developmental and evolutionary perspective. There is growing evidence that modular units of development were highly preserved and recombined during evolution. We first consider a few examples of modules well identifiable from morphology. Next we consider the more difficult issue of identifying functional developmental modules. We dwell especially on modular control of locomotion to argue that the building blocks used to construct different locomotor behaviors are similar across several animal species, presumably related to ancestral neural networks of command. A recurrent theme from comparative studies is that the developmental addition of new premotor modules underlies the postnatal acquisition and refinement of several different motor behaviors in vertebrates.

A large-scale RNA interference screen identifies genes that regulate autophagy at different stages.

Science.gov (United States)

Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man; He, Bin; Zhang, Liqing; Varmark, Hanne; Green, Michael R; Sheng, Zhi

2018-02-12

Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed a large-scale RNA interference screen in K562 human chronic myeloid leukemia cells using monodansylcadaverine staining, an autophagy-detecting approach equivalent to immunoblotting of the autophagy marker LC3B or fluorescence microscopy of GFP-LC3B. By coupling monodansylcadaverine staining with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays revealed that 57 autophagy-regulating genes suppressed autophagy initiation, whereas 21 candidates promoted autophagy maturation. Our RNA interference screen identifies identified genes that regulate autophagy at different stages, which helps decode autophagy regulation in cancer and offers novel avenues to develop autophagy-related therapies for cancer.

The search for evolutionary developmental origins of aging in zebrafish: a novel intersection of developmental and senescence biology in the zebrafish model system.

Science.gov (United States)

Kishi, Shuji

2011-09-01

regulation. We wish to ascertain whether we can identify such genes promptly in a comprehensive manner. The ease of manipulation using the zebrafish system allows us to conduct an exhaustive exploration of novel genes and small molecular compounds that can be linked to the senescence phenotype and thereby facilitates searching for the evolutionary and developmental origins of aging in vertebrates. Copyright © 2011 Wiley-Liss, Inc.

Maturation, fertilisation and culture of bovine oocytes and embryos in an individually identifiable manner: a tool for studying oocyte developmental competence.

Science.gov (United States)

Matoba, Satoko; Fair, Trudee; Lonergan, Patrick

2010-01-01

The ability to successfully culture oocytes and embryos individually would facilitate the study of the relationship between follicle parameters and oocyte developmental competence, in order to identify markers of competent oocytes, as well as the ability to use small numbers of oocytes from an individual donor such as when ovum pick-up is carried out. Using a total of 3118 oocytes, the aim of the present study was to develop a system capable of supporting the development of immature bovine oocytes to the blastocyst stage in an individually identifiable manner. Initially, post-fertilisation embryo culture in the Well-of-the-Well (WOW) system, on the cell adhesive Cell-Tak or in polyester mesh was tested and shown to result in similar development to embryos cultured in standard group culture. The results demonstrate that it is possible to culture bovine oocytes to the blastocyst stage in an individually identifiable manner in all three culture systems with comparable success rates. This permits the localisation and identification of individual embryos throughout preimplantation development in vitro while retaining the developmental benefits of group culture. In terms of ease of preparation and use, culture in isolation within the strands of a polyester mesh is preferable.

Development of the language subtest in a developmental assessment scale to identify Chinese preschool children with special needs.

Science.gov (United States)

Wong, Anita M-Y; Leung, Cynthia; Siu, Elaine K-L; Lam, Catherine C-C; Chan, Grace P-S

2011-01-01

This study reports on the development of the language subtest in the Preschool Developmental Assessment Scale (PDAS) for Cantonese-Chinese speaking children. A pilot pool of 158 items covering the two language modalities and the three language domains was developed. This initial item set was subsequently revised based on Rasch analyses of data from 324 multi-stage randomly selected children between 3 and 6 years of age. The revised 106-item set demonstrated adequate measurement properties, including targeting and uni-dimensionality. The revised 106-item set successfully discriminated preschool children in the three age groups, and between preschool children and their age peers with special education needs (SEN). Results from this study support the collection of normative data from a larger population sample of children to examine its accuracy in identifying language impairment in children with SEN. Test development procedures reported in this study provide insight for the development of language subtests in multi-domain developmental assessment tools for children speaking other varieties of Chinese. Copyright © 2010 Elsevier Ltd. All rights reserved.

Role of developmental factors in hypothalamic function

Directory of Open Access Journals (Sweden)

Jakob eBiran

2015-04-01

Full Text Available The hypothalamus is a brain region which regulates homeostasis by mediating endocrine, autonomic and behavioral functions. It is comprised of several nuclei containing distinct neuronal populations producing neuropeptides and neurotransmitters that regulate fundamental body functions including temperature and metabolic rate, thirst and hunger, sexual behavior and reproduction, circadian rhythm, and emotional responses. The identity, number and connectivity of these neuronal populations are established during the organism’s development and are of crucial importance for normal hypothalamic function. Studies have suggested that developmental abnormalities in specific hypothalamic circuits can lead to obesity, sleep disorders, anxiety, depression and autism. At the molecular level, the development of the hypothalamus is regulated by transcription factors, secreted growth factors, neuropeptides and their receptors. Recent studies in zebrafish and mouse have demonstrated that some of these molecules maintain their expression in the adult brain and subsequently play a role in the physiological functions that are regulated by hypothalamic neurons. Here, we summarize the involvement of some of the key developmental factors in hypothalamic development and function by focusing on the mouse and zebrafish genetic model organisms.

Genetic screens to identify new Notch pathway mutants in Drosophila.

Science.gov (United States)

Giagtzoglou, Nikolaos

2014-01-01

Notch signaling controls a wide range of developmental processes, including proliferation, apoptosis, and cell fate specification during both development and adult tissue homeostasis. The functional versatility of the Notch signaling pathway is tightly linked with the complexity of its regulation in different cellular contexts. To unravel the complexity of Notch signaling, it is important to identify the different components of the Notch signaling pathway. A powerful strategy to accomplish this task is based on genetic screens. Given that the developmental context of signaling is important, these screens should be customized to specific cell populations or tissues. Here, I describe how to perform F1 clonal forward genetic screens in Drosophila to identify novel components of the Notch signaling pathway. These screens combine a classical EMS (ethyl methanesulfonate) chemical mutagenesis protocol along with clonal analysis via FRT-mediated mitotic recombination. These F1 clonal screens allow rapid phenotypic screening within clones of mutant cells induced at specific developmental stages and in tissues of interest, bypassing the pleiotropic effects of isolated mutations. More importantly, since EMS mutations have been notoriously difficult to map to specific genes in the past, I briefly discuss mapping methods that allow rapid identification of the causative mutations.

The silkworm (Bombyx mori microRNAs and their expressions in multiple developmental stages.

Directory of Open Access Journals (Sweden)

Xiaomin Yu

Full Text Available BACKGROUND: MicroRNAs (miRNAs play crucial roles in various physiological processes through post-transcriptional regulation of gene expressions and are involved in development, metabolism, and many other important molecular mechanisms and cellular processes. The Bombyx mori genome sequence provides opportunities for a thorough survey for miRNAs as well as comparative analyses with other sequenced insect species. METHODOLOGY/PRINCIPAL FINDINGS: We identified 114 non-redundant conserved miRNAs and 148 novel putative miRNAs from the B. mori genome with an elaborate computational protocol. We also sequenced 6,720 clones from 14 developmental stage-specific small RNA libraries in which we identified 35 unique miRNAs containing 21 conserved miRNAs (including 17 predicted miRNAs and 14 novel miRNAs (including 11 predicted novel miRNAs. Among the 114 conserved miRNAs, we found six pairs of clusters evolutionarily conserved cross insect lineages. Our observations on length heterogeneity at 5' and/or 3' ends of nine miRNAs between cloned and predicted sequences, and three mature forms deriving from the same arm of putative pre-miRNAs suggest a mechanism by which miRNAs gain new functions. Analyzing development-related miRNAs expression at 14 developmental stages based on clone-sampling and stem-loop RT PCR, we discovered an unusual abundance of 33 sequences representing 12 different miRNAs and sharply fluctuated expression of miRNAs at larva-molting stage. The potential functions of several stage-biased miRNAs were also analyzed in combination with predicted target genes and silkworm's phenotypic traits; our results indicated that miRNAs may play key regulatory roles in specific developmental stages in the silkworm, such as ecdysis. CONCLUSIONS/SIGNIFICANCE: Taking a combined approach, we identified 118 conserved miRNAs and 151 novel miRNA candidates from the B. mori genome sequence. Our expression analyses by sampling miRNAs and real-time PCR over

Analysis of a lin-42/period Null Allele Implicates All Three Isoforms in Regulation of Caenorhabditis elegans Molting and Developmental Timing

Directory of Open Access Journals (Sweden)

Theresa L. B. Edelman

2016-12-01

Full Text Available The Caenorhabditis elegans heterochronic gene pathway regulates the relative timing of events during postembryonic development. lin-42, the worm homolog of the circadian clock gene, period, is a critical element of this pathway. lin-42 function has been defined by a set of hypomorphic alleles that cause precocious phenotypes, in which later developmental events, such as the terminal differentiation of hypodermal cells, occur too early. A subset of alleles also reveals a significant role for lin-42 in molting; larval stages are lengthened and ecdysis often fails in these mutant animals. lin-42 is a complex locus, encoding overlapping and nonoverlapping isoforms. Although existing alleles that affect subsets of isoforms have illuminated important and distinct roles for this gene in developmental timing, molting, and the decision to enter the alternative dauer state, it is essential to have a null allele to understand all of the roles of lin-42 and its individual isoforms. To remedy this problem and discover the null phenotype, we engineered an allele that deletes the entire lin-42 protein-coding region. lin-42 null mutants are homozygously viable, but have more severe phenotypes than observed in previously characterized hypomorphic alleles. We also provide additional evidence for this conclusion by using the null allele as a base for reintroducing different isoforms, showing that each isoform can provide heterochronic and molting pathway activities. Transcript levels of the nonoverlapping isoforms appear to be under coordinate temporal regulation, despite being driven by independent promoters. The lin-42 null allele will continue to be an important tool for dissecting the functions of lin-42 in molting and developmental timing.

Brief report: Poor self-regulation as a predictor of individual differences in adaptive functioning in young children with autism spectrum disorder.

Science.gov (United States)

Uljarević, Mirko; Hedley, Darren; Nevill, Rose; Evans, David W; Cai, Ru Ying; Butter, Eric; Mulick, James A

2018-04-06

The present study examined the link between poor self-regulation (measured by the child behavior checklist dysregulated profile [DP]) and core autism symptoms, as well as with developmental level, in a sample of 107 children with autism spectrum disorder (ASD) aged 19-46 months. We further examined the utility of DP in predicting individual differences in adaptive functioning, relative to the influence of ASD severity, chronological age (CA), and developmental level. Poor self-regulation was unrelated to CA, developmental level, and severity of ADOS-2 restricted and repetitive behaviors, but was associated with lower ADOS-2 social affect severity. Hierarchical regression identified poor self-regulation as a unique independent predictor of adaptive behavior, with more severe dysregulation predicting poorer adaptive functioning. Results highlight the importance of early identification of deficits in self-regulation, and more specifically, of the utility of DP, when designing individually tailored treatments for young children with ASD. Autism Res 2018. © 2018 International Society for Autism Research, Wiley Periodicals, Inc. This study explored the relationship between poor self-regulation and age, verbal and non-verbal developmental level, severity of autism symptoms and adaptive functioning in 107 children with autism under 4 years of age. Poor self-regulation was unrelated to age, developmental level, and severity of restricted and repetitive behaviors but was associated with lower social affect severity. Importantly, more severe self-regulation deficits predicted poorer adaptive functioning. © 2018 International Society for Autism Research, Wiley Periodicals, Inc.

EST analysis in Ginkgo biloba: an assessment of conserved developmental regulators and gymnosperm specific genes

Directory of Open Access Journals (Sweden)

Runko Suzan J

2005-10-01

Full Text Available Abstract Background Ginkgo biloba L. is the only surviving member of one of the oldest living seed plant groups with medicinal, spiritual and horticultural importance worldwide. As an evolutionary relic, it displays many characters found in the early, extinct seed plants and extant cycads. To establish a molecular base to understand the evolution of seeds and pollen, we created a cDNA library and EST dataset from the reproductive structures of male (microsporangiate, female (megasporangiate, and vegetative organs (leaves of Ginkgo biloba. Results RNA from newly emerged male and female reproductive organs and immature leaves was used to create three distinct cDNA libraries from which 6,434 ESTs were generated. These 6,434 ESTs from Ginkgo biloba were clustered into 3,830 unigenes. A comparison of our Ginkgo unigene set against the fully annotated genomes of rice and Arabidopsis, and all available ESTs in Genbank revealed that 256 Ginkgo unigenes match only genes among the gymnosperms and non-seed plants – many with multiple matches to genes in non-angiosperm plants. Conversely, another group of unigenes in Gingko had highly significant homology to transcription factors in angiosperms involved in development, including MADS box genes as well as post-transcriptional regulators. Several of the conserved developmental genes found in Ginkgo had top BLAST homology to cycad genes. We also note here the presence of ESTs in G. biloba similar to genes that to date have only been found in gymnosperms and an additional 22 Ginkgo genes common only to genes from cycads. Conclusion Our analysis of an EST dataset from G. biloba revealed genes potentially unique to gymnosperms. Many of these genes showed homology to fully sequenced clones from our cycad EST dataset found in common only with gymnosperms. Other Ginkgo ESTs are similar to developmental regulators in higher plants. This work sets the stage for future studies on Ginkgo to better understand seed and

Identification of microRNAs regulating the developmental pathways of bone marrow derived mast cells.

Directory of Open Access Journals (Sweden)

Yang Xiang

Full Text Available MicroRNAs (miRNAs play important roles in leukocyte differentiation, although those utilised for specific programs and key functions remain incompletely characterised. As a global approach to gain insights into the potential regulatory role of miRNA in mast cell differentiation we characterised expression in BM cultures from the initiation of differentiation. In cultures enriched in differentiating mast cells we characterised miRNA expression and identified miRNA targeting the mRNA of putative factors involved in differentiation pathways and cellular identity. Detailed pathway analysis identified a unique miRNA network that is intimately linked to the mast cell differentiation program.We identified 86 unique miRNAs with expression patterns that were up- or down- regulated at 5-fold or more during bone marrow derived mast cells (BMMC development. By employing TargetScan and MeSH databases, we identified 524 transcripts involved in 30 canonical pathways as potentially regulated by these specific 86 miRNAs. Furthermore, by applying miRanda and IPA analyses, we predict that 7 specific miRNAs of this group are directly associated with the expression of c-Kit and FcεRIα and likewise, that 18 miRNAs promote expression of Mitf, GATA1 and c/EBPα three core transcription factors that direct mast cell differentiation. Furthermore, we have identified 11 miRNAs that may regulate the expression of STATs-3, -5a/b, GATA2 and GATA3 during differentiation, along with 13 miRNAs that target transcripts encoding Ndst2, mMCP4 and mMCP6 and thus may regulate biosynthesis of mast cell secretory mediators.This investigation characterises changes in miRNA expression in whole BM cultures during the differentiation of mast cells and predicts functional links between miRNAs and their target mRNAs for the regulation of development. This information provides an important resource for further investigations of the contributions of miRNAs to mast cell differentiation and

Regulation of developmental and environmental signaling by interaction between microtubules and membranes in plant cells

Directory of Open Access Journals (Sweden)

Qun Zhang

2015-12-01

Full Text Available ABSTRACT Cell division and expansion require the ordered arrangement of microtubules, which are subject to spatial and temporal modifications by developmental and environmental factors. Understanding how signals translate to changes in cortical microtubule organization is of fundamental importance. A defining feature of the cortical microtubule array is its association with the plasma membrane; modules of the plasma membrane are thought to play important roles in the mediation of microtubule organization. In this review, we highlight advances in research on the regulation of cortical microtubule organization by membrane-associated and membrane-tethered proteins and lipids in response to phytohormones and stress. The transmembrane kinase receptor Rho-like guanosine triphosphatase, phospholipase D, phosphatidic acid, and phosphoinositides are discussed with a focus on their roles in microtubule organization.

Mural granulosa cell gene expression associated with oocyte developmental competence

Directory of Open Access Journals (Sweden)

Jiang Jin-Yi

2010-03-01

Full Text Available Abstract Background Ovarian follicle development is a complex process. Paracrine interactions between somatic and germ cells are critical for normal follicular development and oocyte maturation. Studies have suggested that the health and function of the granulosa and cumulus cells may be reflective of the health status of the enclosed oocyte. The objective of the present study is to assess, using an in vivo immature rat model, gene expression profile in granulosa cells, which may be linked to the developmental competence of the oocyte. We hypothesized that expression of specific genes in granulosa cells may be correlated with the developmental competence of the oocyte. Methods Immature rats were injected with eCG and 24 h thereafter with anti-eCG antibody to induce follicular atresia or with pre-immune serum to stimulate follicle development. A high percentage (30-50%, normal developmental competence, NDC of oocytes from eCG/pre-immune serum group developed to term after embryo transfer compared to those from eCG/anti-eCG (0%, poor developmental competence, PDC. Gene expression profiles of mural granulosa cells from the above oocyte-collected follicles were assessed by Affymetrix rat whole genome array. Results The result showed that twelve genes were up-regulated, while one gene was down-regulated more than 1.5 folds in the NDC group compared with those in the PDC group. Gene ontology classification showed that the up-regulated genes included lysyl oxidase (Lox and nerve growth factor receptor associated protein 1 (Ngfrap1, which are important in the regulation of protein-lysine 6-oxidase activity, and in apoptosis induction, respectively. The down-regulated genes included glycoprotein-4-beta galactosyltransferase 2 (Ggbt2, which is involved in the regulation of extracellular matrix organization and biogenesis. Conclusions The data in the present study demonstrate a close association between specific gene expression in mural granulosa cells and

Proteome and metabolome profiling of cytokinin action in Arabidopsis identifying both distinct and similar responses to cytokinin down- and up-regulation.

Science.gov (United States)

Černý, Martin; Kuklová, Alena; Hoehenwarter, Wolfgang; Fragner, Lena; Novák, Ondrej; Rotková, Gabriela; Jedelsky, Petr L; Žáková, Katerina; Šmehilová, Mária; Strnad, Miroslav; Weckwerth, Wolfram; Brzobohaty, Bretislav

2013-11-01

In plants, numerous developmental processes are controlled by cytokinin (CK) levels and their ratios to levels of other hormones. While molecular mechanisms underlying the regulatory roles of CKs have been intensely researched, proteomic and metabolomic responses to CK deficiency are unknown. Transgenic Arabidopsis seedlings carrying inducible barley cytokinin oxidase/dehydrogenase (CaMV35S>GR>HvCKX2) and agrobacterial isopentenyl transferase (CaMV35S>GR>ipt) constructs were profiled to elucidate proteome- and metabolome-wide responses to down- and up-regulation of CK levels, respectively. Proteome profiling identified >1100 proteins, 155 of which responded to HvCKX2 and/or ipt activation, mostly involved in growth, development, and/or hormone and light signalling. The metabolome profiling covered 79 metabolites, 33 of which responded to HvCKX2 and/or ipt activation, mostly amino acids, carbohydrates, and organic acids. Comparison of the data sets obtained from activated CaMV35S>GR>HvCKX2 and CaMV35S>GR>ipt plants revealed unexpectedly extensive overlaps. Integration of the proteomic and metabolomic data sets revealed: (i) novel components of molecular circuits involved in CK action (e.g. ribosomal proteins); (ii) previously unrecognized links to redox regulation and stress hormone signalling networks; and (iii) CK content markers. The striking overlaps in profiles observed in CK-deficient and CK-overproducing seedlings might explain surprising previously reported similarities between plants with down- and up-regulated CK levels.

Loss of FTO antagonises Wnt signaling and leads to developmental defects associated with ciliopathies.

Directory of Open Access Journals (Sweden)

Daniel P S Osborn

Full Text Available Common intronic variants in the Human fat mass and obesity-associated gene (FTO are found to be associated with an increased risk of obesity. Overexpression of FTO correlates with increased food intake and obesity, whilst loss-of-function results in lethality and severe developmental defects. Despite intense scientific discussions around the role of FTO in energy metabolism, the function of FTO during development remains undefined. Here, we show that loss of Fto leads to developmental defects such as growth retardation, craniofacial dysmorphism and aberrant neural crest cells migration in Zebrafish. We find that the important developmental pathway, Wnt, is compromised in the absence of FTO, both in vivo (zebrafish and in vitro (Fto(-/- MEFs and HEK293T. Canonical Wnt signalling is down regulated by abrogated β-Catenin translocation to the nucleus whilst non-canonical Wnt/Ca(2+ pathway is activated via its key signal mediators CaMKII and PKCδ. Moreover, we demonstrate that loss of Fto results in short, absent or disorganised cilia leading to situs inversus, renal cystogenesis, neural crest cell defects and microcephaly in Zebrafish. Congruently, Fto knockout mice display aberrant tissue specific cilia. These data identify FTO as a protein-regulator of the balanced activation between canonical and non-canonical branches of the Wnt pathway. Furthermore, we present the first evidence that FTO plays a role in development and cilia formation/function.

Co-Occurrence of Developmental Disorders: The Case of Developmental Dyscalculia

Science.gov (United States)

Rubinsten, Orly

2009-01-01

Five to seven percent of children experience severe difficulties in learning mathematics and/or reading. Current trials that are focused on identifying biological markers suggest that these learning disabilities, known as Developmental Dyscalculia (DD) and Dyslexia (for reading), are due to underlying brain dysfunctions. One ongoing controversy…

Abscisic Acid Induction of Vacuolar H+-ATPase Activity in Mesembryanthemum crystallinum Is Developmentally Regulated1

Science.gov (United States)

Barkla, Bronwyn J.; Vera-Estrella, Rosario; Maldonado-Gama, Minerva; Pantoja, Omar

1999-01-01

Abscisic acid (ABA) has been implicated as a key component in water-deficit-induced responses, including those triggered by drought, NaCl, and low- temperature stress. In this study a role for ABA in mediating the NaCl-stress-induced increases in tonoplast H+-translocating ATPase (V-ATPase) and Na+/H+ antiport activity in Mesembryanthemum crystallinum, leading to vacuolar Na+ sequestration, were investigated. NaCl or ABA treatment of adult M. crystallinum plants induced V-ATPase H+ transport activity, and when applied in combination, an additive effect on V-ATPase stimulation was observed. In contrast, treatment of juvenile plants with ABA did not induce V-ATPase activity, whereas NaCl treatment resulted in a similar response to that observed in adult plants. Na+/H+ antiport activity was induced in both juvenile and adult plants by NaCl, but ABA had no effect at either developmental stage. Results indicate that ABA-induced changes in V-ATPase activity are dependent on the plant reaching its adult phase, whereas NaCl-induced increases in V-ATPase and Na+/H+ antiport activity are independent of plant age. This suggests that ABA-induced V-ATPase activity may be linked to the stress-induced, developmentally programmed switch from C3 metabolism to Crassulacean acid metabolism in adult plants, whereas, vacuolar Na+ sequestration, mediated by the V-ATPase and Na+/H+ antiport, is regulated through ABA-independent pathways. PMID:10398716

Transgenerational developmental programming.

Science.gov (United States)

Aiken, Catherine E; Ozanne, Susan E

2014-01-01

The concept of developmental programming suggests that the early life environment influences offspring characteristics in later life, including the propensity to develop diseases such as the metabolic syndrome. There is now growing evidence that the effects of developmental programming may also manifest in further generations without further suboptimal exposure. This review considers the evidence, primarily from rodent models, for effects persisting to subsequent generations, and evaluates the mechanisms by which developmental programming may be transmitted to further generations. In particular, we focus on the potential role of the intrauterine environment in contributing to a developmentally programmed phenotype in subsequent generations. The literature was systematically searched at http://pubmed.org and http://scholar.google.com to identify published findings regarding transgenerational (F2 and beyond) developmental programming effects in human populations and animal models. Transmission of programming effects is often viewed as a form of epigenetic inheritance, either via the maternal or paternal line. Evidence exists for both germline and somatic inheritance of epigenetic modifications which may be responsible for phenotypic changes in further generations. However, there is increasing evidence for the role of both extra-genomic components of the zygote and the interaction of the developing conceptus with the intrauterine environment in propagating programming effects. The contribution of a suboptimal reproductive tract environment or maternal adaptations to pregnancy may be critical to inheritance of programming effects via the maternal line. As the effects of age exacerbate the programmed metabolic phenotype, advancing maternal age may increase the likelihood of developmental programming effects being transmitted to further generations. We suggest that developmental programming effects could be propagated through the maternal line de novo in generations

Developmental fluoxetine exposure increases behavioral despair and alters epigenetic regulation of the hippocampal BDNF gene in adult female offspring.

Science.gov (United States)

Boulle, Fabien; Pawluski, Jodi L; Homberg, Judith R; Machiels, Barbie; Kroeze, Yvet; Kumar, Neha; Steinbusch, Harry W M; Kenis, Gunter; van den Hove, Daniel L A

2016-04-01

A growing number of infants are exposed to selective serotonin reuptake inhibitor (SSRI) medications during the perinatal period. Perinatal exposure to SSRI medications alter neuroplasticity and increase depressive- and anxiety-related behaviors, particularly in male offspring as little work has been done in female offspring to date. The long-term effects of SSRI on development can also differ with previous exposure to prenatal stress, a model of maternal depression. Because of the limited work done on the role of developmental SSRI exposure on neurobehavioral outcomes in female offspring, the aim of the present study was to investigate how developmental fluoxetine exposure affects anxiety and depression-like behavior, as well as the regulation of hippocampal brain-derived neurotrophic factor (BDNF) signaling in the hippocampus of adult female offspring. To do this female Sprague-Dawley rat offspring were exposed to prenatal stress and fluoxetine via the dam, for a total of four groups of female offspring: 1) No Stress+Vehicle, 2) No Stress+Fluoxetine, 3) Prenatal Stress+Vehicle, and 4) Prenatal Stress+Fluoxetine. Primary results show that, in adult female offspring, developmental SSRI exposure significantly increases behavioral despair measures on the forced swim test, decreases hippocampal BDNF exon IV mRNA levels, and increases levels of the repressive histone 3 lysine 27 tri-methylated mark at the corresponding promoter. There was also a significant negative correlation between hippocampal BDNF exon IV mRNA levels and immobility in the forced swim test. No effects of prenatal stress or developmental fluoxetine exposure were seen on tests of anxiety-like behavior. This research provides important evidence for the long-term programming effects of early-life exposure to SSRIs on female offspring, particularily with regard to affect-related behaviors and their underlying molecular mechanisms. Copyright © 2016 Elsevier Inc. All rights reserved.

Bulimia: A Self-Psychological and Ego-Developmental View.

Science.gov (United States)

Brenner-Liss, Deborah

1986-01-01

Discusses key clinical issues in the treatment of bulimia with clinical examples from a self-psychological and ego-developmental point of view. Identifies three developmental issues for bulimia: self-regulatory, differentiation, and self-esteem. (Author/ABB)

Developmental regulation of human truncated nerve growth factor receptor

Energy Technology Data Exchange (ETDEWEB)

DiStefano, P.S.; Clagett-Dame, M.; Chelsea, D.M.; Loy, R. (Abbott Laboratories, Abbott Park, IL (USA))

1991-01-01

Monoclonal antibodies (designated XIF1 and IIIG5) recognizing distinct epitopes of the human truncated nerve growth factor receptor (NGF-Rt) were used in a two-site radiometric immunosorbent assay to monitor levels of NGF-Rt in human urine as a function of age. Urine samples were collected from 70 neurologically normal subjects ranging in age from 1 month to 68 years. By using this sensitive two-site radiometric immunosorbent assay, NGF-Rt levels were found to be highest in urine from 1-month old subjects. By 2.5 months, NGF-Rt values were half of those seen at 1 month and decreased more gradually between 0.5 and 15 years. Between 15 and 68 years, urine NGF-Rt levels were relatively constant at 5% of 1-month values. No evidence for diurnal variation of adult NGF-Rt was apparent. Pregnant women in their third trimester showed significantly elevated urine NGF-Rt values compared with age-matched normals. Affinity labeling of NGF-Rt with 125I-NGF followed by immunoprecipitation with ME20.4-IgG and gel autoradiography indicated that neonatal urine contained high amounts of truncated receptor (Mr = 50 kd); decreasingly lower amounts of NGF-Rt were observed on gel autoradiograms with development, indicating that the two-site radiometric immunosorbent assay correlated well with the affinity labeling technique for measuring NGF-Rt. NGF-Rt in urines from 1-month-old and 36-year-old subjects showed no differences in affinities for NGF or for the monoclonal antibody IIIG5. These data show that NGF-Rt is developmentally regulated in human urine, and are discussed in relation to the development and maturation of the peripheral nervous system.

Developmental regulation of human truncated nerve growth factor receptor

International Nuclear Information System (INIS)

DiStefano, P.S.; Clagett-Dame, M.; Chelsea, D.M.; Loy, R.

1991-01-01

Monoclonal antibodies (designated XIF1 and IIIG5) recognizing distinct epitopes of the human truncated nerve growth factor receptor (NGF-Rt) were used in a two-site radiometric immunosorbent assay to monitor levels of NGF-Rt in human urine as a function of age. Urine samples were collected from 70 neurologically normal subjects ranging in age from 1 month to 68 years. By using this sensitive two-site radiometric immunosorbent assay, NGF-Rt levels were found to be highest in urine from 1-month old subjects. By 2.5 months, NGF-Rt values were half of those seen at 1 month and decreased more gradually between 0.5 and 15 years. Between 15 and 68 years, urine NGF-Rt levels were relatively constant at 5% of 1-month values. No evidence for diurnal variation of adult NGF-Rt was apparent. Pregnant women in their third trimester showed significantly elevated urine NGF-Rt values compared with age-matched normals. Affinity labeling of NGF-Rt with 125I-NGF followed by immunoprecipitation with ME20.4-IgG and gel autoradiography indicated that neonatal urine contained high amounts of truncated receptor (Mr = 50 kd); decreasingly lower amounts of NGF-Rt were observed on gel autoradiograms with development, indicating that the two-site radiometric immunosorbent assay correlated well with the affinity labeling technique for measuring NGF-Rt. NGF-Rt in urines from 1-month-old and 36-year-old subjects showed no differences in affinities for NGF or for the monoclonal antibody IIIG5. These data show that NGF-Rt is developmentally regulated in human urine, and are discussed in relation to the development and maturation of the peripheral nervous system

RNAseq analysis of the parasitic nematode Strongyloides stercoralis reveals divergent regulation of canonical dauer pathways.

Directory of Open Access Journals (Sweden)

Jonathan D Stoltzfus

Full Text Available The infectious form of many parasitic nematodes, which afflict over one billion people globally, is a developmentally arrested third-stage larva (L3i. The parasitic nematode Strongyloides stercoralis differs from other nematode species that infect humans, in that its life cycle includes both parasitic and free-living forms, which can be leveraged to investigate the mechanisms of L3i arrest and activation. The free-living nematode Caenorhabditis elegans has a similar developmentally arrested larval form, the dauer, whose formation is controlled by four pathways: cyclic GMP (cGMP signaling, insulin/IGF-1-like signaling (IIS, transforming growth factor β (TGFβ signaling, and biosynthesis of dafachronic acid (DA ligands that regulate a nuclear hormone receptor. We hypothesized that homologous pathways are present in S. stercoralis, have similar developmental regulation, and are involved in L3i arrest and activation. To test this, we undertook a deep-sequencing study of the polyadenylated transcriptome, generating over 2.3 billion paired-end reads from seven developmental stages. We constructed developmental expression profiles for S. stercoralis homologs of C. elegans dauer genes identified by BLAST searches of the S. stercoralis genome as well as de novo assembled transcripts. Intriguingly, genes encoding cGMP pathway components were coordinately up-regulated in L3i. In comparison to C. elegans, S. stercoralis has a paucity of genes encoding IIS ligands, several of which have abundance profiles suggesting involvement in L3i development. We also identified seven S. stercoralis genes encoding homologs of the single C. elegans dauer regulatory TGFβ ligand, three of which are only expressed in L3i. Putative DA biosynthetic genes did not appear to be coordinately regulated in L3i development. Our data suggest that while dauer pathway genes are present in S. stercoralis and may play a role in L3i development, there are significant differences between

Virtual Embryo: Cell-Agent Based Modeling of Developmental Processes and Toxicities (CSS BOSC)

Science.gov (United States)

Spatial regulation of cellular dynamics is fundamental to morphological development. As such, chemical disruption of spatial dynamics is a determinant of developmental toxicity. Incorporating spatial dynamics into AOPs for developmental toxicity is desired but constrained by the ...

29 CFR 1952.221 - Developmental schedule.

Science.gov (United States)

2010-07-01

... 29 Labor 9 2010-07-01 2010-07-01 false Developmental schedule. 1952.221 Section 1952.221 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... Management data system operational July 1, 1973. Automated Management data system operational January 1, 1974...

29 CFR 1952.341 - Developmental schedule.

Science.gov (United States)

2010-07-01

... 29 Labor 9 2010-07-01 2010-07-01 false Developmental schedule. 1952.341 Section 1952.341 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... State Legislature January 1975 and to become effective by May 1, 1975. (d) Management Information System...

Spatiotemporal network motif reveals the biological traits of developmental gene regulatory networks in Drosophila melanogaster

Directory of Open Access Journals (Sweden)

Kim Man-Sun

2012-05-01

Full Text Available Abstract Background Network motifs provided a “conceptual tool” for understanding the functional principles of biological networks, but such motifs have primarily been used to consider static network structures. Static networks, however, cannot be used to reveal time- and region-specific traits of biological systems. To overcome this limitation, we proposed the concept of a “spatiotemporal network motif,” a spatiotemporal sequence of network motifs of sub-networks which are active only at specific time points and body parts. Results On the basis of this concept, we analyzed the developmental gene regulatory network of the Drosophila melanogaster embryo. We identified spatiotemporal network motifs and investigated their distribution pattern in time and space. As a result, we found how key developmental processes are temporally and spatially regulated by the gene network. In particular, we found that nested feedback loops appeared frequently throughout the entire developmental process. From mathematical simulations, we found that mutual inhibition in the nested feedback loops contributes to the formation of spatial expression patterns. Conclusions Taken together, the proposed concept and the simulations can be used to unravel the design principle of developmental gene regulatory networks.

Insulin and IGF receptors are developmentally regulated in the chick embry eye lens

International Nuclear Information System (INIS)

Bassas, L.; Zelenka, P.S.; Serrano, J.; de Pablo, F.

1987-01-01

The authors have previously reported that insulin-like growth factor (IGF) receptors appear to predominate over insulin receptors in early stages of embryogenesis in the chick (days 2-3 whole embryo membranes). Overall, [ 125 I]IGF and II binding to specific receptors was maximal when the rate of brain growth is highest. In the present study they used the embryonic chick lens, a well-defined tissue composed of a single type of cell, to analyze whether changes of insulin and IGFI binding are correlated with changes in growth rate and differentiation state of the cells. They show that both insulin receptors and IGF receptors are present in the lens epithelial cells, and that each type is distinctly regulated throughout development. While there is a direct correlation between IFG-binding capability and growth rate of the cells, there is less relation to differentiation status and embryo age. Insulin receptors, by contrast, appear to be mostly related to the differentiated state of cells, decreasing sharply in fibers, irrespective of their developmental age

A large-scale RNA interference screen identifies genes that regulate autophagy at different stages

DEFF Research Database (Denmark)

Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man

2018-01-01

Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed...... with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes...... have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays...

Predictive model identifies key network regulators of cardiomyocyte mechano-signaling.

Directory of Open Access Journals (Sweden)

Philip M Tan

2017-11-01

Full Text Available Mechanical strain is a potent stimulus for growth and remodeling in cells. Although many pathways have been implicated in stretch-induced remodeling, the control structures by which signals from distinct mechano-sensors are integrated to modulate hypertrophy and gene expression in cardiomyocytes remain unclear. Here, we constructed and validated a predictive computational model of the cardiac mechano-signaling network in order to elucidate the mechanisms underlying signal integration. The model identifies calcium, actin, Ras, Raf1, PI3K, and JAK as key regulators of cardiac mechano-signaling and characterizes crosstalk logic imparting differential control of transcription by AT1R, integrins, and calcium channels. We find that while these regulators maintain mostly independent control over distinct groups of transcription factors, synergy between multiple pathways is necessary to activate all the transcription factors necessary for gene transcription and hypertrophy. We also identify a PKG-dependent mechanism by which valsartan/sacubitril, a combination drug recently approved for treating heart failure, inhibits stretch-induced hypertrophy, and predict further efficacious pairs of drug targets in the network through a network-wide combinatorial search.

The Tomato Hoffman's Anthocyaninless Gene Encodes a bHLH Transcription Factor Involved in Anthocyanin Biosynthesis That Is Developmentally Regulated and Induced by Low Temperatures.

Science.gov (United States)

Qiu, Zhengkun; Wang, Xiaoxuan; Gao, Jianchang; Guo, Yanmei; Huang, Zejun; Du, Yongchen

2016-01-01

Anthocyanin pigments play many roles in plants, including providing protection against biotic and abiotic stresses. Many of the genes that mediate anthocyanin accumulation have been identified through studies of flowers and fruits; however, the mechanisms of genes involved in anthocyanin regulation in seedlings under low-temperature stimulus are less well understood. Genetic characterization of a tomato inbred line, FMTT271, which showed no anthocyanin pigmentation, revealed a mutation in a bHLH transcription factor (TF) gene, which corresponds to the ah (Hoffman's anthocyaninless) locus, and so the gene in FMTT271 at that locus was named ah. Overexpression of the wild type allele of AH in FMTT271 resulted in greater anthocyanin accumulation and increased expression of several genes in the anthocyanin biosynthetic pathway. The expression of AH and anthocyanin accumulation in seedlings was shown to be developmentally regulated and induced by low-temperature stress. Additionally, transcriptome analyses of hypocotyls and leaves from the near-isogenic lines seedlings revealed that AH not only influences the expression of anthocyanin biosynthetic genes, but also genes associated with responses to abiotic stress. Furthermore, the ah mutation was shown to cause accumulation of reactive oxidative species and the constitutive activation of defense responses under cold conditions. These results suggest that AH regulates anthocyanin biosynthesis, thereby playing a protective role, and that this function is particularly important in young seedlings that are particularly vulnerable to abiotic stresses.

The Tomato Hoffman's Anthocyaninless Gene Encodes a bHLH Transcription Factor Involved in Anthocyanin Biosynthesis That Is Developmentally Regulated and Induced by Low Temperatures.

Directory of Open Access Journals (Sweden)

Zhengkun Qiu

Full Text Available Anthocyanin pigments play many roles in plants, including providing protection against biotic and abiotic stresses. Many of the genes that mediate anthocyanin accumulation have been identified through studies of flowers and fruits; however, the mechanisms of genes involved in anthocyanin regulation in seedlings under low-temperature stimulus are less well understood. Genetic characterization of a tomato inbred line, FMTT271, which showed no anthocyanin pigmentation, revealed a mutation in a bHLH transcription factor (TF gene, which corresponds to the ah (Hoffman's anthocyaninless locus, and so the gene in FMTT271 at that locus was named ah. Overexpression of the wild type allele of AH in FMTT271 resulted in greater anthocyanin accumulation and increased expression of several genes in the anthocyanin biosynthetic pathway. The expression of AH and anthocyanin accumulation in seedlings was shown to be developmentally regulated and induced by low-temperature stress. Additionally, transcriptome analyses of hypocotyls and leaves from the near-isogenic lines seedlings revealed that AH not only influences the expression of anthocyanin biosynthetic genes, but also genes associated with responses to abiotic stress. Furthermore, the ah mutation was shown to cause accumulation of reactive oxidative species and the constitutive activation of defense responses under cold conditions. These results suggest that AH regulates anthocyanin biosynthesis, thereby playing a protective role, and that this function is particularly important in young seedlings that are particularly vulnerable to abiotic stresses.

Developmental checkpoints and feedback circuits time insect maturation

DEFF Research Database (Denmark)

Rewitz, Kim Furbo; Yamanaka, Naoki; O'Connor, Michael B.

2013-01-01

as external cues, to time production and release of ecdysone. Based on results discussed here, we suggest that developmental progression to adulthood is controlled by checkpoints that regulate the genetic timing program enabling it to adapt to different environmental conditions. These checkpoints utilize...... a number of signaling pathways to modulate ecdysone production in the prothoracic gland. Release of ecdysone activates an autonomous cascade of both feedforward and feedback signals that determine the duration of the ecdysone pulse at each developmental transitions. Conservation of the genetic mechanisms...... that coordinate the juvenile-adult transition suggests that insights from the fruit fly Drosophila will provide a framework for future investigation of developmental timing in metazoans....

Redox regulation of cell proliferation: Bioinformatics and redox proteomics approaches to identify redox-sensitive cell cycle regulators.

Science.gov (United States)

Foyer, Christine H; Wilson, Michael H; Wright, Megan H

2018-03-29

Plant stem cells are the foundation of plant growth and development. The balance of quiescence and division is highly regulated, while ensuring that proliferating cells are protected from the adverse effects of environment fluctuations that may damage the genome. Redox regulation is important in both the activation of proliferation and arrest of the cell cycle upon perception of environmental stress. Within this context, reactive oxygen species serve as 'pro-life' signals with positive roles in the regulation of the cell cycle and survival. However, very little is known about the metabolic mechanisms and redox-sensitive proteins that influence cell cycle progression. We have identified cysteine residues on known cell cycle regulators in Arabidopsis that are potentially accessible, and could play a role in redox regulation, based on secondary structure and solvent accessibility likelihoods for each protein. We propose that redox regulation may function alongside other known posttranslational modifications to control the functions of core cell cycle regulators such as the retinoblastoma protein. Since our current understanding of how redox regulation is involved in cell cycle control is hindered by a lack of knowledge regarding both which residues are important and how modification of those residues alters protein function, we discuss how critical redox modifications can be mapped at the molecular level. Crown Copyright © 2018. Published by Elsevier Inc. All rights reserved.

Signal Transduction Pathways that Regulate CAB Gene Expression

Energy Technology Data Exchange (ETDEWEB)

Chory, Joanne

2004-12-31

The process of chloroplast differentiation, involves the coordinate regulation of many nuclear and chloroplast genes. The cues for the initiation of this developmental program are both extrinsic (e.g., light) and intrinsic (cell-type and plastid signals). During this project period, we utilized a molecular genetic approach to select for Arabidopsis mutants that did not respond properly to environmental light conditions, as well as mutants that were unable to perceive plastid damage. These latter mutants, called gun mutants, define two retrograde signaling pathways that regulate nuclear gene expression in response to chloroplasts. A major finding was to identify a signal from chloroplasts that regulates nuclear gene transcription. This signal is the build-up of Mg-Protoporphyrin IX, a key intermediate of the chlorophyll biosynthetic pathway. The signaling pathways downstream of this signal are currently being studied. Completion of this project has provided an increased understanding of the input signals and retrograde signaling pathways that control nuclear gene expression in response to the functional state of chloroplasts. These studies should ultimately influence our abilities to manipulate plant growth and development, and will aid in the understanding of the developmental control of photosynthesis.

Signal Transduction Pathways that Regulate CAB Gene Expression

Energy Technology Data Exchange (ETDEWEB)

Chory, Joanne

2006-01-16

The process of chloroplast differentiation, involves the coordinate regulation of many nuclear and chloroplast genes. The cues for the initiation of this developmental program are both extrinsic (e.g., light) and intrinsic (cell-type and plastid signals). During this project period, we utilized a molecular genetic approach to select for Arabidopsis mutants that did not respond properly to environmental light conditions, as well as mutants that were unable to perceive plastid damage. These latter mutants, called gun mutants, define two retrograde signaling pathways that regulate nuclear gene expression in response to chloroplasts. A major finding was to identify a signal from chloroplasts that regulates nuclear gene transcription. This signal is the build-up of Mg-Protoporphyrin IX, a key intermediate of the chlorophyll biosynthetic pathway. The signaling pathways downstream of this signal are currently being studied. Completion of this project has provided an increased understanding of the input signals and retrograde signaling pathways that control nuclear gene expression in response to the functional state of chloroplasts. These studies should ultimately influence our abilities to manipulate plant growth and development, and will aid in the understanding of the developmental control of photosynthesis.

Modifiers of notch transcriptional activity identified by genome-wide RNAi

Directory of Open Access Journals (Sweden)

Firnhaber Christopher B

2010-10-01

Full Text Available Abstract Background The Notch signaling pathway regulates a diverse array of developmental processes, and aberrant Notch signaling can lead to diseases, including cancer. To obtain a more comprehensive understanding of the genetic network that integrates into Notch signaling, we performed a genome-wide RNAi screen in Drosophila cell culture to identify genes that modify Notch-dependent transcription. Results Employing complementary data analyses, we found 399 putative modifiers: 189 promoting and 210 antagonizing Notch activated transcription. These modifiers included several known Notch interactors, validating the robustness of the assay. Many novel modifiers were also identified, covering a range of cellular localizations from the extracellular matrix to the nucleus, as well as a large number of proteins with unknown function. Chromatin-modifying proteins represent a major class of genes identified, including histone deacetylase and demethylase complex components and other chromatin modifying, remodeling and replacement factors. A protein-protein interaction map of the Notch-dependent transcription modifiers revealed that a large number of the identified proteins interact physically with these core chromatin components. Conclusions The genome-wide RNAi screen identified many genes that can modulate Notch transcriptional output. A protein interaction map of the identified genes highlighted a network of chromatin-modifying enzymes and remodelers that regulate Notch transcription. Our results open new avenues to explore the mechanisms of Notch signal regulation and the integration of this pathway into diverse cellular processes.

The two forms of capitalism: developmentalism and economic liberalism

Directory of Open Access Journals (Sweden)

LUIZ CARLOS BRESSER-PEREIRA

Full Text Available ABSTRACT This paper argues that the state and the market are the main institutions regulating capitalism, and, correspondingly, that the form of the economic and political coordination of capitalism will be either developmental or liberal. It defines the developmental state, relates it to the formation of a developmental class coalition, and notes that capitalism was born developmental in its mercantilist phase, turned liberal in the nineteenth century, and, after 1929, became once again developmental, but, now, democratic and progressive. All industrial and capitalist revolutions took place within the framework of developmentalism, whereby the state coordinates the non-competitive sector of the economy and the five macroeconomic prices (which the market is unable to make “right”, while the market coordinates the competitive sector. In the 1970s, a crisis opened the way for a short-lived and reactionary form of capitalism, neoliberalism or rentier-financier capitalism. Since the 2008 Global Financial Crisis, the neoliberal hegemony has come to an end, and we are now experiencing a period of transition.

29 CFR 1952.151 - Developmental schedule.

Science.gov (United States)

2010-07-01

... Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... developmental plan for a “Management Information System” on the date of Plan approval. This program is to be... years after grant award. (p) A State “Safety and Health” poster will be prepared within ninety (90) days...

Developmental and environmental regulation of Aquaporin gene expression across Populus species: divergence or redundancy?

Science.gov (United States)

Cohen, David; Bogeat-Triboulot, Marie-Béatrice; Vialet-Chabrand, Silvère; Merret, Rémy; Courty, Pierre-Emmanuel; Moretti, Sébastien; Bizet, François; Guilliot, Agnès; Hummel, Irène

2013-01-01

Aquaporins (AQPs) are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants). The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of functional redundancy

Developmental and environmental regulation of Aquaporin gene expression across Populus species: divergence or redundancy?

Directory of Open Access Journals (Sweden)

David Cohen

Full Text Available Aquaporins (AQPs are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants. The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of

Developmental Transcriptomic Features of the Carcinogenic Liver Fluke, Clonorchis sinensis

Science.gov (United States)

Cho, Pyo Yun; Kim, Tae Im; Cho, Shin-Hyeong; Choi, Sang-Haeng; Park, Hong-Seog; Kim, Tong-Soo; Hong, Sung-Jong

2011-01-01

Clonorchis sinensis is the causative agent of the life-threatening disease endemic to China, Korea, and Vietnam. It is estimated that about 15 million people are infected with this fluke. C. sinensis provokes inflammation, epithelial hyperplasia, and periductal fibrosis in bile ducts, and may cause cholangiocarcinoma in chronically infected individuals. Accumulation of a large amount of biological information about the adult stage of this liver fluke in recent years has advanced our understanding of the pathological interplay between this parasite and its hosts. However, no developmental gene expression profiles of C. sinensis have been published. In this study, we generated gene expression profiles of three developmental stages of C. sinensis by analyzing expressed sequence tags (ESTs). Complementary DNA libraries were constructed from the adult, metacercaria, and egg developmental stages of C. sinensis. A total of 52,745 ESTs were generated and assembled into 12,830 C. sinensis assembled EST sequences, and then these assemblies were further categorized into groups according to biological functions and developmental stages. Most of the genes that were differentially expressed in the different stages were consistent with the biological and physical features of the particular developmental stage; high energy metabolism, motility and reproduction genes were differentially expressed in adults, minimal metabolism and final host adaptation genes were differentially expressed in metacercariae, and embryonic genes were differentially expressed in eggs. The higher expression of glucose transporters, proteases, and antioxidant enzymes in the adults accounts for active uptake of nutrients and defense against host immune attacks. The types of ion channels present in C. sinensis are consistent with its parasitic nature and phylogenetic placement in the tree of life. We anticipate that the transcriptomic information on essential regulators of development, bile chemotaxis, and

Developmental transcriptomic features of the carcinogenic liver fluke, Clonorchis sinensis.

Directory of Open Access Journals (Sweden)

Won Gi Yoo

2011-06-01

Full Text Available Clonorchis sinensis is the causative agent of the life-threatening disease endemic to China, Korea, and Vietnam. It is estimated that about 15 million people are infected with this fluke. C. sinensis provokes inflammation, epithelial hyperplasia, and periductal fibrosis in bile ducts, and may cause cholangiocarcinoma in chronically infected individuals. Accumulation of a large amount of biological information about the adult stage of this liver fluke in recent years has advanced our understanding of the pathological interplay between this parasite and its hosts. However, no developmental gene expression profiles of C. sinensis have been published. In this study, we generated gene expression profiles of three developmental stages of C. sinensis by analyzing expressed sequence tags (ESTs. Complementary DNA libraries were constructed from the adult, metacercaria, and egg developmental stages of C. sinensis. A total of 52,745 ESTs were generated and assembled into 12,830 C. sinensis assembled EST sequences, and then these assemblies were further categorized into groups according to biological functions and developmental stages. Most of the genes that were differentially expressed in the different stages were consistent with the biological and physical features of the particular developmental stage; high energy metabolism, motility and reproduction genes were differentially expressed in adults, minimal metabolism and final host adaptation genes were differentially expressed in metacercariae, and embryonic genes were differentially expressed in eggs. The higher expression of glucose transporters, proteases, and antioxidant enzymes in the adults accounts for active uptake of nutrients and defense against host immune attacks. The types of ion channels present in C. sinensis are consistent with its parasitic nature and phylogenetic placement in the tree of life. We anticipate that the transcriptomic information on essential regulators of development

Developmental Methodology as a Context for Interdisciplinary Dialogue in Developmental Science

Science.gov (United States)

Card, Noel A.

2014-01-01

In this comment, I first highlight the contributions of Robinson-Cimpian, Lubienski, Ganley, and Copur-Gencturk (2014) in particular and a more interdisciplinary approach in general for the subdiscipline of developmental psychology. Second, I identify some historic methodological foci of psychology and encourage Robinson-Cimpian et al. to consider…

Neurobehavioural effects of developmental toxicity

DEFF Research Database (Denmark)

Grandjean, Philippe; Landrigan, Philip J

2014-01-01

Neurodevelopmental disabilities, including autism, attention-deficit hyperactivity disorder, dyslexia, and other cognitive impairments, affect millions of children worldwide, and some diagnoses seem to be increasing in frequency. Industrial chemicals that injure the developing brain are among...... the known causes for this rise in prevalence. In 2006, we did a systematic review and identified five industrial chemicals as developmental neurotoxicants: lead, methylmercury, polychlorinated biphenyls, arsenic, and toluene. Since 2006, epidemiological studies have documented six additional developmental...... chemicals should not be presumed to be safe to brain development, and chemicals in existing use and all new chemicals must therefore be tested for developmental neurotoxicity. To coordinate these efforts and to accelerate translation of science into prevention, we propose the urgent formation of a new...

Developmental Social Cognitive Neuroscience: Insights from Deafness

Science.gov (United States)

Corina, David; Singleton, Jenny

2009-01-01

The condition of deafness presents a developmental context that provides insight into the biological, cultural, and linguistic factors underlying the development of neural systems that impact social cognition. Studies of visual attention, behavioral regulation, language development, and face and human action perception are discussed. Visually…

The Tomato Hoffman’s Anthocyaninless Gene Encodes a bHLH Transcription Factor Involved in Anthocyanin Biosynthesis That Is Developmentally Regulated and Induced by Low Temperatures

Science.gov (United States)

Gao, Jianchang; Guo, Yanmei; Huang, Zejun; Du, Yongchen

2016-01-01

Anthocyanin pigments play many roles in plants, including providing protection against biotic and abiotic stresses. Many of the genes that mediate anthocyanin accumulation have been identified through studies of flowers and fruits; however, the mechanisms of genes involved in anthocyanin regulation in seedlings under low-temperature stimulus are less well understood. Genetic characterization of a tomato inbred line, FMTT271, which showed no anthocyanin pigmentation, revealed a mutation in a bHLH transcription factor (TF) gene, which corresponds to the ah (Hoffman's anthocyaninless) locus, and so the gene in FMTT271 at that locus was named ah. Overexpression of the wild type allele of AH in FMTT271 resulted in greater anthocyanin accumulation and increased expression of several genes in the anthocyanin biosynthetic pathway. The expression of AH and anthocyanin accumulation in seedlings was shown to be developmentally regulated and induced by low-temperature stress. Additionally, transcriptome analyses of hypocotyls and leaves from the near-isogenic lines seedlings revealed that AH not only influences the expression of anthocyanin biosynthetic genes, but also genes associated with responses to abiotic stress. Furthermore, the ah mutation was shown to cause accumulation of reactive oxidative species and the constitutive activation of defense responses under cold conditions. These results suggest that AH regulates anthocyanin biosynthesis, thereby playing a protective role, and that this function is particularly important in young seedlings that are particularly vulnerable to abiotic stresses. PMID:26943362

Hepatic deficiency of the pioneer transcription factor FoxA restricts hepatitis B virus biosynthesis by the developmental regulation of viral DNA methylation.

