WorldWideScience

Sample records for identifies important shifts

  1. Identifying Patterns of Participant Shifts in the Psalms

    NARCIS (Netherlands)

    Erwich, C.M.

    2017-01-01

    A great challenge of reading the Hebrew poetry of the Psalms is the identification of participants. The major cause of this problem is a continual shift in person, gender and number (so-called PGN-shifts, or participant shifts) in the text. To account for these PGN-shifts, scholars have always used

  2. The Importance of identifiers: IWGSC Meeting 20170720

    OpenAIRE

    Haak, Laurel

    2017-01-01

    Presentation by Laure Haak at the 20 July 2017 meeting of the IWGSC, about use of identifiers in connecting researchers, funding, facilities, and publications. Description of approach and initial results of User Facilities and Publications Working Group, and applications for Scientific Collections.

  3. Species invasion shifts the importance of predator dependence.

    Science.gov (United States)

    Griffen, Blaine D; Delaney, David G

    2007-12-01

    The strength of interference between foraging individuals can influence per capita consumption rates, with important consequences for predator and prey populations and system stability. Here we demonstrate how the replacement of a previously established invader, the predatory crab Carcinus maenas, by the recently invading predatory crab Hemigrapsus sanguineus shifts predation from a species that experiences strong predator interference (strong predator dependence) to one that experiences weak predator interference (weak predator dependence). We demonstrate using field experiments that differences in the strength of predator dependence persist for these species both when they forage on a single focal prey species only (the mussel Mytilus edulis) and when they forage more broadly across the entire prey community. This shift in predator dependence with species replacement may be altering the biomass across trophic levels, consistent with theoretical predictions, as we show that H. sanguineus populations are much larger than C. maenas populations throughout their invaded ranges. Our study highlights that predator dependence may differ among predator species and demonstrates that different predatory impacts of two conspicuous invasive predators may be explained at least in part by different strengths of predator dependence.

  4. Identifying Importance-Performance Matrix Analysis (IPMA) of ...

    African Journals Online (AJOL)

    Identifying Importance-Performance Matrix Analysis (IPMA) of intellectual capital and Islamic work ethics in Malaysian SMES. ... capital and Islamic work ethics significantly influenced business performance. ... AJOL African Journals Online.

  5. Identifying the important factors in simulation models with many factors

    NARCIS (Netherlands)

    Bettonvil, B.; Kleijnen, J.P.C.

    1994-01-01

    Simulation models may have many parameters and input variables (together called factors), while only a few factors are really important (parsimony principle). For such models this paper presents an effective and efficient screening technique to identify and estimate those important factors. The

  6. Identifying secondary structures in proteins using NMR chemical shift 3D correlation maps

    Science.gov (United States)

    Kumari, Amrita; Dorai, Kavita

    2013-06-01

    NMR chemical shifts are accurate indicators of molecular environment and have been extensively used as aids in protein structure determination. This work focuses on creating empirical 3D correlation maps of backbone chemical shift nuclei for use as identifiers of secondary structure elements in proteins. A correlated database of backbone nuclei chemical shifts was constructed from experimental structural data gathered from entries in the Protein Data Bank (PDB) as well as isotropic chemical shift values from the RefDB database. Rigorous statistical analysis of the maps led to the conclusion that specific correlations between triplets of backbone chemical shifts are best able to differentiate between different secondary structures such as α-helices, β-strands and turns. The method is compared with similar techniques that use NMR chemical shift information as aids in biomolecular structure determination and performs well in tests done on experimental data determined for different types of proteins, including large multi-domain proteins and membrane proteins.

  7. A longitudinal genetic survey identifies temporal shifts in the population structure of Dutch house sparrows

    Science.gov (United States)

    Cousseau, L; Husemann, M; Foppen, R; Vangestel, C; Lens, L

    2016-01-01

    Dutch house sparrow (Passer domesticus) densities dropped by nearly 50% since the early 1980s, and similar collapses in population sizes have been reported across Europe. Whether, and to what extent, such relatively recent demographic changes are accompanied by concomitant shifts in the genetic population structure of this species needs further investigation. Therefore, we here explore temporal shifts in genetic diversity, genetic structure and effective sizes of seven Dutch house sparrow populations. To allow the most powerful statistical inference, historical populations were resampled at identical locations and each individual bird was genotyped using nine polymorphic microsatellites. Although the demographic history was not reflected by a reduction in genetic diversity, levels of genetic differentiation increased over time, and the original, panmictic population (inferred from the museum samples) diverged into two distinct genetic clusters. Reductions in census size were supported by a substantial reduction in effective population size, although to a smaller extent. As most studies of contemporary house sparrow populations have been unable to identify genetic signatures of recent population declines, results of this study underpin the importance of longitudinal genetic surveys to unravel cryptic genetic patterns. PMID:27273323

  8. MEDIASTINAL SHIFT: A SIGN OF SIGNIFICANT CLINICAL AND RADIOLOGICAL IMPORTANCE IN DIAGNOSIS OF MALIGNANT PLEURAL EFFUSION

    Directory of Open Access Journals (Sweden)

    R Khajotia

    2012-08-01

    Full Text Available Mediastinal shift (upper and lower is a clinical and radiologicalmarker of significant importance, which at times helps todetermine the aetiological cause of the underlying pathology.Tracheal shift is an indicator of upper mediastinal shift, whilea shift in the position of the heart indicates a lower mediastinalshift. Since the pleural cavity is confined by the rib cage, incase of a moderately large pleural effusion, the structures inthe thoracic cavity normally get ‘pushed’ to the opposite sideresulting in a shift of the upper and lower mediastinum. Thisis clinically and radiologically detected by a shift in the tracheaand heart to the side opposite to the pleural effusion. This iscommonly seen in pleural effusions resulting from tuberculosisor other infections. However, in some cases even a largepleural effusion fails to shift the mediastinum to the oppositeside. In fact, in some cases, the trachea and heart areobserved to be central or even shifted to the same side asthe effusion. This finding is of immense importance as it is aclinical indicator of a more serious condition which needsprompt diagnosis and urgent management. We report here,one such case of a middle-aged man who presented to theemergency department with complaints of increasingbreathlessness and whose clinical and radiological examinationrevealed a moderately large right-sided pleural effusion withthe trachea and heart also shifted to the right side.

  9. Identifying important nodes by adaptive LeaderRank

    Science.gov (United States)

    Xu, Shuang; Wang, Pei

    2017-03-01

    Spreading process is a common phenomenon in complex networks. Identifying important nodes in complex networks is of great significance in real-world applications. Based on the spreading process on networks, a lot of measures have been proposed to evaluate the importance of nodes. However, most of the existing measures are appropriate to static networks, which are fragile to topological perturbations. Many real-world complex networks are dynamic rather than static, meaning that the nodes and edges of such networks may change with time, which challenge numerous existing centrality measures. Based on a new weighted mechanism and the newly proposed H-index and LeaderRank (LR), this paper introduces a variant of the LR measure, called adaptive LeaderRank (ALR), which is a new member of the LR-family. Simulations on six real-world networks reveal that the new measure can well balance between prediction accuracy and robustness. More interestingly, the new measure can better adapt to the adjustment or local perturbations of network topologies, as compared with the existing measures. By discussing the detailed properties of the measures from the LR-family, we illustrate that the ALR has its competitive advantages over the other measures. The proposed algorithm enriches the measures to understand complex networks, and may have potential applications in social networks and biological systems.

  10. Identifying important motivational factors for professionals in Greek hospitals

    Science.gov (United States)

    Kontodimopoulos, Nick; Paleologou, Victoria; Niakas, Dimitris

    2009-01-01

    Background The purpose of this study was to identify important motivational factors according to the views of health-care professionals in Greek hospitals and particularly to determine if these might differ in the public and private sectors. Methods A previously developed -and validated- instrument addressing four work-related motivators (job attributes, remuneration, co-workers and achievements) was used. Three categories of health care professionals, doctors (N = 354), nurses (N = 581) and office workers (N = 418), working in public and private hospitals, participated and motivation was compared across socio-demographic and occupational variables. Results The range of reported motivational factors was mixed and Maslow's conclusions that lower level motivational factors must be met before ascending to the next level were not confirmed. The highest ranked motivator for the entire sample, and by professional subgroup, was achievements (P motivators were similar, and only one significant difference was observed, namely between doctors and nurses in respect to co-workers (P motivated by all factors significantly more than their public-hospital counterparts. Conclusion The results are in agreement with the literature which focuses attention to management approaches employing both monetary and non-monetary incentives to motivate health care workers. This study showed that intrinsic factors are particularly important and should become a target for effective employee motivation. PMID:19754968

  11. Neural underpinnings of the identifiable victim effect: affect shifts preferences for giving.

    Science.gov (United States)

    Genevsky, Alexander; Västfjäll, Daniel; Slovic, Paul; Knutson, Brian

    2013-10-23

    The "identifiable victim effect" refers to peoples' tendency to preferentially give to identified versus anonymous victims of misfortune, and has been proposed to partly depend on affect. By soliciting charitable donations from human subjects during behavioral and neural (i.e., functional magnetic resonance imaging) experiments, we sought to determine whether and how affect might promote the identifiable victim effect. Behaviorally, subjects gave more to orphans depicted by photographs versus silhouettes, and their shift in preferences was mediated by photograph-induced feelings of positive arousal, but not negative arousal. Neurally, while photographs versus silhouettes elicited activity in widespread circuits associated with facial and affective processing, only nucleus accumbens activity predicted and could statistically account for increased donations. Together, these findings suggest that presenting evaluable identifiable information can recruit positive arousal, which then promotes giving. We propose that affect elicited by identifiable stimuli can compel people to give more to strangers, even despite costs to the self.

  12. Identifying important parameters for a continuous bioscouring process

    NARCIS (Netherlands)

    Lenting, H.B.M.; Lenting, H.B.M.; Zwier, E.; Nierstrasz, Vincent

    2002-01-01

    Compared to a bioscouring process in the batch mode, a continuously operating process requires relatively short processing steps. This study focusses on minimizing the required enzymatic incubation time. It is clear that the presence of a sufficient level of surfactant is of major importance in

  13. A landscape ecology approach identifies important drivers of urban biodiversity.

    Science.gov (United States)

    Turrini, Tabea; Knop, Eva

    2015-04-01

    Cities are growing rapidly worldwide, yet a mechanistic understanding of the impact of urbanization on biodiversity is lacking. We assessed the impact of urbanization on arthropod diversity (species richness and evenness) and abundance in a study of six cities and nearby intensively managed agricultural areas. Within the urban ecosystem, we disentangled the relative importance of two key landscape factors affecting biodiversity, namely the amount of vegetated area and patch isolation. To do so, we a priori selected sites that independently varied in the amount of vegetated area in the surrounding landscape at the 500-m scale and patch isolation at the 100-m scale, and we hold local patch characteristics constant. As indicator groups, we used bugs, beetles, leafhoppers, and spiders. Compared to intensively managed agricultural ecosystems, urban ecosystems supported a higher abundance of most indicator groups, a higher number of bug species, and a lower evenness of bug and beetle species. Within cities, a high amount of vegetated area increased species richness and abundance of most arthropod groups, whereas evenness showed no clear pattern. Patch isolation played only a limited role in urban ecosystems, which contrasts findings from agro-ecological studies. Our results show that urban areas can harbor a similar arthropod diversity and abundance compared to intensively managed agricultural ecosystems. Further, negative consequences of urbanization on arthropod diversity can be mitigated by providing sufficient vegetated space in the urban area, while patch connectivity is less important in an urban context. This highlights the need for applying a landscape ecological approach to understand the mechanisms shaping urban biodiversity and underlines the potential of appropriate urban planning for mitigating biodiversity loss. © 2015 John Wiley & Sons Ltd.

  14. Novel Plasmodium falciparum metabolic network reconstruction identifies shifts associated with clinical antimalarial resistance.

    Science.gov (United States)

    Carey, Maureen A; Papin, Jason A; Guler, Jennifer L

    2017-07-19

    Malaria remains a major public health burden and resistance has emerged to every antimalarial on the market, including the frontline drug, artemisinin. Our limited understanding of Plasmodium biology hinders the elucidation of resistance mechanisms. In this regard, systems biology approaches can facilitate the integration of existing experimental knowledge and further understanding of these mechanisms. Here, we developed a novel genome-scale metabolic network reconstruction, iPfal17, of the asexual blood-stage P. falciparum parasite to expand our understanding of metabolic changes that support resistance. We identified 11 metabolic tasks to evaluate iPfal17 performance. Flux balance analysis and simulation of gene knockouts and enzyme inhibition predict candidate drug targets unique to resistant parasites. Moreover, integration of clinical parasite transcriptomes into the iPfal17 reconstruction reveals patterns associated with antimalarial resistance. These results predict that artemisinin sensitive and resistant parasites differentially utilize scavenging and biosynthetic pathways for multiple essential metabolites, including folate and polyamines. Our findings are consistent with experimental literature, while generating novel hypotheses about artemisinin resistance and parasite biology. We detect evidence that resistant parasites maintain greater metabolic flexibility, perhaps representing an incomplete transition to the metabolic state most appropriate for nutrient-rich blood. Using this systems biology approach, we identify metabolic shifts that arise with or in support of the resistant phenotype. This perspective allows us to more productively analyze and interpret clinical expression data for the identification of candidate drug targets for the treatment of resistant parasites.

  15. Herbivory as an important selective force in the evolution of floral traits and pollinator shifts

    Science.gov (United States)

    Overson, Rick P.; Raguso, Robert A.; Skogen, Krissa A.

    2017-01-01

    Abstract Floral trait evolution is frequently attributed to pollinator-mediated selection but herbivores can play a key role in shaping plant reproductive biology. Here we examine the role of florivores in driving floral trait evolution and pollinator shifts in a recently radiated clade of flowering plants, Oenothera sect. Calylophus. We compare florivory by a specialist, internal feeder, Mompha, on closely related hawkmoth- and bee-pollinated species and document variation in damage based on floral traits within sites, species and among species. Our results show that flowers with longer floral tubes and decreased floral flare have increased Mompha damage. Bee-pollinated flowers, which have substantially smaller floral tubes, experience on average 13% less Mompha florivory than do hawkmoth-pollinated flowers. The positive association between tube length and Mompha damage is evident even within sites of some species, suggesting that Mompha can drive trait differentiation at microevolutionary scales. Given that there are at least two independent shifts from hawkmoth to bee pollination in this clade, florivore-mediated selection on floral traits may have played an important role in facilitating morphological changes associated with transitions from hawkmoth to bee pollination. PMID:28011456

  16. Comparative transcriptomics of the nematode gut identifies global shifts in feeding mode and pathogen susceptibility.

    Science.gov (United States)

    Lightfoot, James W; Chauhan, Veeren M; Aylott, Jonathan W; Rödelsperger, Christian

    2016-03-05

    The nematode Pristionchus pacificus has been established as a model for comparative studies using the well known Caenorhabditis elegans as a reference. Despite their relatedness, previous studies have revealed highly divergent development and a number of morphological differences including the lack of a pharyngal structure, the grinder, used to physically lyse the ingested bacteria in C. elegans. To complement current knowledge about developmental and ecological differences with a better understanding of their feeding modes, we have sequenced the intestinal transcriptomes of both nematodes. In total, we found 464 intestine-enriched genes in P. pacificus and 724 in C. elegans, of which the majority (66%) has been identified by previous studies. Interestingly, only 15 genes could be identified with shared intestinal enrichment in both species, of which three genes are Hedgehog signaling molecules supporting a highly conserved role of this pathway for intestinal development across all metazoa. At the level of gene families, we find similar divergent trends with only five families displaying significant intestinal enrichment in both species. We compared our data with transcriptomic responses to various pathogens. Strikingly, C. elegans intestine-enriched genes showed highly significant overlaps with pathogen response genes whereas this was not the case for P. pacificus, indicating shifts in pathogen susceptibility that might be explained by altered feeding modes. Our study reveals first insights into the evolution of feeding systems and the associated changes in intestinal gene expression that might have facilitated nematodes of the P. pacificus lineage to colonize new environments. These findings deepen our understanding about how morphological and genomic diversity is created during the course of evolution.

  17. The relative importance of fluid and kinetic frequency shifts of an electron plasma wave

    International Nuclear Information System (INIS)

    Winjum, B. J.; Fahlen, J.; Mori, W. B.

    2007-01-01

    The total nonlinear frequency shift of a plasma wave including both fluid and kinetic effects is estimated when the phase velocity of the wave is much less than the speed of light. Using a waterbag or fluid model, the nonlinear frequency shift due to harmonic generation is calculated for an arbitrary shift in the wavenumber. In the limit where the wavenumber does not shift, the result is in agreement with previously published work [R. L. Dewar and J. Lindl, Phys. Fluids 15, 820 (1972); T. P. Coffey, ibid. 14, 1402 (1971)]. This shift is compared to the kinetic shift of Morales and O'Neil [G. J. Morales and T. M. O'Neil, Phys. Rev. Lett. 28, 417 (1972)] for wave amplitudes and values of kλ D of interest to Raman backscatter of a laser driver in inertial confinement fusion

  18. The relative importance of fluid and kinetic frequency shifts of an electron plasma wave

    Science.gov (United States)

    Winjum, B. J.; Fahlen, J.; Mori, W. B.

    2007-10-01

    The total nonlinear frequency shift of a plasma wave including both fluid and kinetic effects is estimated when the phase velocity of the wave is much less than the speed of light. Using a waterbag or fluid model, the nonlinear frequency shift due to harmonic generation is calculated for an arbitrary shift in the wavenumber. In the limit where the wavenumber does not shift, the result is in agreement with previously published work [R. L. Dewar and J. Lindl, Phys. Fluids 15, 820 (1972); T. P. Coffey, Phys. Fluids 14, 1402 (1971)]. This shift is compared to the kinetic shift of Morales and O'Neil [G. J. Morales and T. M. O'Neil, Phys. Rev. Lett. 28, 417 (1972)] for wave amplitudes and values of kλD of interest to Raman backscatter of a laser driver in inertial confinement fusion.

  19. Identify Beta-Hairpin Motifs with Quadratic Discriminant Algorithm Based on the Chemical Shifts.

    Directory of Open Access Journals (Sweden)

    Feng YongE

    Full Text Available Successful prediction of the beta-hairpin motif will be helpful for understanding the of the fold recognition. Some algorithms have been proposed for the prediction of beta-hairpin motifs. However, the parameters used by these methods were primarily based on the amino acid sequences. Here, we proposed a novel model for predicting beta-hairpin structure based on the chemical shift. Firstly, we analyzed the statistical distribution of chemical shifts of six nuclei in not beta-hairpin and beta-hairpin motifs. Secondly, we used these chemical shifts as features combined with three algorithms to predict beta-hairpin structure. Finally, we achieved the best prediction, namely sensitivity of 92%, the specificity of 94% with 0.85 of Mathew's correlation coefficient using quadratic discriminant analysis algorithm, which is clearly superior to the same method for the prediction of beta-hairpin structure from 20 amino acid compositions in the three-fold cross-validation. Our finding showed that the chemical shift is an effective parameter for beta-hairpin prediction, suggesting the quadratic discriminant analysis is a powerful algorithm for the prediction of beta-hairpin.

  20. Identifying stereoisomers by ab-initio calculation of secondary isotope shifts on NMR chemical shieldings.

    Science.gov (United States)

    Böhm, Karl-Heinz; Banert, Klaus; Auer, Alexander A

    2014-04-23

    We present ab-initio calculations of secondary isotope effects on NMR chemical shieldings. The change of the NMR chemical shift of a certain nucleus that is observed if another nucleus is replaced by a different isotope can be calculated by computing vibrational corrections on the NMR parameters using electronic structure methods. We demonstrate that the accuracy of the computational results is sufficient to even distinguish different conformers. For this purpose, benchmark calculations for fluoro(2-2H)ethane in gauche and antiperiplanar conformation are carried out at the HF, MP2 and CCSD(T) level of theory using basis sets ranging from double- to quadruple-zeta quality. The methodology is applied to the secondary isotope shifts for 2-fluoronorbornane in order to resolve an ambiguity in the literature on the assignment of endo- and exo-2-fluoronorbornanes with deuterium substituents in endo-3 and exo-3 positions, also yielding insight into mechanistic details of the corresponding synthesis.

  1. Identifying Stereoisomers by ab-initio Calculation of Secondary Isotope Shifts on NMR Chemical Shieldings

    Directory of Open Access Journals (Sweden)

    Karl-Heinz Böhm

    2014-04-01

    Full Text Available We present ab-initio calculations of secondary isotope effects on NMR chemical shieldings. The change of the NMR chemical shift of a certain nucleus that is observed if another nucleus is replaced by a different isotope can be calculated by computing vibrational corrections on the NMR parameters using electronic structure methods. We demonstrate that the accuracy of the computational results is sufficient to even distinguish different conformers. For this purpose, benchmark calculations for fluoro(2-2Hethane in gauche and antiperiplanar conformation are carried out at the HF, MP2 and CCSD(T level of theory using basis sets ranging from double- to quadruple-zeta quality. The methodology is applied to the secondary isotope shifts for 2-fluoronorbornane in order to resolve an ambiguity in the literature on the assignment of endo- and exo-2-fluoronorbornanes with deuterium substituents in endo-3 and exo-3 positions, also yielding insight into mechanistic details of the corresponding synthesis.

  2. Tropical secondary forests regenerating after shifting cultivation in the Philippines uplands are important carbon sinks.

    Science.gov (United States)

    Mukul, Sharif A; Herbohn, John; Firn, Jennifer

    2016-03-08

    In the tropics, shifting cultivation has long been attributed to large scale forest degradation, and remains a major source of uncertainty in forest carbon accounting. In the Philippines, shifting cultivation, locally known as kaingin, is a major land-use in upland areas. We measured the distribution and recovery of aboveground biomass carbon along a fallow gradient in post-kaingin secondary forests in an upland area in the Philippines. We found significantly higher carbon in the aboveground total biomass and living woody biomass in old-growth forest, while coarse dead wood biomass carbon was higher in the new fallow sites. For young through to the oldest fallow secondary forests, there was a progressive recovery of biomass carbon evident. Multivariate analysis indicates patch size as an influential factor in explaining the variation in biomass carbon recovery in secondary forests after shifting cultivation. Our study indicates secondary forests after shifting cultivation are substantial carbon sinks and that this capacity to store carbon increases with abandonment age. Large trees contribute most to aboveground biomass. A better understanding of the relative contribution of different biomass sources in aboveground total forest biomass, however, is necessary to fully capture the value of such landscapes from forest management, restoration and conservation perspectives.

  3. Comparative analysis of primary versus relapse/refractory DLBCL identifies shifts in mutation spectrum.

    Science.gov (United States)

    Greenawalt, Danielle M; Liang, Winnie S; Saif, Sakina; Johnson, Justin; Todorov, Petar; Dulak, Austin; Enriquez, Daniel; Halperin, Rebecca; Ahmed, Ambar; Saveliev, Vladislav; Carpten, John; Craig, David; Barrett, J Carl; Dougherty, Brian; Zinda, Michael; Fawell, Stephen; Dry, Jonathan R; Byth, Kate

    2017-11-21

    Current understanding of the mutation spectrum of relapsed/refractory (RR) tumors is limited. We performed whole exome sequencing (WES) on 47 diffuse large B cell lymphoma (DLBCL) tumors that persisted after R-CHOP treatment, 8 matched to primary biopsies. We compared genomic alterations from the RR cohort against two treatment-naïve DLBCL cohorts (n=112). While the overall number and types of mutations did not differ significantly, we identified frequency changes in DLBCL driver genes. The overall frequency of MYD88 mutant samples increased (12% to 19%), but we noted a decrease in p.L265P (8% to 4%) and increase in p.S219C mutations (2% to 6%). CARD11 p.D230N, PIM1 p.K115N and CD79B p.Y196C mutations were not observed in the RR cohort, although these mutations were prominent in the primary DLBCL samples. We observed an increase in BCL2 mutations (21% to 38% of samples), BCL2 amplifications (3% to 6% of samples) and CREBBP mutations (31% to 42% of samples) in the RR cohort, supported by acquisition of mutations in these genes in relapsed compared to diagnostic biopsies from the same patient. These increases may reflect the genetic characteristics of R-CHOP RR tumors expected to be enriched for during clinical trial enrollment. These findings hold significance for a number of emerging targeted therapies aligned to genetic targets and biomarkers in DLBCL, reinforcing the importance of time-of-treatment biomarker screening during DLBCL therapy selection.

  4. Methodology for identifying boundaries of systems important to safety in CANDU nuclear power plants

    International Nuclear Information System (INIS)

    Therrien, S.; Komljenovic, D.; Therrien, P.; Ruest, C.; Prevost, P.; Vaillancourt, R.

    2007-01-01

    This paper presents a methodology developed to identify the boundaries of the systems important to safety (SIS) at the Gentilly-2 Nuclear Power Plant (NPP), Hydro-Quebec. The SIS boundaries identification considers nuclear safety only. Components that are not identified as important to safety are systematically identified as related to safety. A global assessment process such as WANO/INPO AP-913 'Equipment Reliability Process' will be needed to implement adequate changes in the management rules of those components. The paper depicts results in applying the methodology to the Shutdown Systems 1 and 2 (SDS 1, 2), and to the Emergency Core Cooling System (ECCS). This validation process enabled fine tuning the methodology, performing a better estimate of the effort required to evaluate a system, and identifying components important to safety of these systems. (author)

  5. Deep Ion Torrent sequencing identifies soil fungal community shifts after frequent prescribed fires in a southeastern US forest ecosystem.

    Science.gov (United States)

    Brown, Shawn P; Callaham, Mac A; Oliver, Alena K; Jumpponen, Ari

    2013-12-01

    Prescribed burning is a common management tool to control fuel loads, ground vegetation, and facilitate desirable game species. We evaluated soil fungal community responses to long-term prescribed fire treatments in a loblolly pine forest on the Piedmont of Georgia and utilized deep Internal Transcribed Spacer Region 1 (ITS1) amplicon sequencing afforded by the recent Ion Torrent Personal Genome Machine (PGM). These deep sequence data (19,000 + reads per sample after subsampling) indicate that frequent fires (3-year fire interval) shift soil fungus communities, whereas infrequent fires (6-year fire interval) permit system resetting to a state similar to that without prescribed fire. Furthermore, in nonmetric multidimensional scaling analyses, primarily ectomycorrhizal taxa were correlated with axes associated with long fire intervals, whereas soil saprobes tended to be correlated with the frequent fire recurrence. We conclude that (1) multiplexed Ion Torrent PGM analyses allow deep cost effective sequencing of fungal communities but may suffer from short read lengths and inconsistent sequence quality adjacent to the sequencing adaptor; (2) frequent prescribed fires elicit a shift in soil fungal communities; and (3) such shifts do not occur when fire intervals are longer. Our results emphasize the general responsiveness of these forests to management, and the importance of fire return intervals in meeting management objectives. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  6. Importance of latrine communication in European rabbits shifts along a rural-to-urban gradient.

    Science.gov (United States)

    Ziege, Madlen; Bierbach, David; Bischoff, Svenja; Brandt, Anna-Lena; Brix, Mareike; Greshake, Bastian; Merker, Stefan; Wenninger, Sandra; Wronski, Torsten; Plath, Martin

    2016-06-14

    Information transfer in mammalian communication networks is often based on the deposition of excreta in latrines. Depending on the intended receiver(s), latrines are either formed at territorial boundaries (between-group communication) or in core areas of home ranges (within-group communication). The relative importance of both types of marking behavior should depend, amongst other factors, on population densities and social group sizes, which tend to differ between urban and rural wildlife populations. Our study is the first to assess (direct and indirect) anthropogenic influences on mammalian latrine-based communication networks along a rural-to-urban gradient in European rabbits (Oryctolagus cuniculus) living in urban, suburban and rural areas in and around Frankfurt am Main (Germany). The proportion of latrines located in close proximity to the burrow was higher at rural study sites compared to urban and suburban ones. At rural sites, we found the largest latrines and highest latrine densities close to the burrow, suggesting that core marking prevailed. By contrast, latrine dimensions and densities increased with increasing distance from the burrow in urban and suburban populations, suggesting a higher importance of peripheral marking. Increased population densities, but smaller social group sizes in urban rabbit populations may lead to an increased importance of between-group communication and thus, favor peripheral over core marking. Our study provides novel insights into the manifold ways by which man-made habitat alterations along a rural-to-urban gradient directly and indirectly affect wildlife populations, including latrine-based communication networks.

  7. Testing peat humification analysis in an Australian context: identifying wet shifts in regional climate over the past 4000 years

    Directory of Open Access Journals (Sweden)

    M.A. Burrows

    2014-08-01

    Full Text Available Peat humification analysis is presented as a robust palaeoclimatic proxy, suitable for use on mid–late Holocene peat sequences situated in the Southern Hemisphere. The proxy is shown to permit the identification of wet and dry shifts in a peat sequence from the humid tropics of north-eastern Australia. A significant correlation is found between the humification record and other proxies indicative of past climate conditions such as pollen, δ13C, C/N and macrocharcoal. Sixteen wet shifts detected in the humification record for Bromfield Swamp occur at the following dates (with 2σ range: 3830 (3920–3740, 3560 (3640–3480, 3490 (3560–3420, 3380 (3450–3300, 3120 (3250–2970, 2950 (3100–2790, 2560 (2710–2450, 2430 (2600–2260, 2120 (2330–1910, 1750 (1980–1520, 1430 (1660–1200, 1170 (1390–960, 1010 (1220–820, 620 (770–500, 300 (400–200 and 100 (200–10 cal. yr BP. Eleven dry shifts are also identified in the record at 4220 (4330–4110, 3670 (3750–3590, 3330 (3420–3220, 3020 (3170–2870, 2350 (2530–2160, 2020 (2230–1800, 1730 (1980–1510, 1290 (1510–1070, 700 (870–560, 400 (470–300 and 260 (360–150 cal yr BP. Blechnum and Poaceae are identified by pollen analysis to be the dominant plants of the swamp surface over the past 4000 years. The ratio of these two plant taxa in the pollen record correlates well with identified wet and dry shifts. It is suggested that a ratio ≤1 possibly indicates dry conditions, a ratio of >1–3 indicates wet or dry conditions, and a ratio >3 implies wet conditions. Large macrocharcoal peaks are recorded during the initiation phase of the peat sequence at approximately 4090 cal. yr BP, and at 3700–3620 cal. yr BP, both of these time periods being coincident with dry phases. Isolated minor macrocharcoal peaks at ca. 2860, 2820, 2620, 2560, 2130, 1930, 1740 and 200 cal. yr BP are found to coincide with periods of average effective precipitation (based on the humification

  8. Genes Important for Schizosaccharomyces pombe Meiosis Identified Through a Functional Genomics Screen

    Science.gov (United States)

    Blyth, Julie; Makrantoni, Vasso; Barton, Rachael E.; Spanos, Christos; Rappsilber, Juri; Marston, Adele L.

    2018-01-01

    Meiosis is a specialized cell division that generates gametes, such as eggs and sperm. Errors in meiosis result in miscarriages and are the leading cause of birth defects; however, the molecular origins of these defects remain unknown. Studies in model organisms are beginning to identify the genes and pathways important for meiosis, but the parts list is still poorly defined. Here we present a comprehensive catalog of genes important for meiosis in the fission yeast, Schizosaccharomyces pombe. Our genome-wide functional screen surveyed all nonessential genes for roles in chromosome segregation and spore formation. Novel genes important at distinct stages of the meiotic chromosome segregation and differentiation program were identified. Preliminary characterization implicated three of these genes in centrosome/spindle pole body, centromere, and cohesion function. Our findings represent a near-complete parts list of genes important for meiosis in fission yeast, providing a valuable resource to advance our molecular understanding of meiosis. PMID:29259000

  9. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C. dubliniensis.

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, P.H.M.

    2003-01-01

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  10. Reducing uncertainty at minimal cost: a method to identify important input parameters and prioritize data collection

    NARCIS (Netherlands)

    Uwizeye, U.A.; Groen, E.A.; Gerber, P.J.; Schulte, Rogier P.O.; Boer, de I.J.M.

    2016-01-01

    The study aims to illustrate a method to identify important input parameters that explain most of the output variance ofenvironmental assessment models. The method is tested for the computation of life-cycle nitrogen (N) use efficiencyindicators among mixed dairy production systems in Rwanda. We

  11. Cooperative dialogues during the shift change-over. Importance for the safety and reliability of production systems

    International Nuclear Information System (INIS)

    Grusenmeyer, C.

    1997-01-01

    During shift changeover, verbal communications between operators constitute a means of cooperating in order to continue actions and to carry out the process. The present study was aimed at analyzing verbal exchanges and consequently the role of this work phase. The paper proposes a method of analyzing verbal exchanges This method allows to follow the development of dialogues step by step and enables the operators' representation to be described as the dialogues unfolds. Dialogues observed in two industrial settings (paper manufacturing and nuclear power plant) are analyzed in two complementary ways. The analysis of the content of verbal exchanges (categorization) shows that these exchanges can be very different depending on the work situation (process state, work organization, last shift of the incoming operator...). More precise dialogues analyses show, in some cases, the construction by the operators of a shared functional representation. They consequently emphasize the importance of these exchanges for collective work. The results point out that these exchanges during shift changeover are not only an information transfer allowing actions related to the production process to be continued. They also allow cooperative problem solving and improvement of operators' expertise. On this basis, propositions related to the improvement of this work phase are made. (authors)

  12. Shifting the Focus to Student Learning: Characteristics of Effective Teaching Practice As Identified by Experienced Pre-service Faculty Advisors

    Directory of Open Access Journals (Sweden)

    Nancy Maynes

    2012-11-01

    Full Text Available Cochrane-Smith and Power identify trends in teacher education programs with some relating to heightened teacher accountability for students’ learning. In this paper we provide a model that identifies characteristics believed to be critical elements related to a teacher’s conceptual focus shifting from an emphasis on their teaching to their students’ learning and we have grounded these characteristics in current educational research. Through focus group inquiry, we have identified those teacher characteristics thought to account for effective teaching practice. These characteristics include: a professional growth perspective, passion and enthusiasm for the  content, pedagogical content knowledge, a rich instructional repertoire of strategies, awareness of assessment for, as, and of learning, ability to read the body language  of the learner, caring classroom management strategies, and instructional efforts (e.g., social justice. Our research data provide a conceptual framework for further study.

  13. Study of a methodology of identifying important research problems by the PIRT process

    International Nuclear Information System (INIS)

    Aoki, Takayuki; Takagi, Toshiyuki; Urayama, Ryoichi; Komura, Ichiro; Furukawa, Takashi; Yusa, Noritaka

    2014-01-01

    In this paper, we propose a new methodology of identifying important research problems to be solved to improve the performance of some specific scientific technologies by the phenomena identification and ranking table (PIRT) process which has been used as a methodology for demonstrating the validity of the best estimate simulation codes in US Nuclear Regulatory Commission (USNRC) licensing of nuclear power plants. The new methodology makes it possible to identify important factors affecting the performance of the technologies from the viewpoint of the figure of merit and problems associated with them while it keeps the fundamental concepts of the original PIRT process. Also in this paper, we demonstrate the effectiveness of the new methodology by applying it to a task of extracting research problems for improving an inspection accuracy of ultrasonic testing or eddy current testing in the inspection of objects having cracks due to fatigue or stress corrosion cracking. (author)

  14. Study of a methodology of identifying important research problems by the PIRT process

    International Nuclear Information System (INIS)

    Aoki, Takayuki; Takagi, Toshiyuki; Urayama, Ryoichi; Komura, Ichiro; Furukawa, Takashi; Yusa, Noritaka

    2013-01-01

    In this paper, we propose a new methodology of identifying important research problems to be solved to improve the performance of some specific scientific technologies by the phenomena identification and ranking table (PIRT) process, which has been used as a methodology for demonstrating the validity of the best estimate simulation codes in USNRC licensing of nuclear power plants. It keeps the fundamental concepts of the original PIRT process but makes it possible to identify important factors affecting the performance of the technologies from the viewpoint of the figure of merit and problems associated with them, which need to be solved to improve the performance. Also in this paper, we demonstrate the effectiveness of the developed method by showing a specific example of the application to physical events or phenomena in objects having fatigue or SCC crack(s) under ultrasonic testing and eddy current testing. (author)

  15. Resequencing 50 accessions of cultivated and wild rice yields markers for identifying agronomically important genes

    DEFF Research Database (Denmark)

    Xu, Xun; Liu, Xin; Ge, Song

    2012-01-01

    Rice is a staple crop that has undergone substantial phenotypic and physiological changes during domestication. Here we resequenced the genomes of 40 cultivated accessions selected from the major groups of rice and 10 accessions of their wild progenitors (Oryza rufipogon and Oryza nivara) to >15 x...... diversity in cultivated but not wild rice, which represent candidate regions selected during domestication. Some of these variants are associated with important biological features, whereas others have yet to be functionally characterized. The molecular markers we have identified should be valuable...... raw data coverage. We investigated genome-wide variation patterns in rice and obtained 6.5 million high-quality single nucleotide polymorphisms (SNPs) after excluding sites with missing data in any accession. Using these population SNP data, we identified thousands of genes with significantly lower...

  16. On the importance of identifying, characterizing, and predicting fundamental phenomena towards microbial electrochemistry applications.

    Science.gov (United States)

    Torres, César Iván

    2014-06-01

    The development of microbial electrochemistry research toward technological applications has increased significantly in the past years, leading to many process configurations. This short review focuses on the need to identify and characterize the fundamental phenomena that control the performance of microbial electrochemical cells (MXCs). Specifically, it discusses the importance of recent efforts to discover and characterize novel microorganisms for MXC applications, as well as recent developments to understand transport limitations in MXCs. As we increase our understanding of how MXCs operate, it is imperative to continue modeling efforts in order to effectively predict their performance, design efficient MXC technologies, and implement them commercially. Thus, the success of MXC technologies largely depends on the path of identifying, understanding, and predicting fundamental phenomena that determine MXC performance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Statistical Analyses of Scatterplots to Identify Important Factors in Large-Scale Simulations

    Energy Technology Data Exchange (ETDEWEB)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-04-01

    The robustness of procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses is investigated. These procedures are based on attempts to detect increasingly complex patterns in the scatterplots under consideration and involve the identification of (1) linear relationships with correlation coefficients, (2) monotonic relationships with rank correlation coefficients, (3) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (4) trends in variability as defined by variances and interquartile ranges, and (5) deviations from randomness as defined by the chi-square statistic. The following two topics related to the robustness of these procedures are considered for a sequence of example analyses with a large model for two-phase fluid flow: the presence of Type I and Type II errors, and the stability of results obtained with independent Latin hypercube samples. Observations from analysis include: (1) Type I errors are unavoidable, (2) Type II errors can occur when inappropriate analysis procedures are used, (3) physical explanations should always be sought for why statistical procedures identify variables as being important, and (4) the identification of important variables tends to be stable for independent Latin hypercube samples.

  18. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae

    Directory of Open Access Journals (Sweden)

    Seong Hwan Park

    2013-01-01

    Full Text Available Identifying species of insects used to estimate postmortem interval (PMI is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science.

  19. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae)

    Science.gov (United States)

    Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon

    2013-01-01

    Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044

  20. Identifying Shifts in Leaf-Litter Ant Assemblages (Hymenoptera: Formicidae across Ecosystem Boundaries Using Multiple Sampling Methods.

    Directory of Open Access Journals (Sweden)

    Michal Wiezik

    Full Text Available Global or regional environmental changes in climate or land use have been increasingly implied in shifts in boundaries (ecotones between adjacent ecosystems such as beech or oak-dominated forests and forest-steppe ecotones that frequently co-occur near the southern range limits of deciduous forest biome in Europe. Yet, our ability to detect changes in biological communities across these ecosystems, or to understand their environmental drivers, can be hampered when different sampling methods are required to characterize biological communities of the adjacent but ecologically different ecosystems. Ants (Hymenoptera: Formicidae have been shown to be particularly sensitive to changes in temperature and vegetation and they require different sampling methods in closed vs. open habitats. We compared ant assemblages of closed-forests (beech- or oak-dominated and open forest-steppe habitats in southwestern Carpathians using methods for closed-forest (litter sifting and open habitats (pitfall trapping, and developed an integrated sampling approach to characterize changes in ant assemblages across these adjacent ecosystems. Using both methods, we collected 5,328 individual ant workers from 28 species. Neither method represented ant communities completely, but pitfall trapping accounted for more species (24 than litter sifting (16. Although pitfall trapping characterized differences in species richness and composition among the ecosystems better, with beech forest being most species poor and ecotone most species rich, litter sifting was more successful in identifying characteristic litter-dwelling species in oak-dominated forest. The integrated sampling approach using both methods yielded more accurate characterization of species richness and composition, and particularly so in species-rich forest-steppe habitat where the combined sample identified significantly higher number of species compared to either of the two methods on their own. Thus, an integrated

  1. Identifying Shifts in Leaf-Litter Ant Assemblages (Hymenoptera: Formicidae) across Ecosystem Boundaries Using Multiple Sampling Methods.

    Science.gov (United States)

    Wiezik, Michal; Svitok, Marek; Wieziková, Adela; Dovčiak, Martin

    2015-01-01

    Global or regional environmental changes in climate or land use have been increasingly implied in shifts in boundaries (ecotones) between adjacent ecosystems such as beech or oak-dominated forests and forest-steppe ecotones that frequently co-occur near the southern range limits of deciduous forest biome in Europe. Yet, our ability to detect changes in biological communities across these ecosystems, or to understand their environmental drivers, can be hampered when different sampling methods are required to characterize biological communities of the adjacent but ecologically different ecosystems. Ants (Hymenoptera: Formicidae) have been shown to be particularly sensitive to changes in temperature and vegetation and they require different sampling methods in closed vs. open habitats. We compared ant assemblages of closed-forests (beech- or oak-dominated) and open forest-steppe habitats in southwestern Carpathians using methods for closed-forest (litter sifting) and open habitats (pitfall trapping), and developed an integrated sampling approach to characterize changes in ant assemblages across these adjacent ecosystems. Using both methods, we collected 5,328 individual ant workers from 28 species. Neither method represented ant communities completely, but pitfall trapping accounted for more species (24) than litter sifting (16). Although pitfall trapping characterized differences in species richness and composition among the ecosystems better, with beech forest being most species poor and ecotone most species rich, litter sifting was more successful in identifying characteristic litter-dwelling species in oak-dominated forest. The integrated sampling approach using both methods yielded more accurate characterization of species richness and composition, and particularly so in species-rich forest-steppe habitat where the combined sample identified significantly higher number of species compared to either of the two methods on their own. Thus, an integrated sampling

  2. Land-use poverty traps identified in shifting cultivation systems shape long-term tropical forest cover

    Science.gov (United States)

    Coomes, Oliver T.; Takasaki, Yoshito; Rhemtulla, Jeanine M.

    2011-01-01

    In this article we illustrate how fine-grained longitudinal analyses of land holding and land use among forest peasant households in an Amazonian village can enrich our understanding of the poverty/land cover nexus. We examine the dynamic links in shifting cultivation systems among asset poverty, land use, and land cover in a community where poverty is persistent and primary forests have been replaced over time—with community enclosure—by secondary forests (i.e., fallows), orchards, and crop land. Land cover change is assessed using aerial photographs/satellite imagery from 1965 to 2007. Household and plot level data are used to track land holding, portfolios, and use as well as land cover over the past 30 y, with particular attention to forest status (type and age). Our analyses find evidence for two important types of “land-use” poverty traps—a “subsistence crop” trap and a “short fallow” trap—and indicate that the initial conditions of land holding by forest peasants have long-term effects on future forest cover and household welfare. These findings suggest a new mechanism driving poverty traps: insufficient initial land holdings induce land use patterns that trap households in low agricultural productivity. Path dependency in the evolution of household land portfolios and land use strategies strongly influences not only the wellbeing of forest people but also the dynamics of tropical deforestation and secondary forest regrowth. PMID:21873179

  3. Identify the Important Decision Factors of Online Shopping Adoption in Indonesia

    Directory of Open Access Journals (Sweden)

    Lailatul HIJRAH

    2017-12-01

    Full Text Available The objective of this study is to identify factors encouraging a consumer to engage in online shopping activities. The expected contribution of this study is for online entrepreneurs, in order to develop the most suitable business strategy, so that it will be clearly identified and sorted out which factors are the most important and the main motivation of Indonesian consumers to shop via online by using responses from respondents who usually shop online and offline in 3 cities in Indonesia, Jakarta, Surabaya and Samarinda. The research instruments were developed by conducting FGDs on relevant groups, either academics, online shopping activists, suppliers and courier businessmen in Jakarta, Surabaya and Samarinda Cities in effort to extract any information that encourages consumers to online shopping. After conducting FGD, the researcher produced 48 items proposed for factor analysis and after extracted to form eleven constructs, some items were removed because they had less loading factors. The eleven constructs or dimensions are trust, risk, consumer factors, website factors, price, service quality, convenience, subjective norm, product guarantee, variety of products and lifestyle. The implications of this study provide valuable insights about consumer decisions to online shopping or not online shopping.

  4. Systematic reviews identify important methodological flaws in stroke rehabilitation therapy primary studies: review of reviews.

