
Sample records for identify cis-acting sequences

  1. A method for selecting cis-acting regulatory sequences that respond to small molecule effectors

    Directory of Open Access Journals (Sweden)

    Allas Ülar


    Full Text Available Abstract Background Several cis-acting regulatory sequences functioning at the level of mRNA or nascent peptide and specifically influencing transcription or translation have been described. These regulatory elements often respond to specific chemicals. Results We have developed a method that allows us to select cis-acting regulatory sequences that respond to diverse chemicals. The method is based on the β-lactamase gene containing a random sequence inserted into the beginning of the ORF. Several rounds of selection are used to isolate sequences that suppress β-lactamase expression in response to the compound under study. We have isolated sequences that respond to erythromycin, troleandomycin, chloramphenicol, meta-toluate and homoserine lactone. By introducing synonymous and non-synonymous mutations we have shown that at least in the case of erythromycin the sequences act at the peptide level. We have also tested the cross-activities of the constructs and found that in most cases the sequences respond most strongly to the compound on which they were isolated. Conclusions Several selected peptides showed ligand-specific changes in amino acid frequencies, but no consensus motif could be identified. This is consistent with previous observations on natural cis-acting peptides, showing that it is often impossible to demonstrate a consensus. Applying the currently developed method on a larger scale, by selecting and comparing an extended set of sequences, might allow the sequence rules underlying the activity of cis-acting regulatory peptides to be identified.

  2. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences


    Lescot, Magali; Déhais, Patrice; Thijs, Gert; Marchal, Kathleen; Moreau, Yves; Van de Peer, Yves; Rouzé, Pierre; Rombauts, Stephane


    PlantCARE is a database of plant cis-acting regulatory elements, enhancers and repressors. Regulatory elements are represented by positional matrices, consensus sequences and individual sites on particular promoter sequences. Links to the EMBL, TRANSFAC and MEDLINE databases are provided when available. Data about the transcription sites are extracted mainly from the literature, supplemented with an increasing number of in silico predicted data. Apart from a general description for specific t...

  3. Cis-acting regulatory sequences promote high-frequency gene conversion between repeated sequences in mammalian cells. (United States)

    Raynard, Steven J; Baker, Mark D


    In mammalian cells, little is known about the nature of recombination-prone regions of the genome. Previously, we reported that the immunoglobulin heavy chain (IgH) mu locus behaved as a hotspot for mitotic, intrachromosomal gene conversion (GC) between repeated mu constant (Cmu) regions in mouse hybridoma cells. To investigate whether elements within the mu gene regulatory region were required for hotspot activity, gene targeting was used to delete a 9.1 kb segment encompassing the mu gene promoter (Pmu), enhancer (Emu) and switch region (Smu) from the locus. In these cell lines, GC between the Cmu repeats was significantly reduced, indicating that this 'recombination-enhancing sequence' (RES) is necessary for GC hotspot activity at the IgH locus. Importantly, the RES fragment stimulated GC when appended to the same Cmu repeats integrated at ectopic genomic sites. We also show that deletion of Emu and flanking matrix attachment regions (MARs) from the RES abolishes GC hotspot activity at the IgH locus. However, no stimulation of ectopic GC was observed with the Emu/MARs fragment alone. Finally, we provide evidence that no correlation exists between the level of transcription and GC promoted by the RES. We suggest a model whereby Emu/MARS enhances mitotic GC at the endogenous IgH mu locus by effecting chromatin modifications in adjacent DNA.

  4. Minimal and contributing sequence determinants of the cis-acting locus of transfer (clt) of streptomycete plasmid pIJ101 occur within an intrinsically curved plasmid region. (United States)

    Ducote, M J; Prakash, S; Pettis, G S


    Efficient interbacterial transfer of streptomycete plasmid pIJ101 requires the pIJ101 tra gene, as well as a cis-acting plasmid function known as clt. Here we show that the minimal pIJ101 clt locus consists of a sequence no greater than 54 bp in size that includes essential inverted-repeat and direct-repeat sequences and is located in close proximity to the 3' end of the korB regulatory gene. Evidence that sequences extending beyond the minimal locus and into the korB open reading frame influence clt transfer function and demonstration that clt-korB sequences are intrinsically curved raise the possibility that higher-order structuring of DNA and protein within this plasmid region may be an inherent feature of efficient pIJ101 transfer.

  5. Direct repeat sequences are essential for function of the cis-acting locus of transfer (clt) of Streptomyces phaeochromogenes plasmid pJV1. (United States)

    Franco, Bernardo; González-Cerón, Gabriela; Servín-González, Luis


    The functionality of direct and inverted repeat sequences inside the cis acting locus of transfer (clt) of the Streptomyces plasmid pJV1 was determined by testing the effect of different deletions on plasmid transfer. The results show that the single most important element for pJV1 clt function is a series of evenly spaced 9 bp long direct repeats which match the consensus CCGCACA(C/G)(C/G), since their deletion caused a dramatic reduction in plasmid transfer. The presence of these repeats in the absence of any other clt sequences allowed plasmid transfer to occur at a frequency that was at least two orders of magnitude higher than that obtained in the complete absence of clt. A database search revealed regions with a similar organization, and in the same position, in Streptomyces plasmids pSN22 and pSLS, which have transfer proteins homologous to those of pJV1.

  6. Recognition of cis-acting sequences in RNA 3 of Prunus necrotic ringspot virus by the replicase of Alfalfa mosaic virus. (United States)

    Aparicio, F; Sánchez-Navarro, J A; Olsthoorn, R C; Pallás, V; Bol, J F


    Alfalfa mosaic virus (AMV) and Prunus necrotic ringspot virus (PNRSV) belong to the genera ALFAMOVIRUS: and ILARVIRUS:, respectively, of the family BROMOVIRIDAE: Initiation of infection by AMV and PNRSV requires binding of a few molecules of coat protein (CP) to the 3' termini of the inoculum RNAs and the CPs of the two viruses are interchangeable in this early step of the replication cycle. CIS:-acting sequences in PNRSV RNA 3 that are recognized by the AMV replicase were studied in in vitro replicase assays and by inoculation of AMV-PNRSV RNA 3 chimeras to tobacco plants and protoplasts transformed with the AMV replicase genes (P12 plants). The results showed that the AMV replicase recognized the promoter for minus-strand RNA synthesis in PNRSV RNA 3 but not the promoter for plus-strand RNA synthesis. A chimeric RNA with PNRSV movement protein and CP genes accumulated in tobacco, which is a non-host for PNRSV.

  7. Novel sequence variations in LAMA2 and SGCG genes modulating cis-acting regulatory elements and RNA secondary structure

    Directory of Open Access Journals (Sweden)

    Olfa Siala


    Full Text Available In this study, we detected new sequence variations in LAMA2 and SGCG genes in 5 ethnic populations, and analysed their effect on enhancer composition and mRNA structure. PCR amplification and DNA sequencing were performed and followed by bioinformatics analyses using ESEfinder as well as MFOLD software. We found 3 novel sequence variations in the LAMA2 (c.3174+22_23insAT and c.6085 +12delA and SGCG (c.*102A/C genes. These variations were present in 210 tested healthy controls from Tunisian, Moroccan, Algerian, Lebanese and French populations suggesting that they represent novel polymorphisms within LAMA2 and SGCG genes sequences. ESEfinder showed that the c.*102A/C substitution created a new exon splicing enhancer in the 3'UTR of SGCG genes, whereas the c.6085 +12delA deletion was situated in the base pairing region between LAMA2 mRNA and the U1snRNA spliceosomal components. The RNA structure analyses showed that both variations modulated RNA secondary structure. Our results are suggestive of correlations between mRNA folding and the recruitment of spliceosomal components mediating splicing, including SR proteins. The contribution of common sequence variations to mRNA structural and functional diversity will contribute to a better study of gene expression.

  8. Cis-acting sequences from a human surfactant protein gene confer pulmonary-specific gene expression in transgenic mice

    Energy Technology Data Exchange (ETDEWEB)

    Korfhagen, T.R.; Glasser, S.W.; Wert, S.E.; Bruno, M.D.; Daugherty, C.C.; McNeish, J.D.; Stock, J.L.; Potter, S.S.; Whitsett, J.A. (Cincinnati College of Medicine, OH (USA))


    Pulmonary surfactant is produced in late gestation by developing type II epithelial cells lining the alveolar epithelium of the lung. Lack of surfactant at birth is associated with respiratory distress syndrome in premature infants. Surfactant protein C (SP-C) is a highly hydrophobic peptide isolated from pulmonary tissue that enhances the biophysical activity of surfactant phospholipids. Like surfactant phospholipid, SP-C is produced by epithelial cells in the distal respiratory epithelium, and its expression increases during the latter part of gestation. A chimeric gene containing 3.6 kilobases of the promoter and 5{prime}-flanking sequences of the human SP-C gene was used to express diphtheria toxin A. The SP-C-diphtheria toxin A fusion gene was injected into fertilized mouse eggs to produce transgenic mice. Affected mice developed respiratory failure in the immediate postnatal period. Morphologic analysis of lungs from affected pups showed variable but severe cellular injury confined to pulmonary tissues. Ultrastructural changes consistent with cell death and injury were prominent in the distal respiratory epithelium. Proximal components of the tracheobronchial tree were not severely affected. Transgenic animals were of normal size at birth, and structural abnormalities were not detected in nonpulmonary tissues. Lung-specific diphtheria toxin A expression controlled by the human SP-C gene injured type II epithelial cells and caused extensive necrosis of the distal respiratory epithelium. The absence of type I epithelial cells in the most severely affected transgenic animals supports the concept that developing type II cells serve as precursors to type I epithelial cells.

  9. Structural and mutational analyses of cis-acting sequences in the 5'-untranslated region of satellite RNA of bamboo mosaic potexvirus

    International Nuclear Information System (INIS)

    Annamalai, Padmanaban; Hsu, Y.-H.; Liu, Y.-P.; Tsai, C.-H.; Lin, N.-S.


    The satellite RNA of Bamboo mosaic virus (satBaMV) contains on open reading frame for a 20-kDa protein that is flanked by a 5'-untranslated region (UTR) of 159 nucleotides (nt) and a 3'-UTR of 129 nt. A secondary structure was predicted for the 5'-UTR of satBaMV RNA, which folds into a large stem-loop (LSL) and a small stem-loop. Enzymatic probing confirmed the existence of LSL (nt 8-138) in the 5'-UTR. The essential cis-acting sequences in the 5'-UTR required for satBaMV RNA replication were determined by deletion and substitution mutagenesis. Their replication efficiencies were analyzed in Nicotiana benthamiana protoplasts and Chenopodium quinoa plants coinoculated with helper BaMV RNA. All deletion mutants abolished the replication of satBaMV RNA, whereas mutations introduced in most of the loop regions and stems showed either no replication or a decreased replication efficiency. Mutations that affected the positive-strand satBaMV RNA accumulation also affected the accumulation of negative-strand RNA; however, the accumulation of genomic and subgenomic RNAs of BaMV were not affected. Moreover, covariation analyses of natural satBaMV variants provide substantial evidence that the secondary structure in the 5'-UTR of satBaMV is necessary for efficient replication

  10. Role for cis-acting RNA sequences in the temperature-dependent expression of the multiadhesive lig proteins in Leptospira interrogans. (United States)

    Matsunaga, James; Schlax, Paula J; Haake, David A


    The spirochete Leptospira interrogans causes a systemic infection that provokes a febrile illness. The putative lipoproteins LigA and LigB promote adhesion of Leptospira to host proteins, interfere with coagulation, and capture complement regulators. In this study, we demonstrate that the expression level of the LigA and LigB proteins was substantially higher when L. interrogans proliferated at 37°C instead of the standard culture temperature of 30°C. The RNA comprising the 175-nucleotide 5' untranslated region (UTR) and first six lig codons, whose sequence is identical in ligA and ligB, is predicted to fold into two distinct stem-loop structures separated by a single-stranded region. The ribosome-binding site is partially sequestered in double-stranded RNA within the second structure. Toeprint analysis revealed that in vitro formation of a 30S-tRNA(fMet)-mRNA ternary complex was inhibited unless a 5' deletion mutation disrupted the second stem-loop structure. To determine whether the lig sequence could mediate temperature-regulated gene expression in vivo, the 5' UTR and the first six codons were inserted between the Escherichia coli l-arabinose promoter and bgaB (β-galactosidase from Bacillus stearothermophilus) to create a translational fusion. The lig fragment successfully conferred thermoregulation upon the β-galactosidase reporter in E. coli. The second stem-loop structure was sufficient to confer thermoregulation on the reporter, while sequences further upstream in the 5' UTR slightly diminished expression at each temperature tested. Finally, the expression level of β-galactosidase was significantly higher when point mutations predicted to disrupt base pairs in the second structure were introduced into the stem. Compensatory mutations that maintained base pairing of the stem without restoring the wild-type sequence reinstated the inhibitory effect of the 5' UTR on expression. These results indicate that ligA and ligB expression is limited by double

  11. In silico analysis of cis-acting regulatory elements in 5' regulatory regions of sucrose transporter gene families in rice (Oryza sativa Japonica) and Arabidopsis thaliana. (United States)

    Ibraheem, Omodele; Botha, Christiaan E J; Bradley, Graeme


    The regulation of gene expression involves a multifarious regulatory system. Each gene contains a unique combination of cis-acting regulatory sequence elements in the 5' regulatory region that determines its temporal and spatial expression. Cis-acting regulatory elements are essential transcriptional gene regulatory units; they control many biological processes and stress responses. Thus a full understanding of the transcriptional gene regulation system will depend on successful functional analyses of cis-acting elements. Cis-acting regulatory elements present within the 5' regulatory region of the sucrose transporter gene families in rice (Oryza sativa Japonica cultivar-group) and Arabidopsis thaliana, were identified using a bioinformatics approach. The possible cis-acting regulatory elements were predicted by scanning 1.5kbp of 5' regulatory regions of the sucrose transporter genes translational start sites, using Plant CARE, PLACE and Genomatix Matinspector professional databases. Several cis-acting regulatory elements that are associated with plant development, plant hormonal regulation and stress response were identified, and were present in varying frequencies within the 1.5kbp of 5' regulatory region, among which are; A-box, RY, CAT, Pyrimidine-box, Sucrose-box, ABRE, ARF, ERE, GARE, Me-JA, ARE, DRE, GA-motif, GATA, GT-1, MYC, MYB, W-box, and I-box. This result reveals the probable cis-acting regulatory elements that possibly are involved in the expression and regulation of sucrose transporter gene families in rice and Arabidopsis thaliana during cellular development or environmental stress conditions. Copyright © 2010 Elsevier Ltd. All rights reserved.

  12. Identification of Cis-Acting Promoter Elements in Cold- and Dehydration-Induced Transcriptional Pathways in Arabidopsis, Rice, and Soybean (United States)

    Maruyama, Kyonoshin; Todaka, Daisuke; Mizoi, Junya; Yoshida, Takuya; Kidokoro, Satoshi; Matsukura, Satoko; Takasaki, Hironori; Sakurai, Tetsuya; Yamamoto, Yoshiharu Y.; Yoshiwara, Kyouko; Kojima, Mikiko; Sakakibara, Hitoshi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko


    The genomes of three plants, Arabidopsis (Arabidopsis thaliana), rice (Oryza sativa), and soybean (Glycine max), have been sequenced, and their many genes and promoters have been predicted. In Arabidopsis, cis-acting promoter elements involved in cold- and dehydration-responsive gene expression have been extensively analysed; however, the characteristics of such cis-acting promoter sequences in cold- and dehydration-inducible genes of rice and soybean remain to be clarified. In this study, we performed microarray analyses using the three species, and compared characteristics of identified cold- and dehydration-inducible genes. Transcription profiles of the cold- and dehydration-responsive genes were similar among these three species, showing representative upregulated (dehydrin/LEA) and downregulated (photosynthesis-related) genes. All (46 = 4096) hexamer sequences in the promoters of the three species were investigated, revealing the frequency of conserved sequences in cold- and dehydration-inducible promoters. A core sequence of the abscisic acid-responsive element (ABRE) was the most conserved in dehydration-inducible promoters of all three species, suggesting that transcriptional regulation for dehydration-inducible genes is similar among these three species, with the ABRE-dependent transcriptional pathway. In contrast, for cold-inducible promoters, the conserved hexamer sequences were diversified among these three species, suggesting the existence of diverse transcriptional regulatory pathways for cold-inducible genes among the species. PMID:22184637

  13. PlantCARE, a plant cis-acting regulatory element database


    Rombauts, Stephane; Déhais, Patrice; Van Montagu, Marc; Rouzé, Pierre


    PlantCARE is a database of plant cis- acting regulatory elements, enhancers and repressors. Besides the transcription motifs found on a sequence, it also offers a link to the EMBL entry that contains the full gene sequence as well as a description of the conditions in which a motif becomes functional. The information on these sites is given by matrices, consensus and individual site sequences on particular genes, depending on the available information. PlantCARE is a relational database avail...

  14. Identification of cis-acting elements on positive-strand subgenomic mRNA required for the synthesis of negative-strand counterpart in bovine coronavirus. (United States)

    Yeh, Po-Yuan; Wu, Hung-Yi


    It has been demonstrated that, in addition to genomic RNA, sgmRNA is able to serve as a template for the synthesis of the negative-strand [(-)-strand] complement. However, the cis-acting elements on the positive-strand [(+)-strand] sgmRNA required for (-)-strand sgmRNA synthesis have not yet been systematically identified. In this study, we employed real-time quantitative reverse transcription polymerase chain reaction to analyze the cis-acting elements on bovine coronavirus (BCoV) sgmRNA 7 required for the synthesis of its (-)-strand counterpart by deletion mutagenesis. The major findings are as follows. (1) Deletion of the 5'-terminal leader sequence on sgmRNA 7 decreased the synthesis of the (-)-strand sgmRNA complement. (2) Deletions of the 3' untranslated region (UTR) bulged stem-loop showed no effect on (-)-strand sgmRNA synthesis; however, deletion of the 3' UTR pseudoknot decreased the yield of (-)-strand sgmRNA. (3) Nucleotides positioned from -15 to -34 of the sgmRNA 7 3'-terminal region are required for efficient (-)-strand sgmRNA synthesis. (4) Nucleotide species at the 3'-most position (-1) of sgmRNA 7 is correlated to the efficiency of (-)-strand sgmRNA synthesis. These results together suggest, in principle, that the 5'- and 3'-terminal sequences on sgmRNA 7 harbor cis-acting elements are critical for efficient (-)-strand sgmRNA synthesis in BCoV.

  15. Two cis-acting elements responsible for posttranscriptional trans-regulation of gene expression of human T-cell leukemia virus type I

    International Nuclear Information System (INIS)

    Seiki, Motoharu; Inoue, Junichiro; Hidaka, Makoto; Yoshida, Mitsuaki


    The pX sequence of human T-cell leukemia virus type I codes for two nuclear proteins, p40 tax and p27 rex and a cytoplasmic protein, p21 X-III . p40 tax activates transcription from the long terminal repeat (LTR), whereas p27 rex modulates posttranscriptional processing to accumulate gag and env mRNAs that retain intron sequences. In this paper, the authors identify two cis-acting sequence elements needed for regulation by p27 rex : a 5' splice signal and a specific sequence in the 3' LTR. These two sequence elements are sufficient for regulation by p27 rex ; expression of a cellular gene (metallothionein I) became sensitive to rex regulation when the LTR was inserted at the 3' end of this gene. The requirement for these two elements suggests and unusual regulatory mechanism of RNA processing in the nucleus

  16. Identification of Cis-Acting Elements on Positive-Strand Subgenomic mRNA Required for the Synthesis of Negative-Strand Counterpart in Bovine Coronavirus

    Directory of Open Access Journals (Sweden)

    Po-Yuan Yeh


    Full Text Available It has been demonstrated that, in addition to genomic RNA, sgmRNA is able to serve as a template for the synthesis of the negative-strand [(−-strand] complement. However, the cis-acting elements on the positive-strand [(+-strand] sgmRNA required for (−-strand sgmRNA synthesis have not yet been systematically identified. In this study, we employed real-time quantitative reverse transcription polymerase chain reaction to analyze the cis-acting elements on bovine coronavirus (BCoV sgmRNA 7 required for the synthesis of its (−-strand counterpart by deletion mutagenesis. The major findings are as follows. (1 Deletion of the 5'-terminal leader sequence on sgmRNA 7 decreased the synthesis of the (−-strand sgmRNA complement. (2 Deletions of the 3' untranslated region (UTR bulged stem-loop showed no effect on (−-strand sgmRNA synthesis; however, deletion of the 3' UTR pseudoknot decreased the yield of (−-strand sgmRNA. (3 Nucleotides positioned from −15 to −34 of the sgmRNA 7 3'-terminal region are required for efficient (−-strand sgmRNA synthesis. (4 Nucleotide species at the 3'-most position (−1 of sgmRNA 7 is correlated to the efficiency of (−-strand sgmRNA synthesis. These results together suggest, in principle, that the 5'- and 3'-terminal sequences on sgmRNA 7 harbor cis-acting elements are critical for efficient (−-strand sgmRNA synthesis in BCoV.

  17. Human apolipoprotein CIII gene expression is regulated by positive and negative cis-acting elements and tissue-specific protein factors

    International Nuclear Information System (INIS)

    Reue, K.; Leff, T.; Breslow, J.L.


    Apolipoprotein CIII (apoCIII) is a major protein constituent of triglyceride-rich lipoproteins and is synthesized primarily in the liver. Cis-acting DNA elements required for liver-specific apoCIII gene transcription were identified with transient expression assays in the human hepatoma (HepG2) and epithelial carcinoma (HeLa) cell lines. In liver cells, 821 nucleotides of the human apoCIII gene 5'-flanking sequence were required for maximum levels of gene expression, while the proximal 110 nucleotides alone were sufficient. No expression was observed in similar studies with HeLa cells. The level of expression was modulated by a combination of positive and negative cis-acting sequences, which interact with distinct sets of proteins from liver and HeLa cell nuclear extracts. The proximal positive regulatory region shares homology with similarly located sequences of other genes strongly expressed in the liver, including α 1 -antitrypsin and other apolipoprotein genes. The negative regulatory region is striking homologous to the human β-interferon gene regulatory element. The distal positive region shares homology with some viral enhancers and has properties of a tissue-specific enhancer. The regulation of the apoCIII gene is complex but shares features with other genes, suggesting shuffling of regulatory elements as a common mechanism for cell type-specific gene expression

  18. Cis-acting elements in the promoter region of the human aldolase C gene. (United States)

    Buono, P; de Conciliis, L; Olivetta, E; Izzo, P; Salvatore, F


    We investigated the cis-acting sequences involved in the expression of the human aldolase C gene by transient transfections into human neuroblastoma cells (SKNBE). We demonstrate that 420 bp of the 5'-flanking DNA direct at high efficiency the transcription of the CAT reporter gene. A deletion between -420 bp and -164 bp causes a 60% decrease of CAT activity. Gel shift and DNase I footprinting analyses revealed four protected elements: A, B, C and D. Competition analyses indicate that Sp1 or factors sharing a similar sequence specificity bind to elements A and B, but not to elements C and D. Sequence analysis shows a half palindromic ERE motif (GGTCA), in elements B and D. Region D binds a transactivating factor which appears also essential to stabilize the initiation complex.

  19. A novel radiation responsive cis-acting element regulates gene induction and mediates tissue injury

    International Nuclear Information System (INIS)

    Hallahan, Dennis E.; Virudachalam, Subbulakshmi; Kuchibahtla, Jaya


    containing binding domains for the transcription factors AP-1 and Ets. This DNA sequence (TGCCTCAGTTTCCC) is similar to antioxidant responsive element. X-ray- mediated transcriptional activation of the 5' regulatory region of ICAM-1 required the antioxidant responsive element (ARE). Electrophoretic mobility shift analysis of nuclear proteins from irradiated endothelial cells incubated with the ARE binding domain (5'-GCTGCTGCCTCAGTTTCCC-3') showed increased protein-DNA complexes at 60 and 120 minutes after irradiation. Conclusions: 1) ICAM induction in irradiated tissue occurs in the microvascular endothelium. 2) ICAM expression contributes to the pathogenesis of radiation-mediated tissue injury and the ICAM knockout serves as a model for the study of the pathogenesis of tissue injury. 3) ICAM expression is regulated by a novel radiation-inducible cis-acting element that has homology to previously identified antioxidant responsive elements

  20. Identification of cis-acting regulatory elements in the human oxytocin gene promoter. (United States)

    Richard, S; Zingg, H H


    The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT

  1. The 3'-terminal 55 nucleotides of bovine coronavirus defective interfering RNA harbor cis-acting elements required for both negative- and positive-strand RNA synthesis.

    Directory of Open Access Journals (Sweden)

    Wei-Yu Liao

    Full Text Available The synthesis of the negative-strand [(--strand] complement of the ∼30 kilobase, positive-strand [(+-strand] coronaviral genome is a necessary early step for genome replication. The identification of cis-acting elements required for (--strand RNA synthesis in coronaviruses, however, has been hampered due to insufficiencies in the techniques used to detect the (--strand RNA species. Here, we employed a method of head-to-tail ligation and real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR to detect and quantitate the synthesis of bovine coronavirus (BCoV defective interfering (DI RNA (- strands. Furthermore, using the aforementioned techniques along with Northern blot assay, we specifically defined the cis-acting RNA elements within the 3'-terminal 55 nucleotides (nts which function in the synthesis of (-- or (+-strand BCoV DI RNA. The major findings are as follows: (i nts from -5 to -39 within the 3'-terminal 55 nts are the cis-acting elements responsible for (--strand BCoV DI RNA synthesis, (ii nts from -3 to -34 within the 3'-terminal 55 nts are cis-acting elements required for (+-strand BCoV DI RNA synthesis, and (iii the nucleotide species at the 3'-most position (-1 is important, but not critical, for both (-- and (+-strand BCoV DI RNA synthesis. These results demonstrate that the 3'-terminal 55 nts in BCoV DI RNA harbor cis-acting RNA elements required for both (-- and (+-strand DI RNA synthesis and extend our knowledge on the mechanisms of coronavirus replication. The method of head-to-tail ligation and qRT-PCR employed in the study may also be applied to identify other cis-acting elements required for (--strand RNA synthesis in coronaviruses.

  2. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters. (United States)

    Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo


    cis-Acting regulatory elements are important molecular switches involved in the transcriptional regulation of a dynamic network of gene activities controlling various biological processes, including abiotic stress responses, hormone responses and developmental processes. In particular, understanding regulatory gene networks in stress response cascades depends on successful functional analyses of cis-acting elements. The ever-improving accuracy of transcriptome expression profiling has led to the identification of various combinations of cis-acting elements in the promoter regions of stress-inducible genes involved in stress and hormone responses. Here we discuss major cis-acting elements, such as the ABA-responsive element (ABRE) and the dehydration-responsive element/C-repeat (DRE/CRT), that are a vital part of ABA-dependent and ABA-independent gene expression in osmotic and cold stress responses.

  3. A novel cis-acting element required for DNA damage-inducible expression of yeast DIN7

    International Nuclear Information System (INIS)

    Yoshitani, Ayako; Yoshida, Minoru; Ling Feng


    Din7 is a DNA damage-inducible mitochondrial nuclease that modulates the stability of mitochondrial DNA (mtDNA) in Saccharomyces cerevisiae. How DIN7 gene expression is regulated, however, has remained largely unclear. Using promoter sequence alignment, we found a highly conserved 19-bp sequence in the promoter regions of DIN7 and NTG1, which encodes an oxidative stress-inducible base-excision-repair enzyme. Deletion of the 19-bp sequence markedly reduced the hydroxyurea (HU)-enhanced DIN7 promoter activity. In addition, nuclear fractions prepared from HU-treated cells were used in in vitro band shift assays to reveal the presence of currently unidentified trans-acting factor(s) that preferentially bound to the 19-bp region. These results suggest that the 19-bp sequence is a novel cis-acting element that is required for the regulation of DIN7 expression in response to HU-induced DNA damage

  4. The cis-acting replication signal at the 3' end of Flock House virus RNA2 is RNA3-dependent

    International Nuclear Information System (INIS)

    Albarino, Cesar G.; Eckerle, Lance D.; Ball, L. Andrew


    The nodavirus Flock House virus has a bipartite positive-sense RNA genome consisting of RNAs 1 and 2, which encode the viral RNA-dependent RNA polymerase (RdRp) and capsid protein precursor, respectively. The RdRp catalyzes replication of both genome segments and produces from RNA1 a subgenomic RNA (RNA3) that transactivates RNA2 replication. Here, we replaced internal sequences of RNAs 1 and 2 with a common heterologous core and were thereby able to test the RNA termini for compatibility in supporting the replication of chimeric RNAs. The results showed that the 3' 50 nt of RNA2 contained an RNA3-dependent cis-acting replication signal. Since covalent RNA dimers can direct the synthesis of monomeric replication products, the RdRp can evidently respond to cis-acting replication signals located internally. Accordingly, RNA templates containing the 3' termini of both RNAs 1 and 2 in tandem generated different replication products depending on the presence or absence of RNA3

  5. Characterization of cis-Acting RNA Elements of Zika Virus by Using a Self-Splicing Ribozyme-Dependent Infectious Clone. (United States)

    Liu, Zhong-Yu; Yu, Jiu-Yang; Huang, Xing-Yao; Fan, Hang; Li, Xiao-Feng; Deng, Yong-Qiang; Ji, Xue; Cheng, Meng-Li; Ye, Qing; Zhao, Hui; Han, Jian-Feng; An, Xiao-Ping; Jiang, Tao; Zhang, Bo; Tong, Yi-Gang; Qin, Cheng-Feng


    Zika virus (ZIKV) has caused significant outbreaks and epidemics in the Americas recently, raising global concern due to its ability to cause microcephaly and other neurological complications. A stable and efficient infectious clone of ZIKV is urgently needed. However, the instability and toxicity of flavivirus cDNA clones in Escherichia coli hosts has hindered the development of ZIKV infectious clones. Here, using a novel self-splicing ribozyme-based strategy, we generated a stable infectious cDNA clone of a contemporary ZIKV strain imported from Venezuela to China in 2016. The constructed clone contained a modified version of the group II self-splicing intron near the junction between the E and NS1 genes, which were removed from the RNA transcripts by an easy-to-establish in vitro splicing reaction. Transfection of the spliced RNAs into BHK-21 cells led to the production of infectious progeny virus that resembled the parental virus. Finally, potential cis -acting RNA elements in ZIKV genomic RNA were identified based on this novel reverse genetics system, and the critical role of 5'-SLA promoter and 5'-3' cyclization sequences were characterized by a combination of different assays. Our results provide another stable and reliable reverse genetics system for ZIKV that will help study ZIKV infection and pathogenesis, and the novel self-splicing intron-based strategy could be further expanded for the construction of infectious clones from other emerging and reemerging flaviviruses. IMPORTANCE The ongoing Zika virus (ZIKV) outbreaks have drawn global concern due to the unexpected causal link to fetus microcephaly and other severe neurological complications. The infectious cDNA clones of ZIKV are critical for the research community to study the virus, understand the disease, and inform vaccine design and antiviral screening. A panel of existing technologies have been utilized to develop ZIKV infectious clones. Here, we successfully generated a stable

  6. Local effect of enhancer of zeste-like reveals cooperation of epigenetic and cis-acting determinants for zygotic genome rearrangements.

    Directory of Open Access Journals (Sweden)

    Maoussi Lhuillier-Akakpo


    Full Text Available In the ciliate Paramecium tetraurelia, differentiation of the somatic nucleus from the zygotic nucleus is characterized by massive and reproducible deletion of transposable elements and of 45,000 short, dispersed, single-copy sequences. A specific class of small RNAs produced by the germline during meiosis, the scnRNAs, are involved in the epigenetic regulation of DNA deletion but the underlying mechanisms are poorly understood. Here, we show that trimethylation of histone H3 (H3K27me3 and H3K9me3 displays a dynamic nuclear localization that is altered when the endonuclease required for DNA elimination is depleted. We identified the putative histone methyltransferase Ezl1 necessary for H3K27me3 and H3K9me3 establishment and show that it is required for correct genome rearrangements. Genome-wide analyses show that scnRNA-mediated H3 trimethylation is necessary for the elimination of long, repeated germline DNA, while single copy sequences display differential sensitivity to depletion of proteins involved in the scnRNA pathway, Ezl1- a putative histone methyltransferase and Dcl5- a protein required for iesRNA biogenesis. Our study reveals cis-acting determinants, such as DNA length, also contribute to the definition of germline sequences to delete. We further show that precise excision of single copy DNA elements, as short as 26 bp, requires Ezl1, suggesting that development specific H3K27me3 and H3K9me3 ensure specific demarcation of very short germline sequences from the adjacent somatic sequences.

  7. Multiple cis-acting elements involved in up-regulation of a cytochrome P450 gene conferring resistance to deltamethrin in smal brown planthopper, Laodelphax striatellus (Fallén). (United States)

    Pu, Jian; Sun, Haina; Wang, Jinda; Wu, Min; Wang, Kangxu; Denholm, Ian; Han, Zhaojun


    As well as arising from single point mutations in binding sites or detoxifying enzymes, it is likely that insecticide resistance mechanisms are frequently controlled by multiple genetic factors, resulting in resistance being inherited as a quantitative trait. However, empirical evidence for this is still rare. Here we analyse the causes of up-regulation of CYP6FU1, a monoxygenase implicated in resistance to deltamethrin in the rice pest Laodelphax striatellus. The 5'-flanking region of this gene was cloned and sequenced from individuals of a susceptible and a resistant strain. A luminescent reporter assay was used to evaluate different 5'-flanking regions and their fragments for promoter activity. Mutations enhancing promoter activity in various fragments were characterized, singly and in combination, by site mutation recovery. Nucleotide diversity in flanking sequences was greatly reduced in deltamethrin-resistant insects compared to susceptible ones. Phylogenetic sequence analysis found that CYP6FU1 had five different types of 5'-flanking region. All five types were present in a susceptible strain but only a single type showing the highest promoter activity was present in a resistant strain. Four cis-acting elements were identified whose influence on up-regulation was much more pronounced in combination than when present singly. Of these, two were new transcription factor (TF) binding sites produced by mutations, another one was also a new TF binding site alternated from an existing one, and the fourth was a unique transcription start site. These results demonstrate that multiple cis-acting elements are involved in up-regulating CYP6FU1 to generate a resistance phenotype. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. PROSPECT improves cis-acting regulatory element prediction by integrating expression profile data with consensus pattern searches (United States)

    Fujibuchi, Wataru; Anderson, John S. J.; Landsman, David


    Consensus pattern and matrix-based searches designed to predict cis-acting transcriptional regulatory sequences have historically been subject to large numbers of false positives. We sought to decrease false positives by incorporating expression profile data into a consensus pattern-based search method. We have systematically analyzed the expression phenotypes of over 6000 yeast genes, across 121 expression profile experiments, and correlated them with the distribution of 14 known regulatory elements over sequences upstream of the genes. Our method is based on a metric we term probabilistic element assessment (PEA), which is a ranking of potential sites based on sequence similarity in the upstream regions of genes with similar expression phenotypes. For eight of the 14 known elements that we examined, our method had a much higher selectivity than a naïve consensus pattern search. Based on our analysis, we have developed a web-based tool called PROSPECT, which allows consensus pattern-based searching of gene clusters obtained from microarray data. PMID:11574681

  9. Insulin increases transcription of rat gene 33 through cis-acting elements in 5[prime]-flanking DNA

    Energy Technology Data Exchange (ETDEWEB)

    Cadilla, C.; Isham, K.R.; Lee, K.L.; Ch' ang, L.Y.; Kenney, F.T. (Oak Ridge National Lab., TN (United States)); Johnson, A.C. (National Cancer Institute, Bethesda, MD (United States). Lab. of Molecular Biology)


    Gene 33 is a multihormonally-regulated rat gene whose transcription is rapidly and markedly enhanced by insulin in liver and cultured hepatoma cells. To examine the mechanism by which insulin regulates transcription, the authors have constructed chimeric plasmids in which expression of the bacterial cat gene, encoding chloramphenicol acetyltransferase (CAT), is governed by gene 33 promoter elements and contiguous sequence in DNA flanking the transcription start point (tsp). When transfected into H4IIE hepatoma cells, these constructs gave rise to stably transformed cell lines producing the bacterial CAT enzyme. This expression was increased by insulin treatment in a fashion resembling the effect of this hormone on transcription of the native gene. In vitro transcription assays in nuclear extracts also revealed increased transcription of the chimeric plasmids when the extracts were prepared from insulin-treated rat hepatoma cells. The results demonstrate that induction by insulin is mediated by cis-acting nucleotide sequences located between bp [minus]480 to +27 relative to the tsp.

  10. A versatile cis-acting inverter module for synthetic translational switches. (United States)

    Endo, Kei; Hayashi, Karin; Inoue, Tan; Saito, Hirohide


    Artificial genetic switches have been designed and tuned individually in living cells. A method to directly invert an existing OFF switch to an ON switch should be highly convenient to construct complex circuits from well-characterized modules, but developing such a technique has remained a challenge. Here we present a cis-acting RNA module to invert the function of a synthetic translational OFF switch to an ON switch in mammalian cells. This inversion maintains the property of the parental switch in response to a particular input signal. In addition, we demonstrate simultaneous and specific expression control of both the OFF and ON switches. The module fits the criteria of universality and expands the versatility of mRNA-based information processing systems developed for artificially controlling mammalian cellular behaviour.

  11. Identification and characterization of cis-acting elements involved in the regulation of ABA- and/or GA-mediated LuPLR1 gene expression and lignan biosynthesis in flax (Linum usitatissimum L.) cell cultures. (United States)

    Corbin, Cyrielle; Renouard, Sullivan; Lopez, Tatiana; Lamblin, Frédéric; Lainé, Eric; Hano, Christophe


    Pinoresinol lariciresinol reductase 1, encoded by the LuPLR1 gene in flax (Linum usitatissimum L.), is responsible for the biosynthesis of (+)-secoisolariciresinol, a cancer chemopreventive phytoestrogenic lignan accumulated in high amount in the hull of flaxseed. Our recent studies have demonstrated a key role of abscisic acid (ABA) in the regulation of LuPLR1 gene expression and thus of the (+)-secoisolariciresinol synthesis during the flax seedcoat development. It is well accepted that gibberellins (GA) and ABA play antagonistic roles in the regulation of numerous developmental processes; therefore it is of interest to clarify their respective effects on lignan biosynthesis. Herein, using flax cell suspension cultures, we demonstrate that LuPLR1 gene expression and (+)-secoisolariciresinol synthesis are up-regulated by ABA and down-regulated by GA. The LuPLR1 gene promoter analysis and mutation experiments allow us to identify and characterize two important cis-acting sequences (ABRE and MYB2) required for these regulations. These results imply that a cross-talk between ABA and GA signaling orchestrated by transcription factors is involved in the regulation of lignan biosynthesis. This is particularly evidenced in the case of the ABRE cis-regulatory sequence of LuPLR1 gene promoter that appears to be a common target sequence of GA and ABA signals. Copyright © 2012 Elsevier GmbH. All rights reserved.

  12. 3'-coterminal subgenomic RNAs and putative cis-acting elements of Grapevine leafroll-associated virus 3 reveals 'unique' features of gene expression strategy in the genus Ampelovirus

    Directory of Open Access Journals (Sweden)

    Dawson William O


    Full Text Available Abstract Background The family Closteroviridae comprises genera with monopartite genomes, Closterovirus and Ampelovirus, and with bipartite and tripartite genomes, Crinivirus. By contrast to closteroviruses in the genera Closterovirus and Crinivirus, much less is known about the molecular biology of viruses in the genus Ampelovirus, although they cause serious diseases in agriculturally important perennial crops like grapevines, pineapple, cherries and plums. Results The gene expression and cis-acting elements of Grapevine leafroll-associated virus 3 (GLRaV-3; genus Ampelovirus was examined and compared to that of other members of the family Closteroviridae. Six putative 3'-coterminal subgenomic (sg RNAs were abundantly present in grapevine (Vitis vinifera infected with GLRaV-3. The sgRNAs for coat protein (CP, p21, p20A and p20B were confirmed using gene-specific riboprobes in Northern blot analysis. The 5'-termini of sgRNAs specific to CP, p21, p20A and p20B were mapped in the 18,498 nucleotide (nt virus genome and their leader sequences determined to be 48, 23, 95 and 125 nt, respectively. No conserved motifs were found around the transcription start site or in the leader sequence of these sgRNAs. The predicted secondary structure analysis of sequences around the start site failed to reveal any conserved motifs among the four sgRNAs. The GLRaV-3 isolate from Washington had a 737 nt long 5' nontranslated region (NTR with a tandem repeat of 65 nt sequence and differed in sequence and predicted secondary structure with a South Africa isolate. Comparison of the dissimilar sequences of the 5'NTRs did not reveal any common predicted structures. The 3'NTR was shorter and more conserved. The lack of similarity among the cis-acting elements of the diverse viruses in the family Closteroviridae is another measure of the complexity of their evolution. Conclusions The results indicate that transcription regulation of GLRaV-3 sgRNAs appears to be different

  13. Identifying driver mutations in sequenced cancer genomes

    DEFF Research Database (Denmark)

    Raphael, Benjamin J; Dobson, Jason R; Oesper, Layla


    High-throughput DNA sequencing is revolutionizing the study of cancer and enabling the measurement of the somatic mutations that drive cancer development. However, the resulting sequencing datasets are large and complex, obscuring the clinically important mutations in a background of errors, nois...... patterns of mutual exclusivity. These techniques, coupled with advances in high-throughput DNA sequencing, are enabling precision medicine approaches to the diagnosis and treatment of cancer....

  14. A distant cis acting intronic element induces site-selective RNA editing

    DEFF Research Database (Denmark)

    Daniel, Chammiran; Venø, Morten Trillingsgaard; Ekdahl, Ylva


    Transcripts have been found to be site selectively edited from adenosine-to-inosine (A-to-I) in the mammalian brain, mostly in genes involved in neurotransmission. While A-to-I editing occurs at double-stranded structures, other structural requirements are largely unknown. We have investigated...... shown to be important for A-to-I editing. We demonstrate that the element also can induce editing in related but normally not edited RNA sequences. In human, thousands of genes are edited in duplexes formed by inverted repeats in non-coding regions. It is likely that numerous such duplexes can induce...... the requirements for editing at the I/M site in the Gabra-3 transcript of the GABA(A) receptor. We identify an evolutionarily conserved intronic duplex, 150 nt downstream of the exonic hairpin where the I/M site resides, which is required for its editing. This is the first time a distant RNA structure has been...

  15. Adaptation to acidic soil is achieved by increased numbers of cis-acting elements regulating ALMT1 expression in Holcus lanatus. (United States)

    Chen, Zhi Chang; Yokosho, Kengo; Kashino, Miho; Zhao, Fang-Jie; Yamaji, Naoki; Ma, Jian Feng


    Yorkshire fog (Holcus lanatus), which belongs to the Poaceae family and is a close relative of the agronomic crop oat (Avena sativa), is a widely adaptable grass species that is able to grow on highly acidic soils with high levels of Al, but the mechanism underlying the high Al tolerance is unknown. Here, we characterized two accessions of H. lanatus collected from an acid plot (soil pH 3.6, HL-A) and a neutral plot (pH 7.1, HL-N) in terms of Al tolerance, organic acid anion secretion and related gene expression. In response to Al (pH 4.5), the HL-A roots secreted approximately twice as much malate as the HL-N roots, but there was no difference in citrate secretion. Cloning of the gene HlALMT1 responsible for malate secretion showed that the encoded amino acid sequence did not differ between two accessions, but the expression level in the outer cell layers of the HL-A roots was twice as high as in the HL-N roots. This difference was not due to the genomic copy number, but was due to the number of cis-acting elements for an Al-responsive transcription factor (HlART1) in the promoter region of HlALMT1, as demonstrated by both a yeast one-hybrid assay and a transient assay in tobacco protoplasts. Furthermore, introduction of HlALMT1 driven by the HL-A promoter into rice resulted in significantly more Al-induced malate secretion than introduction of HlALMT1 driven by the HL-N promoter. These findings indicate that the adaptation of H. lanatus to acidic soils may be achieved by increasing number of cis-acting elements for ART1 in the promoter region of the HlALMT1 gene, enhancing the expression of HlALMT1 and the secretion of malate. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  16. The fitness landscapes of cis-acting binding sites in different promoter and environmental contexts.

    Directory of Open Access Journals (Sweden)

    Ryan K Shultzaberger


    Full Text Available The biophysical nature of the interaction between a transcription factor and its target sequences in vitro is sufficiently well understood to allow for the effects of DNA sequence alterations on affinity to be predicted. But even in relatively simple in vivo systems, the complexities of promoter organization and activity have made it difficult to predict how altering specific interactions between a transcription factor and DNA will affect promoter output. To better understand this, we measured the relative fitness of nearly all Escherichia coli sigma(70 -35 binding sites in different promoter and environmental contexts by competing four randomized -35 promoter libraries controlling the expression of the tetracycline resistance gene (tetagainst each other in increasing concentrations of drug. We sequenced populations after competition to determine the relative enrichment of each -35 sequence. We observed a consistent relationship between the frequency of recovery of each -35 binding site and its predicted affinity for sigma(70 that varied depending on the sequence context of the promoter and drug concentration. Overall the relative fitness of each promoter could be predicted by a simple thermodynamic model of transcriptional regulation, in which the rate of transcriptional initiation (and hence fitness is dependent upon the overall stability of the initiation complex, which in turn is dependent upon the energetic contributions of all sites within the complex. As implied by this model, a decrease in the free energy of association at one site could be compensated for by an increase in the binding energy at another to produce a similar output. Furthermore, these data show that a large and continuous range of transcriptional outputs can be accessed by merely changing the -35, suggesting that evolved or engineered mutations at this site could allow for subtle and precise control over gene expression.

  17. Nitrogen transporter and assimilation genes exhibit developmental stage-selective expression in maize (Zea mays L.) associated with distinct cis-acting promoter motifs. (United States)

    Liseron-Monfils, Christophe; Bi, Yong-Mei; Downs, Gregory S; Wu, Wenqing; Signorelli, Tara; Lu, Guangwen; Chen, Xi; Bondo, Eddie; Zhu, Tong; Lukens, Lewis N; Colasanti, Joseph; Rothstein, Steven J; Raizada, Manish N


    Nitrogen is considered the most limiting nutrient for maize (Zea mays L.), but there is limited understanding of the regulation of nitrogen-related genes during maize development. An Affymetrix 82K maize array was used to analyze the expression of ≤ 46 unique nitrogen uptake and assimilation probes in 50 maize tissues from seedling emergence to 31 d after pollination. Four nitrogen-related expression clusters were identified in roots and shoots corresponding to, or overlapping, juvenile, adult, and reproductive phases of development. Quantitative real time PCR data was consistent with the existence of these distinct expression clusters. Promoters corresponding to each cluster were screened for over-represented cis-acting elements. The 8-bp distal motif of the Arabidopsis 43-bp nitrogen response element (NRE) was over-represented in nitrogen-related maize gene promoters. This conserved motif, referred to here as NRE43-d8, was previously shown to be critical for nitrate-activated transcription of nitrate reductase (NIA1) and nitrite reductase (NIR1) by the NIN-LIKE PROTEIN 6 (NLP6) in Arabidopsis. Here, NRE43-d8 was over-represented in the promoters of maize nitrate and ammonium transporter genes, specifically those that showed peak expression during early-stage vegetative development. This result predicts an expansion of the NRE-NLP6 regulon and suggests that it may have a developmental component in maize. We also report leaf expression of putative orthologs of nitrite transporters (NiTR1), a transporter not previously reported in maize. We conclude by discussing how each of the four transcriptional modules may be responsible for the different nitrogen uptake and assimilation requirements of leaves and roots at different stages of maize development.

  18. Identifying structural variants using linked-read sequencing data. (United States)

    Elyanow, Rebecca; Wu, Hsin-Ta; Raphael, Benjamin J


    Structural variation, including large deletions, duplications, inversions, translocations, and other rearrangements, is common in human and cancer genomes. A number of methods have been developed to identify structural variants from Illumina short-read sequencing data. However, reliable identification of structural variants remains challenging because many variants have breakpoints in repetitive regions of the genome and thus are difficult to identify with short reads. The recently developed linked-read sequencing technology from 10X Genomics combines a novel barcoding strategy with Illumina sequencing. This technology labels all reads that originate from a small number (~5-10) DNA molecules ~50Kbp in length with the same molecular barcode. These barcoded reads contain long-range sequence information that is advantageous for identification of structural variants. We present Novel Adjacency Identification with Barcoded Reads (NAIBR), an algorithm to identify structural variants in linked-read sequencing data. NAIBR predicts novel adjacencies in a individual genome resulting from structural variants using a probabilistic model that combines multiple signals in barcoded reads. We show that NAIBR outperforms several existing methods for structural variant identification - including two recent methods that also analyze linked-reads - on simulated sequencing data and 10X whole-genome sequencing data from the NA12878 human genome and the HCC1954 breast cancer cell line. Several of the novel somatic structural variants identified in HCC1954 overlap known cancer genes. Software is available at Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email:

  19. cis-acting elements at opposite ends of the Citrus tristeza virus genome differ in initiation and termination of subgenomic RNAs

    International Nuclear Information System (INIS)

    Ayllon, Maria A.; Gowda, Siddarame; Satyanarayana, Tatineni; Dawson, William O.


    Citrus tristeza virus (CTV), a member of the Closteroviridae with a plus-stranded genomic RNA of approximately 20 kb, produces 10 3'-coterminal subgenomic (sg) RNAs that serve as messenger (m)RNAs for its internal genes. In addition, a population of 5'-terminal sgRNAs of approximately 700 nts are highly abundant in infected cells. Previous analysis demonstrated that the controller elements (CE) are responsible for the 3'-terminal mRNAs and the small 5'-terminal sgRNAs differ in the number of additional sgRNAs produced. A feature of both types of CE is production of 5'- and 3'-terminal positive-stranded sgRNAs, but the 3' CEs additionally produce a negative-stranded complement of the 3'-terminal mRNAs. Here, we found that the termination (for 5'-terminal sgRNAs) and initiation (for 3'-terminal sgRNAs) sites of the 5' vs. the 3' CEs occur at opposite ends of the respective minimal active CEs. The initiation site for the 3' CE of the major coat protein gene, and probably those of the p20 and p23 genes, was outside (3' in terms of the genomic RNA) the minimal unit, whereas the termination sites were located within the minimal CE, 30-50 nts upstream of the initiation site (referring to the positive-strand sequence). In contrast, the initiation site for the 5' CE was in the 5' region of the minimal unit, with the termination sites 20-35 nts downstream (referring to the positive-strand sequence). Furthermore, the CEs differ in initiation nucleotide and response to mutagenesis of that nucleotide. The 3' CE initiates sgRNA synthesis from a uridylate, whereas the 5' CE initiates from a cytidylate. We previously found that the 3' CEs were unusually tolerant to mutagenesis of the initiation sites, with initiation proceeding from alternative sites. Mutagenesis of the initiation site of the 5' CE prevented synthesis of either the 5'- or 3'-terminal sgRNAs. Thus, the cis-acting elements at opposite ends of the genome are remarkably different, perhaps having arisen from different

  20. Diverse activities of viral cis-acting RNA regulatory elements revealed using multicolor, long-term, single-cell imaging. (United States)

    Pocock, Ginger M; Zimdars, Laraine L; Yuan, Ming; Eliceiri, Kevin W; Ahlquist, Paul; Sherer, Nathan M


    Cis-acting RNA structural elements govern crucial aspects of viral gene expression. How these structures and other posttranscriptional signals affect RNA trafficking and translation in the context of single cells is poorly understood. Herein we describe a multicolor, long-term (>24 h) imaging strategy for measuring integrated aspects of viral RNA regulatory control in individual cells. We apply this strategy to demonstrate differential mRNA trafficking behaviors governed by RNA elements derived from three retroviruses (HIV-1, murine leukemia virus, and Mason-Pfizer monkey virus), two hepadnaviruses (hepatitis B virus and woodchuck hepatitis virus), and an intron-retaining transcript encoded by the cellular NXF1 gene. Striking behaviors include "burst" RNA nuclear export dynamics regulated by HIV-1's Rev response element and the viral Rev protein; transient aggregations of RNAs into discrete foci at or near the nuclear membrane triggered by multiple elements; and a novel, pulsiform RNA export activity regulated by the hepadnaviral posttranscriptional regulatory element. We incorporate single-cell tracking and a data-mining algorithm into our approach to obtain RNA element-specific, high-resolution gene expression signatures. Together these imaging assays constitute a tractable, systems-based platform for studying otherwise difficult to access spatiotemporal features of viral and cellular gene regulation. © 2017 Pocock et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (

  1. Exome sequencing identifies ZNF644 mutations in high myopia.

    Directory of Open Access Journals (Sweden)

    Yi Shi


    Full Text Available Myopia is the most common ocular disorder worldwide, and high myopia in particular is one of the leading causes of blindness. Genetic factors play a critical role in the development of myopia, especially high myopia. Recently, the exome sequencing approach has been successfully used for the disease gene identification of Mendelian disorders. Here we show a successful application of exome sequencing to identify a gene for an autosomal dominant disorder, and we have identified a gene potentially responsible for high myopia in a monogenic form. We captured exomes of two affected individuals from a Han Chinese family with high myopia and performed sequencing analysis by a second-generation sequencer with a mean coverage of 30× and sufficient depth to call variants at ∼97% of each targeted exome. The shared genetic variants of these two affected individuals in the family being studied were filtered against the 1000 Genomes Project and the dbSNP131 database. A mutation A672G in zinc finger protein 644 isoform 1 (ZNF644 was identified as being related to the phenotype of this family. After we performed sequencing analysis of the exons in the ZNF644 gene in 300 sporadic cases of high myopia, we identified an additional five mutations (I587V, R680G, C699Y, 3'UTR+12 C>G, and 3'UTR+592 G>A in 11 different patients. All these mutations were absent in 600 normal controls. The ZNF644 gene was expressed in human retinal and retinal pigment epithelium (RPE. Given that ZNF644 is predicted to be a transcription factor that may regulate genes involved in eye development, mutation may cause the axial elongation of eyeball found in high myopia patients. Our results suggest that ZNF644 might be a causal gene for high myopia in a monogenic form.

  2. DMPD: Activation of lymphokine genes in T cells: role of cis-acting DNA elements thatrespond to T cell activation signals. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available thatrespond to T cell activation signals. Arai N, Naito Y, Watanabe M, Masuda ES, Yamaguchi-Iwai Y, Tsuboi A, Heike T,Matsud... in T cells: role of cis-acting DNA elements thatrespond to T cell activation signals. Authors Arai N, Naito Y, Watanabe M, Masud...a ES, Yamaguchi-Iwai Y, Tsuboi A, Heike T,Matsuda I, Yokota

  3. Cis-acting mutation and duplication: History of molecular evolution in a P450 haplotype responsible for insecticide resistance in Culex quinquefasciatus. (United States)

    Itokawa, Kentaro; Komagata, Osamu; Kasai, Shinji; Masada, Masahiro; Tomita, Takashi


    A cytochrome P450 gene, Cyp9m10, is more than 200-fold overexpressed in a pyrethroid resistant strain of Culex quinquefasciatus, JPal-per. The haplotype of this strain contains two copies of Cyp9m10 resulted from recent tandem duplication. In this study, we discovered and isolated a Cyp9m10 haplotype closely related to this duplicated Cyp9m10 haplotype from JHB, a strain used for the recent genome project for this mosquito species. The isolated haplotype (JHB-NIID-B haplotype) shared the same insertion of a transposable element upstream of the coding region with JPal-per strain but not duplicated. The JHB-NIID-B haplotype was considered to have diverged from the JPal-per lineage just before the duplication event. Cyp9m10 was moderately overexpressed in larvae with the JHB-NIID-B haplotype. The overexpressions in JHB-NIID-B and JPal-per haplotypes were developmentally regulated in similar pattern indicating both haplotypes share a common cis-acting mutation responsible for the overexpressions. The isolated moderately overexpressed haplotype conferred resistance, however, its efficacy was relatively small. We hypothesized that the first cis-acting mutation modified the consequence of the subsequent duplication in JPal-per lineage to confer stronger phenotypic effect than that if it occurred before the first cis-acting mutation. Copyright © 2011 Elsevier Ltd. All rights reserved.

  4. Analysis of a cis-Acting Element Involved in Regulation by Estrogen of Human Angiotensinogen Gene Expression. (United States)

    Zhao, Yan-Yan; Sun, Kai-Lai; Ashok, Kumar


    The work was aimed to identify the estrogen responsive element in the human angiotensinogen gene. The nucleotide sequence between the transcription initiation site and TATA box in angiotensinogen gene promoter was found to be strongly homologous with the consensus estrogen responsive element. This sequence was confirmed as the estrogen responsive element (HAG ERE) by electrophoretic mobility shift assay. The recombinant expression vectors were constructed in which chloramphenicol acetyltransferase (CAT) reporter gene was driven by angiotensinogen core promoter with HAG ERE of by TK core promoter with multiplied HAG ERE, and were used in cotransfection with the human estrogen receptor expression vector into HepG(2) cells; CAT assays showed an increase of the CAT activity on 17beta-estradiol treatment in those transfectants. These results suggest that the human angiotensinogen gene is transcriptionally up-regulated by estrogen through the estrogen responsive element near TATA box of the promoter.

  5. Exome sequencing identifies SUCO mutations in mesial temporal lobe epilepsy. (United States)

    Sha, Zhiqiang; Sha, Longze; Li, Wenting; Dou, Wanchen; Shen, Yan; Wu, Liwen; Xu, Qi


    Mesial temporal lobe epilepsy (mTLE) is the main type and most common medically intractable form of epilepsy. Severity of disease-based stratified samples may help identify new disease-associated mutant genes. We analyzed mRNA expression profiles from patient hippocampal tissue. Three of the seven patients had severe mTLE with generalized-onset convulsions and consciousness loss that occurred over many years. We found that compared with other groups, patients with severe mTLE were classified into a distinct group. Whole-exome sequencing and Sanger sequencing validation in all seven patients identified three novel SUN domain-containing ossification factor (SUCO) mutations in severely affected patients. Furthermore, SUCO knock down significantly reduced dendritic length in vitro. Our results indicate that mTLE defects may affect neuronal development, and suggest that neurons have abnormal development due to lack of SUCO, which may be a generalized-onset epilepsy-related gene. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  6. Characterization of a cis-acting element involved in cell-specific expression of the zebrafish brain aromatase gene. (United States)

    Le Page, Yann; Menuet, Arnaud; Kah, Olivier; Pakdel, Farzad


    The cytochrome P450 Aromatase is the key enzyme catalyzing the conversion of androgens into estrogens. In zebrafish, the brain aromatase is encoded by cyp19b. Expression of cyp19b is restricted to radial glial cells bordering forebrain ventricles and is strongly stimulated by estrogens during development. At the promoter level, we have previously shown that an estrogen responsive element (ERE) is required for induction by estrogens. Here, we investigated the role of ERE flanking regions in the control of cell-specific expression. First, we show that a 20 bp length motif, named G x RE (glial x responsive element), acts in synergy with the ERE to mediate the estrogenic induction specifically in glial cells. Second, we demonstrate that, in vitro, this sequence binds factors exclusively present in glial or neuro-glial cells and is able to confer a glial specificity to an artificial estrogen-dependent gene. Taken together, these results contribute to the understanding of the molecular mechanisms allowing cyp19b regulation by estrogens and allowed to identify a promoter sequence involved in the strong estrogen inducibility of cyp19b which is specific for glial cells. The exceptional aromatase activity measured in the brain of teleost fish could rely on such mechanisms.

  7. n-Alkane and clofibrate, a peroxisome proliferator, activate transcription of ALK2 gene encoding cytochrome P450alk2 through distinct cis-acting promoter elements in Candida maltosa

    International Nuclear Information System (INIS)

    Kogure, Takahisa; Takagi, Masamichi; Ohta, Akinori


    The ALK2 gene, encoding one of the n-alkane-hydroxylating cytochromes P450 in Candida maltosa, is induced by n-alkanes and a peroxisome proliferator, clofibrate. Deletion analysis of this gene's promoter revealed two cis-acting elements-an n-alkane-responsive element (ARE2) and a clofibrate-responsive element (CRE2)-that partly overlap in sequence but have distinct functions. ARE2-mediated activation responded to n-alkanes but not to clofibrate and was repressed by glucose. CRE2-mediated activation responded to polyunsaturated fatty acids and steroid hormones as well as to peroxisome proliferators but not to n-alkanes, and it was not repressed by glucose. Both elements mediated activation by oleic acid. Mutational analysis demonstrated that three CCG sequences in CRE2 were critical to the activation by clofibrate as well as to the in vitro binding of a specific protein to this element. These findings suggest that ALK2 is induced by peroxisome proliferators and steroid hormones through a specific CRE2-mediated regulatory mechanism

  8. MetaPhinder-Identifying Bacteriophage Sequences in Metagenomic Data Sets

    DEFF Research Database (Denmark)

    Jurtz, Vanessa Isabell; Villarroel, Julia; Lund, Ole


    genome structure of many bacteriophages. The method is demonstrated to outperform both BLAST methods based on single hits and methods based on k-mer comparisons. MetaPhinder is available as a web service at the Center for Genomic Epidemiology, while the source...... and understand them. Here we present MetaPhinder, a method to identify assembled genomic fragments (i.e. contigs) of phage origin in metage-nomic data sets. The method is based on a comparison to a database of whole genome bacteriophage sequences, integrating hits to multiple genomes to accomodate for the mosaic...... code can be downloaded from or

  9. The influence of cis-acting P1 protein and translational elements on the expression of Potato virus Y helper-component proteinase (HCPro) in heterologous systems and its suppression of silencing activity. (United States)

    Tena Fernández, Fátima; González, Inmaculada; Doblas, Paula; Rodríguez, César; Sahana, Nandita; Kaur, Harpreet; Tenllado, Francisco; Praveen, Shelly; Canto, Tomas


    In the Potyvirus genus, the P1 protein is the first N-terminal product processed from the viral polyprotein, followed by the helper-component proteinase (HCPro). In silencing suppression patch assays, we found that Potato virus Y (PVY) HCPro expressed from a P1-HCPro sequence increased the accumulation of a reporter gene, whereas protein expressed from an HCPro sequence did not, even with P1 supplied in trans. This enhancing effect of P1 has been noted in other potyviruses, but has remained unexplained. We analysed the accumulation of PVY HCPro in infiltrated tissues and found that it was higher when expressed from P1-HCPro than from HCPro sequences. Co-expression of heterologous suppressors increased the steady-state level of mRNA expressed from the HCPro sequence, but not that of protein. This suggests that, in the absence of P1 upstream, either HCPro acquires a conformation that affects negatively its activity or stability, or that its translation is reduced. To test these options, we purified HCPro expressed in the presence or absence of upstream P1, and found no difference in purification pattern and final soluble state. By contrast, alteration of the Kozak context in the HCPro mRNA sequence to favour translation increased partially suppressor accumulation and activity. Furthermore, protein activity was not lower than in protein expressed from P1-HCPro sequences. Thus, a direct role for P1 on HCPro suppressor activity or stability, by influencing its conformation during translation, can be excluded. However, P1 could still have an indirect effect favouring HCPro accumulation. Our data highlight the relevance of cis-acting translational elements in the heterologous expression of HCPro. © 2013 BSPP AND JOHN WILEY & SONS LTD.

  10. Exome sequencing identifies recurrent somatic RAC1 mutations in melanoma

    Energy Technology Data Exchange (ETDEWEB)

    Krauthammer, Michael; Kong, Yong; Ha, Byung Hak; Evans, Perry; Bacchiocchi, Antonella; McCusker, James P.; Cheng, Elaine; Davis, Matthew J.; Goh, Gerald; Choi, Murim; Ariyan, Stephan; Narayan, Deepak; Dutton-Regester, Ken; Capatana, Ana; Holman, Edna C.; Bosenberg, Marcus; Sznol, Mario; Kluger, Harriet M.; Brash, Douglas E.; Stern, David F.; Materin, Miguel A.; Lo, Roger S.; Mane, Shrikant; Ma, Shuangge; Kidd, Kenneth K.; Hayward, Nicholas K.; Lifton, Richard P.; Schlessinger, Joseph; Boggon, Titus J.; Halaban, Ruth (Yale-MED); (UCLA); (Queens)


    We characterized the mutational landscape of melanoma, the form of skin cancer with the highest mortality rate, by sequencing the exomes of 147 melanomas. Sun-exposed melanomas had markedly more ultraviolet (UV)-like C>T somatic mutations compared to sun-shielded acral, mucosal and uveal melanomas. Among the newly identified cancer genes was PPP6C, encoding a serine/threonine phosphatase, which harbored mutations that clustered in the active site in 12% of sun-exposed melanomas, exclusively in tumors with mutations in BRAF or NRAS. Notably, we identified a recurrent UV-signature, an activating mutation in RAC1 in 9.2% of sun-exposed melanomas. This activating mutation, the third most frequent in our cohort of sun-exposed melanoma after those of BRAF and NRAS, changes Pro29 to serine (RAC1{sup P29S}) in the highly conserved switch I domain. Crystal structures, and biochemical and functional studies of RAC1{sup P29S} showed that the alteration releases the conformational restraint conferred by the conserved proline, causes an increased binding of the protein to downstream effectors, and promotes melanocyte proliferation and migration. These findings raise the possibility that pharmacological inhibition of downstream effectors of RAC1 signaling could be of therapeutic benefit.

  11. Somatic mutations in histiocytic sarcoma identified by next generation sequencing. (United States)

    Liu, Qingqing; Tomaszewicz, Keith; Hutchinson, Lloyd; Hornick, Jason L; Woda, Bruce; Yu, Hongbo


    Histiocytic sarcoma is a rare malignant neoplasm of presumed hematopoietic origin showing morphologic and immunophenotypic evidence of histiocytic differentiation. Somatic mutation importance in the pathogenesis or disease progression of histiocytic sarcoma was largely unknown. To identify somatic mutations in histiocytic sarcoma, we studied 5 histiocytic sarcomas [3 female and 2 male patients; mean age 54.8 (20-72), anatomic sites include lymph node, uterus, and pleura] and matched normal tissues from each patient as germ line controls. Somatic mutations in 50 "Hotspot" oncogenes and tumor suppressor genes were examined using next generation sequencing. Three (out of five) histiocytic sarcoma cases carried somatic mutations in BRAF. Among them, G464V [variant frequency (VF) of 43.6 %] and G466R (VF of 29.6 %) located at the P loop potentially interfere with the hydrophobic interaction between P and activating loops and ultimately activation of BRAF. Also detected was BRAF somatic mutation N581S (VF of 7.4 %), which was located at the catalytic loop of BRAF kinase domain: its role in modifying kinase activity was unclear. A similar mutational analysis was also performed on nine acute monocytic/monoblastic leukemia cases, which did not identify any BRAF somatic mutations. Our study detected several BRAF mutations in histiocytic sarcomas, which may be important in understanding the tumorigenesis of this rare neoplasm and providing mechanisms for potential therapeutical opportunities.

  12. Interaction between two cis-acting elements, ABRE and DRE, in ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses. (United States)

    Narusaka, Yoshihiro; Nakashima, Kazuo; Shinwari, Zabta K; Sakuma, Yoh; Furihata, Takashi; Abe, Hiroshi; Narusaka, Mari; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko


    Many abiotic stress-inducible genes contain two cis-acting elements, namely a dehydration-responsive element (DRE; TACCGACAT) and an ABA-responsive element (ABRE; ACGTGG/TC), in their promoter regions. We precisely analyzed the 120 bp promoter region (-174 to -55) of the Arabidopsis rd29A gene whose expression is induced by dehydration, high-salinity, low-temperature, and abscisic acid (ABA) treatments and whose 120 bp promoter region contains the DRE, DRE/CRT-core motif (A/GCCGAC), and ABRE sequences. Deletion and base substitution analyses of this region showed that the DRE-core motif functions as DRE and that the DRE/DRE-core motif could be a coupling element of ABRE. Gel mobility shift assays revealed that DRE-binding proteins (DREB1s/CBFs and DREB2s) bind to both DRE and the DRE-core motif and that ABRE-binding proteins (AREBs/ABFs) bind to ABRE in the 120 bp promoter region. In addition, transactivation experiments using Arabidopsis leaf protoplasts showed that DREBs and AREBs cumulatively transactivate the expression of a GUS reporter gene fused to the 120 bp promoter region of rd29A. These results indicate that DRE and ABRE are interdependent in the ABA-responsive expression of the rd29A gene in response to ABA in Arabidopsis.

  13. Analysis of sequence diversity through internal transcribed spacers and simple sequence repeats to identify Dendrobium species. (United States)

    Liu, Y T; Chen, R K; Lin, S J; Chen, Y C; Chin, S W; Chen, F C; Lee, C Y


    The Orchidaceae is one of the largest and most diverse families of flowering plants. The Dendrobium genus has high economic potential as ornamental plants and for medicinal purposes. In addition, the species of this genus are able to produce large crops. However, many Dendrobium varieties are very similar in outward appearance, making it difficult to distinguish one species from another. This study demonstrated that the 12 Dendrobium species used in this study may be divided into 2 groups by internal transcribed spacer (ITS) sequence analysis. Red and yellow flowers may also be used to separate these species into 2 main groups. In particular, the deciduous characteristic is associated with the ITS genetic diversity of the A group. Of 53 designed simple sequence repeat (SSR) primer pairs, 7 pairs were polymorphic for polymerase chain reaction products that were amplified from a specific band. The results of this study demonstrate that these 7 SSR primer pairs may potentially be used to identify Dendrobium species and their progeny in future studies.

  14. Cis-Acting Determinants Affecting Centromere Function, Sister-Chromatid Cohesion and Reciprocal Recombination during Meiosis in Saccharomyces Cerevisiae


    Sears, D. D.; Hegemann, J. H.; Shero, J. H.; Hieter, P.


    We have employed a system that utilizes homologous pairs of human DNA-derived yeast artificial chromosomes (YACs) as marker chromosomes to assess the specific role (s) of conserved centromere DNA elements (CDEI, CDEII and CDEIII) in meiotic chromosome disjunction fidelity. Thirteen different centromere (CEN) mutations were tested for their effects on meiotic centromere function. YACs containing a wild-type CEN DNA sequence segregate with high fidelity in meiosis I (99% normal segregation) and...

  15. Murine homeobox-containing gene, Msx-1: analysis of genomic organization, promoter structure, and potential autoregulatory cis-acting elements. (United States)

    Kuzuoka, M; Takahashi, T; Guron, C; Raghow, R


    Detailed molecular organization of the coding and upstream regulatory regions of the murine homeodomain-containing gene, Msx-1, is reported. The protein-encoding portion of the gene is contained in two exons, 590 and 1214 bp in length, separated by a 2107-bp intron; the homeodomain is located in the second exon. The two-exon organization of the murine Msx-1 gene resembles a number of other homeodomain-containing genes. The 5'-(GTAAGT) and 3'-(CCCTAG) splicing junctions and the mRNA polyadenylation signal (UAUAA) of the murine Msx-1 gene are also characteristic of other vertebrate genes. By nuclease protection and primer extension assays, the start of transcription of the Msx-1 gene was located 256 bp upstream of the first AUG. Computer analysis of the promoter proximal 1280-bp sequence revealed a number of potentially important cis-regulatory sequences; these include the recognition elements for Ap-1, Ap-2, Ap-3, Sp-1, a possible binding site for RAR:RXR, and a number of TCF-1 consensus motifs. Importantly, a perfect reverse complement of (C/G)TTAATTG, which was recently shown to be an optimal binding sequence for the homeodomain of Msx-1 protein (K.M. Catron, N. Iler, and C. Abate (1993) Mol. Cell. Biol. 13:2354-2365), was also located in the murine Msx-1 promoter. Binding of bacterially expressed Msx-1 homeodomain polypeptide to Msx-1-specific oligonucleotide was experimentally demonstrated, raising a distinct possibility of autoregulation of this developmentally regulated gene.

  16. Functional Interaction of the Adenovirus IVa2 Protein with Adenovirus Type 5 Packaging Sequences


    Ostapchuk, Philomena; Yang, Jihong; Auffarth, Ece; Hearing, Patrick


    Adenovirus type 5 (Ad5) DNA packaging is initiated in a polar fashion from the left end of the genome. The packaging process is dependent on the cis-acting packaging domain located between nucleotides 230 and 380. Seven AT-rich repeats that direct packaging have been identified within this domain. A1, A2, A5, and A6 are the most important repeats functionally and share a bipartite sequence motif. Several lines of evidence suggest that there is a limiting trans-acting factor(s) that plays a ro...

  17. Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure.

    Directory of Open Access Journals (Sweden)

    Masfique Mehedi

    Full Text Available Ebolavirus (EBOV, the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.

  18. Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure. (United States)

    Mehedi, Masfique; Hoenen, Thomas; Robertson, Shelly; Ricklefs, Stacy; Dolan, Michael A; Taylor, Travis; Falzarano, Darryl; Ebihara, Hideki; Porcella, Stephen F; Feldmann, Heinz


    Ebolavirus (EBOV), the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.

  19. Simple sequence repeat (SSR) markers are effective for identifying ...

    African Journals Online (AJOL)

    DNA was extracted from newly formed leaves and amplified using 21 simple sequence repeat (SSR) markers (NH001c, NH002b, NH005b, NH007b, NH008b, NH009b, NH011b, NH013b, NH012a, NH014a, NH015a, NH017a, KA4b, KA5, KA14, KA16, KB16, KU10, BGA35, BGT23b and HGA8b). The data was analyzed by ...

  20. A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene. (United States)

    Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B


    Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

  1. Transcriptome sequencing in prostate cancer identifies inter-tumor heterogeneity

    Directory of Open Access Journals (Sweden)

    Janet Mendonca


    Full Text Available Given the dearth of gene mutations in prostate cancer, [1] ,[2] it is likely that genomic rearrangements play a significant role in the evolution of prostate cancer. However, in the search for recurrent genomic alterations, "private alterations" have received less attention. Such alterations may provide insights into the evolution, behavior, and clinical outcome of an individual tumor. In a recent report in "Genome Biology" Wyatt et al. [3] defines unique alterations in a cohort of high-risk prostate cancer patient with a lethal phenotype. Utilizing a transcriptome sequencing approach they observe high inter-tumor heterogeneity; however, the genes altered distill into three distinct cancer-relevant pathways. Their analysis reveals the presence of several non-ETS fusions, which may contribute to the phenotype of individual tumors, and have significance for disease progression.

  2. A method of predicting changes in human gene splicing induced by genetic variants in context of cis-acting elements

    Directory of Open Access Journals (Sweden)

    Hicks Chindo


    Full Text Available Abstract Background Polymorphic variants and mutations disrupting canonical splicing isoforms are among the leading causes of human hereditary disorders. While there is a substantial evidence of aberrant splicing causing Mendelian diseases, the implication of such events in multi-genic disorders is yet to be well understood. We have developed a new tool (SpliceScan II for predicting the effects of genetic variants on splicing and cis-regulatory elements. The novel Bayesian non-canonical 5'GC splice site (SS sensor used in our tool allows inference on non-canonical exons. Results Our tool performed favorably when compared with the existing methods in the context of genes linked to the Autism Spectrum Disorder (ASD. SpliceScan II was able to predict more aberrant splicing isoforms triggered by the mutations, as documented in DBASS5 and DBASS3 aberrant splicing databases, than other existing methods. Detrimental effects behind some of the polymorphic variations previously associated with Alzheimer's and breast cancer could be explained by changes in predicted splicing patterns. Conclusions We have developed SpliceScan II, an effective and sensitive tool for predicting the detrimental effects of genomic variants on splicing leading to Mendelian and complex hereditary disorders. The method could potentially be used to screen resequenced patient DNA to identify de novo mutations and polymorphic variants that could contribute to a genetic disorder.

  3. cis-Acting Complex-Trait-Associated lincRNA Expression Correlates with Modulation of Chromosomal Architecture

    Directory of Open Access Journals (Sweden)

    Jennifer Yihong Tan


    Full Text Available Summary: Intergenic long noncoding RNAs (lincRNAs are the largest class of transcripts in the human genome. Although many have recently been linked to complex human traits, the underlying mechanisms for most of these transcripts remain undetermined. We investigated the regulatory roles of a high-confidence and reproducible set of 69 trait-relevant lincRNAs (TR-lincRNAs in human lymphoblastoid cells whose biological relevance is supported by their evolutionary conservation during recent human history and genetic interactions with other trait-associated loci. Their enrichment in enhancer-like chromatin signatures, interactions with nearby trait-relevant protein-coding loci, and preferential location at topologically associated domain (TAD boundaries provide evidence that TR-lincRNAs likely regulate proximal trait-relevant gene expression in cis by modulating local chromosomal architecture. This is consistent with the positive and significant correlation found between TR-lincRNA abundance and intra-TAD DNA-DNA contacts. Our results provide insights into the molecular mode of action by which TR-lincRNAs contribute to complex human traits. : Tan et al. identify and characterize 69 human complex trait/disease-associated lincRNAs in LCLs. They show that these loci are often associated with cis-regulation of gene expression and tend to be localized at TAD boundaries, suggesting that these lincRNAs may influence chromosomal architecture. Keywords: intergenic long noncoding RNA, lincRNA, GWAS, expression quantitative trait loci, eQTL, complex trait and disease, enhancer, cis-regulation, topologically associated domains, TAD

  4. Generation of an efficient artificial promoter of bovine skeletal muscle α-actin gene (ACTA1) through addition of cis-acting element. (United States)

    Hu, Qian; Tong, Huili; Zhao, Dandan; Cao, Yunkao; Zhang, Weiwei; Chang, Shuwei; Yang, Yu; Yan, Yunqin


    The promoter of skeletal muscle α-actin gene (ACTA1) is highly muscle specific. The core of the bovine ACTA1 promoter extends from +29 to -233, about 262 base pairs (bp), which is sufficient to activate transcription in bovine muscle satellite cells. In this study, analysis by PCR site-specific mutagenesis showed that the cis-acting element SRE (serum response element binding factor) was processed as a transcriptional activator. In order to enhance the bovine ACTA1 promoter's activity, we used a strategy to modify it. We cloned a fragment containing three SREs from the promoter of ACTA1, and then one or two clones were linked upstream of the core promoter (262 bp) of ACTA1. One and two clones increased the activity of the ACTA1 promoter 3-fold and 10-fold, respectively, and maintained muscle tissue specificity. The modified promoter with two clones could increase the level of ACTA1 mRNA and protein 4-fold and 1.1-fold, respectively. Immunofluorescence results showed that green fluorescence of ACTA1 increased. Additionally, the number of total muscle microfilaments increased. These genetically engineered promoters might be useful for regulating gene expression in muscle cells and improving muscle mass in livestock.