Directory of Open Access Journals (Sweden)

Vanessa C McFadden

2017-02-01

Full Text Available The FoxA family of pioneer transcription factors regulates hepatitis B virus (HBV transcription, and hence viral replication. Hepatocyte-specific FoxA-deficiency in the HBV transgenic mouse model of chronic infection prevents the transcription of the viral DNA genome as a result of the failure of the developmentally controlled conversion of 5-methylcytosine residues to cytosine during postnatal hepatic maturation. These observations suggest that pioneer transcription factors such as FoxA, which mark genes for expression at subsequent developmental steps in the cellular differentiation program, mediate their effects by reversing the DNA methylation status of their target genes to permit their ensuing expression when the appropriate tissue-specific transcription factor combinations arise during development. Furthermore, as the FoxA-deficient HBV transgenic mice are viable, the specific developmental timing, abundance and isoform type of pioneer factor expression must permit all essential liver gene expression to occur at a level sufficient to support adequate liver function. This implies that pioneer transcription factors can recognize and mark their target genes in distinct developmental manners dependent upon, at least in part, the concentration and affinity of FoxA for its binding sites within enhancer and promoter regulatory sequence elements. This selective marking of cellular genes for expression by the FoxA pioneer factor compared to HBV may offer the opportunity for the specific silencing of HBV gene expression and hence the resolution of chronic HBV infections which are responsible for approximately one million deaths worldwide annually due to liver cirrhosis and hepatocellular carcinoma.

Genome-Wide Analysis of the Expression of WRKY Family Genes in Different Developmental Stages of Wild Strawberry (Fragaria vesca Fruit.

Directory of Open Access Journals (Sweden)

Heying Zhou

Full Text Available WRKY proteins play important regulatory roles in plant developmental processes such as senescence, trichome initiation and embryo morphogenesis. In strawberry, only FaWRKY1 (Fragaria × ananassa has been characterized, leaving numerous WRKY genes to be identified and their function characterized. The publication of the draft genome sequence of the strawberry genome allowed us to conduct a genome-wide search for WRKY proteins in Fragaria vesca, and to compare the identified proteins with their homologs in model plants. Fifty-nine FvWRKY genes were identified and annotated from the F. vesca genome. Detailed analysis, including gene classification, annotation, phylogenetic evaluation, conserved motif determination and expression profiling, based on RNA-seq data, were performed on all members of the family. Additionally, the expression patterns of the WRKY genes in different fruit developmental stages were further investigated using qRT-PCR, to provide a foundation for further comparative genomics and functional studies of this important class of transcriptional regulators in strawberry.

Identification and transcription profiling of trypsin in Aedes taeniorhynchus (Diptera: Culicidae): developmental regulation, blood feeding, and permethrin exposure.

Science.gov (United States)

Zhao, Liming; Chen, Jian; Becnel, James J; Kline, Daniel L; Clark, Gary G; Linthicum, Kenneth J

2011-05-01

The cDNA of a trypsin gene from Aedes (Ochlerotatus) taeniorhynchus (Weidemann) was cloned and sequenced. The full-length mRNA sequence (890 bp) for trypsin from Ae. taeniorhynchus (AetTryp1) was obtained, which encodes an open reading frame of 765 bp (i.e., 255 amino acids). To detect whether AetTryp is developmentally regulated, a quantitative real-time polymerase chain reaction was used to examine AetTrypl mRNA expression levels in different developmental stages of Ae. taeniorhynchus. AetTryp1 was expressed at low levels in egg, larval, and pupal stages, but was differentially expressed in adult Ae. taeniorhynchus, with highest levels found in 5-d-old female adults when compared with teneral adults. In addition, AetTryp1 mRNA expression differed between sexes, with expression levels much lower in males. However, in both males and females, there was a significant increase in AetTryp1 transcription levels as age increased and peaked in 5-d-old adults. AetTrypl expressed in 5-d-old female Ae. taeniorhynchus significantly increased after 30 min postblood feeding compared with the control. The AetTryp1 mRNA expression in 5-d-old female Ae. taeniorhynchus was affected by different concentrations of permethrin.

Neuroendocrine Regulation of Maternal Behavior

Science.gov (United States)

Bridges, Robert S.

2015-01-01

The expression of maternal behavior in mammals is regulated by the developmental and experiential events over a female’s lifetime. In this review the relationships between the endocrine and neural systems that play key roles in these developmental and experiential that affect both the establishment and maintenance of maternal care are presented. The involvement of the hormones estrogen, progesterone, and lactogens are discussed in the context of ligand, receptor, and gene activity in rodents and to a lesser extent in higher mammals. The roles of neuroendocrine factors, including oxytocin, vasopressin, classical neurotransmitters, and other neural gene products that regulate aspects of maternal care are set forth, and the interactions of hormones with central nervous system mediators of maternal behavior are discussed. The impact of prior developmental factors, including epigenetic events, and maternal experience on subsequent maternal care are assessed over the course of the female’s lifespan. It is proposed that common neuroendocrine mechanisms underlie the regulation of maternal care in mammals. PMID:25500107

Instructional Technology Practices in Developmental Education in Texas

Science.gov (United States)

Martirosyan, Nara M.; Kennon, J. Lindsey; Saxon, D. Patrick; Edmonson, Stacey L.; Skidmore, Susan T.

2017-01-01

The purpose of this study was to examine the current state of technology integration in developmental education in Texas higher education. Analyzing survey data from developmental education faculty members in 70 2- and 4-year colleges in Texas, researchers identified instructor-reported best instructional technology practices in developmental…

Developmentally Regulated Post-translational Modification of Nucleoplasmin Controls Histone Sequestration and Deposition

Directory of Open Access Journals (Sweden)

Takashi Onikubo

2015-03-01

Full Text Available Nucleoplasmin (Npm is an abundant histone chaperone in vertebrate oocytes and embryos. During embryogenesis, regulation of Npm histone binding is critical for its function in storing and releasing maternal histones to establish and maintain the zygotic epigenome. Here, we demonstrate that Xenopus laevis Npm post-translational modifications (PTMs specific to the oocyte and egg promote either histone deposition or sequestration, respectively. Mass spectrometry and Npm phosphomimetic mutations used in chromatin assembly assays identified hyperphosphorylation on the N-terminal tail as a critical regulator for sequestration. C-terminal tail phosphorylation and PRMT5-catalyzed arginine methylation enhance nucleosome assembly by promoting histone interaction with the second acidic tract of Npm. Electron microscopy reconstructions of Npm and TTLL4 activity toward the C-terminal tail demonstrate that oocyte- and egg-specific PTMs cause Npm conformational changes. Our results reveal that PTMs regulate Npm chaperoning activity by modulating Npm conformation and Npm-histone interaction, leading to histone sequestration in the egg.

Epigenetics and the Developmental Origins of Health and ...

Science.gov (United States)

Epigenetic programming is likely to be an important mechanism underlying the lasting influence of the developmental environment on lifelong health, a concept known as the Developmental Origins of Health and Disease (DOHaD). DNA methylation, posttranslational histone protei n modifications, noncoding RNAs and recruited protein complexes are elements of the epigenetic regulation of gene transcription. These heritable but reversible changes in gene function are dynamic and labile during specific stages of the reproductive cycle and development. Epigenetic marks may be maintained throughout an individual's lifespan and can alter the life-long risk of disease; the nature of these epigenetic marks and their potential alteration by environmental factors is an area of active research. This chapter provides an overview of epigenetic regulation, particularly as it occurs as an essential component of embryo-fetal development. In this chapter we will present key features of DNA methylation and histone protein modifications, including the enzymes involved and the effects of these modifications on gene transcription. We will discuss the interplay of these dynamic modifications and the emerging role of noncoding RNAs in epigenetic gene regulation.

Genome-wide RNAi Screen Identifies Networks Involved in Intestinal Stem Cell Regulation in Drosophila

Directory of Open Access Journals (Sweden)

Xiankun Zeng

2015-02-01

Full Text Available The intestinal epithelium is the most rapidly self-renewing tissue in adult animals and maintained by intestinal stem cells (ISCs in both Drosophila and mammals. To comprehensively identify genes and pathways that regulate ISC fates, we performed a genome-wide transgenic RNAi screen in adult Drosophila intestine and identified 405 genes that regulate ISC maintenance and lineage-specific differentiation. By integrating these genes into publicly available interaction databases, we further developed functional networks that regulate ISC self-renewal, ISC proliferation, ISC maintenance of diploid status, ISC survival, ISC-to-enterocyte (EC lineage differentiation, and ISC-to-enteroendocrine (EE lineage differentiation. By comparing regulators among ISCs, female germline stem cells, and neural stem cells, we found that factors related to basic stem cell cellular processes are commonly required in all stem cells, and stem-cell-specific, niche-related signals are required only in the unique stem cell type. Our findings provide valuable insights into stem cell maintenance and lineage-specific differentiation.

Integrated systems approach identifies risk regulatory pathways and key regulators in coronary artery disease.

Science.gov (United States)

Zhang, Yan; Liu, Dianming; Wang, Lihong; Wang, Shuyuan; Yu, Xuexin; Dai, Enyu; Liu, Xinyi; Luo, Shanshun; Jiang, Wei

2015-12-01

Coronary artery disease (CAD) is the most common type of heart disease. However, the molecular mechanisms of CAD remain elusive. Regulatory pathways are known to play crucial roles in many pathogenic processes. Thus, inferring risk regulatory pathways is an important step toward elucidating the mechanisms underlying CAD. With advances in high-throughput data, we developed an integrated systems approach to identify CAD risk regulatory pathways and key regulators. Firstly, a CAD-related core subnetwork was identified from a curated transcription factor (TF) and microRNA (miRNA) regulatory network based on a random walk algorithm. Secondly, candidate risk regulatory pathways were extracted from the subnetwork by applying a breadth-first search (BFS) algorithm. Then, risk regulatory pathways were prioritized based on multiple CAD-associated data sources. Finally, we also proposed a new measure to prioritize upstream regulators. We inferred that phosphatase and tensin homolog (PTEN) may be a key regulator in the dysregulation of risk regulatory pathways. This study takes a closer step than the identification of disease subnetworks or modules. From the risk regulatory pathways, we could understand the flow of regulatory information in the initiation and progression of the disease. Our approach helps to uncover its potential etiology. We developed an integrated systems approach to identify risk regulatory pathways. We proposed a new measure to prioritize the key regulators in CAD. PTEN may be a key regulator in dysregulation of the risk regulatory pathways.

Targeting developmental regulators of zebrafish exocrine pancreas as a therapeutic approach in human pancreatic cancer

Directory of Open Access Journals (Sweden)

Nelson S. Yee

2012-02-01

Histone deacetylases (HDACs and RNA polymerase III (POLR3 play vital roles in fundamental cellular processes, and deregulation of these enzymes has been implicated in malignant transformation. Hdacs and Polr3 are required for exocrine pancreatic epithelial proliferation during morphogenesis in zebrafish. We aim to test the hypothesis that Hdacs and Polr3 cooperatively control exocrine pancreatic growth, and combined inhibition of HDACs and POLR3 produces enhanced growth suppression in pancreatic cancer. In zebrafish larvae, combination of a Hdac inhibitor (Trichostatin A and an inhibitor of Polr3 (ML-60218 synergistically prohibited the expansion of exocrine pancreas. In human pancreatic adenocarcinoma cells, combination of the HDAC inhibitor suberoylanilide hydroxamic acid (SAHA and ML-60218 produced augmented suppression of colony formation and proliferation, and induction of cell cycle arrest and apoptotic cell death. The enhanced cytotoxicity was associated with supra-additive upregulation of the pro-apoptotic regulator BAX and the cyclin-dependent kinase inhibitor p21CDKN1A. tRNAs have been shown to have pro-proliferative and anti-apoptotic roles, and SAHA-stimulated expression of tRNAs was reversed by ML-60218. These findings demonstrate that chemically targeting developmental regulators of exocrine pancreas can be translated into an approach with potential impact on therapeutic response in pancreatic cancer, and suggest that counteracting the pro-malignant side effect of HDAC inhibitors can enhance their anti-tumor activity.

Maternal abuse history and self-regulation difficulties in preadolescence.

Science.gov (United States)

Delker, Brianna C; Noll, Laura K; Kim, Hyoun K; Fisher, Philip A

2014-12-01

Although poor parenting is known to be closely linked to self-regulation difficulties in early childhood, comparatively little is understood about the role of other risk factors in the early caregiving environment (such as a parent's own experiences of childhood abuse) in developmental pathways of self-regulation into adolescence. Using a longitudinal design, this study aimed to examine how a mother's history of abuse in childhood relates to her offspring's self-regulation difficulties in preadolescence. Maternal controlling parenting and exposure to intimate partner aggression in the child's first 24-36 months were examined as important early social and environmental influences that may explain the proposed connection between maternal abuse history and preadolescent self-regulation. An ethnically diverse sample of mothers (N=488) who were identified as at-risk for child maltreatment was recruited at the time of their children's birth. Mothers and their children were assessed annually from the child's birth through 36 months, and at age 9-11 years. Structural equation modeling and bootstrap tests of indirect effects were conducted to address the study aims. Findings indicated that maternal abuse history indirectly predicted their children's self-regulation difficulties in preadolescence mainly through maternal controlling parenting in early childhood, but not through maternal exposure to aggression by an intimate partner. Maternal history of childhood abuse and maternal controlling parenting in her child's early life may have long-term developmental implications for child self-regulation. Copyright © 2014 Elsevier Ltd. All rights reserved.

Perturbation-expression analysis identifies RUNX1 as a regulator of human mammary stem cell differentiation.

Directory of Open Access Journals (Sweden)

Ethan S Sokol

2015-04-01

Full Text Available The search for genes that regulate stem cell self-renewal and differentiation has been hindered by a paucity of markers that uniquely label stem cells and early progenitors. To circumvent this difficulty we have developed a method that identifies cell-state regulators without requiring any markers of differentiation, termed Perturbation-Expression Analysis of Cell States (PEACS. We have applied this marker-free approach to screen for transcription factors that regulate mammary stem cell differentiation in a 3D model of tissue morphogenesis and identified RUNX1 as a stem cell regulator. Inhibition of RUNX1 expanded bipotent stem cells and blocked their differentiation into ductal and lobular tissue rudiments. Reactivation of RUNX1 allowed exit from the bipotent state and subsequent differentiation and mammary morphogenesis. Collectively, our findings show that RUNX1 is required for mammary stem cells to exit a bipotent state, and provide a new method for discovering cell-state regulators when markers are not available.

Developmental instability: measures of resistance and resilience using pumpkin (Cucurbita pepo L.)

Science.gov (United States)

Freeman, D. Carl; Brown, Michelle L.; Dobson, Melissa; Jordan, Yolanda; Kizy, Anne; Micallef, Chris; Hancock, Leandria C.; Graham, John H.; Emlen, John M.

2003-01-01

Fluctuating asymmetry measures random deviations from bilateral symmetry, and thus estimates developmental instability, the loss of ability by an organism to regulate its development. There have been few rigorous tests of this proposition. Regulation of bilateral symmetry must involve either feedback between the sides or independent regulation toward a symmetric set point. Either kind of regulation should decrease asymmetry over time, but only right–left feedback produces compensatory growth across sides, seen as antipersistent growth following perturbation. Here, we describe the developmental trajectories of perturbed and unperturbed leaves of pumpkin, Cucurbita pepoL., grown at three densities. Covering one side of a leaf with aluminium foil for 24 h perturbed leaf growth. Reduced growth on the perturbed side caused leaves to become more asymmetrical than unperturbed controls. After the treatment the size-corrected asymmetry decreased over time. In addition, rescaled range analysis showed that asymmetry was antipersistent rather than random, i.e. fluctuation in one direction was likely to be followed by fluctuations in the opposite direction. Development involves right–left feedback. This feedback reduced size-corrected asymmetry over time most strongly in the lowest density treatment suggesting that developmental instability results from a lack of resilience rather than resistance. 

Human developmental enhancers conserved between deuterostomes and protostomes.

Directory of Open Access Journals (Sweden)

Shoa L Clarke

Full Text Available The identification of homologies, whether morphological, molecular, or genetic, is fundamental to our understanding of common biological principles. Homologies bridging the great divide between deuterostomes and protostomes have served as the basis for current models of animal evolution and development. It is now appreciated that these two clades share a common developmental toolkit consisting of conserved transcription factors and signaling pathways. These patterning genes sometimes show common expression patterns and genetic interactions, suggesting the existence of similar or even conserved regulatory apparatus. However, previous studies have found no regulatory sequence conserved between deuterostomes and protostomes. Here we describe the first such enhancers, which we call bilaterian conserved regulatory elements (Bicores. Bicores show conservation of sequence and gene synteny. Sequence conservation of Bicores reflects conserved patterns of transcription factor binding sites. We predict that Bicores act as response elements to signaling pathways, and we show that Bicores are developmental enhancers that drive expression of transcriptional repressors in the vertebrate central nervous system. Although the small number of identified Bicores suggests extensive rewiring of cis-regulation between the protostome and deuterostome clades, additional Bicores may be revealed as our understanding of cis-regulatory logic and sample of bilaterian genomes continue to grow.

Developmental principles: fact or fiction.

Science.gov (United States)

Durston, A J

2012-01-01

While still at school, most of us are deeply impressed by the underlying principles that so beautifully explain why the chemical elements are ordered as they are in the periodic table, and may wonder, with the theoretician Brian Goodwin, "whether there might be equally powerful principles that account for the awe-inspiring diversity of body forms in the living realm". We have considered the arguments for developmental principles, conclude that they do exist and have specifically identified features that may generate principles associated with Hox patterning of the main body axis in bilaterian metazoa in general and in the vertebrates in particular. We wonder whether this exercise serves any purpose. The features we discuss were already known to us as parts of developmental mechanisms and defining developmental principles (how, and at which level?) adds no insight. We also see little profit in the proposal by Goodwin that there are principles outside the emerging genetic mechanisms that need to be taken into account. The emerging developmental genetic hierarchies already reveal a wealth of interesting phenomena, whatever we choose to call them.

A developmental, body-oriented intervention for children and adolescents with medically unexplained chronic pain.

Science.gov (United States)

Kozlowska, Kasia; Khan, Rubina

2011-10-01

The regulation of pain and other emotions is a developmental process that takes place in the context of attachment relationships. Children with chronic, medically unexplained pain struggle to accurately identify, communicate and regulate negative body states, and to connect these body states to their day-to-day experience. This article describes an individual intervention - one component of a multimodal treatment programme - whose aim is to help children find skills to manage their pain. The intervention incorporates ideas and practices from several theoretical models - the dynamic-maturational model of attachment, cognitive-behavioural theories, narrative therapy, art therapy, sensorimotor approaches -pragmatically selected and adapted to help children presenting to our Chronic Pain Service achieve good clinical outcomes. At the outset we assess the child's capacity to identify, regulate and communicate positive and negative body states, and tailor our individual intervention so as to extend each child's proximal level of development. We initially focus on the body in an effort to equip the child with a non-verbal, image-based language for identifying and communicating pain and other negative body states. Once the child has developed a non-verbal way of knowing her body, a range of cognitive-behavioural, narrative and other strategies are introduced. The intervention aims to increase the child's emotional functioning: her skill in identifying, symbolically representing, communicating and managing pain and other negative body states.

Developmental Localization and Methylesterification of Pectin Epitopes during Somatic Embryogenesis of Banana (Musa spp. AAA)

Science.gov (United States)

Xu, Chunxiang; Zhao, Lu; Pan, Xiao; Šamaj, Jozef

2011-01-01

Background The plant cell walls play an important role in somatic embryogenesis and plant development. Pectins are major chemical components of primary cell walls while homogalacturonan (HG) is the most abundant pectin polysaccharide. Developmental regulation of HG methyl-esterification degree is important for cell adhesion, division and expansion, and in general for proper organ and plant development. Methodology/Principal Findings Developmental localization of pectic homogalacturonan (HG) epitopes and the (1→4)-β-D-galactan epitope of rhamnogalacturonan I (RG-I) and degree of pectin methyl-esterification (DM) were studied during somatic embryogenesis of banana (Musa spp. AAA). Histological analysis documented all major developmental stages including embryogenic cells (ECs), pre-globular, globular, pear-shaped and cotyledonary somatic embryos. Histochemical staining of extracellularly secreted pectins with ruthenium red showed the most intense staining at the surface of pre-globular, globular and pear-shaped somatic embryos. Biochemical analysis revealed developmental regulation of galacturonic acid content and DM in diverse embryogenic stages. Immunodots and immunolabeling on tissue sections revealed developmental regulation of highly methyl-esterified HG epitopes recognized by JIM7 and LM20 antibodies during somatic embryogenesis. Cell walls of pre-globular/globular and late-stage embryos contained both low methyl-esterified HG epitopes as well as partially and highly methyl-esterified ones. Extracellular matrix which covered surface of early developing embryos contained pectin epitopes recognized by 2F4, LM18, JIM5, JIM7 and LM5 antibodies. De-esterification of cell wall pectins by NaOH caused a decrease or an elimination of immunolabeling in the case of highly methyl-esterified HG epitopes. However, immunolabeling of some low methyl-esterified epitopes appeared stronger after this base treatment. Conclusions/Significance These data suggest that both low

Postnatal Developmental Trajectories of Neural Circuits in the Primate Prefrontal Cortex: Identifying Sensitive Periods for Vulnerability to Schizophrenia

Science.gov (United States)

Hoftman, Gil D.; Lewis, David A.

2011-01-01

Schizophrenia is a disorder of cognitive neurodevelopment with characteristic abnormalities in working memory attributed, at least in part, to alterations in the circuitry of the dorsolateral prefrontal cortex. Various environmental exposures from conception through adolescence increase risk for the illness, possibly by altering the developmental trajectories of prefrontal cortical circuits. Macaque monkeys provide an excellent model system for studying the maturation of prefrontal cortical circuits. Here, we review the development of glutamatergic and γ-aminobutyric acid (GABA)-ergic circuits in macaque monkey prefrontal cortex and discuss how these trajectories may help to identify sensitive periods during which environmental exposures, such as those associated with increased risk for schizophrenia, might lead to the types of abnormalities in prefrontal cortical function present in schizophrenia. PMID:21505116

CONDOR: a database resource of developmentally associated conserved non-coding elements

Directory of Open Access Journals (Sweden)

Smith Sarah

2007-08-01

Full Text Available Abstract Background Comparative genomics is currently one of the most popular approaches to study the regulatory architecture of vertebrate genomes. Fish-mammal genomic comparisons have proved powerful in identifying conserved non-coding elements likely to be distal cis-regulatory modules such as enhancers, silencers or insulators that control the expression of genes involved in the regulation of early development. The scientific community is showing increasing interest in characterizing the function, evolution and language of these sequences. Despite this, there remains little in the way of user-friendly access to a large dataset of such elements in conjunction with the analysis and the visualization tools needed to study them. Description Here we present CONDOR (COnserved Non-coDing Orthologous Regions available at: http://condor.fugu.biology.qmul.ac.uk. In an interactive and intuitive way the website displays data on > 6800 non-coding elements associated with over 120 early developmental genes and conserved across vertebrates. The database regularly incorporates results of ongoing in vivo zebrafish enhancer assays of the CNEs carried out in-house, which currently number ~100. Included and highlighted within this set are elements derived from duplication events both at the origin of vertebrates and more recently in the teleost lineage, thus providing valuable data for studying the divergence of regulatory roles between paralogs. CONDOR therefore provides a number of tools and facilities to allow scientists to progress in their own studies on the function and evolution of developmental cis-regulation. Conclusion By providing access to data with an approachable graphics interface, the CONDOR database presents a rich resource for further studies into the regulation and evolution of genes involved in early development.

Rational Choice and Developmental Influences on Recidivism Among Adolescent Felony Offenders

OpenAIRE

Fagan, Jeffrey; Piquero, Alex R.

2007-01-01

Recent case law and social science both have claimed that the developmental limitations of adolescents affect their capacity for control and decision making with respect to crime, diminishing their culpability and reducing their exposure to punishment. Social science has focused on two concurrent adolescent developmental influences: the internalization of legal rules and norms that regulate social and antisocial behaviors, and the development of rationality to frame behavioral choices and dec...

CB1 cannabinoid receptor expression in the striatum: Association with corticostriatal circuits and developmental regulation

Directory of Open Access Journals (Sweden)

Vincent eVan Waes

2012-03-01

Full Text Available Corticostriatal circuits mediate various aspects of goal-directed behavior and are critically important for basal ganglia-related disorders. Activity in these circuits is regulated by the endocannabinoid system via stimulation of CB1 cannabinoid receptors. CB1 receptors are highly expressed in projection neurons and select interneurons of the striatum, but expression levels vary considerably between different striatal regions (functional domains. We investigated CB1 receptor expression within specific corticostriatal circuits by mapping CB1 mRNA levels in striatal sectors defined by their cortical inputs in rats. We also assessed changes in CB1 expression in the striatum during development. Our results show that CB1 expression is highest in juveniles (P25 and then progressively decreases towards adolescent (P40 and adult (P70 levels. At every age, CB1 receptors are predominantly expressed in sensorimotor striatal sectors, with considerably lower expression in associative and limbic sectors. Moreover, for most corticostriatal circuits there is an inverse relationship between cortical and striatal expression levels. Thus, striatal sectors with high CB1 expression (sensorimotor sectors tend to receive inputs from cortical areas with low expression, while striatal sectors with low expression (associative/limbic sectors receive inputs from cortical regions with higher expression (medial prefrontal cortex. In so far as CB1 mRNA levels reflect receptor function, our findings suggest differential CB1 signaling between different developmental stages and between sensorimotor and associative/limbic circuits. The regional distribution of CB1 receptor expression in the striatum further suggests that, in sensorimotor sectors, CB1 receptors mostly regulate GABA inputs from local axon collaterals of projection neurons, whereas in associative/limbic sectors, CB1 regulation of GABA inputs from interneurons and glutamate inputs may be more important.

The systematic functional analysis of plasmodium protein kinases identifies essential regulators of mosquito transmission

KAUST Repository

Tewari, Rita; Straschil, Ursula; Bateman, Alex; Bö hme, Ulrike; Cherevach, Inna; Gong, Peng; Pain, Arnab; Billker, Oliver

2010-01-01

Although eukaryotic protein kinases (ePKs) contribute to many cellular processes, only three Plasmodium falciparum ePKs have thus far been identified as essential for parasite asexual blood stage development. To identify pathways essential for parasite transmission between their mammalian host and mosquito vector, we undertook a systematic functional analysis of ePKs in the genetically tractable rodent parasite Plasmodium berghei. Modeling domain signatures of conventional ePKs identified 66 putative Plasmodium ePKs. Kinomes are highly conserved between Plasmodium species. Using reverse genetics, we show that 23 ePKs are redundant for asexual erythrocytic parasite development in mice. Phenotyping mutants at four life cycle stages in Anopheles stephensi mosquitoes revealed functional clusters of kinases required for sexual development and sporogony. Roles for a putative SR protein kinase (SRPK) in microgamete formation, a conserved regulator of clathrin uncoating (GAK) in ookinete formation, and a likely regulator of energy metabolism (SNF1/KIN) in sporozoite development were identified. 2010 Elsevier Inc.

The systematic functional analysis of plasmodium protein kinases identifies essential regulators of mosquito transmission

KAUST Repository

Tewari, Rita

2010-10-21

Although eukaryotic protein kinases (ePKs) contribute to many cellular processes, only three Plasmodium falciparum ePKs have thus far been identified as essential for parasite asexual blood stage development. To identify pathways essential for parasite transmission between their mammalian host and mosquito vector, we undertook a systematic functional analysis of ePKs in the genetically tractable rodent parasite Plasmodium berghei. Modeling domain signatures of conventional ePKs identified 66 putative Plasmodium ePKs. Kinomes are highly conserved between Plasmodium species. Using reverse genetics, we show that 23 ePKs are redundant for asexual erythrocytic parasite development in mice. Phenotyping mutants at four life cycle stages in Anopheles stephensi mosquitoes revealed functional clusters of kinases required for sexual development and sporogony. Roles for a putative SR protein kinase (SRPK) in microgamete formation, a conserved regulator of clathrin uncoating (GAK) in ookinete formation, and a likely regulator of energy metabolism (SNF1/KIN) in sporozoite development were identified. 2010 Elsevier Inc.

The History of Legislation and Regulations Related to Children with Developmental Disabilities: Implications for School Nursing Practice Today

Science.gov (United States)

Dang, Michelle T.

2010-01-01

A significant number of children in the United States have developmental disabilities. Historically, many children with developmental disabilities were institutionalized and rarely seen in public. Currently, children with developmental disabilities are entitled to education and health-related support services that permit them access to public…

cGMP and NHR signaling co-regulate expression of insulin-like peptides and developmental activation of infective larvae in Strongyloides stercoralis.

Directory of Open Access Journals (Sweden)

Jonathan D Stoltzfus

2014-07-01

Full Text Available The infectious form of the parasitic nematode Strongyloides stercoralis is a developmentally arrested third-stage larva (L3i, which is morphologically similar to the developmentally arrested dauer larva in the free-living nematode Caenorhabditis elegans. We hypothesize that the molecular pathways regulating C. elegans dauer development also control L3i arrest and activation in S. stercoralis. This study aimed to determine the factors that regulate L3i activation, with a focus on G protein-coupled receptor-mediated regulation of cyclic guanosine monophosphate (cGMP pathway signaling, including its modulation of the insulin/IGF-1-like signaling (IIS pathway. We found that application of the membrane-permeable cGMP analog 8-bromo-cGMP potently activated development of S. stercoralis L3i, as measured by resumption of feeding, with 85.1 ± 2.2% of L3i feeding in 200 µM 8-bromo-cGMP in comparison to 0.6 ± 0.3% in the buffer diluent. Utilizing RNAseq, we examined L3i stimulated with DMEM, 8-bromo-cGMP, or the DAF-12 nuclear hormone receptor (NHR ligand Δ7-dafachronic acid (DA--a signaling pathway downstream of IIS in C. elegans. L3i stimulated with 8-bromo-cGMP up-regulated transcripts of the putative agonistic insulin-like peptide (ILP -encoding genes Ss-ilp-1 (20-fold and Ss-ilp-6 (11-fold in comparison to controls without stimulation. Surprisingly, we found that Δ7-DA similarly modulated transcript levels of ILP-encoding genes. Using the phosphatidylinositol-4,5-bisphosphate 3-kinase inhibitor LY294002, we demonstrated that 400 nM Δ7-DA-mediated activation (93.3 ± 1.1% L3i feeding can be blocked using this IIS inhibitor at 100 µM (7.6 ± 1.6% L3i feeding. To determine the tissues where promoters of ILP-encoding genes are active, we expressed promoter::egfp reporter constructs in transgenic S. stercoralis post-free-living larvae. Ss-ilp-1 and Ss-ilp-6 promoters are active in the hypodermis and neurons and the Ss-ilp-7 promoter is active in the

Identification of novel miRNAs and miRNA dependent developmental shifts of gene expression in Arabidopsis thaliana.

Directory of Open Access Journals (Sweden)

Shuhua Zhan

Full Text Available microRNAs (miRNAs are small, endogenous RNAs of 20 approximately 25 nucleotides, processed from stem-loop regions of longer RNA precursors. Plant miRNAs act as negative regulators of target mRNAs predominately by slicing target transcripts, and a number of miRNAs play important roles in development. We analyzed a number of published datasets from Arabidopsis thaliana to characterize novel miRNAs, novel miRNA targets, and miRNA-regulated developmental changes in gene expression. These data include microarray profiling data and small RNA (sRNA deep sequencing data derived from miRNA biogenesis/transport mutants, microarray profiling data of mRNAs in a developmental series, and computational predictions of conserved genomic stem-loop structures. Our conservative analyses identified five novel mature miRNAs and seven miRNA targets, including one novel target gene. Two complementary miRNAs that target distinct mRNAs were encoded by one gene. We found that genes targeted by known miRNAs, and genes up-regulated or down-regulated in miRNA mutant inflorescences, are highly expressed in the wild type inflorescence. In addition, transcripts upregulated within the mutant inflorescences were abundant in wild type leaves and shoot meristems and low in pollen and seed. Downregulated transcripts were abundant in wild type pollen and seed and low in shoot meristems, roots and leaves. Thus, disrupting miRNA function causes the inflorescence transcriptome to resemble the leaf and meristem and to differ from pollen and seed. Applications of our computational approach to other species and the use of more liberal criteria than reported here will further expand the number of identified miRNAs and miRNA targets. Our findings suggest that miRNAs have a global role in promoting vegetative to reproductive transitions in A. thaliana.

The Neurospora rca-1 gene complements an Aspergillus flbD sporulation mutant but has no identifiable role in Neurospora sporulation.

OpenAIRE

Shen, W C; Wieser, J; Adams, T H; Ebbole, D J

1998-01-01

The Aspergillus nidulans flbD gene encodes a protein with a Myb-like DNA-binding domain that is proposed to act in concert with other developmental regulators to control initiation of conidiophore development. We have identified a Neurospora crassa gene called rca-1 (regulator of conidiation in Aspergillus) based on its sequence similarity to flbD. We found that N. crassa rca-1 can complement the conidiation defect of an A. nidulans flbD mutant and that induced expression of rca-1 caused coni...

Phenanthrene causes ocular developmental toxicity in zebrafish embryos and the possible mechanisms involved

International Nuclear Information System (INIS)

Huang, Lixing; Wang, Chonggang; Zhang, Youyu; Wu, Meifang; Zuo, Zhenghong

2013-01-01

Highlights: • Phe exposure caused obvious morphological changes in the retina. • Phe exposure caused apoptosis and reduction of cell proliferation in the retina. • Phe causes ocular toxicity might be via the AhR/Zeb1/Mitf/Pax6 signaling pathway. • AhR is a repressor of Zeb1. -- Abstract: Recent studies show that polycyclic aromatic hydrocarbons (PAHs) may be a candidate cause of developmental defects of the retina, but the mechanism is still unclear. We evaluated the mechanism(s) underlying PAH-induced retinal development defects due to exposure to environmental concentrations of Phenanthrene (Phe) in zebrafish. We found that exposure to environmental concentrations of Phe caused obvious morphological changes, developmental retardation, apoptosis, and reduction of cell proliferation in the retina. Our results indicated that Phe could cause visual system developmental defects. Phe exposure up-regulated aryl hydrocarbon receptor (AhR) and microphthalmia-associated transcription factor (Mtif) expression, and down-regulated zinc finger E-box binding homeobox 1 (Zeb1) and paired box 6 (Pax6). Moreover, we demonstrated that AhR was a repressor of Zeb1. We propose that Phe's ocular toxicity is mediated by up-regulating AhR, which then down-regulates Zeb1, in turn inducing Mitf expression while inhibiting Pax6 expression

Fired up or burned out? How developmental challenge differentially impacts leader behavior.

Science.gov (United States)

Courtright, Stephen H; Colbert, Amy E; Choi, Daejeong

2014-07-01

Leadership development research has largely drawn on experiential and enactive learning theories to explore the positive effects of developmental challenge on leaders. In contrast, we examined potential positive and negative effects of developmental challenge (i.e., challenging job assignments) on leader behavior through an alternative theoretical lens--transactional stress theory. We predicted, on one hand, that developmental challenge may be associated with higher leader engagement and transformational leadership behavior; however, developmental challenge also has the potential to be associated with higher leader emotional exhaustion and laissez-faire leadership behavior. We further proposed that leadership self-efficacy (LSE) moderates these potential effects of developmental challenge and helps explain why leaders react either positively or negatively to developmental challenge. We tested our hypotheses in a sample of 153 leaders and 631 direct reports at a Fortune 500 company. Findings supported positive relationships among developmental challenge, leader engagement, and transformational leadership. However, we also found support for significant relationships among developmental challenge, emotional exhaustion, and laissez-faire leadership. Additionally, leaders lower in LSE were more likely to encounter the negative effects of developmental challenge by experiencing increased emotional exhaustion and displaying laissez-faire leadership behaviors. Our study contributes to theory and practice by elucidating a "dark side" of developmental challenge, identifying LSE as a moderator of the negative effects of developmental challenge, identifying antecedents of transformational and laissez-faire leadership behaviors, and investigating demands and stress in leadership roles.

Hydroxylated PBDEs induce developmental arrest in zebrafish

Energy Technology Data Exchange (ETDEWEB)

Usenko, Crystal Y., E-mail: Crystal_usenko@baylor.edu; Hopkins, David C.; Trumble, Stephen J., E-mail: Stephen_trumble@baylor.edu; Bruce, Erica D., E-mail: Erica_bruce@baylor.edu

2012-07-01

The ubiquitous spread of polybrominated diphenyl ethers (PBDEs) has led to concerns regarding the metabolites of these congeners, in particular hydroxylated PBDEs. There are limited studies regarding the biological interactions of these chemicals, yet there is some concern they may be more toxic than their parent compounds. In this study three hydroxylated PBDEs were assessed for toxicity in embryonic zebrafish: 3-OH-BDE 47, 5-OH-BDE 47, and 6-OH-BDE 47. All three congeners induced developmental arrest in a concentration-dependent manner; however, 6-OH-BDE 47 induced adverse effects at lower concentrations than the other congeners. Furthermore, all three induced cell death; however apoptosis was not observed. In short-term exposures (24–28 hours post fertilization), all hydroxylated PBDEs generated oxidative stress in the region corresponding to the cell death at 5 and 10 ppm. To further investigate the short-term effects that may be responsible for the developmental arrest observed in this study, gene regulation was assessed for embryos exposed to 0.625 ppm 6-OH-BDE 47 from 24 to 28 hpf. Genes involved in stress response, thyroid hormone regulation, and neurodevelopment were significantly upregulated compared to controls; however, genes related to oxidative stress were either unaffected or downregulated. This study suggests that hydroxylated PBDEs disrupt development, and may induce oxidative stress and potentially disrupt the cholinergic system and thyroid hormone homeostasis. -- Highlights: ► OH-PBDEs induce developmental arrest in a concentration-dependent manner. ► Hydroxyl group location influences biological interaction. ► OH-PBDEs induce oxidative stress. ► Thyroid hormone gene regulation was disrupted following exposure. ► To our knowledge, this is the first whole organism study of OH-PBDE toxicity.

Identifying gene coexpression networks underlying the dynamic regulation of wood-forming tissues in Populus under diverse environmental conditions.

Science.gov (United States)

Zinkgraf, Matthew; Liu, Lijun; Groover, Andrew; Filkov, Vladimir

2017-06-01

Trees modify wood formation through integration of environmental and developmental signals in complex but poorly defined transcriptional networks, allowing trees to produce woody tissues appropriate to diverse environmental conditions. In order to identify relationships among genes expressed during wood formation, we integrated data from new and publically available datasets in Populus. These datasets were generated from woody tissue and include transcriptome profiling, transcription factor binding, DNA accessibility and genome-wide association mapping experiments. Coexpression modules were calculated, each of which contains genes showing similar expression patterns across experimental conditions, genotypes and treatments. Conserved gene coexpression modules (four modules totaling 8398 genes) were identified that were highly preserved across diverse environmental conditions and genetic backgrounds. Functional annotations as well as correlations with specific experimental treatments associated individual conserved modules with distinct biological processes underlying wood formation, such as cell-wall biosynthesis, meristem development and epigenetic pathways. Module genes were also enriched for DNase I hypersensitivity footprints and binding from four transcription factors associated with wood formation. The conserved modules are excellent candidates for modeling core developmental pathways common to wood formation in diverse environments and genotypes, and serve as testbeds for hypothesis generation and testing for future studies. No claim to original US government works. New Phytologist © 2017 New Phytologist Trust.

Proximity-based differential single cell analysis of the niche to identify stem/progenitor cell regulators

Science.gov (United States)

Silberstein, Lev; Goncalves, Kevin A; Kharchenko, Peter V; Turcotte, Raphael; Kfoury, Youmna; Mercier, Francois; Baryawno, Ninib; Severe, Nicolas; Bachand, Jacqueline; Spencer, Joel; Papazian, Ani; Lee, Dongjun; Chitteti, Brahmananda Reddy; Srour, Edward F; Hoggatt, Jonathan; Tate, Tiffany; Celso, Cristina Lo; Ono, Noriaki; Nutt, Stephen; Heino, Jyrki; Sipilä, Kalle; Shioda, Toshihiro; Osawa, Masatake; Lin, Charles P; Hu, Guo-fu; Scadden, David T

2016-01-01

SUMMARY Physiological stem cell function is regulated by secreted factors produced by niche cells. In this study, we describe an unbiased approach based on differential single-cell gene expression analysis of mesenchymal osteolineage cells close to and further removed from hematopoietic stem/progenitor cells to identify candidate niche factors. Mesenchymal cells displayed distinct molecular profiles based on their relative location. Amongst the genes which were preferentially expressed in proximal cells, we functionally examined three secreted or cell surface molecules not previously connected to HSPC biology: the secreted RNase Angiogenin, the cytokine IL18 and the adhesion molecule Embigin and discovered that all of these factors are HSPC quiescence regulators. Our proximity-based differential single cell approach therefore reveals molecular heterogeneity within niche cells and can be used to identify novel extrinsic stem/progenitor cell regulators. Similar approaches could also be applied to other stem cell/niche pairs to advance understanding of microenvironmental regulation of stem cell function. PMID:27524439

Developmental Principles: Fact or Fiction

Directory of Open Access Journals (Sweden)

A. J. Durston

2012-01-01

Full Text Available While still at school, most of us are deeply impressed by the underlying principles that so beautifully explain why the chemical elements are ordered as they are in the periodic table, and may wonder, with the theoretician Brian Goodwin, “whether there might be equally powerful principles that account for the awe-inspiring diversity of body forms in the living realm”. We have considered the arguments for developmental principles, conclude that they do exist and have specifically identified features that may generate principles associated with Hox patterning of the main body axis in bilaterian metazoa in general and in the vertebrates in particular. We wonder whether this exercise serves any purpose. The features we discuss were already known to us as parts of developmental mechanisms and defining developmental principles (how, and at which level? adds no insight. We also see little profit in the proposal by Goodwin that there are principles outside the emerging genetic mechanisms that need to be taken into account. The emerging developmental genetic hierarchies already reveal a wealth of interesting phenomena, whatever we choose to call them.

A genome-wide RNAi screen identifies regulators of cholesterol-modified hedgehog secretion in Drosophila.

Directory of Open Access Journals (Sweden)

Reid Aikin

Full Text Available Hedgehog (Hh proteins are secreted molecules that function as organizers in animal development. In addition to being palmitoylated, Hh is the only metazoan protein known to possess a covalently-linked cholesterol moiety. The absence of either modification severely disrupts the organization of numerous tissues during development. It is currently not known how lipid-modified Hh is secreted and released from producing cells. We have performed a genome-wide RNAi screen in Drosophila melanogaster cells to identify regulators of Hh secretion. We found that cholesterol-modified Hh secretion is strongly dependent on coat protein complex I (COPI but not COPII vesicles, suggesting that cholesterol modification alters the movement of Hh through the early secretory pathway. We provide evidence that both proteolysis and cholesterol modification are necessary for the efficient trafficking of Hh through the ER and Golgi. Finally, we identified several putative regulators of protein secretion and demonstrate a role for some of these genes in Hh and Wingless (Wg morphogen secretion in vivo. These data open new perspectives for studying how morphogen secretion is regulated, as well as provide insight into regulation of lipid-modified protein secretion.

Microcystin-LR exposure induces developmental neurotoxicity in zebrafish embryo

International Nuclear Information System (INIS)

Wu, Qin; Yan, Wei; Liu, Chunsheng; Li, Li; Yu, Liqin; Zhao, Sujuan; Li, Guangyu

2016-01-01

Microcystin-LR (MCLR) is a commonly acting potent hepatotoxin and has been pointed out of potentially causing developmental neurotoxicity, but the exact mechanism is little known. In this study, zebrafish embryos were exposed to 0, 0.8, 1.6 or 3.2 mg/L MCLR for 120 h. MCLR exposure through submersion caused serious hatching delay and body length decrease. The content of MCLR in zebrafish larvae was analyzed and the results demonstrated that MCLR can accumulate in zebrafish larvae. The locomotor speed of zebrafish larvae was decreased. Furthermore, the dopamine and acetylcholine (ACh) content were detected to be significantly decreased in MCLR exposure groups. And the acetylcholinesterase (AChE) activity was significantly increased after exposure to 1.6 and 3.2 mg/L MCLR. The transcription pattern of manf, chrnα7 and ache gene was consistent with the change of the dopamine content, ACh content and AChE activity. Gene expression involved in the development of neurons was also measured. α1-tubulin and shha gene expression were down-regulated, whereas mbp and gap43 gene expression were observed to be significantly up-regulated upon exposure to MCLR. The above results indicated that MCLR-induced developmental toxicity might attribute to the disorder of cholinergic system, dopaminergic signaling, and the development of neurons. - Highlights: • MCLR accumulation induces developmental neurotoxicity in zebrafish embryo. • The decrease of dopamine levels might be associated with the MCLR-induced developmental neurotoxicity in zebrafish larvae. • The alternation of cholinergic system might contribute to the change of neurobehavior in zebrafish larvae exposure with MCLR. - MCLR accumulation induces developmental neurotoxicity by affecting cholinergic system, dopaminergic signaling, and the development of neurons in zebrafish embryo.

Problems with a False Recognition Paradigm for Developmental Memory Research

Science.gov (United States)

Lindauer, Barbara K.; Paris, Scott G.

1976-01-01

Developmental changes in memory organization based on synonym and antonym relationships were examined in three experiments. Subjects were 64 second graders and 64 sixth graders. Some inadequacies of a false recognition paradigm for developmental research are identified and some alternative analyses are proposed. (Author/JH)

Constructivist developmental theory is needed in developmental neuroscience

Science.gov (United States)

Arsalidou, Marie; Pascual-Leone, Juan

2016-12-01

Neuroscience techniques provide an open window previously unavailable to the origin of thoughts and actions in children. Developmental cognitive neuroscience is booming, and knowledge from human brain mapping is finding its way into education and pediatric practice. Promises of application in developmental cognitive neuroscience rests however on better theory-guided data interpretation. Massive amounts of neuroimaging data from children are being processed, yet published studies often do not frame their work within developmental models—in detriment, we believe, to progress in this field. Here we describe some core challenges in interpreting the data from developmental cognitive neuroscience, and advocate the use of constructivist developmental theories of human cognition with a neuroscience interpretation.

Developmental biology in marine invertebrate symbioses.

Science.gov (United States)

McFall-Ngai, M J; Ruby, E G

2000-12-01

Associations between marine invertebrates and their cooperative bacterial symbionts offer access to an understanding of the roots of host-microbe interaction; for example, several symbioses like the squid-vibrio light organ association serve as models for investigating how each partner affects the developmental biology of the other. Previous results have identified a program of specific developmental events that unfolds as the association is initiated. In the past year, published studies have focused primarily on describing the mechanisms underlying the signaling processes that occur between the juvenile squid and the luminous bacteria that colonize it.

Applying Evolutionary Genetics to Developmental Toxicology and Risk Assessment

Science.gov (United States)

Leung, Maxwell C. K.; Procter, Andrew C.; Goldstone, Jared V.; Foox, Jonathan; DeSalle, Robert; Mattingly, Carolyn J.; Siddall, Mark E.; Timme-Laragy, Alicia R.

2018-01-01

Evolutionary thinking continues to challenge our views on health and disease. Yet, there is a communication gap between evolutionary biologists and toxicologists in recognizing the connections among developmental pathways, high-throughput screening, and birth defects in humans. To increase our capability in identifying potential developmental toxicants in humans, we propose to apply evolutionary genetics to improve the experimental design and data interpretation with various in vitro and whole-organism models. We review five molecular systems of stress response and update 18 consensual cell-cell signaling pathways that are the hallmark for early development, organogenesis, and differentiation; and revisit the principles of teratology in light of recent advances in high-throughput screening, big data techniques, and systems toxicology. Multiscale systems modeling plays an integral role in the evolutionary approach to cross-species extrapolation. Phylogenetic analysis and comparative bioinformatics are both valuable tools in identifying and validating the molecular initiating events that account for adverse developmental outcomes in humans. The discordance of susceptibility between test species and humans (ontogeny) reflects their differences in evolutionary history (phylogeny). This synthesis not only can lead to novel applications in developmental toxicity and risk assessment, but also can pave the way for applying an evo-devo perspective to the study of developmental origins of health and disease. PMID:28267574

Evolution of branched regulatory genetic pathways: directional selection on pleiotropic loci accelerates developmental system drift.

Science.gov (United States)

Johnson, Norman A; Porter, Adam H

2007-01-01

Developmental systems are regulated by a web of interacting loci. One common and useful approach in studying the evolution of development is to focus on classes of interacting elements within these systems. Here, we use individual-based simulations to study the evolution of traits controlled by branched developmental pathways involving three loci, where one locus regulates two different traits. We examined the system under a variety of selective regimes. In the case where one branch was under stabilizing selection and the other under directional selection, we observed "developmental system drift": the trait under stabilizing selection showed little phenotypic change even though the loci underlying that trait showed considerable evolutionary divergence. This occurs because the pleiotropic locus responds to directional selection and compensatory mutants are then favored in the pathway under stabilizing selection. Though developmental system drift may be caused by other mechanisms, it seems likely that it is accelerated by the same underlying genetic mechanism as that producing the Dobzhansky-Muller incompatibilities that lead to speciation in both linear and branched pathways. We also discuss predictions of our model for developmental system drift and how different selective regimes affect probabilities of speciation in the branched pathway system.

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

OpenAIRE

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...

Deciphering the Developmental Dynamics of the Mouse Liver Transcriptome.

Directory of Open Access Journals (Sweden)

Sumedha S Gunewardena

Full Text Available During development, liver undergoes a rapid transition from a hematopoietic organ to a major organ for drug metabolism and nutrient homeostasis. However, little is known on a transcriptome level of the genes and RNA-splicing variants that are differentially regulated with age, and which up-stream regulators orchestrate age-specific biological functions in liver. We used RNA-Seq to interrogate the developmental dynamics of the liver transcriptome in mice at 12 ages from late embryonic stage (2-days before birth to maturity (60-days after birth. Among 21,889 unique NCBI RefSeq-annotated genes, 9,641 were significantly expressed in at least one age, 7,289 were differently regulated with age, and 859 had multiple (> = 2 RNA splicing-variants. Factor analysis showed that the dynamics of hepatic genes fall into six distinct groups based on their temporal expression. The average expression of cytokines, ion channels, kinases, phosphatases, transcription regulators and translation regulators decreased with age, whereas the average expression of peptidases, enzymes and transmembrane receptors increased with age. The average expression of growth factors peak between Day-3 and Day-10, and decrease thereafter. We identified critical biological functions, upstream regulators, and putative transcription modules that seem to govern age-specific gene expression. We also observed differential ontogenic expression of known splicing variants of certain genes, and 1,455 novel splicing isoform candidates. In conclusion, the hepatic ontogeny of the transcriptome ontogeny has unveiled critical networks and up-stream regulators that orchestrate age-specific biological functions in liver, and suggest that age contributes to the complexity of the alternative splicing landscape of the hepatic transcriptome.

The Comet Cometh: Evolving Developmental Systems.

Science.gov (United States)

Jaeger, Johannes; Laubichler, Manfred; Callebaut, Werner

In a recent opinion piece, Denis Duboule has claimed that the increasing shift towards systems biology is driving evolutionary and developmental biology apart, and that a true reunification of these two disciplines within the framework of evolutionary developmental biology (EvoDevo) may easily take another 100 years. He identifies methodological, epistemological, and social differences as causes for this supposed separation. Our article provides a contrasting view. We argue that Duboule's prediction is based on a one-sided understanding of systems biology as a science that is only interested in functional, not evolutionary, aspects of biological processes. Instead, we propose a research program for an evolutionary systems biology, which is based on local exploration of the configuration space in evolving developmental systems. We call this approach-which is based on reverse engineering, simulation, and mathematical analysis-the natural history of configuration space. We discuss a number of illustrative examples that demonstrate the past success of local exploration, as opposed to global mapping, in different biological contexts. We argue that this pragmatic mode of inquiry can be extended and applied to the mathematical analysis of the developmental repertoire and evolutionary potential of evolving developmental mechanisms and that evolutionary systems biology so conceived provides a pragmatic epistemological framework for the EvoDevo synthesis.

Proteomic Analysis of Fetal Ovary Reveals That Ovarian Developmental Potential Is Greater in Meishan Pigs than in Yorkshire Pigs.

Directory of Open Access Journals (Sweden)

Mengmeng Xu

Full Text Available Time-dependent expression of functional proteins in fetal ovaries is important to understand the developmental process of the ovary. This study was carried out to enhance our understanding of the developmental process of porcine fetal ovaries and to better address the differences in fetal ovary development of local and foreign pigs. The objective of the present study is to test the expression of key proteins that regulate the growth and development of fetal ovaries in Meishan and Yorkshire porcine breeds by using proteomics technology. Six Meishan and 6 Yorkshire pregnant gilts were used in this experiment. Fetal ovaries were obtained from Yorkshire and Meishan gilts on days 55 and 90 of the gestation period. Using 2D-DIGE (two dimensional-difference in gel electrophoresis analysis, the results showed that there are about 1551 and 1400 proteins in gilt fetal ovaries on days 55 and 90, respectively of the gestation. Using MALDI TOF-TOF MS analysis, 27 differentially expressed proteins were identified in the fetal ovaries of the 2 breeds on day 55 of gestation, and a total of 18 proteins were identified on day 90 of gestation. These differentially expressed proteins were involved in the regulation of biological processes (cell death, stress response, cytoskeletal proteins and molecular functions (enzyme regulator activity. We also found that alpha-1-antitrypsin, actin, vimentin, and PP2A proteins promote the formation of primordial follicles in the ovaries of Yorkshire pigs on day 55 of gestation while low expression heat shock proteins and high expression alpha-fetoproteins (AFP may promote Meishan fetal ovarian follicular development on day 90 of gestation. These findings provide a deeper understanding of how reduced expression of heat shock proteins and increased expression of AFP can significantly reduce the risk of reproductive disease in obese Meishan sows. Our study also shows how these proteins can increase the ovulation rate and may be

Proteomic Analysis of Fetal Ovary Reveals That Ovarian Developmental Potential Is Greater in Meishan Pigs than in Yorkshire Pigs.