    Science.gov (United States)

    Santaguida, Pasqualina; Oremus, Mark; Walker, Kathryn; Wishart, Laurie R; Siegel, Karen Lohmann; Raina, Parminder

    2012-04-01

    A "review of reviews" was undertaken to assess methodological issues in studies evaluating nondrug rehabilitation interventions in stroke patients. MEDLINE, CINAHL, PsycINFO, and the Cochrane Database of Systematic Reviews were searched from January 2000 to January 2008 within the stroke rehabilitation setting. Electronic searches were supplemented by reviews of reference lists and citations identified by experts. Eligible studies were systematic reviews; excluded citations were narrative reviews or reviews of reviews. Review characteristics and criteria for assessing methodological quality of primary studies within them were extracted. The search yielded 949 English-language citations. We included a final set of 38 systematic reviews. Cochrane reviews, which have a standardized methodology, were generally of higher methodological quality than non-Cochrane reviews. Most systematic reviews used standardized quality assessment criteria for primary studies, but not all were comprehensive. Reviews showed that primary studies had problems with randomization, allocation concealment, and blinding. Baseline comparability, adverse events, and co-intervention or contamination were not consistently assessed. Blinding of patients and providers was often not feasible and was not evaluated as a source of bias. The eligible systematic reviews identified important methodological flaws in the evaluated primary studies, suggesting the need for improvement of research methods and reporting. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Identifying selectively important amino acid positions associated with alternative habitat environments in fish mitochondrial genomes.

    Science.gov (United States)

    Xia, Jun Hong; Li, Hong Lian; Zhang, Yong; Meng, Zi Ning; Lin, Hao Ran

    2018-05-01

    Fish species inhabitating seawater (SW) or freshwater (FW) habitats have to develop genetic adaptations to alternative environment factors, especially salinity. Functional consequences of the protein variations associated with habitat environments in fish mitochondrial genomes have not yet received much attention. We analyzed 829 complete fish mitochondrial genomes and compared the amino acid differences of 13 mitochondrial protein families between FW and SW fish groups. We identified 47 specificity determining sites (SDS) that associated with FW or SW environments from 12 mitochondrial protein families. Thirty-two (68%) of the SDS sites are hydrophobic, 13 (28%) are neutral, and the remaining sites are acidic or basic. Seven of those SDS from ND1, ND2 and ND5 were scored as probably damaging to the protein structures. Furthermore, phylogenetic tree based Bayes Empirical Bayes analysis also detected 63 positive sites associated with alternative habitat environments across ten mtDNA proteins. These signatures could be important for studying mitochondrial genetic variation relevant to fish physiology and ecology.

  6. PCR-RFLP Method to Identify Salmonid Species of Economic Importance

    Directory of Open Access Journals (Sweden)

    Andreea Dudu

    2011-05-01

    Full Text Available The identification of different fish species by molecular methods has become necessary to avoid both the incorrect labelling of individuals involved in repopulation programmes and the commercial frauds on the fish market. Different fish species of great economical importance, like the salmonids, which are very much requested for their meat, can be identified using molecular techniques such as PCR-RFLP. The method is based on the amplification of a target region from the genome by PCR reaction followed by endonucleases digestion to detect the polymorphism of restriction fragments. In our study we analysed the following salmonid species from Romania: Salmo trutta fario, Salmo labrax, Salvelinus fontinalis, Onchorhynchus mykiss, Thymallus thymallus and Hucho hucho. In order to discriminate between the analysed species we amplified a fragment of mitochondrial genome comprising tRNAGlu/ cytochrome b/ tRNAThr/ tRNAPro/ D-loop/ tRNAPhe, followed by digestion with a specific restriction enzyme. The direct digestion of unpurified PCR products generated species-specific restriction patterns and proved to be a simple, reliable, inexpensive and fast method. Thus, it may be successfully utilized in specialized laboratories for the correct identification of the fish species for multiple purposes, including the traceability of fish food products.

  7. Identifying Important Atlantic Areas for the conservation of Balearic shearwaters: Spatial overlap with conservation areas

    Science.gov (United States)

    Pérez-Roda, Amparo; Delord, Karine; Boué, Amélie; Arcos, José Manuel; García, David; Micol, Thierry; Weimerskirch, Henri; Pinaud, David; Louzao, Maite

    2017-07-01

    Marine protected areas (MPAs) are considered one of the main tools in both fisheries and conservation management to protect threatened species and their habitats around the globe. However, MPAs are underrepresented in marine environments compared to terrestrial environments. Within this context, we studied the Atlantic non-breeding distribution of the southern population of Balearic shearwaters (Puffinus mauretanicus) breeding in Eivissa during the 2011-2012 period based on global location sensing (GLS) devices. Our objectives were (1) to identify overall Important Atlantic Areas (IAAs) from a southern population, (2) to describe spatio-temporal patterns of oceanographic habitat use, and (3) to assess whether existing conservation areas (Natura 2000 sites and marine Important Bird Areas (IBAs)) cover the main IAAs of Balearic shearwaters. Our results highlighted that the Atlantic staging (from June to October in 2011) dynamic of the southern population was driven by individual segregation at both spatial and temporal scales. Individuals ranged in the North-East Atlantic over four main IAAs (Bay of Biscay: BoB, Western Iberian shelf: WIS, Gulf of Cadiz: GoC, West of Morocco: WoM). While most individuals spent more time on the WIS or in the GoC, a small number of birds visited IAAs at the extremes of their Atlantic distribution range (i.e., BoB and WoM). The chronology of the arrivals to the IAAs showed a latitudinal gradient with northern areas reached earlier during the Atlantic staging. The IAAs coincided with the most productive areas (higher chlorophyll a values) in the NE Atlantic between July and October. The spatial overlap between IAAs and conservation areas was higher for Natura 2000 sites than marine IBAs (areas with and without legal protection, respectively). Concerning the use of these areas, a slightly higher proportion of estimated positions fell within marine IBAs compared to designated Natura 2000 sites, with Spanish and Portuguese conservation

  8. Balancing virtual land imports by a shift in the diet. Using a land balance approach to assess the sustainability of food consumption. Germany as an example.

    Science.gov (United States)

    Meier, Toni; Christen, Olaf; Semler, Edmund; Jahreis, Gerhard; Voget-Kleschin, Lieske; Schrode, Alexander; Artmann, Martina

    2014-03-01

    Nutrition is considered as one of the main drivers of global environmental change. Dietary patterns in particular, embedded in the international trade of foods and other biomass based commodities, determine the dimension of beneficial or harmful environmental impacts of the agri-food sector - both domestically and abroad. In this study we analysed different dietary scenarios from a virtual land flow perspective, based on representative consumption data for Germany in the years 2006 and 1985-89. Further we identified the consumer groups that would have to adapt most to balance Germany's virtual land import and analysed the impact reduced food wastage. For the study, official data sets concerning production, trade and consumption were used. We derived land use data from environmentally extended input-output data sets and FAO statistics. The conversion of agricultural raw products to consumed commodities is based on official processing and composition data. Subgroup-specific intake data from the last representative National Nutrition Survey in Germany were used. We analysed 42 commodities, aggregated into 23 product groups, seven land use types and six nutrition scenarios. The results show that in the baseline scenario the average nutrition in the year 2006 leads to a virtual land import of 707m(2)p(-1)a(-1), which represents 30% of the total nutrition-induced land demand of 2365m(2)p(-1)a(-1). On the other hand, the German agri-food sector exports virtual land, in the form of commodities, equivalent to 262m(2)p(-1)a(-1). In this paper we calculate that the resulting net import of virtual land could be balanced by way of a shift to an officially recommended diet and a reduction in the consumption of stimulants (cocoa, coffee, green/black tea, wine). A shift to an ovo-lacto-vegetarian or vegan diet would even lead to a positive virtual land balance (even with maintained consumption of stimulants). Moreover, we demonstrate that a shift in the average diet profile could

  9. Competence Description for Personal Recommendations: The Importance of Identifying the Complexity of Learning and Performance Situations

    Science.gov (United States)

    Prins, Frans J.; Nadolski, Rob J.; Berlanga, Adriana J.; Drachsler, Hendrik; Hummel, Hans G. K.; Koper, Rob

    2008-01-01

    For competences development of learners and professionals, target competences and corresponding competence development opportunities have to be identified. Personal Recommender Systems (PRS) provide personal recommendations for learners aimed at finding and selecting learning activities that best match their needs. This article argues that a…

  10. Identifying Important Career Indicators of Undergraduate Geoscience Students Upon Completion of Their Degree

    Science.gov (United States)

    Wilson, C. E.; Keane, C. M.; Houlton, H. R.

    2012-12-01

    The American Geosciences Institute (AGI) decided to create the National Geoscience Student Exit Survey in order to identify the initial pathways into the workforce for these graduating students, as well as assess their preparedness for entering the workforce upon graduation. The creation of this survey stemmed from a combination of experiences with the AGI/AGU Survey of Doctorates and discussions at the following Science Education Research Center (SERC) workshops: "Developing Pathways to Strong Programs for the Future", "Strengthening Your Geoscience Program", and "Assessing Geoscience Programs". These events identified distinct gaps in understanding the experiences and perspectives of geoscience students during one of their most profound professional transitions. Therefore, the idea for the survey arose as a way to evaluate how the discipline is preparing and educating students, as well as identifying the students' desired career paths. The discussions at the workshops solidified the need for this survey and created the initial framework for the first pilot of the survey. The purpose of this assessment tool is to evaluate student preparedness for entering the geosciences workforce; identify student decision points for entering geosciences fields and remaining in the geosciences workforce; identify geosciences fields that students pursue in undergraduate and graduate school; collect information on students' expected career trajectories and geosciences professions; identify geosciences career sectors that are hiring new graduates; collect information about salary projections; overall effectiveness of geosciences departments regionally and nationally; demonstrate the value of geosciences degrees to future students, the institutions, and employers; and establish a benchmark to perform longitudinal studies of geosciences graduates to understand their career pathways and impacts of their educational experiences on these decisions. AGI's Student Exit Survey went through

  11. An empirical model of the Baltic Sea reveals the importance of social dynamics for ecological regime shifts.

    Science.gov (United States)

    Lade, Steven J; Niiranen, Susa; Hentati-Sundberg, Jonas; Blenckner, Thorsten; Boonstra, Wiebren J; Orach, Kirill; Quaas, Martin F; Österblom, Henrik; Schlüter, Maja

    2015-09-01

    Regime shifts triggered by human activities and environmental changes have led to significant ecological and socioeconomic consequences in marine and terrestrial ecosystems worldwide. Ecological processes and feedbacks associated with regime shifts have received considerable attention, but human individual and collective behavior is rarely treated as an integrated component of such shifts. Here, we used generalized modeling to develop a coupled social-ecological model that integrated rich social and ecological data to investigate the role of social dynamics in the 1980s Baltic Sea cod boom and collapse. We showed that psychological, economic, and regulatory aspects of fisher decision making, in addition to ecological interactions, contributed both to the temporary persistence of the cod boom and to its subsequent collapse. These features of the social-ecological system also would have limited the effectiveness of stronger fishery regulations. Our results provide quantitative, empirical evidence that incorporating social dynamics into models of natural resources is critical for understanding how resources can be managed sustainably. We also show that generalized modeling, which is well-suited to collaborative model development and does not require detailed specification of causal relationships between system variables, can help tackle the complexities involved in creating and analyzing social-ecological models.

  12. Genome-wide association study identified copy number variants important for appendicular lean mass.

    Science.gov (United States)

    Ran, Shu; Liu, Yong-Jun; Zhang, Lei; Pei, Yufang; Yang, Tie-Lin; Hai, Rong; Han, Ying-Ying; Lin, Yong; Tian, Qing; Deng, Hong-Wen

    2014-01-01

    Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM), is a heritable trait. Copy number variation (CNV) is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2) and 3.34×10(-3), respectively). In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2) and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1), which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL) gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.

  13. Genome-wide association study identified copy number variants important for appendicular lean mass.

    Directory of Open Access Journals (Sweden)

    Shu Ran

    Full Text Available Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM, is a heritable trait. Copy number variation (CNV is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2 and 3.34×10(-3, respectively. In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2 and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1, which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.

  14. Identifying faecal impaction is important for ensuring the timely diagnosis of childhood functional constipation

    DEFF Research Database (Denmark)

    Modin, Line; Walsted, Anne-Mette; Jakobsen, Marianne Skytte

    2015-01-01

    AIM: Most research on functional constipation has been carried out at a tertiary level. We focused this study on a secondary-level hospital outpatients' department, assessing the distribution of diagnostic criteria for childhood functional constipation and evaluating the consequences of current...... diagnostic practice based on current guidelines. METHODS: We enrolled 235 children, aged two to 16 years of age, with functional constipation according to the Rome III criteria and assessed them using medical histories and physical examinations, including rectal examinations and ultrasound measurements...... the timely diagnosis of childhood functional constipation at the secondary care level. Ultrasound examination proved a reliable alternative to rectal examination or abdominal radiography when identifying faecal impaction....

  15. Salinity shifts in marine sediment: Importance of number of fluctuation rather than their intensities on bacterial denitrifying community.

    Science.gov (United States)

    Zaghmouri, Imen; Michotey, Valerie D; Armougom, Fabrice; Guasco, Sophie; Bonin, Patricia C

    2018-05-01

    The sensitivity of denitrifying community to salinity fluctuations was studied in microcosms filled with marine coastal sediments subjected to different salinity disturbances over time (sediment under frequent salinity changes vs sediment with "stable" salinity pattern). Upon short-term salinity shift, denitrification rate and denitrifiers abundance showed high resistance whatever the sediment origin is. Denitrifying community adapted to frequent salinity changes showed high resistance when salinity increases, with a dynamic nosZ relative expression level. Marine sediment denitrifying community, characterized by more stable pattern, was less resistant when salinity decreases. However, after two successive variations of salinity, it shifted toward the characteristic community of fluctuating conditions, with larger proportion of Pseudomonas-nosZ, exhibiting an increase of nosZ relative expression level. The impact of long-term salinity variation upon bacterial community was confirmed at ribosomal level with a higher percentage of Pseudomonas and lower proportion of nosZII clade genera. Copyright © 2018 Elsevier Ltd. All rights reserved.

  16. A case study of identify importance of land use planning in road safety, Benidorm

    Energy Technology Data Exchange (ETDEWEB)

    Casares Blanco, J.; Sanchez Galiano, J.C.; Fernandez Aracil, P.; Ortuño Padilla, A.

    2016-07-01

    This research analyses how urban form, land use and urban density, may influence the incidence of traffic-related crashes injuries and deaths. It begins with a theoretical overview of studies which deal with the study of the relationship between urban patterns and road safety. Next, it details the development of a database of crash incidence and urban form at the district level for the city of Benidorm (Alicante, Spain) in 2010. Subsequently, it is developed a negative binomial approach for intra-city motor vehicle crash analysis. One-year crash data for Benidorm (the fourth largest tourism destination of Spain, after Barcelona, Madrid and San Bartolomé de Tirajana, and exclusively tourist-oriented city) are analyzed using a geographic information system (GIS) to generate relevant inputs for the analysis. In general, the study finds that a strong land use mix results on fewer road accidents, whereas accidents are more common but less severe in areas of high urban density. Finally, pedestrian accidents research showed that rural and low density environment is related to an important road accident numbers unlike tourism-oriented zones, much more safe for them. Based on these findings, the paper discusses the implications for urban design practice. (Author)

  17. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  18. Promoting wellbeing in young unemployed adults: the importance of identifying meaningful patterns of time use.

    Science.gov (United States)

    Scanlan, Justin Newton; Bundy, Anita C; Matthews, Lynda R

    2011-04-01

    This study set out to explore the differences in time use between 'unemployed', 'unemployed but in education' and part-time and full-time employed 18- to 25-year-old Australians. Unemployed individuals generally experience poor health and this may be related to the way they use their time. Activity-based interventions may be one health-promoting strategy. This knowledge is important for all occupational therapists, as many service users are likely to be unemployed. Time use of unemployed 18- to 25-year-olds (measured using the Modified Occupational Questionnaire) was compared with the time use of part- and full-time employed 18- to 25-year-olds (from the 2006 Australian Time Use Survey). Individuals in the 'unemployed' groups spent significantly less time engaged in work-related activities than their employed peers. This time was reallocated mainly to recreation and leisure and household work (for both men and women) and child care and sleeping (women only). Recreation and leisure activities were generally passive, home-based activities such as watching television or 'doing nothing'. Individuals in the 'unemployed but in education' groups also spent less time in employment-related activities, but the majority of this time was reallocated to education activities. Individuals in the 'unemployed' groups spent large amounts of time engaged in potentially non-directed use of time (e.g. watching television or 'doing nothing'). Such patterns of time use have previously been associated with poor health. To support the health of unemployed individuals more effectively, occupational therapy interventions must focus on enhancing the quality of time use for this population. © 2010 The Authors. Australian Occupational Therapy Journal © 2010 Australian Association of Occupational Therapists.

  19. CSI 3.0: a web server for identifying secondary and super-secondary structure in proteins using NMR chemical shifts.

    Science.gov (United States)

    Hafsa, Noor E; Arndt, David; Wishart, David S

    2015-07-01

    The Chemical Shift Index or CSI 3.0 (http://csi3.wishartlab.com) is a web server designed to accurately identify the location of secondary and super-secondary structures in protein chains using only nuclear magnetic resonance (NMR) backbone chemical shifts and their corresponding protein sequence data. Unlike earlier versions of CSI, which only identified three types of secondary structure (helix, β-strand and coil), CSI 3.0 now identifies total of 11 types of secondary and super-secondary structures, including helices, β-strands, coil regions, five common β-turns (type I, II, I', II' and VIII), β hairpins as well as interior and edge β-strands. CSI 3.0 accepts experimental NMR chemical shift data in multiple formats (NMR Star 2.1, NMR Star 3.1 and SHIFTY) and generates colorful CSI plots (bar graphs) and secondary/super-secondary structure assignments. The output can be readily used as constraints for structure determination and refinement or the images may be used for presentations and publications. CSI 3.0 uses a pipeline of several well-tested, previously published programs to identify the secondary and super-secondary structures in protein chains. Comparisons with secondary and super-secondary structure assignments made via standard coordinate analysis programs such as DSSP, STRIDE and VADAR on high-resolution protein structures solved by X-ray and NMR show >90% agreement between those made with CSI 3.0. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C-dubliniensis

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, PHM

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  1. The hierarchy-by-interval approach to identifying important models that need improvement in severe-accident simulation codes

    International Nuclear Information System (INIS)

    Heames, T.J.; Khatib-Rahbar, M.; Kelly, J.E.

    1995-01-01

    The hierarchy-by-interval (HBI) methodology was developed to determine an appropriate phenomena identification and ranking table for an independent peer review of severe-accident computer codes. The methodology is described, and the results of a specific code review are presented. Use of this systematic and structured approach ensures that important code models that need improvement are identified and prioritized, which allows code sponsors to more effectively direct limited resources in future code development. In addition, critical phenomenological areas that need more fundamental work, such as experimentation, are identified

  2. Global sensitivity analysis for identifying important parameters of nitrogen nitrification and denitrification under model uncertainty and scenario uncertainty

    Science.gov (United States)

    Chen, Zhuowei; Shi, Liangsheng; Ye, Ming; Zhu, Yan; Yang, Jinzhong

    2018-06-01

    Nitrogen reactive transport modeling is subject to uncertainty in model parameters, structures, and scenarios. By using a new variance-based global sensitivity analysis method, this paper identifies important parameters for nitrogen reactive transport with simultaneous consideration of these three uncertainties. A combination of three scenarios of soil temperature and two scenarios of soil moisture creates a total of six scenarios. Four alternative models describing the effect of soil temperature and moisture content are used to evaluate the reduction functions used for calculating actual reaction rates. The results show that for nitrogen reactive transport problem, parameter importance varies substantially among different models and scenarios. Denitrification and nitrification process is sensitive to soil moisture content status rather than to the moisture function parameter. Nitrification process becomes more important at low moisture content and low temperature. However, the changing importance of nitrification activity with respect to temperature change highly relies on the selected model. Model-averaging is suggested to assess the nitrification (or denitrification) contribution by reducing the possible model error. Despite the introduction of biochemical heterogeneity or not, fairly consistent parameter importance rank is obtained in this study: optimal denitrification rate (Kden) is the most important parameter; reference temperature (Tr) is more important than temperature coefficient (Q10); empirical constant in moisture response function (m) is the least important one. Vertical distribution of soil moisture but not temperature plays predominant role controlling nitrogen reaction. This study provides insight into the nitrogen reactive transport modeling and demonstrates an effective strategy of selecting the important parameters when future temperature and soil moisture carry uncertainties or when modelers face with multiple ways of establishing nitrogen

  3. From success to persistence: Identifying an evolutionary regime shift in the diverse Paleozoic aquatic arthropod group Eurypterida, driven by the Devonian biotic crisis.

    Science.gov (United States)

    Lamsdell, James C; Selden, Paul A

    2017-01-01

    Mass extinctions have altered the trajectory of evolution a number of times over the Phanerozoic. During these periods of biotic upheaval a different selective regime appears to operate, although it is still unclear whether consistent survivorship rules apply across different extinction events. We compare variations in diversity and disparity across the evolutionary history of a major Paleozoic arthropod group, the Eurypterida. Using these data, we explore the group's transition from a successful, dynamic clade to a stagnant persistent lineage, pinpointing the Devonian as the period during which this evolutionary regime shift occurred. The late Devonian biotic crisis is potentially unique among the "Big Five" mass extinctions in exhibiting a drop in speciation rates rather than an increase in extinction. Our study reveals eurypterids show depressed speciation rates throughout the Devonian but no abnormal peaks in extinction. Loss of morphospace occupation is random across all Paleozoic extinction events; however, differential origination during the Devonian results in a migration and subsequent stagnation of occupied morphospace. This shift appears linked to an ecological transition from euryhaline taxa to freshwater species with low morphological diversity alongside a decrease in endemism. These results demonstrate the importance of the Devonian biotic crisis in reshaping Paleozoic ecosystems. © 2016 The Author(s). Evolution © 2016 The Society for the Study of Evolution.

  4. Imaging-Based Screen Identifies Laminin 411 as a Physiologically Relevant Niche Factor with Importance for i-Hep Applications

    Directory of Open Access Journals (Sweden)

    John Ong

    2018-03-01

    Full Text Available Summary: Use of hepatocytes derived from induced pluripotent stem cells (i-Heps is limited by their functional differences in comparison with primary cells. Extracellular niche factors likely play a critical role in bridging this gap. Using image-based characterization (high content analysis; HCA of freshly isolated hepatocytes from 17 human donors, we devised and validated an algorithm (Hepatocyte Likeness Index; HLI for comparing the hepatic properties of cells against a physiological gold standard. The HLI was then applied in a targeted screen of extracellular niche factors to identify substrates driving i-Heps closer to the standard. Laminin 411, the top hit, was validated in two additional induced pluripotent stem cell (iPSC lines, primary tissue, and an in vitro model of α1-antitrypsin deficiency. Cumulatively, these data provide a reference method to control and screen for i-Hep differentiation, identify Laminin 411 as a key niche protein, and underscore the importance of combining substrates, soluble factors, and HCA when developing iPSC applications. : Rashid and colleagues demonstrate the utility of a high-throughput imaging platform for identification of physiologically relevant extracellular niche factors to advance i-Heps closer to their primary tissue counterparts. The extracellular matrix (ECM protein screen identified Laminin 411 as an important niche factor facilitating i-Hep-based disease modeling in vitro. Keywords: iPS hepatocytes, extracellular niche, image-based screening, disease modeling, laminin

  5. NRC Information No. 90-01: Importance of proper response to self-identified violations by licensees

    International Nuclear Information System (INIS)

    Cunningham, R.E.

    1992-01-01

    NRC expects a high standard of compliance by its licensees and requires that licensees provide NRC accurate and complete information and that required records will also be complete and accurate in all material respects. Licensees should be aware of the importance placed by NRC on licensee programs for self detection, correction and reporting of violations or errors related to regulatory requirements. The General Statement of Policy and Procedures for NRC Enforcement Actions in Appendix C to 10 CFR Part 2 underscores the importance of licensees responding promptly and properly to self-identified violations in two ways. It is suggested that when a licensee identifies a violation involving an NRC-required record, the licensee should make a dated notation indicating identification, either on the record itself or other appropriate documentation retrievable for NRC review. The record with the self-identified violation noted should not be altered in any way to mask the correction. The licensee should determine the cause of the violation, correct the root cause of the violation, and document such findings in an appropriate manner. Licensees should also assure that if a report of the violation is required, the report is submitted to NRC in a timely manner. These actions will be considered by NRC in making any enforcement decision, and generally lead to lesser or no civil penalty

  6. Statistical analyses of scatterplots to identify important factors in large-scale simulations, 1: Review and comparison of techniques

    International Nuclear Information System (INIS)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-01-01

    Procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses are described and illustrated. These procedures attempt to detect increasingly complex patterns in scatterplots and involve the identification of (i) linear relationships with correlation coefficients, (ii) monotonic relationships with rank correlation coefficients, (iii) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (iv) trends in variability as defined by variances and interquartile ranges, and (v) deviations from randomness as defined by the chi-square statistic. A sequence of example analyses with a large model for two-phase fluid flow illustrates how the individual procedures can differ in the variables that they identify as having effects on particular model outcomes. The example analyses indicate that the use of a sequence of procedures is a good analysis strategy and provides some assurance that an important effect is not overlooked

  7. Statistical analyses of scatterplots to identify important factors in large-scale simulations, 2: robustness of techniques

    International Nuclear Information System (INIS)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-01-01

    The robustness of procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses is investigated. These procedures are based on attempts to detect increasingly complex patterns in the scatterplots under consideration and involve the identification of (i) linear relationships with correlation coefficients, (ii) monotonic relationships with rank correlation coefficients, (iii) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (iv) trends in variability as defined by variances and interquartile ranges, and (v) deviations from randomness as defined by the chi-square statistic. The following two topics related to the robustness of these procedures are considered for a sequence of example analyses with a large model for two-phase fluid flow: the presence of Type I and Type II errors, and the stability of results obtained with independent Latin hypercube samples. Observations from analysis include: (i) Type I errors are unavoidable, (ii) Type II errors can occur when inappropriate analysis procedures are used, (iii) physical explanations should always be sought for why statistical procedures identify variables as being important, and (iv) the identification of important variables tends to be stable for independent Latin hypercube samples

  8. Crowd-sourced Ontology for Photoleukocoria: Identifying Common Internet Search Terms for a Potentially Important Pediatric Ophthalmic Sign.

    Science.gov (United States)

    Staffieri, Sandra E; Kearns, Lisa S; Sanfilippo, Paul G; Craig, Jamie E; Mackey, David A; Hewitt, Alex W

    2018-02-01

    Leukocoria is the most common presenting sign for pediatric eye disease including retinoblastoma and cataract, with worse outcomes if diagnosis is delayed. We investigated whether individuals could identify leukocoria in photographs (photoleukocoria) and examined their subsequent Internet search behavior. Using a web-based questionnaire, in this cross-sectional study we invited adults aged over 18 years to view two photographs of a child with photoleukocoria, and then search the Internet to determine a possible diagnosis and action plan. The most commonly used search terms and websites accessed were recorded. The questionnaire was completed by 1639 individuals. Facebook advertisement was the most effective recruitment strategy. The mean age of all respondents was 38.95 ± 14.59 years (range, 18-83), 94% were female, and 59.3% had children. An abnormality in the images presented was identified by 1613 (98.4%) participants. The most commonly used search terms were: "white," "pupil," "photo," and "eye" reaching a variety of appropriate websites or links to print or social media articles. Different words or phrases were used to describe the same observation of photoleukocoria leading to a range of websites. Variations in the description of observed signs and search words influenced the sites reached, information obtained, and subsequent help-seeking intentions. Identifying the most commonly used search terms for photoleukocoria is an important step for search engine optimization. Being directed to the most appropriate websites informing of the significance of photoleukocoria and the appropriate actions to take could improve delays in diagnosis of important pediatric eye disease such as retinoblastoma or cataract.

  9. Identifying and Characterizing Important Trembling Aspen Competitors with Juvenile Lodgepole Pine in Three South-Central British Columbia Ecosystems

    Directory of Open Access Journals (Sweden)

    Teresa A. Newsome

    2012-01-01

    Full Text Available Critical height ratios for predicting competition between trembling aspen and lodgepole pine were identified in six juvenile stands in three south-central British Columbia ecosystems. We used a series of regression analyses predicting pine stem diameter from the density of neighbouring aspen in successively shorter relative height classes to identify the aspen-pine height ratio that maximized R2. Critical height ratios varied widely among sites when stands were 8–12 years old but, by age 14–19, had converged at 1.25–1.5. Maximum R2 values at age 14–19 ranged from 13.4% to 69.8%, demonstrating that the importance of aspen competition varied widely across a relatively small geographic range. Logistic regression also indicated that the risk of poor pine vigour in the presence of aspen varied between sites. Generally, the degree of competition, risk to pine vigour, and size of individual aspen contributing to the models declined along a gradient of decreasing ecosystem productivity.

  10. Use of DNA sequences to identify forensically important fly species and their distribution in the coastal region of Central California.

    Science.gov (United States)

    Nakano, Angie; Honda, Jeff

    2015-08-01

    Forensic entomology has gained prominence in recent years, as improvements in DNA technology and molecular methods have allowed insect and other arthropod evidence to become increasingly useful in criminal and civil investigations. However, comprehensive faunal inventories are still needed, including cataloging local DNA sequences for forensically significant Diptera. This multi-year fly-trapping study was built upon and expanded a previous survey of these flies in Santa Clara County, including the addition of genetic barcoding data from collected species of flies. Flies from the families Calliphoridae, Sarcophagidae, and Muscidae were trapped in meat-baited traps set in a variety of locations throughout the county. Flies were identified using morphological features and confirmed by molecular analysis. A total of 16 calliphorid species, 11 sarcophagid species, and four muscid species were collected and differentiated. This study found more species of flies than previous area surveys and established new county records for two calliphorid species: Cynomya cadaverina and Chrysomya rufifacies. Differences were found in fly fauna in different areas of the county, indicating the importance of microclimates in the distribution of these flies. Molecular analysis supported the use of DNA barcoding as an effective method of identifying cryptic fly species. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  11. Combining Methods to Describe Important Marine Habitats for Top Predators: Application to Identify Biological Hotspots in Tropical Waters.

    Science.gov (United States)

    Thiers, Laurie; Louzao, Maite; Ridoux, Vincent; Le Corre, Matthieu; Jaquemet, Sébastien; Weimerskirch, Henri

    2014-01-01

    In tropical waters resources are usually scarce and patchy, and predatory species generally show specific adaptations for foraging. Tropical seabirds often forage in association with sub-surface predators that create feeding opportunities by bringing prey close to the surface, and the birds often aggregate in large multispecific flocks. Here we hypothesize that frigatebirds, a tropical seabird adapted to foraging with low energetic costs, could be a good predictor of the distribution of their associated predatory species, including other seabirds (e.g. boobies, terns) and subsurface predators (e.g., dolphins, tunas). To test this hypothesis, we compared distribution patterns of marine predators in the Mozambique Channel based on a long-term dataset of both vessel- and aerial surveys, as well as tracking data of frigatebirds. By developing species distribution models (SDMs), we identified key marine areas for tropical predators in relation to contemporaneous oceanographic features to investigate multi-species spatial overlap areas and identify predator hotspots in the Mozambique Channel. SDMs reasonably matched observed patterns and both static (e.g. bathymetry) and dynamic (e.g. Chlorophyll a concentration and sea surface temperature) factors were important explaining predator distribution patterns. We found that the distribution of frigatebirds included the distributions of the associated species. The central part of the channel appeared to be the best habitat for the four groups of species considered in this study (frigatebirds, brown terns, boobies and sub-surface predators).

  12. Combining Methods to Describe Important Marine Habitats for Top Predators: Application to Identify Biological Hotspots in Tropical Waters.

    Directory of Open Access Journals (Sweden)

    Laurie Thiers

    Full Text Available In tropical waters resources are usually scarce and patchy, and predatory species generally show specific adaptations for foraging. Tropical seabirds often forage in association with sub-surface predators that create feeding opportunities by bringing prey close to the surface, and the birds often aggregate in large multispecific flocks. Here we hypothesize that frigatebirds, a tropical seabird adapted to foraging with low energetic costs, could be a good predictor of the distribution of their associated predatory species, including other seabirds (e.g. boobies, terns and subsurface predators (e.g., dolphins, tunas. To test this hypothesis, we compared distribution patterns of marine predators in the Mozambique Channel based on a long-term dataset of both vessel- and aerial surveys, as well as tracking data of frigatebirds. By developing species distribution models (SDMs, we identified key marine areas for tropical predators in relation to contemporaneous oceanographic features to investigate multi-species spatial overlap areas and identify predator hotspots in the Mozambique Channel. SDMs reasonably matched observed patterns and both static (e.g. bathymetry and dynamic (e.g. Chlorophyll a concentration and sea surface temperature factors were important explaining predator distribution patterns. We found that the distribution of frigatebirds included the distributions of the associated species. The central part of the channel appeared to be the best habitat for the four groups of species considered in this study (frigatebirds, brown terns, boobies and sub-surface predators.

  13. The importance of geomorphic and hydrologic factors in shaping the sensitivity of alpine/subalpine lake volumes to shifts in climate

    Science.gov (United States)

    Mercer, J.; Liefert, D. T.; Shuman, B. N.; Befus, K. M.; Williams, D. G.; Kraushaar, B.

    2017-12-01

    Alpine and subalpine lakes are important components of the hydrologic cycle in mountain ecosystems. These lakes are also highly sensitive to small shifts in temperature and precipitation. Mountain lake volumes and their contributions to mountain hydrology may change in response to even minor declines in snowpack or increases in temperature. However, it is still not clear to what degree non-climatic factors, such as geomorphic setting and lake geometry, play in shaping the sensitivity of high elevation lakes to climate change. We investigated the importance of lake geometry and groundwater connectivity to mountain lakes in the Snowy Range, Wyoming using a combination of hydrophysical and hydrochemical methods, including stable water isotopes, to better understand the role these factors play in controlling lake volume. Water isotope values in open lakes were less sensitive to evaporation compared to those in closed basin lakes. Lake geometry played an important role, with wider, shallower lakes being more sensitive to evaporation over time. Groundwater contributions appear to play only a minor role in buffering volumetric changes to lakes over the growing season. These results confirm that mountain lakes are sensitive to climate factors, but also highlight a significant amount of variability in that sensitivity. This research has implications for water resource managers concerned with downstream water quantity and quality from mountain ecosystems, biologists interested in maintaining aquatic biodiversity, and paleoclimatologists interested in using lake sedimentary information to infer past climate regimes.

  14. Molecular characterization of NRXN1 deletions from 19,263 clinical microarray cases identifies exons important for neurodevelopmental disease expression

    Science.gov (United States)

    Lowther, Chelsea; Speevak, Marsha; Armour, Christine M.; Goh, Elaine S.; Graham, Gail E.; Li, Chumei; Zeesman, Susan; Nowaczyk, Malgorzata J.M.; Schultz, Lee-Anne; Morra, Antonella; Nicolson, Rob; Bikangaga, Peter; Samdup, Dawa; Zaazou, Mostafa; Boyd, Kerry; Jung, Jack H.; Siu, Victoria; Rajguru, Manjulata; Goobie, Sharan; Tarnopolsky, Mark A.; Prasad, Chitra; Dick, Paul T.; Hussain, Asmaa S.; Walinga, Margreet; Reijenga, Renske G.; Gazzellone, Matthew; Lionel, Anath C.; Marshall, Christian R.; Scherer, Stephen W.; Stavropoulos, Dimitri J.; McCready, Elizabeth; Bassett, Anne S.

    2016-01-01

    Purpose The purpose of the current study was to assess the penetrance of NRXN1 deletions. Methods We compared the prevalence and genomic extent of NRXN1 deletions identified among 19,263 clinically referred cases to that of 15,264 controls. The burden of additional clinically relevant CNVs was used as a proxy to estimate the relative penetrance of NRXN1 deletions. Results We identified 41 (0.21%) previously unreported exonic NRXN1 deletions ascertained for developmental delay/intellectual disability, significantly greater than in controls [OR=8.14 (95% CI 2.91–22.72), p< 0.0001)]. Ten (22.7%) of these had a second clinically relevant CNV. Subjects with a deletion near the 3′ end of NRXN1 were significantly more likely to have a second rare CNV than subjects with a 5′ NRXN1 deletion [OR=7.47 (95% CI 2.36–23.61), p=0.0006]. The prevalence of intronic NRXN1 deletions was not statistically different between cases and controls (p=0.618). The majority (63.2%) of intronic NRXN1 deletion cases had a second rare CNV, a two-fold greater prevalence than for exonic NRXN1 deletion cases (p=0.0035). Conclusions The results support the importance of exons near the 5′ end of NRXN1 in the expression of neurodevelopmental disorders. Intronic NRXN1 deletions do not appear to substantially increase the risk for clinical phenotypes. PMID:27195815

  15. Gene Expression Profiling Identifies Important Genes Affected by R2 Compound Disrupting FAK and P53 Complex

    International Nuclear Information System (INIS)

    Golubovskaya, Vita M.; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G.

    2014-01-01

    Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53 +/+ and p53 −/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53 +/+ cells but not in p53 −/− cells. Among up-regulated genes in HCT p53 +/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53 +/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach

  16. DNA-SIP identifies sulfate-reducing Clostridia as important toluene degraders in tar-oil-contaminated aquifer sediment

    Energy Technology Data Exchange (ETDEWEB)

    Winderl, C.; Penning, H.; von Netzer, F.; Meckenstock, R.U.; Lueders, T. [Helmholtz Zentrum Munchen, Neuherberg (Germany)

    2010-10-15

    Global groundwater resources are constantly challenged by a multitude of contaminants such as aromatic hydrocarbons. Especially in anaerobic habitats, a large diversity of unrecognized microbial populations may be responsible for their degradation. Still, our present understanding of the respective microbiota and their ecophysiology is almost exclusively based on a small number of cultured organisms, mostly within the Proteobacteria. Here, by DNA-based stable isotope probing (SIP), we directly identified the most active sulfate-reducing toluene degraders in a diverse sedimentary microbial community originating from a tar-oil-contaminated aquifer at a former coal gasification plant. On incubation of fresh sediments with {sup 13}C{sub 7}-toluene, the production of both sulfide and (CS{sub 2}){sup 13}CO{sub 2} was clearly coupled to the {sup 13}Clabeling of DNA of microbes related to Desulfosporosinus spp. within the Peptococcaceae (Clostridia). The screening of labeled DNA fractions also suggested a novel benzylsuccinate synthase alpha-subunit (bssA) sequence type previously only detected in the environment to be tentatively affiliated with these degraders. However, carbon flow from the contaminant into degrader DNA was only similar to 50%, pointing toward high ratios of heterotrophic CS{sub 2}-fixation during assimilation of acetyl-CoA originating from the contaminant by these degraders. These findings demonstrate that the importance of non-proteobacterial populations in anaerobic aromatics degradation, as well as their specific ecophysiology in the subsurface may still be largely ungrasped.

  17. Evaluation of bentonite alteration due to interactions with iron. Sensitivity analyses to identify the important factors for the bentonite alteration

    International Nuclear Information System (INIS)

    Sasamoto, Hiroshi; Wilson, James; Sato, Tsutomu

    2013-01-01

    Performance assessment of geological disposal systems for high-level radioactive waste requires a consideration of long-term systems behaviour. It is possible that the alteration of swelling clay present in bentonite buffers might have an impact on buffer functions. In the present study, iron (as a candidate overpack material)-bentonite (I-B) interactions were evaluated as the main buffer alteration scenario. Existing knowledge on alteration of bentonite during I-B interactions was first reviewed, then the evaluation methodology was developed considering modeling techniques previously used overseas. A conceptual model for smectite alteration during I-B interactions was produced. The following reactions and processes were selected: 1) release of Fe 2+ due to overpack corrosion; 2) diffusion of Fe 2+ in compacted bentonite; 3) sorption of Fe 2+ on smectite edge and ion exchange in interlayers; 4) dissolution of primary phases and formation of alteration products. Sensitivity analyses were performed to identify the most important factors for the alteration of bentonite by I-B interactions. (author)

  18. Identifying important and feasible policies and actions for health at community sports clubs: a consensus-generating approach.

    Science.gov (United States)

    Kelly, Bridget; King, Lesley; Bauman, Adrian E; Baur, Louise A; Macniven, Rona; Chapman, Kathy; Smith, Ben J

    2014-01-01

    Children's high participation in organised sport in Australia makes sport an ideal setting for health promotion. This study aimed to generate consensus on priority health promotion objectives for community sports clubs, based on informed expert judgements. Delphi survey using three structured questionnaires. Forty-six health promotion, nutrition, physical activity and sport management/delivery professionals were approached to participate in the survey. Questionnaires used an iterative process to determine aspects of sports clubs deemed necessary for developing healthy sporting environments for children. Initially, participants were provided with a list of potential standards for a range of health promotion areas and asked to rate standards based on their importance and feasibility, and any barriers to implementation. Subsequently, participants were provided with information that summarised ratings for each standard to indicate convergence of the group, and asked to review and potentially revise their responses where they diverged. In a third round, participants ranked confirmed standards by priority. 26 professionals completed round 1, 21 completed round 2, and 18 completed round 3. The highest ranked standards related to responsible alcohol practices, availability of healthy food and drinks at sports canteens, smoke-free club facilities, restricting the sale and consumption of alcohol during junior sporting activities, and restricting unhealthy food and beverage company sponsorship. Identifying and prioritising health promotion areas that are relevant to children's sports clubs assists in focusing public health efforts and may guide future engagement of sports clubs. Approaches for providing informational and financial support to clubs to operationalise these standards are proposed. Copyright © 2013 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  19. Identifying organisational principles and management practices important to the quality of health care services for chronic conditions.

    Science.gov (United States)

    Frølich, Anne

    2012-02-01

    effect of financial incentives and public performance reporting on the behaviour of professionals and quality of care. Using secondary data, KP and the Danish health care system were compared in terms of six central dimensions: population, health care professionals, health care organisations, utilization patterns, quality measurements, and costs. Differences existed between the two systems on all dimensions, complicating the interpretation of findings. For instance, observed differences might be due to similar tendencies in the two health care systems that were observed at different times, rather than true structural differences. The expenses in the two health care systems were corrected for differences in the populations served and the purchasing power of currencies. However, no validated methods existed to correct for observed differences in case-mixes of chronic conditions. Data from a population of about half a million patients with diabetes in a large U.S. integrated health care delivery system affiliated with 41 medical centers employing 15 different CCM management practices was the basis for identifying effective management practices. Through the use of statistical modelling, the management practice of provider alerts was identified as most effective for promoting screening for hemoglobin A1c and lipid profile. The CCM was used as a framework for implementing four rehabilitation programs. The model promoted continuity of care and quality of health care services. New management practices were developed in the study, and known practices were further developed. However, the observational nature of the study limited the generalisability of the findings. In a structured literature survey focusing on the effect of financial incentives and public performance reporting on the quality of health care services, few studies documenting an effect were identified. The results varied, and important program aspects or contextual variables were often omitted. A model describing

  20. Shift Colors

    Science.gov (United States)

    Publications & News Shift Colors Pages default Sign In NPC Logo Banner : Shift Colors Search Navy Personnel Command > Reference Library > Publications & News > Shift Colors Top Link Bar Navy Personnel Library Expand Reference Library Quick Launch Shift Colors Shift Colors Archives Mailing Address How to

  1. Identifying Important Gaps in Randomized Controlled Trials of Adult Cardiac Arrest Treatments: A Systematic Review of the Published Literature

    Science.gov (United States)

    Sinha, Shashank S.; Sukul, Devraj; Lazarus, John J.; Polavarapu, Vivek; Chan, Paul S.; Neumar, Robert W.; Nallamothu, Brahmajee K.

    2016-01-01

    Background Cardiac arrests are a major public health concern worldwide. The extent and types of randomized controlled trials (RCTs) – our most reliable source of clinical evidence – conducted in these high-risk patients over recent years are largely unknown. Methods and Results We performed a systematic review, identifying all RCTs published in PubMed, EMBASE, Scopus, Web of Science, and the Cochrane Library from 1995 to 2014 that focused on acute treatment of non-traumatic cardiac arrest in adults. We then extracted data on the setting of study populations, types and timing of interventions studied, risk of bias, outcomes reported and how these factors have changed over time. Over this twenty-year period, 92 RCTs were published containing 64,309 patients (median, 225.5 per trial). Of these, 81 RCTs (88.0%) involved out-of-hospital cardiac arrest whereas 4 (4.3%) involved in-hospital cardiac arrest and 7 (7.6%) included both. Eighteen RCTs (19.6%) were performed in the U.S., 68 (73.9%) were performed outside the U.S., and 6 (6.5%) were performed in both settings. Thirty-eight RCTs (41.3%) evaluated drug therapy, 39 (42.4%) evaluated device therapy, and 15 (16.3%) evaluated protocol improvements. Seventy-four RCTs (80.4%) examined interventions during the cardiac arrest, 15 (16.3%) examined post-cardiac arrest treatment, and 3 (3.3%) studied both. Overall, reporting of risk of bias was limited. The most common outcome reported was ROSC: 86 (93.5%) with only 22 (23.9%) reporting survival beyond 6 months. Fifty-three RCTs (57.6%) reported global ordinal outcomes whereas 15 (16.3%) reported quality-of-life. RCTs in the last 5 years were more likely to be focused on protocol improvement and post-cardiac arrest care. Conclusions Important gaps in RCTs of cardiac arrest treatments exist, especially those examining in-hospital cardiac arrest, protocol improvement, post-cardiac arrest care, and long-term or quality-of-life outcomes. PMID:27756794

  2. What Does It Take to Change an Editor's Mind? Identifying Minimally Important Difference Thresholds for Peer Reviewer Rating Scores of Scientific Articles.