  5. Potential of DNA sequences to identify zoanthids (Cnidaria: Zoantharia). (United States)

    Sinniger, Frederic; Reimer, James D; Pawlowski, Jan


    The order Zoantharia is known for its chaotic taxonomy and difficult morphological identification. One method that potentially could help for examining such troublesome taxa is DNA barcoding, which identifies species using standard molecular markers. The mitochondrial cytochrome oxidase subunit I (COI) has been utilized to great success in groups such as birds and insects; however, its applicability in many other groups is controversial. Recently, some studies have suggested that barcoding is not applicable to anthozoans. Here, we examine the use of COI and mitochondrial 16S ribosomal DNA for zoanthid identification. Despite the absence of a clear barcoding gap, our results show that for most of 54 zoanthid samples, both markers could separate samples to the species, or species group, level, particularly when easily accessible ecological or distributional data were included. Additionally, we have used the short V5 region of mt 16S rDNA to identify eight old (13 to 50 years old) museum samples. We discuss advantages and disadvantages of COI and mt 16S rDNA as barcodes for Zoantharia, and recommend that either one or both of these markers be considered for zoanthid identification in the future.

  6. Identifying Statistical Dependence in Genomic Sequences via Mutual Information Estimates

    Directory of Open Access Journals (Sweden)

    Wojciech Szpankowski


    Full Text Available Questions of understanding and quantifying the representation and amount of information in organisms have become a central part of biological research, as they potentially hold the key to fundamental advances. In this paper, we demonstrate the use of information-theoretic tools for the task of identifying segments of biomolecules (DNA or RNA that are statistically correlated. We develop a precise and reliable methodology, based on the notion of mutual information, for finding and extracting statistical as well as structural dependencies. A simple threshold function is defined, and its use in quantifying the level of significance of dependencies between biological segments is explored. These tools are used in two specific applications. First, they are used for the identification of correlations between different parts of the maize zmSRp32 gene. There, we find significant dependencies between the 5′ untranslated region in zmSRp32 and its alternatively spliced exons. This observation may indicate the presence of as-yet unknown alternative splicing mechanisms or structural scaffolds. Second, using data from the FBI's combined DNA index system (CODIS, we demonstrate that our approach is particularly well suited for the problem of discovering short tandem repeats—an application of importance in genetic profiling.

  7. Gene Unprediction with Spurio: A tool to identify spurious protein sequences. (United States)

    Höps, Wolfram; Jeffryes, Matt; Bateman, Alex


    We now have access to the sequences of tens of millions of proteins. These protein sequences are essential for modern molecular biology and computational biology. The vast majority of protein sequences are derived from gene prediction tools and have no experimental supporting evidence for their translation.  Despite the increasing accuracy of gene prediction tools there likely exists a large number of spurious protein predictions in the sequence databases.  We have developed the Spurio tool to help identify spurious protein predictions in prokaryotes.  Spurio searches the query protein sequence against a prokaryotic nucleotide database using tblastn and identifies homologous sequences. The tblastn matches are used to score the query sequence's likelihood of being a spurious protein prediction using a Gaussian process model. The most informative feature is the appearance of stop codons within the presumed translation of homologous DNA sequences. Benchmarking shows that the Spurio tool is able to distinguish spurious from true proteins. However, transposon proteins are prone to be predicted as spurious because of the frequency of degraded homologs found in the DNA sequence databases. Our initial experiments suggest that less than 1% of the proteins in the UniProtKB sequence database are likely to be spurious and that Spurio is able to identify over 60 times more spurious proteins than the AntiFam resource. The Spurio software and source code is available under an MIT license at the following URL:

  8. Identifying Corneal Infections in Formalin-Fixed Specimens Using Next Generation Sequencing. (United States)

    Li, Zhigang; Breitwieser, Florian P; Lu, Jennifer; Jun, Albert S; Asnaghi, Laura; Salzberg, Steven L; Eberhart, Charles G


    We test the ability of next-generation sequencing, combined with computational analysis, to identify a range of organisms causing infectious keratitis. This retrospective study evaluated 16 cases of infectious keratitis and four control corneas in formalin-fixed tissues from the pathology laboratory. Infectious cases also were analyzed in the microbiology laboratory using culture, polymerase chain reaction, and direct staining. Classified sequence reads were analyzed with two different metagenomics classification engines, Kraken and Centrifuge, and visualized using the Pavian software tool. Sequencing generated 20 to 46 million reads per sample. On average, 96% of the reads were classified as human, 0.3% corresponded to known vectors or contaminant sequences, 1.7% represented microbial sequences, and 2.4% could not be classified. The two computational strategies successfully identified the fungal, bacterial, and amoebal pathogens in most patients, including all four bacterial and mycobacterial cases, five of six fungal cases, three of three Acanthamoeba cases, and one of three herpetic keratitis cases. In several cases, additional potential pathogens also were identified. In one case with cytomegalovirus identified by Kraken and Centrifuge, the virus was confirmed by direct testing, while two where Staphylococcus aureus or cytomegalovirus were identified by Centrifuge but not Kraken could not be confirmed. Confirmation was not attempted for an additional three potential pathogens identified by Kraken and 11 identified by Centrifuge. Next generation sequencing combined with computational analysis can identify a wide range of pathogens in formalin-fixed corneal specimens, with potential applications in clinical diagnostics and research.

  9. Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene. (United States)

    Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M


    We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

  10. kmer-SVM: a web server for identifying predictive regulatory sequence features in genomic data sets (United States)

    Fletez-Brant, Christopher; Lee, Dongwon; McCallion, Andrew S.; Beer, Michael A.


    Massively parallel sequencing technologies have made the generation of genomic data sets a routine component of many biological investigations. For example, Chromatin immunoprecipitation followed by sequence assays detect genomic regions bound (directly or indirectly) by specific factors, and DNase-seq identifies regions of open chromatin. A major bottleneck in the interpretation of these data is the identification of the underlying DNA sequence code that defines, and ultimately facilitates prediction of, these transcription factor (TF) bound or open chromatin regions. We have recently developed a novel computational methodology, which uses a support vector machine (SVM) with kmer sequence features (kmer-SVM) to identify predictive combinations of short transcription factor-binding sites, which determine the tissue specificity of these genomic assays (Lee, Karchin and Beer, Discriminative prediction of mammalian enhancers from DNA sequence. Genome Res. 2011; 21:2167–80). This regulatory information can (i) give confidence in genomic experiments by recovering previously known binding sites, and (ii) reveal novel sequence features for subsequent experimental testing of cooperative mechanisms. Here, we describe the development and implementation of a web server to allow the broader research community to independently apply our kmer-SVM to analyze and interpret their genomic datasets. We analyze five recently published data sets and demonstrate how this tool identifies accessory factors and repressive sequence elements. kmer-SVM is available at PMID:23771147

  11. The heptanucleotide motif GAGACGC is a key component of a cis-acting promoter element that is critical for SnSAG1 expression in Sarcocystis neurona. (United States)

    Gaji, Rajshekhar Y; Howe, Daniel K


    The apicomplexan parasite Sarcocystis neurona undergoes a complex process of intracellular development, during which many genes are temporally regulated. The described study was undertaken to begin identifying the basic promoter elements that control gene expression in S. neurona. Sequence analysis of the 5'-flanking region of five S. neurona genes revealed a conserved heptanucleotide motif GAGACGC that is similar to the WGAGACG motif described upstream of multiple genes in Toxoplasma gondii. The promoter region for the major surface antigen gene SnSAG1, which contains three heptanucleotide motifs within 135 bases of the transcription start site, was dissected by functional analysis using a dual luciferase reporter assay. These analyses revealed that a minimal promoter fragment containing all three motifs was sufficient to drive reporter molecule expression, with the presence and orientation of the 5'-most heptanucleotide motif being absolutely critical for promoter function. Further studies should help to identify additional sequence elements important for promoter function and for controlling gene expression during intracellular development by this apicomplexan pathogen.

  12. Close Sequence Comparisons are Sufficient to Identify Humancis-Regulatory Elements

    Energy Technology Data Exchange (ETDEWEB)

    Prabhakar, Shyam; Poulin, Francis; Shoukry, Malak; Afzal, Veena; Rubin, Edward M.; Couronne, Olivier; Pennacchio, Len A.


    Cross-species DNA sequence comparison is the primary method used to identify functional noncoding elements in human and other large genomes. However, little is known about the relative merits of evolutionarily close and distant sequence comparisons, due to the lack of a universal metric for sequence conservation, and also the paucity of empirically defined benchmark sets of cis-regulatory elements. To address this problem, we developed a general-purpose algorithm (Gumby) that detects slowly-evolving regions in primate, mammalian and more distant comparisons without requiring adjustment of parameters, and ranks conserved elements by P-value using Karlin-Altschul statistics. We benchmarked Gumby predictions against previously identified cis-regulatory elements at diverse genomic loci, and also tested numerous extremely conserved human-rodent sequences for transcriptional enhancer activity using reporter-gene assays in transgenic mice. Human regulatory elements were identified with acceptable sensitivity and specificity by comparison with 1-5 other eutherian mammals or 6 other simian primates. More distant comparisons (marsupial, avian, amphibian and fish) failed to identify many of the empirically defined functional noncoding elements. We derived an intuitive relationship between ancient and recent noncoding sequence conservation from whole genome comparative analysis, which explains some of these findings. Lastly, we determined that, in addition to strength of conservation, genomic location and/or density of surrounding conserved elements must also be considered in selecting candidate enhancers for testing at embryonic time points.

  13. Identifying recombinants in human and primate immunodeficiency virus sequence alignments using quartet scanning

    Directory of Open Access Journals (Sweden)

    Martin Darren P


    Full Text Available Abstract Background Recombination has a profound impact on the evolution of viruses, but characterizing recombination patterns in molecular sequences remains a challenging endeavor. Despite its importance in molecular evolutionary studies, identifying the sequences that exhibit such patterns has received comparatively less attention in the recombination detection framework. Here, we extend a quartet-mapping based recombination detection method to enable identification of recombinant sequences without prior specifications of either query and reference sequences. Through simulations we evaluate different recombinant identification statistics and significance tests. We compare the quartet approach with triplet-based methods that employ additional heuristic tests to identify parental and recombinant sequences. Results Analysis of phylogenetic simulations reveal that identifying the descendents of relatively old recombination events is a challenging task for all methods available, and that quartet scanning performs relatively well compared to the triplet based methods. The use of quartet scanning is further demonstrated by analyzing both well-established and putative HIV-1 recombinant strains. In agreement with recent findings, we provide evidence that the presumed circulating recombinant CRF02_AG is a 'pure' lineage, whereas the presumed parental lineage subtype G has a recombinant origin. We also demonstrate HIV-1 intrasubtype recombination, confirm the hybrid origin of SIV in chimpanzees and further disentangle the recombinant history of SIV lineages in a primate immunodeficiency virus data set. Conclusion Quartet scanning makes a valuable addition to triplet-based methods for identifying recombinant sequences without prior specifications of either query and reference sequences. The new method is available in the VisRD v.3.0 package

  14. An Evolutionarily Young Polar Bear (Ursus maritimus Endogenous Retrovirus Identified from Next Generation Sequence Data

    Directory of Open Access Journals (Sweden)

    Kyriakos Tsangaras


    Full Text Available Transcriptome analysis of polar bear (Ursus maritimus tissues identified sequences with similarity to Porcine Endogenous Retroviruses (PERV. Based on these sequences, four proviral copies and 15 solo long terminal repeats (LTRs of a newly described endogenous retrovirus were characterized from the polar bear draft genome sequence. Closely related sequences were identified by PCR analysis of brown bear (Ursus arctos and black bear (Ursus americanus but were absent in non-Ursinae bear species. The virus was therefore designated UrsusERV. Two distinct groups of LTRs were observed including a recombinant ERV that contained one LTR belonging to each group indicating that genomic invasions by at least two UrsusERV variants have recently occurred. Age estimates based on proviral LTR divergence and conservation of integration sites among ursids suggest the viral group is only a few million years old. The youngest provirus was polar bear specific, had intact open reading frames (ORFs and could potentially encode functional proteins. Phylogenetic analyses of UrsusERV consensus protein sequences suggest that it is part of a pig, gibbon and koala retrovirus clade. The young age estimates and lineage specificity of the virus suggests UrsusERV is a recent cross species transmission from an unknown reservoir and places the viral group among the youngest of ERVs identified in mammals.

  15. An Evolutionarily Young Polar Bear (Ursus maritimus) Endogenous Retrovirus Identified from Next Generation Sequence Data. (United States)

    Tsangaras, Kyriakos; Mayer, Jens; Alquezar-Planas, David E; Greenwood, Alex D


    Transcriptome analysis of polar bear (Ursus maritimus) tissues identified sequences with similarity to Porcine Endogenous Retroviruses (PERV). Based on these sequences, four proviral copies and 15 solo long terminal repeats (LTRs) of a newly described endogenous retrovirus were characterized from the polar bear draft genome sequence. Closely related sequences were identified by PCR analysis of brown bear (Ursus arctos) and black bear (Ursus americanus) but were absent in non-Ursinae bear species. The virus was therefore designated UrsusERV. Two distinct groups of LTRs were observed including a recombinant ERV that contained one LTR belonging to each group indicating that genomic invasions by at least two UrsusERV variants have recently occurred. Age estimates based on proviral LTR divergence and conservation of integration sites among ursids suggest the viral group is only a few million years old. The youngest provirus was polar bear specific, had intact open reading frames (ORFs) and could potentially encode functional proteins. Phylogenetic analyses of UrsusERV consensus protein sequences suggest that it is part of a pig, gibbon and koala retrovirus clade. The young age estimates and lineage specificity of the virus suggests UrsusERV is a recent cross species transmission from an unknown reservoir and places the viral group among the youngest of ERVs identified in mammals.

  16. An Evolutionarily Young Polar Bear (Ursus maritimus) Endogenous Retrovirus Identified from Next Generation Sequence Data (United States)

    Tsangaras, Kyriakos; Mayer, Jens; Alquezar-Planas, David E.; Greenwood, Alex D.


    Transcriptome analysis of polar bear (Ursus maritimus) tissues identified sequences with similarity to Porcine Endogenous Retroviruses (PERV). Based on these sequences, four proviral copies and 15 solo long terminal repeats (LTRs) of a newly described endogenous retrovirus were characterized from the polar bear draft genome sequence. Closely related sequences were identified by PCR analysis of brown bear (Ursus arctos) and black bear (Ursus americanus) but were absent in non-Ursinae bear species. The virus was therefore designated UrsusERV. Two distinct groups of LTRs were observed including a recombinant ERV that contained one LTR belonging to each group indicating that genomic invasions by at least two UrsusERV variants have recently occurred. Age estimates based on proviral LTR divergence and conservation of integration sites among ursids suggest the viral group is only a few million years old. The youngest provirus was polar bear specific, had intact open reading frames (ORFs) and could potentially encode functional proteins. Phylogenetic analyses of UrsusERV consensus protein sequences suggest that it is part of a pig, gibbon and koala retrovirus clade. The young age estimates and lineage specificity of the virus suggests UrsusERV is a recent cross species transmission from an unknown reservoir and places the viral group among the youngest of ERVs identified in mammals. PMID:26610552

  17. Natural history bycatch: a pipeline for identifying metagenomic sequences in RADseq data

    Directory of Open Access Journals (Sweden)

    Iris Holmes


    Full Text Available Background Reduced representation genomic datasets are increasingly becoming available from a variety of organisms. These datasets do not target specific genes, and so may contain sequences from parasites and other organisms present in the target tissue sample. In this paper, we demonstrate that (1 RADseq datasets can be used for exploratory analysis of tissue-specific metagenomes, and (2 tissue collections house complete metagenomic communities, which can be investigated and quantified by a variety of techniques. Methods We present an exploratory method for mining metagenomic “bycatch” sequences from a range of host tissue types. We use a combination of the pyRAD assembly pipeline, NCBI’s blastn software, and custom R scripts to isolate metagenomic sequences from RADseq type datasets. Results When we focus on sequences that align with existing references in NCBI’s GenBank, we find that between three and five percent of identifiable double-digest restriction site associated DNA (ddRAD sequences from host tissue samples are from phyla to contain known blood parasites. In addition to tissue samples, we examine ddRAD sequences from metagenomic DNA extracted snake and lizard hind-gut samples. We find that the sequences recovered from these samples match with expected bacterial and eukaryotic gut microbiome phyla. Discussion Our results suggest that (1 museum tissue banks originally collected for host DNA archiving are also preserving valuable parasite and microbiome communities, (2 that publicly available RADseq datasets may include metagenomic sequences that could be explored, and (3 that restriction site approaches are a useful exploratory technique to identify microbiome lineages that could be missed by primer-based approaches.

  18. An Internet-Accessible DNA Sequence Database for Identifying Fusaria from Human and Animal Infections (United States)

    Because less than one-third of clinically relevant fusaria can be accurately identified to species level using phenotypic data (i.e., morphological species recognition), we constructed a three-locus DNA sequence database to facilitate molecular identification of the 69 Fusarium species associated wi...

  19. Exome Sequencing Fails to Identify the Genetic Cause of Aicardi Syndrome. (United States)

    Lund, Caroline; Striano, Pasquale; Sorte, Hanne Sørmo; Parisi, Pasquale; Iacomino, Michele; Sheng, Ying; Vigeland, Magnus D; Øye, Anne-Marte; Møller, Rikke Steensbjerre; Selmer, Kaja K; Zara, Federico


    Aicardi syndrome (AS) is a well-characterized neurodevelopmental disorder with an unknown etiology. In this study, we performed whole-exome sequencing in 11 female patients with the diagnosis of AS, in order to identify the disease-causing gene. In particular, we focused on detecting variants in the X chromosome, including the analysis of variants with a low number of sequencing reads, in case of somatic mosaicism. For 2 of the patients, we also sequenced the exome of the parents to search for de novo mutations. We did not identify any genetic variants likely to be damaging. Only one single missense variant was identified by the de novo analyses of the 2 trios, and this was considered benign. The failure to identify a disease gene in this study may be due to technical limitations of our study design, including the possibility that the genetic aberration leading to AS is situated in a non-exonic region or that the mutation is somatic and not detectable by our approach. Alternatively, it is possible that AS is genetically heterogeneous and that 11 patients are not sufficient to reveal the causative genes. Future studies of AS should consider designs where also non-exonic regions are explored and apply a sequencing depth so that also low-grade somatic mosaicism can be detected.

  20. Exome Sequencing Fails to Identify the Genetic Cause of Aicardi Syndrome

    DEFF Research Database (Denmark)

    Lund, Caroline; Striano, Pasquale; Sorte, Hanne Sørmo


    Aicardi syndrome (AS) is a well-characterized neurodevelopmental disorder with an unknown etiology. In this study, we performed whole-exome sequencing in 11 female patients with the diagnosis of AS, in order to identify the disease-causing gene. In particular, we focused on detecting variants in ...

  1. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes


    Hu, H.; Haas, S.A.; Chelly, J.; Van Esch, H.; Raynaud, M.; de Brouwer, A.P.M.; Weinert, S.; Froyen, G.; Frints, S.G.M.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.


    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of ...

  2. A Novel Prosthetic Joint Infection Pathogen, Mycoplasma salivarium, Identified by Metagenomic Shotgun Sequencing. (United States)

    Thoendel, Matthew; Jeraldo, Patricio; Greenwood-Quaintance, Kerryl E; Chia, Nicholas; Abdel, Matthew P; Steckelberg, James M; Osmon, Douglas R; Patel, Robin


    Defining the microbial etiology of culture-negative prosthetic joint infection (PJI) can be challenging. Metagenomic shotgun sequencing is a new tool to identify organisms undetected by conventional methods. We present a case where metagenomics was used to identify Mycoplasma salivarium as a novel PJI pathogen in a patient with hypogammaglobulinemia. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail:

  3. SoftSearch: integration of multiple sequence features to identify breakpoints of structural variations.

    Directory of Open Access Journals (Sweden)

    Steven N Hart

    Full Text Available BACKGROUND: Structural variation (SV represents a significant, yet poorly understood contribution to an individual's genetic makeup. Advanced next-generation sequencing technologies are widely used to discover such variations, but there is no single detection tool that is considered a community standard. In an attempt to fulfil this need, we developed an algorithm, SoftSearch, for discovering structural variant breakpoints in Illumina paired-end next-generation sequencing data. SoftSearch combines multiple strategies for detecting SV including split-read, discordant read-pair, and unmated pairs. Co-localized split-reads and discordant read pairs are used to refine the breakpoints. RESULTS: We developed and validated SoftSearch using real and synthetic datasets. SoftSearch's key features are 1 not requiring secondary (or exhaustive primary alignment, 2 portability into established sequencing workflows, and 3 is applicable to any DNA-sequencing experiment (e.g. whole genome, exome, custom capture, etc.. SoftSearch identifies breakpoints from a small number of soft-clipped bases from split reads and a few discordant read-pairs which on their own would not be sufficient to make an SV call. CONCLUSIONS: We show that SoftSearch can identify more true SVs by combining multiple sequence features. SoftSearch was able to call clinically relevant SVs in the BRCA2 gene not reported by other tools while offering significantly improved overall performance.

  4. Incorporation of unique molecular identifiers in TruSeq adapters improves the accuracy of quantitative sequencing. (United States)

    Hong, Jungeui; Gresham, David


    Quantitative analysis of next-generation sequencing (NGS) data requires discriminating duplicate reads generated by PCR from identical molecules that are of unique origin. Typically, PCR duplicates are identified as sequence reads that align to the same genomic coordinates using reference-based alignment. However, identical molecules can be independently generated during library preparation. Misidentification of these molecules as PCR duplicates can introduce unforeseen biases during analyses. Here, we developed a cost-effective sequencing adapter design by modifying Illumina TruSeq adapters to incorporate a unique molecular identifier (UMI) while maintaining the capacity to undertake multiplexed, single-index sequencing. Incorporation of UMIs into TruSeq adapters (TrUMIseq adapters) enables identification of bona fide PCR duplicates as identically mapped reads with identical UMIs. Using TrUMIseq adapters, we show that accurate removal of PCR duplicates results in improved accuracy of both allele frequency (AF) estimation in heterogeneous populations using DNA sequencing and gene expression quantification using RNA-Seq.

  5. Unique Trichomonas vaginalis gene sequences identified in multinational regions of Northwest China. (United States)

    Liu, Jun; Feng, Meng; Wang, Xiaolan; Fu, Yongfeng; Ma, Cailing; Cheng, Xunjia


    Trichomonas vaginalis (T. vaginalis) is a flagellated protozoan parasite that infects humans worldwide. This study determined the sequence of the 18S ribosomal RNA gene of T. vaginalis infecting both females and males in Xinjiang, China. Samples from 73 females and 28 males were collected and confirmed for infection with T. vaginalis, a total of 110 sequences were identified when the T. vaginalis 18S ribosomal RNA gene was sequenced. These sequences were used to prepare a phylogenetic network. The rooted network comprised three large clades and several independent branches. Most of the Xinjiang sequences were in one group. Preliminary results suggest that Xinjiang T. vaginalis isolates might be genetically unique, as indicated by the sequence of their 18S ribosomal RNA gene. Low migration rate of local people in this province may contribute to a genetic conservativeness of T. vaginalis. The unique genetic feature of our isolates may suggest a different clinical presentation of trichomoniasis, including metronidazole susceptibility, T. vaginalis virus or Mycoplasma co-infection characteristics. The transmission and evolution of Xinjiang T. vaginalis is of interest and should be studied further. More attention should be given to T. vaginalis infection in both females and males in Xinjiang.

  6. RNA-ID, a Powerful Tool for Identifying and Characterizing Regulatory Sequences. (United States)

    Brule, C E; Dean, K M; Grayhack, E J


    The identification and analysis of sequences that regulate gene expression is critical because regulated gene expression underlies biology. RNA-ID is an efficient and sensitive method to discover and investigate regulatory sequences in the yeast Saccharomyces cerevisiae, using fluorescence-based assays to detect green fluorescent protein (GFP) relative to a red fluorescent protein (RFP) control in individual cells. Putative regulatory sequences can be inserted either in-frame or upstream of a superfolder GFP fusion protein whose expression, like that of RFP, is driven by the bidirectional GAL1,10 promoter. In this chapter, we describe the methodology to identify and study cis-regulatory sequences in the RNA-ID system, explaining features and variations of the RNA-ID reporter, as well as some applications of this system. We describe in detail the methods to analyze a single regulatory sequence, from construction of a single GFP variant to assay of variants by flow cytometry, as well as modifications required to screen libraries of different strains simultaneously. We also describe subsequent analyses of regulatory sequences. © 2016 Elsevier Inc. All rights reserved.

  7. SeqAnt: A web service to rapidly identify and annotate DNA sequence variations

    Directory of Open Access Journals (Sweden)

    Patel Viren


    Full Text Available Abstract Background The enormous throughput and low cost of second-generation sequencing platforms now allow research and clinical geneticists to routinely perform single experiments that identify tens of thousands to millions of variant sites. Existing methods to annotate variant sites using information from publicly available databases via web browsers are too slow to be useful for the large sequencing datasets being routinely generated by geneticists. Because sequence annotation of variant sites is required before functional characterization can proceed, the lack of a high-throughput pipeline to efficiently annotate variant sites can act as a significant bottleneck in genetics research. Results SeqAnt (Sequence Annotator is an open source web service and software package that rapidly annotates DNA sequence variants and identifies recessive or compound heterozygous loci in human, mouse, fly, and worm genome sequencing experiments. Variants are characterized with respect to their functional type, frequency, and evolutionary conservation. Annotated variants can be viewed on a web browser, downloaded in a tab-delimited text file, or directly uploaded in a BED format to the UCSC genome browser. To demonstrate the speed of SeqAnt, we annotated a series of publicly available datasets that ranged in size from 37 to 3,439,107 variant sites. The total time to completely annotate these data completely ranged from 0.17 seconds to 28 minutes 49.8 seconds. Conclusion SeqAnt is an open source web service and software package that overcomes a critical bottleneck facing research and clinical geneticists using second-generation sequencing platforms. SeqAnt will prove especially useful for those investigators who lack dedicated bioinformatics personnel or infrastructure in their laboratories.

  8. Whole-Exome Sequencing Identifies Rare and Low-Frequency Coding Variants Associated with LDL Cholesterol (United States)

    Lange, Leslie A.; Hu, Youna; Zhang, He; Xue, Chenyi; Schmidt, Ellen M.; Tang, Zheng-Zheng; Bizon, Chris; Lange, Ethan M.; Smith, Joshua D.; Turner, Emily H.; Jun, Goo; Kang, Hyun Min; Peloso, Gina; Auer, Paul; Li, Kuo-ping; Flannick, Jason; Zhang, Ji; Fuchsberger, Christian; Gaulton, Kyle; Lindgren, Cecilia; Locke, Adam; Manning, Alisa; Sim, Xueling; Rivas, Manuel A.; Holmen, Oddgeir L.; Gottesman, Omri; Lu, Yingchang; Ruderfer, Douglas; Stahl, Eli A.; Duan, Qing; Li, Yun; Durda, Peter; Jiao, Shuo; Isaacs, Aaron; Hofman, Albert; Bis, Joshua C.; Correa, Adolfo; Griswold, Michael E.; Jakobsdottir, Johanna; Smith, Albert V.; Schreiner, Pamela J.; Feitosa, Mary F.; Zhang, Qunyuan; Huffman, Jennifer E.; Crosby, Jacy; Wassel, Christina L.; Do, Ron; Franceschini, Nora; Martin, Lisa W.; Robinson, Jennifer G.; Assimes, Themistocles L.; Crosslin, David R.; Rosenthal, Elisabeth A.; Tsai, Michael; Rieder, Mark J.; Farlow, Deborah N.; Folsom, Aaron R.; Lumley, Thomas; Fox, Ervin R.; Carlson, Christopher S.; Peters, Ulrike; Jackson, Rebecca D.; van Duijn, Cornelia M.; Uitterlinden, André G.; Levy, Daniel; Rotter, Jerome I.; Taylor, Herman A.; Gudnason, Vilmundur; Siscovick, David S.; Fornage, Myriam; Borecki, Ingrid B.; Hayward, Caroline; Rudan, Igor; Chen, Y. Eugene; Bottinger, Erwin P.; Loos, Ruth J.F.; Sætrom, Pål; Hveem, Kristian; Boehnke, Michael; Groop, Leif; McCarthy, Mark; Meitinger, Thomas; Ballantyne, Christie M.; Gabriel, Stacey B.; O’Donnell, Christopher J.; Post, Wendy S.; North, Kari E.; Reiner, Alexander P.; Boerwinkle, Eric; Psaty, Bruce M.; Altshuler, David; Kathiresan, Sekar; Lin, Dan-Yu; Jarvik, Gail P.; Cupples, L. Adrienne; Kooperberg, Charles; Wilson, James G.; Nickerson, Deborah A.; Abecasis, Goncalo R.; Rich, Stephen S.; Tracy, Russell P.; Willer, Cristen J.; Gabriel, Stacey B.; Altshuler, David M.; Abecasis, Gonçalo R.; Allayee, Hooman; Cresci, Sharon; Daly, Mark J.; de Bakker, Paul I.W.; DePristo, Mark A.; Do, Ron; Donnelly, Peter; Farlow, Deborah N.; Fennell, Tim; Garimella, Kiran; Hazen, Stanley L.; Hu, Youna; Jordan, Daniel M.; Jun, Goo; Kathiresan, Sekar; Kang, Hyun Min; Kiezun, Adam; Lettre, Guillaume; Li, Bingshan; Li, Mingyao; Newton-Cheh, Christopher H.; Padmanabhan, Sandosh; Peloso, Gina; Pulit, Sara; Rader, Daniel J.; Reich, David; Reilly, Muredach P.; Rivas, Manuel A.; Schwartz, Steve; Scott, Laura; Siscovick, David S.; Spertus, John A.; Stitziel, Nathaniel O.; Stoletzki, Nina; Sunyaev, Shamil R.; Voight, Benjamin F.; Willer, Cristen J.; Rich, Stephen S.; Akylbekova, Ermeg; Atwood, Larry D.; Ballantyne, Christie M.; Barbalic, Maja; Barr, R. Graham; Benjamin, Emelia J.; Bis, Joshua; Boerwinkle, Eric; Bowden, Donald W.; Brody, Jennifer; Budoff, Matthew; Burke, Greg; Buxbaum, Sarah; Carr, Jeff; Chen, Donna T.; Chen, Ida Y.; Chen, Wei-Min; Concannon, Pat; Crosby, Jacy; Cupples, L. Adrienne; D’Agostino, Ralph; DeStefano, Anita L.; Dreisbach, Albert; Dupuis, Josée; Durda, J. Peter; Ellis, Jaclyn; Folsom, Aaron R.; Fornage, Myriam; Fox, Caroline S.; Fox, Ervin; Funari, Vincent; Ganesh, Santhi K.; Gardin, Julius; Goff, David; Gordon, Ora; Grody, Wayne; Gross, Myron; Guo, Xiuqing; Hall, Ira M.; Heard-Costa, Nancy L.; Heckbert, Susan R.; Heintz, Nicholas; Herrington, David M.; Hickson, DeMarc; Huang, Jie; Hwang, Shih-Jen; Jacobs, David R.; Jenny, Nancy S.; Johnson, Andrew D.; Johnson, Craig W.; Kawut, Steven; Kronmal, Richard; Kurz, Raluca; Lange, Ethan M.; Lange, Leslie A.; Larson, Martin G.; Lawson, Mark; Lewis, Cora E.; Levy, Daniel; Li, Dalin; Lin, Honghuang; Liu, Chunyu; Liu, Jiankang; Liu, Kiang; Liu, Xiaoming; Liu, Yongmei; Longstreth, William T.; Loria, Cay; Lumley, Thomas; Lunetta, Kathryn; Mackey, Aaron J.; Mackey, Rachel; Manichaikul, Ani; Maxwell, Taylor; McKnight, Barbara; Meigs, James B.; Morrison, Alanna C.; Musani, Solomon K.; Mychaleckyj, Josyf C.; Nettleton, Jennifer A.; North, Kari; O’Donnell, Christopher J.; O’Leary, Daniel; Ong, Frank; Palmas, Walter; Pankow, James S.; Pankratz, Nathan D.; Paul, Shom; Perez, Marco; Person, Sharina D.; Polak, Joseph; Post, Wendy S.; Psaty, Bruce M.; Quinlan, Aaron R.; Raffel, Leslie J.; Ramachandran, Vasan S.; Reiner, Alexander P.; Rice, Kenneth; Rotter, Jerome I.; Sanders, Jill P.; Schreiner, Pamela; Seshadri, Sudha; Shea, Steve; Sidney, Stephen; Silverstein, Kevin; Smith, Nicholas L.; Sotoodehnia, Nona; Srinivasan, Asoke; Taylor, Herman A.; Taylor, Kent; Thomas, Fridtjof; Tracy, Russell P.; Tsai, Michael Y.; Volcik, Kelly A.; Wassel, Chrstina L.; Watson, Karol; Wei, Gina; White, Wendy; Wiggins, Kerri L.; Wilk, Jemma B.; Williams, O. Dale; Wilson, Gregory; Wilson, James G.; Wolf, Phillip; Zakai, Neil A.; Hardy, John; Meschia, James F.; Nalls, Michael; Singleton, Andrew; Worrall, Brad; Bamshad, Michael J.; Barnes, Kathleen C.; Abdulhamid, Ibrahim; Accurso, Frank; Anbar, Ran; Beaty, Terri; Bigham, Abigail; Black, Phillip; Bleecker, Eugene; Buckingham, Kati; Cairns, Anne Marie; Caplan, Daniel; Chatfield, Barbara; Chidekel, Aaron; Cho, Michael; Christiani, David C.; Crapo, James D.; Crouch, Julia; Daley, Denise; Dang, Anthony; Dang, Hong; De Paula, Alicia; DeCelie-Germana, Joan; Drumm, Allen DozorMitch; Dyson, Maynard; Emerson, Julia; Emond, Mary J.; Ferkol, Thomas; Fink, Robert; Foster, Cassandra; Froh, Deborah; Gao, Li; Gershan, William; Gibson, Ronald L.; Godwin, Elizabeth; Gondor, Magdalen; Gutierrez, Hector; Hansel, Nadia N.; Hassoun, Paul M.; Hiatt, Peter; Hokanson, John E.; Howenstine, Michelle; Hummer, Laura K.; Kanga, Jamshed; Kim, Yoonhee; Knowles, Michael R.; Konstan, Michael; Lahiri, Thomas; Laird, Nan; Lange, Christoph; Lin, Lin; Lin, Xihong; Louie, Tin L.; Lynch, David; Make, Barry; Martin, Thomas R.; Mathai, Steve C.; Mathias, Rasika A.; McNamara, John; McNamara, Sharon; Meyers, Deborah; Millard, Susan; Mogayzel, Peter; Moss, Richard; Murray, Tanda; Nielson, Dennis; Noyes, Blakeslee; O’Neal, Wanda; Orenstein, David; O’Sullivan, Brian; Pace, Rhonda; Pare, Peter; Parker, H. Worth; Passero, Mary Ann; Perkett, Elizabeth; Prestridge, Adrienne; Rafaels, Nicholas M.; Ramsey, Bonnie; Regan, Elizabeth; Ren, Clement; Retsch-Bogart, George; Rock, Michael; Rosen, Antony; Rosenfeld, Margaret; Ruczinski, Ingo; Sanford, Andrew; Schaeffer, David; Sell, Cindy; Sheehan, Daniel; Silverman, Edwin K.; Sin, Don; Spencer, Terry; Stonebraker, Jackie; Tabor, Holly K.; Varlotta, Laurie; Vergara, Candelaria I.; Weiss, Robert; Wigley, Fred; Wise, Robert A.; Wright, Fred A.; Wurfel, Mark M.; Zanni, Robert; Zou, Fei; Nickerson, Deborah A.; Rieder, Mark J.; Green, Phil; Shendure, Jay; Akey, Joshua M.; Bustamante, Carlos D.; Crosslin, David R.; Eichler, Evan E.; Fox, P. Keolu; Fu, Wenqing; Gordon, Adam; Gravel, Simon; Jarvik, Gail P.; Johnsen, Jill M.; Kan, Mengyuan; Kenny, Eimear E.; Kidd, Jeffrey M.; Lara-Garduno, Fremiet; Leal, Suzanne M.; Liu, Dajiang J.; McGee, Sean; O’Connor, Timothy D.; Paeper, Bryan; Robertson, Peggy D.; Smith, Joshua D.; Staples, Jeffrey C.; Tennessen, Jacob A.; Turner, Emily H.; Wang, Gao; Yi, Qian; Jackson, Rebecca; Peters, Ulrike; Carlson, Christopher S.; Anderson, Garnet; Anton-Culver, Hoda; Assimes, Themistocles L.; Auer, Paul L.; Beresford, Shirley; Bizon, Chris; Black, Henry; Brunner, Robert; Brzyski, Robert; Burwen, Dale; Caan, Bette; Carty, Cara L.; Chlebowski, Rowan; Cummings, Steven; Curb, J. David; Eaton, Charles B.; Ford, Leslie; Franceschini, Nora; Fullerton, Stephanie M.; Gass, Margery; Geller, Nancy; Heiss, Gerardo; Howard, Barbara V.; Hsu, Li; Hutter, Carolyn M.; Ioannidis, John; Jiao, Shuo; Johnson, Karen C.; Kooperberg, Charles; Kuller, Lewis; LaCroix, Andrea; Lakshminarayan, Kamakshi; Lane, Dorothy; Lasser, Norman; LeBlanc, Erin; Li, Kuo-Ping; Limacher, Marian; Lin, Dan-Yu; Logsdon, Benjamin A.; Ludlam, Shari; Manson, JoAnn E.; Margolis, Karen; Martin, Lisa; McGowan, Joan; Monda, Keri L.; Kotchen, Jane Morley; Nathan, Lauren; Ockene, Judith; O’Sullivan, Mary Jo; Phillips, Lawrence S.; Prentice, Ross L.; Robbins, John; Robinson, Jennifer G.; Rossouw, Jacques E.; Sangi-Haghpeykar, Haleh; Sarto, Gloria E.; Shumaker, Sally; Simon, Michael S.; Stefanick, Marcia L.; Stein, Evan; Tang, Hua; Taylor, Kira C.; Thomson, Cynthia A.; Thornton, Timothy A.; Van Horn, Linda; Vitolins, Mara; Wactawski-Wende, Jean; Wallace, Robert; Wassertheil-Smoller, Sylvia; Zeng, Donglin; Applebaum-Bowden, Deborah; Feolo, Michael; Gan, Weiniu; Paltoo, Dina N.; Sholinsky, Phyliss; Sturcke, Anne


    Elevated low-density lipoprotein cholesterol (LDL-C) is a treatable, heritable risk factor for cardiovascular disease. Genome-wide association studies (GWASs) have identified 157 variants associated with lipid levels but are not well suited to assess the impact of rare and low-frequency variants. To determine whether rare or low-frequency coding variants are associated with LDL-C, we exome sequenced 2,005 individuals, including 554 individuals selected for extreme LDL-C (>98th or <2nd percentile). Follow-up analyses included sequencing of 1,302 additional individuals and genotype-based analysis of 52,221 individuals. We observed significant evidence of association between LDL-C and the burden of rare or low-frequency variants in PNPLA5, encoding a phospholipase-domain-containing protein, and both known and previously unidentified variants in PCSK9, LDLR and APOB, three known lipid-related genes. The effect sizes for the burden of rare variants for each associated gene were substantially higher than those observed for individual SNPs identified from GWASs. We replicated the PNPLA5 signal in an independent large-scale sequencing study of 2,084 individuals. In conclusion, this large whole-exome-sequencing study for LDL-C identified a gene not known to be implicated in LDL-C and provides unique insight into the design and analysis of similar experiments. PMID:24507775

  9. HIV-1 envelope sequence-based diversity measures for identifying recent infections.

    Directory of Open Access Journals (Sweden)

    Alexis Kafando

    Full Text Available Identifying recent HIV-1 infections is crucial for monitoring HIV-1 incidence and optimizing public health prevention efforts. To identify recent HIV-1 infections, we evaluated and compared the performance of 4 sequence-based diversity measures including percent diversity, percent complexity, Shannon entropy and number of haplotypes targeting 13 genetic segments within the env gene of HIV-1. A total of 597 diagnostic samples obtained in 2013 and 2015 from recently and chronically HIV-1 infected individuals were selected. From the selected samples, 249 (134 from recent versus 115 from chronic infections env coding regions, including V1-C5 of gp120 and the gp41 ectodomain of HIV-1, were successfully amplified and sequenced by next generation sequencing (NGS using the Illumina MiSeq platform. The ability of the four sequence-based diversity measures to correctly identify recent HIV infections was evaluated using the frequency distribution curves, median and interquartile range and area under the curve (AUC of the receiver operating characteristic (ROC. Comparing the median and interquartile range and evaluating the frequency distribution curves associated with the 4 sequence-based diversity measures, we observed that the percent diversity, number of haplotypes and Shannon entropy demonstrated significant potential to discriminate recent from chronic infections (p<0.0001. Using the AUC of ROC analysis, only the Shannon entropy measure within three HIV-1 env segments could accurately identify recent infections at a satisfactory level. The env segments were gp120 C2_1 (AUC = 0.806, gp120 C2_3 (AUC = 0.805 and gp120 V3 (AUC = 0.812. Our results clearly indicate that the Shannon entropy measure represents a useful tool for predicting HIV-1 infection recency.

  10. BLAT2DOLite: An Online System for Identifying Significant Relationships between Genetic Sequences and Diseases.

    Directory of Open Access Journals (Sweden)

    Liang Cheng

    Full Text Available The significantly related diseases of sequences could play an important role in understanding the functions of these sequences. In this paper, we introduced BLAT2DOLite, an online system for annotating human genes and diseases and identifying the significant relationships between sequences and diseases. Currently, BLAT2DOLite integrates Entrez Gene database and Disease Ontology Lite (DOLite, which contain loci of gene and relationships between genes and diseases. It utilizes hypergeometric test to calculate P-values between genes and diseases of DOLite. The system can be accessed from: The corresponding web service is described in:

  11. Novel expressed sequences identified in a model of androgen independent prostate cancer

    Directory of Open Access Journals (Sweden)

    Jones Steven JM


    Full Text Available Abstract Background Prostate cancer is the most frequently diagnosed cancer in American men, and few effective treatment options are available to patients who develop hormone-refractory prostate cancer. The molecular changes that occur to allow prostate cells to proliferate in the absence of androgens are not fully understood. Results Subtractive hybridization experiments performed with samples from an in vivo model of hormonal progression identified 25 expressed sequences representing novel human transcripts. Intriguingly, these 25 sequences have small open-reading frames and are not highly conserved through evolution, suggesting many of these novel expressed sequences may be derived from untranslated regions of novel transcripts or from non-coding transcripts. Examination of a large metalibrary of human Serial Analysis of Gene Expression (SAGE tags demonstrated that only three of these novel sequences had been previously detected. RT-PCR experiments confirmed that the 6 sequences tested were expressed in specific human tissues, as well as in clinical samples of prostate cancer. Further RT-PCR experiments for five of these fragments indicated they originated from large untranslated regions of unannotated transcripts. Conclusion This study underlines the value of using complementary techniques in the annotation of the human genome. The tissue-specific expression of 4 of the 6 clones tested indicates the expression of these novel transcripts is tightly regulated, and future work will determine the possible role(s these novel transcripts may play in the progression of prostate cancer.

  12. Functional brain activation differences in stuttering identified with a rapid fMRI sequence (United States)

    Kraft, Shelly Jo; Choo, Ai Leen; Sharma, Harish; Ambrose, Nicoline G.


    The purpose of this study was to investigate whether brain activity related to the presence of stuttering can be identified with rapid functional MRI (fMRI) sequences that involved overt and covert speech processing tasks. The long-term goal is to develop sensitive fMRI approaches with developmentally appropriate tasks to identify deviant speech motor and auditory brain activity in children who stutter closer to the age at which recovery from stuttering is documented. Rapid sequences may be preferred for individuals or populations who do not tolerate long scanning sessions. In this report, we document the application of a picture naming and phoneme monitoring task in three minute fMRI sequences with adults who stutter (AWS). If relevant brain differences are found in AWS with these approaches that conform to previous reports, then these approaches can be extended to younger populations. Pairwise contrasts of brain BOLD activity between AWS and normally fluent adults indicated the AWS showed higher BOLD activity in the right inferior frontal gyrus (IFG), right temporal lobe and sensorimotor cortices during picture naming and and higher activity in the right IFG during phoneme monitoring. The right lateralized pattern of BOLD activity together with higher activity in sensorimotor cortices is consistent with previous reports, which indicates rapid fMRI sequences can be considered for investigating stuttering in younger participants. PMID:22133409

  13. Molecular defects identified by whole exome sequencing in a child with Fanconi anemia. (United States)

    Zheng, Zhaojing; Geng, Juan; Yao, Ru-En; Li, Caihua; Ying, Daming; Shen, Yongnian; Ying, Lei; Yu, Yongguo; Fu, Qihua


    Fanconi anemia is a rare genetic disease characterized by bone marrow failure, multiple congenital malformations, and an increased susceptibility to malignancy. At least 15 genes have been identified that are involved in the pathogenesis of Fanconi anemia. However, it is still a challenge to assign the complementation group and to characterize the molecular defects in patients with Fanconi anemia. In the current study, whole exome sequencing was used to identify the affected gene(s) in a boy with Fanconi anemia. A recurring, non-synonymous mutation was found (c.3971C>T, p.P1324L) as well as a novel frameshift mutation (c.989_995del, p.H330LfsX2) in FANCA gene. Our results indicate that whole exome sequencing may be useful in clinical settings for rapid identification of disease-causing mutations in rare genetic disorders such as Fanconi anemia. © 2013 Elsevier B.V. All rights reserved.

  14. A Flexible, Efficient Binomial Mixed Model for Identifying Differential DNA Methylation in Bisulfite Sequencing Data (United States)

    Lea, Amanda J.


    Identifying sources of variation in DNA methylation levels is important for understanding gene regulation. Recently, bisulfite sequencing has become a popular tool for investigating DNA methylation levels. However, modeling bisulfite sequencing data is complicated by dramatic variation in coverage across sites and individual samples, and because of the computational challenges of controlling for genetic covariance in count data. To address these challenges, we present a binomial mixed model and an efficient, sampling-based algorithm (MACAU: Mixed model association for count data via data augmentation) for approximate parameter estimation and p-value computation. This framework allows us to simultaneously account for both the over-dispersed, count-based nature of bisulfite sequencing data, as well as genetic relatedness among individuals. Using simulations and two real data sets (whole genome bisulfite sequencing (WGBS) data from Arabidopsis thaliana and reduced representation bisulfite sequencing (RRBS) data from baboons), we show that our method provides well-calibrated test statistics in the presence of population structure. Further, it improves power to detect differentially methylated sites: in the RRBS data set, MACAU detected 1.6-fold more age-associated CpG sites than a beta-binomial model (the next best approach). Changes in these sites are consistent with known age-related shifts in DNA methylation levels, and are enriched near genes that are differentially expressed with age in the same population. Taken together, our results indicate that MACAU is an efficient, effective tool for analyzing bisulfite sequencing data, with particular salience to analyses of structured populations. MACAU is freely available at PMID:26599596

  15. Whole-exome sequencing identified a variant in EFTUD2 gene in establishing a genetic diagnosis. (United States)

    Rengasamy Venugopalan, S; Farrow, E G; Lypka, M


    Craniofacial anomalies are complex and have an overlapping phenotype. Mandibulofacial Dysostosis and Oculo-Auriculo-Vertebral Spectrum are conditions that share common craniofacial phenotype and present a challenge in arriving at a diagnosis. In this report, we present a case of female proband who was given a differential diagnosis of Treacher Collins syndrome or Hemifacial Microsomia without certainty. Prior genetic testing reported negative for 22q deletion and FGFR screenings. The objective of this study was to demonstrate the critical role of whole-exome sequencing in establishing a genetic diagnosis of the proband. The participants were 14½-year-old affected female proband/parent trio. Proband/parent trio were enrolled in the study. Surgical tissue sample from the proband and parental blood samples were collected and prepared for whole-exome sequencing. Illumina HiSeq 2500 instrument was used for sequencing (125 nucleotide reads/84X coverage). Analyses of variants were performed using custom-developed software, RUNES and VIKING. Variant analyses following whole-exome sequencing identified a heterozygous de novo pathogenic variant, c.259C>T (p.Gln87*), in EFTUD2 (NM_004247.3) gene in the proband. Previous studies have reported that the variants in EFTUD2 gene were associated with Mandibulofacial Dysostosis with Microcephaly. Patients with facial asymmetry, micrognathia, choanal atresia and microcephaly should be analyzed for variants in EFTUD2 gene. Next-generation sequencing techniques, such as whole-exome sequencing offer great promise to improve the understanding of etiologies of sporadic genetic diseases. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. Identifying transposon insertions and their effects from RNA-sequencing data. (United States)

    de Ruiter, Julian R; Kas, Sjors M; Schut, Eva; Adams, David J; Koudijs, Marco J; Wessels, Lodewyk F A; Jonkers, Jos


    Insertional mutagenesis using engineered transposons is a potent forward genetic screening technique used to identify cancer genes in mouse model systems. In the analysis of these screens, transposon insertion sites are typically identified by targeted DNA-sequencing and subsequently assigned to predicted target genes using heuristics. As such, these approaches provide no direct evidence that insertions actually affect their predicted targets or how transcripts of these genes are affected. To address this, we developed IM-Fusion, an approach that identifies insertion sites from gene-transposon fusions in standard single- and paired-end RNA-sequencing data. We demonstrate IM-Fusion on two separate transposon screens of 123 mammary tumors and 20 B-cell acute lymphoblastic leukemias, respectively. We show that IM-Fusion accurately identifies transposon insertions and their true target genes. Furthermore, by combining the identified insertion sites with expression quantification, we show that we can determine the effect of a transposon insertion on its target gene(s) and prioritize insertions that have a significant effect on expression. We expect that IM-Fusion will significantly enhance the accuracy of cancer gene discovery in forward genetic screens and provide initial insight into the biological effects of insertions on candidate cancer genes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Targeted next-generation sequencing analysis identifies novel mutations in families with severe familial exudative vitreoretinopathy (United States)

    Huang, Xiao-Yan; Zhuang, Hong; Wu, Ji-Hong; Li, Jian-Kang; Hu, Fang-Yuan; Zheng, Yu; Tellier, Laurent Christian Asker M.; Zhang, Sheng-Hai; Gao, Feng-Juan; Zhang, Jian-Guo


    Purpose Familial exudative vitreoretinopathy (FEVR) is a genetically and clinically heterogeneous disease, characterized by failure of vascular development of the peripheral retina. The symptoms of FEVR vary widely among patients in the same family, and even between the two eyes of a given patient. This study was designed to identify the genetic defect in a patient cohort of ten Chinese families with a definitive diagnosis of FEVR. Methods To identify the causative gene, next-generation sequencing (NGS)-based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members by using Sanger sequencing and quantitative real-time PCR (QPCR). Results Of the cohort of ten FEVR families, six pathogenic variants were identified, including four novel and two known heterozygous mutations. Of the variants identified, four were missense variants, and two were novel heterozygous deletion mutations [LRP5, c.4053 DelC (p.Ile1351IlefsX88); TSPAN12, EX8Del]. The two novel heterozygous deletion mutations were not observed in the control subjects and could give rise to a relatively severe FEVR phenotype, which could be explained by the protein function prediction. Conclusions We identified two novel heterozygous deletion mutations [LRP5, c.4053 DelC (p.Ile1351IlefsX88); TSPAN12, EX8Del] using targeted NGS as a causative mutation for FEVR. These genetic deletion variations exhibit a severe form of FEVR, with tractional retinal detachments compared with other known point mutations. The data further enrich the mutation spectrum of FEVR and enhance our understanding of genotype–phenotype correlations to provide useful information for disease diagnosis, prognosis, and effective genetic counseling. PMID:28867931

  18. Deep sequencing of uveal melanoma identifies a recurrent mutation in PLCB4

    DEFF Research Database (Denmark)

    Johansson, Peter; Aoude, Lauren G; Wadt, Karin


    Next generation sequencing of uveal melanoma (UM) samples has identified a number of recurrent oncogenic or loss-of-function mutations in key driver genes including: GNAQ, GNA11, EIF1AX, SF3B1 and BAP1. To search for additional driver mutations in this tumor type we carried out whole......, instead, a BRCA mutation signature predominated. In addition to mutations in the known UM driver genes, we found a recurrent mutation in PLCB4 (c.G1888T, p.D630Y, NM_000933), which was validated using Sanger sequencing. The identical mutation was also found in published UM sequence data (1 of 56 tumors......-genome or whole-exome sequencing of 28 tumors or primary cell lines. These samples have a low mutation burden, with a mean of 10.6 protein changing mutations per sample (range 0 to 53). As expected for these sun-shielded melanomas the mutation spectrum was not consistent with an ultraviolet radiation signature...

  19. Whole exome sequencing identifies novel mutation in eight Chinese children with isolated tetralogy of Fallot. (United States)

    Liu, Lin; Wang, Hong-Dan; Cui, Cun-Ying; Qin, Yun-Yun; Fan, Tai-Bing; Peng, Bang-Tian; Zhang, Lian-Zhong; Wang, Cheng-Zeng


    Tetralogy of Fallot is the most common cyanotic congenital heart disease. However, its pathogenesis remains to be clarified. The purpose of this study was to identify the genetic variants in Tetralogy of Fallot by whole exome sequencing. Whole exome sequencing was performed among eight small families with Tetralogy of Fallot. Differential single nucleotide polymorphisms and small InDels were found by alignment within families and between families and then were verified by Sanger sequencing. Tetralogy of Fallot-related genes were determined by analysis using Gene Ontology /pathway, Online Mendelian Inheritance in Man, PubMed and other databases. A total of sixteen differential single nucleotide polymorphisms loci and eight differential small InDels were discovered. The sixteen differential single nucleotide polymorphisms loci were located on Chr 1, 2, 4, 5, 11, 12, 15, 22 and X. Among the sixteen single nucleotide polymorphisms loci, six has not been reported. The eight differential small InDels were located on Chr 2, 4, 9, 12, 17, 19 and X, whereas of the eight differential small InDels, two has not been reported. Analysis using Gene Ontology /pathway, Online Mendelian Inheritance in Man, PubMed and other databases revealed that PEX5 , NACA , ATXN2 , CELA1 , PCDHB4 and CTBP1 were associated with Tetralogy of Fallot. Our findings identify PEX5 , NACA , ATXN2 , CELA1 , PCDHB4 and CTBP1 mutations as underlying genetic causes of isolated tetralogy of Fallot.

  20. Exome Sequencing Identifies Potential Risk Variants for Mendelian Disorders at High Prevalence in Qatar (United States)

    Rodriguez-Flores, Juan L.; Fakhro, Khalid; Hackett, Neil R.; Salit, Jacqueline; Fuller, Jennifer; Agosto-Perez, Francisco; Gharbiah, Maey; Malek, Joel A.; Zirie, Mahmoud; Jayyousi, Amin; Badii, Ramin; Al-Marri, Ajayeb Al-Nabet; Chouchane, Lotfi; Stadler, Dora J.; Hunter-Zinck, Haley; Mezey, Jason G.; Crystal, Ronald G.


    Exome sequencing of families of related individuals has been highly successful in identifying genetic polymorphisms responsible for Mendelian disorders. Here, we demonstrate the value of the reverse approach, where we use exome sequencing of a sample of unrelated individuals to analyze allele frequencies of known causal mutations for Mendelian diseases. We sequenced the exomes of 100 individuals representing the three major genetic subgroups of the Qatari population (Q1 Bedouin, Q2 Persian-South Asian, Q3 African) and identified 37 variants in 33 genes with effects on 36 clinically significant Mendelian diseases. These include variants not present in 1000 Genomes and variants at high frequency when compared to 1000 Genomes populations. Several of these Mendelian variants were only segregating in one Qatari subpopulation, where the observed subpopulation specificity trends were confirmed in an independent population of 386 Qataris. Pre-marital genetic screening in Qatar tests for only 4 out of the 37, such that this study provides a set of Mendelian disease variants with potential impact on the epidemiological profile of the population that could be incorporated into the testing program if further experimental and clinical characterization confirms high penetrance. PMID:24123366

  1. Complete genome sequence of Clostridium estertheticum DSM 8809, a microbe identified in spoiled vacuum packed beef

    Directory of Open Access Journals (Sweden)

    Zhongyi Yu


    Full Text Available Blown pack spoilage (BPS is a major issue for the beef industry. Aetiological agents of BPS involve members of a group of Clostridium species, including Clostridium estertheticum which has the ability to produce gas, mostly carbon dioxide, under anaerobic psychotrophic growth conditions. This spore-forming bacterium grows slowly under laboratory conditions, and it can take up to 3 months to produce a workable culture. These characteristics have limited the study of this commercially challenging bacterium. Consequently information on this bacterium is limited and no effective controls are currently available to confidently detect and manage this production risk. In this study the complete genome of Clostridium estertheticum DSM 8809 was determined by SMRT® sequencing. The genome consists of a circular chromosome of 4.7 Mbp along with a single plasmid carrying a potential tellurite resistance gene tehB and a Tn3-like resolvase-encoding gene tnpR. The genome sequence was searched for central metabolic pathways that would support its biochemical profile and several enzymes contributing to this phenotype were identified. Several putative antibiotic/biocide/metal resistance-encoding genes and virulence factors were also identified in the genome, a feature that requires further research. The availability of the genome sequence will provide a basic blueprint from which to develop valuable biomarkers that could support and improve the detection and control of this bacterium along the beef production chain.

  2. Somatic mosaicism of a CDKL5 mutation identified by next-generation sequencing. (United States)

    Kato, Takeshi; Morisada, Naoya; Nagase, Hiroaki; Nishiyama, Masahiro; Toyoshima, Daisaku; Nakagawa, Taku; Maruyama, Azusa; Fu, Xue Jun; Nozu, Kandai; Wada, Hiroko; Takada, Satoshi; Iijima, Kazumoto


    CDKL5-related encephalopathy is an X-linked dominantly inherited disorder that is characterized by early infantile epileptic encephalopathy or atypical Rett syndrome. We describe a 5-year-old Japanese boy with intractable epilepsy, severe developmental delay, and Rett syndrome-like features. Onset was at 2 months, when his electroencephalogram showed sporadic single poly spikes and diffuse irregular poly spikes. We conducted a genetic analysis using an Illumina® TruSight™ One sequencing panel on a next-generation sequencer. We identified two epilepsy-associated single nucleotide variants in our case: CDKL5 p.Ala40Val and KCNQ2 p.Glu515Asp. CDKL5 p.Ala40Val has been previously reported to be responsible for early infantile epileptic encephalopathy. In our case, the CDKL5 heterozygous mutation showed somatic mosaicism because the boy's karyotype was 46,XY. The KCNQ2 variant p.Glu515Asp is known to cause benign familial neonatal seizures-1, and this variant showed paternal inheritance. Although we believe that the somatic mosaic CDKL5 mutation is mainly responsible for the neurological phenotype in the patient, the KCNQ2 variant might have some neurological effect. Genetic analysis by next-generation sequencing is capable of identifying multiple variants in a patient. Copyright © 2015 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

  3. Genetic mapping and exome sequencing identify variants associated with five novel diseases.

    Directory of Open Access Journals (Sweden)

    Erik G Puffenberger

    Full Text Available The Clinic for Special Children (CSC has integrated biochemical and molecular methods into a rural pediatric practice serving Old Order Amish and Mennonite (Plain children. Among the Plain people, we have used single nucleotide polymorphism (SNP microarrays to genetically map recessive disorders to large autozygous haplotype blocks (mean = 4.4 Mb that contain many genes (mean = 79. For some, uninformative mapping or large gene lists preclude disease-gene identification by Sanger sequencing. Seven such conditions were selected for exome sequencing at the Broad Institute; all had been previously mapped at the CSC using low density SNP microarrays coupled with autozygosity and linkage analyses. Using between 1 and 5 patient samples per disorder, we identified sequence variants in the known disease-causing genes SLC6A3 and FLVCR1, and present evidence to strongly support the pathogenicity of variants identified in TUBGCP6, BRAT1, SNIP1, CRADD, and HARS. Our results reveal the power of coupling new genotyping technologies to population-specific genetic knowledge and robust clinical data.

  4. Expressed sequences tags of the anther smut fungus, Microbotryum violaceum, identify mating and pathogenicity genes

    Directory of Open Access Journals (Sweden)

    Devier Benjamin


    Full Text Available Abstract Background The basidiomycete fungus Microbotryum violaceum is responsible for the anther-smut disease in many plants of the Caryophyllaceae family and is a model in genetics and evolutionary biology. Infection is initiated by dikaryotic hyphae produced after the conjugation of two haploid sporidia of opposite mating type. This study describes M. violaceum ESTs corresponding to nuclear genes expressed during conjugation and early hyphal production. Results A normalized cDNA library generated 24,128 sequences, which were assembled into 7,765 unique genes; 25.2% of them displayed significant similarity to annotated proteins from other organisms, 74.3% a weak similarity to the same set of known proteins, and 0.5% were orphans. We identified putative pheromone receptors and genes that in other fungi are involved in the mating process. We also identified many sequences similar to genes known to be involved in pathogenicity in other fungi. The M. violaceum EST database, MICROBASE, is available on the Web and provides access to the sequences, assembled contigs, annotations and programs to compare similarities against MICROBASE. Conclusion This study provides a basis for cloning the mating type locus, for further investigation of pathogenicity genes in the anther smut fungi, and for comparative genomics.

  5. Use of a mitochondrial COI sequence to identify species of the subtribe Aphidina (Hemiptera, Aphididae

    Directory of Open Access Journals (Sweden)

    Jianfeng WANG


    Full Text Available Aphids of the subtribe Aphidina are found mainly in the North Temperate Zone. The relative lack of diagnostic morphological characteristics has obscured the identification of species in this group. However, DNA-based taxonomic methods can clarify species relationships within this group. Sequence variation in a partial segment of the mitochondrial COI gene was highly effective for resolving species relationships within Aphidina. Forty-five species were correctly identified in a neighbor-joining tree. Mean intraspecific sequence divergence was 0.17%, with a range of 0.00% to 1.54%. Mean interspecific divergence within previously recognized genera or morphologically similar species groups was 4.54%, with variation mainly in the range of 3.50% to 8.00%. Possible reasons for anomalous levels of mean nucleotide divergence within or between some taxa are discussed.

  6. Whole-genome and Transcriptome Sequencing of Prostate Cancer Identify New Genetic Alterations Driving Disease Progression

    DEFF Research Database (Denmark)

    Ren, Shancheng; Wei, Gong-Hong; Liu, Dongbing


    BACKGROUND: Global disparities in prostate cancer (PCa) incidence highlight the urgent need to identify genomic abnormalities in prostate tumors in different ethnic populations including Asian men. OBJECTIVE: To systematically explore the genomic complexity and define disease-driven genetic......-scale and comprehensive genomic data of prostate cancer from Asian population. Identification of these genetic alterations may help advance prostate cancer diagnosis, prognosis, and treatment....... alterations in PCa. DESIGN, SETTING, AND PARTICIPANTS: The study sequenced whole-genome and transcriptome of tumor-benign paired tissues from 65 treatment-naive Chinese PCa patients. Subsequent targeted deep sequencing of 293 PCa-relevant genes was performed in another cohort of 145 prostate tumors. OUTCOME...

  7. Microsatellite Primers Identified by 454 Sequencing in the Floodplain Tree Species Eucalyptus victrix (Myrtaceae

    Directory of Open Access Journals (Sweden)

    Paul G. Nevill


    Full Text Available Premise of the study: Microsatellite primers were developed for Eucalyptus victrix (Myrtaceae to evaluate the population and spatial genetic structure of this widespread northwestern Australian riparian tree species, which may be impacted by hydrological changes associated with mining activity. Methods and Results: 454 GS-FLX shotgun sequencing was used to obtain 1895 sequences containing putative microsatellite motifs. Ten polymorphic microsatellite loci were identified and screened for variation in individuals from two populations in the Pilbara region. Observed heterozygosities ranged from 0.44 to 0.91 (mean: 0.66 and the number of alleles per locus ranged from five to 25 (average: 11. Conclusions: These microsatellite loci will be useful in future studies of population and spatial genetic structure in E. victrix, and inform the development of seed sourcing strategies for the species.

  8. Sequence-Based Introgression Mapping Identifies Candidate White Mold Tolerance Genes in Common Bean

    Directory of Open Access Journals (Sweden)

    Sujan Mamidi


    Full Text Available White mold, caused by the necrotrophic fungus (Lib. de Bary, is a major disease of common bean ( L.. WM7.1 and WM8.3 are two quantitative trait loci (QTL with major effects on tolerance to the pathogen. Advanced backcross populations segregating individually for either of the two QTL, and a recombinant inbred (RI population segregating for both QTL were used to fine map and confirm the genetic location of the QTL. The QTL intervals were physically mapped using the reference common bean genome sequence, and the physical intervals for each QTL were further confirmed by sequence-based introgression mapping. Using whole-genome sequence data from susceptible and tolerant DNA pools, introgressed regions were identified as those with significantly higher numbers of single-nucleotide polymorphisms (SNPs relative to the whole genome. By combining the QTL and SNP data, WM7.1 was located to a 660-kb region that contained 41 gene models on the proximal end of chromosome Pv07, while the WM8.3 introgression was narrowed to a 1.36-Mb region containing 70 gene models. The most polymorphic candidate gene in the WM7.1 region encodes a BEACH-domain protein associated with apoptosis. Within the WM8.3 interval, a receptor-like protein with the potential to recognize pathogen effectors was the most polymorphic gene. The use of gene and sequence-based mapping identified two candidate genes whose putative functions are consistent with the current model of pathogenicity.

  9. Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes. (United States)

    Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich


    The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.

  10. Contig Maps and Genomic Sequencing Identify Candidate Genes in the Usher 1C Locus (United States)

    Higgins, Michael J.; Day, Colleen D.; Smilinich, Nancy J.; Ni, L.; Cooper, Paul R.; Nowak, Norma J.; Davies, Chris; de Jong, Pieter J.; Hejtmancik, Fielding; Evans, Glen A.; Smith, Richard J.H.; Shows, Thomas B.


    Usher syndrome 1C (USH1C) is a congenital condition manifesting profound hearing loss, the absence of vestibular function, and eventual retinal degeneration. The USH1C locus has been mapped genetically to a 2- to 3-cM interval in 11p14–15.1 between D11S899 and D11S861. In an effort to identify the USH1C disease gene we have isolated the region between these markers in yeast artificial chromosomes (YACs) using a combination of STS content mapping and Alu–PCR hybridization. The YAC contig is ∼3.5 Mb and has located several other loci within this interval, resulting in the order CEN-LDHA-SAA1-TPH-D11S1310-(D11S1888/KCNC1)-MYOD1-D11S902D11S921-D11S1890-TEL. Subsequent haplotyping and homozygosity analysis refined the location of the disease gene to a 400-kb interval between D11S902 and D11S1890 with all affected individuals being homozygous for the internal marker D11S921. To facilitate gene identification, the critical region has been converted into P1 artificial chromosome (PAC) clones using sequence-tagged sites (STSs) mapped to the YAC contig, Alu–PCR products generated from the YACs, and PAC end probes. A contig of >50 PAC clones has been assembled between D11S1310 and D11S1890, confirming the order of markers used in haplotyping. Three PAC clones representing nearly two-thirds of the USH1C critical region have been sequenced. PowerBLAST analysis identified six clusters of expressed sequence tags (ESTs), two known genes (BIR,SUR1) mapped previously to this region, and a previously characterized but unmapped gene NEFA (DNA binding/EF hand/acidic amino-acid-rich). GRAIL analysis identified 11 CpG islands and 73 exons of excellent quality. These data allowed the construction of a transcription map for the USH1C critical region, consisting of three known genes and six or more novel transcripts. Based on their map location, these loci represent candidate disease loci for USH1C. The NEFA gene was assessed as the USH1C locus by the sequencing of an amplified NEFA

  11. Exome Sequencing and Linkage Analysis Identified Novel Candidate Genes in Recessive Intellectual Disability Associated with Ataxia. (United States)

    Jazayeri, Roshanak; Hu, Hao; Fattahi, Zohreh; Musante, Luciana; Abedini, Seyedeh Sedigheh; Hosseini, Masoumeh; Wienker, Thomas F; Ropers, Hans Hilger; Najmabadi, Hossein; Kahrizi, Kimia


    Intellectual disability (ID) is a neuro-developmental disorder which causes considerable socio-economic problems. Some ID individuals are also affected by ataxia, and the condition includes different mutations affecting several genes. We used whole exome sequencing (WES) in combination with homozygosity mapping (HM) to identify the genetic defects in five consanguineous families among our cohort study, with two affected children with ID and ataxia as major clinical symptoms. We identified three novel candidate genes, RIPPLY1, MRPL10, SNX14, and a new mutation in known gene SURF1. All are autosomal genes, except RIPPLY1, which is located on the X chromosome. Two are housekeeping genes, implicated in transcription and translation regulation and intracellular trafficking, and two encode mitochondrial proteins. The pathogenesis of these variants was evaluated by mutation classification, bioinformatic methods, review of medical and biological relevance, co-segregation studies in the particular family, and a normal population study. Linkage analysis and exome sequencing of a small number of affected family members is a powerful new technique which can be used to decrease the number of candidate genes in heterogenic disorders such as ID, and may even identify the responsible gene(s).

  12. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes. (United States)

    Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M


    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.

  13. Globicatella sanguinis bacteraemia identified by partial 16S rRNA gene sequencing

    DEFF Research Database (Denmark)

    Abdul-Redha, Rawaa Jalil; Balslew, Ulla; Christensen, Jens Jørgen


    Globicatella sanguinis is a gram-positive coccus, resembling non-haemolytic streptococci. The organism has been isolated infrequently from normally sterile sites of humans. Three isolates obtained by blood culture could not be identified by Rapid 32 ID Strep, but partial sequencing of the 16S r......RNA gene revealed the identity of the isolated bacteria, and supplementary biochemical tests confirmed the species identification. The cases histories illustrate the dilemma of finding relevant, newly recognized, opportunistic pathogens and the identification achievement (s) that can be obtained by using...

  14. RePS: a sequence assembler that masks exact repeats identified from the shotgun data

    DEFF Research Database (Denmark)

    Wang, Jun; Wong, Gane Ka-Shu; Ni, Peixiang


    We describe a sequence assembler, RePS (repeat-masked Phrap with scaffolding), that explicitly identifies exact 20mer repeats from the shotgun data and removes them prior to the assembly. The established software is used to compute meaningful error probabilities for each base. Clone......-end-pairing information is used to construct scaffolds that order and orient the contigs. We show with real data for human and rice that reasonable assemblies are possible even at coverages of only 4x to 6x, despite having up to 42.2% in exact repeats. Udgivelsesdato: 2002-May...

  15. Completed Ensemble Empirical Mode Decomposition: a Robust Signal Processing Tool to Identify Sequence Strata (United States)

    Purba, H.; Musu, J. T.; Diria, S. A.; Permono, W.; Sadjati, O.; Sopandi, I.; Ruzi, F.


    Well logging data provide many geological information and its trends resemble nonlinear or non-stationary signals. As long well log data recorded, there will be external factors can interfere or influence its signal resolution. A sensitive signal analysis is required to improve the accuracy of logging interpretation which it becomes an important thing to determine sequence stratigraphy. Complete Ensemble Empirical Mode Decomposition (CEEMD) is one of nonlinear and non-stationary signal analysis method which decomposes complex signal into a series of intrinsic mode function (IMF). Gamma Ray and Spontaneous Potential well log parameters decomposed into IMF-1 up to IMF-10 and each of its combination and correlation makes physical meaning identification. It identifies the stratigraphy and cycle sequence and provides an effective signal treatment method for sequence interface. This method was applied to BRK- 30 and BRK-13 well logging data. The result shows that the combination of IMF-5, IMF-6, and IMF-7 pattern represent short-term and middle-term while IMF-9 and IMF-10 represent the long-term sedimentation which describe distal front and delta front facies, and inter-distributary mouth bar facies, respectively. Thus, CEEMD clearly can determine the different sedimentary layer interface and better identification of the cycle of stratigraphic base level.

  16. Exome sequencing of a large family identifies potential candidate genes contributing risk to bipolar disorder. (United States)

    Zhang, Tianxiao; Hou, Liping; Chen, David T; McMahon, Francis J; Wang, Jen-Chyong; Rice, John P


    Bipolar disorder is a mental illness with lifetime prevalence of about 1%. Previous genetic studies have identified multiple chromosomal linkage regions and candidate genes that might be associated with bipolar disorder. The present study aimed to identify potential susceptibility variants for bipolar disorder using 6 related case samples from a four-generation family. A combination of exome sequencing and linkage analysis was performed to identify potential susceptibility variants for bipolar disorder. Our study identified a list of five potential candidate genes for bipolar disorder. Among these five genes, GRID1(Glutamate Receptor Delta-1 Subunit), which was previously reported to be associated with several psychiatric disorders and brain related traits, is particularly interesting. Variants with functional significance in this gene were identified from two cousins in our bipolar disorder pedigree. Our findings suggest a potential role for these genes and the related rare variants in the onset and development of bipolar disorder in this one family. Additional research is needed to replicate these findings and evaluate their patho-biological significance. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Transcriptome Sequencing of Chemically Induced Aquilaria sinensis to Identify Genes Related to Agarwood Formation. (United States)

    Ye, Wei; Wu, Hongqing; He, Xin; Wang, Lei; Zhang, Weimin; Li, Haohua; Fan, Yunfei; Tan, Guohui; Liu, Taomei; Gao, Xiaoxia


    Agarwood is a traditional Chinese medicine used as a clinical sedative, carminative, and antiemetic drug. Agarwood is formed in Aquilaria sinensis when A. sinensis trees are threatened by external physical, chemical injury or endophytic fungal irritation. However, the mechanism of agarwood formation via chemical induction remains unclear. In this study, we characterized the transcriptome of different parts of a chemically induced A. sinensis trunk sample with agarwood. The Illumina sequencing platform was used to identify the genes involved in agarwood formation. A five-year-old Aquilaria sinensis treated by formic acid was selected. The white wood part (B1 sample), the transition part between agarwood and white wood (W2 sample), the agarwood part (J3 sample), and the rotten wood part (F5 sample) were collected for transcriptome sequencing. Accordingly, 54,685,634 clean reads, which were assembled into 83,467 unigenes, were obtained with a Q20 value of 97.5%. A total of 50,565 unigenes were annotated using the Nr, Nt, SWISS-PROT, KEGG, COG, and GO databases. In particular, 171,331,352 unigenes were annotated by various pathways, including the sesquiterpenoid (ko00909) and plant-pathogen interaction (ko03040) pathways. These pathways were related to sesquiterpenoid biosynthesis and defensive responses to chemical stimulation. The transcriptome data of the different parts of the chemically induced A. sinensis trunk provide a rich source of materials for discovering and identifying the genes involved in sesquiterpenoid production and in defensive responses to chemical stimulation. This study is the first to use de novo sequencing and transcriptome assembly for different parts of chemically induced A. sinensis. Results demonstrate that the sesquiterpenoid biosynthesis pathway and WRKY transcription factor play important roles in agarwood formation via chemical induction. The comparative analysis of the transcriptome data of agarwood and A. sinensis lays the foundation

  18. Exome sequencing identifies CTSK mutations in patients originally diagnosed as intermediate osteopetrosis☆ (United States)

    Pangrazio, Alessandra; Puddu, Alessandro; Oppo, Manuela; Valentini, Maria; Zammataro, Luca; Vellodi, Ashok; Gener, Blanca; Llano-Rivas, Isabel; Raza, Jamal; Atta, Irum; Vezzoni, Paolo; Superti-Furga, Andrea; Villa, Anna; Sobacchi, Cristina


    Autosomal Recessive Osteopetrosis is a genetic disorder characterized by increased bone density due to lack of resorption by the osteoclasts. Genetic studies have widely unraveled the molecular basis of the most severe forms, while cases of intermediate severity are more difficult to characterize, probably because of a large heterogeneity. Here, we describe the use of exome sequencing in the molecular diagnosis of 2 siblings initially thought to be affected by “intermediate osteopetrosis”, which identified a homozygous mutation in the CTSK gene. Prompted by this finding, we tested by Sanger sequencing 25 additional patients addressed to us for recessive osteopetrosis and found CTSK mutations in 4 of them. In retrospect, their clinical and radiographic features were found to be compatible with, but not typical for, Pycnodysostosis. We sought to identify modifier genes that might have played a role in the clinical manifestation of the disease in these patients, but our results were not informative. In conclusion, we underline the difficulties of differential diagnosis in some patients whose clinical appearance does not fit the classical malignant or benign picture and recommend that CTSK gene be included in the molecular diagnosis of high bone density conditions. PMID:24269275

  19. Identifying Genetic Signatures of Natural Selection Using Pooled Population Sequencing in Picea abies. (United States)

    Chen, Jun; Källman, Thomas; Ma, Xiao-Fei; Zaina, Giusi; Morgante, Michele; Lascoux, Martin


    The joint inference of selection and past demography remain a costly and demanding task. We used next generation sequencing of two pools of 48 Norway spruce mother trees, one corresponding to the Fennoscandian domain, and the other to the Alpine domain, to assess nucleotide polymorphism at 88 nuclear genes. These genes are candidate genes for phenological traits, and most belong to the photoperiod pathway. Estimates of population genetic summary statistics from the pooled data are similar to previous estimates, suggesting that pooled sequencing is reliable. The nonsynonymous SNPs tended to have both lower frequency differences and lower FST values between the two domains than silent ones. These results suggest the presence of purifying selection. The divergence between the two domains based on synonymous changes was around 5 million yr, a time similar to a recent phylogenetic estimate of 6 million yr, but much larger than earlier estimates based on isozymes. Two approaches, one of them novel and that considers both FST and difference in allele frequencies between the two domains, were used to identify SNPs potentially under diversifying selection. SNPs from around 20 genes were detected, including genes previously identified as main target for selection, such as PaPRR3 and PaGI. Copyright © 2016 Chen et al.