Science.gov (United States)

Xu, Mengmeng; Che, Long; Wang, Dingyue; Yang, Zhenguo; Zhang, Pan; Lin, Yan; Fang, Zhengfeng; Che, Lianqiang; Li, Jian; Chen, Daiwen; Wu, De; Xu, Shengyu

2015-01-01

Time-dependent expression of functional proteins in fetal ovaries is important to understand the developmental process of the ovary. This study was carried out to enhance our understanding of the developmental process of porcine fetal ovaries and to better address the differences in fetal ovary development of local and foreign pigs. The objective of the present study is to test the expression of key proteins that regulate the growth and development of fetal ovaries in Meishan and Yorkshire porcine breeds by using proteomics technology. Six Meishan and 6 Yorkshire pregnant gilts were used in this experiment. Fetal ovaries were obtained from Yorkshire and Meishan gilts on days 55 and 90 of the gestation period. Using 2D-DIGE (two dimensional-difference in gel electrophoresis) analysis, the results showed that there are about 1551 and 1400 proteins in gilt fetal ovaries on days 55 and 90, respectively of the gestation. Using MALDI TOF-TOF MS analysis, 27 differentially expressed proteins were identified in the fetal ovaries of the 2 breeds on day 55 of gestation, and a total of 18 proteins were identified on day 90 of gestation. These differentially expressed proteins were involved in the regulation of biological processes (cell death, stress response, cytoskeletal proteins) and molecular functions (enzyme regulator activity). We also found that alpha-1-antitrypsin, actin, vimentin, and PP2A proteins promote the formation of primordial follicles in the ovaries of Yorkshire pigs on day 55 of gestation while low expression heat shock proteins and high expression alpha-fetoproteins (AFP) may promote Meishan fetal ovarian follicular development on day 90 of gestation. These findings provide a deeper understanding of how reduced expression of heat shock proteins and increased expression of AFP can significantly reduce the risk of reproductive disease in obese Meishan sows. Our study also shows how these proteins can increase the ovulation rate and may be responsible for

Methodological Implications of the Affect Revolution: A 35-Year Review of Emotion Regulation Assessment in Children

Science.gov (United States)

Adrian, Molly; Zeman, Janice; Veits, Gina

2011-01-01

This investigation analyzed the methods used over the past 35 years to study emotion regulation (ER) in children. Articles published from 1975 through 2010 were identified in 42 child clinical, developmental, and emotion psychology journals. Overall, 61.1% of published ER articles relied on one method and 23.6% used two methods. Analyses revealed…

Label-free proteome profiling reveals developmental-dependent patterns in young barley grains.

Science.gov (United States)

Kaspar-Schoenefeld, Stephanie; Merx, Kathleen; Jozefowicz, Anna Maria; Hartmann, Anja; Seiffert, Udo; Weschke, Winfriede; Matros, Andrea; Mock, Hans-Peter

2016-06-30

Due to its importance as a cereal crop worldwide, high interest in the determination of factors influencing barley grain quality exists. This study focusses on the elucidation of protein networks affecting early grain developmental processes. NanoLC-based separation coupled to label-free MS detection was applied to gain insights into biochemical processes during five different grain developmental phases (pre-storage until storage phase, 3days to 16days after flowering). Multivariate statistics revealed two distinct developmental patterns during the analysed grain developmental phases: proteins showed either highest abundance in the middle phase of development - in the transition phase - or at later developmental stages - within the storage phase. Verification of developmental patterns observed by proteomic analysis was done by applying hypothesis-driven approaches, namely Western Blot analysis and enzyme assays. High general metabolic activity of the grain with regard to protein synthesis, cell cycle regulation, defence against oxidative stress, and energy production via photosynthesis was observed in the transition phase. Proteins upregulated in the storage phase are related towards storage protein accumulation, and interestingly to the defence of storage reserves against pathogens. A mixed regulatory pattern for most enzymes detected in our study points to regulatory mechanisms at the level of protein isoforms. In-depth understanding of early grain developmental processes of cereal caryopses is of high importance as they influence final grain weight and quality. Our knowledge about these processes is still limited, especially on proteome level. To identify key mechanisms in early barley grain development, a label-free data-independent proteomics acquisition approach has been applied. Our data clearly show, that proteins either exhibit highest expression during cellularization and the switch to the storage phase (transition phase, 5-7 DAF), or during storage

MicroRNAs in Breastmilk and the Lactating Breast: Potential Immunoprotectors and Developmental Regulators for the Infant and the Mother

Directory of Open Access Journals (Sweden)

Mohammed Alsaweed

2015-10-01

Full Text Available Human milk (HM is the optimal source of nutrition, protection and developmental programming for infants. It is species-specific and consists of various bioactive components, including microRNAs, small non-coding RNAs regulating gene expression at the post-transcriptional level. microRNAs are both intra- and extra-cellular and are present in body fluids of humans and animals. Of these body fluids, HM appears to be one of the richest sources of microRNA, which are highly conserved in its different fractions, with milk cells containing more microRNAs than milk lipids, followed by skim milk. Potential effects of exogenous food-derived microRNAs on gene expression have been demonstrated, together with the stability of milk-derived microRNAs in the gastrointestinal tract. Taken together, these strongly support the notion that milk microRNAs enter the systemic circulation of the HM fed infant and exert tissue-specific immunoprotective and developmental functions. This has initiated intensive research on the origin, fate and functional significance of milk microRNAs. Importantly, recent studies have provided evidence of endogenous synthesis of HM microRNA within the human lactating mammary epithelium. These findings will now form the basis for investigations of the role of microRNA in the epigenetic control of normal and aberrant mammary development, and particularly lactation performance.

Proximity-Based Differential Single-Cell Analysis of the Niche to Identify Stem/Progenitor Cell Regulators.

Science.gov (United States)

Silberstein, Lev; Goncalves, Kevin A; Kharchenko, Peter V; Turcotte, Raphael; Kfoury, Youmna; Mercier, Francois; Baryawno, Ninib; Severe, Nicolas; Bachand, Jacqueline; Spencer, Joel A; Papazian, Ani; Lee, Dongjun; Chitteti, Brahmananda Reddy; Srour, Edward F; Hoggatt, Jonathan; Tate, Tiffany; Lo Celso, Cristina; Ono, Noriaki; Nutt, Stephen; Heino, Jyrki; Sipilä, Kalle; Shioda, Toshihiro; Osawa, Masatake; Lin, Charles P; Hu, Guo-Fu; Scadden, David T

2016-10-06

Physiological stem cell function is regulated by secreted factors produced by niche cells. In this study, we describe an unbiased approach based on the differential single-cell gene expression analysis of mesenchymal osteolineage cells close to, and further removed from, hematopoietic stem/progenitor cells (HSPCs) to identify candidate niche factors. Mesenchymal cells displayed distinct molecular profiles based on their relative location. We functionally examined, among the genes that were preferentially expressed in proximal cells, three secreted or cell-surface molecules not previously connected to HSPC biology-the secreted RNase angiogenin, the cytokine IL18, and the adhesion molecule Embigin-and discovered that all of these factors are HSPC quiescence regulators. Therefore, our proximity-based differential single-cell approach reveals molecular heterogeneity within niche cells and can be used to identify novel extrinsic stem/progenitor cell regulators. Similar approaches could also be applied to other stem cell/niche pairs to advance the understanding of microenvironmental regulation of stem cell function. Copyright © 2016 Elsevier Inc. All rights reserved.

Applied Developmental Science, Social Justice, and Socio-Political Well-Being

Science.gov (United States)

Fisher, Celia B.; Busch-Rossnagel, Nancy A.; Jopp, Daniela S.; Brown, Joshua L.

2012-01-01

In this article we present a vision of applied developmental science (ADS) as a means of promoting social justice and socio-political well-being. This vision draws upon the field's significant accomplishments in identifying and strengthening developmental assets in marginalized youth communities, understanding the effects of poverty and racial…

Gene up-regulation in response to predator kairomones in the water flea, Daphnia pulex

Directory of Open Access Journals (Sweden)

Okada Yasukazu

2010-04-01

Full Text Available Abstract Background Numerous cases of predator-induced polyphenisms, in which alternate phenotypes are produced in response to extrinsic stimuli, have been reported in aquatic taxa to date. The genus Daphnia (Branchiopoda, Cladocera provides a model experimental system for the study of the developmental mechanisms and evolutionary processes associated with predator-induced polyphenisms. In D. pulex, juveniles form neckteeth in response to predatory kairomones released by Chaoborus larvae (Insecta, Diptera. Results Previous studies suggest that the timing of the sensitivity to kairomones in D. pulex can generally be divided into the embryonic and postembryonic developmental periods. We therefore examined which of the genes in the embryonic and first-instar juvenile stages exhibit different expression levels in the presence or absence of predator kairomones. Employing a candidate gene approach and identifying differentially-expressed genes revealed that the morphogenetic factors, Hox3, extradenticle and escargot, were up-regulated by kairomones in the postembryonic stage and may potentially be responsible for defense morph formation. In addition, the juvenile hormone pathway genes, JHAMT and Met, and the insulin signaling pathway genes, InR and IRS-1, were up-regulated in the first-instar stage. It is well known that these hormonal pathways are involved in physiological regulation following morphogenesis in many insect species. During the embryonic stage when morphotypes were determined, one of the novel genes identified by differential display was up-regulated, suggesting that this gene may be related to morphotype determination. Biological functions of the up-regulated genes are discussed in the context of defense morph formation. Conclusions It is suggested that, following the reception of kairomone signals, the identified genes are involved in a series of defensive phenotypic alterations and the production of a defensive phenotype.

Pancreatic mesenchyme regulates epithelial organogenesis throughout development.

Directory of Open Access Journals (Sweden)

Limor Landsman

2011-09-01

Full Text Available The developing pancreatic epithelium gives rise to all endocrine and exocrine cells of the mature organ. During organogenesis, the epithelial cells receive essential signals from the overlying mesenchyme. Previous studies, focusing on ex vivo tissue explants or complete knockout mice, have identified an important role for the mesenchyme in regulating the expansion of progenitor cells in the early pancreas epithelium. However, due to the lack of genetic tools directing expression specifically to the mesenchyme, the potential roles of this supporting tissue in vivo, especially in guiding later stages of pancreas organogenesis, have not been elucidated. We employed transgenic tools and fetal surgical techniques to ablate mesenchyme via Cre-mediated mesenchymal expression of Diphtheria Toxin (DT at the onset of pancreas formation, and at later developmental stages via in utero injection of DT into transgenic mice expressing the Diphtheria Toxin receptor (DTR in this tissue. Our results demonstrate that mesenchymal cells regulate pancreatic growth and branching at both early and late developmental stages by supporting proliferation of precursors and differentiated cells, respectively. Interestingly, while cell differentiation was not affected, the expansion of both the endocrine and exocrine compartments was equally impaired. To further elucidate signals required for mesenchymal cell function, we eliminated β-catenin signaling and determined that it is a critical pathway in regulating mesenchyme survival and growth. Our study presents the first in vivo evidence that the embryonic mesenchyme provides critical signals to the epithelium throughout pancreas organogenesis. The findings are novel and relevant as they indicate a critical role for the mesenchyme during late expansion of endocrine and exocrine compartments. In addition, our results provide a molecular mechanism for mesenchymal expansion and survival by identifying β-catenin signaling as an

Aquaporin family genes exhibit developmentally-regulated and host-dependent transcription patterns in the sea louse Caligus rogercresseyi.

Science.gov (United States)

Farlora, Rodolfo; Valenzuela-Muñoz, Valentina; Chávez-Mardones, Jacqueline; Gallardo-Escárate, Cristian

2016-07-01

Aquaporins are small integral membrane proteins that function as pore channels for the transport of water and other small solutes across the cell membrane. Considering the important roles of these proteins in several biological processes, including host-parasite interactions, there has been increased research on aquaporin proteins recently. The present study expands on the knowledge of aquaporin family genes in parasitic copepods, examining diversity and expression during the ontogeny of the sea louse Caligus rogercresseyi. Furthermore, aquaporin expression was evaluated during the early infestation of Atlantic (Salmo salar) and Coho salmon (Oncorhynchus kisutch). Deep transcriptome sequencing data revealed eight full length and two partial open reading frames belonging to the aquaporin protein family. Clustering analyses with identified Caligidae sequences revealed three major clades of aquaglyceroporins (Cr-Glp), classical aquaporin channels (Cr-Bib and Cr-PripL), and unorthodox aquaporins (Cr-Aqp12-like). In silico analysis revealed differential expression of aquaporin genes between developmental stages and between sexes. Male-biased expression of Cr-Glp1_v1 and female-biased expression of Cr-Bib were further confirmed in adults by RT-qPCR. Additionally, gene expressions were measured for seven aquaporins during the early infestation stage. The majority of aquaporin genes showed significant differential transcription expressions between sea lice parasitizing different hosts, with Atlantic salmon sea lice exhibiting overall reduced expression as compared to Coho salmon. The observed differences in the regulation of aquaporin genes may reveal osmoregulatory adaptations associated with nutrient ingestion and metabolite waste export, exposing complex host-parasite relationships in C. rogercresseyi. Copyright © 2016 Elsevier B.V. All rights reserved.

Functional genomics identifies regulators of the phototransduction machinery in the Drosophila larval eye and adult ocelli.

Science.gov (United States)

Mishra, Abhishek Kumar; Bargmann, Bastiaan O R; Tsachaki, Maria; Fritsch, Cornelia; Sprecher, Simon G

2016-02-15

Sensory perception of light is mediated by specialized Photoreceptor neurons (PRs) in the eye. During development all PRs are genetically determined to express a specific Rhodopsin (Rh) gene and genes mediating a functional phototransduction pathway. While the genetic and molecular mechanisms of PR development is well described in the adult compound eye, it remains unclear how the expression of Rhodopsins and the phototransduction cascade is regulated in other visual organs in Drosophila, such as the larval eye and adult ocelli. Using transcriptome analysis of larval PR-subtypes and ocellar PRs we identify and study new regulators required during PR differentiation or necessary for the expression of specific signaling molecules of the functional phototransduction pathway. We found that the transcription factor Krüppel (Kr) is enriched in the larval eye and controls PR differentiation by promoting Rh5 and Rh6 expression. We also identified Camta, Lola, Dve and Hazy as key genes acting during ocellar PR differentiation. Further we show that these transcriptional regulators control gene expression of the phototransduction cascade in both larval eye and adult ocelli. Our results show that PR cell type-specific transcriptome profiling is a powerful tool to identify key transcriptional regulators involved during several aspects of PR development and differentiation. Our findings greatly contribute to the understanding of how combinatorial action of key transcriptional regulators control PR development and the regulation of a functional phototransduction pathway in both larval eye and adult ocelli. Copyright © 2015 Elsevier Inc. All rights reserved.

Functional mapping imprinted quantitative trait loci underlying developmental characteristics

Directory of Open Access Journals (Sweden)

Li Gengxin

2008-03-01

Full Text Available Abstract Background Genomic imprinting, a phenomenon referring to nonequivalent expression of alleles depending on their parental origins, has been widely observed in nature. It has been shown recently that the epigenetic modification of an imprinted gene can be detected through a genetic mapping approach. Such an approach is developed based on traditional quantitative trait loci (QTL mapping focusing on single trait analysis. Recent studies have shown that most imprinted genes in mammals play an important role in controlling embryonic growth and post-natal development. For a developmental character such as growth, current approach is less efficient in dissecting the dynamic genetic effect of imprinted genes during individual ontology. Results Functional mapping has been emerging as a powerful framework for mapping quantitative trait loci underlying complex traits showing developmental characteristics. To understand the genetic architecture of dynamic imprinted traits, we propose a mapping strategy by integrating the functional mapping approach with genomic imprinting. We demonstrate the approach through mapping imprinted QTL controlling growth trajectories in an inbred F2 population. The statistical behavior of the approach is shown through simulation studies, in which the parameters can be estimated with reasonable precision under different simulation scenarios. The utility of the approach is illustrated through real data analysis in an F2 family derived from LG/J and SM/J mouse stains. Three maternally imprinted QTLs are identified as regulating the growth trajectory of mouse body weight. Conclusion The functional iQTL mapping approach developed here provides a quantitative and testable framework for assessing the interplay between imprinted genes and a developmental process, and will have important implications for elucidating the genetic architecture of imprinted traits.

An integrative review of ethnic and cultural variation in socialization and children's self-regulation.

Science.gov (United States)

LeCuyer, Elizabeth A; Zhang, Yi

2015-04-01

To examine the evidence for cross-cultural variation in socialization and children's normative self-regulation, based on a contextual-developmental perspective. Nurses and healthcare workers in multi-cultural societies must understand diversity in socializing influences (including parenting) and in children's behaviour. A contextual-developmental perspective implies that normative cultural and ethnic values will influence socializing processes and behaviour, which in turn will influence children's self-regulation. Integrative review. Studies were located using five major search engines from 1990-2011. Domains of a contextual-developmental perspective and a comprehensive definition of self-regulation assisted the generation of search terms. Selected studies compared at least two ethnic or cultural groups and addressed contextual-developmental domains: (1) culturally specific social values, beliefs, or attitudes; (2) socializing behaviours; and (3) children's normative self-regulation. Eleven studies about children's self-regulation were found to have data consistent with a contextual-developmental perspective. Studies used descriptive correlational or comparative designs with primarily convenience sampling; eight confirmed stated hypotheses, three were exploratory. Findings across studies evidenced coherent patterns of sociocultural influence on children's attention, compliance, delay of gratification, effortful control and executive function. A contextual-developmental perspective provided a useful perspective to examine normative differences in values, socializing behaviours and children's self-regulation. This perspective and these findings are expected to guide future research, to assist nurses and healthcare providers to understand diversity in parenting and children's behaviour. © 2014 John Wiley & Sons Ltd.

Identifying developmental toxicity pathways for a subset of ToxCast chemicals using human embryonic stem cells and metabolomics

Energy Technology Data Exchange (ETDEWEB)

Kleinstreuer, N.C., E-mail: kleinstreuer.nicole@epa.gov [NCCT, US EPA, RTP, NC 27711 (United States); Smith, A.M.; West, P.R.; Conard, K.R.; Fontaine, B.R. [Stemina Biomarker Discovery, Inc., Madison, WI 53719 (United States); Weir-Hauptman, A.M. [Covance, Inc., Madison, WI 53704 (United States); Palmer, J.A. [Stemina Biomarker Discovery, Inc., Madison, WI 53719 (United States); Knudsen, T.B.; Dix, D.J. [NCCT, US EPA, RTP, NC 27711 (United States); Donley, E.L.R. [Stemina Biomarker Discovery, Inc., Madison, WI 53719 (United States); Cezar, G.G. [Stemina Biomarker Discovery, Inc., Madison, WI 53719 (United States); University of Wisconsin-Madison, Madison, WI 53706 (United States)

2011-11-15

Metabolomics analysis was performed on the supernatant of human embryonic stem (hES) cell cultures exposed to a blinded subset of 11 chemicals selected from the chemical library of EPA's ToxCast Trade-Mark-Sign chemical screening and prioritization research project. Metabolites from hES cultures were evaluated for known and novel signatures that may be indicative of developmental toxicity. Significant fold changes in endogenous metabolites were detected for 83 putatively annotated mass features in response to the subset of ToxCast chemicals. The annotations were mapped to specific human metabolic pathways. This revealed strong effects on pathways for nicotinate and nicotinamide metabolism, pantothenate and CoA biosynthesis, glutathione metabolism, and arginine and proline metabolism pathways. Predictivity for adverse outcomes in mammalian prenatal developmental toxicity studies used ToxRefDB and other sources of information, including Stemina Biomarker Discovery's predictive DevTox Registered-Sign model trained on 23 pharmaceutical agents of known developmental toxicity and differing potency. The model initially predicted developmental toxicity from the blinded ToxCast compounds in concordance with animal data with 73% accuracy. Retraining the model with data from the unblinded test compounds at one concentration level increased the predictive accuracy for the remaining concentrations to 83%. These preliminary results on a 11-chemical subset of the ToxCast chemical library indicate that metabolomics analysis of the hES secretome provides information valuable for predictive modeling and mechanistic understanding of mammalian developmental toxicity. -- Highlights: Black-Right-Pointing-Pointer We tested 11 environmental compounds in a hESC metabolomics platform. Black-Right-Pointing-Pointer Significant changes in secreted small molecule metabolites were observed. Black-Right-Pointing-Pointer Perturbed mass features map to pathways critical for normal

Identifying developmental toxicity pathways for a subset of ToxCast chemicals using human embryonic stem cells and metabolomics

International Nuclear Information System (INIS)

Kleinstreuer, N.C.; Smith, A.M.; West, P.R.; Conard, K.R.; Fontaine, B.R.; Weir-Hauptman, A.M.; Palmer, J.A.; Knudsen, T.B.; Dix, D.J.; Donley, E.L.R.; Cezar, G.G.

2011-01-01

Metabolomics analysis was performed on the supernatant of human embryonic stem (hES) cell cultures exposed to a blinded subset of 11 chemicals selected from the chemical library of EPA's ToxCast™ chemical screening and prioritization research project. Metabolites from hES cultures were evaluated for known and novel signatures that may be indicative of developmental toxicity. Significant fold changes in endogenous metabolites were detected for 83 putatively annotated mass features in response to the subset of ToxCast chemicals. The annotations were mapped to specific human metabolic pathways. This revealed strong effects on pathways for nicotinate and nicotinamide metabolism, pantothenate and CoA biosynthesis, glutathione metabolism, and arginine and proline metabolism pathways. Predictivity for adverse outcomes in mammalian prenatal developmental toxicity studies used ToxRefDB and other sources of information, including Stemina Biomarker Discovery's predictive DevTox® model trained on 23 pharmaceutical agents of known developmental toxicity and differing potency. The model initially predicted developmental toxicity from the blinded ToxCast compounds in concordance with animal data with 73% accuracy. Retraining the model with data from the unblinded test compounds at one concentration level increased the predictive accuracy for the remaining concentrations to 83%. These preliminary results on a 11-chemical subset of the ToxCast chemical library indicate that metabolomics analysis of the hES secretome provides information valuable for predictive modeling and mechanistic understanding of mammalian developmental toxicity. -- Highlights: ► We tested 11 environmental compounds in a hESC metabolomics platform. ► Significant changes in secreted small molecule metabolites were observed. ► Perturbed mass features map to pathways critical for normal development and pregnancy. ► Arginine, proline, nicotinate, nicotinamide and glutathione pathways were affected.

Developmental cognitive genetics: How psychology can inform genetics and vice versa

OpenAIRE

Bishop, Dorothy V. M.

2006-01-01

Developmental neuropsychology is concerned with uncovering the underlying basis of developmental disorders such as specific language impairment (SLI), developmental dyslexia, and autistic disorder. Twin and family studies indicate that genetic influences play an important part in the aetiology of all of these disorders, yet progress in identifying genes has been slow. One way forward is to cut loose from conventional clinical criteria for diagnosing disorders and to focus instead on measures ...

Tissue expression and developmental regulation of chicken cathelicidin antimicrobial peptides

Directory of Open Access Journals (Sweden)

Achanta Mallika

2012-05-01

Full Text Available Abstract Cathelicidins are a major family of antimicrobial peptides present in vertebrate animals with potent microbicidal and immunomodulatory activities. Four cathelicidins, namely fowlicidins 1 to 3 and cathelicidin B1, have been identified in chickens. As a first step to understand their role in early innate host defense of chickens, we examined the tissue and developmental expression patterns of all four cathelicidins. Real-time PCR revealed an abundant expression of four cathelicidins throughout the gastrointestinal, respiratory, and urogenital tracts as well as in all primary and secondary immune organs of chickens. Fowlicidins 1 to 3 exhibited a similar tissue expression pattern with the highest expression in the bone marrow and lung, while cathelicidin B1 was synthesized most abundantly in the bursa of Fabricius. Additionally, a tissue-specific regulatory pattern was evident for all four cathelicidins during the first 28 days after hatching. The expression of fowlicidins 1 to 3 showed an age-dependent increase both in the cecal tonsil and lung, whereas all four cathelicidins were peaked in the bursa on day 4 after hatching, with a gradual decline by day 28. An abrupt augmentation in the expression of fowlicidins 1 to 3 was also observed in the cecum on day 28, while the highest expression of cathelicidin B1 was seen in both the lung and cecal tonsil on day 14. Collectively, the presence of cathelicidins in a broad range of tissues and their largely enhanced expression during development are suggestive of their potential important role in early host defense and disease resistance of chickens.

Genome-wide survey and developmental expression mapping of zebrafish SET domain-containing genes.

Directory of Open Access Journals (Sweden)

Xiao-Jian Sun

Full Text Available SET domain-containing proteins represent an evolutionarily conserved family of epigenetic regulators, which are responsible for most histone lysine methylation. Since some of these genes have been revealed to be essential for embryonic development, we propose that the zebrafish, a vertebrate model organism possessing many advantages for developmental studies, can be utilized to study the biological functions of these genes and the related epigenetic mechanisms during early development. To this end, we have performed a genome-wide survey of zebrafish SET domain genes. 58 genes total have been identified. Although gene duplication events give rise to several lineage-specific paralogs, clear reciprocal orthologous relationship reveals high conservation between zebrafish and human SET domain genes. These data were further subject to an evolutionary analysis ranging from yeast to human, leading to the identification of putative clusters of orthologous groups (COGs of this gene family. By means of whole-mount mRNA in situ hybridization strategy, we have also carried out a developmental expression mapping of these genes. A group of maternal SET domain genes, which are implicated in the programming of histone modification states in early development, have been identified and predicted to be responsible for all known sites of SET domain-mediated histone methylation. Furthermore, some genes show specific expression patterns in certain tissues at certain stages, suggesting the involvement of epigenetic mechanisms in the development of these systems. These results provide a global view of zebrafish SET domain histone methyltransferases in evolutionary and developmental dimensions and pave the way for using zebrafish to systematically study the roles of these genes during development.

Dynamic changes in energy metabolism upon embryonic stem cell differentiation support developmental toxicant identification

NARCIS (Netherlands)

Dartel, van D.A.M.; Schulpen, S.H.; Theunissen, P.T.; Bunschoten, A.; Piersma, A.H.; Keijer, J.

2014-01-01

Embryonic stem cells (ESC) are widely used to study embryonic development and to identify developmental toxicants. Particularly, the embryonic stem cell test (EST) is well known as in vitro model to identify developmental toxicants. Although it is clear that energy metabolism plays a crucial role in

Eco-Evo-Devo: developmental symbiosis and developmental plasticity as evolutionary agents.

Science.gov (United States)

Gilbert, Scott F; Bosch, Thomas C G; Ledón-Rettig, Cristina

2015-10-01

The integration of research from developmental biology and ecology into evolutionary theory has given rise to a relatively new field, ecological evolutionary developmental biology (Eco-Evo-Devo). This field integrates and organizes concepts such as developmental symbiosis, developmental plasticity, genetic accommodation, extragenic inheritance and niche construction. This Review highlights the roles that developmental symbiosis and developmental plasticity have in evolution. Developmental symbiosis can generate particular organs, can produce selectable genetic variation for the entire animal, can provide mechanisms for reproductive isolation, and may have facilitated evolutionary transitions. Developmental plasticity is crucial for generating novel phenotypes, facilitating evolutionary transitions and altered ecosystem dynamics, and promoting adaptive variation through genetic accommodation and niche construction. In emphasizing such non-genomic mechanisms of selectable and heritable variation, Eco-Evo-Devo presents a new layer of evolutionary synthesis.

A Rhodium(III) Complex as an Inhibitor of Neural Precursor Cell Expressed, Developmentally Down-Regulated 8-Activating Enzyme with in Vivo Activity against Inflammatory Bowel Disease.

Science.gov (United States)

Zhong, Hai-Jing; Wang, Wanhe; Kang, Tian-Shu; Yan, Hui; Yang, Yali; Xu, Lipeng; Wang, Yuqiang; Ma, Dik-Lung; Leung, Chung-Hang

2017-01-12

We report herein the identification of the rhodium(III) complex [Rh(phq) 2 (MOPIP)] + (1) as a potent and selective ATP-competitive neural precursor cell expressed, developmentally down-regulated 8 (NEDD8)-activating enzyme (NAE) inhibitor. Structure-activity relationship analysis indicated that the overall organometallic design of complex 1 was important for anti-inflammatory activity. Complex 1 showed promising anti-inflammatory activity in vivo for the potential treatment of inflammatory bowel disease.

Distinct emotion regulation skills explain psychopathology and problems in social relationships following childhood emotional abuse and neglect.

Science.gov (United States)

Berzenski, Sara R

2018-03-22

Efforts to differentiate between the developmental sequelae of childhood emotional abuse and childhood emotional neglect are critical to both research and practice efforts. As an oft-identified mechanism of the effects of child maltreatment on later adjustment, emotion dysregulation represents a key potential pathway. The present study explored a higher order factor model of specific emotion regulation skills, and the extent to which these skill sets would indicate distinct developmental pathways from unique emotional maltreatment experiences to multidomain adjustment. A sample of 500 ethnoracially diverse college students reported on their experiences. A two-factor model of emotion regulation skills based on subscales of the Difficulties in Emotion Regulation Scale was revealed. Significant indirect effects of childhood emotional abuse on psychopathology and problems in social relationships were found through response-focused difficulties in emotion regulation, whereas a significant indirect effect of childhood emotional neglect on problems in social relationships was found through antecedent-focused difficulties in emotion regulation. These results are consistent with theoretical models and empirical evidence suggesting differential effects of childhood emotional abuse and emotional neglect, and provide an important indication for developing targeted interventions focusing on specific higher order emotion dysregulation skill clusters.

Developmental and adult characterization of secretagogin expressing amacrine cells in zebrafish retina.

Directory of Open Access Journals (Sweden)

Stefanie Dudczig

Full Text Available Calcium binding proteins show stereotypical expression patterns within diverse neuron types across the central nervous system. Here, we provide a characterization of developmental and adult secretagogin-immunolabelled neurons in the zebrafish retina with an emphasis on co-expression of multiple calcium binding proteins. Secretagogin is a recently identified and cloned member of the F-hand family of calcium binding proteins, which labels distinct neuron populations in the retinas of mammalian vertebrates. Both the adult distribution of secretagogin labeled retinal neurons as well as the developmental expression indicative of the stage of neurogenesis during which this calcium binding protein is expressed was quantified. Secretagogin expression was confined to an amacrine interneuron population in the inner nuclear layer, with monostratified neurites in the center of the inner plexiform layer and a relatively regular soma distribution (regularity index > 2.5 across central-peripheral areas. However, only a subpopulation (~60% co-labeled with gamma-aminobutyric acid as their neurotransmitter, suggesting that possibly two amacrine subtypes are secretagogin immunoreactive. Quantitative co-labeling analysis with other known amacrine subtype markers including the three main calcium binding proteins parvalbumin, calbindin and calretinin identifies secretagogin immunoreactive neurons as a distinct neuron population. The highest density of secretagogin cells of ~1800 cells / mm2 remained relatively evenly along the horizontal meridian, whilst the density dropped of to 125 cells / mm2 towards the dorsal and ventral periphery. Thus, secretagogin represents a new amacrine label within the zebrafish retina. The developmental expression suggests a possible role in late stage differentiation. This characterization forms the basis of functional studies assessing how the expression of distinct calcium binding proteins might be regulated to compensate for the loss

Regulation of Expressive Behavior as Reflecting Affect Socialization.

Science.gov (United States)

Saarni, Carolyn

Regulated expressiveness (the modification of expressive behavior) is a complex phenomenon. Accomplished basically in four ways, regulated expressiveness has developmental dimensions, motivational precursors, and cognitive antecedents, including perspective-taking ability and the growth of self-awareness. Ability to regulate expressiveness appears…

The phenotypic plasticity of developmental modules

Directory of Open Access Journals (Sweden)

Aabha I. Sharma

2016-08-01

Full Text Available Abstract Background Organisms develop and evolve in a modular fashion, but how individual modules interact with the environment remains poorly understood. Phenotypically plastic traits are often under selection, and studies are needed to address how traits respond to the environment in a modular fashion. In this study, tissue-specific plasticity of melanic spots was examined in the large milkweed bug, Oncopeltus fasciatus. Results Although the size of the abdominal melanic bands varied according to rearing temperatures, wing melanic bands were more robust. To explore the regulation of abdominal pigmentation plasticity, candidate genes involved in abdominal melanic spot patterning and biosynthesis of melanin were analyzed. While the knockdown of dopa decarboxylase (Ddc led to lighter pigmentation in both the wings and the abdomen, the shape of the melanic elements remained unaffected. Although the knockdown of Abdominal-B (Abd-B partially phenocopied the low-temperature phenotype, the abdominal bands were still sensitive to temperature shifts. These observations suggest that regulators downstream of Abd-B but upstream of DDC are responsible for the temperature response of the abdomen. Ablation of wings led to the regeneration of a smaller wing with reduced melanic bands that were shifted proximally. In addition, the knockdown of the Wnt signaling nuclear effector genes, armadillo 1 and armadillo 2, altered both the melanic bands and the wing shape. Thus, the pleiotropic effects of Wnt signaling may constrain the amount of plasticity in wing melanic bands. Conclusions We propose that when traits are regulated by distinct pre-patterning mechanisms, they can respond to the environment in a modular fashion, whereas when the environment impacts developmental regulators that are shared between different modules, phenotypic plasticity can manifest as a developmentally integrated system.

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

Science.gov (United States)

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Identification of developmentally regulated PCP-responsive non-coding RNA, prt6, in the rat thalamus.

Directory of Open Access Journals (Sweden)

Hironao Takebayashi

Full Text Available Schizophrenia and similar psychoses induced by NMDA-type glutamate receptor antagonists, such as phencyclidine (PCP and ketamine, usually develop after adolescence. Moreover, adult-type behavioral disturbance following NMDA receptor antagonist application in rodents is observed after a critical period at around 3 postnatal weeks. These observations suggest that the schizophrenic symptoms caused by and psychotomimetic effects of NMDA antagonists require the maturation of certain brain neuron circuits and molecular networks, which differentially respond to NMDA receptor antagonists across adolescence and the critical period. From this viewpoint, we have identified a novel developmentally regulated phencyclidine-responsive transcript from the rat thalamus, designated as prt6, as a candidate molecule involved in the above schizophrenia-related systems using a DNA microarray technique. The transcript is a non-coding RNA that includes sequences of at least two microRNAs, miR132 and miR212, and is expressed strongly in the brain and testis, with trace or non-detectable levels in the spleen, heart, liver, kidney, lung and skeletal muscle, as revealed by Northern blot analysis. The systemic administration of PCP (7.5 mg/kg, subcutaneously (s.c. significantly elevated the expression of prt6 mRNA in the thalamus at postnatal days (PD 32 and 50, but not at PD 8, 13, 20, or 24 as compared to saline-treated controls. At PD 50, another NMDA receptor antagonist, dizocilpine (0.5 mg/kg, s.c., and a schizophrenomimetic dopamine agonist, methamphetamine (4.8 mg/kg, s.c., mimicked a significant increase in the levels of thalamic prt6 mRNAs, while a D2 dopmamine receptor antagonist, haloperidol, partly inhibited the increasing influence of PCP on thalamic prt6 expression without its own effects. These data indicate that prt6 may be involved in the pathophysiology of the onset of drug-induced schizophrenia-like symptoms and schizophrenia through the possible

IGF-1 deficiency in a critical period early in life influences the vascular aging phenotype in mice by altering miRNA-mediated post-transcriptional gene regulation: implications for the developmental origins of health and disease hypothesis.

Science.gov (United States)

Tarantini, Stefano; Giles, Cory B; Wren, Jonathan D; Ashpole, Nicole M; Valcarcel-Ares, M Noa; Wei, Jeanne Y; Sonntag, William E; Ungvari, Zoltan; Csiszar, Anna

2016-08-01

Epidemiological findings support the concept of Developmental Origins of Health and Disease, suggesting that early-life hormonal influences during a sensitive period of development have a fundamental impact on vascular health later in life. The endocrine changes that occur during development are highly conserved across mammalian species and include dramatic increases in circulating IGF-1 levels during adolescence. The present study was designed to characterize the effect of developmental IGF-1 deficiency on the vascular aging phenotype. To achieve that goal, early-onset endocrine IGF-1 deficiency was induced in mice by knockdown of IGF-1 in the liver using Cre-lox technology (Igf1 f/f mice crossed with mice expressing albumin-driven Cre recombinase). This model exhibits low-circulating IGF-1 levels during the peripubertal phase of development, which is critical for the biology of aging. Due to the emergence of miRNAs as important regulators of the vascular aging phenotype, the effect of early-life IGF-1 deficiency on miRNA expression profile in the aorta was examined in animals at 27 months of age. We found that developmental IGF-1 deficiency elicits persisting late-life changes in miRNA expression in the vasculature, which significantly differed from those in mice with adult-onset IGF-1 deficiency (TBG-Cre-AAV8-mediated knockdown of IGF-1 at 5 month of age in Igf1 f/f mice). Using a novel computational approach, we identified miRNA target genes that are co-expressed with IGF-1 and associate with aging and vascular pathophysiology. We found that among the predicted targets, the expression of multiple extracellular matrix-related genes, including collagen-encoding genes, were downregulated in mice with developmental IGF-1 deficiency. Collectively, IGF-1 deficiency during a critical period during early in life results in persistent changes in post-transcriptional miRNA-mediated control of genes critical targets for vascular health, which likely contribute to the

SOX9 regulates microRNA miR-202-5p/3p expression during mouse testis differentiation

DEFF Research Database (Denmark)

Wainwright, Elanor N; Jorgensen, Joan S; Kim, Youngha

2013-01-01

MicroRNAs are important regulators of developmental gene expression, but their contribution to fetal gonad development is not well understood. We have identified the evolutionarily conserved gonadal microRNAs miR-202-5p and miR-202-3p as having a potential role in regulating mouse embryonic gonad....... Expression of the primary transcript of miR-202-5p/3p remained low in XY gonads in a conditional Sox9-null mouse model, suggesting that pri-miR-202 transcription is downstream of SOX9, a transcription factor that is both necessary and sufficient for male sex determination. We identified the pri-miR-202...

Role of the pre- and post-natal environment in developmental programming of health and productivity.

Science.gov (United States)

Reynolds, Lawrence P; Caton, Joel S

2012-05-06

The concept that developmental insults (for example, poor pre- or postnatal nutrition) can have long-term consequences on health and well-being of the offspring has been termed developmental programming. In livestock, developmental programming affects production traits, including growth, body composition, and reproduction. Although low birth weight was used as a proxy for compromised fetal development in the initial epidemiological studies, based on controlled studies using livestock and other animal models in the last two decades we now know that developmental programming can occur independently of any effects on birth weight. Studies in humans, rodents, and livestock also have confirmed the critical role of the placenta in developmental programming. In addition, the central role of epigenetic regulation in developmental programming has been confirmed. Lastly, relatively simple therapeutic/management strategies designed to 'rescue' placental development and function are being developed to minimize the effects of developmental programming on health and productivity of humans, livestock, and other mammals. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Developmental regulation of Xenopus 5S RNA genes

International Nuclear Information System (INIS)

Wormington, W.M.; Schlissel, M.; Brown, D.D.

1983-01-01

In this paper it is demonstrated that the actively transcribed fraction of somatic 5S RNA genes in somatic-cell chromatin is complexed stably with all required factors, so that the addition of only purified RNA polymerase III is needed to support somatic 5S RNA synthesis in vitro. Oocyte 5S RNA genes in somatic-cell chromatin appear to lack these factors, since their activation in salt-washed somatic-cell chromatin depends on exogeneous transciption factors in addition to RNA polymerase III. The developmental control of 5S RNA genes is established over a period beginning with the onset of 5S RNA synthesis in late blastula embryos, and this control is reproduced in vitro using chromatin templates isolated from appropriate stages. We propose that a decreasing concentration of the 5S-specific transcription factor during embryogenesis contributes to the inactivation of oocyte 5S RNA genes. 12 references, 4 figures, 1 table

Learning To Breathe: Developmental Phase Transitions in Oxygen Status.

Science.gov (United States)

Considine, Michael J; Diaz-Vivancos, Pedro; Kerchev, Pavel; Signorelli, Santiago; Agudelo-Romero, Patricia; Gibbs, Daniel J; Foyer, Christine H

2017-02-01

Plants are developmentally disposed to significant changes in oxygen availability, but our understanding of the importance of hypoxia is almost entirely limited to stress biology. Differential patterns of the abundance of oxygen, nitric oxide ( • NO), and reactive oxygen species (ROS), as well as of redox potential, occur in organs and meristems, and examples are emerging in the literature of mechanistic relationships of these to development. We describe here the convergence of these cues in meristematic and reproductive tissues, and discuss the evidence for regulated hypoxic niches within which oxygen-, ROS-, • NO-, and redox-dependent signalling curate developmental transitions in plants. Copyright © 2017 Elsevier Ltd. All rights reserved.

A novel 3-hydroxysteroid dehydrogenase that regulates reproductive development and longevity.

Directory of Open Access Journals (Sweden)

Joshua Wollam

Full Text Available Endogenous small molecule metabolites that regulate animal longevity are emerging as a novel means to influence health and life span. In C. elegans, bile acid-like steroids called the dafachronic acids (DAs regulate developmental timing and longevity through the conserved nuclear hormone receptor DAF-12, a homolog of mammalian sterol-regulated receptors LXR and FXR. Using metabolic genetics, mass spectrometry, and biochemical approaches, we identify new activities in DA biosynthesis and characterize an evolutionarily conserved short chain dehydrogenase, DHS-16, as a novel 3-hydroxysteroid dehydrogenase. Through regulation of DA production, DHS-16 controls DAF-12 activity governing longevity in response to signals from the gonad. Our elucidation of C. elegans bile acid biosynthetic pathways reveals the possibility of novel ligands as well as striking biochemical conservation to other animals, which could illuminate new targets for manipulating longevity in metazoans.

A phosphatidylinositol transfer protein integrates phosphoinositide signaling with lipid droplet metabolism to regulate a developmental program of nutrient stress-induced membrane biogenesis

Energy Technology Data Exchange (ETDEWEB)

Ren, Jihui; Lin, Coney Pei-Chen; Pathak, Manish C.; Temple, Brenda R.S.; Nile, Aaron H.; Mousley, Carl J.; Duncan, Mara C.; Eckert, Debra M.; Leiker, Thomas J.; Ivanova, Pavlina T.; Myers, David S.; Murphy, Robert C.; Brown, H. Alex; Verdaasdonk, Jolien; Bloom, Kerry S.; Ortlund, Eric A.; Neiman, Aaron M.; Bankaitis, Vytas A. [Emory-MED; (SBU); (TAM); (UNC); (Vanderbilt-MED); (Utah); (UCHSC)

2014-07-11

Lipid droplet (LD) utilization is an important cellular activity that regulates energy balance and release of lipid second messengers. Because fatty acids exhibit both beneficial and toxic properties, their release from LDs must be controlled. Here we demonstrate that yeast Sfh3, an unusual Sec14-like phosphatidylinositol transfer protein, is an LD-associated protein that inhibits lipid mobilization from these particles. We further document a complex biochemical diversification of LDs during sporulation in which Sfh3 and select other LD proteins redistribute into discrete LD subpopulations. The data show that Sfh3 modulates the efficiency with which a neutral lipid hydrolase-rich LD subclass is consumed during biogenesis of specialized membrane envelopes that package replicated haploid meiotic genomes. These results present novel insights into the interface between phosphoinositide signaling and developmental regulation of LD metabolism and unveil meiosis-specific aspects of Sfh3 (and phosphoinositide) biology that are invisible to contemporary haploid-centric cell biological, proteomic, and functional genomics approaches.

A phosphatidylinositol transfer protein integrates phosphoinositide signaling with lipid droplet metabolism to regulate a developmental program of nutrient stress-induced membrane biogenesis

Energy Technology Data Exchange (ETDEWEB)

Ren, Jihui; Lin, Coney Pei-Chen; Pathak, Manish C.; Temple, Brenda R.S.; Nile, Aaron H.; Mousley, Carl J.; Duncan, Mara C.; Eckert, Debra M.; Leiker, Thomas J.; Ivanova, Pavlina T.; Myers, David S.; Murphy, Robert C.; Brown, H. Alex; Verdaasdonk, Jolien; Bloom, Kerry S.; Ortlund, Eric A.; Neiman, Aaron M.; Bankaitis, Vytas A. (Emory-MED); (UNCSM); (UNC); (UCHSC); (TAM); (Vanderbilt-MED); (SBU); (Utah)

2016-07-06

Lipid droplet (LD) utilization is an important cellular activity that regulates energy balance and release of lipid second messengers. Because fatty acids exhibit both beneficial and toxic properties, their release from LDs must be controlled. Here we demonstrate that yeast Sfh3, an unusual Sec14-like phosphatidylinositol transfer protein, is an LD-associated protein that inhibits lipid mobilization from these particles. We further document a complex biochemical diversification of LDs during sporulation in which Sfh3 and select other LD proteins redistribute into discrete LD subpopulations. The data show that Sfh3 modulates the efficiency with which a neutral lipid hydrolase-rich LD subclass is consumed during biogenesis of specialized membrane envelopes that package replicated haploid meiotic genomes. These results present novel insights into the interface between phosphoinositide signaling and developmental regulation of LD metabolism and unveil meiosis-specific aspects of Sfh3 (and phosphoinositide) biology that are invisible to contemporary haploid-centric cell biological, proteomic, and functional genomics approaches.

Magnetic Resonance Imaging (MRI) Evaluation of Developmental Delay in Pediatric Patients

OpenAIRE

Ali, Althaf S.; Syed, Naziya P.; Murthy, G.S.N.; Nori, Madhavi; Abkari, Anand; Pooja, B.K.; Venkateswarlu, J.

2015-01-01

Introduction: Developmental delay is defined as significant delay in one or more developmental domains. Magnetic Resonance Imaging (MRI) is the best modality to investigate such patients. Evaluation of a child with developmental delay is important not only because it allows early diagnosis and treatment but also helpful for parental counseling regarding the outcome of their child and to identify any possible risk of recurrence in the siblings. Thus this study was undertaken to evaluate the de...

Young Children’s Developmental Ecologies and Kindergarten Readiness

Science.gov (United States)

Mollborn, Stefanie

2016-01-01

Children enter the crucial transition to school with sociodemographic disparities firmly established. Domain-specific research (e.g., on poverty and family structure) has shed light on these disparities, but we need broader operationalizations of children’s environments to explain them. Building on existing theory, this study articulates the concept of developmental ecology—those interrelated features of a child’s proximal environment that shape development and health. Developmental ecology links structural and demographic factors with interactional, psychological, and genetic factors. Using the Early Childhood Longitudinal Study, Birth Cohort (ECLS-B), this study conducts latent class analyses to identify how 41 factors from three domains—namely, household resources, health risks, and ecological changes—cluster within children as four overarching developmental ecologies. Because it documents how numerous factors co-occur within children, this method allows an approximation of their lived environments. Findings illuminate powerful relationships between race/ethnicity, parental age, socioeconomic background, and nativity and a child’s developmental ecology, as well as associations between developmental ecology and kindergarten cognition, behavior, and health. Developmental ecology represents a major pathway through which demographic characteristics shape school readiness. Because specific factors have different implications depending on the ecologies in which they are embedded, findings support the usefulness of a broad ecological approach. PMID:27873222

Properties and regulation of biosynthesis of cottonseed storage proteins. Comprehensive progress report, December 1, 1976 to September 1, 1979

Energy Technology Data Exchange (ETDEWEB)

Dure, III, L S

1979-01-01

The regulation of gene expression in cotton seed embryogenesis was studied by attempting to define what gene products are likely to be highly regulated during this developmental progression. The flow of nitrogen into the free amino acids pools of the developing cotyledons, and into the principal nitrogen nutritional reserve of the seed, the storage proteins was measured. This was continued by following the flow of nitrogen from the storage proteins to the principal exported amino acid asparagine that occurs during the first several days of germination. In this fashion the rise and fall of certain enzymes of amino acid intermediary metabolism could be postulated, and in some cases, verified. The subsets of abundant mRNAs whose appearance and disappearance coincided with developmental events in cotyledon embryogenesis/germination with the short range goal of identifying proteins/enzyme activities were delineated as well as their mRNAs that represent specific developmental stages and the long range goal of using these representatives as probes for studying the mechanisms controlling the rise and fall of these mRNAs and their protein products.

Mild developmental foreign accent syndrome and psychiatric comorbidity: Altered white matter integrity in speech and emotion regulation networks

Directory of Open Access Journals (Sweden)

Marcelo L Berthier

2016-08-01

Full Text Available Foreign accent syndrome (FAS is a speech disorder that is defined by the emergence of a peculiar manner of articulation and intonation which is perceived as foreign. In most cases of acquired FAS (AFAS the new accent is secondary to small focal lesions involving components of the bilaterally distributed neural network for speech production. In the past few years FAS has also been described in different psychiatric conditions (conversion disorder, bipolar disorder, schizophrenia as well as in developmental disorders (specific language impairment, apraxia of speech. In the present study, two adult males, one with atypical phonetic production and the other one with cluttering, reported having developmental FAS (DFAS since their adolescence. Perceptual analysis by naïve judges could not confirm the presence of foreign accent, possibly due to the mildness of the speech disorder. However, detailed linguistic analysis provided evidence of prosodic and segmental errors previously reported in AFAS cases. Cognitive testing showed reduced communication in activities of daily living and mild deficits related to psychiatric disorders. Psychiatric evaluation revealed long-lasting internalizing disorders (neuroticism, anxiety, obsessive-compulsive disorder, social phobia, depression, alexithymia, hopelessness, and apathy in both subjects. Diffusion tensor imaging (DTI data from each subject with DFAS were compared with data from a group of 21 age- and gender-matched healthy control subjects. Diffusion parameters (MD, AD, and RD in predefined regions of interest showed changes of white matter microstructure in regions previously related with AFAS and psychiatric disorders. In conclusion, the present findings militate against the possibility that these two subjects have FAS of psychogenic origin. Rather, our findings provide evidence that mild DFAS occurring in the context of subtle, yet persistent, developmental speech disorders may be associated with

let-7 miRNAs Can Act through Notch to Regulate Human Gliogenesis

Directory of Open Access Journals (Sweden)

M. Patterson

2014-11-01

Full Text Available It is clear that neural differentiation from human pluripotent stem cells generates cells that are developmentally immature. Here, we show that the let-7 plays a functional role in the developmental decision making of human neural progenitors, controlling whether these cells make neurons or glia. Through gain- and loss-of-function studies on both tissue and pluripotent derived cells, our data show that let-7 specifically regulates decision making in this context by regulation of a key chromatin-associated protein, HMGA2. Furthermore, we provide evidence that the let-7/HMGA2 circuit acts on HES5, a NOTCH effector and well-established node that regulates fate decisions in the nervous system. These data link the let-7 circuit to NOTCH signaling and suggest that this interaction serves to regulate human developmental progression.

Hormonal regulation and developmental role of Krüppel homolog 1, a repressor of metamorphosis, in the silkworm Bombyx mori.

Science.gov (United States)

Kayukawa, Takumi; Murata, Mika; Kobayashi, Isao; Muramatsu, Daisuke; Okada, Chieko; Uchino, Keiro; Sezutsu, Hideki; Kiuchi, Makoto; Tamura, Toshiki; Hiruma, Kiyoshi; Ishikawa, Yukio; Shinoda, Tetsuro

2014-04-01

Juvenile hormone (JH) has an ability to repress the precocious metamorphosis of insects during their larval development. Krüppel homolog 1 (Kr-h1) is an early JH-inducible gene that mediates this action of JH; however, the fine hormonal regulation of Kr-h1 and the molecular mechanism underlying its antimetamorphic effect are little understood. In this study, we attempted to elucidate the hormonal regulation and developmental role of Kr-h1. We found that the expression of Kr-h1 in the epidermis of penultimate-instar larvae of the silkworm Bombyx mori was induced by JH secreted by the corpora allata (CA), whereas the CA were not involved in the transient induction of Kr-h1 at the prepupal stage. Tissue culture experiments suggested that the transient peak of Kr-h1 at the prepupal stage is likely to be induced cooperatively by JH derived from gland(s) other than the CA and the prepupal surge of ecdysteroid, although involvement of unknown factor(s) could not be ruled out. To elucidate the developmental role of Kr-h1, we generated transgenic silkworms overexpressing Kr-h1. The transgenic silkworms grew normally until the spinning stage, but their development was arrested at the prepupal stage. The transgenic silkworms from which the CA were removed in the penultimate instar did not undergo precocious pupation or larval-larval molt but fell into prepupal arrest. This result demonstrated that Kr-h1 is indeed involved in the repression of metamorphosis but that Kr-h1 alone is incapable of implementing normal larval molt. Moreover, the expression profiles and hormonal responses of early ecdysone-inducible genes (E74, E75, and Broad) in transgenic silkworms suggested that Kr-h1 is not involved in the JH-dependent modulation of these genes, which is associated with the control of metamorphosis. Copyright © 2014 Elsevier Inc. All rights reserved.

A Screening of UNF Targets Identifies Rnb, a Novel Regulator of Drosophila Circadian Rhythms.

Science.gov (United States)

Kozlov, Anatoly; Jaumouillé, Edouard; Machado Almeida, Pedro; Koch, Rafael; Rodriguez, Joseph; Abruzzi, Katharine C; Nagoshi, Emi

2017-07-12

Behavioral circadian rhythms are controlled by multioscillator networks comprising functionally different subgroups of clock neurons. Studies have demonstrated that molecular clocks in the fruit fly Drosophila melanogaster are regulated differently in clock neuron subclasses to support their specific functions (Lee et al., 2016; Top et al., 2016). The nuclear receptor unfulfilled ( unf ) represents a regulatory node that provides the small ventral lateral neurons (s-LNvs) unique characteristics as the master pacemaker (Beuchle et al., 2012). We previously showed that UNF interacts with the s-LNv molecular clocks by regulating transcription of the core clock gene period ( per ) (Jaumouillé et al., 2015). To gain more insight into the mechanisms by which UNF contributes to the functioning of the circadian master pacemaker, we identified UNF target genes using chromatin immunoprecipitation. Our data demonstrate that a previously uncharacterized gene CG7837 , which we termed R and B ( Rnb ), acts downstream of UNF to regulate the function of the s-LNvs as the master circadian pacemaker. Mutations and LNv-targeted adult-restricted knockdown of Rnb impair locomotor rhythms. RNB localizes to the nucleus, and its loss-of-function blunts the molecular rhythms and output rhythms of the s-LNvs, particularly the circadian rhythms in PDF accumulation and axonal arbor remodeling. These results establish a second pathway by which UNF interacts with the molecular clocks in the s-LNvs and highlight the mechanistic differences in the molecular clockwork within the pacemaker circuit. SIGNIFICANCE STATEMENT Circadian behavior is generated by a pacemaker circuit comprising diverse classes of pacemaker neurons, each of which contains a molecular clock. In addition to the anatomical and functional diversity, recent studies have shown the mechanistic differences in the molecular clockwork among the pacemaker neurons in Drosophila Here, we identified the molecular characteristics

Developmental Functions of miR156-Regulated SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) Genes in Arabidopsis thaliana.