    Science.gov (United States)

    Callaham, Michael; John, Leslie K

    2018-01-05

    We define a minimally important difference for the Likert-type scores frequently used in scientific peer review (similar to existing minimally important differences for scores in clinical medicine). The magnitude of score change required to change editorial decisions has not been studied, to our knowledge. Experienced editors at a journal in the top 6% by impact factor were asked how large a change of rating in "overall desirability for publication" was required to trigger a change in their initial decision on an article. Minimally important differences were assessed twice for each editor: once assessing the rating change required to shift the editor away from an initial decision to accept, and the other assessing the magnitude required to shift away from an initial rejection decision. Forty-one editors completed the survey (89% response rate). In the acceptance frame, the median minimally important difference was 0.4 points on a scale of 1 to 5. Editors required a greater rating change to shift from an initial rejection decision; in the rejection frame, the median minimally important difference was 1.2 points. Within each frame, there was considerable heterogeneity: in the acceptance frame, 38% of editors did not change their decision within the maximum available range; in the rejection frame, 51% did not. To our knowledge, this is the first study to determine the minimally important difference for Likert-type ratings of research article quality, or in fact any nonclinical scientific assessment variable. Our findings may be useful for future research assessing whether changes to the peer review process produce clinically meaningful differences in editorial decisionmaking. Copyright © 2017 American College of Emergency Physicians. Published by Elsevier Inc. All rights reserved.

  3. Impact of the occurrence of a response shift on the determination of the minimal important difference in a health-related quality of life score over time.

    Science.gov (United States)

    Ousmen, Ahmad; Conroy, Thierry; Guillemin, Francis; Velten, Michel; Jolly, Damien; Mercier, Mariette; Causeret, Sylvain; Cuisenier, Jean; Graesslin, Olivier; Hamidou, Zeinab; Bonnetain, Franck; Anota, Amélie

    2016-12-03

    An important challenge of the longitudinal analysis of health-related quality of life (HRQOL) is the potential occurrence of a Response Shift (RS) effect. While the impact of RS effect on the longitudinal analysis of HRQOL has already been studied, few studies have been conducted on its impact on the determination of the Minimal Important Difference (MID). This study aims to investigate the impact of the RS effect on the determination of the MID over time for each scale of both EORTC QLQ-C30 and QLQ-BR23 questionnaires in breast cancer patients. Patients with breast cancer completed the EORTC QLQ-C30 and the EORTC QLQ-BR23 questionnaires at baseline (time of diagnosis; T0), three months (T1) and six months after surgery (T2). Four hospitals and care centers participated in this study: cancer centers of Dijon and Nancy, the university hospitals of Reims and Strasbourg At T1 and T2, patients were asked to evaluate their HRQOL change during the last 3 months using the Jaeschke transition question. They were also asked to assess retrospectively their HRQOL level of three months ago. The occurrence of the RS effect was explored using the then-test method and its impact on the determination of the MID by using the Anchor-based method. Between February 2006 and February 2008, 381 patients were included of mean age 58 years old (SD = 11). For patients who reported a deterioration of their HRQOL level at each follow-up, an increase of RS effect has been detected between T1 and T2 in 13/15 dimensions of QLQ-C30 questionnaire, and 4/7 dimensions of QLQ-BR23 questionnaire. In contrast, a decrease of the RS effect was observed in 8/15 dimensions of QLQ-C30 questionnaire and in 5/7 dimensions of QLQ-BR23 questionnaire in case of improvement. At T2, the MID became ≥ 5 points when taking into account the RS effect in 10/15 dimensions of QLQ-C30 questionnaire and in 5/7 dimensions of QLQ-BR23 questionnaire. This study highlights that the RS effect increases over time in

  4. Identifying organisational principles and management practices important to the quality of health care services for chronic conditions

    DEFF Research Database (Denmark)

    Frølich, Anne

    2012-01-01

    are limited, it is necessary to identify efficient methods to improve the quality of care. Comparing health care systems is a well-known method for identifying new knowledge regarding, for instance, organisational methods and principles. Kaiser Permanente (KP), an integrated health care delivery system...... in the U.S., is recognized as providing high-quality chronic care; to some extent, this is due to KP's implementation of the chronic care model (CCM). This model recommends a range of evidence-based management practices that support the implementation of evidence-based medicine. However, it is not clear...... which management practices in the CCM are most efficient and in what combinations. In addition, financial incentives and public reporting of performance are often considered effective at improving the quality of health care services, but this has not yet been definitively proved....

  5. Identifying diabetes-related important protein targets with few interacting partners with the PageRank algorithm.

    Science.gov (United States)

    Grolmusz, Vince I

    2015-04-01

    Diabetes is a growing concern for the developed nations worldwide. New genomic, metagenomic and gene-technologic approaches may yield considerable results in the next several years in its early diagnosis, or in advances in therapy and management. In this work, we highlight some human proteins that may serve as new targets in the early diagnosis and therapy. With the help of a very successful mathematical tool for network analysis that formed the basis of the early successes of Google(TM), Inc., we analyse the human protein-protein interaction network gained from the IntAct database with a mathematical algorithm. The novelty of our approach is that the new protein targets suggested do not have many interacting partners (so, they are not hubs or super-hubs), so their inhibition or promotion probably will not have serious side effects. We have identified numerous possible protein targets for diabetes therapy and/or management; some of these have been well known for a long time (these validate our method), some of them appeared in the literature in the last 12 months (these show the cutting edge of the algorithm), and the remainder are still unknown to be connected with diabetes, witnessing completely new hits of the method.

  6. Gene expression profiling and candidate gene resequencing identifies pathways and mutations important for malignant transformation caused by leukemogenic fusion genes.

    Science.gov (United States)

    Novak, Rachel L; Harper, David P; Caudell, David; Slape, Christopher; Beachy, Sarah H; Aplan, Peter D

    2012-12-01

    NUP98-HOXD13 (NHD13) and CALM-AF10 (CA10) are oncogenic fusion proteins produced by recurrent chromosomal translocations in patients with acute myeloid leukemia (AML). Transgenic mice that express these fusions develop AML with a long latency and incomplete penetrance, suggesting that collaborating genetic events are required for leukemic transformation. We employed genetic techniques to identify both preleukemic abnormalities in healthy transgenic mice as well as collaborating events leading to leukemic transformation. Candidate gene resequencing revealed that 6 of 27 (22%) CA10 AMLs spontaneously acquired a Ras pathway mutation and 8 of 27 (30%) acquired an Flt3 mutation. Two CA10 AMLs acquired an Flt3 internal-tandem duplication, demonstrating that these mutations can be acquired in murine as well as human AML. Gene expression profiles revealed a marked upregulation of Hox genes, particularly Hoxa5, Hoxa9, and Hoxa10 in both NHD13 and CA10 mice. Furthermore, mir196b, which is embedded within the Hoxa locus, was overexpressed in both CA10 and NHD13 samples. In contrast, the Hox cofactors Meis1 and Pbx3 were differentially expressed; Meis1 was increased in CA10 AMLs but not NHD13 AMLs, whereas Pbx3 was consistently increased in NHD13 but not CA10 AMLs. Silencing of Pbx3 in NHD13 cells led to decreased proliferation, increased apoptosis, and decreased colony formation in vitro, suggesting a previously unexpected role for Pbx3 in leukemic transformation. Published by Elsevier Inc.

  7. Using the apparent diffusion coefficient to identifying MGMT promoter methylation status early in glioblastoma: importance of analytical method

    Energy Technology Data Exchange (ETDEWEB)

    Rundle-Thiele, Dayle [Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia); Day, Bryan; Stringer, Brett [Brain Cancer Research Unit, Queensland Institute of Medical Research, Brisbane, Queensland (Australia); Fay, Michael [Department of Radiation Oncology, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Martin, Jennifer [Discipline of Clinical Pharmacology, School of Medicine and Public Health, University of Newcastle, Newcastle, New South Wales (Australia); Jeffree, Rosalind L [Department of Neurosurgery, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Thomas, Paul [Queensland PET Service, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Bell, Christopher [Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia); Salvado, Olivier [CSIRO Digital Productivity Flagship, CSIRO, Herston, Queensland (Australia); Gal, Yaniv [Centre for Medical Diagnostic Technologies in Queensland, University of Queensland, Brisbane, Queensland (Australia); Coulthard, Alan [Discipline of Medical Imaging, University of Queensland, St Lucia, Queensland (Australia); Department of Medical Imaging, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Crozier, Stuart [Centre for Medical Diagnostic Technologies in Queensland, University of Queensland, Brisbane, Queensland (Australia); Rose, Stephen, E-mail: stephen.rose@csiro.au [CSIRO Digital Productivity Flagship, CSIRO, Herston, Queensland (Australia); Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia)

    2015-06-15

    Accurate knowledge of O{sup 6}-methylguanine methyltransferase (MGMT) gene promoter subtype in patients with glioblastoma (GBM) is important for treatment. However, this test is not always available. Pre-operative diffusion MRI (dMRI) can be used to probe tumour biology using the apparent diffusion coefficient (ADC); however, its ability to act as a surrogate to predict MGMT status has shown mixed results. We investigated whether this was due to variations in the method used to analyse ADC. We undertook a retrospective study of 32 patients with GBM who had MGMT status measured. Matching pre-operative MRI data were used to calculate the ADC within contrast enhancing regions of tumour. The relationship between ADC and MGMT was examined using two published ADC methods. A strong trend between a measure of ‘minimum ADC’ and methylation status was seen. An elevated minimum ADC was more likely in the methylated compared to the unmethylated MGMT group (U = 56, P = 0.0561). In contrast, utilising a two-mixture model histogram approach, a significant reduction in mean measure of the ‘low ADC’ component within the histogram was associated with an MGMT promoter methylation subtype (P < 0.0246). This study shows that within the same patient cohort, the method selected to analyse ADC measures has a significant bearing on the use of that metric as a surrogate marker of MGMT status. Thus for dMRI data to be clinically useful, consistent methods of data analysis need to be established prior to establishing any relationship with genetic or epigenetic profiling.

  8. Using the apparent diffusion coefficient to identifying MGMT promoter methylation status early in glioblastoma: importance of analytical method

    International Nuclear Information System (INIS)

    Rundle-Thiele, Dayle; Day, Bryan; Stringer, Brett; Fay, Michael; Martin, Jennifer; Jeffree, Rosalind L; Thomas, Paul; Bell, Christopher; Salvado, Olivier; Gal, Yaniv; Coulthard, Alan; Crozier, Stuart; Rose, Stephen

    2015-01-01

    Accurate knowledge of O 6 -methylguanine methyltransferase (MGMT) gene promoter subtype in patients with glioblastoma (GBM) is important for treatment. However, this test is not always available. Pre-operative diffusion MRI (dMRI) can be used to probe tumour biology using the apparent diffusion coefficient (ADC); however, its ability to act as a surrogate to predict MGMT status has shown mixed results. We investigated whether this was due to variations in the method used to analyse ADC. We undertook a retrospective study of 32 patients with GBM who had MGMT status measured. Matching pre-operative MRI data were used to calculate the ADC within contrast enhancing regions of tumour. The relationship between ADC and MGMT was examined using two published ADC methods. A strong trend between a measure of ‘minimum ADC’ and methylation status was seen. An elevated minimum ADC was more likely in the methylated compared to the unmethylated MGMT group (U = 56, P = 0.0561). In contrast, utilising a two-mixture model histogram approach, a significant reduction in mean measure of the ‘low ADC’ component within the histogram was associated with an MGMT promoter methylation subtype (P < 0.0246). This study shows that within the same patient cohort, the method selected to analyse ADC measures has a significant bearing on the use of that metric as a surrogate marker of MGMT status. Thus for dMRI data to be clinically useful, consistent methods of data analysis need to be established prior to establishing any relationship with genetic or epigenetic profiling

  9. Ovulatory shifts in women's attractions to primary partners and other men: further evidence of the importance of primary partner sexual attractiveness.

    Directory of Open Access Journals (Sweden)

    Christina M Larson

    Full Text Available Previous research has documented shifts in women's attractions to their romantic partner and to men other than their partner across the ovulation cycle, contingent on the degree to which her partner displays hypothesized indicators of high-fitness genes. The current study set out to replicate and extend this finding. Forty-one couples in which the woman was naturally cycling participated. Female partners reported their feelings of in-pair attraction and extra-pair attraction on two occasions, once on a low-fertility day of the cycle and once on a high-fertility day of the cycle just prior to ovulation. Ovulation was confirmed using luteinizing hormone tests. We collected two measures of male partner sexual attractiveness. First, the women in the study rated their partner's sexual attractiveness. Second, we photographed the partners and had the photos independently rated for attractiveness. Shifts in women's in-pair attractions across the cycle were significantly moderated by women's ratings of partner sexual attractiveness, such that the less sexually attractive women rated their partner, the less in-pair attraction they reported at high fertility compared with low fertility (partial r = .37, p(dir = .01. Shifts in women's extra-pair attractions across the cycle were significantly moderated by third-party ratings of partner attractiveness, such that the less attractive the partner was, the more extra-pair attraction women reported at high relative to low fertility (partial r = -.33, p(dir = .03. In line with previous findings, we found support for the hypothesis that the degree to which a woman's romantic partner displays indicators of high-fitness genes affects women's attractions to their own partner and other men at high fertility.

  10. Choice Shifts in Groups

    OpenAIRE

    Kfir Eliaz; Debraj Ray

    2004-01-01

    The phenomenon of "choice shifts" in group decision-making is fairly ubiquitous in the social psychology literature. Faced with a choice between a ``safe" and ``risky" decision, group members appear to move to one extreme or the other, relative to the choices each member might have made on her own. Both risky and cautious shifts have been identified in different situations. This paper demonstrates that from an individual decision-making perspective, choice shifts may be viewed as a systematic...

  11. Triangulating Principal Effectiveness: How Perspectives of Parents, Teachers, and Assistant Principals Identify the Central Importance of Managerial Skills. Working Paper 35

    Science.gov (United States)

    Grissom, Jason A.; Loeb, Susanna

    2009-01-01

    While the importance of effective principals is undisputed, few studies have addressed what specific skills principals need to promote school success. This study draws on unique data combining survey responses from principals, assistant principals, teachers and parents with rich administrative data to identify which principal skills matter most…

  12. Shifted Independent Component Analysis

    DEFF Research Database (Denmark)

    Mørup, Morten; Madsen, Kristoffer Hougaard; Hansen, Lars Kai

    2007-01-01

    Delayed mixing is a problem of theoretical interest and practical importance, e.g., in speech processing, bio-medical signal analysis and financial data modelling. Most previous analyses have been based on models with integer shifts, i.e., shifts by a number of samples, and have often been carried...

  13. Shifting Attention

    Science.gov (United States)

    Ingram, Jenni

    2014-01-01

    This article examines the shifts in attention and focus as one teacher introduces and explains an image that represents the processes involved in a numeric problem that his students have been working on. This paper takes a micro-analytic approach to examine how the focus of attention shifts through what the teacher and students do and say in the…

  14. Expert system application for prioritizing preventive actions for shift work: shift expert.

    Science.gov (United States)

    Esen, Hatice; Hatipoğlu, Tuğçen; Cihan, Ahmet; Fiğlali, Nilgün

    2017-09-19

    Shift patterns, work hours, work arrangements and worker motivations have increasingly become key factors for job performance. The main objective of this article is to design an expert system that identifies the negative effects of shift work and prioritizes mitigation efforts according to their importance in preventing these negative effects. The proposed expert system will be referred to as the shift expert. A thorough literature review is conducted to determine the effects of shift work on workers. Our work indicates that shift work is linked to demographic variables, sleepiness and fatigue, health and well-being, and social and domestic conditions. These parameters constitute the sections of a questionnaire designed to focus on 26 important issues related to shift work. The shift expert is then constructed to provide prevention advice at the individual and organizational levels, and it prioritizes this advice using a fuzzy analytic hierarchy process model, which considers comparison matrices provided by users during the prioritization process. An empirical study of 61 workers working on three rotating shifts is performed. After administering the questionnaires, the collected data are analyzed statistically, and then the shift expert produces individual and organizational recommendations for these workers.

  15. Insomnia in shift work.

    Science.gov (United States)

    Vallières, Annie; Azaiez, Aïda; Moreau, Vincent; LeBlanc, Mélanie; Morin, Charles M

    2014-12-01

    Shift work disorder involves insomnia and/or excessive sleepiness associated with the work schedule. The present study examined the impact of insomnia on the perceived physical and psychological health of adults working on night and rotating shift schedules compared to day workers. A total of 418 adults (51% women, mean age 41.4 years), including 51 night workers, 158 rotating shift workers, and 209 day workers were selected from an epidemiological study. An algorithm was used to classify each participant of the two groups (working night or rotating shifts) according to the presence or absence of insomnia symptoms. Each of these individuals was paired with a day worker according to gender, age, and income. Participants completed several questionnaires measuring sleep, health, and psychological variables. Night and rotating shift workers with insomnia presented a sleep profile similar to that of day workers with insomnia. Sleep time was more strongly related to insomnia than to shift work per se. Participants with insomnia in the three groups complained of anxiety, depression, and fatigue, and reported consuming equal amounts of sleep-aid medication. Insomnia also contributed to chronic pain and otorhinolaryngology problems, especially among rotating shift workers. Work productivity and absenteeism were more strongly related to insomnia. The present study highlights insomnia as an important component of the sleep difficulties experienced by shift workers. Insomnia may exacerbate certain physical and mental health problems of shift workers, and impair their quality of life. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L.) Using SLAF-seq.

    Science.gov (United States)

    Xie, Dongwei; Dai, Zhigang; Yang, Zemao; Sun, Jian; Zhao, Debao; Yang, Xue; Zhang, Liguo; Tang, Qing; Su, Jianguang

    2017-01-01

    Flax ( Linum usitatissimum L.) is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq) was employed to perform a genome-wide association study (GWAS) for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP) loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM) and a mixed linear model (MLM) as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  17. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L. Using SLAF-seq

    Directory of Open Access Journals (Sweden)

    Dongwei Xie

    2018-01-01

    Full Text Available Flax (Linum usitatissimum L. is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq was employed to perform a genome-wide association study (GWAS for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM and a mixed linear model (MLM as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  18. The Importance of Health Surveys in Workplaces, with Emphasis on the Field of Public Health, in the Target Group of Employees Who Work in Shifts

    Directory of Open Access Journals (Sweden)

    Vámosiné-Rovó Gyöngyvér

    2016-08-01

    Full Text Available In today’s world the economic uncertainty, the huge overload of work, the expectations related to the work performance – which are not said –, the monotone work and the risk of violence contribute to the increase of psychosocial risks, which can lead to serious consequences in a company. If we succeed in preventing the negative impact of stress originating from the workplace, then the employer can keep the productivity of the company and besides that, the company gets rid of large expenses. The occupational health and safety is an important component of the social responsibility taking. One of the most efficient tools of prevention is the psychosocial risk assessment and the changes based on this in the company’s operation and regulation.

  19. Josephson shift registers

    International Nuclear Information System (INIS)

    Przybysz, J.X.

    1989-01-01

    This paper gives a review of Josephson shift register circuits that were designed, fabricated, or tested, with emphasis on work in the 1980s. Operating speed is most important, since it often limits system performance. Older designs used square-wave clocks, but most modern designs use offset sine waves, with either two or three phases. Operating margins and gate bias uniformity are key concerns. The fastest measured Josephson shift register operated at 2.3 GHz, which compares well with a GaAs shift register that consumes 250 times more power. The difficulties of high-speed testing have prevented many Josephson shift registers from being operated at their highest speeds. Computer simulations suggest that 30-GHz operation is possible with current Nb/Al 2 O 3 /Nb technology. Junctions with critical current densities near 10 kA/cm 2 would make 100-GHz shift registers feasible

  20. The strategic importance of identifying knowledge-based and intangible assets for generating value, competitiveness and innovation in sub-Saharan Africa

    Directory of Open Access Journals (Sweden)

    Nicoline Ondari-Okemwa

    2011-01-01

    Full Text Available This article discusses the strategic importance of identifying intangible assets for creating value and enhancing competitiveness and innovation in science and technology in a knowledge economy with particular reference to the sub- Saharan Africa region. It has always been difficult to gather the prerequisite information to manage such assets and create value from them. The paper discusses the nature of intangible assets, the characteristics of a knowledge economy and the role of knowledge workers in a knowledge economy. The paper also discusses the importance of identifying intangible assets in relation to capturing the value of such assets, the transfer of intangible assets to other owners and the challenges of managing organizational intangible assets. Objectives of the article include: underscoring the strategic importance of identifying intangible assets in sub-Saharan Africa; examining the performance of intangible assets in a knowledge economy; how intangible assets may generate competitiveness, economic growth and innovation; and assess how knowledge workers are becoming a dominant factor in the knowledge economy. An extensive literature review was employed to collect data for this article. It is concluded in the article that organizations and governments in sub-Saharan Africa should look at knowledge-based assets as strategic resources, even though the traditional accounting systems may still be having problems in determining the exact book value of such assets. It is recommended that organizations and government departments in sub-Saharan Africa should implement a system of the reporting of the value of intangible organizational assets just like the reporting of the value of tangible assets; and that organizations in sub-Saharan Africa should use knowledge to produce “smart products and services” which command premium prices.

  1. Market shifting

    Energy Technology Data Exchange (ETDEWEB)

    Forst, Michael

    2013-11-01

    After years of oversupply and artificially low module pricing, market analysts believe that the solar industry will begin to stabilize by 2017. While the market activities are shifting from Europe to the Asia Pacific region and the United States, the solar shakeout continues to be in full swing including solar cell and module manufacturing. (orig.)

  2. Tough Shift

    DEFF Research Database (Denmark)

    Brewer, Robert S.; Verdezoto, Nervo; Holst, Thomas

    2015-01-01

    people to change their behavior at home. Leveraging prior research on encouraging reductions in residential energy use through game play, we introduce ShareBuddy: a casual mobile game intended to encourage players not only to reduce, but also to shift their electricity use. We conducted two field studies...... real-world resource use into a game....

  3. Identifying obstacles and ranking common biological control research priorities for Europe to manage most economically important pests in arable, vegetable and perennial crops.

    Science.gov (United States)

    Lamichhane, Jay Ram; Bischoff-Schaefer, Monika; Bluemel, Sylvia; Dachbrodt-Saaydeh, Silke; Dreux, Laure; Jansen, Jean-Pierre; Kiss, Jozsef; Köhl, Jürgen; Kudsk, Per; Malausa, Thibaut; Messéan, Antoine; Nicot, Philippe C; Ricci, Pierre; Thibierge, Jérôme; Villeneuve, François

    2017-01-01

    EU agriculture is currently in transition from conventional crop protection to integrated pest management (IPM). Because biocontrol is a key component of IPM, many European countries recently have intensified their national efforts on biocontrol research and innovation (R&I), although such initiatives are often fragmented. The operational outputs of national efforts would benefit from closer collaboration among stakeholders via transnationally coordinated approaches, as most economically important pests are similar across Europe. This paper proposes a common European framework on biocontrol R&I. It identifies generic R&I bottlenecks and needs as well as priorities for three crop types (arable, vegetable and perennial crops). The existing gap between the market offers of biocontrol solutions and the demand of growers, the lengthy and expensive registration process for biocontrol solutions and their varying effectiveness due to variable climatic conditions and site-specific factors across Europe are key obstacles hindering the development and adoption of biocontrol solutions in Europe. Considering arable, vegetable and perennial crops, a dozen common target pests are identified for each type of crop and ranked by order of importance at European level. Such a ranked list indicates numerous topics on which future joint transnational efforts would be justified. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  4. Linking the Salt Transcriptome with Physiological Responses of a Salt-Resistant Populus Species as a Strategy to Identify Genes Important for Stress Acclimation1[W][OA

    Science.gov (United States)

    Brinker, Monika; Brosché, Mikael; Vinocur, Basia; Abo-Ogiala, Atef; Fayyaz, Payam; Janz, Dennis; Ottow, Eric A.; Cullmann, Andreas D.; Saborowski, Joachim; Kangasjärvi, Jaakko; Altman, Arie; Polle, Andrea

    2010-01-01

    To investigate early salt acclimation mechanisms in a salt-tolerant poplar species (Populus euphratica), the kinetics of molecular, metabolic, and physiological changes during a 24-h salt exposure were measured. Three distinct phases of salt stress were identified by analyses of the osmotic pressure and the shoot water potential: dehydration, salt accumulation, and osmotic restoration associated with ionic stress. The duration and intensity of these phases differed between leaves and roots. Transcriptome analysis using P. euphratica-specific microarrays revealed clusters of coexpressed genes in these phases, with only 3% overlapping salt-responsive genes in leaves and roots. Acclimation of cellular metabolism to high salt concentrations involved remodeling of amino acid and protein biosynthesis and increased expression of molecular chaperones (dehydrins, osmotin). Leaves suffered initially from dehydration, which resulted in changes in transcript levels of mitochondrial and photosynthetic genes, indicating adjustment of energy metabolism. Initially, decreases in stress-related genes were found, whereas increases occurred only when leaves had restored the osmotic balance by salt accumulation. Comparative in silico analysis of the poplar stress regulon with Arabidopsis (Arabidopsis thaliana) orthologs was used as a strategy to reduce the number of candidate genes for functional analysis. Analysis of Arabidopsis knockout lines identified a lipocalin-like gene (AtTIL) and a gene encoding a protein with previously unknown functions (AtSIS) to play roles in salt tolerance. In conclusion, by dissecting the stress transcriptome of tolerant species, novel genes important for salt endurance can be identified. PMID:20959419

  5. Linking the salt transcriptome with physiological responses of a salt-resistant Populus species as a strategy to identify genes important for stress acclimation.

    Science.gov (United States)

    Brinker, Monika; Brosché, Mikael; Vinocur, Basia; Abo-Ogiala, Atef; Fayyaz, Payam; Janz, Dennis; Ottow, Eric A; Cullmann, Andreas D; Saborowski, Joachim; Kangasjärvi, Jaakko; Altman, Arie; Polle, Andrea

    2010-12-01

    To investigate early salt acclimation mechanisms in a salt-tolerant poplar species (Populus euphratica), the kinetics of molecular, metabolic, and physiological changes during a 24-h salt exposure were measured. Three distinct phases of salt stress were identified by analyses of the osmotic pressure and the shoot water potential: dehydration, salt accumulation, and osmotic restoration associated with ionic stress. The duration and intensity of these phases differed between leaves and roots. Transcriptome analysis using P. euphratica-specific microarrays revealed clusters of coexpressed genes in these phases, with only 3% overlapping salt-responsive genes in leaves and roots. Acclimation of cellular metabolism to high salt concentrations involved remodeling of amino acid and protein biosynthesis and increased expression of molecular chaperones (dehydrins, osmotin). Leaves suffered initially from dehydration, which resulted in changes in transcript levels of mitochondrial and photosynthetic genes, indicating adjustment of energy metabolism. Initially, decreases in stress-related genes were found, whereas increases occurred only when leaves had restored the osmotic balance by salt accumulation. Comparative in silico analysis of the poplar stress regulon with Arabidopsis (Arabidopsis thaliana) orthologs was used as a strategy to reduce the number of candidate genes for functional analysis. Analysis of Arabidopsis knockout lines identified a lipocalin-like gene (AtTIL) and a gene encoding a protein with previously unknown functions (AtSIS) to play roles in salt tolerance. In conclusion, by dissecting the stress transcriptome of tolerant species, novel genes important for salt endurance can be identified.

  6. Nurses' shift reports

    DEFF Research Database (Denmark)

    Buus, Niels; Hoeck, Bente; Hamilton, Bridget Elizabeth

    2017-01-01

    AIMS AND OBJECTIVES: To identify reporting practices that feature in studies of nurses' shift reports across diverse nursing specialities. The objectives were to perform an exhaustive systematic literature search and to critically review the quality and findings of qualitative field studies...... of nurses' shift reports. BACKGROUND: Nurses' shift reports are routine occurrences in healthcare organisations that are viewed as crucial for patient outcomes, patient safety and continuity of care. Studies of communication between nurses attend primarily to 1:1 communication and analyse the adequacy...... and accuracy of patient information and feature handovers at the bedside. Still, verbal reports between groups of nurses about patients are commonplace. Shift reports are obvious sites for studying the situated accomplishment of professional nursing at the group level. This review is focused exclusively...

  7. Experimental assessment of the importance of amino acid positions identified by an entropy-based correlation analysis of multiple-sequence alignments.

    Science.gov (United States)

    Dietrich, Susanne; Borst, Nadine; Schlee, Sandra; Schneider, Daniel; Janda, Jan-Oliver; Sterner, Reinhard; Merkl, Rainer

    2012-07-17

    The analysis of a multiple-sequence alignment (MSA) with correlation methods identifies pairs of residue positions whose occupation with amino acids changes in a concerted manner. It is plausible to assume that positions that are part of many such correlation pairs are important for protein function or stability. We have used the algorithm H2r to identify positions k in the MSAs of the enzymes anthranilate phosphoribosyl transferase (AnPRT) and indole-3-glycerol phosphate synthase (IGPS) that show a high conn(k) value, i.e., a large number of significant correlations in which k is involved. The importance of the identified residues was experimentally validated by performing mutagenesis studies with sAnPRT and sIGPS from the archaeon Sulfolobus solfataricus. For sAnPRT, five H2r mutant proteins were generated by replacing nonconserved residues with alanine or the prevalent residue of the MSA. As a control, five residues with conn(k) values of zero were chosen randomly and replaced with alanine. The catalytic activities and conformational stabilities of the H2r and control mutant proteins were analyzed by steady-state enzyme kinetics and thermal unfolding studies. Compared to wild-type sAnPRT, the catalytic efficiencies (k(cat)/K(M)) were largely unaltered. In contrast, the apparent thermal unfolding temperature (T(M)(app)) was lowered in most proteins. Remarkably, the strongest observed destabilization (ΔT(M)(app) = 14 °C) was caused by the V284A exchange, which pertains to the position with the highest correlation signal [conn(k) = 11]. For sIGPS, six H2r mutant and four control proteins with alanine exchanges were generated and characterized. The k(cat)/K(M) values of four H2r mutant proteins were reduced between 13- and 120-fold, and their T(M)(app) values were decreased by up to 5 °C. For the sIGPS control proteins, the observed activity and stability decreases were much less severe. Our findings demonstrate that positions with high conn(k) values have an

  8. High throughput phenotypic selection of Mycobacterium tuberculosis mutants with impaired resistance to reactive oxygen species identifies genes important for intracellular growth.

    Directory of Open Access Journals (Sweden)

    Olga Mestre

    Full Text Available Mycobacterium tuberculosis has the remarkable capacity to survive within the hostile environment of the macrophage, and to resist potent antibacterial molecules such as reactive oxygen species (ROS. Thus, understanding mycobacterial resistance mechanisms against ROS may contribute to the development of new anti-tuberculosis therapies. Here we identified genes involved in such mechanisms by screening a high-density transposon mutant library, and we show that several of them are involved in the intracellular lifestyle of the pathogen. Many of these genes were found to play a part in cell envelope functions, further strengthening the important role of the mycobacterial cell envelope in protection against aggressions such as the ones caused by ROS inside host cells.

  9. Fluid Shifts

    Science.gov (United States)

    Stenger, M. B.; Hargens, A. R.; Dulchavsky, S. A.; Arbeille, P.; Danielson, R. W.; Ebert, D. J.; Garcia, K. M.; Johnston, S. L.; Laurie, S. S.; Lee, S. M. C.; hide

    2017-01-01

    Introduction. NASA's Human Research Program is focused on addressing health risks associated with long-duration missions on the International Space Station (ISS) and future exploration-class missions beyond low Earth orbit. Visual acuity changes observed after short-duration missions were largely transient, but now more than 50 percent of ISS astronauts have experienced more profound, chronic changes with objective structural findings such as optic disc edema, globe flattening and choroidal folds. These structural and functional changes are referred to as the visual impairment and intracranial pressure (VIIP) syndrome. Development of VIIP symptoms may be related to elevated intracranial pressure (ICP) secondary to spaceflight-induced cephalad fluid shifts, but this hypothesis has not been tested. The purpose of this study is to characterize fluid distribution and compartmentalization associated with long-duration spaceflight and to determine if a relation exists with vision changes and other elements of the VIIP syndrome. We also seek to determine whether the magnitude of fluid shifts during spaceflight, as well as any VIIP-related effects of those shifts, are predicted by the crewmember's pre-flight status and responses to acute hemodynamic manipulations, specifically posture changes and lower body negative pressure. Methods. We will examine a variety of physiologic variables in 10 long-duration ISS crewmembers using the test conditions and timeline presented in the figure below. Measures include: (1) fluid compartmentalization (total body water by D2O, extracellular fluid by NaBr, intracellular fluid by calculation, plasma volume by CO rebreathe, interstitial fluid by calculation); (2) forehead/eyelids, tibia, and calcaneus tissue thickness (by ultrasound); (3) vascular dimensions by ultrasound (jugular veins, cerebral and carotid arteries, vertebral arteries and veins, portal vein); (4) vascular dynamics by MRI (head/neck blood flow, cerebrospinal fluid

  10. Systemic analysis of different colorectal cancer cell lines and TCGA datasets identified IGF-1R/EGFR-PPAR-CASPASE axis as important indicator for radiotherapy sensitivity.

    Science.gov (United States)

    Chen, Lin; Zhu, Zhe; Gao, Wei; Jiang, Qixin; Yu, Jiangming; Fu, Chuangang

    2017-09-05

    Insulin-like growth factor 1 receptor (IGF-1R) is proved to contribute the development of many types of cancers. But, little is known about its roles in radio-resistance of colorectal cancer (CRC). Here, we demonstrated that low IGF-1R expression value was associated with the better radiotherapy sensitivity of CRC. Besides, through Quantitative Real-time PCR (qRT-PCR), the elevated expression value of epidermal growth factor receptor (EGFR) was observed in CRC cell lines (HT29, RKO) with high radio-sensitivity compared with those with low sensitivity (SW480, LOVO). The irradiation induced apoptosis rates of wild type and EGFR agonist (EGF) or IGF-1R inhibitor (NVP-ADW742) treated HT29 and SW480 cells were quantified by flow cytometry. As a result, the apoptosis rate of EGF and NVP-ADW742 treated HT29 cells was significantly higher than that of those wild type ones, which indicated that high EGFR and low IGF-1R expression level in CRC was associated with the high sensitivity to radiotherapy. We next conducted systemic bioinformatics analysis of genome-wide expression profiles of CRC samples from the Cancer Genome Atlas (TCGA). Differential expression analysis between IGF-1R and EGFR abnormal CRC samples, i.e. CRC samples with higher IGF-1R and lower EGFR expression levels based on their median expression values, and the rest of CRC samples identified potential genes contribute to radiotherapy sensitivity. Functional enrichment of analysis of those differential expression genes (DEGs) in the Database for Annotation, Visualization and Integrated Discovery (DAVID) indicated PPAR signaling pathway as an important pathway for the radio-resistance of CRC. Our study identified the potential biomarkers for the rational selection of radiotherapy for CRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Whole-exome sequencing of muscle-invasive bladder cancer identifies recurrent mutations of UNC5C and prognostic importance of DNA repair gene mutations on survival.

    Science.gov (United States)

    Yap, Kai Lee; Kiyotani, Kazuma; Tamura, Kenji; Antic, Tatjana; Jang, Miran; Montoya, Magdeline; Campanile, Alexa; Yew, Poh Yin; Ganshert, Cory; Fujioka, Tomoaki; Steinberg, Gary D; O'Donnell, Peter H; Nakamura, Yusuke

    2014-12-15

    Because of suboptimal outcomes in muscle-invasive bladder cancer even with multimodality therapy, determination of potential genetic drivers offers the possibility of improving therapeutic approaches and discovering novel prognostic indicators. Using pTN staging, we case-matched 81 patients with resected ≥pT2 bladder cancers for whom perioperative chemotherapy use and disease recurrence status were known. Whole-exome sequencing was conducted in 43 cases to identify recurrent somatic mutations and targeted sequencing of 10 genes selected from the initial screening in an additional 38 cases was completed. Mutational profiles along with clinicopathologic information were correlated with recurrence-free survival (RFS) in the patients. We identified recurrent novel somatic mutations in the gene UNC5C (9.9%), in addition to TP53 (40.7%), KDM6A (21.0%), and TSC1 (12.3%). Patients who were carriers of somatic mutations in DNA repair genes (one or more of ATM, ERCC2, FANCD2, PALB2, BRCA1, or BRCA2) had a higher overall number of somatic mutations (P = 0.011). Importantly, after a median follow-up of 40.4 months, carriers of somatic mutations (n = 25) in any of these six DNA repair genes had significantly enhanced RFS compared with noncarriers [median, 32.4 vs. 14.8 months; hazard ratio of 0.46, 95% confidence interval (CI), 0.22-0.98; P = 0.0435], after adjustment for pathologic pTN staging and independent of adjuvant chemotherapy usage. Better prognostic outcomes of individuals carrying somatic mutations in DNA repair genes suggest these mutations as favorable prognostic events in muscle-invasive bladder cancer. Additional mechanistic investigation into the previously undiscovered role of UNC5C in bladder cancer is warranted. ©2014 American Association for Cancer Research.

  12. Integrated physiological, biochemical and molecular analysis identifies important traits and mechanisms associated with differential response of rice genotypes to elevated temperature

    Directory of Open Access Journals (Sweden)

    Boghireddy eSailaja

    2015-11-01

    Full Text Available In changing climate, heat stress caused by high temperature poses a serious threat to rice cultivation. A multiple organizational analysis at physiological, biochemical and molecular level is required to fully understand the impact of elevated temperature in rice. This study was aimed at deciphering the elevated temperature response in eleven popular and mega rice cultivars widely grown in India. Physiological and biochemical traits specifically membrane thermostability (MTS, antioxidants, and photosynthesis were studied at vegetative and reproductive phases which were used to establish a correlation with grain yield under stress. Several useful traits in different genotypes were identified which will be important resource to develop high temperature tolerant rice cultivars. Interestingly, Nagina22 emerged as best performer in terms of yield as well as expression of physiological and biochemical traits at elevated temperature. It showed lesser relative injury, lesser reduction in chlorophyll content, increased super oxide dismutase, catalase and peroxidase activity, lesser reduction in net photosynthetic rate (PN, high transpiration rate (E and other photosynthetic/ fluorescence parameters contributing to least reduction in spikelet fertility and grain yield at elevated temperature. Further, expression of 14 genes including heat shock transcription factors and heat shock proteins was analyzed in Nagina22 (tolerant and Vandana (susceptible at flowering phase, strengthening the fact that N22 performs better at molecular level also during elevated temperature. This study shows that elevated temperature response is complex and involves multiple biological processes which are needed to be characterized to address the challenges of future climate extreme conditions.

  13. Machine Learning Analysis Identifies Drosophila Grunge/Atrophin as an Important Learning and Memory Gene Required for Memory Retention and Social Learning.

    Science.gov (United States)

    Kacsoh, Balint Z; Greene, Casey S; Bosco, Giovanni

    2017-11-06

    High-throughput experiments are becoming increasingly common, and scientists must balance hypothesis-driven experiments with genome-wide data acquisition. We sought to predict novel genes involved in Drosophila learning and long-term memory from existing public high-throughput data. We performed an analysis using PILGRM, which analyzes public gene expression compendia using machine learning. We evaluated the top prediction alongside genes involved in learning and memory in IMP, an interface for functional relationship networks. We identified Grunge/Atrophin ( Gug/Atro ), a transcriptional repressor, histone deacetylase, as our top candidate. We find, through multiple, distinct assays, that Gug has an active role as a modulator of memory retention in the fly and its function is required in the adult mushroom body. Depletion of Gug specifically in neurons of the adult mushroom body, after cell division and neuronal development is complete, suggests that Gug function is important for memory retention through regulation of neuronal activity, and not by altering neurodevelopment. Our study provides a previously uncharacterized role for Gug as a possible regulator of neuronal plasticity at the interface of memory retention and memory extinction. Copyright © 2017 Kacsoh et al.

  14. Identifying inter-residue resonances in crowded 2D {sup 13}C-{sup 13}C chemical shift correlation spectra of membrane proteins by solid-state MAS NMR difference spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Miao Yimin; Cross, Timothy A. [Florida State University, Department of Chemistry and Biochemistry (United States); Fu Riqiang, E-mail: rfu@magnet.fsu.edu [National High Magnet Field Lab (United States)

    2013-07-15

    The feasibility of using difference spectroscopy, i.e. subtraction of two correlation spectra at different mixing times, for substantially enhanced resolution in crowded two-dimensional {sup 13}C-{sup 13}C chemical shift correlation spectra is presented. With the analyses of {sup 13}C-{sup 13}C spin diffusion in simple spin systems, difference spectroscopy is proposed to partially separate the spin diffusion resonances of relatively short intra-residue distances from the longer inter-residue distances, leading to a better identification of the inter-residue resonances. Here solid-state magic-angle-spinning NMR spectra of the full length M2 protein embedded in synthetic lipid bilayers have been used to illustrate the resolution enhancement in the difference spectra. The integral membrane M2 protein of Influenza A virus assembles as a tetrameric bundle to form a proton-conducting channel that is activated by low pH and is essential for the viral lifecycle. Based on known amino acid resonance assignments from amino acid specific labeled samples of truncated M2 sequences or from time-consuming 3D experiments of uniformly labeled samples, some inter-residue resonances of the full length M2 protein can be identified in the difference spectra of uniformly {sup 13}C labeled protein that are consistent with the high resolution structure of the M2 (22-62) protein (Sharma et al., Science 330(6003):509-512, 2010)

  15. Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses

    Directory of Open Access Journals (Sweden)

    Su Zhen

    2011-07-01

    Full Text Available Abstract Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants.

  16. A method to identify important dynamical states in Boolean models of regulatory networks: application to regulation of stomata closure by ABA in A. thaliana.

    Science.gov (United States)

    Bugs, Cristhian A; Librelotto, Giovani R; Mombach, José C M

    2011-12-22

    We introduce a method to analyze the states of regulatory Boolean models that identifies important network states and their biological influence on the global network dynamics. It consists in (1) finding the states of the network that are most frequently visited and (2) the identification of variable and frozen nodes of the network. The method, along with a simulation that includes random features, is applied to the study of stomata closure by abscisic acid (ABA) in A. thaliana proposed by Albert and coworkers. We find that for the case of study, that the dynamics of wild and mutant networks have just two states that are highly visited in their space of states and about a third of all nodes of the wild network are variable while the rest remain frozen in True or False states. This high number of frozen elements explains the low cardinality of the space of states of the wild network. Similar results are observed in the mutant networks. The application of the method allowed us to explain how wild and mutants behave dynamically in the SS and determined an essential feature of the activation of the closure node (representing stomata closure), i.e. its synchronization with the AnionEm node (representing anion efflux at the plasma membrane). The dynamics of this synchronization explains the efficiency reached by the wild and each of the mutant networks. For the biological problem analyzed, our method allows determining how wild and mutant networks differ 'phenotypically'. It shows that the different efficiencies of stomata closure reached among the simulated wild and mutant networks follow from a dynamical behavior of two nodes that are always synchronized. Additionally, we predict that the involvement of the anion efflux at the plasma membrane is crucial for the plant response to ABA. The algorithm used in the simulations is available upon request.

  17. Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses

    Science.gov (United States)

    2011-01-01

    Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants. PMID:21718548

  18. Shifting Sugars and Shifting Paradigms

    Science.gov (United States)

    Siegal, Mark L.

    2015-01-01

    No organism lives in a constant environment. Based on classical studies in molecular biology, many have viewed microbes as following strict rules for shifting their metabolic activities when prevailing conditions change. For example, students learn that the bacterium Escherichia coli makes proteins for digesting lactose only when lactose is available and glucose, a better sugar, is not. However, recent studies, including three PLOS Biology papers examining sugar utilization in the budding yeast Saccharomyces cerevisiae, show that considerable heterogeneity in response to complex environments exists within and between populations. These results join similar recent results in other organisms that suggest that microbial populations anticipate predictable environmental changes and hedge their bets against unpredictable ones. The classical view therefore represents but one special case in a range of evolutionary adaptations to environmental changes that all organisms face. PMID:25688600

  19. Shifting sugars and shifting paradigms.

    Directory of Open Access Journals (Sweden)

    Mark L Siegal

    2015-02-01

    Full Text Available No organism lives in a constant environment. Based on classical studies in molecular biology, many have viewed microbes as following strict rules for shifting their metabolic activities when prevailing conditions change. For example, students learn that the bacterium Escherichia coli makes proteins for digesting lactose only when lactose is available and glucose, a better sugar, is not. However, recent studies, including three PLOS Biology papers examining sugar utilization in the budding yeast Saccharomyces cerevisiae, show that considerable heterogeneity in response to complex environments exists within and between populations. These results join similar recent results in other organisms that suggest that microbial populations anticipate predictable environmental changes and hedge their bets against unpredictable ones. The classical view therefore represents but one special case in a range of evolutionary adaptations to environmental changes that all organisms face.