  20. Identifying and sequencing a Mycobacterium sp. strain F4 as a potential bioremediation agent for quinclorac. (United States)

    Li, Yingying; Chen, Wu; Wang, Yunsheng; Luo, Kun; Li, Yue; Bai, Lianyang; Luo, Feng


    Quinclorac is a widely used herbicide in rice filed. Unfortunately, quinclorac residues are phytotoxic to many crops/vegetables. The degradation of quinclorac in nature is very slow. On the other hand, degradation of quinclorac using bacteria can be an effective and efficient method to reduce its contamination. In this study, we isolated a quinclorac bioremediation bacterium strain F4 from quinclorac contaminated soils. Based on morphological characteristics and 16S rRNA gene sequence analysis, we identified strain F4 as Mycobacterium sp. We investigated the effects of temperature, pH, inoculation size and initial quinclorac concentration on growth and degrading efficiency of F4 and determined the optimal quinclorac degrading condition of F4. Under optimal degrading conditions, F4 degraded 97.38% of quinclorac from an initial concentration of 50 mg/L in seven days. Our indoor pot experiment demonstrated that the degradation products were non-phytotoxic to tobacco. After analyzing the quinclorac degradation products of F4, we proposed that F4 could employ two pathways to degrade quinclorac: one is through methylation, the other is through dechlorination. Furthermore, we reconstructed the whole genome of F4 through single molecular sequencing and de novo assembly. We identified 77 methyltransferases and eight dehalogenases in the F4 genome to support our hypothesized degradation path.

  1. Exome sequencing identifies CTSK mutations in patients originally diagnosed as intermediate osteopetrosis. (United States)

    Pangrazio, Alessandra; Puddu, Alessandro; Oppo, Manuela; Valentini, Maria; Zammataro, Luca; Vellodi, Ashok; Gener, Blanca; Llano-Rivas, Isabel; Raza, Jamal; Atta, Irum; Vezzoni, Paolo; Superti-Furga, Andrea; Villa, Anna; Sobacchi, Cristina


    Autosomal Recessive Osteopetrosis is a genetic disorder characterized by increased bone density due to lack of resorption by the osteoclasts. Genetic studies have widely unraveled the molecular basis of the most severe forms, while cases of intermediate severity are more difficult to characterize, probably because of a large heterogeneity. Here, we describe the use of exome sequencing in the molecular diagnosis of 2 siblings initially thought to be affected by "intermediate osteopetrosis", which identified a homozygous mutation in the CTSK gene. Prompted by this finding, we tested by Sanger sequencing 25 additional patients addressed to us for recessive osteopetrosis and found CTSK mutations in 4 of them. In retrospect, their clinical and radiographic features were found to be compatible with, but not typical for, Pycnodysostosis. We sought to identify modifier genes that might have played a role in the clinical manifestation of the disease in these patients, but our results were not informative. In conclusion, we underline the difficulties of differential diagnosis in some patients whose clinical appearance does not fit the classical malignant or benign picture and recommend that CTSK gene be included in the molecular diagnosis of high bone density conditions. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Transcriptome sequencing in pediatric acute lymphoblastic leukemia identifies fusion genes associated with distinct DNA methylation profiles

    Directory of Open Access Journals (Sweden)

    Yanara Marincevic-Zuniga


    Full Text Available Abstract Background Structural chromosomal rearrangements that lead to expressed fusion genes are a hallmark of acute lymphoblastic leukemia (ALL. In this study, we performed transcriptome sequencing of 134 primary ALL patient samples to comprehensively detect fusion transcripts. Methods We combined fusion gene detection with genome-wide DNA methylation analysis, gene expression profiling, and targeted sequencing to determine molecular signatures of emerging ALL subtypes. Results We identified 64 unique fusion events distributed among 80 individual patients, of which over 50% have not previously been reported in ALL. Although the majority of the fusion genes were found only in a single patient, we identified several recurrent fusion gene families defined by promiscuous fusion gene partners, such as ETV6, RUNX1, PAX5, and ZNF384, or recurrent fusion genes, such as DUX4-IGH. Our data show that patients harboring these fusion genes displayed characteristic genome-wide DNA methylation and gene expression signatures in addition to distinct patterns in single nucleotide variants and recurrent copy number alterations. Conclusion Our study delineates the fusion gene landscape in pediatric ALL, including both known and novel fusion genes, and highlights fusion gene families with shared molecular etiologies, which may provide additional information for prognosis and therapeutic options in the future.

  3. Epidemiological analysis of Salmonella clusters identified by whole genome sequencing, England and Wales 2014. (United States)

    Waldram, Alison; Dolan, Gayle; Ashton, Philip M; Jenkins, Claire; Dallman, Timothy J


    The unprecedented level of bacterial strain discrimination provided by whole genome sequencing (WGS) presents new challenges with respect to the utility and interpretation of the data. Whole genome sequences from 1445 isolates of Salmonella belonging to the most commonly identified serotypes in England and Wales isolated between April and August 2014 were analysed. Single linkage single nucleotide polymorphism thresholds at the 10, 5 and 0 level were explored for evidence of epidemiological links between clustered cases. Analysis of the WGS data organised 566 of the 1445 isolates into 32 clusters of five or more. A statistically significant epidemiological link was identified for 17 clusters. The clusters were associated with foreign travel (n = 8), consumption of Chinese takeaways (n = 4), chicken eaten at home (n = 2), and one each of the following; eating out, contact with another case in the home and contact with reptiles. In the same time frame, one cluster was detected using traditional outbreak detection methods. WGS can be used for the highly specific and highly sensitive detection of biologically related isolates when epidemiological links are obscured. Improvements in the collection of detailed, standardised exposure information would enhance cluster investigations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Identifying and sequencing a Mycobacterium sp. strain F4 as a potential bioremediation agent for quinclorac.

    Directory of Open Access Journals (Sweden)

    Yingying Li

    Full Text Available Quinclorac is a widely used herbicide in rice filed. Unfortunately, quinclorac residues are phytotoxic to many crops/vegetables. The degradation of quinclorac in nature is very slow. On the other hand, degradation of quinclorac using bacteria can be an effective and efficient method to reduce its contamination. In this study, we isolated a quinclorac bioremediation bacterium strain F4 from quinclorac contaminated soils. Based on morphological characteristics and 16S rRNA gene sequence analysis, we identified strain F4 as Mycobacterium sp. We investigated the effects of temperature, pH, inoculation size and initial quinclorac concentration on growth and degrading efficiency of F4 and determined the optimal quinclorac degrading condition of F4. Under optimal degrading conditions, F4 degraded 97.38% of quinclorac from an initial concentration of 50 mg/L in seven days. Our indoor pot experiment demonstrated that the degradation products were non-phytotoxic to tobacco. After analyzing the quinclorac degradation products of F4, we proposed that F4 could employ two pathways to degrade quinclorac: one is through methylation, the other is through dechlorination. Furthermore, we reconstructed the whole genome of F4 through single molecular sequencing and de novo assembly. We identified 77 methyltransferases and eight dehalogenases in the F4 genome to support our hypothesized degradation path.

  5. Whole-genome sequencing identifies recurrent somatic NOTCH2 mutations in splenic marginal zone lymphoma. (United States)

    Kiel, Mark J; Velusamy, Thirunavukkarasu; Betz, Bryan L; Zhao, Lili; Weigelin, Helmut G; Chiang, Mark Y; Huebner-Chan, David R; Bailey, Nathanael G; Yang, David T; Bhagat, Govind; Miranda, Roberto N; Bahler, David W; Medeiros, L Jeffrey; Lim, Megan S; Elenitoba-Johnson, Kojo S J


    Splenic marginal zone lymphoma (SMZL), the most common primary lymphoma of spleen, is poorly understood at the genetic level. In this study, using whole-genome DNA sequencing (WGS) and confirmation by Sanger sequencing, we observed mutations identified in several genes not previously known to be recurrently altered in SMZL. In particular, we identified recurrent somatic gain-of-function mutations in NOTCH2, a gene encoding a protein required for marginal zone B cell development, in 25 of 99 (∼25%) cases of SMZL and in 1 of 19 (∼5%) cases of nonsplenic MZLs. These mutations clustered near the C-terminal proline/glutamate/serine/threonine (PEST)-rich domain, resulting in protein truncation or, rarely, were nonsynonymous substitutions affecting the extracellular heterodimerization domain (HD). NOTCH2 mutations were not present in other B cell lymphomas and leukemias, such as chronic lymphocytic leukemia/small lymphocytic lymphoma (CLL/SLL; n = 15), mantle cell lymphoma (MCL; n = 15), low-grade follicular lymphoma (FL; n = 44), hairy cell leukemia (HCL; n = 15), and reactive lymphoid hyperplasia (n = 14). NOTCH2 mutations were associated with adverse clinical outcomes (relapse, histological transformation, and/or death) among SMZL patients (P = 0.002). These results suggest that NOTCH2 mutations play a role in the pathogenesis and progression of SMZL and are associated with a poor prognosis.

  6. microRNA expression profiling in fetal single ventricle malformation identified by deep sequencing. (United States)

    Yu, Zhang-Bin; Han, Shu-Ping; Bai, Yun-Fei; Zhu, Chun; Pan, Ya; Guo, Xi-Rong


    microRNAs (miRNAs) have emerged as key regulators in many biological processes, particularly cardiac growth and development, although the specific miRNA expression profile associated with this process remains to be elucidated. This study aimed to characterize the cellular microRNA profile involved in the development of congenital heart malformation, through the investigation of single ventricle (SV) defects. Comprehensive miRNA profiling in human fetal SV cardiac tissue was performed by deep sequencing. Differential expression of 48 miRNAs was revealed by sequencing by oligonucleotide ligation and detection (SOLiD) analysis. Of these, 38 were down-regulated and 10 were up-regulated in differentiated SV cardiac tissue, compared to control cardiac tissue. This was confirmed by real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analysis. Predicted target genes of the 48 differentially expressed miRNAs were analyzed by gene ontology and categorized according to cellular process, regulation of biological process and metabolic process. Pathway-Express analysis identified the WNT and mTOR signaling pathways as the most significant processes putatively affected by the differential expression of these miRNAs. The candidate genes involved in cardiac development were identified as potential targets for these differentially expressed microRNAs and the collaborative network of microRNAs and cardiac development related-mRNAs was constructed. These data provide the basis for future investigation of the mechanism of the occurrence and development of fetal SV malformations.

  7. Whole-genome sequencing identifies recurrent mutations in chronic lymphocytic leukaemia (United States)

    Puente, Xose S.; Pinyol, Magda; Quesada, Víctor; Conde, Laura; Ordóñez, Gonzalo R.; Villamor, Neus; Escaramis, Georgia; Jares, Pedro; Beà, Sílvia; González-Díaz, Marcos; Bassaganyas, Laia; Baumann, Tycho; Juan, Manel; López-Guerra, Mónica; Colomer, Dolors; Tubío, José M. C.; López, Cristina; Navarro, Alba; Tornador, Cristian; Aymerich, Marta; Rozman, María; Hernández, Jesús M.; Puente, Diana A.; Freije, José M. P.; Velasco, Gloria; Gutiérrez-Fernández, Ana; Costa, Dolors; Carrió, Anna; Guijarro, Sara; Enjuanes, Anna; Hernández, Lluís; Yagüe, Jordi; Nicolás, Pilar; Romeo-Casabona, Carlos M.; Himmelbauer, Heinz; Castillo, Ester; Dohm, Juliane C.; de Sanjosé, Silvia; Piris, Miguel A.; de Alava, Enrique; Miguel, Jesús San; Royo, Romina; Gelpí, Josep L.; Torrents, David; Orozco, Modesto; Pisano, David G.; Valencia, Alfonso; Guigó, Roderic; Bayés, Mónica; Heath, Simon; Gut, Marta; Klatt, Peter; Marshall, John; Raine, Keiran; Stebbings, Lucy A.; Futreal, P. Andrew; Stratton, Michael R.; Campbell, Peter J.; Gut, Ivo; López-Guillermo, Armando; Estivill, Xavier; Montserrat, Emili; López-Otín, Carlos; Campo, Elías


    Chronic lymphocytic leukaemia (CLL), the most frequent leukaemia in adults in Western countries, is a heterogeneous disease with variable clinical presentation and evolution1,2. Two major molecular subtypes can be distinguished, characterized respectively by a high or low number of somatic hypermutations in the variable region of immunoglobulin genes3,4. The molecular changes leading to the pathogenesis of the disease are still poorly understood. Here we performed whole-genome sequencing of four cases of CLL and identified 46 somatic mutations that potentially affect gene function. Further analysis of these mutations in 363 patients with CLL identified four genes that are recurrently mutated: notch 1 (NOTCH1), exportin 1 (XPO1), myeloid differentiation primary response gene 88 (MYD88) and kelch-like 6 (KLHL6). Mutations in MYD88 and KLHL6 are predominant in cases of CLL with mutated immunoglobulin genes, whereas NOTCH1 and XPO1 mutations are mainly detected in patients with unmutated immunoglobulins. The patterns of somatic mutation, supported by functional and clinical analyses, strongly indicate that the recurrent NOTCH1, MYD88 and XPO1 mutations are oncogenic changes that contribute to the clinical evolution of the disease. To our knowledge, this is the first comprehensive analysis of CLL combining whole-genome sequencing with clinical characteristics and clinical outcomes. It highlights the usefulness of this approach for the identification of clinically relevant mutations in cancer. PMID:21642962

  8. Genomic Aberrations in Crizotinib Resistant Lung Adenocarcinoma Samples Identified by Transcriptome Sequencing.

    Directory of Open Access Journals (Sweden)

    Ali Saber

    Full Text Available ALK-break positive non-small cell lung cancer (NSCLC patients initially respond to crizotinib, but resistance occurs inevitably. In this study we aimed to identify fusion genes in crizotinib resistant tumor samples. Re-biopsies of three patients were subjected to paired-end RNA sequencing to identify fusion genes using deFuse and EricScript. The IGV browser was used to determine presence of known resistance-associated mutations. Sanger sequencing was used to validate fusion genes and digital droplet PCR to validate mutations. ALK fusion genes were detected in all three patients with EML4 being the fusion partner. One patient had no additional fusion genes. Another patient had one additional fusion gene, but without a predicted open reading frame (ORF. The third patient had three additional fusion genes, of which two were derived from the same chromosomal region as the EML4-ALK. A predicted ORF was identified only in the CLIP4-VSNL1 fusion product. The fusion genes validated in the post-treatment sample were also present in the biopsy before crizotinib. ALK mutations (p.C1156Y and p.G1269A detected in the re-biopsies of two patients, were not detected in pre-treatment biopsies. In conclusion, fusion genes identified in our study are unlikely to be involved in crizotinib resistance based on presence in pre-treatment biopsies. The detection of ALK mutations in post-treatment tumor samples of two patients underlines their role in crizotinib resistance.

  9. Cooperative action of multiple cis-acting elements is required for N-myc expression in branchial arches: specific contribution of GATA3. (United States)

    Potvin, Eric; Beuret, Laurent; Cadrin-Girard, Jean-François; Carter, Marcelle; Roy, Sophie; Tremblay, Michel; Charron, Jean


    The precise expression of the N-myc proto-oncogene is essential for normal mammalian development, whereas altered N-myc gene regulation is known to be a determinant factor in tumor formation. Using transgenic mouse embryos, we show that N-myc sequences from kb -8.7 to kb +7.2 are sufficient to reproduce the N-myc embryonic expression profile in developing branchial arches and limb buds. These sequences encompass several regulatory elements dispersed throughout the N-myc locus, including an upstream limb bud enhancer, a downstream somite enhancer, a branchial arch enhancer in the second intron, and a negative regulatory element in the first intron. N-myc expression in the limb buds is under the dominant control of the limb bud enhancer. The expression in the branchial arches necessitates the interplay of three regulatory domains. The branchial arch enhancer cooperates with the somite enhancer region to prevent an inhibitory activity contained in the first intron. The characterization of the branchial arch enhancer has revealed a specific role of the transcription factor GATA3 in the regulation of N-myc expression. Together, these data demonstrate that correct N-myc developmental expression is achieved via cooperation of multiple positive and negative regulatory elements.

  10. Whole exome sequencing identifies RAI1 mutation in a morbidly obese child diagnosed with ROHHAD syndrome. (United States)

    Thaker, Vidhu V; Esteves, Kristyn M; Towne, Meghan C; Brownstein, Catherine A; James, Philip M; Crowley, Laura; Hirschhorn, Joel N; Elsea, Sarah H; Beggs, Alan H; Picker, Jonathan; Agrawal, Pankaj B


    The current obesity epidemic is attributed to complex interactions between genetic and environmental factors. However, a limited number of cases, especially those with early-onset severe obesity, are linked to single gene defects. Rapid-onset obesity with hypothalamic dysfunction, hypoventilation and autonomic dysregulation (ROHHAD) is one of the syndromes that presents with abrupt-onset extreme weight gain with an unknown genetic basis. To identify the underlying genetic etiology in a child with morbid early-onset obesity, hypoventilation, and autonomic and behavioral disturbances who was clinically diagnosed with ROHHAD syndrome. Design/Setting/Intervention: The index patient was evaluated at an academic medical center. Whole-exome sequencing was performed on the proband and his parents. Genetic variants were validated by Sanger sequencing. We identified a novel de novo nonsense mutation, c.3265 C>T (p.R1089X), in the retinoic acid-induced 1 (RAI1) gene in the proband. Mutations in the RAI1 gene are known to cause Smith-Magenis syndrome (SMS). On further evaluation, his clinical features were not typical of either SMS or ROHHAD syndrome. This study identifies a de novo RAI1 mutation in a child with morbid obesity and a clinical diagnosis of ROHHAD syndrome. Although extreme early-onset obesity, autonomic disturbances, and hypoventilation are present in ROHHAD, several of the clinical findings are consistent with SMS. This case highlights the challenges in the diagnosis of ROHHAD syndrome and its potential overlap with SMS. We also propose RAI1 as a candidate gene for children with morbid obesity.

  11. Exome sequencing identifies three novel candidate genes implicated in intellectual disability.

    Directory of Open Access Journals (Sweden)

    Zehra Agha

    Full Text Available Intellectual disability (ID is a major health problem mostly with an unknown etiology. Recently exome sequencing of individuals with ID identified novel genes implicated in the disease. Therefore the purpose of the present study was to identify the genetic cause of ID in one syndromic and two non-syndromic Pakistani families. Whole exome of three ID probands was sequenced. Missense variations in two plausible novel genes implicated in autosomal recessive ID were identified: lysine (K-specific methyltransferase 2B (KMT2B, zinc finger protein 589 (ZNF589, as well as hedgehog acyltransferase (HHAT with a de novo mutation with autosomal dominant mode of inheritance. The KMT2B recessive variant is the first report of recessive Kleefstra syndrome-like phenotype. Identification of plausible causative mutations for two recessive and a dominant type of ID, in genes not previously implicated in disease, underscores the large genetic heterogeneity of ID. These results also support the viewpoint that large number of ID genes converge on limited number of common networks i.e. ZNF589 belongs to KRAB-domain zinc-finger proteins previously implicated in ID, HHAT is predicted to affect sonic hedgehog, which is involved in several disorders with ID, KMT2B associated with syndromic ID fits the epigenetic module underlying the Kleefstra syndromic spectrum. The association of these novel genes in three different Pakistani ID families highlights the importance of screening these genes in more families with similar phenotypes from different populations to confirm the involvement of these genes in pathogenesis of ID.

  12. Integrated sequence analysis pipeline provides one-stop solution for identifying disease-causing mutations. (United States)

    Hu, Hao; Wienker, Thomas F; Musante, Luciana; Kalscheuer, Vera M; Kahrizi, Kimia; Najmabadi, Hossein; Ropers, H Hilger


    Next-generation sequencing has greatly accelerated the search for disease-causing defects, but even for experts the data analysis can be a major challenge. To facilitate the data processing in a clinical setting, we have developed a novel medical resequencing analysis pipeline (MERAP). MERAP assesses the quality of sequencing, and has optimized capacity for calling variants, including single-nucleotide variants, insertions and deletions, copy-number variation, and other structural variants. MERAP identifies polymorphic and known causal variants by filtering against public domain databases, and flags nonsynonymous and splice-site changes. MERAP uses a logistic model to estimate the causal likelihood of a given missense variant. MERAP considers the relevant information such as phenotype and interaction with known disease-causing genes. MERAP compares favorably with GATK, one of the widely used tools, because of its higher sensitivity for detecting indels, its easy installation, and its economical use of computational resources. Upon testing more than 1,200 individuals with mutations in known and novel disease genes, MERAP proved highly reliable, as illustrated here for five families with disease-causing variants. We believe that the clinical implementation of MERAP will expedite the diagnostic process of many disease-causing defects. © 2014 WILEY PERIODICALS, INC.

  13. Whole-exome sequencing identifies novel candidate predisposition genes for familial polycythemia vera. (United States)

    Hirvonen, Elina A M; Pitkänen, Esa; Hemminki, Kari; Aaltonen, Lauri A; Kilpivaara, Outi


    Polycythemia vera (PV), characterized by massive production of erythrocytes, is one of the myeloproliferative neoplasms. Most patients carry a somatic gain-of-function mutation in JAK2, c.1849G > T (p.Val617Phe), leading to constitutive activation of JAK-STAT signaling pathway. Familial clustering is also observed occasionally, but high-penetrance predisposition genes to PV have remained unidentified. We studied the predisposition to PV by exome sequencing (three cases) in a Finnish PV family with four patients. The 12 shared variants (maximum allowed minor allele frequency  G (p.Phe418Leu) in ZXDC, c.1931C > G (p.Pro644Arg) in ATN1, and c.701G > A (p.Arg234Gln) in LRRC3. We also observed a rare, predicted benign germline variant c.2912C > G (p.Ala971Gly) in BCORL1 in all four patients. Somatic mutations in BCORL1 have been reported in myeloid malignancies. We further screened the variants in eight PV patients in six other Finnish families, but no other carriers were found. Exome sequencing provides a powerful tool for the identification of novel variants, and understanding the familial predisposition of diseases. This is the first report on Finnish familial PV cases, and we identified three novel candidate variants that may predispose to the disease.

  14. Targeted exome sequencing identified novel USH2A mutations in Usher syndrome families.

    Directory of Open Access Journals (Sweden)

    Xiu-Feng Huang

    Full Text Available Usher syndrome (USH is a leading cause of deaf-blindness in autosomal recessive trait. Phenotypic and genetic heterogeneities in USH make molecular diagnosis much difficult. This is a pilot study aiming to develop an approach based on next-generation sequencing to determine the genetic defects in patients with USH or allied diseases precisely and effectively. Eight affected patients and twelve unaffected relatives from five unrelated Chinese USH families, including 2 pseudo-dominant ones, were recruited. A total of 144 known genes of inherited retinal diseases were selected for deep exome resequencing. Through systematic data analysis using established bioinformatics pipeline and segregation analysis, a number of genetic variants were released. Eleven mutations, eight of them were novel, in the USH2A gene were identified. Biparental mutations in USH2A were revealed in 2 families with pseudo-dominant inheritance. A proband was found to have triple mutations, two of them were supposed to locate in the same chromosome. In conclusion, this study revealed the genetic defects in the USH2A gene and demonstrated the robustness of targeted exome sequencing to precisely and rapidly determine genetic defects. The methodology provides a reliable strategy for routine gene diagnosis of USH.

  15. LigandRFs: random forest ensemble to identify ligand-binding residues from sequence information alone

    KAUST Repository

    Chen, Peng


    Background Protein-ligand binding is important for some proteins to perform their functions. Protein-ligand binding sites are the residues of proteins that physically bind to ligands. Despite of the recent advances in computational prediction for protein-ligand binding sites, the state-of-the-art methods search for similar, known structures of the query and predict the binding sites based on the solved structures. However, such structural information is not commonly available. Results In this paper, we propose a sequence-based approach to identify protein-ligand binding residues. We propose a combination technique to reduce the effects of different sliding residue windows in the process of encoding input feature vectors. Moreover, due to the highly imbalanced samples between the ligand-binding sites and non ligand-binding sites, we construct several balanced data sets, for each of which a random forest (RF)-based classifier is trained. The ensemble of these RF classifiers forms a sequence-based protein-ligand binding site predictor. Conclusions Experimental results on CASP9 and CASP8 data sets demonstrate that our method compares favorably with the state-of-the-art protein-ligand binding site prediction methods.

  16. Development of a functional cell-based assay that probes the specific interaction between influenza A virus NP and its packaging signal sequence RNA. (United States)

    Woo, Jiwon; Yu, Kyung Lee; Lee, Sun Hee; You, Ji Chang


    Although cis-acting packaging signal RNA sequences for the influenza virus NP encoding vRNA have been identified recently though genetic studies, little is known about the interaction between NP and the vRNA packaging signals either in vivo or in vitro. Here, we provide evidence that NP is able to interact specifically with the vRNA packaging sequence RNA within living cells and that the specific RNA binding activity of NP in vivo requires both the N-terminal and central region of the protein. This assay established would be a valuable tool for further detailed studies of the NP-packaging signal RNA interaction in living cells. Copyright © 2014 Elsevier Inc. All rights reserved.


    International Nuclear Information System (INIS)

    Ren Juanjuan; Luo Ali; Li Yinbi; Wei Peng; Zhao Jingkun; Zhao Yongheng; Song Yihan; Zhao Gang


    We present a set of white-dwarf-main-sequence (WDMS) binaries identified spectroscopically from the Large sky Area Multi-Object fiber Spectroscopic Telescope (LAMOST, also called the Guo Shou Jing Telescope) pilot survey. We develop a color selection criteria based on what is so far the largest and most complete Sloan Digital Sky Survey (SDSS) DR7 WDMS binary catalog and identify 28 WDMS binaries within the LAMOST pilot survey. The primaries in our binary sample are mostly DA white dwarfs except for one DB white dwarf. We derive the stellar atmospheric parameters, masses, and radii for the two components of 10 of our binaries. We also provide cooling ages for the white dwarf primaries as well as the spectral types for the companion stars of these 10 WDMS binaries. These binaries tend to contain hot white dwarfs and early-type companions. Through cross-identification, we note that nine binaries in our sample have been published in the SDSS DR7 WDMS binary catalog. Nineteen spectroscopic WDMS binaries identified by the LAMOST pilot survey are new. Using the 3σ radial velocity variation as a criterion, we find two post-common-envelope binary candidates from our WDMS binary sample

  18. Microfluidic screening and whole-genome sequencing identifies mutations associated with improved protein secretion by yeast

    DEFF Research Database (Denmark)

    Huang, Mingtao; Bai, Yunpeng; Sjostrom, Staffan L.


    There is an increasing demand for biotech-based production of recombinant proteins for use as pharmaceuticals in the food and feed industry and in industrial applications. Yeast Saccharomyces cerevisiae is among preferred cell factories for recombinant protein production, and there is increasing...... interest in improving its protein secretion capacity. Due to the complexity of the secretory machinery in eukaryotic cells, it is difficult to apply rational engineering for construction of improved strains. Here we used high-throughput microfluidics for the screening of yeast libraries, generated by UV...... mutagenesis. Several screening and sorting rounds resulted in the selection of eight yeast clones with significantly improved secretion of recombinant a-amylase. Efficient secretion was genetically stable in the selected clones. We performed whole-genome sequencing of the eight clones and identified 330...

  19. SSR_pipeline: a bioinformatic infrastructure for identifying microsatellites from paired-end Illumina high-throughput DNA sequencing data (United States)

    Miller, Mark P.; Knaus, Brian J.; Mullins, Thomas D.; Haig, Susan M.


    SSR_pipeline is a flexible set of programs designed to efficiently identify simple sequence repeats (e.g., microsatellites) from paired-end high-throughput Illumina DNA sequencing data. The program suite contains 3 analysis modules along with a fourth control module that can automate analyses of large volumes of data. The modules are used to 1) identify the subset of paired-end sequences that pass Illumina quality standards, 2) align paired-end reads into a single composite DNA sequence, and 3) identify sequences that possess microsatellites (both simple and compound) conforming to user-specified parameters. The microsatellite search algorithm is extremely efficient, and we have used it to identify repeats with motifs from 2 to 25bp in length. Each of the 3 analysis modules can also be used independently to provide greater flexibility or to work with FASTQ or FASTA files generated from other sequencing platforms (Roche 454, Ion Torrent, etc.). We demonstrate use of the program with data from the brine fly Ephydra packardi (Diptera: Ephydridae) and provide empirical timing benchmarks to illustrate program performance on a common desktop computer environment. We further show that the Illumina platform is capable of identifying large numbers of microsatellites, even when using unenriched sample libraries and a very small percentage of the sequencing capacity from a single DNA sequencing run. All modules from SSR_pipeline are implemented in the Python programming language and can therefore be used from nearly any computer operating system (Linux, Macintosh, and Windows).

  20. SSR_pipeline: a bioinformatic infrastructure for identifying microsatellites from paired-end Illumina high-throughput DNA sequencing data. (United States)

    Miller, Mark P; Knaus, Brian J; Mullins, Thomas D; Haig, Susan M


    SSR_pipeline is a flexible set of programs designed to efficiently identify simple sequence repeats (e.g., microsatellites) from paired-end high-throughput Illumina DNA sequencing data. The program suite contains 3 analysis modules along with a fourth control module that can automate analyses of large volumes of data. The modules are used to 1) identify the subset of paired-end sequences that pass Illumina quality standards, 2) align paired-end reads into a single composite DNA sequence, and 3) identify sequences that possess microsatellites (both simple and compound) conforming to user-specified parameters. The microsatellite search algorithm is extremely efficient, and we have used it to identify repeats with motifs from 2 to 25 bp in length. Each of the 3 analysis modules can also be used independently to provide greater flexibility or to work with FASTQ or FASTA files generated from other sequencing platforms (Roche 454, Ion Torrent, etc.). We demonstrate use of the program with data from the brine fly Ephydra packardi (Diptera: Ephydridae) and provide empirical timing benchmarks to illustrate program performance on a common desktop computer environment. We further show that the Illumina platform is capable of identifying large numbers of microsatellites, even when using unenriched sample libraries and a very small percentage of the sequencing capacity from a single DNA sequencing run. All modules from SSR_pipeline are implemented in the Python programming language and can therefore be used from nearly any computer operating system (Linux, Macintosh, and Windows).

  1. Third-Generation Sequencing and Analysis of Four Complete Pig Liver Esterase Gene Sequences in Clones Identified by Screening BAC Library. (United States)

    Zhou, Qiongqiong; Sun, Wenjuan; Liu, Xiyan; Wang, Xiliang; Xiao, Yuncai; Bi, Dingren; Yin, Jingdong; Shi, Deshi


    Pig liver carboxylesterase (PLE) gene sequences in GenBank are incomplete, which has led to difficulties in studying the genetic structure and regulation mechanisms of gene expression of PLE family genes. The aim of this study was to obtain and analysis of complete gene sequences of PLE family by screening from a Rongchang pig BAC library and third-generation PacBio gene sequencing. After a number of existing incomplete PLE isoform gene sequences were analysed, primers were designed based on conserved regions in PLE exons, and the whole pig genome used as a template for Polymerase chain reaction (PCR) amplification. Specific primers were then selected based on the PCR amplification results. A three-step PCR screening method was used to identify PLE-positive clones by screening a Rongchang pig BAC library and PacBio third-generation sequencing was performed. BLAST comparisons and other bioinformatics methods were applied for sequence analysis. Five PLE-positive BAC clones, designated BAC-10, BAC-70, BAC-75, BAC-119 and BAC-206, were identified. Sequence analysis yielded the complete sequences of four PLE genes, PLE1, PLE-B9, PLE-C4, and PLE-G2. Complete PLE gene sequences were defined as those containing regulatory sequences, exons, and introns. It was found that, not only did the PLE exon sequences of the four genes show a high degree of homology, but also that the intron sequences were highly similar. Additionally, the regulatory region of the genes contained two 720bps reverse complement sequences that may have an important function in the regulation of PLE gene expression. This is the first report to confirm the complete sequences of four PLE genes. In addition, the study demonstrates that each PLE isoform is encoded by a single gene and that the various genes exhibit a high degree of sequence homology, suggesting that the PLE family evolved from a single ancestral gene. Obtaining the complete sequences of these PLE genes provides the necessary foundation for

  2. Application of small RNA sequencing to identify microRNAs in acute kidney injury and fibrosis

    Energy Technology Data Exchange (ETDEWEB)

    Pellegrini, Kathryn L. [Department of Medicine, Renal Division, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Gerlach, Cory V. [Department of Medicine, Renal Division, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Department of Environmental Health, Harvard T.H. Chan School of Public Health, Boston, MA (United States); Laboratory of Systems Pharmacology, Harvard Program in Therapeutic Sciences, Harvard Medical School, Boston, MA (United States); Craciun, Florin L.; Ramachandran, Krithika [Department of Medicine, Renal Division, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Bijol, Vanesa [Department of Pathology, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Kissick, Haydn T. [Department of Surgery, Urology Division, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA (United States); Vaidya, Vishal S., E-mail: [Department of Medicine, Renal Division, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Department of Environmental Health, Harvard T.H. Chan School of Public Health, Boston, MA (United States); Laboratory of Systems Pharmacology, Harvard Program in Therapeutic Sciences, Harvard Medical School, Boston, MA (United States)


    Establishing a microRNA (miRNA) expression profile in affected tissues provides an important foundation for the discovery of miRNAs involved in the development or progression of pathologic conditions. We conducted small RNA sequencing to generate a temporal profile of miRNA expression in the kidneys using a mouse model of folic acid-induced (250 mg/kg i.p.) kidney injury and fibrosis. From the 103 miRNAs that were differentially expressed over the time course (> 2-fold, p < 0.05), we chose to further investigate miR-18a-5p, which is expressed during the acute stage of the injury; miR-132-3p, which is upregulated during transition between acute and fibrotic injury; and miR-146b-5p, which is highly expressed at the peak of fibrosis. Using qRT-PCR, we confirmed the increased expression of these candidate miRNAs in the folic acid model as well as in other established mouse models of acute injury (ischemia/reperfusion injury) and fibrosis (unilateral ureteral obstruction). In situ hybridization confirmed high expression of miR-18a-5p, miR-132-3p and miR-146b-5p throughout the kidney cortex in mice and humans with severe kidney injury or fibrosis. When primary human proximal tubular epithelial cells were treated with model nephrotoxicants such as cadmium chloride (CdCl{sub 2}), arsenic trioxide, aristolochic acid (AA), potassium dichromate (K{sub 2}Cr{sub 2}O{sub 7}) and cisplatin, miRNA-132-3p was upregulated 4.3-fold after AA treatment and 1.5-fold after K{sub 2}Cr{sub 2}O{sub 7} and CdCl{sub 2} treatment. These results demonstrate the application of temporal small RNA sequencing to identify miR-18a, miR-132 and miR-146b as differentially expressed miRNAs during distinct phases of kidney injury and fibrosis progression. - Highlights: • We used small RNA sequencing to identify differentially expressed miRNAs in kidney. • Distinct patterns were found for acute injury and fibrotic stages in the kidney. • Upregulation of miR-18a, -132 and -146b was confirmed in mice

  3. Molecular profiling of appendiceal epithelial tumors using massively parallel sequencing to identify somatic mutations. (United States)

    Liu, Xiaoying; Mody, Kabir; de Abreu, Francine B; Pipas, J Marc; Peterson, Jason D; Gallagher, Torrey L; Suriawinata, Arief A; Ripple, Gregory H; Hourdequin, Kathryn C; Smith, Kerrington D; Barth, Richard J; Colacchio, Thomas A; Tsapakos, Michael J; Zaki, Bassem I; Gardner, Timothy B; Gordon, Stuart R; Amos, Christopher I; Wells, Wendy A; Tsongalis, Gregory J


    Some epithelial neoplasms of the appendix, including low-grade appendiceal mucinous neoplasm and adenocarcinoma, can result in pseudomyxoma peritonei (PMP). Little is known about the mutational spectra of these tumor types and whether mutations may be of clinical significance with respect to therapeutic selection. In this study, we identified somatic mutations using the Ion Torrent AmpliSeq Cancer Hotspot Panel v2. Specimens consisted of 3 nonneoplastic retention cysts/mucocele, 15 low-grade mucinous neoplasms (LAMNs), 8 low-grade/well-differentiated mucinous adenocarcinomas with pseudomyxoma peritonei, and 12 adenocarcinomas with/without goblet cell/signet ring cell features. Barcoded libraries were prepared from up to 10 ng of extracted DNA and multiplexed on single 318 chips for sequencing. Data analysis was performed using Golden Helix SVS. Variants that remained after the analysis pipeline were individually interrogated using the Integrative Genomics Viewer. A single Janus kinase 3 (JAK3) mutation was detected in the mucocele group. Eight mutations were identified in the V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) and GNAS complex locus (GNAS) genes among LAMN samples. Additional gene mutations were identified in the AKT1 (v-akt murine thymoma viral oncogene homolog 1), APC (adenomatous polyposis coli), JAK3, MET (met proto-oncogene), phosphatidylinositol-4,5-bisphosphate 3-kinase (PIK3CA), RB1 (retinoblastoma 1), STK11 (serine/threonine kinase 11), and tumor protein p53 (TP53) genes. Among the PMPs, 6 mutations were detected in the KRAS gene and also in the GNAS, TP53, and RB1 genes. Appendiceal cancers showed mutations in the APC, ATM (ataxia telangiectasia mutated), KRAS, IDH1 [isocitrate dehydrogenase 1 (NADP+)], NRAS [neuroblastoma RAS viral (v-ras) oncogene homolog], PIK3CA, SMAD4 (SMAD family member 4), and TP53 genes. Our results suggest molecular heterogeneity among epithelial tumors of the appendix. Next generation sequencing efforts

  4. Extended exome sequencing identifies BACH2 as a novel major risk locus for Addison's disease. (United States)

    Eriksson, D; Bianchi, M; Landegren, N; Nordin, J; Dalin, F; Mathioudaki, A; Eriksson, G N; Hultin-Rosenberg, L; Dahlqvist, J; Zetterqvist, H; Karlsson, Å; Hallgren, Å; Farias, F H G; Murén, E; Ahlgren, K M; Lobell, A; Andersson, G; Tandre, K; Dahlqvist, S R; Söderkvist, P; Rönnblom, L; Hulting, A-L; Wahlberg, J; Ekwall, O; Dahlqvist, P; Meadows, J R S; Bensing, S; Lindblad-Toh, K; Kämpe, O; Pielberg, G R


    Autoimmune disease is one of the leading causes of morbidity and mortality worldwide. In Addison's disease, the adrenal glands are targeted by destructive autoimmunity. Despite being the most common cause of primary adrenal failure, little is known about its aetiology. To understand the genetic background of Addison's disease, we utilized the extensively characterized patients of the Swedish Addison Registry. We developed an extended exome capture array comprising a selected set of 1853 genes and their potential regulatory elements, for the purpose of sequencing 479 patients with Addison's disease and 1394 controls. We identified BACH2 (rs62408233-A, OR = 2.01 (1.71-2.37), P = 1.66 × 10 -15 , MAF 0.46/0.29 in cases/controls) as a novel gene associated with Addison's disease development. We also confirmed the previously known associations with the HLA complex. Whilst BACH2 has been previously reported to associate with organ-specific autoimmune diseases co-inherited with Addison's disease, we have identified BACH2 as a major risk locus in Addison's disease, independent of concomitant autoimmune diseases. Our results may enable future research towards preventive disease treatment. © 2016 The Authors. Journal of Internal Medicine published by John Wiley & Sons Ltd on behalf of Association for Publication of The Journal of Internal Medicine.

  5. Exome sequencing in 53 sporadic cases of schizophrenia identifies 18 putative candidate genes.

    Directory of Open Access Journals (Sweden)

    Michel Guipponi

    Full Text Available Schizophrenia (SCZ is a severe, debilitating mental illness which has a significant genetic component. The identification of genetic factors related to SCZ has been challenging and these factors remain largely unknown. To evaluate the contribution of de novo variants (DNVs to SCZ, we sequenced the exomes of 53 individuals with sporadic SCZ and of their non-affected parents. We identified 49 DNVs, 18 of which were predicted to alter gene function, including 13 damaging missense mutations, 2 conserved splice site mutations, 2 nonsense mutations, and 1 frameshift deletion. The average number of exonic DNV per proband was 0.88, which corresponds to an exonic point mutation rate of 1.7×10(-8 per nucleotide per generation. The non-synonymous-to-synonymous mutation ratio of 2.06 did not differ from neutral expectations. Overall, this study provides a list of 18 putative candidate genes for sporadic SCZ, and when combined with the results of similar reports, identifies a second proband carrying a non-synonymous DNV in the RGS12 gene.

  6. Next-generation sequencing identifies transportin 3 as the causative gene for LGMD1F.

    Directory of Open Access Journals (Sweden)

    Annalaura Torella

    Full Text Available Limb-girdle muscular dystrophies (LGMD are genetically and clinically heterogeneous conditions. We investigated a large family with autosomal dominant transmission pattern, previously classified as LGMD1F and mapped to chromosome 7q32. Affected members are characterized by muscle weakness affecting earlier the pelvic girdle and the ileopsoas muscles. We sequenced the whole exome of four family members and identified a shared heterozygous frame-shift variant in the Transportin 3 (TNPO3 gene, encoding a member of the importin-β super-family. The TNPO3 gene is mapped within the LGMD1F critical interval and its 923-amino acid human gene product is also expressed in skeletal muscle. In addition, we identified an isolated case of LGMD with a new missense mutation in the same gene. We localized the mutant TNPO3 around the nucleus, but not inside. The involvement of gene related to the nuclear transport suggests a novel disease mechanism leading to muscular dystrophy.

  7. Screening of whole genome sequences identified high-impact variants for stallion fertility. (United States)

    Schrimpf, Rahel; Gottschalk, Maren; Metzger, Julia; Martinsson, Gunilla; Sieme, Harald; Distl, Ottmar


    g.37455302G>A in NOTCH1 with the de-regressed estimated breeding values of the paternal component of the pregnancy rate per estrus (EBV-PAT). For 9 high-impact variants within the genes CFTR, OVGP1, FBXO43, TSSK6, PKD1, FOXP1, TCP11, SPATA31E1 and NOTCH1 (g.37453246G>C) absence of the homozygous mutant genotype in the validation sample of all 337 fertile stallions was obvious. Therefore, these variants were considered as potentially deleterious factors for stallion fertility. In conclusion, this study revealed 17 genetic variants with a predicted high damaging effect on protein structure and missing homozygous mutant genotype. The g.37455302G>A NOTCH1 variant was identified as a significant stallion fertility locus in Hanoverian stallions and further 9 candidate fertility loci with missing homozygous mutant genotypes were validated in a panel including 19 horse breeds. To our knowledge this is the first study in horses using next generation sequencing data to uncover strong candidate factors for stallion fertility.

  8. Whole-exome sequencing and high throughput genotyping identified KCNJ11 as the thirteenth MODY gene. (United States)

    Bonnefond, Amélie; Philippe, Julien; Durand, Emmanuelle; Dechaume, Aurélie; Huyvaert, Marlène; Montagne, Louise; Marre, Michel; Balkau, Beverley; Fajardy, Isabelle; Vambergue, Anne; Vatin, Vincent; Delplanque, Jérôme; Le Guilcher, David; De Graeve, Franck; Lecoeur, Cécile; Sand, Olivier; Vaxillaire, Martine; Froguel, Philippe


    Maturity-onset of the young (MODY) is a clinically heterogeneous form of diabetes characterized by an autosomal-dominant mode of inheritance, an onset before the age of 25 years, and a primary defect in the pancreatic beta-cell function. Approximately 30% of MODY families remain genetically unexplained (MODY-X). Here, we aimed to use whole-exome sequencing (WES) in a four-generation MODY-X family to identify a new susceptibility gene for MODY. WES (Agilent-SureSelect capture/Illumina-GAIIx sequencing) was performed in three affected and one non-affected relatives in the MODY-X family. We then performed a high-throughput multiplex genotyping (Illumina-GoldenGate assay) of the putative causal mutations in the whole family and in 406 controls. A linkage analysis was also carried out. By focusing on variants of interest (i.e. gains of stop codon, frameshift, non-synonymous and splice-site variants not reported in dbSNP130) present in the three affected relatives and not present in the control, we found 69 mutations. However, as WES was not uniform between samples, a total of 324 mutations had to be assessed in the whole family and in controls. Only one mutation (p.Glu227Lys in KCNJ11) co-segregated with diabetes in the family (with a LOD-score of 3.68). No KCNJ11 mutation was found in 25 other MODY-X unrelated subjects. Beyond neonatal diabetes mellitus (NDM), KCNJ11 is also a MODY gene ('MODY13'), confirming the wide spectrum of diabetes related phenotypes due to mutations in NDM genes (i.e. KCNJ11, ABCC8 and INS). Therefore, the molecular diagnosis of MODY should include KCNJ11 as affected carriers can be ideally treated with oral sulfonylureas.

  9. Whole-exome sequencing and high throughput genotyping identified KCNJ11 as the thirteenth MODY gene.

    Directory of Open Access Journals (Sweden)

    Amélie Bonnefond

    Full Text Available BACKGROUND: Maturity-onset of the young (MODY is a clinically heterogeneous form of diabetes characterized by an autosomal-dominant mode of inheritance, an onset before the age of 25 years, and a primary defect in the pancreatic beta-cell function. Approximately 30% of MODY families remain genetically unexplained (MODY-X. Here, we aimed to use whole-exome sequencing (WES in a four-generation MODY-X family to identify a new susceptibility gene for MODY. METHODOLOGY: WES (Agilent-SureSelect capture/Illumina-GAIIx sequencing was performed in three affected and one non-affected relatives in the MODY-X family. We then performed a high-throughput multiplex genotyping (Illumina-GoldenGate assay of the putative causal mutations in the whole family and in 406 controls. A linkage analysis was also carried out. PRINCIPAL FINDINGS: By focusing on variants of interest (i.e. gains of stop codon, frameshift, non-synonymous and splice-site variants not reported in dbSNP130 present in the three affected relatives and not present in the control, we found 69 mutations. However, as WES was not uniform between samples, a total of 324 mutations had to be assessed in the whole family and in controls. Only one mutation (p.Glu227Lys in KCNJ11 co-segregated with diabetes in the family (with a LOD-score of 3.68. No KCNJ11 mutation was found in 25 other MODY-X unrelated subjects. CONCLUSIONS/SIGNIFICANCE: Beyond neonatal diabetes mellitus (NDM, KCNJ11 is also a MODY gene ('MODY13', confirming the wide spectrum of diabetes related phenotypes due to mutations in NDM genes (i.e. KCNJ11, ABCC8 and INS. Therefore, the molecular diagnosis of MODY should include KCNJ11 as affected carriers can be ideally treated with oral sulfonylureas.

  10. Diagnostic SNPs for inferring population structure in American mink (Neovison vison) identified through RAD sequencing

    DEFF Research Database (Denmark)


    Data from: "Diagnostic SNPs for inferring population structure in American mink (Neovison vison) identified through RAD sequencing" in Genomic Resources Notes accepted 1 October 2014 to 30 November 2014....

  11. The Ebola virus VP35 protein binds viral immunostimulatory and host RNAs identified through deep sequencing.

    Directory of Open Access Journals (Sweden)

    Kari A Dilley

    Full Text Available Ebola virus and Marburg virus are members of the Filovirdae family and causative agents of hemorrhagic fever with high fatality rates in humans. Filovirus virulence is partially attributed to the VP35 protein, a well-characterized inhibitor of the RIG-I-like receptor pathway that triggers the antiviral interferon (IFN response. Prior work demonstrates the ability of VP35 to block potent RIG-I activators, such as Sendai virus (SeV, and this IFN-antagonist activity is directly correlated with its ability to bind RNA. Several structural studies demonstrate that VP35 binds short synthetic dsRNAs; yet, there are no data that identify viral immunostimulatory RNAs (isRNA or host RNAs bound to VP35 in cells. Utilizing a SeV infection model, we demonstrate that both viral isRNA and host RNAs are bound to Ebola and Marburg VP35s in cells. By deep sequencing the purified VP35-bound RNA, we identified the SeV copy-back defective interfering (DI RNA, previously identified as a robust RIG-I activator, as the isRNA bound by multiple filovirus VP35 proteins, including the VP35 protein from the West African outbreak strain (Makona EBOV. Moreover, RNAs isolated from a VP35 RNA-binding mutant were not immunostimulatory and did not include the SeV DI RNA. Strikingly, an analysis of host RNAs bound by wild-type, but not mutant, VP35 revealed that select host RNAs are preferentially bound by VP35 in cell culture. Taken together, these data support a model in which VP35 sequesters isRNA in virus-infected cells to avert RIG-I like receptor (RLR activation.

  12. The Ebola virus VP35 protein binds viral immunostimulatory and host RNAs identified through deep sequencing. (United States)

    Dilley, Kari A; Voorhies, Alexander A; Luthra, Priya; Puri, Vinita; Stockwell, Timothy B; Lorenzi, Hernan; Basler, Christopher F; Shabman, Reed S


    Ebola virus and Marburg virus are members of the Filovirdae family and causative agents of hemorrhagic fever with high fatality rates in humans. Filovirus virulence is partially attributed to the VP35 protein, a well-characterized inhibitor of the RIG-I-like receptor pathway that triggers the antiviral interferon (IFN) response. Prior work demonstrates the ability of VP35 to block potent RIG-I activators, such as Sendai virus (SeV), and this IFN-antagonist activity is directly correlated with its ability to bind RNA. Several structural studies demonstrate that VP35 binds short synthetic dsRNAs; yet, there are no data that identify viral immunostimulatory RNAs (isRNA) or host RNAs bound to VP35 in cells. Utilizing a SeV infection model, we demonstrate that both viral isRNA and host RNAs are bound to Ebola and Marburg VP35s in cells. By deep sequencing the purified VP35-bound RNA, we identified the SeV copy-back defective interfering (DI) RNA, previously identified as a robust RIG-I activator, as the isRNA bound by multiple filovirus VP35 proteins, including the VP35 protein from the West African outbreak strain (Makona EBOV). Moreover, RNAs isolated from a VP35 RNA-binding mutant were not immunostimulatory and did not include the SeV DI RNA. Strikingly, an analysis of host RNAs bound by wild-type, but not mutant, VP35 revealed that select host RNAs are preferentially bound by VP35 in cell culture. Taken together, these data support a model in which VP35 sequesters isRNA in virus-infected cells to avert RIG-I like receptor (RLR) activation.

  13. Estrogen receptor β (ERβ1) transactivation is differentially modulated by the transcriptional coregulator Tip60 in a cis-acting element-dependent manner. (United States)

    Lee, Ming-Tsung; Leung, Yuet-Kin; Chung, Irving; Tarapore, Pheruza; Ho, Shuk-Mei


    Estrogen receptor (ER) β1 and ERα have overlapping and distinct functions despite their common use of estradiol as the physiological ligand. These attributes are explained in part by their differential utilization of coregulators and ligands. Although Tip60 has been shown to interact with both receptors, its regulatory role in ERβ1 transactivation has not been defined. In this study, we found that Tip60 enhances transactivation of ERβ1 at the AP-1 site but suppresses its transcriptional activity at the estrogen-response element (ERE) site in an estradiol-independent manner. However, different estrogenic compounds can modify the Tip60 action. The corepressor activity of Tip60 at the ERE site is abolished by diarylpropionitrile, genistein, equol, and bisphenol A, whereas its coactivation at the AP-1 site is augmented by fulvestrant (ICI 182,780). GRIP1 is an important tethering mediator for ERs at the AP-1 site. We found that coexpression of GRIP1 synergizes the action of Tip60. Although Tip60 is a known acetyltransferase, it is unable to acetylate ERβ1, and its coregulatory functions are independent of its acetylation activity. In addition, we showed the co-occupancy of ERβ1 and Tip60 at ERE and AP-1 sites of ERβ1 target genes. Tip60 differentially regulates the endogenous expression of the target genes by modulating the binding of ERβ1 to the cis-regulatory regions. Thus, we have identified Tip60 as the first dual-function coregulator of ERβ1.

  14. Identifying Genetic Differences Between Dongxiang Blue-Shelled and White Leghorn Chickens Using Sequencing Data

    Directory of Open Access Journals (Sweden)

    Qing-bo Zhao


    Full Text Available The Dongxiang Blue-shelled chicken is one of the most valuable Chinese indigenous poultry breeds. However, compared to the Italian native White Leghorn, although this Chinese breed possesses numerous favorable characteristics, it also exhibits lower growth performance and fertility. Here, we utilized genotyping sequencing data obtained via genome reduction on a sequencing platform to detect 100,114 single nucleotide polymorphisms and perform further biological analysis and functional annotation. We employed cross-population extended haplotype homozygosity, eigenvector decomposition combined with genome-wide association studies (EigenGWAS, and efficient mixed-model association expedited methods to detect areas of the genome that are potential selected regions (PSR in both chicken breeds, and performed gene ontology (GO enrichment and quantitative trait loci (QTL analyses annotating using the Kyoto Encyclopedia of Genes and Genomes. The results of this study revealed a total of 2424 outlier loci (p-value <0.01, of which 2144 occur in the White Leghorn breed and 280 occur in the Dongxiang Blue-shelled chicken. These correspond to 327 and 94 PSRs containing 297 and 54 genes, respectively. The most significantly selected genes in Blue-shelled chicken are TMEM141 and CLIC3, while the SLCO1B3 gene, related to eggshell color, was identified via EigenGWAS. We show that the White Leghorn genes JARID2, RBMS3, GPC3, TRIB2, ROBO1, SAMSN1, OSBP2, and IGFALS are involved in immunity, reproduction, and growth, and thus might represent footprints of the selection process. In contrast, we identified six significantly enriched pathways in the Dongxiang Blue-shelled chicken that are related to amino acid and lipid metabolism as well as signal transduction. Our results also reveal the presence of a GO term associated with cell metabolism that occurs mainly in the White Leghorn breed, while the most significant QTL regions mapped to the Chicken QTL Database (GG_4

  15. Estrogen Receptor β (ERβ1) Transactivation Is Differentially Modulated by the Transcriptional Coregulator Tip60 in a cis-Acting Element-dependent Manner* (United States)

    Lee, Ming-Tsung; Leung, Yuet-Kin; Chung, Irving; Tarapore, Pheruza; Ho, Shuk-Mei


    Estrogen receptor (ER) β1 and ERα have overlapping and distinct functions despite their common use of estradiol as the physiological ligand. These attributes are explained in part by their differential utilization of coregulators and ligands. Although Tip60 has been shown to interact with both receptors, its regulatory role in ERβ1 transactivation has not been defined. In this study, we found that Tip60 enhances transactivation of ERβ1 at the AP-1 site but suppresses its transcriptional activity at the estrogen-response element (ERE) site in an estradiol-independent manner. However, different estrogenic compounds can modify the Tip60 action. The corepressor activity of Tip60 at the ERE site is abolished by diarylpropionitrile, genistein, equol, and bisphenol A, whereas its coactivation at the AP-1 site is augmented by fulvestrant (ICI 182,780). GRIP1 is an important tethering mediator for ERs at the AP-1 site. We found that coexpression of GRIP1 synergizes the action of Tip60. Although Tip60 is a known acetyltransferase, it is unable to acetylate ERβ1, and its coregulatory functions are independent of its acetylation activity. In addition, we showed the co-occupancy of ERβ1 and Tip60 at ERE and AP-1 sites of ERβ1 target genes. Tip60 differentially regulates the endogenous expression of the target genes by modulating the binding of ERβ1 to the cis-regulatory regions. Thus, we have identified Tip60 as the first dual-function coregulator of ERβ1. PMID:23857583

  16. Genome-wide analysis of regulatory proteases sequences identified through bioinformatics data mining in Taenia solium. (United States)

    Yan, Hong-Bin; Lou, Zhong-Zi; Li, Li; Brindley, Paul J; Zheng, Yadong; Luo, Xuenong; Hou, Junling; Guo, Aijiang; Jia, Wan-Zhong; Cai, Xuepeng


    Cysticercosis remains a major neglected tropical disease of humanity in many regions, especially in sub-Saharan Africa, Central America and elsewhere. Owing to the emerging drug resistance and the inability of current drugs to prevent re-infection, identification of novel vaccines and chemotherapeutic agents against Taenia solium and related helminth pathogens is a public health priority. The T. solium genome and the predicted proteome were reported recently, providing a wealth of information from which new interventional targets might be identified. In order to characterize and classify the entire repertoire of protease-encoding genes of T. solium, which act fundamental biological roles in all life processes, we analyzed the predicted proteins of this cestode through a combination of bioinformatics tools. Functional annotation was performed to yield insights into the signaling processes relevant to the complex developmental cycle of this tapeworm and to highlight a suite of the proteases as potential intervention targets. Within the genome of this helminth parasite, we identified 200 open reading frames encoding proteases from five clans, which correspond to 1.68% of the 11,902 protein-encoding genes predicted to be present in its genome. These proteases include calpains, cytosolic, mitochondrial signal peptidases, ubiquitylation related proteins, and others. Many not only show significant similarity to proteases in the Conserved Domain Database but have conserved active sites and catalytic domains. KEGG Automatic Annotation Server (KAAS) analysis indicated that ~60% of these proteases share strong sequence identities with proteins of the KEGG database, which are involved in human disease, metabolic pathways, genetic information processes, cellular processes, environmental information processes and organismal systems. Also, we identified signal peptides and transmembrane helices through comparative analysis with classes of important regulatory proteases

  17. Pooled-DNA sequencing identifies genomic regions of selection in Nigerian isolates of Plasmodium falciparum. (United States)

    Oyebola, Kolapo M; Idowu, Emmanuel T; Olukosi, Yetunde A; Awolola, Taiwo S; Amambua-Ngwa, Alfred


    The burden of falciparum malaria is especially high in sub-Saharan Africa. Differences in pressure from host immunity and antimalarial drugs lead to adaptive changes responsible for high level of genetic variations within and between the parasite populations. Population-specific genetic studies to survey for genes under positive or balancing selection resulting from drug pressure or host immunity will allow for refinement of interventions. We performed a pooled sequencing (pool-seq) of the genomes of 100 Plasmodium falciparum isolates from Nigeria. We explored allele-frequency based neutrality test (Tajima's D) and integrated haplotype score (iHS) to identify genes under selection. Fourteen shared iHS regions that had at least 2 SNPs with a score > 2.5 were identified. These regions code for genes that were likely to have been under strong directional selection. Two of these genes were the chloroquine resistance transporter (CRT) on chromosome 7 and the multidrug resistance 1 (MDR1) on chromosome 5. There was a weak signature of selection in the dihydrofolate reductase (DHFR) gene on chromosome 4 and MDR5 genes on chromosome 13, with only 2 and 3 SNPs respectively identified within the iHS window. We observed strong selection pressure attributable to continued chloroquine and sulfadoxine-pyrimethamine use despite their official proscription for the treatment of uncomplicated malaria. There was also a major selective sweep on chromosome 6 which had 32 SNPs within the shared iHS region. Tajima's D of circumsporozoite protein (CSP), erythrocyte-binding antigen (EBA-175), merozoite surface proteins - MSP3 and MSP7, merozoite surface protein duffy binding-like (MSPDBL2) and serine repeat antigen (SERA-5) were 1.38, 1.29, 0.73, 0.84 and 0.21, respectively. We have demonstrated the use of pool-seq to understand genomic patterns of selection and variability in P. falciparum from Nigeria, which bears the highest burden of infections. This investigation identified known

  18. Whole exome sequencing identifies mutations in Usher syndrome genes in profoundly deaf Tunisian patients. (United States)

    Riahi, Zied; Bonnet, Crystel; Zainine, Rim; Lahbib, Saida; Bouyacoub, Yosra; Bechraoui, Rym; Marrakchi, Jihène; Hardelin, Jean-Pierre; Louha, Malek; Largueche, Leila; Ben Yahia, Salim; Kheirallah, Moncef; Elmatri, Leila; Besbes, Ghazi; Abdelhak, Sonia; Petit, Christine


    Usher syndrome (USH) is an autosomal recessive disorder characterized by combined deafness-blindness. It accounts for about 50% of all hereditary deafness blindness cases. Three clinical subtypes (USH1, USH2, and USH3) are described, of which USH1 is the most severe form, characterized by congenital profound deafness, constant vestibular dysfunction, and a prepubertal onset of retinitis pigmentosa. We performed whole exome sequencing in four unrelated Tunisian patients affected by apparently isolated, congenital profound deafness, with reportedly normal ocular fundus examination. Four biallelic mutations were identified in two USH1 genes: a splice acceptor site mutation, c.2283-1G>T, and a novel missense mutation, c.5434G>A (p.Glu1812Lys), in MYO7A, and two previously unreported mutations in USH1G, i.e. a frameshift mutation, c.1195_1196delAG (p.Leu399Alafs*24), and a nonsense mutation, c.52A>T (p.Lys18*). Another ophthalmological examination including optical coherence tomography actually showed the presence of retinitis pigmentosa in all the patients. Our findings provide evidence that USH is under-diagnosed in Tunisian deaf patients. Yet, early diagnosis of USH is of utmost importance because these patients should undergo cochlear implant surgery in early childhood, in anticipation of the visual loss.

  19. Exome sequencing identifies a novel SMCHD1 mutation in facioscapulohumeral muscular dystrophy 2. (United States)

    Mitsuhashi, Satomi; Boyden, Steven E; Estrella, Elicia A; Jones, Takako I; Rahimov, Fedik; Yu, Timothy W; Darras, Basil T; Amato, Anthony A; Folkerth, Rebecca D; Jones, Peter L; Kunkel, Louis M; Kang, Peter B


    FSHD2 is a rare form of facioscapulohumeral muscular dystrophy (FSHD) characterized by the absence of a contraction in the D4Z4 macrosatellite repeat region on chromosome 4q35 that is the hallmark of FSHD1. However, hypomethylation of this region is common to both subtypes. Recently, mutations in SMCHD1 combined with a permissive 4q35 allele were reported to cause FSHD2. We identified a novel p.Lys275del SMCHD1 mutation in a family affected with FSHD2 using whole-exome sequencing and linkage analysis. This mutation alters a highly conserved amino acid in the ATPase domain of SMCHD1. Subject III-11 is a male who developed asymmetrical muscle weakness characteristic of FSHD at 13 years. Physical examination revealed marked bilateral atrophy at biceps brachii, bilateral scapular winging, some asymmetrical weakness at tibialis anterior and peroneal muscles, and mild lower facial weakness. Biopsy of biceps brachii in subject II-5, the father of III-11, demonstrated lobulated fibers and dystrophic changes. Endomysial and perivascular inflammation was found, which has been reported in FSHD1 but not FSHD2. Given the previous report of SMCHD1 mutations in FSHD2 and the clinical presentations consistent with the FSHD phenotype, we conclude that the SMCHD1 mutation is the likely cause of the disease in this family. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder (United States)

    Yuen, Ryan KC; Merico, Daniele; Bookman, Matt; Howe, Jennifer L; Thiruvahindrapuram, Bhooma; Patel, Rohan V; Whitney, Joe; Deflaux, Nicole; Bingham, Jonathan; Wang, Zhuozhi; Pellecchia, Giovanna; Buchanan, Janet A; Walker, Susan; Marshall, Christian R; Uddin, Mohammed; Zarrei, Mehdi; Deneault, Eric; D’Abate, Lia; Chan, Ada JS; Koyanagi, Stephanie; Paton, Tara; Pereira, Sergio L; Hoang, Ny; Engchuan, Worrawat; Higginbotham, Edward J; Ho, Karen; Lamoureux, Sylvia; Li, Weili; MacDonald, Jeffrey R; Nalpathamkalam, Thomas; Sung, Wilson WL; Tsoi, Fiona J; Wei, John; Xu, Lizhen; Tasse, Anne-Marie; Kirby, Emily; Van Etten, William; Twigger, Simon; Roberts, Wendy; Drmic, Irene; Jilderda, Sanne; Modi, Bonnie MacKinnon; Kellam, Barbara; Szego, Michael; Cytrynbaum, Cheryl; Weksberg, Rosanna; Zwaigenbaum, Lonnie; Woodbury-Smith, Marc; Brian, Jessica; Senman, Lili; Iaboni, Alana; Doyle-Thomas, Krissy; Thompson, Ann; Chrysler, Christina; Leef, Jonathan; Savion-Lemieux, Tal; Smith, Isabel M; Liu, Xudong; Nicolson, Rob; Seifer, Vicki; Fedele, Angie; Cook, Edwin H; Dager, Stephen; Estes, Annette; Gallagher, Louise; Malow, Beth A; Parr, Jeremy R; Spence, Sarah J; Vorstman, Jacob; Frey, Brendan J; Robinson, James T; Strug, Lisa J; Fernandez, Bridget A; Elsabbagh, Mayada; Carter, Melissa T; Hallmayer, Joachim; Knoppers, Bartha M; Anagnostou, Evdokia; Szatmari, Peter; Ring, Robert H; Glazer, David; Pletcher, Mathew T; Scherer, Stephen W


    We are performing whole genome sequencing (WGS) of families with Autism Spectrum Disorder (ASD) to build a resource, named MSSNG, to enable the sub-categorization of phenotypes and underlying genetic factors involved. Here, we report WGS of 5,205 samples from families with ASD, accompanied by clinical information, creating a database accessible in a cloud platform, and through an internet portal with controlled access. We found an average of 73.8 de novo single nucleotide variants and 12.6 de novo insertion/deletions (indels) or copy number variations (CNVs) per ASD subject. We identified 18 new candidate ASD-risk genes such as MED13 and PHF3, and found that participants bearing mutations in susceptibility genes had significantly lower adaptive ability (p=6×10−4). In 294/2,620 (11.2%) of ASD cases, a molecular basis could be determined and 7.2% of these carried CNV/chromosomal abnormalities, emphasizing the importance of detecting all forms of genetic variation as diagnostic and therapeutic targets in ASD. PMID:28263302

  1. Antimicrobial susceptibility among clinical Nocardia species identified by multilocus sequence analysis. (United States)

    McTaggart, Lisa R; Doucet, Jennifer; Witkowska, Maria; Richardson, Susan E


    Antimicrobial susceptibility patterns of 112 clinical isolates, 28 type strains, and 9 reference strains of Nocardia were determined using the Sensititre Rapmyco microdilution panel (Thermo Fisher, Inc.). Isolates were identified by highly discriminatory multilocus sequence analysis and were chosen to represent the diversity of species recovered from clinical specimens in Ontario, Canada. Susceptibility to the most commonly used drug, trimethoprim-sulfamethoxazole, was observed in 97% of isolates. Linezolid and amikacin were also highly effective; 100% and 99% of all isolates demonstrated a susceptible phenotype. For the remaining antimicrobials, resistance was species specific with isolates of Nocardia otitidiscaviarum, N. brasiliensis, N. abscessus complex, N. nova complex, N. transvalensis complex, N. farcinica, and N. cyriacigeorgica displaying the traditional characteristic drug pattern types. In addition, the antimicrobial susceptibility profiles of a variety of rarely encountered species isolated from clinical specimens are reported for the first time and were categorized into four additional drug pattern types. Finally, MICs for the control strains N. nova ATCC BAA-2227, N. asteroides ATCC 19247(T), and N. farcinica ATCC 23826 were robustly determined to demonstrate method reproducibility and suitability of the commercial Sensititre Rapmyco panel for antimicrobial susceptibility testing of Nocardia spp. isolated from clinical specimens. The reported values will facilitate quality control and standardization among laboratories. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  2. Whole exome sequencing identifies mutations in Usher syndrome genes in profoundly deaf Tunisian patients.

    Directory of Open Access Journals (Sweden)

    Zied Riahi

    Full Text Available Usher syndrome (USH is an autosomal recessive disorder characterized by combined deafness-blindness. It accounts for about 50% of all hereditary deafness blindness cases. Three clinical subtypes (USH1, USH2, and USH3 are described, of which USH1 is the most severe form, characterized by congenital profound deafness, constant vestibular dysfunction, and a prepubertal onset of retinitis pigmentosa. We performed whole exome sequencing in four unrelated Tunisian patients affected by apparently isolated, congenital profound deafness, with reportedly normal ocular fundus examination. Four biallelic mutations were identified in two USH1 genes: a splice acceptor site mutation, c.2283-1G>T, and a novel missense mutation, c.5434G>A (p.Glu1812Lys, in MYO7A, and two previously unreported mutations in USH1G, i.e. a frameshift mutation, c.1195_1196delAG (p.Leu399Alafs*24, and a nonsense mutation, c.52A>T (p.Lys18*. Another ophthalmological examination including optical coherence tomography actually showed the presence of retinitis pigmentosa in all the patients. Our findings provide evidence that USH is under-diagnosed in Tunisian deaf patients. Yet, early diagnosis of USH is of utmost importance because these patients should undergo cochlear implant surgery in early childhood, in anticipation of the visual loss.

  3. Whole-genome sequencing identifies genomic heterogeneity at a nucleotide and chromosomal level in bladder cancer (United States)

    Morrison, Carl D.; Liu, Pengyuan; Woloszynska-Read, Anna; Zhang, Jianmin; Luo, Wei; Qin, Maochun; Bshara, Wiam; Conroy, Jeffrey M.; Sabatini, Linda; Vedell, Peter; Xiong, Donghai; Liu, Song; Wang, Jianmin; Shen, He; Li, Yinwei; Omilian, Angela R.; Hill, Annette; Head, Karen; Guru, Khurshid; Kunnev, Dimiter; Leach, Robert; Eng, Kevin H.; Darlak, Christopher; Hoeflich, Christopher; Veeranki, Srividya; Glenn, Sean; You, Ming; Pruitt, Steven C.; Johnson, Candace S.; Trump, Donald L.


    Using complete genome analysis, we sequenced five bladder tumors accrued from patients with muscle-invasive transitional cell carcinoma of the urinary bladder (TCC-UB) and identified a spectrum of genomic aberrations. In three tumors, complex genotype changes were noted. All three had tumor protein p53 mutations and a relatively large number of single-nucleotide variants (SNVs; average of 11.2 per megabase), structural variants (SVs; average of 46), or both. This group was best characterized by chromothripsis and the presence of subclonal populations of neoplastic cells or intratumoral mutational heterogeneity. Here, we provide evidence that the process of chromothripsis in TCC-UB is mediated by nonhomologous end-joining using kilobase, rather than megabase, fragments of DNA, which we refer to as “stitchers,” to repair this process. We postulate that a potential unifying theme among tumors with the more complex genotype group is a defective replication–licensing complex. A second group (two bladder tumors) had no chromothripsis, and a simpler genotype, WT tumor protein p53, had relatively few SNVs (average of 5.9 per megabase) and only a single SV. There was no evidence of a subclonal population of neoplastic cells. In this group, we used a preclinical model of bladder carcinoma cell lines to study a unique SV (translocation and amplification) of the gene glutamate receptor ionotropic N-methyl D-aspertate as a potential new therapeutic target in bladder cancer. PMID:24469795

  4. PACCMIT/PACCMIT-CDS: identifying microRNA targets in 3' UTRs and coding sequences. (United States)

    Šulc, Miroslav; Marín, Ray M; Robins, Harlan S; Vaníček, Jiří


    The purpose of the proposed web server, publicly available at, is to provide a user-friendly interface to two algorithms for predicting messenger RNA (mRNA) molecules regulated by microRNAs: (i) PACCMIT (Prediction of ACcessible and/or Conserved MIcroRNA Targets), which identifies primarily mRNA transcripts targeted in their 3' untranslated regions (3' UTRs), and (ii) PACCMIT-CDS, designed to find mRNAs targeted within their coding sequences (CDSs). While PACCMIT belongs among the accurate algorithms for predicting conserved microRNA targets in the 3' UTRs, the main contribution of the web server is 2-fold: PACCMIT provides an accurate tool for predicting targets also of weakly conserved or non-conserved microRNAs, whereas PACCMIT-CDS addresses the lack of similar portals adapted specifically for targets in CDS. The web server asks the user for microRNAs and mRNAs to be analyzed, accesses the precomputed P-values for all microRNA-mRNA pairs from a database for all mRNAs and microRNAs in a given species, ranks the predicted microRNA-mRNA pairs, evaluates their significance according to the false discovery rate and finally displays the predictions in a tabular form. The results are also available for download in several standard formats. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. PACCMIT/PACCMIT-CDS: identifying microRNA targets in 3′ UTRs and coding sequences (United States)

    Šulc, Miroslav; Marín, Ray M.; Robins, Harlan S.; Vaníček, Jiří


    The purpose of the proposed web server, publicly available at, is to provide a user-friendly interface to two algorithms for predicting messenger RNA (mRNA) molecules regulated by microRNAs: (i) PACCMIT (Prediction of ACcessible and/or Conserved MIcroRNA Targets), which identifies primarily mRNA transcripts targeted in their 3′ untranslated regions (3′ UTRs), and (ii) PACCMIT-CDS, designed to find mRNAs targeted within their coding sequences (CDSs). While PACCMIT belongs among the accurate algorithms for predicting conserved microRNA targets in the 3′ UTRs, the main contribution of the web server is 2-fold: PACCMIT provides an accurate tool for predicting targets also of weakly conserved or non-conserved microRNAs, whereas PACCMIT-CDS addresses the lack of similar portals adapted specifically for targets in CDS. The web server asks the user for microRNAs and mRNAs to be analyzed, accesses the precomputed P-values for all microRNA–mRNA pairs from a database for all mRNAs and microRNAs in a given species, ranks the predicted microRNA–mRNA pairs, evaluates their significance according to the false discovery rate and finally displays the predictions in a tabular form. The results are also available for download in several standard formats. PMID:25948580

  6. Global Transcriptome Sequencing Identifies Chlamydospore Specific Markers in Candida albicans and Candida dubliniensis

    LENUS (Irish Health Repository)

    Palige, Katja


    Candida albicans and Candida dubliniensis are pathogenic fungi that are highly related but differ in virulence and in some phenotypic traits. During in vitro growth on certain nutrient-poor media, C. albicans and C. dubliniensis are the only yeast species which are able to produce chlamydospores, large thick-walled cells of unknown function. Interestingly, only C. dubliniensis forms pseudohyphae with abundant chlamydospores when grown on Staib medium, while C. albicans grows exclusively as a budding yeast. In order to further our understanding of chlamydospore development and assembly, we compared the global transcriptional profile of both species during growth in liquid Staib medium by RNA sequencing. We also included a C. albicans mutant in our study which lacks the morphogenetic transcriptional repressor Nrg1. This strain, which is characterized by its constitutive pseudohyphal growth, specifically produces masses of chlamydospores in Staib medium, similar to C. dubliniensis. This comparative approach identified a set of putatively chlamydospore-related genes. Two of the homologous C. albicans and C. dubliniensis genes (CSP1 and CSP2) which were most strongly upregulated during chlamydospore development were analysed in more detail. By use of the green fluorescent protein as a reporter, the encoded putative cell wall related proteins were found to exclusively localize to C. albicans and C. dubliniensis chlamydospores. Our findings uncover the first chlamydospore specific markers in Candida species and provide novel insights in the complex morphogenetic development of these important fungal pathogens.

  7. SEQATOMS: a web tool for identifying missing regions in PDB in sequence context

    NARCIS (Netherlands)

    Brandt, B.W.; Heringa, J.; Leunissen, J.A.M.


    With over 46 000 proteins, the Protein Data Bank (PDB) is the most important database with structural information of biological macromolecules. PDB files contain sequence and coordinate information. Residues present in the sequence can be absent from the coordinate section, which means their

  8. Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder

    NARCIS (Netherlands)

    Yuen, Ryan K C; Merico, Daniele; Bookman, Matt; Howe, Jennifer L.; Thiruvahindrapuram, Bhooma; Patel, Rohan V.; Whitney, Joe; Deflaux, Nicole; Bingham, Jonathan; Wang, Zhuozhi; Pellecchia, Giovanna; Buchanan, Janet A.; Walker, Susan; Marshall, Christian R.; Uddin, Mohammed; Zarrei, Mehdi; Deneault, Eric; D'Abate, Lia; Chan, Ada J S; Koyanagi, Stephanie; Paton, Tara; Pereira, Sergio L.; Hoang, Ny; Engchuan, Worrawat; Higginbotham, Edward J.; Ho, Karen; Lamoureux, Sylvia; Li, Weili; MacDonald, Jeffrey R.; Nalpathamkalam, Thomas; Sung, Wilson W L; Tsoi, Fiona J.; Wei, John; Xu, Lizhen; Tasse, Anne Marie; Kirby, Emily; Van Etten, William; Twigger, Simon; Roberts, Wendy; Drmic, Irene; Jilderda, Sanne; Modi, Bonnie Mackinnon; Kellam, Barbara; Szego, Michael; Cytrynbaum, Cheryl; Weksberg, Rosanna; Zwaigenbaum, Lonnie; Woodbury-Smith, Marc; Brian, Jessica; Senman, Lili; Iaboni, Alana; Doyle-Thomas, Krissy; Thompson, Ann; Chrysler, Christina; Leef, Jonathan; Savion-Lemieux, Tal; Smith, Isabel M.; Liu, Xudong; Nicolson, Rob; Seifer, Vicki; Fedele, Angie; Cook, Edwin H.; Dager, Stephen; Estes, Annette; Gallagher, Louise; Malow, Beth A.; Parr, Jeremy R.; Spence, Sarah J.; Vorstman, Jacob; Frey, Brendan J.; Robinson, James T.; Strug, Lisa J.; Fernandez, Bridget A.; Elsabbagh, Mayada; Carter, Melissa T.; Hallmayer, Joachim; Knoppers, Bartha M.; Anagnostou, Evdokia; Szatmari, Peter; Ring, Robert H.; Glazer, David; Pletcher, Mathew T.; Scherer, Stephen W.