Science.gov (United States)

Xu, Mingli; Hu, Tieqiang; Zhao, Jianfei; Park, Mee-Yeon; Earley, Keith W; Wu, Gang; Yang, Li; Poethig, R Scott

2016-08-01

Correct developmental timing is essential for plant fitness and reproductive success. Two important transitions in shoot development-the juvenile-to-adult vegetative transition and the vegetative-to-reproductive transition-are mediated by a group of genes targeted by miR156, SQUAMOSA PROMOTER BINDING PROTEIN (SBP) genes. To determine the developmental functions of these genes in Arabidopsis thaliana, we characterized their expression patterns, and their gain-of-function and loss-of-function phenotypes. Our results reveal that SBP-LIKE (SPL) genes in Arabidopsis can be divided into three functionally distinct groups: 1) SPL2, SPL9, SPL10, SPL11, SPL13 and SPL15 contribute to both the juvenile-to-adult vegetative transition and the vegetative-to-reproductive transition, with SPL9, SP13 and SPL15 being more important for these processes than SPL2, SPL10 and SPL11; 2) SPL3, SPL4 and SPL5 do not play a major role in vegetative phase change or floral induction, but promote the floral meristem identity transition; 3) SPL6 does not have a major function in shoot morphogenesis, but may be important for certain physiological processes. We also found that miR156-regulated SPL genes repress adventitious root development, providing an explanation for the observation that the capacity for adventitious root production declines as the shoot ages. miR156 is expressed at very high levels in young seedlings, and declines in abundance as the shoot develops. It completely blocks the expression of its SPL targets in the first two leaves of the rosette, and represses these genes to different degrees at later stages of development, primarily by promoting their translational repression. These results provide a framework for future studies of this multifunctional family of transcription factors, and offer new insights into the role of miR156 in Arabidopsis development.

Transition of Plasmodium sporozoites into liver stage-like forms is regulated by the RNA binding protein Pumilio

KAUST Repository

Gomes-Santos, Carina S. S.

2011-05-19

Many eukaryotic developmental and cell fate decisions that are effected post-transcriptionally involve RNA binding proteins as regulators of translation of key mRNAs. In malaria parasites (Plasmodium spp.), the development of round, non-motile and replicating exo-erythrocytic liver stage forms from slender, motile and cell-cycle arrested sporozoites is believed to depend on environmental changes experienced during the transmission of the parasite from the mosquito vector to the vertebrate host. Here we identify a Plasmodium member of the RNA binding protein family PUF as a key regulator of this transformation. In the absence of Pumilio-2 (Puf2) sporozoites initiate EEF development inside mosquito salivary glands independently of the normal transmission-associated environmental cues. Puf2- sporozoites exhibit genome-wide transcriptional changes that result in loss of gliding motility, cell traversal ability and reduction in infectivity, and, moreover, trigger metamorphosis typical of early Plasmodium intra-hepatic development. These data demonstrate that Puf2 is a key player in regulating sporozoite developmental control, and imply that transformation of salivary gland-resident sporozoites into liver stage-like parasites is regulated by a post-transcriptional mechanism. 2011 Gomes-Santos et al.

Borderline personality disorder and the emerging field of developmental neuroscience.

Science.gov (United States)

Crowell, Sheila E; Kaufman, Erin A

2016-10-01

Over the past 2 decades there has been a dramatic shift in understanding of personality disorders, such as borderline personality disorder (BPD). What was historically viewed as an entrenched pattern of antagonistic, interpersonally dependent, and uncorrectable conduct is now seen as the outcome of complex-yet modifiable-developmental processes. The borderline label, which once inspired such harsh opprobrium in clinical communities that early diagnosis was considered taboo, is now increasingly applied to adolescents who are receiving effective treatment and desisting from a borderline trajectory. Research examining the developmental origins and early manifestations of BPD is increasing rapidly, making it an appropriate time to take stock of current developmental research and articulate an agenda for the future. We identify 4 challenges that continue to impede innovative research on borderline personality development: (a) inadequate attention to continuity and discontinuity across development, (b) medical and diagnostic systems that localize personality pathology within the individual, (c) the lingering belief that biological research is antithetical to contextual/interpersonal understandings of psychopathology (and vice versa), and (d) reluctance to reach across disciplinary and developmental boundaries to identify creative paradigms and foster innovative discovery. In order to overcome these challenges, we propose an approach to future research on adolescent borderline pathology that integrates developmental psychopathology, social and affective neuroscience, and personality theory perspectives. This intersection-the developmental neuroscience of personality pathology-offers theoretical and methodological advantages over disciplinary isolation and is fertile ground for generating novel hypotheses on the development and prevention of BPD. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

RNAi-Mediated Reverse Genetic Screen Identified Drosophila Chaperones Regulating Eye and Neuromuscular Junction Morphology

Directory of Open Access Journals (Sweden)

Sandeep Raut

2017-07-01

Full Text Available Accumulation of toxic proteins in neurons has been linked with the onset of neurodegenerative diseases, which in many cases are characterized by altered neuronal function and synapse loss. Molecular chaperones help protein folding and the resolubilization of unfolded proteins, thereby reducing the protein aggregation stress. While most of the chaperones are expressed in neurons, their functional relevance remains largely unknown. Here, using bioinformatics analysis, we identified 95 Drosophila chaperones and classified them into seven different classes. Ubiquitous actin5C-Gal4-mediated RNAi knockdown revealed that ∼50% of the chaperones are essential in Drosophila. Knocking down these genes in eyes revealed that ∼30% of the essential chaperones are crucial for eye development. Using neuron-specific knockdown, immunocytochemistry, and robust behavioral assays, we identified a new set of chaperones that play critical roles in the regulation of Drosophila NMJ structural organization. Together, our data present the first classification and comprehensive analysis of Drosophila chaperones. Our screen identified a new set of chaperones that regulate eye and NMJ morphogenesis. The outcome of the screen reported here provides a useful resource for further elucidating the role of individual chaperones in Drosophila eye morphogenesis and synaptic development.

Integrative analysis of a cross-loci regulation network identifies App as a gene regulating insulin secretion from pancreatic islets.

Directory of Open Access Journals (Sweden)

Zhidong Tu

Full Text Available Complex diseases result from molecular changes induced by multiple genetic factors and the environment. To derive a systems view of how genetic loci interact in the context of tissue-specific molecular networks, we constructed an F2 intercross comprised of >500 mice from diabetes-resistant (B6 and diabetes-susceptible (BTBR mouse strains made genetically obese by the Leptin(ob/ob mutation (Lep(ob. High-density genotypes, diabetes-related clinical traits, and whole-transcriptome expression profiling in five tissues (white adipose, liver, pancreatic islets, hypothalamus, and gastrocnemius muscle were determined for all mice. We performed an integrative analysis to investigate the inter-relationship among genetic factors, expression traits, and plasma insulin, a hallmark diabetes trait. Among five tissues under study, there are extensive protein-protein interactions between genes responding to different loci in adipose and pancreatic islets that potentially jointly participated in the regulation of plasma insulin. We developed a novel ranking scheme based on cross-loci protein-protein network topology and gene expression to assess each gene's potential to regulate plasma insulin. Unique candidate genes were identified in adipose tissue and islets. In islets, the Alzheimer's gene App was identified as a top candidate regulator. Islets from 17-week-old, but not 10-week-old, App knockout mice showed increased insulin secretion in response to glucose or a membrane-permeant cAMP analog, in agreement with the predictions of the network model. Our result provides a novel hypothesis on the mechanism for the connection between two aging-related diseases: Alzheimer's disease and type 2 diabetes.

LncRNA Dum interacts with Dnmts to regulate Dppa2 expression during myogenic differentiation and muscle regeneration

Science.gov (United States)

Wang, Lijun; Zhao, Yu; Bao, Xichen; Zhu, Xihua; Kwok, Yvonne Ka-yin; Sun, Kun; Chen, Xiaona; Huang, Yongheng; Jauch, Ralf; Esteban, Miguel A; Sun, Hao; Wang, Huating

2015-01-01

Emerging studies document the roles of long non-coding RNAs (LncRNAs) in regulating gene expression at chromatin level but relatively less is known how they regulate DNA methylation. Here we identify an lncRNA, Dum (developmental pluripotency-associated 2 (Dppa2) Upstream binding Muscle lncRNA) in skeletal myoblast cells. The expression of Dum is dynamically regulated during myogenesis in vitro and in vivo. It is also transcriptionally induced by MyoD binding upon myoblast differentiation. Functional analyses show that it promotes myoblast differentiation and damage-induced muscle regeneration. Mechanistically, Dum was found to silence its neighboring gene, Dppa2, in cis through recruiting Dnmt1, Dnmt3a and Dnmt3b. Furthermore, intrachromosomal looping between Dum locus and Dppa2 promoter is necessary for Dum/Dppa2 interaction. Collectively, we have identified a novel lncRNA that interacts with Dnmts to regulate myogenesis. PMID:25686699

One of the Two Genes Encoding Nucleoid-Associated HU Proteins in Streptomyces coelicolor Is Developmentally Regulated and Specifically Involved in Spore Maturation▿ †

Science.gov (United States)

Salerno, Paola; Larsson, Jessica; Bucca, Giselda; Laing, Emma; Smith, Colin P.; Flärdh, Klas

2009-01-01

Streptomyces genomes encode two homologs of the nucleoid-associated HU proteins. One of them, here designated HupA, is of a conventional type similar to E. coli HUα and HUβ, while the other, HupS, is a two-domain protein. In addition to the N-terminal part that is similar to that of HU proteins, it has a C-terminal domain that is similar to the alanine- and lysine-rich C termini of eukaryotic linker histones. Such two-domain HU proteins are found only among Actinobacteria. In this phylum some organisms have only a single HU protein of the type with a C-terminal histone H1-like domain (e.g., Hlp in Mycobacterium smegmatis), while others have only a single conventional HU. Yet others, including the streptomycetes, produce both types of HU proteins. We show here that the two HU genes in Streptomyces coelicolor are differentially regulated and that hupS is specifically expressed during sporulation, while hupA is expressed in vegetative hyphae. The developmental upregulation of hupS occurred in sporogenic aerial hyphal compartments and was dependent on the developmental regulators whiA, whiG, and whiI. HupS was found to be nucleoid associated in spores, and a hupS deletion mutant had an average nucleoid size in spores larger than that in the parent strain. The mutant spores were also defective in heat resistance and spore pigmentation, although they possessed apparently normal spore walls and displayed no increased sensitivity to detergents. Overall, the results show that HupS is specifically involved in sporulation and may affect nucleoid architecture and protection in spores of S. coelicolor. PMID:19717607

Adaptive developmental delay in Chagas disease vectors: an evolutionary ecology approach.

Directory of Open Access Journals (Sweden)

Frédéric Menu

2010-05-01

Full Text Available The developmental time of vector insects is important in population dynamics, evolutionary biology, epidemiology and in their responses to global climatic change. In the triatomines (Triatominae, Reduviidae, vectors of Chagas disease, evolutionary ecology concepts, which may allow for a better understanding of their biology, have not been applied. Despite delay in the molting in some individuals observed in triatomines, no effort was made to explain this variability.We applied four methods: (1 an e-mail survey sent to 30 researchers with experience in triatomines, (2 a statistical description of the developmental time of eleven triatomine species, (3 a relationship between development time pattern and climatic inter-annual variability, (4 a mathematical optimization model of evolution of developmental delay (diapause.85.6% of responses informed on prolonged developmental times in 5(th instar nymphs, with 20 species identified with remarkable developmental delays. The developmental time analysis showed some degree of bi-modal pattern of the development time of the 5(th instars in nine out of eleven species but no trend between development time pattern and climatic inter-annual variability was observed. Our optimization model predicts that the developmental delays could be due to an adaptive risk-spreading diapause strategy, only if survival throughout the diapause period and the probability of random occurrence of "bad" environmental conditions are sufficiently high.Developmental delay may not be a simple non-adaptive phenotypic plasticity in development time, and could be a form of adaptive diapause associated to a physiological mechanism related to the postponement of the initiation of reproduction, as an adaptation to environmental stochasticity through a spreading of risk (bet-hedging strategy. We identify a series of parameters that can be measured in the field and laboratory to test this hypothesis. The importance of these findings is

Integrated Network Analysis Identifies Fight-Club Nodes as a Class of Hubs Encompassing Key Putative Switch Genes That Induce Major Transcriptome Reprogramming during Grapevine Development[W][OPEN

Science.gov (United States)

Palumbo, Maria Concetta; Zenoni, Sara; Fasoli, Marianna; Massonnet, Mélanie; Farina, Lorenzo; Castiglione, Filippo; Pezzotti, Mario; Paci, Paola

2014-01-01

We developed an approach that integrates different network-based methods to analyze the correlation network arising from large-scale gene expression data. By studying grapevine (Vitis vinifera) and tomato (Solanum lycopersicum) gene expression atlases and a grapevine berry transcriptomic data set during the transition from immature to mature growth, we identified a category named “fight-club hubs” characterized by a marked negative correlation with the expression profiles of neighboring genes in the network. A special subset named “switch genes” was identified, with the additional property of many significant negative correlations outside their own group in the network. Switch genes are involved in multiple processes and include transcription factors that may be considered master regulators of the previously reported transcriptome remodeling that marks the developmental shift from immature to mature growth. All switch genes, expressed at low levels in vegetative/green tissues, showed a significant increase in mature/woody organs, suggesting a potential regulatory role during the developmental transition. Finally, our analysis of tomato gene expression data sets showed that wild-type switch genes are downregulated in ripening-deficient mutants. The identification of known master regulators of tomato fruit maturation suggests our method is suitable for the detection of key regulators of organ development in different fleshy fruit crops. PMID:25490918

Building clinical networks: a developmental evaluation framework.

Science.gov (United States)

Carswell, Peter; Manning, Benjamin; Long, Janet; Braithwaite, Jeffrey

2014-05-01

Clinical networks have been designed as a cross-organisational mechanism to plan and deliver health services. With recent concerns about the effectiveness of these structures, it is timely to consider an evidence-informed approach for how they can be developed and evaluated. To document an evaluation framework for clinical networks by drawing on the network evaluation literature and a 5-year study of clinical networks. We searched literature in three domains: network evaluation, factors that aid or inhibit network development, and on robust methods to measure network characteristics. This material was used to build a framework required for effective developmental evaluation. The framework's architecture identifies three stages of clinical network development; partner selection, network design and network management. Within each stage is evidence about factors that act as facilitators and barriers to network growth. These factors can be used to measure progress via appropriate methods and tools. The framework can provide for network growth and support informed decisions about progress. For the first time in one place a framework incorporating rigorous methods and tools can identify factors known to affect the development of clinical networks. The target user group is internal stakeholders who need to conduct developmental evaluation to inform key decisions along their network's developmental pathway.

Using Administrative Health Data to Identify Individuals with Intellectual and Developmental Disabilities: A Comparison of Algorithms

Science.gov (United States)

Lin, E.; Balogh, R.; Cobigo, V.; Ouellette-Kuntz, H.; Wilton, A. S.; Lunsky, Y.

2013-01-01

Background: Individuals with intellectual and developmental disabilities (IDD) experience high rates of physical and mental health problems; yet their health care is often inadequate. Information about their characteristics and health services needs is critical for planning efficient and equitable services. A logical source of such information is…

A Loss-of-Function Screen for Phosphatases that Regulate Neurite Outgrowth Identifies PTPN12 as a Negative Regulator of TrkB Tyrosine Phosphorylation

DEFF Research Database (Denmark)

Ambjørn, Malene; Dubreuil, Véronique; Miozzo, Federico

2013-01-01

Alterations in function of the neurotrophin BDNF are associated with neurodegeneration, cognitive decline, and psychiatric disorders. BDNF promotes axonal outgrowth and branching, regulates dendritic tree morphology and is important for axonal regeneration after injury, responses that largely....... This approach identified phosphatases from diverse families, which either positively or negatively modulate BDNF-TrkB-mediated neurite outgrowth, and most of which have little or no previously established function related to NT signaling. "Classical" protein tyrosine phosphatases (PTPs) accounted for 13......% of the candidate regulatory phosphatases. The top classical PTP identified as a negative regulator of BDNF-TrkB-mediated neurite outgrowth was PTPN12 (also called PTP-PEST). Validation and follow-up studies showed that endogenous PTPN12 antagonizes tyrosine phosphorylation of TrkB itself, and the downstream...

Nitrogen assimilation system in maize is regulated by developmental and tissue-specific mechanisms

KAUST Repository

Plett, Darren

2016-08-10

Key message: We found metabolites, enzyme activities and enzyme transcript abundances vary significantly across the maize lifecycle, but weak correlation exists between the three groups. We identified putative genes regulating nitrate assimilation. Abstract: Progress in improving nitrogen (N) use efficiency (NUE) of crop plants has been hampered by the complexity of the N uptake and utilisation systems. To understand this complexity we measured the activities of seven enzymes and ten metabolites related to N metabolism in the leaf and root tissues of Gaspe Flint maize plants grown in 0.5 or 2.5 mM NO3 − throughout the lifecycle. The amino acids had remarkably similar profiles across the lifecycle except for transient responses, which only appeared in the leaves for aspartate or in the roots for asparagine, serine and glycine. The activities of the enzymes for N assimilation were also coordinated to a certain degree, most noticeably with a peak in root activity late in the lifecycle, but with wide variation in the activity levels over the course of development. We analysed the transcriptional data for gene sets encoding the measured enzymes and found that, unlike the enzyme activities, transcript levels of the corresponding genes did not exhibit the same coordination across the lifecycle and were only weakly correlated with the levels of various amino acids or individual enzyme activities. We identified gene sets which were correlated with the enzyme activity profiles, including seven genes located within previously known quantitative trait loci for enzyme activities and hypothesise that these genes are important for the regulation of enzyme activities. This work provides insights into the complexity of the N assimilation system throughout development and identifies candidate regulatory genes, which warrant further investigation in efforts to improve NUE in crop plants. © 2016, Springer Science+Business Media Dordrecht.

Nitrogen assimilation system in maize is regulated by developmental and tissue-specific mechanisms

KAUST Repository

Plett, Darren; Holtham, Luke; Baumann, Ute; Kalashyan, Elena; Francis, Karen; Enju, Akiko; Toubia, John; Roessner, Ute; Bacic, Antony; Rafalski, Antoni; Dhugga, Kanwarpal S.; Tester, Mark A.; Garnett, Trevor; Kaiser, Brent N.

2016-01-01

Key message: We found metabolites, enzyme activities and enzyme transcript abundances vary significantly across the maize lifecycle, but weak correlation exists between the three groups. We identified putative genes regulating nitrate assimilation. Abstract: Progress in improving nitrogen (N) use efficiency (NUE) of crop plants has been hampered by the complexity of the N uptake and utilisation systems. To understand this complexity we measured the activities of seven enzymes and ten metabolites related to N metabolism in the leaf and root tissues of Gaspe Flint maize plants grown in 0.5 or 2.5 mM NO3 − throughout the lifecycle. The amino acids had remarkably similar profiles across the lifecycle except for transient responses, which only appeared in the leaves for aspartate or in the roots for asparagine, serine and glycine. The activities of the enzymes for N assimilation were also coordinated to a certain degree, most noticeably with a peak in root activity late in the lifecycle, but with wide variation in the activity levels over the course of development. We analysed the transcriptional data for gene sets encoding the measured enzymes and found that, unlike the enzyme activities, transcript levels of the corresponding genes did not exhibit the same coordination across the lifecycle and were only weakly correlated with the levels of various amino acids or individual enzyme activities. We identified gene sets which were correlated with the enzyme activity profiles, including seven genes located within previously known quantitative trait loci for enzyme activities and hypothesise that these genes are important for the regulation of enzyme activities. This work provides insights into the complexity of the N assimilation system throughout development and identifies candidate regulatory genes, which warrant further investigation in efforts to improve NUE in crop plants. © 2016, Springer Science+Business Media Dordrecht.

Developmental Programming, a Pathway to Disease

Science.gov (United States)

Cardoso, Rodolfo C.; Puttabyatappa, Muraly

2016-01-01

Accumulating evidence suggests that insults occurring during the perinatal period alter the developmental trajectory of the fetus/offspring leading to long-term detrimental outcomes that often culminate in adult pathologies. These perinatal insults include maternal/fetal disease states, nutritional deficits/excess, stress, lifestyle choices, exposure to environmental chemicals, and medical interventions. In addition to reviewing the various insults that contribute to developmental programming and the benefits of animal models in addressing underlying mechanisms, this review focuses on the commonalities in disease outcomes stemming from various insults, the convergence of mechanistic pathways via which various insults can lead to common outcomes, and identifies the knowledge gaps in the field and future directions. PMID:26859334

Mixed Integer Linear Programming based machine learning approach identifies regulators of telomerase in yeast.

Science.gov (United States)

Poos, Alexandra M; Maicher, André; Dieckmann, Anna K; Oswald, Marcus; Eils, Roland; Kupiec, Martin; Luke, Brian; König, Rainer

2016-06-02

Understanding telomere length maintenance mechanisms is central in cancer biology as their dysregulation is one of the hallmarks for immortalization of cancer cells. Important for this well-balanced control is the transcriptional regulation of the telomerase genes. We integrated Mixed Integer Linear Programming models into a comparative machine learning based approach to identify regulatory interactions that best explain the discrepancy of telomerase transcript levels in yeast mutants with deleted regulators showing aberrant telomere length, when compared to mutants with normal telomere length. We uncover novel regulators of telomerase expression, several of which affect histone levels or modifications. In particular, our results point to the transcription factors Sum1, Hst1 and Srb2 as being important for the regulation of EST1 transcription, and we validated the effect of Sum1 experimentally. We compiled our machine learning method leading to a user friendly package for R which can straightforwardly be applied to similar problems integrating gene regulator binding information and expression profiles of samples of e.g. different phenotypes, diseases or treatments. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

iTRAQ and RNA-Seq Analyses Provide New Insights into Regulation Mechanism of Symbiotic Germination of Dendrobium officinale Seeds (Orchidaceae).

Science.gov (United States)

Chen, Juan; Liu, Si Si; Kohler, Annegret; Yan, Bo; Luo, Hong Mei; Chen, Xiao Mei; Guo, Shun Xing

2017-06-02

Mycorrhizal fungi colonize orchid seeds and induce germination. This so-called symbiotic germination is a critical developmental process in the lifecycle of all orchid species. However, the molecular changes that occur during orchid seed symbiotic germination remain largely unknown. To better understand the molecular mechanism of orchid seed germination, we performed a comparative transcriptomic and proteomic analysis of the Chinese traditional medicinal orchid Dendrobium officinale to explore the change in protein expression at the different developmental stages during asymbiotic and symbiotic germination and identify the key proteins that regulate the symbiotic germination of orchid seeds. Among 2256 identified plant proteins, 308 were differentially expressed across three developmental stages during asymbiotic and symbiotic germination, and 229 were differentially expressed during symbiotic germination compared to asymbiotic development. Of these, 32 proteins were coup-regulated at both the proteomic and transcriptomic levels during symbiotic germination compared to asymbiotic germination. Our results suggest that symbiotic germination of D. officinale seeds shares a common signaling pathway with asymbiotic germination during the early germination stage. However, compared to asymbiotic germination, fungal colonization of orchid seeds appears to induce higher and earlier expression of some key proteins involved in lipid and carbohydrate metabolism and thus improves the efficiency of utilization of stored substances present in the embryo. This study provides new insight into the molecular basis of orchid seed germination.

Developmental Programming: State-of-the-Science and Future Directions

Science.gov (United States)

Sutton, Elizabeth F.; Gilmore, L. Anne; Dunger, David B.; Heijmans, Bas T.; Hivert, Marie-France; Ling, Charlotte; Martinez, J. Alfredo; Ozanne, Susan E.; Simmons, Rebecca A.; Szyf, Moshe; Waterland, Robert A.; Redman, Leanne M.; Ravussin, Eric

2016-01-01

Objective On December 8–9, 2014, the Pennington Biomedical Research Center convened a scientific symposium to review the state-of-the-science and future directions for the study of developmental programming of obesity and chronic disease. The objectives of the symposium were to discuss: (i) past and current scientific advances in animal models, population-based cohort studies and human clinical trials, (ii) the state-of-the-science of epigenetic-based research, and (iii) considerations for future studies. Results The overarching goal was to provide a comprehensive assessment of the state of the scientific field, to identify research gaps and opportunities for future research in order to identify and understand the mechanisms contributing to the developmental programming of health and disease. Conclusions Identifying the mechanisms which cause or contribute to developmental programming of future generations will be invaluable to the scientific and medical community. The ability to intervene during critical periods of prenatal and early postnatal life to promote lifelong health is the ultimate goal. Considerations for future research including the use of animal models, the study design in human cohorts with considerations about the timing of the intrauterine exposure and the resulting tissue specific epigenetic signature were extensively discussed and are presented in this meeting summary. PMID:27037645

Neuroimaging of developmental psychopathologies: the importance of self-regulatory and neuroplastic processes in adolescence

DEFF Research Database (Denmark)

Spessot, Alexandra L; Plessen, Kerstin J; Peterson, Bradley S

2004-01-01

Normal brain maturational and developmental processes, together with plastic reorganization of the brain in response to experiential demands, contribute to the acquisition of improved capacities for self-regulation and impulse control during adolescence. The frontal lobe is a main focus for these......Normal brain maturational and developmental processes, together with plastic reorganization of the brain in response to experiential demands, contribute to the acquisition of improved capacities for self-regulation and impulse control during adolescence. The frontal lobe is a main focus...... for these developmental and plastic processes during the transition from adolescence into adulthood. Tourette syndrome (TS), defined as the chronic presence of motor and vocal tics, has been increasingly conceptualized as a disorder of impaired self-regulatory control. This disordered control is thought to give rise...... to semicompulsory urges to perform the movements that constitute simple tics, complex tics, or compulsions. Neuroimaging studies suggest that the expression of the genetic diathesis to TS is influenced by genetic and nongenetic factors affecting activity-dependent reorganization of neuroregulatory systems, thereby...

Identifying Subtypes among Children with Developmental Coordination Disorder and Mathematical Learning Disabilities, Using Model-Based Clustering

Science.gov (United States)

Pieters, Stefanie; Roeyers, Herbert; Rosseel, Yves; Van Waelvelde, Hilde; Desoete, Annemie

2015-01-01

A relationship between motor and mathematical skills has been shown by previous research. However, the question of whether subtypes can be differentiated within developmental coordination disorder (DCD) and/or mathematical learning disability (MLD) remains unresolved. In a sample of children with and without DCD and/or MLD, a data-driven…

Developmentally regulated sesquiterpene production confers resistance to Colletotrichum gloeosporioides in ripe pepper fruits.

Directory of Open Access Journals (Sweden)

Sangkyu Park

Full Text Available Sesquiterpenoid capsidiol, exhibiting antifungal activity against pathogenic fungus, is accumulated in infected ripe pepper fruits. In this study, we found a negative relation between the capsidiol level and lesion size in fruits infected with Colletotrichum gloeosporioides, depending on the stage of ripening. To understand the developmental regulation of capsidiol biosynthesis, fungal-induced gene expressions in the isoprenoid biosynthetic pathways were examined in unripe and ripe pepper fruits. The sterol biosynthetic pathway was almost shut down in healthy ripe fruits, showing very low expression of hydroxymethyl glutaryl CoA reductase (HMGR and squalene synthase (SS genes. In contrast, genes in the carotenoid pathway were highly expressed in ripe fruits. In the sesquiterpene pathway, 5-epi-aristolochene synthase (EAS, belonging to a sesquiterpene cyclase (STC family, was significantly induced in the ripe fruits upon fungal infection. Immunoblot and enzyme activity analyses showed that the STCs were induced both in the infected unripe and ripe fruits, while capsidiol was synthesized discriminatively in the ripe fruits, implying diverse enzymatic specificity of multiple STCs. Thereby, to divert sterol biosynthesis into sesquiterpene production, infected fruits were pretreated with an SS inhibitor, zaragozic acid (ZA, resulting in increased levels of capsidiol by more than 2-fold in the ripe fruits, with concurrent reduction of phytosterols. Taken together, the present results suggest that the enhanced expression and activity of EAS in the ripe fruits play an important role in capsidiol production, contributing to the incompatibility between the anthracnose fungus and the ripe pepper fruits.

Developmental pathways in infants from 4 to 24 months.

Science.gov (United States)

Valla, L; Birkeland, M S; Hofoss, D; Slinning, K

2017-07-01

There has been limited epidemiological research describing population-based samples regarding developmental pathways throughout infancy, and the research that exists has revealed substantial diversity. Identifying predictors for developmental pathways can inform early intervention services. The Ages and Stages Questionnaire was used to measure communication, gross motor, fine motor, problem-solving and personal-social skills longitudinally in a large, population-based sample of 1555 infants recruited from well-baby clinics in five municipalities in southeast Norway. We conducted latent class analyses to identify common pathways within the five developmental areas. Our results indicated that most classes of infants showed generally positive and stable normative developmental pathways. However, for communication and gross motor areas, more heterogeneity was found. For gross motor development, a class of 10% followed a U-shaped curve. A class of 8% had a declining communication pathway and did not reach the level of the high stable communication class at 24 months. Low gestational age, low Apgar score, male sex, maternal depression symptoms, non-Scandinavian maternal ethnicity and high maternal education significantly predict less beneficial communication pathways. The results suggest that infants with low gestational age, low Apgar score, male sex and a mother with depression symptoms or non-Scandinavian ethnicity may be at risk of developing less beneficial developmental pathways, especially within the communication area. Targeting these infants for surveillance and support might be protective against delayed development in several areas during a critical window of development. © 2017 John Wiley & Sons Ltd.

The Development of Emotional and Behavioral Self-Regulation and Their Effects on Academic Achievement in Childhood

Science.gov (United States)

Edossa, Ashenafi Kassahun; Schroeders, Ulrich; Weinert, Sabine; Artelt, Cordula

2018-01-01

Self-regulation is an essential ability of children to cope with various developmental challenges. This study examines the developmental interplay between emotional and behavioral self-regulation during childhood and the relationship with academic achievement using data from the longitudinal Millennium Cohort Study (UK). Using cross-lagged panel…

Identifying play characteristics of pre-school children with developmental coordination disorder via parental questionnaires.

Science.gov (United States)

Rosenblum, Sara; Waissman, Pola; Diamond, Gary W

2017-06-01

Motor coordination deficits that characterize children with Developmental Coordination Disorder (DCD) affect their quality of participation. The aim of the current study was to identify play characteristics of young children with DCD, compared to those of children with typical development in three dimensions: activity and participation, environmental factors and children's impairments. Sixty-four children, aged four to six years, participated. Thirty were diagnosed as having DCD; the remaining 34 children were age, gender and socioeconomic level matched controls with typical development. The children were evaluated by the M-ABC. In addition, their parents completed a demographic questionnaire, the Children's Activity Scale for Parents (CHAS-P), the Children's Leisure Assessment Scale for preschoolers (CLASS-Pre), and My Child's Play Questionnaire (MCP). Children with DCD performed significantly poorer in each of the four play activity and participation domains: variety, frequency, sociability, and preference (CLASS-Pre). Furthermore, their environmental characteristics were significantly different (MCP). They displayed significantly inferior performance (impairments) in interpersonal interaction and executive functioning during play, in comparison to controls (MCP). Moreover, the children's motor and executive control as reflected in their daily function as well as their activities of daily living (ADL) performance level, contributed to the prediction of their global play participation. The results indicate that the use of both the CLASS-Pre and the MCP questionnaires enables the identification of unique play characteristics of pre-school children with DCD via parents' reports. A better insight into these characteristics may contribute to theoretical knowledge and clinical practice to improve the children's daily participation. Copyright © 2016 Elsevier B.V. All rights reserved.

Developmental psychopathology in an era of molecular genetics and neuroimaging: A developmental neurogenetics approach.

Science.gov (United States)

Hyde, Luke W

2015-05-01

The emerging field of neurogenetics seeks to model the complex pathways from gene to brain to behavior. This field has focused on imaging genetics techniques that examine how variability in common genetic polymorphisms predict differences in brain structure and function. These studies are informed by other complimentary techniques (e.g., animal models and multimodal imaging) and have recently begun to incorporate the environment through examination of Imaging Gene × Environment interactions. Though neurogenetics has the potential to inform our understanding of the development of psychopathology, there has been little integration between principles of neurogenetics and developmental psychopathology. The paper describes a neurogenetics and Imaging Gene × Environment approach and how these approaches have been usefully applied to the study of psychopathology. Six tenets of developmental psychopathology (the structure of phenotypes, the importance of exploring mechanisms, the conditional nature of risk, the complexity of multilevel pathways, the role of development, and the importance of who is studied) are identified, and how these principles can further neurogenetics applications to understanding the development of psychopathology is discussed. A major issue of this piece is how neurogenetics and current imaging and molecular genetics approaches can be incorporated into developmental psychopathology perspectives with a goal of providing models for better understanding pathways from among genes, environments, the brain, and behavior.

Integrated network analysis identifies fight-club nodes as a class of hubs encompassing key putative switch genes that induce major transcriptome reprogramming during grapevine development.

Science.gov (United States)

Palumbo, Maria Concetta; Zenoni, Sara; Fasoli, Marianna; Massonnet, Mélanie; Farina, Lorenzo; Castiglione, Filippo; Pezzotti, Mario; Paci, Paola

2014-12-01

We developed an approach that integrates different network-based methods to analyze the correlation network arising from large-scale gene expression data. By studying grapevine (Vitis vinifera) and tomato (Solanum lycopersicum) gene expression atlases and a grapevine berry transcriptomic data set during the transition from immature to mature growth, we identified a category named "fight-club hubs" characterized by a marked negative correlation with the expression profiles of neighboring genes in the network. A special subset named "switch genes" was identified, with the additional property of many significant negative correlations outside their own group in the network. Switch genes are involved in multiple processes and include transcription factors that may be considered master regulators of the previously reported transcriptome remodeling that marks the developmental shift from immature to mature growth. All switch genes, expressed at low levels in vegetative/green tissues, showed a significant increase in mature/woody organs, suggesting a potential regulatory role during the developmental transition. Finally, our analysis of tomato gene expression data sets showed that wild-type switch genes are downregulated in ripening-deficient mutants. The identification of known master regulators of tomato fruit maturation suggests our method is suitable for the detection of key regulators of organ development in different fleshy fruit crops. © 2014 American Society of Plant Biologists. All rights reserved.

Getting Back to the Woods: Familial Perspectives on Culture and Preschoolers' Acquisition of Self-Regulation and Emotion Regulation

Science.gov (United States)

Boyer, Wanda

2013-01-01

Discourse on culture is vital to early childhood educators' understanding of the young child in various socio-cultural experiences in family and community settings. In this article, the author will present a contemporary definition of culture. This article will then discuss the developmental constructs of self-regulation and emotion regulation and…

An explanatory evo-devo model for the developmental hourglass [v1; ref status: indexed, http://f1000r.es/3s6

Directory of Open Access Journals (Sweden)

Saamer Akhshabi

2014-07-01

Full Text Available The "developmental hourglass'' describes a pattern of increasing morphological divergence towards earlier and later embryonic development, separated by a period of significant conservation across distant species (the "phylotypic stage''. Recent studies have found evidence in support of the hourglass effect at the genomic level. For instance, the phylotypic stage expresses the oldest and most conserved transcriptomes. However, the regulatory mechanism that causes the hourglass pattern remains an open question. Here, we use an evolutionary model of regulatory gene interactions during development to identify the conditions under which the hourglass effect can emerge in a general setting. The model focuses on the hierarchical gene regulatory network that controls the developmental process, and on the evolution of a population under random perturbations in the structure of that network. The model predicts, under fairly general assumptions, the emergence of an hourglass pattern in the structure of a temporal representation of the underlying gene regulatory network. The evolutionary age of the corresponding genes also follows an hourglass pattern, with the oldest genes concentrated at the hourglass waist. The key behind the hourglass effect is that developmental regulators should have an increasingly specific function as development progresses. Analysis of developmental gene expression profiles from Drosophila melanogaster and Arabidopsis thaliana provide consistent results with our theoretical predictions.

An explanatory evo-devo model for the developmental hourglass [v2; ref status: indexed, http://f1000r.es/4x3

Directory of Open Access Journals (Sweden)

Saamer Akhshabi

2014-12-01

Full Text Available The "developmental hourglass'' describes a pattern of increasing morphological divergence towards earlier and later embryonic development, separated by a period of significant conservation across distant species (the "phylotypic stage''. Recent studies have found evidence in support of the hourglass effect at the genomic level. For instance, the phylotypic stage expresses the oldest and most conserved transcriptomes. However, the regulatory mechanism that causes the hourglass pattern remains an open question. Here, we use an evolutionary model of regulatory gene interactions during development to identify the conditions under which the hourglass effect can emerge in a general setting. The model focuses on the hierarchical gene regulatory network that controls the developmental process, and on the evolution of a population under random perturbations in the structure of that network. The model predicts, under fairly general assumptions, the emergence of an hourglass pattern in the structure of a temporal representation of the underlying gene regulatory network. The evolutionary age of the corresponding genes also follows an hourglass pattern, with the oldest genes concentrated at the hourglass waist. The key behind the hourglass effect is that developmental regulators should have an increasingly specific function as development progresses. Analysis of developmental gene expression profiles from Drosophila melanogaster and Arabidopsis thaliana provide consistent results with our theoretical predictions.

Reculer Pour Mieux Sauter: A Review of Attachment and Other Developmental Processes Inherent in Identified Risk Factors for Juvenile Delinquency and Juvenile Offending

Directory of Open Access Journals (Sweden)

Dianna T. Kenny

2014-07-01

Full Text Available The task of this paper is to identify the causes of juvenile delinquency and juvenile offending. The French proverb chosen for its title (Step back in order to jump better reflects the inherent challenge in this task; that is, how far back must we step in order to gain a complete understanding of these causes? Do we commence with adolescence, childhood, birth, pregnancy, conception, or the young person’s parents and their life experiences? How wide a net do we cast? Should we focus primarily on intra-individual factors, or the social ecologies in which young delinquents are found? Every story must have a beginning. In this story about young people who fall off the prosocial developmental trajectory, all sign posts point to attachment and the quality of the child’s first attachment experiences. This review will examine, from attachment and other developmental perspectives, how many of the more proximal causes of delinquency and youth offending have their origins in the emotional deficits suffered in early life. We will argue that delinquent and offending behavior represent attempts to redress these deficits. Consequently, interventions that attempt to prevent offending and reduce recidivism that do not address attachment ruptures and other early deficits cannot expect satisfactory outcomes.

Social geography of developmental health in the early years.

Science.gov (United States)

Hertzman, Clyde

2010-01-01

What happens to children in their earliest years is critical for their development throughout the life course. The years from zero to school age are foundational for brain and biological development. Attachment and face recognition; impulse control and regulation of physical aggression; executive function in the prefrontal cortex and focused attention; fine and gross motor functions and coordination; receptive and expressive language; and understandings of quantitative concepts are all established during this time and become embedded in the architecture and function of the brain (Doherty 1997; Kolb 2009; McCain and Mustard 1999). Brain and biological development are in turn expressed through three broad domains of development of the whole child: physical, social-emotional and language-cognitive, which together are the basis of "developmental health" (Keating and Hertzman 1999). Developmental health influences many aspects of well-being, including obesity and stunting, mental health, heart disease, competence in literacy and numeracy, criminality and economic participation throughout life (Irwin et al. 2007). Accordingly, developmental health is the central concern of this article.

A Multidimensional Scaling Approach to Developmental Dimensions in Object Permanence and Tracking Stimuli.

Science.gov (United States)

Townes-Rosenwein, Linda

This paper discusses a longitudinal, exploratory study of developmental dimensions related to object permanence theory and explains how multidimensional scaling techniques can be used to identify developmental dimensions. Eighty infants, randomly assigned to one of four experimental groups and one of four counterbalanced orders of stimuli, were…

Applying a Lifespan Developmental Perspective to Chronic Pain: Pediatrics to Geriatrics.

Science.gov (United States)

Walco, Gary A; Krane, Elliot J; Schmader, Kenneth E; Weiner, Debra K

2016-09-01

An ideal taxonomy of chronic pain would be applicable to people of all ages. Developmental sciences focus on lifespan developmental approaches, and view the trajectory of processes in the life course from birth to death. In this article we provide a review of lifespan developmental models, describe normal developmental processes that affect pain processing, and identify deviations from those processes that lead to stable individual differences of clinical interest, specifically the development of chronic pain syndromes. The goals of this review were 1) to unify what are currently separate purviews of "pediatric pain," "adult pain," and "geriatric pain," and 2) to generate models so that specific elements of the chronic pain taxonomy might include important developmental considerations. A lifespan developmental model is applied to the forthcoming Analgesic, Anesthetic, and Addiction Clinical Trial Translations, Innovations, Opportunities, and Networks-American Pain Society Pain Taxonomy to ascertain the degree to which general "adult" descriptions apply to pediatric and geriatric populations, or if age- or development-related considerations need to be invoked. Copyright © 2016. Published by Elsevier Inc.

A Genome-Wide Screen for Dendritically Localized RNAs Identifies Genes Required for Dendrite Morphogenesis

Directory of Open Access Journals (Sweden)

Mala Misra

2016-08-01

Full Text Available Localizing messenger RNAs at specific subcellular sites is a conserved mechanism for targeting the synthesis of cytoplasmic proteins to distinct subcellular domains, thereby generating the asymmetric protein distributions necessary for cellular and developmental polarity. However, the full range of transcripts that are asymmetrically distributed in specialized cell types, and the significance of their localization, especially in the nervous system, are not known. We used the EP-MS2 method, which combines EP transposon insertion with the MS2/MCP in vivo fluorescent labeling system, to screen for novel localized transcripts in polarized cells, focusing on the highly branched Drosophila class IV dendritic arborization neurons. Of a total of 541 lines screened, we identified 55 EP-MS2 insertions producing transcripts that were enriched in neuronal processes, particularly in dendrites. The 47 genes identified by these insertions encode molecularly diverse proteins, and are enriched for genes that function in neuronal development and physiology. RNAi-mediated knockdown confirmed roles for many of the candidate genes in dendrite morphogenesis. We propose that the transport of mRNAs encoded by these genes into the dendrites allows their expression to be regulated on a local scale during the dynamic developmental processes of dendrite outgrowth, branching, and/or remodeling.

White matter microstructure and developmental improvement of hyperactive/impulsive symptoms in Attention-Deficit/Hyperactivity

NARCIS (Netherlands)

Francx, W.; Zwiers, M.P.; Mennes, M.; Oosterlaan, J.; Heslenfeld, D.J.; Hoekstra, P.; Hartman, C.A.; Franke, C.; Faraone, S.V.; O'Dwyer, L.; Buitelaar, J.K.

2015-01-01

Background A developmental improvement of symptoms in attention-deficit/hyperactivity disorder (ADHD) is frequently reported, but the underlying neurobiological substrate has not been identified. The aim of this study was to determine whether white matter microstructure is related to developmental

Comparative Transcriptome Analysis Reveal Candidate Genes Potentially Involved in Regulation of Primocane Apex Rooting in Raspberry (Rubus spp.).

Science.gov (United States)

Liu, Jianfeng; Ming, Yuetong; Cheng, Yunqing; Zhang, Yuchu; Xing, Jiyang; Sun, Yuqi

2017-01-01

Raspberries ( Rubus spp.) exhibit a unique rooting process that is initiated from the stem apex of primocane, conferring an unusual asexual mode of reproduction to this plant. However, the full complement of genes involved in this process has not been identified. To this end, the present study analyzed the transcriptomes of the Rubus primocane and floricane stem apex at three developmental stages by Digital Gene Expression profiling to identify genes that regulate rooting. Sequencing and de novo assembly yielded 26.82 Gb of nucleotides and 59,173 unigenes; 498, 7,346, 4,110, 7,900, 9,397, and 4,776 differently expressed genes were identified in paired comparisons of SAF1 (floricane at developmental stage 1) vs. SAP1 (primocane at developmental stage 1), SAF2 vs. SAP2, SAF3 vs. SAP3, SAP1 vs. SAP2, SAP1 vs. SAP3, and SAP2 vs. SAP3, respectively. SAP1 maintains an extension growth pattern; SAP2 then exhibits growth arrest and vertical (downward) gravitropic deflection; and finally, short roots begin to form on the apex of SAP3. The Kyoto Encyclopedia of Genes and Genomes enrichment analysis of SAP1 vs. SAP2 revealed 12 pathways that were activated in response to shoot growth arrest and root differentiation, including circadian rhythm-plant (ko04712) and plant hormone signal transduction (ko04075). Our results indicate that genes related to circadian rhythm, ethylene and auxin signaling, shoot growth, and root development are potentially involved in the regulation of primocane apex rooting in Rubus . These findings provide a basis for elucidating the molecular mechanisms of primocane apex rooting in this economically valuable crop.

Developmental changes rather than repeated administration drive paracetamol glucuronidation in neonates and infants.

Science.gov (United States)

Krekels, Elke H J; van Ham, Saskia; Allegaert, Karel; de Hoon, Jan; Tibboel, Dick; Danhof, Meindert; Knibbe, Catherijne A J

2015-09-01

Based on recovered metabolite ratios in urine, it has been concluded that paracetamol glucuronidation may be up-regulated upon multiple dosing. This study investigates paracetamol clearance in neonates and infants after single and multiple dosing using a population modelling approach. A population pharmacokinetic model was developed in NONMEM VI, based on paracetamol plasma concentrations from 54 preterm and term neonates and infants, and on paracetamol, paracetamol-glucuronide and paracetamol-sulphate amounts in urine from 22 of these patients. Patients received either a single intravenous propacetamol dose or up to 12 repeated doses. Paracetamol and metabolite disposition was best described with one-compartment models. The formation clearance of paracetamol-sulphate was 1.46 mL/min/kg(1.4), which was about 5.5 times higher than the formation clearance of the glucuronide of 0.266 mL/min/kg. The renal excretion rate constants of both metabolites was estimated to be 11.4 times higher than the excretion rate constant of unchanged paracetamol, yielding values of 0.580 mL/min/kg. Developmental changes were best described by bodyweight in linear relationships on the distribution volumes, the formation of paracetamol-glucuronide and the unchanged excretion of paracetamol, and in an exponential relationship on the formation of paracetamol-sulphate. There was no evidence for up-regulation or other time-varying changes in any of the model parameters. Simulations with this model illustrate how paracetamol-glucuronide recovery in urine increases over time due to the slower formation of this metabolite and in the absence of up-regulation. Developmental changes, described by bodyweight-based functions, rather than up-regulation, explain developmental changes in paracetamol disposition in neonates and infants.

Identifying a K-10 Developmental Framework for Teaching Philosophy

Science.gov (United States)

Poulton, Janette

2014-01-01

The intention of the study was to identify predictable opportunities for teachers to scaffold middle year students' philosophical learning. Such opportunities were identified in terms of students' readiness to learn certain behaviours in the context of a "community of inquiry". Thus it was hoped that the project would provide a useful…

Developmentally Regulated Production of meso-Zeaxanthin in Chicken Retinal Pigment Epithelium/Choroid and Retina.

Science.gov (United States)

Gorusupudi, Aruna; Shyam, Rajalekshmy; Li, Binxing; Vachali, Preejith; Subhani, Yumna K; Nelson, Kelly; Bernstein, Paul S

2016-04-01

meso-Zeaxanthin is a carotenoid that is rarely encountered in nature outside of the vertebrate eye. It is not a constituent of a normal human diet, yet this carotenoid comprises one-third of the primate macular pigment. In the current study, we undertook a systematic approach to biochemically characterize the production of meso-zeaxanthin in the vertebrate eye. Fertilized White Leghorn chicken eggs were analyzed for the presence of carotenoids during development. Yolk, liver, brain, serum, retina, and RPE/choroid were isolated, and carotenoids were extracted. The samples were analyzed on C-30 or chiral HPLC columns to determine the carotenoid composition. Lutein and zeaxanthin were found in all studied nonocular tissues, but no meso-zeaxanthin was ever detected. Among the ocular tissues, the presence of meso-zeaxanthin was consistently observed starting at embryonic day 17 (E17) in the RPE/choroid, several days before its consistent detection in the retina. If RPE/choroid of an embryo was devoid of meso-zeaxanthin, the corresponding retina was always negative as well. This is the first report of developmentally regulated synthesis of meso-zeaxanthin in a vertebrate system. Our observations suggest that the RPE/choroid is the primary site of meso-zeaxanthin synthesis. Identification of meso-zeaxanthin isomerase enzyme in the developing chicken embryo will facilitate our ability to determine the biochemical mechanisms responsible for production of this unique carotenoid in other higher vertebrates, such as humans.

Measuring Self-Regulated Learning in the Workplace

Science.gov (United States)

Fontana, Rosa Pia; Milligan, Colin; Littlejohn, Allison; Margaryan, Anoush

2015-01-01

In knowledge-intensive industries, the workplace has become a key locus of learning. To perform effectively, knowledge workers must be able to take responsibility for their own developmental needs, and in particular, to regulate their own learning. This paper describes the construction and validation of an instrument (the Self-Regulated Learning…

Parental Influences on Children's Self-Regulation of Energy Intake: Insights from Developmental Literature on Emotion Regulation

Directory of Open Access Journals (Sweden)

Leslie A. Frankel

2012-01-01

Full Text Available The following article examines the role of parents in the development of children's self-regulation of energy intake. Various paths of parental influence are offered based on the literature on parental influences on children's emotion self-regulation. The parental paths include modeling, responses to children's behavior, assistance in helping children self-regulate, and motivating children through rewards and punishments. Additionally, sources of variation in parental influences on regulation are examined, including parenting style, child temperament, and child-parent attachment security. Parallels in the nature of parents' role in socializing children's regulation of emotions and energy intake are examined. Implications for future research are discussed.

Human regulator of telomere elongation helicase 1 (RTEL1) is required for the nuclear and cytoplasmic trafficking of pre-U2 RNA

OpenAIRE

Schertzer , Michael; Jouravleva , Karina; Perderiset , Mylène; Dingli , Florent; Loew , Damarys; Le Guen , Tangui; Bardoni , Barbara; De Villartay , Jean-Pierre; Revy , Patrick; Londono-Vallejo , Arturo

2015-01-01

International audience; Hoyeraal-Hreidarsson syndrome (HHS) is a severe form of Dyskeratosis congenita characterized by developmental defects, bone marrow failure and im-munodeficiency and has been associated with telom-ere dysfunction. Recently, mutations in Regulator of Telomere ELongation helicase 1 (RTEL1), a helicase first identified in Mus musculus as being responsible for the maintenance of long telomeres, have been identified in several HHS patients. Here we show that RTEL1 is require...

Cumulative-Genetic Plasticity, Parenting and Adolescent Self-Regulation

Science.gov (United States)

Belsky, Jay; Beaver, Kevin M.

2011-01-01

Background: The capacity to control or regulate one's emotions, cognitions and behavior is central to competent functioning, with limitations in these abilities associated with developmental problems. Parenting appears to influence such self-regulation. Here the differential-susceptibility hypothesis is tested that the more putative "plasticity…

Developmental transcriptomic analyses for mechanistic insights into critical pathways involved in embryogenesis of pelagic mahi-mahi (Coryphaena hippurus.

Directory of Open Access Journals (Sweden)

Elvis Genbo Xu

Full Text Available Mahi-mahi (Coryphaena hippurus is a commercially and ecologically important species of fish occurring in tropical and temperate waters worldwide. Understanding early life events is crucial for predicting effects of environmental stress, which is largely restricted by a lack of genetic resources regarding expression of early developmental genes and regulation of pathways. The need for anchoring developmental stages to transcriptional activities is highlighted by increasing evidence on the impacts of recurrent worldwide oil spills in this sensitive species during early development. By means of high throughput sequencing, we characterized the developmental transcriptome of mahi-mahi at three critical developmental stages, from pharyngula embryonic stage (24 hpf to 48 hpf yolk-sac larva (transition 1, and to 96 hpf free-swimming larva (transition 2. With comparative analysis by multiple bioinformatic tools, a larger number of significantly altered genes and more diverse gene ontology terms were observed during transition 2 than transition 1. Cellular and tissue development terms were more significantly enriched in transition 1, while metabolism related terms were more enriched in transition 2, indicating a switch progressing from general embryonic development to metabolism during the two transitions. Special focus was given on the most significant common canonical pathways (e.g. calcium signaling, glutamate receptor signaling, cAMP response element-binding protein signaling, cardiac β-adrenergic signaling, etc. and expression of developmental genes (e.g. collagens, myosin, notch, glutamate metabotropic receptor etc., which were associated with morphological changes of nervous, muscular, and cardiovascular system. These data will provide an important basis for understanding embryonic development and identifying molecular mechanisms of abnormal development in fish species.

Regulation of Hepatic Stellate Cells and Fibrogenesis by Fibroblast Growth Factors

Directory of Open Access Journals (Sweden)

Justin D. Schumacher

2016-01-01

Full Text Available Fibroblast growth factors (FGFs are a family of growth factors critically involved in developmental, physiological, and pathological processes, including embryogenesis, angiogenesis, wound healing, and endocrine functions. In the liver, several FGFs are produced basally by hepatocytes and hepatic stellate cells (HSCs. Upon insult to the liver, expression of FGFs in HSCs is greatly upregulated, stimulating hepatocyte regeneration and growth. Various FGF isoforms have also been shown to directly induce HSC proliferation and activation thereby enabling autocrine and paracrine regulation of HSC function. Regulation of HSCs by the endocrine FGFs, namely, FGF15/19 and FGF21, has also recently been identified. With the ability to modulate HSC proliferation and transdifferentiation, targeting FGF signaling pathways constitutes a promising new therapeutic strategy to treat hepatic fibrosis.

Family Decision Making: Benefits to Persons with Developmental Disabilities and Their Family Members

Science.gov (United States)

Neely-Barnes, Susan; Graff, J. Carolyn; Marcenko, Maureen; Weber, Lisa

2008-01-01

Family involvement in planning and choosing services has become a key intervention concept in developmental disability services. This study (N = 547) modeled patterns of family decision making and assessed benefits to persons with developmental disabilities (DDs) and their family members. A latent profile analysis identified 4 classes that were…

48 CFR 219.7104 - Developmental assistance costs eligible for reimbursement or credit.

Science.gov (United States)

2010-10-01

... costs eligible for reimbursement or credit. 219.7104 Section 219.7104 Federal Acquisition Regulations... reimbursement or credit. (a) Developmental assistance provided under an approved mentor-protege agreement is... eligible for reimbursement are set forth in appendix I. (b) Before incurring any costs under the Program...