  20. The importance of Foxp3 antibody and fixation/permeabilization buffer combinations in identifying CD4+CD25+Foxp3+ regulatory T cells.

    Science.gov (United States)

    Law, Jacqueline P; Hirschkorn, Dale F; Owen, Rachel E; Biswas, Hope H; Norris, Philip J; Lanteri, Marion C

    2009-12-01

    Foxp3 is a key marker for CD4(+) regulatory T cells (T(regs)) and was used in developing a multiparameter flow cytometric panel to identify T(regs). Achieving reproducible staining and analysis first required optimization of Foxp3 staining. We present a comparative study of PCH101, 236A/E7, 3G3, 206D, 150D, and 259D/C7 clones of anti-human-Foxp3 antibodies used in combination with five different fixation/permeabilization buffers. Staining for CD25, CD152, and CD127 was also compared between fixation/permeabilization treatments. Promising antibody/buffer combinations were tested in a panel of peripheral blood mononuclear cells from 10 individuals, and then on fresh versus frozen cells from four individuals. Finally, different fluorochromes coupled to two representative antibodies were compared to optimize separation of Foxp3(+) from Foxp3(-) events. Foxp3 gates were set using two gating strategies based on CD127(+)CD25(-) "non-T(regs)" or based on isotype controls. For Foxp3 staining, the best conditions for fixation/permeabilization were obtained using the eBioscience Foxp3, Imgenex, BioLegend, and BD Foxp3 buffers. Comparing results from 10 subjects, 259D/C7, PCH101, 236A/E7, and 206D antibodies yielded statistically higher levels of Foxp3 cells than those by 150D and 3G3 antibodies (mean = 6.9, 5.1, 4.7, and 3.7% compared with 1.7, and 0.3% of CD25(+)Foxp3(+) events within CD4(+) cells, respectively). Importantly, the "nonspecificity" of some antibodies observed with a Foxp3 gate based on isotype controls could be eliminated by setting the Foxp3 gate on "non-T(regs)". Better separation of Foxp3(+) and Foxp3(-) populations was observed using the PCH101 clone coupled to Alexa647 compared with FITC or the 259D/C7 clone coupled to PE compared with Alexa488 fluorochrome. Foxp3 staining can be highly variable and depends on the choice of antibody/buffer pair and the fluorochrome used. Selecting the correct population for setting the Foxp3 gate is critical to avoid

  1. Work shifts in Emergency Medicine

    Directory of Open Access Journals (Sweden)

    Roberto Recupero

    2007-06-01

    Full Text Available Emergency Medicine is known as a high stress specialty. The adverse effect of constantly rotating shifts is the single most important reason given for premature attrition from the field. In this work problems tied with night shift work will be taken into account and some solutions to reduce the impact of night work on the emergency physicians will be proposed.

  2. When teams shift among processes: insights from simulation and optimization.

    Science.gov (United States)

    Kennedy, Deanna M; McComb, Sara A

    2014-09-01

    This article introduces process shifts to study the temporal interplay among transition and action processes espoused in the recurring phase model proposed by Marks, Mathieu, and Zacarro (2001). Process shifts are those points in time when teams complete a focal process and change to another process. By using team communication patterns to measure process shifts, this research explores (a) when teams shift among different transition processes and initiate action processes and (b) the potential of different interventions, such as communication directives, to manipulate process shift timing and order and, ultimately, team performance. Virtual experiments are employed to compare data from observed laboratory teams not receiving interventions, simulated teams receiving interventions, and optimal simulated teams generated using genetic algorithm procedures. Our results offer insights about the potential for different interventions to affect team performance. Moreover, certain interventions may promote discussions about key issues (e.g., tactical strategies) and facilitate shifting among transition processes in a manner that emulates optimal simulated teams' communication patterns. Thus, we contribute to theory regarding team processes in 2 important ways. First, we present process shifts as a way to explore the timing of when teams shift from transition to action processes. Second, we use virtual experimentation to identify those interventions with the greatest potential to affect performance by changing when teams shift among processes. Additionally, we employ computational methods including neural networks, simulation, and optimization, thereby demonstrating their applicability in conducting team research. PsycINFO Database Record (c) 2014 APA, all rights reserved.

  3. Testing of cavity attenuation phase shift technology for siting near-road NO2 monitors.

    Science.gov (United States)

    2015-07-01

    Recent research has identified the public health importance of air pollution exposures : near busy roadways. As a result, EPA significantly revised its NO2 air quality standard in 2010. : The current regulatory focus has shifted from assessment of lo...

  4. Chemical shift homology in proteins

    International Nuclear Information System (INIS)

    Potts, Barbara C.M.; Chazin, Walter J.

    1998-01-01

    The degree of chemical shift similarity for homologous proteins has been determined from a chemical shift database of over 50 proteins representing a variety of families and folds, and spanning a wide range of sequence homologies. After sequence alignment, the similarity of the secondary chemical shifts of C α protons was examined as a function of amino acid sequence identity for 37 pairs of structurally homologous proteins. A correlation between sequence identity and secondary chemical shift rmsd was observed. Important insights are provided by examining the sequence identity of homologous proteins versus percentage of secondary chemical shifts that fall within 0.1 and 0.3 ppm thresholds. These results begin to establish practical guidelines for the extent of chemical shift similarity to expect among structurally homologous proteins

  5. A novel screening method for cell wall mutants in Aspergillus niger identifies UDP-galactopyranose mutase as an important protein in fungal cell wall biosynthesis

    NARCIS (Netherlands)

    Damveld, R.A.; Franken, A.; Arentshorst, M.; Punt, P.J.; Klis, F.M.; van den Hondel, C.A.M.J.J.; Ram, A.F.J.

    2008-01-01

    To identify cell wall biosynthetic genes in filamentous fungi and thus potential targets for the discovery of new antifungals, we developed a novel screening method for cell wall mutants. It is based on our earlier observation that the Aspergillus niger agsA gene, which encodes a putative

  6. Gene expression profiling identifies FYN as an important molecule in tamoxifen resistance and a predictor of early recurrence in patients treated with endocrine therapy

    DEFF Research Database (Denmark)

    Elias, D; (Hansen) Vever, Henriette; Lænkholm, A-V

    2015-01-01

    To elucidate the molecular mechanisms of tamoxifen resistance in breast cancer, we performed gene array analyses and identified 366 genes with altered expression in four unique tamoxifen-resistant (TamR) cell lines vs the parental tamoxifen-sensitive MCF-7/S0.5 cell line. Most of these genes were...

  7. A novel screening method for cell wall mutants in Aspergillus niger identifies UDP-galactopyranose mutase as an important protein in fungal cell wall biosynthesis

    NARCIS (Netherlands)

    Damveld, R.A.; Franken, A.; Arentshorst, M.; Punt, P.J.; Klis, F.M.; Hondel, C.A.M.J.J. van den; Ram, A.F.J.

    2008-01-01

    To identify cell wall biosynthetic genes in filamentous fungi and thus potential targets for the discovery of new antifungals, we developed a novel screening method for cell wall mutants. It is based on our earlier observation that the Aspergillus niger agsA gene, which encodes a putative a-glucan

  8. Prevalence and Clinical Import of Thoracic Injury Identified by Chest Computed Tomography but Not Chest Radiography in Blunt Trauma: Multicenter Prospective Cohort Study.

    Science.gov (United States)

    Langdorf, Mark I; Medak, Anthony J; Hendey, Gregory W; Nishijima, Daniel K; Mower, William R; Raja, Ali S; Baumann, Brigitte M; Anglin, Deirdre R; Anderson, Craig L; Lotfipour, Shahram; Reed, Karin E; Zuabi, Nadia; Khan, Nooreen A; Bithell, Chelsey A; Rowther, Armaan A; Villar, Julian; Rodriguez, Robert M

    2015-12-01

    Chest computed tomography (CT) diagnoses more injuries than chest radiography, so-called occult injuries. Wide availability of chest CT has driven substantial increase in emergency department use, although the incidence and clinical significance of chest CT findings have not been fully described. We determine the frequency, severity, and clinical import of occult injury, as determined by changes in management. These data will better inform clinical decisions, need for chest CT, and odds of intervention. Our sample included prospective data (2009 to 2013) on 5,912 patients at 10 Level I trauma center EDs with both chest radiography and chest CT at physician discretion. These patients were 40.6% of 14,553 enrolled in the parent study who had either chest radiography or chest CT. Occult injuries were pneumothorax, hemothorax, sternal or greater than 2 rib fractures, pulmonary contusion, thoracic spine or scapula fracture, and diaphragm or great vessel injury found on chest CT but not on preceding chest radiography. A priori, we categorized thoracic injuries as major (having invasive procedures), minor (observation or inpatient pain control >24 hours), or of no clinical significance. Primary outcome was prevalence and proportion of occult injury with major interventions of chest tube, mechanical ventilation, or surgery. Secondary outcome was minor interventions of admission rate or observation hours because of occult injury. Two thousand forty-eight patients (34.6%) had chest injury on chest radiography or chest CT, whereas 1,454 of these patients (71.0%, 24.6% of all patients) had occult injury. Of these, in 954 patients (46.6% of injured, 16.1% of total), chest CT found injuries not observed on immediately preceding chest radiography. In 500 more patients (24.4% of injured patients, 8.5% of all patients), chest radiography found some injury, but chest CT found occult injury. Chest radiography found all injuries in only 29.0% of injured patients. Two hundred and two

  9. Comparison of Spot Urine Protein to Creatinine Ratio to 24-Hour Proteinuria to Identify Important Change Over Time in Proteinuria in Lupus.

    Science.gov (United States)

    Medina-Rosas, Jorge; Su, Jiandong; Cook, Richard J; Sabapathy, Arthy; Touma, Zahi

    2017-09-01

    The aim of this study was to determine whether spot urine protein-to-creatinine ratio (PCR) accurately measures the change in proteinuria compared with 24-hour proteinuria (24H-P). This was a retrospective analysis on patients' paired visits and paired urine samples for PCR and 24H-P. Patients with both abnormal 24H-P (>0.5 g/d) and PCR (>0.05 g/mmol) or both normal 24H-P (≤0.5 g/d) and PCR (≤0.05 g/mmol) at baseline visit were identified.The first follow-up visit with partial recovery (50% decrease in proteinuria) or complete recovery (≤0.5 g/d) was identified for those with abnormal baseline 24H-P, and new proteinuria (>0.5 g/d) was identified for those with normal 24H-P. Twenty-four-hour urine collection and PCR end-point frequencies were compared. Twenty-four-hour urine collection results were converted to 24H-PCR. Twenty-four-hour PCR and PCR were utilized to measure the magnitude of change (by standardized response mean [SRM]) in patients who achieved the end points. Of 230 patients, at baseline, 95 patients had abnormal and 109 had normal 24H-P and PCR. On follow-up, 57 achieved partial recovery, and 53 achieved complete recovery by 24H-P. Standardized response mean was -1.03 and -1.10 for 24H-PCR and PCR, respectively. By PCR, 53 patients had partial recovery, and 27 had complete recovery. Standardized response mean was -1.25 and -0.86 by 24H-PCR and PCR, respectively.For new proteinuria, 28 patients were identified by 24H-P and 21 by PCR. Twenty-four-hour PCR SRM was 0.80, and PCR SRM was 0.68. Protein-to-creatinine ratio does not have sufficient accuracy compared with 24H-P for improvement and worsening to be used in lieu of 24H-P.

  10. Identifying most important skills for PhD students in Food Science and Technology: a comparison between industry and academic stakeholders

    Directory of Open Access Journals (Sweden)

    Chelo González-Martínez

    2015-10-01

    Full Text Available Nowadays, there is an increasing need of new skills for PhD students to face the future labour market prospects. PhD graduates must have qualities attractive not only in academia but also outside, in both manufacture and service-oriented enterprises, in small innovative companies, and in the civil services and public administration, among others. To know what the needs of these future employees are, is of great importance to be able to improve their personal and academic formation. The aim of this work was, in the framework of the EC-funded ISEKI_Food 4 network, to evaluate the most desirable specific and soft skills that PhD students should acquire by the end of their doctoral studies. To this aim, several surveys were conducted and sent to the different stakeholders (academia and food industry partners in order to collect the information needed. Results showed that competences related to research skills and techniques, research management, personal effectiveness and communication skills were considered to be the most valuable skills to be acquired by our PhD students to meet the future needs of the labour market.  The importance of these skills was appreciated differently, depending on the stakeholder. To sum up, some recommendations to integrate such valuable skills into the curricula of the PhD student are given.

  11. Post-hoc principal component analysis on a largely illiterate elderly population from North-west India to identify important elements of mini-mental state examination

    Directory of Open Access Journals (Sweden)

    Sunil Kumar Raina

    2016-01-01

    Full Text Available Background: Mini-mental state examination (MMSE scale measures cognition using specific elements that can be isolated, defined, and subsequently measured. This study was conducted with the aim to analyze the factorial structure of MMSE in a largely, illiterate, elderly population in India and to reduce the number of variables to a few meaningful and interpretable combinations. Methodology: Principal component analysis (PCA was performed post-hoc on the data generated by a research project conducted to estimate the prevalence of dementia in four geographically defined habitations in Himachal Pradesh state of India. Results: Questions on orientation and registration account for high percentage of cumulative variance in comparison to other questions. Discussion: The PCA conducted on the data derived from a largely, illiterate population reveals that the most important components to consider for the estimation of cognitive impairment in illiterate Indian population are temporal orientation, spatial orientation, and immediate memory.

  12. Post-hoc principal component analysis on a largely illiterate elderly population from North-west India to identify important elements of mini-mental state examination.

    Science.gov (United States)

    Raina, Sunil Kumar; Chander, Vishav; Raina, Sujeet; Grover, Ashoo

    2016-01-01

    Mini-mental state examination (MMSE) scale measures cognition using specific elements that can be isolated, defined, and subsequently measured. This study was conducted with the aim to analyze the factorial structure of MMSE in a largely, illiterate, elderly population in India and to reduce the number of variables to a few meaningful and interpretable combinations. Principal component analysis (PCA) was performed post-hoc on the data generated by a research project conducted to estimate the prevalence of dementia in four geographically defined habitations in Himachal Pradesh state of India. Questions on orientation and registration account for high percentage of cumulative variance in comparison to other questions. The PCA conducted on the data derived from a largely, illiterate population reveals that the most important components to consider for the estimation of cognitive impairment in illiterate Indian population are temporal orientation, spatial orientation, and immediate memory.

  13. Bipolar disorder: The importance of clinical assessment in identifying prognostic factors - An Audit. Part 1: An analysis of potential prognostic factors.

    Science.gov (United States)

    Verdolini, Norma; Dean, Jonathon; Elisei, Sandro; Quartesan, Roberto; Zaman, Rashid; Agius, Mark

    2014-11-01

    Prognostic factors of bipolar disorder must be identified to assist in staging and treatment, and this may be done primarily during the initial psychiatric assessment. In fact, most of the prognostic factors, which determine disease outcome, could be detected from simple but often-unrecorded questions asked during the psychiatric clinic visit. We collected data from the clinical notes of 70 bipolar outpatients seen at the initial psychiatric assessment clinic about socio-demographic and clinical factors to determine whether various factors had relevance to prevalence, prognosis, or outcome. The sample comprised 16 bipolar I (22.9%) and 54 bipolar II (77.1%) outpatients; a psychiatric comorbidity was noted in 26 patients (37.1%). 60.9% (42 patients) reported anxiety features and 12 patients (17.6%) were noted to have obsessive-compulsive characteristics. Percentages reported in our results are of the sample for which the data was available. Anhedonia is a depressive feature that was present in most of the population where this data was available (92.2%, 59 patients) and 81.8% (54 patients) reported suicidal thoughts during a depressive episode. 74.6% (47 patients) had a family history of bipolar disorder, depression, suicide or psychosis. 27 patients (39.7%) reported current alcohol use and 14 patients (22.6%) current illicit drug use. A comparison between 10 prognostic factors found that only the correlations between current illicit drug use/previous illicit drug use (χ(2)=11.471, Palcohol use/previous alcohol use (χ(2)=31.510, Palcohol use (χ(2)=5.071, P=0.023) and previous alcohol use/family history (χ(2)=4.309, P=0.037) were almost statistically significant. 17 patients (24.3%) of the 70 bipolar patients were assigned to a care coordinator; we have evaluated the possible differences between the patients with or without a care coordinator on the basis of the presence of 10 possible prognostic factors and found no statistically significant differences between

  14. Improving a full-text search engine: the importance of negation detection and family history context to identify cases in a biomedical data warehouse.

    Science.gov (United States)

    Garcelon, Nicolas; Neuraz, Antoine; Benoit, Vincent; Salomon, Rémi; Burgun, Anita

    2017-05-01

    The repurposing of electronic health records (EHRs) can improve clinical and genetic research for rare diseases. However, significant information in rare disease EHRs is embedded in the narrative reports, which contain many negated clinical signs and family medical history. This paper presents a method to detect family history and negation in narrative reports and evaluates its impact on selecting populations from a clinical data warehouse (CDW). We developed a pipeline to process 1.6 million reports from multiple sources. This pipeline is part of the load process of the Necker Hospital CDW. We identified patients with "Lupus and diarrhea," "Crohn's and diabetes," and "NPHP1" from the CDW. The overall precision, recall, specificity, and F-measure were 0.85, 0.98, 0.93, and 0.91, respectively. The proposed method generates a highly accurate identification of cases from a CDW of rare disease EHRs. © The Author 2016. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  15. A hypothesis-testing framework for studies investigating ontogenetic niche shifts using stable isotope ratios.

    Directory of Open Access Journals (Sweden)

    Caroline M Hammerschlag-Peyer

    Full Text Available Ontogenetic niche shifts occur across diverse taxonomic groups, and can have critical implications for population dynamics, community structure, and ecosystem function. In this study, we provide a hypothesis-testing framework combining univariate and multivariate analyses to examine ontogenetic niche shifts using stable isotope ratios. This framework is based on three distinct ontogenetic niche shift scenarios, i.e., (1 no niche shift, (2 niche expansion/reduction, and (3 discrete niche shift between size classes. We developed criteria for identifying each scenario, as based on three important resource use characteristics, i.e., niche width, niche position, and niche overlap. We provide an empirical example for each ontogenetic niche shift scenario, illustrating differences in resource use characteristics among different organisms. The present framework provides a foundation for future studies on ontogenetic niche shifts, and also can be applied to examine resource variability among other population sub-groupings (e.g., by sex or phenotype.

  16. Proteome analysis identifies the Dpr protein of Streptococcus mutans as an important factor in the presence of early streptococcal colonizers of tooth surfaces.

    Directory of Open Access Journals (Sweden)

    Akihiro Yoshida

    Full Text Available Oral streptococci are primary colonizers of tooth surfaces and Streptococcus mutans is the principal causative agent of dental caries in humans. A number of proteins are involved in the formation of monospecies biofilms by S. mutans. This study analyzed the protein expression profiles of S. mutans biofilms formed in the presence or absence of S. gordonii, a pioneer colonizer of the tooth surface, by two-dimensional gel electrophoresis (2-DE. After identifying S. mutans proteins by Mass spectrometric analysis, their expression in the presence of S. gordonii was analyzed. S. mutans was inoculated with or without S. gordonii DL1. The two species were compartmentalized using 0.2-μl Anopore membranes. The biofilms on polystyrene plates were harvested, and the solubilized proteins were separated by 2-DE. When S. mutans biofilms were formed in the presence of S. gordonii, the peroxide resistance protein Dpr of the former showed 4.3-fold increased expression compared to biofilms that developed in the absence of the pioneer colonizer. In addition, we performed a competition assay using S. mutans antioxidant protein mutants together with S. gordonii and other initial colonizers. Growth of the dpr-knockout S. mutans mutant was significantly inhibited by S. gordonii, as well as by S. sanguinis. Furthermore, a cell viability assay revealed that the viability of the dpr-defective mutant was significantly attenuated compared to the wild-type strain when co-cultured with S. gordonii. Therefore, these results suggest that Dpr might be one of the essential proteins for S. mutans survival on teeth in the presence of early colonizing oral streptococci.

  17. Proteome Analysis Identifies the Dpr Protein of Streptococcus mutans as an Important Factor in the Presence of Early Streptococcal Colonizers of Tooth Surfaces

    Science.gov (United States)

    Yoshida, Akihiro; Niki, Mamiko; Yamamoto, Yuji; Yasunaga, Ai; Ansai, Toshihiro

    2015-01-01

    Oral streptococci are primary colonizers of tooth surfaces and Streptococcus mutans is the principal causative agent of dental caries in humans. A number of proteins are involved in the formation of monospecies biofilms by S. mutans. This study analyzed the protein expression profiles of S. mutans biofilms formed in the presence or absence of S. gordonii, a pioneer colonizer of the tooth surface, by two-dimensional gel electrophoresis (2-DE). After identifying S. mutans proteins by Mass spectrometric analysis, their expression in the presence of S. gordonii was analyzed. S. mutans was inoculated with or without S. gordonii DL1. The two species were compartmentalized using 0.2-μl Anopore membranes. The biofilms on polystyrene plates were harvested, and the solubilized proteins were separated by 2-DE. When S. mutans biofilms were formed in the presence of S. gordonii, the peroxide resistance protein Dpr of the former showed 4.3-fold increased expression compared to biofilms that developed in the absence of the pioneer colonizer. In addition, we performed a competition assay using S. mutans antioxidant protein mutants together with S. gordonii and other initial colonizers. Growth of the dpr-knockout S. mutans mutant was significantly inhibited by S. gordonii, as well as by S. sanguinis. Furthermore, a cell viability assay revealed that the viability of the dpr-defective mutant was significantly attenuated compared to the wild-type strain when co-cultured with S. gordonii. Therefore, these results suggest that Dpr might be one of the essential proteins for S. mutans survival on teeth in the presence of early colonizing oral streptococci. PMID:25816242

  18. The impact of shift work on intensive care nurses' lives outside work

    DEFF Research Database (Denmark)

    Jensen, Hanne Irene; Larsen, Jette West; Thomsen, Tina Damgaard

    2018-01-01

    AIMS AND OBJECTIVES: To examine how shift work affects intensive care nurses' lives outside work. BACKGROUND: Shift work is unavoidable for many nurses. When attempting to minimise negative effects of shift work it is important to identify areas which affect nurses working shifts. DESIGN: A cross...... subsequently to plan interventions aimed at decreasing the negative effects. Interventions may include nurses having increased influence on their work schedules and education in sleep hygiene and dietary habits. This article is protected by copyright. All rights reserved.......AIMS AND OBJECTIVES: To examine how shift work affects intensive care nurses' lives outside work. BACKGROUND: Shift work is unavoidable for many nurses. When attempting to minimise negative effects of shift work it is important to identify areas which affect nurses working shifts. DESIGN: A cross......-sectional study. METHODS: A questionnaire survey among Danish intensive care nurses concerning experiences with shift work and family life, spare time activities, sleep and health. RESULTS: A total of 114 nurses (88%) participated. Shift work was found to influence the opportunities for spare time activities...

  19. Foxtail millet NF-Y families: genome-wide survey and evolution analyses identified two functional genes important in abiotic stresses

    Directory of Open Access Journals (Sweden)

    Zhi-Juan eFeng

    2015-12-01

    Full Text Available It was reported that Nuclear Factor Y (NF-Y genes were involved in abiotic stress in plants. Foxtail millet (Setaria italica, an elite stress tolerant crop, provided an impetus for the investigation of the NF-Y families in abiotic responses. In the present study, a total of 39 NF-Y genes were identified in foxtail millet. Synteny analyses suggested that foxtail millet NF-Y genes had experienced rapid expansion and strong purifying selection during the process of plant evolution. De novo transcriptome assembly of foxtail millet revealed 11 drought up-regulated NF-Y genes. SiNF-YA1 and SiNF-YB8 were highly activated in leaves and/or roots by drought and salt stresses. Abscisic acid (ABA and H2O2 played positive roles in the induction of SiNF-YA1 and SiNF-YB8 under stress treatments. Transient luciferase (LUC expression assays revealed that SiNF-YA1 and SiNF-YB8 could activate the LUC gene driven by the tobacco (Nicotiana tobacam NtERD10, NtLEA5, NtCAT, NtSOD or NtPOD promoter under normal or stress conditions. Overexpression of SiNF-YA1 enhanced drought and salt tolerance by activating stress-related genes NtERD10 and NtCAT1 and by maintaining relatively stable relative water content (RWC and contents of chlorophyll, superoxide dismutase (SOD, peroxidase (POD, catalase (CAT and malondialdehyde (MDA in transgenic lines under stresses. SiNF-YB8 regulated expression of NtSOD, NtPOD, NtLEA5 and NtERD10 and conferred relatively high RWC and chlorophyll contents and low MDA content, resulting in drought and osmotic tolerance in transgenic lines under stresses. Therefore, SiNF-YA1 and SiNF-YB8 could activate stress-related genes and improve physiological traits, resulting in tolerance to abiotic stresses in plants. All these results will facilitate functional characterization of foxtail millet NF-Ys in future studies.

  20. Visual attention shifting in autism spectrum disorders.

    Science.gov (United States)

    Richard, Annette E; Lajiness-O'Neill, Renee

    2015-01-01

    Abnormal visual attention has been frequently observed in autism spectrum disorders (ASD). Abnormal shifting of visual attention is related to abnormal development of social cognition and has been identified as a key neuropsychological finding in ASD. Better characterizing attention shifting in ASD and its relationship with social functioning may help to identify new targets for intervention and improving social communication in these disorders. Thus, the current study investigated deficits in attention shifting in ASD as well as relationships between attention shifting and social communication in ASD and neurotypicals (NT). To investigate deficits in visual attention shifting in ASD, 20 ASD and 20 age- and gender-matched NT completed visual search (VS) and Navon tasks with attention-shifting demands as well as a set-shifting task. VS was a feature search task with targets defined in one of two dimensions; Navon required identification of a target letter presented at the global or local level. Psychomotor and processing speed were entered as covariates. Relationships between visual attention shifting, set shifting, and social functioning were also examined. ASD and NT showed comparable costs of shifting attention. However, psychomotor and processing speed were slower in ASD than in NT, and psychomotor and processing speed were positively correlated with attention-shifting costs on Navon and VS, respectively, for both groups. Attention shifting on VS and Navon were correlated among NT, while attention shifting on Navon was correlated with set shifting among ASD. Attention-shifting costs on Navon were positively correlated with restricted and repetitive behaviors among ASD. Relationships between attention shifting and psychomotor and processing speed, as well as relationships between measures of different aspects of visual attention shifting, suggest inefficient top-down influences over preattentive visual processing in ASD. Inefficient attention shifting may be

  1. Micropatch Antenna Phase Shifting

    National Research Council Canada - National Science Library

    Thursby, Michael

    2000-01-01

    .... We have been looking at the ability of embedded element to adjust the phase shift seen by the element with the goal of being able to remove the phase shifting devices from the antenna and replace...

  2. Micropatch Antenna Phase Shifting

    National Research Council Canada - National Science Library

    Thursby, Michael

    1999-01-01

    .... We have been looking at the ability of embedded element to adjust the phase shift seen by the element wit the goal of being able to remove the phase shifting devices from the antenna and replace...

  3. OpenShift Workshop

    CERN Multimedia

    CERN. Geneva; Rodriguez Peon, Alberto

    2017-01-01

    Workshop to introduce developers to the OpenShift platform available at CERN. Several use cases will be shown, including deploying an existing application into OpenShift. We expect attendees to realize about OpenShift features and general architecture of the service.

  4. Physician Rating Websites: What Aspects Are Important to Identify a Good Doctor, and Are Patients Capable of Assessing Them? A Mixed-Methods Approach Including Physicians' and Health Care Consumers' Perspectives.

    Science.gov (United States)

    Rothenfluh, Fabia; Schulz, Peter J

    2017-05-01

    Physician rating websites (PRWs) offer health care consumers the opportunity to evaluate their doctor anonymously. However, physicians' professional training and experience create a vast knowledge gap in medical matters between physicians and patients. This raises ethical concerns about the relevance and significance of health care consumers' evaluation of physicians' performance. To identify the aspects physician rating websites should offer for evaluation, this study investigated the aspects of physicians and their practice relevant for identifying a good doctor, and whether health care consumers are capable of evaluating these aspects. In a first step, a Delphi study with physicians from 4 specializations was conducted, testing various indicators to identify a good physician. These indicators were theoretically derived from Donabedian, who classifies quality in health care into pillars of structure, process, and outcome. In a second step, a cross-sectional survey with health care consumers in Switzerland (N=211) was launched based on the indicators developed in the Delphi study. Participants were asked to rate the importance of these indicators to identify a good physician and whether they would feel capable to evaluate those aspects after the first visit to a physician. All indicators were ordered into a 4×4 grid based on evaluation and importance, as judged by the physicians and health care consumers. Agreement between the physicians and health care consumers was calculated applying Holsti's method. In the majority of aspects, physicians and health care consumers agreed on what facets of care were important and not important to identify a good physician and whether patients were able to evaluate them, yielding a level of agreement of 74.3%. The two parties agreed that the infrastructure, staff, organization, and interpersonal skills are both important for a good physician and can be evaluated by health care consumers. Technical skills of a doctor and outcomes

  5. Assessment of cardiometabolic risk among shift workers in Hungary

    Directory of Open Access Journals (Sweden)

    Jermendy György

    2012-02-01

    Full Text Available Abstract Aim Shift workers may be at risk of different diseases. In order to assess cardiometabolic risk in shift workers, a cross-sectional study was performed among active workers. Methods A total of 481 workers (121 men, 360 women were investigated; most of them were employees in light industry (58.2% or in public services (23.9%. Past medical history was recorded and physical examination was performed. Questionnaires were used to characterize daily activity. Fasting venous blood sample was collected for measuring laboratory parameters. Data from shift workers (n = 234, age: 43.9 ± 8.1 years were compared to those of daytime workers (n = 247, age: 42.8 ± 8.5 years, men and women were analyzed separately. Results In men, systolic blood pressure was higher in shift workers compared to daytime workers (133 ± 8 vs 126 ± 17 mmHg; p vs 67.7 ± 13.2 kg; p vs 13.4%; p vs 21.7%; p vs 1.68 ± 0.36 mmol/l; p Conclusion Middle-aged active shift workers, especially women, have a less healthy lifestyle and are at higher cardiometabolic risk as compared to daytime workers. Our study highlights the importance of measures for identifying and preventing cardiometabolic risk factors in shift workers.

  6. Effect of Shift Work on Nocturia.

    Science.gov (United States)

    Kim, Jin Wook

    2016-01-01

    To identify the circadian sensitive component of nocturia by comparing nocturia in patients who voluntarily choose a disrupted circadian rhythm, that is, shift workers, with those who maintain normal day-night cycles. Between 2011 and 2013, a total of 1741 untreated patients, 1376 nonshift workers and 365 shift workers, were compared for nocturia indices based on frequency volume charts (FVCs). General linear model of 8-hour interval urine production and frequency were compared between FVCs of nonshift workers, FVCs of night-shift workers, and FVCs of day-shift workers. Nocturia frequency was increased in the night-shift workers (2.38 ± 1.44) compared with nonshift workers (2.18 ± 1.04) (P night-shift workers, 0.34 ± 0.13 for nonshift workers, P = .24), nocturnal bladder capacity index increased significantly (1.41 ± 1.06 for night-shift workers, 1.26 ± 0.92 for nonshift workers, P shift (P shift changes (P = .35). Patients in alternating work shifts showed increased nocturia, especially during their night shift. These changes tended to be more associated with decreased nocturnal bladder capacity than increased nocturnal polyuria. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Paradigm Shifts in Ophthalmic Diagnostics.

    Science.gov (United States)

    Sebag, J; Sadun, Alfredo A; Pierce, Eric A

    2016-08-01

    Future advances in ophthalmology will see a paradigm shift in diagnostics from a focus on dysfunction and disease to better measures of psychophysical function and health. Practical methods to define genotypes will be increasingly important and non-invasive nanotechnologies are needed to detect molecular changes that predate histopathology. This is not a review nor meant to be comprehensive. Specific topics have been selected to illustrate the principles of important paradigm shifts that will influence the future of ophthalmic diagnostics. It is our impression that future evaluation of vision will go beyond visual acuity to assess ocular health in terms of psychophysical function. The definition of disease will incorporate genotype into what has historically been a phenotype-centric discipline. Non-invasive nanotechnologies will enable a paradigm shift from disease detection on a cellular level to a sub-cellular molecular level. Vision can be evaluated beyond visual acuity by measuring contrast sensitivity, color vision, and macular function, as these provide better insights into the impact of aging and disease. Distortions can be quantified and the psychophysical basis of vision can be better evaluated than in the past by designing tests that assess particular macular cell function(s). Advances in our understanding of the genetic basis of eye diseases will enable better characterization of ocular health and disease. Non-invasive nanotechnologies can assess molecular changes in the lens, vitreous, and macula that predate visible pathology. Oxygen metabolism and circulatory physiology are measurable indices of ocular health that can detect variations of physiology and early disease. This overview of paradigm shifts in ophthalmology suggests that the future will see significant improvements in ophthalmic diagnostics. The selected topics illustrate the principles of these paradigm shifts and should serve as a guide to further research and development. Indeed

  8. Implementing OpenShift

    CERN Document Server

    Miller, Adam

    2013-01-01

    A standard tutorial-based approach to using OpenShift and deploying custom or pre-built web applications to the OpenShift Online cloud.This book is for software developers and DevOps alike who are interested in learning how to use the OpenShift Platform-as-a-Service for developing and deploying applications, how the environment works on the back end, and how to deploy their very own open source Platform-as-a-Service based on the upstream OpenShift Origin project.

  9. Homogeneous bilateral block shifts

    Indian Academy of Sciences (India)

    Douglas class were classified in [3]; they are unilateral block shifts of arbitrary block size (i.e. dim H(n) can be anything). However, no examples of irreducible homogeneous bilateral block shifts of block size larger than 1 were known until now.

  10. OpenShift cookbook

    CERN Document Server

    Gulati, Shekhar

    2014-01-01

    If you are a web application developer who wants to use the OpenShift platform to host your next big idea but are looking for guidance on how to achieve this, then this book is the first step you need to take. This is a very accessible cookbook where no previous knowledge of OpenShift is needed.

  11. Pole shifting with constrained output feedback

    International Nuclear Information System (INIS)

    Hamel, D.; Mensah, S.; Boisvert, J.

    1984-03-01

    The concept of pole placement plays an important role in linear, multi-variable, control theory. It has received much attention since its introduction, and several pole shifting algorithms are now available. This work presents a new method which allows practical and engineering constraints such as gain limitation and controller structure to be introduced right into the pole shifting design strategy. This is achieved by formulating the pole placement problem as a constrained optimization problem. Explicit constraints (controller structure and gain limits) are defined to identify an admissible region for the feedback gain matrix. The desired pole configuration is translated into an appropriate cost function which must be closed-loop minimized. The resulting constrained optimization problem can thus be solved with optimization algorithms. The method has been implemented as an algorithmic interactive module in a computer-aided control system design package, MVPACK. The application of the method is illustrated to design controllers for an aircraft and an evaporator. The results illustrate the importance of controller structure on overall performance of a control system

  12. Promoting integrity of shift report by applying ISBAR principles among nursing students in clinical placement

    Directory of Open Access Journals (Sweden)

    Pang Weng Ian

    2017-01-01

    Full Text Available Shift report is an essential method for nursing staff to carry out health care communication. The most important purpose of the shift report is to ensure the safety of patients and to provide continuous care. Nursing students are inadequate of clinical experience and rational organization during patient care. They may not be able to handle the critically ill patients and pass the messages to the following nursing staff. ISBAR (Identify, Situation, Background, Assessment and Recommendation tool is increasingly being utilized as a format for structured shift report communication. In this study, a scale of ISBAR principles is designed to provide students with self-assessment and teachers with evaluation, in a way to improve nursing students’ self-awareness of shift report. Hopefully, with the use of the scale of ISBAR, nursing students are able to complete shift report in systemic integrity and orderliness during clinical placement.

  13. Special training of shift personnel

    International Nuclear Information System (INIS)

    Martin, H.D.

    1981-01-01

    The first step of on-the-job training is practical observation phase in an operating Nuclear Plant, where the participants are assigned to shift work. The simulator training for operating personnel, for key personnel and, to some extent, also for maintenance personnel and specialists give the practical feeling for Nuclear Power Plant behaviour during normal and abnormal conditions. During the commissioning phase of the own Nuclear Power Plant, which is the most important practical training, the participants are integrated into the commissioning staff and assisted during their process of practical learning by special instructors. The preparation for the licensing exams is vitally important for shift personnel and special courses are provided after the first non-nuclear trial operation of the plant. Personnel training also includes performance of programmes and material for retraining, training of instructors and assistance in building up special training programmes and material as well as training centers. (orig./RW)

  14. Principal component analysis of normalized full spectrum mass spectrometry data in multiMS-toolbox: An effective tool to identify important factors for classification of different metabolic patterns and bacterial strains.

    Science.gov (United States)

    Cejnar, Pavel; Kuckova, Stepanka; Prochazka, Ales; Karamonova, Ludmila; Svobodova, Barbora

    2018-06-15

    Explorative statistical analysis of mass spectrometry data is still a time-consuming step. We analyzed critical factors for application of principal component analysis (PCA) in mass spectrometry and focused on two whole spectrum based normalization techniques and their application in the analysis of registered peak data and, in comparison, in full spectrum data analysis. We used this technique to identify different metabolic patterns in the bacterial culture of Cronobacter sakazakii, an important foodborne pathogen. Two software utilities, the ms-alone, a python-based utility for mass spectrometry data preprocessing and peak extraction, and the multiMS-toolbox, an R software tool for advanced peak registration and detailed explorative statistical analysis, were implemented. The bacterial culture of Cronobacter sakazakii was cultivated on Enterobacter sakazakii Isolation Agar, Blood Agar Base and Tryptone Soya Agar for 24 h and 48 h and applied by the smear method on an Autoflex speed MALDI-TOF mass spectrometer. For three tested cultivation media only two different metabolic patterns of Cronobacter sakazakii were identified using PCA applied on data normalized by two different normalization techniques. Results from matched peak data and subsequent detailed full spectrum analysis identified only two different metabolic patterns - a cultivation on Enterobacter sakazakii Isolation Agar showed significant differences to the cultivation on the other two tested media. The metabolic patterns for all tested cultivation media also proved the dependence on cultivation time. Both whole spectrum based normalization techniques together with the full spectrum PCA allow identification of important discriminative factors in experiments with several variable condition factors avoiding any problems with improper identification of peaks or emphasis on bellow threshold peak data. The amounts of processed data remain still manageable. Both implemented software utilities are available

  15. Formal consensus to identify clinically important changes in management resulting from the use of cardiovascular magnetic resonance (CMR) in patients who activate the primary percutaneous coronary intervention (PPCI) pathway.

    Science.gov (United States)

    Pufulete, Maria; Brierley, Rachel C; Bucciarelli-Ducci, Chiara; Greenwood, John P; Dorman, Stephen; Anderson, Richard A; Harris, Jessica; McAlindon, Elisa; Rogers, Chris A; Reeves, Barnaby C

    2017-06-22

    To define important changes in management arising from the use of cardiovascular magnetic resonance (CMR) in patients who activate the primary percutaneous coronary intervention (PPCI) pathway. Formal consensus study using literature review and cardiologist expert opinion to formulate consensus statements and setting up a consensus panel to review the statements (by completing a web-based survey, attending a face-to-face meeting to discuss survey results and modify the survey to reflect group discussion and completing the modified survey to determine which statements were in consensus). Formulation of consensus statements: four cardiologists (two CMR and two interventional) and six non-clinical researchers. Formal consensus: seven cardiologists (two CMR and three interventional, one echocardiography and one heart failure). Forty-nine additional cardiologists completed the modified survey. Thirty-seven draft statements describing changes in management following CMR were generated; these were condensed into 12 statements and reviewed through the formal consensus process. Three of 12 statements were classified in consensus in the first survey; these related to the role of CMR in identifying the cause of out-of-hospital cardiac arrest, providing a definitive diagnosis in patients found to have unobstructed arteries on angiography and identifying patients with left ventricular thrombus. Two additional statements were in consensus in the modified survey, relating to the ability of CMR to identify patients who have a poor prognosis after PPCI and assess ischaemia and viability in patients with multivessel disease. There was consensus that CMR leads to clinically important changes in management in five subgroups of patients who activate the PPCI pathway. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  16. MicroRNAs regulate T-cell production of interleukin-9 and identify hypoxia-inducible factor-2α as an important regulator of T helper 9 and regulatory T-cell differentiation.

    Science.gov (United States)

    Singh, Yogesh; Garden, Oliver A; Lang, Florian; Cobb, Bradley S

    2016-09-01

    MicroRNAs (miRNAs) regulate many aspects of helper T cell (Th) development and function. Here we found that they are required for the suppression of interleukin-9 (IL-9) expression in Th9 cells and other Th subsets. Two highly related miRNAs (miR-15b and miR-16) that we previously found to play an important role in regulatory T (Treg) cell differentiation were capable of suppressing IL-9 expression when they were over-expressed in Th9 cells. We used these miRNAs as tools to identify novel regulators of IL-9 expression and found that they could regulate the expression of Epas1, which encodes hypoxia-inducible factor (HIF)-2α. HIF proteins regulate metabolic pathway usage that is important in determining appropriate Th differentiation. The related protein, HIF-1α enhances Th17 differentiation and inhibits Treg cell differentiation. Here we found that HIF-2α was required for IL-9 expression in Th9 cells, but its expression was not sufficient in other Th subsets. Furthermore, HIF-2α suppressed Treg cell differentiation like HIF-1α, demonstrating both similar and distinct roles of the HIF proteins in Th differentiation and adding a further dimension to their function. Ironically, even though miR-15b and miR-16 suppressed HIF-2α expression in Treg cells, inhibiting their function in Treg cells did not lead to an increase in IL-9 expression. Therefore, the physiologically relevant miRNAs that regulate IL-9 expression in Treg cells and other subsets remain unknown. Nevertheless, the analysis of miR-15b and miR-16 function led to the discovery of the importance of HIF-2α so this work demonstrated the utility of studying miRNA function to identify novel regulatory pathways in helper T-cell development. © 2016 John Wiley & Sons Ltd.

  17. Anthropometric changes and fluid shifts

    Science.gov (United States)

    Thornton, W. E.; Hoffler, G. W.; Rummel, J. A.

    1974-01-01

    Several observations of body size, shape, posture, and configuration were made to document changes resulting from direct effects of weightlessness during the Skylab 4 mission. After the crewmen were placed in orbit, a number of anatomical and anthropometric changes occurred including a straightening of the thoracolumbar spine, a general decrease in truncal girth, and an increase in height. By the time of the earliest in-flight measurement on mission day 3, all crewmen had lost more than two liters of extravascular fluid from the calf and thigh. The puffy facies, the bird legs effect, the engorgement of upper body veins, and the reduced volume of lower body veins were all documented with photographs. Center-of-mass measurements confirmed a fluid shift cephalad. This shift remained throughout the mission until recovery, when a sharp reversal occurred; a major portion of the reversal was completed in a few hours. The anatomical changes are of considerable scientific interest and of import to the human factors design engineer, but the shifts of blood and extravascular fluid are of more consequence. It is hypothesized that the driving force for the fluid shift is the intrinsic and unopposed lower limb elasticity that forces venous blood and then other fluid cephalad.

  18. Shift Verification and Validation

    Energy Technology Data Exchange (ETDEWEB)

    Pandya, Tara M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Evans, Thomas M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Davidson, Gregory G [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Johnson, Seth R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Godfrey, Andrew T. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2016-09-07

    This documentation outlines the verification and validation of Shift for the Consortium for Advanced Simulation of Light Water Reactors (CASL). Five main types of problems were used for validation: small criticality benchmark problems; full-core reactor benchmarks for light water reactors; fixed-source coupled neutron-photon dosimetry benchmarks; depletion/burnup benchmarks; and full-core reactor performance benchmarks. We compared Shift results to measured data and other simulated Monte Carlo radiation transport code results, and found very good agreement in a variety of comparison measures. These include prediction of critical eigenvalue, radial and axial pin power distributions, rod worth, leakage spectra, and nuclide inventories over a burn cycle. Based on this validation of Shift, we are confident in Shift to provide reference results for CASL benchmarking.

  19. Analytic matrix elements with shifted correlated Gaussians

    DEFF Research Database (Denmark)

    Fedorov, D. V.

    2017-01-01

    Matrix elements between shifted correlated Gaussians of various potentials with several form-factors are calculated analytically. Analytic matrix elements are of importance for the correlated Gaussian method in quantum few-body physics.......Matrix elements between shifted correlated Gaussians of various potentials with several form-factors are calculated analytically. Analytic matrix elements are of importance for the correlated Gaussian method in quantum few-body physics....

  20. Molecular Electronic Shift Registers

    Science.gov (United States)

    Beratan, David N.; Onuchic, Jose N.