    We are performing whole-genome sequencing of families with autism spectrum disorder (ASD) to build a resource (MSSNG) for subcategorizing the phenotypes and underlying genetic factors involved. Here we report sequencing of 5,205 samples from families with ASD, accompanied by clinical information,

  9. Exome sequencing in amyotrophic lateral sclerosis identifies risk genes and pathways

    NARCIS (Netherlands)

    Cirulli, Elizabeth T.; Lasseigne, Brittany N.; Petrovski, Slavé; Sapp, Peter C.; Dion, Patrick A.; Leblond, Claire S.; Couthouis, Julien; Lu, Yi-Fan; Wang, Quanli; Krueger, Brian J.; Ren, Zhong; Keebler, Jonathan; Han, Yujun; Levy, Shawn E.; Boone, Braden E.; Wimbish, Jack R.; Waite, Lindsay L.; Jones, Angela L.; Carulli, John P.; Day-Williams, Aaron G.; Staropoli, John F.; Xin, Winnie W.; Chesi, Alessandra; Raphael, Alya R.; McKenna-Yasek, Diane; Cady, Janet; de Jong, J. M. B. Vianney; Kenna, Kevin P.; Smith, Bradley N.; Topp, Simon; Miller, Jack; Gkazi, Athina; Al-Chalabi, Ammar; van den Berg, Leonard H.; Veldink, Jan; Silani, Vincenzo; Ticozzi, Nicola; Shaw, Christopher E.; Baloh, Robert H.; Appel, Stanley; Simpson, Ericka; Lagier-Tourenne, Clotilde; Pulst, Stefan M.; Gibson, Summer; Trojanowski, John Q.; Elman, Lauren; McCluskey, Leo; Grossman, Murray; Baas, Frank; ten Asbroek, Anneloor L. M. A.


    Amyotrophic lateral sclerosis (ALS) is a devastating neurological disease with no effective treatment. We report the results of a moderate-scale sequencing study aimed at increasing the number of genes known to contribute to predisposition for ALS. We performed whole-exome sequencing of 2869 ALS

  10. Identifying Students' Conceptions of Basic Principles in Sequence Stratigraphy (United States)

    Herrera, Juan S.; Riggs, Eric M.


    Sequence stratigraphy is a major research subject in the geosciences academia and the oil industry. However, the geoscience education literature addressing students' understanding of the basic concepts of sequence stratigraphy is relatively thin, and the topic has not been well explored. We conducted an assessment of 27 students' conceptions of…

  11. Investigating Salmonella Eko from Various Sources in Nigeria by Whole Genome Sequencing to Identify the Source of Human Infections.

    Directory of Open Access Journals (Sweden)

    Pimlapas Leekitcharoenphon

    Full Text Available Twenty-six Salmonella enterica serovar Eko isolated from various sources in Nigeria were investigated by whole genome sequencing to identify the source of human infections. Diversity among the isolates was observed and camel and cattle were identified as the primary reservoirs and the most likely source of the human infections.

  12. Investigating Salmonella Eko from Various Sources in Nigeria by Whole Genome Sequencing to Identify the Source of Human Infections

    DEFF Research Database (Denmark)

    Leekitcharoenphon, Pimlapas; Raufu, Ibrahim; Thorup Nielsen, Mette


    Twenty-six Salmonella enterica serovar Eko isolated from various sources in Nigeria were investigated by whole genome sequencing to identify the source of human infections. Diversity among the isolates was observed and camel and cattle were identified as the primary reservoirs and the most likely...

  13. Exome sequencing of Pakistani consanguineous families identifies 30 novel candidate genes for recessive intellectual disability. (United States)

    Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S


    Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.

  14. A bioinformatics approach for identifying transgene insertion sites using whole genome sequencing data. (United States)

    Park, Doori; Park, Su-Hyun; Ban, Yong Wook; Kim, Youn Shic; Park, Kyoung-Cheul; Kim, Nam-Soo; Kim, Ju-Kon; Choi, Ik-Young


    Genetically modified crops (GM crops) have been developed to improve the agricultural traits of modern crop cultivars. Safety assessments of GM crops are of paramount importance in research at developmental stages and before releasing transgenic plants into the marketplace. Sequencing technology is developing rapidly, with higher output and labor efficiencies, and will eventually replace existing methods for the molecular characterization of genetically modified organisms. To detect the transgenic insertion locations in the three GM rice gnomes, Illumina sequencing reads are mapped and classified to the rice genome and plasmid sequence. The both mapped reads are classified to characterize the junction site between plant and transgene sequence by sequence alignment. Herein, we present a next generation sequencing (NGS)-based molecular characterization method, using transgenic rice plants SNU-Bt9-5, SNU-Bt9-30, and SNU-Bt9-109. Specifically, using bioinformatics tools, we detected the precise insertion locations and copy numbers of transfer DNA, genetic rearrangements, and the absence of backbone sequences, which were equivalent to results obtained from Southern blot analyses. NGS methods have been suggested as an effective means of characterizing and detecting transgenic insertion locations in genomes. Our results demonstrate the use of a combination of NGS technology and bioinformatics approaches that offers cost- and time-effective methods for assessing the safety of transgenic plants.

  15. The complete genomic sequence of a tentative new polerovirus identified in barley in South Korea. (United States)

    Zhao, Fumei; Lim, Seungmo; Yoo, Ran Hee; Igori, Davaajargal; Kim, Sang-Min; Kwak, Do Yeon; Kim, Sun Lim; Lee, Bong Choon; Moon, Jae Sun


    The complete nucleotide sequence of a new barley polerovirus, tentatively named barley virus G (BVG), which was isolated in Gimje, South Korea, has been determined using an RNA sequencing technique combined with polymerase chain reaction methods. The viral genomic RNA of BVG is 5,620 nucleotides long and contains six typical open reading frames commonly observed in other poleroviruses. Sequence comparisons revealed that BVG is most closely related to maize yellow dwarf virus-RMV, with the highest amino acid identities being less than 90 % for all of the corresponding proteins. These results suggested that BVG is a member of a new species in the genus Polerovirus.

  16. The Comparison of Biochemical and Sequencing 16S rDNA Gene Methods to Identify Nontuberculous Mycobacteria

    Directory of Open Access Journals (Sweden)

    Shafipour1, M.


    Full Text Available The identification of Mycobacteria in the species level has great medical importance. Biochemical tests are laborious and time-consuming, so new techniques could be used to identify the species. This research aimed to the comparison of biochemical and sequencing 16S rDNA gene methods to identify nontuberculous Mycobacteria in patients suspected to tuberculosis in Golestan province which is the most prevalent region of tuberculosis in Iran. Among 3336 patients suspected to tuberculosis referred to hospitals and health care centres in Golestan province during 2010-2011, 319 (9.56% culture positive cases were collected. Identification of species by using biochemical tests was done. On the samples recognized as nontuberculous Mycobacteria, after DNA extraction by boiling, 16S rDNA PCR was done and their sequencing were identified by NCBI BLAST. Of the 319 positive samples in Golestan Province, 300 cases were M.tuberculosis and 19 cases (5.01% were identified as nontuberculous Mycobacteria by biochemical tests. 15 out of 19 nontuberculous Mycobacteria were identified by PCR and sequencing method as similar by biochemical methods (similarity rate: 78.9%. But after PCR, 1 case known as M.simiae by biochemical test was identified as M. lentiflavum and 3 other cases were identified as Nocardia. Biochemical methods corresponded to the 16S rDNA PCR and sequencing in 78.9% of cases. However, in identification of M. lentiflavum and Nocaria sp. the molecular method is better than biochemical methods.

  17. VWF mutations and new sequence variations identified in healthy controls are more frequent in the African-American population. (United States)

    Bellissimo, Daniel B; Christopherson, Pamela A; Flood, Veronica H; Gill, Joan Cox; Friedman, Kenneth D; Haberichter, Sandra L; Shapiro, Amy D; Abshire, Thomas C; Leissinger, Cindy; Hoots, W Keith; Lusher, Jeanne M; Ragni, Margaret V; Montgomery, Robert R


    Diagnosis and classification of VWD is aided by molecular analysis of the VWF gene. Because VWF polymorphisms have not been fully characterized, we performed VWF laboratory testing and gene sequencing of 184 healthy controls with a negative bleeding history. The controls included 66 (35.9%) African Americans (AAs). We identified 21 new sequence variations, 13 (62%) of which occurred exclusively in AAs and 2 (G967D, T2666M) that were found in 10%-15% of the AA samples, suggesting they are polymorphisms. We identified 14 sequence variations reported previously as VWF mutations, the majority of which were type 1 mutations. These controls had VWF Ag levels within the normal range, suggesting that these sequence variations might not always reduce plasma VWF levels. Eleven mutations were found in AAs, and the frequency of M740I, H817Q, and R2185Q was 15%-18%. Ten AA controls had the 2N mutation H817Q; 1 was homozygous. The average factor VIII level in this group was 99 IU/dL, suggesting that this variation may confer little or no clinical symptoms. This study emphasizes the importance of sequencing healthy controls to understand ethnic-specific sequence variations so that asymptomatic sequence variations are not misidentified as mutations in other ethnic or racial groups.

  18. High throughput sequencing and proteomics to identify immunogenic proteins of a new pathogen: the dirty genome approach. (United States)

    Greub, Gilbert; Kebbi-Beghdadi, Carole; Bertelli, Claire; Collyn, François; Riederer, Beat M; Yersin, Camille; Croxatto, Antony; Raoult, Didier


    With the availability of new generation sequencing technologies, bacterial genome projects have undergone a major boost. Still, chromosome completion needs a costly and time-consuming gap closure, especially when containing highly repetitive elements. However, incomplete genome data may be sufficiently informative to derive the pursued information. For emerging pathogens, i.e. newly identified pathogens, lack of release of genome data during gap closure stage is clearly medically counterproductive. We thus investigated the feasibility of a dirty genome approach, i.e. the release of unfinished genome sequences to develop serological diagnostic tools. We showed that almost the whole genome sequence of the emerging pathogen Parachlamydia acanthamoebae was retrieved even with relatively short reads from Genome Sequencer 20 and Solexa. The bacterial proteome was analyzed to select immunogenic proteins, which were then expressed and used to elaborate the first steps of an ELISA. This work constitutes the proof of principle for a dirty genome approach, i.e. the use of unfinished genome sequences of pathogenic bacteria, coupled with proteomics to rapidly identify new immunogenic proteins useful to develop in the future specific diagnostic tests such as ELISA, immunohistochemistry and direct antigen detection. Although applied here to an emerging pathogen, this combined dirty genome sequencing/proteomic approach may be used for any pathogen for which better diagnostics are needed. These genome sequences may also be very useful to develop DNA based diagnostic tests. All these diagnostic tools will allow further evaluations of the pathogenic potential of this obligate intracellular bacterium.

  19. Mutations in the newly identified RAX regulatory sequence are not a frequent cause of micro/anophthalmia. (United States)

    Chassaing, Nicolas; Vigouroux, Adeline; Calvas, Patrick


    Microphthalmia and anophthalmia are at the severe end of the spectrum of abnormalities in ocular development. A few genes (SOX2, OTX2, RAX, and CHX10) have been implicated in isolated micro/anophthalmia, but causative mutations of these genes explain less than a quarter of these developmental defects. A specifically conserved SOX2/OTX2-mediated RAX expression regulatory sequence has recently been identified. We postulated that mutations in this sequence could lead to micro/anophthalmia, and thus we performed molecular screening of this regulatory element in patients suffering from micro/anophthalmia. Fifty-one patients suffering from nonsyndromic microphthalmia (n = 40) or anophthalmia (n = 11) were included in this study after negative molecular screening for SOX2, OTX2, RAX, and CHX10 mutations. Mutation screening of the RAX regulatory sequence was performed by direct sequencing for these patients. No mutations were identified in the highly conserved RAX regulatory sequence in any of the 51 patients. Mutations in the newly identified RAX regulatory sequence do not represent a frequent cause of nonsyndromic micro/anophthalmia.

  20. Salmonella Persistence in Tomatoes Requires a Distinct Set of Metabolic Functions Identified by Transposon Insertion Sequencing (United States)

    Desai, Prerak; Porwollik, Steffen; Canals, Rocio; Perez, Daniel R.; Chu, Weiping; McClelland, Michael; Teplitski, Max


    ABSTRACT Human enteric pathogens, such as Salmonella spp. and verotoxigenic Escherichia coli, are increasingly recognized as causes of gastroenteritis outbreaks associated with the consumption of fruits and vegetables. Persistence in plants represents an important part of the life cycle of these pathogens. The identification of the full complement of Salmonella genes involved in the colonization of the model plant (tomato) was carried out using transposon insertion sequencing analysis. With this approach, 230,000 transposon insertions were screened in tomato pericarps to identify loci with reduction in fitness, followed by validation of the screen results using competition assays of the isogenic mutants against the wild type. A comparison with studies in animals revealed a distinct plant-associated set of genes, which only partially overlaps with the genes required to elicit disease in animals. De novo biosynthesis of amino acids was critical to persistence within tomatoes, while amino acid scavenging was prevalent in animal infections. Fitness reduction of the Salmonella amino acid synthesis mutants was generally more severe in the tomato rin mutant, which hyperaccumulates certain amino acids, suggesting that these nutrients remain unavailable to Salmonella spp. within plants. Salmonella lipopolysaccharide (LPS) was required for persistence in both animals and plants, exemplifying some shared pathogenesis-related mechanisms in animal and plant hosts. Similarly to phytopathogens, Salmonella spp. required biosynthesis of amino acids, LPS, and nucleotides to colonize tomatoes. Overall, however, it appears that while Salmonella shares some strategies with phytopathogens and taps into its animal virulence-related functions, colonization of tomatoes represents a distinct strategy, highlighting this pathogen's flexible metabolism. IMPORTANCE Outbreaks of gastroenteritis caused by human pathogens have been increasingly associated with foods of plant origin, with tomatoes

  1. Exome Sequencing Identifies a Novel MAP3K14 Mutation in Recessive Atypical Combined Immunodeficiency

    Directory of Open Access Journals (Sweden)

    Nikola Schlechter


    Full Text Available Primary immunodeficiency disorders (PIDs render patients vulnerable to infection with a wide range of microorganisms and thus provide good in vivo models for the assessment of immune responses during infectious challenges. Priming of the immune system, especially in infancy, depends on different environmental exposures and medical practices. This may determine the timing and phenotype of clinical appearance of immune deficits as exemplified with early exposure to Bacillus Calmette-Guérin (BCG vaccination and dissemination in combined immunodeficiencies. Varied phenotype expression poses a challenge to identification of the putative immune deficit. Without the availability of genomic diagnosis and data analysis resources and with limited capacity for functional definition of immune pathways, it is difficult to establish a definitive diagnosis and to decide on appropriate treatment. This study describes the use of exome sequencing to identify a homozygous recessive variant in MAP3K14, NIKVal345Met, in a patient with combined immunodeficiency, disseminated BCG-osis, and paradoxically elevated lymphocytes. Laboratory testing confirmed hypogammaglobulinemia with normal CD19, but failed to confirm a definitive diagnosis for targeted treatment decisions. NIKVal345Met is predicted to be deleterious and pathogenic by two in silico prediction tools and is situated in a gene crucial for effective functioning of the non-canonical nuclear factor-kappa B signaling pathway. Functional analysis of NIKVal345Met- versus NIKWT-transfected human embryonic kidney-293T cells showed that this mutation significantly affects the kinase activity of NIK leading to decreased levels of phosphorylated IkappaB kinase-alpha (IKKα, the target of NIK. BCG-stimulated RAW264.7 cells transfected with NIKVal345Met also presented with reduced levels of phosphorylated IKKα, significantly increased p100 levels and significantly decreased p52 levels compared to cells transfected

  2. Mining genome sequencing data to identify the genomic features linked to breast cancer histopathology (United States)

    Ping, Zheng; Siegal, Gene P.; Almeida, Jonas S.; Schnitt, Stuart J.; Shen, Dejun


    Background: Genetics and genomics have radically altered our understanding of breast cancer progression. However, the genomic basis of various histopathologic features of breast cancer is not yet well-defined. Materials and Methods: The Cancer Genome Atlas (TCGA) is an international database containing a large collection of human cancer genome sequencing data. cBioPortal is a web tool developed for mining these sequencing data. We performed mining of TCGA sequencing data in an attempt to characterize the genomic features correlated with breast cancer histopathology. We first assessed the quality of the TCGA data using a group of genes with known alterations in various cancers. Both genome-wide gene mutation and copy number changes as well as a group of genes with a high frequency of genetic changes were then correlated with various histopathologic features of invasive breast cancer. Results: Validation of TCGA data using a group of genes with known alterations in breast cancer suggests that the TCGA has accurately documented the genomic abnormalities of multiple malignancies. Further analysis of TCGA breast cancer sequencing data shows that accumulation of specific genomic defects is associated with higher tumor grade, larger tumor size and receptor negativity. Distinct groups of genomic changes were found to be associated with the different grades of invasive ductal carcinoma. The mutator role of the TP53 gene was validated by genomic sequencing data of invasive breast cancer and TP53 mutation was found to play a critical role in defining high tumor grade. Conclusions: Data mining of the TCGA genome sequencing data is an innovative and reliable method to help characterize the genomic abnormalities associated with histopathologic features of invasive breast cancer. PMID:24672738

  3. Mining genome sequencing data to identify the genomic features linked to breast cancer histopathology

    Directory of Open Access Journals (Sweden)

    Zheng Ping


    Full Text Available Background: Genetics and genomics have radically altered our understanding of breast cancer progression. However, the genomic basis of various histopathologic features of breast cancer is not yet well-defined. Materials and Methods: The Cancer Genome Atlas (TCGA is an international database containing a large collection of human cancer genome sequencing data. cBioPortal is a web tool developed for mining these sequencing data. We performed mining of TCGA sequencing data in an attempt to characterize the genomic features correlated with breast cancer histopathology. We first assessed the quality of the TCGA data using a group of genes with known alterations in various cancers. Both genome-wide gene mutation and copy number changes as well as a group of genes with a high frequency of genetic changes were then correlated with various histopathologic features of invasive breast cancer. Results: Validation of TCGA data using a group of genes with known alterations in breast cancer suggests that the TCGA has accurately documented the genomic abnormalities of multiple malignancies. Further analysis of TCGA breast cancer sequencing data shows that accumulation of specific genomic defects is associated with higher tumor grade, larger tumor size and receptor negativity. Distinct groups of genomic changes were found to be associated with the different grades of invasive ductal carcinoma. The mutator role of the TP53 gene was validated by genomic sequencing data of invasive breast cancer and TP53 mutation was found to play a critical role in defining high tumor grade. Conclusions: Data mining of the TCGA genome sequencing data is an innovative and reliable method to help characterize the genomic abnormalities associated with histopathologic features of invasive breast cancer.

  4. An Efficient Method for Identifying Gene Fusions by Targeted RNA Sequencing from Fresh Frozen and FFPE Samples.

    Directory of Open Access Journals (Sweden)

    Jonathan A Scolnick

    Full Text Available Fusion genes are known to be key drivers of tumor growth in several types of cancer. Traditionally, detecting fusion genes has been a difficult task based on fluorescent in situ hybridization to detect chromosomal abnormalities. More recently, RNA sequencing has enabled an increased pace of fusion gene identification. However, RNA-Seq is inefficient for the identification of fusion genes due to the high number of sequencing reads needed to detect the small number of fusion transcripts present in cells of interest. Here we describe a method, Single Primer Enrichment Technology (SPET, for targeted RNA sequencing that is customizable to any target genes, is simple to use, and efficiently detects gene fusions. Using SPET to target 5701 exons of 401 known cancer fusion genes for sequencing, we were able to identify known and previously unreported gene fusions from both fresh-frozen and formalin-fixed paraffin-embedded (FFPE tissue RNA in both normal tissue and cancer cells.

  5. Exome sequencing identifies NBEAL2 as the causative gene for gray platelet syndrome

    NARCIS (Netherlands)

    Albers, Cornelis A.; Cvejic, Ana; Favier, Rémi; Bouwmans, Evelien E.; Alessi, Marie-Christine; Bertone, Paul; Jordan, Gregory; Kettleborough, Ross N. W.; Kiddle, Graham; Kostadima, Myrto; Read, Randy J.; Sipos, Botond; Sivapalaratnam, Suthesh; Smethurst, Peter A.; Stephens, Jonathan; Voss, Katrin; Nurden, Alan; Rendon, Augusto; Nurden, Paquita; Ouwehand, Willem H.


    Gray platelet syndrome (GPS) is a predominantly recessive platelet disorder that is characterized by mild thrombocytopenia with large platelets and a paucity of α-granules; these abnormalities cause mostly moderate but in rare cases severe bleeding. We sequenced the exomes of four unrelated

  6. Identifying Learning Behaviors by Contextualizing Differential Sequence Mining with Action Features and Performance Evolution (United States)

    Kinnebrew, John S.; Biswas, Gautam


    Our learning-by-teaching environment, Betty's Brain, captures a wealth of data on students' learning interactions as they teach a virtual agent. This paper extends an exploratory data mining methodology for assessing and comparing students' learning behaviors from these interaction traces. The core algorithm employs sequence mining techniques to…

  7. Use of microsatellite markers derived from whole genome sequence data for identifying polymorphism in Phytophthora ramorum (United States)

    Kelly Ivors; Matteo Garbelotto; Ineke De Vries; Peter Bonants


    Investigating the population genetics of Phytophthora ramorum, the causal agent of sudden oak death (SOD), is critical to understanding the biology and epidemiology of this important phytopathogen. Raw sequence data (445,000 reads) of P. ramorum was provided by the Joint Genome Institute. Our objective was to develop and utilize...

  8. Sequence analysis of the its-2 region: a tool to identify strains of Scenedesmus (Chlorophyceae)

    NARCIS (Netherlands)

    Van Hannen, E.J.; Lürling, M.; Van Donk, E.


    The genetic distances between several strains of Senedesmus obliquus (Turp,) Kutz,, S, acutus Hortobagyi, and S, naegelii Chod. calculated from ITS-2 sequences were found to be smaller than the genetic distances within other strains of Scenedesmus-that is, in S, acuminatus (Lagerh,) Chod, and S,

  9. Whole-genome sequencing and comprehensive molecular profiling identify new driver mutations in gastric cancer

    NARCIS (Netherlands)

    Wang, Kai; Yuen, Siu Tsan; Xu, Jiangchun; Lee, Siu Po; Yan, Helen H N; Shi, Stephanie T; Siu, Hoi Cheong; Deng, Shibing; Chu, Kent Man; Law, Simon; Chan, Kok Hoe; Chan, Annie S Y; Tsui, Wai Yin; Ho, Siu Lun; Chan, Anthony K W; Man, Jonathan L K; Foglizzo, Valentina; Ng, Man Kin; Chan, April S; Ching, Yick Pang; Cheng, Grace H W; Xie, Tao; Fernandez, Julio; Li, Vivian S W; Clevers, Hans; Rejto, Paul A; Mao, Mao; Leung, Suet Yi

    Gastric cancer is a heterogeneous disease with diverse molecular and histological subtypes. We performed whole-genome sequencing in 100 tumor-normal pairs, along with DNA copy number, gene expression and methylation profiling, for integrative genomic analysis. We found subtype-specific genetic and

  10. Diverse Array of New Viral Sequences Identified in Worldwide Populations of the Asian Citrus Psyllid (Diaphorina citri) Using Viral Metagenomics. (United States)

    Nouri, Shahideh; Salem, Nidá; Nigg, Jared C; Falk, Bryce W


    The Asian citrus psyllid, Diaphorina citri, is the natural vector of the causal agent of Huanglongbing (HLB), or citrus greening disease. Together; HLB and D. citri represent a major threat to world citrus production. As there is no cure for HLB, insect vector management is considered one strategy to help control the disease, and D. citri viruses might be useful. In this study, we used a metagenomic approach to analyze viral sequences associated with the global population of D. citri. By sequencing small RNAs and the transcriptome coupled with bioinformatics analysis, we showed that the virus-like sequences of D. citri are diverse. We identified novel viral sequences belonging to the picornavirus superfamily, the Reoviridae, Parvoviridae, and Bunyaviridae families, and an unclassified positive-sense single-stranded RNA virus. Moreover, a Wolbachia prophage-related sequence was identified. This is the first comprehensive survey to assess the viral community from worldwide populations of an agricultural insect pest. Our results provide valuable information on new putative viruses, some of which may have the potential to be used as biocontrol agents. Insects have the most species of all animals, and are hosts to, and vectors of, a great variety of known and unknown viruses. Some of these most likely have the potential to be important fundamental and/or practical resources. In this study, we used high-throughput next-generation sequencing (NGS) technology and bioinformatics analysis to identify putative viruses associated with Diaphorina citri, the Asian citrus psyllid. D. citri is the vector of the bacterium causing Huanglongbing (HLB), currently the most serious threat to citrus worldwide. Here, we report several novel viral sequences associated with D. citri. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  11. Novel Genetic Variants of Sporadic Atrial Septal Defect (ASD) in a Chinese Population Identified by Whole-Exome Sequencing (WES). (United States)

    Liu, Yong; Cao, Yu; Li, Yaxiong; Lei, Dongyun; Li, Lin; Hou, Zong Liu; Han, Shen; Meng, Mingyao; Shi, Jianlin; Zhang, Yayong; Wang, Yi; Niu, Zhaoyi; Xie, Yanhua; Xiao, Benshan; Wang, Yuanfei; Li, Xiao; Yang, Lirong; Wang, Wenju; Jiang, Lihong


    BACKGROUND Recently, mutations in several genes have been described to be associated with sporadic ASD, but some genetic variants remain to be identified. The aim of this study was to use whole-exome sequencing (WES) combined with bioinformatics analysis to identify novel genetic variants in cases of sporadic congenital ASD, followed by validation by Sanger sequencing. MATERIAL AND METHODS Five Han patients with secundum ASD were recruited, and their tissue samples were analyzed by WES, followed by verification by Sanger sequencing of tissue and blood samples. Further evaluation using blood samples included 452 additional patients with sporadic secundum ASD (212 male and 240 female patients) and 519 healthy subjects (252 male and 267 female subjects) for further verification by a multiplexed MassARRAY system. Bioinformatic analyses were performed to identify novel genetic variants associated with sporadic ASD. RESULTS From five patients with sporadic ASD, a total of 181,762 genomic variants in 33 exon loci, validated by Sanger sequencing, were selected and underwent MassARRAY analysis in 452 patients with ASD and 519 healthy subjects. Three loci with high mutation frequencies, the 138665410 FOXL2 gene variant, the 23862952 MYH6 gene variant, and the 71098693 HYDIN gene variant were found to be significantly associated with sporadic ASD (PASD (PASD, and supported the use of WES and bioinformatics analysis to identify disease-associated mutations.

  12. 3′-Terminal Sequence in Poliovirus Negative-Strand Templates Is the Primary cis-Acting Element Required for VPgpUpU-Primed Positive-Strand Initiation


    Sharma, Nidhi; O'Donnell, Brian J.; Flanegan, James B.


    The 5′ cloverleaf in poliovirus RNA has a direct role in regulating the stability, translation, and replication of viral RNA. In this study, we investigated the role of stem a in the 5′ cloverleaf in regulating the stability and replication of poliovirus RNA in HeLa S10 translation-replication reactions. Our results showed that disrupting the duplex structure of stem a destabilized viral RNA and inhibited efficient negative-strand synthesis. Surprisingly, the duplex structure of stem a was no...

  13. Unique features of a global human ectoparasite identified through sequencing of the bed bug genome. (United States)

    Benoit, Joshua B; Adelman, Zach N; Reinhardt, Klaus; Dolan, Amanda; Poelchau, Monica; Jennings, Emily C; Szuter, Elise M; Hagan, Richard W; Gujar, Hemant; Shukla, Jayendra Nath; Zhu, Fang; Mohan, M; Nelson, David R; Rosendale, Andrew J; Derst, Christian; Resnik, Valentina; Wernig, Sebastian; Menegazzi, Pamela; Wegener, Christian; Peschel, Nicolai; Hendershot, Jacob M; Blenau, Wolfgang; Predel, Reinhard; Johnston, Paul R; Ioannidis, Panagiotis; Waterhouse, Robert M; Nauen, Ralf; Schorn, Corinna; Ott, Mark-Christoph; Maiwald, Frank; Johnston, J Spencer; Gondhalekar, Ameya D; Scharf, Michael E; Peterson, Brittany F; Raje, Kapil R; Hottel, Benjamin A; Armisén, David; Crumière, Antonin Jean Johan; Refki, Peter Nagui; Santos, Maria Emilia; Sghaier, Essia; Viala, Sèverine; Khila, Abderrahman; Ahn, Seung-Joon; Childers, Christopher; Lee, Chien-Yueh; Lin, Han; Hughes, Daniel S T; Duncan, Elizabeth J; Murali, Shwetha C; Qu, Jiaxin; Dugan, Shannon; Lee, Sandra L; Chao, Hsu; Dinh, Huyen; Han, Yi; Doddapaneni, Harshavardhan; Worley, Kim C; Muzny, Donna M; Wheeler, David; Panfilio, Kristen A; Vargas Jentzsch, Iris M; Vargo, Edward L; Booth, Warren; Friedrich, Markus; Weirauch, Matthew T; Anderson, Michelle A E; Jones, Jeffery W; Mittapalli, Omprakash; Zhao, Chaoyang; Zhou, Jing-Jiang; Evans, Jay D; Attardo, Geoffrey M; Robertson, Hugh M; Zdobnov, Evgeny M; Ribeiro, Jose M C; Gibbs, Richard A; Werren, John H; Palli, Subba R; Schal, Coby; Richards, Stephen


    The bed bug, Cimex lectularius, has re-established itself as a ubiquitous human ectoparasite throughout much of the world during the past two decades. This global resurgence is likely linked to increased international travel and commerce in addition to widespread insecticide resistance. Analyses of the C. lectularius sequenced genome (650 Mb) and 14,220 predicted protein-coding genes provide a comprehensive representation of genes that are linked to traumatic insemination, a reduced chemosensory repertoire of genes related to obligate hematophagy, host-symbiont interactions, and several mechanisms of insecticide resistance. In addition, we document the presence of multiple putative lateral gene transfer events. Genome sequencing and annotation establish a solid foundation for future research on mechanisms of insecticide resistance, human-bed bug and symbiont-bed bug associations, and unique features of bed bug biology that contribute to the unprecedented success of C. lectularius as a human ectoparasite.

  14. Unique features of a global human ectoparasite identified through sequencing of the bed bug genome (United States)

    Benoit, Joshua B.; Adelman, Zach N.; Reinhardt, Klaus; Dolan, Amanda; Poelchau, Monica; Jennings, Emily C.; Szuter, Elise M.; Hagan, Richard W.; Gujar, Hemant; Shukla, Jayendra Nath; Zhu, Fang; Mohan, M.; Nelson, David R.; Rosendale, Andrew J.; Derst, Christian; Resnik, Valentina; Wernig, Sebastian; Menegazzi, Pamela; Wegener, Christian; Peschel, Nicolai; Hendershot, Jacob M.; Blenau, Wolfgang; Predel, Reinhard; Johnston, Paul R.; Ioannidis, Panagiotis; Waterhouse, Robert M.; Nauen, Ralf; Schorn, Corinna; Ott, Mark-Christoph; Maiwald, Frank; Johnston, J. Spencer; Gondhalekar, Ameya D.; Scharf, Michael E.; Peterson, Brittany F.; Raje, Kapil R.; Hottel, Benjamin A.; Armisén, David; Crumière, Antonin Jean Johan; Refki, Peter Nagui; Santos, Maria Emilia; Sghaier, Essia; Viala, Sèverine; Khila, Abderrahman; Ahn, Seung-Joon; Childers, Christopher; Lee, Chien-Yueh; Lin, Han; Hughes, Daniel S. T.; Duncan, Elizabeth J.; Murali, Shwetha C.; Qu, Jiaxin; Dugan, Shannon; Lee, Sandra L.; Chao, Hsu; Dinh, Huyen; Han, Yi; Doddapaneni, Harshavardhan; Worley, Kim C.; Muzny, Donna M.; Wheeler, David; Panfilio, Kristen A.; Vargas Jentzsch, Iris M.; Vargo, Edward L.; Booth, Warren; Friedrich, Markus; Weirauch, Matthew T.; Anderson, Michelle A. E.; Jones, Jeffery W.; Mittapalli, Omprakash; Zhao, Chaoyang; Zhou, Jing-Jiang; Evans, Jay D.; Attardo, Geoffrey M.; Robertson, Hugh M.; Zdobnov, Evgeny M.; Ribeiro, Jose M. C.; Gibbs, Richard A.; Werren, John H.; Palli, Subba R.; Schal, Coby; Richards, Stephen


    The bed bug, Cimex lectularius, has re-established itself as a ubiquitous human ectoparasite throughout much of the world during the past two decades. This global resurgence is likely linked to increased international travel and commerce in addition to widespread insecticide resistance. Analyses of the C. lectularius sequenced genome (650 Mb) and 14,220 predicted protein-coding genes provide a comprehensive representation of genes that are linked to traumatic insemination, a reduced chemosensory repertoire of genes related to obligate hematophagy, host–symbiont interactions, and several mechanisms of insecticide resistance. In addition, we document the presence of multiple putative lateral gene transfer events. Genome sequencing and annotation establish a solid foundation for future research on mechanisms of insecticide resistance, human–bed bug and symbiont–bed bug associations, and unique features of bed bug biology that contribute to the unprecedented success of C. lectularius as a human ectoparasite. PMID:26836814

  15. The genome sequence of the emerging common midwife toad virus identifies an evolutionary intermediate within ranaviruses. (United States)

    Mavian, Carla; López-Bueno, Alberto; Balseiro, Ana; Casais, Rosa; Alcamí, Antonio; Alejo, Alí


    Worldwide amphibian population declines have been ascribed to global warming, increasing pollution levels, and other factors directly related to human activities. These factors may additionally be favoring the emergence of novel pathogens. In this report, we have determined the complete genome sequence of the emerging common midwife toad ranavirus (CMTV), which has caused fatal disease in several amphibian species across Europe. Phylogenetic and gene content analyses of the first complete genomic sequence from a ranavirus isolated in Europe show that CMTV is an amphibian-like ranavirus (ALRV). However, the CMTV genome structure is novel and represents an intermediate evolutionary stage between the two previously described ALRV groups. We find that CMTV clusters with several other ranaviruses isolated from different hosts and locations which might also be included in this novel ranavirus group. This work sheds light on the phylogenetic relationships within this complex group of emerging, disease-causing viruses.

  16. High throughput sequencing identifies chilling responsive genes in sweetpotato (Ipomoea batatas Lam.) during storage. (United States)

    Xie, Zeyi; Zhou, Zhilin; Li, Hongmin; Yu, Jingjing; Jiang, Jiaojiao; Tang, Zhonghou; Ma, Daifu; Zhang, Baohong; Han, Yonghua; Li, Zongyun


    Sweetpotato (Ipomoea batatas L.) is a globally important economic food crop. It belongs to Convolvulaceae family and origins in the tropics; however, sweetpotato is sensitive to cold stress during storage. In this study, we performed transcriptome sequencing to investigate the sweetpotato response to chilling stress during storage. A total of 110,110 unigenes were generated via high-throughput sequencing. Differentially expressed genes (DEGs) analysis showed that 18,681 genes were up-regulated and 21,983 genes were down-regulated in low temperature condition. Many DEGs were related to the cell membrane system, antioxidant enzymes, carbohydrate metabolism, and hormone metabolism, which are potentially associated with sweetpotato resistance to low temperature. The existence of DEGs suggests a molecular basis for the biochemical and physiological consequences of sweetpotato in low temperature storage conditions. Our analysis will provide a new target for enhancement of sweetpotato cold stress tolerance in postharvest storage through genetic manipulation. Copyright © 2018. Published by Elsevier Inc.

  17. Identifying spatial clustering properties of the 1997-2003 Liguria (Northern Italy) forest-fire sequence

    International Nuclear Information System (INIS)

    Telesca, Luciano; Amatulli, Giuseppe; Lasaponara, Rosa; Lovallo, Michele; Santulli, Adriano


    The spatial clustering of the forest-fire sequence (1997-2003) of Liguria Region (Northern Italy) has been analysed using the correlation dimension D C , calculated by means of the correlation integral method. Studying the variations of this parameter, we recognize the presence of a strong variability of the spatial clusterization, modulated by seasonal cycles. Furthermore, we found that the larger fires (size >400 ha) mark the cyclic behaviour of the correlation dimension

  18. Epitope Sequences in Dengue Virus NS1 Protein Identified by Monoclonal Antibodies

    Directory of Open Access Journals (Sweden)

    Leticia Barboza Rocha


    Full Text Available Dengue nonstructural protein 1 (NS1 is a multi-functional glycoprotein with essential functions both in viral replication and modulation of host innate immune responses. NS1 has been established as a good surrogate marker for infection. In the present study, we generated four anti-NS1 monoclonal antibodies against recombinant NS1 protein from dengue virus serotype 2 (DENV2, which were used to map three NS1 epitopes. The sequence 193AVHADMGYWIESALNDT209 was recognized by monoclonal antibodies 2H5 and 4H1BC, which also cross-reacted with Zika virus (ZIKV protein. On the other hand, the sequence 25VHTWTEQYKFQPES38 was recognized by mAb 4F6 that did not cross react with ZIKV. Lastly, a previously unidentified DENV2 NS1-specific epitope, represented by the sequence 127ELHNQTFLIDGPETAEC143, is described in the present study after reaction with mAb 4H2, which also did not cross react with ZIKV. The selection and characterization of the epitope, specificity of anti-NS1 mAbs, may contribute to the development of diagnostic tools able to differentiate DENV and ZIKV infections.

  19. MicroRNA repertoire for functional genome research in tilapia identified by deep sequencing. (United States)

    Yan, Biao; Wang, Zhen-Hua; Zhu, Chang-Dong; Guo, Jin-Tao; Zhao, Jin-Liang


    The Nile tilapia (Oreochromis niloticus; Cichlidae) is an economically important species in aquaculture and occupies a prominent position in the aquaculture industry. MicroRNAs (miRNAs) are a class of noncoding RNAs that post-transcriptionally regulate gene expression involved in diverse biological and metabolic processes. To increase the repertoire of miRNAs characterized in tilapia, we used the Illumina/Solexa sequencing technology to sequence a small RNA library using pooled RNA sample isolated from the different developmental stages of tilapia. Bioinformatic analyses suggest that 197 conserved and 27 novel miRNAs are expressed in tilapia. Sequence alignments indicate that all tested miRNAs and miRNAs* are highly conserved across many species. In addition, we characterized the tissue expression patterns of five miRNAs using real-time quantitative PCR. We found that miR-1/206, miR-7/9, and miR-122 is abundantly expressed in muscle, brain, and liver, respectively, implying a potential role in the regulation of tissue differentiation or the maintenance of tissue identity. Overall, our results expand the number of tilapia miRNAs, and the discovery of miRNAs in tilapia genome contributes to a better understanding the role of miRNAs in regulating diverse biological processes.

  20. Leaf Transcriptome Sequencing for Identifying Genic-SSR Markers and SNP Heterozygosity in Crossbred Mango Variety 'Amrapali' (Mangifera indica L.). (United States)

    Mahato, Ajay Kumar; Sharma, Nimisha; Singh, Akshay; Srivastav, Manish; Jaiprakash; Singh, Sanjay Kumar; Singh, Anand Kumar; Sharma, Tilak Raj; Singh, Nagendra Kumar


    Mango (Mangifera indica L.) is called "king of fruits" due to its sweetness, richness of taste, diversity, large production volume and a variety of end usage. Despite its huge economic importance genomic resources in mango are scarce and genetics of useful horticultural traits are poorly understood. Here we generated deep coverage leaf RNA sequence data for mango parental varieties 'Neelam', 'Dashehari' and their hybrid 'Amrapali' using next generation sequencing technologies. De-novo sequence assembly generated 27,528, 20,771 and 35,182 transcripts for the three genotypes, respectively. The transcripts were further assembled into a non-redundant set of 70,057 unigenes that were used for SSR and SNP identification and annotation. Total 5,465 SSR loci were identified in 4,912 unigenes with 288 type I SSR (n ≥ 20 bp). One hundred type I SSR markers were randomly selected of which 43 yielded PCR amplicons of expected size in the first round of validation and were designated as validated genic-SSR markers. Further, 22,306 SNPs were identified by aligning high quality sequence reads of the three mango varieties to the reference unigene set, revealing significantly enhanced SNP heterozygosity in the hybrid Amrapali. The present study on leaf RNA sequencing of mango varieties and their hybrid provides useful genomic resource for genetic improvement of mango.

  1. High throughput sequencing and proteomics to identify immunogenic proteins of a new pathogen: the dirty genome approach.

    Directory of Open Access Journals (Sweden)

    Gilbert Greub

    Full Text Available BACKGROUND: With the availability of new generation sequencing technologies, bacterial genome projects have undergone a major boost. Still, chromosome completion needs a costly and time-consuming gap closure, especially when containing highly repetitive elements. However, incomplete genome data may be sufficiently informative to derive the pursued information. For emerging pathogens, i.e. newly identified pathogens, lack of release of genome data during gap closure stage is clearly medically counterproductive. METHODS/PRINCIPAL FINDINGS: We thus investigated the feasibility of a dirty genome approach, i.e. the release of unfinished genome sequences to develop serological diagnostic tools. We showed that almost the whole genome sequence of the emerging pathogen Parachlamydia acanthamoebae was retrieved even with relatively short reads from Genome Sequencer 20 and Solexa. The bacterial proteome was analyzed to select immunogenic proteins, which were then expressed and used to elaborate the first steps of an ELISA. CONCLUSIONS/SIGNIFICANCE: This work constitutes the proof of principle for a dirty genome approach, i.e. the use of unfinished genome sequences of pathogenic bacteria, coupled with proteomics to rapidly identify new immunogenic proteins useful to develop in the future specific diagnostic tests such as ELISA, immunohistochemistry and direct antigen detection. Although applied here to an emerging pathogen, this combined dirty genome sequencing/proteomic approach may be used for any pathogen for which better diagnostics are needed. These genome sequences may also be very useful to develop DNA based diagnostic tests. All these diagnostic tools will allow further evaluations of the pathogenic potential of this obligate intracellular bacterium.

  2. The genome sequence of the most widely cultivated cacao type and its use to identify candidate genes regulating pod color. (United States)

    Motamayor, Juan C; Mockaitis, Keithanne; Schmutz, Jeremy; Haiminen, Niina; Livingstone, Donald; Cornejo, Omar; Findley, Seth D; Zheng, Ping; Utro, Filippo; Royaert, Stefan; Saski, Christopher; Jenkins, Jerry; Podicheti, Ram; Zhao, Meixia; Scheffler, Brian E; Stack, Joseph C; Feltus, Frank A; Mustiga, Guiliana M; Amores, Freddy; Phillips, Wilbert; Marelli, Jean Philippe; May, Gregory D; Shapiro, Howard; Ma, Jianxin; Bustamante, Carlos D; Schnell, Raymond J; Main, Dorrie; Gilbert, Don; Parida, Laxmi; Kuhn, David N


    Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. We describe the sequencing and assembly of the genome of Theobroma cacao L. cultivar Matina 1-6. The genome of the Matina 1-6 cultivar is 445 Mbp, which is significantly larger than a sequenced Criollo cultivar, and more typical of other cultivars. The chromosome-scale assembly, version 1.1, contains 711 scaffolds covering 346.0 Mbp, with a contig N50 of 84.4 kbp, a scaffold N50 of 34.4 Mbp, and an evidence-based gene set of 29,408 loci. Version 1.1 has 10x the scaffold N50 and 4x the contig N50 as Criollo, and includes 111 Mb more anchored sequence. The version 1.1 assembly has 4.4% gap sequence, while Criollo has 10.9%. Through a combination of haplotype, association mapping and gene expression analyses, we leverage this robust reference genome to identify a promising candidate gene responsible for pod color variation. We demonstrate that green/red pod color in cacao is likely regulated by the R2R3 MYB transcription factor TcMYB113, homologs of which determine pigmentation in Rosaceae, Solanaceae, and Brassicaceae. One SNP within the target site for a highly conserved trans-acting siRNA in dicots, found within TcMYB113, seems to affect transcript levels of this gene and therefore pod color variation. We report a high-quality sequence and annotation of Theobroma cacao L. and demonstrate its utility in identifying candidate genes regulating traits.

  3. The genome sequence of the most widely cultivated cacao type and its use to identify candidate genes regulating pod color (United States)


    Background Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. Results We describe the sequencing and assembly of the genome of Theobroma cacao L. cultivar Matina 1-6. The genome of the Matina 1-6 cultivar is 445 Mbp, which is significantly larger than a sequenced Criollo cultivar, and more typical of other cultivars. The chromosome-scale assembly, version 1.1, contains 711 scaffolds covering 346.0 Mbp, with a contig N50 of 84.4 kbp, a scaffold N50 of 34.4 Mbp, and an evidence-based gene set of 29,408 loci. Version 1.1 has 10x the scaffold N50 and 4x the contig N50 as Criollo, and includes 111 Mb more anchored sequence. The version 1.1 assembly has 4.4% gap sequence, while Criollo has 10.9%. Through a combination of haplotype, association mapping and gene expression analyses, we leverage this robust reference genome to identify a promising candidate gene responsible for pod color variation. We demonstrate that green/red pod color in cacao is likely regulated by the R2R3 MYB transcription factor TcMYB113, homologs of which determine pigmentation in Rosaceae, Solanaceae, and Brassicaceae. One SNP within the target site for a highly conserved trans-acting siRNA in dicots, found within TcMYB113, seems to affect transcript levels of this gene and therefore pod color variation. Conclusions We report a high-quality sequence and annotation of Theobroma cacao L. and demonstrate its utility in identifying candidate genes regulating traits. PMID:23731509

  4. Whole-exome sequencing identifies USH2A mutations in a pseudo-dominant Usher syndrome family. (United States)

    Zheng, Sui-Lian; Zhang, Hong-Liang; Lin, Zhen-Lang; Kang, Qian-Yan


    Usher syndrome (USH) is an autosomal recessive (AR) multi-sensory degenerative disorder leading to deaf-blindness. USH is clinically subdivided into three subclasses, and 10 genes have been identified thus far. Clinical and genetic heterogeneities in USH make a precise diagnosis difficult. A dominant‑like USH family in successive generations was identified, and the present study aimed to determine the genetic predisposition of this family. Whole‑exome sequencing was performed in two affected patients and an unaffected relative. Systematic data were analyzed by bioinformatic analysis to remove the candidate mutations via step‑wise filtering. Direct Sanger sequencing and co‑segregation analysis were performed in the pedigree. One novel and two known mutations in the USH2A gene were identified, and were further confirmed by direct sequencing and co‑segregation analysis. The affected mother carried compound mutations in the USH2A gene, while the unaffected father carried a heterozygous mutation. The present study demonstrates that whole‑exome sequencing is a robust approach for the molecular diagnosis of disorders with high levels of genetic heterogeneity.

  5. Recurrent chimeric RNAs enriched in human prostate cancer identified by deep sequencing (United States)

    Kannan, Kalpana; Wang, Liguo; Wang, Jianghua; Ittmann, Michael M.; Li, Wei; Yen, Laising


    Transcription-induced chimeric RNAs, possessing sequences from different genes, are expected to increase the proteomic diversity through chimeric proteins or altered regulation. Despite their importance, few studies have focused on chimeric RNAs especially regarding their presence/roles in human cancers. By deep sequencing the transcriptome of 20 human prostate cancer and 10 matched benign prostate tissues, we obtained 1.3 billion sequence reads, which led to the identification of 2,369 chimeric RNA candidates. Chimeric RNAs occurred in significantly higher frequency in cancer than in matched benign samples. Experimental investigation of a selected 46 set led to the confirmation of 32 chimeric RNAs, of which 27 were highly recurrent and previously undescribed in prostate cancer. Importantly, a subset of these chimeras was present in prostate cancer cell lines, but not detectable in primary human prostate epithelium cells, implying their associations with cancer. These chimeras contain discernable 5′ and 3′ splice sites at the RNA junction, indicating that their formation is mediated by splicing. Their presence is also largely independent of the expression of parental genes, suggesting that other factors are involved in their production and regulation. One chimera, TMEM79-SMG5, is highly differentially expressed in human cancer samples and therefore a potential biomarker. The prevalence of chimeric RNAs may allow the limited number of human genes to encode a substantially larger number of RNAs and proteins, forming an additional layer of cellular complexity. Together, our results suggest that chimeric RNAs are widespread, and increased chimeric RNA events could represent a unique class of molecular alteration in cancer. PMID:21571633

  6. TAPDANCE: An automated tool to identify and annotate transposon insertion CISs and associations between CISs from next generation sequence data

    Directory of Open Access Journals (Sweden)

    Sarver Aaron L


    Full Text Available Abstract Background Next generation sequencing approaches applied to the analyses of transposon insertion junction fragments generated in high throughput forward genetic screens has created the need for clear informatics and statistical approaches to deal with the massive amount of data currently being generated. Previous approaches utilized to 1 map junction fragments within the genome and 2 identify Common Insertion Sites (CISs within the genome are not practical due to the volume of data generated by current sequencing technologies. Previous approaches applied to this problem also required significant manual annotation. Results We describe Transposon Annotation Poisson Distribution Association Network Connectivity Environment (TAPDANCE software, which automates the identification of CISs within transposon junction fragment insertion data. Starting with barcoded sequence data, the software identifies and trims sequences and maps putative genomic sequence to a reference genome using the bowtie short read mapper. Poisson distribution statistics are then applied to assess and rank genomic regions showing significant enrichment for transposon insertion. Novel methods of counting insertions are used to ensure that the results presented have the expected characteristics of informative CISs. A persistent mySQL database is generated and utilized to keep track of sequences, mappings and common insertion sites. Additionally, associations between phenotypes and CISs are also identified using Fisher’s exact test with multiple testing correction. In a case study using previously published data we show that the TAPDANCE software identifies CISs as previously described, prioritizes them based on p-value, allows holistic visualization of the data within genome browser software and identifies relationships present in the structure of the data. Conclusions The TAPDANCE process is fully automated, performs similarly to previous labor intensive approaches

  7. Exome sequencing identifies highly recurrent MED12 somatic mutations in breast fibroadenoma. (United States)

    Lim, Weng Khong; Ong, Choon Kiat; Tan, Jing; Thike, Aye Aye; Ng, Cedric Chuan Young; Rajasegaran, Vikneswari; Myint, Swe Swe; Nagarajan, Sanjanaa; Nasir, Nur Diyana Md; McPherson, John R; Cutcutache, Ioana; Poore, Gregory; Tay, Su Ting; Ooi, Wei Siong; Tan, Veronique Kiak Mien; Hartman, Mikael; Ong, Kong Wee; Tan, Benita K T; Rozen, Steven G; Tan, Puay Hoon; Tan, Patrick; Teh, Bin Tean


    Fibroadenomas are the most common breast tumors in women under 30 (refs. 1,2). Exome sequencing of eight fibroadenomas with matching whole-blood samples revealed recurrent somatic mutations solely in MED12, which encodes a Mediator complex subunit. Targeted sequencing of an additional 90 fibroadenomas confirmed highly frequent MED12 exon 2 mutations (58/98, 59%) that are probably somatic, with 71% of mutations occurring in codon 44. Using laser capture microdissection, we show that MED12 fibroadenoma mutations are present in stromal but not epithelial mammary cells. Expression profiling of MED12-mutated and wild-type fibroadenomas revealed that MED12 mutations are associated with dysregulated estrogen signaling and extracellular matrix organization. The fibroadenoma MED12 mutation spectrum is nearly identical to that of previously reported MED12 lesions in uterine leiomyoma but not those of other tumors. Benign tumors of the breast and uterus, both of which are key target tissues of estrogen, may thus share a common genetic basis underpinned by highly frequent and specific MED12 mutations.

  8. Multiplexed resequencing analysis to identify rare variants in pooled DNA with barcode indexing using next-generation sequencer. (United States)

    Mitsui, Jun; Fukuda, Yoko; Azuma, Kyo; Tozaki, Hirokazu; Ishiura, Hiroyuki; Takahashi, Yuji; Goto, Jun; Tsuji, Shoji


    We have recently found that multiple rare variants of the glucocerebrosidase gene (GBA) confer a robust risk for Parkinson disease, supporting the 'common disease-multiple rare variants' hypothesis. To develop an efficient method of identifying rare variants in a large number of samples, we applied multiplexed resequencing using a next-generation sequencer to identification of rare variants of GBA. Sixteen sets of pooled DNAs from six pooled DNA samples were prepared. Each set of pooled DNAs was subjected to polymerase chain reaction to amplify the target gene (GBA) covering 6.5 kb, pooled into one tube with barcode indexing, and then subjected to extensive sequence analysis using the SOLiD System. Individual samples were also subjected to direct nucleotide sequence analysis. With the optimization of data processing, we were able to extract all the variants from 96 samples with acceptable rates of false-positive single-nucleotide variants.

  9. Next generation sequencing identifies abnormal Y chromosome and candidate causal variants in premature ovarian failure patients. (United States)

    Lee, Yujung; Kim, Changshin; Park, YoungJoon; Pyun, Jung-A; Kwack, KyuBum


    Premature ovarian failure (POF) is characterized by heterogeneous genetic causes such as chromosomal abnormalities and variants in causal genes. Recently, development of techniques made next generation sequencing (NGS) possible to detect genome wide variants including chromosomal abnormalities. Among 37 Korean POF patients, XY karyotype with distal part deletions of Y chromosome, Yp11.32-31 and Yp12 end part, was observed in two patients through NGS. Six deleterious variants in POF genes were also detected which might explain the pathogenesis of POF with abnormalities in the sex chromosomes. Additionally, the two POF patients had no mutation in SRY but three non-synonymous variants were detected in genes regarding sex reversal. These findings suggest candidate causes of POF and sex reversal and show the propriety of NGS to approach the heterogeneous pathogenesis of POF. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Whole-exome sequencing identifies common and rare variant metabolic QTLs in a Middle Eastern population. (United States)

    Yousri, Noha A; Fakhro, Khalid A; Robay, Amal; Rodriguez-Flores, Juan L; Mohney, Robert P; Zeriri, Hassina; Odeh, Tala; Kader, Sara Abdul; Aldous, Eman K; Thareja, Gaurav; Kumar, Manish; Al-Shakaki, Alya; Chidiac, Omar M; Mohamoud, Yasmin A; Mezey, Jason G; Malek, Joel A; Crystal, Ronald G; Suhre, Karsten


    Metabolomics-genome-wide association studies (mGWAS) have uncovered many metabolic quantitative trait loci (mQTLs) influencing human metabolic individuality, though predominantly in European cohorts. By combining whole-exome sequencing with a high-resolution metabolomics profiling for a highly consanguineous Middle Eastern population, we discover 21 common variant and 12 functional rare variant mQTLs, of which 45% are novel altogether. We fine-map 10 common variant mQTLs to new metabolite ratio associations, and 11 common variant mQTLs to putative protein-altering variants. This is the first work to report common and rare variant mQTLs linked to diseases and/or pharmacological targets in a consanguineous Arab cohort, with wide implications for precision medicine in the Middle East.

  11. Identifying Likely Transmission Pathways within a 10-Year Community Outbreak of Tuberculosis by High-Depth Whole Genome Sequencing.

    Directory of Open Access Journals (Sweden)

    Alexander C Outhred

    Full Text Available Improved tuberculosis control and the need to contain the spread of drug-resistant strains provide a strong rationale for exploring tuberculosis transmission dynamics at the population level. Whole-genome sequencing provides optimal strain resolution, facilitating detailed mapping of potential transmission pathways.We sequenced 22 isolates from a Mycobacterium tuberculosis cluster in New South Wales, Australia, identified during routine 24-locus mycobacterial interspersed repetitive unit typing. Following high-depth paired-end sequencing using the Illumina HiSeq 2000 platform, two independent pipelines were employed for analysis, both employing read mapping onto reference genomes as well as de novo assembly, to control biases in variant detection. In addition to single-nucleotide polymorphisms, the analyses also sought to identify insertions, deletions and structural variants.Isolates were highly similar, with a distance of 13 variants between the most distant members of the cluster. The most sensitive analysis classified the 22 isolates into 18 groups. Four of the isolates did not appear to share a recent common ancestor with the largest clade; another four isolates had an uncertain ancestral relationship with the largest clade.Whole genome sequencing, with analysis of single-nucleotide polymorphisms, insertions, deletions, structural variants and subpopulations, enabled the highest possible level of discrimination between cluster members, clarifying likely transmission pathways and exposing the complexity of strain origin. The analysis provides a basis for targeted public health intervention and enhanced classification of future isolates linked to the cluster.

  12. A nonsense mutation causing decreased levels of insulin receptor mRNA: Detection by a simplified technique for direct sequencing of genomic DNA amplified by the polymerase chain reaction

    International Nuclear Information System (INIS)

    Kadowaki, T.; Kadowaki, H.; Taylor, S.I.


    Mutations in the insulin receptor gene can render the cell resistant to the biological action of insulin. The authors have studied a patient with leprechaunism (leprechaun/Minn-1), a genetic syndrome associated with intrauterine growth retardation and extreme insulin resistance. Genomic DNA from the patient was amplified by the polymerase chain reaction catalyzed by Thermus aquaticus (Taq) DNA polymerase, and the amplified DNA was directly sequenced. A nonsense mutations was identified at codon 897 in exon 14 in the paternal allele of the patient's insulin receptor gene. Levels of insulin receptor mRNA are decreased to <10% of normal in Epstein-Barr virus-transformed lymphoblasts and cultured skin fibroblasts from this patient. Thus, this nonsense mutation appears to cause a decrease in the levels of insulin receptor mRNA. In addition, they have obtained indirect evidence that the patient's maternal allele of the insulin receptor gene contains a cis-acting dominant mutation that also decreases the level of mRNA, but by a different mechanism. The nucleotide sequence of the entire protein-coding domain and the sequences of the intron-exon boundaries for all 22 exons of the maternal allele were normal. Presumably, the mutation in the maternal allele maps elsewhere in the insulin receptor gene. Thus, they conclude that the patient is a compound heterozygote for two cis-acting dominant mutations in the insulin receptor gene: (i) a nonsense mutation in the paternal allel that reduces the level of insulin receptor mRNA and (ii) an as yet unidentified mutation in the maternal allele that either decreases the rate of transcription or decreases the stability of the mRNA

  13. Greater than the sum of its parts: single-nucleus sequencing identifies convergent evolution of independent EGFR mutants in GBM. (United States)

    Gini, Beatrice; Mischel, Paul S


    Single-cell sequencing approaches are needed to characterize the genomic diversity of complex tumors, shedding light on their evolutionary paths and potentially suggesting more effective therapies. In this issue of Cancer Discovery, Francis and colleagues develop a novel integrative approach to identify distinct tumor subpopulations based on joint detection of clonal and subclonal events from bulk tumor and single-nucleus whole-genome sequencing, allowing them to infer a subclonal architecture. Surprisingly, the authors identify convergent evolution of multiple, mutually exclusive, independent EGFR gain-of-function variants in a single tumor. This study demonstrates the value of integrative single-cell genomics and highlights the biologic primacy of EGFR as an actionable target in glioblastoma. ©2014 American Association for Cancer Research.

  14. Integrative analysis of functional genomic annotations and sequencing data to identify rare causal variants via hierarchical modeling

    Directory of Open Access Journals (Sweden)

    Marinela eCapanu


    Full Text Available Identifying the small number of rare causal variants contributing to disease has beena major focus of investigation in recent years, but represents a formidable statisticalchallenge due to the rare frequencies with which these variants are observed. In thiscommentary we draw attention to a formal statistical framework, namely hierarchicalmodeling, to combine functional genomic annotations with sequencing data with theobjective of enhancing our ability to identify rare causal variants. Using simulations weshow that in all configurations studied, the hierarchical modeling approach has superiordiscriminatory ability compared to a recently proposed aggregate measure of deleteriousness,the Combined Annotation-Dependent Depletion (CADD score, supportingour premise that aggregate functional genomic measures can more accurately identifycausal variants when used in conjunction with sequencing data through a hierarchicalmodeling approach

  15. Use of Whole-Genus Genome Sequence Data To Develop a Multilocus Sequence Typing Tool That Accurately Identifies Yersinia Isolates to the Species and Subspecies Levels (United States)

    Hall, Miquette; Chattaway, Marie A.; Reuter, Sandra; Savin, Cyril; Strauch, Eckhard; Carniel, Elisabeth; Connor, Thomas; Van Damme, Inge; Rajakaruna, Lakshani; Rajendram, Dunstan; Jenkins, Claire; Thomson, Nicholas R.


    The genus Yersinia is a large and diverse bacterial genus consisting of human-pathogenic species, a fish-pathogenic species, and a large number of environmental species. Recently, the phylogenetic and population structure of the entire genus was elucidated through the genome sequence data of 241 strains encompassing every known species in the genus. Here we report the mining of this enormous data set to create a multilocus sequence typing-based scheme that can identify Yersinia strains to the species level to a level of resolution equal to that for whole-genome sequencing. Our assay is designed to be able to accurately subtype the important human-pathogenic species Yersinia enterocolitica to whole-genome resolution levels. We also report the validation of the scheme on 386 strains from reference laboratory collections across Europe. We propose that the scheme is an important molecular typing system to allow accurate and reproducible identification of Yersinia isolates to the species level, a process often inconsistent in nonspecialist laboratories. Additionally, our assay is the most phylogenetically informative typing scheme available for Y. enterocolitica. PMID:25339391

  16. Activity of Posaconazole and Other Antifungal Agents against Mucorales Strains Identified by Sequencing of Internal Transcribed Spacers▿ (United States)

    Alastruey-Izquierdo, Ana; Castelli, Maria Victoria; Cuesta, Isabel; Monzon, Araceli; Cuenca-Estrella, Manuel; Rodriguez-Tudela, Juan Luis


    The antifungal susceptibility profiles of 77 clinical strains of Mucorales species, identified by internal transcribed spacer sequencing, were analyzed. MICs obtained at 24 and 48 h were compared. Amphotericin B was the most active agent against all isolates, except for Cunninghamella and Apophysomyces isolates. Posaconazole also showed good activity for all species but Cunninghamella bertholletiae. Voriconazole had no activity against any of the fungi tested. Terbinafine showed good activity, except for Rhizopus oryzae, Mucor circinelloides, and Rhizomucor variabilis isolates. PMID:19171801

  17. Activity of posaconazole and other antifungal agents against Mucorales strains identified by sequencing of internal transcribed spacers. (United States)

    Alastruey-Izquierdo, Ana; Castelli, Maria Victoria; Cuesta, Isabel; Monzon, Araceli; Cuenca-Estrella, Manuel; Rodriguez-Tudela, Juan Luis


    The antifungal susceptibility profiles of 77 clinical strains of Mucorales species, identified by internal transcribed spacer sequencing, were analyzed. MICs obtained at 24 and 48 h were compared. Amphotericin B was the most active agent against all isolates, except for Cunninghamella and Apophysomyces isolates. Posaconazole also showed good activity for all species but Cunninghamella bertholletiae. Voriconazole had no activity against any of the fungi tested. Terbinafine showed good activity, except for Rhizopus oryzae, Mucor circinelloides, and Rhizomucor variabilis isolates.

  18. Whole-exome sequencing identifies rare and low-frequency coding variants associated with LDL cholesterol

    NARCIS (Netherlands)

    L.A. Lange (Leslie); Y. Hu (Youna); H. Zhang (He); C. Xue (Chenyi); E.M. Schmidt (Ellen); Z.-Z. Tang (Zheng-Zheng); C. Bizon (Chris); E.M. Lange (Ethan); G.D. Smith; E.H. Turner (Emily); Y. Jun (Yang); H.M. Kang (Hyun Min); G.M. Peloso (Gina); P. Auer (Paul); K.-P. Li (Kuo-Ping); J. Flannick (Jason); J. Zhang (Ji); C. Fuchsberger (Christian); K. Gaulton (Kyle); C.M. Lindgren (Cecilia); A. Locke (Adam); A.K. Manning (Alisa); X. Sim (Xueling); M.A. Rivas (Manuel); O.L. Holmen (Oddgeir); R.F. Gottesman (Rebecca); Y. Lu (Yingchang); D. Ruderfer (Douglas); E.A. Stahl (Eli); Q. Duan (Qing); Y. Li (Yun); P. Durda (Peter); S. Jiao (Shuo); A.J. Isaacs (Aaron); A. Hofman (Albert); J.C. Bis (Joshua); D.D. Correa; M.D. Griswold (Michael); M. Jakobsdottir (Margret); G.D. Smith; P.J. Schreiner (Pamela); M.F. Feitosa (Mary Furlan); Q. Zhang (Qunyuan); J.E. Huffman (Jennifer); S. Crosby; C.L. Wassel (Christina); R. Do (Ron); N. Franceschini (Nora); L.W. Martin (Lisa); J.G. Robinson (Jennifer); T.L. Assimes (Themistocles); D.R. Crosslin (David); E.A. Rosenthal (Elisabeth); M.Y. Tsai (Michael); M. Rieder (Mark); D.N. Farlow (Deborah); A.R. Folsom (Aaron); T. Lumley (Thomas); E.R. Fox (Ervin); C.S. Carlson (Christopher); U. Peters (Ulrike); R.D. Jackson (Rebecca); C.M. van Duijn (Cornelia); A.G. Uitterlinden (André); D. Levy (Daniel); J.I. Rotter (Jerome); H.A. Taylor (Herman); V. Gudnason (Vilmundur); D.S. Siscovick (David); M. Fornage (Myriam); I.B. Borecki (Ingrid); C. Hayward (Caroline); I. Rudan (Igor); Y.E. Chen (Y. Eugene); E.P. Bottinger (Erwin); R.J.F. Loos (Ruth); P. Sætrom (Pål); K. Hveem (Kristian); M. Boehnke (Michael); L. Groop (Leif); M.I. McCarthy (Mark); T. Meitinger (Thomas); C. Ballantyne (Christie); S.B. Gabriel (Stacey); C.J. O'Donnell (Christopher); W.S. Post (Wendy S.); K.E. North (Kari); A. Reiner (Alexander); E.A. Boerwinkle (Eric); B.M. Psaty (Bruce); D. Altshuler (David); S. Kathiresan (Sekar); D.Y. Lin (Dan); G.P. Jarvik (Gail); L.A. Cupples (Adrienne); C. Kooperberg (Charles); J.G. Wilson (James); D.A. Nickerson (Deborah); G.R. Abecasis (Gonçalo); S.S. Rich (Stephen); R.P. Tracy (Russell); C.J. Willer (Cristen)


    textabstractElevated low-density lipoprotein cholesterol (LDL-C) is a treatable, heritable risk factor for cardiovascular disease. Genome-wide association studies (GWASs) have identified 157 variants associated with lipid levels but are not well suited to assess the impact of rare and low-frequency

  19. Discovery and molecular characterization of a new luteovirus identified by high-throughput sequencing from apple (United States)

    ‘Rapid Apple Decline’ (RAD) is a newly emerging problem of young, dwarf apple trees in the northeastern USA. The affected trees show trunk necrosis, bark cracking and canker formation before collapsing in the summer. In this study, a new luteovirus and three common viruses were identified from apple...

  20. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    NARCIS (Netherlands)

    Hu, H; Haas, S.A.; Chelly, J.; Esch, H. Van; Raynaud, M.; Brouwer, A.P. de; Weinert, S.; Froyen, G.; Frints, S.G.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.; Jensen, C.; Hambrock, M.; Fischer, U.; Langnick, C.; Feldkamp, M.; Wissink-Lindhout, W.; Lebrun, N.; Castelnau, L.; Rucci, J.; Montjean, R.; Dorseuil, O.; Billuart, P.; Stuhlmann, T.; Shaw, M.; Corbett, M.A.; Gardner, A.; Willis-Owen, S.; Tan, C.; Friend, K.L.; Belet, S.; Roozendaal, K.E. van; Jimenez-Pocquet, M.; Moizard, M.P.; Ronce, N.; Sun, R.; O'Keeffe, S.; Chenna, R.; Bommel, A. van; Goke, J.; Hackett, A.; Field, M.; Christie, L.; Boyle, J.; Haan, E.; Nelson, J.; Turner, G.; Baynam, G.; Gillessen-Kaesbach, G.; Muller, U.; Steinberger, D.; Budny, B.; Badura-Stronka, M.; Latos-Bielenska, A.; Ousager, L.B.; Wieacker, P.; Rodriguez Criado, G.; Bondeson, M.L.; Anneren, G.; Dufke, A.; Cohen, M.; Maldergem, L. Van; Vincent-Delorme, C.; Echenne, B.; Simon-Bouy, B.; Kleefstra, T.; Willemsen, M.H.; Fryns, J.P.; Devriendt, K.; Ullmann, R.; Vingron, M.; Wrogemann, K.; Wienker, T.F.; Tzschach, A.; Bokhoven, H. van; Gecz, J.; Jentsch, T.J.; Chen, W.; Ropers, H.H.; Kalscheuer, V.M.


    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or

  1. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    DEFF Research Database (Denmark)

    Hu, H; Haas, S A; Chelly, J


    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes...

  2. Regulation of the Osem gene by abscisic acid and the transcriptional activator VP1: analysis of cis-acting promoter elements required for regulation by abscisic acid and VP1. (United States)

    Hattori, T; Terada, T; Hamasuna, S


    Osem, a rice gene homologous to the wheat Em gene, which encodes one of the late-embryogenesis abundant proteins was isolated. The gene was characterized with respect to control of transcription by abscisic acid (ABA) and the transcriptional activator VP1, which is involved in the ABA-regulated gene expression during late embryo-genesis. A fusion gene (Osem-GUS) consisting of the Osem promoter and the bacterial beta-glucuronidase (GUS) gene was constructed and tested in a transient expression system, using protoplasts derived from a suspension-cultured line of rice cells, for activation by ABA and by co-transfection with an expression vector (35S-Osvp1) for the rice VP1 (OSVP1) cDNA. The expression of Osem-GUS was strongly (40- to 150-fold) activated by externally applied ABA and by over-expression of (OS)VP1. The Osem promoter has three ACGTG-containing sequences, motif A, motif B and motif A', which resemble the abscisic acid-responsive element (ABRE) that was previously identified in the wheat Em and the rice Rab16. There is also a CATGCATG sequence, which is known as the Sph box and is shown to be essential for the regulation by VP1 of the maize anthocyanin regulatory gene C1. Focusing on these sequence elements, various mutant derivatives of the Osem promoter in the transient expression system were assayed. The analysis revealed that motif A functions not only as an ABRE but also as a sequence element required for the regulation by (OS)VP1.

  3. Exome sequencing identifies early gastric carcinoma as an early stage of advanced gastric cancer.

    Directory of Open Access Journals (Sweden)

    Guhyun Kang

    Full Text Available Gastric carcinoma is one of the major causes of cancer-related mortality worldwide. Early detection and treatment leads to an excellent prognosis in patients with early gastric cancer (EGC, whereas the prognosis of patients with advanced gastric cancer (AGC remains poor. It is unclear whether EGCs and AGCs are distinct entities or whether EGCs are the beginning stages of AGCs. We performed whole exome sequencing of four samples from patients with EGC and compared the results with those from AGCs. In both EGCs and AGCs, a total of 268 genes were commonly mutated and independent mutations were additionally found in EGCs (516 genes and AGCs (3104 genes. A higher frequency of C>G transitions was observed in intestinal-type compared to diffuse-type carcinomas (P = 0.010. The DYRK3, GPR116, MCM10, PCDH17, PCDHB1, RDH5 and UNC5C genes are recurrently mutated in EGCs and may be involved in early carcinogenesis.

  4. A survey of single nucleotide polymorphisms identified from whole-genome sequencing and their functional effect in the porcine genome. (United States)

    Keel, B N; Nonneman, D J; Rohrer, G A


    Genetic variants detected from sequence have been used to successfully identify causal variants and map complex traits in several organisms. High and moderate impact variants, those expected to alter or disrupt the protein coded by a gene and those that regulate protein production, likely have a more significant effect on phenotypic variation than do other types of genetic variants. Hence, a comprehensive list of these functional variants would be of considerable interest in swine genomic studies, particularly those targeting fertility and production traits. Whole-genome sequence was obtained from 72 of the founders of an intensely phenotyped experimental swine herd at the U.S. Meat Animal Research Center (USMARC). These animals included all 24 of the founding boars (12 Duroc and 12 Landrace) and 48 Yorkshire-Landrace composite sows. Sequence reads were mapped to the Sscrofa10.2 genome build, resulting in a mean of 6.1 fold (×) coverage per genome. A total of 22 342 915 high confidence SNPs were identified from the sequenced genomes. These included 21 million previously reported SNPs and 79% of the 62 163 SNPs on the PorcineSNP60 BeadChip assay. Variation was detected in the coding sequence or untranslated regions (UTRs) of 87.8% of the genes in the porcine genome: loss-of-function variants were predicted in 504 genes, 10 202 genes contained nonsynonymous variants, 10 773 had variation in UTRs and 13 010 genes contained synonymous variants. Approximately 139 000 SNPs were classified as loss-of-function, nonsynonymous or regulatory, which suggests that over 99% of the variation detected in our pigs could potentially be ignored, allowing us to focus on a much smaller number of functional SNPs during future analyses. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

  5. Deep sequencing identifies ethnicity-specific bacterial signatures in the oral microbiome.

    Directory of Open Access Journals (Sweden)

    Matthew R Mason

    Full Text Available Oral infections have a strong ethnic predilection; suggesting that ethnicity is a critical determinant of oral microbial colonization. Dental plaque and saliva samples from 192 subjects belonging to four major ethnicities in the United States were analyzed using terminal restriction fragment length polymorphism (t-RFLP and 16S pyrosequencing. Ethnicity-specific clustering of microbial communities was apparent in saliva and subgingival biofilms, and a machine-learning classifier was capable of identifying an individual's ethnicity from subgingival microbial signatures. The classifier identified African Americans with a 100% sensitivity and 74% specificity and Caucasians with a 50% sensitivity and 91% specificity. The data demonstrates a significant association between ethnic affiliation and the composition of the oral microbiome; to the extent that these microbial signatures appear to be capable of discriminating between ethnicities.

  6. Exome sequencing identifies rare deleterious mutations in DNA repair genes FANCC and BLM as potential breast cancer susceptibility alleles.

    Directory of Open Access Journals (Sweden)

    Ella R Thompson


    Full Text Available Despite intensive efforts using linkage and candidate gene approaches, the genetic etiology for the majority of families with a multi-generational breast cancer predisposition is unknown. In this study, we used whole-exome sequencing of thirty-three individuals from 15 breast cancer families to identify potential predisposing genes. Our analysis identified families with heterozygous, deleterious mutations in the DNA repair genes FANCC and BLM, which are responsible for the autosomal recessive disorders Fanconi Anemia and Bloom syndrome. In total, screening of all exons in these genes in 438 breast cancer families identified three with truncating mutations in FANCC and two with truncating mutations in BLM. Additional screening of FANCC mutation hotspot exons identified one pathogenic mutation among an additional 957 breast cancer families. Importantly, none of the deleterious mutations were identified among 464 healthy controls and are not reported in the 1,000 Genomes data. Given the rarity of Fanconi Anemia and Bloom syndrome disorders among Caucasian populations, the finding of multiple deleterious mutations in these critical DNA repair genes among high-risk breast cancer families is intriguing and suggestive of a predisposing role. Our data demonstrate the utility of intra-family exome-sequencing approaches to uncover cancer predisposition genes, but highlight the major challenge of definitively validating candidates where the incidence of sporadic disease is high, germline mutations are not fully penetrant, and individual predisposition genes may only account for a tiny proportion of breast cancer families.

  7. High-throughput sequencing enhanced phage display identifies peptides that bind mycobacteria

    CSIR Research Space (South Africa)

    Ngubane, NAC


    Full Text Available . The displayed peptides are flanked by two cysteine residues, which are oxidized during phage assembly to a disulfide bond, resulting in a loop constrained peptide. We initially used the traditional clone picking method to identify the enriched clones... of the library, 1.236109 heptapeptides, it represented sufficient depth to measure the quantitative enrich- ment of relevant peptides. To confirm successful enrichment during selection, we characterized the reduction in diversity of the pool in the consecutive...

  8. Particular Candida albicans strains in the digestive tract of dyspeptic patients, identified by multilocus sequence typing.

    Directory of Open Access Journals (Sweden)

    Yan-Bing Gong

    Full Text Available BACKGROUND: Candida albicans is a human commensal that is also responsible for chronic gastritis and peptic ulcerous disease. Little is known about the genetic profiles of the C. albicans strains in the digestive tract of dyspeptic patients. The aim of this study was to evaluate the prevalence, diversity, and genetic profiles among C. albicans isolates recovered from natural colonization of the digestive tract in the dyspeptic patients. METHODS AND FINDINGS: Oral swab samples (n = 111 and gastric mucosa samples (n = 102 were obtained from a group of patients who presented dyspeptic symptoms or ulcer complaints. Oral swab samples (n = 162 were also obtained from healthy volunteers. C. albicans isolates were characterized and analyzed by multilocus sequence typing. The prevalence of Candida spp. in the oral samples was not significantly different between the dyspeptic group and the healthy group (36.0%, 40/111 vs. 29.6%, 48/162; P > 0.05. However, there were significant differences between the groups in the distribution of species isolated and the genotypes of the C. albicans isolates. C. albicans was isolated from 97.8% of the Candida-positive subjects in the dyspeptic group, but from only 56.3% in the healthy group (P < 0.001. DST1593 was the dominant C. albicans genotype from the digestive tract of the dyspeptic group (60%, 27/45, but not the healthy group (14.8%, 4/27 (P < 0.001. CONCLUSIONS: Our data suggest a possible link between particular C. albicans strain genotypes and the host microenvironment. Positivity for particular C. albicans genotypes could signify susceptibility to dyspepsia.