Reporter-Based Isolation of Developmental Myogenic Progenitors

Directory of Open Access Journals (Sweden)

Eyemen Kheir

2018-04-01

Full Text Available The formation and activity of mammalian tissues entail finely regulated processes, involving the concerted organization and interaction of multiple cell types. In recent years the prospective isolation of distinct progenitor and stem cell populations has become a powerful tool in the hands of developmental biologists and has rendered the investigation of their intrinsic properties possible. In this protocol, we describe how to purify progenitors with different lineage history and degree of differentiation from embryonic and fetal skeletal muscle by fluorescence-activated cell sorting (FACS. The approach takes advantage of a panel of murine strains expressing fluorescent reporter genes specifically in the myogenic progenitors. We provide a detailed description of the dissection procedures and of the enzymatic dissociation required to maximize the yield of mononucleated cells for subsequent FACS-based purification. The procedure takes ~6–7 h to complete and allows for the isolation and the subsequent molecular and phenotypic characterization of developmental myogenic progenitors.

The phonological and visual basis of developmental dyslexia in Brazilian Portuguese reading children

Science.gov (United States)

Germano, Giseli D.; Reilhac, Caroline; Capellini, Simone A.; Valdois, Sylviane

2014-01-01

Evidence from opaque languages suggests that visual attention processing abilities in addition to phonological skills may act as cognitive underpinnings of developmental dyslexia. We explored the role of these two cognitive abilities on reading fluency in Brazilian Portuguese, a more transparent orthography than French or English. Sixty-six children with developmental dyslexia and normal Brazilian Portuguese children participated. They were administered three tasks of phonological skills (phoneme identification, phoneme, and syllable blending) and three visual tasks (a letter global report task and two non-verbal tasks of visual closure and visual constancy). Results show that Brazilian Portuguese children with developmental dyslexia are impaired not only in phonological processing but further in visual processing. The phonological and visual processing abilities significantly and independently contribute to reading fluency in the whole population. Last, different cognitively homogeneous subtypes can be identified in the Brazilian Portuguese population of children with developmental dyslexia. Two subsets of children with developmental dyslexia were identified as having a single cognitive disorder, phonological or visual; another group exhibited a double deficit and a few children showed no visual or phonological disorder. Thus the current findings extend previous data from more opaque orthographies as French and English, in showing the importance of investigating visual processing skills in addition to phonological skills in children with developmental dyslexia whatever their language orthography transparency. PMID:25352822

Solution scanning as a key policy tool: identifying management interventions to help maintain and enhance regulating ecosystem services

Directory of Open Access Journals (Sweden)

William J. Sutherland

2014-06-01

Full Text Available The major task of policy makers and practitioners when confronted with a resource management problem is to decide on the potential solution(s to adopt from a range of available options. However, this process is unlikely to be successful and cost effective without access to an independently verified and comprehensive available list of options. There is currently burgeoning interest in ecosystem services and quantitative assessments of their importance and value. Recognition of the value of ecosystem services to human well-being represents an increasingly important argument for protecting and restoring the natural environment, alongside the moral and ethical justifications for conservation. As well as understanding the benefits of ecosystem services, it is also important to synthesize the practical interventions that are capable of maintaining and/or enhancing these services. Apart from pest regulation, pollination, and global climate regulation, this type of exercise has attracted relatively little attention. Through a systematic consultation exercise, we identify a candidate list of 296 possible interventions across the main regulating services of air quality regulation, climate regulation, water flow regulation, erosion regulation, water purification and waste treatment, disease regulation, pest regulation, pollination and natural hazard regulation. The range of interventions differs greatly between habitats and services depending upon the ease of manipulation and the level of research intensity. Some interventions have the potential to deliver benefits across a range of regulating services, especially those that reduce soil loss and maintain forest cover. Synthesis and applications: Solution scanning is important for questioning existing knowledge and identifying the range of options available to researchers and practitioners, as well as serving as the necessary basis for assessing cost effectiveness and guiding implementation strategies. We

Age-dependent regulation of ERF-VII transcription factor activity in Arabidopsis thaliana.

Science.gov (United States)

Giuntoli, Beatrice; Shukla, Vinay; Maggiorelli, Federica; Giorgi, Federico M; Lombardi, Lara; Perata, Pierdomenico; Licausi, Francesco

2017-10-01

The Group VII Ethylene Responsive Factors (ERFs-VII) RAP2.2 and RAP2.12 have been mainly characterized with regard to their contribution as activators of fermentation in plants. However, transcriptional changes measured in conditions that stabilize these transcription factors exceed the mere activation of this biochemical pathway, implying additional roles performed by the ERF-VIIs in other processes. We evaluated gene expression in transgenic Arabidopsis lines expressing a stabilized form of RAP2.12, or hampered in ERF-VII activity, and identified genes affected by this transcriptional regulator and its homologs, including some involved in oxidative stress response, which are not universally induced under anaerobic conditions. The contribution of the ERF-VIIs in regulating this set of genes in response to chemically induced or submergence-stimulated mitochondria malfunctioning was found to depend on the plant developmental stage. A similar age-dependent mechanism also restrained ERF-VII activity upon the core-hypoxic genes, independently of the N-end rule pathway, which is accounted for the control of the anaerobic response. To conclude, this study shed new light on a dual role of ERF-VII proteins under submergence: as positive regulators of the hypoxic response and as repressors of oxidative-stress related genes, depending on the developmental stage at which plants are challenged by stress conditions. © 2017 John Wiley & Sons Ltd.

Prepatterning of developmental gene expression by modified histones before zygotic genome activation

DEFF Research Database (Denmark)

Lindeman, Leif C.; Andersen, Ingrid S.; Reiner, Andrew H.

2011-01-01

A hallmark of anamniote vertebrate development is a window of embryonic transcription-independent cell divisions before onset of zygotic genome activation (ZGA). Chromatin determinants of ZGA are unexplored; however, marking of developmental genes by modified histones in sperm suggests a predictive...... role of histone marks for ZGA. In zebrafish, pre-ZGA development for ten cell cycles provides an opportunity to examine whether genomic enrichment in modified histones is present before initiation of transcription. By profiling histone H3 trimethylation on all zebrafish promoters before and after ZGA......, we demonstrate here an epigenetic prepatterning of developmental gene expression. This involves pre-ZGA marking of transcriptionally inactive genes involved in homeostatic and developmental regulation by permissive H3K4me3 with or without repressive H3K9me3 or H3K27me3. Our data suggest that histone...

Desenvolvimentismo e neodesenvolvimentismo: tragédia e farsa Developmentalism and new developmentalism: tragedy and farce

Directory of Open Access Journals (Sweden)

Plínio de Arruda Sampaio Jr.

2012-12-01

Full Text Available A pretensão do neodesenvolvimentismo de pleitear a continuidade do desenvolvimentismo não encontra nenhum fundamento objetivo. As duas expressões do pensamento econômico correspondem a épocas históricas distintas e representam espectros ideológicos opostos. Ao identificar a realidade da economia brasileira contemporânea com o desenvolvimento capitalista virtuoso, o novo desenvolvimentista revela‑se tal qual é - uma apologia do poder. Não passa de um esforço provinciano para dar roupa nova à velha teoria da modernização como solução para os graves problemas das populações que vivem no elo fraco do sistema capitalista mundial.The pretension of the new developmentalism to plead the continuity of the old developmentalism has no objective foundation. The two expressions of economic thought correspond to different historical epochs and represent opposing sides of the ideological spectrum. When the new developmentalism identifies the contemporary reality of the Brazilian economy with virtuous capitalist development, it reveals what it is really: an apologia for power. It is nothing more than a parochial effort to make up the old theory of modernization as a solution to the serious problems of the population living in the weak link of the capitalist world system.

Proteomic Analysis Reveals Coordinated Regulation of Anthocyanin Biosynthesis through Signal Transduction and Sugar Metabolism in Black Rice Leaf.

Science.gov (United States)

Chen, Linghua; Huang, Yining; Xu, Ming; Cheng, Zuxin; Zheng, Jingui

2017-12-15

Black rice ( Oryza sativa L.) is considered to be a healthy food due to its high content of anthocyanins in the pericarp. The synthetic pathway of anthocyanins in black rice grains has been identified, however, the proteomic profile of leaves during grain development is still unclear. Here, isobaric Tags Relative and Absolute Quantification (iTRAQ) MS/MS was carried out to identify statistically significant changes of leaf proteome in the black rice during grain development. Throughout three sequential developmental stages, a total of 3562 proteins were detected and 24 functional proteins were differentially expressed 3-10 days after flowering (DAF). The detected proteins are known to be involved in various biological processes and most of these proteins were related to gene expression regulatory (33.3%), signal transduction (16.7%) and developmental regulation and hormone-like proteins (12.5%). The coordinated changes were consistent with changes in regulatory proteins playing a leading role in leaves during black rice grain development. This indicated that signal transduction between leaves and grains may have an important role in anthocyanin biosynthesis and accumulation during grain development of black rice. In addition, four identified up-regulated proteins associated with starch metabolism suggested that the remobilization of nutrients for starch synthesis plays a potential role in anthocyanin biosynthesis of grain. The mRNA transcription for eight selected proteins was validated with quantitative real-time PCR. Our results explored the proteomics of the coordination between leaf and grain in anthocyanins biosynthesis of grain, which might be regulated by signal transduction and sugar metabolism in black rice leaf.

Proteomic Analysis Reveals Coordinated Regulation of Anthocyanin Biosynthesis through Signal Transduction and Sugar Metabolism in Black Rice Leaf

Directory of Open Access Journals (Sweden)

Linghua Chen

2017-12-01

Full Text Available Black rice (Oryza sativa L. is considered to be a healthy food due to its high content of anthocyanins in the pericarp. The synthetic pathway of anthocyanins in black rice grains has been identified, however, the proteomic profile of leaves during grain development is still unclear. Here, isobaric Tags Relative and Absolute Quantification (iTRAQ MS/MS was carried out to identify statistically significant changes of leaf proteome in the black rice during grain development. Throughout three sequential developmental stages, a total of 3562 proteins were detected and 24 functional proteins were differentially expressed 3–10 days after flowering (DAF. The detected proteins are known to be involved in various biological processes and most of these proteins were related to gene expression regulatory (33.3%, signal transduction (16.7% and developmental regulation and hormone-like proteins (12.5%. The coordinated changes were consistent with changes in regulatory proteins playing a leading role in leaves during black rice grain development. This indicated that signal transduction between leaves and grains may have an important role in anthocyanin biosynthesis and accumulation during grain development of black rice. In addition, four identified up-regulated proteins associated with starch metabolism suggested that the remobilization of nutrients for starch synthesis plays a potential role in anthocyanin biosynthesis of grain. The mRNA transcription for eight selected proteins was validated with quantitative real-time PCR. Our results explored the proteomics of the coordination between leaf and grain in anthocyanins biosynthesis of grain, which might be regulated by signal transduction and sugar metabolism in black rice leaf.

Hemodynamic forces regulate developmental patterning of atrial conduction.

Directory of Open Access Journals (Sweden)

Michael C Bressan

Full Text Available Anomalous action potential conduction through the atrial chambers of the heart can lead to severe cardiac arrhythmia. To date, however, little is known regarding the mechanisms that pattern proper atrial conduction during development. Here we demonstrate that atrial muscle functionally diversifies into at least two heterogeneous subtypes, thin-walled myocardium and rapidly conducting muscle bundles, during a developmental window just following cardiac looping. During this process, atrial muscle bundles become enriched for the fast conduction markers Cx40 and Nav1.5, similar to the precursors of the fast conduction Purkinje fiber network located within the trabeculae of the ventricles. In contrast to the ventricular trabeculae, however, atrial muscle bundles display an increased proliferation rate when compared to the surrounding myocardium. Interestingly, mechanical loading of the embryonic atrial muscle resulted in an induction of Cx40, Nav1.5 and the cell cycle marker Cyclin D1, while decreasing atrial pressure via in vivo ligation of the vitelline blood vessels results in decreased atrial conduction velocity. Taken together, these data establish a novel model for atrial conduction patterning, whereby hemodynamic stretch coordinately induces proliferation and fast conduction marker expression, which in turn promotes the formation of large diameter muscle bundles to serve as preferential routes of conduction.

Developmental Pathways Are Blueprints for Designing Successful Crops

Directory of Open Access Journals (Sweden)

Ben Trevaskis

2018-06-01

Full Text Available Genes controlling plant development have been studied in multiple plant systems. This has provided deep insights into conserved genetic pathways controlling core developmental processes including meristem identity, phase transitions, determinacy, stem elongation, and branching. These pathways control plant growth patterns and are fundamentally important to crop biology and agriculture. This review describes the conserved pathways that control plant development, using Arabidopsis as a model. Historical examples of how plant development has been altered through selection to improve crop performance are then presented. These examples, drawn from diverse crops, show how the genetic pathways controlling development have been modified to increase yield or tailor growth patterns to suit local growing environments or specialized crop management practices. Strategies to apply current progress in genomics and developmental biology to future crop improvement are then discussed within the broader context of emerging trends in plant breeding. The ways that knowledge of developmental processes and understanding of gene function can contribute to crop improvement, beyond what can be achieved by selection alone, are emphasized. These include using genome re-sequencing, mutagenesis, and gene editing to identify or generate novel variation in developmental genes. The expanding scope for comparative genomics, the possibility to engineer new developmental traits and new approaches to resolve gene–gene or gene–environment interactions are also discussed. Finally, opportunities to integrate fundamental research and crop breeding are highlighted.

Cheating by exploitation of developmental prestalk patterning in Dictyostelium discoideum.

Directory of Open Access Journals (Sweden)

Anupama Khare

2010-02-01

Full Text Available The cooperative developmental system of the social amoeba Dictyostelium discoideum is susceptible to exploitation by cheaters-strains that make more than their fair share of spores in chimerae. Laboratory screens in Dictyostelium have shown that the genetic potential for facultative cheating is high, and field surveys have shown that cheaters are abundant in nature, but the cheating mechanisms are largely unknown. Here we describe cheater C (chtC, a strong facultative cheater mutant that cheats by affecting prestalk differentiation. The chtC gene is developmentally regulated and its mRNA becomes stalk-enriched at the end of development. chtC mutants are defective in maintaining the prestalk cell fate as some of their prestalk cells transdifferentiate into prespore cells, but that defect does not affect gross developmental morphology or sporulation efficiency. In chimerae between wild-type and chtC mutant cells, the wild-type cells preferentially give rise to prestalk cells, and the chtC mutants increase their representation in the spore mass. Mixing chtC mutants with other cell-type proportioning mutants revealed that the cheating is directly related to the prestalk-differentiation propensity of the victim. These findings illustrate that a cheater can victimize cooperative strains by exploiting an established developmental pathway.

Cheating by Exploitation of Developmental Prestalk Patterning in Dictyostelium discoideum

Science.gov (United States)

Khare, Anupama; Shaulsky, Gad

2010-01-01

The cooperative developmental system of the social amoeba Dictyostelium discoideum is susceptible to exploitation by cheaters—strains that make more than their fair share of spores in chimerae. Laboratory screens in Dictyostelium have shown that the genetic potential for facultative cheating is high, and field surveys have shown that cheaters are abundant in nature, but the cheating mechanisms are largely unknown. Here we describe cheater C (chtC), a strong facultative cheater mutant that cheats by affecting prestalk differentiation. The chtC gene is developmentally regulated and its mRNA becomes stalk-enriched at the end of development. chtC mutants are defective in maintaining the prestalk cell fate as some of their prestalk cells transdifferentiate into prespore cells, but that defect does not affect gross developmental morphology or sporulation efficiency. In chimerae between wild-type and chtC mutant cells, the wild-type cells preferentially give rise to prestalk cells, and the chtC mutants increase their representation in the spore mass. Mixing chtC mutants with other cell-type proportioning mutants revealed that the cheating is directly related to the prestalk-differentiation propensity of the victim. These findings illustrate that a cheater can victimize cooperative strains by exploiting an established developmental pathway. PMID:20195510

Quantitative developmental transcriptomes of the Mediterranean sea urchin Paracentrotus lividus.

Science.gov (United States)

Gildor, Tsvia; Malik, Assaf; Sher, Noa; Avraham, Linor; Ben-Tabou de-Leon, Smadar

2016-02-01

Embryonic development progresses through the timely activation of thousands of differentially activated genes. Quantitative developmental transcriptomes provide the means to relate global patterns of differentially expressed genes to the emerging body plans they generate. The sea urchin is one of the classic model systems for embryogenesis and the models of its developmental gene regulatory networks are of the most comprehensive of their kind. Thus, the sea urchin embryo is an excellent system for studies of its global developmental transcriptional profiles. Here we produced quantitative developmental transcriptomes of the sea urchin Paracentrotus lividus (P. lividus) at seven developmental stages from the fertilized egg to prism stage. We generated de-novo reference transcriptome and identified 29,817 genes that are expressed at this time period. We annotated and quantified gene expression at the different developmental stages and confirmed the reliability of the expression profiles by QPCR measurement of a subset of genes. The progression of embryo development is reflected in the observed global expression patterns and in our principle component analysis. Our study illuminates the rich patterns of gene expression that participate in sea urchin embryogenesis and provide an essential resource for further studies of the dynamic expression of P. lividus genes. Copyright © 2015 Elsevier B.V. All rights reserved.

Homologous recombination and non-homologous end-joining repair pathways in bovine embryos with different developmental competence

Energy Technology Data Exchange (ETDEWEB)

Henrique Barreta, Marcos [Universidade Federal de Santa Catarina, Campus Universitario de Curitibanos, Curitibanos, SC (Brazil); Laboratorio de Biotecnologia e Reproducao Animal-BioRep, Universidade Federal de Santa Maria, Santa Maria, RS (Brazil); Garziera Gasperin, Bernardo; Braga Rissi, Vitor; Cesaro, Matheus Pedrotti de [Laboratorio de Biotecnologia e Reproducao Animal-BioRep, Universidade Federal de Santa Maria, Santa Maria, RS (Brazil); Ferreira, Rogerio [Centro de Educacao Superior do Oeste-Universidade do Estado de Santa Catarina, Chapeco, SC (Brazil); Oliveira, Joao Francisco de; Goncalves, Paulo Bayard Dias [Laboratorio de Biotecnologia e Reproducao Animal-BioRep, Universidade Federal de Santa Maria, Santa Maria, RS (Brazil); Bordignon, Vilceu, E-mail: vilceu.bordignon@mcgill.ca [Department of Animal Science, McGill University, Ste-Anne-De-Bellevue, QC (Canada)

2012-10-01

This study investigated the expression of genes controlling homologous recombination (HR), and non-homologous end-joining (NHEJ) DNA-repair pathways in bovine embryos of different developmental potential. It also evaluated whether bovine embryos can respond to DNA double-strand breaks (DSBs) induced with ultraviolet irradiation by regulating expression of genes involved in HR and NHEJ repair pathways. Embryos with high, intermediate or low developmental competence were selected based on the cleavage time after in vitro insemination and were removed from in vitro culture before (36 h), during (72 h) and after (96 h) the expected period of embryonic genome activation. All studied genes were expressed before, during and after the genome activation period regardless the developmental competence of the embryos. Higher mRNA expression of 53BP1 and RAD52 was found before genome activation in embryos with low developmental competence. Expression of 53BP1, RAD51 and KU70 was downregulated at 72 h and upregulated at 168 h post-insemination in response to DSBs induced by ultraviolet irradiation. In conclusion, important genes controlling HR and NHEJ DNA-repair pathways are expressed in bovine embryos, however genes participating in these pathways are only regulated after the period of embryo genome activation in response to ultraviolet-induced DSBs.

Homologous recombination and non-homologous end-joining repair pathways in bovine embryos with different developmental competence

International Nuclear Information System (INIS)

Henrique Barreta, Marcos; Garziera Gasperin, Bernardo; Braga Rissi, Vitor; Cesaro, Matheus Pedrotti de; Ferreira, Rogério; Oliveira, João Francisco de; Gonçalves, Paulo Bayard Dias; Bordignon, Vilceu

2012-01-01

This study investigated the expression of genes controlling homologous recombination (HR), and non-homologous end-joining (NHEJ) DNA-repair pathways in bovine embryos of different developmental potential. It also evaluated whether bovine embryos can respond to DNA double-strand breaks (DSBs) induced with ultraviolet irradiation by regulating expression of genes involved in HR and NHEJ repair pathways. Embryos with high, intermediate or low developmental competence were selected based on the cleavage time after in vitro insemination and were removed from in vitro culture before (36 h), during (72 h) and after (96 h) the expected period of embryonic genome activation. All studied genes were expressed before, during and after the genome activation period regardless the developmental competence of the embryos. Higher mRNA expression of 53BP1 and RAD52 was found before genome activation in embryos with low developmental competence. Expression of 53BP1, RAD51 and KU70 was downregulated at 72 h and upregulated at 168 h post-insemination in response to DSBs induced by ultraviolet irradiation. In conclusion, important genes controlling HR and NHEJ DNA-repair pathways are expressed in bovine embryos, however genes participating in these pathways are only regulated after the period of embryo genome activation in response to ultraviolet-induced DSBs.

Autism in community pre-schoolers: developmental profiles.

Science.gov (United States)

Kantzer, Anne-Katrin; Fernell, Elisabeth; Gillberg, Christopher; Miniscalco, Carmela

2013-09-01

Autism is often a complex developmental disorder. The aim of the present study was to describe the developmental characteristics of 129 1-4-year-old children (102 boys, 27 girls) referred for clinical assessment (mean age 2.9 years) due to suspicion of autism spectrum disorder (ASD) after community screening at Child Health Care centers. All children were clinically assessed at the Child Neuropsychiatry Clinic (CNC) in Gothenburg by a research team (neurodevelopmental examination, structured interviews and general cognitive and language examinations). Of the 129 children, 100 met diagnostic criteria for ASD (69 with autistic disorder, and 31 with atypical autism/pervasive developmental disorder-not otherwise specified). The remaining 29 children had a variety of developmental disorders, most often attention-deficit/hyperactivity disorder (ADHD), language disorder, borderline intellectual functioning, and intellectual developmental disorder (IDD) with (n=25) or without (n=4) autistic traits (AT). IDD was found in 36% of the 100 children with ASD, and in 4% of the 25 children with AT. Of the children with ASD, 56% had language disorder with no or just a few words at the initial assessment at the CNC, many of whom in combination with IDD. Hyperactivity was found in 37% of those with ASD and in 40% of those with AT. Epilepsy was found in 6% of the total group and in 7% of those with a diagnosis of ASD. Of the latter group 11% had a history of regression, while none of the AT cases had a similar background. When results were compared with a non-screened preschool ASD group of 208 children, referred for ASD intervention at a mean age of 3.4 years, very similar developmental profiles were seen. In conclusion, early community ASD screening appears to systematically identify those children who are in need of intervention and follow-up. Copyright © 2013 Elsevier Ltd. All rights reserved.

Rational Choice and Developmental Influences on Recidivism Among Adolescent Felony Offenders.

Science.gov (United States)

Fagan, Jeffrey; Piquero, Alex R

2007-12-01

Recent case law and social science both have claimed that the developmental limitations of adolescents affect their capacity for control and decision making with respect to crime, diminishing their culpability and reducing their exposure to punishment. Social science has focused on two concurrent adolescent developmental influences: the internalization of legal rules and norms that regulate social and antisocial behaviors, and the development of rationality to frame behavioral choices and decisions. The interaction of these two developmental processes, and the identification of one domain of socialization and development as the primary source of motivation or restraint in adolescence, is the focus of this article. Accordingly, we combine rational choice and legal socialization frameworks into an integrated, developmental model of criminality. We test this framework in a large sample of adolescent felony offenders who have been interviewed at six-month intervals for two years. Using hierarchical and growth curve models, we show that both legal socialization and rational choice factors influence patterns of criminal offending over time. When punishment risks and costs are salient, crime rates are lower over time. We show that procedural justice is a significant antecedent of legal socialization, but not of rational choice. We also show that both mental health and developmental maturity moderate the effects of perceived crime risks and costs on criminal offending.

Rational Choice and Developmental Influences on Recidivism Among Adolescent Felony Offenders

Science.gov (United States)

Fagan, Jeffrey; Piquero, Alex R.

2009-01-01

Recent case law and social science both have claimed that the developmental limitations of adolescents affect their capacity for control and decision making with respect to crime, diminishing their culpability and reducing their exposure to punishment. Social science has focused on two concurrent adolescent developmental influences: the internalization of legal rules and norms that regulate social and antisocial behaviors, and the development of rationality to frame behavioral choices and decisions. The interaction of these two developmental processes, and the identification of one domain of socialization and development as the primary source of motivation or restraint in adolescence, is the focus of this article. Accordingly, we combine rational choice and legal socialization frameworks into an integrated, developmental model of criminality. We test this framework in a large sample of adolescent felony offenders who have been interviewed at six-month intervals for two years. Using hierarchical and growth curve models, we show that both legal socialization and rational choice factors influence patterns of criminal offending over time. When punishment risks and costs are salient, crime rates are lower over time. We show that procedural justice is a significant antecedent of legal socialization, but not of rational choice. We also show that both mental health and developmental maturity moderate the effects of perceived crime risks and costs on criminal offending. PMID:20148123

HUPO BPP pilot study: a proteomics analysis of the mouse brain of different developmental stages.

Science.gov (United States)

Wang, Jing; Gu, Yong; Wang, Lihong; Hang, Xingyi; Gao, Yan; Wang, Hangyan; Zhang, Chenggang

2007-11-01

This study is a part of the HUPO Brain Proteome Project (BPP) pilot study, which aims at obtaining a reliable database of mouse brain proteome, at the comparison of techniques, laboratories, and approaches as well as at preparing subsequent proteome studies of neurologic diseases. The C57/Bl6 mouse brains of three developmental stages at embryonic day 16 (E16), postnatal day 7 (P7), and 8 wk (P56) (n = 5 in each group) were provided by the HUPO BPP executive committee. The whole brain proteins of each animal were individually prepared using 2-DE coupled with PDQuest software analysis. The protein spots representing developmentally related or stably expressed proteins were then prepared with in-gel digestion followed with MALDI-TOF/TOF MS/MS and analyzed using the MASCOT search engines to search the Swiss-Prot or NCBInr database. The 2-DE gel maps of the mouse brains of all of the developmental stages were obtained and submitted to the Data Collection Centre (DCC). The proteins alpha-enolase, stathmin, actin, C14orf166 homolog, 28,000 kDa heat- and acid-stable phosphoprotein, 3-mercaptopyruvate sulfurtransferase and 40 S ribosomal protein S3a were successfully identified. A further Western blotting analysis demonstrated that enolase is a protein up-regulated in the mouse brain from embryonic stage to adult stage. These data are helpful for understanding the proteome changes in the development of the mouse brain.

Genome-wide association study identifies candidate genes for starch content regulation in maize kernels

Directory of Open Access Journals (Sweden)

Na Liu

2016-07-01

Full Text Available Kernel starch content is an important trait in maize (Zea mays L. as it accounts for 65% to 75% of the dry kernel weight and positively correlates with seed yield. A number of starch synthesis-related genes have been identified in maize in recent years. However, many loci underlying variation in starch content among maize inbred lines still remain to be identified. The current study is a genome-wide association study that used a set of 263 maize inbred lines. In this panel, the average kernel starch content was 66.99%, ranging from 60.60% to 71.58% over the three study years. These inbred lines were genotyped with the SNP50 BeadChip maize array, which is comprised of 56,110 evenly spaced, random SNPs. Population structure was controlled by a mixed linear model (MLM as implemented in the software package TASSEL. After the statistical analyses, four SNPs were identified as significantly associated with starch content (P ≤ 0.0001, among which one each are located on chromosomes 1 and 5 and two are on chromosome 2. Furthermore, 77 candidate genes associated with starch synthesis were found within the 100-kb intervals containing these four QTLs, and four highly associated genes were within 20-kb intervals of the associated SNPs. Among the four genes, Glucose-1-phosphate adenylyltransferase (APS1; Gene ID GRMZM2G163437 is known as an important regulator of kernel starch content. The identified SNPs, QTLs, and candidate genes may not only be readily used for germplasm improvement by marker-assisted selection in breeding, but can also elucidate the genetic basis of starch content. Further studies on these identified candidate genes may help determine the molecular mechanisms regulating kernel starch content in maize and other important cereal crops.

The Domain of Developmental Psychopathology.

Science.gov (United States)

Sroufe, L. Alan; Rutter, Michael

1984-01-01

Describes how developmental psychopathology differs from related disciplines, including abnormal psychology, psychiatry, clinical child psychology, and developmental psychology. Points out propositions underlying a developmental perspective and discusses implications for research in developmental psychopathology. (Author/RH)

Embryonic common snapping turtles (Chelydra serpentina) preferentially regulate intracellular tissue pH during acid-base challenges.

Science.gov (United States)

Shartau, Ryan B; Crossley, Dane A; Kohl, Zachary F; Brauner, Colin J

2016-07-01

The nests of embryonic turtles naturally experience elevated CO2 (hypercarbia), which leads to increased blood PCO2  and a respiratory acidosis, resulting in reduced blood pH [extracellular pH (pHe)]. Some fishes preferentially regulate tissue pH [intracellular pH (pHi)] against changes in pHe; this has been proposed to be associated with exceptional CO2 tolerance and has never been identified in amniotes. As embryonic turtles may be CO2 tolerant based on nesting strategy, we hypothesized that they preferentially regulate pHi, conferring tolerance to severe acute acid-base challenges. This hypothesis was tested by investigating pH regulation in common snapping turtles (Chelydra serpentina) reared in normoxia then exposed to hypercarbia (13 kPa PCO2 ) for 1 h at three developmental ages: 70% and 90% of incubation, and yearlings. Hypercarbia reduced pHe but not pHi, at all developmental ages. At 70% of incubation, pHe was depressed by 0.324 pH units while pHi of brain, white muscle and lung increased; heart, liver and kidney pHi remained unchanged. At 90% of incubation, pHe was depressed by 0.352 pH units but heart pHi increased with no change in pHi of other tissues. Yearlings exhibited a pHe reduction of 0.235 pH units but had no changes in pHi of any tissues. The results indicate common snapping turtles preferentially regulate pHi during development, but the degree of response is reduced throughout development. This is the first time preferential pHi regulation has been identified in an amniote. These findings may provide insight into the evolution of acid-base homeostasis during development of amniotes, and vertebrates in general. © 2016. Published by The Company of Biologists Ltd.

Searching for biomarkers of developmental toxicity with microarrays: normal eye morphogenesis in rodent embryos

International Nuclear Information System (INIS)

Nemeth, Kimberly A.; Singh, Amar V.; Knudsen, Thomas B.

2005-01-01

Gene expression arrays reveal the potential linkage of altered gene expression with specific adverse effects leading to disease phenotypes. But how closely do microarray data reflect early physiological or pharmacological measures that predict toxic event(s)? To explore this issue, we have undertaken experiments in early mouse embryos exposed to various teratogens during neurulation stages with the aim of correlating large-scale changes in gene expression across the critical period during exposure. This study reports some of the large-scale changes in gene expression that can be detected in the optic rudiment of the developing mouse and rat embryo across the window of development during which the eye is exceedingly sensitive to teratogen-induced micro-/anophthalmia. Microarray analysis was performed on RNA from the headfold or ocular region at the optic vesicle and optic cup stages when the ocular primordium is enriched for Pax-6, a master control gene for eye morphogenesis. Statistical selection of differentially regulated genes and various clustering techniques identified groups of genes in upward or downward trajectories in the normal optic primordium during early eye development in mouse and rat species. We identified 165 genes with significant differential expression during eye development, and a smaller subset of 58 genes that showed a tight correlation between mouse-rat development. Significantly over-represented functional categories included fatty acid metabolism (up-regulated) and glycolysis (down-regulated). From studies such as these that benchmark large-scale gene expression during normal embryonic development, we may be able to identify the panel of biomarkers that best correlate with species differences and the risks for developmental toxicity

Habits of the heart: life history and the developmental neuroendocrinology of emotion.

Science.gov (United States)

Worthman, Carol M

2009-01-01

The centrality of emotion in cognition and social intelligence as well as its impact on health has intensified investigation into the causes and consequences of individual variation in emotion regulation. Central processing of experience directly informs regulation of endocrine axes, essentially forming a neuro-endocrine continuum integrating information intake, processing, and physiological and behavioral response. Two major elements of life history-resource allocation and niche partitioning-are served by linking cognitive-affective with physiologic and behavioral processes. Scarce cognitive resources (attention, memory, and time) are allocated under guidance from affective co-processing. Affective-cognitive processing, in turn, regulates physiologic activity through neuro-endocrine outflow and thereby orchestrates energetic resource allocation and trade-offs, both acutely and through time. Reciprocally, peripheral activity (e.g., immunologic, metabolic, or energetic markers) influences affective-cognitive processing. By guiding attention, memory, and behavior, affective-cognitive processing also informs individual stances toward, patterns of activity in, and relationships with the world. As such, it mediates processes of niche partitioning that adaptively exploit social and material resources. Developmental behavioral neurobiology has identified multiple factors that influence the ontogeny of emotion regulation to form affective and behavioral styles. Evidence is reviewed documenting roles for genetic, epigenetic, and experiential factors in the development of emotion regulation, social cognition, and behavior with important implications for understanding mechanisms that underlie life history construction and the sources of differential health. Overall, this dynamic arena for research promises to link the biological bases of life history theory with the psychobehavioral phenomena that figure so centrally in quotidian experience and adaptation, particularly, for

A Functional Analysis of Gestural Behaviors Emitted by Young Children with Severe Developmental Disabilities

Science.gov (United States)

Ferreri, Summer J.; Plavnick, Joshua B.

2011-01-01

Many children with severe developmental disabilities emit idiosyncratic gestures that may function as verbal operants (Sigafoos et al., 2000). This study examined the effectiveness of a functional analysis methodology to identify the variables responsible for gestures emitted by 2 young children with severe developmental disabilities. Potential…

Life Span Developmental Approach

Directory of Open Access Journals (Sweden)

Ali Eryilmaz

2011-03-01

Full Text Available The Life Span Developmental Approach examines development of individuals which occurs from birth to death. Life span developmental approach is a multi-disciplinary approach related with disciplines like psychology, psychiatry, sociology, anthropology and geriatrics that indicates the fact that development is not completed in adulthood, it continues during the life course. Development is a complex process that consists of dying and death. This approach carefully investigates the development of individuals with respect to developmental stages. This developmental approach suggests that scientific disciplines should not explain developmental facts only with age changes. Along with aging, cognitive, biological, and socioemotional development throughout life should also be considered to provide a reasonable and acceptable context, guideposts, and reasonable expectations for the person. There are three important subjects whom life span developmental approach deals with. These are nature vs nurture, continuity vs discontinuity, and change vs stability. Researchers using life span developmental approach gather and produce knowledge on these three most important domains of individual development with their unique scientific methodology.

White matter microstructure and developmental improvement of hyperactive/impulsive symptoms in Attention-Deficit/Hyperactivity Disorder

NARCIS (Netherlands)

Francx, W.C.L.; Zwiers, M.P.; Mennes, M.J.J.; Oosterlaan, J.; Heslenfeld, D.J.; Hoekstra, P.J.; Hartman, C.A.; Franke, B.; Faraone, S.V; O'Dwyer, L.G.; Buitelaar, J.K.

2015-01-01

Background A developmental improvement of symptoms in Attention-Deficit/Hyperactivity Disorder (ADHD) is frequently reported, but the underlying neurobiological substrate has not been identified. The aim of this study was to determine whether white matter microstructure is related to developmental

White matter microstructure and developmental improvement of hyperactive/impulsive symptoms in attention-deficit/hyperactivity disorder

NARCIS (Netherlands)

Francx, Winke; Zwiers, Marcel P.; Mennes, Maarten; Oosterlaan, Jaap; Heslenfeld, Dirk; Hoekstra, Pieter J.; Hartman, Catharina A.; Franke, Barbara; Faraone, Stephen V.; O'Dwyer, Laurence; Buitelaar, Jan K.

2015-01-01

Background: A developmental improvement of symptoms in attention-deficit/hyperactivity disorder (ADHD) is frequently reported, but the underlying neurobiological substrate has not been identified. The aim of this study was to determine whether white matter microstructure is related to developmental

Non-centered spike-triggered covariance analysis reveals neurotrophin-3 as a developmental regulator of receptive field properties of ON-OFF retinal ganglion cells.

Directory of Open Access Journals (Sweden)

Donald R Cantrell

2010-10-01

Full Text Available The functional separation of ON and OFF pathways, one of the fundamental features of the visual system, starts in the retina. During postnatal development, some retinal ganglion cells (RGCs whose dendrites arborize in both ON and OFF sublaminae of the inner plexiform layer transform into RGCs with dendrites that monostratify in either the ON or OFF sublamina, acquiring final dendritic morphology in a subtype-dependent manner. Little is known about how the receptive field (RF properties of ON, OFF, and ON-OFF RGCs mature during this time because of the lack of a reliable and efficient method to classify RGCs into these subtypes. To address this deficiency, we developed an innovative variant of Spike Triggered Covariance (STC analysis, which we term Spike Triggered Covariance - Non-Centered (STC-NC analysis. Using a multi-electrode array (MEA, we recorded the responses of a large population of mouse RGCs to a Gaussian white noise stimulus. As expected, the Spike-Triggered Average (STA fails to identify responses driven by symmetric static nonlinearities such as those that underlie ON-OFF center RGC behavior. The STC-NC technique, in contrast, provides an efficient means to identify ON-OFF responses and quantify their RF center sizes accurately. Using this new tool, we find that RGCs gradually develop sensitivity to focal stimulation after eye opening, that the percentage of ON-OFF center cells decreases with age, and that RF centers of ON and ON-OFF cells become smaller. Importantly, we demonstrate for the first time that neurotrophin-3 (NT-3 regulates the development of physiological properties of ON-OFF center RGCs. Overexpression of NT-3 leads to the precocious maturation of RGC responsiveness and accelerates the developmental decrease of RF center size in ON-OFF cells. In summary, our study introduces STC-NC analysis which successfully identifies subtype RGCs and demonstrates how RF development relates to a neurotrophic driver in the retina.

Developmental regulation of aromatase activity in the rat hypothalamus

International Nuclear Information System (INIS)

Lephart, E.D.

1989-01-01

The brain of all mammalian species studied thus far contain an enzymatic activity (aromatase) that catalyzes the conversion of androgens to estrogens. The activity is highest during prenatal development and contributes to the establishment of sex differences which determine adult gonadotropin secretion patterns and reproductive behavior. The studies presented in this dissertation represent a systematic effort to elucidate the mechanism(s) that control the initiation of and contribute to maintaining rat hypothalamic aromatase activity during pre- and postnatal development. Aromatase enzyme activity was measured by the 3 H 2 O release assay or by traditional estrogen product isolation. Brain aromatase mRNA was detected by hybridization to a cDNA encoding rat aromatase cytochrome P-450. In both males and females the time of puberty was associated with a decline in hypothalamic aromatase activity. This decline may represent a factor underlying the peri-pubertal decrease in the sensitivity to gonadal steroid feedback that accompanies completion of puberty. The results also indicate that androgens regulate brain aromatase levels during both the prepubertal and peri-pubertal stages of sexual development and that this regulation is transiently lost in young adults. Utilizing a hypothalamic organotypic culture system, aromatase activity in vitro was maintained for as long as two days. The results of studies of a variety of hormonal and metabolic regulators suggest that prenatal aromatase activity is regulated by factor(s) that function independently from the classical cyclic AMP and protein kinase C trans-membrane signaling pathways

Identification of developmentally toxic drinking water disinfection byproducts and evaluation of data relevant to mode of action

International Nuclear Information System (INIS)

Colman, Joan; Rice, Glenn E.; Wright, J. Michael; Hunter, E. Sidney; Teuschler, Linda K.; Lipscomb, John C.; Hertzberg, Richard C.; Simmons, Jane Ellen; Fransen, Margaret; Osier, Mark; Narotsky, Michael G.

2011-01-01

Reactions between chemicals used to disinfect drinking water and compounds present in source waters produce chemical mixtures containing hundreds of disinfection byproducts (DBPs). Although the results have been somewhat inconsistent, some epidemiological studies suggest associations may exist between DBP exposures and adverse developmental outcomes. The potencies of individual DBPs in rodent and rabbit developmental bioassays suggest that no individual DBP can account for the relative risk estimates reported in the positive epidemiologic studies, leading to the hypothesis that these outcomes could result from the toxicity of DBP mixtures. As a first step in a mixtures risk assessment for DBP developmental effects, this paper identifies developmentally toxic DBPs and examines data relevant to the mode of action (MOA) for DBP developmental toxicity. We identified 24 developmentally toxic DBPs and four adverse developmental outcomes associated with human DBP exposures: spontaneous abortion, cardiovascular defects, neural tube defects, and low birth weight infancy. A plausible MOA, involving hormonal disruption of pregnancy, is delineated for spontaneous abortion, which some epidemiologic studies associate with total trihalomethane and bromodichloromethane exposures. The DBP data for the other three outcomes were inadequate to define key MOA steps.

Perspectives on Conceptualizing Developmentally Appropriate Sexuality Education

Science.gov (United States)

Silvério Marques, Sara; Goldfarb, Eva S.; Deardorff, Julianna; Constantine, Norman A.

2017-01-01

Despite recognition of the importance of a developmentally appropriate approach to sexuality education, there is little direct guidance on how to do this. This study employed in-depth interviews with experienced sexuality educators and developers of sexuality education materials to identify how this concept is understood and applied in the field.…

Expression of the Ly-6 family proteins Lynx1 and Ly6H in the rat brain is compartmentalized, cell-type specific, and developmentally regulated

DEFF Research Database (Denmark)

Thomsen, Morten Skøtt; Cinar, Betül; Jensen, Majbrit Myrup

2014-01-01

regarding the distribution and developmental regulation of these proteins in the brain. We use protein cross-linking and synaptosomal fractions to demonstrate that the Ly-6 proteins Lynx1 and Ly6H are membrane-bound proteins in the brain, which are present on the cell surface and localize to synaptic...... demonstrate that Lynx1 and Ly6H are expressed in cultured neurons, but not cultured micro- or astroglial cultures. In addition, Lynx1, but not Ly6H was detected in the CSF. Finally, we show that the Ly-6 proteins Lynx1, Lynx2, Ly6H, and PSCA, display distinct expression patterns during postnatal development...

Developmental and genetic determinants of leadership role occupancy among women.

Science.gov (United States)

Arvey, Richard D; Zhang, Zhen; Avolio, Bruce J; Krueger, Robert F

2007-05-01

The genetic and developmental influences on leadership role occupancy were investigated using a sample of 178 fraternal and 214 identical female twins. Two general developmental factors were identified, one involving formal work experiences and the other a family experiences factor hypothesized to influence whether women move into positions of leadership in organizations. Results indicated that 32% of the variance in leadership role occupancy was associated with heritability. The 2 developmental factors also showed significant correlations with leadership role occupancy. However, after genetic factors were partialed out, only the work experience factor was significantly related to leadership role occupancy. Results are discussed in terms of prior life events and experiences that may trigger leadership development and the limitations of this study. 2007 APA, all rights reserved

Glue protein production can be triggered by steroid hormone signaling independent of the developmental program in Drosophila melanogaster.

Science.gov (United States)

Kaieda, Yuya; Masuda, Ryota; Nishida, Ritsuo; Shimell, MaryJane; O'Connor, Michael B; Ono, Hajime

2017-10-01

Steroid hormones regulate life stage transitions, allowing animals to appropriately follow a developmental timeline. During insect development, the steroid hormone ecdysone is synthesized and released in a regulated manner by the prothoracic gland (PG) and then hydroxylated to the active molting hormone, 20-hydroxyecdysone (20E), in peripheral tissues. We manipulated ecdysteroid titers, through temporally controlled over-expression of the ecdysteroid-inactivating enzyme, CYP18A1, in the PG using the GeneSwitch-GAL4 system in the fruit fly Drosophila melanogaster. We monitored expression of a 20E-inducible glue protein gene, Salivary gland secretion 3 (Sgs3), using a Sgs3:GFP fusion transgene. In wild type larvae, Sgs3-GFP expression is activated at the midpoint of the third larval instar stage in response to the rising endogenous level of 20E. By first knocking down endogenous 20E levels during larval development and then feeding 20E to these larvae at various stages, we found that Sgs3-GFP expression could be triggered at an inappropriate developmental stage after a certain time lag. This stage-precocious activation of Sgs3 required expression of the Broad-complex, similar to normal Sgs3 developmental regulation, and a small level of nutritional input. We suggest that these studies provide evidence for a tissue-autonomic regulatory system for a metamorphic event independent from the primary 20E driven developmental progression. Copyright © 2017 Elsevier Inc. All rights reserved.

CEREBELLUM: LINKS BETWEEN DEVELOPMENT, DEVELOPMENTAL DISORDERS AND MOTOR LEARNING

Directory of Open Access Journals (Sweden)

Mario U Manto

2012-01-01

Full Text Available The study of the links and interactions between development and motor learning has noticeable implications for the understanding and management of neurodevelopmental disorders. This is particularly relevant for the cerebellum which is critical for sensorimotor learning. The olivocerebellar pathway is a key pathway contributing to learning of motor skills. Its developmental maturation and remodelling are being unravelled. Advances in genetics have led to major improvements in our appraisal of the genes involved in cerebellar development, especially studies in mutant mice. Cerebellar neurogenesis is compartmentalized in relationship with neurotransmitter fate. The Engrailed-2 gene is a major actor of the specification of cerebellar cell types and late embryogenic morphogenesis. Math1, expressed by the rhombic lip (RL, is required for the genesis of glutamatergic neurons. Mutants deficient for the transcription factor Ptf1a display a lack of Purkinje cells and gabaergic interneurons. Rora gene contributes to the developmental signalling between granule cells and Purkinje neurons. The expression profile of SHH (Sonic hedgehog in postnatal stages determines the final size/shape of the cerebellum. Genes affecting the development impact upon the physiological properties of the cerebellar circuits. For instance, receptors are developmentally regulated and their action interferes directly with developmental processes. Another field of research which is expanding relates to very preterm neonates. They are at risk for cerebellar lesions, which may themselves impair the developmental events. Very preterm neonates often show sensori-motor deficits, highlighting another major link between impaired development and learning deficiencies. Pathways playing a critical role in cerebellar development are likely to become therapeutical targets for several neurodevelopmental disorders.

High-Throughput Screening to Identify Regulators of Meiosis-Specific Gene Expression in Saccharomyces cerevisiae.

Science.gov (United States)

Kassir, Yona

2017-01-01

Meiosis and gamete formation are processes that are essential for sexual reproduction in all eukaryotic organisms. Multiple intracellular and extracellular signals feed into pathways that converge on transcription factors that induce the expression of meiosis-specific genes. Once triggered the meiosis-specific gene expression program proceeds in a cascade that drives progress through the events of meiosis and gamete formation. Meiosis-specific gene expression is tightly controlled by a balance of positive and negative regulatory factors that respond to a plethora of signaling pathways. The budding yeast Saccharomyces cerevisiae has proven to be an outstanding model for the dissection of gametogenesis owing to the sophisticated genetic manipulations that can be performed with the cells. It is possible to use a variety selection and screening methods to identify genes and their functions. High-throughput screening technology has been developed to allow an array of all viable yeast gene deletion mutants to be screened for phenotypes and for regulators of gene expression. This chapter describes a protocol that has been used to screen a library of homozygous diploid yeast deletion strains to identify regulators of the meiosis-specific IME1 gene.

Distinct Molecular Signature of Murine Fetal Liver and Adult Hematopoietic Stem Cells Identify Novel Regulators of Hematopoietic Stem Cell Function.

Science.gov (United States)

Manesia, Javed K; Franch, Monica; Tabas-Madrid, Daniel; Nogales-Cadenas, Ruben; Vanwelden, Thomas; Van Den Bosch, Elisa; Xu, Zhuofei; Pascual-Montano, Alberto; Khurana, Satish; Verfaillie, Catherine M

2017-04-15

During ontogeny, fetal liver (FL) acts as a major site for hematopoietic stem cell (HSC) maturation and expansion, whereas HSCs in the adult bone marrow (ABM) are largely quiescent. HSCs in the FL possess faster repopulation capacity as compared with ABM HSCs. However, the molecular mechanism regulating the greater self-renewal potential of FL HSCs has not yet extensively been assessed. Recently, we published RNA sequencing-based gene expression analysis on FL HSCs from 14.5-day mouse embryo (E14.5) in comparison to the ABM HSCs. We reanalyzed these data to identify key transcriptional regulators that play important roles in the expansion of HSCs during development. The comparison of FL E14.5 with ABM HSCs identified more than 1,400 differentially expressed genes. More than 200 genes were shortlisted based on the gene ontology (GO) annotation term "transcription." By morpholino-based knockdown studies in zebrafish, we assessed the function of 18 of these regulators, previously not associated with HSC proliferation. Our studies identified a previously unknown role for tdg, uhrf1, uchl5, and ncoa1 in the emergence of definitive hematopoiesis in zebrafish. In conclusion, we demonstrate that identification of genes involved in transcriptional regulation differentially expressed between expanding FL HSCs and quiescent ABM HSCs, uncovers novel regulators of HSC function.

Developmental transcriptome of Aplysia californica'

KAUST Repository

Heyland, Andreas

2010-12-06

Genome-wide transcriptional changes in development provide important insight into mechanisms underlying growth, differentiation, and patterning. However, such large-scale developmental studies have been limited to a few representatives of Ecdysozoans and Chordates. Here, we characterize transcriptomes of embryonic, larval, and metamorphic development in the marine mollusc Aplysia californica and reveal novel molecular components associated with life history transitions. Specifically, we identify more than 20 signal peptides, putative hormones, and transcription factors in association with early development and metamorphic stages-many of which seem to be evolutionarily conserved elements of signal transduction pathways. We also characterize genes related to biomineralization-a critical process of molluscan development. In summary, our experiment provides the first large-scale survey of gene expression in mollusc development, and complements previous studies on the regulatory mechanisms underlying body plan patterning and the formation of larval and juvenile structures. This study serves as a resource for further functional annotation of transcripts and genes in Aplysia, specifically and molluscs in general. A comparison of the Aplysia developmental transcriptome with similar studies in the zebra fish Danio rerio, the fruit fly Drosophila melanogaster, the nematode Caenorhabditis elegans, and other studies on molluscs suggests an overall highly divergent pattern of gene regulatory mechanisms that are likely a consequence of the different developmental modes of these organisms. © 2010 Wiley-Liss, Inc., A Wiley Company.

Receptor tyrosine kinase mutations in developmental syndromes and cancer: two sides of the same coin

Science.gov (United States)

McDonell, Laura M.; Kernohan, Kristin D.; Boycott, Kym M.; Sawyer, Sarah L.

2015-01-01

Receptor tyrosine kinases (RTKs) are a family of ligand-binding cell surface receptors that regulate a wide range of essential cellular activities, including proliferation, differentiation, cell-cycle progression, survival and apoptosis. As such, these proteins play an important role during development and throughout life; germline mutations in genes encoding RTKs cause several developmental syndromes, while somatic alterations contribute to the pathogenesis of many aggressive cancers. This creates an interesting paradigm in which mutation timing, type and location in a gene leads to different cell signaling and biological responses, and ultimately phenotypic outcomes. In this review, we highlight the roles of RTKs in developmental disorders and cancer. The multifaceted roles of these receptors, their genetic signatures and their signaling during developmental morphogenesis and oncogenesis are discussed. Additionally, we propose that comparative analysis of RTK mutations responsible for developmental syndromes may shed light on those driving tumorigenesis. PMID:26152202

Turmeric (Curcuma longa): miRNAs and their regulating targets are involved in development and secondary metabolite pathways.

Science.gov (United States)

Singh, Noopur; Sharma, Ashok

Turmeric has been used as a therapeutic herb over centuries in traditional medicinal systems due to the presence of several secondary metabolite compounds. microRNAs are known to regulate gene expression at the post-transcriptional level by transcriptional cleavage or translation repression. miRNAs have been demonstrated to play an active role in secondary metabolism regulation. The present work was focused on the identification of the miRNAs involved in the regulation of secondary metabolite and development process of turmeric. Eighteen miRNA families were identified for turmeric. Sixteen miRNA families were observed to regulate 238 target transcripts. LncRNAs targets of the putative miRNA candidates were also predicted. Our results indicated their role in binding, reproduction, stress, and other developmental processes. Gene annotation and pathway analysis illustrated the biological function of the targets regulated by the putative miRNAs. The miRNA-mediated gene regulatory network also revealed co-regulated targets that were regulated by two or more miRNA families. miR156 and miR5015 were observed to be involved in rhizome development. miR5021 showed regulation for terpenoid backbone biosynthesis and isoquinoline alkaloid biosynthesis pathways. The flavonoid biosynthesis pathway was observed to be regulated by miR2919. The analysis revealed the probable involvement of three miRNAs (miR1168.2, miR156b and miR1858) in curcumin biosynthesis. Other miRNAs were found to be involved in the growth and developmental process of turmeric. Phylogenetic analysis of selective miRNAs was also performed. Copyright © 2017 Académie des sciences. Published by Elsevier Masson SAS. All rights reserved.

Early Postnatal Manganese Exposure Causes Lasting Impairment of Selective and Focused Attention and Arousal Regulation in Adult Rats

Science.gov (United States)

Beaudin, Stephane A.; Strupp, Barbara J.; Strawderman, Myla; Smith, Donald R.