    1990-01-01

    Molecular-scale shift registers eventually constructed as parts of high-density integrated memory circuits. In principle, variety of organic molecules makes possible large number of different configurations and modes of operation for such shift-register devices. Several classes of devices and implementations in some specific types of molecules proposed. All based on transfer of electrons or holes along chains of repeating molecular units.

  1. Night shift work and modifiable lifestyle factors.

    Science.gov (United States)

    Pepłońska, Beata; Burdelak, Weronika; Krysicka, Jolanta; Bukowska, Agnieszka; Marcinkiewicz, Andrzej; Sobala, Wojciech; Klimecka-Muszyńska, Dorota; Rybacki, Marcin

    2014-10-01

    Night shift work has been linked to some chronic diseases. Modification of lifestyle by night work may partially contribute to the development of these diseases, nevertheless, so far epidemiological evidence is limited. The aim of the study was to explore association between night shift work and lifestyle factors using data from a cross-sectional study among blue-collar workers employed in industrial plants in Łódź, Poland. The anonymous questionnaire was self-administered among 605 employees (236 women and 369 men, aged 35 or more) - 434 individuals currently working night shifts. Distribution of the selected lifestyle related factors such as smoking, alcohol drinking, physical activity, body mass index (BMI), number of main meals and the hour of the last meal was compared between current, former, and never night shift workers. Adjusted ORs or predicted means were calculated, as a measure of the associations between night shift work and lifestyle factors, with age, marital status and education included in the models as covariates. Recreational inactivity (defined here as less than one hour per week of recreational physical activity) was associated with current night shift work when compared to never night shift workers (OR = 2.43, 95% CI: 1.13-5.22) among men. Alcohol abstinence and later time of the last meal was associated with night shift work among women. Statistically significant positive relationship between night shift work duration and BMI was observed among men (p = 0.029). This study confirms previous studies reporting lower exercising among night shift workers and tendency to increase body weight. This finding provides important public health implication for the prevention of chronic diseases among night shift workers. Initiatives promoting physical activity addressed in particular to the night shift workers are recommended.

  2. Night shift work and modifiable lifestyle factors

    Directory of Open Access Journals (Sweden)

    Beata Pepłońska

    2014-10-01

    Full Text Available Objectives: Night shift work has been linked to some chronic diseases. Modification of lifestyle by night work may partially contribute to the development of these diseases, nevertheless, so far epidemiological evidence is limited. The aim of the study was to explore association between night shift work and lifestyle factors using data from a cross-sectional study among blue-collar workers employed in industrial plants in Łódź, Poland. Material and Methods: The anonymous questionnaire was self-administered among 605 employees (236 women and 369 men, aged 35 or more - 434 individuals currently wor­king night shifts. Distribution of the selected lifestyle related factors such as smoking, alcohol drinking, physical activity, body mass index (BMI, number of main meals and the hour of the last meal was compared between current, former, and never night shift workers. Adjusted ORs or predicted means were calculated, as a measure of the associations between night shift work and lifestyle factors, with age, marital status and education included in the models as covariates. Results: Recreational inactivity (defined here as less than one hour per week of recreational physical activity was associated with current night shift work when compared to never night shift workers (OR = 2.43, 95% CI: 1.13-5.22 among men. Alcohol abstinence and later time of the last meal was associated with night shift work among women. Statistically significant positive relationship between night shift work duration and BMI was observed among men (p = 0.029. Conclusions: This study confirms previous studies reporting lower exercising among night shift workers and tendency to increase body weight. This finding provides important public health implication for the prevention of chronic diseases among night shift workers. Initiatives promoting physical activity addressed in particular to the night shift workers are recommended.

  3. Shift systems in nuclear power plants - aspects for planning, shift systems, utility practice

    International Nuclear Information System (INIS)

    Grauf, E.

    1986-01-01

    This lecture contains the most important aspects of shift structure and shift organisation. The criteria for shift planning involving essential tasks, duties, laws and regulations, medical aspects, social aspects, will be presented. In the Federal Republic of Germany some basic models were established, which will be shown and explained with special reference to the number of teams, size of shift crews and absence regulations. Moreover, the lecture will deal with rotation systems and provisions for the transfer of shift responsibilities. By example of a utility plant commissioning time scale (1300 MW PWR) the practice of shift installations will be shown as well as the most important points of education and training. Within this compass the criteria and requirements for training and education of operational personnel in the Federal Republic of Germany will also be touched. (orig.)

  4. Effects of Napping During Shift Work on Sleepiness and Performance in Emergency Medical Services Personnel and Similar Shift Workers: A Systematic Review and Meta-Analysis.

    Science.gov (United States)

    Martin-Gill, Christian; Barger, Laura K; Moore, Charity G; Higgins, J Stephen; Teasley, Ellen M; Weiss, Patricia M; Condle, Joseph P; Flickinger, Katharyn L; Coppler, Patrick J; Sequeira, Denisse J; Divecha, Ayushi A; Matthews, Margaret E; Lang, Eddy S; Patterson, P Daniel

    2018-02-15

    Scheduled napping during work shifts may be an effective way to mitigate fatigue-related risk. This study aimed to critically review and synthesize existing literature on the impact of scheduled naps on fatigue-related outcomes for EMS personnel and similar shift worker groups. A systematic literature review was performed of the impact of a scheduled nap during shift work on EMS personnel or similar shift workers. The primary (critical) outcome of interest was EMS personnel safety. Secondary (important) outcomes were patient safety; personnel performance; acute states of fatigue, alertness, and sleepiness; indicators of sleep duration and/or quality; employee retention/turnover; indicators of long-term health; and cost to the system. Meta-analyses were performed to evaluate the impact of napping on a measure of personnel performance (the psychomotor vigilance test [PVT]) and measures of acute fatigue. Of 4,660 unique records identified, 13 experimental studies were determined relevant and summarized. The effect of napping on reaction time measured at the end of shift was small and non-significant (SMD 0.12, 95% CI -0.13 to 0.36; p = 0.34). Napping during work did not change reaction time from the beginning to the end of the shift (SMD -0.01, 95% CI -25.0 to 0.24; p = 0.96). Naps had a moderate, significant effect on sleepiness measured at the end of shift (SMD 0.40, 95% CI 0.09 to 0.72; p = 0.01). The difference in sleepiness from the start to the end of shift was moderate and statistically significant (SMD 0.41, 95% CI 0.09 to 0.72; p = 0.01). Reviewed literature indicated that scheduled naps at work improved performance and decreased fatigue in shift workers. Further research is required to identify the optimal timing and duration of scheduled naps to maximize the beneficial outcomes.

  5. Methodological aspects of shift-work research.

    Science.gov (United States)

    Knutsson, Anders

    2004-01-01

    A major issue in shift-work research is to understand the possible ways in which shift work can impact performance and health. Nearly all body functions, from those of the cellular level to those of the entire body, are circadian rhythmic. Disturbances of these rhythms as well as the social consequences of odd work hours are of importance for the health and well-being of shift workers. This article reviews a number of common methodological issues which are of relevance to epidemiological studies in this area of research. It discusses conceptual problems regarding the use of the term "shift work," and it underscores the need to develop models that explain the mechanisms of disease in shift workers.

  6. Importance measures

    International Nuclear Information System (INIS)

    Gomez Cobo, A.

    1997-01-01

    The presentation discusses the following: general concepts of importance measures; example fault tree, used to illustrate importance measures; Birnbaum's structural importance; criticality importance; Fussel-Vesely importance; upgrading function; risk achievement worth; risk reduction worth

  7. The Prerequisites for a Degrowth Paradigm Shift

    DEFF Research Database (Denmark)

    Buch-Hansen, Hubert

    2018-01-01

    What would it take for a degrowth paradigm shift to take place? Drawing on contemporary critical political economy scholarship, this article identifies four prerequisites for socio-economic paradigm shifts: deep crisis, an alternative political project, a comprehensive coalition of social forces...... currently facing humanity. On the other hand, the prospects for a degrowth paradigm shift remain bleak: unlike political projects that became hegemonic in the past, degrowth has neither support from a comprehensive coalition of social forces nor any consent to its agenda among the broader population....

  8. PSYCHE Pure Shift NMR Spectroscopy.

    Science.gov (United States)

    Foroozandeh, Mohammadali; Morris, Gareth; Nilsson, Mathias

    2018-03-13

    Broadband homodecoupling techniques in NMR, also known as "pure shift" methods, aim to enhance spectral resolution by suppressing the effects of homonuclear coupling interactions to turn multiplet signals into singlets. Such techniques typically work by selecting a subset of "active" nuclear spins to observe, and selectively inverting the remaining, "passive", spins to reverse the effects of coupling. Pure Shift Yielded by Chirp Excitation (PSYCHE) is one such method; it is relatively recent, but has already been successfully implemented in a range of different NMR experiments. Paradoxically, PSYCHE is one of the trickiest of pure shift NMR techniques to understand but one of the easiest to use. Here we offer some insights into theoretical and practical aspects of the method, and into the effects and importance of the experimental parameters. Some recent improvements that enhance the spectral purity of PSYCHE spectra will be presented, and some experimental frameworks including examples in 1D and 2D NMR spectroscopy, for the implementation of PSYCHE will be introduced. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. A putative biomarker signature for clinically effective AKT inhibition: correlation of in vitro, in vivo and clinical data identifies the importance of modulation of the mTORC1 pathway.

    Science.gov (United States)

    Cheraghchi-Bashi, Azadeh; Parker, Christine A; Curry, Ed; Salazar, Jean-Frederic; Gungor, Hatice; Saleem, Azeem; Cunnea, Paula; Rama, Nona; Salinas, Cristian; Mills, Gordon B; Morris, Shannon R; Kumar, Rakesh; Gabra, Hani; Stronach, Euan A

    2015-12-08

    Our identification of dysregulation of the AKT pathway in ovarian cancer as a platinum resistance specific event led to a comprehensive analysis of in vitro, in vivo and clinical behaviour of the AKT inhibitor GSK2141795. Proteomic biomarker signatures correlating with effects of GSK2141795 were developed using in vitro and in vivo models, well characterised for related molecular, phenotypic and imaging endpoints. Signatures were validated in temporally paired biopsies from patients treated with GSK2141795 in a clinical study. GSK2141795 caused growth-arrest as single agent in vitro, enhanced cisplatin-induced apoptosis in vitro and reduced tumour volume in combination with platinum in vivo. GSK2141795 treatment in vitro and in vivo resulted in ~50-90% decrease in phospho-PRAS40 and 20-80% decrease in fluoro-deoxyglucose (FDG) uptake. Proteomic analysis of GSK2141795 in vitro and in vivo identified a signature of pathway inhibition including changes in AKT and p38 phosphorylation and total Bim, IGF1R, AR and YB1 levels. In patient biopsies, prior to treatment with GSK2141795 in a phase 1 clinical trial, this signature was predictive of post-treatment changes in the response marker CA125. Development of this signature represents an opportunity to demonstrate the clinical importance of AKT inhibition for re-sensitisation of platinum resistant ovarian cancer to platinum.

  10. Bipolar disorder: The importance of clinical assessment in identifying prognostic factors - An Audit. Part 3: A comparison between Italian and English mental health services and a survey of bipolar disorder.

    Science.gov (United States)

    Verdolini, Norma; Dean, Jonathon; Massucci, Giampaolo; Elisei, Sandro; Quartesan, Roberto; Zaman, Rashid; Agius, Mark

    2014-11-01

    Most of the prognostic factors of bipolar disorder, which determine disease course and outcome, could be detected from simple but often-unrecorded questions asked during the psychiatric clinic assessments. In previous parts of this research, we analysed various prognostic factors and focused on mixed states and rapid cycling subsets. We now compare our sample in England with a small sample from Italy to demonstrate the utility of focused prognostic questioning and of international comparison. We collected data from the clinical notes of 70 English bipolar and 8 Italian bipolar outpatients seen at the initial psychiatric assessment clinic about socio-demographic and clinical factors to determine whether various factors had relevance to prevalence, prognosis, or outcome. The sample comprised 16 bipolar I (22.9%) and 54 bipolar II (77.1%) English outpatients and 7 bipolar I (87.5%) and 1 bipolar II (12.5%) Italian outpatients. Differences between the groups are seen mainly in terms of age of onset, duration of both depressive and hypomanic episodes, presence of psychiatric family history, incidence of mixed state features and rapid cycling, presence of elated mood in response to past antidepressant treatment, and misuse of illicit drugs and alcohol. In order to promote improved mental health primary care, mental health systems in all countries should develop standardized epidemiological tools that are shared between countries. We recommend the use of a questionnaire that reminds clinicians of potentially prognostic information and suggest that this might identify important components of a potential standardized diagnostic and prognostic tool.

  11. Achieving excellence on shift through teamwork

    International Nuclear Information System (INIS)

    Newman, L.

    1988-01-01

    Anyone familiar with the nuclear industry realizes the importance of operators. Operators can achieve error-free plant operations, i.e., excellence on shift through teamwork. As a shift supervisor (senior reactor operator/shift technical advisor) the author went through the plant's first cycle of operations with no scrams and no equipment damaged by operator error, having since changed roles (and companies) to one of assessing plant operations. This change has provided the opportunity to see objectively the importance of operators working together and of the team building and teamwork that contribute to the shift's success. This paper uses examples to show the effectiveness of working together and outlines steps for building a group of operators into a team

  12. Examining the Conservative Shift from Harsh Justice

    Directory of Open Access Journals (Sweden)

    Joycelyn Pollock

    2015-03-01

    Full Text Available Recently, a political shift has been observed, in that some political conservatives are now advocating, adjusting, or abandoning draconian drug laws, including mandatory minimums, and funding diversion, re-entry, and drug programs. Vocal proponents of this movement include Grover Norquist, Rand Paul, Edwin Meese, and Mark Levin, from the Texas Public Policy Council. Any movement away from the mass incarceration that has characterized the U.S. correctional policy for the last 30 years is welcomed; however, it is important to note carefully the philosophical foundation of the conservative’s interest in shifting correctional policy. This paper explores the potential factors contributing to this philosophical shift.

  13. Mechanical spectral shift reactor

    International Nuclear Information System (INIS)

    Sherwood, D.G.; Wilson, J.F.; Salton, R.B.; Fensterer, H.F.

    1981-01-01

    A mechanical spectral shift reactor comprises apparatus for inserting and withdrawing water displacer elements from the reactor core for selectively changing the water-moderator volume in the core thereby changing the reactivity of the core. The apparatus includes drivemechanisms for moving the displacer elements relative to the core and guide mechanisms for guiding the displayer rods through the reactor vessel

  14. Mechanical spectral shift reactor

    International Nuclear Information System (INIS)

    Sherwood, D.G.; Wilson, J.F.; Salton, R.B.; Fensterer, H.F.

    1982-01-01

    A mechanical spectral shift reactor comprises apparatus for inserting and withdrawing water displacer elements from the reactor core for selectively changing the water-moderator volume in the core thereby changing the reactivity of the core. The apparatus includes drive mechanisms for moving the displacer elements relative to the core and guide mechanisms for guiding the displacer rods through the reactor vessel. (author)

  15. Influences on Dietary Choices during Day versus Night Shift in Shift Workers: A Mixed Methods Study

    Science.gov (United States)

    Bonnell, Emily K.; Huggins, Catherine E.; Huggins, Chris T.; McCaffrey, Tracy A.; Palermo, Claire; Bonham, Maxine P.

    2017-01-01

    Shift work is associated with diet-related chronic conditions such as obesity and cardiovascular disease. This study aimed to explore factors influencing food choice and dietary intake in shift workers. A fixed mixed method study design was undertaken on a convenience sample of firefighters who continually work a rotating roster. Six focus groups (n = 41) were conducted to establish factors affecting dietary intake whilst at work. Dietary intake was assessed using repeated 24 h dietary recalls (n = 19). Interviews were audio recorded, transcribed verbatim, and interpreted using thematic analysis. Dietary data were entered into FoodWorks and analysed using Wilcoxon signed-rank test; p shift schedule; attitudes and decisions of co-workers; time and accessibility; and knowledge of the relationship between food and health. Participants reported consuming more discretionary foods and limited availability of healthy food choices on night shift. Energy intakes (kJ/day) did not differ between days that included a day or night shift but greater energy density (EDenergy, kJ/g/day) of the diet was observed on night shift compared with day shift. This study has identified a number of dietary-specific shift-related factors that may contribute to an increase in unhealthy behaviours in a shift-working population. Given the increased risk of developing chronic diseases, organisational change to support workers in this environment is warranted. PMID:28245625

  16. Shifting currents: Progress, setbacks, and shifts in policy and practice

    Science.gov (United States)

    ,; Dunning, Charles; Robertson, Dale M.

    2016-01-01

    The Wisconsin Academy’s initial Waters of Wisconsin project (WOW I) facilitated a statewide conversation between 2000 and 2003 around one main question: How can we ensure healthy aquatic ecosystems and clean, abundant water supplies for tomorrow’s Wisconsin? Robust participation in this conversation underscored the important role citizens have in the stewardship of our waters, and we found enthusiastic support for farsighted policies—based on sound science—to manage our water legacy. Overall, we found that Wisconsinites cherish water and see our waters as essential to our way of life in Wisconsin. Nationally, our state ranks 25th in land area but has the fourth-highest area covered by water. Wisconsin is 20th in population but is second only to Florida in the number of fishing licenses sold each year. Clean water supports billions of dollars’ worth of economic activity through tourism, agriculture, and industry. From the Northwoods cabin to the Port of Milwaukee to the Wisconsin Dells, water shapes our state’s identity. Our tradition of safeguarding Wisconsin’s waters is grounded in values such as responsibility to family and future generations, respect for land and wildlife, protecting public health and safety, and caring for water as a common good, as articulated in the state’s Public Trust Doctrine (see page 9). These deeply held values have also shaped a conservation ethic, and its legacy has served many generations who depend upon and enjoy the waters of the state. Through WOW I, we identified the need to overcome the institutional and disciplinary separation of science, policy, and management protocols through a more integrated approach to water management. WOW also affirmed that the Wisconsin Department of Natural Resources (DNR) and other public agencies play a critical role in sound scientific application, citizen participation, and the practical implementation of policy while balancing public and private interests toward the goal of a

  17. Meaning shift: findings from wellness acupuncture.

    Science.gov (United States)

    Stibich, Mark; Wissow, Lawrence

    2006-01-01

    Wellness or holistic acupuncture places an emphasis on working with and developing the patient's understanding of health and illness. This research project examines changes in meaning in 367 letters from successful wellness acupuncture. Mentions of changes of the meaning of health and illness were categorized into themes using content analysis. Five main meaning shifts were identified in the data. These shifts are (1) from a goal of fixing the problem to a goal of increasing health, (2) from symptoms as problems to symptoms as teachers, (3) from healing as passive to healing as active, (4) from being dominated by illness to moving beyond the illness, and (5) from regarding the practitioner as a technician to regarding the practitioner as a healer or friend. The shifts in meaning seen in the data illustrate a potential pathway for bringing health benefits to patients and may provide a useful strategy for healing. Narrative (defined here as "first-person accounts by respondents of their experience") is thought to play a major role in the manifestation of symptoms and the ability of patients to cope with illness. Patients suffer not only from their primary symptoms, but also from the results and effects of their illnesses, such as depression and changes in their relationships. For the patient, symptoms often hold much meaning beyond physical sensation. A recurrence of symptoms can have other unpleasant results, such as additional trips to doctors, paying for medications, time off from work, not being able to play with children, or changes in relationships with family members. In many cases, the anxiety and depression surrounding the symptoms causes suffering which are greater than the suffering caused by the physical symptoms directly. These factors also change how the ill individual interacts socially, thereby reducing both instrumental and emotional social support, resulting in a downward spiral of suffering. By interacting with narrative, a path to improved health

  18. Isotope shift studies in gadolinium spectra

    International Nuclear Information System (INIS)

    Ahmad, S.A.; Saksena, G.D.; Venugopalan, A.

    1976-01-01

    Isotope shift studies have been carried out in the gadolinium spectrum using a recording Fabry-Perot spectrometer and gadolinium samples enriched in 156 Gd and 160 Gd isotopes. Isotope shifts Δsigma(156-160) have been recorded in 134 lines in the region 3930-4140 A. Some of these lines involve the recently identified even configuration 4f 8 5d6s of Gd I and the newly classified transition 4f 8 6s-4f 8 6p of Gd II. From the isotope shift measurements of lines involving the 4f 8 6s-4f 8 6p transition in Gd II, the isotope shift, ΔT(156-160)=87 mK, has been obtained for the 4f 8 6s configuration. Electronic configurations have been suggested for a number of energy levels and configuration mixing has been pointed out in certain cases. (Auth.)

  19. Mechanical spectral shift reactor

    International Nuclear Information System (INIS)

    Wilson, J.F.; Sherwood, D.G.

    1982-01-01

    A mechanical spectral shift reactor comprises a reactive core having fuel assemblies accommodating both water displacer elements and neutron absorbing control rods for selectively changing the volume of water-moderator in the core. The fuel assemblies with displacer and control rods are arranged in alternating fashion so that one displacer element drive mechanism may move displacer elements in more than one fuel assembly without interfering with the movement of control rods of a corresponding control rod drive mechanisms. (author)

  20. Comparison of sleep disturbances in shift workers and people working with a fixed shift

    Directory of Open Access Journals (Sweden)

    Zohreh Yazdi

    2013-11-01

    Full Text Available Background: Different types of sleep disturbances can have a serious negative effect on a person’s ability, function and overall well-being. One of the most important issues that can result in sleep disturbances are occupational causes, the most important among them is shift work. The objective of this study was to compare the prevalence of sleep disturbances between shift work and non-shift workers. Material and Methods: This study was designed as a case-control study in 196 shift workers and 204 non-shift workers in a textile factory. The data were collected by using a comprehensive questionnaire including Pittsburg Sleep Quality Index questionnaire, Berlin Questionnaire, Epworth Sleepiness Scale, Insomnia Severity Index and Restless Leg Syndrome Questionnaire. Data analyses were carried out using the SPSS software version 13 by student's t-test, Chi square and multiple logistic regressions. Results: The duration of night sleep in shift workers was less than day workers (p<0.001. Prevalence of poor sleep quality and insomnia were higher in shift workers significantly than non shift workers (p<0.001, OR=2.3 95% CI: 1.7-2.9. The most prevalent type of insomnia was problems in initiating sleep (P=0.022, OR=2.2 95% CI: 1.5-3.2. There was no difference in the prevalence of excessive day-time sleepiness, restless leg syndrome, snoring, obstructive sleep apnea and different types of parasomnias between two groups. Conclusion: Reduced length of sleep and higher prevalence of poor sleep quality and insomnia in shift workers emphasizes the importance of serious attention to sleep disorders in shift workers.

  1. Identificando mudanças de regimes sistêmicos em processos econômicos: um procedimento baseado na abordagem de dinâmica de sistemas Identifying systemic regime shifts in economic processes: a procedure based on the system dynamics approach

    Directory of Open Access Journals (Sweden)

    Newton Paulo Bueno

    2013-04-01

    Full Text Available A tese deste trabalho é que as técnicas mais sofisticadas atualmente utilizadas pelos economistas para fazer previsões (métodos não estruturais de previsão, em geral, e modelos de detecção de mudanças de regime, em particular não parecem realmente muito eficazes em prever mudanças radicais de regime como a que ocorreu na economia mundial recentemente. Assim, para aumentar seu grau de acurácia, parece razoável imaginar que tais técnicas devam ser complementadas por abordagens mais holísticas. O objetivo geral deste trabalho é mostrar que a metodologia de dinâmica de sistemas (system dynamics, que permite identificar os ciclos de feedback que comandam a dinâmica de sistemas complexos, parece estar especialmente bem-equipada para se tornar uma dessas abordagens complementares. Pretende-se, especificamente, apresentar um algoritmo sistêmico para identificar processos de mudança de regime como os que ocorrem quando uma economia, após anos de expansão continuada, sofre os efeitos da explosão de uma bolha financeira, como ocorreu recentemente.This paper argues that the sophisticated techniques presently used by economists to forecast macroeconomic variables behavior (non-structural forecasting methods, in general, and regime-switching models, in particular do not seem much effective for anticipating radical regime shifts as recently happened in the world economy. Thus, in order to improve their accuracy, it seems that they should be complemented by more holistic approaches. The general purpose of the paper is to show that the system dynamics methodology, which allows identifying the critical feedback loops that drive complex systems' dynamics, seems to be especially fitted to be one of those complementary approaches. To reach that goal, we present a systemic algorithm which allows identifying regime shift processes as the ones that take place when an economy is hit by the effects of a financial bubble burst.

  2. The shifting beverage landscape.

    Science.gov (United States)

    Storey, Maureen

    2010-04-26

    STOREY, M.L. The shifting beverage landscape. PHYSIOL BEHAV, 2010. - Simultaneous lifestyle changes have occurred in the last few decades, creating an imbalance in energy intake and energy expenditure that has led to overweight and obesity. Trends in the food supply show that total daily calories available per capita increased 28% since 1970. Total energy intake among men and women has also increased dramatically since that time. Some have suggested that intake of beverages has had a disproportional impact on obesity. Data collected by the Beverage Marketing Corporation between 1988-2008 demonstrate that, in reality, fewer calories per ounce are being produced by the beverage industry. Moreover, data from the National Cancer Institute show that soft drink intake represents 5.5% of daily calories. Data from NHANES 1999-2003 vs. 2003-06 may demonstrate a shift in beverage consumption for age/gender groups, ages 6 to>60years. The beverages provided in schools have significantly changed since 2006 when the beverage industry implemented School Beverage Guidelines. This voluntary action has removed full-calorie soft drinks from participating schools across the country. This shift to lower-calorie and smaller-portion beverages in school has led to a significant decrease in total beverage calories in schools. These data support the concept that to prevent and treat obesity, public health efforts should focus on energy balance and that a narrow focus on sweetened beverages is unlikely to have any meaningful impact on this complex problem. Copyright 2010 Elsevier Inc. All rights reserved.

  3. Mechanical spectral shift reactor

    International Nuclear Information System (INIS)

    Doshi, P.K.; George, R.A.; Dollard, W.J.

    1982-01-01

    A mechanical spectral shift arrangement for controlling a nuclear reactor includes a plurality of reactor coolant displacer members which are inserted into a reactor core at the beginning of the core life to reduce the volume of reactor coolant-moderator in the core at start-up. However, as the reactivity of the core declines with fuel depletion, selected displacer members are withdrawn from the core at selected time intervals to increase core moderation at a time when fuel reactivity is declining. (author)

  4. Spectral shift reactor

    International Nuclear Information System (INIS)

    Carlson, W.R.; Piplica, E.J.

    1982-01-01

    A spectral shift pressurized water reactor comprising apparatus for inserting and withdrawing water displacer elements having differing neutron absorbing capabilities for selectively changing the water-moderator volume in the core thereby changing the reactivity of the core. The displacer elements comprise substantially hollow cylindrical low neutron absorbing rods and substantially hollow cylindrical thick walled stainless rods. Since the stainless steel displacer rods have greater neutron absorbing capability, they can effect greater reactivity change per rod. However, by arranging fewer stainless steel displacer rods in a cluster, the reactivity worth of the stainless steel displacer rod cluster can be less than a low neutron absorbing displacer rod cluster. (author)

  5. Influences on Dietary Choices during Day versus Night Shift in Shift Workers: A Mixed Methods Study.

    Science.gov (United States)

    Bonnell, Emily K; Huggins, Catherine E; Huggins, Chris T; McCaffrey, Tracy A; Palermo, Claire; Bonham, Maxine P

    2017-02-26

    Shift work is associated with diet-related chronic conditions such as obesity and cardiovascular disease. This study aimed to explore factors influencing food choice and dietary intake in shift workers. A fixed mixed method study design was undertaken on a convenience sample of firefighters who continually work a rotating roster. Six focus groups ( n = 41) were conducted to establish factors affecting dietary intake whilst at work. Dietary intake was assessed using repeated 24 h dietary recalls ( n = 19). Interviews were audio recorded, transcribed verbatim, and interpreted using thematic analysis. Dietary data were entered into FoodWorks and analysed using Wilcoxon signed-rank test; p night shift. Energy intakes (kJ/day) did not differ between days that included a day or night shift but greater energy density (ED energy , kJ/g/day) of the diet was observed on night shift compared with day shift. This study has identified a number of dietary-specific shift-related factors that may contribute to an increase in unhealthy behaviours in a shift-working population. Given the increased risk of developing chronic diseases, organisational change to support workers in this environment is warranted.

  6. Identical and shifted identical bands

    International Nuclear Information System (INIS)

    Dodder, R.S; Jones, E.F.; Hamilton, J.H.

    1997-01-01

    Spontaneous fission of 252 Cm was studied with 72 large Compton suppressed Ge detectors in Gamma sphere. New isotopes 160 Sm and 162 Gd were identified. Through X-ray-γ and γ-γ-γ) coincidence measurements, level energies were established to spins 14 + to 20 + in 152 , 154 156 60 Nd 92 94 96 , 156 , 158 , 160 62 Sm 94 , 96 , 98 , and 160 , 162 64 Gd 96 , 98 . These nuclei exhibit a remarkable variety of identical bands and bands where the energies and moments of inertia are shifted by the same constant amount for every spin state from 2 + to 12 + for various combinations of nuclei differing by 2n, 4n, 2p, 4p, and α

  7. Repetition and Translation Shifts

    Directory of Open Access Journals (Sweden)

    Simon Zupan

    2006-06-01

    Full Text Available Repetition manifests itself in different ways and at different levels of the text. The first basic type of repetition involves complete recurrences; in which a particular textual feature repeats in its entirety. The second type involves partial recurrences; in which the second repetition of the same textual feature includes certain modifications to the first occurrence. In the article; repetitive patterns in Edgar Allan Poe’s short story “The Fall of the House of Usher” and its Slovene translation; “Konec Usherjeve hiše”; are compared. The author examines different kinds of repetitive patterns. Repetitions are compared at both the micro- and macrostructural levels. As detailed analyses have shown; considerable microstructural translation shifts occur in certain types of repetitive patterns. Since these are not only occasional; sporadic phenomena; but are of a relatively high frequency; they reduce the translated text’s potential for achieving some of the gothic effects. The macrostructural textual property particularly affected by these shifts is the narrator’s experience as described by the narrative; which suffers a reduction in intensity.

  8. Shift Work: Improving Daytime Sleep

    Science.gov (United States)

    ... night. Good daytime sleep is possible, though, if shift work is a necessary part of your work life. ... mayoclinic.org/healthy-lifestyle/adult-health/expert-answers/shift-work/faq-20057991 . Mayo Clinic Footer Legal Conditions and ...

  9. Shift Work Disorder and Mental and Physical Effects of Shift Work

    Directory of Open Access Journals (Sweden)

    Pinar Guzel Ozdemir

    2018-03-01

    Full Text Available With the growing prevalence of shift work all over the the world, the relationship between the daily lives of irregular lifestyles and rhythms is being investigated for those working as shift workers and their families. The effect of shift work on physical and mental health is a very important field of research in recent years. The onset and persistence of medical complications in shift workers includes impaired synchronization between work schedule rhythms and circadian clock. In this context, studies have been carried out showing the increased risk of sleep-wake disorders, gastrointestinal problems, and cardiovascular diseases. There is little information about the actual frequency, effect on health and treatment of shift work disorder, known as circadian rhythm sleep disorder. Shift work disorder includes insomnia and/or excessive sleepiness related with the work schedule. The aim of this rewiev, mentioning about the physical and mental effects of shift work, and to provide information about the diagnosis, clinic and treatment methods of shift-work disorder.

  10. Understanding and controlling chromaticity shift in LED devices

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Lynn; Mills, Karmann; Lamvik, Michael; Perkins, Curtis; Bobashev, Georgiy; Young, Joseph; Yaga, Robert; Johnson, Cortina

    2017-05-30

    Chromaticity shift in light-emitting diode (LED) devices arises from multiple mechanisms, and at least five different chromaticity shift modes (CSMs) have been identified to date. This paper focuses on the impacts of irreversible phosphor degradation as a cause of chromaticity shifts in LED devices. The nitride phosphors used to produce warm white LEDs are especially vulnerable to degradation due to thermal and chemical effects such as reactions with oxygen and water. As a result, LED devices utilizing these phosphors were found to undergo either a green shift or, less commonly, a red shift depending on the phosphor mix in the LED devices. These types of chromaticity shifts are classified as CSM-2 (green shift) and CSM-5 (red shift). This paper provides an overview of the kinetic processes responsible for green and red chromaticity shifts along with examples from accelerated stress testing of 6” downlights. Both CSMs appear to proceed through analogous mechanisms that are initiated at the surface of the phosphor. A green shift is produced by the surface oxidation of the nitride phosphor that changes the emission profile to lower wavelengths. As the surface oxidation reaction proceeds, reactant limitations slow the rate and bulk oxidation processes become more prevalent. We found that a red chromaticity shift arises from quenching of the green phosphor, also possibly due to surface reactions of oxygen, which shift the emission chromaticity in the red direction. In conclusion, we discuss the implications of these findings on projecting chromaticity.

  11. Lanthanide shift reagents, binding, shift mechanisms and exchange

    International Nuclear Information System (INIS)

    Boer, J.W.M. de

    1977-01-01

    Paramagnetic lanthanide shift reagents, when added to a solution of a substrate, induce shifts in the nuclear magnetic resonance (NMR) spectrum of the substrate molecules. The induced shifts contain information about the structure of the shift reagent substrate complex. The structural information, however, may be difficult to extract because of the following effects: (1) different complexes between shift reagent and substrate may be present in solution, e.g. 1:1 and 1:2 complexes, and the shift observed is a weighed average of the shifts of the substrate nuclei in the different complexes; (2) the Fermi contact interaction, arising from the spin density at the nucleus, contributes to the induced shift; (3) chemical exchange effects may complicate the NMR spectrum. In this thesis, the results of an investigation into the influence of these effects on the NMR spectra of solutions containing a substrate and LSR are presented. The equations describing the pseudo contact and the Fermi contact shift are derived. In addition, it is shown how the modified Bloch equations describing the effect of the chemical exchange processes occurring in the systems studied can be reduced to the familiar equations for a two-site exchange case. The binding of mono- and bifunctional ethers to the shift reagent are reported. An analysis of the induced shifts is given. Finally, the results of the experiments performed to study the exchange behavior of dimethoxyethane and heptafluorodimethyloctanedionato ligands are presented

  12. [Sleep disorders among physicians on shift work].

    Science.gov (United States)

    Schlafer, O; Wenzel, V; Högl, B

    2014-11-01

    Sleep disorders in physicians who perform shift work can result in increased risks of health problems that negatively impact performance and patient safety. Even those who cope well with shift work are likely to suffer from sleep disorders. The aim of this manuscript is to discuss possible causes, contributing factors and consequences of sleep disorders in physicians and to identify measures that can improve adaptation to shift work and treatment strategies for shift work-associated sleep disorders. The risk factors that influence the development of sleep disorders in physicians are numerous and include genetic factors (15 % of the population), age (> 50 years), undiagnosed sleep apnea,, alcohol abuse as well as multiple stress factors inherent in clinical duties (including shift work), research, teaching and family obligations. Several studies have reported an increased risk for medical errors in sleep-deprived physicians. Shift workers have an increased risk for psychiatric and cardiovascular diseases and shift work may also be a contributing factor to cancer. A relationship has been reported not only with sleep deprivation and changes in food intake but also with diabetes mellitus, obesity, hypertension and coronary heart disease. Nicotine and alcohol consumption are more frequent among shift workers. Increased sickness and accident rates among physicians when commuting (especially after night shifts) have a socioeconomic impact. In order to reduce fatigue and to improve performance, short naps during shiftwork or naps plus caffeine, have been proposed as coping strategies; however, napping during adverse circadian phases is less effective, if not impossible when unable to fall asleep. Bright and blue light supports alertness during a night shift. After shiftwork, direct sunlight exposure to the retina can be avoided by using dark sunglasses or glasses with orange lenses for commuting home. The home environment for daytime sleeping after a night shift should be

  13. Faktor Dan Penjadualan Shift Kerja

    OpenAIRE

    Maurits, Lientje Setyawati; Widodo, Imam Djati

    2008-01-01

    Work shift has negative effect in physical and mental health, work performance and job accident. Disturbance of circadian rhythms is indicated as source of the problems. This article explores some researches related to the impacts of work shift and establishes basic principles of work shift scheduling that considers human need and limitation.

  14. Isotope shifting capacity of rock

    International Nuclear Information System (INIS)

    Blattner, P.; Department of Scientific and Industrial Research, Lower Hutt

    1980-01-01

    Any oxygen isotope shifted rock volume exactly defines a past throughput of water. An expression is derived that relates the throughput of an open system to the isotope shift of reservoir rock and present-day output. The small isotope shift of Ngawha reservoir rock and the small, high delta oxygen-18 output are best accounted for by a magmatic water source

  15. Ecosystem regime shifts disrupt trophic structure.

    Science.gov (United States)

    Hempson, Tessa N; Graham, Nicholas A J; MacNeil, M Aaron; Hoey, Andrew S; Wilson, Shaun K

    2018-01-01

    Regime shifts between alternative stable ecosystem states are becoming commonplace due to the combined effects of local stressors and global climate change. Alternative states are characterized as substantially different in form and function from pre-disturbance states, disrupting the delivery of ecosystem services and functions. On coral reefs, regime shifts are typically characterized by a change in the benthic composition from coral to macroalgal dominance. Such fundamental shifts in the benthos are anticipated to impact associated fish communities that are reliant on the reef for food and shelter, yet there is limited understanding of how regime shifts propagate through the fish community over time, relative to initial or recovery conditions. This study addresses this knowledge gap using long-term data of coral reef regime shifts and recovery on Seychelles reefs following the 1998 mass bleaching event. It shows how trophic structure of the reef fish community becomes increasingly dissimilar between alternative reef ecosystem states (regime-shifted vs. recovering) with time since disturbance. Regime-shifted reefs developed a concave trophic structure, with increased biomass in base trophic levels as herbivorous species benefitted from increased algal resources. Mid trophic level species, including specialists such as corallivores, declined with loss of coral habitat, while biomass was retained in upper trophic levels by large-bodied, generalist invertivores. Recovering reefs also experienced an initial decline in mid trophic level biomass, but moved toward a bottom-heavy pyramid shape, with a wide range of feeding groups (e.g., planktivores, corallivores, omnivores) represented at mid trophic levels. Given the importance of coral reef fishes in maintaining the ecological function of coral reef ecosystems and their associated fisheries, understanding the effects of regime shifts on these communities is essential to inform decisions that enhance ecological

  16. Steady State Shift Damage Localization

    DEFF Research Database (Denmark)

    Sekjær, Claus; Bull, Thomas; Markvart, Morten Kusk

    2017-01-01

    The steady state shift damage localization (S3DL) method localizes structural deterioration, manifested as either a mass or stiffness perturbation, by interrogating the damage-induced change in the steady state vibration response with damage patterns cast from a theoretical model. Damage is, thus...... the required accuracy when examining complex structures, an extensive amount of degrees of freedom (DOF) must often be utilized. Since the interrogation matrix for each damage pattern depends on the size of the system matrices constituting the FE-model, the computational time quickly becomes of first......-order importance. The present paper investigates two sub-structuring approaches, in which the idea is to employ Craig-Bampton super-elements to reduce the amount of interrogation distributions while still providing an acceptable localization resolution. The first approach operates on a strict super-element level...

  17. The shift in windpower

    International Nuclear Information System (INIS)

    Gipe, P.

    1992-01-01

    Despite new production records, the near-term market for new windpower projects in the US remains bleak. Congressional incentives and project proposals in the mid-1990s offer promise, but for now most development has shifted to Europe. During 1992 and 1993 the largest wind projects developed by US companies will not be in the US, but in the United Kingdom and Spain. Indeed, most of the US's windpower industry is going abroad, establishing offices overseas. This move toward Europe comes as little surprise. New project development for US firms has faltered at home while the European market has burgeoned. The topics of the article include the move to Europe, a reduction in California's share of producing wind power plants, a rise in Europe's share of producing wind power plants, the future market for wind power in the US, and reawakening California's market

  18. Optimal coal import strategy

    International Nuclear Information System (INIS)

    Chen, C.Y.; Shih, L.H.

    1992-01-01

    Recently, the main power company in Taiwan has shifted the primary energy resource from oil to coal and tried to diversify the coal supply from various sources. The company wants to have the imported coal meet the environmental standards and operation requirements as well as to have high heating value. In order to achieve these objectives, establishment of a coal blending system for Taiwan is necessary. A mathematical model using mixed integer programming technique is used to model the import strategy and the blending system. 6 refs., 1 tab

  19. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  20. Cancer research in need of a scientific revolution: Using 'paradigm shift' as a method of investigation.

    Science.gov (United States)

    Wion, Didier; Appaix, Florence; Burruss, Meriwether; Berger, Francois; van der Sanden, Boudewijn

    2015-09-01

    Despite important human and financial resources and considerable accumulation of scientific publications, patents, and clinical trials, cancer research has been slow in achieving a therapeutic revolution similar to the one that occurred in the last century for infectious diseases. It has been proposed that science proceeds not only by accumulating data but also through paradigm shifts. Here, we propose to use the concept of 'paradigm shift' as a method of investigation when dominant paradigms fail to achieve their promises. The first step in using the 'paradigm shift' method in cancer research requires identifying its founding paradigms. In this review, two of these founding paradigms will be discussed: (i) the reification of cancer as a tumour mass and (ii) the translation of the concepts issued from infectious disease in cancer research. We show how these founding paradigms can generate biases that lead to over-diagnosis and over-treatment and also hamper the development of curative cancer therapies. We apply the 'paradigm shift' method to produce perspective reversals consistent with current experimental evidence. The 'paradigm shift' method enlightens the existence of a tumour physiologic-prophylactic-pathologic continuum. It integrates the target/antitarget concept and that cancer is also an extracellular disease. The 'paradigm shift' method has immediate implications for cancer prevention and therapy. It could be a general method of investigation for other diseases awaiting therapy.

  1. Education and training of the shift technical advisor

    International Nuclear Information System (INIS)

    Thomas, E.L.

    1981-01-01

    This paper discusses the background and current approaches for qualifying the required position of Shift Technical Advisor (STA). Industry positions regarding the regulation are given. Problems associated with meeting the requirement are identified, along with a discussion of other alternatives for upgrading the education level of shift management. Inherent in the discussion is the conclusion that voluntary improvements in the training and education of shift management personnel are more effective than mandatory positions or degree requirements

  2. IMPORTANT NOTIFICATION

    CERN Multimedia

    HR Department

    2009-01-01

    Green plates, removals and importation of personal effects Please note that, as from 1 April 2009, formalities relating to K and CD special series French vehicle plates (green plates), removals and importation of personal effects into France and Switzerland will be dealt with by GS Department (Building 73/3-014, tel. 73683/74407). Importation and purchase of tax-free vehicles in Switzerland, as well as diplomatic privileges, will continue to be dealt with by the Installation Service of HR Department (Building 33/1-011, tel. 73962). HR and GS Departments

  3. Using Matrix-Assisted Laser Desorption Ionization-Time of Flight (MALDI-TOF) Complemented with Selected 16S rRNA and gyrB Genes Sequencing to Practically Identify Clinical Important Viridans Group Streptococci (VGS).

    Science.gov (United States)

    Zhou, Menglan; Yang, Qiwen; Kudinha, Timothy; Zhang, Li; Xiao, Meng; Kong, Fanrong; Zhao, Yupei; Xu, Ying-Chun

    2016-01-01

    There are challenges in viridans group streptococci (VGS) identification especially for the mitis group. Few studies have investigated the performance of MALDI-TOF MS system in VGS identification. Using 16S rRNA gene and gyrB gene sequencing as a gold standard, the performance of two MALDI-TOF MS instruments in the identification of 181 VGS clinical isolates was studied. The Bruker Biotyper and Vitek MS IVD systems correctly identified 88.4% and 98.9% of the 181 isolates, respectively. The Vitek MS RUO system was the least reliable, only correctly identifying 38.7% of the isolates to species level with several misidentifications and invalid results. The Bruker Biotyper system was very unreliable in the identification of species within the mitis group. Among 22 non-pneumococci isolates (S. mitis/S. oralis/S. pseudopneumoniae), Biotyper misidentified 21 of them as S. pneumoniae leading to a low sensitivity and low positive predictive value in these species. In contrast, the Vitek MS IVD demonstrated a better resolution for pneumococci and non-pneumococci despite the inability to distinguish between S. mitis/S. oralis. For more accurate species-level identification, further improvements in the VGS spectra databases are needed. Based on MALDI-TOF analysis and selected 16S rRNA gene plus gyrB genes sequencing, we designed a practical VGS identification algorithm.

  4. Chemical shift imaging: a review

    International Nuclear Information System (INIS)

    Brateman, L.