  9. Whole-exome sequencing identifies novel MPL and JAK2 mutations in triple-negative myeloproliferative neoplasms. (United States)

    Milosevic Feenstra, Jelena D; Nivarthi, Harini; Gisslinger, Heinz; Leroy, Emilie; Rumi, Elisa; Chachoua, Ilyas; Bagienski, Klaudia; Kubesova, Blanka; Pietra, Daniela; Gisslinger, Bettina; Milanesi, Chiara; Jäger, Roland; Chen, Doris; Berg, Tiina; Schalling, Martin; Schuster, Michael; Bock, Christoph; Constantinescu, Stefan N; Cazzola, Mario; Kralovics, Robert


    Essential thrombocythemia (ET) and primary myelofibrosis (PMF) are chronic diseases characterized by clonal hematopoiesis and hyperproliferation of terminally differentiated myeloid cells. The disease is driven by somatic mutations in exon 9 of CALR or exon 10 of MPL or JAK2-V617F in >90% of the cases, whereas the remaining cases are termed "triple negative." We aimed to identify the disease-causing mutations in the triple-negative cases of ET and PMF by applying whole-exome sequencing (WES) on paired tumor and control samples from 8 patients. We found evidence of clonal hematopoiesis in 5 of 8 studied cases based on clonality analysis and presence of somatic genetic aberrations. WES identified somatic mutations in 3 of 8 cases. We did not detect any novel recurrent somatic mutations. In 3 patients with clonal hematopoiesis analyzed by WES, we identified a somatic MPL-S204P, a germline MPL-V285E mutation, and a germline JAK2-G571S variant. We performed Sanger sequencing of the entire coding region of MPL in 62, and of JAK2 in 49 additional triple-negative cases of ET or PMF. New somatic (T119I, S204F, E230G, Y591D) and 1 germline (R321W) MPL mutation were detected. All of the identified MPL mutations were gain-of-function when analyzed in functional assays. JAK2 variants were identified in 5 of 57 triple-negative cases analyzed by WES and Sanger sequencing combined. We could demonstrate that JAK2-V625F and JAK2-F556V are gain-of-function mutations. Our results suggest that triple-negative cases of ET and PMF do not represent a homogenous disease entity. Cases with polyclonal hematopoiesis might represent hereditary disorders. © 2016 by The American Society of Hematology.

  10. Saprolegniaceae identified on amphibian eggs throughout the Pacific Northwest, USA, by internal transcribed spacer sequences and phylogenetic analysis. (United States)

    Petrisko, Jill E; Pearl, Christopher A; Pilliod, David S; Sheridan, Peter P; Williams, Charles F; Peterson, Charles R; Bury, R Bruce


    We assessed the diversity and phylogeny of Saprolegniaceae on amphibian eggs from the Pacific Northwest, with particular focus on Saprolegnia ferax, a species implicated in high egg mortality. We identified isolates from eggs of six amphibians with the internal transcribed spacer (ITS) and 5.8S gene regions and BLAST of the GenBank database. We identified 68 sequences as Saprolegniaceae and 43 sequences as true fungi from at least nine genera. Our phylogenetic analysis of the Saprolegniaceae included isolates within the genera Saprolegnia, Achlya and Leptolegnia. Our phylogeny grouped S. semihypogyna with Achlya rather than with the Saprolegnia reference sequences. We found only one isolate that grouped closely with S. ferax, and this came from a hatchery-raised salmon (Idaho) that we sampled opportunistically. We had representatives of 7-12 species and three genera of Saprolegniaceae on our amphibian eggs. Further work on the ecological roles of different species of Saprolegniaceae is needed to clarify their potential importance in amphibian egg mortality and potential links to population declines.

  11. Exome Sequencing Identified a Recessive RDH12 Mutation in a Family with Severe Early-Onset Retinitis Pigmentosa

    Directory of Open Access Journals (Sweden)

    Bo Gong


    Full Text Available Retinitis pigmentosa (RP is the most important hereditary retinal disease caused by progressive degeneration of the photoreceptor cells. This study is to identify gene mutations responsible for autosomal recessive retinitis pigmentosa (arRP in a Chinese family using next-generation sequencing technology. A Chinese family with 7 members including two individuals affected with severe early-onset RP was studied. All patients underwent a complete ophthalmic examination. Exome sequencing was performed on a single RP patient (the proband of this family and direct Sanger sequencing on other family members and normal controls was followed to confirm the causal mutations. A homozygous mutation c.437Tidentified as being related to the phenotype of this arRP family. This homozygous mutation was detected in the two affected patients, but not present in other family members and 600 normal controls. Another three normal members in the family were found to carry this heterozygous missense mutation. Our results emphasize the importance of c.437T

  12. Hybridization-based antibody cDNA recovery for the production of recombinant antibodies identified by repertoire sequencing. (United States)

    Valdés-Alemán, Javier; Téllez-Sosa, Juan; Ovilla-Muñoz, Marbella; Godoy-Lozano, Elizabeth; Velázquez-Ramírez, Daniel; Valdovinos-Torres, Humberto; Gómez-Barreto, Rosa E; Martinez-Barnetche, Jesús


    High-throughput sequencing of the antibody repertoire is enabling a thorough analysis of B cell diversity and clonal selection, which may improve the novel antibody discovery process. Theoretically, an adequate bioinformatic analysis could allow identification of candidate antigen-specific antibodies, requiring their recombinant production for experimental validation of their specificity. Gene synthesis is commonly used for the generation of recombinant antibodies identified in silico. Novel strategies that bypass gene synthesis could offer more accessible antibody identification and validation alternatives. We developed a hybridization-based recovery strategy that targets the complementarity-determining region 3 (CDRH3) for the enrichment of cDNA of candidate antigen-specific antibody sequences. Ten clonal groups of interest were identified through bioinformatic analysis of the heavy chain antibody repertoire of mice immunized with hen egg white lysozyme (HEL). cDNA from eight of the targeted clonal groups was recovered efficiently, leading to the generation of recombinant antibodies. One representative heavy chain sequence from each clonal group recovered was paired with previously reported anti-HEL light chains to generate full antibodies, later tested for HEL-binding capacity. The recovery process proposed represents a simple and scalable molecular strategy that could enhance antibody identification and specificity assessment, enabling a more cost-efficient generation of recombinant antibodies.

  13. Identifying genomic changes associated with insecticide resistance in the dengue mosquito Aedes aegypti by deep targeted sequencing (United States)

    Faucon, Frederic; Dusfour, Isabelle; Gaude, Thierry; Navratil, Vincent; Boyer, Frederic; Chandre, Fabrice; Sirisopa, Patcharawan; Thanispong, Kanutcharee; Juntarajumnong, Waraporn; Poupardin, Rodolphe; Chareonviriyaphap, Theeraphap; Girod, Romain; Corbel, Vincent; Reynaud, Stephane; David, Jean-Philippe


    The capacity of mosquitoes to resist insecticides threatens the control of diseases such as dengue and malaria. Until alternative control tools are implemented, characterizing resistance mechanisms is crucial for managing resistance in natural populations. Insecticide biodegradation by detoxification enzymes is a common resistance mechanism; however, the genomic changes underlying this mechanism have rarely been identified, precluding individual resistance genotyping. In particular, the role of copy number variations (CNVs) and polymorphisms of detoxification enzymes have never been investigated at the genome level, although they can represent robust markers of metabolic resistance. In this context, we combined target enrichment with high-throughput sequencing for conducting the first comprehensive screening of gene amplifications and polymorphisms associated with insecticide resistance in mosquitoes. More than 760 candidate genes were captured and deep sequenced in several populations of the dengue mosquito Ae. aegypti displaying distinct genetic backgrounds and contrasted resistance levels to the insecticide deltamethrin. CNV analysis identified 41 gene amplifications associated with resistance, most affecting cytochrome P450s overtranscribed in resistant populations. Polymorphism analysis detected more than 30,000 variants and strong selection footprints in specific genomic regions. Combining Bayesian and allele frequency filtering approaches identified 55 nonsynonymous variants strongly associated with resistance. Both CNVs and polymorphisms were conserved within regions but differed across continents, confirming that genomic changes underlying metabolic resistance to insecticides are not universal. By identifying novel DNA markers of insecticide resistance, this study opens the way for tracking down metabolic changes developed by mosquitoes to resist insecticides within and among populations. PMID:26206155

  14. Validation of rearrangement break points identified by paired-end sequencing in natural populations of Drosophila melanogaster. (United States)

    Cridland, Julie M; Thornton, Kevin R


    Several recent studies have focused on the evolution of recently duplicated genes in Drosophila. Currently, however, little is known about the evolutionary forces acting upon duplications that are segregating in natural populations. We used a high-throughput, paired-end sequencing platform (Illumina) to identify structural variants in a population sample of African D. melanogaster. Polymerase chain reaction and sequencing confirmation of duplications detected by multiple, independent paired-ends showed that paired-end sequencing reliably uncovered the break points of structural rearrangements and allowed us to identify a number of tandem duplications segregating within a natural population. Our confirmation experiments show that rates of confirmation are very high, even at modest coverage. Our results also compare well with previous studies using microarrays (Emerson J, Cardoso-Moreira M, Borevitz JO, Long M. 2008. Natural selection shapes genome wide patterns of copy-number polymorphism in Drosophila melanogaster. Science. 320:1629-1631. and Dopman EB, Hartl DL. 2007. A portrait of copy-number polymorphism in Drosophila melanogaster. Proc Natl Acad Sci U S A. 104:19920-19925.), which both gives us confidence in the results of this study as well as confirms previous microarray results.We were also able to identify whole-gene duplications, such as a novel duplication of Or22a, an olfactory receptor, and identify copy-number differences in genes previously known to be under positive selection, like Cyp6g1, which confers resistance to dichlorodiphenyltrichloroethane. Several "hot spots" of duplications were detected in this study, which indicate that particular regions of the genome may be more prone to generating duplications. Finally, population frequency analysis of confirmed events also showed an excess of rare variants in our population, which indicates that duplications segregating in the population may be deleterious and ultimately destined to be lost from the

  15. Intragenic HIV-1 env sequences that enhance gag expression

    International Nuclear Information System (INIS)

    Suptawiwat, Ornpreya; Sutthent, Ruengpung; Lee, T.-H.; Auewarakul, Prasert


    Expression of HIV-1 genes is regulated at multiple levels including the complex RNA splicing and transport mechanisms. Multiple cis-acting elements involved in these regulations have been previously identified in various regions of HIV-1 genome. Here we show that another cis-acting element was present in HIV-1 env region. This element enhanced the expression of Gag when inserted together with Rev response element (RRE) into a truncated HIV-1 genome in the presence of Rev. The enhancing activity was mapped to a 263-bp fragment in the gp41 region downstream to RRE. RNA analysis showed that it might function by promoting RNA stability and Rev-dependent RNA export. The enhancement was specific to Rev-dependent expression, since it did not enhance Gag expression driven by Sam68, a cellular protein that has been shown to be able to substitute for Rev in RNA export function

  16. Genome-wide linkage, exome sequencing and functional analyses identify ABCB6 as the pathogenic gene of dyschromatosis universalis hereditaria.

    Directory of Open Access Journals (Sweden)

    Hong Liu

    Full Text Available As a genetic disorder of abnormal pigmentation, the molecular basis of dyschromatosis universalis hereditaria (DUH had remained unclear until recently when ABCB6 was reported as a causative gene of DUH.We performed genome-wide linkage scan using Illumina Human 660W-Quad BeadChip and exome sequencing analyses using Agilent SureSelect Human All Exon Kits in a multiplex Chinese DUH family to identify the pathogenic mutations and verified the candidate mutations using Sanger sequencing. Quantitative RT-PCR and Immunohistochemistry was performed to verify the expression of the pathogenic gene, Zebrafish was also used to confirm the functional role of ABCB6 in melanocytes and pigmentation.Genome-wide linkage (assuming autosomal dominant inheritance mode and exome sequencing analyses identified ABCB6 as the disease candidate gene by discovering a coding mutation (c.1358C>T; p.Ala453Val that co-segregates with the disease phenotype. Further mutation analysis of ABCB6 in four other DUH families and two sporadic cases by Sanger sequencing confirmed the mutation (c.1358C>T; p.Ala453Val and discovered a second, co-segregating coding mutation (c.964A>C; p.Ser322Lys in one of the four families. Both mutations were heterozygous in DUH patients and not present in the 1000 Genome Project and dbSNP database as well as 1,516 unrelated Chinese healthy controls. Expression analysis in human skin and mutagenesis interrogation in zebrafish confirmed the functional role of ABCB6 in melanocytes and pigmentation. Given the involvement of ABCB6 mutations in coloboma, we performed ophthalmological examination of the DUH carriers of ABCB6 mutations and found ocular abnormalities in them.Our study has advanced our understanding of DUH pathogenesis and revealed the shared pathological mechanism between pigmentary DUH and ocular coloboma.

  17. Cytoplasmic male sterility-associated chimeric open reading frames identified by mitochondrial genome sequencing of four Cajanus genotypes. (United States)

    Tuteja, Reetu; Saxena, Rachit K; Davila, Jaime; Shah, Trushar; Chen, Wenbin; Xiao, Yong-Li; Fan, Guangyi; Saxena, K B; Alverson, Andrew J; Spillane, Charles; Town, Christopher; Varshney, Rajeev K


    The hybrid pigeonpea (Cajanus cajan) breeding technology based on cytoplasmic male sterility (CMS) is currently unique among legumes and displays major potential for yield increase. CMS is defined as a condition in which a plant is unable to produce functional pollen grains. The novel chimeric open reading frames (ORFs) produced as a results of mitochondrial genome rearrangements are considered to be the main cause of CMS. To identify these CMS-related ORFs in pigeonpea, we sequenced the mitochondrial genomes of three C. cajan lines (the male-sterile line ICPA 2039, the maintainer line ICPB 2039, and the hybrid line ICPH 2433) and of the wild relative (Cajanus cajanifolius ICPW 29). A single, circular-mapping molecule of length 545.7 kb was assembled and annotated for the ICPA 2039 line. Sequence annotation predicted 51 genes, including 34 protein-coding and 17 RNA genes. Comparison of the mitochondrial genomes from different Cajanus genotypes identified 31 ORFs, which differ between lines within which CMS is present or absent. Among these chimeric ORFs, 13 were identified by comparison of the related male-sterile and maintainer lines. These ORFs display features that are known to trigger CMS in other plant species and to represent the most promising candidates for CMS-related mitochondrial rearrangements in pigeonpea.

  18. Targeted/exome sequencing identified mutations in ten Chinese patients diagnosed with Noonan syndrome and related disorders

    Directory of Open Access Journals (Sweden)

    Shanshan Xu


    Full Text Available Abstract Background Noonan syndrome (NS and Noonan syndrome with multiple lentigines (NSML are autosomal dominant developmental disorders. NS and NSML are caused by abnormalities in genes that encode proteins related to the RAS-MAPK pathway, including PTPN11, RAF1, BRAF, and MAP2K. In this study, we diagnosed ten NS or NSML patients via targeted sequencing or whole exome sequencing (TS/WES. Methods TS/WES was performed to identify mutations in ten Chinese patients who exhibited the following manifestations: potential facial dysmorphisms, short stature, congenital heart defects, and developmental delay. Sanger sequencing was used to confirm the suspected pathological variants in the patients and their family members. Results TS/WES revealed three mutations in the PTPN11 gene, three mutations in RAF1 gene, and four mutations in BRAF gene in the NS and NSML patients who were previously diagnosed based on the abovementioned clinical features. All the identified mutations were determined to be de novo mutations. However, two patients who carried the same mutation in the RAF1 gene presented different clinical features. One patient with multiple lentigines was diagnosed with NSML, while the other patient without lentigines was diagnosed with NS. In addition, a patient who carried a hotspot mutation in the BRAF gene was diagnosed with NS instead of cardiofaciocutaneous syndrome (CFCS. Conclusions TS/WES has emerged as a useful tool for definitive diagnosis and accurate genetic counseling of atypical cases. In this study, we analyzed ten Chinese patients diagnosed with NS and related disorders and identified their correspondingPTPN11, RAF1, and BRAF mutations. Among the target genes, BRAF showed the same degree of correlation with NS incidence as that of PTPN11 or RAF1.

  19. T cell receptor sequencing of early-stage breast cancer tumors identifies altered clonal structure of the T cell repertoire. (United States)

    Beausang, John F; Wheeler, Amanda J; Chan, Natalie H; Hanft, Violet R; Dirbas, Frederick M; Jeffrey, Stefanie S; Quake, Stephen R


    Tumor-infiltrating T cells play an important role in many cancers, and can improve prognosis and yield therapeutic targets. We characterized T cells infiltrating both breast cancer tumors and the surrounding normal breast tissue to identify T cells specific to each, as well as their abundance in peripheral blood. Using immune profiling of the T cell beta-chain repertoire in 16 patients with early-stage breast cancer, we show that the clonal structure of the tumor is significantly different from adjacent breast tissue, with the tumor containing ∼2.5-fold greater density of T cells and higher clonality compared with normal breast. The clonal structure of T cells in blood and normal breast is more similar than between blood and tumor, and could be used to distinguish tumor from normal breast tissue in 14 of 16 patients. Many T cell sequences overlap between tissue and blood from the same patient, including ∼50% of T cells between tumor and normal breast. Both tumor and normal breast contain high-abundance "enriched" sequences that are absent or of low abundance in the other tissue. Many of these T cells are either not detected or detected with very low frequency in the blood, suggesting the existence of separate compartments of T cells in both tumor and normal breast. Enriched T cell sequences are typically unique to each patient, but a subset is shared between many different patients. We show that many of these are commonly generated sequences, and thus unlikely to play an important role in the tumor microenvironment. Copyright © 2017 the Author(s). Published by PNAS.

  20. Identifying Rare Variation in Cases of Schizophrenia in the Isolated Population of the Faroe Islands using Whole-genome Sequencing

    DEFF Research Database (Denmark)

    Als, Thomas Damm; Lescai, Francesco; Dahl, Hans

    to map risk variants involved in complex traits. We aim at utilizing samples of cases and controls of the isolated population of the Faroe Islands to conduct whole-genome-sequence analysis in order to identify rare genetic variants associated with schizophrenia. We will search for rare genetic variants...... of developing SZ. However, these studies are designed to examining only “the common variant” proportion of the genomic landscape of SZ. Due to increased genetic drift during founding and potential bottlenecks, followed by population expansion, isolated populations may be particularly useful in identifying rare...... disease variants, that may appear at higher frequencies and/or within a more clearly distinct haplotype structure compared to outbred populations. Small isolated populations also typically show reduced phenotypic, genetic and environmental heterogeneity, thus making them advantageous in studies aiming...

  1. Exome sequencing identifies compound heterozygous mutations in CYP4V2 in a pedigree with retinitis pigmentosa.

    Directory of Open Access Journals (Sweden)

    Yun Wang

    Full Text Available Retinitis pigmentosa (RP is a heterogeneous group of progressive retinal degenerations characterized by pigmentation and atrophy in the mid-periphery of the retina. Twenty two subjects from a four-generation Chinese family with RP and thin cornea, congenital cataract and high myopia is reported in this study. All family members underwent complete ophthalmologic examinations. Patients of the family presented with bone spicule-shaped pigment deposits in retina, retinal vascular attenuation, retinal and choroidal dystrophy, as well as punctate opacity of the lens, reduced cornea thickness and high myopia. Peripheral venous blood was obtained from all patients and their family members for genetic analysis. After mutation analysis in a few known RP candidate genes, exome sequencing was used to analyze the exomes of 3 patients III2, III4, III6 and the unaffected mother II2. A total of 34,693 variations shared by 3 patients were subjected to several filtering steps against existing variation databases. Identified variations were verified in the rest family members by PCR and Sanger sequencing. Compound heterozygous c.802-8_810del17insGC and c.1091-2A>G mutations of the CYP4V2 gene, known as genetic defects for Bietti crystalline corneoretinal dystrophy, were identified as causative mutations for RP of this family.

  2. Cross-comparison of the genome sequences from human, chimpanzee, Neanderthal and a Denisovan hominin identifies novel potentially compensated mutations

    Directory of Open Access Journals (Sweden)

    Zhang Guojie


    Full Text Available Abstract The recent publication of the draft genome sequences of the Neanderthal and a ~50,000-year-old archaic hominin from Denisova Cave in southern Siberia has ushered in a new age in molecular archaeology. We previously cross-compared the human, chimpanzee and Neanderthal genome sequences with respect to a set of disease-causing/disease-associated missense and regulatory mutations (Human Gene Mutation Database and succeeded in identifying genetic variants which, although apparently pathogenic in humans, may represent a 'compensated' wild-type state in at least one of the other two species. Here, in an attempt to identify further 'potentially compensated mutations' (PCMs of interest, we have compared our dataset of disease-causing/disease-associated mutations with their corresponding nucleotide positions in the Denisovan hominin, Neanderthal and chimpanzee genomes. Of the 15 human putatively disease-causing mutations that were found to be compensated in chimpanzee, Denisovan or Neanderthal, only a solitary F5 variant (Val1736Met was specific to the Denisovan. In humans, this missense mutation is associated with activated protein C resistance and an increased risk of thromboembolism and recurrent miscarriage. It is unclear at this juncture whether this variant was indeed a PCM in the Denisovan or whether it could instead have been associated with disease in this ancient hominin.

  3. Lariat sequencing in a unicellular yeast identifies regulated alternative splicing of exons that are evolutionarily conserved with humans. (United States)

    Awan, Ali R; Manfredo, Amanda; Pleiss, Jeffrey A


    Alternative splicing is a potent regulator of gene expression that vastly increases proteomic diversity in multicellular eukaryotes and is associated with organismal complexity. Although alternative splicing is widespread in vertebrates, little is known about the evolutionary origins of this process, in part because of the absence of phylogenetically conserved events that cross major eukaryotic clades. Here we describe a lariat-sequencing approach, which offers high sensitivity for detecting splicing events, and its application to the unicellular fungus, Schizosaccharomyces pombe, an organism that shares many of the hallmarks of alternative splicing in mammalian systems but for which no previous examples of exon-skipping had been demonstrated. Over 200 previously unannotated splicing events were identified, including examples of regulated alternative splicing. Remarkably, an evolutionary analysis of four of the exons identified here as subject to skipping in S. pombe reveals high sequence conservation and perfect length conservation with their homologs in scores of plants, animals, and fungi. Moreover, alternative splicing of two of these exons have been documented in multiple vertebrate organisms, making these the first demonstrations of identical alternative-splicing patterns in species that are separated by over 1 billion y of evolution.

  4. Targeted next generation sequencing identifies functionally deleterious germline mutations in novel genes in early-onset/familial prostate cancer.

    Directory of Open Access Journals (Sweden)

    Paula Paulo


    Full Text Available Considering that mutations in known prostate cancer (PrCa predisposition genes, including those responsible for hereditary breast/ovarian cancer and Lynch syndromes, explain less than 5% of early-onset/familial PrCa, we have sequenced 94 genes associated with cancer predisposition using next generation sequencing (NGS in a series of 121 PrCa patients. We found monoallelic truncating/functionally deleterious mutations in seven genes, including ATM and CHEK2, which have previously been associated with PrCa predisposition, and five new candidate PrCa associated genes involved in cancer predisposing recessive disorders, namely RAD51C, FANCD2, FANCI, CEP57 and RECQL4. Furthermore, using in silico pathogenicity prediction of missense variants among 18 genes associated with breast/ovarian cancer and/or Lynch syndrome, followed by KASP genotyping in 710 healthy controls, we identified "likely pathogenic" missense variants in ATM, BRIP1, CHEK2 and TP53. In conclusion, this study has identified putative PrCa predisposing germline mutations in 14.9% of early-onset/familial PrCa patients. Further data will be necessary to confirm the genetic heterogeneity of inherited PrCa predisposition hinted in this study.

  5. Somatic mutation profiles of MSI and MSS colorectal cancer identified by whole exome next generation sequencing and bioinformatics analysis.

    Directory of Open Access Journals (Sweden)

    Bernd Timmermann

    Full Text Available BACKGROUND: Colorectal cancer (CRC is with approximately 1 million cases the third most common cancer worldwide. Extensive research is ongoing to decipher the underlying genetic patterns with the hope to improve early cancer diagnosis and treatment. In this direction, the recent progress in next generation sequencing technologies has revolutionized the field of cancer genomics. However, one caveat of these studies remains the large amount of genetic variations identified and their interpretation. METHODOLOGY/PRINCIPAL FINDINGS: Here we present the first work on whole exome NGS of primary colon cancers. We performed 454 whole exome pyrosequencing of tumor as well as adjacent not affected normal colonic tissue from microsatellite stable (MSS and microsatellite instable (MSI colon cancer patients and identified more than 50,000 small nucleotide variations for each tissue. According to predictions based on MSS and MSI pathomechanisms we identified eight times more somatic non-synonymous variations in MSI cancers than in MSS and we were able to reproduce the result in four additional CRCs. Our bioinformatics filtering approach narrowed down the rate of most significant mutations to 359 for MSI and 45 for MSS CRCs with predicted altered protein functions. In both CRCs, MSI and MSS, we found somatic mutations in the intracellular kinase domain of bone morphogenetic protein receptor 1A, BMPR1A, a gene where so far germline mutations are associated with juvenile polyposis syndrome, and show that the mutations functionally impair the protein function. CONCLUSIONS/SIGNIFICANCE: We conclude that with deep sequencing of tumor exomes one may be able to predict the microsatellite status of CRC and in addition identify potentially clinically relevant mutations.

  6. De novo sequencing of circulating miRNAs identifies novel markers predicting clinical outcome of locally advanced breast cancer

    Directory of Open Access Journals (Sweden)

    Wu Xiwei


    Full Text Available Abstract Background MicroRNAs (miRNAs have been recently detected in the circulation of cancer patients, where they are associated with clinical parameters. Discovery profiling of circulating small RNAs has not been reported in breast cancer (BC, and was carried out in this study to identify blood-based small RNA markers of BC clinical outcome. Methods The pre-treatment sera of 42 stage II-III locally advanced and inflammatory BC patients who received neoadjuvant chemotherapy (NCT followed by surgical tumor resection were analyzed for marker identification by deep sequencing all circulating small RNAs. An independent validation cohort of 26 stage II-III BC patients was used to assess the power of identified miRNA markers. Results More than 800 miRNA species were detected in the circulation, and observed patterns showed association with histopathological profiles of BC. Groups of circulating miRNAs differentially associated with ER/PR/HER2 status and inflammatory BC were identified. The relative levels of selected miRNAs measured by PCR showed consistency with their abundance determined by deep sequencing. Two circulating miRNAs, miR-375 and miR-122, exhibited strong correlations with clinical outcomes, including NCT response and relapse with metastatic disease. In the validation cohort, higher levels of circulating miR-122 specifically predicted metastatic recurrence in stage II-III BC patients. Conclusions Our study indicates that certain miRNAs can serve as potential blood-based biomarkers for NCT response, and that miR-122 prevalence in the circulation predicts BC metastasis in early-stage patients. These results may allow optimized chemotherapy treatments and preventive anti-metastasis interventions in future clinical applications.

  7. Pooled Enrichment Sequencing Identifies Diversity and Evolutionary Pressures at NLR Resistance Genes within a Wild Tomato Population. (United States)

    Stam, Remco; Scheikl, Daniela; Tellier, Aurélien


    Nod-like receptors (NLRs) are nucleotide-binding domain and leucine-rich repeats containing proteins that are important in plant resistance signaling. Many of the known pathogen resistance (R) genes in plants are NLRs and they can recognize pathogen molecules directly or indirectly. As such, divergence and copy number variants at these genes are found to be high between species. Within populations, positive and balancing selection are to be expected if plants coevolve with their pathogens. In order to understand the complexity of R-gene coevolution in wild nonmodel species, it is necessary to identify the full range of NLRs and infer their evolutionary history. Here we investigate and reveal polymorphism occurring at 220 NLR genes within one population of the partially selfing wild tomato species Solanum pennellii. We use a combination of enrichment sequencing and pooling ten individuals, to specifically sequence NLR genes in a resource and cost-effective manner. We focus on the effects which different mapping and single nucleotide polymorphism calling software and settings have on calling polymorphisms in customized pooled samples. Our results are accurately verified using Sanger sequencing of polymorphic gene fragments. Our results indicate that some NLRs, namely 13 out of 220, have maintained polymorphism within our S. pennellii population. These genes show a wide range of πN/πS ratios and differing site frequency spectra. We compare our observed rate of heterozygosity with expectations for this selfing and bottlenecked population. We conclude that our method enables us to pinpoint NLR genes which have experienced natural selection in their habitat. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  8. Pooled Enrichment Sequencing Identifies Diversity and Evolutionary Pressures at NLR Resistance Genes within a Wild Tomato Population (United States)

    Stam, Remco; Scheikl, Daniela; Tellier, Aurélien


    Nod-like receptors (NLRs) are nucleotide-binding domain and leucine-rich repeats containing proteins that are important in plant resistance signaling. Many of the known pathogen resistance (R) genes in plants are NLRs and they can recognize pathogen molecules directly or indirectly. As such, divergence and copy number variants at these genes are found to be high between species. Within populations, positive and balancing selection are to be expected if plants coevolve with their pathogens. In order to understand the complexity of R-gene coevolution in wild nonmodel species, it is necessary to identify the full range of NLRs and infer their evolutionary history. Here we investigate and reveal polymorphism occurring at 220 NLR genes within one population of the partially selfing wild tomato species Solanum pennellii. We use a combination of enrichment sequencing and pooling ten individuals, to specifically sequence NLR genes in a resource and cost-effective manner. We focus on the effects which different mapping and single nucleotide polymorphism calling software and settings have on calling polymorphisms in customized pooled samples. Our results are accurately verified using Sanger sequencing of polymorphic gene fragments. Our results indicate that some NLRs, namely 13 out of 220, have maintained polymorphism within our S. pennellii population. These genes show a wide range of πN/πS ratios and differing site frequency spectra. We compare our observed rate of heterozygosity with expectations for this selfing and bottlenecked population. We conclude that our method enables us to pinpoint NLR genes which have experienced natural selection in their habitat. PMID:27189991

  9. Full genome sequencing and genetic characterization of Eubenangee viruses identify Pata virus as a distinct species within the genus Orbivirus.

    Directory of Open Access Journals (Sweden)

    Manjunatha N Belaganahalli

    Full Text Available Eubenangee virus has previously been identified as the cause of Tammar sudden death syndrome (TSDS. Eubenangee virus (EUBV, Tilligery virus (TILV, Pata virus (PATAV and Ngoupe virus (NGOV are currently all classified within the Eubenangee virus species of the genus Orbivirus, family Reoviridae. Full genome sequencing confirmed that EUBV and TILV (both of which are from Australia show high levels of aa sequence identity (>92% in the conserved polymerase VP1(Pol, sub-core VP3(T2 and outer core VP7(T13 proteins, and are therefore appropriately classified within the same virus species. However, they show much lower amino acid (aa identity levels in their larger outer-capsid protein VP2 (<53%, consistent with membership of two different serotypes - EUBV-1 and EUBV-2 (respectively. In contrast PATAV showed significantly lower levels of aa sequence identity with either EUBV or TILV (with <71% in VP1(Pol and VP3(T2, and <57% aa identity in VP7(T13 consistent with membership of a distinct virus species. A proposal has therefore been sent to the Reoviridae Study Group of ICTV to recognise 'Pata virus' as a new Orbivirus species, with the PATAV isolate as serotype 1 (PATAV-1. Amongst the other orbiviruses, PATAV shows closest relationships to Epizootic Haemorrhagic Disease virus (EHDV, with 80.7%, 72.4% and 66.9% aa identity in VP3(T2, VP1(Pol, and VP7(T13 respectively. Although Ngoupe virus was not available for these studies, like PATAV it was isolated in Central Africa, and therefore seems likely to also belong to the new species, possibly as a distinct 'type'. The data presented will facilitate diagnostic assay design and the identification of additional isolates of these viruses.

  10. The First Endogenous Herpesvirus, Identified in the Tarsier Genome, and Novel Sequences from Primate Rhadinoviruses and Lymphocryptoviruses (United States)

    Aswad, Amr; Katzourakis, Aris


    Herpesviridae is a diverse family of large and complex pathogens whose genomes are extremely difficult to sequence. This is particularly true for clinical samples, and if the virus, host, or both genomes are being sequenced for the first time. Although herpesviruses are known to occasionally integrate in host genomes, and can also be inherited in a Mendelian fashion, they are notably absent from the genomic fossil record comprised of endogenous viral elements (EVEs). Here, we combine paleovirological and metagenomic approaches to both explore the constituent viral diversity of mammalian genomes and search for endogenous herpesviruses. We describe the first endogenous herpesvirus from the genome of the Philippine tarsier, belonging to the Roseolovirus genus, and characterize its highly defective genome that is integrated and flanked by unambiguous host DNA. From a draft assembly of the aye-aye genome, we use bioinformatic tools to reveal over 100,000 bp of a novel rhadinovirus that is the first lemur gammaherpesvirus, closely related to Kaposi's sarcoma-associated virus. We also identify 58 genes of Pan paniscus lymphocryptovirus 1, the bonobo equivalent of human Epstein-Barr virus. For each of the viruses, we postulate gene function via comparative analysis to known viral relatives. Most notably, the evidence from gene content and phylogenetics suggests that the aye-aye sequences represent the most basal known rhadinovirus, and indicates that tumorigenic herpesviruses have been infecting primates since their emergence in the late Cretaceous. Overall, these data show that a genomic fossil record of herpesviruses exists despite their extremely large genomes, and expands the known diversity of Herpesviridae, which will aid the characterization of pathogenesis. Our analytical approach illustrates the benefit of intersecting evolutionary approaches with metagenomics, genetics and paleovirology. PMID:24945689

  11. Genotyping-by-sequencing in an orphan plant species Physocarpus opulifolius helps identify the evolutionary origins of the genus Prunus. (United States)

    Buti, Matteo; Sargent, Daniel J; Mhelembe, Khethani G; Delfino, Pietro; Tobutt, Kenneth R; Velasco, Riccardo


    The Rosaceae family encompasses numerous genera exhibiting morphological diversification in fruit types and plant habit as well as a wide variety of chromosome numbers. Comparative genomics between various Rosaceous genera has led to the hypothesis that the ancestral genome of the family contained nine chromosomes, however, the synteny studies performed in the Rosaceae to date encompass species with base chromosome numbers x = 7 (Fragaria), x = 8 (Prunus), and x = 17 (Malus), and no study has included species from one of the many Rosaceous genera containing a base chromosome number of x = 9. A genetic linkage map of the species Physocarpus opulifolius (x = 9) was populated with sequence characterised SNP markers using genotyping by sequencing. This allowed for the first time, the extent of the genome diversification of a Rosaceous genus with a base chromosome number of x = 9 to be performed. Orthologous loci distributed throughout the nine chromosomes of Physocarpus and the eight chromosomes of Prunus were identified which permitted a meaningful comparison of the genomes of these two genera to be made. The study revealed a high level of macro-synteny between the two genomes, and relatively few chromosomal rearrangements, as has been observed in studies of other Rosaceous genomes, lending further support for a relatively simple model of genomic evolution in Rosaceae.

  12. Flavonoid Biosynthesis Genes Putatively Identified in the Aromatic Plant Polygonum minus via Expressed Sequences Tag (EST Analysis

    Directory of Open Access Journals (Sweden)

    Zamri Zainal


    Full Text Available P. minus is an aromatic plant, the leaf of which is widely used as a food additive and in the perfume industry. The leaf also accumulates secondary metabolites that act as active ingredients such as flavonoid. Due to limited genomic and transcriptomic data, the biosynthetic pathway of flavonoids is currently unclear. Identification of candidate genes involved in the flavonoid biosynthetic pathway will significantly contribute to understanding the biosynthesis of active compounds. We have constructed a standard cDNA library from P. minus leaves, and two normalized full-length enriched cDNA libraries were constructed from stem and root organs in order to create a gene resource for the biosynthesis of secondary metabolites, especially flavonoid biosynthesis. Thus, large‑scale sequencing of P. minus cDNA libraries identified 4196 expressed sequences tags (ESTs which were deposited in dbEST in the National Center of Biotechnology Information (NCBI. From the three constructed cDNA libraries, 11 ESTs encoding seven genes were mapped to the flavonoid biosynthetic pathway. Finally, three flavonoid biosynthetic pathway-related ESTs chalcone synthase, CHS (JG745304, flavonol synthase, FLS (JG705819 and leucoanthocyanidin dioxygenase, LDOX (JG745247 were selected for further examination by quantitative RT-PCR (qRT-PCR in different P. minus organs. Expression was detected in leaf, stem and root. Gene expression studies have been initiated in order to better understand the underlying physiological processes.

  13. De Novo Transcriptome Sequencing of Olea europaea L. to Identify Genes Involved in the Development of the Pollen Tube. (United States)

    Iaria, Domenico; Chiappetta, Adriana; Muzzalupo, Innocenzo


    In olive (Olea europaea L.), the processes controlling self-incompatibility are still unclear and the molecular basis underlying this process are still not fully characterized. In order to determine compatibility relationships, using next-generation sequencing techniques and a de novo transcriptome assembly strategy, we show that pollen tubes from different olive plants, grown in vitro in a medium containing its own pistil and in combination pollen/pistil from self-sterile and self-fertile cultivars, have a distinct gene expression profile and many of the differentially expressed sequences between the samples fall within gene families involved in the development of the pollen tube, such as lipase, carboxylesterase, pectinesterase, pectin methylesterase, and callose synthase. Moreover, different genes involved in signal transduction, transcription, and growth are overrepresented. The analysis also allowed us to identify members in actin and actin depolymerization factor and fibrin gene family and member of the Ca(2+) binding gene family related to the development and polarization of pollen apical tip. The whole transcriptomic analysis, through the identification of the differentially expressed transcripts set and an extended functional annotation analysis, will lead to a better understanding of the mechanisms of pollen germination and pollen tube growth in the olive.

  14. Use of deep whole-genome sequencing data to identify structure risk variants in breast cancer susceptibility genes. (United States)

    Guo, Xingyi; Shi, Jiajun; Cai, Qiuyin; Shu, Xiao-Ou; He, Jing; Wen, Wanqing; Allen, Jamie; Pharoah, Paul; Dunning, Alison; Hunter, David J; Kraft, Peter; Easton, Douglas F; Zheng, Wei; Long, Jirong


    Functional disruptions of susceptibility genes by large genomic structure variant (SV) deletions in germlines are known to be associated with cancer risk. However, few studies have been conducted to systematically search for SV deletions in breast cancer susceptibility genes. We analysed deep (> 30x) whole-genome sequencing (WGS) data generated in blood samples from 128 breast cancer patients of Asian and European descent with either a strong family history of breast cancer or early cancer onset disease. To identify SV deletions in known or suspected breast cancer susceptibility genes, we used multiple SV calling tools including Genome STRiP, Delly, Manta, BreakDancer and Pindel. SV deletions were detected by at least three of these bioinformatics tools in five genes. Specifically, we identified heterozygous deletions covering a fraction of the coding regions of BRCA1 (with approximately 80kb in two patients), and TP53 genes (with ∼1.6 kb in two patients), and of intronic regions (∼1 kb) of the PALB2 (one patient), PTEN (three patients) and RAD51C genes (one patient). We confirmed the presence of these deletions using real-time quantitative PCR (qPCR). Our study identified novel SV deletions in breast cancer susceptibility genes and the identification of such SV deletions may improve clinical testing.

  15. Whole genome sequencing identifies circulating Beijing-lineage Mycobacterium tuberculosis strains in Guatemala and an associated urban outbreak. (United States)

    Saelens, Joseph W; Lau-Bonilla, Dalia; Moller, Anneliese; Medina, Narda; Guzmán, Brenda; Calderón, Maylena; Herrera, Raúl; Sisk, Dana M; Xet-Mull, Ana M; Stout, Jason E; Arathoon, Eduardo; Samayoa, Blanca; Tobin, David M


    Limited data are available regarding the molecular epidemiology of Mycobacterium tuberculosis (Mtb) strains circulating in Guatemala. Beijing-lineage Mtb strains have gained prevalence worldwide and are associated with increased virulence and drug resistance, but there have been only a few cases reported in Central America. Here we report the first whole genome sequencing of Central American Beijing-lineage strains of Mtb. We find that multiple Beijing-lineage strains, derived from independent founding events, are currently circulating in Guatemala, but overall still represent a relatively small proportion of disease burden. Finally, we identify a specific Beijing-lineage outbreak centered on a poor neighborhood in Guatemala City. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  16. Massively parallel signature sequencing and bioinformatics analysis identifies up-regulation of TGFBI and SOX4 in human glioblastoma.

    Directory of Open Access Journals (Sweden)

    Biaoyang Lin

    Full Text Available BACKGROUND: A comprehensive network-based understanding of molecular pathways abnormally altered in glioblastoma multiforme (GBM is essential for developing effective therapeutic approaches for this deadly disease. METHODOLOGY/PRINCIPAL FINDINGS: Applying a next generation sequencing technology, massively parallel signature sequencing (MPSS, we identified a total of 4535 genes that are differentially expressed between normal brain and GBM tissue. The expression changes of three up-regulated genes, CHI3L1, CHI3L2, and FOXM1, and two down-regulated genes, neurogranin and L1CAM, were confirmed by quantitative PCR. Pathway analysis revealed that TGF- beta pathway related genes were significantly up-regulated in GBM tumor samples. An integrative pathway analysis of the TGF beta signaling network identified two alternative TGF-beta signaling pathways mediated by SOX4 (sex determining region Y-box 4 and TGFBI (Transforming growth factor beta induced. Quantitative RT-PCR and immunohistochemistry staining demonstrated that SOX4 and TGFBI expression is elevated in GBM tissues compared with normal brain tissues at both the RNA and protein levels. In vitro functional studies confirmed that TGFBI and SOX4 expression is increased by TGF-beta stimulation and decreased by a specific inhibitor of TGF-beta receptor 1 kinase. CONCLUSIONS/SIGNIFICANCE: Our MPSS database for GBM and normal brain tissues provides a useful resource for the scientific community. The identification of non-SMAD mediated TGF-beta signaling pathways acting through SOX4 and TGFBI (GENE ID:7045 in GBM indicates that these alternative pathways should be considered, in addition to the canonical SMAD mediated pathway, in the development of new therapeutic strategies targeting TGF-beta signaling in GBM. Finally, the construction of an extended TGF-beta signaling network with overlaid gene expression changes between GBM and normal brain extends our understanding of the biology of GBM.

  17. Sequencing illustrates the transcriptional response of Legionella pneumophila during infection and identifies seventy novel small non-coding RNAs.

    LENUS (Irish Health Repository)

    Weissenmayer, Barbara A


    Second generation sequencing has prompted a number of groups to re-interrogate the transcriptomes of several bacterial and archaeal species. One of the central findings has been the identification of complex networks of small non-coding RNAs that play central roles in transcriptional regulation in all growth conditions and for the pathogen\\'s interaction with and survival within host cells. Legionella pneumophila is a gram-negative facultative intracellular human pathogen with a distinct biphasic lifestyle. One of its primary environmental hosts in the free-living amoeba Acanthamoeba castellanii and its infection by L. pneumophila mimics that seen in human macrophages. Here we present analysis of strand specific sequencing of the transcriptional response of L. pneumophila during exponential and post-exponential broth growth and during the replicative and transmissive phase of infection inside A. castellanii. We extend previous microarray based studies as well as uncovering evidence of a complex regulatory architecture underpinned by numerous non-coding RNAs. Over seventy new non-coding RNAs could be identified; many of them appear to be strain specific and in configurations not previously reported. We discover a family of non-coding RNAs preferentially expressed during infection conditions and identify a second copy of 6S RNA in L. pneumophila. We show that the newly discovered putative 6S RNA as well as a number of other non-coding RNAs show evidence for antisense transcription. The nature and extent of the non-coding RNAs and their expression patterns suggests that these may well play central roles in the regulation of Legionella spp. specific traits and offer clues as to how L. pneumophila adapts to its intracellular niche. The expression profiles outlined in the study have been deposited into Genbank\\'s Gene Expression Omnibus (GEO) database under the series accession GSE27232.

  18. Transcriptomic variation among six Arabidopsis thaliana accessions identified several novel genes controlling aluminium tolerance. (United States)

    Kusunoki, Kazutaka; Nakano, Yuki; Tanaka, Keisuke; Sakata, Yoichi; Koyama, Hiroyuki; Kobayashi, Yuriko


    Differences in the expression levels of aluminium (Al) tolerance genes are a known determinant of Al tolerance among plant varieties. We combined transcriptomic analysis of six Arabidopsis thaliana accessions with contrasting Al tolerance and a reverse genetic approach to identify Al-tolerance genes responsible for differences in Al tolerance between accession groups. Gene expression variation increased in the signal transduction process under Al stress and in growth-related processes in the absence of stress. Co-expression analysis and promoter single nucleotide polymorphism searching suggested that both trans-acting polymorphisms of Al signal transduction pathway and cis-acting polymorphisms in the promoter sequences caused the variations in gene expression associated with Al tolerance. Compared with the wild type, Al sensitivity increased in T-DNA knockout (KO) lines for five genes, including TARGET OF AVRB OPERATION1 (TAO1) and an unannotated gene (At5g22530). These were identified from 53 Al-inducible genes showing significantly higher expression in tolerant accessions than in sensitive accessions. These results indicate that the difference in transcriptional signalling is partly associated with the natural variation in Al tolerance in Arabidopsis. Our study also demonstrates the feasibility of comparative transcriptome analysis by using natural genetic variation for the identification of genes responsible for Al stress tolerance. © 2016 John Wiley & Sons Ltd.

  19. Identification, characterization, and utilization of genome-wide simple sequence repeats to identify a QTL for acidity in apple (United States)


    Background Apple is an economically important fruit crop worldwide. Developing a genetic linkage map is a critical step towards mapping and cloning of genes responsible for important horticultural traits in apple. To facilitate linkage map construction, we surveyed and characterized the distribution and frequency of perfect microsatellites in assembled contig sequences of the apple genome. Results A total of 28,538 SSRs have been identified in the apple genome, with an overall density of 40.8 SSRs per Mb. Di-nucleotide repeats are the most frequent microsatellites in the apple genome, accounting for 71.9% of all microsatellites. AT/TA repeats are the most frequent in genomic regions, accounting for 38.3% of all the G-SSRs, while AG/GA dimers prevail in transcribed sequences, and account for 59.4% of all EST-SSRs. A total set of 310 SSRs is selected to amplify eight apple genotypes. Of these, 245 (79.0%) are found to be polymorphic among cultivars and wild species tested. AG/GA motifs in genomic regions have detected more alleles and higher PIC values than AT/TA or AC/CA motifs. Moreover, AG/GA repeats are more variable than any other dimers in apple, and should be preferentially selected for studies, such as genetic diversity and linkage map construction. A total of 54 newly developed apple SSRs have been genetically mapped. Interestingly, clustering of markers with distorted segregation is observed on linkage groups 1, 2, 10, 15, and 16. A QTL responsible for malic acid content of apple fruits is detected on linkage group 8, and accounts for ~13.5% of the observed phenotypic variation. Conclusions This study demonstrates that di-nucleotide repeats are prevalent in the apple genome and that AT/TA and AG/GA repeats are the most frequent in genomic and transcribed sequences of apple, respectively. All SSR motifs identified in this study as well as those newly mapped SSRs will serve as valuable resources for pursuing apple genetic studies, aiding the apple breeding

  20. RNA sequencing of Populus x canadensis roots identifies key molecular mechanisms underlying physiological adaption to excess zinc.

    Directory of Open Access Journals (Sweden)

    Andrea Ariani

    Full Text Available Populus x canadensis clone I-214 exhibits a general indicator phenotype in response to excess Zn, and a higher metal uptake in roots than in shoots with a reduced translocation to aerial parts under hydroponic conditions. This physiological adaptation seems mainly regulated by roots, although the molecular mechanisms that underlie these processes are still poorly understood. Here, differential expression analysis using RNA-sequencing technology was used to identify the molecular mechanisms involved in the response to excess Zn in root. In order to maximize specificity of detection of differentially expressed (DE genes, we consider the intersection of genes identified by three distinct statistical approaches (61 up- and 19 down-regulated and validate them by RT-qPCR, yielding an agreement of 93% between the two experimental techniques. Gene Ontology (GO terms related to oxidation-reduction processes, transport and cellular iron ion homeostasis were enriched among DE genes, highlighting the importance of metal homeostasis in adaptation to excess Zn by P. x canadensis clone I-214. We identified the up-regulation of two Populus metal transporters (ZIP2 and NRAMP1 probably involved in metal uptake, and the down-regulation of a NAS4 gene involved in metal translocation. We identified also four Fe-homeostasis transcription factors (two bHLH38 genes, FIT and BTS that were differentially expressed, probably for reducing Zn-induced Fe-deficiency. In particular, we suggest that the down-regulation of FIT transcription factor could be a mechanism to cope with Zn-induced Fe-deficiency in Populus. These results provide insight into the molecular mechanisms involved in adaption to excess Zn in Populus spp., but could also constitute a starting point for the identification and characterization of molecular markers or biotechnological targets for possible improvement of phytoremediation performances of poplar trees.

  1. Analyses of Tissue Culture Adaptation of Human Herpesvirus-6A by Whole Genome Deep Sequencing Redefines the Reference Sequence and Identifies Virus Entry Complex Changes. (United States)

    Tweedy, Joshua G; Escriva, Eric; Topf, Maya; Gompels, Ursula A


    Tissue-culture adaptation of viruses can modulate infection. Laboratory passage and bacterial artificial chromosome (BAC)mid cloning of human cytomegalovirus, HCMV, resulted in genomic deletions and rearrangements altering genes encoding the virus entry complex, which affected cellular tropism, virulence, and vaccine development. Here, we analyse these effects on the reference genome for related betaherpesviruses, Roseolovirus, human herpesvirus 6A (HHV-6A) strain U1102. This virus is also naturally "cloned" by germline subtelomeric chromosomal-integration in approximately 1% of human populations, and accurate references are key to understanding pathological relationships between exogenous and endogenous virus. Using whole genome next-generation deep-sequencing Illumina-based methods, we compared the original isolate to tissue-culture passaged and the BACmid-cloned virus. This re-defined the reference genome showing 32 corrections and 5 polymorphisms. Furthermore, minor variant analyses of passaged and BACmid virus identified emerging populations of a further 32 single nucleotide polymorphisms (SNPs) in 10 loci, half non-synonymous indicating cell-culture selection. Analyses of the BAC-virus genome showed deletion of the BAC cassette via loxP recombination removing green fluorescent protein (GFP)-based selection. As shown for HCMV culture effects, select HHV-6A SNPs mapped to genes encoding mediators of virus cellular entry, including virus envelope glycoprotein genes gB and the gH/gL complex. Comparative models suggest stabilisation of the post-fusion conformation. These SNPs are essential to consider in vaccine-design, antimicrobial-resistance, and pathogenesis.

  2. Deep Sequencing Reveals the Complete Genome and Evidence for Transcriptional Activity of the First Virus-Like Sequences Identified in Aristotelia chilensis (Maqui Berry

    Directory of Open Access Journals (Sweden)

    Javier Villacreses


    Full Text Available Here, we report the genome sequence and evidence for transcriptional activity of a virus-like element in the native Chilean berry tree Aristotelia chilensis. We propose to name the endogenous sequence as Aristotelia chilensis Virus 1 (AcV1. High-throughput sequencing of the genome of this tree uncovered an endogenous viral element, with a size of 7122 bp, corresponding to the complete genome of AcV1. Its sequence contains three open reading frames (ORFs: ORFs 1 and 2 shares 66%–73% amino acid similarity with members of the Caulimoviridae virus family, especially the Petunia vein clearing virus (PVCV, Petuvirus genus. ORF1 encodes a movement protein (MP; ORF2 a Reverse Transcriptase (RT and a Ribonuclease H (RNase H domain; and ORF3 showed no amino acid sequence similarity with any other known virus proteins. Analogous to other known endogenous pararetrovirus sequences (EPRVs, AcV1 is integrated in the genome of Maqui Berry and showed low viral transcriptional activity, which was detected by deep sequencing technology (DNA and RNA-seq. Phylogenetic analysis of AcV1 and other pararetroviruses revealed a closer resemblance with Petuvirus. Overall, our data suggests that AcV1 could be a new member of Caulimoviridae family, genus Petuvirus, and the first evidence of this kind of virus in a fruit plant.

  3. Targeted high-throughput sequencing identifies mutations in atlastin-1 as a cause of hereditary sensory neuropathy type I. (United States)

    Guelly, Christian; Zhu, Peng-Peng; Leonardis, Lea; Papić, Lea; Zidar, Janez; Schabhüttl, Maria; Strohmaier, Heimo; Weis, Joachim; Strom, Tim M; Baets, Jonathan; Willems, Jan; De Jonghe, Peter; Reilly, Mary M; Fröhlich, Eleonore; Hatz, Martina; Trajanoski, Slave; Pieber, Thomas R; Janecke, Andreas R; Blackstone, Craig; Auer-Grumbach, Michaela


    Hereditary sensory neuropathy type I (HSN I) is an axonal form of autosomal-dominant hereditary motor and sensory neuropathy distinguished by prominent sensory loss that leads to painless injuries. Unrecognized, these can result in delayed wound healing and osteomyelitis, necessitating distal amputations. To elucidate the genetic basis of an HSN I subtype in a family in which mutations in the few known HSN I genes had been excluded, we employed massive parallel exon sequencing of the 14.3 Mb disease interval on chromosome 14q. We detected a missense mutation (c.1065C>A, p.Asn355Lys) in atlastin-1 (ATL1), a gene that is known to be mutated in early-onset hereditary spastic paraplegia SPG3A and that encodes the large dynamin-related GTPase atlastin-1. The mutant protein exhibited reduced GTPase activity and prominently disrupted ER network morphology when expressed in COS7 cells, strongly supporting pathogenicity. An expanded screen in 115 additional HSN I patients identified two further dominant ATL1 mutations (c.196G>C [p.Glu66Gln] and c.976 delG [p.Val326TrpfsX8]). This study highlights an unexpected major role for atlastin-1 in the function of sensory neurons and identifies HSN I and SPG3A as allelic disorders.

  4. Use of DNA sequences to identify forensically important fly species and their distribution in the coastal region of Central California. (United States)

    Nakano, Angie; Honda, Jeff


    Forensic entomology has gained prominence in recent years, as improvements in DNA technology and molecular methods have allowed insect and other arthropod evidence to become increasingly useful in criminal and civil investigations. However, comprehensive faunal inventories are still needed, including cataloging local DNA sequences for forensically significant Diptera. This multi-year fly-trapping study was built upon and expanded a previous survey of these flies in Santa Clara County, including the addition of genetic barcoding data from collected species of flies. Flies from the families Calliphoridae, Sarcophagidae, and Muscidae were trapped in meat-baited traps set in a variety of locations throughout the county. Flies were identified using morphological features and confirmed by molecular analysis. A total of 16 calliphorid species, 11 sarcophagid species, and four muscid species were collected and differentiated. This study found more species of flies than previous area surveys and established new county records for two calliphorid species: Cynomya cadaverina and Chrysomya rufifacies. Differences were found in fly fauna in different areas of the county, indicating the importance of microclimates in the distribution of these flies. Molecular analysis supported the use of DNA barcoding as an effective method of identifying cryptic fly species. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  5. Epidemiological study on the penicillin resistance of clinical Streptococcus pneumoniae isolates identified as the common sequence types. (United States)

    Gao, Wei; Shi, Wei; Chen, Chang-hui; Wen, De-nian; Tian, Jin; Yao, Kai-hu


    There were some limitation in the current interpretation about the penicillin resistance mechanism of clinical Streptococcus pneumoniae isolates at the strain level. To explore the possibilities of studying the mechanism based on the sequence types (ST) of this bacteria, 488 isolates collected in Beijing from 1997-2014 and 88 isolates collected in Youyang County, Chongqing and Zhongjiang County, Sichuan in 2015 were analyzed by penicillin minimum inhibitory concentration (MIC) distribution and annual distribution. The results showed that the penicillin MICs of the all isolates covering by the given ST in Beijing have a defined range, either penicillin MIC penicillin MICs in the first few years after it was identified. The penicillin MIC of isolates identified as common STs and collected in Youyang County, Chongqing and Sichuan Zhongjiang County, including the ST271, ST320 and ST81, was around 0.25~2 mg/L (≥0.25 mg/L). Our study revealed the epidemiological distribution of penicillin MICs of the given STs determined in clinical S. pneumoniae isolates, suggesting that it is reasonable to research the penicillin resistance mechanism based on the STs of this bacteria.

  6. TSSer: an automated method to identify transcription start sites in prokaryotic genomes from differential RNA sequencing data. (United States)

    Jorjani, Hadi; Zavolan, Mihaela


    Accurate identification of transcription start sites (TSSs) is an essential step in the analysis of transcription regulatory networks. In higher eukaryotes, the capped analysis of gene expression technology enabled comprehensive annotation of TSSs in genomes such as those of mice and humans. In bacteria, an equivalent approach, termed differential RNA sequencing (dRNA-seq), has recently been proposed, but the application of this approach to a large number of genomes is hindered by the paucity of computational analysis methods. With few exceptions, when the method has been used, annotation of TSSs has been largely done manually. In this work, we present a computational method called 'TSSer' that enables the automatic inference of TSSs from dRNA-seq data. The method rests on a probabilistic framework for identifying both genomic positions that are preferentially enriched in the dRNA-seq data as well as preferentially captured relative to neighboring genomic regions. Evaluating our approach for TSS calling on several publicly available datasets, we find that TSSer achieves high consistency with the curated lists of annotated TSSs, but identifies many additional TSSs. Therefore, TSSer can accelerate genome-wide identification of TSSs in bacterial genomes and can aid in further characterization of bacterial transcription regulatory networks. TSSer is freely available under GPL license at

  7. Whole-Exome Sequencing Identified a Novel Compound Heterozygous Mutation of LRRC6 in a Chinese Primary Ciliary Dyskinesia Patient

    Directory of Open Access Journals (Sweden)

    Lv Liu


    Full Text Available Primary ciliary dyskinesia (PCD is a clinical rare peculiar disorder, mainly featured by respiratory infection, tympanitis, nasosinusitis, and male infertility. Previous study demonstrated it is an autosomal recessive disease and by 2017 almost 40 pathologic genes have been identified. Among them are the leucine-rich repeat- (LRR- containing 6 (LRRC6 codes for a 463-amino-acid cytoplasmic protein, expressed distinctively in motile cilia cells, including the testis cells and the respiratory epithelial cells. In this study, we applied whole-exome sequencing combined with PCD-known genes filtering to explore the genetic lesion of a PCD patient. A novel compound heterozygous mutation in LRRC6 (c.183T>G/p.N61K; c.179-1G>A was identified and coseparated in this family. The missense mutation (c.183T>G/p.N61K may lead to a substitution of asparagine by lysine at position 61 in exon 3 of LRRC6. The splice site mutation (c.179-1G>A may cause a premature stop codon in exon 4 and decrease the mRNA levels of LRRC6. Both mutations were not present in our 200 local controls, dbSNP, and 1000 genomes. Three bioinformatics programs also predicted that both mutations are deleterious. Our study not only further supported the importance of LRRC6 in PCD, but also expanded the spectrum of LRRC6 mutations and will contribute to the genetic diagnosis and counseling of PCD patients.

  8. Whole-genome sequencing identifies EN1 as a determinant of bone density and fracture

    DEFF Research Database (Denmark)

    Zheng, Hou-Feng; Forgetta, Vincenzo; Hsu, Yi-Hsiang


    . Associations for BMD were derived from whole-genome sequencing (n = 2,882 from UK10K (ref. 10); a population-based genome sequencing consortium), whole-exome sequencing (n = 3,549), deep imputation of genotyped samples using a combined UK10K/1000 Genomes reference panel (n = 26,534), and de novo replication...

  9. De Novo Transcriptome Sequencing in Passiflora edulis Sims to Identify Genes and Signaling Pathways Involved in Cold Tolerance

    Directory of Open Access Journals (Sweden)

    Sian Liu


    Full Text Available The passion fruit (Passiflora edulis Sims, also known as the purple granadilla, is widely cultivated as the new darling of the fruit market throughout southern China. This exotic and perennial climber is adapted to warm and humid climates, and thus is generally intolerant of cold. There is limited information about gene regulation and signaling pathways related to the cold stress response in this species. In this study, two transcriptome libraries (KEDU_AP vs. GX_AP were constructed from the aerial parts of cold-tolerant and cold-susceptible varieties of P. edulis, respectively. Overall, 126,284,018 clean reads were obtained, and 86,880 unigenes with a mean size of 1449 bp were assembled. Of these, there were 64,067 (73.74% unigenes with significant similarity to publicly available plant protein sequences. Expression profiles were generated, and 3045 genes were found to be significantly differentially expressed between the KEDU_AP and GX_AP libraries, including 1075 (35.3% up-regulated and 1970 (64.7% down-regulated. These included 36 genes in enriched pathways of plant hormone signal transduction, and 56 genes encoding putative transcription factors. Six genes involved in the ICE1–CBF–COR pathway were induced in the cold-tolerant variety, and their expression levels were further verified using quantitative real-time PCR. This report is the first to identify genes and signaling pathways involved in cold tolerance using high-throughput transcriptome sequencing in P. edulis. These findings may provide useful insights into the molecular mechanisms regulating cold tolerance and genetic breeding in Passiflora spp.

  10. Identifying Faults Associated with the 2001 Avoca Induced(?) Seismicity Sequence of Western New York State Using Potential Field Wavelets. (United States)

    Horowitz, F. G.; Ebinger, C.; Jordan, T. E.


    Results from recent DOE and USGS sponsored projects in the (intraplate) northeastern portions of the US and southeastern portions of Canada have identified locations of steeply dipping structures - many previously unknown - from a Poisson wavelet multiscale edge ('worm') analysis of gravity and magnetic fields. The Avoca sequence of induced(?) seismicity in western New York state occurred during January and February of 2001. The Avoca earthquake sequence is associated with industrial hydraulic fracturing activity "related to a proposed natural gas storage facility near Avoca to be constructed by solution mining" (Kim, 2001). The main Avoca event was a felt Mb = 3.2 earthquake on Feb. 3, 2001 recorded by the Lamont Cooperative Seismic Network. Earlier, smaller events were located by the Canadian Geological Survey's seismic network north of the Canadian border - implying that the event locations might be biased because they occurred off the southern edge of the array. Some of these events were also felt locally, according to local newspaper reports. By plotting the location of the seismic events and that of the injection well - reported via it's API number - we find a strong correlation with structures detected via our potential field worms. The injection occurred near a NE-SW striking structure that was not activated. All but one of the earthquakes occurred about 5 km north of the injection well on or nearby to an E-W striking structure that appears to intersect the NE-SW structure. The final, small (MN=2.2) earthquake was located on a different complex structure about 10 km north of the other events. We suggest that potential field methods such as ours might be appropriate to locating structures of concern for induced seismic activity in association with industrial activity. Reference: Kim, W.-Y. (2001). The Lamont cooperative seismic network and the national seismic system: Earthquake hazard studies in the northeastern United States. Tech. Rep. 98-01, Lamont

  11. High-throughput sequencing of the T cell receptor β gene identifies aggressive early-stage mycosis fungoides. (United States)

    de Masson, Adele; O'Malley, John T; Elco, Christopher P; Garcia, Sarah S; Divito, Sherrie J; Lowry, Elizabeth L; Tawa, Marianne; Fisher, David C; Devlin, Phillip M; Teague, Jessica E; Leboeuf, Nicole R; Kirsch, Ilan R; Robins, Harlan; Clark, Rachael A; Kupper, Thomas S


    Mycosis fungoides (MF), the most common cutaneous T cell lymphoma (CTCL) is a malignancy of skin-tropic memory T cells. Most MF cases present as early stage (stage I A/B, limited to the skin), and these patients typically have a chronic, indolent clinical course. However, a small subset of early-stage cases develop progressive and fatal disease. Because outcomes can be so different, early identification of this high-risk population is an urgent unmet clinical need. We evaluated the use of next-generation high-throughput DNA sequencing of the T cell receptor β gene ( TCRB ) in lesional skin biopsies to predict progression and survival in a discovery cohort of 208 patients with CTCL (177 with MF) from a 15-year longitudinal observational clinical study. We compared these data to the results in an independent validation cohort of 101 CTCL patients (87 with MF). The tumor clone frequency (TCF) in lesional skin, measured by high-throughput sequencing of the TCRB gene, was an independent prognostic factor of both progression-free and overall survival in patients with CTCL and MF in particular. In early-stage patients, a TCF of >25% in the skin was a stronger predictor of progression than any other established prognostic factor (stage IB versus IA, presence of plaques, high blood lactate dehydrogenase concentration, large-cell transformation, or age). The TCF therefore may accurately predict disease progression in early-stage MF. Early identification of patients at high risk for progression could help identify candidates who may benefit from allogeneic hematopoietic stem cell transplantation before their disease becomes treatment-refractory. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  12. A RAD-Based Genetic Map for Anchoring Scaffold Sequences and Identifying QTLs in Bitter Gourd (Momordica charantia) (United States)

    Cui, Junjie; Luo, Shaobo; Niu, Yu; Huang, Rukui; Wen, Qingfang; Su, Jianwen; Miao, Nansheng; He, Weiming; Dong, Zhensheng; Cheng, Jiaowen; Hu, Kailin


    Genetic mapping is a basic tool necessary for anchoring assembled scaffold sequences and for identifying QTLs controlling important traits. Though bitter gourd (Momordica charantia) is both consumed and used as a medicinal, research on its genomics and genetic mapping is severely limited. Here, we report the construction of a restriction site associated DNA (RAD)-based genetic map for bitter gourd using an F2 mapping population comprising 423 individuals derived from two cultivated inbred lines, the gynoecious line ‘K44’ and the monoecious line ‘Dali-11.’ This map comprised 1,009 SNP markers and spanned a total genetic distance of 2,203.95 cM across the 11 linkage groups. It anchored a total of 113 assembled scaffolds that covered about 251.32 Mb (85.48%) of the 294.01 Mb assembled genome. In addition, three horticulturally important traits including sex expression, fruit epidermal structure, and immature fruit color were evaluated using a combination of qualitative and quantitative data. As a result, we identified three QTL/gene loci responsible for these traits in three environments. The QTL/gene gy/fffn/ffn, controlling sex expression involved in gynoecy, first female flower node, and female flower number was detected in the reported region. Particularly, two QTLs/genes, Fwa/Wr and w, were found to be responsible for fruit epidermal structure and white immature fruit color, respectively. This RAD-based genetic map promotes the assembly of the bitter gourd genome and the identified genetic loci will accelerate the cloning of relevant genes in the future. PMID:29706980

  13. Panel-based whole exome sequencing identifies novel mutations in microphthalmia and anophthalmia patients showing complex Mendelian inheritance patterns. (United States)

    Riera, Marina; Wert, Ana; Nieto, Isabel; Pomares, Esther


    Microphthalmia and anophthalmia (MA) are congenital eye abnormalities that show an extremely high clinical and genetic complexity. In this study, we evaluated the implementation of whole exome sequencing (WES) for the genetic analysis of MA patients. This approach was used to investigate three unrelated families in which previous single-gene analyses failed to identify the molecular cause. A total of 47 genes previously associated with nonsyndromic MA were included in our panel. WES was performed in one affected patient from each family using the AmpliSeq TM Exome technology and the Ion Proton TM platform. A novel heterozygous OTX2 missense mutation was identified in a patient showing bilateral anophthalmia who inherited the variant from a parent who was a carrier, but showed no sign of the condition. We also describe a new PAX6 missense variant in an autosomal-dominant pedigree affected by mild bilateral microphthalmia showing high intrafamiliar variability, with germline mosaicism determined to be the most plausible molecular cause of the disease. Finally, a heterozygous missense mutation in RBP4 was found to be responsible in an isolated case of bilateral complex microphthalmia. This study highlights that panel-based WES is a reliable and effective strategy for the genetic diagnosis of MA. Furthermore, using this technique, the mutational spectrum of these diseases was broadened, with novel variants identified in each of the OTX2, PAX6, and RBP4 genes. Moreover, we report new cases of reduced penetrance, mosaicism, and variable phenotypic expressivity associated with MA, further demonstrating the heterogeneity of such disorders. © 2017 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  14. A RAD-Based Genetic Map for Anchoring Scaffold Sequences and Identifying QTLs in Bitter Gourd (Momordica charantia

    Directory of Open Access Journals (Sweden)

    Junjie Cui


    Full Text Available Genetic mapping is a basic tool necessary for anchoring assembled scaffold sequences and for identifying QTLs controlling important traits. Though bitter gourd (Momordica charantia is both consumed and used as a medicinal, research on its genomics and genetic mapping is severely limited. Here, we report the construction of a restriction site associated DNA (RAD-based genetic map for bitter gourd using an F2 mapping population comprising 423 individuals derived from two cultivated inbred lines, the gynoecious line ‘K44’ and the monoecious line ‘Dali-11.’ This map comprised 1,009 SNP markers and spanned a total genetic distance of 2,203.95 cM across the 11 linkage groups. It anchored a total of 113 assembled scaffolds that covered about 251.32 Mb (85.48% of the 294.01 Mb assembled genome. In addition, three horticulturally important traits including sex expression, fruit epidermal structure, and immature fruit color were evaluated using a combination of qualitative and quantitative data. As a result, we identified three QTL/gene loci responsible for these traits in three environments. The QTL/gene gy/fffn/ffn, controlling sex expression involved in gynoecy, first female flower node, and female flower number was detected in the reported region. Particularly, two QTLs/genes, Fwa/Wr and w, were found to be responsible for fruit epidermal structure and white immature fruit color, respectively. This RAD-based genetic map promotes the assembly of the bitter gourd genome and the identified genetic loci will accelerate the cloning of relevant genes in the future.

  15. Whole-Exome Sequencing Identifies One De Novo Variant in the FGD6 Gene in a Thai Family with Autism Spectrum Disorder

    Directory of Open Access Journals (Sweden)

    Chuphong Thongnak


    Full Text Available Autism spectrum disorder (ASD has a strong genetic basis, although the genetics of autism is complex and it is unclear. Genetic testing such as microarray or sequencing was widely used to identify autism markers, but they are unsuccessful in several cases. The objective of this study is to identify causative variants of autism in two Thai families by using whole-exome sequencing technique. Whole-exome sequencing was performed with autism-affected children from two unrelated families. Each sample was sequenced on SOLiD 5500xl Genetic Analyzer system followed by combined bioinformatics pipeline including annotation and filtering process to identify candidate variants. Candidate variants were validated, and the segregation study with other family members was performed using Sanger sequencing. This study identified a possible causative variant for ASD, c.2951G>A, in the FGD6 gene. We demonstrated the potential for ASD genetic variants associated with ASD using whole-exome sequencing and a bioinformatics filtering procedure. These techniques could be useful in identifying possible causative ASD variants, especially in cases in which variants cannot be identified by other techniques.

  16. Whole exome sequencing identifies novel genes for fetal hemoglobin response to hydroxyurea in children with sickle cell anemia. (United States)

    Sheehan, Vivien A; Crosby, Jacy R; Sabo, Aniko; Mortier, Nicole A; Howard, Thad A; Muzny, Donna M; Dugan-Perez, Shannon; Aygun, Banu; Nottage, Kerri A; Boerwinkle, Eric; Gibbs, Richard A; Ware, Russell E; Flanagan, Jonathan M


    Hydroxyurea has proven efficacy in children and adults with sickle cell anemia (SCA), but with considerable inter-individual variability in the amount of fetal hemoglobin (HbF) produced. Sibling and twin studies indicate that some of that drug response variation is heritable. To test the hypothesis that genetic modifiers influence pharmacological induction of HbF, we investigated phenotype-genotype associations using whole exome sequencing of children with SCA treated prospectively with hydroxyurea to maximum tolerated dose (MTD). We analyzed 171 unrelated patients enrolled in two prospective clinical trials, all treated with dose escalation to MTD. We examined two MTD drug response phenotypes: HbF (final %HbF minus baseline %HbF), and final %HbF. Analyzing individual genetic variants, we identified multiple low frequency and common variants associated with HbF induction by hydroxyurea. A validation cohort of 130 pediatric sickle cell patients treated to MTD with hydroxyurea was genotyped for 13 non-synonymous variants with the strongest association with HbF response to hydroxyurea in the discovery cohort. A coding variant in Spalt-like transcription factor, or SALL2, was associated with higher final HbF in this second independent replication sample and SALL2 represents an outstanding novel candidate gene for further investigation. These findings may help focus future functional studies and provide new insights into the pharmacological HbF upregulation by hydroxyurea in patients with SCA.

  17. Automatically Identifying Fusion Events between GLUT4 Storage Vesicles and the Plasma Membrane in TIRF Microscopy Image Sequences

    Directory of Open Access Journals (Sweden)

    Jian Wu


    Full Text Available Quantitative analysis of the dynamic behavior about membrane-bound secretory vesicles has proven to be important in biological research. This paper proposes a novel approach to automatically identify the elusive fusion events between VAMP2-pHluorin labeled GLUT4 storage vesicles (GSVs and the plasma membrane. The differentiation is implemented to detect the initiation of fusion events by modified forward subtraction of consecutive frames in the TIRFM image sequence. Spatially connected pixels in difference images brighter than a specified adaptive threshold are grouped into a distinct fusion spot. The vesicles are located at the intensity-weighted centroid of their fusion spots. To reveal the true in vivo nature of a fusion event, 2D Gaussian fitting for the fusion spot is used to derive the intensity-weighted centroid and the spot size during the fusion process. The fusion event and its termination can be determined according to the change of spot size. The method is evaluated on real experiment data with ground truth annotated by expert cell biologists. The evaluation results show that it can achieve relatively high accuracy comparing favorably to the manual analysis, yet at a small fraction of time.

  18. A targeted sequencing panel identifies rare damaging variants in multiple genes in the cranial neural tube defect, anencephaly. (United States)

    Ishida, M; Cullup, T; Boustred, C; James, C; Docker, J; English, C; Lench, N; Copp, A J; Moore, G E; Greene, N D E; Stanier, P


    Neural tube defects (NTDs) affecting the brain (anencephaly) are lethal before or at birth, whereas lower spinal defects (spina bifida) may lead to lifelong neurological handicap. Collectively, NTDs rank among the most common birth defects worldwide. This study focuses on anencephaly, which despite having a similar frequency to spina bifida and being the most common type of NTD observed in mouse models, has had more limited inclusion in genetic studies. A genetic influence is strongly implicated in determining risk of NTDs and a molecular diagnosis is of fundamental importance to families both in terms of understanding the origin of the condition and for managing future pregnancies. Here we used a custom panel of 191 NTD candidate genes to screen 90 patients with cranial NTDs (n = 85 anencephaly and n = 5 craniorachischisis) with a targeted exome sequencing platform. After filtering and comparing to our in-house control exome database (N = 509), we identified 397 rare variants (minor allele frequency, MAF < 1%), 21 of which were previously unreported and predicted damaging. This included 1 frameshift (PDGFRA), 2 stop-gained (MAT1A; NOS2) and 18 missense variations. Together with evidence for oligogenic inheritance, this study provides new information on the possible genetic causation of anencephaly. © 2017 The Authors. Clinical Genetics published by John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Whole Genome Sequencing Identifies a Missense Mutation in HES7 Associated with Short Tails in Asian Domestic Cats. (United States)

    Xu, Xiao; Sun, Xin; Hu, Xue-Song; Zhuang, Yan; Liu, Yue-Chen; Meng, Hao; Miao, Lin; Yu, He; Luo, Shu-Jin


    Domestic cats exhibit abundant variations in tail morphology and serve as an excellent model to study the development and evolution of vertebrate tails. Cats with shortened and kinked tails were first recorded in the Malayan archipelago by Charles Darwin in 1868 and remain quite common today in Southeast and East Asia. To elucidate the genetic basis of short tails in Asian cats, we built a pedigree of 13 cats segregating at the trait with a founder from southern China and performed linkage mapping based on whole genome sequencing data from the pedigree. The short-tailed trait was mapped to a 5.6 Mb region of Chr E1, within which the substitution c. 5T > C in the somite segmentation-related gene HES7 was identified as the causal mutation resulting in a missense change (p.V2A). Validation in 245 unrelated cats confirmed the correlation between HES7-c. 5T > C and Chinese short-tailed feral cats as well as the Japanese Bobtail breed, indicating a common genetic basis of the two. In addition, some of our sampled kinked-tailed cats could not be explained by either HES7 or the Manx-related T-box, suggesting at least three independent events in the evolution of domestic cats giving rise to short-tailed traits.

  20. Mining environmental high-throughput sequence data sets to identify divergent amplicon clusters for phylogenetic reconstruction and morphotype visualization. (United States)

    Gimmler, Anna; Stoeck, Thorsten


    Environmental high-throughput sequencing (envHTS) is a very powerful tool, which in protistan ecology is predominantly used for the exploration of diversity and its geographic and local patterns. We here used a pyrosequenced V4-SSU rDNA data set from a solar saltern pond as test case to exploit such massive protistan amplicon data sets beyond this descriptive purpose. Therefore, we combined a Swarm-based blastn network including 11 579 ciliate V4 amplicons to identify divergent amplicon clusters with targeted polymerase chain reaction (PCR) primer design for full-length small subunit of the ribosomal DNA retrieval and probe design for fluorescence in situ hybridization (FISH). This powerful strategy allows to benefit from envHTS data sets to (i) reveal the phylogenetic position of the taxon behind divergent amplicons; (ii) improve phylogenetic resolution and evolutionary history of specific taxon groups; (iii) solidly assess an amplicons (species') degree of similarity to its closest described relative; (iv) visualize the morphotype behind a divergent amplicons cluster; (v) rapidly FISH screen many environmental samples for geographic/habitat distribution and abundances of the respective organism and (vi) to monitor the success of enrichment strategies in live samples for cultivation and isolation of the respective organisms. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

  1. Next Generation Sequencing Identifies Five Major Classes of Potentially Therapeutic Enzymes Secreted by Lucilia sericata Medical Maggots. (United States)

    Franta, Zdeněk; Vogel, Heiko; Lehmann, Rüdiger; Rupp, Oliver; Goesmann, Alexander; Vilcinskas, Andreas


    Lucilia sericata larvae are used as an alternative treatment for recalcitrant and chronic wounds. Their excretions/secretions contain molecules that facilitate tissue debridement, disinfect, or accelerate wound healing and have therefore been recognized as a potential source of novel therapeutic compounds. Among the substances present in excretions/secretions various peptidase activities promoting the wound healing processes have been detected but the peptidases responsible for these activities remain mostly unidentified. To explore these enzymes we applied next generation sequencing to analyze the transcriptomes of different maggot tissues (salivary glands, gut, and crop) associated with the production of excretions/secretions and/or with digestion as well as the rest of the larval body. As a result we obtained more than 123.8 million paired-end reads, which were assembled de novo using Trinity and Oases assemblers, yielding 41,421 contigs with an N50 contig length of 2.22 kb and a total length of 67.79 Mb. BLASTp analysis against the MEROPS database identified 1729 contigs in 577 clusters encoding five peptidase classes (serine, cysteine, aspartic, threonine, and metallopeptidases), which were assigned to 26 clans, 48 families, and 185 peptidase species. The individual enzymes were differentially expressed among maggot tissues and included peptidase activities related to the therapeutic effects of maggot excretions/secretions.