2016-01-01

Background: Studies in children and adolescents have associated early developmental manganese (Mn) exposure with inattention, impulsivity, hyperactivity, and oppositional behaviors, but causal inferences are precluded by the correlational nature of the data and generally limited control for potential confounders. Objectives: To determine whether early postnatal oral Mn exposure causes lasting attentional and impulse control deficits in adulthood, and whether continued lifelong Mn exposure exacerbates these effects, using a rat model of environmental Mn exposure. Methods: Neonates were exposed orally to 0, 25 or 50 mg Mn/kg/day during early postnatal life (PND 1–21) or throughout life from PND 1 until the end of the study. In adulthood, the animals were tested on a series of learning and attention tasks using the five-choice serial reaction time task. Results: Early postnatal Mn exposure caused lasting attentional dysfunction due to impairments in attentional preparedness, selective attention, and arousal regulation, whereas associative ability (learning) and impulse control were spared. The presence and severity of these deficits varied with the dose and duration of Mn exposure. Conclusions: This study is the first to show that developmental Mn exposure can cause lasting impairments in focused and selective attention and arousal regulation, and to identify the specific nature of the impairments. Given the importance of attention and arousal regulation in cognitive functioning, these findings substantiate concerns about the adverse effects of developmental Mn exposure in humans. Citation: Beaudin SA, Strupp BJ, Strawderman M, Smith DR. 2017. Early postnatal manganese exposure causes lasting impairment of selective and focused attention and arousal regulation in adult rats. Environ Health Perspect 125:230–237; http://dx.doi.org/10.1289/EHP258 PMID:27384154

Early Postnatal Manganese Exposure Causes Lasting Impairment of Selective and Focused Attention and Arousal Regulation in Adult Rats.

Science.gov (United States)

Beaudin, Stephane A; Strupp, Barbara J; Strawderman, Myla; Smith, Donald R

2017-02-01

Studies in children and adolescents have associated early developmental manganese (Mn) exposure with inattention, impulsivity, hyperactivity, and oppositional behaviors, but causal inferences are precluded by the correlational nature of the data and generally limited control for potential confounders. To determine whether early postnatal oral Mn exposure causes lasting attentional and impulse control deficits in adulthood, and whether continued lifelong Mn exposure exacerbates these effects, using a rat model of environmental Mn exposure. Neonates were exposed orally to 0, 25 or 50 mg Mn/kg/day during early postnatal life (PND 1-21) or throughout life from PND 1 until the end of the study. In adulthood, the animals were tested on a series of learning and attention tasks using the five-choice serial reaction time task. Early postnatal Mn exposure caused lasting attentional dysfunction due to impairments in attentional preparedness, selective attention, and arousal regulation, whereas associative ability (learning) and impulse control were spared. The presence and severity of these deficits varied with the dose and duration of Mn exposure. This study is the first to show that developmental Mn exposure can cause lasting impairments in focused and selective attention and arousal regulation, and to identify the specific nature of the impairments. Given the importance of attention and arousal regulation in cognitive functioning, these findings substantiate concerns about the adverse effects of developmental Mn exposure in humans. Citation: Beaudin SA, Strupp BJ, Strawderman M, Smith DR. 2017. Early postnatal manganese exposure causes lasting impairment of selective and focused attention and arousal regulation in adult rats. Environ Health Perspect 125:230-237; http://dx.doi.org/10.1289/EHP258.

Mindfulness and emotion regulation in clinically depressed youth

OpenAIRE

Chambers, Richard

2017-01-01

Adolescence is a developmental period marked by a number of significant changes in psychological and social functioning. The demands placed upon adolescents and young adults by these changes place them at increased risk of depression, at least in part by the emergence of developmentally new stressors that can overwhelm the adolescent’s capacity for emotion regulation (ER). The adverse consequences of such early onset depression are dire, and include increased risk of suicide, increased impair...

A Developmental Neuroscience Perspective on Affect-Biased Attention

Science.gov (United States)

Morales, Santiago; Fu, Xiaoxue; Pérez-Edgar, Koraly E.

2016-01-01

There is growing interest regarding the impact of affect-biased attention on psychopathology. However, most of the research to date lacks a developmental approach. In the present review, we examine the role affect-biased attention plays in shaping socioemotional trajectories within a developmental neuroscience framework. We propose that affect-biased attention, particularly if stable and entrenched, acts as a developmental tether that helps sustain early socioemotional and behavioral profiles over time, placing some individuals on maladaptive developmental trajectories. Although most of the evidence is found in the anxiety literature, we suggest that these relations may operate across multiple domains of interest, including positive affect, externalizing behaviors, drug use, and eating behaviors. We also review the general mechanisms and neural correlates of affect-biased attention, as well as the current evidence for the co-development of attention and affect. Based on the reviewed literature, we propose a model that may help us better understand the nuances of affect-biased attention across development. The model may serve as a strong foundation for ongoing attempts to identify neurocognitive mechanisms and intervene with individuals at risk. Finally, we discuss open issues for future research that may help bridge existing gaps in the literature. PMID:27606972

Tyrosine pathway regulation is host-mediated in the pea aphid symbiosis during late embryonic and early larval development.

Science.gov (United States)

Rabatel, Andréane; Febvay, Gérard; Gaget, Karen; Duport, Gabrielle; Baa-Puyoulet, Patrice; Sapountzis, Panagiotis; Bendridi, Nadia; Rey, Marjolaine; Rahbé, Yvan; Charles, Hubert; Calevro, Federica; Colella, Stefano

2013-04-10

Nutritional symbioses play a central role in insects' adaptation to specialized diets and in their evolutionary success. The obligatory symbiosis between the pea aphid, Acyrthosiphon pisum, and the bacterium, Buchnera aphidicola, is no exception as it enables this important agricultural pest insect to develop on a diet exclusively based on plant phloem sap. The symbiotic bacteria provide the host with essential amino acids lacking in its diet but necessary for the rapid embryonic growth seen in the parthenogenetic viviparous reproduction of aphids. The aphid furnishes, in exchange, non-essential amino acids and other important metabolites. Understanding the regulations acting on this integrated metabolic system during the development of this insect is essential in elucidating aphid biology. We used a microarray-based approach to analyse gene expression in the late embryonic and the early larval stages of the pea aphid, characterizing, for the first time, the transcriptional profiles in these developmental phases. Our analyses allowed us to identify key genes in the phenylalanine, tyrosine and dopamine pathways and we identified ACYPI004243, one of the four genes encoding for the aspartate transaminase (E.C. 2.6.1.1), as specifically regulated during development. Indeed, the tyrosine biosynthetic pathway is crucial for the symbiotic metabolism as it is shared between the two partners, all the precursors being produced by B. aphidicola. Our microarray data are supported by HPLC amino acid analyses demonstrating an accumulation of tyrosine at the same developmental stages, with an up-regulation of the tyrosine biosynthetic genes. Tyrosine is also essential for the synthesis of cuticular proteins and it is an important precursor for cuticle maturation: together with the up-regulation of tyrosine biosynthesis, we observed an up-regulation of cuticular genes expression. We were also able to identify some amino acid transporter genes which are essential for the switch

Developmental prosopagnosia and adaptative compensatory strategies: Case study

Directory of Open Access Journals (Sweden)

Anair Rodrigues

Full Text Available Abstract Prosopagnosia is a type of visual agnosia with inability to identify faces, usually secondary to brain lesion in associative cortex areas, but there is also a congenital form known as developmental prosopagnosia. Objectives: To describe a case of developmental prosopagnosia that illustrates the specificity of the pathways for perception of faces in the visual system. Also, we will describe possible mechanisms of recognition used by this patient. Methods: R.S., a 50 year-old woman, was referred for neuropsychological assessment due to difficulties in perception of familiar faces since childhood, unexplained by any loss of visual acuity. Results: The exam showed good performance for comprehension, reasoning, concept formation, constructional abilities, criticism, judgment, mental control, memory and visual perception for other kinds of stimuli. No difficulties were seen regarding identification of ethnicity, age and types of animals. The patient was able to match celebrities' faces in different positions, but could not identify the matching pictures for unknown people. Conclusions: These findings indicate the patient had developed strategies, throughout life, to recognize familiar faces (relatives, celebrities from memorized fragments, but still had difficulties in identifying non-familiar faces holistically.

DAF-16/FOXO and EGL-27/GATA promote developmental growth in response to persistent somatic DNA damage.

Science.gov (United States)

Mueller, Michael M; Castells-Roca, Laia; Babu, Vipin; Ermolaeva, Maria A; Müller, Roman-Ulrich; Frommolt, Peter; Williams, Ashley B; Greiss, Sebastian; Schneider, Jennifer I; Benzing, Thomas; Schermer, Bernhard; Schumacher, Björn

2014-12-01

Genome maintenance defects cause complex disease phenotypes characterized by developmental failure, cancer susceptibility and premature ageing. It remains poorly understood how DNA damage responses function during organismal development and maintain tissue functionality when DNA damage accumulates with ageing. Here we show that the FOXO transcription factor DAF-16 is activated in response to DNA damage during development, whereas the DNA damage responsiveness of DAF-16 declines with ageing. We find that in contrast to its established role in mediating starvation arrest, DAF-16 alleviates DNA-damage-induced developmental arrest and even in the absence of DNA repair promotes developmental growth and enhances somatic tissue functionality. We demonstrate that the GATA transcription factor EGL-27 co-regulates DAF-16 target genes in response to DNA damage and together with DAF-16 promotes developmental growth. We propose that EGL-27/GATA activity specifies DAF-16-mediated DNA damage responses to enable developmental progression and to prolong tissue functioning when DNA damage persists.

Regulation of signaling genes by TGFβ during entry into dauer diapause in C. elegans

Directory of Open Access Journals (Sweden)

Patterson Garth I

2004-09-01

Full Text Available Abstract Background When resources are scant, C. elegans larvae arrest as long-lived dauers under the control of insulin/IGF- and TGFβ-related signaling pathways. However, critical questions remain regarding the regulation of this developmental event. How do three dozen insulin-like proteins regulate one tyrosine kinase receptor to control complex events in dauer, metabolism and aging? How are signals from the TGFβ and insulin/IGF pathways integrated? What gene expression programs do these pathways regulate, and how do they control complex downstream events? Results We have identified genes that show different levels of expression in a comparison of wild-type L2 or L3 larvae (non-dauer to TGFβ mutants at similar developmental stages undergoing dauer formation. Many insulin/IGF pathway and other known dauer regulatory genes have changes in expression that suggest strong positive feedback by the TGFβ pathway. In addition, many insulin-like ligand and novel genes with similarity to the extracellular domain of insulin/IGF receptors have altered expression. We have identified a large group of regulated genes with putative binding sites for the FOXO transcription factor, DAF-16. Genes with DAF-16 sites upstream of the transcription start site tend to be upregulated, whereas genes with DAF-16 sites downstream of the coding region tend to be downregulated. Finally, we also see strong regulation of many novel hedgehog- and patched-related genes, hormone biosynthetic genes, cell cycle genes, and other regulatory genes. Conclusions The feedback regulation of insulin/IGF pathway and other dauer genes that we observe would be predicted to amplify signals from the TGFβ pathway; this amplification may serve to ensure a decisive choice between "dauer" and "non-dauer", even if environmental cues are ambiguous. Up and down regulation of insulin-like ligands and novel genes with similarity to the extracellular domain of insulin/IGF receptors suggests opposing

Reproduction Symposium: developmental programming of reproductive and metabolic health.

Science.gov (United States)

Padmanabhan, V; Veiga-Lopez, A

2014-08-01

Inappropriate programming of the reproductive system by developmental exposure to excess steroid hormones is of concern. Sheep are well suited for investigating developmental origin of reproductive and metabolic disorders. The developmental time line of female sheep (approximately 5 mo gestation and approximately 7 mo to puberty) is ideal for conducting sequential studies of the progression of metabolic and/or reproductive disruption from the developmental insult to manifestation of adult consequences. Major benefits of using sheep include knowledge of established critical periods to target adult defects, a rich understanding of reproductive neuroendocrine regulation, availability of noninvasive approaches to monitor follicular dynamics, established surgical approaches to obtain hypophyseal portal blood for measurement of hypothalamic hormones, and the ability to perform studies in natural setting thereby keeping behavioral interactions intact. Of importance is the ability to chronically instrument fetus and mother for determining early endocrine perturbations. Prenatal exposure of the female to excess testosterone (T) leads to an array of adult reproductive disorders that include LH excess, functional hyperandrogenism, neuroendocrine defects, multifollicular ovarian morphology, and corpus luteum dysfunction culminating in early reproductive failure. At the neuroendocrine level, all 3 feedback systems are compromised. At the pituitary level, gonadotrope (LH secretion) sensitivity to GnRH is increased. Multifollicular ovarian morphology stems from persistence of follicles as well as enhanced follicular recruitment. These defects culminate in progressive loss of cyclicity and reduced fecundity. Prenatal T excess also leads to fetal growth retardation, an early marker of adult reproductive and metabolic diseases, insulin resistance, hypertension, and behavioral deficits. Collectively, the reproductive and metabolic deficits of prenatal T-treated sheep provide proof of

Developmental programming of reproductive and metabolic health1,2

Science.gov (United States)

Padmanabhan, V.; Veiga-Lopez, A.

2014-01-01

The inappropriate programming of the reproductive system by developmental exposure to excess steroid hormones is of concern. Sheep are well suited for investigating developmental origin of reproductive and metabolic disorders. The developmental time line of female sheep (~5 mo gestation and ~7 mo to puberty) is ideal for conducting sequential studies of the progression of metabolic and (or) reproductive disruption from the developmental insult to manifestation of adult consequences. Major benefits of using sheep include knowledge of established critical periods to target adult defects, a rich understanding of reproductive neuroendocrine regulation, availability of non-invasive approaches to monitor follicular dynamics, established surgical approaches to obtain hypophyseal portal blood for measurement of hypothalamic hormones, and the ability to perform studies in natural setting keeping behavioral interactions intact. Of importance is the ability to chronically instrument fetus and mother for determining early endocrine perturbations. Prenatal exposure of the female to excess testosterone (T) leads to an array of adult reproductive disorders that include LH excess, functional hyperandrogenism, neuroendocrine defects, multifollicular ovarian morphology, and corpus luteum dysfunction culminating in early reproductive failure. At the neuroendocrine level all three feedback systems are compromised. At the pituitary level, gonadotrope (LH secretion) sensitivity to GnRH is increased. Multifollicular ovarian morphology stems from persistence of follicles, as well as enhanced follicular recruitment. These defects culminate in progressive loss of cyclicity and reduced fecundity. Prenatal T excess also leads to fetal growth retardation, an early marker of adult reproductive/metabolic diseases, insulin resistance, hypertension and behavioral deficits. Collectively, the reproductive and metabolic deficits of prenatal T-treated sheep provide proof of concept for the

Integrated expression analysis of muscle hypertrophy identifies Asb2 as a negative regulator of muscle mass

Science.gov (United States)

Davey, Jonathan R.; Watt, Kevin I.; Parker, Benjamin L.; Chaudhuri, Rima; Ryall, James G.; Cunningham, Louise; Qian, Hongwei; Sartorelli, Vittorio; Chamberlain, Jeffrey; James, David E.

2016-01-01

The transforming growth factor-β (TGF-β) signaling network is a critical regulator of skeletal muscle mass and function and, thus, is an attractive therapeutic target for combating muscle disease, but the underlying mechanisms of action remain undetermined. We report that follistatin-based interventions (which modulate TGF-β network activity) can promote muscle hypertrophy that ameliorates aging-associated muscle wasting. However, the muscles of old sarcopenic mice demonstrate reduced response to follistatin compared with healthy young-adult musculature. Quantitative proteomic and transcriptomic analyses of young-adult muscles identified a transcription/translation signature elicited by follistatin exposure, which included repression of ankyrin repeat and SOCS box protein 2 (Asb2). Increasing expression of ASB2 reduced muscle mass, thereby demonstrating that Asb2 is a TGF-β network–responsive negative regulator of muscle mass. In contrast to young-adult muscles, sarcopenic muscles do not exhibit reduced ASB2 abundance with follistatin exposure. Moreover, preventing repression of ASB2 in young-adult muscles diminished follistatin-induced muscle hypertrophy. These findings provide insight into the program of transcription and translation events governing follistatin-mediated adaptation of skeletal muscle attributes and identify Asb2 as a regulator of muscle mass implicated in the potential mechanistic dysfunction between follistatin-mediated muscle growth in young and old muscles. PMID:27182554

Between and within Ethnic Differences in Strategic Learning: A Study of Developmental Mathematics Students

Science.gov (United States)

Fong, Carlton J.; Zientek, Linda Reichwein; Yetkiner Ozel, Zeynep Ebrar; Phelps, Julie M.

2015-01-01

The present study investigated developmental mathematics students' efficacy beliefs for motivational, self-regulated learning, resource management, and cognitive strategies and which of these beliefs most differentiated European American, African American and Hispanic students in terms of their mathematics achievement. The diverse sample consisted…

Building a developmental toxicity ontology.

Science.gov (United States)

Baker, Nancy; Boobis, Alan; Burgoon, Lyle; Carney, Edward; Currie, Richard; Fritsche, Ellen; Knudsen, Thomas; Laffont, Madeleine; Piersma, Aldert H; Poole, Alan; Schneider, Steffen; Daston, George

2018-04-03

As more information is generated about modes of action for developmental toxicity and more data are generated using high-throughput and high-content technologies, it is becoming necessary to organize that information. This report discussed the need for a systematic representation of knowledge about developmental toxicity (i.e., an ontology) and proposes a method to build one based on knowledge of developmental biology and mode of action/ adverse outcome pathways in developmental toxicity. This report is the result of a consensus working group developing a plan to create an ontology for developmental toxicity that spans multiple levels of biological organization. This report provide a description of some of the challenges in building a developmental toxicity ontology and outlines a proposed methodology to meet those challenges. As the ontology is built on currently available web-based resources, a review of these resources is provided. Case studies on one of the most well-understood morphogens and developmental toxicants, retinoic acid, are presented as examples of how such an ontology might be developed. This report outlines an approach to construct a developmental toxicity ontology. Such an ontology will facilitate computer-based prediction of substances likely to induce human developmental toxicity. © 2018 Wiley Periodicals, Inc.

Role of epigenetics in developmental biology and transgenerational inheritance.

Science.gov (United States)

Skinner, Michael K

2011-03-01

The molecular mechanisms involved in developmental biology and cellular differentiation have traditionally been considered to be primarily genetic. Environmental factors that influence early life critical windows of development generally do not have the capacity to modify genome sequence, nor promote permanent genetic modifications. Epigenetics provides a molecular mechanism for environment to influence development, program cellular differentiation, and alter the genetic regulation of development. The current review discusses how epigenetics can cooperate with genetics to regulate development and allow for greater plasticity in response to environmental influences. This impacts area such as cellular differentiation, tissue development, environmental induced disease etiology, epigenetic transgenerational inheritance, and the general systems biology of organisms and evolution. Copyright © 2011 Wiley-Liss, Inc.

Regulation of somatic embryo development in Norway spruce (Picea abies). A molecular approach to the characterization of specific developmental stages

Energy Technology Data Exchange (ETDEWEB)

Sabala, I. [Swedish Univ. of Agricultural Sciences, Uppsala (Sweden). Dept. of Forest Genetics

1998-12-31

Embryo development is a complex process involving a set of strictly regulated events. The regulation of these events is poorly understood especially during the early stages of embryo development. Somatic embryos go through the same developmental stages as zygotic embryos making them an ideal model system for studying the regulation of embryo development. We have used embryogenic cultures of Picea abies to study some aspects of the regulation of embryo development in gymnosperms. The bottle neck during somatic embryogenesis is the switch from the proliferation stage to the maturation stage. This switch is initiated by giving somatic embryos a maturation treatment i.e. the embryos are treated with abscisic acid (ABA). Somatic embryos which respond to ABA by forming mature somatic embryos were stimulated to secret a 70 kDa protein, AF70. The af70 gene was isolated and characterised. The expression of the af70 gene was constitutive in embryos but was highly ABA-induced in seedlings. Moreover, expression of this gene was stimulated during cold acclimation of Picea abies seedlings. A full length Picea abies cDNA clone Pa18, encoding a protein with the characteristics of plant lipid transfer proteins (LTPs), was isolated and characterised. The Pa18 gene is constitutively expressed in embryogenic cultures of Picea abies representing different stages of development as well as in nonembryogenic callus and seedlings. In situ hybridization showed that Pa18 gene is expressed in all embryonic cells of proliferating somatic embryos but the expression of the gene in mature somatic and zygotic embryos is restricted to the outer cell layer. Southern blot analysis at different stringencies was consistent with a single gene. An alteration in expression of Pa18 causes disturbance in the formation of the proper outer cell layer in the maturing somatic embryos. In addition to its influence on embryo development the Pa18 gene product also inhibits growth of Agrobacterium tumefaciens 195

Kinase Screening in Pichia pastoris Identified Promising Targets Involved in Cell Growth and Alcohol Oxidase 1 Promoter (PAOX1 Regulation.

Directory of Open Access Journals (Sweden)

Wei Shen

Full Text Available As one of the most commonly used eukaryotic recombinant protein expression systems, P. pastoris relies heavily on the AOX1 promoter (PAOX1, which is strongly induced by methanol but strictly repressed by glycerol and glucose. However, the complicated signaling pathways involved in PAOX1 regulation when supplemented with different carbon sources are poorly understood. Here we constructed a kinase deletion library in P. pastoris and identified 27 mutants which showed peculiar phenotypes in cell growth or PAOX1 regulation. We analyzed both annotations and possible functions of these 27 targets, and then focused on the MAP kinase Hog1. In order to locate its potential downstream components, we performed the phosphoproteome analysis on glycerol cultured WT and Δhog1 strains and identified 157 differentially phosphorylated proteins. Our results identified important kinases involved in P. pastoris cell growth and PAOX1 regulation, which could serve as valuable targets for further mechanistic studies.

Co-expression analysis identifies CRC and AP1 the regulator of Arabidopsis fatty acid biosynthesis.

Science.gov (United States)

Han, Xinxin; Yin, Linlin; Xue, Hongwei

2012-07-01

Fatty acids (FAs) play crucial rules in signal transduction and plant development, however, the regulation of FA metabolism is still poorly understood. To study the relevant regulatory network, fifty-eight FA biosynthesis genes including de novo synthases, desaturases and elongases were selected as "guide genes" to construct the co-expression network. Calculation of the correlation between all Arabidopsis thaliana (L.) genes with each guide gene by Arabidopsis co-expression dating mining tools (ACT) identifies 797 candidate FA-correlated genes. Gene ontology (GO) analysis of these co-expressed genes showed they are tightly correlated to photosynthesis and carbohydrate metabolism, and function in many processes. Interestingly, 63 transcription factors (TFs) were identified as candidate FA biosynthesis regulators and 8 TF families are enriched. Two TF genes, CRC and AP1, both correlating with 8 FA guide genes, were further characterized. Analyses of the ap1 and crc mutant showed the altered total FA composition of mature seeds. The contents of palmitoleic acid, stearic acid, arachidic acid and eicosadienoic acid are decreased, whereas that of oleic acid is increased in ap1 and crc seeds, which is consistent with the qRT-PCR analysis revealing the suppressed expression of the corresponding guide genes. In addition, yeast one-hybrid analysis and electrophoretic mobility shift assay (EMSA) revealed that CRC can bind to the promoter regions of KCS7 and KCS15, indicating that CRC may directly regulate FA biosynthesis. © 2012 Institute of Botany, Chinese Academy of Sciences.

Effect of milrinone on the developmental competence of growing lamb oocytes identified with brilliant cresyl blue.

Science.gov (United States)

Wang, Liqin; Jiang, Xiangjiu; Wu, Yangsheng; Lin, Jiapeng; Zhang, Li; Yang, Nan; Huang, Juncheng

2016-11-01

Juvenile in vitro embryo transfer is a novel technique that can be used to increase the rate of genetic gain in a population and presents an alternative to embryo technologies on the basis of adult animals. However, oocytes from prepubertal animals have a lower viability than those obtained from adult ewe oocyte donors. In this research, we aimed to determine the optimum concentration and time of treatment of oocytes from prepubertal lambs with brilliant cresyl blue (BCB) stain and milrinone during IVM. This would improve the developmental rate of lamb oocytes and embryos after IVF. First, lamb cumulus-oocyte complexes were cultured under different concentrations (13 or 26 μM) of BCB staining. Treated lamb oocytes were then divided into BCB- (colorless cytoplasm) and BCB+ (colored cytoplasm) groups on the basis of their glucose-6-phosphate dehydrogenase activity. The blastocyst efficiency rate of BCB+ oocytes treated with 13 μM BCB (37.03%) was significantly higher than that of BCB+ oocytes treated with 26 μM BCB (23.25%) and that of nontreated BCB control oocytes (15.37%), as well as that of BCB- oocytes (6.28%). Both control oocytes and BCB+ oocytes exhibited significantly higher cleavage rates (60.15% and 73.44%, respectively) than that of BCB- oocytes (36.19%). Moreover, the diameter and glutathione content of BCB+ oocytes were found to be significantly greater than those of BCB- oocytes (163.37 vs. 159.25 μm and 6.39 vs. 0.26 pM, respectively). After culturing BCB- oocytes in different concentrations of milrinone (0, 50, 75, and 100 μM) for 3, 6, or 9 hours, results reported that supplementation of IVM medium with 75 μM milrinone for 6 hours yielded a significantly higher proportion of blastocysts than the other treatments. These results show that the staining of lamb cumulus-oocyte complexes with 13 μM BCB before IVM may be used to select developmentally competent lamb oocytes. Furthermore, they suggest that milrinone can be used to promote

Introduction: digital games as a context for cognitive development, learning, and developmental research.

Science.gov (United States)

Blumberg, Fran C; Fisch, Shalom M

2013-01-01

The authors present reasons why developmental psychologists should care about children's and adolescents' digital game play. These reasons may be identified as: a) digital game play is an integral aspect of children's and adolescents' lives; b) digital game play contributes to learning and cognitive development; and c) developmental research has the potential to contribute to effective educational game design. The authors expand on these reasons with the goal of introducing or reintroducing to developmental psychologists a rich and very relevant context in which to examine children's and adolescents' applied cognitive development. Copyright © 2013 Wiley Periodicals, Inc., A Wiley Company.

Proteomic analysis of polyribosomes identifies splicing factors as potential regulators of translation during mitosis.

Science.gov (United States)

Aviner, Ranen; Hofmann, Sarah; Elman, Tamar; Shenoy, Anjana; Geiger, Tamar; Elkon, Ran; Ehrlich, Marcelo; Elroy-Stein, Orna

2017-06-02

Precise regulation of mRNA translation is critical for proper cell division, but little is known about the factors that mediate it. To identify mRNA-binding proteins that regulate translation during mitosis, we analyzed the composition of polysomes from interphase and mitotic cells using unbiased quantitative mass-spectrometry (LC-MS/MS). We found that mitotic polysomes are enriched with a subset of proteins involved in RNA processing, including alternative splicing and RNA export. To demonstrate that these may indeed be regulators of translation, we focused on heterogeneous nuclear ribonucleoprotein C (hnRNP C) as a test case and confirmed that it is recruited to elongating ribosomes during mitosis. Then, using a combination of pulsed SILAC, metabolic labeling and ribosome profiling, we showed that knockdown of hnRNP C affects both global and transcript-specific translation rates and found that hnRNP C is specifically important for translation of mRNAs that encode ribosomal proteins and translation factors. Taken together, our results demonstrate how proteomic analysis of polysomes can provide insight into translation regulation under various cellular conditions of interest and suggest that hnRNP C facilitates production of translation machinery components during mitosis to provide daughter cells with the ability to efficiently synthesize proteins as they enter G1 phase. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Integrative genomic analysis identifies isoleucine and CodY as regulators of Listeria monocytogenes virulence.

Directory of Open Access Journals (Sweden)

Lior Lobel

2012-09-01

Full Text Available Intracellular bacterial pathogens are metabolically adapted to grow within mammalian cells. While these adaptations are fundamental to the ability to cause disease, we know little about the relationship between the pathogen's metabolism and virulence. Here we used an integrative Metabolic Analysis Tool that combines transcriptome data with genome-scale metabolic models to define the metabolic requirements of Listeria monocytogenes during infection. Twelve metabolic pathways were identified as differentially active during L. monocytogenes growth in macrophage cells. Intracellular replication requires de novo synthesis of histidine, arginine, purine, and branch chain amino acids (BCAAs, as well as catabolism of L-rhamnose and glycerol. The importance of each metabolic pathway during infection was confirmed by generation of gene knockout mutants in the respective pathways. Next, we investigated the association of these metabolic requirements in the regulation of L. monocytogenes virulence. Here we show that limiting BCAA concentrations, primarily isoleucine, results in robust induction of the master virulence activator gene, prfA, and the PrfA-regulated genes. This response was specific and required the nutrient responsive regulator CodY, which is known to bind isoleucine. Further analysis demonstrated that CodY is involved in prfA regulation, playing a role in prfA activation under limiting conditions of BCAAs. This study evidences an additional regulatory mechanism underlying L. monocytogenes virulence, placing CodY at the crossroads of metabolism and virulence.

Prevalence and effect of developmental coordination disorder on ...

African Journals Online (AJOL)

Physically awkward children face a host of difficulties, which include difficulties in the school environment. Therefore, it is important to identify Developmental Coordination Disorder (DCD) early in a child's life to allow for proper and timely intervention and support. The objective of this study was to determine the prevalence ...

Wash functions downstream of Rho1 GTPase in a subset of Drosophila immune cell developmental migrations

Science.gov (United States)

Verboon, Jeffrey M.; Rahe, Travis K.; Rodriguez-Mesa, Evelyn; Parkhurst, Susan M.

2015-01-01

Drosophila immune cells, the hemocytes, undergo four stereotypical developmental migrations to populate the embryo, where they provide immune reconnoitering, as well as a number of non–immune-related functions necessary for proper embryogenesis. Here, we describe a role for Rho1 in one of these developmental migrations in which posteriorly located hemocytes migrate toward the head. This migration requires the interaction of Rho1 with its downstream effector Wash, a Wiskott–Aldrich syndrome family protein. Both Wash knockdown and a Rho1 transgene harboring a mutation that prevents Wash binding exhibit the same developmental migratory defect as Rho1 knockdown. Wash activates the Arp2/3 complex, whose activity is needed for this migration, whereas members of the WASH regulatory complex (SWIP, Strumpellin, and CCDC53) are not. Our results suggest a WASH complex–independent signaling pathway to regulate the cytoskeleton during a subset of hemocyte developmental migrations. PMID:25739458

Developmental Trajectories for Children With Dyslexia and Low IQ Poor Readers

Science.gov (United States)

2016-01-01

Reading difficulties are found in children with both high and low IQ and it is now clear that both groups exhibit difficulties in phonological processing. Here, we apply the developmental trajectories approach, a new methodology developed for studying language and cognitive impairments in developmental disorders, to both poor reader groups. The trajectory methodology enables identification of atypical versus delayed development in datasets gathered using group matching designs. Regarding the cognitive predictors of reading, which here are phonological awareness, phonological short-term memory (PSTM) and rapid automatized naming (RAN), the method showed that trajectories for the two groups diverged markedly. Children with dyslexia showed atypical development in phonological awareness, while low IQ poor readers showed developmental delay. Low IQ poor readers showed atypical PSTM and RAN development, but children with dyslexia showed developmental delay. These divergent trajectories may have important ramifications for supporting each type of poor reader, although all poor readers showed weakness in all areas. Regarding auditory processing, the developmental trajectories were very similar for the two poor reader groups. However, children with dyslexia demonstrated developmental delay for auditory discrimination of Duration, while the low IQ children showed atypical development on this measure. The data show that, regardless of IQ, poor readers have developmental trajectories that differ from typically developing children. The trajectories approach enables differences in trajectory classification to be identified across poor reader group, as well as specifying the individual nature of these trajectories. PMID:27110928

Screening, intervention and outcome in autism and other developmental disorders: the role of randomized controlled trials.

Science.gov (United States)

Fernell, Elisabeth; Wilson, Philip; Hadjikhani, Nouchine; Bourgeron, Thomas; Neville, Brian; Taylor, David; Minnis, Helen; Gillberg, Christopher

2014-08-01

We draw attention to a number of important considerations in the arguments about screening and outcome of intervention in children with autism and other developmental disorders. Autism screening in itself never provides a final clinical diagnosis, but may well identify developmental deviations indicative of autism-or of other developmental disorders-that should lead to referral for further clinical assessment. Decisions regarding population or clinic screening cannot be allowed to be based on the fact that prospective longitudinal RCT designs over decades could never be performed in complex developmental disorders. We propose an alternative approach. Early screening for autism and other developmental disorders is likely to be of high societal importance and should be promoted and rigorously evaluated.

Performance-oriented packaging: A guide to identifying and designing. Identifying and designing hazardous materials packaging for compliance with post HM-181 DOT Regulations

International Nuclear Information System (INIS)

1994-08-01

With the initial publication of Docket HM-181 (hereafter referred to as HM-181), the U.S. Department of Energy (DOE), Headquarters, Transportation Management Division decided to produce guidance to help the DOE community transition to performance-oriented packagings (POP). As only a few individuals were familiar with the new requirements, elementary guidance was desirable. The decision was to prepare the guidance at a level easily understood by a novice to regulatory requirements. This document identifies design development strategies for use in obtaining performance-oriented packagings that are not readily available commercially. These design development strategies will be part of the methodologies for compliance with post HM-181 U.S. Department of Transportation (DOT) packaging regulations. This information was prepared for use by the DOE and its contractors. The document provides guidance for making decisions associated with designing performance-oriented packaging, and not for identifying specific material or fabrication design details. It does provide some specific design considerations. Having a copy of the regulations handy when reading this document is recommended to permit a fuller understanding of the requirements impacting the design effort. While this document is not written for the packaging specialist, it does contain guidance important to those not familiar with the new POP requirements

Parental influences on children's self-regulation of energy intake: Insights from developmental literature on emotion regulation

Science.gov (United States)

This article examines the role of parents in the development of children's self-regulation of energy intake. Various paths of parental influence are offered based on the literature on parental influences on children's emotion self-regulation. The parental paths include modeling, responses to childre...

Screening, intervention and outcome in autism and other developmental disorders: the role of randomized controlled trials

OpenAIRE

Fernell, Elisabeth; Wilson, Philip; Hadjikhani, Nouchine; Bourgeron, Thomas; Neville, Brian; Taylor, David; Minnis, Helen; Gillberg, Christopher

2014-01-01

We draw attention to a number of important considerations in the arguments about screening and outcome of intervention in children with autism and other developmental disorders. Autism screening in itself never provides a final clinical diagnosis, but may well identify developmental deviations indicative of autism—or of other developmental disorders—that should lead to referral for further clinical assessment. Decisions regarding population or clinic screening cannot be allowed to be based on...

In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.

Directory of Open Access Journals (Sweden)

Juan Du

Full Text Available Hedgehog (Hh signaling is highly conserved in all metazoan animals and plays critical roles in many developmental processes. Dysregulation of the Hh signaling cascade has been implicated in many diseases, including cancer. Although key components of the Hh pathway have been identified, significant gaps remain in our understanding of the regulation of individual Hh signaling molecules. Here, we report the identification of novel regulators of the Hh pathway, obtained from an in vivo RNA interference (RNAi screen in Drosophila. By selectively targeting critical genes functioning in post-translational modification systems utilizing ubiquitin (Ub and Ub-like proteins, we identify two novel genes (dUba3 and dUbc12 that negatively regulate Hh signaling activity. We provide in vivo and in vitro evidence illustrating that dUba3 and dUbc12 are essential components of the neddylation pathway; they function in an enzyme cascade to conjugate the ubiquitin-like NEDD8 modifier to Cullin proteins. Neddylation activates the Cullin-containing ubiquitin ligase complex, which in turn promotes the degradation of Cubitus interruptus (Ci, the downstream transcription factor of the Hh pathway. Our study reveals a conserved molecular mechanism of the neddylation pathway in Drosophila and sheds light on the complex post-translational regulations in Hh signaling.

Developmental Exposure to Valproate or Ethanol Alters Locomotor Activity and Retino-Tectal Projection Area in Zebrafish Embryos

Science.gov (United States)

Given the minimal developmental neurotoxicity data available for the large number of new and existing chemicals, there is a critical need for alternative methods to identify and prioritize chemicals for further testing. We outline a developmental neurotoxicity screening approach ...

Oral Health Characteristics and Dental Rehabilitation of Children with Global Developmental Delay

Directory of Open Access Journals (Sweden)

Saurabh Kumar

2017-01-01

Full Text Available Global developmental delay (GDD is a chronic neurological disturbance which includes defects in one or more developmental domains. The developmental domain can be motor, cognitive, daily activities, speech or language, and social or personal development. The etiology for GDD can be prenatal, perinatal, or postnatal. It can be diagnosed early in childhood as the delay or absence of one or more developmental milestones. Hence the role of pedodontist and pediatricians becomes more crucial in identifying this condition. The diagnosis of GDD requires a detailed history including family history and environmental risk factors followed by physical and neurological examinations. Investigations for GDD include diagnostic laboratory tests, brain imaging, and other evidence-based evaluations. GDD affects multiple developmental domains that not only have direct bearing on maintenance of oral health, but also require additional behavior management techniques to deliver optimal dental care. This paper describes two different spectra of children with GDD. Since the severity of GDD can vary, this paper also discusses the different behavior management techniques that were applied to provide dental treatment in such children.

Oral Health Characteristics and Dental Rehabilitation of Children with Global Developmental Delay.

Science.gov (United States)

Kumar, Saurabh; Pai, Deepika; Saran, Runki

2017-01-01

Global developmental delay (GDD) is a chronic neurological disturbance which includes defects in one or more developmental domains. The developmental domain can be motor, cognitive, daily activities, speech or language, and social or personal development. The etiology for GDD can be prenatal, perinatal, or postnatal. It can be diagnosed early in childhood as the delay or absence of one or more developmental milestones. Hence the role of pedodontist and pediatricians becomes more crucial in identifying this condition. The diagnosis of GDD requires a detailed history including family history and environmental risk factors followed by physical and neurological examinations. Investigations for GDD include diagnostic laboratory tests, brain imaging, and other evidence-based evaluations. GDD affects multiple developmental domains that not only have direct bearing on maintenance of oral health, but also require additional behavior management techniques to deliver optimal dental care. This paper describes two different spectra of children with GDD. Since the severity of GDD can vary, this paper also discusses the different behavior management techniques that were applied to provide dental treatment in such children.

Biomarkers to assess potential developmental immunotoxicity in children

International Nuclear Information System (INIS)

Luster, Michael I.; Johnson, Victor J.; Yucesoy, Berran; Simeonova, Petia P.

2005-01-01

Clinical tests are readily available for assessing severe loss of immune function in children with diseases such as AIDS or primary immunodeficiency. However tests that could reliably identify subtle immune changes, as might be expected to result from exposure to developmental immunotoxic agents, are not readily available. A number of tests are described which we believe have potential applicability for epidemiological studies involving developmental immunotoxicity. Several of the tests, such as T cell receptor rearrangement excision circles (TRECs) and cytokine measurements, while highly relevant from a biological standpoint, may be precluded from use at the current time, for either technical issues or insufficient validation. Immunophenotyping and measurement of serum immunoglobulin levels, on the other hand, are well validated. Yet they may require extraordinary care in experimental design and technical performance in order to obtain data that would consistently detect subtle changes, as these tests are not generally considered highly sensitive. Quantification of the immune response to childhood vaccine, while up to the present used sparingly, may represent an excellent indicator for developmental immunotoxicity when conducted under appropriate conditions

ODORANT1 Regulates Fragrance Biosynthesis in Petunia FlowersW⃞

Science.gov (United States)

Verdonk, Julian C.; Haring, Michel A.; van Tunen, Arjen J.; Schuurink, Robert C.

2005-01-01

Floral scent is important to plant reproduction because it attracts pollinators to the sexual organs. Therefore, volatile emission is usually tuned to the foraging activity of the pollinators. In Petunia hybrida, volatile benzenoids determine the floral aroma. Although the pathways for benzenoid biosynthesis have been characterized, the enzymes involved are less well understood. How production and emission are regulated is unknown. By targeted transcriptome analyses, we identified ODORANT1 (ODO1), a member of the R2R3-type MYB family, as a candidate for the regulation of volatile benzenoids in Petunia hybrida cv W115 (Mitchell) flowers. These flowers are only fragrant in the evening and at night. Transcript levels of ODO1 increased before the onset of volatile emission and decreased when volatile emission declined. Downregulation of ODO1 in transgenic P. hybrida Mitchell plants strongly reduced volatile benzenoid levels through decreased synthesis of precursors from the shikimate pathway. The transcript levels of several genes in this pathway were reduced by suppression of ODO1 expression. Moreover, ODO1 could activate the promoter of the 5-enol-pyruvylshikimate-3-phosphate synthase gene. Flower pigmentation, which is furnished from the same shikimate precursors, was not influenced because color and scent biosynthesis occur at different developmental stages. Our studies identify ODO1 as a key regulator of floral scent biosynthesis. PMID:15805488

Alternative splicing: a novel mechanism of regulation identified in the chorismate mutase gene of the potato cyst nematode Globodera rostochiensis.

Science.gov (United States)

Lu, Shun-Wen; Tian, Duanhua; Borchardt-Wier, Harmony B; Wang, Xiaohong

2008-11-01

Chorismate mutase (CM) secreted from the stylet of plant-parasitic nematodes plays an important role in plant parasitism. We isolated and characterized a new nematode CM gene (Gr-cm-1) from the potato cyst nematode, Globodera rostochiensis. The Gr-cm-1 gene was found to exist in the nematode genome as a single-copy gene that has two different alleles, Gr-cm-1A and Gr-cm-1B, both of which could give rise to two different mRNA transcripts of Gr-cm-1 and Gr-cm-1-IRII. In situ mRNA hybridization showed that the Gr-cm-1 gene was exclusively expressed within the subventral oesophageal gland cells of the nematode. Gr-cm-1 was demonstrated to encode a functional CM (GR-CM-1) potentially having a dimeric structure as the secreted bacterial *AroQ CMs. Gr-cm-1-IRII, generated by retention of intron 2 of the Gr-cm-1 pre-mRNA through alternative splicing (AS), would encode a truncated protein (GR-CM-1t) lacking the CM domain with no CM activity. The quantitative real-time reverse transcription-PCR assay revealed that splicing of the Gr-cm-1 gene was developmentally regulated; Gr-cm-1 was up-regulated whereas Gr-cm-1-IRII was down-regulated in early nematode parasitic stages compared to the preparasitic juvenile stage. Low-temperature SDS-PAGE analysis revealed that GR-CM-1 could form homodimers when expressed in Escherichia coli and the dimerization domain was retained in the truncated GR-CM-1t protein. The specific interaction between the two proteins was demonstrated in yeast. Our data suggested that the novel splice variant might function as a dominant negative isoform through heterodimerization with the full-length GR-CM-1 protein and that AS may represent an important mechanism for regulating CM activity during nematode parasitism.

Systems approach identifies an organic nitrogen-responsive gene network that is regulated by the master clock control gene CCA1.

Science.gov (United States)

Gutiérrez, Rodrigo A; Stokes, Trevor L; Thum, Karen; Xu, Xiaodong; Obertello, Mariana; Katari, Manpreet S; Tanurdzic, Milos; Dean, Alexis; Nero, Damion C; McClung, C Robertson; Coruzzi, Gloria M

2008-03-25

Understanding how nutrients affect gene expression will help us to understand the mechanisms controlling plant growth and development as a function of nutrient availability. Nitrate has been shown to serve as a signal for the control of gene expression in Arabidopsis. There is also evidence, on a gene-by-gene basis, that downstream products of nitrogen (N) assimilation such as glutamate (Glu) or glutamine (Gln) might serve as signals of organic N status that in turn regulate gene expression. To identify genome-wide responses to such organic N signals, Arabidopsis seedlings were transiently treated with ammonium nitrate in the presence or absence of MSX, an inhibitor of glutamine synthetase, resulting in a block of Glu/Gln synthesis. Genes that responded to organic N were identified as those whose response to ammonium nitrate treatment was blocked in the presence of MSX. We showed that some genes previously identified to be regulated by nitrate are under the control of an organic N-metabolite. Using an integrated network model of molecular interactions, we uncovered a subnetwork regulated by organic N that included CCA1 and target genes involved in N-assimilation. We validated some of the predicted interactions and showed that regulation of the master clock control gene CCA1 by Glu or a Glu-derived metabolite in turn regulates the expression of key N-assimilatory genes. Phase response curve analysis shows that distinct N-metabolites can advance or delay the CCA1 phase. Regulation of CCA1 by organic N signals may represent a novel input mechanism for N-nutrients to affect plant circadian clock function.

Medical Marijuana: Review of the Science and Implications for Developmental Behavioral Pediatric Practice

Science.gov (United States)

Hadland, Scott E.; Knight, John R.; Harris, Sion K.

2014-01-01

Marijuana policy is rapidly evolving in the United States and elsewhere, with cannabis sales fully legalized and regulated in some jurisdictions and use of the drug for medicinal purposes permitted in many others. Amidst this political change, patients and families are increasingly asking whether cannabis and its derivatives may have therapeutic utility for a number of conditions, including developmental and behavioral disorders in children and adolescents. This review examines the epidemiology of cannabis use among children and adolescents, including those with developmental and behavioral diagnoses. It then outlines the increasingly well-recognized neurocognitive changes shown to occur in adolescents who use cannabis regularly, highlighting the unique susceptibility of the developing adolescent brain and describing the role of the endocannabinoid system in normal neurodevelopment. The review then discusses some of the proposed uses of cannabis in developmental and behavioral conditions, including attention deficit hyperactivity disorder (ADHD) and autism spectrum disorder (ASD). Throughout, the review outlines gaps in current knowledge and highlights directions for future research, especially in light of a dearth of studies specifically examining neurocognitive and psychiatric outcomes among children and adolescents with developmental and behavioral concerns exposed to cannabis. PMID:25650954

Medical marijuana: review of the science and implications for developmental-behavioral pediatric practice.

Science.gov (United States)

Hadland, Scott E; Knight, John R; Harris, Sion K

2015-01-01

Marijuana policy is rapidly evolving in the United States and elsewhere, with cannabis sales fully legalized and regulated in some jurisdictions and use of the drug for medicinal purposes permitted in many others. Amidst this political change, patients and families are increasingly asking whether cannabis and its derivatives may have therapeutic utility for a number of conditions, including developmental and behavioral disorders in children and adolescents. This review examines the epidemiology of cannabis use among children and adolescents, including those with developmental and behavioral diagnoses. It then outlines the increasingly well-recognized neurocognitive changes shown to occur in adolescents who use cannabis regularly, highlighting the unique susceptibility of the developing adolescent brain and describing the role of the endocannabinoid system in normal neurodevelopment. The review then discusses some of the proposed uses of cannabis in developmental and behavioral conditions, including attention-deficit hyperactivity disorder and autism spectrum disorder. Throughout, the review outlines gaps in current knowledge and highlights directions for future research, especially in light of a dearth of studies specifically examining neurocognitive and psychiatric outcomes among children and adolescents with developmental and behavioral concerns exposed to cannabis.

Assessing Variations in Developmental Outcomes Among Teenage Offspring of Teen Mothers: Maternal Life Course Correlates.

Science.gov (United States)

Lee, Jungeun Olivia; Gilchrist, Lewayne D; Beadnell, Blair A; Lohr, Mary Jane; Yuan, Chaoyue; Hartigan, Lacey A; Morrison, Diane M

2017-09-01

This study investigated potential heterogeneity in development among offspring (age 17) of teen mothers and maternal life course as correlates of variation. Using latent class analysis, subgroups of developmental outcomes were identified. Maternal standing in two life course realms (i.e., socioeconomic and domestic) was considered as a potential explanation for heterogeneity in offspring's development. Offspring reported on measures assessing their psychological, academic, and behavioral development. Teen mothers reported on measures of life course realms. Three subgroups of developmental outcomes were identified: on track (52%), at risk (37%), and troubled (11%). Findings suggest that economic hardship and number of pregnancies among teen mothers distinguish developmental patterns among teenage offspring, whereas teen mothers' educational attainment and marital status do not. © 2016 The Authors. Journal of Research on Adolescence © 2016 Society for Research on Adolescence.

Crystallization and X-ray diffraction analysis of the HMG domain of the chondrogenesis master regulator Sox9 in complex with a ChIP-Seq-identified DNA element

Energy Technology Data Exchange (ETDEWEB)

Vivekanandan, Saravanan; Moovarkumudalvan, Balasubramanian; Lescar, Julien; Kolatkar, Prasanna R.

2015-10-30

Sox9 is a fundamental sex-determining gene and the master regulator of chondrogenesis, and is involved in the development of various vital organs such as testes, kidney, heart and brain, and in skeletal development. Similar to other known Sox transcription factors, Sox9 recognizes and binds DNA with the consensus sequence C(T/A)TTG(T/A)(T/A) through the highly conserved HMG domain. Nonetheless, the molecular basis of the functional specificity of Sox9 in key developmental processes is still unclear. As an initial step towards a mechanistic understanding of Sox9 transcriptional regulation, the current work describes the details of the purification of the mouse Sox9 HMG domain (mSox9HMG), its crystallization in complex with a ChIP-Seq-identified FOXP2 promoter DNA element and the X-ray diffraction data analysis of this complex. The mSox9HMG–FOXP2 promoter DNA complex was crystallized by the hanging-drop vapour-diffusion method using 20% PEG 3350 in 200 mMsodium/potassium phosphate with 100 mMbis-tris propane at pH 8.5. The crystals diffracted to 2.7 Å resolution and the complex crystallized in the tetragonal space groupP4₁2₁2, with unit-cell parametersa=b= 99.49,c= 45.89 Å. Crystal-packing parameters revealed that asymmetric unit contained one mSox9HMG–FOXP2 promoter DNA complex with an estimated solvent content of 64%.

Adaptive developmental plasticity: Compartmentalized responses to environmental cues and corresponding internal signals provide phenotypic flexibility

NARCIS (Netherlands)

Mateus, A.R.A.; Marques-Pita, M.; Oostra, V.; Lafuente, E.; Brakefield, P.M.; Zwaan, B.J.; Beldade, P.

2014-01-01

Background The environmental regulation of development can result in the production of distinct phenotypes from the same genotype and provide the means for organisms to cope with environmental heterogeneity. The effect of the environment on developmental outcomes is typically mediated by hormonal

Why developmental niche construction is not selective niche construction: and why it matters.

Science.gov (United States)

Stotz, Karola

2017-10-06

In the last decade, niche construction has been heralded as the neglected process in evolution. But niche construction is just one way in which the organism's interaction with and construction of the environment can have potential evolutionary significance. The constructed environment does not just select for , it also produces new variation. Nearly 3 decades ago, and in parallel with Odling-Smee's article 'Niche-constructing phenotypes', West and King introduced the 'ontogenetic niche' to give the phenomena of exo genetic inheritance a formal name. Since then, a range of fields in the life sciences and medicine has amassed evidence that parents influence their offspring by means other than DNA (parental effects), and proposed mechanisms for how heritable variation can be environmentally induced and developmentally regulated. The concept of 'developmental niche construction' (DNC) elucidates how a diverse range of mechanisms contributes to the transgenerational transfer of developmental resources. My most central of claims is that whereas the selective niche of niche construction theory is primarily used to explain the active role of the organism in its selective environment, DNC is meant to indicate the active role of the organism in its developmental environment. The paper highlights the differences between the construction of the selective and the developmental niche, and explores the overall significance of DNC for evolutionary theory.

Associations of Motor Developmental Risks with the Socioeconomic Status of Preschool Children in North-Eastern Germany

Directory of Open Access Journals (Sweden)

Annika Gottschling-Lang

2013-01-01

Full Text Available Aims. The study is part of the pilot project “children in preschools” and aims to detect developmental risks of preschool children in the context of their socioeconomic status (SES as a base to initiate individual intervention strategies. Methods. The “Dortmund Developmental Screening for the Kindergarten” was used in 12 preschools in Mecklenburg-Western Pomerania (MWP to detect early developmental risks in children aged 3 to 6 years (n=870. Socioeconomic data from n=530 parents were collected by a standardised questionnaire. Results. Significant differences between the SES groups were identified especially in the field of fine motor skills (P<0.05. In gross motor development differences were not statistically significant. Prevalence rate of fine motor developmental risks ranges from 1.7% to 20.9%; the rate of gross motor developmental risks tops out at 14.4%. The prevalence rates are associated with age and sex. Conclusions. Fine motor skills in 3–6 years old preschool children are significantly associated with the socioeconomic status. In gross motor skills an association could not be identified. In this study, motor development was more affected by sex than by SES.

Developmental and growth temperature regulation of two different microsomal omega-6 desaturase genes in soybeans.

Science.gov (United States)

Heppard, E P; Kinney, A J; Stecca, K L; Miao, G H

1996-01-01

The polyunsaturated fatty acid content is one of the major factors influencing the quality of vegetable oils. Edible oils rich in monounsaturated fatty acid provide improved oil stability, flavor, and nutrition for human and animal consumption. In plants, the microsomal omega-6 desaturase-catalyzed pathway is the primary route of production of polyunsaturated lipids. We report the isolation of two different cDNA sequences, FAD2-1 and FAD2-2, encoding microsomal omega-6 desaturase in soybeans and the characterization of their developmental and temperature regulation. The FAD2-1 gene is strongly expressed in developing seeds, whereas the FAD2-2 gene is constitutively expressed in both vegetative tissues and developing seeds. Thus, the FAD2-2 gene-encoded omega-6 desaturase appears to be responsible for production of polyunsaturated fatty acids within membrane lipids in both vegetative tissues and developing seeds. The seed-specifically expressed FAD2-1 gene is likely to play a major role in controlling conversion of oleic acid to linoleic acid within storage lipids during seed development. In both soybean seed and leaf tissues, linoleic acid and linolenic acid levels gradually increase as temperature decreases. However, the levels of transcripts for FAD2-1, FAD2-2, and the plastidial omega-6 desaturase gene (FAD 6) do not increase at low temperature. These results suggest that the elevated polyunsaturated fatty acid levels in developing soybean seeds grown at low temperature are not due to the enhanced expression of omega-6 desaturase genes. PMID:8587990

Phosphoproteomic Analysis Identifies Signaling Pathways Regulated by Curcumin in Human Colon Cancer Cells.

Science.gov (United States)

Sato, Tatsuhiro; Higuchi, Yutaka; Shibagaki, Yoshio; Hattori, Seisuke

2017-09-01

Curcumin, a major polyphenol of the spice turmeric, acts as a potent chemopreventive and chemotherapeutic agent in several cancer types, including colon cancer. Although various proteins have been shown to be affected by curcumin, how curcumin exerts its anticancer activity is not fully understood. Phosphoproteomic analyses were performed using SW480 and SW620 human colon cancer cells to identify curcumin-affected signaling pathways. Curcumin inhibited the growth of the two cell lines in a dose-dependent manner. Thirty-nine curcumin-regulated phosphoproteins were identified, five of which are involved in cancer signaling pathways. Detailed analyses revealed that the mTORC1 and p53 signaling pathways are main targets of curcumin. Our results provide insight into the molecular mechanisms of the anticancer activities of curcumin and future molecular targets for its clinical application. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Magnetic resonance imaging (MRI) evaluation of developmental delay in pediatric patients.