    1986-01-01

    Chemical shift is the phenomenon that is seen when an isotope possessing a nuclear magnetic dipole moment resonates at a spectrum of resonance frequencies in a given magnetic field. These resonance frequencies, or chemical shifts, depend on the chemical environments of particular nuclei. Mapping the spatial distribution of nuclei associated with a particular chemical shift (e.g., hydrogen nuclei associated with water molecules or with lipid groups) is called chemical shift imaging. Several techniques of proton chemical shift imaging that have been applied in vivo are presented, and their clinical findings are reported and summarized. Acquiring high-resolution spectra for large numbers of volume elements in two or three dimensions may be prohibitive because of time constraints, but other methods of imaging lipid of water distributions (i.e., selective excitation, selective saturation, or variations in conventional magnetic resonance imaging pulse sequences) can provide chemical shift information. These techniques require less time, but they lack spectral information. Since fat deposition seen by chemical shift imaging may not be demonstrated by conventional magnetic resonance imaging, certain applications of chemical shift imaging, such as in the determination of fatty liver disease, have greater diagnostic utility than conventional magnetic resonance imaging. Furthermore, edge artifacts caused by chemical shift effects can be eliminated by certain selective methods of data acquisition employed in chemical shift imaging

  5. Shift work--problems and its impact on female nurses in Udaipur, Rajasthan India.

    Science.gov (United States)

    Rathore, H; Shukla, K; Singh, S; Tiwari, G

    2012-01-01

    Abstract : There is good evidence that shift work has negative effects on workers health, safety and performance. It is quite appropriate that attention is paid to this very important feature of socio-technical systems, which may adversely affect mental and physical health, social life and safety of shift workers. Research into the impact of shift work on professionals has consistently identified a range of negative outcomes in physical, psychological, and social domains (Akerstedt, 1988; Costa, Lievore, Casaletti, Gaffuri, & Folkard, 1989; Kogi, 2005; Paley & Tepas, 1994). Hospitals, the biggest employer in the health care field, employ more night shift workers than any other industry. It can therefore be inferred that in medical domain high percentage of workforce may be affected by problems related to shift work. Thus the present study will provide knowledge base for the problems faced by the female nurses. The present study was undertaken with an objective of getting an insight into the problems faced by female nurses in shift work. . It was found that the female nurses in India worked on roaster pattern of change in shift every seven days. They did not have a say in the change of duties, it could only be done on mutual grounds. Partners of younger group did not much adjust to their shift pattern this created stress among the nurses.The results showed that the female nurses in both the age groups i.e. 30-45 years and 45-60 years faced many problems related to health and well being, fatigue, social and domestic situations. They could not give much time to their children in particular. Travelling in nights was risky for them. Common problem was the insufficient sleep during night shifts. The nurses had to cater to the needs of the family, children in particular along with the adjustments to be made due to shift work. They had to sometimes do the night duties and attend social functions as a part of their duty. Children and husband in some cases did not cooperate

  6. Competition for FDI and Profit Shifting

    DEFF Research Database (Denmark)

    Ma, Jie; Raimondos-Møller, Pascalis

    When countries compete for the location of a new multinational plant they need to be aware of the profit shifting opportunities this new plant creates for the global multinational firm. By modelling explicitly the multinational’s intra-firm transactions, we show that the home market advantage...... that large countries have due to their size will be counteracted by such profit shifting opportunities. As a result of this, large countries will not be able to capitalize on their size and sustain high corporate taxes. We show that, on the basis of these profit shifting opportunities, a small country can...... easily win the location game ahead of a large country. How lenient the small country is in implementing transfer pricing regulations turns out to be an important variable in such location games....

  7. Scandinavian Object Shift and Optimality Theory

    DEFF Research Database (Denmark)

    Engels, Eva; Vikner, Sten

    This study presents an account of object shift, a word order phenomenon found in most of the Scandinavian languages where an object occurs unexpectedly to the left and not to the right of a sentential adverbial. The book examines object shift across many of the Scandinavian languages and dialects...... and original observations, this book is an important addition to the fields of phonology, optimality theory and theoretical syntax......., and analyses the variation, for example whether object shift is optional or obligatory, whether it applies only to pronouns or other objects as well, and whether it applies to adverbials. The authors show that optimality theory, traditionally used in phonology, is a useful framework for accounting...

  8. Researching Style: Epistemology, Paradigm Shifts and Research Interest Groups

    Science.gov (United States)

    Rayner, Stephen

    2011-01-01

    This paper identifies the need for a deliberate approach to theory building in the context of researching cognitive and learning style differences in human performance. A case for paradigm shift and a focus upon research epistemology is presented, building upon a recent critique of style research. A proposal for creating paradigm shift is made,…

  9. Written Language Shift among Norwegian Youth

    Directory of Open Access Journals (Sweden)

    Kamil ÖZERK

    2013-07-01

    Full Text Available In Norway there are two written Norwegian languages, Bokmål and Nynorsk. Of these two written languages Bokmål is being used by the majority of the people, and Bokmål has the highest prestige in the society. This article is about the shift of written language from Nynorsk to Bokmål among young people in a traditional Nynorsk district in the country. Drawing on empirical data we conclude that many adolescents are experiencing written language shift. We discuss various reasons for this phenomenon in the linguistic landscape of Norway. In our discussions we emphasize the importance of the school with regard to language maintenance and language revitalization. We call for a new language policy in the educational system that can prevent language shift. Having several dialects and two officially written forms of Norwegian in the country, creates a special linguistic landscape in Norway. Despite the fact that the Norwegian language situation is in several ways unique, it’s done very little research on how the existing policy works in practice. Our research reveals that the existing language policy and practice in the school system is not powerful enough to prevent language shift and language decay among the youngsters. The school system functions like a fabric for language shift.

  10. Staffing, overtime, and shift scheduling project

    International Nuclear Information System (INIS)

    Lewis, P.M.

    1989-01-01

    Recent events at the Peach Bottom nuclear power plant have demonstrated the need to establish a quantifiable basis for assessing the safety significance of long work hours on nuclear power plant operators. The incidents at TMI-2, Chernobyl, and Bhopal, which all occurred during the late evening/night shift, further highlight the importance of the relationship between shift scheduling and performance. The objective of this project is to estimate, using statistical analysis on data from the nuclear industry, the effects on safety of staffing levels, overtime, and shift scheduling for operators and maintenance personnel. Regarding staffing levels, the Nuclear Regulatory Commission (NRC) currently has no explicit regulation concerning the minimum acceptable levels of staffing in a plant that has an operating license. The NRC has no systematic method for collecting data on the number of licensed operators on the operating crews. In 1982 the NRC recommended that plants write into their technical specifications a model policy on overtime. Currently, 77 nuclear power plant units have the model policy or a modification of it written into their technical specifications; 33 units have no policy on overtime. The model policy sets limits on overtime for safety related personnel, although these limits can be exceeded with plant manger approval. The US nuclear power industry has three types of shift schedules: (1) forward-rotating 8-hour/day shift schedules, (2) backward-rotating 8-hour/day schedules, and (3) 12-hour/day schedules

  11. Dark refraction shift with allowance for astigmatism

    Directory of Open Access Journals (Sweden)

    W.D.H. Gillan

    2005-12-01

    Full Text Available Purpose: To show that the dark refraction shift (dark focus is a more complicated phenomenon than implied when presented as spherical. Methods: Fifty autorefractor measurements of refractive state of the right eye were obtained in light  and  dark  conditions.  Multivariate  methods were used to analyze the data and stereo-pair scat-ter plots, polar meridional profiles and other means of presenting results are used to show important characteristics of the dark refraction shift. Results: The complexity of the dark refrac-tion shift is indicated by stereo-pair scatter plots showing the amount of stigmatic and antistigmatic variation that occurs in light and dark conditions. The mean dark refraction shift is presented in a complete manner including all three components of refractive state. The greater variance and covari-ance under dark conditions is clearly shown by the term-by-term dark-light variance-covariance ratio and polar profiles  of variance and covariance.Conclusions: The  dark  refraction  shift  is  a more complicated phenomenon than implied by representations as purely spherical in nature.

  12. Associations Among Rotating Night Shift Work, Sleep, and Skin Cancer in Nurses’ Health Study II Participants

    Science.gov (United States)

    Heckman, Carolyn J.; Kloss, Jacqueline D.; Feskanich, Diane; Culnan, Elizabeth; Schernhammer, Eva S.

    2016-01-01

    Background Night shift work and sleep duration have been associated with breast and other cancers. Results from the few prior studies of night shift work and skin cancer risk have been mixed and not fully accounted for other potentially important health-related variables (e.g., sleep characteristics). This study evaluated the relationship between rotating night shift work and skin cancer risk and included additional skin cancer risk factors and sleep-related variables. Methods The current study used data from 74,323 Nurses’ Health Study (NHS) II participants. Cox proportional hazards models were used to estimate multivariable-adjusted hazard ratios (HRs) and 95% confidence intervals (CIs) for skin cancers across categories of shift work and sleep duration. Results Over 10 years of follow-up, 4308 BCC, 334 SCC and 212 melanoma cases were identified. Longer duration of rotating night shifts was associated with a linear decline in risk of BCC (HR=0.93, 95% CI: 0.90-0.97 per 5-year increase). Shift work was not significantly associated with either melanoma (HR=1.02, 95% CI: 0.86-1.21) or SCC (HR=0.92, 95% CI: 0.80-1.06). A short sleep duration (≤6 hours per day) was associated with lower risks of melanoma (HR=0.68, 95% CI: 0.46-0.98) and BCC (HR=0.93, 95% CI: 0.86-1.00) compared with the most common report of 7 hours. SCC was not associated with duration of sleep (HR=0.94, 95% CI: 0.83-1.06). Conclusions Longer duration of rotating night shift work and shorter sleep duration were associated with lower risk of some skin cancers. Further research is needed to confirm and identify the mechanisms underlying these associations. PMID:27663986

  13. Problems with the use of line shifts in plasmas

    International Nuclear Information System (INIS)

    Alexiou, Spiros

    2003-01-01

    In this work a nonperturbative semiclassical treatment with proper account of penetrating collisions and monopoles is used to illustrate the relative importance of penetration, close collisions and monopoles to the line shift. The main result of this work is that shifts are very sensitive, not linear in the density and even the sign of shifts may be affected by fairly fine effects, such as small deviations from thermal behavior

  14. Assessment of the pivot shift using inertial sensors

    OpenAIRE

    Zaffagnini, Stefano; Signorelli, Cecilia; Grassi, Alberto; Yue, Han; Raggi, Federico; Urrizola, Francisco; Bonanzinga, Tommaso; Marcacci, Maurilio

    2016-01-01

    The pivot shift test is an important clinical tool used to assess the stability of the knee following an injury to the anterior cruciate ligament (ACL). Previous studies have shown that significant variability exists in the performance and interpretation of this manoeuvre. Accordingly, a variety of techniques aimed at standardizing and quantifying the pivot shift test have been developed. In recent years, inertial sensors have been used to measure the kinematics of the pivot shift. The goal o...

  15. Shifted-modified Chebyshev filters

    OpenAIRE

    ŞENGÜL, Metin

    2013-01-01

    This paper introduces a new type of filter approximation method that utilizes shifted-modified Chebyshev filters. Construction of the new filters involves the use of shifted-modified Chebyshev polynomials that are formed using the roots of conventional Chebyshev polynomials. The study also includes 2 tables containing the shifted-modified Chebyshev polynomials and the normalized element values for the low-pass prototype filters up to degree 6. The transducer power gain, group dela...

  16. Portable shift register

    International Nuclear Information System (INIS)

    Halbig, J.K.; Bourret, S.C.; Hansen, W.J.; Hicks, D.V.; Klosterbuer, S.F.; Krick, M.S.

    1994-01-01

    An electronics package for a small, battery-operated, self-contained, neutron coincidence counter based on a portable shift-register (PSR) has been developed. The counter was developed for applications not adequately addressed by commercial packages, including in-plant measurements to demonstrate compliance with regulations (domestic and international), in-plant process control, and in-field measurements (environmental monitoring or safeguards). Our package's features, which address these applications, include the following: Small size for portability and ease of installation;battery or mains operation; a built-in battery to power the unit and a typical detector such as a small sample counter, for over 6 h if power lines are bad or noisy, if there is a temporary absence of power, or if portability is desired; complete support, including bias, for standard neutron detectors; a powerful communications package to easily facilitate robust external control over a serial port; and a C-library to simplify creating external control programs in computers or other controllers. Whereas the PSR specifically addresses the applications mentioned above, it also performs all the measurements made by previous electronics packages for neutron coincidence counters developed at Los Alamos and commercialized. The PSR electronics package, exclusive of carrying handle, is 8 by 10 by 20 cm; it contains the circuit boards, battery, and bias supply and weighs less than 2 kg. This instrument package is the second in an emerging family of portable measurement instruments being developed; the first was the Miniature and Modular Multichannel Analyzer (M 3 CA). The PSR makes extensive use of hardware and software developed for the M 3 CA; like the M 3 CA, it is intended primarily for use with an external controller interfaced over a serial channel

  17. Shorter Versus Longer Shift Durations to Mitigate Fatigue and Fatigue-Related Risks in Emergency Medical Services Personnel and Related Shift Workers: A Systematic Review

    Science.gov (United States)

    2018-01-11

    Background: This study comprehensively reviewed the literature on the impact of shorter versus longer shifts on critical and important outcomes for Emergency Medical Services (EMS) personnel and related shift worker groups. Methods: Six databases (e....

  18. Quantized beam shifts in graphene

    Energy Technology Data Exchange (ETDEWEB)

    de Melo Kort-Kamp, Wilton Junior [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Sinitsyn, Nikolai [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Dalvit, Diego Alejandro Roberto [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-10-08

    We predict the existence of quantized Imbert-Fedorov, Goos-Hanchen, and photonic spin Hall shifts for light beams impinging on a graphene-on-substrate system in an external magnetic field. In the quantum Hall regime the Imbert-Fedorov and photonic spin Hall shifts are quantized in integer multiples of the fine structure constant α, while the Goos-Hanchen ones in multiples of α2. We investigate the influence on these shifts of magnetic field, temperature, and material dispersion and dissipation. An experimental demonstration of quantized beam shifts could be achieved at terahertz frequencies for moderate values of the magnetic field.

  19. Importance classification

    International Nuclear Information System (INIS)

    Mizumachi, Wataru; Kobayashi, Masahide

    2008-01-01

    Conventionally, the design of a nuclear reactor has been performed from a viewpoint of a safety function and the importance on earthquake-proof on the basis of not giving off the mainly included radioactivity outside. In this Niigataken-Chuetsuoki earthquake, there is almost no damage to the system, components and structure on safe also in the earthquake beyond assumption, and the validity of the design was checked. But, the situation peculiar to a big earthquake was also generated. The emergency plan room which should serve as a connection center with the exterior was not able to open a door and use at the beginning. Fire-extinguishing system piping fractured and self-defense fire fighting was not made. And so on. Discussion from the following three viewpoints was performed. 1st: The importance from a viewpoint which should maintain a function also with the disaster in case of an earthquake like an emergency plan room etc. 2nd: In the earthquake, since the safe system and un-safe system was influenced, the importance from a viewpoint which may have influence safely inquired when the un-safe system broke down. 3rd: Although it was not directly related safely, discussion from a viewpoint which influences fear of insecurity, such as taking out smoke, for example, was performed (author)

  20. Metabolic syndrome in fixed-shift workers.

    Science.gov (United States)

    Canuto, Raquel; Pattussi, Marcos Pascoal; Macagnan, Jamile Block Araldi; Henn, Ruth Liane; Olinto, Maria Teresa Anselmo

    2015-01-01

    OBJECTIVE To analyze if metabolic syndrome and its altered components are associated with demographic, socioeconomic and behavioral factors in fixed-shift workers. METHODS A cross-sectional study was conducted on a sample of 902 shift workers of both sexes in a poultry processing plant in Southern Brazil in 2010. The diagnosis of metabolic syndrome was determined according to the recommendations from Harmonizing the Metabolic Syndrome. Its frequency was evaluated according to the demographic (sex, skin color, age and marital status), socioeconomic (educational level, income and work shift), and behavioral characteristics (smoking, alcohol intake, leisure time physical activity, number of meals and sleep duration) of the sample. The multivariate analysis followed a theoretical framework for identifying metabolic syndrome in fixed-shift workers. RESULTS The prevalence of metabolic syndrome in the sample was 9.3% (95%CI 7.4;11.2). The most frequently altered component was waist circumference (PR 48.4%; 95%CI 45.5;51.2), followed by high-density lipoprotein. Work shift was not associated with metabolic syndrome and its altered components. After adjustment, the prevalence of metabolic syndrome was positively associated with women (PR 2.16; 95%CI 1.28;3.64), workers aged over 40 years (PR 3.90; 95%CI 1.78;8.93) and those who reported sleeping five hours or less per day (PR 1.70; 95%CI 1.09;2.24). On the other hand, metabolic syndrome was inversely associated with educational level and having more than three meals per day (PR 0.43; 95%CI 0.26;0.73). CONCLUSIONS Being female, older and deprived of sleep are probable risk factors for metabolic syndrome, whereas higher educational level and higher number of meals per day are protective factors for metabolic syndrome in fixed-shift workers.

  1. Metabolic syndrome in fixed-shift workers

    Directory of Open Access Journals (Sweden)

    Raquel Canuto

    2015-01-01

    Full Text Available OBJECTIVE To analyze if metabolic syndrome and its altered components are associated with demographic, socioeconomic and behavioral factors in fixed-shift workers. METHODS A cross-sectional study was conducted on a sample of 902 shift workers of both sexes in a poultry processing plant in Southern Brazil in 2010. The diagnosis of metabolic syndrome was determined according to the recommendations from Harmonizing the Metabolic Syndrome. Its frequency was evaluated according to the demographic (sex, skin color, age and marital status, socioeconomic (educational level, income and work shift, and behavioral characteristics (smoking, alcohol intake, leisure time physical activity, number of meals and sleep duration of the sample. The multivariate analysis followed a theoretical framework for identifying metabolic syndrome in fixed-shift workers. RESULTS The prevalence of metabolic syndrome in the sample was 9.3% (95%CI 7.4;11.2. The most frequently altered component was waist circumference (PR 48.4%; 95%CI 45.5;51.2, followed by high-density lipoprotein. Work shift was not associated with metabolic syndrome and its altered components. After adjustment, the prevalence of metabolic syndrome was positively associated with women (PR 2.16; 95%CI 1.28;3.64, workers aged over 40 years (PR 3.90; 95%CI 1.78;8.93 and those who reported sleeping five hours or less per day (PR 1.70; 95%CI 1.09;2.24. On the other hand, metabolic syndrome was inversely associated with educational level and having more than three meals per day (PR 0.43; 95%CI 0.26;0.73. CONCLUSIONS Being female, older and deprived of sleep are probable risk factors for metabolic syndrome, whereas higher educational level and higher number of meals per day are protective factors for metabolic syndrome in fixed-shift workers.

  2. The androgen receptor malignancy shift in prostate cancer.

    Science.gov (United States)

    Copeland, Ben T; Pal, Sumanta K; Bolton, Eric C; Jones, Jeremy O

    2018-05-01

    Androgens and the androgen receptor (AR) are necessary for the development, function, and homeostatic growth regulation of the prostate gland. However, once prostate cells are transformed, the AR is necessary for the proliferation and survival of the malignant cells. This change in AR function appears to occur in nearly every prostate cancer. We have termed this the AR malignancy shift. In this review, we summarize the current knowledge of the AR malignancy shift, including the DNA-binding patterns that define the shift, the transcriptome changes associated with the shift, the putative drivers of the shift, and its clinical implications. In benign prostate epithelial cells, the AR primarily binds consensus AR binding sites. In carcinoma cells, the AR cistrome is dramatically altered, as the AR associates with FOXA1 and HOXB13 motifs, among others. This shift leads to the transcription of genes associated with a malignant phenotype. In model systems, some mutations commonly found in localized prostate cancer can alter the AR cistrome, consistent with the AR malignancy shift. Current evidence suggests that the AR malignancy shift is necessary but not sufficient for transformation of prostate epithelial cells. Reinterpretation of prostate cancer genomic classification systems in light of the AR malignancy shift may improve our ability to predict clinical outcomes and treat patients appropriately. Identifying and targeting the molecular factors that contribute to the AR malignancy shift is not trivial but by doing so, we may be able to develop new strategies for the treatment or prevention of prostate cancer. © 2018 Wiley Periodicals, Inc.

  3. Empirical isotropic chemical shift surfaces

    International Nuclear Information System (INIS)

    Czinki, Eszter; Csaszar, Attila G.

    2007-01-01

    A list of proteins is given for which spatial structures, with a resolution better than 2.5 A, are known from entries in the Protein Data Bank (PDB) and isotropic chemical shift (ICS) values are known from the RefDB database related to the Biological Magnetic Resonance Bank (BMRB) database. The structures chosen provide, with unknown uncertainties, dihedral angles φ and ψ characterizing the backbone structure of the residues. The joint use of experimental ICSs of the same residues within the proteins, again with mostly unknown uncertainties, and ab initio ICS(φ,ψ) surfaces obtained for the model peptides For-(l-Ala) n -NH 2 , with n = 1, 3, and 5, resulted in so-called empirical ICS(φ,ψ) surfaces for all major nuclei of the 20 naturally occurring α-amino acids. Out of the many empirical surfaces determined, it is the 13C α ICS(φ,ψ) surface which seems to be most promising for identifying major secondary structure types, α-helix, β-strand, left-handed helix (α D ), and polyproline-II. Detailed tests suggest that Ala is a good model for many naturally occurring α-amino acids. Two-dimensional empirical 13C α - 1 H α ICS(φ,ψ) correlation plots, obtained so far only from computations on small peptide models, suggest the utility of the experimental information contained therein and thus they should provide useful constraints for structure determinations of proteins

  4. A Shift in Emphasis: Comments on CAE's New Mission Statement

    Science.gov (United States)

    Anderson-Levitt, Kathryn M.

    2007-01-01

    In a presidential address prepared for the 2006 Council on Anthropology and Education (CAE) meeting, I argue that the new mission statement for CAE represents not a new direction for the organization, but simply a shift in emphasis, albeit an important and timely shift.

  5. Thoughts on identifiers

    CERN Multimedia

    CERN. Geneva

    2005-01-01

    As business processes and information transactions have become an inextricably intertwined with the Web, the importance of assignment, registration, discovery, and maintenance of identifiers has increased. In spite of this, integrated frameworks for managing identifiers have been slow to emerge. Instead, identification systems arise (quite naturally) from immediate business needs without consideration for how they fit into larger information architectures. In addition, many legacy identifier systems further complicate the landscape, making it difficult for content managers to select and deploy identifier systems that meet both the business case and long term information management objectives. This presentation will outline a model for evaluating identifier applications and the functional requirements of the systems necessary to support them. The model is based on a layered analysis of the characteristics of identifier systems, including: * Functional characteristics * Technology * Policy * Business * Social T...

  6. Flexible Schedules and Shift Work.

    Science.gov (United States)

    Beers, Thomas M.

    2000-01-01

    Flexible work hours have gained prominence, as more than 25 million workers (27.6% of all full-time workers) can now vary their schedules. However, there has been little change since the mid-1980s in the proportion who work a shift other than a regular daytime shift. (JOW)

  7. Restoration of weight-shifting capacity in patients with postacute stroke: a rehabilitation cohort study.

    NARCIS (Netherlands)

    Haart, M. de; Geurts, A.C.H.; Dault, M.C.; Nienhuis, B.; Duysens, J.E.J.

    2005-01-01

    OBJECTIVES: To identify and interrelate recovery characteristics of voluntary weight shifting after stroke and to examine whether the assessment of weight shifting adds information about balance recovery compared with the assessment of quiet standing. DESIGN: Exploratory study using an inception

  8. Restoration of weight-shifting capacity in patients with postacute stroke: a rehabilitation cohort study

    NARCIS (Netherlands)

    de Haart, Mirjam; Geurts, Alexander C.; Dault, Mylène C.; Nienhuis, Bart; Duysens, Jacques

    2005-01-01

    OBJECTIVES: To identify and interrelate recovery characteristics of voluntary weight shifting after stroke and to examine whether the assessment of weight shifting adds information about balance recovery compared with the assessment of quiet standing. DESIGN: Exploratory study using an inception

  9. Unconventional imports

    International Nuclear Information System (INIS)

    Yamaguchi, N.D.

    2001-01-01

    This article focuses on bitumens and bitumen products from Canadian oil sands and explores how they will affect the Canadian oil industry and the US refining industry. The falling production of crude, the growing demand for it, and the stagnating refining capacity in the US are reported, and Canadian and Mexican exports to the US, the definition of bitumens and bitumen quality, and the position of Canada as world leader in bitumen resources are considered. Bitumen production techniques, sales of bitumens and synthetic crude, the production outlook, and the quality and refining of bitumen and synthetic crude are examined. Plots illustrating North American crude refining capacity, production and demand for 1980-2000; US crude imports from Canada and Mexico (1981-2000), world proven oil reserves (2001), world bitumen resources, and Canadian oil production (1998-2000) are provided. Details of the composition of crudes and bitumens, and recent synthetic crude production are tabulated

  10. Understanding regime shifts

    DEFF Research Database (Denmark)

    Heymann, Matthias; Nielsen, Kristian Hvidtfelt

    Wind power was an important power source not only in the preindustrial era but also into the nineteenth and early twentieth century. In most regions by the mid twentieth century the ubiquitous windmill was quickly replaced by alternative power sources, mainly electricity. Efforts to revive wind...... in Denmark proved more successful than heavily funded efforts in the USA, Sweden or Germany. Within few years, Danish wind turbines dominated California wind parks and outclassed the turbines from other producers. Since the 1980s, all successful wind turbine producers copied basic features of “Danish Design...

  11. Rotating shift work associated with obesity in men from northeastern Ontario

    OpenAIRE

    Anne Grundy; Michelle Cotterchio; Victoria A. Kirsh; Victoria Nadalin; Nancy Lightfoot; Nancy Kreiger

    2017-01-01

    Introduction: While some studies have suggested associations between shift work and obesity, few have been population-based or considered multiple shift schedules. Since obesity is linked with several chronic health conditions, understanding which types of shift work influence obesity is important and additional work with more detailed exposure assessment of shift work is warranted. Methods: Using multivariate polytomous logistic regression, we investigated the associations between shift work...

  12. Corporate Profit Shifting and the Multinational Enterprise

    OpenAIRE

    Webber, Stuart

    2012-01-01

    This dissertation analyzes ways in which Multinational Enterprises (MNEs) shift profits from one country to another to reduce their income tax expense. This is an important topic for a number of reasons. From a country’s perspective, its income tax rates and policies can have a significant impact upon its tax revenue, economic competitiveness, and the vibrancy of its economy. From the MNE’s perspective, income tax rates and policies determine a firm’s tax obligations, and thus ...

  13. Shifting Borderland of Technoscience

    DEFF Research Database (Denmark)

    Lindtner, Silvia; Cohn, Marisa; Leahu, Lucian

    2015-01-01

    other how to navigate changing terrains of technology research and design. To maximize in- depth collaboration between junior and senior scholars, we propose a format that includes in-depth mentoring sessions, panel presentations from junior and senior participants, group activities, and working......Since the publication of Phil Agre’s [1] seminal work on critical technical practice, the sites of intersection between computation and society have multiplied, and so too have the sociotechnical borderlands we inhabit. Critical methodologies such as “critical design” [8,6,5], “reflective design...... like big data and social computing pose new challenges. Given the fluidity of the landscape it is important for us to articulate the specificities of our scholarly borderlands. By bringing together junior and senior scholars we aim to provide a forum for researchers in this area to learn from each...

  14. A probabilistic approach for validating protein NMR chemical shift assignments

    International Nuclear Information System (INIS)

    Wang Bowei; Wang, Yunjun; Wishart, David S.

    2010-01-01

    It has been estimated that more than 20% of the proteins in the BMRB are improperly referenced and that about 1% of all chemical shift assignments are mis-assigned. These statistics also reflect the likelihood that any newly assigned protein will have shift assignment or shift referencing errors. The relatively high frequency of these errors continues to be a concern for the biomolecular NMR community. While several programs do exist to detect and/or correct chemical shift mis-referencing or chemical shift mis-assignments, most can only do one, or the other. The one program (SHIFTCOR) that is capable of handling both chemical shift mis-referencing and mis-assignments, requires the 3D structure coordinates of the target protein. Given that chemical shift mis-assignments and chemical shift re-referencing issues should ideally be addressed prior to 3D structure determination, there is a clear need to develop a structure-independent approach. Here, we present a new structure-independent protocol, which is based on using residue-specific and secondary structure-specific chemical shift distributions calculated over small (3-6 residue) fragments to identify mis-assigned resonances. The method is also able to identify and re-reference mis-referenced chemical shift assignments. Comparisons against existing re-referencing or mis-assignment detection programs show that the method is as good or superior to existing approaches. The protocol described here has been implemented into a freely available Java program called 'Probabilistic Approach for protein Nmr Assignment Validation (PANAV)' and as a web server (http://redpoll.pharmacy.ualberta.ca/PANAVhttp://redpoll.pharmacy.ualberta.ca/PANAV) which can be used to validate and/or correct as well as re-reference assigned protein chemical shifts.

  15. Associations of rotational shift work and night shift status with hypertension: a systematic review and meta-analysis.

    Science.gov (United States)

    Manohar, Sandhya; Thongprayoon, Charat; Cheungpasitporn, Wisit; Mao, Michael A; Herrmann, Sandra M

    2017-10-01

    The reported risks of hypertension (HTN) in rotating shift and night shift workers are controversial. The objective of this meta-analysis was to assess the association between shift work status and HTN. A literature search was performed using MEDLINE, EMBASE and Cochrane Database from inception through October 2016. Studies that reported odds ratios (OR) comparing the risk of HTN in shift workers were included. A prespecified subgroup analysis by rotating shift and night shift statuses were also performed. Pooled OR and 95% confidence interval (CI) were calculated using a random-effect, generic inverse variance method. The protocol for this study is registered with International Prospective Register of Systematic Reviews; no. CRD42016051843. Twenty-seven observational studies (nine cohort and 18 cross-sectional studies) with a total of 394 793 individuals were enrolled. The pooled ORs of HTN in shift workers in cohort and cross-sectional studies were 1.31 (95% CI, 1.07-1.60) and 1.10 (95% CI, 1.00-1.20), respectively. When meta-analysis was restricted only to cohort studies in rotating shift, the pooled OR of HTN in rotating shift workers was 1.34 (95% CI, 1.08-1.67). The data regarding night shift and HTN in cohort studies was limited. The pooled OR of HTN in night shift workers in cross-sectional studies was 1.07 (95% CI, 0.85-1.35). Based on the findings of our meta-analysis, shiftwork status may play an important role in HTN, as there is a significant association between rotating shift work and HTN. However, there is no significant association between night shift status and risk of HTN.

  16. TIPS (trigger an IIF paradigm shift)

    Energy Technology Data Exchange (ETDEWEB)

    Kilcup, P.E. Glen [Intel Corporation, MS: F9-016, 4100 Sara Road, Rio Rancho, NM 87124 (United States)]. E-mail: glen.w.kilcup@intel.com; Hickox, Dick [Intel Corporation, MS: F9-016, 4100 Sara Road, Rio Rancho, NM 87124 (United States); Reynaga, Adolfo [Intel Corporation, MS: F9-016, 4100 Sara Road, Rio Rancho, NM 87124 (United States)

    2007-04-11

    Challenge: New Mexico Corporate Services (NMCS) recordable injuries have been averaging 2-4 per year for the last 5 years with no statistical improvement. However, we believe all NM employees must go home incident and injury free every day and just as healthy as they came to work. In addition, we have received feedback from several sources, that indicates some employees are reluctant to report injuries. These indicators showed us that continuing our current strategies, making incremental improvement and changes, would not give us the improvement desired. We needed a paradigm shift to get everyone completely engaged in the IIF (Incident and Injury Free) culture, in order to achieve true IIF results. Methods/Strategies: We formed a small (3-person) taskforce consisting of safety representatives from EHS, Site Services and CS Operations. We reviewed 5 years worth of data to determine what was injuring our people. We also decided to review all injuries, not simply those classified as recordable by OSHA standards. First we identified the types of injury information needed to get a true picture of our safety issues. We analyzed IRB (Incident Review Board) data showing us the following factors and whether any of them contributed to the injury: - Date - Incident Description - Severity - Root Cause - Type of Injury - Season - Work Group/Shift - Area - Improper evaluation of hazard - Inadequate work procedures - Incorrect Mental Model - Inadequate PPE Requirement - Failure to Follow or Unaware of PPE Requirement - Shortcut or Schedule Pressure - Last or First Day of Shift or Adjacent to Holiday - OT - Aggravate Existing Condition - Inadequate Training or Passdown - Experience in Task - Corrective Action Taken - Overall Quality of Response. Once this information was collected for all injuries in an Excel file, we graphed it several ways to help reveal trends: - Shift 7 had double the injuries of shift 5 - Night shift injuries were relatively high but lower than Shift 7 -Shift

  17. TIPS (trigger an IIF paradigm shift)

    International Nuclear Information System (INIS)

    Kilcup, P.E. Glen; Hickox, Dick; Reynaga, Adolfo

    2007-01-01

    Challenge: New Mexico Corporate Services (NMCS) recordable injuries have been averaging 2-4 per year for the last 5 years with no statistical improvement. However, we believe all NM employees must go home incident and injury free every day and just as healthy as they came to work. In addition, we have received feedback from several sources, that indicates some employees are reluctant to report injuries. These indicators showed us that continuing our current strategies, making incremental improvement and changes, would not give us the improvement desired. We needed a paradigm shift to get everyone completely engaged in the IIF (Incident and Injury Free) culture, in order to achieve true IIF results. Methods/Strategies: We formed a small (3-person) taskforce consisting of safety representatives from EHS, Site Services and CS Operations. We reviewed 5 years worth of data to determine what was injuring our people. We also decided to review all injuries, not simply those classified as recordable by OSHA standards. First we identified the types of injury information needed to get a true picture of our safety issues. We analyzed IRB (Incident Review Board) data showing us the following factors and whether any of them contributed to the injury: - Date - Incident Description - Severity - Root Cause - Type of Injury - Season - Work Group/Shift - Area - Improper evaluation of hazard - Inadequate work procedures - Incorrect Mental Model - Inadequate PPE Requirement - Failure to Follow or Unaware of PPE Requirement - Shortcut or Schedule Pressure - Last or First Day of Shift or Adjacent to Holiday - OT - Aggravate Existing Condition - Inadequate Training or Passdown - Experience in Task - Corrective Action Taken - Overall Quality of Response. Once this information was collected for all injuries in an Excel file, we graphed it several ways to help reveal trends: - Shift 7 had double the injuries of shift 5 - Night shift injuries were relatively high but lower than Shift 7 -Shift

  18. TIPS (trigger an IIF paradigm shift).

    Science.gov (United States)

    Kilcup P E, Glen; Hickox, Dick; Reynaga, Adolfo

    2007-04-11

    New Mexico Corporate Services (NMCS) recordable injuries have been averaging 2-4 per year for the last 5 years with no statistical improvement. However, we believe all NM employees must go home incident and injury free every day and just as healthy as they came to work. In addition, we have received feedback from several sources, that indicates some employees are reluctant to report injuries. These indicators showed us that continuing our current strategies, making incremental improvement and changes, would not give us the improvement desired. We needed a paradigm shift to get everyone completely engaged in the IIF (Incident & Injury Free) culture, in order to achieve true IIF results. We formed a small (3-person) taskforce consisting of safety representatives from EHS, Site Services and CS Operations. We reviewed 5 years worth of data to determine what was injuring our people. We also decided to review all injuries, not simply those classified as recordable by OSHA standards. First we identified the types of injury information needed to get a true picture of our safety issues. We analyzed IRB (Incident Review Board) data showing us the following factors and whether any of them contributed to the injury: - Date - Incident Description - Severity - Root Cause - Type of Injury - Season - Work Group/Shift - Area - Improper evaluation of hazard - Inadequate work procedures - Incorrect Mental Model - Inadequate PPE Requirement - Failure to Follow or Unaware of PPE Requirement - Shortcut or Schedule Pressure - Last or First Day of Shift or Adjacent to Holiday - OT - Aggravate Existing Condition - Inadequate Training or Passdown - Experience in Task - Corrective Action Taken - Overall Quality of Response. Once this information was collected for all injuries in an Excel file, we graphed it several ways to help reveal trends: Shift 7 had double the injuries of shift 5. Night shift injuries were relatively high but lower than Shift 7. Shift 5 had no severe (recordable

  19. Inequalities for scattering phase shifts

    International Nuclear Information System (INIS)

    Baumgartner, B.; Grosse, H.

    1985-01-01

    A recently developed method, which was used to derive bounds on energy levels, is applied to continuous spectra and gives relations between scattering phase shifts of various angular momenta. (Author)

  20. Isotope shifts in unstable nuclei

    International Nuclear Information System (INIS)

    Rebel, H.

    1980-05-01

    Current experimental investigations of isotope shifts in atomic spectra of unstable nuclei and the resulting information about size and shape of nuclei far off stability are discussed with reference to some representative examples. (orig.)

  1. SHIFT: server for hidden stops analysis in frame-shifted translation.

    Science.gov (United States)

    Gupta, Arun; Singh, Tiratha Raj

    2013-02-23

    Frameshift is one of the three classes of recoding. Frame-shifts lead to waste of energy, resources and activity of the biosynthetic machinery. In addition, some peptides synthesized after frame-shifts are probably cytotoxic which serve as plausible cause for innumerable number of diseases and disorders such as muscular dystrophies, lysosomal storage disorders, and cancer. Hidden stop codons occur naturally in coding sequences among all organisms. These codons are associated with the early termination of translation for incorrect reading frame selection and help to reduce the metabolic cost related to the frameshift events. Researchers have identified several consequences of hidden stop codons and their association with myriad disorders. However the wealth of information available is speckled and not effortlessly acquiescent to data-mining. To reduce this gap, this work describes an algorithmic web based tool to study hidden stops in frameshifted translation for all the lineages through respective genetic code systems. This paper describes SHIFT, an algorithmic web application tool that provides a user-friendly interface for identifying and analyzing hidden stops in frameshifted translation of genomic sequences for all available genetic code systems. We have calculated the correlation between codon usage frequencies and the plausible contribution of codons towards hidden stops in an off-frame context. Markovian chains of various order have been used to model hidden stops in frameshifted peptides and their evolutionary association with naturally occurring hidden stops. In order to obtain reliable and persuasive estimates for the naturally occurring and predicted hidden stops statistical measures have been implemented. This paper presented SHIFT, an algorithmic tool that allows user-friendly exploration, analysis, and visualization of hidden stop codons in frameshifted translations. It is expected that this web based tool would serve as a useful complement for

  2. Suitability of commercial transport for a shift to electric mobility

    DEFF Research Database (Denmark)

    Christensen, Linda; Kveiborg, Ole; Klauenberg, Jens

    2016-01-01

    the travel range of large vans is an important barrier for electrification due to the battery weight and the limitation of 3.5 tonnes gross vehicle weight for driving with a normal driving licence. The rule needs amendments for electric vehicles, as has been done in Germany. The paper recommends EU countries......This paper identifies commercial sectors suitable for a shift to electric mobility. The paper concludes that the construction and the health care service sectors are the most suitable for electric mobility because many vehicles are registered in these sectors and daily mileage is reasonably low....... They should be primary target groups of specific policy measures to promote the use of electric vehicles. Denmark has only had a few incentives to promote the use of commercial electric vehicles. Until now electric vehicles do generally not show economic benefits unless travel distance is high. However, today...

  3. Global regime shift dynamics of catastrophic sea urchin overgrazing

    Science.gov (United States)

    Ling, S. D.; Scheibling, R. E.; Rassweiler, A.; Johnson, C. R.; Shears, N.; Connell, S. D.; Salomon, A. K.; Norderhaug, K. M.; Pérez-Matus, A.; Hernández, J. C.; Clemente, S.; Blamey, L. K.; Hereu, B.; Ballesteros, E.; Sala, E.; Garrabou, J.; Cebrian, E.; Zabala, M.; Fujita, D.; Johnson, L. E.

    2015-01-01

    A pronounced, widespread and persistent regime shift among marine ecosystems is observable on temperate rocky reefs as a result of sea urchin overgrazing. Here, we empirically define regime-shift dynamics for this grazing system which transitions between productive macroalgal beds and impoverished urchin barrens. Catastrophic in nature, urchin overgrazing in a well-studied Australian system demonstrates a discontinuous regime shift, which is of particular management concern as recovery of desirable macroalgal beds requires reducing grazers to well below the initial threshold of overgrazing. Generality of this regime-shift dynamic is explored across 13 rocky reef systems (spanning 11 different regions from both hemispheres) by compiling available survey data (totalling 10 901 quadrats surveyed in situ) plus experimental regime-shift responses (observed during a total of 57 in situ manipulations). The emergent and globally coherent pattern shows urchin grazing to cause a discontinuous ‘catastrophic’ regime shift, with hysteresis effect of approximately one order of magnitude in urchin biomass between critical thresholds of overgrazing and recovery. Different life-history traits appear to create asymmetry in the pace of overgrazing versus recovery. Once shifted, strong feedback mechanisms provide resilience for each alternative state thus defining the catastrophic nature of this regime shift. Importantly, human-derived stressors can act to erode resilience of desirable macroalgal beds while strengthening resilience of urchin barrens, thus exacerbating the risk, spatial extent and irreversibility of an unwanted regime shift for marine ecosystems.

  4. De novo protein structure generation from incomplete chemical shift assignments

    Energy Technology Data Exchange (ETDEWEB)

    Shen Yang [National Institutes of Health, Laboratory of Chemical Physics, National Institute of Diabetes and Digestive and Kidney Diseases (United States); Vernon, Robert; Baker, David [University of Washington, Department of Biochemistry and Howard Hughes Medical Institute (United States); Bax, Ad [National Institutes of Health, Laboratory of Chemical Physics, National Institute of Diabetes and Digestive and Kidney Diseases (United States)], E-mail: bax@nih.gov

    2009-02-15

    NMR chemical shifts provide important local structural information for proteins. Consistent structure generation from NMR chemical shift data has recently become feasible for proteins with sizes of up to 130 residues, and such structures are of a quality comparable to those obtained with the standard NMR protocol. This study investigates the influence of the completeness of chemical shift assignments on structures generated from chemical shifts. The Chemical-Shift-Rosetta (CS-Rosetta) protocol was used for de novo protein structure generation with various degrees of completeness of the chemical shift assignment, simulated by omission of entries in the experimental chemical shift data previously used for the initial demonstration of the CS-Rosetta approach. In addition, a new CS-Rosetta protocol is described that improves robustness of the method for proteins with missing or erroneous NMR chemical shift input data. This strategy, which uses traditional Rosetta for pre-filtering of the fragment selection process, is demonstrated for two paramagnetic proteins and also for two proteins with solid-state NMR chemical shift assignments.

  5. Integrated trend assessment of ecosystem changes in the Limfjord (Denmark): evidence of a recent regime shift?

    DEFF Research Database (Denmark)

    Tomczak, Maciej Tomasz; Dinesen, Grete E.; Hoffmann, Erik

    2012-01-01

    An integrated ecosystem assessment was carried out for the Limfjord over the period from 1984 to 2008 to describe changes in ecosystem structure and potentially important drivers. The Limfjord is an eutrophic transitional Danish fjord system with the main inflow from the North Sea in the west and...... further showed the regime shift to be driven by a combination of anthropogenic pressures and possible interplay with climatic disturbance......An integrated ecosystem assessment was carried out for the Limfjord over the period from 1984 to 2008 to describe changes in ecosystem structure and potentially important drivers. The Limfjord is an eutrophic transitional Danish fjord system with the main inflow from the North Sea in the west......), jellyfish, common shore crab, starfish and blue mussels. We interpret this change as a regime shift that showed a similar temporal pattern to regime shifts identified in adjacent seas. The observed changes in trophic interactions and food web reorganisation suggested a non-linear regime shift. The analyses...

  6. [Shift work and night work: what effect on blood pressure?].

    Science.gov (United States)

    Cassat, M; Wuerzner, G; Burnier, M

    2015-09-09

    Shift work has become more and more common for the last thirty years. By definition, shift work disturbs the circadian rhythm and the internal clock. Even if the pathophysiological mechanisms are not well understood, a greater cardiovascular risk has been attributed to shift work. Cross-sectional and cohort studies have identified an association between shift work and an elevated blood pressure. Shift workers also present a higher incidence of hypertension and progression than day workers. Unfortunately, the heterogeneity of the studies, the multiple confounding factors, as well as the complexity to achieve a suitable comparison group make it impossible to draw firm clinical evidence. Nevertheless, this population needs a medical follow-up focused on the cardiovascular risks and blood pressure.

  7. Shifting schedules: the health effects of reorganizing shift work.

    Science.gov (United States)

    Bambra, Clare L; Whitehead, Margaret M; Sowden, Amanda J; Akers, Joanne; Petticrew, Mark P

    2008-05-01

    Approximately one fifth of workers are engaged in some kind of shift work. The harmful effects of shift work on the health and work-life balance of employees are well known. A range of organizational interventions has been suggested to address these negative effects. This study undertook the systematic review (following Quality Of Reporting Of Meta [QUORUM] analyses guidelines) of experimental and quasi-experimental studies, from any country (in any language) that evaluated the effects on health and work-life balance of organizational-level interventions that redesign shift work schedules. Twenty-seven electronic databases (medical, social science, economic) were searched. Data extraction and quality appraisal were carried out by two independent reviewers. Narrative synthesis was performed. The review was conducted between October 2005 and November 2006. Twenty-six studies were found relating to a variety of organizational interventions. No one type of intervention was found to be consistently harmful to workers. However, three types were found to have beneficial effects on health and work-life balance: (1) switching from slow to fast rotation, (2) changing from backward to forward rotation, and (3) self-scheduling of shifts. Improvements were usually at little or no direct organizational cost. However, there were concerns about the generalizability of the evidence, and no studies reported on impacts on health inequalities. This review reinforces the findings of epidemiologic and laboratory-based research by suggesting that certain organizational-level interventions can improve the health of shift workers, their work-life balance, or both. This evidence could be useful when designing interventions to improve the experience of shift work.