  2. Patterns of oligonucleotide sequences in viral and host cell RNA identify mediators of the host innate immune system.

    Directory of Open Access Journals (Sweden)

    Benjamin D Greenbaum

    Full Text Available The innate immune response provides a first line of defense against pathogens by targeting generic differential features that are present in foreign organisms but not in the host. These innate responses generate selection forces acting both in pathogens and hosts that further determine their co-evolution. Here we analyze the nucleic acid sequence fingerprints of these selection forces acting in parallel on both host innate immune genes and ssRNA viral genomes. We do this by identifying dinucleotide biases in the coding regions of innate immune response genes in plasmacytoid dendritic cells, and then use this signal to identify other significant host innate immune genes. The persistence of these biases in the orthologous groups of genes in humans and chickens is also examined. We then compare the significant motifs in highly expressed genes of the innate immune system to those in ssRNA viruses and study the evolution of these motifs in the H1N1 influenza genome. We argue that the significant under-represented motif pattern of CpG in an AU context--which is found in both the ssRNA viruses and innate genes, and has decreased throughout the history of H1N1 influenza replication in humans--is immunostimulatory and has been selected against during the co-evolution of viruses and host innate immune genes. This shows how differences in host immune biology can drive the evolution of viruses that jump into species with different immune priorities than the original host.

  3. Exome sequencing identifies mutations in ABCD1 and DACH2 in two brothers with a distinct phenotype


    Zhang, Yanliang; Liu, Yanhui; Li, Ya; Duan, Yong; Zhang, Keyun; Wang, Junwang; Dai, Yong


    Background We report on two brothers with a distinct syndromic phenotype and explore the potential pathogenic cause. Methods Cytogenetic tests and exome sequencing were performed on the two brothers and their parents. Variants detected by exome sequencing were validated by Sanger sequencing. Results The main phenotype of the two brothers included congenital language disorder, growth retardation, intellectual disability, difficulty in standing and walking, and urinary and fecal incontinence. T...

  4. Targeted sequencing identifies genetic alterations that confer primary resistance to EGFR tyrosine kinase inhibitor (Korean Lung Cancer Consortium). (United States)

    Lim, Sun Min; Kim, Hye Ryun; Cho, Eun Kyung; Min, Young Joo; Ahn, Jin Seok; Ahn, Myung-Ju; Park, Keunchil; Cho, Byoung Chul; Lee, Ji-Hyun; Jeong, Hye Cheol; Kim, Eun Kyung; Kim, Joo-Hang


    Non-small-cell lung cancer (NSCLC) patients with activating epidermal growth factor receptor (EGFR) mutations may exhibit primary resistance to EGFR tyrosine kinase inhibitor (TKI). We aimed to examine genomic alterations associated with de novo resistance to gefitinib in a prospective study of NSCLC patients. One-hundred and fifty two patients with activating EGFR mutations were included in this study and 136 patients' tumor sample were available for targeted sequencing of genomic alterations in 22 genes using the Colon and Lung Cancer panel (Ampliseq, Life Technologies). All 132 patients with EGFR mutation were treated with gefitinib for their treatment of advanced NSCLC. Twenty patients showed primary resistance to EGFR TKI, and were classified as non-responders. A total of 543 somatic single-nucleotide variants (498 missense, 13 nonsense) and 32 frameshift insertions/deletions, with a median of 3 mutations per sample. TP53 was most commonly mutated (47%) and mutations in SMAD4 was also common (19%), as well as DDR2 (16%), PIK3CA (15%), STK11 (14%), and BRAF (7%). Genomic mutations in the PI3K/Akt/mTOR pathway were commonly found in non-responders (45%) compared to responders (27%), and they had significantly shorter progression-free survival and overall survival compared to patients without mutations (2.1 vs. 12.8 months, P=0.04, 15.7 vs. not reached, PAkt/mTOR pathway were commonly identified in non-responders and may confer resistance to EGFR TKI. Screening lung adenocarcinoma patients with clinical cancer gene test may aid in selecting out those who show primary resistance to EGFR TKI (NCT01697163).

  5. PineElm_SSRdb: a microsatellite marker database identified from genomic, chloroplast, mitochondrial and EST sequences of pineapple (Ananas comosus (L.) Merrill). (United States)

    Chaudhary, Sakshi; Mishra, Bharat Kumar; Vivek, Thiruvettai; Magadum, Santoshkumar; Yasin, Jeshima Khan


    Simple Sequence Repeats or microsatellites are resourceful molecular genetic markers. There are only few reports of SSR identification and development in pineapple. Complete genome sequence of pineapple available in the public domain can be used to develop numerous novel SSRs. Therefore, an attempt was made to identify SSRs from genomic, chloroplast, mitochondrial and EST sequences of pineapple which will help in deciphering genetic makeup of its germplasm resources. A total of 359511 SSRs were identified in pineapple (356385 from genome sequence, 45 from chloroplast sequence, 249 in mitochondrial sequence and 2832 from EST sequences). The list of EST-SSR markers and their details are available in the database. PineElm_SSRdb is an open source database available for non-commercial academic purpose at with a mapping tool which can develop circular maps of selected marker set. This database will be of immense use to breeders, researchers and graduates working on Ananas spp. and to others working on cross-species transferability of markers, investigating diversity, mapping and DNA fingerprinting.

  6. Identity-by-descent filtering of exome sequence data identifies PIGV mutations in hyperphosphatasia mental retardation syndrome.

    NARCIS (Netherlands)

    Krawitz, P.M.; Schweiger, M.R.; Rodelsperger, C.; Marcelis, C.L.M.; Kolsch, U.; Meisel, C.; Stephani, F.; Kinoshita, T.; Murakami, Y.; Bauer, S.; Isau, M.; Fischer, A.; Dahl, A.; Kerick, M.; Hecht, J.; Kohler, S.; Jager, M. de; Grunhagen, J.; Condor, B.J. de; Doelken, S.; Brunner, H.G.; Meinecke, P.; Passarge, E.; Thompson, M.D.; Cole, D.E.; Horn, D.; Roscioli, T.; Mundlos, S.; Robinson, P.N.


    Hyperphosphatasia mental retardation (HPMR) syndrome is an autosomal recessive form of mental retardation with distinct facial features and elevated serum alkaline phosphatase. We performed whole-exome sequencing in three siblings of a nonconsanguineous union with HPMR and performed computational

  7. Multiple viral infections in Agaricus bisporus - Characterisation of 18 unique RNA viruses and 8 ORFans identified by deep sequencing


    Deakin, Gregory; Dobbs, Edward; Bennett, Julie M.; Jones, Ian M.; Grogan, Helen M.; Burton, Kerry S.


    Thirty unique non-host RNAs were sequenced in the cultivated fungus, Agaricus bisporus, comprising 18 viruses each encoding an RdRp domain with an additional 8 ORFans (non-host RNAs with no similarity to known sequences). Two viruses were multipartite with component RNAs showing correlative abundances and common 3′ motifs. The viruses, all positive sense single-stranded, were classified into diverse orders/families. Multiple infections of Agaricus may represent a diverse, dynamic and interact...

  8. Structural and functional analysis of mouse Msx1 gene promoter: sequence conservation with human MSX1 promoter points at potential regulatory elements. (United States)

    Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E


    Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.

  9. Deep Ion Torrent sequencing identifies soil fungal community shifts after frequent prescribed fires in a southeastern US forest ecosystem. (United States)

    Brown, Shawn P; Callaham, Mac A; Oliver, Alena K; Jumpponen, Ari


    Prescribed burning is a common management tool to control fuel loads, ground vegetation, and facilitate desirable game species. We evaluated soil fungal community responses to long-term prescribed fire treatments in a loblolly pine forest on the Piedmont of Georgia and utilized deep Internal Transcribed Spacer Region 1 (ITS1) amplicon sequencing afforded by the recent Ion Torrent Personal Genome Machine (PGM). These deep sequence data (19,000 + reads per sample after subsampling) indicate that frequent fires (3-year fire interval) shift soil fungus communities, whereas infrequent fires (6-year fire interval) permit system resetting to a state similar to that without prescribed fire. Furthermore, in nonmetric multidimensional scaling analyses, primarily ectomycorrhizal taxa were correlated with axes associated with long fire intervals, whereas soil saprobes tended to be correlated with the frequent fire recurrence. We conclude that (1) multiplexed Ion Torrent PGM analyses allow deep cost effective sequencing of fungal communities but may suffer from short read lengths and inconsistent sequence quality adjacent to the sequencing adaptor; (2) frequent prescribed fires elicit a shift in soil fungal communities; and (3) such shifts do not occur when fire intervals are longer. Our results emphasize the general responsiveness of these forests to management, and the importance of fire return intervals in meeting management objectives. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  10. TFpredict and SABINE: sequence-based prediction of structural and functional characteristics of transcription factors.

    Directory of Open Access Journals (Sweden)

    Johannes Eichner

    Full Text Available One of the key mechanisms of transcriptional control are the specific connections between transcription factors (TF and cis-regulatory elements in gene promoters. The elucidation of these specific protein-DNA interactions is crucial to gain insights into the complex regulatory mechanisms and networks underlying the adaptation of organisms to dynamically changing environmental conditions. As experimental techniques for determining TF binding sites are expensive and mostly performed for selected TFs only, accurate computational approaches are needed to analyze transcriptional regulation in eukaryotes on a genome-wide level. We implemented a four-step classification workflow which for a given protein sequence (1 discriminates TFs from other proteins, (2 determines the structural superclass of TFs, (3 identifies the DNA-binding domains of TFs and (4 predicts their cis-acting DNA motif. While existing tools were extended and adapted for performing the latter two prediction steps, the first two steps are based on a novel numeric sequence representation which allows for combining existing knowledge from a BLAST scan with robust machine learning-based classification. By evaluation on a set of experimentally confirmed TFs and non-TFs, we demonstrate that our new protein sequence representation facilitates more reliable identification and structural classification of TFs than previously proposed sequence-derived features. The algorithms underlying our proposed methodology are implemented in the two complementary tools TFpredict and SABINE. The online and stand-alone versions of TFpredict and SABINE are freely available to academics at and

  11. Complete genome sequence analysis identifies a new genotype of brassica yellows virus that infects cabbage and radish in China. (United States)

    Zhang, Xiao-Yan; Xiang, Hai-Ying; Zhou, Cui-Ji; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui


    For brassica yellows virus (BrYV), proposed to be a member of a new polerovirus species, two clearly distinct genotypes (BrYV-A and BrYV-B) have been described. In this study, the complete nucleotide sequences of two BrYV isolates from radish and Chinese cabbage were determined. Sequence analysis suggested that these isolates represent a new genotype, referred to here as BrYV-C. The full-length sequences of the two BrYV-C isolates shared 93.4-94.8 % identity with BrYV-A and BrYV-B. Further phylogenetic analysis showed that the BrYV-C isolates formed a subgroup that was distinct from the BrYV-A and BrYV-B isolates based on all of the proteins except P5.

  12. MicroRNA of the fifth-instar posterior silk gland of silkworm identified by Solexa sequencing

    Directory of Open Access Journals (Sweden)

    Jisheng Li


    Full Text Available No special studies have been focused on the microRNA (miRNA in the fifth-instar posterior silk gland of Bombyx mori. Here, using next-generation sequencing, we acquired 93.2 million processed reads from 10 small RNA libraries. In this paper, we tried to thoroughly describe how our dataset generated from deep sequencing which was recently published in BMC genomics. Results showed that our findings are largely enriched silkworm miRNA depository and may benefit us to reveal the miRNA functions in the process of silk production.

  13. High-fidelity target sequencing of individual molecules identified using barcode sequences: de novo detection and absolute quantitation of mutations in plasma cell-free DNA from cancer patients. (United States)

    Kukita, Yoji; Matoba, Ryo; Uchida, Junji; Hamakawa, Takuya; Doki, Yuichiro; Imamura, Fumio; Kato, Kikuya


    Circulating tumour DNA (ctDNA) is an emerging field of cancer research. However, current ctDNA analysis is usually restricted to one or a few mutation sites due to technical limitations. In the case of massively parallel DNA sequencers, the number of false positives caused by a high read error rate is a major problem. In addition, the final sequence reads do not represent the original DNA population due to the global amplification step during the template preparation. We established a high-fidelity target sequencing system of individual molecules identified in plasma cell-free DNA using barcode sequences; this system consists of the following two steps. (i) A novel target sequencing method that adds barcode sequences by adaptor ligation. This method uses linear amplification to eliminate the errors introduced during the early cycles of polymerase chain reaction. (ii) The monitoring and removal of erroneous barcode tags. This process involves the identification of individual molecules that have been sequenced and for which the number of mutations have been absolute quantitated. Using plasma cell-free DNA from patients with gastric or lung cancer, we demonstrated that the system achieved near complete elimination of false positives and enabled de novo detection and absolute quantitation of mutations in plasma cell-free DNA. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  14. An effective approach for annotation of protein families with low sequence similarity and conserved motifs: identifying GDSL hydrolases across the plant kingdom. (United States)

    Vujaklija, Ivan; Bielen, Ana; Paradžik, Tina; Biđin, Siniša; Goldstein, Pavle; Vujaklija, Dušica


    The massive accumulation of protein sequences arising from the rapid development of high-throughput sequencing, coupled with automatic annotation, results in high levels of incorrect annotations. In this study, we describe an approach to decrease annotation errors of protein families characterized by low overall sequence similarity. The GDSL lipolytic family comprises proteins with multifunctional properties and high potential for pharmaceutical and industrial applications. The number of proteins assigned to this family has increased rapidly over the last few years. In particular, the natural abundance of GDSL enzymes reported recently in plants indicates that they could be a good source of novel GDSL enzymes. We noticed that a significant proportion of annotated sequences lack specific GDSL motif(s) or catalytic residue(s). Here, we applied motif-based sequence analyses to identify enzymes possessing conserved GDSL motifs in selected proteomes across the plant kingdom. Motif-based HMM scanning (Viterbi decoding-VD and posterior decoding-PD) and the here described PD/VD protocol were successfully applied on 12 selected plant proteomes to identify sequences with GDSL motifs. A significant number of identified GDSL sequences were novel. Moreover, our scanning approach successfully detected protein sequences lacking at least one of the essential motifs (171/820) annotated by Pfam profile search (PfamA) as GDSL. Based on these analyses we provide a curated list of GDSL enzymes from the selected plants. CLANS clustering and phylogenetic analysis helped us to gain a better insight into the evolutionary relationship of all identified GDSL sequences. Three novel GDSL subfamilies as well as unreported variations in GDSL motifs were discovered in this study. In addition, analyses of selected proteomes showed a remarkable expansion of GDSL enzymes in the lycophyte, Selaginella moellendorffii. Finally, we provide a general motif-HMM scanner which is easily accessible through

  15. Isolation of Canine parvovirus with a view to identify the prevalent serotype on the basis of partial sequence analysis

    Directory of Open Access Journals (Sweden)

    Gurpreet Kaur


    Full Text Available Aim: The aim of this study was to isolate Canine parvovirus (CPV from suspected dogs on madin darby canine kidney (MDCK cell line and its confirmation by polymerase chain reaction (PCR and nested PCR (NPCR. Further, VP2 gene of the CPV isolates was amplified and sequenced to determine prevailing antigenic type. Materials and Methods: A total of 60 rectal swabs were collected from dogs showing signs of gastroenteritis, processed and subjected to isolation in MDCK cell line. The samples showing cytopathic effects (CPE were confirmed by PCR and NPCR. These samples were subjected to PCR for amplification of VP2 gene of CPV, sequenced and analyzed to study the prevailing antigenic types of CPV. Results: Out of the 60 samples subjected to isolation in MDCK cell line five samples showed CPE in the form of rounding of cells, clumping of cells and finally detachment of the cells. When these samples and the two commercially available vaccines were subjected to PCR for amplification of VP2 gene, a 1710 bp product was amplified. The sequence analysis revealed that the vaccines belonged to the CPV-2 type and the samples were of CPV-2b type. Conclusion: It can be concluded from the present study that out of a total of 60 samples 5 samples exhibited CPE as observed in MDCK cell line. Sequence analysis of the VP2 gene among the samples and vaccine strains revealed that samples belonged to CPV-2b type and vaccines belonging to CPV-2.

  16. Representational difference analysis of Neisseria meningitidis identifies sequences that are specific for the hyper-virulent lineage III clone

    NARCIS (Netherlands)

    Bart, A.; Dankert, J.; van der Ende, A.


    Neisseria meningitidis may cause meningitis and septicemia. Since the early 1980s, an increased incidence of meningococcal disease has been caused by the lineage III clone in many countries in Europe and in New Zealand. We hypothesized that lineage III meningococci have specific DNA sequences,

  17. Isolation of Canine parvovirus with a view to identify the prevalent serotype on the basis of partial sequence analysis. (United States)

    Kaur, Gurpreet; Chandra, Mudit; Dwivedi, P N; Sharma, N S


    The aim of this study was to isolate Canine parvovirus (CPV) from suspected dogs on madin darby canine kidney (MDCK) cell line and its confirmation by polymerase chain reaction (PCR) and nested PCR (NPCR). Further, VP2 gene of the CPV isolates was amplified and sequenced to determine prevailing antigenic type. A total of 60 rectal swabs were collected from dogs showing signs of gastroenteritis, processed and subjected to isolation in MDCK cell line. The samples showing cytopathic effects (CPE) were confirmed by PCR and NPCR. These samples were subjected to PCR for amplification of VP2 gene of CPV, sequenced and analyzed to study the prevailing antigenic types of CPV. Out of the 60 samples subjected to isolation in MDCK cell line five samples showed CPE in the form of rounding of cells, clumping of cells and finally detachment of the cells. When these samples and the two commercially available vaccines were subjected to PCR for amplification of VP2 gene, a 1710 bp product was amplified. The sequence analysis revealed that the vaccines belonged to the CPV-2 type and the samples were of CPV-2b type. It can be concluded from the present study that out of a total of 60 samples 5 samples exhibited CPE as observed in MDCK cell line. Sequence analysis of the VP2 gene among the samples and vaccine strains revealed that samples belonged to CPV-2b type and vaccines belonging to CPV-2.

  18. Criteria for confirming sequence periodicity identified by Fourier transform analysis: application to GCR2, a candidate plant GPCR? (United States)

    Illingworth, Christopher J R; Parkes, Kevin E; Snell, Christopher R; Mullineaux, Philip M; Reynolds, Christopher A


    Methods to determine periodicity in protein sequences are useful for inferring function. Fourier transformation is one approach but care is required to ensure the periodicity is genuine. Here we have shown that empirically-derived statistical tables can be used as a measure of significance. Genuine protein sequences data rather than randomly generated sequences were used as the statistical backdrop. The method has been applied to G-protein coupled receptor (GPCR) sequences, by Fourier transformation of hydrophobicity values, codon frequencies and the extent of over-representation of codon pairs; the latter being related to translational step times. Genuine periodicity was observed in the hydrophobicity whereas the apparent periodicity (as inferred from previously reported measures) in the translation step times was not validated statistically. GCR2 has recently been proposed as the plant GPCR receptor for the hormone abscisic acid. It has homology to the Lanthionine synthetase C-like family of proteins, an observation confirmed by fold recognition. Application of the Fourier transform algorithm to the GCR2 family revealed strongly predicted seven fold periodicity in hydrophobicity, suggesting why GCR2 has been reported to be a GPCR, despite negative indications in most transmembrane prediction algorithms. The underlying multiple sequence alignment, also required for the Fourier transform analysis of periodicity, indicated that the hydrophobic regions around the 7 GXXG motifs commence near the C-terminal end of each of the 7 inner helices of the alpha-toroid and continue to the N-terminal region of the helix. The results clearly explain why GCR2 has been understandably but erroneously predicted to be a GPCR.


    We are attempting to identify specific root fragments from soil cores with individual trees. We successfully used Inter Simple Sequence Repeats (ISSR) to distinguish neighboring old-growth Douglas-fir trees from one another, while maintaining identity among each tree's parts. W...

  20. Next-generation sequencing identifies a novel compound heterozygous mutation in MYO7A in a Chinese patient with Usher Syndrome 1B. (United States)

    Wei, Xiaoming; Sun, Yan; Xie, Jiansheng; Shi, Quan; Qu, Ning; Yang, Guanghui; Cai, Jun; Yang, Yi; Liang, Yu; Wang, Wei; Yi, Xin


    Targeted enrichment and next-generation sequencing (NGS) have been employed for detection of genetic diseases. The purpose of this study was to validate the accuracy and sensitivity of our method for comprehensive mutation detection of hereditary hearing loss, and identify inherited mutations involved in human deafness accurately and economically. To make genetic diagnosis of hereditary hearing loss simple and timesaving, we designed a 0.60 MB array-based chip containing 69 nuclear genes and mitochondrial genome responsible for human deafness and conducted NGS toward ten patients with five known mutations and a Chinese family with hearing loss (never genetically investigated). Ten patients with five known mutations were sequenced using next-generation sequencing to validate the sensitivity of the method. We identified four known mutations in two nuclear deafness causing genes (GJB2 and SLC26A4), one in mitochondrial DNA. We then performed this method to analyze the variants in a Chinese family with hearing loss and identified compound heterozygosity for two novel mutations in gene MYO7A. The compound heterozygosity identified in gene MYO7A causes Usher Syndrome 1B with severe phenotypes. The results support that the combination of enrichment of targeted genes and next-generation sequencing is a valuable molecular diagnostic tool for hereditary deafness and suitable for clinical application. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Older persons' worries expressed during home care visits: exploring the content of cues and concerns identified by the Verona coding definitions of emotional sequences.

    NARCIS (Netherlands)

    Hafskjold, L.; Eide, T.; Holmström, I.K.; Sundling, V.; Dulmen, S. van; Eide, H.


    Objective: Little is known about how older persons in home care express their concerns. Emotional cues and concerns can be identified by the Verona coding definitions of emotional sequences (VR-CoDES), but the method gives no insight into what causes the distress and the emotions involved. The aims

  2. Spatially conserved regulatory elements identified within human and mouse Cd247 gene using high-throughput sequencing data from the ENCODE project

    DEFF Research Database (Denmark)

    Pundhir, Sachin; Hannibal, Tine Dahlbæk; Bang-Berthelsen, Claus Heiner


    . In this study, we have utilized the wealth of high-throughput sequencing data produced during the Encyclopedia of DNA Elements (ENCODE) project to identify spatially conserved regulatory elements within the Cd247 gene from human and mouse. We show the presence of two transcription factor binding sites...

  3. Whole-Genome Sequencing of Invasion-Resistant Cells Identifies Laminin α2 as a Host Factor for Bacterial Invasion

    DEFF Research Database (Denmark)

    van Wijk, Xander M.; Döhrmann, Simon; Hallstrom, Bjorn


    cells. Whole-genome sequencing and transcriptome sequencing (RNA-Seq) uncovered a deletion in the gene encoding the laminin subunit α2 (Lama2) that eliminated much of domain L4a. Silencing of the long Lama2 isoform in wild-type cells strongly reduced bacterial invasion, whereas transfection with human...... LAMA2 cDNA significantly enhanced invasion in pgsA745 cells. The addition of exogenous laminin-α2β1γ1/laminin-α2β2γ1 strongly increased bacterial invasion in CHO cells, as well as in human alveolar basal epithelial and human brain microvascular endothelial cells. Thus, the L4a domain in laminin α2...

  4. Exome sequencing identifies mutations in ABCD1 and DACH2 in two brothers with a distinct phenotype. (United States)

    Zhang, Yanliang; Liu, Yanhui; Li, Ya; Duan, Yong; Zhang, Keyun; Wang, Junwang; Dai, Yong


    We report on two brothers with a distinct syndromic phenotype and explore the potential pathogenic cause. Cytogenetic tests and exome sequencing were performed on the two brothers and their parents. Variants detected by exome sequencing were validated by Sanger sequencing. The main phenotype of the two brothers included congenital language disorder, growth retardation, intellectual disability, difficulty in standing and walking, and urinary and fecal incontinence. To the best of our knowledge, no similar phenotype has been reported previously. No abnormalities were detected by G-banding chromosome analysis or array comparative genomic hybridization. However, exome sequencing revealed novel mutations in the ATP-binding cassette, sub-family D member 1 (ABCD1) and Dachshund homolog 2 (DACH2) genes in both brothers. The ABCD1 mutation was a missense mutation c.1126G > C in exon 3 leading to a p.E376Q substitution. The DACH2 mutation was also a missense mutation c.1069A > T in exon 6, leading to a p.S357C substitution. The mother was an asymptomatic heterozygous carrier. Plasma levels of very-long-chain fatty acids were increased in both brothers, suggesting a diagnosis of adrenoleukodystrophy (ALD); however, their phenotype was not compatible with any reported forms of ALD. DACH2 plays an important role in the regulation of brain and limb development, suggesting that this mutation may be involved in the phenotype of the two brothers. The distinct phenotype demonstrated by these two brothers might represent a new form of ALD or a new syndrome. The combination of mutations in ABCD1 and DACH2 provides a plausible mechanism for this phenotype.

  5. ATRX mutation in two adult brothers with non-specific moderate intellectual disability identified by exome sequencing


    Moncini, S.; Bedeschi, M.F.; Castronovo, P.; Crippa, M.; Calvello, M.; Garghentino, R.R.; Scuvera, G.; Finelli, P.; Venturin, M.


    In this report, we describe two adult brothers affected by moderate non-specific intellectual disability (ID). They showed minor facial anomalies, not clearly ascribable to any specific syndromic patterns, microcephaly, brachydactyly and broad toes. Both brothers presented seizures. Karyotype, subtelomeric and FMR1 analysis were normal in both cases. We performed array-CGH analysis that revealed no copy-number variations potentially associated with ID. Subsequent exome sequence analysis allow...

  6. Exome sequencing identifies pathogenic variants of VPS13B in a patient with familial 16p11.2 duplication


    Dastan, Jila; Chijiwa, Chieko; Tang, Flamingo; Martell, Sally; Qiao, Ying; Rajcan-Separovic, Evica; Lewis, M. E. Suzanne


    Background The recurrent microduplication of 16p11.2 (dup16p11.2) is associated with a broad spectrum of neurodevelopmental disorders (NDD) confounded by incomplete penetrance and variable expressivity. This inter- and intra-familial clinical variability highlights the importance of personalized genetic counselling in individuals at-risk. Case presentation In this study, we performed whole exome sequencing (WES) to look for other genomic alterations that could explain the clinical variability...

  7. ATRX mutation in two adult brothers with non-specific moderate intellectual disability identified by exome sequencing. (United States)

    Moncini, S; Bedeschi, M F; Castronovo, P; Crippa, M; Calvello, M; Garghentino, R R; Scuvera, G; Finelli, P; Venturin, M


    In this report, we describe two adult brothers affected by moderate non-specific intellectual disability (ID). They showed minor facial anomalies, not clearly ascribable to any specific syndromic patterns, microcephaly, brachydactyly and broad toes. Both brothers presented seizures. Karyotype, subtelomeric and FMR1 analysis were normal in both cases. We performed array-CGH analysis that revealed no copy-number variations potentially associated with ID. Subsequent exome sequence analysis allowed the identification of the ATRX c.109C>T (p.R37X) mutation in both the affected brothers. Sanger sequencing confirmed the presence of the mutation in the brothers and showed that the mother is a healthy carrier. Mutations in the ATRX gene cause the X-linked alpha thalassemia/mental retardation (ATR-X) syndrome (MIM #301040), a severe clinical condition usually associated with profound ID, facial dysmorphism and alpha thalassemia. However, the syndrome is clinically heterogeneous and some mutations, including the c.109C>T, are associated with a broad phenotypic spectrum, with patients displaying a less severe phenotype with only mild-moderate ID. In the case presented here, exome sequencing provided an effective strategy to achieve the molecular diagnosis of ATR-X syndrome, which otherwise would have been difficult to consider due to the mild non-specific phenotype and the absence of a family history with typical severe cases.

  8. Spectrum of benzo[a]pyrene-induced mutations in the Pig-a gene of L5178YTk+/- cells identified with next generation sequencing. (United States)

    Revollo, Javier; Wang, Yiying; McKinzie, Page; Dad, Azra; Pearce, Mason; Heflich, Robert H; Dobrovolsky, Vasily N


    We used Sanger sequencing and next generation sequencing (NGS) for analysis of mutations in the endogenous X-linked Pig-a gene of clonally expanded L5178YTk +/- cells. The clones developed from single cells that were sorted on a flow cytometer based upon the expression pattern of the GPI-anchored marker, CD90, on their surface. CD90-deficient and CD90-proficient cells were sorted from untreated cultures and CD90-deficient cells were sorted from cultures treated with benzo[a]pyrene (B[a]P). Pig-a mutations were identified in all clones developed from CD90-deficient cells; no Pig-a mutations were found in clones of CD90-proficient cells. The spectrum of B[a]P-induced Pig-a mutations was dominated by basepair substitutions, small insertions and deletions at G:C, or at sequences rich in G:C content. We observed high concordance between Pig-a mutations determined by Sanger sequencing and by NGS, but NGS was able to identify mutations in samples that were difficult to analyze by Sanger sequencing (e.g., mixtures of two mutant clones). Overall, the NGS method is a cost and labor efficient high throughput approach for analysis of a large number of mutant clones. Published by Elsevier B.V.

  9. Leaf Transcriptome Sequencing for Identifying Genic-SSR Markers and SNP Heterozygosity in Crossbred Mango Variety ‘Amrapali’ (Mangifera indica L.) (United States)

    Mahato, Ajay Kumar; Sharma, Nimisha; Singh, Akshay; Srivastav, Manish; Jaiprakash; Singh, Sanjay Kumar; Singh, Anand Kumar; Sharma, Tilak Raj; Singh, Nagendra Kumar


    Mango (Mangifera indica L.) is called “king of fruits” due to its sweetness, richness of taste, diversity, large production volume and a variety of end usage. Despite its huge economic importance genomic resources in mango are scarce and genetics of useful horticultural traits are poorly understood. Here we generated deep coverage leaf RNA sequence data for mango parental varieties ‘Neelam’, ‘Dashehari’ and their hybrid ‘Amrapali’ using next generation sequencing technologies. De-novo sequence assembly generated 27,528, 20,771 and 35,182 transcripts for the three genotypes, respectively. The transcripts were further assembled into a non-redundant set of 70,057 unigenes that were used for SSR and SNP identification and annotation. Total 5,465 SSR loci were identified in 4,912 unigenes with 288 type I SSR (n ≥ 20 bp). One hundred type I SSR markers were randomly selected of which 43 yielded PCR amplicons of expected size in the first round of validation and were designated as validated genic-SSR markers. Further, 22,306 SNPs were identified by aligning high quality sequence reads of the three mango varieties to the reference unigene set, revealing significantly enhanced SNP heterozygosity in the hybrid Amrapali. The present study on leaf RNA sequencing of mango varieties and their hybrid provides useful genomic resource for genetic improvement of mango. PMID:27736892

  10. Evaluation of sequence ambiguities of the HIV-1 pol gene as a method to identify recent HIV-1 infection in transmitted drug resistance surveys. (United States)

    Andersson, Emmi; Shao, Wei; Bontell, Irene; Cham, Fatim; Cuong, Do Duy; Wondwossen, Amogne; Morris, Lynn; Hunt, Gillian; Sönnerborg, Anders; Bertagnolio, Silvia; Maldarelli, Frank; Jordan, Michael R


    Identification of recent HIV infection within populations is a public health priority for accurate estimation of HIV incidence rates and transmitted drug resistance at population level. Determining HIV incidence rates by prospective follow-up of HIV-uninfected individuals is challenging and serological assays have important limitations. HIV diversity within an infected host increases with duration of infection. We explore a simple bioinformatics approach to assess viral diversity by determining the percentage of ambiguous base calls in sequences derived from standard genotyping of HIV-1 protease and reverse transcriptase. Sequences from 691 recently infected (≤1 year) and chronically infected (>1 year) individuals from Sweden, Vietnam and Ethiopia were analyzed for ambiguity. A significant difference (p<0.0001) in the proportion of ambiguous bases was observed between sequences from individuals with recent and chronic infection in both HIV-1 subtype B and non-B infection, consistent with previous studies. In our analysis, a cutoff of <0.47% ambiguous base calls identified recent infection with a sensitivity and specificity of 88.8% and 74.6% respectively. 1,728 protease and reverse transcriptase sequences from 36 surveys of transmitted HIV drug resistance performed following World Health Organization guidance were analyzed for ambiguity. The 0.47% ambiguity cutoff was applied and survey sequences were classified as likely derived from recently or chronically infected individuals. 71% of patients were classified as likely to have been infected within one year of genotyping but results varied considerably amongst surveys. This bioinformatics approach may provide supporting population-level information to identify recent infection but its application is limited by infection with more than one viral variant, decreasing viral diversity in advanced disease and technical aspects of population based sequencing. Standardization of sequencing techniques and base calling

  11. Screening for sequence-specific RNA-BPs by comprehensive UV crosslinking

    Directory of Open Access Journals (Sweden)

    Le Meuth-Metzinger Valerie


    Full Text Available Abstract Background Specific cis-elements and the associated trans-acting factors have been implicated in the post-transcriptional regulation of gene expression. In the era of genome wide analyses identifying novel trans-acting factors and cis-regulatory elements is a step towards understanding coordinated gene expression. UV-crosslink analysis is a standard method used to identify RNA-binding proteins. Uridine is traditionally used to radiolabel substrate RNAs, however, proteins binding to cis-elments particularly uridine poor will be weakly or not detected. We evaluate here the possibility of using UV-crosslinking with RNA substrates radiolabeled with each of the four ribonucleotides as an approach for screening for novel sequence specific RNA-binding proteins. Results The radiolabeled RNA substrates were derived from the 3'UTRs of the cloned Eg and c-mos Xenopus laevis maternal mRNAs. Specific, but not identical, uv-crosslinking signals were obtained, some of which corresponded to already identified proteins. A signal for a novel 90 kDa protein was observed with the c-mos 3'UTR radiolabeled with both CTP and GTP but not with UTP. The binding site of the 90 kDa RNA-binding protein was localised to a 59-nucleotide portion of the c-mos 3'UTR. Conclusion That the 90 kDa signal was detected with RNAs radiolabeled with CTP or GTP but not UTP illustrates the advantage of radiolabeling all four nucleotides in a UV-crosslink based screen. This method can be used for both long and short RNAs and does not require knowledge of the cis-acting sequence. It should be amenable to high throughput screening for RNA binding proteins.

  12. Analysis of Perioperative Chemotherapy in Resected Pancreatic Cancer: Identifying the Number and Sequence of Chemotherapy Cycles Needed to Optimize Survival. (United States)

    Epelboym, Irene; Zenati, Mazen S; Hamad, Ahmad; Steve, Jennifer; Lee, Kenneth K; Bahary, Nathan; Hogg, Melissa E; Zeh, Herbert J; Zureikat, Amer H


    Receipt of 6 cycles of adjuvant chemotherapy (AC) is standard of care in pancreatic cancer (PC). Neoadjuvant chemotherapy (NAC) is increasingly utilized; however, optimal number of cycles needed alone or in combination with AC remains unknown. We sought to determine the optimal number and sequence of perioperative chemotherapy cycles in PC. Single institutional review of all resected PCs from 2008 to 2015. The impact of cumulative number of chemotherapy cycles received (0, 1-5, and ≥6 cycles) and their sequence (NAC, AC, or NAC + AC) on overall survival was evaluated Cox-proportional hazard modeling, using 6 cycles of AC as reference. A total of 522 patients were analyzed. Based on sample size distribution, four combinations were evaluated: 0 cycles = 12.1%, 1-5 cycles of combined NAC + AC = 29%, 6 cycles of AC = 25%, and ≥6 cycles of combined NAC + AC = 34%, with corresponding survival. 13.1, 18.5, 37, and 36.8 months. On MVA (P cycles AC, receipt of 0 cycles [HR 3.57, confidence interval (CI) 2.47-5.18] or 1-5 cycles in any combination (HR 2.37, CI 1.73-3.23) was associated with increased hazard of death, whereas receipt of ≥6 cycles in any sequence was associated with optimal and comparable survival (HR 1.07, CI 0.78-1.47). Receipt of 6 or more perioperative cycles of chemotherapy either as combined neoadjuvant and adjuvant or adjuvant alone may be associated with optimal and comparable survival in resected PC.

  13. Identifying return-to-work trajectories using sequence analysis in a cohort of workers with work-related musculoskeletal disorders

    NARCIS (Netherlands)

    McLeod, Christopher B.; Reiff, Eline; Maas, Esther; Bultmann, Ute


    Objectives This study aimed to identify return-to-work (RTW) trajectories among workers with work-related musculoskeletal disorders (MSD) and examine the associations between different MSD and these RTW trajectories. Methods We used administrative workers' compensation data to identify accepted MSD

  14. Novel mutation of FKBP10 in a pediatric patient with osteogenesis imperfecta type XI identified by clinical exome sequencing (United States)

    Velasco, Harvy Mauricio; Morales, Jessica L


    Osteogenesis imperfecta (OI) is a hereditary disease characterized by bone fragility caused by mutations in the proteins that support the formation of the extracellular matrix in the bone. The diagnosis of OI begins with clinical suspicion, from phenotypic findings at birth, low-impact fractures during childhood or family history that may lead to it. However, the variability in the semiology of the disease does not allow establishing an early diagnosis in all cases, and unfortunately, specific clinical data provided by the literature only report 28 patients with OI type XI. This information is limited and heterogeneous, and therefore, detailed information on the natural history of this disease is not yet available. This paper reports the case of a male patient who, despite undergoing multidisciplinary management, did not have a diagnosis for a long period of time, and could only be given one with the use of whole-exome sequencing. The use of the next-generation sequencing in patients with ultrarare genetic diseases, including skeletal dysplasias, should be justified when clear clinical criteria and an improvement in the quality of life of the patients and their families are intended while reducing economic and time costs. Thus, this case report corresponds to the 29th patient affected with OI type XI, and the 18th mutation in FKBP10, causative of this pathology. PMID:29158687

  15. Sequencing of a patient with balanced chromosome abnormalities and neurodevelopmental disease identifies disruption of multiple high risk loci by structural variation.

    Directory of Open Access Journals (Sweden)

    Jonathon Blake

    Full Text Available Balanced chromosome abnormalities (BCAs occur at a high frequency in healthy and diseased individuals, but cost-efficient strategies to identify BCAs and evaluate whether they contribute to a phenotype have not yet become widespread. Here we apply genome-wide mate-pair library sequencing to characterize structural variation in a patient with unclear neurodevelopmental disease (NDD and complex de novo BCAs at the karyotype level. Nucleotide-level characterization of the clinically described BCA breakpoints revealed disruption of at least three NDD candidate genes (LINC00299, NUP205, PSMD14 that gave rise to abnormal mRNAs and could be assumed as disease-causing. However, unbiased genome-wide analysis of the sequencing data for cryptic structural variation was key to reveal an additional submicroscopic inversion that truncates the schizophrenia- and bipolar disorder-associated brain transcription factor ZNF804A as an equally likely NDD-driving gene. Deep sequencing of fluorescent-sorted wild-type and derivative chromosomes confirmed the clinically undetected BCA. Moreover, deep sequencing further validated a high accuracy of mate-pair library sequencing to detect structural variants larger than 10 kB, proposing that this approach is powerful for clinical-grade genome-wide structural variant detection. Our study supports previous evidence for a role of ZNF804A in NDD and highlights the need for a more comprehensive assessment of structural variation in karyotypically abnormal individuals and patients with neurocognitive disease to avoid diagnostic deception.

  16. Sequencing of a Patient with Balanced Chromosome Abnormalities and Neurodevelopmental Disease Identifies Disruption of Multiple High Risk Loci by Structural Variation (United States)

    Blake, Jonathon; Riddell, Andrew; Theiss, Susanne; Gonzalez, Alexis Perez; Haase, Bettina; Jauch, Anna; Janssen, Johannes W. G.; Ibberson, David; Pavlinic, Dinko; Moog, Ute; Benes, Vladimir; Runz, Heiko


    Balanced chromosome abnormalities (BCAs) occur at a high frequency in healthy and diseased individuals, but cost-efficient strategies to identify BCAs and evaluate whether they contribute to a phenotype have not yet become widespread. Here we apply genome-wide mate-pair library sequencing to characterize structural variation in a patient with unclear neurodevelopmental disease (NDD) and complex de novo BCAs at the karyotype level. Nucleotide-level characterization of the clinically described BCA breakpoints revealed disruption of at least three NDD candidate genes (LINC00299, NUP205, PSMD14) that gave rise to abnormal mRNAs and could be assumed as disease-causing. However, unbiased genome-wide analysis of the sequencing data for cryptic structural variation was key to reveal an additional submicroscopic inversion that truncates the schizophrenia- and bipolar disorder-associated brain transcription factor ZNF804A as an equally likely NDD-driving gene. Deep sequencing of fluorescent-sorted wild-type and derivative chromosomes confirmed the clinically undetected BCA. Moreover, deep sequencing further validated a high accuracy of mate-pair library sequencing to detect structural variants larger than 10 kB, proposing that this approach is powerful for clinical-grade genome-wide structural variant detection. Our study supports previous evidence for a role of ZNF804A in NDD and highlights the need for a more comprehensive assessment of structural variation in karyotypically abnormal individuals and patients with neurocognitive disease to avoid diagnostic deception. PMID:24625750

  17. Enriched whole genome sequencing identified compensatory mutations in the RNA polymerase gene of rifampicin-resistant Mycobacterium leprae strains

    Directory of Open Access Journals (Sweden)

    Lavania M


    Full Text Available Mallika Lavania,1 Itu Singh,1 Ravindra P Turankar,1 Anuj Kumar Gupta,2 Madhvi Ahuja,1 Vinay Pathak,1 Utpal Sengupta1 1Stanley Browne Laboratory, The Leprosy Mission Trust India, TLM Community Hospital Nand Nagari, 2Agilent Technologies India Pvt Ltd, Jasola District Centre, New Delhi, India Abstract: Despite more than three decades of multidrug therapy (MDT, leprosy remains a major public health issue in several endemic countries, including India. The emergence of drug resistance in Mycobacterium leprae (M. leprae is a cause of concern and poses a threat to the leprosy-control program, which might ultimately dampen the achievement of the elimination program of the country. Rifampicin resistance in clinical strains of M. leprae are supposed to arise from harboring bacterial strains with mutations in the 81-bp rifampicin resistance determining region (RRDR of the rpoB gene. However, complete dynamics of rifampicin resistance are not explained only by this mutation in leprosy strains. To understand the role of other compensatory mutations and transmission dynamics of drug-resistant leprosy, a genome-wide sequencing of 11 M. leprae strains – comprising five rifampicin-resistant strains, five sensitive strains, and one reference strain – was done in this study. We observed the presence of compensatory mutations in two rifampicin-resistant strains in rpoC and mmpL7 genes, along with rpoB, that may additionally be responsible for conferring resistance in those strains. Our findings support the role for compensatory mutation(s in RNA polymerase gene(s, resulting in rifampicin resistance in relapsed leprosy patients. Keywords: leprosy, rifampicin resistance, compensatory mutations, next generation sequencing, relapsed, MDT, India

  18. 3D MR cisternography to identify distal dural rings. Comparison of 3D-CISS and 3D-SPACE sequences

    International Nuclear Information System (INIS)

    Watanabe, Yoshiyuki; Makidono, Akari; Nakamura, Miho; Saida, Yukihisa


    The distal dural ring (DDR) is an anatomical landmark used to distinguish intra- and extradural aneurysms. We investigated identification of the DDR using 2 three-dimensional (3D) magnetic resonance (MR) cisternography sequences-3D constructive interference in steady state (CISS) and 3D sampling perfection with application optimized contrasts using different flip angle evolutions (SPACE)-at 3.0 tesla. Ten healthy adult volunteers underwent imaging with 3D-CISS, 3D-SPACE, and time-of-flight (TOF) MR angiography (TOF-MRA) sequences at 3.0T. We analyzed DDR identification and internal carotid artery (ICA) signal intensity and classified the shape of the carotid cave. We identified the DDR using both 3D-SPACE and 3D-CISS, with no significant difference between the sequences. Visualization of the outline of the ICA in the cavernous sinus (CS) was significantly clearer with 3D-SPACE than 3D-CISS. In the CS and petrous portions, signal intensity was lower with 3D-SPACE, and the flow void was poor with 3D-CISS in some subjects. We identified the DDR with both 3D-SPACE and 3D-CISS, but the superior contrast of the ICA in the CS using 3D-SPACE suggests the superiority of this sequence for evaluating the DDR. (author)

  19. Whole-Exome Sequencing Identifies ALMS1, IQCB1, CNGA3, and MYO7A Mutations in Patients with Leber Congenital Amaurosis


    Wang, Xia; Wang, Hui; Cao, Ming; Li, Zhe; Chen, Xianfeng; Patenia, Claire; Gore, Athurva; Abboud, Emad B.; Al-Rajhi, Ali A.; Lewis, Richard A.; Lupski, James R.; Mardon, Graeme; Zhang, Kun; Muzny, Donna; Gibbs, Richard A.


    It has been well documented that mutations in the same retinal disease gene can result in different clinical phenotypes due to difference in the mutant allele and/or genetic background. To evaluate this, a set of consanguineous patient families with Leber congenital amaurosis (LCA) that do not carry mutations in known LCA disease genes was characterized through homozygosity mapping followed by targeted exon/whole-exome sequencing to identify genetic variations. Among these families, a total o...

  20. Impetigo-like tinea faciei around the nostrils caused by Arthroderma vanbreuseghemii identified using polymerase chain reaction-based sequencing of crusts. (United States)

    Kang, Daoxian; Ran, Yuping; Li, Conghui; Dai, Yaling; Lama, Jebina


    We report a case of Arthroderma vanbreuseghemii (a teleomorph of Trichophyton interdigitale) infection around the nostrils in a 3-year-old girl. The culture was negative, so the pathogenic agent was identified using polymerase chain reaction-based sequencing of the crusts taken from the lesion on the nostril. Treatment with oral itraconazole and topical 1% naftifine/0.25% ketoconazole cream after a topical wash with ketoconazole shampoo was effective. © 2012 Wiley Periodicals, Inc.

  1. Saprolegniaceae identified on amphibian eggs throughout the Pacific Northwest, USA, by internal transcribed spacer sequences and phylogenetic analysis (United States)

    Jill E. Petrisko; Christopher A. Pearl; David S. Pilliod; Peter P. Sheridan; Charles F. Williams; Charles R. Peterson; R. Bruce Bury


    We assessed the diversity and phylogeny of Saprolegniaceae on amphibian eggs from the Pacific Northwest, with particular focus on Saprolegnia ferax, a species implicated in high egg mortality. We identified isolates from eggs of six amphibians with the internal transcribed spacer (ITS) and 5.8S gene regions and BLAST of the GenBank database. We...

  2. Somatosensory neuron types identified by high-coverage single-cell RNA-sequencing and functional heterogeneity (United States)

    Li, Chang-Lin; Li, Kai-Cheng; Wu, Dan; Chen, Yan; Luo, Hao; Zhao, Jing-Rong; Wang, Sa-Shuang; Sun, Ming-Ming; Lu, Ying-Jin; Zhong, Yan-Qing; Hu, Xu-Ye; Hou, Rui; Zhou, Bei-Bei; Bao, Lan; Xiao, Hua-Sheng; Zhang, Xu


    Sensory neurons are distinguished by distinct signaling networks and receptive characteristics. Thus, sensory neuron types can be defined by linking transcriptome-based neuron typing with the sensory phenotypes. Here we classify somatosensory neurons of the mouse dorsal root ganglion (DRG) by high-coverage single-cell RNA-sequencing (10 950 ± 1 218 genes per neuron) and neuron size-based hierarchical clustering. Moreover, single DRG neurons responding to cutaneous stimuli are recorded using an in vivo whole-cell patch clamp technique and classified by neuron-type genetic markers. Small diameter DRG neurons are classified into one type of low-threshold mechanoreceptor and five types of mechanoheat nociceptors (MHNs). Each of the MHN types is further categorized into two subtypes. Large DRG neurons are categorized into four types, including neurexophilin 1-expressing MHNs and mechanical nociceptors (MNs) expressing BAI1-associated protein 2-like 1 (Baiap2l1). Mechanoreceptors expressing trafficking protein particle complex 3-like and Baiap2l1-marked MNs are subdivided into two subtypes each. These results provide a new system for cataloging somatosensory neurons and their transcriptome databases. PMID:26691752

  3. Enriched whole genome sequencing identified compensatory mutations in the RNA polymerase gene of rifampicin-resistant Mycobacterium leprae strains. (United States)

    Lavania, Mallika; Singh, Itu; Turankar, Ravindra P; Gupta, Anuj Kumar; Ahuja, Madhvi; Pathak, Vinay; Sengupta, Utpal


    Despite more than three decades of multidrug therapy (MDT), leprosy remains a major public health issue in several endemic countries, including India. The emergence of drug resistance in Mycobacterium leprae (M. leprae) is a cause of concern and poses a threat to the leprosy-control program, which might ultimately dampen the achievement of the elimination program of the country. Rifampicin resistance in clinical strains of M. leprae are supposed to arise from harboring bacterial strains with mutations in the 81-bp rifampicin resistance determining region (RRDR) of the rpoB gene. However, complete dynamics of rifampicin resistance are not explained only by this mutation in leprosy strains. To understand the role of other compensatory mutations and transmission dynamics of drug-resistant leprosy, a genome-wide sequencing of 11 M. leprae strains - comprising five rifampicin-resistant strains, five sensitive strains, and one reference strain - was done in this study. We observed the presence of compensatory mutations in two rifampicin-resistant strains in rpoC and mmpL7 genes, along with rpoB , that may additionally be responsible for conferring resistance in those strains. Our findings support the role for compensatory mutation(s) in RNA polymerase gene(s), resulting in rifampicin resistance in relapsed leprosy patients.

  4. Novel compound heterozygous mutations in the GPR98 (USH2C) gene identified by whole exome sequencing in a Moroccan deaf family. (United States)

    Bousfiha, Amale; Bakhchane, Amina; Charoute, Hicham; Detsouli, Mustapha; Rouba, Hassan; Charif, Majida; Lenaers, Guy; Barakat, Abdelhamid


    In the present work, we identified two novel compound heterozygote mutations in the GPR98 (G protein-coupled receptor 98) gene causing Usher syndrome. Whole-exome sequencing was performed to study the genetic causes of Usher syndrome in a Moroccan family with three affected siblings. We identify two novel compound heterozygote mutations (c.1054C > A, c.16544delT) in the GPR98 gene in the three affected siblings carrying post-linguale bilateral moderate hearing loss with normal vestibular functions and before installing visual disturbances. This is the first time that mutations in the GPR98 gene are described in the Moroccan deaf patients.

  5. Laser capture microdissection followed by next-generation sequencing identifies disease-related microRNAs in psoriatic skin that reflect systemic microRNA changes in psoriasis

    DEFF Research Database (Denmark)

    Løvendorf, Marianne B; Mitsui, Hiroshi; Zibert, John R


    Psoriasis is a systemic disease with cutaneous manifestations. MicroRNAs (miRNAs) are small non-coding RNA molecules that are differentially expressed in psoriatic skin; however, only few cell- and region-specific miRNAs have been identified in psoriatic lesions. We used laser capture...... microdissection (LCM) and next-generation sequencing (NGS) to study the specific miRNA expression profiles in the epidermis (Epi) and dermal inflammatory infiltrates (RD) of psoriatic skin (N = 6). We identified 24 deregulated miRNAs in the Epi and 37 deregulated miRNAs in the RD of psoriatic plaque compared...... with normal psoriatic skin (FCH > 2, FDR

  6. snpTree - a web-server to identify and construct SNP trees from whole genome sequence data

    DEFF Research Database (Denmark)

    Leekitcharoenphon, Pimlapas; Kaas, Rolf Sommer; Thomsen, Martin Christen Frølund


    identify SNPs and construct phylogenetic trees from WGS as well as from assembled genomes or contigs. WGS data in fastq format are aligned to reference genomes by BWA while contigs in fasta format are processed by Nucmer. SNPs are concatenated based on position on reference genome and a tree is constructed...... to differentiate and classify isolates. One of the successfully and broadly used methods is analysis of single nucletide polymorphisms (SNPs). Currently, there are different tools and methods to identify SNPs including various options and cut-off values. Furthermore, all current methods require bioinformatic...... skills. Thus, we lack a standard and simple automatic tool to determine SNPs and construct phylogenetic tree from WGS data. Results Here we introduce snpTree, a server for online-automatic SNPs analysis. This tool is composed of different SNPs analysis suites, perl and python scripts. snpTree can...

  7. Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response

    Directory of Open Access Journals (Sweden)

    Chong Kang


    Full Text Available Abstract Background MicroRNAs (miRNAs are endogenous small RNAs having large-scale regulatory effects on plant development and stress responses. Extensive studies of miRNAs have only been performed in a few model plants. Although miRNAs are proved to be involved in plant cold stress responses, little is known for winter-habit monocots. Brachypodium distachyon, with close evolutionary relationship to cool-season cereals, has recently emerged as a novel model plant. There are few reports of Brachypodium miRNAs. Results High-throughput sequencing and whole-genome-wide data mining led to the identification of 27 conserved miRNAs, as well as 129 predicted miRNAs in Brachypodium. For multiple-member conserved miRNA families, their sizes in Brachypodium were much smaller than those in rice and Populus. The genome organization of miR395 family in Brachypodium was quite different from that in rice. The expression of 3 conserved miRNAs and 25 predicted miRNAs showed significant changes in response to cold stress. Among these miRNAs, some were cold-induced and some were cold-suppressed, but all the conserved miRNAs were up-regulated under cold stress condition. Conclusion Our results suggest that Brachypodium miRNAs are composed of a set of conserved miRNAs and a large proportion of non-conserved miRNAs with low expression levels. Both kinds of miRNAs were involved in cold stress response, but all the conserved miRNAs were up-regulated, implying an important role for cold-induced miRNAs. The different size and genome organization of miRNA families in Brachypodium and rice suggest that the frequency of duplication events or the selection pressure on duplicated miRNAs are different between these two closely related plant species.

  8. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling.

    Directory of Open Access Journals (Sweden)

    Luís França

    Full Text Available Over a period of ten months a total of 5618 cord blood units (CBU were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes.

  9. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling. (United States)

    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S


    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes.

  10. Sequencing of sporadic Attention-Deficit Hyperactivity Disorder (ADHD) identifies novel and potentially pathogenic de novo variants and excludes overlap with genes associated with autism spectrum disorder. (United States)

    Kim, Daniel Seung; Burt, Amber A; Ranchalis, Jane E; Wilmot, Beth; Smith, Joshua D; Patterson, Karynne E; Coe, Bradley P; Li, Yatong K; Bamshad, Michael J; Nikolas, Molly; Eichler, Evan E; Swanson, James M; Nigg, Joel T; Nickerson, Deborah A; Jarvik, Gail P


    Attention-Deficit Hyperactivity Disorder (ADHD) has high heritability; however, studies of common variation account for ADHD variance. Using data from affected participants without a family history of ADHD, we sought to identify de novo variants that could account for sporadic ADHD. Considering a total of 128 families, two analyses were conducted in parallel: first, in 11 unaffected parent/affected proband trios (or quads with the addition of an unaffected sibling) we completed exome sequencing. Six de novo missense variants at highly conserved bases were identified and validated from four of the 11 families: the brain-expressed genes TBC1D9, DAGLA, QARS, CSMD2, TRPM2, and WDR83. Separately, in 117 unrelated probands with sporadic ADHD, we sequenced a panel of 26 genes implicated in intellectual disability (ID) and autism spectrum disorder (ASD) to evaluate whether variation in ASD/ID-associated genes were also present in participants with ADHD. Only one putative deleterious variant (Gln600STOP) in CHD1L was identified; this was found in a single proband. Notably, no other nonsense, splice, frameshift, or highly conserved missense variants in the 26 gene panel were identified and validated. These data suggest that de novo variant analysis in families with independently adjudicated sporadic ADHD diagnosis can identify novel genes implicated in ADHD pathogenesis. Moreover, that only one of the 128 cases (0.8%, 11 exome, and 117 MIP sequenced participants) had putative deleterious variants within our data in 26 genes related to ID and ASD suggests significant independence in the genetic pathogenesis of ADHD as compared to ASD and ID phenotypes. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  11. Genome-Wide Association Study Identifies Loci for Salt Tolerance during Germination in Autotetraploid Alfalfa (Medicago sativa L.) Using Genotyping-by-Sequencing (United States)

    Yu, Long-Xi; Liu, Xinchun; Boge, William; Liu, Xiang-Ping


    Salinity is one of major abiotic stresses limiting alfalfa (Medicago sativa L.) production in the arid and semi-arid regions in US and other counties. In this study, we used a diverse panel of alfalfa accessions previously described by Zhang et al. (2015) to identify molecular markers associated with salt tolerance during germination using genome-wide association study (GWAS) and genotyping-by-sequencing (GBS). Phenotyping was done by germinating alfalfa seeds under different levels of salt stress. Phenotypic data of adjusted germination rates and SNP markers generated by GBS were used for marker-trait association. Thirty six markers were significantly associated with salt tolerance in at least one level of salt treatments. Alignment of sequence tags to the Medicago truncatula genome revealed genetic locations of the markers on all chromosomes except chromosome 3. Most significant markers were found on chromosomes 1, 2, and 4. BLAST search using the flanking sequences of significant markers identified 14 putative candidate genes linked to 23 significant markers. Most of them were repeatedly identified in two or three salt treatments. Several loci identified in the present study had similar genetic locations to the reported QTL associated with salt tolerance in M. truncatula. A locus identified on chromosome 6 by this study overlapped with that by drought in our previous study. To our knowledge, this is the first report on mapping loci associated with salt tolerance during germination in autotetraploid alfalfa. Further investigation on these loci and their linked genes would provide insight into understanding molecular mechanisms by which salt and drought stresses affect alfalfa growth. Functional markers closely linked to the resistance loci would be useful for MAS to improve alfalfa cultivars with enhanced resistance to drought and salt stresses. PMID:27446182

  12. Novel mutations in CRB1 gene identified in a chinese pedigree with retinitis pigmentosa by targeted capture and next generation sequencing (United States)

    Lo, David; Weng, Jingning; Liu, xiaohong; Yang, Juhua; He, Fen; Wang, Yun; Liu, Xuyang


    PURPOSE To detect the disease-causing gene in a Chinese pedigree with autosomal-recessive retinitis pigmentosa (ARRP). METHODS All subjects in this family underwent a complete ophthalmic examination. Targeted-capture next generation sequencing (NGS) was performed on the proband to detect variants. All variants were verified in the remaining family members by PCR amplification and Sanger sequencing. RESULTS All the affected subjects in this pedigree were diagnosed with retinitis pigmentosa (RP). The compound heterozygous c.138delA (p.Asp47IlefsX24) and c.1841G>T (p.Gly614Val) mutations in the Crumbs homolog 1 (CRB1) gene were identified in all the affected patients but not in the unaffected individuals in this family. These mutations were inherited from their parents, respectively. CONCLUSION The novel compound heterozygous mutations in CRB1 were identified in a Chinese pedigree with ARRP using targeted-capture next generation sequencing. After evaluating the significant heredity and impaired protein function, the compound heterozygous c.138delA (p.Asp47IlefsX24) and c.1841G>T (p.Gly614Val) mutations are the causal genes of early onset ARRP in this pedigree. To the best of our knowledge, there is no previous report regarding the compound mutations. PMID:27806333

  13. Reduced Representation Libraries from DNA Pools Analysed with Next Generation Semiconductor Based-Sequencing to Identify SNPs in Extreme and Divergent Pigs for Back Fat Thickness

    Directory of Open Access Journals (Sweden)

    Samuele Bovo


    Full Text Available The aim of this study was to identify single nucleotide polymorphisms (SNPs that could be associated with back fat thickness (BFT in pigs. To achieve this goal, we evaluated the potential and limits of an experimental design that combined several methodologies. DNA samples from two groups of Italian Large White pigs with divergent estimating breeding value (EBV for BFT were separately pooled and sequenced, after preparation of reduced representation libraries (RRLs, on the Ion Torrent technology. Taking advantage from SNAPE for SNPs calling in sequenced DNA pools, 39,165 SNPs were identified; 1/4 of them were novel variants not reported in dbSNP. Combining sequencing data with Illumina PorcineSNP60 BeadChip genotyping results on the same animals, 661 genomic positions overlapped with a good approximation of minor allele frequency estimation. A total of 54 SNPs showing enriched alleles in one or in the other RRLs might be potential markers associated with BFT. Some of these SNPs were close to genes involved in obesity related phenotypes.

  14. Genome-Wide Association Study with Sequence Variants Identifies Candidate Genes for Mastitis Resistance in Dairy Cattle

    DEFF Research Database (Denmark)

    Sahana, Goutam; Guldbrandtsen, Bernt; Bendixen, Christian

    Six genomic regions affecting clinical mastitis were identified through a GWAS study with imputed BovineHD chip genotype data in the Nordic Holstein cattle population. The association analyses were carried out using a SNP-by-SNP analysis by fitting the regression of allele dosage and a polygenic...... Effect Predictor (VEP) vers. 2.6 using ENSEMBL vers. 67 databases. Candidate polymorphisms affecting clinical mastitis were selected based on their association with the traits and functional annotations. A strong positional candidate gene for mastitis resistance on chromosome-6 is the NPFFR2 which...... Factor Receptor Alpha (LIFR) emerged as a strong candidate gene for mastitis resistance. The LIFR gene is involved in acute phase response and is expressed in saliva and mammary gland....

  15. Features of Two New Proteins with OmpA-Like Domains Identified in the Genome Sequences of Leptospira interrogans (United States)

    Teixeira, Aline F.; de Morais, Zenaide M.; Kirchgatter, Karin; Romero, Eliete C.; Vasconcellos, Silvio A.; Nascimento, Ana Lucia T. O.


    Leptospirosis is an acute febrile disease caused by pathogenic spirochetes of the genus Leptospira. It is considered an important re-emerging infectious disease that affects humans worldwide. The knowledge about the mechanisms by which pathogenic leptospires invade and colonize the host remains limited since very few virulence factors contributing to the pathogenesis of the disease have been identified. Here, we report the identification and characterization of two new leptospiral proteins with OmpA-like domains. The recombinant proteins, which exhibit extracellular matrix-binding properties, are called Lsa46 - LIC13479 and Lsa77 - LIC10050 (Leptospiral surface adhesins of 46 and 77 kDa, respectively). Attachment of Lsa46 and Lsa77 to laminin was specific, dose dependent and saturable, with KD values of 24.3 ± 17.0 and 53.0 ± 17.5 nM, respectively. Lsa46 and Lsa77 also bind plasma fibronectin, and both adhesins are plasminogen (PLG)-interacting proteins, capable of generating plasmin (PLA) and as such, increase the proteolytic ability of leptospires. The proteins corresponding to Lsa46 and Lsa77 are present in virulent L. interrogans L1-130 and in saprophyte L. biflexa Patoc 1 strains, as detected by immunofluorescence. The adhesins are recognized by human leptospirosis serum samples at the onset and convalescent phases of the disease, suggesting that they are expressed during infection. Taken together, our data could offer valuable information to the understanding of leptospiral pathogenesis. PMID:25849456

  16. Features of two new proteins with OmpA-like domains identified in the genome sequences of Leptospira interrogans.

    Directory of Open Access Journals (Sweden)

    Aline F Teixeira

    Full Text Available Leptospirosis is an acute febrile disease caused by pathogenic spirochetes of the genus Leptospira. It is considered an important re-emerging infectious disease that affects humans worldwide. The knowledge about the mechanisms by which pathogenic leptospires invade and colonize the host remains limited since very few virulence factors contributing to the pathogenesis of the disease have been identified. Here, we report the identification and characterization of two new leptospiral proteins with OmpA-like domains. The recombinant proteins, which exhibit extracellular matrix-binding properties, are called Lsa46 - LIC13479 and Lsa77 - LIC10050 (Leptospiral surface adhesins of 46 and 77 kDa, respectively. Attachment of Lsa46 and Lsa77 to laminin was specific, dose dependent and saturable, with KD values of 24.3 ± 17.0 and 53.0 ± 17.5 nM, respectively. Lsa46 and Lsa77 also bind plasma fibronectin, and both adhesins are plasminogen (PLG-interacting proteins, capable of generating plasmin (PLA and as such, increase the proteolytic ability of leptospires. The proteins corresponding to Lsa46 and Lsa77 are present in virulent L. interrogans L1-130 and in saprophyte L. biflexa Patoc 1 strains, as detected by immunofluorescence. The adhesins are recognized by human leptospirosis serum samples at the onset and convalescent phases of the disease, suggesting that they are expressed during infection. Taken together, our data could offer valuable information to the understanding of leptospiral pathogenesis.

  17. Whole-exome sequencing identifies novel compound heterozygous mutations in USH2A in Spanish patients with autosomal recessive retinitis pigmentosa. (United States)

    Méndez-Vidal, Cristina; González-Del Pozo, María; Vela-Boza, Alicia; Santoyo-López, Javier; López-Domingo, Francisco J; Vázquez-Marouschek, Carmen; Dopazo, Joaquin; Borrego, Salud; Antiñolo, Guillermo


    Retinitis pigmentosa (RP) is an inherited retinal dystrophy characterized by extreme genetic and clinical heterogeneity. Thus, the diagnosis is not always easily performed due to phenotypic and genetic overlap. Current clinical practices have focused on the systematic evaluation of a set of known genes for each phenotype, but this approach may fail in patients with inaccurate diagnosis or infrequent genetic cause. In the present study, we investigated the genetic cause of autosomal recessive RP (arRP) in a Spanish family in which the causal mutation has not yet been identified with primer extension technology and resequencing. We designed a whole-exome sequencing (WES)-based approach using NimbleGen SeqCap EZ Exome V3 sample preparation kit and the SOLiD 5500×l next-generation sequencing platform. We sequenced the exomes of both unaffected parents and two affected siblings. Exome analysis resulted in the identification of 43,204 variants in the index patient. All variants passing filter criteria were validated with Sanger sequencing to confirm familial segregation and absence in the control population. In silico prediction tools were used to determine mutational impact on protein function and the structure of the identified variants. Novel Usher syndrome type 2A (USH2A) compound heterozygous mutations, c.4325T>C (p.F1442S) and c.15188T>G (p.L5063R), located in exons 20 and 70, respectively, were identified as probable causative mutations for RP in this family. Family segregation of the variants showed the presence of both mutations in all affected members and in two siblings who were apparently asymptomatic at the time of family ascertainment. Clinical reassessment confirmed the diagnosis of RP in these patients. Using WES, we identified two heterozygous novel mutations in USH2A as the most likely disease-causing variants in a Spanish family diagnosed with arRP in which the cause of the disease had not yet been identified with commonly used techniques. Our data

  18. Somatic loss of function mutations in neurofibromin 1 and MYC associated factor X genes identified by exome-wide sequencing in a wild-type GIST case

    International Nuclear Information System (INIS)

    Belinsky, Martin G.; Rink, Lori; Cai, Kathy Q.; Capuzzi, Stephen J.; Hoang, Yen; Chien, Jeremy; Godwin, Andrew K.; Mehren, Margaret von


    Approximately 10–15 % of gastrointestinal stromal tumors (GISTs) lack gain of function mutations in the KIT and platelet-derived growth factor receptor alpha (PDGFRA) genes. An alternate mechanism of oncogenesis through loss of function of the succinate-dehydrogenase (SDH) enzyme complex has been identified for a subset of these “wild type” GISTs. Paired tumor and normal DNA from an SDH-intact wild-type GIST case was subjected to whole exome sequencing to identify the pathogenic mechanism(s) in this tumor. Selected findings were further investigated in panels of GIST tumors through Sanger DNA sequencing, quantitative real-time PCR, and immunohistochemical approaches. A hemizygous frameshift mutation (p.His2261Leufs*4), in the neurofibromin 1 (NF1) gene was identified in the patient’s GIST; however, no germline NF1 mutation was found. A somatic frameshift mutation (p.Lys54Argfs*31) in the MYC associated factor X (MAX) gene was also identified. Immunohistochemical analysis for MAX on a large panel of GISTs identified loss of MAX expression in the MAX-mutated GIST and in a subset of mainly KIT-mutated tumors. This study suggests that inactivating NF1 mutations outside the context of neurofibromatosis may be the oncogenic mechanism for a subset of sporadic GIST. In addition, loss of function mutation of the MAX gene was identified for the first time in GIST, and a broader role for MAX in GIST progression was suggested. The online version of this article (doi:10.1186/s12885-015-1872-y) contains supplementary material, which is available to authorized users

  19. Recurrent targeted genes of hepatitis B virus in the liver cancer genomes identified by a next-generation sequencing-based approach.

    Directory of Open Access Journals (Sweden)

    Dong Ding

    Full Text Available Integration of the viral DNA into host chromosomes was found in most of the hepatitis B virus (HBV-related hepatocellular carcinomas (HCCs. Here we devised a massive anchored parallel sequencing (MAPS method using next-generation sequencing to isolate and sequence HBV integrants. Applying MAPS to 40 pairs of HBV-related HCC tissues (cancer and adjacent tissues, we identified 296 HBV integration events corresponding to 286 unique integration sites (UISs with precise HBV-Human DNA junctions. HBV integration favored chromosome 17 and preferentially integrated into human transcript units. HBV targeted genes were enriched in GO terms: cAMP metabolic processes, T cell differentiation and activation, TGF beta receptor pathway, ncRNA catabolic process, and dsRNA fragmentation and cellular response to dsRNA. The HBV targeted genes include 7 genes (PTPRJ, CNTN6, IL12B, MYOM1, FNDC3B, LRFN2, FN1 containing IPR003961 (Fibronectin, type III domain, 7 genes (NRG3, MASP2, NELL1, LRP1B, ADAM21, NRXN1, FN1 containing IPR013032 (EGF-like region, conserved site, and three genes (PDE7A, PDE4B, PDE11A containing IPR002073 (3', 5'-cyclic-nucleotide phosphodiesterase. Enriched pathways include hsa04512 (ECM-receptor interaction, hsa04510 (Focal adhesion, and hsa04012 (ErbB signaling pathway. Fewer integration events were found in cancers compared to cancer-adjacent tissues, suggesting a clonal expansion model in HCC development. Finally, we identified 8 genes that were recurrent target genes by HBV integration including fibronectin 1 (FN1 and telomerase reverse transcriptase (TERT1, two known recurrent target genes, and additional novel target genes such as SMAD family member 5 (SMAD5, phosphatase and actin regulator 4 (PHACTR4, and RNA binding protein fox-1 homolog (C. elegans 1 (RBFOX1. Integrating analysis with recently published whole-genome sequencing analysis, we identified 14 additional recurrent HBV target genes, greatly expanding the HBV recurrent target list

  20. 16S rRNA amplicon sequencing identifies microbiota associated with oral cancer, human papilloma virus infection and surgical treatment. (United States)

    Guerrero-Preston, Rafael; Godoy-Vitorino, Filipa; Jedlicka, Anne; Rodríguez-Hilario, Arnold; González, Herminio; Bondy, Jessica; Lawson, Fahcina; Folawiyo, Oluwasina; Michailidi, Christina; Dziedzic, Amanda; Thangavel, Rajagowthamee; Hadar, Tal; Noordhuis, Maartje G; Westra, William; Koch, Wayne; Sidransky, David


    Systemic inflammatory events and localized disease, mediated by the microbiome, may be measured in saliva as head and neck squamous cell carcinoma (HNSCC) diagnostic and prognostic biomonitors. We used a 16S rRNA V3-V5 marker gene approach to compare the saliva microbiome in DNA isolated from Oropharyngeal (OPSCC), Oral Cavity Squamous Cell Carcinoma (OCSCC) patients and normal epithelium controls, to characterize the HNSCC saliva microbiota and examine their abundance before and after surgical resection.The analyses identified a predominance of Firmicutes, Proteobacteria and Bacteroidetes, with less frequent presence of Actinobacteria and Fusobacteria before surgery. At lower taxonomic levels, the most abundant genera were Streptococcus, Prevotella, Haemophilus, Lactobacillus and Veillonella, with lower numbers of Citrobacter and Neisseraceae genus Kingella. HNSCC patients had a significant loss in richness and diversity of microbiota species (p<0.05) compared to the controls. Overall, the Operational Taxonomic Units network shows that the relative abundance of OTU's within genus Streptococcus, Dialister, and Veillonella can be used to discriminate tumor from control samples (p<0.05). Tumor samples lost Neisseria, Aggregatibacter (Proteobacteria), Haemophillus (Firmicutes) and Leptotrichia (Fusobacteria). Paired taxa within family Enterobacteriaceae, together with genus Oribacterium, distinguish OCSCC samples from OPSCC and normal samples (p<0.05). Similarly, only HPV positive samples have an abundance of genus Gemellaceae and Leuconostoc (p<0.05). Longitudinal analyses of samples taken before and after surgery, revealed a reduction in the alpha diversity measure after surgery, together with an increase of this measure in patients that recurred (p<0.05). These results suggest that microbiota may be used as HNSCC diagnostic and prognostic biomonitors.

  1. Gamma-Irradiated Mannheimia (Pasteurella) Haemolytica Identified by rRNA Gene Sequencing as a Potential Vaccine in Mice

    International Nuclear Information System (INIS)

    Araby, E.


    Pneumonic pasteurellosis is a significant disease in beef production medicine. The most information suggests that this disease is a $700 million dollar per year economic burden in bovine food animal production. The current study was designed to assess the immune efficacy of whole cell killed of M. haemolytica strain from satisfactory cases (infected lung from sheep). The efficacy of gamma- irradiated M. haemolytica vaccine (GIV) was evaluated in mice in comparison to the classical aqueous formalized (AFV) one. The bacteria under study were cultivation on blood agar, purification and genetically identified. Then the bacterial cells were exposed to different doses of gamma radiation (2- 20 kGy) with 2 kGy intervals and the dose response curve of the survivors was plotted and 20 kGy was selected as the dose for the preparation of the vaccine. A total of 30 male mice (two weeks – old) were used for the further experimental investigations. Animals were divided into three equal groups each of 10 animals. The first group (group A) was given GIV . The second group (group B) received AFV. The third group (group C) was injected with sterile saline solution and represents the control. Animals were vaccinated via intraperitoneal (i.p) injection with 1x10 8 CFU per treated mouse. After vaccination, the immuno response was determined by cellular surface antigens-reactive antibodies using a modified protein- electrophoresis procedure. Antibody-antigen hybrids was visualized at molecular weight more than 225 KDa in samples represented M. haemolytica antibodies group (A, B) against both bacterial samples (M. haemolytica and Pasteurella multocida ) , while non-treated bacterial cells in which cells incubated with serum of mice group (C) revealed no hybridization reaction, this results verify that, there is shared cellular surface antigens among the two Pasteurella species. Also, the bacterial distribution with (LD 50 ) 2x10 7 CFU of a live M. heamolytica into vaccinated and non

  2. Exome Sequencing Identifies a Missense Variant in EFEMP1 Co-Segregating in a Family with Autosomal Dominant Primary Open-Angle Glaucoma.

    Directory of Open Access Journals (Sweden)

    Donna S Mackay

    Full Text Available Primary open-angle glaucoma (POAG is a clinically important and genetically heterogeneous cause of progressive vision loss as a result of retinal ganglion cell death. Here we have utilized trio-based, whole-exome sequencing to identify the genetic defect underlying an autosomal dominant form of adult-onset POAG segregating in an African-American family. Exome sequencing identified a novel missense variant (c.418C>T, p.Arg140Trp in exon-5 of the gene coding for epidermal growth factor (EGF containing fibulin-like extracellular matrix protein 1 (EFEMP1 that co-segregated with disease in the family. Linkage and haplotype analyses with microsatellite markers indicated that the disease interval overlapped a known POAG locus (GLC1H on chromosome 2p. The p.Arg140Trp substitution was predicted in silico to have damaging effects on protein function and transient expression studies in cultured cells revealed that the Trp140-mutant protein exhibited increased intracellular accumulation compared with wild-type EFEMP1. In situ hybridization of the mouse eye with oligonucleotide probes detected the highest levels of EFEMP1 transcripts in the ciliary body, cornea, inner nuclear layer of the retina, and the optic nerve head. The recent finding that a common variant near EFEMP1 was associated with optic nerve-head morphology supports the possibility that the EFEMP1 variant identified in this POAG family may be pathogenic.

  3. Single nucleotide variants and InDels identified from whole-genome re-sequencing of Guzerat, Gyr, Girolando and Holstein cattle breeds.

    Directory of Open Access Journals (Sweden)

    Nedenia Bonvino Stafuzza

    Full Text Available Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose, Gyr, Girolando and Holstein (dairy production. A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs and 3,828,041 insertions/deletions (InDels were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs.

  4. Application of CHD1 Gene and EE0.6 Sequences to Identify Sexes of Several Protected Bird Species in Taiwan

    Directory of Open Access Journals (Sweden)

    E.-C. Lin


    Full Text Available Many bird species, for example: Crested Serpent Eagle (Spilornis cheela hoya, Collared Scops (Owl Otus bakkamoena, Tawny Fish Owl (Ketupa flavipes, Crested Goshawk (Accipiter trivirgatus, and Grass Owl (Tyto longimembris... etc, are monomorphic, which is difficult to identify their sex simply by their outward appearance. Especially for those monomorphic endangered species, finding an effective tool to identify their sex beside outward appearance is needed for further captive breeding programs or other conservation plans. In this study, we collected samples of Black Swan (Cygmus atratus and Nicobar Pigeon (Caloenas nicobarica, two aviaries introduced monomorphic species served as control group, and Crested Serpent Eagle, Collared Scops Owl, Tawny Fish Owl, Crested Goshawk, and Grass Owl, five protected monomorphic species in Taiwan. We used sex-specific primers of avian CHD1 (chromo-helicase-DNA-binding gene and EE0.6 (EcoRI 0.6-kb fragment sequences to identify the sex of these birds. The results showed that CHD1 gene primers could be used to correctly identify the sex of Black Swans, Nicobar Pigeons and Crested Serpent Eagles, but it could not be used to correctly identify sex in Collared Scops Owls, Tawny Fish Owls, and Crested Goshawks. In the sex identification using EE0.6 sequence fragment, A, C, D and E primer sets could be used for sexing Black Swans; A, B, C, and D primer sets could be used for sexing Crested Serpent Eagles; and E primer set could be used for sexing Nicobar Pigeons and the two owl species. Correct determination of sex is the first step if a captive breeding measure is required. We have demonstrated that several of the existing primer sets can be used for sex determination of several captive breeding and indigenous bird species.