Science.gov (United States)

Ali, Althaf S; Syed, Naziya P; Murthy, G S N; Nori, Madhavi; Abkari, Anand; Pooja, B K; Venkateswarlu, J

2015-01-01

Developmental delay is defined as significant delay in one or more developmental domains. Magnetic Resonance Imaging (MRI) is the best modality to investigate such patients. Evaluation of a child with developmental delay is important not only because it allows early diagnosis and treatment but also helpful for parental counseling regarding the outcome of their child and to identify any possible risk of recurrence in the siblings. Thus this study was undertaken to evaluate the developmental delay in Indian children which will help the clinicians in providing an estimation of the child's ultimate developmental potential and organize specific treatment requirement and also relieve parental apprehension. To study the prevalence of normal and abnormal MRI in pediatric patients presenting with developmental delay and further categorize the abnormal MRI based on its morphological features. It is a prospective, observational & descriptive study of MRI Brain in 81 paediatric patients (46 Males and 35 Females), aged between three months to 12 years; presenting with developmental delay in Deccan College of Medical Sciences, Hyderabad; over a period of three years (Sept 2011 to Sept 2014). MRI brain was done on 1.5T Siemens Magnetom Essenza & 0.35T Magnetom C with appropriate sequences and planes after making the child sleep/sedated/ anesthetized. Various anatomical structures like Ventricles, Corpus callosum, etc were systematically assessed. The MRI findings were divided into various aetiological subgroups. Normal MRI findings were seen in 32% cases and 68% had abnormal findings of which the proportion of Traumatic/ Neurovascular Diseases, Congenital & Developmental, Metabolic and Degenerative, neoplastic and non specific were 31%, 17%, 10%, 2.5% and 7.5% respectively. The ventricles and white matter mainly the corpus callosum were the most commonly affected anatomical structures. The diagnostic yield was found to be 68% and higher yield was seen in patients presenting with

Specification of Drosophila corpora cardiaca neuroendocrine cells from mesoderm is regulated by Notch signaling.

Directory of Open Access Journals (Sweden)

Sangbin Park

2011-08-01

Full Text Available Drosophila neuroendocrine cells comprising the corpora cardiaca (CC are essential for systemic glucose regulation and represent functional orthologues of vertebrate pancreatic α-cells. Although Drosophila CC cells have been regarded as developmental orthologues of pituitary gland, the genetic regulation of CC development is poorly understood. From a genetic screen, we identified multiple novel regulators of CC development, including Notch signaling factors. Our studies demonstrate that the disruption of Notch signaling can lead to the expansion of CC cells. Live imaging demonstrates localized emergence of extra precursor cells as the basis of CC expansion in Notch mutants. Contrary to a recent report, we unexpectedly found that CC cells originate from head mesoderm. We show that Tinman expression in head mesoderm is regulated by Notch signaling and that the combination of Daughterless and Tinman is sufficient for ectopic CC specification in mesoderm. Understanding the cellular, genetic, signaling, and transcriptional basis of CC cell specification and expansion should accelerate discovery of molecular mechanisms regulating ontogeny of organs that control metabolism.

Developmental differences in beta and theta power during sentence processing

Directory of Open Access Journals (Sweden)

Julie M. Schneider

2016-06-01

Full Text Available Although very young children process ongoing language quickly and effortlessly, research indicates that they continue to improve and mature in their language skills through adolescence. This prolonged development may be related to differing engagement of semantic and syntactic processes. This study used event related potentials and time frequency analysis of EEG to identify developmental differences in neural engagement as children (ages 10–12 and adults performed an auditory verb agreement grammaticality judgment task. Adults and children revealed very few differences in comprehending grammatically correct sentences. When identifying grammatical errors, however, adults displayed widely distributed beta and theta power decreases that were significantly less pronounced in children. Adults also demonstrated a significant P600 effect, while children exhibited an apparent N400 effect. Thus, when identifying subtle grammatical errors in real time, adults display greater neural activation that is traditionally associated with syntactic processing whereas children exhibit greater activity more commonly associated with semantic processing. These findings support previous claims that the cognitive and neural underpinnings of syntactic processing are still developing in adolescence, and add to them by more clearly identifying developmental changes in the neural oscillations underlying grammatical processing.

Genome Transfer Prevents Fragmentation and Restores Developmental Potential of Developmentally Compromised Postovulatory Aged Mouse Oocytes

Directory of Open Access Journals (Sweden)

Mitsutoshi Yamada

2017-03-01

Full Text Available Changes in oocyte quality can have great impact on the developmental potential of early embryos. Here we test whether nuclear genome transfer from a developmentally incompetent to a developmentally competent oocyte can restore developmental potential. Using in vitro oocyte aging as a model system we performed nuclear transfer in mouse oocytes at metaphase II or at the first interphase, and observed that development to the blastocyst stage and to term was as efficient as in control embryos. The increased developmental potential is explained primarily by correction of abnormal cytokinesis at anaphase of meiosis and mitosis, by a reduction in chromosome segregation errors, and by normalization of the localization of chromosome passenger complex components survivin and cyclin B1. These observations demonstrate that developmental decline is primarily due to abnormal function of cytoplasmic factors involved in cytokinesis, while the genome remains developmentally fully competent.

Quantitative assessment of developmental levels in overarm throwing using wearable inertial sensing technology.

Science.gov (United States)

Grimpampi, Eleni; Masci, Ilaria; Pesce, Caterina; Vannozzi, Giuseppe

2016-09-01

Motor proficiency in childhood has been recently recognised as a public health determinant, having a potential impact on the physical activity level and possible sedentary behaviour of the child later in life. Among fundamental motor skills, ballistic skills assessment based on in-field quantitative observations is progressively needed in the motor development community. The aim of this study was to propose an in-field quantitative approach to identify different developmental levels in overarm throwing. Fifty-eight children aged 5-10 years performed an overarm throwing task while wearing three inertial sensors located at the wrist, trunk and pelvis level and were then categorised using a developmental sequence of overarm throwing. A set of biomechanical parameters were defined and analysed using multivariate statistics to evaluate whether they can be used as developmental indicators. Trunk and pelvis angular velocities and time durations before the ball release showed increasing/decreasing trends with increasing developmental level. Significant differences between developmental level pairs were observed for selected biomechanical parameters. The results support the suitability and feasibility of objective developmental measures in ecological learning contexts, suggesting their potential supportiveness to motor learning experiences in educational and youth sports training settings.

Developmental Idealism: The Cultural Foundations of World Development Programs

Science.gov (United States)

Thornton, Arland; Dorius, Shawn F.; Swindle, Jeffrey

2015-01-01

This paper extends theory and research concerning cultural models of development beyond family and demographic matters to a broad range of additional factors, including government, education, human rights, daily social conventions, and religion. Developmental idealism is a cultural model—a set of beliefs and values—that identifies the appropriate goals of development and the ends for achieving these goals. It includes beliefs about positive cause and effect relationships among such factors as economic growth, educational achievement, health, and political governance, as well as strong values regarding many attributes, including economic growth, education, small families, gender equality, and democratic governance. This cultural model has spread from its origins among the elites of northwest Europe to elites and ordinary people throughout the world. Developmental idealism has become so entrenched in local, national, and global social institutions that it has now achieved a taken-for-granted status among many national elites, academics, development practitioners, and ordinary people around the world. We argue that developmental idealism culture has been a fundamental force behind many cultural clashes within and between societies, and continues to be an important cause of much global social change. We suggest that developmental idealism should be included as a causal factor in theories of human behavior and social change. PMID:26457325

Streptomyces sporulation - Genes and regulators involved in bacterial cell differentiation

OpenAIRE

Larsson, Jessica

2010-01-01

Streptomycetes are Gram-positive bacteria with a complex developmental life cycle. They form spores on specialized cells called aerial hyphae, and this sporulation involves alterations in growth, morphogenesis and cell cycle processes like cell division and chromosome segregation. Understanding the developmental mechanisms that streptomycetes have evolved for regulating for example cell division is of general interest in bacterial cell biology. It can also be valuable in the design of new dru...

Developmental and transcriptional consequences of mutations in Drosophila TAF(II)60.

Science.gov (United States)

Aoyagi, N; Wassarman, D A

2001-10-01

In vitro, the TAF(II)60 component of the TFIID complex contributes to RNA polymerase II transcription initiation by serving as a coactivator that interacts with specific activator proteins and possibly as a promoter selectivity factor that interacts with the downstream promoter element. In vivo roles for TAF(II)60 in metazoan transcription are not as clear. Here we have investigated the developmental and transcriptional requirements for TAF(II)60 by analyzing four independent Drosophila melanogaster TAF(II)60 mutants. Loss-of-function mutations in Drosophila TAF(II)60 result in lethality, indicating that TAF(II)60 provides a nonredundant function in vivo. Molecular analysis of TAF(II)60 alleles revealed that essential TAF(II)60 functions are provided by two evolutionarily conserved regions located in the N-terminal half of the protein. TAF(II)60 is required at all stages of Drosophila development, in both germ cells and somatic cells. Expression of TAF(II)60 from a transgene rescued the lethality of TAF(II)60 mutants and exposed requirements for TAF(II)60 during imaginal development, spermatogenesis, and oogenesis. Phenotypes of rescued TAF(II)60 mutant flies implicate TAF(II)60 in transcriptional mechanisms that regulate cell growth and cell fate specification and suggest that TAF(II)60 is a limiting component of the machinery that regulates the transcription of dosage-sensitive genes. Finally, TAF(II)60 plays roles in developmental regulation of gene expression that are distinct from those of other TAF(II) proteins.

Detecting Preschool Language Impairment and Risk of Developmental Dyslexia

Science.gov (United States)

Helland, Turid; Jones, Lise Øen; Helland, Wenche

2017-01-01

This study assessed and compared results from evidence-based screening tools to be filled out by caregivers to identify preschool children at risk of language impairment (LI) and dyslexia. Three different tools were used: one assessing children's communicative abilities, one assessing risk of developmental dyslexia, and one assessing early…

Developmental Continuity and Change in Physical, Verbal, and Relational Aggression and Peer Victimization from Childhood to Adolescence

Science.gov (United States)

Ettekal, Idean; Ladd, Gary W.

2017-01-01

To investigate the developmental course of aggression and peer victimization in childhood and adolescence, distinct subgroups of children were identified based on similarities and differences in their physical, verbal and relational aggression, and victimization. Developmental continuity and change were assessed by examining transitions within and…

76 FR 59142 - Guidance for Industry on Reproductive and Developmental Toxicities-Integrating Study Results To...

Science.gov (United States)

2011-09-23

... of study results to assess concerns about human reproductive and developmental toxicities. It does... assist that office in processing your requests. See the SUPPLEMENTARY INFORMATION section for electronic access to the guidance document. Submit electronic comments on the guidance to http://www.regulations.gov...

Translations of Developmental Screening Instruments: An Evidence Map of Available Research.

Science.gov (United States)

El-Behadli, Ana F; Neger, Emily N; Perrin, Ellen C; Sheldrick, R Christopher

2015-01-01

Children whose parents do not speak English experience significant disparities in the identification of developmental delays and disorders; however, little is known about the availability and validity of translations of developmental screeners. The goal was to create a map of the scientific evidence regarding translations of the 9 Academy of Pediatrics-recommended screening instruments into languages other than English. The authors conducted a systematic search of Medline and PsycINFO, references of identified articles, publishers' Web sites, and official manuals. Through evidence mapping, a new methodology supported by AHRQ and the Cochrane Collaboration, the authors documented the extent and distribution of published evidence supporting translations of developmental screeners. Data extraction focused on 3 steps of the translation and validation process: (1) translation methods used, (2) collection of normative data in the target language, and (3) evidence for reliability and validity. The authors identified 63 distinct translations among the 9 screeners, of which 44 had supporting evidence published in peer-reviewed sources. Of the 63 translations, 35 had at least some published evidence regarding translation methods used, 28 involving normative data, and 32 regarding reliability and/or construct validity. One-third of the translations found were of the Denver Developmental Screening Test. Specific methods used varied greatly across screeners, as did the level of detail with which results were reported. Few developmental screeners have been translated into many languages. Evidence map of the authors demonstrates considerable variation in both the amount and the comprehensiveness of information available about translated instruments. Informal guidelines exist for conducting translation of psychometric instruments but not for documentation of this process. The authors propose that uniform guidelines be established for reporting translation research in peer

Regulation of bone morphogenetic proteins in early embryonic development

Science.gov (United States)

Yamamoto, Yukiyo; Oelgeschläger, Michael

2004-11-01

Bone morphogenetic proteins (BMPs), a large subgroup of the TGF-β family of secreted growth factors, control fundamental events in early embryonic development, organogenesis and adult tissue homeostasis. The plethora of dose-dependent cellular processes regulated by BMP signalling demand a tight regulation of BMP activity. Over the last decade, a number of proteins have been identified that bind BMPs in the extracellular space and regulate the interaction of BMPs with their cognate receptors, including the secreted BMP antagonist Chordin. In the early vertebrate embryo, the localized secretion of BMP antagonists from the dorsal blastopore lip establishes a functional BMP signalling gradient that is required for the determination of the dorsoventral or back to belly body axis. In particular, inhibition of BMP activity is essential for the formation of neural tissue in the development of vertebrate and invertebrate embryos. Here we review recent studies that have provided new insight into the regulation of BMP signalling in the extracellular space. In particular, we discuss the recently identified Twisted gastrulation protein that modulates, in concert with metalloproteinases of the Tolloid family, the interaction of Chordin with BMP and a family of proteins that share structural similarities with Chordin in the respective BMP binding domains. In addition, genetic and functional studies in zebrafish and frog provide compelling evidence that the secreted protein Sizzled functionally interacts with the Chd BMP pathway, despite being expressed ventrally in the early gastrula-stage embryo. These intriguing discoveries may have important implications, not only for our current concept of early embryonic patterning, but also for the regulation of BMP activity at later developmental stages and tissue homeostasis in the adult.

Developmental Trajectories of Hand Movements in Typical Infants and Those at Risk of Developmental Disorders: An Observational Study of Kinematics during the First Year of Life

Directory of Open Access Journals (Sweden)

Lisa Ouss

2018-02-01

of using kinematics of HM to identify very early developmental disorders in an interactive context and would allow early prevention and intervention for at-risk infants.

An Interpretation of Part of Gilbert Gottlieb's Legacy: Developmental Systems Theory Contra Developmental Behavior Genetics

Science.gov (United States)

Molenaar, Peter C. M.

2015-01-01

The main theme of this paper concerns the persistent critique of Gilbert Gottlieb on developmental behavior genetics and my reactions to this critique, the latter changing from rejection to complete acceptation. Concise characterizations of developmental behavior genetics, developmental systems theory (to which Gottlieb made essential…

Experience with developmental facial paralysis: part II. Outcomes of reconstruction.

Science.gov (United States)

Terzis, Julia K; Anesti, Katerina

2012-01-01

The purpose of this study was to document the 30-year experience of the authors' center in the management of developmental facial paralysis and to analyze the outcomes of microsurgical reconstruction. Forty-two cases of developmental facial paralysis were identified in a retrospective clinical review (1980 to 2010); 34 (80.95 percent) were children (age, 8 ± 6 years) and eight (19.05 percent) were adults (age, 27 ± 12 years). Comparisons between preoperative and postoperative results were performed with electrophysiologic studies and video evaluations by three independent observers. Mean follow-up was 8 ± 6.3 years (range, 1 to 23 years). Overall, outcome scores improved in all of the patients, as was evident from the observers' mean scores (preoperatively, 2.44; 2 years postoperatively, 3.66; final, 4.11; p children as compared with adults (p children with developmental facial paralysis and reduces the prevalence of aesthetic and functional sequelae of the condition, thus facilitating reintegration among their peers. The experience of this center should serve as a framework for the establishment of accurate and reliable guidelines that will facilitate early diagnosis and management of developmental facial paralysis and provide support and counseling to the family.

[Neuropsychomotor developmental delay: conceptual map, term definitions, uses and limitations].

Science.gov (United States)

Dornelas, Lílian de Fátima; Duarte, Neuza Maria de Castro; Magalhães, Lívia de Castro

2015-01-01

To retrieve the origin of the term neuropsychomotor developmental delay" (NPMD), its conceptual evolution over time, and to build a conceptual map based on literature review. A literature search was performed in the SciELO Brazil, Web of Science, Science Direct, OneFile (GALE), Pubmed (Medline), Whiley Online, and Springer databases, from January of 1940 to January of 2013, using the following keywords NPMD delay, NPMD retardation, developmental delay, and global developmental delay. A total of 71 articles were selected, which were used to build the conceptual map of the term. Of the 71 references, 55 were international and 16 national. The terms developmental delay and global developmental delay were the most frequently used in the international literature and, in Brazil, delayed NPMD was the most often used. The term developmental delay emerged in the mid 1940s, gaining momentum in the 1990 s. In Brazil, the term delayed NPMD started to be used in the 1980s, and has been frequently cited and published in the literature. Delayed development was a characteristic of 13 morbidities described in 23 references. Regarding the type of use, 19 references were found, with seven forms of use. Among the references, 34 had definitions of the term, and 16 different concepts were identified. Developmental delay is addressed in the international and national literature under different names, various applications, and heterogeneous concepts. Internationally, ways to improve communication between professionals have been indicated, with standardized definition of the term and use in very specific situations up to the fifth year of life, which was not found in Brazilian publications. Copyright © 2014 Associação de Pediatria de São Paulo. Publicado por Elsevier Editora Ltda. All rights reserved.

Expression of ACC oxidase promoter-GUS fusions in tomato and Nicotiana plumbaginifolia regulated by developmental and environmental stimuli.

Science.gov (United States)

Blume, B; Grierson, D

1997-10-01

The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.

A Quantitative RNAi Screen for JNK Modifiers Identifies Pvr as a Novel Regulator of Drosophila Immune Signaling

Science.gov (United States)

Bond, David; Foley, Edan

2009-01-01

Drosophila melanogaster responds to gram-negative bacterial challenges through the IMD pathway, a signal transduction cassette that is driven by the coordinated activities of JNK, NF-κB and caspase modules. While many modifiers of NF-κB activity were identified in cell culture and in vivo assays, the regulatory apparatus that determines JNK inputs into the IMD pathway is relatively unexplored. In this manuscript, we present the first quantitative screen of the entire genome of Drosophila for novel regulators of JNK activity in the IMD pathway. We identified a large number of gene products that negatively or positively impact on JNK activation in the IMD pathway. In particular, we identified the Pvr receptor tyrosine kinase as a potent inhibitor of JNK activation. In a series of in vivo and cell culture assays, we demonstrated that activation of the IMD pathway drives JNK-dependent expression of the Pvr ligands, Pvf2 and Pvf3, which in turn act through the Pvr/ERK MAP kinase pathway to attenuate the JNK and NF-κB arms of the IMD pathway. Our data illuminate a poorly understood arm of a critical and evolutionarily conserved innate immune response. Furthermore, given the pleiotropic involvement of JNK in eukaryotic cell biology, we believe that many of the novel regulators identified in this screen are of interest beyond immune signaling. PMID:19893628

Developmental regulation of nucleolus size during Drosophila eye differentiation.

Directory of Open Access Journals (Sweden)

Nicholas E Baker

Full Text Available When cell cycle withdrawal accompanies terminal differentiation, biosynthesis and cellular growth are likely to change also. In this study, nucleolus size was monitored during cell fate specification in the Drosophila eye imaginal disc using fibrillarin antibody labeling. Nucleolus size is an indicator of ribosome biogenesis and can correlate with cellular growth rate. Nucleolar size was reduced significantly during cell fate specification and differentiation, predominantly as eye disc cells entered a cell cycle arrest that preceded cell fate specification. This reduction in nucleolus size required Dpp and Hh signaling. A transient enlargement of the nucleolus accompanied cell division in the Second Mitotic Wave. Nucleoli continued to diminish in postmitotic cells following fate specification. These results suggest that cellular growth is regulated early in the transition from proliferating progenitor cells to terminal cell fate specification, contemporary with regulation of the cell cycle, and requiring the same extracellular signals.

Developmental regulation of nucleolus size during Drosophila eye differentiation.

Science.gov (United States)

Baker, Nicholas E

2013-01-01

When cell cycle withdrawal accompanies terminal differentiation, biosynthesis and cellular growth are likely to change also. In this study, nucleolus size was monitored during cell fate specification in the Drosophila eye imaginal disc using fibrillarin antibody labeling. Nucleolus size is an indicator of ribosome biogenesis and can correlate with cellular growth rate. Nucleolar size was reduced significantly during cell fate specification and differentiation, predominantly as eye disc cells entered a cell cycle arrest that preceded cell fate specification. This reduction in nucleolus size required Dpp and Hh signaling. A transient enlargement of the nucleolus accompanied cell division in the Second Mitotic Wave. Nucleoli continued to diminish in postmitotic cells following fate specification. These results suggest that cellular growth is regulated early in the transition from proliferating progenitor cells to terminal cell fate specification, contemporary with regulation of the cell cycle, and requiring the same extracellular signals.

Qualitative methodology in developmental psychology

DEFF Research Database (Denmark)

Demuth, Carolin; Mey, Günter

2015-01-01

Qualitative methodology presently is gaining increasing recognition in developmental psychology. Although the founders of developmental psychology to a large extent already used qualitative procedures, the field was long dominated by a (post) positivistic quantitative paradigm. The increasing rec...... in qualitative research offers a promising avenue to advance the field in this direction.......Qualitative methodology presently is gaining increasing recognition in developmental psychology. Although the founders of developmental psychology to a large extent already used qualitative procedures, the field was long dominated by a (post) positivistic quantitative paradigm. The increasing...

Critical Windows of Cardiovascular Susceptibility to Developmental Hypoxia in Common Snapping Turtle (Chelydra serpentina) Embryos.

Science.gov (United States)

Tate, Kevin B; Kohl, Zachary F; Eme, John; Rhen, Turk; Crossley, Dane A

2015-01-01

Environmental conditions fluctuate dramatically in some reptilian nests. However, critical windows of environmental sensitivity for cardiovascular development have not been identified. Continuous developmental hypoxia has been shown to alter cardiovascular form and function in embryonic snapping turtles (Chelydra serpentina), and we used this species to identify critical periods during which hypoxia modifies the cardiovascular phenotype. We hypothesized that incubation in 10% O2 during specific developmental periods would have differential effects on the cardiovascular system versus overall somatic growth. Two critical windows were identified with 10% O2 from 50% to 70% of incubation, resulting in relative heart enlargement, either via preservation of or preferential growth of this tissue, while exposure to 10% O2 from 20% to 70% of incubation resulted in a reduction in arterial pressure. The deleterious or advantageous aspects of these embryonic phenotypes in posthatching snapping turtles have yet to be explored. However, identification of these critical windows has provided insight into how the developmental environment alters the phenotype of reptiles and will also be pivotal in understanding its impact on the fitness of egg-laying reptiles.

Attentional networks in developmental dyscalculia

Directory of Open Access Journals (Sweden)

Henik Avishai

2010-01-01

Full Text Available Abstract Background Very little is known about attention deficits in developmental dyscalculia, hence, this study was designed to provide the missing information. We examined attention abilities of participants suffering from developmental dyscalculia using the attention networks test - interactions. This test was designed to examine three different attention networks--executive function, orienting and alerting--and the interactions between them. Methods Fourteen university students that were diagnosed as suffering from developmental dyscalculia--intelligence and reading abilities in the normal range and no indication of attention-deficit hyperactivity disorder--and 14 matched controls were tested using the attention networks test - interactions. All participants were given preliminary tests to measure mathematical abilities, reading, attention and intelligence. Results The results revealed deficits in the alerting network--a larger alerting effect--and in the executive function networks--a larger congruity effect in developmental dyscalculia participants. The interaction between the alerting and executive function networks was also modulated by group. In addition, developmental dyscalculia participants were slower to respond in the non-cued conditions. Conclusions These results imply specific attentional deficits in pure developmental dyscalculia. Namely, those with developmental dyscalculia seem to be deficient in the executive function and alertness networks. They suffer from difficulty in recruiting attention, in addition to the deficits in numerical processing.

Attentional networks in developmental dyscalculia.

Science.gov (United States)

Askenazi, Sarit; Henik, Avishai

2010-01-07

Very little is known about attention deficits in developmental dyscalculia, hence, this study was designed to provide the missing information. We examined attention abilities of participants suffering from developmental dyscalculia using the attention networks test - interactions. This test was designed to examine three different attention networks--executive function, orienting and alerting--and the interactions between them. Fourteen university students that were diagnosed as suffering from developmental dyscalculia--intelligence and reading abilities in the normal range and no indication of attention-deficit hyperactivity disorder--and 14 matched controls were tested using the attention networks test-interactions. All participants were given preliminary tests to measure mathematical abilities, reading, attention and intelligence. The results revealed deficits in the alerting network--a larger alerting effect--and in the executive function networks--a larger congruity effect in developmental dyscalculia participants. The interaction between the alerting and executive function networks was also modulated by group. In addition, developmental dyscalculia participants were slower to respond in the non-cued conditions. These results imply specific attentional deficits in pure developmental dyscalculia. Namely, those with developmental dyscalculia seem to be deficient in the executive function and alertness networks. They suffer from difficulty in recruiting attention, in addition to the deficits in numerical processing.

Transcriptional Profiling of Hypoxic Neural Stem Cells Identifies Calcineurin-NFATc4 Signaling as a Major Regulator of Neural Stem Cell Biology

Science.gov (United States)

Moreno, Marta; Fernández, Virginia; Monllau, Josep M.; Borrell, Víctor; Lerin, Carles; de la Iglesia, Núria

2015-01-01

Summary Neural stem cells (NSCs) reside in a hypoxic microenvironment within the brain. However, the crucial transcription factors (TFs) that regulate NSC biology under physiologic hypoxia are poorly understood. Here we have performed gene set enrichment analysis (GSEA) of microarray datasets from hypoxic versus normoxic NSCs with the aim of identifying pathways and TFs that are activated under oxygen concentrations mimicking normal brain tissue microenvironment. Integration of TF target (TFT) and pathway enrichment analysis identified the calcium-regulated TF NFATc4 as a major candidate to regulate hypoxic NSC functions. Nfatc4 expression was coordinately upregulated by top hypoxia-activated TFs, while NFATc4 target genes were enriched in hypoxic NSCs. Loss-of-function analyses further revealed that the calcineurin-NFATc4 signaling axis acts as a major regulator of NSC self-renewal and proliferation in vitro and in vivo by promoting the expression of TFs, including Id2, that contribute to the maintenance of the NSC state. PMID:26235896

Developmental shaping of dendritic arbors in Drosophila relies on tightly regulated intra-neuronal activity of protein kinase A (PKA).

Science.gov (United States)

Copf, Tijana

2014-09-15

Dendrites develop morphologies characterized by multiple levels of complexity that involve neuron type specific dendritic length and particular spatial distribution. How this is developmentally regulated and in particular which signaling molecules are crucial in the process is still not understood. Using Drosophila class IV dendritic arborization (da) neurons we test in vivo the effects of cell-autonomous dose-dependent changes in the activity levels of the cAMP-dependent Protein Kinase A (PKA) on the formation of complex dendritic arbors. We find that genetic manipulations of the PKA activity levels affect profoundly the arbor complexity with strongest impact on distal branches. Both decreasing and increasing PKA activity result in a reduced complexity of the arbors, as reflected in decreased dendritic length and number of branching points, suggesting an inverted U-shape response to PKA. The phenotypes are accompanied by changes in organelle distribution: Golgi outposts and early endosomes in distal dendritic branches are reduced in PKA mutants. By using Rab5 dominant negative we find that PKA interacts genetically with the early endosomal pathway. We test if the possible relationship between PKA and organelles may be the result of phosphorylation of the microtubule motor dynein components or Rab5. We find that Drosophila cytoplasmic dynein components are direct PKA phosphorylation targets in vitro, but not in vivo, thus pointing to a different putative in vivo target. Our data argue that tightly controlled dose-dependent intra-neuronal PKA activity levels are critical in determining the dendritic arbor complexity, one of the possible ways being through the regulation of organelle distribution. Copyright © 2014 Elsevier Inc. All rights reserved.

Developmental Scaffolding

DEFF Research Database (Denmark)

Giorgi, Franco; Bruni, Luis Emilio

2015-01-01

. Within the developmental hierarchy, each module yields an inter-level relationship that makes it possible for the scaffolding to mediate the production of selectable variations. Awide range of genetic, cellular and morphological mechanisms allows the scaffolding to integrate these modular variations...... to the complexity of sign recognition proper of a cellular community. In this semiotic perspective, the apparent goal directness of any developmental strategy should no longer be accounted for by a predetermined genetic program, but by the gradual definition of the relationships selected amongst the ones...

Psychotherapy with people with developmental disabilities

Directory of Open Access Journals (Sweden)

Barbara Zafošnik

2011-08-01

Full Text Available People with developmental disabilities can experience any psychological abnormalitiy and psychiatric illness as do people without developmental disabilities. Due to different diagnostic criteria, assessment procedures and instruments, we lack definite prevalence rates for people with developmental disabilities, also suffering from mental health problems, eventhough most studies place the rate at 20 to 40%. One of the possible treatment alternatives for augmenting psychological well-being is psychotherapy, but is extremely rarely used for people with severe and profound disabilities, where speech cannot be the main therapeutic medium. So, those that are included in the psychotherapuetic process are predominantly clients with mild developmental disabilities, and they are mostly in cognitive-behavioral therapy. Recently, two models of (psychotherapy for persons with severe and profound developmental disabilities were developed: developmental-dynamic relationship therapy and attachment-based behaviour therapy for children. Conceptually, they both originate form developmental psychoanalytic theories.

Factors that regulate embryonic gustatory development

Directory of Open Access Journals (Sweden)

Krimm Robin F

2007-09-01

Full Text Available Abstract Numerous molecular factors orchestrate the development of the peripheral taste system. The unique anatomy/function of the taste system makes this system ideal for understanding the mechanisms by which these factors function; yet the taste system is underutilized for this role. This review focuses on some of the many factors that are known to regulate gustatory development, and discusses a few topics where more work is needed. Some attention is given to factors that regulate epibranchial placode formation, since gustatory neurons are thought to be primarily derived from this region. Epibranchial placodes appear to arise from a pan-placodal region and a number of regulatory factors control the differentiation of individual placodes. Gustatory neuron differentiation is regulated by a series of transcription factors and perhaps bone morphongenic proteins (BMP. As neurons differentiate, they also proliferate such that their numbers exceed those in the adult, and this is followed by developmental death. Some of these cell-cycling events are regulated by neurotrophins. After gustatory neurons become post-mitotic, axon outgrowth occurs. Axons are guided by multiple chemoattractive and chemorepulsive factors, including semaphorins, to the tongue epithelium. Brain derived neurotrophic factor (BDNF, functions as a targeting factor in the final stages of axon guidance and is required for gustatory axons to find and innervate taste epithelium. Numerous factors are involved in the development of gustatory papillae including Sox-2, Sonic hedge hog and Wnt-β-catenin signaling. It is likely that just as many factors regulate taste bud differentiation; however, these factors have not yet been identified. Studies examining the molecular factors that regulate terminal field formation in the nucleus of the solitary tract are also lacking. However, it is possible that some of the factors that regulate geniculate ganglion development, outgrowth, guidance and

The many forms of a pleomorphic bacterial pathogen – The developmental network of Legionella pneumophila

Directory of Open Access Journals (Sweden)

Peter eRobertson

2014-12-01

Full Text Available Legionella pneumophila is a natural intracellular bacterial parasite of free-living freshwater protozoa and an accidental human pathogen that causes Legionnaires’ disease. L. pneumophila differentiates, and does it in style. Recent experimental data on L. pneumophila’s differentiation point at the existence of a complex network that involves many developmental forms. We intend readers to: (i understand the biological relevance of L. pneumophila’s forms found in freshwater and their potential to transmit Legionnaires’ disease, and (ii learn that the common depiction of L. pneumophila’s differentiation as a biphasic developmental cycle that alternates between a replicative and a transmissive form is but an oversimplification of the actual process. Our specific objectives are to provide updates on the molecular factors that regulate L. pneumophila’s differentiation (section 2, and describe the developmental network of L. pneumophila (section 3, which for clarity’s sake we have dissected into five separate developmental cycles. Finally, since each developmental form seems to contribute differently to the human pathogenic process and the transmission of Legionnaires’ disease, readers are presented with a challenge to develop novel methods to detect the various L. pneumophila forms present in water (section 4, as a means to improve our assessment of risk and more effectively prevent legionellosis outbreaks.

Evidence for a developmental role for TLR4 in learning and memory.

Directory of Open Access Journals (Sweden)

Eitan Okun

Full Text Available Toll-like receptors (TLRs play essential roles in innate immunity and increasing evidence indicates that these receptors are expressed in neurons, astrocytes and microglia in the brain where they mediate responses to infection, stress and injury. Very little is known about the roles of TLRs in cognition. To test the hypothesis that TLR4 has a role in hippocampus-dependent spatial learning and memory, we used mice deficient for TLR4 and mice receiving chronic TLR4 antagonist infusion to the lateral ventricles in the brain. We found that developmental TLR4 deficiency enhances spatial reference memory acquisition and memory retention, impairs contextual fear-learning and enhances motor functions, traits that were correlated with CREB up-regulation in the hippocampus. TLR4 antagonist infusion into the cerebral ventricles of adult mice did not affect cognitive behavior, but instead affected anxiety responses. Our findings indicate a developmental role for TLR4 in shaping spatial reference memory, and fear learning and memory. Moreover, we show that central TLR4 inhibition using a TLR4 antagonist has no discernible physiological role in regulating spatial and contextual hippocampus-dependent cognitive behavior.

Regulation of Development and Nitrogen Fixation in Anabaena

Energy Technology Data Exchange (ETDEWEB)

James W. Golden

2008-10-17

The regulation of development and cellular differentiation is important for all multicellular organisms. The nitrogen-fixing filamentous cyanobacterium Anabaena (also Nostoc) sp. PCC 7120 (hereafter Anabaena) provides a model of multicellular microbial development and pattern formation. Anabaena reduces N2 to ammonia in specialized terminally differentiated cells called heterocysts. A one-dimensional developmental pattern of single heterocysts regularly spaced along filaments of photosynthetic vegetative cells is established to form a multicellular organism composed of these two interdependent cell types. This multicellular growth pattern, the distinct phylogeny of cyanobacteria, and the suspected antiquity of heterocyst development make this an important model system. Our long-term goal is to understand the regulatory network required for heterocyst development and nitrogen fixation. This project is focused on two key aspects of heterocyst regulation: one, the mechanism by which HetR controls the initiation of differentiation, and two, the cis and trans acting factors required for expression of the nitrogen-fixation (nif) genes. HetR is thought to be a central regulator of heterocyst development but the partners and mechanisms involved in this regulation are unknown. Our recent results indicate that PatS and other signals that regulate heterocyst pattern cannot interact, directly or indirectly, with a R223W mutant of HetR. We plan to use biochemical and genetic approaches to identify proteins that interact with the HetR protein, which will help reveal the mechanisms underlying its regulation of development. Our second goal is to determine how the nif genes are expressed. It is important to understand the mechanisms controlling nif genes since they represent the culmination of the differentiation process and the essence of heterocyst function. The Anabaena genome lacks the genes required for expression of nif genes present in other organisms such as rpoN (sigma 54

Progranulin regulates neurogenesis in the developing vertebrate retina.

Science.gov (United States)

Walsh, Caroline E; Hitchcock, Peter F

2017-09-01

We evaluated the expression and function of the microglia-specific growth factor, Progranulin-a (Pgrn-a) during developmental neurogenesis in the embryonic retina of zebrafish. At 24 hpf pgrn-a is expressed throughout the forebrain, but by 48 hpf pgrn-a is exclusively expressed by microglia and/or microglial precursors within the brain and retina. Knockdown of Pgrn-a does not alter the onset of neurogenic programs or increase cell death, however, in its absence, neurogenesis is significantly delayed-retinal progenitors fail to exit the cell cycle at the appropriate developmental time and postmitotic cells do not acquire markers of terminal differentiation, and microglial precursors do not colonize the retina. Given the link between Progranulin and cell cycle regulation in peripheral tissues and transformed cells, we analyzed cell cycle kinetics among retinal progenitors following Pgrn-a knockdown. Depleting Pgrn-a results in a significant lengthening of the cell cycle. These data suggest that Pgrn-a plays a dual role during nervous system development by governing the rate at which progenitors progress through the cell cycle and attracting microglial progenitors into the embryonic brain and retina. Collectively, these data show that Pgrn-a governs neurogenesis by regulating cell cycle kinetics and the transition from proliferation to cell cycle exit and differentiation. © 2017 The Authors. Developmental Neurobiology Published by Wiley Periodicals, Inc. Develop Neurobiol 77: 1114-1129, 2017. © 2017 The Authors. Developmental Neurobiology Published by Wiley Periodicals, Inc.

Population genetic structure of a centipede species with high levels of developmental instability.

Directory of Open Access Journals (Sweden)

Giuseppe Fusco

Full Text Available European populations of the geophilomorph centipede Haplophilus subterraneus show a high proportion of individuals with morphological anomalies, suggesting high levels of developmental instability. The broad geographic distribution of this phenomenon seems to exclude local environmental causes, but the source of instability is still to be identified. The goal of the present study was to collect quantitative data on the occurrence of phenodeviants in different populations, along with data on the patterns of genetic variation within and between populations, in order to investigate possible association between developmental instability and genetic features. In a sample of 11 populations of H. subterraneus, distributed in western and central Europe, we looked for phenodeviants, in particular with respect to trunk morphology, and studied genetic variation through the genotyping of microsatellite loci. Overall, no support was found to the idea that developmental instability in H. subterraneus is related to a specific patterns of genetic variation, including inbreeding estimates. We identified a major genetic partition that subdivides French populations from the others, and a low divergence among northwestern areas, which are possibly related to the post-glacial recolonization from southern refugia and/or to recent anthropogenic soil displacements. A weak correlation between individual number of leg bearing segments and the occurrence of trunk anomalies seems to support a trade-off between these two developmental traits. These results, complemented by preliminary data on developmental stability in two related species, suggest that the phenomenon has not a simple taxonomic distribution, while it exhibits an apparent localization in central and eastern Europe.

Macrophage/epithelium cross-talk regulates cell cycle progression and migration in pancreatic progenitors.

Directory of Open Access Journals (Sweden)

Kristin Mussar

Full Text Available Macrophages populate the mesenchymal compartment of all organs during embryogenesis and have been shown to support tissue organogenesis and regeneration by regulating remodeling of the extracellular microenvironment. Whether this mesenchymal component can also dictate select developmental decisions in epithelia is unknown. Here, using the embryonic pancreatic epithelium as model system, we show that macrophages drive the epithelium to execute two developmentally important choices, i.e. the exit from cell cycle and the acquisition of a migratory phenotype. We demonstrate that these developmental decisions are effectively imparted by macrophages activated toward an M2 fetal-like functional state, and involve modulation of the adhesion receptor NCAM and an uncommon "paired-less" isoform of the transcription factor PAX6 in the epithelium. Over-expression of this PAX6 variant in pancreatic epithelia controls both cell motility and cell cycle progression in a gene-dosage dependent fashion. Importantly, induction of these phenotypes in embryonic pancreatic transplants by M2 macrophages in vivo is associated with an increased frequency of endocrine-committed cells emerging from ductal progenitor pools. These results identify M2 macrophages as key effectors capable of coordinating epithelial cell cycle withdrawal and cell migration, two events critical to pancreatic progenitors' delamination and progression toward their differentiated fates.

Macrophage/epithelium cross-talk regulates cell cycle progression and migration in pancreatic progenitors.

Science.gov (United States)

Mussar, Kristin; Tucker, Andrew; McLennan, Linsey; Gearhart, Addie; Jimenez-Caliani, Antonio J; Cirulli, Vincenzo; Crisa, Laura

2014-01-01

Macrophages populate the mesenchymal compartment of all organs during embryogenesis and have been shown to support tissue organogenesis and regeneration by regulating remodeling of the extracellular microenvironment. Whether this mesenchymal component can also dictate select developmental decisions in epithelia is unknown. Here, using the embryonic pancreatic epithelium as model system, we show that macrophages drive the epithelium to execute two developmentally important choices, i.e. the exit from cell cycle and the acquisition of a migratory phenotype. We demonstrate that these developmental decisions are effectively imparted by macrophages activated toward an M2 fetal-like functional state, and involve modulation of the adhesion receptor NCAM and an uncommon "paired-less" isoform of the transcription factor PAX6 in the epithelium. Over-expression of this PAX6 variant in pancreatic epithelia controls both cell motility and cell cycle progression in a gene-dosage dependent fashion. Importantly, induction of these phenotypes in embryonic pancreatic transplants by M2 macrophages in vivo is associated with an increased frequency of endocrine-committed cells emerging from ductal progenitor pools. These results identify M2 macrophages as key effectors capable of coordinating epithelial cell cycle withdrawal and cell migration, two events critical to pancreatic progenitors' delamination and progression toward their differentiated fates.

Thyroid Hormone Regulates the Expression of the Sonic Hedgehog Signaling Pathway in the Embryonic and Adult Mammalian Brain

OpenAIRE

Desouza, Lynette A.; Sathanoori, Malini; Kapoor, Richa; Rajadhyaksha, Neha; Gonzalez, Luis E.; Kottmann, Andreas H.; Tole, Shubha; Vaidya, Vidita A.

2011-01-01

Thyroid hormone is important for development and plasticity in the immature and adult mammalian brain. Several thyroid hormone-responsive genes are regulated during specific developmental time windows, with relatively few influenced across the lifespan. We provide novel evidence that thyroid hormone regulates expression of the key developmental morphogen sonic hedgehog (Shh), and its coreceptors patched (Ptc) and smoothened (Smo), in the early embryonic and adult forebrain. Maternal hypo- and...

Heterogeneity among Peer-Rejected Boys across Middle Childhood: Developmental Pathways of Social Behavior.

Science.gov (United States)

Haselager, Gerbert J. T.; Cillessen, Antonius H. N.; Van Lieshout, Cornelius F. M.; Riksen-Walraven, J. Marianne A.; Hartup, Willard W.

2002-01-01

This longitudinal study identified subgroups of rejected boys with different developmental pathways of aggression and prosocial behavior during middle childhood. Four subgroups were identified associated with different patterns of sociometric acceptance and rejection over time and with social emotional adjustment in the last measurement wave.…

Transcriptional profiling identifies differentially expressed genes in developing turkey skeletal muscle

Directory of Open Access Journals (Sweden)

Velleman Sandra G

2011-03-01

Full Text Available Abstract Background Skeletal muscle growth and development from embryo to adult consists of a series of carefully regulated changes in gene expression. Understanding these developmental changes in agriculturally important species is essential to the production of high quality meat products. For example, consumer demand for lean, inexpensive meat products has driven the turkey industry to unprecedented production through intensive genetic selection. However, achievements of increased body weight and muscle mass have been countered by an increased incidence of myopathies and meat quality defects. In a previous study, we developed and validated a turkey skeletal muscle-specific microarray as a tool for functional genomics studies. The goals of the current study were to utilize this microarray to elucidate functional pathways of genes responsible for key events in turkey skeletal muscle development and to compare differences in gene expression between two genetic lines of turkeys. To achieve these goals, skeletal muscle samples were collected at three critical stages in muscle development: 18d embryo (hyperplasia, 1d post-hatch (shift from myoblast-mediated growth to satellite cell-modulated growth by hypertrophy, and 16wk (market age from two genetic lines: a randombred control line (RBC2 maintained without selection pressure, and a line (F selected from the RBC2 line for increased 16wk body weight. Array hybridizations were performed in two experiments: Experiment 1 directly compared the developmental stages within genetic line, while Experiment 2 directly compared the two lines within each developmental stage. Results A total of 3474 genes were differentially expressed (false discovery rate; FDR Conclusions The current study identified gene pathways and uncovered novel genes important in turkey muscle growth and development. Future experiments will focus further on several of these candidate genes and the expression and mechanism of action of

A Brief Overview of Adolescent Developmental Problems in Hong Kong

Science.gov (United States)

Shek, Daniel T. L.; Keung Ma, Hing; Sun, Rachel C. F.

2011-01-01

Several adolescent developmental problems in Hong Kong are briefly reviewed in this paper. First, rising adolescent substance abuse trends are described. Second, Internet use problems and Internet addiction among young people are examined. Third, worrying trends in adolescent sexuality are identified. Fourth, phenomena on bullying among young people are reviewed. Finally, phenomena related to adolescent materialistic orientation are focused upon. With reference to these adolescent developmental problems, possible solutions are briefly discussed particularly with reference to the ecological perspective. It is argued that the related scientific literature provides useful pointers for designing the curriculum in the extension phase of the Project P.A.T.H.S. in Hong Kong. PMID:22194661

Growth Conditions Regulate the Requirements for Caulobacter Chromosome Segregation

DEFF Research Database (Denmark)

Shebelut, Conrad W.; Jensen, Rasmus Bugge; Gitai, Zemer

2009-01-01

Growth environments are important metabolic and developmental regulators. Here we demonstrate a growth environment-dependent effect on Caulobacter chromosome segregation of a small-molecule inhibitor of the MreB bacterial actin cytoskeleton. Our results also implicate ParAB as important segregation...... determinants, suggesting that multiple distinct mechanisms can mediate Caulobacter chromosome segregation and that their relative contributions can be environmentally regulated....

Attention Dysfunction Subtypes of Developmental Dyslexia

OpenAIRE

Lewandowska, Monika; Milner, Rafał; Ganc, Małgorzata; Włodarczyk, Elżbieta; Skarżyński, Henryk

2014-01-01

Background Previous studies indicate that many different aspects of attention are impaired in children diagnosed with developmental dyslexia (DD). The objective of the present study was to identify cognitive profiles of DD on the basis of attentional test performance. Material/Methods 78 children with DD (30 girls, 48 boys, mean age of 12 years ±8 months) and 32 age- and sex-matched non-dyslexic children (14 girls, 18 boys) were examined using a battery of standardized tests of reading, phono...

Tracking developmentally regulated post-synthetic processing of homogalacturonan and chitin using reciprocal oligosaccharide probes

DEFF Research Database (Denmark)

Mravec, Jozef; Kračun, Stjepan K.; Rydahl, Maja G.

2014-01-01

Polysaccharides are major components of extracellular matrices and are often extensively modified post-synthetically to suit local requirements and developmental programmes. However, our current understanding of the spatiotemporal dynamics and functional significance of these modifications is lim...... and animal systems. We demonstrated their potential for providing new biological insights by using them to study homogalacturonan processing during Arabidopsis thaliana root cap development and by analyzing sites of chitosan deposition in fungal cell walls and arthropod exoskeletons....

An emerging picture of the seed desiccome: confirmed regulators and newcomers identified using transcriptome comparison.

Science.gov (United States)

Terrasson, Emmanuel; Buitink, Julia; Righetti, Karima; Ly Vu, Benoit; Pelletier, Sandra; Zinsmeister, Julia; Lalanne, David; Leprince, Olivier

2013-01-01

Desiccation tolerance (DT) is the capacity to withstand total loss of cellular water. It is acquired during seed filling and lost just after germination. However, in many species, a germinated seed can regain DT under adverse conditions such as osmotic stress. The genes, proteins and metabolites that are required to establish this DT is referred to as the desiccome. It includes both a range of protective mechanisms and underlying regulatory pathways that remain poorly understood. As a first step toward the identification of the seed desiccome of Medicago truncatula, using updated microarrays we characterized the overlapping transcriptomes associated with acquisition of DT in developing seeds and the re-establishment of DT in germinated seeds using a polyethylene glycol treatment (-1.7 MPa). The resulting list contained 740 and 2829 transcripts whose levels, respectively, increased and decreased with DT. Fourty-eight transcription factors (TF) were identified including MtABI3, MtABI5 and many genes regulating flowering transition and cell identity. A promoter enrichment analysis revealed a strong over-representation of ABRE elements together with light-responsive cis-acting elements. In Mtabi5 Tnt1 insertion mutants, DT could no longer be re-established by an osmotic stress. Transcriptome analysis on Mtabi5 radicles during osmotic stress revealed that 13 and 15% of the up-regulated and down-regulated genes, respectively, are mis-regulated in the mutants and might be putative downstream targets of MtABI5 implicated in the re-establishment of DT. Likewise, transcriptome comparisons of the desiccation sensitive Mtabi3 mutants and hairy roots ectopically expressing MtABI3 revealed that 35 and 23% of the up-regulated and down-regulated genes are acting downstream of MtABI3. Our data suggest that ABI3 and ABI5 have complementary roles in DT. Whether DT evolved by co-opting existing pathways regulating flowering and cellular phase transition and cell identity is discussed.

An emerging picture of the seed desiccome: confirmed regulators and newcomers identified using transcriptome comparison

Directory of Open Access Journals (Sweden)

Emmanuel eTerrasson

2013-12-01

Full Text Available Desiccation tolerance (DT is the capacity to withstand total loss of cellular water. It is acquired during seed filling and lost just after germination. However, in many species, a germinated seed can regain DT under adverse conditions such as osmotic stress. The genes, proteins and metabolites that are required to establish this DT is referred to as the desiccome. It includes both a range of protective mechanisms and underlying regulatory pathways that remain poorly understood. As a first step towards the identification of the seed desiccome of Medicago truncatula, using updated microarrays we characterised the overlapping transcriptomes associated with acquisition of DT in developing seeds and the re-establishment of DT in germinated seeds using a polyethylene glycol treatment (-1.7 MPa. The resulting list contained 740 and 2829 transcripts whose levels respectively increased and decreased with DT. Fourty-eight transcription factors were identified including MtABI3, MtABI5 and many genes regulating flowering transition and cell identity. A promoter enrichment analysis revealed a strong over-representation of ABRE elements together with light-responsive cis-acting elements. In Mtabi5 Tnt1 insertion mutants, DT could no longer be re-established by an osmotic stress. Transcriptome analysis on Mtabi5 radicles during osmotic stress revealed that 13 and 15 % of the up-regulated and down-regulated genes, respectively, are mis-regulated in the mutants and might be putative downstream targets of MtABI5 implicated in the re-establishment of DT. Likewise, transcriptome comparisons of the desiccation sensitive Mtabi3 mutants and hairy roots ectopically expressing MtABI3 revealed that 35% and 23% of the up-regulated and down-regulated genes are acting downstream of MtABI3. Our data suggest that ABI3 and ABI5 have complementary roles in DT. Whether DT evolved by co-opting existing pathways regulating flowering and cellular phase transition and cell identity

Myostatin regulates miR-431 expression via the Ras-Mek-Erk signaling pathway.

Science.gov (United States)

Wu, Rimao; Li, Hu; Li, Tingting; Zhang, Yong; Zhu, Dahai

2015-05-29

MicroRNAs (miRNAs) play critical regulatory roles in controlling myogenic development both in vitro and in vivo; however, the molecular mechanisms underlying transcriptional regulation of miRNA genes in skeletal muscle cells are largely unknown. Here, using a microarray hybridization approach, we identified myostatin-regulated miRNA genes in skeletal muscle tissues by systematically searching miRNAs that are differentially expressed between wild-type and myostatin-null mice during development. We found that 116 miRNA genes were differentially expressed in muscles between these mice across different developmental stages. We further characterized myostatin-regulated miR-431 was upregulated in skeletal muscle tissues of myostatin-null mice. In functional studies, we found that overexpression of miR-431 in C2C12 myoblast cells attenuated myostatin-induced suppression of myogenic differentiation. Mechanistic studies further demonstrated that myostatin acted through the Ras-Mek-Erk signaling pathway to transcriptionally regulate miR-431 expression C2C12 cells. Our findings provide new insight into the mechanisms underlying transcriptional regulation of miRNA genes by myostatin during skeletal muscle development. Copyright © 2015 Elsevier Inc. All rights reserved.

Communication difficulties in children identified with psychiatric problems

OpenAIRE

Helland, Wenche Andersen

2010-01-01

Several studies have pointed to an overlap between different developmental psychopathological conditions and language impairments, and difficulties with communication have been identified in children of various diagnostic backgrounds. This thesis is based on three empirical studies, and the purposes are to investigate communication difficulties as reported by parents, in children identified with psychiatric problems as well as to evaluate a Norwegian adaptation of the Children’...

Cognitive-emotional interplay:implications for children’s development of self-aware emotion regulation as the last developmental phase of emotional intelligence

OpenAIRE

Kralj, S. (Sara)

2016-01-01

Abstract Cognitive and emotional developmental trajectories account for individual differences in children. Individual variations of emotional intelligence may be a result of various factors. For the purpose of this work children’s development of emotional intelligence is examined through individual developmental aspect related to development of cognition and emotion. The ability to be aware of own emotions and emotions of ...

Research Resource: A Dual Proteomic Approach Identifies Regulated Islet Proteins During β-Cell Mass Expansion In Vivo

DEFF Research Database (Denmark)

Horn, Signe; Kirkegaard, Jeannette S.; Hoelper, Soraya

2016-01-01

to be up regulated as a response to pregnancy. These included several proteins, not previously associated with pregnancy-induced islet expansion, such as CLIC1, STMN1, MCM6, PPIB, NEDD4, and HLTF. Confirming the validity of our approach, we also identified proteins encoded by genes known to be associated...

Toward an understanding of late life suicidal behavior: the role of lifespan developmental theory.

Science.gov (United States)

Fiske, Amy; O'Riley, Alisa A

2016-01-01

Suicidal behavior in late life differs in important ways from suicidal behavior that occurs earlier in the lifespan, suggesting the possibility of developmental differences in the etiology of suicidal behavior. This paper examines late life suicidal behavior within the context of lifespan developmental theory. This paper presents a conceptual framework for using lifespan developmental theory to better understand late life suicidal behavior. We argue that the motivational theory of lifespan development, which focuses on control, is particularly relevant to late life suicide. This theory posits that opportunities to exert control over important aspects of one's life diminish in late life as a result of declines in physical functioning and other factors, and that successful aging is associated with adaptive regulation of this developmental change. Although continued striving to meet goals is normative throughout the lifespan, most individuals also increase the use of compensatory strategies in old age or when faced with a decline in functioning. We propose that individuals who do not adapt to developmental changes by altering their strategies for exerting control will be at risk for suicidal behavior in late life. This paper reviews evidence that supports the importance of control with respect to suicidal outcomes in older adults, as well as findings regarding specific types of control strategies that may be related to suicide risk in older adults with health-related limitations. Although suicidal behavior is not a normal part of aging, the application of lifespan developmental theory may be useful in understanding and potentially preventing suicide among older adults.