  8. Relationship between thyroid stimulating hormone and night shift work.

    Science.gov (United States)

    Moon, So-Hyun; Lee, Bum-Joon; Kim, Seong-Jin; Kim, Hwan-Cheol

    2016-01-01

    Night shift work has well-known adverse effects on health. However, few studies have investigated the relationship between thyroid diseases and night shift work. This study aimed to examine night shift workers and their changes in thyroid stimulating hormones (TSH) levels over time. Medical check-up data (2011-2015) were obtained from 967 female workers at a university hospital in Incheon, Korea. Data regarding TSH levels were extracted from the records, and 2015 was used as a reference point to determine night shift work status. The relationships between TSH levels and night shift work in each year were analyzed using the general linear model (GLM). The generalized estimating equation (GEE) was used to evaluate the repeated measurements over the 5-year period. The GEE analysis revealed that from 2011 to 2015, night shift workers had TSH levels that were 0.303 mIU/L higher than the levels of non-night shift workers (95 % CI: 0.087-0.519 mIU/L, p  = 0.006) after adjusting for age and department. When we used TSH levels of 4.5 ≥ mIU/L to identify subclinical hypothyroidism, night shift workers exhibited a 1.399 fold higher risk of subclinical hypothyroidism (95 % CI: 1.050-1.863, p  = 0.022), compared to their non-night shift counterparts. This result of this study suggests that night shift workers may have an increased risk of thyroid diseases, compared to non-night shift workers.

  9. SAT in shift manager training

    International Nuclear Information System (INIS)

    Lecuyer, F.

    1995-01-01

    EDF has improved the organization of the operation shift teams with the replacement of shift supervisor in shift manager function. The shift manager is not only responsible for tasks associated to plant operation (production), but he is also responsible for safety of these tasks and for management of shift team members. A job analysis of this new job position has been performed in order to design the training programme. It resulted in a 10-month training programme that includes 8 weeks in safety-related topics and 12 weeks in soft-skills related topics. The safety related training courses are mandatory, the other courses are optional courses depending on individual trainee needs. The training also includes the development of management competencies. During the 10 month period, each trainee develops an individual project that is evaluated by NPP manager. As well, as group project is undertaken by the trainees and overseen by a steering committee. The steering committee participates in the evaluation process and provides operational experience feedback to the trainee groups and to the overall programme

  10. Environmental tax shifting in Canada : theory and application

    International Nuclear Information System (INIS)

    Taylor, A.; Hornung, R.; Cairns, S.

    2003-03-01

    Canada's leading energy and resource companies along with the Pembina Institute for Appropriate Development have collaborated in the Triple E Tax Shift Research Collaborative which examines the use of environmental tax shifting in Canada. The objective is to design, evaluate and advance federal and provincial environmental tax shifts that will influence individual behaviour and decisions to improve ecological integrity through measurable reductions in materials and energy throughput, and to maintain or increase economic competitiveness through the creation of a tax framework that would encourage businesses to improve energy efficiency. Another objective is to increase employment and social benefits through more employment opportunities and improved quality of life. Environmental tax shifting means shifting a portion of a government's tax base onto goods, services and activities associated with harmful environmental impacts that add to societal costs. Tax shifting can be implemented by offering rebates to consumers of environmental significant goods, or by adjustments to existing taxes so that environmentally sensitive goods are taxed at a lower rate than environmentally harmful goods and services. Environmental tax shifting can also be implemented by reducing existing environmental taxes and introducing a carbon dioxide emissions tax. This report is the first product of the collaboration and is intended to promote public dialogue on the subject and identify ways to implement environmental tax shifting. tabs., figs

  11. A Decision-Theoretic Basis for Choice Shifts in Groups

    OpenAIRE

    Eliaz, Kfir; Ray, Debraj; Razin, Ronny

    2004-01-01

    The phenomenon of choice shifts in group decision-making is fairly ubiquitous in the social psychology literature. Faced with a choice between a ‘safe’ and ‘risky’ decision, group members appear to move to one extreme or the other, relative to the choices each member might have made alone. Both risky and cautious shifts have been identified in different situations. This Paper demonstrates that from an individual decision-making perspective, choice shifts may be viewed as a systematic violatio...

  12. Does the ARFIMA really shift?

    DEFF Research Database (Denmark)

    Monache, Davide Delle; Grassi, Stefano; Santucci de Magistris, Paolo

    Short memory models contaminated by level shifts have long-memory features similar to those associated to processes generated under fractional integration. In this paper, we propose a robust testing procedure, based on an encompassing parametric specification, that allows to disentangle the level...... the highest power compared to other existing tests for spurious long-memory. Finally, we illustrate the usefulness of the proposed approach on the daily series of bipower variation and share turnover and on the monthly inflation series of G7 countries....... shift term from the ARFIMA component. The estimation is carried out via a state-space methodology and it leads to a robust estimate of the fractional integration parameter also in presence of level shifts.The Monte Carlo simulations show that this approach produces unbiased estimates of the fractional...

  13. Impacts of shift work on sleep and circadian rhythms.

    Science.gov (United States)

    Boivin, D B; Boudreau, P

    2014-10-01

    Shift work comprises work schedules that extend beyond the typical "nine-to-five" workday, wherein schedules often comprise early work start, compressed work weeks with 12-hour shifts, and night work. According to recent American and European surveys, between 15 and 30% of adult workers are engaged in some type of shift work, with 19% of the European population reportedly working at least 2 hours between 22:00 and 05:00. The 2005 International Classification of Sleep Disorders estimates that a shift work sleep disorder can be found in 2-5% of workers. This disorder is characterized by excessive sleepiness and/or sleep disruption for at least one month in relation with the atypical work schedule. Individual tolerance to shift work remains a complex problem that is affected by the number of consecutive work hours and shifts, the rest periods, and the predictability of work schedules. Sleepiness usually occurs during night shifts and is maximal at the end of the night. Impaired vigilance and performance occur around times of increased sleepiness and can seriously compromise workers' health and safety. Indeed, workers suffering from a shift work sleep-wake disorder can fall asleep involuntarily at work or while driving back home after a night shift. Working on atypical shifts has important socioeconomic impacts as it leads to an increased risk of accidents, workers' impairment and danger to public safety, especially at night. The aim of the present review is to review the circadian and sleep-wake disturbances associated with shift work as well as their medical impacts. Copyright © 2014. Published by Elsevier SAS.

  14. Review of 12-hour shifts at nuclear generating stations

    International Nuclear Information System (INIS)

    Smiley, A.; Moray, N.P.

    1989-04-01

    This project reviewed the practice of 12-hour shift work schedules at nuclear power plants, and its relationship to safety. The current literature was examined for information on accidents, fatigue and personal preferences. Interviews with operators and maintainers showed that these groups had attitude and preference differences related to both 12 hour shift schedules and overtime work opportunities. Several factors related to 12-hour schedules were identified which could affect safety, but which have not been adequately considered. (24 refs.)

  15. How prosody marks shifts in footing in classroom discourse

    DEFF Research Database (Denmark)

    Skidmore, David; Murakami, Kyoko

    2010-01-01

    concept of footing. We show that, within an episode of teacher-led plenary discourse, prosody may be used to signal shifts in footing between different kinds of pedagogic activity. We identify: (i) teacher-led IRF (Initiation– Response–Feedback) discussion; (ii) the teacher’smodelling of exploratory talk......; (iii) a shift to instruction-giving. If teachers are able to model the enquiring tone of exploratory talk, they may in turn encourage more thoughtful contributions from students....

  16. Morphisms Between Sofic Shift Spaces

    DEFF Research Database (Denmark)

    Nielsen, Jan Agentoft

    The lower entropy factor problem asks for necessary and sufficient conditions for the existence of a factor map from a (mixing) sofic shift space onto another (mixing) sofic subshift of lower entropy. The problem was posed by Mike Boyle in 1984. It remains an open problem, but the present thesis...... gives a re-formulation which can be used to effectively decide the question for a larger class of sofic shifts than all previous results. In addition, the methods are used to make progress on the corresponding embedding problem which asks for necessary and sufficient conditions for the existence...

  17. Shift-Variant Multidimensional Systems.

    Science.gov (United States)

    1985-05-29

    x,y;u,v) is the system response at (x,y) to an unit impulse applied at (u,v). The presence of additive noise in the preceding input-output model of a...space model developed works very effi- ciently to deblur images affected by 2-D linear shift- varying blurs, its use, in presence of noise needs to be...causal linear shift-variant (LSV) system, whose impulse res- ponse is a K-th order degenerate sequence, a K-th order state-space model was obtained

  18. Explaining (Missing) Regulator Paradigm Shifts

    DEFF Research Database (Denmark)

    Wigger, Angela; Buch-Hansen, Hubert

    2014-01-01

    The global financial and economic crisis has prompted some scholars to suggest that a fundamental regulatory shift away from neoliberalism will take place – both in general and in the field of EU competition regulation. This paper shows that so far no radical break with the neoliberal type...... regulation after the crisis in the 1970s, the paper argues that the preconditions for a fundamental shift in this issue area are not present this time around. Several reasons account for this: the current crisis has been construed by economic and political elites as a crisis within and not of neoliberal...

  19. Oxidative DNA damage during night shift work.

    Science.gov (United States)

    Bhatti, Parveen; Mirick, Dana K; Randolph, Timothy W; Gong, Jicheng; Buchanan, Diana Taibi; Zhang, Junfeng Jim; Davis, Scott

    2017-09-01

    We previously reported that compared with night sleep, day sleep among shift workers was associated with reduced urinary excretion of 8-hydroxydeoxyguanosine (8-OH-dG), potentially reflecting a reduced ability to repair 8-OH-dG lesions in DNA. We identified the absence of melatonin during day sleep as the likely causative factor. We now investigate whether night work is also associated with reduced urinary excretion of 8-OH-dG. For this cross-sectional study, 50 shift workers with the largest negative differences in night work versus night sleep circulating melatonin levels (measured as 6-sulfatoxymelatonin in urine) were selected from among the 223 shift workers included in our previous study. 8-OH-dG concentrations were measured in stored urine samples using high performance liquid chromatography with electrochemical detection. Mixed effects models were used to compare night work versus night sleep 8-OH-dG levels. Circulating melatonin levels during night work (mean=17.1 ng/mg creatinine/mg creatinine) were much lower than during night sleep (mean=51.7 ng/mg creatinine). In adjusted analyses, average urinary 8-OH-dG levels during the night work period were only 20% of those observed during the night sleep period (95% CI 10% to 30%; psleep, is associated with reduced repair of 8-OH-dG lesions in DNA and that the effect is likely driven by melatonin suppression occurring during night work relative to night sleep. If confirmed, future studies should evaluate melatonin supplementation as a means to restore oxidative DNA damage repair capacity among shift workers. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  20. Nurse perceptions of workplace environment: differences across shifts.

    Science.gov (United States)

    Teclaw, Robert; Osatuke, Katerine

    2015-11-01

    To evaluate whether nurse work shift affected workplace perceptions. Although the importance of work schedule in shaping work attitudes, generally (and specifically for nurses) is well accepted, much work remains in characterising how and why nurses' perceptions might differ across shifts. Using an exploratory study of observational data, we examined whether shift influenced non-supervisory nurses' job perceptions in the Veterans Health Administration All Employee Survey (n = 14057; years 2008, 2010, 2012). The size of differences in item means (95% C.I.) across shifts was evaluated graphically. Using ordinal logistic regression, we accounted for the ordinal outcome variables and controlled for the demographic and survey year effects. Nurses' perceptions of workplace climate differed across shifts. Items with the greatest differences, consistent across years and analytic methods, involved supervisors and fairness. Night and weekend shift nurse ratings were more negative than for weekday shift nurses. Off-shift nurses are less satisfied with work/life balance, their supervisors and especially fairness. Overall satisfaction and turnover intention are not affected to the same extent. These results indicate several specific areas that nurse managers can address through workforce support and communication. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

  1. Is there a shift to 'active nanostructures'?

    International Nuclear Information System (INIS)

    Subramanian, Vrishali; Youtie, Jan; Porter, Alan L.; Shapira, Philip

    2010-01-01

    It has been suggested that an important transition in the long-run trajectory of nanotechnology development is a shift from passive to active nanostructures. Such a shift could present different or increased societal impacts and require new approaches for risk assessment. An active nanostructure 'changes or evolves its state during its operation,' according to the National Science Foundation's (2006) Active Nanostructures and Nanosystems grant solicitation. Active nanostructure examples include nanoelectromechanical systems (NEMS), nanomachines, self-healing materials, targeted drugs and chemicals, energy storage devices, and sensors. This article considers two questions: (a) Is there a 'shift' to active nanostructures? (b) How can we characterize the prototypical areas into which active nanostructures may emerge? We build upon the NSF definition of active nanostructures to develop a research publication search strategy, with a particular intent to distinguish between passive and active nanotechnologies. We perform bibliometric analyses and describe the main publication trends from 1995 to 2008. We then describe the prototypes of research that emerge based on reading the abstracts and review papers encountered in our search. Preliminary results suggest that there is a sharp rise in active nanostructures publications in 2006, and this rise is maintained in 2007 and through to early 2008. We present a typology that can be used to describe the kind of active nanostructures that may be commercialized and regulated in the future.

  2. Energy efficiency improvement by gear shifting optimization

    Directory of Open Access Journals (Sweden)

    Blagojevic Ivan A.

    2013-01-01

    Full Text Available Many studies have proved that elements of driver’s behavior related to gear selection have considerable influence on the fuel consumption. Optimal gear shifting is a complex task, especially for inexperienced drivers. This paper presents an implemented idea for gear shifting optimization with the aim of fuel consumption minimization with more efficient engine working regimes. Optimized gear shifting enables the best possible relation between vehicle motion regimes and engine working regimes. New theoretical-experimental approach has been developed using On-Board Diagnostic technology which so far has not been used for this purpose. The matrix of driving modes according to which tests were performed is obtained and special data acquisition system and analysis process have been developed. Functional relations between experimental test modes and adequate engine working parameters have been obtained and all necessary operations have been conducted to enable their use as inputs for the designed algorithm. The created Model has been tested in real exploitation conditions on passenger car with Otto fuel injection engine and On-Board Diagnostic connection without any changes on it. The conducted tests have shown that the presented Model has significantly positive effects on fuel consumption which is an important ecological aspect. Further development and testing of the Model allows implementation in wide range of motor vehicles with various types of internal combustion engines.

  3. Is there a shift to "active nanostructures"?

    Science.gov (United States)

    Subramanian, Vrishali; Youtie, Jan; Porter, Alan L.; Shapira, Philip

    2010-01-01

    It has been suggested that an important transition in the long-run trajectory of nanotechnology development is a shift from passive to active nanostructures. Such a shift could present different or increased societal impacts and require new approaches for risk assessment. An active nanostructure "changes or evolves its state during its operation," according to the National Science Foundation's (2006) Active Nanostructures and Nanosystems grant solicitation. Active nanostructure examples include nanoelectromechanical systems (NEMS), nanomachines, self-healing materials, targeted drugs and chemicals, energy storage devices, and sensors. This article considers two questions: (a) Is there a "shift" to active nanostructures? (b) How can we characterize the prototypical areas into which active nanostructures may emerge? We build upon the NSF definition of active nanostructures to develop a research publication search strategy, with a particular intent to distinguish between passive and active nanotechnologies. We perform bibliometric analyses and describe the main publication trends from 1995 to 2008. We then describe the prototypes of research that emerge based on reading the abstracts and review papers encountered in our search. Preliminary results suggest that there is a sharp rise in active nanostructures publications in 2006, and this rise is maintained in 2007 and through to early 2008. We present a typology that can be used to describe the kind of active nanostructures that may be commercialized and regulated in the future.

  4. Steganalytic methods for the detection of histogram shifting data-hiding schemes

    OpenAIRE

    Lerch Hostalot, Daniel

    2011-01-01

    In this paper, some steganalytic techniques designed to detect the existence of hidden messages using histogram shifting methods are presented. Firstly, some techniques to identify specific methods of histogram shifting, based on visible marks on the histogram or abnormal statistical distributions are suggested. Then, we present a general technique capable of detecting all histogram shifting techniques analyzed. This technique is based on the effect of histogram shifting methods on the "volat...

  5. Probabilistic validation of protein NMR chemical shift assignments

    International Nuclear Information System (INIS)

    Dashti, Hesam; Tonelli, Marco; Lee, Woonghee; Westler, William M.; Cornilescu, Gabriel; Ulrich, Eldon L.; Markley, John L.

    2016-01-01

    Data validation plays an important role in ensuring the reliability and reproducibility of studies. NMR investigations of the functional properties, dynamics, chemical kinetics, and structures of proteins depend critically on the correctness of chemical shift assignments. We present a novel probabilistic method named ARECA for validating chemical shift assignments that relies on the nuclear Overhauser effect data. ARECA has been evaluated through its application to 26 case studies and has been shown to be complementary to, and usually more reliable than, approaches based on chemical shift databases. ARECA is available online at http://areca.nmrfam.wisc.edu/ http://areca.nmrfam.wisc.edu/

  6. Probabilistic validation of protein NMR chemical shift assignments

    Energy Technology Data Exchange (ETDEWEB)

    Dashti, Hesam [University of Wisconsin-Madison, Graduate Program in Biophysics, Biochemistry Department (United States); Tonelli, Marco; Lee, Woonghee; Westler, William M.; Cornilescu, Gabriel [University of Wisconsin-Madison, Biochemistry Department, National Magnetic Resonance Facility at Madison (United States); Ulrich, Eldon L. [University of Wisconsin-Madison, BioMagResBank, Biochemistry Department (United States); Markley, John L., E-mail: markley@nmrfam.wisc.edu, E-mail: jmarkley@wisc.edu [University of Wisconsin-Madison, Biochemistry Department, National Magnetic Resonance Facility at Madison (United States)

    2016-01-15

    Data validation plays an important role in ensuring the reliability and reproducibility of studies. NMR investigations of the functional properties, dynamics, chemical kinetics, and structures of proteins depend critically on the correctness of chemical shift assignments. We present a novel probabilistic method named ARECA for validating chemical shift assignments that relies on the nuclear Overhauser effect data. ARECA has been evaluated through its application to 26 case studies and has been shown to be complementary to, and usually more reliable than, approaches based on chemical shift databases. ARECA is available online at http://areca.nmrfam.wisc.edu/ http://areca.nmrfam.wisc.edu/.

  7. Leadership Shifts in Changing Field

    Science.gov (United States)

    Zubrzycki, Jaclyn

    2013-01-01

    As groups representing local and state education players struggle to remain relevant in a policy conversation often dominated by foundations, think tanks, new advocacy groups, and political and business figures, a shift in leadership has been under way at major associations. Most of the changes have come as part of the natural churn; former…

  8. Crichton's phase-shift ambiguity

    NARCIS (Netherlands)

    Atkinson, D.; Johnson, P.W.; Mehta, N.; Roo, M. de

    1973-01-01

    A re-examination of the SPD phase-shift ambiguity is made with a view to understanding certain singular features of the elastic unitarity constraint. An explicit solution of Crichton's equations is presented, and certain features of this solution are displayed graphically. In particular, it is shown

  9. Environmental Protection: a shifting focus

    NARCIS (Netherlands)

    Dr. ir. Jan Venselaar

    2004-01-01

    The last two decades have seen a fundamental change in the way chemistry handles environmental issues. A shift in focus has occurred from 'end-of-pipe' to prevention and process integration. Presently an even more fundamental change is brought about by the need for sustainable development. It is

  10. Shift work and burnout among health care workers.

    Science.gov (United States)

    Wisetborisut, A; Angkurawaranon, C; Jiraporncharoen, W; Uaphanthasath, R; Wiwatanadate, P

    2014-06-01

    Burnout, defined as a syndrome derived from prolonged exposure to stressors at work, is often seen in health care workers. Shift work is considered one of the occupational risks for burnout in health care workers. To identify and describe the association between shift work and burnout among health care workers. A cross-sectional study of health care workers in Chiang Mai University Hospital, Thailand. Data were collected via an online self-answered questionnaire and included details of shift work and burnout. Burnout was measured by the Maslach Burnout Inventory (MBI). Two thousand seven hundred and seventy two health care workers participated, a 52% response rate. Burnout was found more frequently among shift workers than those who did not work shifts (adjusted odds ratio [aOR] 1.4, 95% confidence interval [CI]: 1.0-1.9). Among shift workers, over 10 years of being a shift worker was associated with increasing burnout (aOR 1.7, 95% CI: 1.2-2.6) and having 6-8 sleeping hours per day was associated with having less burnout (aOR 0.7, 95% CI: 0.5-0.9). Nurses who had at least 8 days off per month had lower odds of burnout compared with those with fewer than 8 days off (aOR 0.6, 95% CI: 0.5-0.8). Shift work was associated with burnout in this sample. Increased years of work as a shift worker were associated with more frequent burnout. Adequate sleeping hours and days off were found to be possible protective factors. Policies on shift work should take into account the potential of such work for contributing towards increasing burnout. © The Author 2014. Published by Oxford University Press on behalf of the Society of Occupational Medicine. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  11. Mexican oil industry: Shifting to difficult oil

    Energy Technology Data Exchange (ETDEWEB)

    Bazan G., Gerardo; Gonzalez, Cristobal J.

    2010-09-15

    Mexico has stepped into an important transition of declining oil fields and new challenging oil projects. The aim of this paper is to show a new perspective of the oil resources that have been exploited throughout the Mexican territory, as well as the remaining resources yet to be exploited. We have developed a resources/production-costs chart that illustrates the historical and future development of the Mexican oil industry, showing the shift that the industry will face in the coming years; this chart was taken from a model already in use by the most prestige energy agencies in the world.

  12. Research by Design: A paradigm shift?

    DEFF Research Database (Denmark)

    Verbeke, Johan

    2016-01-01

    In this paper we will argue that architectural research is becoming more and more important, not only in academia but also in architectural practice. Moreover, a shift is taking place from using and absorbing research methods from other disciplines towards building on the own specific strength...... of the discipline of architecture, i.e. using design and creative practice as a method to generate knowledge and disclose unknown aspects of reality. In doing so, this paper tries to place the Delft ARENA meeting Architectural Research Network Meeting (November 2013) in perspective....

  13. Self-Reported Recovery from 2-Week 12-Hour Shift Work Schedules: A 14-Day Follow-Up

    NARCIS (Netherlands)

    Merkus, S.L.; Holte, K.A.; Huysmans, M.A.; van de Ven, P.M.; van Mechelen, W.; van der Beek, A.J.

    2015-01-01

    Background Recovery from fatigue is important in maintaining night workers' health. This study compared the course of self-reported recovery after 2-week 12-hour schedules consisting of either night shifts or swing shifts (i.e., 7 night shifts followed by 7 day shifts) to such schedules consisting

  14. SIMULATION OF CHARACTERISTICS OF DUAL-CORE PHASE SHIFTING TRANSFORMER

    Directory of Open Access Journals (Sweden)

    Kalinin L.P.

    2014-04-01

    Full Text Available The role and importance of phase shifting transformers are increased as a result of the further development of integrated power systems. This gives the rise to new technical solutions which entails the necessity of comparison of new developments with existing. The article consider the technical characteristics of dual-core phase shifting transformer which later will be used as a basis for comparison with other competing options and assess of their technical efficiency.

  15. [Burden and health effects of shift work].

    Science.gov (United States)

    Heitmann, Jörg

    2010-10-01

    In Germany aprox. 15% of all employees have irregular or flexible working hours. Disturbed sleep and/or hypersomnia are direct consequences of shift work and therefore described as shift work disorder. Beyond this, shift work can also be associated with specific pathological disorders. There are individual differences in tolerance to shift work. Optimization of both shift schedules and sleep to "non-physiological" times of the day are measures to counteract the negative effects of shift work. There is still not enough evidence to recommend drugs for routine use in shift workers. © Georg Thieme Verlag Stuttgart · New York.

  16. Shift work as an oxidative stressor

    OpenAIRE

    Pasalar Parvin; Farahani Saeed; Sharifian Akbar; Gharavi Marjan; Aminian Omid

    2005-01-01

    Abstract Background Some medical disorders have higher prevalence in shift workers than others. This study was designed to evaluate the effect of night-shift-working on total plasma antioxidant capacity, with respect to the causative role of oxidative stress in induction of some of these disorders. Methods Two blood samples were taken from 44 workers with a rotational shift schedule, one after their day shift and one after their night shift. The total plasma antioxidant capacity of each worke...

  17. Perihelium shifts in central potentials

    International Nuclear Information System (INIS)

    Amorim, A.E.A.; Ferreira, P.L.

    1987-01-01

    Motivated by the rigorous results on level ordering for arbitrary central potentials recently derived in the literature a classical treatment of the perihelium shifts is presented, based on the consideration of those orbits which lie in the vicinity of a circular orbit. The role played by the Laplacian of the potential is emphasized. By the same approach Bertrand's theorem is also discussed, in connection with Arnold's proof. (Author) [pt

  18. Multicolor Holography With Phase Shifting

    Science.gov (United States)

    Vikram, Chandra S.

    1996-01-01

    Prototype apparatus constructed to test feasibility of two-color holographic interferometric scheme in which data for reconstructing holographic wavefront obtained with help of phase-shifting technique. Provides two sets of data needed to solve equations for effects of temperature and concentration. Concept extended to holography at three or more wavelengths to measure three or more phenomena associated with significant variations in index of refraction

  19. Shift Work and Endocrine Disorders

    Directory of Open Access Journals (Sweden)

    M. A. Ulhôa

    2015-01-01

    Full Text Available The objective of this review was to investigate the impact of shift and night work on metabolic processes and the role of alterations in the sleep-wake cycle and feeding times and environmental changes in the occurrence of metabolic disorders. The literature review was performed by searching three electronic databases for relevant studies published in the last 10 years. The methodological quality of each study was assessed, and best-evidence synthesis was applied to draw conclusions. The literature has shown changes in concentrations of melatonin, cortisol, ghrelin, and leptin among shift workers. Melatonin has been implicated for its role in the synthesis and action of insulin. The action of this hormone also regulates the expression of transporter glucose type 4 or triggers phosphorylation of the insulin receptor. Therefore, a reduction in melatonin can be associated with an increase in insulin resistance and a propensity for the development of diabetes. Moreover, shift work can negatively affect sleep and contribute to sedentarism, unhealthy eating habits, and stress. Recent studies on metabolic processes have increasingly revealed their complexity. Physiological changes induced in workers who invert their activity-rest cycle to fulfill work hours include disruptions in metabolic processes.

  20. Multidirectional abundance shifts among North American birds and the relative influence of multifaceted climate factors.

    Science.gov (United States)

    Huang, Qiongyu; Sauer, John R; Dubayah, Ralph O

    2017-09-01

    Shifts in species distributions are major fingerprint of climate change. Examining changes in species abundance structures at a continental scale enables robust evaluation of climate change influences, but few studies have conducted these evaluations due to limited data and methodological constraints. In this study, we estimate temporal changes in abundance from North American Breeding Bird Survey data at the scale of physiographic strata to examine the relative influence of different components of climatic factors and evaluate the hypothesis that shifting species distributions are multidirectional in resident bird species in North America. We quantify the direction and velocity of the abundance shifts of 57 permanent resident birds over 44 years using a centroid analysis. For species with significant abundance shifts in the centroid analysis, we conduct a more intensive correlative analysis to identify climate components most strongly associated with composite change of abundance within strata. Our analysis focus on two contrasts: the relative importance of climate extremes vs. averages, and of temperature vs. precipitation in strength of association with abundance change. Our study shows that 36 species had significant abundance shifts over the study period. The average velocity of the centroid is 5.89 km·yr -1 . The shifted distance on average covers 259 km, 9% of range extent. Our results strongly suggest that the climate change fingerprint in studied avian distributions is multidirectional. Among 6 directions with significant abundance shifts, the northwestward shift was observed in the largest number of species (n = 13). The temperature/average climate model consistently has greater predictive ability than the precipitation/extreme climate model in explaining strata-level abundance change. Our study shows heterogeneous avian responses to recent environmental changes. It highlights needs for more species-specific approaches to examine contributing

  1. Health workforce skill mix and task shifting in low income countries: a review of recent evidence

    Directory of Open Access Journals (Sweden)

    Auh Erica

    2011-01-01

    Full Text Available Abstract Background Health workforce needs-based shortages and skill mix imbalances are significant health workforce challenges. Task shifting, defined as delegating tasks to existing or new cadres with either less training or narrowly tailored training, is a potential strategy to address these challenges. This study uses an economics perspective to review the skill mix literature to determine its strength of the evidence, identify gaps in the evidence, and to propose a research agenda. Methods Studies primarily from low-income countries published between 2006 and September 2010 were found using Google Scholar and PubMed. Keywords included terms such as skill mix, task shifting, assistant medical officer, assistant clinical officer, assistant nurse, assistant pharmacist, and community health worker. Thirty-one studies were selected to analyze, based on the strength of evidence. Results First, the studies provide substantial evidence that task shifting is an important policy option to help alleviate workforce shortages and skill mix imbalances. For example, in Mozambique, surgically trained assistant medical officers, who were the key providers in district hospitals, produced similar patient outcomes at a significantly lower cost as compared to physician obstetricians and gynaecologists. Second, although task shifting is promising, it can present its own challenges. For example, a study analyzing task shifting in HIV/AIDS in sub-Saharan Africa noted quality and safety concerns, professional and institutional resistance, and the need to sustain motivation and performance. Third, most task shifting studies compare the results of the new cadre with the traditional cadre. Studies also need to compare the new cadre's results to the results from the care that would have been provided--if any care at all--had task shifting not occurred. Conclusions Task shifting is a promising policy option to increase the productive efficiency of the delivery of health

  2. Associations among rotating night shift work, sleep and skin cancer in Nurses' Health Study II participants.

    Science.gov (United States)

    Heckman, Carolyn J; Kloss, Jacqueline D; Feskanich, Diane; Culnan, Elizabeth; Schernhammer, Eva S

    2017-03-01

    Night shift work and sleep duration have been associated with breast and other cancers. Results from the few prior studies of night shift work and skin cancer risk have been mixed and not fully accounted for other potentially important health-related variables (eg, sleep characteristics). This study evaluated the relationship between rotating night shift work and skin cancer risk and included additional skin cancer risk factors and sleep-related variables. The current study used data from 74 323 Nurses' Health Study (NHS) II participants. Cox proportional hazards models were used to estimate multivariable-adjusted HRs and 95% CIs for skin cancers across categories of shift work and sleep duration. Over 10 years of follow-up, 4308 basal cell carcinoma (BCC), 334 squamous cell carcinoma (SCC) and 212 melanoma cases were identified. Longer duration of rotating night shifts was associated with a linear decline in risk of BCC (HR=0.93, 95% CI 0.90 to 0.97 per 5-year increase). Shift work was not significantly associated with either melanoma (HR=1.02, 95% CI 0.86 to 1.21) or SCC (HR=0.92, 95% CI 0.80 to 1.06). A short sleep duration (≤6 hours per day) was associated with lower risks of melanoma (HR=0.68, 95% CI 0.46 to 0.98) and BCC (HR=0.93, 95% CI 0.86 to 1.00) compared with the most common report of 7 hours. SCC was not associated with duration of sleep (HR=0.94, 95% CI 0.83 to 1.06). Longer duration of rotating night shift work and shorter sleep duration were associated with lower risk of some skin cancers. Further research is needed to confirm and identify the mechanisms underlying these associations. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  3. Introduction: Science, Sexuality, and Psychotherapy: Shifting Paradigms.

    Science.gov (United States)

    Cerbone, Armand R

    2017-08-01

    This introduction presents an overview of the current issue (73, 8) of Journal of Clinical Psychology: In Session. This issue features a series of articles, with clinical cases, each presented to illustrate the challenges faced by individuals and couples whose sexual and gender identities and expressions do not comport with traditional and cultural norms. These articles also document the challenges to the therapists who treat them. Considered individually, each article underscores the need to recognize the importance of evidence in guiding psychotherapy in cases involving sexuality. The discussions in each article offer recommendations meant to help and guide psychotherapists. Considered collectively, they raise important questions and considerations about shifting paradigms of human sexuality. Implications for assessment and treatment of cases involving sexuality and gender identity are discussed and recommended. © 2017 Wiley Periodicals, Inc.

  4. Socioeconomic Development and Shifts in Mate Preferences

    Directory of Open Access Journals (Sweden)

    Emily A. Stone

    2008-07-01

    Full Text Available Mate preferences shift according to contexts such as temporal duration of mateship sought and ecological prevalence of parasites. One important cross-cultural context that has not been explored is a country's socioeconomic development. Because individuals in less developed countries are generally less healthy and possess fewer resources than those in more developed countries, displays of health and resources in a prospective long-term partner were hypothesized to be valued more in populations in which they are rare than in populations in which they are more common. We also predicted negative correlations between development and preferences for similar religious background and a desire for children. We found strong support for the health hypothesis and modest support for the resource acquisition potential hypothesis. We also found an unpredicted positive correlation between development and importance ratings for love. Discussion addresses limitations of the current research and highlights directions for future cross-cultural research on mating psychology.

  5. PEAK SHIFTS PRODUCED BY CORRELATED RESPONSE TO SELECTION.

    Science.gov (United States)

    Price, Trevor; Turelli, Michael; Slatkin, Montgomery

    1993-02-01

    Traits may evolve both as a consequence of direct selection and also as a correlated response to selection on other traits. While correlated response may be important for both the production of evolutionary novelty and in the build-up of complex characters, its potential role in peak shifts has been neglected empirically and theoretically. We use a quantitative genetic model to investigate the conditions under which a character, Y, which has two alternative optima, can be dragged from one optimum to the other as a correlated response to selection on a second character, X. High genetic correlations between the two characters make the transition, or peak shift, easier, as does weak selection tending to restore Y to the optimum from which it is being dragged. When selection on Y is very weak, the conditions for a peak shift depend only on the location of the new optimum for X and are independent of the strength of selection moving it there. Thus, if the "adaptive valley" for Y is very shallow, little reduction in mean fitness is needed to produce a shift. If the selection acts strongly to keep Y at its current optimum, very intense directional selection on X, associated with a dramatic drop in mean fitness, is required for a peak shift. When strong selection is required, the conditions for peak shifts driven by correlated response might occur rarely, but still with sufficient frequency on a geological timescale to be evolutionarily important. © 1993 The Society for the Study of Evolution.

  6. Metacognitive Instruction: Global and Local Shifts in Considering Listening Input

    Directory of Open Access Journals (Sweden)

    Hossein Bozorgian

    2013-01-01

    Full Text Available A key shift of thinking for effective learning and teaching of listening input has been seen and organized in education locally and globally. This study has probed whether metacognitive instruction through a pedagogical cycle shifts high-intermediate students' English language learning and English as a second language (ESL teacher's teaching focus on listening input. Twenty male Iranian students with an age range of 18 to 24 received a guided methodology including metacognitive strategies (planning, monitoring, and evaluation for a period of three months. This study has used the strategies and probed the importance of metacognitive instruction through interviewing both the teacher and the students. The results have shown that metacognitive instruction helped both the ESL teacher's and the students' shift of thinking about teaching and learning listening input. This key shift of thinking has implications globally and locally for classroom practices of listening input.

  7. Solution of generalized shifted linear systems with complex symmetric matrices

    International Nuclear Information System (INIS)

    Sogabe, Tomohiro; Hoshi, Takeo; Zhang, Shao-Liang; Fujiwara, Takeo

    2012-01-01

    We develop the shifted COCG method [R. Takayama, T. Hoshi, T. Sogabe, S.-L. Zhang, T. Fujiwara, Linear algebraic calculation of Green’s function for large-scale electronic structure theory, Phys. Rev. B 73 (165108) (2006) 1–9] and the shifted WQMR method [T. Sogabe, T. Hoshi, S.-L. Zhang, T. Fujiwara, On a weighted quasi-residual minimization strategy of the QMR method for solving complex symmetric shifted linear systems, Electron. Trans. Numer. Anal. 31 (2008) 126–140] for solving generalized shifted linear systems with complex symmetric matrices that arise from the electronic structure theory. The complex symmetric Lanczos process with a suitable bilinear form plays an important role in the development of the methods. The numerical examples indicate that the methods are highly attractive when the inner linear systems can efficiently be solved.

  8. Shifting sands - from descriptions to solutions.

    Science.gov (United States)

    Armstrong, R; Pettman, T L; Waters, E

    2014-06-01

    (effective solutions) was often described as a more daunting task. As a result, there was low awareness of, and competence with, Types 2 and 3 evidence. Organizational processes for using these types of evidence were almost non-existent. Applying this typology with stakeholders has allowed us to observe that it; (1) has been useful in conceptualizing useful evidence for public health, which has guided our work (2) has been useful in stakeholder interactions to introduce evidence, its definition and what it means to be 'evidence-informed' and (3) has identified 'faults' in the EIDM approach. The typology includes examples of common questions in public health, and suggestions of the types of evidence that may be useful to answer those questions. Findings that test the use of the typology have been synthesized. These have demonstrated inconsistencies in defining and applying evidence, and low awareness about what types of evidence are crucial to ensure that interventions are effective and minimize harm. Based upon these findings, the authors would argue that current investment in type 1 evidence (e.g. data repositories) shifts to make way for KT strategies, which facilitate the uptake of type 2 and 3 evidence (interventions and implementation guidance). Building a shared understanding of the types of evidence and their importance in public health decision-making is crucial if we wish to build a system that supports EIDM and results in effective interventions being delivered. There are a number of 'faults' in the system which the authors have illuminated through understanding the individual and organizational realities of evidence use. These faults could be addressed through KT strategies with the public health workforce, and development of organizational cultures and the broader system. Copyright © 2014 The Royal Society for Public Health. Published by Elsevier Ltd. All rights reserved.

  9. Language Lateralization Shifts with Learning by Adults

    Science.gov (United States)

    Plante, Elena; Almryde, Kyle; Patterson, Dianne K.; Vance, Christopher J.; Asbjørnsen, Arve E.

    2014-01-01

    For the majority of the population, language is a left hemisphere lateralized function. During childhood, a pattern of increasing left lateralization for language has been described in brain imaging studies, suggesting this trait develops. This development could reflect change due to brain maturation or change due to skill acquisition, given that children acquire and refine language skills as they mature. We test the possibility that skill acquisition, independent of age-associated maturation can result in shifts in language lateralization in classic language cortex. We imaged adults exposed to unfamiliar language during three successive fMRI scans. Participants were then asked to identify specific words embedded in Norwegian sentences. Exposure to these sentences, relative to complex tones, resulted in consistent activation in the left and right superior temporal gyrus. Activation in this region became increasingly left lateralized with repeated exposure to the unfamiliar language. These results demonstrate that shifts in lateralization can be produced in the short-term within a learning context, independent of maturation. PMID:25285756

  10. Attention shifts the language network reflecting paradigm presentation

    Directory of Open Access Journals (Sweden)

    Kathrin eKollndorfer

    2013-11-01

    Full Text Available Objectives: Functional magnetic resonance imaging (fMRI is a reliable and non-invasive method with which to localize language function in pre-surgical planning. In clinical practice, visual stimulus presentation is often difficult or impossible, due to the patient’s restricted language or attention abilities. Therefore, our aim was to investigate modality-specific differences in visual and auditory stimulus presentation.Methods: Ten healthy subjects participated in an fMRI study comprising two experiments with visual and auditory stimulus presentation. In both experiments, two language paradigms (one for language comprehension and one for language production used in clinical practice were investigated. In addition to standard data analysis by the means of the general linear model (GLM, independent component analysis (ICA was performed to achieve more detailed information on language processing networks.Results: GLM analysis revealed modality-specific brain activation for both language paradigms for the contrast visual > auditory in the area of the intraparietal sulcus and the hippocampus, two areas related to attention and working memory. Using group ICA, a language network was detected for both paradigms independent of stimulus presentation modality. The investigation of language lateralization revealed no significant variations. Visually presented stimuli further activated an attention-shift network, which could not be identified for the auditory presented language.Conclusion: The results of this study indicate that the visually presented language stimuli additionally activate an attention-shift network. These findings will provide important information for pre-surgical planning in order to preserve reading abilities after brain surgery, significantly improving surgical outcomes. Our findings suggest that the presentation modality for language paradigms should be adapted on behalf of individual indication.

  11. Tax shifting in long-term gas sales contracts

    International Nuclear Information System (INIS)

    Asche, Frank; Osmundsen, Petter; Tveteraas, Ragnar

    2002-01-01

    Producers or consumers faced with an increase in taxes are usually able to shift parts of it to other levels in the value chain. We examine who are actually bearing the burden of increased taxes on natural gas in the EU-area - consumers or exporters. Strategic trade policy and cross-border consumer tax shifting are of particular interest, as the EU-area increasingly is a net importer of gas. Traditional tax incidence theory presumes spot markets. Natural gas in the EU-area, however, is to a large extent regulated by incomplete long-term contracts. Still, spot market forces could be indicative for tax shifting, by determining the ex post bargaining power in contract renegotiations. By examining tax shifting in gas sales data we test whether this is the case. To investigate tax incidence, we estimate natural gas demand elasticities for the household sector in EU countries as well as a reduced form import equation. We test whether gas import prices, which are predominantly determined by long-term contracts, have been influenced by end-user tax shifts. (author)

  12. Shift work and its association with metabolic disorders.

    Science.gov (United States)

    Brum, Maria Carlota Borba; Filho, Fábio Fernandes Dantas; Schnorr, Claudia Carolina; Bottega, Gustavo Borchardt; Rodrigues, Ticiana C

    2015-01-01

    Although the health burden of shift work has not been extensively studied, evidence suggests that it may affect the metabolic balance and cause obesity and other metabolic disorders. Sleep deprivation, circadian desynchronization and behavioral changes in diet and physical activity are among the most commonly mentioned factors in studies of the association between night work and metabolic disorders. Individual adaptation to night work depends greatly on personal factors such as family and social life, but occupational interventions may also make a positive contribution to the transition to shift work, such as exposure to bright lights during the night shift, melatonin use, shift regularity and clockwise rotation, and dietary adaptations for the metabolic needs of night workers. The evaluation of the impact of night work on health and of the mechanisms underlying this relationship can serve as a basis for intervention strategies to minimize the health burden of shift work. This review aimed to identify highlights regarding therapeutic implications following the association between night and shift work and metabolic disorders, as well as the mechanisms and pathways responsible for these relationships.

  13. Impact of shift work on critical care nurses.

    Science.gov (United States)

    Pryce, Cheryl

    2016-01-01

    Shift work is a common practice in the health care field to maintain 24-hour patient care. The purpose of this article is to recognize the negative impact of shift work on critical care nurses, and identify strategies to mitigate these effects. A review of the literature was completed, using the search terms: 'shift work, 'critical care', impact, and health. The literature revealed that shift work has an adverse effect on the health of a nurse. Some of the health implications include stress, sleep deprivation, cardiovascular disease, gastrointestinal symptoms, and mental health illnesses. Furthermore, shift work impacts a nurse's social life and may result in patient harm. Strategies to reduce the negative impact of shift work will be focused on educating critical care nurses and managers. These strategies include frontline staff maintaining a moderate amount of exercise, sustaining a well-balanced diet, using relaxation techniques, reducing the use of cigarettes, working an eight-hour work day, and napping during scheduled breaks. Recommendations for managers include implementing quiet time at the workplace, providing a safe space for staff to nap during breaks, facilitating an eight-hour work day, and encouraging a multidisciplinary team approach when managing workload.

  14. Grizzly bear diet shifting on reclaimed mines

    Directory of Open Access Journals (Sweden)

    Bogdan Cristescu

    2015-07-01

    Full Text Available Industrial developments and reclamation change habitat, possibly altering large carnivore food base. We monitored the diet of a low-density population of grizzly bears occupying a landscape with open-pit coal mines in Canada. During 2009–2010 we instrumented 10 bears with GPS radiocollars and compared their feeding on reclaimed coal mines and neighboring Rocky Mountains and their foothills. In addition, we compared our data with historical bear diet for the same population collected in 2001–2003, before extensive mine reclamation occurred. Diet on mines (n=331 scats was dominated by non-native forbs and graminoids, while diets in the Foothills and Mountains consisted primarily of ungulates and Hedysarum spp. roots respectively, showing diet shifting with availability. Field visitation of feeding sites (n=234 GPS relocation clusters also showed that ungulates were the main diet component in the Foothills, whereas on reclaimed mines bears were least carnivorous. These differences illustrate a shift to feeding on non-native forbs while comparisons with historical diet reveal emergence of elk as an important bear food. Food resources on reclaimed mines attract bears from wilderness areas and bears may be more adaptable to landscape change than previously thought. The grizzly bear’s ready use of mines cautions the universal view of this species as umbrella indicative of biodiversity.

  15. Security proof for round robin differential phase shift QKD

    NARCIS (Netherlands)

    Leermakers, D.; Skoric, B.