  5. Whole-exome re-sequencing in a family quartet identifies POP1 mutations as the cause of a novel skeletal dysplasia.

    Directory of Open Access Journals (Sweden)

    Evgeny A Glazov


    Full Text Available Recent advances in DNA sequencing have enabled mapping of genes for monogenic traits in families with small pedigrees and even in unrelated cases. We report the identification of disease-causing mutations in a rare, severe, skeletal dysplasia, studying a family of two healthy unrelated parents and two affected children using whole-exome sequencing. The two affected daughters have clinical and radiographic features suggestive of anauxetic dysplasia (OMIM 607095, a rare form of dwarfism caused by mutations of RMRP. However, mutations of RMRP were excluded in this family by direct sequencing. Our studies identified two novel compound heterozygous loss-of-function mutations in POP1, which encodes a core component of the RNase mitochondrial RNA processing (RNase MRP complex that directly interacts with the RMRP RNA domains that are affected in anauxetic dysplasia. We demonstrate that these mutations impair the integrity and activity of this complex and that they impair cell proliferation, providing likely molecular and cellular mechanisms by which POP1 mutations cause this severe skeletal dysplasia.

  6. Design of a High Density SNP Genotyping Assay in the Pig Using SNPs Identified and Characterized by Next Generation Sequencing Technology (United States)

    Ramos, Antonio M.; Crooijmans, Richard P. M. A.; Affara, Nabeel A.; Amaral, Andreia J.; Archibald, Alan L.; Beever, Jonathan E.; Bendixen, Christian; Churcher, Carol; Clark, Richard; Dehais, Patrick; Hansen, Mark S.; Hedegaard, Jakob; Hu, Zhi-Liang; Kerstens, Hindrik H.; Law, Andy S.; Megens, Hendrik-Jan; Milan, Denis; Nonneman, Danny J.; Rohrer, Gary A.; Rothschild, Max F.; Smith, Tim P. L.; Schnabel, Robert D.; Van Tassell, Curt P.; Taylor, Jeremy F.; Wiedmann, Ralph T.; Schook, Lawrence B.; Groenen, Martien A. M.


    Background The dissection of complex traits of economic importance to the pig industry requires the availability of a significant number of genetic markers, such as single nucleotide polymorphisms (SNPs). This study was conducted to discover several hundreds of thousands of porcine SNPs using next generation sequencing technologies and use these SNPs, as well as others from different public sources, to design a high-density SNP genotyping assay. Methodology/Principal Findings A total of 19 reduced representation libraries derived from four swine breeds (Duroc, Landrace, Large White, Pietrain) and a Wild Boar population and three restriction enzymes (AluI, HaeIII and MspI) were sequenced using Illumina's Genome Analyzer (GA). The SNP discovery effort resulted in the de novo identification of over 372K SNPs. More than 549K SNPs were used to design the Illumina Porcine 60K+SNP iSelect Beadchip, now commercially available as the PorcineSNP60. A total of 64,232 SNPs were included on the Beadchip. Results from genotyping the 158 individuals used for sequencing showed a high overall SNP call rate (97.5%). Of the 62,621 loci that could be reliably scored, 58,994 were polymorphic yielding a SNP conversion success rate of 94%. The average minor allele frequency (MAF) for all scorable SNPs was 0.274. Conclusions/Significance Overall, the results of this study indicate the utility of using next generation sequencing technologies to identify large numbers of reliable SNPs. In addition, the validation of the PorcineSNP60 Beadchip demonstrated that the assay is an excellent tool that will likely be used in a variety of future studies in pigs. PMID:19654876

  7. iNR-PhysChem: a sequence-based predictor for identifying nuclear receptors and their subfamilies via physical-chemical property matrix.

    Directory of Open Access Journals (Sweden)

    Xuan Xiao

    Full Text Available Nuclear receptors (NRs form a family of ligand-activated transcription factors that regulate a wide variety of biological processes, such as homeostasis, reproduction, development, and metabolism. Human genome contains 48 genes encoding NRs. These receptors have become one of the most important targets for therapeutic drug development. According to their different action mechanisms or functions, NRs have been classified into seven subfamilies. With the avalanche of protein sequences generated in the postgenomic age, we are facing the following challenging problems. Given an uncharacterized protein sequence, how can we identify whether it is a nuclear receptor? If it is, what subfamily it belongs to? To address these problems, we developed a predictor called iNR-PhysChem in which the protein samples were expressed by a novel mode of pseudo amino acid composition (PseAAC whose components were derived from a physical-chemical matrix via a series of auto-covariance and cross-covariance transformations. It was observed that the overall success rate achieved by iNR-PhysChem was over 98% in identifying NRs or non-NRs, and over 92% in identifying NRs among the following seven subfamilies: NR1--thyroid hormone like, NR2--HNF4-like, NR3--estrogen like, NR4--nerve growth factor IB-like, NR5--fushi tarazu-F1 like, NR6--germ cell nuclear factor like, and NR0--knirps like. These rates were derived by the jackknife tests on a stringent benchmark dataset in which none of protein sequences included has ≥60% pairwise sequence identity to any other in a same subset. As a user-friendly web-server, iNR-PhysChem is freely accessible to the public at either or Also a step-by-step guide is provided on how to use the web-server to get the desired results without the need to follow the complicated mathematics involved in developing the predictor. It is anticipated that iNR-PhysChem may

  8. Whole-exome sequencing identified a homozygous FNBP4 mutation in a family with a condition similar to microphthalmia with limb anomalies. (United States)

    Kondo, Yukiko; Koshimizu, Eriko; Megarbane, Andre; Hamanoue, Haruka; Okada, Ippei; Nishiyama, Kiyomi; Kodera, Hirofumi; Miyatake, Satoko; Tsurusaki, Yoshinori; Nakashima, Mitsuko; Doi, Hiroshi; Miyake, Noriko; Saitsu, Hirotomo; Matsumoto, Naomichi


    Microphthalmia with limb anomalies (MLA), also known as Waardenburg anophthalmia syndrome or ophthalmoacromelic syndrome, is a rare autosomal recessive disorder. Recently, we and others successfully identified SMOC1 as the causative gene for MLA. However, there are several MLA families without SMOC1 abnormality, suggesting locus heterogeneity in MLA. We aimed to identify a pathogenic mutation in one Lebanese family having an MLA-like condition without SMOC1 mutation by whole-exome sequencing (WES) combined with homozygosity mapping. A c.683C>T (p.Thr228Met) in FNBP4 was found as a primary candidate, drawing the attention that FNBP4 and SMOC1 may potentially modulate BMP signaling. Copyright © 2013 Wiley Periodicals, Inc.

  9. Whole exome sequencing identifies a POLRID mutation segregating in a father and two daughters with findings of Klippel-Feil and Treacher Collins syndromes. (United States)

    Giampietro, Philip F; Armstrong, Linlea; Stoddard, Alex; Blank, Robert D; Livingston, Janet; Raggio, Cathy L; Rasmussen, Kristen; Pickart, Michael; Lorier, Rachel; Turner, Amy; Sund, Sarah; Sobrera, Nara; Neptune, Enid; Sweetser, David; Santiago-Cornier, Alberto; Broeckel, Ulrich


    We report on a father and his two daughters diagnosed with Klippel-Feil syndrome (KFS) but with craniofacial differences (zygomatic and mandibular hypoplasia and cleft palate) and external ear abnormalities suggestive of Treacher Collins syndrome (TCS). The diagnosis of KFS was favored, given that the neck anomalies were the predominant manifestations, and that the diagnosis predated later recognition of the association between spinal segmentation abnormalities and TCS. Genetic heterogeneity and the rarity of large families with KFS have limited the ability to identify mutations by traditional methods. Whole exome sequencing identified a nonsynonymous mutation in POLR1D (subunit of RNA polymerase I and II): exon2:c.T332C:p.L111P. Mutations in POLR1D are present in about 5% of individuals diagnosed with TCS. We propose that this mutation is causal in this family, suggesting a pathogenetic link between KFS and TCS. © 2014 Wiley Periodicals, Inc.

  10. Apoptosis-inducing signal sequence mutation in carbonic anhydrase IV identified in patients with the RP17 form of retinitis pigmentosa (United States)

    Rebello, George; Ramesar, Rajkumar; Vorster, Alvera; Roberts, Lisa; Ehrenreich, Liezle; Oppon, Ekow; Gama, Dumisani; Bardien, Soraya; Greenberg, Jacquie; Bonapace, Giuseppe; Waheed, Abdul; Shah, Gul N.; Sly, William S.


    Genetic and physical mapping of the RP17 locus on 17q identified a 3.6-megabase candidate region that includes the gene encoding carbonic anhydrase IV (CA4), a glycosylphosphatidylinositol-anchored protein that is highly expressed in the choriocapillaris of the human eye. By sequencing candidate genes in this region, we identified a mutation that causes replacement of an arginine with a tryptophan (R14W) in the signal sequence of the CA4 gene at position -5 relative to the signal sequence cleavage site. This mutation was found to cosegregate with the disease phenotype in two large families and was not found in 36 unaffected family members or 100 controls. Expression of the mutant cDNA in COS-7 cells produced several findings, suggesting a mechanism by which the mutation can explain the autosomal dominant disease. In transfected COS-7 cells, the R14W mutation (i) reduced the steady-state level of carbonic anhydrase IV activity expressed by 28% due to a combination of decreased synthesis and accelerated turnover; (ii) led to up-regulation of immunoglobulin-binding protein, double-stranded RNA-regulated protein kinase-like ER kinase, and CCAAT/enhancer-binding protein homologous protein, markers of the unfolded protein response and endoplasmic reticulum stress; and (iii) induced apoptosis, as evidenced by annexin V binding and terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling staining, in most cells expressing the mutant, but not the WT, protein. We suggest that a high level of expression of the mutant allele in the endothelial cells of the choriocapillaris leads to apoptosis, leading in turn to ischemia in the overlying retina and producing autosomal dominant retinitis pigmentosa. PMID:15090652

  11. NFATC3-PLA2G15 Fusion Transcript Identified by RNA Sequencing Promotes Tumor Invasion and Proliferation in Colorectal Cancer Cell Lines. (United States)

    Jang, Jee-Eun; Kim, Hwang-Phill; Han, Sae-Won; Jang, Hoon; Lee, Si-Hyun; Song, Sang-Hyun; Bang, Duhee; Kim, Tae-You


    This study was designed to identify novel fusion transcripts (FTs) and their functional significance in colorectal cancer lines. We performed paired-end RNA sequencing of 28 colorectal cancer (CRC) cell lines. FT candidates were identified using TopHat-fusion, ChimeraScan, and FusionMap tools and further experimental validation was conducted through reverse transcription-polymerase chain reaction and Sanger sequencing. FT was depleted in human CRC line and the effects on cell proliferation, cell migration, and cell invasion were analyzed. 1,380 FT candidates were detected through bioinformatics filtering. We selected 6 candidate FTs, including 4 inter-chromosomal and 2 intra-chromosomal FTs and each FT was found in at least 1 of the 28 cell lines. Moreover, when we tested 19 pairs of CRC tumor and adjacent normal tissue samples, NFATC3-PLA2G15 FT was found in 2. Knockdown of NFATC3-PLA2G15 using siRNA reduced mRNA expression of epithelial-mesenchymal transition (EMT) markers such as vimentin, twist, and fibronectin and increased mesenchymal-epithelial transition markers of E-cadherin, claudin-1, and FOXC2 in colo-320 cell line harboring NFATC3-PLA2G15 FT. The NFATC3-PLA2G15 knockdown also inhibited invasion, colony formation capacity, and cell proliferation. These results suggest that that NFATC3-PLA2G15 FTs may contribute to tumor progression by enhancing invasion by EMT and proliferation.

  12. Deep sequencing of Salmonella RNA associated with heterologous Hfq proteins in vivo reveals small RNAs as a major target class and identifies RNA processing phenotypes. (United States)

    Sittka, Alexandra; Sharma, Cynthia M; Rolle, Katarzyna; Vogel, Jörg


    The bacterial Sm-like protein, Hfq, is a key factor for the stability and function of small non-coding RNAs (sRNAs) in Escherichia coli. Homologues of this protein have been predicted in many distantly related organisms yet their functional conservation as sRNA-binding proteins has not entirely been clear. To address this, we expressed in Salmonella the Hfq proteins of two eubacteria (Neisseria meningitides, Aquifex aeolicus) and an archaeon (Methanocaldococcus jannaschii), and analyzed the associated RNA by deep sequencing. This in vivo approach identified endogenous Salmonella sRNAs as a major target of the foreign Hfq proteins. New Salmonella sRNA species were also identified, and some of these accumulated specifically in the presence of a foreign Hfq protein. In addition, we observed specific RNA processing defects, e.g., suppression of precursor processing of SraH sRNA by Methanocaldococcus Hfq, or aberrant accumulation of extracytoplasmic target mRNAs of the Salmonella GcvB, MicA or RybB sRNAs. Taken together, our study provides evidence of a conserved inherent sRNA-binding property of Hfq, which may facilitate the lateral transmission of regulatory sRNAs among distantly related species. It also suggests that the expression of heterologous RNA-binding proteins combined with deep sequencing analysis of RNA ligands can be used as a molecular tool to dissect individual steps of RNA metabolism in vivo.

  13. Whole-exome sequencing, without prior linkage, identifies a mutation in LAMB3 as a cause of dominant hypoplastic amelogenesis imperfecta. (United States)

    Poulter, James A; El-Sayed, Walid; Shore, Roger C; Kirkham, Jennifer; Inglehearn, Chris F; Mighell, Alan J


    The conventional approach to identifying the defective gene in a family with an inherited disease is to find the disease locus through family studies. However, the rapid development and decreasing cost of next generation sequencing facilitates a more direct approach. Here, we report the identification of a frameshift mutation in LAMB3 as a cause of dominant hypoplastic amelogenesis imperfecta (AI). Whole-exome sequencing of three affected family members and subsequent filtering of shared variants, without prior genetic linkage, sufficed to identify the pathogenic variant. Simultaneous analysis of multiple family members confirms segregation, enhancing the power to filter the genetic variation found and leading to rapid identification of the pathogenic variant. LAMB3 encodes a subunit of Laminin-5, one of a family of basement membrane proteins with essential functions in cell growth, movement and adhesion. Homozygous LAMB3 mutations cause junctional epidermolysis bullosa (JEB) and enamel defects are seen in JEB cases. However, to our knowledge, this is the first report of dominant AI due to a LAMB3 mutation in the absence of JEB.

  14. Private selective sweeps identified from next-generation pool-sequencing reveal convergent pathways under selection in two inbred Schistosoma mansoni strains.

    Directory of Open Access Journals (Sweden)

    Julie A J Clément

    Full Text Available BACKGROUND: The trematode flatworms of the genus Schistosoma, the causative agents of schistosomiasis, are among the most prevalent parasites in humans, affecting more than 200 million people worldwide. In this study, we focused on two well-characterized strains of S. mansoni, to explore signatures of selection. Both strains are highly inbred and exhibit differences in life history traits, in particular in their compatibility with the intermediate host Biomphalaria glabrata. METHODOLOGY/PRINCIPAL FINDINGS: We performed high throughput sequencing of DNA from pools of individuals of each strain using Illumina technology and identified single nucleotide polymorphisms (SNP and copy number variations (CNV. In total, 708,898 SNPs were identified and roughly 2,000 CNVs. The SNPs revealed low nucleotide diversity (π = 2 × 10(-4 within each strain and a high differentiation level (Fst = 0.73 between them. Based on a recently developed in-silico approach, we further detected 12 and 19 private (i.e. specific non-overlapping selective sweeps among the 121 and 151 sweeps found in total for each strain. CONCLUSIONS/SIGNIFICANCE: Functional annotation of transcripts lying in the private selective sweeps revealed specific selection for functions related to parasitic interaction (e.g. cell-cell adhesion or redox reactions. Despite high differentiation between strains, we identified evolutionary convergence of genes related to proteolysis, known as a key virulence factor and a potential target of drug and vaccine development. Our data show that pool-sequencing can be used for the detection of selective sweeps in parasite populations and enables one to identify biological functions under selection.

  15. Increased genetic diversity and prevalence of co-infection with Trypanosoma spp. in koalas (Phascolarctos cinereus and their ticks identified using next-generation sequencing (NGS.

    Directory of Open Access Journals (Sweden)

    Amanda D Barbosa

    Full Text Available Infections with Trypanosoma spp. have been associated with poor health and decreased survival of koalas (Phascolarctos cinereus, particularly in the presence of concurrent pathogens such as Chlamydia and koala retrovirus. The present study describes the application of a next-generation sequencing (NGS-based assay to characterise the prevalence and genetic diversity of trypanosome communities in koalas and two native species of ticks (Ixodes holocyclus and I. tasmani removed from koala hosts. Among 168 koalas tested, 32.2% (95% CI: 25.2-39.8% were positive for at least one Trypanosoma sp. Previously described Trypanosoma spp. from koalas were identified, including T. irwini (32.1%, 95% CI: 25.2-39.8%, T. gilletti (25%, 95% CI: 18.7-32.3%, T. copemani (27.4%, 95% CI: 20.8-34.8% and T. vegrandis (10.1%, 95% CI: 6.0-15.7%. Trypanosoma noyesi was detected for the first time in koalas, although at a low prevalence (0.6% 95% CI: 0-3.3%, and a novel species (Trypanosoma sp. AB-2017 was identified at a prevalence of 4.8% (95% CI: 2.1-9.2%. Mixed infections with up to five species were present in 27.4% (95% CI: 21-35% of the koalas, which was significantly higher than the prevalence of single infections 4.8% (95% CI: 2-9%. Overall, a considerably higher proportion (79.7% of the Trypanosoma sequences isolated from koala blood samples were identified as T. irwini, suggesting this is the dominant species. Co-infections involving T. gilletti, T. irwini, T. copemani, T. vegrandis and Trypanosoma sp. AB-2017 were also detected in ticks, with T. gilletti and T. copemani being the dominant species within the invertebrate hosts. Direct Sanger sequencing of Trypanosoma 18S rRNA gene amplicons was also performed and results revealed that this method was only able to identify the genotypes with greater amount of reads (according to NGS within koala samples, which highlights the advantages of NGS in detecting mixed infections. The present study provides new insights

  16. Increased genetic diversity and prevalence of co-infection with Trypanosoma spp. in koalas (Phascolarctos cinereus) and their ticks identified using next-generation sequencing (NGS). (United States)

    Barbosa, Amanda D; Gofton, Alexander W; Paparini, Andrea; Codello, Annachiara; Greay, Telleasha; Gillett, Amber; Warren, Kristin; Irwin, Peter; Ryan, Una


    Infections with Trypanosoma spp. have been associated with poor health and decreased survival of koalas (Phascolarctos cinereus), particularly in the presence of concurrent pathogens such as Chlamydia and koala retrovirus. The present study describes the application of a next-generation sequencing (NGS)-based assay to characterise the prevalence and genetic diversity of trypanosome communities in koalas and two native species of ticks (Ixodes holocyclus and I. tasmani) removed from koala hosts. Among 168 koalas tested, 32.2% (95% CI: 25.2-39.8%) were positive for at least one Trypanosoma sp. Previously described Trypanosoma spp. from koalas were identified, including T. irwini (32.1%, 95% CI: 25.2-39.8%), T. gilletti (25%, 95% CI: 18.7-32.3%), T. copemani (27.4%, 95% CI: 20.8-34.8%) and T. vegrandis (10.1%, 95% CI: 6.0-15.7%). Trypanosoma noyesi was detected for the first time in koalas, although at a low prevalence (0.6% 95% CI: 0-3.3%), and a novel species (Trypanosoma sp. AB-2017) was identified at a prevalence of 4.8% (95% CI: 2.1-9.2%). Mixed infections with up to five species were present in 27.4% (95% CI: 21-35%) of the koalas, which was significantly higher than the prevalence of single infections 4.8% (95% CI: 2-9%). Overall, a considerably higher proportion (79.7%) of the Trypanosoma sequences isolated from koala blood samples were identified as T. irwini, suggesting this is the dominant species. Co-infections involving T. gilletti, T. irwini, T. copemani, T. vegrandis and Trypanosoma sp. AB-2017 were also detected in ticks, with T. gilletti and T. copemani being the dominant species within the invertebrate hosts. Direct Sanger sequencing of Trypanosoma 18S rRNA gene amplicons was also performed and results revealed that this method was only able to identify the genotypes with greater amount of reads (according to NGS) within koala samples, which highlights the advantages of NGS in detecting mixed infections. The present study provides new insights on the

  17. High Throughput Sequencing of Small RNAs in the Two Cucurbita Germplasm with Different Sodium Accumulation Patterns Identifies Novel MicroRNAs Involved in Salt Stress Response. (United States)

    Xie, Junjun; Lei, Bo; Niu, Mengliang; Huang, Yuan; Kong, Qiusheng; Bie, Zhilong


    MicroRNAs (miRNAs), a class of small non-coding RNAs, recognize their mRNA targets based on perfect sequence complementarity. MiRNAs lead to broader changes in gene expression after plants are exposed to stress. High-throughput sequencing is an effective method to identify and profile small RNA populations in non-model plants under salt stresses, significantly improving our knowledge regarding miRNA functions in salt tolerance. Cucurbits are sensitive to soil salinity, and the Cucurbita genus is used as the rootstock of other cucurbits to enhance salt tolerance. Several cucurbit crops have been used for miRNA sequencing but salt stress-related miRNAs in cucurbit species have not been reported. In this study, we subjected two Cucurbita germplasm, namely, N12 (Cucurbita. maxima Duch.) and N15 (Cucurbita. moschata Duch.), with different sodium accumulation patterns, to Illumina sequencing to determine small RNA populations in root tissues after 4 h of salt treatment and control. A total of 21,548,326 and 19,394,108 reads were generated from the control and salt-treated N12 root tissues, respectively. By contrast, 19,108,240 and 20,546,052 reads were obtained from the control and salt-treated N15 root tissues, respectively. Fifty-eight conserved miRNA families and 33 novel miRNAs were identified in the two Cucurbita germplasm. Seven miRNAs (six conserved miRNAs and one novel miRNAs) were up-regulated in salt-treated N12 and N15 samples. Most target genes of differentially expressed novel miRNAs were transcription factors and salt stress-responsive proteins, including dehydration-induced protein, cation/H+ antiporter 18, and CBL-interacting serine/threonine-protein kinase. The differential expression of miRNAs between the two Cucurbita germplasm under salt stress conditions and their target genes demonstrated that novel miRNAs play an important role in the response of the two Cucurbita germplasm to salt stress. The present study initially explored small RNAs in the

  18. High Throughput Sequencing of Small RNAs in the Two Cucurbita Germplasm with Different Sodium Accumulation Patterns Identifies Novel MicroRNAs Involved in Salt Stress Response.

    Directory of Open Access Journals (Sweden)

    Junjun Xie

    Full Text Available MicroRNAs (miRNAs, a class of small non-coding RNAs, recognize their mRNA targets based on perfect sequence complementarity. MiRNAs lead to broader changes in gene expression after plants are exposed to stress. High-throughput sequencing is an effective method to identify and profile small RNA populations in non-model plants under salt stresses, significantly improving our knowledge regarding miRNA functions in salt tolerance. Cucurbits are sensitive to soil salinity, and the Cucurbita genus is used as the rootstock of other cucurbits to enhance salt tolerance. Several cucurbit crops have been used for miRNA sequencing but salt stress-related miRNAs in cucurbit species have not been reported. In this study, we subjected two Cucurbita germplasm, namely, N12 (Cucurbita. maxima Duch. and N15 (Cucurbita. moschata Duch., with different sodium accumulation patterns, to Illumina sequencing to determine small RNA populations in root tissues after 4 h of salt treatment and control. A total of 21,548,326 and 19,394,108 reads were generated from the control and salt-treated N12 root tissues, respectively. By contrast, 19,108,240 and 20,546,052 reads were obtained from the control and salt-treated N15 root tissues, respectively. Fifty-eight conserved miRNA families and 33 novel miRNAs were identified in the two Cucurbita germplasm. Seven miRNAs (six conserved miRNAs and one novel miRNAs were up-regulated in salt-treated N12 and N15 samples. Most target genes of differentially expressed novel miRNAs were transcription factors and salt stress-responsive proteins, including dehydration-induced protein, cation/H+ antiporter 18, and CBL-interacting serine/threonine-protein kinase. The differential expression of miRNAs between the two Cucurbita germplasm under salt stress conditions and their target genes demonstrated that novel miRNAs play an important role in the response of the two Cucurbita germplasm to salt stress. The present study initially explored small

  19. Targeted next-generation sequencing identifies a homozygous nonsense mutation in ABHD12, the gene underlying PHARC, in a family clinically diagnosed with Usher syndrome type 3 (United States)


    Background Usher syndrome (USH) is an autosomal recessive genetically heterogeneous disorder with congenital sensorineural hearing impairment and retinitis pigmentosa (RP). We have identified a consanguineous Lebanese family with two affected members displaying progressive hearing loss, RP and cataracts, therefore clinically diagnosed as USH type 3 (USH3). Our study was aimed at the identification of the causative mutation in this USH3-like family. Methods Candidate loci were identified using genomewide SNP-array-based homozygosity mapping followed by targeted enrichment and next-generation sequencing. Results Using a capture array targeting the three identified homozygosity-by-descent regions on chromosomes 1q43-q44, 20p13-p12.2 and 20p11.23-q12, we identified a homozygous nonsense mutation, p.Arg65X, in ABHD12 segregating with the phenotype. Conclusion Mutations of ABHD12, an enzyme hydrolyzing an endocannabinoid lipid transmitter, cause PHARC (polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and early-onset cataract). After the identification of the ABHD12 mutation in this family, one patient underwent neurological examination which revealed ataxia, but no polyneuropathy. ABHD12 is not known to be related to the USH protein interactome. The phenotype of our patient represents a variant of PHARC, an entity that should be taken into account as differential diagnosis for USH3. Our study demonstrates the potential of comprehensive genetic analysis for improving the clinical diagnosis. PMID:22938382

  20. Targeted next-generation sequencing identifies a homozygous nonsense mutation in ABHD12, the gene underlying PHARC, in a family clinically diagnosed with Usher syndrome type 3. (United States)

    Eisenberger, Tobias; Slim, Rima; Mansour, Ahmad; Nauck, Markus; Nürnberg, Gudrun; Nürnberg, Peter; Decker, Christian; Dafinger, Claudia; Ebermann, Inga; Bergmann, Carsten; Bolz, Hanno Jörn


    Usher syndrome (USH) is an autosomal recessive genetically heterogeneous disorder with congenital sensorineural hearing impairment and retinitis pigmentosa (RP). We have identified a consanguineous Lebanese family with two affected members displaying progressive hearing loss, RP and cataracts, therefore clinically diagnosed as USH type 3 (USH3). Our study was aimed at the identification of the causative mutation in this USH3-like family. Candidate loci were identified using genomewide SNP-array-based homozygosity mapping followed by targeted enrichment and next-generation sequencing. Using a capture array targeting the three identified homozygosity-by-descent regions on chromosomes 1q43-q44, 20p13-p12.2 and 20p11.23-q12, we identified a homozygous nonsense mutation, p.Arg65X, in ABHD12 segregating with the phenotype. Mutations of ABHD12, an enzyme hydrolyzing an endocannabinoid lipid transmitter, cause PHARC (polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and early-onset cataract). After the identification of the ABHD12 mutation in this family, one patient underwent neurological examination which revealed ataxia, but no polyneuropathy. ABHD12 is not known to be related to the USH protein interactome. The phenotype of our patient represents a variant of PHARC, an entity that should be taken into account as differential diagnosis for USH3. Our study demonstrates the potential of comprehensive genetic analysis for improving the clinical diagnosis.

  1. Targeted next-generation sequencing identifies a homozygous nonsense mutation in ABHD12, the gene underlying PHARC, in a family clinically diagnosed with Usher syndrome type 3

    Directory of Open Access Journals (Sweden)

    Eisenberger Tobias


    Full Text Available Abstract Background Usher syndrome (USH is an autosomal recessive genetically heterogeneous disorder with congenital sensorineural hearing impairment and retinitis pigmentosa (RP. We have identified a consanguineous Lebanese family with two affected members displaying progressive hearing loss, RP and cataracts, therefore clinically diagnosed as USH type 3 (USH3. Our study was aimed at the identification of the causative mutation in this USH3-like family. Methods Candidate loci were identified using genomewide SNP-array-based homozygosity mapping followed by targeted enrichment and next-generation sequencing. Results Using a capture array targeting the three identified homozygosity-by-descent regions on chromosomes 1q43-q44, 20p13-p12.2 and 20p11.23-q12, we identified a homozygous nonsense mutation, p.Arg65X, in ABHD12 segregating with the phenotype. Conclusion Mutations of ABHD12, an enzyme hydrolyzing an endocannabinoid lipid transmitter, cause PHARC (polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and early-onset cataract. After the identification of the ABHD12 mutation in this family, one patient underwent neurological examination which revealed ataxia, but no polyneuropathy. ABHD12 is not known to be related to the USH protein interactome. The phenotype of our patient represents a variant of PHARC, an entity that should be taken into account as differential diagnosis for USH3. Our study demonstrates the potential of comprehensive genetic analysis for improving the clinical diagnosis.

  2. Bioinformatic analysis of neurotropic HIV envelope sequences identifies polymorphisms in the gp120 bridging sheet that increase macrophage-tropism through enhanced interactions with CCR5

    International Nuclear Information System (INIS)

    Mefford, Megan E.; Kunstman, Kevin; Wolinsky, Steven M.; Gabuzda, Dana


    Macrophages express low levels of the CD4 receptor compared to T-cells. Macrophage-tropic HIV strains replicating in brain of untreated patients with HIV-associated dementia (HAD) express Envs that are adapted to overcome this restriction through mechanisms that are poorly understood. Here, bioinformatic analysis of env sequence datasets together with functional studies identified polymorphisms in the β3 strand of the HIV gp120 bridging sheet that increase M-tropism. D197, which results in loss of an N-glycan located near the HIV Env trimer apex, was detected in brain in some HAD patients, while position 200 was estimated to be under positive selection. D197 and T/V200 increased fusion and infection of cells expressing low CD4 by enhancing gp120 binding to CCR5. These results identify polymorphisms in the HIV gp120 bridging sheet that overcome the restriction to macrophage infection imposed by low CD4 through enhanced gp120–CCR5 interactions, thereby promoting infection of brain and other macrophage-rich tissues. - Highlights: • We analyze HIV Env sequences and identify amino acids in beta 3 of the gp120 bridging sheet that enhance macrophage tropism. • These amino acids at positions 197 and 200 are present in brain of some patients with HIV-associated dementia. • D197 results in loss of a glycan near the HIV Env trimer apex, which may increase exposure of V3. • These variants may promote infection of macrophages in the brain by enhancing gp120–CCR5 interactions

  3. Integration of sequence data from a Consanguineous family with genetic data from an outbred population identifies PLB1 as a candidate rheumatoid arthritis risk gene.

    Directory of Open Access Journals (Sweden)

    Yukinori Okada

    Full Text Available Integrating genetic data from families with highly penetrant forms of disease together with genetic data from outbred populations represents a promising strategy to uncover the complete frequency spectrum of risk alleles for complex traits such as rheumatoid arthritis (RA. Here, we demonstrate that rare, low-frequency and common alleles at one gene locus, phospholipase B1 (PLB1, might contribute to risk of RA in a 4-generation consanguineous pedigree (Middle Eastern ancestry and also in unrelated individuals from the general population (European ancestry. Through identity-by-descent (IBD mapping and whole-exome sequencing, we identified a non-synonymous c.2263G>C (p.G755R mutation at the PLB1 gene on 2q23, which significantly co-segregated with RA in family members with a dominant mode of inheritance (P = 0.009. We further evaluated PLB1 variants and risk of RA using a GWAS meta-analysis of 8,875 RA cases and 29,367 controls of European ancestry. We identified significant contributions of two independent non-coding variants near PLB1 with risk of RA (rs116018341 [MAF = 0.042] and rs116541814 [MAF = 0.021], combined P = 3.2 × 10(-6. Finally, we performed deep exon sequencing of PLB1 in 1,088 RA cases and 1,088 controls (European ancestry, and identified suggestive dispersion of rare protein-coding variant frequencies between cases and controls (P = 0.049 for C-alpha test and P = 0.055 for SKAT. Together, these data suggest that PLB1 is a candidate risk gene for RA. Future studies to characterize the full spectrum of genetic risk in the PLB1 genetic locus are warranted.

  4. Bioinformatic analysis of neurotropic HIV envelope sequences identifies polymorphisms in the gp120 bridging sheet that increase macrophage-tropism through enhanced interactions with CCR5

    Energy Technology Data Exchange (ETDEWEB)

    Mefford, Megan E., E-mail: [Department of Cancer Immunology and AIDS, Dana-Farber Cancer Institute, Boston, MA (United States); Kunstman, Kevin, E-mail: [Northwestern University Medical School, Chicago, IL (United States); Wolinsky, Steven M., E-mail: [Northwestern University Medical School, Chicago, IL (United States); Gabuzda, Dana, E-mail: [Department of Cancer Immunology and AIDS, Dana-Farber Cancer Institute, Boston, MA (United States); Department of Neurology (Microbiology and Immunobiology), Harvard Medical School, Boston, MA (United States)


    Macrophages express low levels of the CD4 receptor compared to T-cells. Macrophage-tropic HIV strains replicating in brain of untreated patients with HIV-associated dementia (HAD) express Envs that are adapted to overcome this restriction through mechanisms that are poorly understood. Here, bioinformatic analysis of env sequence datasets together with functional studies identified polymorphisms in the β3 strand of the HIV gp120 bridging sheet that increase M-tropism. D197, which results in loss of an N-glycan located near the HIV Env trimer apex, was detected in brain in some HAD patients, while position 200 was estimated to be under positive selection. D197 and T/V200 increased fusion and infection of cells expressing low CD4 by enhancing gp120 binding to CCR5. These results identify polymorphisms in the HIV gp120 bridging sheet that overcome the restriction to macrophage infection imposed by low CD4 through enhanced gp120–CCR5 interactions, thereby promoting infection of brain and other macrophage-rich tissues. - Highlights: • We analyze HIV Env sequences and identify amino acids in beta 3 of the gp120 bridging sheet that enhance macrophage tropism. • These amino acids at positions 197 and 200 are present in brain of some patients with HIV-associated dementia. • D197 results in loss of a glycan near the HIV Env trimer apex, which may increase exposure of V3. • These variants may promote infection of macrophages in the brain by enhancing gp120–CCR5 interactions.

  5. Next-generation sequencing to identify candidate genes and develop diagnostic markers for a novel Phytophthora resistance gene, RpsHC18, in soybean. (United States)

    Zhong, Chao; Sun, Suli; Li, Yinping; Duan, Canxing; Zhu, Zhendong


    A novel Phytophthora sojae resistance gene RpsHC18 was identified and finely mapped on soybean chromosome 3. Two NBS-LRR candidate genes were identified and two diagnostic markers of RpsHC18 were developed. Phytophthora root rot caused by Phytophthora sojae is a destructive disease of soybean. The most effective disease-control strategy is to deploy resistant cultivars carrying Phytophthora-resistant Rps genes. The soybean cultivar Huachun 18 has a broad and distinct resistance spectrum to 12 P. sojae isolates. Quantitative trait loci sequencing (QTL-seq), based on the whole-genome resequencing (WGRS) of two extreme resistant and susceptible phenotype bulks from an F 2:3 population, was performed, and one 767-kb genomic region with ΔSNP-index ≥ 0.9 on chromosome 3 was identified as the RpsHC18 candidate region in Huachun 18. The candidate region was reduced to a 146-kb region by fine mapping. Nonsynonymous SNP and haplotype analyses were carried out in the 146-kb region among ten soybean genotypes using WGRS. Four specific nonsynonymous SNPs were identified in two nucleotide-binding sites-leucine-rich repeat (NBS-LRR) genes, RpsHC18-NBL1 and RpsHC18-NBL2, which were considered to be the candidate genes. Finally, one specific SNP marker in each candidate gene was successfully developed using a tetra-primer ARMS-PCR assay, and the two markers were verified to be specific for RpsHC18 and to effectively distinguish other known Rps genes. In this study, we applied an integrated genomic-based strategy combining WGRS with traditional genetic mapping to identify RpsHC18 candidate genes and develop diagnostic markers. These results suggest that next-generation sequencing is a precise, rapid and cost-effective way to identify candidate genes and develop diagnostic markers, and it can accelerate Rps gene cloning and marker-assisted selection for breeding of P. sojae-resistant soybean cultivars.

  6. RNA Sequencing Identifies Upregulated Kyphoscoliosis Peptidase and Phosphatidic Acid Signaling Pathways in Muscle Hypertrophy Generated by Transgenic Expression of Myostatin Propeptide

    Directory of Open Access Journals (Sweden)

    Yuanxin Miao


    Full Text Available Myostatin (MSTN, a member of the transforming growth factor-β superfamily, plays a crucial negative role in muscle growth. MSTN mutations or inhibitions can dramatically increase muscle mass in most mammal species. Previously, we generated a transgenic mouse model of muscle hypertrophy via the transgenic expression of the MSTN N-terminal propeptide cDNA under the control of the skeletal muscle-specific MLC1 promoter. Here, we compare the mRNA profiles between transgenic mice and wild-type littermate controls with a high-throughput RNA sequencing method. The results show that 132 genes were significantly differentially expressed between transgenic mice and wild-type control mice; 97 of these genes were up-regulated, and 35 genes were down-regulated in the skeletal muscle. Several genes that had not been reported to be involved in muscle hypertrophy were identified, including up-regulated myosin binding protein H (mybph, and zinc metallopeptidase STE24 (Zmpste24. In addition, kyphoscoliosis peptidase (Ky, which plays a vital role in muscle growth, was also up-regulated in the transgenic mice. Interestingly, a pathway analysis based on grouping the differentially expressed genes uncovered that cardiomyopathy-related pathways and phosphatidic acid (PA pathways (Dgki, Dgkz, Plcd4 were up-regulated. Increased PA signaling may increase mTOR signaling, resulting in skeletal muscle growth. The findings of the RNA sequencing analysis help to understand the molecular mechanisms of muscle hypertrophy caused by MSTN inhibition.

  7. RNA sequencing on Amomum villosum Lour. induced by MeJA identifies the genes of WRKY and terpene synthases involved in terpene biosynthesis. (United States)

    He, Xueying; Wang, Huan; Yang, Jinfen; Deng, Ke; Wang, Teng


    Amomum villosum Lour. is an important Chinese medicinal plant that has diverse medicinal functions, and mainly contains volatile terpenes. This study aims to explore the WRKY transcription factors (TFs) and terpene synthase (TPS) unigenes that might be involved in terpene biosynthesis in A. villosum, and thus providing some new information on the regulation of terpenes in plants. RNA sequencing of A. villosum induced by methyl jasmonate (MeJA) revealed that the WRKY family was the second largest TF family in the transcriptome. Thirty-six complete WRKY domain sequences were expressed in response to MeJA. Further, six WRKY unigenes were highly correlated with eight deduced TPS unigenes. Ultimately, we combined the terpene abundance with the expression of candidate WRKY TFs and TPS unigenes to presume a possible model wherein AvWRKY61, AvWRKY28, and AvWRKY40 might coordinately trans-activate the AvNeoD promoter. We propose an approach to further investigate TF unigenes that might be involved in terpenoid biosynthesis, and identified four unigenes for further analyses.

  8. RNA sequencing identifies upregulated kyphoscoliosis peptidase and phosphatidic acid signaling pathways in muscle hypertrophy generated by transgenic expression of myostatin propeptide. (United States)

    Miao, Yuanxin; Yang, Jinzeng; Xu, Zhong; Jing, Lu; Zhao, Shuhong; Li, Xinyun


    Myostatin (MSTN), a member of the transforming growth factor-β superfamily, plays a crucial negative role in muscle growth. MSTN mutations or inhibitions can dramatically increase muscle mass in most mammal species. Previously, we generated a transgenic mouse model of muscle hypertrophy via the transgenic expression of the MSTN N-terminal propeptide cDNA under the control of the skeletal muscle-specific MLC1 promoter. Here, we compare the mRNA profiles between transgenic mice and wild-type littermate controls with a high-throughput RNA sequencing method. The results show that 132 genes were significantly differentially expressed between transgenic mice and wild-type control mice; 97 of these genes were up-regulated, and 35 genes were down-regulated in the skeletal muscle. Several genes that had not been reported to be involved in muscle hypertrophy were identified, including up-regulated myosin binding protein H (mybph), and zinc metallopeptidase STE24 (Zmpste24). In addition, kyphoscoliosis peptidase (Ky), which plays a vital role in muscle growth, was also up-regulated in the transgenic mice. Interestingly, a pathway analysis based on grouping the differentially expressed genes uncovered that cardiomyopathy-related pathways and phosphatidic acid (PA) pathways (Dgki, Dgkz, Plcd4) were up-regulated. Increased PA signaling may increase mTOR signaling, resulting in skeletal muscle growth. The findings of the RNA sequencing analysis help to understand the molecular mechanisms of muscle hypertrophy caused by MSTN inhibition.

  9. Applying Unique Molecular Identifiers in Next Generation Sequencing Reveals a Constrained Viral Quasispecies Evolution under Cross-Reactive Antibody Pressure Targeting Long Alpha Helix of Hemagglutinin (United States)

    Hauck, Nastasja C.; Kirpach, Josiane; Kiefer, Christina; Farinelle, Sophie; Morris, Stephen A.; Muller, Claude P.; Lu, I-Na


    To overcome yearly efforts and costs for the production of seasonal influenza vaccines, new approaches for the induction of broadly protective and long-lasting immune responses have been developed in the past decade. To warrant safety and efficacy of the emerging crossreactive vaccine candidates, it is critical to understand the evolution of influenza viruses in response to these new immune pressures. Here we applied unique molecular identifiers in next generation sequencing to analyze the evolution of influenza quasispecies under in vivo antibody pressure targeting the hemagglutinin (HA) long alpha helix (LAH). Our vaccine targeting LAH of hemagglutinin elicited significant seroconversion and protection against homologous and heterologous influenza virus strains in mice. The vaccine not only significantly reduced lung viral titers, but also induced a well-known bottleneck effect by decreasing virus diversity. In contrast to the classical bottleneck effect, here we showed a significant increase in the frequency of viruses with amino acid sequences identical to that of vaccine targeting LAH domain. No escape mutant emerged after vaccination. These results not only support the potential of a universal influenza vaccine targeting the conserved LAH domains, but also clearly demonstrate that the well-established bottleneck effect on viral quasispecies evolution does not necessarily generate escape mutants. PMID:29587397

  10. De novo RNA sequencing transcriptome of Rhododendron obtusum identified the early heat response genes involved in the transcriptional regulation of photosynthesis.

    Directory of Open Access Journals (Sweden)

    Linchuan Fang

    Full Text Available Rhododendron spp. is an important ornamental species that is widely cultivated for landscape worldwide. Heat stress is a major obstacle for its cultivation in south China. Previous studies on rhododendron principally focused on its physiological and biochemical processes, which are involved in a series of stress tolerance. However, molecular or genetic properties of rhododendron's response to heat stress are still poorly understood. The phenotype and chlorophyll fluorescence kinetics parameters of four rhododendron cultivars were compared under normal or heat stress conditions, and a cultivar with highest heat tolerance, "Yanzhimi" (R. obtusum was selected for transcriptome sequencing. A total of 325,429,240 high quality reads were obtained and assembled into 395,561 transcripts and 92,463 unigenes. Functional annotation showed that 38,724 unigenes had sequence similarity to known genes in at least one of the proteins or nucleotide databases used in this study. These 38,724 unigenes were categorized into 51 functional groups based on Gene Ontology classification and were blasted to 24 known cluster of orthologous groups. A total of 973 identified unigenes belonged to 57 transcription factor families, including the stress-related HSF, DREB, ZNF, and NAC genes. Photosynthesis was significantly enriched in the Kyoto Encyclopedia of Genes and Genomes pathway, and the changed expression pattern was illustrated. The key pathways and signaling components that contribute to heat tolerance in rhododendron were revealed. These results provide a potentially valuable resource that can be used for heat-tolerance breeding.

  11. Exome sequencing identifies a novel mutation of the GDI1 gene in a Chinese non-syndromic X-linked intellectual disability family

    Directory of Open Access Journals (Sweden)

    Yongheng Duan


    Full Text Available Abstract X-linked intellectual disability (XLID has been associated with various genes. Diagnosis of XLID, especially for non-syndromic ones (NS-XLID, is often hampered by the heterogeneity of this disease. Here we report the case of a Chinese family in which three males suffer from intellectual disability (ID. The three patients shared the same phenotype: no typical clinical manifestation other than IQ score ≤ 70. For a genetic diagnosis for this family we carried out whole exome sequencing on the proband, and validated 16 variants of interest in the genomic DNA of all the family members. A missense mutation (c.710G > T, which mapped to exon 6 of the Rab GDP-Dissociation Inhibitor 1 (GDI1 gene, was found segregating with the ID phenotype, and this mutation changes the 237th position in the guanosine diphosphate dissociation inhibitor (GDI protein from glycine to valine (p. Gly237Val. Through molecular dynamics simulations we found that this substitution results in a conformational change of GDI, possibly affecting the Rab-binding capacity of this protein. In conclusion, our study identified a novel GDI1 mutation that is possibly NS-XLID causative, and showed that whole exome sequencing provides advantages for detecting novel ID-associated variants and can greatly facilitate the genetic diagnosis of the disease.

  12. Whole Exome Sequencing Identified a Novel Heterozygous Mutation in HMBS Gene in a Chinese Patient With Acute Intermittent Porphyria With Rare Type of Mild Anemia

    Directory of Open Access Journals (Sweden)

    Yongjiang Zheng


    Full Text Available Acute intermittent porphyria (AIP is a rare hereditary metabolic disease with an autosomal dominant mode of inheritance. Germline mutations of HMBS gene causes AIP. Mutation of HMBS gene results into the partial deficiency of the heme biosynthetic enzyme hydroxymethylbilane synthase. AIP is clinically manifested with abdominal pain, vomiting, and neurological complaints. Additionally, an extreme phenotypic heterogeneity has been reported in AIP patients with mutations in HMBS gene. Here, we investigated a Chinese patient with AIP. The proband is a 28-year-old Chinese male manifested with severe stomach ache, constipation, nausea and depression. Proband’s father and mother is normal. Proband’s blood sample was collected and genomic DNA was extracted. Whole exome sequencing and Sanger sequencing identified a heterozygous novel single nucleotide deletion (c.809delC in exon 12 of HMBS gene in the proband. This mutation leads to frameshift followed by formation of a truncated (p.Ala270Valfs∗2 HMBS protein with 272 amino acids comparing with the wild type HMBS protein of 361 amino acids. This mutation has not been found in proband’s unaffected parents as well as in 100 healthy normal control. According to the variant interpretation guidelines of American College of Medical Genetics and Genomics (ACMG, this variant is classified as “likely pathogenic” variant. Our findings expand the mutational spectra of HMBS gene related AIP which are significant for screening and genetic diagnosis for AIP.

  13. Applying Unique Molecular Identifiers in Next Generation Sequencing Reveals a Constrained Viral Quasispecies Evolution under Cross-Reactive Antibody Pressure Targeting Long Alpha Helix of Hemagglutinin

    Directory of Open Access Journals (Sweden)

    Nastasja C. Hauck


    Full Text Available To overcome yearly efforts and costs for the production of seasonal influenza vaccines, new approaches for the induction of broadly protective and long-lasting immune responses have been developed in the past decade. To warrant safety and efficacy of the emerging crossreactive vaccine candidates, it is critical to understand the evolution of influenza viruses in response to these new immune pressures. Here we applied unique molecular identifiers in next generation sequencing to analyze the evolution of influenza quasispecies under in vivo antibody pressure targeting the hemagglutinin (HA long alpha helix (LAH. Our vaccine targeting LAH of hemagglutinin elicited significant seroconversion and protection against homologous and heterologous influenza virus strains in mice. The vaccine not only significantly reduced lung viral titers, but also induced a well-known bottleneck effect by decreasing virus diversity. In contrast to the classical bottleneck effect, here we showed a significant increase in the frequency of viruses with amino acid sequences identical to that of vaccine targeting LAH domain. No escape mutant emerged after vaccination. These results not only support the potential of a universal influenza vaccine targeting the conserved LAH domains, but also clearly demonstrate that the well-established bottleneck effect on viral quasispecies evolution does not necessarily generate escape mutants.

  14. De novo RNA sequencing transcriptome of Rhododendron obtusum identified the early heat response genes involved in the transcriptional regulation of photosynthesis (United States)

    Tong, Jun; Dong, Yanfang; Xu, Dongyun; Mao, Jing; Zhou, Yuan


    Rhododendron spp. is an important ornamental species that is widely cultivated for landscape worldwide. Heat stress is a major obstacle for its cultivation in south China. Previous studies on rhododendron principally focused on its physiological and biochemical processes, which are involved in a series of stress tolerance. However, molecular or genetic properties of rhododendron’s response to heat stress are still poorly understood. The phenotype and chlorophyll fluorescence kinetics parameters of four rhododendron cultivars were compared under normal or heat stress conditions, and a cultivar with highest heat tolerance, “Yanzhimi” (R. obtusum) was selected for transcriptome sequencing. A total of 325,429,240 high quality reads were obtained and assembled into 395,561 transcripts and 92,463 unigenes. Functional annotation showed that 38,724 unigenes had sequence similarity to known genes in at least one of the proteins or nucleotide databases used in this study. These 38,724 unigenes were categorized into 51 functional groups based on Gene Ontology classification and were blasted to 24 known cluster of orthologous groups. A total of 973 identified unigenes belonged to 57 transcription factor families, including the stress-related HSF, DREB, ZNF, and NAC genes. Photosynthesis was significantly enriched in the Kyoto Encyclopedia of Genes and Genomes pathway, and the changed expression pattern was illustrated. The key pathways and signaling components that contribute to heat tolerance in rhododendron were revealed. These results provide a potentially valuable resource that can be used for heat-tolerance breeding. PMID:29059200

  15. Genome Sequencing Identifies Two Nearly Unchanged Strains of Persistent Listeria monocytogenes Isolated at Two Different Fish Processing Plants Sampled 6 Years Apart

    DEFF Research Database (Denmark)

    Holch, Anne; Webb, Kristen; Lukjancenko, Oksana


    Listeria monocytogenes is a food-borne human-pathogenic bacterium that can cause infections with a high mortality rate. It has a remarkable ability to persist in food processing facilities. Here we report the genome sequences for two L. monocytogenes strains (N53-1 and La111) that were isolated 6...... that has been isolated as a persistent subtype in several European countries. The purpose of this study was to use genome analyses to identify genes or proteins that could contribute to persistence. In a genome comparison, the two persistent strains were extremely similar and collectively differed from...... are required to determine if the absence of these genes promotes persistence. While the genome comparison did not point to a clear physiological explanation of the persistent phenotype, the remarkable similarity between the two strains indicates that subtypes with specific traits are selected for in the food...

  16. Complete re-sequencing of a 2Mb topological domain encompassing the FTO/IRXB genes identifies a novel obesity-associated region upstream of IRX5

    DEFF Research Database (Denmark)

    Hunt, Lilian E; Noyvert, Boris; Bhaw-Rosun, Leena


    BACKGROUND: Association studies have identified a number of loci that contribute to an increased body mass index (BMI), the strongest of which is in the first intron of the FTO gene on human chromosome 16q12.2. However, this region is both non-coding and under strong linkage disequilibrium, making...... it recalcitrant to functional interpretation. Furthermore, the FTO gene is located within a complex cis-regulatory landscape defined by a topologically associated domain that includes the IRXB gene cluster, a trio of developmental regulators. Consequently, at least three genes in this interval have been...... implicated in the aetiology of obesity. METHODS: Here, we sequence a 2 Mb region encompassing the FTO, RPGRIP1L and IRXB cluster genes in 284 individuals from a well-characterised study group of Danish men containing extremely overweight young adults and controls. We further replicate our findings both...

  17. TBX1 mutation identified by exome sequencing in a Japanese family with 22q11.2 deletion syndrome-like craniofacial features and hypocalcemia.

    Directory of Open Access Journals (Sweden)

    Tsutomu Ogata

    Full Text Available BACKGROUND: Although TBX1 mutations have been identified in patients with 22q11.2 deletion syndrome (22q11.2DS-like phenotypes including characteristic craniofacial features, cardiovascular anomalies, hypoparathyroidism, and thymic hypoplasia, the frequency of TBX1 mutations remains rare in deletion-negative patients. Thus, it would be reasonable to perform a comprehensive genetic analysis in deletion-negative patients with 22q11.2DS-like phenotypes. METHODOLOGY/PRINCIPAL FINDINGS: We studied three subjects with craniofacial features and hypocalcemia (group 1, two subjects with craniofacial features alone (group 2, and three subjects with normal phenotype within a single Japanese family. Fluorescence in situ hybridization analysis excluded chromosome 22q11.2 deletion, and genomewide array comparative genomic hybridization analysis revealed no copy number change specific to group 1 or groups 1+2. However, exome sequencing identified a heterozygous TBX1 frameshift mutation (c.1253delA, p.Y418fsX459 specific to groups 1+2, as well as six missense variants and two in-frame microdeletions specific to groups 1+2 and two missense variants specific to group 1. The TBX1 mutation resided at exon 9C and was predicted to produce a non-functional truncated protein missing the nuclear localization signal and most of the transactivation domain. CONCLUSIONS/SIGNIFICANCE: Clinical features in groups 1+2 are well explained by the TBX1 mutation, while the clinical effects of the remaining variants are largely unknown. Thus, the results exemplify the usefulness of exome sequencing in the identification of disease-causing mutations in familial disorders. Furthermore, the results, in conjunction with the previous data, imply that TBX1 isoform C is the biologically essential variant and that TBX1 mutations are associated with a wide phenotypic spectrum, including most of 22q11.2DS phenotypes.

  18. Targeted next-generation sequencing identifies a novel nonsense mutation in SPTB for hereditary spherocytosis: A case report of a Korean family. (United States)

    Shin, Soyoung; Jang, Woori; Kim, Myungshin; Kim, Yonggoo; Park, Suk Young; Park, Joonhong; Yang, Young Jun


    Hereditary spherocytosis (HS) is an inherited disorder characterized by the presence of spherical-shaped red blood cells (RBCs) on the peripheral blood (PB) smear. To date, a number of mutations in 5 genes have been identified and the mutations in SPTB gene account for about 20% patients. A 65-year-old female had been diagnosed as hemolytic anemia 30 years ago, based on a history of persistent anemia and hyperbilirubinemia for several years. She received RBC transfusion several times and a cholecystectomy roughly 20 years ago before. Round, densely staining spherical-shaped erythrocytes (spherocytes) were frequently found on the PB smear. Numerous spherocytes were frequently found in the PB smears of symptomatic family members, her 3rd son and his 2 grandchildren. One heterozygous mutation of SPTB was identified by targeted next-generation sequencing (NGS). The nonsense mutation, c.1956G>A (p.Trp652*), in exon 13 was confirmed by Sanger sequencing and thus the proband was diagnosed with HS. The proband underwent a splenectomy due to transfusion-refractory anemia and splenomegaly. After the splenectomy, her hemoglobin level improved to normal range (14.1 g/dL) and her bilirubin levels decreased dramatically (total bilirubin 1.9 mg/dL; direct bilirubin 0.6 mg/dL). We suggest that NGS of causative genes could be a useful diagnostic tool for the genetically heterogeneous RBC membrane disorders, especially in cases with a mild or atypical clinical manifestation. Copyright © 2017 The Authors. Published by Wolters Kluwer Health, Inc. All rights reserved.

  19. Exome Sequencing Identified a Splice Site Mutation in FHL1 that Causes Uruguay Syndrome, an X-Linked Disorder With Skeletal Muscle Hypertrophy and Premature Cardiac Death. (United States)

    Xue, Yuan; Schoser, Benedikt; Rao, Aliz R; Quadrelli, Roberto; Vaglio, Alicia; Rupp, Verena; Beichler, Christine; Nelson, Stanley F; Schapacher-Tilp, Gudrun; Windpassinger, Christian; Wilcox, William R


    Previously, we reported a rare X-linked disorder, Uruguay syndrome in a single family. The main features are pugilistic facies, skeletal deformities, and muscular hypertrophy despite a lack of exercise and cardiac ventricular hypertrophy leading to premature death. An ≈19 Mb critical region on X chromosome was identified through identity-by-descent analysis of 3 affected males. Exome sequencing was conducted on one affected male to identify the disease-causing gene and variant. A splice site variant (c.502-2A>G) in the FHL1 gene was highly suspicious among other candidate genes and variants. FHL1A is the predominant isoform of FHL1 in cardiac and skeletal muscle. Sequencing cDNA showed the splice site variant led to skipping of exons 6 of the FHL1A isoform, equivalent to the FHL1C isoform. Targeted analysis showed that this splice site variant cosegregated with disease in the family. Western blot and immunohistochemical analysis of muscle from the proband showed a significant decrease in protein expression of FHL1A. Real-time polymerase chain reaction analysis of different isoforms of FHL1 demonstrated that the FHL1C is markedly increased. Mutations in the FHL1 gene have been reported in disorders with skeletal and cardiac myopathy but none has the skeletal or facial phenotype seen in patients with Uruguay syndrome. Our data suggest that a novel FHL1 splice site variant results in the absence of FHL1A and the abundance of FHL1C, which may contribute to the complex and severe phenotype. Mutation screening of the FHL1 gene should be considered for patients with uncharacterized myopathies and cardiomyopathies. © 2016 American Heart Association, Inc.

  20. Whole exome sequencing of a consanguineous family identifies the possible modifying effect of a globally rare AK5 allelic variant in celiac disease development among Saudi patients.

    Directory of Open Access Journals (Sweden)

    Jumana Yousuf Al-Aama

    Full Text Available Celiac disease (CD, a multi-factorial auto-inflammatory disease of the small intestine, is known to occur in both sporadic and familial forms. Together HLA and Non-HLA genes can explain up to 50% of CD's heritability. In order to discover the missing heritability due to rare variants, we have exome sequenced a consanguineous Saudi family presenting CD in an autosomal recessive (AR pattern. We have identified a rare homozygous insertion c.1683_1684insATT, in the conserved coding region of AK5 gene that showed classical AR model segregation in this family. Sequence validation of 200 chromosomes each of sporadic CD cases and controls, revealed that this extremely rare (EXac MAF 0.000008 mutation is highly penetrant among general Saudi populations (MAF is 0.62. Genotype and allelic distribution analysis have indicated that this AK5 (c.1683_1684insATT mutation is negatively selected among patient groups and positively selected in the control group, in whom it may modify the risk against CD development [p<0.002]. Our observation gains additional support from computational analysis which predicted that Iso561 insertion shifts the existing H-bonds between 400th and 556th amino acid residues lying near the functional domain of adenylate kinase. This shuffling of amino acids and their H-bond interactions is likely to disturb the secondary structure orientation of the polypeptide and induces the gain-of-function in nucleoside phosphate kinase activity of AK5, which may eventually down-regulates the reactivity potential of CD4+ T-cells against gluten antigens. Our study underlines the need to have population-specific genome databases to avoid false leads and to identify true candidate causal genes for the familial form of celiac disease.

  1. Whole-exome sequencing of muscle-invasive bladder cancer identifies recurrent mutations of UNC5C and prognostic importance of DNA repair gene mutations on survival. (United States)

    Yap, Kai Lee; Kiyotani, Kazuma; Tamura, Kenji; Antic, Tatjana; Jang, Miran; Montoya, Magdeline; Campanile, Alexa; Yew, Poh Yin; Ganshert, Cory; Fujioka, Tomoaki; Steinberg, Gary D; O'Donnell, Peter H; Nakamura, Yusuke


    Because of suboptimal outcomes in muscle-invasive bladder cancer even with multimodality therapy, determination of potential genetic drivers offers the possibility of improving therapeutic approaches and discovering novel prognostic indicators. Using pTN staging, we case-matched 81 patients with resected ≥pT2 bladder cancers for whom perioperative chemotherapy use and disease recurrence status were known. Whole-exome sequencing was conducted in 43 cases to identify recurrent somatic mutations and targeted sequencing of 10 genes selected from the initial screening in an additional 38 cases was completed. Mutational profiles along with clinicopathologic information were correlated with recurrence-free survival (RFS) in the patients. We identified recurrent novel somatic mutations in the gene UNC5C (9.9%), in addition to TP53 (40.7%), KDM6A (21.0%), and TSC1 (12.3%). Patients who were carriers of somatic mutations in DNA repair genes (one or more of ATM, ERCC2, FANCD2, PALB2, BRCA1, or BRCA2) had a higher overall number of somatic mutations (P = 0.011). Importantly, after a median follow-up of 40.4 months, carriers of somatic mutations (n = 25) in any of these six DNA repair genes had significantly enhanced RFS compared with noncarriers [median, 32.4 vs. 14.8 months; hazard ratio of 0.46, 95% confidence interval (CI), 0.22-0.98; P = 0.0435], after adjustment for pathologic pTN staging and independent of adjuvant chemotherapy usage. Better prognostic outcomes of individuals carrying somatic mutations in DNA repair genes suggest these mutations as favorable prognostic events in muscle-invasive bladder cancer. Additional mechanistic investigation into the previously undiscovered role of UNC5C in bladder cancer is warranted. ©2014 American Association for Cancer Research.

  2. A high-density genetic map for anchoring genome sequences and identifying QTLs associated with dwarf vine in pumpkin (Cucurbita maxima Duch.). (United States)

    Zhang, Guoyu; Ren, Yi; Sun, Honghe; Guo, Shaogui; Zhang, Fan; Zhang, Jie; Zhang, Haiying; Jia, Zhangcai; Fei, Zhangjun; Xu, Yong; Li, Haizhen


    Pumpkin (Cucurbita maxima Duch.) is an economically important crop belonging to the Cucurbitaceae family. However, very few genomic and genetic resources are available for this species. As part of our ongoing efforts to sequence the pumpkin genome, high-density genetic map is essential for anchoring and orienting the assembled scaffolds. In addition, a saturated genetic map can facilitate quantitative trait locus (QTL) mapping. A set of 186 F2 plants derived from the cross of pumpkin inbred lines Rimu and SQ026 were genotyped using the genotyping-by-sequencing approach. Using the SNPs we identified, a high-density genetic map containing 458 bin-markers was constructed, spanning a total genetic distance of 2,566.8 cM across the 20 linkage groups of C. maxima with a mean marker density of 5.60 cM. Using this map we were able to anchor 58 assembled scaffolds that covered about 194.5 Mb (71.7%) of the 271.4 Mb assembled pumpkin genome, of which 44 (183.0 Mb; 67.4%) were oriented. Furthermore, the high-density genetic map was used to identify genomic regions highly associated with an important agronomic trait, dwarf vine. Three QTLs on linkage groups (LGs) 1, 3 and 4, respectively, were recovered. One QTL, qCmB2, which was located in an interval of 0.42 Mb on LG 3, explained 21.4% phenotypic variations. Within qCmB2, one gene, Cma_004516, encoding the gibberellin (GA) 20-oxidase in the GA biosynthesis pathway, had a 1249-bp deletion in its promoter in bush type lines, and its expression level was significantly increased during the vine growth and higher in vine type lines than bush type lines, supporting Cma_004516 as a possible candidate gene controlling vine growth in pumpkin. A high-density pumpkin genetic map was constructed, which was used to successfully anchor and orient the assembled genome scaffolds, and to identify QTLs highly associated with pumpkin vine length. The map provided a valuable resource for gene cloning and marker assisted breeding in pumpkin and

  3. Inhibition of Hepatitis C Virus in Mice by a Small Interfering RNA Targeting a Highly Conserved Sequence in Viral IRES Pseudoknot.

    Directory of Open Access Journals (Sweden)

    Jae-Su Moon

    Full Text Available The hepatitis C virus (HCV internal ribosome entry site (IRES that directs cap-independent viral translation is a primary target for small interfering RNA (siRNA-based HCV antiviral therapy. However, identification of potent siRNAs against HCV IRES by bioinformatics-based siRNA design is a challenging task given the complexity of HCV IRES secondary and tertiary structures and association with multiple proteins, which can also dynamically change the structure of this cis-acting RNA element. In this work, we utilized siRNA tiling approach whereby siRNAs were tiled with overlapping sequences that were shifted by one or two nucleotides over the HCV IRES stem-loop structures III and IV spanning nucleotides (nts 277-343. Based on their antiviral activity, we mapped a druggable region (nts 313-343 where the targets of potent siRNAs were enriched. siIE22, which showed the greatest anti-HCV potency, targeted a highly conserved sequence across diverse HCV genotypes, locating within the IRES subdomain IIIf involved in pseudoknot formation. Stepwise target shifting toward the 5' or 3' direction by 1 or 2 nucleotides reduced the antiviral potency of siIE22, demonstrating the importance of siRNA accessibility to this highly structured and sequence-conserved region of HCV IRES for RNA interference. Nanoparticle-mediated systemic delivery of the stability-improved siIE22 derivative gs_PS1 siIE22, which contains a single phosphorothioate linkage on the guide strand, reduced the serum HCV genome titer by more than 4 log10 in a xenograft mouse model for HCV replication without generation of resistant variants. Our results provide a strategy for identifying potent siRNA species against a highly structured RNA target and offer a potential pan-HCV genotypic siRNA therapy that might be beneficial for patients resistant to current treatment regimens.

  4. Comparison of the accuracy of two conventional phenotypic methods and two MALDI-TOF MS systems with that of DNA sequencing analysis for correctly identifying clinically encountered yeasts. (United States)

    Chao, Qiao-Ting; Lee, Tai-Fen; Teng, Shih-Hua; Peng, Li-Yun; Chen, Ping-Hung; Teng, Lee-Jene; Hsueh, Po-Ren


    We assessed the accuracy of species-level identification of two commercially available matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) systems (Bruker Biotyper and Vitek MS) and two conventional phenotypic methods (Phoenix 100 YBC and Vitek 2 Yeast ID) with that of rDNA gene sequencing analysis among 200 clinical isolates of commonly encountered yeasts. The correct identification rates of the 200 yeast isolates to species or complex (Candida parapsilosis complex, C. guilliermondii complex and C. rugosa complex) levels by the Bruker Biotyper, Vitek MS (using in vitro devices [IVD] database), Phoenix 100 YBC and Vitek 2 Yeast ID (Sabouraud's dextrose agar) systems were 92.5%, 79.5%, 89%, and 74%, respectively. An additional 72 isolates of C. parapsilosis complex and 18 from the above 200 isolates (30 in each of C. parapsilosis, C. metapsilosis, and C. orthopsilosis) were also evaluated separately. Bruker Biotyper system could accurately identify all C. parapsilosis complex to species level. Using Vitek 2 MS (IVD) system, all C. parapsilosis but none of C. metapsilosis, or C. orthopsilosis could be accurately identified. Among the 89 yeasts misidentified by the Vitek 2 MS (IVD) system, 39 (43.8%), including 27 C. orthopsilosis isolates, could be correctly identified Using the Vitek MS Plus SARAMIS database for research use only. This resulted in an increase in the rate of correct identification of all yeast isolates (87.5%) by Vitek 2 MS. The two species in C. guilliermondii complex (C. guilliermondii and C. fermentati) isolates were correctly identified by cluster analysis of spectra generated by the Bruker Biotyper system. Based on the results obtained in the current study, MALDI-TOF MS systems present a promising alternative for the routine identification of yeast species, including clinically commonly and rarely encountered yeast species and several species belonging to C. parapsilosis complex, C. guilliermondii complex

  5. Comparison of the accuracy of two conventional phenotypic methods and two MALDI-TOF MS systems with that of DNA sequencing analysis for correctly identifying clinically encountered yeasts.

    Directory of Open Access Journals (Sweden)

    Qiao-Ting Chao

    Full Text Available We assessed the accuracy of species-level identification of two commercially available matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS systems (Bruker Biotyper and Vitek MS and two conventional phenotypic methods (Phoenix 100 YBC and Vitek 2 Yeast ID with that of rDNA gene sequencing analysis among 200 clinical isolates of commonly encountered yeasts. The correct identification rates of the 200 yeast isolates to species or complex (Candida parapsilosis complex, C. guilliermondii complex and C. rugosa complex levels by the Bruker Biotyper, Vitek MS (using in vitro devices [IVD] database, Phoenix 100 YBC and Vitek 2 Yeast ID (Sabouraud's dextrose agar systems were 92.5%, 79.5%, 89%, and 74%, respectively. An additional 72 isolates of C. parapsilosis complex and 18 from the above 200 isolates (30 in each of C. parapsilosis, C. metapsilosis, and C. orthopsilosis were also evaluated separately. Bruker Biotyper system could accurately identify all C. parapsilosis complex to species level. Using Vitek 2 MS (IVD system, all C. parapsilosis but none of C. metapsilosis, or C. orthopsilosis could be accurately identified. Among the 89 yeasts misidentified by the Vitek 2 MS (IVD system, 39 (43.8%, including 27 C. orthopsilosis isolates, could be correctly identified Using the Vitek MS Plus SARAMIS database for research use only. This resulted in an increase in the rate of correct identification of all yeast isolates (87.5% by Vitek 2 MS. The two species in C. guilliermondii complex (C. guilliermondii and C. fermentati isolates were correctly identified by cluster analysis of spectra generated by the Bruker Biotyper system. Based on the results obtained in the current study, MALDI-TOF MS systems present a promising alternative for the routine identification of yeast species, including clinically commonly and rarely encountered yeast species and several species belonging to C. parapsilosis complex, C. guilliermondii

  6. Older persons' worries expressed during home care visits: Exploring the content of cues and concerns identified by the Verona coding definitions of emotional sequences. (United States)

    Hafskjold, Linda; Eide, Tom; Holmström, Inger K; Sundling, Vibeke; van Dulmen, Sandra; Eide, Hilde


    Little is known about how older persons in home care express their concerns. Emotional cues and concerns can be identified by the Verona coding definitions of emotional sequences (VR-CoDES), but the method gives no insight into what causes the distress and the emotions involved. The aims of this study are to explore (1) older persons' worries and (2) the content of these expressions. An observational exploratory two-step approach was used to investigate audiotaped recordings from 38 Norwegian home care visits with older persons and nurse assistants. First, 206 cues and concerns were identified using VR-CoDES. Second, the content and context of these expressions were analysed inductively. Four main categories emerged: worries about relationships with others, worries about health care-related issues, worries about aging and bodily impairment, and life narratives and value issues, with several subcategories showing the causes of worry and emotions involved. The two-step approach provides an in-depth knowledge of older persons' worries, causes of worries, and their related emotions. The subcategories described in a language close to the experience can be useful in practice development and communication training for students and health care providers. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  7. High-Throughput Sequencing Identifies MicroRNAs from Posterior Intestine of Loach (Misgurnus anguillicaudatus) and Their Response to Intestinal Air-Breathing Inhibition. (United States)

    Huang, Songqian; Cao, Xiaojuan; Tian, Xianchang; Wang, Weimin


    MicroRNAs (miRNAs) exert important roles in animal growth, immunity, and development, and regulate gene expression at the post-transcriptional level. Knowledges about the diversities of miRNAs and their roles in accessory air-breathing organs (ABOs) of fish remain unknown. In this work, we used high-throughput sequencing to identify known and novel miRNAs from the posterior intestine, an important ABO, in loach (Misgurnus anguillicaudatus) under normal and intestinal air-breathing inhibited conditions. A total of 204 known and 84 novel miRNAs were identified, while 47 miRNAs were differentially expressed between the two small RNA libraries (i.e. between the normal and intestinal air-breathing inhibited group). Potential miRNA target genes were predicted by combining our transcriptome data of the posterior intestine of the loach under the same conditions, and then annotated using COG, GO, KEGG, Swissprot and Nr databases. The regulatory networks of miRNAs and their target genes were analyzed. The abundances of nine known miRNAs were validated by qRT-PCR. The relative expression profiles of six known miRNAs and their eight corresponding target genes, and two novel potential miRNAs were also detected. Histological characteristics of the posterior intestines in both normal and air-breathing inhibited group were further analyzed. This study contributes to our understanding on the functions and molecular regulatory mechanisms of miRNAs in accessory air-breathing organs of fish.

  8. Germ-line variants identified by next generation sequencing in a panel of estrogen and cancer associated genes correlate with poor clinical outcome in Lynch syndrome patients. (United States)

    Jóri, Balazs; Kamps, Rick; Xanthoulea, Sofia; Delvoux, Bert; Blok, Marinus J; Van de Vijver, Koen K; de Koning, Bart; Oei, Felicia Trups; Tops, Carli M; Speel, Ernst Jm; Kruitwagen, Roy F; Gomez-Garcia, Encarna B; Romano, Andrea


    The risk to develop colorectal and endometrial cancers among subjects testing positive for a pathogenic Lynch syndrome mutation varies, making the risk prediction difficult. Genetic risk modifiers alter the risk conferred by inherited Lynch syndrome mutations, and their identification can improve genetic counseling. We aimed at identifying rare genetic modifiers of the risk of Lynch syndrome endometrial cancer. A family based approach was used to assess the presence of genetic risk modifiers among 35 Lynch syndrome mutation carriers having either a poor clinical phenotype (early age of endometrial cancer diagnosis or multiple cancers) or a neutral clinical phenotype. Putative genetic risk modifiers were identified by Next Generation Sequencing among a panel of 154 genes involved in endometrial physiology and carcinogenesis. A simple pipeline, based on an allele frequency lower than 0.001 and on predicted non-conservative amino-acid substitutions returned 54 variants that were considered putative risk modifiers. The presence of two or more risk modifying variants in women carrying a pathogenic Lynch syndrome mutation was associated with a poor clinical phenotype. A gene-panel is proposed that comprehends genes that can carry variants with putative modifying effects on the risk of Lynch syndrome endometrial cancer. Validation in further studies is warranted before considering the possible use of this tool in genetic counseling.

  9. Exome Capture and Massively Parallel Sequencing Identifies a Novel HPSE2 Mutation in a Saudi Arabian Child with Ochoa (Urofacial) Syndrome (United States)

    Al Badr, Wisam; Al Bader, Suha; Otto, Edgar; Hildebrandt, Friedhelm; Ackley, Todd; Peng, Weiping; Xu, Jishu; Li, Jun; Owens, Kailey M.; Bloom, David; Innis, Jeffrey W.


    We describe a child of Middle Eastern descent by first-cousin mating with idiopathic neurogenic bladder and high grade vesicoureteral reflux at 1 year of age, whose characteristic facial grimace led to the diagnosis of Ochoa (Urofacial) syndrome at age 5 years. We used homozygosity mapping, exome capture and paired end sequencing to identify the disease causing mutation in the proband. We reviewed the literature with respect to the urologic manifestations of Ochoa syndrome. A large region of marker homozygosity was observed at 10q24, consistent with known autosomal recessive inheritance, family consanguinity and previous genetic mapping in other families with Ochoa syndrome. A homozygous mutation was identified in the proband in HPSE2: c.1374_1378delTGTGC, a deletion of 5 nucleotides in exon 10 that is predicted to lead to a frameshift followed by replacement of 132 C-terminal amino acids with 153 novel amino acids (p.Ala458Alafsdel132ins153). This mutation is novel relative to very recently published mutations in HPSE2 in other families. Early intervention and recognition of Ochoa syndrome with control of risk factors and close surveillance will decrease complications and renal failure. PMID:21450525

  10. Identifying Active Faults by Improving Earthquake Locations with InSAR Data and Bayesian Estimation: The 2004 Tabuk (Saudi Arabia) Earthquake Sequence

    KAUST Repository

    Xu, Wenbin


    A sequence of shallow earthquakes of magnitudes ≤5.1 took place in 2004 on the eastern flank of the Red Sea rift, near the city of Tabuk in northwestern Saudi Arabia. The earthquakes could not be well located due to the sparse distribution of seismic stations in the region, making it difficult to associate the activity with one of the many mapped faults in the area and thus to improve the assessment of seismic hazard in the region. We used Interferometric Synthetic Aperture Radar (InSAR) data from the European Space Agency’s Envisat and ERS‐2 satellites to improve the location and source parameters of the largest event of the sequence (Mw 5.1), which occurred on 22 June 2004. The mainshock caused a small but distinct ∼2.7  cm displacement signal in the InSAR data, which reveals where the earthquake took place and shows that seismic reports mislocated it by 3–16 km. With Bayesian estimation, we modeled the InSAR data using a finite‐fault model in a homogeneous elastic half‐space and found the mainshock activated a normal fault, roughly 70 km southeast of the city of Tabuk. The southwest‐dipping fault has a strike that is roughly parallel to the Red Sea rift, and we estimate the centroid depth of the earthquake to be ∼3.2  km. Projection of the fault model uncertainties to the surface indicates that one of the west‐dipping normal faults located in the area and oriented parallel to the Red Sea is a likely source for the mainshock. The results demonstrate how InSAR can be used to improve locations of moderate‐size earthquakes and thus to identify currently active faults.

  11. Identifying Active Faults by Improving Earthquake Locations with InSAR Data and Bayesian Estimation: The 2004 Tabuk (Saudi Arabia) Earthquake Sequence

    KAUST Repository

    Xu, Wenbin; Dutta, Rishabh; Jonsson, Sigurjon


    A sequence of shallow earthquakes of magnitudes ≤5.1 took place in 2004 on the eastern flank of the Red Sea rift, near the city of Tabuk in northwestern Saudi Arabia. The earthquakes could not be well located due to the sparse distribution of seismic stations in the region, making it difficult to associate the activity with one of the many mapped faults in the area and thus to improve the assessment of seismic hazard in the region. We used Interferometric Synthetic Aperture Radar (InSAR) data from the European Space Agency’s Envisat and ERS‐2 satellites to improve the location and source parameters of the largest event of the sequence (Mw 5.1), which occurred on 22 June 2004. The mainshock caused a small but distinct ∼2.7  cm displacement signal in the InSAR data, which reveals where the earthquake took place and shows that seismic reports mislocated it by 3–16 km. With Bayesian estimation, we modeled the InSAR data using a finite‐fault model in a homogeneous elastic half‐space and found the mainshock activated a normal fault, roughly 70 km southeast of the city of Tabuk. The southwest‐dipping fault has a strike that is roughly parallel to the Red Sea rift, and we estimate the centroid depth of the earthquake to be ∼3.2  km. Projection of the fault model uncertainties to the surface indicates that one of the west‐dipping normal faults located in the area and oriented parallel to the Red Sea is a likely source for the mainshock. The results demonstrate how InSAR can be used to improve locations of moderate‐size earthquakes and thus to identify currently active faults.