Effects of a parent-implemented Developmental Reciprocity Treatment Program for children with autism spectrum disorder.

Science.gov (United States)

Gengoux, Grace W; Schapp, Salena; Burton, Sarah; Ardel, Christina M; Libove, Robin A; Baldi, Gina; Berquist, Kari L; Phillips, Jennifer M; Hardan, Antonio Y

2018-05-01

Developmental approaches to autism treatment aim to establish strong interpersonal relationships through joint play. These approaches have emerging empirical support; however, there is a need for further research documenting the procedures and demonstrating their effectiveness. This pilot study evaluated changes in parent behavior and child autism symptoms following a 12-week Developmental Reciprocity Treatment parent-training program. A total of 22 children with autism spectrum disorder between 2 and 6 years (mean age = 44.6 months, standard deviation = 12.7) and a primary caregiver participated in 12 weekly sessions of Developmental Reciprocity Treatment parent training, covering topics including introduction to developmental approaches, supporting attention and motivation, sensory regulation and sensory-social routines, imitation/building nonverbal communication, functional language development, and turn taking. Results indicated improvement in aspects of parent empowerment and social quality of life. Improvement in core autism symptoms was observed on the Social Responsiveness Scale total score (F(1,19): 5.550, p = 0.029), MacArthur-Bates Communicative Development Inventories number of words produced out of 680 (F(1,18): 18.104, p = 0.000), and two subscales of the Repetitive Behavior Scale, Revised (compulsive, p = 0.046 and restricted, p = 0.025). No differences in sensory sensitivity were observed on the Short Sensory Profile. Findings from this pilot study indicate that Developmental Reciprocity Treatment shows promise and suggest the need for future controlled trials of this developmentally based intervention.

Longitudinal Stability of Phonological and Surface Subtypes of Developmental Dyslexia

Science.gov (United States)

Peterson, Robin L.; Pennington, Bruce F.; Olson, Richard K.; Wadsworth, Sally J.

2014-01-01

Limited evidence supports the external validity of the distinction between developmental phonological and surface dyslexia. We previously identified children ages 8 to 13 meeting criteria for these subtypes (Peterson, Pennington, & Olson, 2013) and now report on their reading and related skills approximately 5 years later. Longitudinal…

Regulation of rice root development by a retrotransposon acting as a microRNA sponge.

Science.gov (United States)

Cho, Jungnam; Paszkowski, Jerzy

2017-08-26

It is well documented that transposable elements (TEs) can regulate the expression of neighbouring genes. However, their ability to act in trans and influence ectopic loci has been reported rarely. We searched in rice transcriptomes for tissue-specific expression of TEs and found them to be regulated developmentally. They often shared sequence homology with co-expressed genes and contained potential microRNA-binding sites, which suggested possible contributions to gene regulation. In fact, we have identified a retrotransposon that is highly transcribed in roots and whose spliced transcript constitutes a target mimic for miR171. miR171 destabilizes mRNAs encoding the root-specific family of SCARECROW-Like transcription factors. We demonstrate that retrotransposon-derived transcripts act as decoys for miR171, triggering its degradation and thus results in the root-specific accumulation of SCARECROW-Like mRNAs. Such transposon-mediated post-transcriptional control of miR171 levels is conserved in diverse rice species.

Communication-Based Assessment of Developmental Age for Young Children with Developmental Disabilities

Science.gov (United States)

DeVeney, Shari L.; Hoffman, Lesa; Cress, Cynthia J.

2012-01-01

Purpose: In this study, the authors compared a multiple-domain strategy for assessing developmental age of young children with developmental disabilities who were at risk for long-term reliance on augmentative and alternative communication (AAC) with a communication-based strategy composed of receptive language and communication indices that may…

Transcriptional regulation of gene expression clusters in motor neurons following spinal cord injury

Directory of Open Access Journals (Sweden)

Westerdahl Ann-Charlotte

2010-06-01

Full Text Available Abstract Background Spinal cord injury leads to neurological dysfunctions affecting the motor, sensory as well as the autonomic systems. Increased excitability of motor neurons has been implicated in injury-induced spasticity, where the reappearance of self-sustained plateau potentials in the absence of modulatory inputs from the brain correlates with the development of spasticity. Results Here we examine the dynamic transcriptional response of motor neurons to spinal cord injury as it evolves over time to unravel common gene expression patterns and their underlying regulatory mechanisms. For this we use a rat-tail-model with complete spinal cord transection causing injury-induced spasticity, where gene expression profiles are obtained from labeled motor neurons extracted with laser microdissection 0, 2, 7, 21 and 60 days post injury. Consensus clustering identifies 12 gene clusters with distinct time expression profiles. Analysis of these gene clusters identifies early immunological/inflammatory and late developmental responses as well as a regulation of genes relating to neuron excitability that support the development of motor neuron hyper-excitability and the reappearance of plateau potentials in the late phase of the injury response. Transcription factor motif analysis identifies differentially expressed transcription factors involved in the regulation of each gene cluster, shaping the expression of the identified biological processes and their associated genes underlying the changes in motor neuron excitability. Conclusions This analysis provides important clues to the underlying mechanisms of transcriptional regulation responsible for the increased excitability observed in motor neurons in the late chronic phase of spinal cord injury suggesting alternative targets for treatment of spinal cord injury. Several transcription factors were identified as potential regulators of gene clusters containing elements related to motor neuron hyper

Transcriptional regulation of gene expression clusters in motor neurons following spinal cord injury.

Science.gov (United States)

Ryge, Jesper; Winther, Ole; Wienecke, Jacob; Sandelin, Albin; Westerdahl, Ann-Charlotte; Hultborn, Hans; Kiehn, Ole

2010-06-09

Spinal cord injury leads to neurological dysfunctions affecting the motor, sensory as well as the autonomic systems. Increased excitability of motor neurons has been implicated in injury-induced spasticity, where the reappearance of self-sustained plateau potentials in the absence of modulatory inputs from the brain correlates with the development of spasticity. Here we examine the dynamic transcriptional response of motor neurons to spinal cord injury as it evolves over time to unravel common gene expression patterns and their underlying regulatory mechanisms. For this we use a rat-tail-model with complete spinal cord transection causing injury-induced spasticity, where gene expression profiles are obtained from labeled motor neurons extracted with laser microdissection 0, 2, 7, 21 and 60 days post injury. Consensus clustering identifies 12 gene clusters with distinct time expression profiles. Analysis of these gene clusters identifies early immunological/inflammatory and late developmental responses as well as a regulation of genes relating to neuron excitability that support the development of motor neuron hyper-excitability and the reappearance of plateau potentials in the late phase of the injury response. Transcription factor motif analysis identifies differentially expressed transcription factors involved in the regulation of each gene cluster, shaping the expression of the identified biological processes and their associated genes underlying the changes in motor neuron excitability. This analysis provides important clues to the underlying mechanisms of transcriptional regulation responsible for the increased excitability observed in motor neurons in the late chronic phase of spinal cord injury suggesting alternative targets for treatment of spinal cord injury. Several transcription factors were identified as potential regulators of gene clusters containing elements related to motor neuron hyper-excitability, the manipulation of which potentially could be

A developmental screening tool for toddlers with multiple domains based on Rasch analysis.

Science.gov (United States)

Hwang, Ai-Wen; Chou, Yeh-Tai; Hsieh, Ching-Lin; Hsieh, Wu-Shiun; Liao, Hua-Fang; Wong, Alice May-Kuen

2015-01-01

Using multidomain developmental screening tools is a feasible method for pediatric health care professionals to identify children at risk of developmental problems in multiple domains simultaneously. The purpose of this study was to develop a Rasch-based tool for Multidimensional Screening in Child Development (MuSiC) for children aged 0-3 years. The MuSic was developed by constructing items bank based on three commonly used screening tools, validating with developmental status (at risk for delay or not) on five developmental domains. Parents of a convenient sample of 632 children (aged 3-35.5 months) with and without developmental delays responded to items from the three screening tools funded by health authorities in Taiwan. Item bank was determined by item fit of Rasch analysis for each of the five developmental domains (cognitive skills, language skills, gross motor skills, fine motor skills, and socioadaptive skills). Children's performance scores in logits derived in Rasch analysis were validated with developmental status for each domain using the area under receiver operating characteristic curves. MuSiC, a 75-item developmental screening tool for five domains, was derived. The diagnostic validity of all five domains was acceptable for all stages of development, except for the infant stage (≤11 months and 15 days). MuSiC can be applied simultaneously to well-child care visits as a universal screening tool for children aged 1-3 years on multiple domains. Items with sound validity for infants need to be further developed. Copyright © 2014. Published by Elsevier B.V.

The promise of two-person neuroscience for developmental psychiatry: Using interaction-based sociometrics to identify disorders of social interaction

OpenAIRE

Leong, Victoria; Schilbach, Leonhard

2018-01-01

Social interactions are fundamental for human development, and disordered social interactions are pervasive in many psychiatric disorders. Recent advances in “two-person neuroscience” have provided new tools for characterising social interactions. Accordingly, interaction-based ‘sociometrics’ hold great promise for developmental psychology and psychiatry, particularly in the early identification of social disorders.

Transcript profiling of Elf5+/- mammary glands during pregnancy identifies novel targets of Elf5.

Directory of Open Access Journals (Sweden)

Renee L Rogers

Full Text Available BACKGROUND: Elf5, an epithelial specific Ets transcription factor, plays a crucial role in the pregnancy-associated development of the mouse mammary gland. Elf5(-/- embryos do not survive, however the Elf5(+/- mammary gland displays a severe pregnancy-associated developmental defect. While it is known that Elf5 is crucial for correct mammary development and lactation, the molecular mechanisms employed by Elf5 to exert its effects on the mammary gland are largely unknown. PRINCIPAL FINDINGS: Transcript profiling was used to investigate the transcriptional changes that occur as a result of Elf5 haploinsufficiency in the Elf5(+/- mouse model. We show that the development of the mouse Elf5(+/- mammary gland is delayed at a transcriptional and morphological level, due to the delayed increase in Elf5 protein in these glands. We also identify a number of potential Elf5 target genes, including Mucin 4, whose expression, is directly regulated by the binding of Elf5 to an Ets binding site within its promoter. CONCLUSION: We identify novel transcriptional targets of Elf5 and show that Muc4 is a direct target of Elf5, further elucidating the mechanisms through which Elf5 regulates proliferation and differentiation in the mammary gland.

NF-Y recruits both transcription activator and repressor to modulate tissue- and developmental stage-specific expression of human γ-globin gene.

Directory of Open Access Journals (Sweden)

Xingguo Zhu

Full Text Available The human embryonic, fetal and adult β-like globin genes provide a paradigm for tissue- and developmental stage-specific gene regulation. The fetal γ-globin gene is expressed in fetal erythroid cells but is repressed in adult erythroid cells. The molecular mechanism underlying this transcriptional switch during erythroid development is not completely understood. Here, we used a combination of in vitro and in vivo assays to dissect the molecular assemblies of the active and the repressed proximal γ-globin promoter complexes in K562 human erythroleukemia cell line and primary human fetal and adult erythroid cells. We found that the proximal γ-globin promoter complex is assembled by a developmentally regulated, general transcription activator NF-Y bound strongly at the tandem CCAAT motifs near the TATA box. NF-Y recruits to neighboring DNA motifs the developmentally regulated, erythroid transcription activator GATA-2 and general repressor BCL11A, which in turn recruit erythroid repressor GATA-1 and general repressor COUP-TFII to form respectively the NF-Y/GATA-2 transcription activator hub and the BCL11A/COUP-TFII/GATA-1 transcription repressor hub. Both the activator and the repressor hubs are present in both the active and the repressed γ-globin promoter complexes in fetal and adult erythroid cells. Through changes in their levels and respective interactions with the co-activators and co-repressors during erythroid development, the activator and the repressor hubs modulate erythroid- and developmental stage-specific transcription of γ-globin gene.

A genetic screen identifies BRCA2 and PALB2 as key regulators of G2 checkpoint maintenance

DEFF Research Database (Denmark)

Menzel, Tobias; Nähse-Kumpf, Viola; Kousholt, Arne Nedergaard

2011-01-01

To identify key connections between DNA-damage repair and checkpoint pathways, we performed RNA interference screens for regulators of the ionizing radiation-induced G2 checkpoint, and we identified the breast cancer gene BRCA2. The checkpoint was also abrogated following depletion of PALB2......, an interaction partner of BRCA2. BRCA2 and PALB2 depletion led to premature checkpoint abrogation and earlier activation of the AURORA A-PLK1 checkpoint-recovery pathway. These results indicate that the breast cancer tumour suppressors and homologous recombination repair proteins BRCA2 and PALB2 are main...

Developmental plasticity: Friend or foe?

Science.gov (United States)

Michels, Karin B

2017-01-01

Developmental plasticity - the concept that adaptation to changing and unfavorable environmental conditions are possible but may come at the price of compromised health potentials - has evolutionary grounding as it facilitates survival but dissents with fundamental evolutionary principles in that it may advance the lesser fit. It is an important cornerstone of the Developmental Origins of Health and Disease (DOHaD). Unlike evolutionary adaptation developmental plasticity may be short-lived and restricted to one or few generations and inheritance is uncertain. Potential mechanisms include epigenetic modifications adopted in utero which may not transmit to the next generation; future insights may allow adjustments of the outcomes of developmental plasticity.

Katanin: A Sword Cutting Microtubules for Cellular, Developmental, and Physiological Purposes

Directory of Open Access Journals (Sweden)

Ivan Luptovčiak

2017-11-01

Full Text Available KATANIN is a well-studied microtubule severing protein affecting microtubule organization and dynamic properties in higher plants. By regulating mitotic and cytokinetic and cortical microtubule arrays it is involved in the progression of cell division and cell division plane orientation. KATANIN is also involved in cell elongation and morphogenesis during plant growth. In this way KATANIN plays critical roles in diverse plant developmental processes including the development of pollen, embryo, seed, meristem, root, hypocotyl, cotyledon, leaf, shoot, and silique. KATANIN-dependent microtubule regulation seems to be under the control of plant hormones. This minireview provides an overview on available KATANIN mutants and discusses advances in our understanding of KATANIN biological roles in plants.

Protein expression in the nucleus accumbens of rats exposed to developmental vitamin D deficiency.

Directory of Open Access Journals (Sweden)

John McGrath

Full Text Available INTRODUCTION: Developmental vitamin D (DVD deficiency is a candidate risk factor for schizophrenia. Animal models have confirmed that DVD deficiency is associated with a range of altered genomic, proteomic, structural and behavioural outcomes in the rat. Because the nucleus accumbens has been implicated in neuropsychiatric disorders, in the current study we examined protein expression in this region in adult rats exposed to DVD deficiency METHODS: Female Sprague Dawley rats were maintained on a vitamin D deficient diet for 6 weeks, mated and allowed to give birth, after which a diet containing vitamin D was reintroduced. Male adult offspring (n = 8 were compared to control male (n = 8. 2-D gel electrophoresis-based proteomics and mass spectroscopy were used to investigate differential protein expression. RESULTS: There were 35 spots, mapped to 33 unique proteins, which were significantly different between the two groups. Of these, 22 were down-regulated and 13 up-regulated. The fold changes were uniformly small, with the largest FC being -1.67. Within the significantly different spots, three calcium binding proteins (calbindin1, calbindin2 and hippocalcin were altered. Other proteins associated with DVD deficiency related to mitochondrial function, and the dynamin-like proteins. CONCLUSIONS: Developmental vitamin D deficiency was associated with subtle changes in protein expression in the nucleus accumbens. Disruptions in pathways related to calcium-binding proteins and mitochondrial function may underlie some of the behavioural features associated with animal models of developmental vitamin D deficiency.

The Diagnostic Yield of Array Comparative Genomic Hybridization Is High Regardless of Severity of Intellectual Disability/Developmental Delay in Children.

Science.gov (United States)

D'Arrigo, Stefano; Gavazzi, Francesco; Alfei, Enrico; Zuffardi, Orsetta; Montomoli, Cristina; Corso, Barbara; Buzzi, Erika; Sciacca, Francesca L; Bulgheroni, Sara; Riva, Daria; Pantaleoni, Chiara

2016-05-01

Microarray-based comparative genomic hybridization is a method of molecular analysis that identifies chromosomal anomalies (or copy number variants) that correlate with clinical phenotypes. The aim of the present study was to apply a clinical score previously designated by de Vries to 329 patients with intellectual disability/developmental disorder (intellectual disability/developmental delay) referred to our tertiary center and to see whether the clinical factors are associated with a positive outcome of aCGH analyses. Another goal was to test the association between a positive microarray-based comparative genomic hybridization result and the severity of intellectual disability/developmental delay. Microarray-based comparative genomic hybridization identified structural chromosomal alterations responsible for the intellectual disability/developmental delay phenotype in 16% of our sample. Our study showed that causative copy number variants are frequently found even in cases of mild intellectual disability (30.77%). We want to emphasize the need to conduct microarray-based comparative genomic hybridization on all individuals with intellectual disability/developmental delay, regardless of the severity, because the degree of intellectual disability/developmental delay does not predict the diagnostic yield of microarray-based comparative genomic hybridization. © The Author(s) 2015.

Developmental Trajectories of Childhood Obesity and Risk Behaviors in Adolescence

Science.gov (United States)

Huang, David Y. C.; Lanza, H. Isabella; Wright-Volel, Kynna; Anglin, M. Douglas

2013-01-01

Using group-based trajectory modeling, this study examined 5156 adolescents from the child sample of the 1979 National Longitudinal Survey of Youth to identify developmental trajectories of obesity from ages 6-18 and evaluate associations of such trajectories with risk behaviors and psychosocial health in adolescence. Four distinctive obesity…

Developmental expression of the alpha-skeletal actin gene

Directory of Open Access Journals (Sweden)

Vonk Freek J

2008-06-01

Full Text Available Abstract Background Actin is a cytoskeletal protein which exerts a broad range of functions in almost all eukaryotic cells. In higher vertebrates, six primary actin isoforms can be distinguished: alpha-skeletal, alpha-cardiac, alpha-smooth muscle, gamma-smooth muscle, beta-cytoplasmic and gamma-cytoplasmic isoactin. Expression of these actin isoforms during vertebrate development is highly regulated in a temporal and tissue-specific manner, but the mechanisms and the specific differences are currently not well understood. All members of the actin multigene family are highly conserved, suggesting that there is a high selective pressure on these proteins. Results We present here a model for the evolution of the genomic organization of alpha-skeletal actin and by molecular modeling, illustrate the structural differences of actin proteins of different phyla. We further describe and compare alpha-skeletal actin expression in two developmental stages of five vertebrate species (mouse, chicken, snake, salamander and fish. Our findings confirm that alpha-skeletal actin is expressed in skeletal muscle and in the heart of all five species. In addition, we identify many novel non-muscular expression domains including several in the central nervous system. Conclusion Our results show that the high sequence homology of alpha-skeletal actins is reflected by similarities of their 3 dimensional protein structures, as well as by conserved gene expression patterns during vertebrate development. Nonetheless, we find here important differences in 3D structures, in gene architectures and identify novel expression domains for this structural and functional important gene.

Detection of genes regulated by Lmx1b during limb dorsalization.

Science.gov (United States)

Feenstra, Jennifer M; Kanaya, Kohei; Pira, Charmaine U; Hoffman, Sarah E; Eppey, Richard J; Oberg, Kerby C

2012-05-01

Lmx1b is a homeodomain transcription factor that regulates dorsal identity during limb development. Lmx1b knockout (KO) mice develop distal ventral-ventral limbs. Although induction of Lmx1b is linked to Wnt7a expression in the dorsal limb ectoderm, the downstream targets of Lmx1b that accomplish limb dorsalization are unknown. To identify genes targeted by Lmx1b, we compared gene arrays from Lmx1b KO and wild type mouse limbs during limb dorsalization, i.e., 11.5, 12.5, and 13.5 days post coitum. We identified 54 target genes that were differentially expressed in all three stages. Several skeletal targets, including Emx2, Matrilin1 and Matrilin4, demonstrated a loss of scapular expression in the Lmx1b KO mice, supporting a role for Lmx1b in scapula development. Furthermore, the relative abundance of extracellular matrix-related soft tissue targets regulated by Lmx1b, such as collagens and proteoglycans, suggests a mechanism that includes changes in the extracellular matrix composition to accomplish limb dorsalization. Our study provides the most comprehensive characterization of genes regulated by Lmx1b during limb development to-date and provides targets for further investigation. © 2012 The Authors. Development, Growth & Differentiation © 2012 Japanese Society of Developmental Biologists.

Polysome profiling in liver identifies dynamic regulation of endoplasmic reticulum translatome by obesity and fasting.

Directory of Open Access Journals (Sweden)

Suneng Fu

2012-08-01

Full Text Available Obesity-associated metabolic complications are generally considered to emerge from abnormalities in carbohydrate and lipid metabolism, whereas the status of protein metabolism is not well studied. Here, we performed comparative polysome and associated transcriptional profiling analyses to study the dynamics and functional implications of endoplasmic reticulum (ER-associated protein synthesis in the mouse liver under conditions of obesity and nutrient deprivation. We discovered that ER from livers of obese mice exhibits a general reduction in protein synthesis, and comprehensive analysis of polysome-bound transcripts revealed extensive down-regulation of protein synthesis machinery, mitochondrial components, and bile acid metabolism in the obese translatome. Nutrient availability also plays an important but distinct role in remodeling the hepatic ER translatome in lean and obese mice. Fasting in obese mice partially reversed the overall translatomic differences between lean and obese nonfasted controls, whereas fasting of the lean mice mimicked many of the translatomic changes induced by the development of obesity. The strongest examples of such regulations were the reduction in Cyp7b1 and Slco1a1, molecules involved in bile acid metabolism. Exogenous expression of either gene significantly lowered plasma glucose levels, improved hepatic steatosis, but also caused cholestasis, indicating the fine balance bile acids play in regulating metabolism and health. Together, our work defines dynamic regulation of the liver translatome by obesity and nutrient availability, and it identifies a novel role for bile acid metabolism in the pathogenesis of metabolic abnormalities associated with obesity.

Polysome profiling in liver identifies dynamic regulation of endoplasmic reticulum translatome by obesity and fasting.

Science.gov (United States)

Fu, Suneng; Fan, Jason; Blanco, Joshua; Gimenez-Cassina, Alfredo; Danial, Nika N; Watkins, Steve M; Hotamisligil, Gökhan S

2012-08-01

Obesity-associated metabolic complications are generally considered to emerge from abnormalities in carbohydrate and lipid metabolism, whereas the status of protein metabolism is not well studied. Here, we performed comparative polysome and associated transcriptional profiling analyses to study the dynamics and functional implications of endoplasmic reticulum (ER)-associated protein synthesis in the mouse liver under conditions of obesity and nutrient deprivation. We discovered that ER from livers of obese mice exhibits a general reduction in protein synthesis, and comprehensive analysis of polysome-bound transcripts revealed extensive down-regulation of protein synthesis machinery, mitochondrial components, and bile acid metabolism in the obese translatome. Nutrient availability also plays an important but distinct role in remodeling the hepatic ER translatome in lean and obese mice. Fasting in obese mice partially reversed the overall translatomic differences between lean and obese nonfasted controls, whereas fasting of the lean mice mimicked many of the translatomic changes induced by the development of obesity. The strongest examples of such regulations were the reduction in Cyp7b1 and Slco1a1, molecules involved in bile acid metabolism. Exogenous expression of either gene significantly lowered plasma glucose levels, improved hepatic steatosis, but also caused cholestasis, indicating the fine balance bile acids play in regulating metabolism and health. Together, our work defines dynamic regulation of the liver translatome by obesity and nutrient availability, and it identifies a novel role for bile acid metabolism in the pathogenesis of metabolic abnormalities associated with obesity.

Developmental Trends in Self-Regulation among Low-Income Toddlers

Science.gov (United States)

Raikes, H. Abigail; Robinson, JoAnn L.; Bradley, Robert H.; Raikes, Helen H.; Ayoub, Catherine C.

2007-01-01

The attainment of self-regulatory skills during the toddler years is an understudied issue, especially among low-income children. The present study used growth modeling to examine the change over time and the final status in children's abilities to self-regulate, in a sample of 2,441 low-income children aged 14 to 36 months. Positive growth in…

Sex-specific mouse liver gene expression: genome-wide analysis of developmental changes from pre-pubertal period to young adulthood

Directory of Open Access Journals (Sweden)

Conforto Tara L

2012-04-01

Full Text Available Abstract Background Early liver development and the transcriptional transitions during hepatogenesis are well characterized. However, gene expression changes during the late postnatal/pre-pubertal to young adulthood period are less well understood, especially with regards to sex-specific gene expression. Methods Microarray analysis of male and female mouse liver was carried out at 3, 4, and 8 wk of age to elucidate developmental changes in gene expression from the late postnatal/pre-pubertal period to young adulthood. Results A large number of sex-biased and sex-independent genes showed significant changes during this developmental period. Notably, sex-independent genes involved in cell cycle, chromosome condensation, and DNA replication were down regulated from 3 wk to 8 wk, while genes associated with metal ion binding, ion transport and kinase activity were up regulated. A majority of genes showing sex differential expression in adult liver did not display sex differences prior to puberty, at which time extensive changes in sex-specific gene expression were seen, primarily in males. Thus, in male liver, 76% of male-specific genes were up regulated and 47% of female-specific genes were down regulated from 3 to 8 wk of age, whereas in female liver 67% of sex-specific genes showed no significant change in expression. In both sexes, genes up regulated from 3 to 8 wk were significantly enriched (p p Ihh; female-specific Cdx4, Cux2, Tox, and Trim24 and may contribute to the developmental changes that lead to global acquisition of liver sex-specificity by 8 wk of age. Conclusions Overall, the observed changes in gene expression during postnatal liver development reflect the deceleration of liver growth and the induction of specialized liver functions, with widespread changes in sex-specific gene expression primarily occurring in male liver.

Integrative screening approach identifies regulators of polyploidization and targets for acute megakaryocytic leukemia

Science.gov (United States)

Wen, Qiang; Goldenson, Benjamin; Silver, Serena J.; Schenone, Monica; Dancik, Vladimir; Huang, Zan; Wang, Ling-Zhi; Lewis, Timothy; An, W. Frank; Li, Xiaoyu; Bray, Mark-Anthony; Thiollier, Clarisse; Diebold, Lauren; Gilles, Laure; Vokes, Martha S.; Moore, Christopher B.; Bliss-Moreau, Meghan; VerPlank, Lynn; Tolliday, Nicola J.; Mishra, Rama; Vemula, Sasidhar; Shi, Jianjian; Wei, Lei; Kapur, Reuben; Lopez, Cécile K.; Gerby, Bastien; Ballerini, Paola; Pflumio, Francoise; Gilliland, D. Gary; Goldberg, Liat; Birger, Yehudit; Izraeli, Shai; Gamis, Alan S.; Smith, Franklin O.; Woods, William G.; Taub, Jeffrey; Scherer, Christina A.; Bradner, James; Goh, Boon-Cher; Mercher, Thomas; Carpenter, Anne E.; Gould, Robert J.; Clemons, Paul A.; Carr, Steven A.; Root, David E.; Schreiber, Stuart L.; Stern, Andrew M.; Crispino, John D.

2012-01-01

Summary The mechanism by which cells decide to skip mitosis to become polyploid is largely undefined. Here we used a high-content image-based screen to identify small-molecule probes that induce polyploidization of megakaryocytic leukemia cells and serve as perturbagens to help understand this process. We found that dimethylfasudil (diMF, H-1152P) selectively increased polyploidization, mature cell-surface marker expression, and apoptosis of malignant megakaryocytes. A broadly applicable, highly integrated target identification approach employing proteomic and shRNA screening revealed that a major target of diMF is Aurora A kinase (AURKA), which has not been studied extensively in megakaryocytes. Moreover, we discovered that MLN8237 (Alisertib), a selective inhibitor of AURKA, induced polyploidization and expression of mature megakaryocyte markers in AMKL blasts and displayed potent anti-AMKL activity in vivo. This research provides the rationale to support clinical trials of MLN8237 and other inducers of polyploidization in AMKL. Finally, we have identified five networks of kinases that regulate the switch to polyploidy. PMID:22863010

Conserved patterns of integrated developmental plasticity in a group of polyphenic tropical butterflies.

Science.gov (United States)

van Bergen, Erik; Osbaldeston, Dave; Kodandaramaiah, Ullasa; Brattström, Oskar; Aduse-Poku, Kwaku; Brakefield, Paul M

2017-02-27

Developmental plasticity is thought to have profound macro-evolutionary effects, for example, by increasing the probability of establishment in new environments and subsequent divergence into independently evolving lineages. In contrast to plasticity optimized for individual traits, phenotypic integration, which enables a concerted response of plastic traits to environmental variability, may affect the rate of local adaptation by constraining independent responses of traits to selection. Using a comparative framework, this study explores the evolution of reaction norms for a variety of life history and morphological traits across five related species of mycalesine butterflies from the Old World tropics. Our data indicate that an integrated response of a suite of key traits is shared amongst these species. Interestingly, the traits that make up the functional suite are all known to be regulated by ecdysteroid signalling in Bicyclus anynana, one of the species included in this study, suggesting the same underlying hormonal regulator may be conserved within this group of polyphenic butterflies. We also detect developmental thresholds for the expression of alternative morphs. The phenotypic plasticity of a broad suite of morphological and life history traits is integrated and shared among species from three geographically independent lineages of mycalesine butterflies, despite considerable periods of independent evolution and exposure to disparate environments. At the same time, we have detected examples of evolutionary change where independent traits show different patterns of reaction norms. We argue that the expression of more robust phenotypes may occur by shifting developmental thresholds beyond the boundaries of the typical environmental variation.

Ancient Pbx-Hox signatures define hundreds of vertebrate developmental enhancers

Directory of Open Access Journals (Sweden)

Parker Hugo J

2011-12-01

Full Text Available Abstract Background Gene regulation through cis-regulatory elements plays a crucial role in development and disease. A major aim of the post-genomic era is to be able to read the function of cis-regulatory elements through scrutiny of their DNA sequence. Whilst comparative genomics approaches have identified thousands of putative regulatory elements, our knowledge of their mechanism of action is poor and very little progress has been made in systematically de-coding them. Results Here, we identify ancient functional signatures within vertebrate conserved non-coding elements (CNEs through a combination of phylogenetic footprinting and functional assay, using genomic sequence from the sea lamprey as a reference. We uncover a striking enrichment within vertebrate CNEs for conserved binding-site motifs of the Pbx-Hox hetero-dimer. We further show that these predict reporter gene expression in a segment specific manner in the hindbrain and pharyngeal arches during zebrafish development. Conclusions These findings evoke an evolutionary scenario in which many CNEs evolved early in the vertebrate lineage to co-ordinate Hox-dependent gene-regulatory interactions that pattern the vertebrate head. In a broader context, our evolutionary analyses reveal that CNEs are composed of tightly linked transcription-factor binding-sites (TFBSs, which can be systematically identified through phylogenetic footprinting approaches. By placing a large number of ancient vertebrate CNEs into a developmental context, our findings promise to have a significant impact on efforts toward de-coding gene-regulatory elements that underlie vertebrate development, and will facilitate building general models of regulatory element evolution.

Crosstalk between histone modifications maintains the developmental pattern of gene expression on a tissue-specific locus.

Science.gov (United States)

Hosey, Alison M; Chaturvedi, Chandra-Prakash; Brand, Marjorie

2010-05-16

Genome wide studies have provided a wealth of information related to histone modifications. Particular modifications, which can encompass both broad and discrete regions, are associated with certain genomic elements and gene expression status. Here we focus on how studies on the beta-globin gene cluster can complement the genome wide effort through the thorough dissection of histone modifying protein crosstalk. The beta-globin locus serves as a model system to study both regulation of gene expression driven at a distance by enhancers and mechanisms of developmental switching of clustered genes. We investigate recent studies, which uncover that histone methyltransferases, recruited at the beta-globin enhancer, control gene expression by long range propagation on chromatin. Specifically, we focus on how seemingly antagonistic complexes, such as those including MLL2, G9a and UTX, can cooperate to functionally regulate developmentally controlled gene expression. Finally, we speculate on the mechanisms of chromatin modifying complex propagation on genomic domains.

The Utility of Chromosomal Microarray Analysis in Developmental and Behavioral Pediatrics

Science.gov (United States)

Beaudet, Arthur L.

2013-01-01

Chromosomal microarray analysis (CMA) has emerged as a powerful new tool to identify genomic abnormalities associated with a wide range of developmental disabilities including congenital malformations, cognitive impairment, and behavioral abnormalities. CMA includes array comparative genomic hybridization (CGH) and single nucleotide polymorphism…

Self-Regulation Processes and Thriving in Childhood and Adolescence: A View of the Issues

Science.gov (United States)

Lerner, Richard M.; Lerner, Jacqueline V.; Bowers, Edmond P.; Lewin-Bizan, Selva; Gestsdottir, Steinunn; Urban, Jennifer Brown

2011-01-01

Both organismic and intentional self-regulation processes must be integrated across childhood and adolescence for adaptive developmental regulations to exist and for the developing person to thrive, both during the first two decades of life and through the adult years. To date, such an integrated, life-span approach to self-regulation during…

Rictor/TORC2 regulates Caenorhabditis elegans fat storage, body size, and development through sgk-1.

Directory of Open Access Journals (Sweden)

Kevin T Jones

2009-03-01

Full Text Available The target of rapamycin (TOR kinase coordinately regulates fundamental metabolic and cellular processes to support growth, proliferation, survival, and differentiation, and consequently it has been proposed as a therapeutic target for the treatment of cancer, metabolic disease, and aging. The TOR kinase is found in two biochemically and functionally distinct complexes, termed TORC1 and TORC2. Aided by the compound rapamycin, which specifically inhibits TORC1, the role of TORC1 in regulating translation and cellular growth has been extensively studied. The physiological roles of TORC2 have remained largely elusive due to the lack of pharmacological inhibitors and its genetic lethality in mammals. Among potential targets of TORC2, the pro-survival kinase AKT has garnered much attention. Within the context of intact animals, however, the physiological consequences of phosphorylation of AKT by TORC2 remain poorly understood. Here we describe viable loss-of-function mutants in the Caenorhabditis elegans homolog of the TORC2-specific component, Rictor (CeRictor. These mutants display a mild developmental delay and decreased body size, but have increased lipid storage. These functions of CeRictor are not mediated through the regulation of AKT kinases or their major downstream target, the insulin-regulated FOXO transcription factor DAF-16. We found that loss of sgk-1, a homolog of the serum- and glucocorticoid-induced kinase, mimics the developmental, growth, and metabolic phenotypes of CeRictor mutants, while a novel, gain-of-function mutation in sgk-1 suppresses these phenotypes, indicating that SGK-1 is a mediator of CeRictor activity. These findings identify new physiological roles for TORC2, mediated by SGK, in regulation of C. elegans lipid accumulation and growth, and they challenge the notion that AKT is the primary effector of TORC2 function.

Translational co-regulation of a ligand and inhibitor by a conserved RNA element

DEFF Research Database (Denmark)

Zaucker, Andreas; Nagorska, Agnieszka; Kumari, Pooja

2018-01-01

In many organisms, transcriptional and post-transcriptional regulation of components of pathways or processes has been reported. However, to date, there are few reports of translational co-regulation of multiple components of a developmental signaling pathway. Here, we show that an RNA element wh...

Associations Between Maternal-Foetal Attachment and Infant Developmental Outcomes: A Systematic Review.

Science.gov (United States)

Branjerdporn, Grace; Meredith, Pamela; Strong, Jenny; Garcia, Jenniffer

2017-03-01

Objectives Infant developmental outcomes may be influenced by a range of prenatal maternal characteristics. While there is some evidence to suggest that maternal-foetal attachment may be associated with infant developmental outcomes, there is a need to systematically review this evidence to guide future research and clinical practice. Methods Five electronic databases were systematically scanned. Key journals and reference lists were hand-searched. Papers were included if: (1) pregnant women were assessed for maternal-foetal attachment; (2) the infants were later assessed, under 2 years old, for any developmental outcome (e.g., social-emotional, cognition, motor, language, adaptive behaviour); and (3) they were published in English. Two independent reviewers used the STROBE checklist to appraise the quality of each paper. Results Of the 968 papers identified, eight were included in the review, and four of these were of low quality (infant temperament (n = 5), adaptive behaviour (e.g., colic, sleep) (n = 2), and milestone attainment (n = 1). There is some evidence to suggest that lower maternal-foetal attachment is related to suboptimal developmental outcomes. However, these results should be interpreted with caution due to the limited and low quality studies available. Conclusions Although maternal-foetal attachment may be associated with infant developmental outcomes, future research is required which: (1) considers a range of developmental outcomes, (2) has increased scientific rigour, (3) assesses mother-infant dyads at different prenatal and postnatal time points, and (4) examines different target populations.

Developmentally regulated expression by Trypanosoma cruzi of molecules that accelerate the decay of complement C3 convertases

International Nuclear Information System (INIS)

Rimoldi, M.T.; Sher, A.; Heiny, A.; Lituchy, A.; Hammer, C.H.; Joiner, K.

1988-01-01

The authors recently showed that culture-derived metacyclic trypomastigotes (CMT), but not epimastigotes (Epi), of the Miranda 99 strain of Trypanosoma cruzi evade lysis by the human alternative complement pathway because of inefficient binding of factor B to complement component C3b on the parasite surface. These results suggested that CMT and tissue-culture-derived trypomastigotes (TCT), which also activate the alternative pathway poorly, might produce a molecule capable of interfering with factor B binding to C3b. They now demonstrate that CMT and TCT lysates, as well as molecules spontaneously shed from CMT and TCT but not Epi, accelerate decay of 125 I-labeled factor Bb from the alternative-pathway C3 convertase (C3bBb) assembled on zymosan or Epi and also accelerate decay of the classical-pathway C3 convertase (C4b2a) on sheep erythrocytes. Parasites metabolically labeled with [ 35 S]methionine spontaneously shed a limited number of radioactive components, ranging in molecular mass from 86 to 155 kDa for trypomastigotes and 25 to 80 kDa for Epi. Decay-accelerating activity within supernatants is inactivated by papain and is coeluted with 35 S-containing polypeptides on FPLC anion-exchange chromatography, suggesting that the active constituents are protein molecules. Molecules with decay-accelerating activity may explain the developmentally regulated resistance to complement-mediated lysis in infective and vertebrate stages for T. cruzi life cycle

Activation by insulin and amino acids of signaling components leading to translation initiation in skeletal muscle of neonatal pigs is developmentally regulated.

Science.gov (United States)

Suryawan, Agus; Orellana, Renan A; Nguyen, Hanh V; Jeyapalan, Asumthia S; Fleming, Jillian R; Davis, Teresa A

2007-12-01

Insulin and amino acids act independently to stimulate protein synthesis in skeletal muscle of neonatal pigs, and the responses decrease with development. The purpose of this study was to compare the separate effects of fed levels of INS and AA on the activation of signaling components leading to translation initiation and how these responses change with development. Overnight-fasted 6- (n = 4/group) and 26-day-old (n = 6/ group) pigs were studied during 1) euinsulinemic-euglycemiceuaminoacidemic conditions (controls), 2) euinsulinemic-euglycemichyperaminoacidemic clamps (AA), and 3) hyperinsulinemic-euglycemic-euaminoacidemic clamps (INS). INS, but not AA, increased the phosphorylation of protein kinase B (PKB) and tuberous sclerosis 2 (TSC2). Both INS and AA increased protein synthesis and the phosphorylation of mammalian target of rapamycin (mTOR), ribosomal protein S6 kinase-1, and eukaryotic initiation factor (eIF)4E-binding protein 1 (4E-BP1), and these responses were higher in 6-day-old compared with 26-day-old pigs. Both INS and AA decreased the binding of 4E-BP1 to eIF4E and increased eIF4E binding to eIF4G; these effects were greater in 6-day-old than in 26-day-old pigs. Neither INS nor AA altered the composition of mTORC1 (raptor, mTOR, and GbetaL) or mTORC2 (rictor, mTOR, and GbetaL) complexes. Furthermore, neither INS, AA, nor age had any effect on the abundance of Rheb and the phosphorylation of AMP-activated protein kinase and eukaryotic elongation factor 2. Our results suggest that the activation by insulin and amino acids of signaling components leading to translation initiation is developmentally regulated and parallels the developmental decline in protein synthesis in skeletal muscle of neonatal pigs.

Temporal, Diagnostic, and Tissue-Specific Regulation of NRG3 Isoform Expression in Human Brain Development and Affective Disorders

Science.gov (United States)

Paterson, Clare; Wang, Yanhong; Hyde, Thomas M.; Weinberger, Daniel R.; Kleinman, Joel E.; Law, Amanda J.

2018-01-01

Mapping the temporal expression of genes during human brain development provides vital insight into gene function and identifies critical sensitive periods whereby genetic factors may influence risk for psychiatric disease. Here the authors provide comprehensive insight into the transcriptional landscape of the psychiatric risk gene, NRG3, in human neocortical development and expand on previous findings in schizophrenia to identify increased expression of developmentally and genetically regulated isoforms in the brain of patients with mood disorders. Principally, the finding that NRG3 classes II and III are brain-specific isoforms predicted by rs10748842 risk genotype and are increased in mood disorders further implicates a molecular mechanism of psychiatric risk at the NRG3 locus and identifies a potential developmental role for NRG3 in bipolar disorder and major depression. These observations encourage investigation of the neurobiology of NRG3 isoforms and highlight inhibition of NRG3 signaling as a potential target for psychiatric treatment development. PMID:27771971

Identifying the "Truly Disadvantaged": A Comprehensive Biosocial Approach

Science.gov (United States)

Barnes, J. C.; Beaver, Kevin M.; Connolly, Eric J.; Schwartz, Joseph A.

2016-01-01

There has been significant interest in examining the developmental factors that predispose individuals to chronic criminal offending. This body of research has identified some social-environmental risk factors as potentially important. At the same time, the research producing these results has generally failed to employ genetically sensitive…

DEVELOPMENTAL TAXONOMY OF CONDUCT DISORDER

OpenAIRE

Jelena Kostić; Milkica Nešić; Jasminka Marković; Miodrag Stanković

2015-01-01

Conduct disorder is a heterogeneous disorder in terms of etiology, course and prognosis, and currently, there is no singular model that would describe the development of the disorder. The results of empirical research on males confirm this heterogeneity, as they point out to two possible developmental pathways: childhood-onset and adolescentonset type. This paper presents the basic elements of developmental taxonomic theory which argues that there are two different developmental pathways to c...

Lifespan Development of Neuromodulation of Adaptive Control and Motivation as an Ontogenetic Mechanism for Developmental Niche Construction

Science.gov (United States)

Li, Shu-Chen

2013-01-01

Instead of viewing organisms and individuals as passive recipients of their biological, ecological, and cultural inheritances, the developmental niche construction theory and the biocultural co-construction framework both emphasize that the individual's agency plays a key role in regulating how environmental and sociocontextual influences may…

Assessing self-regulated learning in early childhood education: Difficulties, needs, and prospects.

Science.gov (United States)

de la Fuente Arias, Jesús; Lozano Díaz, Antonia

2010-05-01

Self-regulated learning is one of the main processes being investigated today within developmental and educational psychology; however, the research has come up against a number of challenges for which no satisfactory response has been found, and which are impeding progress in the field. These challenges are two-fold: one part is methodological, as the process of self-regulation must be evaluated at the very moment in which it occurs, and the other part is developmental, as these processes have not been fully assessed in children under the age of 6 years. This article gives a broad overview of these challenges, as well as prospects for future solutions which are beginning to take shape.

NeuroD1: developmental expression and regulated genes in the rodent pineal gland

DEFF Research Database (Denmark)

Muñoz, Estela M; Bailey, Michael J; Rath, Martin F

2007-01-01

NeuroD1/BETA2, a member of the bHLH transcription factor family, is known to influence the fate of specific neuronal, endocrine and retinal cells. We report here that NeuroD1 mRNA is highly abundant in the developing and adult rat pineal gland. Pineal expression begins in the 17-day embryo at which...... time it is also detectable in other brain regions. Expression in the pineal gland increases during the embryonic period and is maintained thereafter at levels equivalent to those found in the cerebellum and retina. In contrast, NeuroD1 mRNA decreases markedly in non-cerebellar brain regions during...... development. Pineal NeuroD1 levels are similar during the day and night, and do not appear to be influenced by sympathetic neural input. Gene expression analysis of the pineal glands from neonatal NeuroD1 knockout mice identifies 127 transcripts that are down-regulated (>twofold, p

Mig-6 regulates endometrial genes involved in cell cycle and progesterone signaling

Energy Technology Data Exchange (ETDEWEB)

Yoo, Jung-Yoon; Kim, Tae Hoon; Lee, Jae Hee [Department of Obstetrics, Gynecology & Reproductive Biology, Michigan State University, Grand Rapids, MI (United States); Dunwoodie, Sally L. [Developmental and Stem Cell Biology Division, Victor Chang Cardiac Research Institute, Darlinghurst, New South Wales 2010 (Australia); St. Vincent' s Clinical School and the School of Biotechnology and Biomolecular Sciences, University of New South Wales, Kensington, New South Wales 2033 (Australia); Ku, Bon Jeong, E-mail: bonjeong@cnu.ac.kr [Department of Internal Medicine, Chungnam National University School of Medicine, Daejeon (Korea, Republic of); Jeong, Jae-Wook, E-mail: JaeWook.Jeong@hc.msu.edu [Department of Obstetrics, Gynecology & Reproductive Biology, Michigan State University, Grand Rapids, MI (United States); Department of Women' s Health, Spectrum Health System, Grand Rapids, MI (United States)

2015-07-10

Mitogen inducible gene 6 (Mig-6) is an important mediator of progesterone (P4) signaling to inhibit estrogen (E2) signaling in the uterus. Ablation of Mig-6 in the murine uterus leads to the development of endometrial hyperplasia and E2-induced endometrial cancer. To identify the molecular pathways regulated by Mig-6, we performed microarray analysis on the uterus of ovariectomized Mig-6{sup f/f} and PGR{sup cre/+}Mig-6{sup f/f} (Mig-6{sup d/d}) mice treated with vehicle or P4 for 6 h. The results revealed that 772 transcripts were significantly regulated in the Mig-6{sup d/d} uterus treated with vehicle as compared with Mig-6{sup f/f} mice. The pathway analysis showed that Mig-6 suppressed the expression of gene-related cell cycle regulation in the absence of ovarian steroid hormone. The epithelium of Mig-6{sup d/d} mice showed a significant increase in the number of proliferative cells compared to Mig-6{sup f/f} mice. This microarray analysis also revealed that 324 genes are regulated by P4 as well as Mig-6. Cited2, the developmentally important transcription factor, was identified as being regulated by the P4-Mig-6 axis. To determine the role of Cited2 in the uterus, we used the mice with Cited2 that were conditionally ablated in progesterone receptor-positive cells (PGR{sup cre/+}Cited2{sup f/f}; Cited2{sup d/d}). Ablation of Cited2 in the uterus resulted in a significant reduction in the ability of the uterus to undergo a hormonally induced decidual reaction. Identification and analysis of these responsive genes will help define the role of P4 as well as Mig-6 in regulating uterine biology. - Highlights: • We identify Mig-6- and P4-regulated uterine genes by microarray analysis. • Mig-6 suppresses cell cycle progression and epithelial cell proliferation in uterus. • We identify the Mig-6 dependent induced genes by P4. • Cited2 plays an important role for decidualization as a P4 and Mig-6 target gene.

Understanding retirement: the promise of life-span developmental frameworks.

Science.gov (United States)

Löckenhoff, Corinna E

2012-09-01

The impending retirement of large population cohorts creates a pressing need for practical interventions to optimize outcomes at the individual and societal level. This necessitates comprehensive theoretical models that acknowledge the multi-layered nature of the retirement process and shed light on the dynamic mechanisms that drive longitudinal patterns of adjustment. The present commentary highlights ways in which contemporary life-span developmental frameworks can inform retirement research, drawing on the specific examples of Bronfenbrenner's Ecological Model, Baltes and Baltes Selective Optimization with Compensation Framework, Schulz and Heckhausen's Motivational Theory of Life-Span Development, and Carstensen's Socioemotional Selectivity Theory. Ultimately, a life-span developmental perspective on retirement offers not only new interpretations of known phenomena but may also help to identify novel directions for future research as well as promising pathways for interventions.

Core References in Introductory Social Psychology and Developmental Psychology Textbooks

Science.gov (United States)

Whitehead, George I., III; Smith, Stephanie H.; Losonczy-Marshall, Marta

2017-01-01

The purpose of the present study was to identify the core references in introductory textbooks in two sub-disciplines of psychology: social psychology and developmental psychology. One research question was the extent to which the common references in these textbooks present the trends in contemporary research in each sub-discipline. An analysis…

Topographic processing in developmental prosopagnosia

DEFF Research Database (Denmark)

Klargaard, Solja K.; Starrfelt, Randi; Petersen, Anders

2016-01-01

deficit in visual processing or visual short-term memory. Interestingly, a classical dissociation could be demonstrated between impaired face memory and preserved topographic memory in two developmental prosopagnosics. We conclude that impairments in topographic memory tend to co-occur with developmental......Anecdotal evidence suggests a relation between impaired spatial (navigational) processing and developmental prosopagnosia. To address this formally, we tested two aspects of topographic processing – that is, perception and memory of mountain landscapes shown from different viewpoints. Participants...

Developmental stages of developmental screening: steps to implementation of a successful program.

Science.gov (United States)

Pinto-Martin, Jennifer A; Dunkle, Margaret; Earls, Marian; Fliedner, Dane; Landes, Cynthia

2005-11-01

Through the use of 2-stage screening strategies, research studies have shown that autism spectrum disorders and other developmental disabilities can now be detected reliably and with greater validity and in children as young as 18 months of age. Screening and diagnostic practices in the medical and educational arena lag far behind clinical research, however, with the average patient age at time of diagnosis being 3 to 6 years.We discuss the challenges of instituting universal developmental screening as part of pediatric care and present 2 models of existing or planned programs of early screening for autism spectrum disorder and developmental disability (1 in a community-based setting and 1 in a pediatric setting), and discuss the pros and cons of the different strategies.

Genome-wide Expression Analysis and Metabolite Profiling Elucidate Transcriptional Regulation of Flavonoid Biosynthesis and Modulation under Abiotic Stresses in Banana.

Science.gov (United States)

Pandey, Ashutosh; Alok, Anshu; Lakhwani, Deepika; Singh, Jagdeep; Asif, Mehar H; Trivedi, Prabodh K

2016-08-19

Flavonoid biosynthesis is largely regulated at the transcriptional level due to the modulated expression of genes related to the phenylpropanoid pathway in plants. Although accumulation of different flavonoids has been reported in banana, a staple fruit crop, no detailed information is available on regulation of the biosynthesis in this important plant. We carried out genome-wide analysis of banana (Musa acuminata, AAA genome) and identified 28 genes belonging to 9 gene families associated with flavonoid biosynthesis. Expression analysis suggested spatial and temporal regulation of the identified genes in different tissues of banana. Analysis revealed enhanced expression of genes related to flavonol and proanthocyanidin (PA) biosynthesis in peel and pulp at the early developmental stages of fruit. Genes involved in anthocyanin biosynthesis were highly expressed during banana fruit ripening. In general, higher accumulation of metabolites was observed in the peel as compared to pulp tissue. A correlation between expression of genes and metabolite content was observed at the early stage of fruit development. Furthermore, this study also suggests regulation of flavonoid biosynthesis, at transcriptional level, under light and dark exposures as well as methyl jasmonate (MJ) treatment in banana.

Genome-wide discovery and differential regulation of conserved and novel microRNAs in chickpea via deep sequencing.

Science.gov (United States)

Jain, Mukesh; Chevala, V V S Narayana; Garg, Rohini

2014-11-01

MicroRNAs (miRNAs) are essential components of complex gene regulatory networks that orchestrate plant development. Although several genomic resources have been developed for the legume crop chickpea, miRNAs have not been discovered until now. For genome-wide discovery of miRNAs in chickpea (Cicer arietinum), we sequenced the small RNA content from seven major tissues/organs employing Illumina technology. About 154 million reads were generated, which represented more than 20 million distinct small RNA sequences. We identified a total of 440 conserved miRNAs in chickpea based on sequence similarity with known miRNAs in other plants. In addition, 178 novel miRNAs were identified using a miRDeep pipeline with plant-specific scoring. Some of the conserved and novel miRNAs with significant sequence similarity were grouped into families. The chickpea miRNAs targeted a wide range of mRNAs involved in diverse cellular processes, including transcriptional regulation (transcription factors), protein modification and turnover, signal transduction, and metabolism. Our analysis revealed several miRNAs with differential spatial expression. Many of the chickpea miRNAs were expressed in a tissue-specific manner. The conserved and differential expression of members of the same miRNA family in different tissues was also observed. Some of the same family members were predicted to target different chickpea mRNAs, which suggested the specificity and complexity of miRNA-mediated developmental regulation. This study, for the first time, reveals a comprehensive set of conserved and novel miRNAs along with their expression patterns and putative targets in chickpea, and provides a framework for understanding regulation of developmental processes in legumes. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Treatment of Bruxism in Individuals with Developmental Disabilities: A Systematic Review

Science.gov (United States)

Lang, Russell; White, Pamela J.; Machalicek, Wendy; Rispoli, Mandy; Kang, Soyeon; Aquilar, Jeannie; O'Reilly, Mark; Sigafoos, Jeff; Lancioni, Giulio; Didden, Robert

2009-01-01

We reviewed studies involving the treatment of bruxism (i.e., teeth clenching or teeth grinding) in individuals with developmental disabilities. Systematic searches of electronic databases, journals, and reference lists identified 11 studies meeting the inclusion criteria. These studies were evaluated in terms of: (a) participants, (b) procedures…

Emergence of differentially regulated pathways associated with the development of regional specificity in chicken skin.

Science.gov (United States)

Chang, Kai-Wei; Huang, Nancy A; Liu, I-Hsuan; Wang, Yi-Hui; Wu, Ping; Tseng, Yen-Tzu; Hughes, Michael W; Jiang, Ting Xin; Tsai, Mong-Hsun; Chen, Chien-Yu; Oyang, Yen-Jen; Lin, En-Chung; Chuong, Cheng-Ming; Lin, Shau-Ping

2015-01-23