  12. Integrative analysis of deep sequencing data identifies estrogen receptor early response genes and links ATAD3B to poor survival in breast cancer.

    Directory of Open Access Journals (Sweden)

    Kristian Ovaska

    Full Text Available Identification of responsive genes to an extra-cellular cue enables characterization of pathophysiologically crucial biological processes. Deep sequencing technologies provide a powerful means to identify responsive genes, which creates a need for computational methods able to analyze dynamic and multi-level deep sequencing data. To answer this need we introduce here a data-driven algorithm, SPINLONG, which is designed to search for genes that match the user-defined hypotheses or models. SPINLONG is applicable to various experimental setups measuring several molecular markers in parallel. To demonstrate the SPINLONG approach, we analyzed ChIP-seq data reporting PolII, estrogen receptor α (ERα, H3K4me3 and H2A.Z occupancy at five time points in the MCF-7 breast cancer cell line after estradiol stimulus. We obtained 777 ERa early responsive genes and compared the biological functions of the genes having ERα binding within 20 kb of the transcription start site (TSS to genes without such binding site. Our results show that the non-genomic action of ERα via the MAPK pathway, instead of direct ERa binding, may be responsible for early cell responses to ERα activation. Our results also indicate that the ERα responsive genes triggered by the genomic pathway are transcribed faster than those without ERα binding sites. The survival analysis of the 777 ERα responsive genes with 150 primary breast cancer tumors and in two independent validation cohorts indicated the ATAD3B gene, which does not have ERα binding site within 20 kb of its TSS, to be significantly associated with poor patient survival.

  13. Next-generation sequencing identifies deregulation of microRNAs involved in both innate and adaptive immune response in ALK+ ALCL.

    Directory of Open Access Journals (Sweden)

    Julia Steinhilber

    Full Text Available Anaplastic large cell lymphoma (ALCL is divided into two systemic diseases according to the expression of the anaplastic lymphoma kinase (ALK. We investigated the differential expression of miRNAs between ALK+ ALCL, ALK- ALCL cells and normal T-cells using next generation sequencing (NGS. In addition, a C/EBPβ-dependent miRNA profile was generated. The data were validated in primary ALCL cases. NGS identified 106 miRNAs significantly differentially expressed between ALK+ and ALK- ALCL and 228 between ALK+ ALCL and normal T-cells. We identified a signature of 56 miRNAs distinguishing ALK+ ALCL, ALK- ALCL and T-cells. The top candidates significant differentially expressed between ALK+ and ALK- ALCL included 5 upregulated miRNAs: miR-340, miR-203, miR-135b, miR-182, miR-183; and 7 downregulated: miR-196b, miR-155, miR-146a, miR-424, miR-503, miR-424*, miR-542-3p. The miR-17-92 cluster was also upregulated in ALK+ cells. Additionally, we identified a signature of 3 miRNAs significantly regulated by the transcription factor C/EBPβ, which is specifically overexpressed in ALK+ ALCL, including the miR-181 family. Of interest, miR-181a, which regulates T-cell differentiation and modulates TCR signalling strength, was significantly downregulated in ALK+ ALCL cases. In summary, our data reveal a miRNA signature linking ALK+ ALCL to a deregulated immune response and may reflect the abnormal TCR antigen expression known in ALK+ ALCL.

  14. Limitations of variable number of tandem repeat typing identified through whole genome sequencing of Mycobacterium avium subsp. paratuberculosis on a national and herd level. (United States)

    Ahlstrom, Christina; Barkema, Herman W; Stevenson, Karen; Zadoks, Ruth N; Biek, Roman; Kao, Rowland; Trewby, Hannah; Haupstein, Deb; Kelton, David F; Fecteau, Gilles; Labrecque, Olivia; Keefe, Greg P; McKenna, Shawn L B; De Buck, Jeroen


    Mycobacterium avium subsp. paratuberculosis (MAP), the causative bacterium of Johne's disease in dairy cattle, is widespread in the Canadian dairy industry and has significant economic and animal welfare implications. An understanding of the population dynamics of MAP can be used to identify introduction events, improve control efforts and target transmission pathways, although this requires an adequate understanding of MAP diversity and distribution between herds and across the country. Whole genome sequencing (WGS) offers a detailed assessment of the SNP-level diversity and genetic relationship of isolates, whereas several molecular typing techniques used to investigate the molecular epidemiology of MAP, such as variable number of tandem repeat (VNTR) typing, target relatively unstable repetitive elements in the genome that may be too unpredictable to draw accurate conclusions. The objective of this study was to evaluate the diversity of bovine MAP isolates in Canadian dairy herds using WGS and then determine if VNTR typing can distinguish truly related and unrelated isolates. Phylogenetic analysis based on 3,039 SNPs identified through WGS of 124 MAP isolates identified eight genetically distinct subtypes in dairy herds from seven Canadian provinces, with the dominant type including over 80% of MAP isolates. VNTR typing of 527 MAP isolates identified 12 types, including "bison type" isolates, from seven different herds. At a national level, MAP isolates differed from each other by 1-2 to 239-240 SNPs, regardless of whether they belonged to the same or different VNTR types. A herd-level analysis of MAP isolates demonstrated that VNTR typing may both over-estimate and under-estimate the relatedness of MAP isolates found within a single herd. The presence of multiple MAP subtypes in Canada suggests multiple introductions into the country including what has now become one dominant type, an important finding for Johne's disease control. VNTR typing often failed to

  15. ChimericSeq: An open-source, user-friendly interface for analyzing NGS data to identify and characterize viral-host chimeric sequences (United States)

    Shieh, Fwu-Shan; Jongeneel, Patrick; Steffen, Jamin D.; Lin, Selena; Jain, Surbhi; Song, Wei


    Identification of viral integration sites has been important in understanding the pathogenesis and progression of diseases associated with particular viral infections. The advent of next-generation sequencing (NGS) has enabled researchers to understand the impact that viral integration has on the host, such as tumorigenesis. Current computational methods to analyze NGS data of virus-host junction sites have been limited in terms of their accessibility to a broad user base. In this study, we developed a software application (named ChimericSeq), that is the first program of its kind to offer a graphical user interface, compatibility with both Windows and Mac operating systems, and optimized for effectively identifying and annotating virus-host chimeric reads within NGS data. In addition, ChimericSeq’s pipeline implements custom filtering to remove artifacts and detect reads with quantitative analytical reporting to provide functional significance to discovered integration sites. The improved accessibility of ChimericSeq through a GUI interface in both Windows and Mac has potential to expand NGS analytical support to a broader spectrum of the scientific community. PMID:28829778

  16. A Sequence in the loop domain of hepatitis C virus E2 protein identified in silico as crucial for the selective binding to human CD81.

    Directory of Open Access Journals (Sweden)

    Chun-Chun Chang

    Full Text Available Hepatitis C virus (HCV is a species-specific pathogenic virus that infects only humans and chimpanzees. Previous studies have indicated that interactions between the HCV E2 protein and CD81 on host cells are required for HCV infection. To determine the crucial factors for species-specific interactions at the molecular level, this study employed in silico molecular docking involving molecular dynamic simulations of the binding of HCV E2 onto human and rat CD81s. In vitro experiments including surface plasmon resonance measurements and cellular binding assays were applied for simple validations of the in silico results. The in silico studies identified two binding regions on the HCV E2 loop domain, namely E2-site1 and E2-site2, as being crucial for the interactions with CD81s, with the E2-site2 as the determinant factor for human-specific binding. Free energy calculations indicated that the E2/CD81 binding process might follow a two-step model involving (i the electrostatic interaction-driven initial binding of human-specific E2-site2, followed by (ii changes in the E2 orientation to facilitate the hydrophobic and van der Waals interaction-driven binding of E2-site1. The sequence of the human-specific, stronger-binding E2-site2 could serve as a candidate template for the future development of HCV-inhibiting peptide drugs.

  17. ChimericSeq: An open-source, user-friendly interface for analyzing NGS data to identify and characterize viral-host chimeric sequences.

    Directory of Open Access Journals (Sweden)

    Fwu-Shan Shieh

    Full Text Available Identification of viral integration sites has been important in understanding the pathogenesis and progression of diseases associated with particular viral infections. The advent of next-generation sequencing (NGS has enabled researchers to understand the impact that viral integration has on the host, such as tumorigenesis. Current computational methods to analyze NGS data of virus-host junction sites have been limited in terms of their accessibility to a broad user base. In this study, we developed a software application (named ChimericSeq, that is the first program of its kind to offer a graphical user interface, compatibility with both Windows and Mac operating systems, and optimized for effectively identifying and annotating virus-host chimeric reads within NGS data. In addition, ChimericSeq's pipeline implements custom filtering to remove artifacts and detect reads with quantitative analytical reporting to provide functional significance to discovered integration sites. The improved accessibility of ChimericSeq through a GUI interface in both Windows and Mac has potential to expand NGS analytical support to a broader spectrum of the scientific community.

  18. Spatially resolved RNA-sequencing of the embryonic heart identifies a role for Wnt/β-catenin signaling in autonomic control of heart rate (United States)

    Burkhard, Silja Barbara


    Development of specialized cells and structures in the heart is regulated by spatially -restricted molecular pathways. Disruptions in these pathways can cause severe congenital cardiac malformations or functional defects. To better understand these pathways and how they regulate cardiac development we used tomo-seq, combining high-throughput RNA-sequencing with tissue-sectioning, to establish a genome-wide expression dataset with high spatial resolution for the developing zebrafish heart. Analysis of the dataset revealed over 1100 genes differentially expressed in sub-compartments. Pacemaker cells in the sinoatrial region induce heart contractions, but little is known about the mechanisms underlying their development. Using our transcriptome map, we identified spatially restricted Wnt/β-catenin signaling activity in pacemaker cells, which was controlled by Islet-1 activity. Moreover, Wnt/β-catenin signaling controls heart rate by regulating pacemaker cellular response to parasympathetic stimuli. Thus, this high-resolution transcriptome map incorporating all cell types in the embryonic heart can expose spatially restricted molecular pathways critical for specific cardiac functions. PMID:29400650

  19. POU4F3 mutation screening in Japanese hearing loss patients: Massively parallel DNA sequencing-based analysis identified novel variants associated with autosomal dominant hearing loss.

    Directory of Open Access Journals (Sweden)

    Tomohiro Kitano

    Full Text Available A variant in a transcription factor gene, POU4F3, is responsible for autosomal dominant nonsyndromic hereditary hearing loss, DFNA15. To date, 14 variants, including a whole deletion of POU4F3, have been reported to cause HL in various ethnic groups. In the present study, genetic screening for POU4F3 variants was carried out for a large series of Japanese hearing loss (HL patients to clarify the prevalence and clinical characteristics of DFNA15 in the Japanese population. Massively parallel DNA sequencing of 68 target candidate genes was utilized in 2,549 unrelated Japanese HL patients (probands to identify genomic variations responsible for HL. The detailed clinical features in patients with POU4F3 variants were collected from medical charts and analyzed. Novel 12 POU4F3 likely pathogenic variants (six missense variants, three frameshift variants, and three nonsense variants were successfully identified in 15 probands (2.5% among 602 families exhibiting autosomal dominant HL, whereas no variants were detected in the other 1,947 probands with autosomal recessive or inheritance pattern unknown HL. To obtain the audiovestibular configuration of the patients harboring POU4F3 variants, we collected audiograms and vestibular symptoms of the probands and their affected family members. Audiovestibular phenotypes in a total of 24 individuals from the 15 families possessing variants were characterized by progressive HL, with a large variation in the onset age and severity with or without vestibular symptoms observed. Pure-tone audiograms indicated the most prevalent configuration as mid-frequency HL type followed by high-frequency HL type, with asymmetry observed in approximately 20% of affected individuals. Analysis of the relationship between age and pure-tone average suggested that individuals with truncating variants showed earlier onset and slower progression of HL than did those with non-truncating variants. The present study showed that variants

  20. Targeted sequencing identifies associations between IL7R-JAK mutations and epigenetic modulators in T-cell acute lymphoblastic leukemia (United States)

    Vicente, Carmen; Schwab, Claire; Broux, Michaël; Geerdens, Ellen; Degryse, Sandrine; Demeyer, Sofie; Lahortiga, Idoya; Elliott, Alannah; Chilton, Lucy; La Starza, Roberta; Mecucci, Cristina; Vandenberghe, Peter; Goulden, Nicholas; Vora, Ajay; Moorman, Anthony V.; Soulier, Jean; Harrison, Christine J.; Clappier, Emmanuelle; Cools, Jan


    T-cell acute lymphoblastic leukemia is caused by the accumulation of multiple oncogenic lesions, including chromosomal rearrangements and mutations. To determine the frequency and co-occurrence of mutations in T-cell acute lymphoblastic leukemia, we performed targeted re-sequencing of 115 genes across 155 diagnostic samples (44 adult and 111 childhood cases). NOTCH1 and CDKN2A/B were mutated/deleted in more than half of the cases, while an additional 37 genes were mutated/deleted in 4% to 20% of cases. We found that IL7R-JAK pathway genes were mutated in 27.7% of cases, with JAK3 mutations being the most frequent event in this group. Copy number variations were also detected, including deletions of CREBBP or CTCF and duplication of MYB. FLT3 mutations were rare, but a novel extracellular mutation in FLT3 was detected and confirmed to be transforming. Furthermore, we identified complex patterns of pairwise associations, including a significant association between mutations in IL7R-JAK genes and epigenetic regulators (WT1, PRC2, PHF6). Our analyses showed that IL7R-JAK genetic lesions did not confer adverse prognosis in T-cell acute lymphoblastic leukemia cases enrolled in the UK ALL2003 trial. Overall, these results identify interconnections between the T-cell acute lymphoblastic leukemia genome and disease biology, and suggest a potential clinical application for JAK inhibitors in a significant proportion of patients with T-cell acute lymphoblastic leukemia. PMID:26206799

  1. High-Throughput Sequencing Identifies MicroRNAs from Posterior Intestine of Loach (Misgurnus anguillicaudatus and Their Response to Intestinal Air-Breathing Inhibition.

    Directory of Open Access Journals (Sweden)

    Songqian Huang

    Full Text Available MicroRNAs (miRNAs exert important roles in animal growth, immunity, and development, and regulate gene expression at the post-transcriptional level. Knowledges about the diversities of miRNAs and their roles in accessory air-breathing organs (ABOs of fish remain unknown. In this work, we used high-throughput sequencing to identify known and novel miRNAs from the posterior intestine, an important ABO, in loach (Misgurnus anguillicaudatus under normal and intestinal air-breathing inhibited conditions. A total of 204 known and 84 novel miRNAs were identified, while 47 miRNAs were differentially expressed between the two small RNA libraries (i.e. between the normal and intestinal air-breathing inhibited group. Potential miRNA target genes were predicted by combining our transcriptome data of the posterior intestine of the loach under the same conditions, and then annotated using COG, GO, KEGG, Swissprot and Nr databases. The regulatory networks of miRNAs and their target genes were analyzed. The abundances of nine known miRNAs were validated by qRT-PCR. The relative expression profiles of six known miRNAs and their eight corresponding target genes, and two novel potential miRNAs were also detected. Histological characteristics of the posterior intestines in both normal and air-breathing inhibited group were further analyzed. This study contributes to our understanding on the functions and molecular regulatory mechanisms of miRNAs in accessory air-breathing organs of fish.

  2. Exome sequencing in schizophrenic patients with high levels of homozygosity identifies novel and extremely rare mutations in the GABA/glutamatergic pathways.

    Directory of Open Access Journals (Sweden)

    Edoardo Giacopuzzi

    Full Text Available Inbreeding is a known risk factor for recessive Mendelian diseases and previous studies have suggested that it could also play a role in complex disorders, such as psychiatric diseases. Recent inbreeding results in the presence of long runs of homozygosity (ROHs along the genome, which are also defined as autozygosity regions. Genetic variants in these regions have two alleles that are identical by descent, thus increasing the odds of bearing rare recessive deleterious mutations due to a homozygous state. A recent study showed a suggestive enrichment of long ROHs in schizophrenic patients, suggesting that recent inbreeding could play a role in the disease. To better understand the impact of autozygosity on schizophrenia risk, we selected, from a cohort of 180 Italian patients, seven subjects with extremely high numbers of large ROHs that were likely due to recent inbreeding and characterized the mutational landscape within their ROHs using Whole Exome Sequencing and, gene set enrichment analysis. We identified a significant overlap (17%; empirical p-value = 0.0171 between genes inside ROHs affected by low frequency functional homozygous variants (107 genes and the group of most promising candidate genes mutated in schizophrenia. Moreover, in four patients, we identified novel and extremely rare damaging mutations in the genes involved in neurodevelopment (MEGF8 and in GABA/glutamatergic synaptic transmission (GAD1, FMN1, ANO2. These results provide insights into the contribution of rare recessive mutations and inbreeding as risk factors for schizophrenia. ROHs that are likely due to recent inbreeding harbor a combination of predisposing low-frequency variants and extremely rare variants that have a high impact on pivotal biological pathways implicated in the disease. In addition, this study confirms that focusing on patients with high levels of homozygosity could be a useful prioritization strategy for discovering new high-impact mutations in

  3. Exome sequencing in schizophrenic patients with high levels of homozygosity identifies novel and extremely rare mutations in the GABA/glutamatergic pathways. (United States)

    Giacopuzzi, Edoardo; Gennarelli, Massimo; Minelli, Alessandra; Gardella, Rita; Valsecchi, Paolo; Traversa, Michele; Bonvicini, Cristian; Vita, Antonio; Sacchetti, Emilio; Magri, Chiara


    Inbreeding is a known risk factor for recessive Mendelian diseases and previous studies have suggested that it could also play a role in complex disorders, such as psychiatric diseases. Recent inbreeding results in the presence of long runs of homozygosity (ROHs) along the genome, which are also defined as autozygosity regions. Genetic variants in these regions have two alleles that are identical by descent, thus increasing the odds of bearing rare recessive deleterious mutations due to a homozygous state. A recent study showed a suggestive enrichment of long ROHs in schizophrenic patients, suggesting that recent inbreeding could play a role in the disease. To better understand the impact of autozygosity on schizophrenia risk, we selected, from a cohort of 180 Italian patients, seven subjects with extremely high numbers of large ROHs that were likely due to recent inbreeding and characterized the mutational landscape within their ROHs using Whole Exome Sequencing and, gene set enrichment analysis. We identified a significant overlap (17%; empirical p-value = 0.0171) between genes inside ROHs affected by low frequency functional homozygous variants (107 genes) and the group of most promising candidate genes mutated in schizophrenia. Moreover, in four patients, we identified novel and extremely rare damaging mutations in the genes involved in neurodevelopment (MEGF8) and in GABA/glutamatergic synaptic transmission (GAD1, FMN1, ANO2). These results provide insights into the contribution of rare recessive mutations and inbreeding as risk factors for schizophrenia. ROHs that are likely due to recent inbreeding harbor a combination of predisposing low-frequency variants and extremely rare variants that have a high impact on pivotal biological pathways implicated in the disease. In addition, this study confirms that focusing on patients with high levels of homozygosity could be a useful prioritization strategy for discovering new high-impact mutations in genetically

  4. Analyses of expressed sequence tags from the maize foliar pathogen Cercospora zeae-maydis identify novel genes expressed during vegetative, infectious, and reproductive growth

    Directory of Open Access Journals (Sweden)

    Kema Gert HJ


    Full Text Available Abstract Background The ascomycete fungus Cercospora zeae-maydis is an aggressive foliar pathogen of maize that causes substantial losses annually throughout the Western Hemisphere. Despite its impact on maize production, little is known about the regulation of pathogenesis in C. zeae-maydis at the molecular level. The objectives of this study were to generate a collection of expressed sequence tags (ESTs from C. zeae-maydis and evaluate their expression during vegetative, infectious, and reproductive growth. Results A total of 27,551 ESTs was obtained from five cDNA libraries constructed from vegetative and sporulating cultures of C. zeae-maydis. The ESTs, grouped into 4088 clusters and 531 singlets, represented 4619 putative unique genes. Of these, 36% encoded proteins similar (E value ≤ 10-05 to characterized or annotated proteins from the NCBI non-redundant database representing diverse molecular functions and biological processes based on Gene Ontology (GO classification. We identified numerous, previously undescribed genes with potential roles in photoreception, pathogenesis, and the regulation of development as well as Zephyr, a novel, actively transcribed transposable element. Differential expression of selected genes was demonstrated by real-time PCR, supporting their proposed roles in vegetative, infectious, and reproductive growth. Conclusion Novel genes that are potentially involved in regulating growth, development, and pathogenesis were identified in C. zeae-maydis, providing specific targets for characterization by molecular genetics and functional genomics. The EST data establish a foundation for future studies in evolutionary and comparative genomics among species of Cercospora and other groups of plant pathogenic fungi.

  5. Quantitation of heteroplasmy of mtDNA sequence variants identified in a population of AD patients and controls by array-based resequencing. (United States)

    Coon, Keith D; Valla, Jon; Szelinger, Szabolics; Schneider, Lonnie E; Niedzielko, Tracy L; Brown, Kevin M; Pearson, John V; Halperin, Rebecca; Dunckley, Travis; Papassotiropoulos, Andreas; Caselli, Richard J; Reiman, Eric M; Stephan, Dietrich A


    The role of mitochondrial dysfunction in the pathogenesis of Alzheimer's disease (AD) has been well documented. Though evidence for the role of mitochondria in AD seems incontrovertible, the impact of mitochondrial DNA (mtDNA) mutations in AD etiology remains controversial. Though mutations in mitochondrially encoded genes have repeatedly been implicated in the pathogenesis of AD, many of these studies have been plagued by lack of replication as well as potential contamination of nuclear-encoded mitochondrial pseudogenes. To assess the role of mtDNA mutations in the pathogenesis of AD, while avoiding the pitfalls of nuclear-encoded mitochondrial pseudogenes encountered in previous investigations and showcasing the benefits of a novel resequencing technology, we sequenced the entire coding region (15,452 bp) of mtDNA from 19 extremely well-characterized AD patients and 18 age-matched, unaffected controls utilizing a new, reliable, high-throughput array-based resequencing technique, the Human MitoChip. High-throughput, array-based DNA resequencing of the entire mtDNA coding region from platelets of 37 subjects revealed the presence of 208 loci displaying a total of 917 sequence variants. There were no statistically significant differences in overall mutational burden between cases and controls, however, 265 independent sites of statistically significant change between cases and controls were identified. Changed sites were found in genes associated with complexes I (30.2%), III (3.0%), IV (33.2%), and V (9.1%) as well as tRNA (10.6%) and rRNA (14.0%). Despite their statistical significance, the subtle nature of the observed changes makes it difficult to determine whether they represent true functional variants involved in AD etiology or merely naturally occurring dissimilarity. Regardless, this study demonstrates the tremendous value of this novel mtDNA resequencing platform, which avoids the pitfalls of erroneously amplifying nuclear-encoded mtDNA pseudogenes, and

  6. Amplification of the Kaposi's sarcoma-associated herpesvirus/human herpesvirus 8 lytic origin of DNA replication is dependent upon a cis-acting AT-rich region and an ORF50 response element and the trans-acting factors ORF50 (K-Rta) and K8 (K-bZIP)

    International Nuclear Information System (INIS)

    AuCoin, David P.; Colletti, Kelly S.; Cei, Sylvia A.; Papouskova, Iva; Tarrant, Margaret; Pari, Gregory S.


    Kaposi's sarcoma-associated herpesvirus (KSHV), also known as human herpesvirus 8 (HHV8), has significant sequence homology to Epstein-Barr virus (EBV). In cell culture, HHV8 is primarily latent, and viral genes associated with lytic replication are not expressed. Two lytic origins of DNA replication (oriLyt) are present within the HHV8 genome and are composed of an AT-rich region adjacent to GC-rich DNA sequences. We have now identified essential cis- and trans-acting elements required for oriLyt-dependent DNA replication. The transient replication assay was used to show that two AT-rich elements, three consensus AP1 transcription factor-binding sites, an ORF50 response element (RE), and a consensus TATA box motif are essential for efficient origin-dependent DNA replication. Transient transfection of luciferase reporter constructs indicated that the downstream region of the HHV8 oriLyt responds to ORF50 and suggests that part of the oriLyt may be an enhancer/promoter. In addition, a transient cotransfection-replication assay elucidated the set of trans-acting factors required for lytic DNA replication. These factors consist of homologues to the core replication proteins: ORF6 (ssDNA binding protein), ORF9 (DNA polymerase), ORF40-41 (primase-associated factor), ORF44 (helicase), ORF56 (primase), and ORF59 (polymerase processivity factor) common to all herpesviruses along with ORF50 (K-Rta) and K8 (K-bZIP)

  7. Experimental assessment of the importance of amino acid positions identified by an entropy-based correlation analysis of multiple-sequence alignments. (United States)

    Dietrich, Susanne; Borst, Nadine; Schlee, Sandra; Schneider, Daniel; Janda, Jan-Oliver; Sterner, Reinhard; Merkl, Rainer


    The analysis of a multiple-sequence alignment (MSA) with correlation methods identifies pairs of residue positions whose occupation with amino acids changes in a concerted manner. It is plausible to assume that positions that are part of many such correlation pairs are important for protein function or stability. We have used the algorithm H2r to identify positions k in the MSAs of the enzymes anthranilate phosphoribosyl transferase (AnPRT) and indole-3-glycerol phosphate synthase (IGPS) that show a high conn(k) value, i.e., a large number of significant correlations in which k is involved. The importance of the identified residues was experimentally validated by performing mutagenesis studies with sAnPRT and sIGPS from the archaeon Sulfolobus solfataricus. For sAnPRT, five H2r mutant proteins were generated by replacing nonconserved residues with alanine or the prevalent residue of the MSA. As a control, five residues with conn(k) values of zero were chosen randomly and replaced with alanine. The catalytic activities and conformational stabilities of the H2r and control mutant proteins were analyzed by steady-state enzyme kinetics and thermal unfolding studies. Compared to wild-type sAnPRT, the catalytic efficiencies (k(cat)/K(M)) were largely unaltered. In contrast, the apparent thermal unfolding temperature (T(M)(app)) was lowered in most proteins. Remarkably, the strongest observed destabilization (ΔT(M)(app) = 14 °C) was caused by the V284A exchange, which pertains to the position with the highest correlation signal [conn(k) = 11]. For sIGPS, six H2r mutant and four control proteins with alanine exchanges were generated and characterized. The k(cat)/K(M) values of four H2r mutant proteins were reduced between 13- and 120-fold, and their T(M)(app) values were decreased by up to 5 °C. For the sIGPS control proteins, the observed activity and stability decreases were much less severe. Our findings demonstrate that positions with high conn(k) values have an

  8. Epidemiological links between tuberculosis cases identified twice as efficiently by whole genome sequencing than conventional molecular typing: A population-based study. (United States)

    Jajou, Rana; de Neeling, Albert; van Hunen, Rianne; de Vries, Gerard; Schimmel, Henrieke; Mulder, Arnout; Anthony, Richard; van der Hoek, Wim; van Soolingen, Dick


    Patients with Mycobacterium tuberculosis isolates sharing identical DNA fingerprint patterns can be epidemiologically linked. However, municipal health services in the Netherlands are able to confirm an epidemiological link in only around 23% of the patients with isolates clustered by the conventional variable number of tandem repeat (VNTR) genotyping. This research aims to investigate whether whole genome sequencing (WGS) is a more reliable predictor of epidemiological links between tuberculosis patients than VNTR genotyping. VNTR genotyping and WGS were performed in parallel on all Mycobacterium tuberculosis complex isolates received at the Netherlands National Institute for Public Health and the Environment in 2016. Isolates were clustered by VNTR when they shared identical 24-loci VNTR patterns; isolates were assigned to a WGS cluster when the pair-wise genetic distance was ≤ 12 single nucleotide polymorphisms (SNPs). Cluster investigation was performed by municipal health services on all isolates clustered by VNTR in 2016. The proportion of epidemiological links identified among patients clustered by either method was calculated. In total, 535 isolates were genotyped, of which 25% (134/535) were clustered by VNTR and 14% (76/535) by WGS; the concordance between both typing methods was 86%. The proportion of epidemiological links among WGS clustered cases (57%) was twice as common than among VNTR clustered cases (31%). When WGS was applied, the number of clustered isolates was halved, while all epidemiologically linked cases remained clustered. WGS is therefore a more reliable tool to predict epidemiological links between tuberculosis cases than VNTR genotyping and will allow more efficient transmission tracing, as epidemiological investigations based on false clustering can be avoided.

  9. Whole-Exome Sequencing Identifies Homozygous AFG3L2 Mutations in a Spastic Ataxia-Neuropathy Syndrome Linked to Mitochondrial m-AAA Proteases (United States)

    Martinelli, Paola; Cherukuri, Praveen F.; Teer, Jamie K.; Hansen, Nancy F.; Cruz, Pedro; Mullikin for the NISC Comparative Sequencing Program, James C.; Blakesley, Robert W.; Golas, Gretchen; Kwan, Justin; Sandler, Anthony; Fuentes Fajardo, Karin; Markello, Thomas; Tifft, Cynthia; Blackstone, Craig; Rugarli, Elena I.; Langer, Thomas; Gahl, William A.; Toro, Camilo


    We report an early onset spastic ataxia-neuropathy syndrome in two brothers of a consanguineous family characterized clinically by lower extremity spasticity, peripheral neuropathy, ptosis, oculomotor apraxia, dystonia, cerebellar atrophy, and progressive myoclonic epilepsy. Whole-exome sequencing identified a homozygous missense mutation (c.1847G>A; p.Y616C) in AFG3L2, encoding a subunit of an m-AAA protease. m-AAA proteases reside in the mitochondrial inner membrane and are responsible for removal of damaged or misfolded proteins and proteolytic activation of essential mitochondrial proteins. AFG3L2 forms either a homo-oligomeric isoenzyme or a hetero-oligomeric complex with paraplegin, a homologous protein mutated in hereditary spastic paraplegia type 7 (SPG7). Heterozygous loss-of-function mutations in AFG3L2 cause autosomal-dominant spinocerebellar ataxia type 28 (SCA28), a disorder whose phenotype is strikingly different from that of our patients. As defined in yeast complementation assays, the AFG3L2Y616C gene product is a hypomorphic variant that exhibited oligomerization defects in yeast as well as in patient fibroblasts. Specifically, the formation of AFG3L2Y616C complexes was impaired, both with itself and to a greater extent with paraplegin. This produced an early-onset clinical syndrome that combines the severe phenotypes of SPG7 and SCA28, in additional to other “mitochondrial” features such as oculomotor apraxia, extrapyramidal dysfunction, and myoclonic epilepsy. These findings expand the phenotype associated with AFG3L2 mutations and suggest that AFG3L2-related disease should be considered in the differential diagnosis of spastic ataxias. PMID:22022284

  10. Whole-exome sequencing identifies homozygous AFG3L2 mutations in a spastic ataxia-neuropathy syndrome linked to mitochondrial m-AAA proteases.

    Directory of Open Access Journals (Sweden)

    Tyler Mark Pierson


    Full Text Available We report an early onset spastic ataxia-neuropathy syndrome in two brothers of a consanguineous family characterized clinically by lower extremity spasticity, peripheral neuropathy, ptosis, oculomotor apraxia, dystonia, cerebellar atrophy, and progressive myoclonic epilepsy. Whole-exome sequencing identified a homozygous missense mutation (c.1847G>A; p.Y616C in AFG3L2, encoding a subunit of an m-AAA protease. m-AAA proteases reside in the mitochondrial inner membrane and are responsible for removal of damaged or misfolded proteins and proteolytic activation of essential mitochondrial proteins. AFG3L2 forms either a homo-oligomeric isoenzyme or a hetero-oligomeric complex with paraplegin, a homologous protein mutated in hereditary spastic paraplegia type 7 (SPG7. Heterozygous loss-of-function mutations in AFG3L2 cause autosomal-dominant spinocerebellar ataxia type 28 (SCA28, a disorder whose phenotype is strikingly different from that of our patients. As defined in yeast complementation assays, the AFG3L2(Y616C gene product is a hypomorphic variant that exhibited oligomerization defects in yeast as well as in patient fibroblasts. Specifically, the formation of AFG3L2(Y616C complexes was impaired, both with itself and to a greater extent with paraplegin. This produced an early-onset clinical syndrome that combines the severe phenotypes of SPG7 and SCA28, in additional to other "mitochondrial" features such as oculomotor apraxia, extrapyramidal dysfunction, and myoclonic epilepsy. These findings expand the phenotype associated with AFG3L2 mutations and suggest that AFG3L2-related disease should be considered in the differential diagnosis of spastic ataxias.

  11. [3H]Azidodantrolene photoaffinity labeling, synthetic domain peptides and monoclonal antibody reactivity identify the dantrolene binding sequence on RyR1

    Energy Technology Data Exchange (ETDEWEB)

    Paul-Pletzer, Kalanethee; Yamamoto, Takeshi; Bhat, Manju B.; Ma, Jianjie; Ikemoto, Noriaki; Jimenez, Leslie S.; Morimoto, Hiromi; Williams, Philip G.; Parness, Jerome


    Dantrolene is a drug that suppresses intracellular Ca2+ release from sarcoplasmic reticulum in normal skeletal muscle and is used as a therapeutic agent in individuals susceptible to malignant hyperthermia. Though its precise mechanism of action has not been elucidated, we have identified the N-terminal region (amino acids 1-1400) of the skeletal muscle isoform of the ryanodine receptor (RyR1), the primary Ca2+ release channel in sarcoplasmic reticulum, as a molecular target for dantrolene using the photoaffinity analog [3H]azidodantrolene(1). Here, we demonstrate that heterologously expressed RyR1 retains its capacity to be specifically labeled with [3H]azidodantrolene,indicating that muscle specific factors are not required for this ligand-receptor interaction. Synthetic domain peptides of RyR1, previously shown to affect RyR1 function in vitro and in vivo, were exploited as potential drug binding site mimics and used in photoaffinity labeling experiments. Only DP1 and DP1-2, peptide s containing the amino acid sequence corresponding to RyR1 residues 590-609, were specifically labeled by [3H]azidodantrolene. A monoclonal anti-RyR1 antibody which recognizes RyR1 and its 1400 amino acid N-terminal fragment, recognizes DP1 and DP1-2 in both Western blots and immunoprecipitation assays, and specifically inhibits [3H]azidodantrolene photolabeling of RyR1 and its N-terminal fragment in sarcoplasmic reticulum. Our results indicate that synthetic domain peptides can mimic a native, ligand binding conformation in vitro, and that the dantrolene binding site and the epitope for the monoclonal antibody on RyR1 are equivalent and composed of amino-acids 590-609.

  12. Complete Genome Sequence of Germline Chromosomally Integrated Human Herpesvirus 6A and Analyses Integration Sites Define a New Human Endogenous Virus with Potential to Reactivate as an Emerging Infection. (United States)

    Tweedy, Joshua; Spyrou, Maria Alexandra; Pearson, Max; Lassner, Dirk; Kuhl, Uwe; Gompels, Ursula A


    Human herpesvirus-6A and B (HHV-6A, HHV-6B) have recently defined endogenous genomes, resulting from integration into the germline: chromosomally-integrated "CiHHV-6A/B". These affect approximately 1.0% of human populations, giving potential for virus gene expression in every cell. We previously showed that CiHHV-6A was more divergent than CiHHV-6B by examining four genes in 44 European CiHHV-6A/B cardiac/haematology patients. There was evidence for gene expression/reactivation, implying functional non-defective genomes. To further define the relationship between HHV-6A and CiHHV-6A we used next-generation sequencing to characterize genomes from three CiHHV-6A cardiac patients. Comparisons to known exogenous HHV-6A showed CiHHV-6A genomes formed a separate clade; including all 85 non-interrupted genes and necessary cis-acting signals for reactivation as infectious virus. Greater single nucleotide polymorphism (SNP) density was defined in 16 genes and the direct repeats (DR) terminal regions. Using these SNPs, deep sequencing analyses demonstrated superinfection with exogenous HHV-6A in two of the CiHHV-6A patients with recurrent cardiac disease. Characterisation of the integration sites in twelve patients identified the human chromosome 17p subtelomere as a prevalent site, which had specific repeat structures and phylogenetically related CiHHV-6A coding sequences indicating common ancestral origins. Overall CiHHV-6A genomes were similar, but distinct from known exogenous HHV-6A virus, and have the capacity to reactivate as emerging virus infections.

  13. Complete Genome Sequence of Germline Chromosomally Integrated Human Herpesvirus 6A and Analyses Integration Sites Define a New Human Endogenous Virus with Potential to Reactivate as an Emerging Infection (United States)

    Tweedy, Joshua; Spyrou, Maria Alexandra; Pearson, Max; Lassner, Dirk; Kuhl, Uwe; Gompels, Ursula A.


    Human herpesvirus-6A and B (HHV-6A, HHV-6B) have recently defined endogenous genomes, resulting from integration into the germline: chromosomally-integrated “CiHHV-6A/B”. These affect approximately 1.0% of human populations, giving potential for virus gene expression in every cell. We previously showed that CiHHV-6A was more divergent than CiHHV-6B by examining four genes in 44 European CiHHV-6A/B cardiac/haematology patients. There was evidence for gene expression/reactivation, implying functional non-defective genomes. To further define the relationship between HHV-6A and CiHHV-6A we used next-generation sequencing to characterize genomes from three CiHHV-6A cardiac patients. Comparisons to known exogenous HHV-6A showed CiHHV-6A genomes formed a separate clade; including all 85 non-interrupted genes and necessary cis-acting signals for reactivation as infectious virus. Greater single nucleotide polymorphism (SNP) density was defined in 16 genes and the direct repeats (DR) terminal regions. Using these SNPs, deep sequencing analyses demonstrated superinfection with exogenous HHV-6A in two of the CiHHV-6A patients with recurrent cardiac disease. Characterisation of the integration sites in twelve patients identified the human chromosome 17p subtelomere as a prevalent site, which had specific repeat structures and phylogenetically related CiHHV-6A coding sequences indicating common ancestral origins. Overall CiHHV-6A genomes were similar, but distinct from known exogenous HHV-6A virus, and have the capacity to reactivate as emerging virus infections. PMID:26784220

  14. Novel ZEB2-BCL11B Fusion Gene Identified by RNA-Sequencing in Acute Myeloid Leukemia with t(2;14(q22;q32.

    Directory of Open Access Journals (Sweden)

    Synne Torkildsen

    Full Text Available RNA-sequencing of a case of acute myeloid leukemia with the bone marrow karyotype 46,XY,t(2;14(q22;q32[5]/47,XY,idem,+?4,del(6(q13q21[cp6]/46,XY[4] showed that the t(2;14 generated a ZEB2-BCL11B chimera in which exon 2 of ZEB2 (nucleotide 595 in the sequence with accession number NM_014795.3 was fused to exon 2 of BCL11B (nucleotide 554 in the sequence with accession number NM_022898.2. RT-PCR together with Sanger sequencing verified the presence of the above-mentioned fusion transcript. All functional domains of BCL11B are retained in the chimeric protein. Abnormal expression of BCL11B coding regions subjected to control by the ZEB2 promoter seems to be the leukemogenic mechanism behind the translocation.

  15. Deep Sequencing-Identified Kanamycin-Resistant Paenibacillus sp. Strain KS1 Isolated from Epiphyte Tillandsia usneoides (Spanish Moss) in Central Florida, USA. (United States)

    Lata, Pushpa; Govindarajan, Subramaniam S; Qi, Feng; Li, Jian-Liang; Sahoo, Malaya K


    Paenibacillus sp. strain KS1 was isolated from an epiphyte, Tillandsia usneoides (Spanish moss), in central Florida, USA. Here, we report a draft genome sequence of this strain, which consists of a total of 398 contigs spanning 6,508,195 bp, with a G+C content of 46.5% and comprising 5,401 predicted coding sequences. Copyright © 2017 Lata et al.

  16. A bacterial genetic screen identifies functional coding sequences of the insect mariner transposable element Famar1 amplified from the genome of the earwig, Forficula auricularia. (United States)

    Barry, Elizabeth G; Witherspoon, David J; Lampe, David J


    Transposons of the mariner family are widespread in animal genomes and have apparently infected them by horizontal transfer. Most species carry only old defective copies of particular mariner transposons that have diverged greatly from their active horizontally transferred ancestor, while a few contain young, very similar, and active copies. We report here the use of a whole-genome screen in bacteria to isolate somewhat diverged Famar1 copies from the European earwig, Forficula auricularia, that encode functional transposases. Functional and nonfunctional coding sequences of Famar1 and nonfunctional copies of Ammar1 from the European honey bee, Apis mellifera, were sequenced to examine their molecular evolution. No selection for sequence conservation was detected in any clade of a tree derived from these sequences, not even on branches leading to functional copies. This agrees with the current model for mariner transposon evolution that expects neutral evolution within particular hosts, with selection for function occurring only upon horizontal transfer to a new host. Our results further suggest that mariners are not finely tuned genetic entities and that a greater amount of sequence diversification than had previously been appreciated can occur in functional copies in a single host lineage. Finally, this method of isolating active copies can be used to isolate other novel active transposons without resorting to reconstruction of ancestral sequences.

  17. RNA-ID, a highly sensitive and robust method to identify cis-regulatory sequences using superfolder GFP and a fluorescence-based assay. (United States)

    Dean, Kimberly M; Grayhack, Elizabeth J


    We have developed a robust and sensitive method, called RNA-ID, to screen for cis-regulatory sequences in RNA using fluorescence-activated cell sorting (FACS) of yeast cells bearing a reporter in which expression of both superfolder green fluorescent protein (GFP) and yeast codon-optimized mCherry red fluorescent protein (RFP) is driven by the bidirectional GAL1,10 promoter. This method recapitulates previously reported progressive inhibition of translation mediated by increasing numbers of CGA codon pairs, and restoration of expression by introduction of a tRNA with an anticodon that base pairs exactly with the CGA codon. This method also reproduces effects of paromomycin and context on stop codon read-through. Five key features of this method contribute to its effectiveness as a selection for regulatory sequences: The system exhibits greater than a 250-fold dynamic range, a quantitative and dose-dependent response to known inhibitory sequences, exquisite resolution that allows nearly complete physical separation of distinct populations, and a reproducible signal between different cells transformed with the identical reporter, all of which are coupled with simple methods involving ligation-independent cloning, to create large libraries. Moreover, we provide evidence that there are sequences within a 9-nt library that cause reduced GFP fluorescence, suggesting that there are novel cis-regulatory sequences to be found even in this short sequence space. This method is widely applicable to the study of both RNA-mediated and codon-mediated effects on expression.

  18. Ginger and turmeric expressed sequence tags identify signature genes for rhizome identity and development and the biosynthesis of curcuminoids, gingerols and terpenoids (United States)


    Background Ginger (Zingiber officinale) and turmeric (Curcuma longa) accumulate important pharmacologically active metabolites at high levels in their rhizomes. Despite their importance, relatively little is known regarding gene expression in the rhizomes of ginger and turmeric. Results In order to identify rhizome-enriched genes and genes encoding specialized metabolism enzymes and pathway regulators, we evaluated an assembled collection of expressed sequence tags (ESTs) from eight different ginger and turmeric tissues. Comparisons to publicly available sorghum rhizome ESTs revealed a total of 777 gene transcripts expressed in ginger/turmeric and sorghum rhizomes but apparently absent from other tissues. The list of rhizome-specific transcripts was enriched for genes associated with regulation of tissue growth, development, and transcription. In particular, transcripts for ethylene response factors and AUX/IAA proteins appeared to accumulate in patterns mirroring results from previous studies regarding rhizome growth responses to exogenous applications of auxin and ethylene. Thus, these genes may play important roles in defining rhizome growth and development. Additional associations were made for ginger and turmeric rhizome-enriched MADS box transcription factors, their putative rhizome-enriched homologs in sorghum, and rhizomatous QTLs in rice. Additionally, analysis of both primary and specialized metabolism genes indicates that ginger and turmeric rhizomes are primarily devoted to the utilization of leaf supplied sucrose for the production and/or storage of specialized metabolites associated with the phenylpropanoid pathway and putative type III polyketide synthase gene products. This finding reinforces earlier hypotheses predicting roles of this enzyme class in the production of curcuminoids and gingerols. Conclusion A significant set of genes were found to be exclusively or preferentially expressed in the rhizome of ginger and turmeric. Specific

  19. Shotgun protein sequencing.

    Energy Technology Data Exchange (ETDEWEB)

    Faulon, Jean-Loup Michel; Heffelfinger, Grant S.


    A novel experimental and computational technique based on multiple enzymatic digestion of a protein or protein mixture that reconstructs protein sequences from sequences of overlapping peptides is described in this SAND report. This approach, analogous to shotgun sequencing of DNA, is to be used to sequence alternative spliced proteins, to identify post-translational modifications, and to sequence genetically engineered proteins.

  20. Case report: Exome sequencing identifies T-ALL with myeloid features as a IKZF1-struck early precursor T-cell malignancy

    DEFF Research Database (Denmark)

    Hansen, Marcus Celik; Nederby, Line; Kjeldsen, Eigil


    Lineage origin of a minority of patients with acute leukemia can be difficult determine, although advances in sequencing provide approaches to this problem. We describe longitudinal follow-up of a young man diagnosed with T- cell ALL. In conjunction with allele frequency cluster analysis we deter...

  1. Genome sequencing and transposon mutagenesis of Burkholderia seminalis TC3.4.2R3 identify genes contributing to suppression of orchid necrosis caused by B. gladioli (United States)

    Thirty six strains of Burkholderia spp. isolated from sugarcane were evaluated for biological control of leaf and pseudobulb necrosis of orchid caused by B. gladioli. Twenty nine of the sugarcane strains suppressed the disease in greenhouse assays. We generated a draft genomic sequence of one suppr...

  2. Sieve analysis of breakthrough HIV-1 sequences in HVTN 505 identifies vaccine pressure targeting the CD4 binding site of Env-gp120. (United States)

    deCamp, Allan C; Rolland, Morgane; Edlefsen, Paul T; Sanders-Buell, Eric; Hall, Breana; Magaret, Craig A; Fiore-Gartland, Andrew J; Juraska, Michal; Carpp, Lindsay N; Karuna, Shelly T; Bose, Meera; LePore, Steven; Miller, Shana; O'Sullivan, Annemarie; Poltavee, Kultida; Bai, Hongjun; Dommaraju, Kalpana; Zhao, Hong; Wong, Kim; Chen, Lennie; Ahmed, Hasan; Goodman, Derrick; Tay, Matthew Z; Gottardo, Raphael; Koup, Richard A; Bailer, Robert; Mascola, John R; Graham, Barney S; Roederer, Mario; O'Connell, Robert J; Michael, Nelson L; Robb, Merlin L; Adams, Elizabeth; D'Souza, Patricia; Kublin, James; Corey, Lawrence; Geraghty, Daniel E; Frahm, Nicole; Tomaras, Georgia D; McElrath, M Juliana; Frenkel, Lisa; Styrchak, Sheila; Tovanabutra, Sodsai; Sobieszczyk, Magdalena E; Hammer, Scott M; Kim, Jerome H; Mullins, James I; Gilbert, Peter B


    Although the HVTN 505 DNA/recombinant adenovirus type 5 vector HIV-1 vaccine trial showed no overall efficacy, analysis of breakthrough HIV-1 sequences in participants can help determine whether vaccine-induced immune responses impacted viruses that caused infection. We analyzed 480 HIV-1 genomes sampled from 27 vaccine and 20 placebo recipients and found that intra-host HIV-1 diversity was significantly lower in vaccine recipients (P ≤ 0.04, Q-values ≤ 0.09) in Gag, Pol, Vif and envelope glycoprotein gp120 (Env-gp120). Furthermore, Env-gp120 sequences from vaccine recipients were significantly more distant from the subtype B vaccine insert than sequences from placebo recipients (P = 0.01, Q-value = 0.12). These vaccine effects were associated with signatures mapping to CD4 binding site and CD4-induced monoclonal antibody footprints. These results suggest either (i) no vaccine efficacy to block acquisition of any viral genotype but vaccine-accelerated Env evolution post-acquisition; or (ii) vaccine efficacy against HIV-1s with Env sequences closest to the vaccine insert combined with increased acquisition due to other factors, potentially including the vaccine vector.

  3. Case report: Exome sequencing identifies T-ALL with myeloid features as a IKZF1-struck early precursor T-cell malignancy

    DEFF Research Database (Denmark)

    Hansen, Marcus Celik; Nederby, Line; Kjeldsen, Eigil


    Lineage origin of a minority of patients with acute leukemia can be difficult determine, although advances in sequencing provide approaches to this problem. We describe longitudinal follow-up of a young man diagnosed with T- cell ALL. In conjunction with allele frequency cluster analysis we...... to strengthen somatic observations, tumor detection and cytogenetics by assessment of allelic frequencies, elucidating disease evolution....

  4. Analyses of expressed sequence tags from the maize foliar pathogen Cercospora zeae-maydis identify novel genes expressed during vegetative, infectious, and reproductive growth


    Bluhm, Burton H; Dhillon, Braham; Lindquist, Erika A; Kema, Gert HJ; Goodwin, Stephen B; Dunkle, Larry D


    Abstract Background The ascomycete fungus Cercospora zeae-maydis is an aggressive foliar pathogen of maize that causes substantial losses annually throughout the Western Hemisphere. Despite its impact on maize production, little is known about the regulation of pathogenesis in C. zeae-maydis at the molecular level. The objectives of this study were to generate a collection of expressed sequence tags (ESTs) from C. zeae-maydis and evaluate their expression during vegetative, infectious, and re...

  5. Sequencing of mitochondrial genomes of nine Aspergillus and Penicillium species identifies mobile introns and accessory genes as main sources of genome size variability. (United States)

    Joardar, Vinita; Abrams, Natalie F; Hostetler, Jessica; Paukstelis, Paul J; Pakala, Suchitra; Pakala, Suman B; Zafar, Nikhat; Abolude, Olukemi O; Payne, Gary; Andrianopoulos, Alex; Denning, David W; Nierman, William C


    The genera Aspergillus and Penicillium include some of the most beneficial as well as the most harmful fungal species such as the penicillin-producer Penicillium chrysogenum and the human pathogen Aspergillus fumigatus, respectively. Their mitochondrial genomic sequences may hold vital clues into the mechanisms of their evolution, population genetics, and biology, yet only a handful of these genomes have been fully sequenced and annotated. Here we report the complete sequence and annotation of the mitochondrial genomes of six Aspergillus and three Penicillium species: A. fumigatus, A. clavatus, A. oryzae, A. flavus, Neosartorya fischeri (A. fischerianus), A. terreus, P. chrysogenum, P. marneffei, and Talaromyces stipitatus (P. stipitatum). The accompanying comparative analysis of these and related publicly available mitochondrial genomes reveals wide variation in size (25-36 Kb) among these closely related fungi. The sources of genome expansion include group I introns and accessory genes encoding putative homing endonucleases, DNA and RNA polymerases (presumed to be of plasmid origin) and hypothetical proteins. The two smallest sequenced genomes (A. terreus and P. chrysogenum) do not contain introns in protein-coding genes, whereas the largest genome (T. stipitatus), contains a total of eleven introns. All of the sequenced genomes have a group I intron in the large ribosomal subunit RNA gene, suggesting that this intron is fixed in these species. Subsequent analysis of several A. fumigatus strains showed low intraspecies variation. This study also includes a phylogenetic analysis based on 14 concatenated core mitochondrial proteins. The phylogenetic tree has a different topology from published multilocus trees, highlighting the challenges still facing the Aspergillus systematics. The study expands the genomic resources available to fungal biologists by providing mitochondrial genomes with consistent annotations for future genetic, evolutionary and population

  6. Isolation of Persicaria minor sesquiterpene synthase promoter and its deletions for transgenic Arabidopsis thaliana (United States)

    Omar, Aimi Farehah; Ismail, Ismanizan


    Sesquiterpene synthase (SS) catalyzes the formation of sesquiterpenes from farnesyl diphosphate (FDP) via carbocation intermediates. In this study, the promoter region of sesquiterpene synthase was isolated from Persicaria minor to identify possible cis-acting elements in the promoter. The full-length PmSS promoter of P. minor is 1824-bp sequences. The sequence was analyzed and several putative cis-acting regulatory elements were identified. Three cis-acting regulatory elements were selected for deletion analysis which are cis-acting element involved in wound responsiveness (WUN), cis - acting element involved in defense and stress responsiveness (TC) and cis-acting element involved in ABA responsiveness (ABRE). Series of deletions were conducted to assess the promoter activity producing three truncated fragments promoter; Prom 2 1606-bp, Prom 3 1144- bp, and Prom 4 921-bp. The full-length promoter and its deletion series were cloned into the pBGWFS7 vector which contain β-glucuronidase (GUS) gene and green fluorescent protein (GFP) as the reporter gene. All constructs were successfully transformed into Arabidopsis thaliana based on PCR of positive BASTA resistance plants.

  7. Sequence variation of the glycoprotein gene identifies three distinct lineages within field isolates of viral hemorrhagic septicemia virus, a fish rhabdovirus (United States)

    Benmansour, A.; Bascuro, B.; Monnier, A.F.; Vende, P.; Winton, J.R.; de Kinkelin, P.


    To evaluate the genetic diversity of viral haemorrhagic septicaemia virus (VHSV), the sequence of the glycoprotein genes (G) of 11 North American and European isolates were determined. Comparison with the G protein of representative members of the family Rhabdoviridae suggested that VHSV was a different virus species from infectious haemorrhagic necrosis virus (IHNV) and Hirame rhabdovirus (HIRRV). At a higher taxonomic level, VHSV, IHNV and HIRRV formed a group which was genetically closest to the genus Lyssavirus. Compared with each other, the G genes of VHSV displayed a dissimilar overall genetic diversity which correlated with differences in geographical origin. The multiple sequence alignment of the complete G protein, showed that the divergent positions were not uniformly distributed along the sequence. A central region (amino acid position 245-300) accumulated substitutions and appeared to be highly variable. The genetic heterogeneity within a single isolate was high, with an apparent internal mutation frequency of 1.2 x 10(-3) per nucleotide site, attesting the quasispecies nature of the viral population. The phylogeny separated VHSV strains according to the major geographical area of isolation: genotype I for continental Europe, genotype II for the British Isles, and genotype III for North America. Isolates from continental Europe exhibited the highest genetic variability, with sub-groups correlated partially with the serological classification. Neither neutralizing polyclonal sera, nor monoclonal antibodies, were able to discriminate between the genotypes. The overall structure of the phylogenetic tree suggests that VHSV genetic diversity and evolution fit within the model of random change and positive selection operating on quasispecies.

  8. Pooled Sequencing of 531 Genes in Inflammatory Bowel Disease Identifies an Associated Rare Variant in BTNL2 and Implicates Other Immune Related Genes (United States)

    Prescott, Natalie J.; Lehne, Benjamin; Stone, Kristina; Lee, James C.; Taylor, Kirstin; Knight, Jo; Papouli, Efterpi; Mirza, Muddassar M.; Simpson, Michael A.; Spain, Sarah L.; Lu, Grace; Fraternali, Franca; Bumpstead, Suzannah J.; Gray, Emma; Amar, Ariella; Bye, Hannah; Green, Peter; Chung-Faye, Guy; Hayee, Bu’Hussain; Pollok, Richard; Satsangi, Jack; Parkes, Miles; Barrett, Jeffrey C.; Mansfield, John C.; Sanderson, Jeremy; Lewis, Cathryn M.; Weale, Michael E.; Schlitt, Thomas; Mathew, Christopher G.


    The contribution of rare coding sequence variants to genetic susceptibility in complex disorders is an important but unresolved question. Most studies thus far have investigated a limited number of genes from regions which contain common disease associated variants. Here we investigate this in inflammatory bowel disease by sequencing the exons and proximal promoters of 531 genes selected from both genome-wide association studies and pathway analysis in pooled DNA panels from 474 cases of Crohn’s disease and 480 controls. 80 variants with evidence of association in the sequencing experiment or with potential functional significance were selected for follow up genotyping in 6,507 IBD cases and 3,064 population controls. The top 5 disease associated variants were genotyped in an extension panel of 3,662 IBD cases and 3,639 controls, and tested for association in a combined analysis of 10,147 IBD cases and 7,008 controls. A rare coding variant p.G454C in the BTNL2 gene within the major histocompatibility complex was significantly associated with increased risk for IBD (p = 9.65x10−10, OR = 2.3[95% CI = 1.75–3.04]), but was independent of the known common associated CD and UC variants at this locus. Rare (T) or decreased risk (IL12B p.V298F, and NICN p.H191R) of IBD. These results provide additional insights into the involvement of the inhibition of T cell activation in the development of both sub-phenotypes of inflammatory bowel disease. We suggest that although rare coding variants may make a modest overall contribution to complex disease susceptibility, they can inform our understanding of the molecular pathways that contribute to pathogenesis. PMID:25671699

  9. De-novo RNA sequencing and metabolite profiling to identify genes involved in anthocyanin biosynthesis in Korean black raspberry (Rubus coreanus Miquel.

    Directory of Open Access Journals (Sweden)

    Tae Kyung Hyun

    Full Text Available The Korean black raspberry (Rubus coreanus Miquel, KB on ripening is usually consumed as fresh fruit, whereas the unripe KB has been widely used as a source of traditional herbal medicine. Such a stage specific utilization of KB has been assumed due to the changing metabolite profile during fruit ripening process, but so far molecular and biochemical changes during its fruit maturation are poorly understood. To analyze biochemical changes during fruit ripening process at molecular level, firstly, we have sequenced, assembled, and annotated the transcriptome of KB fruits. Over 4.86 Gb of normalized cDNA prepared from fruits was sequenced using Illumina HiSeq™ 2000, and assembled into 43,723 unigenes. Secondly, we have reported that alterations in anthocyanins and proanthocyanidins are the major factors facilitating variations in these stages of fruits. In addition, up-regulation of F3'H1, DFR4 and LDOX1 resulted in the accumulation of cyanidin derivatives during the ripening process of KB, indicating the positive relationship between the expression of anthocyanin biosynthetic genes and the anthocyanin accumulation. Furthermore, the ability of RcMCHI2 (R. coreanus Miquel chalcone flavanone isomerase 2 gene to complement Arabidopsis transparent testa 5 mutant supported the feasibility of our transcriptome library to provide the gene resources for improving plant nutrition and pigmentation. Taken together, these datasets obtained from transcriptome library and metabolic profiling would be helpful to define the gene-metabolite relationships in this non-model plant.

  10. Targeted next generation sequencing identified a novel mutation in MYO7A causing Usher syndrome type 1 in an Iranian consanguineous pedigree. (United States)

    Kooshavar, Daniz; Razipour, Masoumeh; Movasat, Morteza; Keramatipour, Mohammad


    Usher syndrome (USH) is characterized by congenital hearing loss and retinitis pigmentosa (RP) with a later onset. It is an autosomal recessive trait with clinical and genetic heterogeneity which makes the molecular diagnosis much difficult. In this study, we introduce a pedigree with two affected members with USH type 1 and represent a cost and time effective approach for genetic diagnosis of USH as a genetically heterogeneous disorder. Target region capture in the genes of interest, followed by next generation sequencing (NGS) was used to determine the causative mutations in one of the probands. Then segregation analysis in the pedigree was conducted using PCR-Sanger sequencing. Targeted NGS detected a novel homozygous nonsense variant c.4513G > T (p.Glu1505Ter) in MYO7A. The variant is segregating in the pedigree with an autosomal recessive pattern. In this study, a novel stop gained variant c.4513G > T (p.Glu1505Ter) in MYO7A was found in an Iranian pedigree with two affected members with USH type 1. Bioinformatic as well as pedigree segregation analyses were in line with pathogenic nature of this variant. Targeted NGS panel was showed to be an efficient method for mutation detection in hereditary disorders with locus heterogeneity. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Neuronal genes for subcutaneous fat thickness in human and pig are identified by local genomic sequencing and combined SNP association study.

    Directory of Open Access Journals (Sweden)

    Kyung-Tai Lee


    Full Text Available Obesity represents a major global public health problem that increases the risk for cardiovascular or metabolic disease. The pigs represent an exceptional biomedical model related to energy metabolism and obesity in humans. To pinpoint causal genetic factors for a common form of obesity, we conducted local genomic de novo sequencing, 18.2 Mb, of a porcine QTL region affecting fatness traits, and carried out SNP association studies for backfat thickness and intramuscular fat content in pigs. In order to relate the association studies in pigs to human obesity, we performed a targeted genome wide association study for subcutaneous fat thickness in a cohort population of 8,842 Korean individuals. These combined association studies in human and pig revealed a significant SNP located in a gene family with sequence similarity 73, member A (FAM73A associated with subscapular skin-fold thickness in humans (rs4121165, GC-corrected p-value  = 0.0000175 and with backfat thickness in pigs (ASGA0029495, p-value  = 0.000031. Our combined association studies also suggest that eight neuronal genes are responsible for subcutaneous fat thickness: NEGR1, SLC44A5, PDE4B, LPHN2, ELTD1, ST6GALNAC3, ST6GALNAC5, and TTLL7. These results provide strong support for a major involvement of the CNS in the genetic predisposition to a common form of obesity.

  12. Analyses of expressed sequence tags from the maize foliar pathogen Cercospora zeae-maydis identify novel genes expressed during vegetative, infectious, and reproductive growth. (United States)

    Bluhm, Burton H; Dhillon, Braham; Lindquist, Erika A; Kema, Gert Hj; Goodwin, Stephen B; Dunkle, Larry D


    The ascomycete fungus Cercospora zeae-maydis is an aggressive foliar pathogen of maize that causes substantial losses annually throughout the Western Hemisphere. Despite its impact on maize production, little is known about the regulation of pathogenesis in C. zeae-maydis at the molecular level. The objectives of this study were to generate a collection of expressed sequence tags (ESTs) from C. zeae-maydis and evaluate their expression during vegetative, infectious, and reproductive growth. A total of 27,551 ESTs was obtained from five cDNA libraries constructed from vegetative and sporulating cultures of C. zeae-maydis. The ESTs, grouped into 4088 clusters and 531 singlets, represented 4619 putative unique genes. Of these, 36% encoded proteins similar (E value zeae-maydis, providing specific targets for characterization by molecular genetics and functional genomics. The EST data establish a foundation for future studies in evolutionary and comparative genomics among species of Cercospora and other groups of plant pathogenic fungi.

  13. Benign and Deleterious Cystic Fibrosis Transmembrane Conductance Regulator Mutations Identified by Sequencing in Positive Cystic Fibrosis Newborn Screen Children from California. (United States)

    Salinas, Danieli B; Sosnay, Patrick R; Azen, Colleen; Young, Suzanne; Raraigh, Karen S; Keens, Thomas G; Kharrazi, Martin


    Of the 2007 Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) mutations, 202 have been assigned disease liability. California's racially diverse population, along with CFTR sequencing as part of newborn screening model, provides the opportunity to examine the phenotypes of children with uncategorized mutations to help inform disease liability and penetrance. We conducted a retrospective cohort study based on children screened from 2007 to 2011 and followed for two to six years. Newborns that screened positive were divided into three genotype groups: those with two CF-causing mutations (CF-C); those with one mutation of varying clinic consequence (VCC); and those with one mutation of unknown disease liability (Unknown). Sweat chloride tests, pancreatic sufficiency status, and Pseudomonas aeruginosa colonization were compared. Children with two CF-causing mutations had a classical CF phenotype, while 5% of VCC (4/78) and 11% of Unknown (27/244) met diagnostic criteria of CF. Children carrying Unknown mutations 2215insG with D836Y, and T1036N had early and classical CF phenotype, while others carrying 1525-42G>A, L320V, L967S, R170H, and 296+28A>G had a benign clinical presentation, suggesting that these are non-CF causing. While most infants with VCC and Unknown CFTR mutations do not meet diagnostic criteria for CF, a small proportion do. These findings highlight the range of genotypes and phenotypes in the first few years of life following CF newborn screening when CFTR sequencing is performed.

  14. Benign and Deleterious Cystic Fibrosis Transmembrane Conductance Regulator Mutations Identified by Sequencing in Positive Cystic Fibrosis Newborn Screen Children from California.

    Directory of Open Access Journals (Sweden)

    Danieli B Salinas

    Full Text Available Of the 2007 Cystic Fibrosis Transmembrane Conductance Regulator (CFTR mutations, 202 have been assigned disease liability. California's racially diverse population, along with CFTR sequencing as part of newborn screening model, provides the opportunity to examine the phenotypes of children with uncategorized mutations to help inform disease liability and penetrance.We conducted a retrospective cohort study based on children screened from 2007 to 2011 and followed for two to six years. Newborns that screened positive were divided into three genotype groups: those with two CF-causing mutations (CF-C; those with one mutation of varying clinic consequence (VCC; and those with one mutation of unknown disease liability (Unknown. Sweat chloride tests, pancreatic sufficiency status, and Pseudomonas aeruginosa colonization were compared.Children with two CF-causing mutations had a classical CF phenotype, while 5% of VCC (4/78 and 11% of Unknown (27/244 met diagnostic criteria of CF. Children carrying Unknown mutations 2215insG with D836Y, and T1036N had early and classical CF phenotype, while others carrying 1525-42G>A, L320V, L967S, R170H, and 296+28A>G had a benign clinical presentation, suggesting that these are non-CF causing.While most infants with VCC and Unknown CFTR mutations do not meet diagnostic criteria for CF, a small proportion do. These findings highlight the range of genotypes and phenotypes in the first few years of life following CF newborn screening when CFTR sequencing is performed.

  15. TargetM6A: Identifying N6-Methyladenosine Sites From RNA Sequences via Position-Specific Nucleotide Propensities and a Support Vector Machine. (United States)

    Li, Guang-Qing; Liu, Zi; Shen, Hong-Bin; Yu, Dong-Jun


    As one of the most ubiquitous post-transcriptional modifications of RNA, N 6 -methyladenosine ( [Formula: see text]) plays an essential role in many vital biological processes. The identification of [Formula: see text] sites in RNAs is significantly important for both basic biomedical research and practical drug development. In this study, we designed a computational-based method, called TargetM6A, to rapidly and accurately target [Formula: see text] sites solely from the primary RNA sequences. Two new features, i.e., position-specific nucleotide/dinucleotide propensities (PSNP/PSDP), are introduced and combined with the traditional nucleotide composition (NC) feature to formulate RNA sequences. The extracted features are further optimized to obtain a much more compact and discriminative feature subset by applying an incremental feature selection (IFS) procedure. Based on the optimized feature subset, we trained TargetM6A on the training dataset with a support vector machine (SVM) as the prediction engine. We compared the proposed TargetM6A method with existing methods for predicting [Formula: see text] sites by performing stringent jackknife tests and independent validation tests on benchmark datasets. The experimental results show that the proposed TargetM6A method outperformed the existing methods for predicting [Formula: see text] sites and remarkably improved the prediction performances, with MCC = 0.526 and AUC = 0.818. We also provided a user-friendly web server for TargetM6A, which is publicly accessible for academic use at

  16. Exome sequencing identifies DYNC2H1 mutations as a common cause of asphyxiating thoracic dystrophy (Jeune syndrome) without major polydactyly, renal or retinal involvement (United States)

    Schmidts, Miriam; Arts, Heleen H; Bongers, Ernie M H F; Yap, Zhimin; Oud, Machteld M; Antony, Dinu; Duijkers, Lonneke; Emes, Richard D; Stalker, Jim; Yntema, Jan-Bart L; Plagnol, Vincent; Hoischen, Alexander; Gilissen, Christian; Forsythe, Elisabeth; Lausch, Ekkehart; Veltman, Joris A; Roeleveld, Nel; Superti-Furga, Andrea; Kutkowska-Kazmierczak, Anna; Kamsteeg, Erik-Jan; Elçioğlu, Nursel; van Maarle, Merel C; Graul-Neumann, Luitgard M; Devriendt, Koenraad; Smithson, Sarah F; Wellesley, Diana; Verbeek, Nienke E; Hennekam, Raoul C M; Kayserili, Hulya; Scambler, Peter J; Beales, Philip L; Knoers, Nine VAM; Roepman, Ronald; Mitchison, Hannah M


    Background Jeune asphyxiating thoracic dystrophy (JATD) is a rare, often lethal, recessively inherited chondrodysplasia characterised by shortened ribs and long bones, sometimes accompanied by polydactyly, and renal, liver and retinal disease. Mutations in intraflagellar transport (IFT) genes cause JATD, including the IFT dynein-2 motor subunit gene DYNC2H1. Genetic heterogeneity and the large DYNC2H1 gene size have hindered JATD genetic diagnosis. Aims and methods To determine the contribution to JATD we screened DYNC2H1 in 71 JATD patients JATD patients combining SNP mapping, Sanger sequencing and exome sequencing. Results and conclusions We detected 34 DYNC2H1 mutations in 29/71 (41%) patients from 19/57 families (33%), showing it as a major cause of JATD especially in Northern European patients. This included 13 early protein termination mutations (nonsense/frameshift, deletion, splice site) but no patients carried these in combination, suggesting the human phenotype is at least partly hypomorphic. In addition, 21 missense mutations were distributed across DYNC2H1 and these showed some clustering to functional domains, especially the ATP motor domain. DYNC2H1 patients largely lacked significant extra-skeletal involvement, demonstrating an important genotype–phenotype correlation in JATD. Significant variability exists in the course and severity of the thoracic phenotype, both between affected siblings with identical DYNC2H1 alleles and among individuals with different alleles, which suggests the DYNC2H1 phenotype might be subject to modifier alleles, non-genetic or epigenetic factors. Assessment of fibroblasts from patients showed accumulation of anterograde IFT proteins in the ciliary tips, confirming defects similar to patients with other retrograde IFT machinery mutations, which may be of undervalued potential for diagnostic purposes. PMID:23456818

  17. Molecular analysis of the genus Asparagus based on matK sequences and its application to identify A. racemosus, a medicinally phytoestrogenic species. (United States)

    Boonsom, Teerawat; Waranuch, Neti; Ingkaninan, Kornkanok; Denduangboripant, Jessada; Sukrong, Suchada


    The plant Asparagus racemosus is one of the most widely used sources of phytoestrogens because of its high content of the steroidal saponins, shatavarins I-IV, in roots. The dry root of A. racemosus, known as "Rak-Sam-Sip" in Thai, is one of the most popular herbal medicines, used as an anti-inflammatory, an aphrodisiac and a galactagogue. Recently, the interest in plant-derived estrogens has increased tremendously, making A. racemosus particularly important and a possible target for fraudulent labeling. However, the identification of A. racemosus is generally difficult due to its similar morphology to other Asparagus spp. Thus, accurate authentication of A. racemosus is essential. In this study, 1557-bp nucleotide sequences of the maturase K (matK) gene of eight Asparagus taxa were analyzed. A phylogenetic relationship based on the matK gene was also constructed. Ten polymorphic sites of nucleotide substitutions were found within the matK sequences. A. racemosus showed different nucleotide substitutions to the other species. A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis of the matK gene was developed to discriminate A. racemosus from others. Only the 650-bp PCR product from A. racemosus could be digested with BssKI into two fragments of 397 and 253-bp while the products of other species remained undigested. Ten commercially crude drugs were analyzed and revealed that eight samples were derived from A. racemosus while two samples of that were not. Thus, the PCR-RFLP analysis of matK gene was shown to be an effective method for authentication of the medicinally phytoestrogenic species, A. racemosus. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Exome Sequencing Identifies a Novel LMNA Splice-Site Mutation and Multigenic Heterozygosity of Potential Modifiers in a Family with Sick Sinus Syndrome, Dilated Cardiomyopathy, and Sudden Cardiac Death.

    Directory of Open Access Journals (Sweden)

    Michael V Zaragoza

    Full Text Available The goals are to understand the primary genetic mechanisms that cause Sick Sinus Syndrome and to identify potential modifiers that may result in intrafamilial variability within a multigenerational family. The proband is a 63-year-old male with a family history of individuals (>10 with sinus node dysfunction, ventricular arrhythmia, cardiomyopathy, heart failure, and sudden death. We used exome sequencing of a single individual to identify a novel LMNA mutation and demonstrated the importance of Sanger validation and family studies when evaluating candidates. After initial single-gene studies were negative, we conducted exome sequencing for the proband which produced 9 gigabases of sequencing data. Bioinformatics analysis showed 94% of the reads mapped to the reference and identified 128,563 unique variants with 108,795 (85% located in 16,319 genes of 19,056 target genes. We discovered multiple variants in known arrhythmia, cardiomyopathy, or ion channel associated genes that may serve as potential modifiers in disease expression. To identify candidate mutations, we focused on ~2,000 variants located in 237 genes of 283 known arrhythmia, cardiomyopathy, or ion channel associated genes. We filtered the candidates to 41 variants in 33 genes using zygosity, protein impact, database searches, and clinical association. Only 21 of 41 (51% variants were validated by Sanger sequencing. We selected nine confirmed variants with minor allele frequencies G, a novel heterozygous splice-site mutation as the primary mutation with rare or novel variants in HCN4, MYBPC3, PKP4, TMPO, TTN, DMPK and KCNJ10 as potential modifiers and a mechanism consistent with haploinsufficiency.

  19. Exome and Transcriptome Sequencing of Aedes aegypti Identifies a Locus That Confers Resistance to Brugia malayi and Alters the Immune Response

    KAUST Repository

    Juneja, Punita; Ariani, Cristina V.; Ho, Yung Shwen; Akorli, Jewelna; Palmer, William J.; Pain, Arnab; Jiggins, Francis M.


    to target protein-coding regions of the genome, and used association mapping in a wild Kenyan population to identify a single, dominant, sex-linked locus underlying resistance. This falls in a region of the genome where a resistance locus was previously

  20. Free-living protozoa in two unchlorinated drinking water supplies identified by phylogenic analysis of 18S rRNA gene sequences

    NARCIS (Netherlands)

    Valster, R.M.; Wullings, B.A.; Bakker, G.; Smidt, H.; Kooij, van der D.


    Free-living protozoan communities in water supplies may include hosts for Legionella pneumophila and other undesired bacteria and also pathogens. This study aimed at identifying free-living protozoa in two unchlorinated groundwater supplies using cultivation-independent molecular approaches. For

  1. Phylogeny of geminivirus coat protein sequences and digital PCR aid in identifying Spissistilus festinus (Say) as a vector of Grapevine red blotch-associated virus (United States)

    Grapevine red blotch-associated virus (GRBaV) is a newly identified virus of grapevines, and a putative member of a new genus within the family Geminiviridae. This virus is associated with red blotch disease that was first reported in California in 2008. It affects the profitability of vineyards by ...

  2. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations. (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth


    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  3. Deep sequencing of small RNAs identifies canonical and non-canonical miRNA and endogenous siRNAs in mammalian somatic tissues. (United States)

    Castellano, Leandro; Stebbing, Justin


    MicroRNAs (miRNAs) are small RNA molecules that regulate gene expression. They are characterized by specific maturation processes defined by canonical and non-canonical biogenic pathways. Analysis of ∼0.5 billion sequences from mouse data sets derived from different tissues, developmental stages and cell types, partly characterized by either ablation or mutation of the main proteins belonging to miRNA processor complexes, reveals 66 high-confidence new genomic loci coding for miRNAs that could be processed in a canonical or non-canonical manner. A proportion of the newly discovered miRNAs comprises mirtrons, for which we define a new sub-class. Notably, some of these newly discovered miRNAs are generated from untranslated and open reading frames of coding genes, and we experimentally validate these. We also show that many annotated miRNAs do not present miRNA-like features, as they are neither processed by known processing complexes nor loaded on AGO2; this indicates that the current miRNA miRBase database list should be refined and re-defined. Accordingly, a group of them map on ribosomal RNA molecules, whereas others cannot undergo genuine miRNA biogenesis. Notably, a group of annotated miRNAs are Dgcr8 independent and DICER dependent endogenous small interfering RNAs that derive from a unique hairpin formed from a short interspersed nuclear element.

  4. A viral metagenomic approach on a non-metagenomic experiment: Mining next generation sequencing datasets from pig DNA identified several porcine parvoviruses for a retrospective evaluation of viral infections.

    Directory of Open Access Journals (Sweden)

    Samuele Bovo

    Full Text Available Shot-gun next generation sequencing (NGS on whole DNA extracted from specimens collected from mammals often produces reads that are not mapped (i.e. unmapped reads on the host reference genome and that are usually discarded as by-products of the experiments. In this study, we mined Ion Torrent reads obtained by sequencing DNA isolated from archived blood samples collected from 100 performance tested Italian Large White pigs. Two reduced representation libraries were prepared from two DNA pools constructed each from 50 equimolar DNA samples. Bioinformatic analyses were carried out to mine unmapped reads on the reference pig genome that were obtained from the two NGS datasets. In silico analyses included read mapping and sequence assembly approaches for a viral metagenomic analysis using the NCBI Viral Genome Resource. Our approach identified sequences matching several viruses of the Parvoviridae family: porcine parvovirus 2 (PPV2, PPV4, PPV5 and PPV6 and porcine bocavirus 1-H18 isolate (PBoV1-H18. The presence of these viruses was confirmed by PCR and Sanger sequencing of individual DNA samples. PPV2, PPV4, PPV5, PPV6 and PBoV1-H18 were all identified in samples collected in 1998-2007, 1998-2000, 1997-2000, 1998-2004 and 2003, respectively. For most of these viruses (PPV4, PPV5, PPV6 and PBoV1-H18 previous studies reported their first occurrence much later (from 5 to more than 10 years than our identification period and in different geographic areas. Our study provided a retrospective evaluation of apparently asymptomatic parvovirus infected pigs providing information that could be important to define occurrence and prevalence of different parvoviruses in South Europe. This study demonstrated the potential of mining NGS datasets non-originally derived by metagenomics experiments for viral metagenomics analyses in a livestock species.