    2017-01-01

    We give the first information-theoretic security proof of the `Round Robin Differential Phase Shift' Quantum Key Distribution scheme. Our proof consists of the following steps. We construct an EPR variant of the scheme. We identify Eve's optimal way of coupling an ancilla to an EPR qudit pair under

  16. Shift in genomic RNA patterns of human rotaviruses isolated from ...

    African Journals Online (AJOL)

    Rotalvirus-positive specimens from 322 infants and young children submitted to private patl1ology laboratories were analysed by polyacrylamide-gel electrophoresis of the viral RNA. A predominance of long RNA profiles occurred and a temporal shift in the genomic patterns was identified. An epidemic of the classic shorter ...

  17. Cortisol shifts financial risk preferences.

    Science.gov (United States)

    Kandasamy, Narayanan; Hardy, Ben; Page, Lionel; Schaffner, Markus; Graggaber, Johann; Powlson, Andrew S; Fletcher, Paul C; Gurnell, Mark; Coates, John

    2014-03-04

    Risk taking is central to human activity. Consequently, it lies at the focal point of behavioral sciences such as neuroscience, economics, and finance. Many influential models from these sciences assume that financial risk preferences form a stable trait. Is this assumption justified and, if not, what causes the appetite for risk to fluctuate? We have previously found that traders experience a sustained increase in the stress hormone cortisol when the amount of uncertainty, in the form of market volatility, increases. Here we ask whether these elevated cortisol levels shift risk preferences. Using a double-blind, placebo-controlled, cross-over protocol we raised cortisol levels in volunteers over 8 d to the same extent previously observed in traders. We then tested for the utility and probability weighting functions underlying their risk taking and found that participants became more risk-averse. We also observed that the weighting of probabilities became more distorted among men relative to women. These results suggest that risk preferences are highly dynamic. Specifically, the stress response calibrates risk taking to our circumstances, reducing it in times of prolonged uncertainty, such as a financial crisis. Physiology-induced shifts in risk preferences may thus be an underappreciated cause of market instability.

  18. Cortisol shifts financial risk preferences

    Science.gov (United States)

    Kandasamy, Narayanan; Hardy, Ben; Page, Lionel; Schaffner, Markus; Graggaber, Johann; Powlson, Andrew S.; Fletcher, Paul C.; Gurnell, Mark; Coates, John

    2014-01-01

    Risk taking is central to human activity. Consequently, it lies at the focal point of behavioral sciences such as neuroscience, economics, and finance. Many influential models from these sciences assume that financial risk preferences form a stable trait. Is this assumption justified and, if not, what causes the appetite for risk to fluctuate? We have previously found that traders experience a sustained increase in the stress hormone cortisol when the amount of uncertainty, in the form of market volatility, increases. Here we ask whether these elevated cortisol levels shift risk preferences. Using a double-blind, placebo-controlled, cross-over protocol we raised cortisol levels in volunteers over 8 d to the same extent previously observed in traders. We then tested for the utility and probability weighting functions underlying their risk taking and found that participants became more risk-averse. We also observed that the weighting of probabilities became more distorted among men relative to women. These results suggest that risk preferences are highly dynamic. Specifically, the stress response calibrates risk taking to our circumstances, reducing it in times of prolonged uncertainty, such as a financial crisis. Physiology-induced shifts in risk preferences may thus be an underappreciated cause of market instability. PMID:24550472

  19. Night-shift work is associated with increased pain perception.

    Science.gov (United States)

    Matre, Dagfinn; Knardahl, Stein; Nilsen, Kristian Bernhard

    2017-05-01

    Objectives The aim of the present study was to determine whether shift workers exhibit increased perception of experimentally induced pain after working night shifts. Methods The study was a paired cross-over design with two sleep conditions, after at least two nights of habitual sleep and after two consecutive night shifts at work. Fifty-three nurses in rotating shift work participated. The sensitivity to electrically induced pain, heat pain, cold pain, pressure pain and pain inhibition was determined experimentally in each sleep condition. Sleepiness and vigilance were also assessed. Results Night-shift work (NSW) increased the sensitivity to electrically induced pain and heat pain (P≤0.001). Relative to habitual sleep, electrically induced pain increased by 22.3% and heat pain increased by 26.5%. The sensitivity to cold and pressure pain did not change, changes relative to habitual sleep was 0.5). Pain inhibition was 66.9% stronger after NSW versus after habitual sleep (Peffect sizes and may be an important marker for studies comparing the physiological effects of different shift work schedules. Explanations for the differential effect on different pain modalities should be a focus for future studies.

  20. Advantages of shift changeovers with meetings: ergonomic analysis of shift supervisors' activity in aircraft building.

    Science.gov (United States)

    Le Bris, Valérie; Barthe, Béatrice; Marquié, Jean-Claude; Kerguelen, Alain; Aubert, Sophie; Bernadou, Bernadette

    2012-03-01

    Good shift changeovers contribute to ensuring continuity and reliability in shift work. In situations where production is not maintained 24 h a day, changeovers with meetings (SCM) between the two work teams (written plus oral face-to-face handovers) alternate with changeovers without meetings (SCnM; written handovers only). An ergonomic work analysis on an aircraft assembly line showed that (1) incoming and outgoing operators met during the overlap time allotted by the company, and (2) the content of the exchanges was richer for SCMs than for SCnMs. SCMs enabled the operators to pass on and process more aspects of their work than SCnMs did. SCMs also allowed incoming operators to validate their predictions, and enabled both outgoing and incoming operators to update their mental models and work together on peripheral aspects of the technical process over a greater time span. The findings highlight the importance of allowing overlap time in shift work. Copyright © 2011 Elsevier Ltd and The Ergonomics Society. All rights reserved.

  1. Reflections on shifts in the work identity of research team members

    Directory of Open Access Journals (Sweden)

    Rina A. Smith

    2015-06-01

    Full Text Available Orientation: This study explores shifts in the work identity of individual members of a research team. Research purpose: The aim of the study is to explore shifts in work identity experienced by individual research team members during a project wherein they were studying work identity themselves. Motivation for the study: This study seized the opportunity to do research on the shifts in work identify experienced by researchers whilst they were studying work identify as part of the South African–Netherlands Project for Alternatives in Development. This allowed the researcher the rather novel opportunity of conducting research on researchers and resulted in the project as a whole occurring at a dual level of analysis. Research approach, design and method: Using thematic analysis methodology in the context of qualitative field research, 10 semi-structured interviews were conducted with five participants, all of them part of the research team who were themselves involved in conducting research on work identity. The sixth member of the research team, who is also one of the authors of this article, presented data related to shifts in her own work identity in her dissertation as an autoethnographic account. For purposes of this article, she is referred to as Participant 6. Given the multiple research team members, each one of whom constituted an individual case, the researcher made use of a multiple case study approach whilst focusing on the intrinsic case. The holistic nature of description found in the case study involved every aspect of the lives of the research team members. Analysis was done by means of content analysis. Main findings: In exploring the shifts in work identity experienced by individual research team members, it was discovered that finding meaning and purpose in the professional activities participants engaged in was of critical importance. Contextual realities and the way in which individuals approached the possibility of shifts

  2. Individual differences in shift work tolerance

    NARCIS (Netherlands)

    Lammers-van der Holst, H.M.

    2016-01-01

    Shift work is a key feature of our contemporary 24/7 society, employing several successive work teams to sustain around-the-clock operations. However, numerous studies imply that frequently shifting the periods of sleep and wakefulness poses a serious threat to the shift worker’s physical, mental

  3. Shifting Cultivation : Promoting Innovative Policy and Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Shifting Cultivation : Promoting Innovative Policy and Development Options in the Eastern Himalayas. Shifting ... pressure and market forces. The idea is to share good policies and practices related to shifting cultivation and alternative options through regional exchange. ... Les chaînes de valeur comme leviers stratégiques.

  4. Tilt shift determinations with spatial-carrier phase-shift method in temporal phase-shift interferometry

    International Nuclear Information System (INIS)

    Liu, Qian; Wang, Yang; He, Jianguo; Ji, Fang; Wang, Baorui

    2014-01-01

    An algorithm is proposed to deal with tilt-shift errors in temporal phase-shift interferometry (PSI). In the algorithm, the tilt shifts are detected with the spatial-carrier phase-shift (SCPS) method and then the tilt shifts are applied as priori information to the least-squares fittings of phase retrieval. The algorithm combines the best features of the SCPS and the temporal PSI. The algorithm could be applied to interferograms of arbitrary aperture without data extrapolation for the Fourier transform is not involved. Simulations and experiments demonstrate the effectiveness of the algorithm. The statistics of simulation results show a satisfied accuracy in detecting tilt-shift errors. Comparisons of the measurements with and without environmental vibration show that the proposed algorithm could compensate tilt-shift errors and retrieve wavefront phase accurately. The algorithm provides an approach to retrieve wavefront phase for the temporal PSI in vibrating environment. (paper)

  5. Shift work disorder, depression, and anxiety in the transition to rotating shifts: the role of sleep reactivity.

    Science.gov (United States)

    Kalmbach, David A; Pillai, Vivek; Cheng, Philip; Arnedt, J Todd; Drake, Christopher L

    2015-12-01

    The aim of this study is to investigate premorbid sleep reactivity as a vulnerability to incident shift work disorder (SWD), and related changes in depression as well as anxiety following a transition to a rotating shifts work schedule. This is a longitudinal study with two waves of data collection. The community-based sample included normal sleeping non-shift workers (N = 96; 62.5% female; 47.9 ± 13.3 years) without a lifetime history of insomnia or baseline excessive daytime sleepiness who transitioned to rotating shift work one year later. Participants reported demographic characteristics, trait sleep reactivity on the Ford Insomnia Response to Stress Test, depression symptoms on the Quick Inventory of Depression Symptomatology, and anxiety symptoms on the Beck Anxiety Inventory. SWD was determined based on significant sleep disturbance and/or excessive sleepiness in the context of working in a rotating-shift schedule. Analyses revealed that the odds were over five times greater for highly sleep-reactive individuals to develop SWD after transitioning to rotating shifts (OR = 5.59, p = 0.04). Nearly 90% of participants who suffered from SWD were accurately identified as high risk at one year before disease onset. Furthermore, individuals who developed SWD reported greater increases in symptoms of depression and anxiety. Finally, analyses revealed significant indirect effects wherein high sleep reactivity increased risk for SWD, which led to greater severity of anxiety and depression symptoms. The Ford Insomnia Response to Stress Test (FIRST) accurately identifies a focused target population in which the premorbid psychobiological processes complicit in SWD onset and progression, as well as shift work-related depression and anxiety changes, can be better investigated, thus improving future preventative efforts. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Who is sleepier on the night shift? The influence of bio-psycho-social factors on subjective sleepiness of female nurses during the night shift.

    Science.gov (United States)

    Zion, Nataly; Drach-Zahavy, Anat; Shochat, Tamar

    2018-07-01

    Sleepiness is a common complaint during the night shift and may impair performance. The current study aims to identify bio-psycho-social factors associated with subjective sleepiness during the night shift. Ninety-two female nurses working rotating shifts completed a sociodemographic questionnaire, the Munich ChronoType Questionaire for shift workers, the Pittsburg Sleep Quality Index, and the Pre-sleep Arousal Scale. Subjective sleepiness was measured hourly during two night shifts using the Karolinska Sleepiness Scale, and activity monitors assessed sleep duration 24-h before each shift. Findings showed that increased sleepiness was associated with increased age in nurses with early chronotypes and with more children. High cognitive pre-sleep arousal, but not sleep, was associated with increased sleepiness, especially in late chronotypes. The impact of bio-psycho-social factors on night shift sleepiness is complex, and depends on mutual interactions between these factors. Nurses most prone to increased sleepiness must develop personal strategies for maintaining vigilance on the night shift. Practitioner Summary: This study aims to identify bio-psycho-social factors associated with subjective sleepiness of female nurses during the night shift. Increasing sleepiness was associated with increased age in nurses with early chronotypes and with more children. Increased cognitive pre-sleep arousal, but not sleep, was associated with increased sleepiness, especially in late chronotypes.

  7. The Impact of a Rigorous Multiple Work Shift Schedule and Day Versus Night Shift Work on Reaction Time and Balance Performance in Female Nurses: A Repeated Measures Study.

    Science.gov (United States)

    Thompson, Brennan J; Stock, Matt S; Banuelas, Victoria K; Akalonu, Chibuzo C

    2016-07-01

    The aim of this study was to determine the impact of a demanding work schedule involving long, cumulative work shifts on response time and balance-related performance outcomes and to evaluate the prevalence of musculoskeletal disorders between day and night shift working nurses. A questionnaire was used to identify the prevalence of past (12-month) and current (7-day) musculoskeletal disorders. Nurses worked three 12-hour work shifts in a 4-day period. Reaction time and balance tests were conducted before and after the work period. The work period induced impairments for reaction time, errors on reaction time tasks, and balance performance, independent of shift type. Musculoskeletal symptom prevalence was high in workers of both work shifts. Compressed work shifts caused performance-based fatigue in nurses. Reaction time and balance tests may be sensitive fatigue identification markers in nurses.

  8. Soil bacterial community shifts associated with sugarcane straw removal

    Science.gov (United States)

    Pimentel, Laisa; Gumiere, Thiago; Andreote, Fernando; Cerri, Carlos

    2017-04-01

    In Brazil, the adoption of the mechanical unburned sugarcane harvest potentially increase the quantity of residue left in the field after harvesting. Economically, this material has a high potential for second generation ethanol (2G) production. However, crop residues have an essential role in diverse properties and processes in the soil. The greater part of the uncertainties about straw removal for 2G ethanol production is based on its effects in soil microbial community. In this sense, it is important to identify the main impacts of sugarcane straw removal on soil microbial community. Therefore, we conducted a field study, during one year, in Valparaíso (São Paulo state - Brazil) to evaluate the effects of straw decomposition on soil bacterial community. Specifically, we wanted: i) to compare the rates of straw removal and ii) to evaluate the effects of straw decomposition on soil bacterial groups over one year. The experiment was in a randomized block design with treatments arranged in strip plot. The treatments are different rates of sugarcane straw removal, namely: no removal, 50, 75 and 100% of straw removal. Soil sampling was carried out at 0, 4, 8 and 12 months after the sugarcane harvest (August 2015). Total DNA was extracted from soil using the PowersoilTM DNA Isolation kit. And the abundance of bacterial in each soil sample was estimated via quantification of 16S rRNA gene. The composition of the bacterial communities was estimated via terminal restriction fragment length polymorphism (T-RFLP) analysis, and the T-RF sizes were performed on a 3500 Genetic Analyzer. Finally, the results were examined with GeneMapper 4.1 software. There was bacterial community shifts through the time and among the rates of sugarcane straw removal. Bacterial community was firstly determined by the time scale, which explained 29.16% of total variation. Rates of straw removal explained 11.55% of shifts on bacterial community. Distribution through the time is an important

  9. Real life working shift assignment problem

    Science.gov (United States)

    Sze, San-Nah; Kwek, Yeek-Ling; Tiong, Wei-King; Chiew, Kang-Leng

    2017-07-01

    This study concerns about the working shift assignment in an outlet of Supermarket X in Eastern Mall, Kuching. The working shift assignment needs to be solved at least once in every month. Current approval process of working shifts is too troublesome and time-consuming. Furthermore, the management staff cannot have an overview of manpower and working shift schedule. Thus, the aim of this study is to develop working shift assignment simulation and propose a working shift assignment solution. The main objective for this study is to fulfill manpower demand at minimum operation cost. Besides, the day off and meal break policy should be fulfilled accordingly. Demand based heuristic is proposed to assign working shift and the quality of the solution is evaluated by using the real data.

  10. Dynamics and computation in functional shifts

    Science.gov (United States)

    Namikawa, Jun; Hashimoto, Takashi

    2004-07-01

    We introduce a new type of shift dynamics as an extended model of symbolic dynamics, and investigate the characteristics of shift spaces from the viewpoints of both dynamics and computation. This shift dynamics is called a functional shift, which is defined by a set of bi-infinite sequences of some functions on a set of symbols. To analyse the complexity of functional shifts, we measure them in terms of topological entropy, and locate their languages in the Chomsky hierarchy. Through this study, we argue that considering functional shifts from the viewpoints of both dynamics and computation gives us opposite results about the complexity of systems. We also describe a new class of shift spaces whose languages are not recursively enumerable.

  11. Characteristics of shift work and their impact on employee performance and wellbeing: a literature review

    OpenAIRE

    Dall'ora, Chiara; Griffiths, P.; Ball, J.; Recio Saucedo, A.

    2016-01-01

    BACKGROUND: Shift work is recognised as a component of work organisation that may affect the balance between employee’s efficiency, effectiveness and wellbeing. Shift work is frequent in healthcare and for nurses in particular, as they typically comprise a large proportion of the workforce in healthcare AIM: To identify the characteristics of shift work that have an effect on employee’s performance (including job performance, productivity, safety, quality of care delivered, errors, adverse ev...

  12. Psychosocial and Physical Workload of Hotel’s Shift Worker In Yogyakarta Indonesia

    OpenAIRE

    Dewi, Luciana Triani; Yuniartha, Deny Ratna; Purnama, Ign. Luddy Indra

    2014-01-01

    Shift works are common in hospitality industries, such as hotel industries. Shift work can cause many human problems for worker, e.g. circadian rhythms, fatigue, health effects, individual factors, social and family factors, etc. The objective of the present study was to identify and examine the psychosocial and physical workload on employees working as hotel’s shift worker in Yogyakarta, Indonesia. Copenhagen Psychosocial Questionnaire (COPSOQ) which covers 18 aspects of psychosocial workloa...

  13. Simulation-based medical education: time for a pedagogical shift.

    Science.gov (United States)

    Kalaniti, Kaarthigeyan; Campbell, Douglas M

    2015-01-01

    The purpose of medical education at all levels is to prepare physicians with the knowledge and comprehensive skills, required to deliver safe and effective patient care. The traditional 'apprentice' learning model in medical education is undergoing a pedagogical shift to a 'simulation-based' learning model. Experiential learning, deliberate practice and the ability to provide immediate feedback are the primary advantages of simulation-based medical education. It is an effective way to develop new skills, identify knowledge gaps, reduce medical errors, and maintain infrequently used clinical skills even among experienced clinical teams, with the overall goal of improving patient care. Although simulation cannot replace clinical exposure as a form of experiential learning, it promotes learning without compromising patient safety. This new paradigm shift is revolutionizing medical education in the Western world. It is time that the developing countries embrace this new pedagogical shift.

  14. Optimization of protein samples for NMR using thermal shift assays

    International Nuclear Information System (INIS)

    Kozak, Sandra; Lercher, Lukas; Karanth, Megha N.; Meijers, Rob; Carlomagno, Teresa; Boivin, Stephane

    2016-01-01

    Maintaining a stable fold for recombinant proteins is challenging, especially when working with highly purified and concentrated samples at temperatures >20 °C. Therefore, it is worthwhile to screen for different buffer components that can stabilize protein samples. Thermal shift assays or ThermoFluor"® provide a high-throughput screening method to assess the thermal stability of a sample under several conditions simultaneously. Here, we describe a thermal shift assay that is designed to optimize conditions for nuclear magnetic resonance studies, which typically require stable samples at high concentration and ambient (or higher) temperature. We demonstrate that for two challenging proteins, the multicomponent screen helped to identify ingredients that increased protein stability, leading to clear improvements in the quality of the spectra. Thermal shift assays provide an economic and time-efficient method to find optimal conditions for NMR structural studies.

  15. Optimization of protein samples for NMR using thermal shift assays

    Energy Technology Data Exchange (ETDEWEB)

    Kozak, Sandra [European Molecular Biology Laboratory (EMBL), Hamburg Outstation, SPC Facility (Germany); Lercher, Lukas; Karanth, Megha N. [European Molecular Biology Laboratory (EMBL), SCB Unit (Germany); Meijers, Rob [European Molecular Biology Laboratory (EMBL), Hamburg Outstation, SPC Facility (Germany); Carlomagno, Teresa, E-mail: teresa.carlomagno@oci.uni-hannover.de [European Molecular Biology Laboratory (EMBL), SCB Unit (Germany); Boivin, Stephane, E-mail: sboivin77@hotmail.com, E-mail: s.boivin@embl-hamburg.de [European Molecular Biology Laboratory (EMBL), Hamburg Outstation, SPC Facility (Germany)

    2016-04-15

    Maintaining a stable fold for recombinant proteins is challenging, especially when working with highly purified and concentrated samples at temperatures >20 °C. Therefore, it is worthwhile to screen for different buffer components that can stabilize protein samples. Thermal shift assays or ThermoFluor{sup ®} provide a high-throughput screening method to assess the thermal stability of a sample under several conditions simultaneously. Here, we describe a thermal shift assay that is designed to optimize conditions for nuclear magnetic resonance studies, which typically require stable samples at high concentration and ambient (or higher) temperature. We demonstrate that for two challenging proteins, the multicomponent screen helped to identify ingredients that increased protein stability, leading to clear improvements in the quality of the spectra. Thermal shift assays provide an economic and time-efficient method to find optimal conditions for NMR structural studies.

  16. Evaluating amber force fields using computed NMR chemical shifts.

    Science.gov (United States)

    Koes, David R; Vries, John K

    2017-10-01

    NMR chemical shifts can be computed from molecular dynamics (MD) simulations using a template matching approach and a library of conformers containing chemical shifts generated from ab initio quantum calculations. This approach has potential utility for evaluating the force fields that underlie these simulations. Imperfections in force fields generate flawed atomic coordinates. Chemical shifts obtained from flawed coordinates have errors that can be traced back to these imperfections. We use this approach to evaluate a series of AMBER force fields that have been refined over the course of two decades (ff94, ff96, ff99SB, ff14SB, ff14ipq, and ff15ipq). For each force field a series of MD simulations are carried out for eight model proteins. The calculated chemical shifts for the 1 H, 15 N, and 13 C a atoms are compared with experimental values. Initial evaluations are based on root mean squared (RMS) errors at the protein level. These results are further refined based on secondary structure and the types of atoms involved in nonbonded interactions. The best chemical shift for identifying force field differences is the shift associated with peptide protons. Examination of the model proteins on a residue by residue basis reveals that force field performance is highly dependent on residue position. Examination of the time course of nonbonded interactions at these sites provides explanations for chemical shift differences at the atomic coordinate level. Results show that the newer ff14ipq and ff15ipq force fields developed with the implicitly polarized charge method perform better than the older force fields. © 2017 Wiley Periodicals, Inc.

  17. Overnight shift work: factors contributing to diagnostic discrepancies.

    Science.gov (United States)

    Hanna, Tarek N; Loehfelm, Thomas; Khosa, Faisal; Rohatgi, Saurabh; Johnson, Jamlik-Omari

    2016-02-01

    The aims of the study are to identify factors contributing to preliminary interpretive discrepancies on overnight radiology resident shifts and apply this data in the context of known literature to draw parallels to attending overnight shift work schedules. Residents in one university-based training program provided preliminary interpretations of 18,488 overnight (11 pm–8 am) studies at a level 1 trauma center between July 1, 2013 and December 31, 2014. As part of their normal workflow and feedback, attendings scored the reports as major discrepancy, minor discrepancy, agree, and agree--good job. We retrospectively obtained the preliminary interpretation scores for each study. Total relative value units (RVUs) per shift were calculated as an indicator of overnight workload. The dataset was supplemented with information on trainee level, number of consecutive nights on night float, hour, modality, and per-shift RVU. The data were analyzed with proportional logistic regression and Fisher's exact test. There were 233 major discrepancies (1.26 %). Trainee level (senior vs. junior residents; 1.08 vs. 1.38 %; p performance. Increased workload affected more junior residents' performance, with R3 residents performing significantly worse on busier nights. Hour of the night was not significantly associated with performance, but there was a trend toward best performance at 2 am, with subsequent decreased accuracy throughout the remaining shift hours. Improved performance occurred after the first six night float shifts, presumably as residents acclimated to a night schedule. As overnight shift work schedules increase in popularity for residents and attendings, focused attention to factors impacting interpretative accuracy is warranted.

  18. Shifted identical bands: A new phenomenon

    International Nuclear Information System (INIS)

    Jones, E.F.; Lima, A.P. de; Gore, P.M.; Hamilton, J.H.; Ramayya, A.V.; Dodder, R.S.; Kormicki, J.; Hwang, J.K.; Beyer, C.J.; Zhang, X.Q.; Zhu, S.J.; Ter-Akopian, G.M.; Oganessian, Yu.Ts.; Daniel, A.V.; Rasmussen, J.O.; Lee, I.Y.; Cole, J.D.; Drigert, M.W.; Ma, W.-C.

    2001-01-01

    The levels in 162 Gd were identified in spontaneous fission studies. Its transition energies are remarkably similar to those in 160 Gd. From that work, an analysis of yrast bands in even-even proton to neutron-rich Ba to Pb nuclei led to the discovery of a new phenomenon, shifted identical bands (SIB). SIBs are yrast bands in neighboring nuclei (a, b) with moments of inertia which are identical when shifted by a constant amount κ, so J 1a (1 + κ) = J 1b , from 2 + to 8 + and higher to 16 + . Out of over 700 comparisons, 55 SIBs were found from stable to the most neutron-rich Ce-W nuclei with |κ-bar| between 1.5% and 13%, where the spread in κ is less than ± 1%, and only four identical bands (κ-bar congruent with 0). As examples, we found for 158 Sm- 160 Gd, κ-bar (-3.2 +0.1 -0.2 )% (where the ± is the total spread in κ from -3.1 to -3.4); 156 Nd- 160 Gd, (-10.6 +0.4 -0.2 )%; 158 Sm- 160 Sm, (3.4 +0.5 -0.3 )%. The J 1 values were fitted to a variable moment of inertia model with parameters J 0 and C whose values correlate with the SIB J 1 values. The SIBs are not correlated either with deformation or with the N p N n product of the IBA model

  19. Evaluation of a well-established task-shifting initiative: the lay counselor cadre in Botswana.

    Science.gov (United States)

    Ledikwe, Jenny H; Kejelepula, Mable; Maupo, Kabelo; Sebetso, Siwulani; Thekiso, Mothwana; Smith, Monica; Mbayi, Bagele; Houghton, Nankie; Thankane, Kabo; O'Malley, Gabrielle; Semo, Bazghina-Werq

    2013-01-01

    Evidence supports the implementation of task shifting to address health worker shortages that are common in resource-limited settings. However, there is need to learn from established programs to identify ways to achieve the strongest, most sustainable impact. This study examined the Botswana lay counselor cadre, a task shifting initiative, to explore effectiveness and contribution to the health workforce. This evaluation used multiple methods, including a desk review, a national lay counselor survey (n = 385; response = 94%), in-depth interviews (n = 79), lay counselors focus group discussions (n = 7), lay counselors observations (n = 25), and client exit interviews (n = 47). Interview and focus group data indicate that lay counselors contribute to essentially all HIV-related programs in Botswana and they conduct the majority of HIV tests and related counseling at public health facilities throughout the country. Interviews showed that the lay counselor cadre is making the workload of more skilled health workers more manageable and increasing HIV acceptance in communities. The average score on a work-related knowledge test was 74.5%. However for 3 questions, less than half answered correctly. During observations, lay counselors demonstrated average competence for most skills assessed and clients (97.9%) were satisfied with services received. From the survey, lay counselors generally reported being comfortable with their duties; however, some reported clinical duties that extended beyond their training and mandate. Multiple factors affecting the performance of the lay counselors were identified, including insufficient resources, such as private counseling space and HIV test kits; and technical, administrative, and supervisory support. Lay counselors are fulfilling an important role in Botswana's healthcare system, serving as the entry point into HIV care, support, and treatment services. For this and other similar task shifting initiatives

  20. Accessible mathematics ten instructional shifts that raise student achievement

    CERN Document Server

    Leinwand, Steven

    2009-01-01

    Accessible Mathematics is Steven Leinwand's latest important book for math teachers. He focuses on the crucial issue of classroom instruction. He scours the research and visits highly effective classrooms for practical examples of small adjustments to teaching that lead to deeper student learning in math. Some of his 10 classroom-tested teaching shifts may surprise you and others will validate your thinking. But all will improve students' performance. Read Accessible Mathematics, try its 10 suggestions, and discover how minor shifts in teaching can put learning into high gear.

  1. Increased diversification rates follow shifts to bisexuality in liverworts

    DEFF Research Database (Denmark)

    Laenen, Benjamin; Machac, Antonin; Gradstein, S. Robbert

    2016-01-01

    on diversification are presumably mediated by the interplay of high fertilization rates, massive spore production and long-distance dispersal, which may separately or together have facilitated liverwort speciation, suppressed their extinction, or both. Importantly, shifts in liverwort sexual systems have...... shifts in sexual systems influence diversification using hidden state speciation and extinction analysis (HiSSE). This new method compares the effects of the variable of interest to the best-fitting latent variable, yielding robust and conservative tests. We find that the transitions in sexual systems...

  2. The design & delivery of quality services: A paradigm shift

    Directory of Open Access Journals (Sweden)

    D. B.H. Smith

    2002-12-01

    Full Text Available As result of the increasingly important role information technology (IT is playing in service provision, less person-to-person contact will in future be made during service provision. Highly skilled specialists will make the remaining contact. Emphasis will shift to speed of delivery, with logistics playing an important role. The designers of services must take these factors into account if they wish to design quality services.

  3. Non-occupational physical activity levels of shift workers compared with non-shift workers

    Science.gov (United States)

    Loef, Bette; Hulsegge, Gerben; Wendel-Vos, G C Wanda; Verschuren, W M Monique; Bakker, Marije F; van der Beek, Allard J; Proper, Karin I

    2017-01-01

    Objectives Lack of physical activity (PA) has been hypothesised as an underlying mechanism in the adverse health effects of shift work. Therefore, our aim was to compare non-occupational PA levels between shift workers and non-shift workers. Furthermore, exposure–response relationships for frequency of night shifts and years of shift work regarding non-occupational PA levels were studied. Methods Data of 5980 non-shift workers and 532 shift workers from the European Prospective Investigation into Cancer and Nutrition-Netherlands (EPIC-NL) were used in these cross-sectional analyses. Time spent (hours/week) in different PA types (walking/cycling/exercise/chores) and intensities (moderate/vigorous) were calculated based on self-reported PA. Furthermore, sports were operationalised as: playing sports (no/yes), individual versus non-individual sports, and non-vigorous-intensity versus vigorous-intensity sports. PA levels were compared between shift workers and non-shift workers using Generalized Estimating Equations and logistic regression. Results Shift workers reported spending more time walking than non-shift workers (B=2.3 (95% CI 1.2 to 3.4)), but shift work was not associated with other PA types and any of the sports activities. Shift workers who worked 1–4 night shifts/month (B=2.4 (95% CI 0.6 to 4.3)) and ≥5 night shifts/month (B=3.7 (95% CI 1.8 to 5.6)) spent more time walking than non-shift workers. No exposure–response relationships were found between years of shift work and PA levels. Conclusions Shift workers spent more time walking than non-shift workers, but we observed no differences in other non-occupational PA levels. To better understand if and how PA plays a role in the negative health consequences of shift work, our findings need to be confirmed in future studies. PMID:27872151

  4. Actigraph measures of sleep among female hospital employees working day or alternating day and night shifts.

    Science.gov (United States)

    Korsiak, Jill; Tranmer, Joan; Leung, Michael; Borghese, Michael M; Aronson, Kristan J

    2017-07-14

    Sleep disturbance is common among shift workers, and may be an important factor in the effect of shift work on chronic disease development. In this cross-sectional study, we described sleep patterns of 294 female hospital workers (142 alternating day-night shift workers, 152 day workers) and determined associations between shift work and sleep duration. Rest-activity cycles were recorded with the ActiGraph GT3X+ for 1 week. Analyses were stratified by chronotype of shift workers. Using all study days to calculate average sleep duration, shift workers slept approximately 13 min less than day workers during main sleep periods, while 24-h sleep duration did not differ between day workers and shift workers. Results from age-adjusted models demonstrated that all shift workers, regardless of chronotype, slept 20-30 min less than day workers on day shifts during main and total sleep. Early and intermediate chronotypes working night shifts slept between 114 and 125 min less than day workers, both with regard to the main sleep episode and 24-h sleep duration, while the difference was less pronounced among late chronotypes. When sleep duration on free days was compared between shift workers and day workers, only shift workers with late chronotypes slept less, by approximately 50 min, than day workers during main sleep. Results from this study demonstrate how an alternating day-night shift work schedule impacts sleep negatively among female hospital workers, and the importance of considering chronotype in sleep research among shift workers. © 2017 European Sleep Research Society.

  5. Shift work-related health problems in

    Directory of Open Access Journals (Sweden)

    S. Khavaji

    2010-04-01

    Full Text Available Background and aimsShift work is a major feature of working life that affects diverse aspects of human life. The main purposes of this study were to investigate shift work-related health problems and their risk factors among workers of "12-hour shift" schedule.MethodsThis cross-sectional study was carried out at 8 petrochemical industries in Asalooyeh area. Study population consisted of 1203 workers including 549 shift worker (46% and 654 day worker (54%. Data on personal details, shift schedule and adverse effects of shift work werecollected by anonymous questionnaire. Statistical analyses were performed using SPSS, version 11.5. The level of significance was set at 5%.ResultsAlthough, the results showed that health problems among shift workers was more prevalent than day workers, but the differences were just significant in gastrointestinal and musculoskeletal disorders (p<0.05. Multiple linear regressions indicated that in addition to shift working, other variants such as long work hours, type of employment, second job, number of children and job title were associated with health problems.ConclusionPrevalence rates of gastrointestinal and musculoskeletal problems among shift workers were significantly higher than that of day workers. Although, working in shift system was the main significant factor associated with the reported problems, but other demographic andwork variables were also found to have association.

  6. Shift work as an oxidative stressor

    Directory of Open Access Journals (Sweden)

    Pasalar Parvin

    2005-12-01

    Full Text Available Abstract Background Some medical disorders have higher prevalence in shift workers than others. This study was designed to evaluate the effect of night-shift-working on total plasma antioxidant capacity, with respect to the causative role of oxidative stress in induction of some of these disorders. Methods Two blood samples were taken from 44 workers with a rotational shift schedule, one after their day shift and one after their night shift. The total plasma antioxidant capacity of each worker was measured through the FRAP method. The impacts of age and weight were also assessed. Results The total plasma antioxidant capacity was measured in 44 shift-workers with a mean age of 36.57 years (SD: 10.18 and mean BMI of 26.06 (SD: 4.37 after their day and night shifts. The mean reduction of total plasma antioxidant capacity after the night shift was 105.8 μmol/L (SD: 146.39. Also, a significant correlation was shown between age and weight and total plasma antioxidant capacity. Age and weight were found to be inversely related to total plasma antioxidant capacity; as age and weight increased, the total plasma antioxidant capacity decreased. Conclusion Shift work can act as an oxidative stressor and may induce many medical disorders. Aging and obesity in shift workers makes them more sensitive to this hazardous effect.

  7. Red Shifts and Existing Speculations

    Science.gov (United States)

    Aisenberg, Sol

    2009-03-01

    There are many current flaws, mysteries, and errors in the standard model of the universe - all based upon speculative interpretation of many excellent and verified observations. The most serious cause of some errors is the speculation about the meaning of the redshifts observed in the 1930s by Hubble. He ascribed the redshifts as due to ``an apparent Doppler effect''. This led to speculation that the remote stars were receding, and the universe was expanding -- although without observational proof of the actual receding velocity of the stars. The age of the universe, based upon the Hubble constant is pure speculation because of lack of velocity demonstration. The belief in expansion, the big bang, and of inflation should be reexamined. Also, the redshift cannot always be used as a distance measure, particularly for photons from quasars containing massive black holes that can reduce photon energy through gravitational attraction. If the linear Hubble constant is extrapolated to the most remote super novae and beyond, it would eventually require that the corresponding photon energy go to zero or become negative -- according to Hubble linear relationship. This should require a reexamination of the meaning of the red shift and the speculative consequences and give a model with fewer mysteries.

  8. Core shift effect in blazars

    Science.gov (United States)

    Agarwal, A.; Mohan, P.; Gupta, Alok C.; Mangalam, A.; Volvach, A. E.; Aller, M. F.; Aller, H. D.; Gu, M. F.; Lähteenmäki, A.; Tornikoski, M.; Volvach, L. N.

    2017-07-01

    We studied the pc-scale core shift effect using radio light curves for three blazars, S5 0716+714, 3C 279 and BL Lacertae, which were monitored at five frequencies (ν) between 4.8 and 36.8 GHz using the University of Michigan Radio Astronomical Observatory (UMRAO), the Crimean Astrophysical Observatory (CrAO) and Metsähovi Radio Observatory for over 40 yr. Flares were Gaussian fitted to derive time delays between observed frequencies for each flare (Δt), peak amplitude (A) and their half width. Using A ∝ να, we infer α in the range of -16.67-2.41 and using Δ t ∝ ν ^{1/k_r}, we infer kr ∼ 1, employed in the context of equipartition between magnetic and kinetic energy density for parameter estimation. From the estimated core position offset (Ωrν) and the core radius (rcore), we infer that opacity model may not be valid in all cases. The mean magnetic field strengths at 1 pc (B1) and at the core (Bcore) are in agreement with previous estimates. We apply the magnetically arrested disc model to estimate black hole spins in the range of 0.15-0.9 for these blazars, indicating that the model is consistent with expected accretion mode in such sources. The power-law-shaped power spectral density has slopes -1.3 to -2.3 and is interpreted in terms of multiple shocks or magnetic instabilities.

  9. Prevalence of workers with shifts in hearing by industry: a comparison of OSHA and NIOSH Hearing Shift Criteria.

    Science.gov (United States)

    Masterson, Elizabeth A; Sweeney, Marie Haring; Deddens, James A; Themann, Christa L; Wall, David K

    2014-04-01

    The purpose of this study was to compare the prevalence of workers with National Institute for Occupational Safety and Health significant threshold shifts (NSTS), Occupational Safety and Health Administration standard threshold shifts (OSTS), and with OSTS with age correction (OSTS-A), by industry using North American Industry Classification System codes. From 2001 to 2010, worker audiograms were examined. Prevalence and adjusted prevalence ratios for NSTS were estimated by industry. NSTS, OSTS, and OSTS-A prevalences were compared by industry. Twenty percent of workers had an NSTS, 14% had an OSTS, and 6% had an OSTS-A. For most industries, the OSTS and OSTS-A criteria identified 28% to 36% and 66% to 74% fewer workers than the NSTS criteria, respectively. Use of NSTS criteria allowing for earlier detection of shifts in hearing is recommended for improved prevention of occupational hearing loss.

  10. BIAS IN THE MEASUREMENT OF QUALITY OF LIFE: RESPONSE SHIFT

    Directory of Open Access Journals (Sweden)

    Yesim SENOL

    2006-10-01

    Full Text Available Quality of Life (QoL is a descriptive term that refers to people’s emotional, social and physical wellbeing, and their ability to function in the ordinary task of living. The importance of QoL makes it critical to improve and refine measure to understand patients’ experience of health, illness and treatment. However individuals change with time and the basis on which they make a QoL judgment may also change, a phenomenon increasingly referred to as response shift. The definition of response shift is recalibration of internal standards of measurement and reconceptualization of the meaning of item. The purpose of study is to discuss the effects of response shift bias. [TAF Prev Med Bull 2006; 5(5.000: 382-389

  11. The collective Lamb shift in nuclear γ-ray superradiance

    International Nuclear Information System (INIS)

    Röhlsberger, Ralf

    2012-01-01

    The electromagnetic transitions of Mössbauer nuclei provide almost ideal two-level systems to transfer quantum optical concepts into the regime of hard x-rays. If many identical atoms collectively interact with a resonant radiation field, one observes (quantum) optical properties that are strongly different from those of a single atom. The most prominent effect is the broadening of the resonance line known as collective enhancement, resulting from multiple scattering of real photons within the atomic ensemble. On the other hand, the exchange of virtual photons within the ensemble leads to a tiny energy shift of the resonance line, the collective Lamb shift, that remained experimentally elusive for a long time after its prediction. Here we illustrate how highly brilliant synchrotron radiation allows one to prepare superradiant states of excited Mössbauer nuclei, an important condition for observation of the collective Lamb shift.

  12. Laser frequency stabilization and shifting by using modulation transfer spectroscopy

    Science.gov (United States)

    Cheng, Bing; Wang, Zhao-Ying; Wu, Bin; Xu, Ao-Peng; Wang, Qi-Yu; Xu, Yun-Fei; Lin, Qiang

    2014-10-01

    The stabilizing and shifting of laser frequency are very important for the interaction between the laser and atoms. The modulation transfer spectroscopy for the 87Rb atom with D2 line transition F = 2 → F' = 3 is used for stabilizing and shifting the frequency of the external cavity grating feedback diode laser. The resonant phase modulator with electro—optical effect is used to generate frequency sideband to lock the laser frequency. In the locking scheme, circularly polarized pump- and probe-beams are used. By optimizing the temperature of the vapor, the pump- and probe-beam intensity, the laser linewidth of 280 kHz is obtained. Furthermore, the magnetic field generated by a solenoid is added into the system. Therefore the system can achieve the frequency locking at any point in a range of hundreds of megahertz frequency shifting with very low power loss.

  13. How important is importance for prospective memory? A review

    Directory of Open Access Journals (Sweden)

    Stefan eWalter

    2014-06-01

    Full Text Available Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover, we address the relationship between importance and other factors known to affect prospective memory and ongoing task performance such as type of prospective memory task (time-, event- or activity-based, cognitive loads, and cue focality. Finally, we provide a connection to motivation, we summarize the effects of task importance and we identify important venues for future research.

  14. How important is importance for prospective memory? A review

    Science.gov (United States)

    Walter, Stefan; Meier, Beat

    2014-01-01

    Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover, we address the relationship between importance and other factors known to affect prospective memory and ongoing task performance such as type of prospective memory task (time-, event-, or activity-based), cognitive loads, and processing overlaps. Finally, we provide a connection to motivation, we summarize the effects of task importance and we identify important venues for future research. PMID:25018743

  15. The STAR ESL, electronic shift and handover log

    Energy Technology Data Exchange (ETDEWEB)

    Hajdu, L; Lauret, J, E-mail: lbhajdu@bnl.gov

    2008-07-01

    Keeping a clear and accurate experiment log is important for any scientific experiment. The concept is certainly not new but keeping accurate while useful records for a Nuclear Physics experiment such as the Solenoidal Tracker at the Relativistic Heavy Ion Collider (STAR at RHIC) is not a priori a simple matter - STAR operates 24 hours a day for six months out of the year with more than 24 shift crews operating 16 different subsystems (some located remotely). To meet the challenge of not only logging the information but passing it in a concise manner from one shift to another, the STAR experiment has designed an Electronic Shift-Log (ESL), a flexible application written in Java and interfacing with the Data Acquisition tools, Quality Assurance reporting, Online shift crews or remote personnel and experts as well as including features such as shift change-over (or handover) forms, tailored to the sub-group of interest. We will present an overview of STAR's Electronic Log, a system that is clear, reliable, safe, consistent, easy to use and globally viewable in real time with secure connections.

  16. Regional Distribution Shifts Help Explain Local Changes in Wintering Raptor Abundance: Implications for Interpreting Population Trends

    OpenAIRE

    Paprocki, Neil; Heath, Julie A.; Novak, Stephen J.

    2014-01-01

    Studies of multiple taxa across broad-scales suggest that species distributions are shifting poleward in response to global climate change. Recognizing the influence of distribution shifts on population indices will be an important part of interpreting trends within management units because current practice often assumes that changes in local populations reflect local habitat conditions. However, the individual- and population-level processes that drive distribution shifts may occur across a ...

  17. What Do We Know About Base Erosion and Profit Shifting? A Review of the Empirical Literature

    OpenAIRE

    Dhammika Dharmapala

    2014-01-01

    The issue of tax-motivated income shifting within multinational firms has attracted increasing global attention in recent years. It is of central importance to many current policy debates, including those related to recent initiatives by the OECD on base erosion and profit shifting (BEPS) and to proposals for US tax reform in a territorial direction. This paper provides a survey of the empirical literature on tax-motivated income-shifting within multinational firms. Its emphasis is on clarify...

  18. [Cancer and nutrition - a paradigma shift].

    Science.gov (United States)

    Imoberdorf, R; Rühlin, M; Ballmer, P E

    2017-08-01

    Substantial international differences in the prevalence of cancer disease suppose that nutrition may be an important factor in the development of cancer. Many experts believe, that nutritional factors may contribute up to 35 % to the development of malignant tumors. Many patients have lost substantial body weight already at the time of the diagnosis of the disease as consequence of undernutrition and malnutrition, respectively. During the course of the disease the nutritional status often is deteriorating further. Caused by both the cancer disease itself and the treatment, loss of appetite, changes in taste, nausea and vomiting may additionally contribute to undernutrition. Undernutrition is a relevant factor for the outcome of the disease and for the tolerance of the treatment as well. Therefore, supporting the heavily impaired patients in nutritional intake is of paramount importance and an urgent task for physicians and nurses. In view of physiology, pathophysiology, genetics and molecular biology, metabolic processes in cancer are highly complex regulated and there is increasing evidence that a diet rich in fat and protein is favourable. This, however, implies a paradigma shift away from the "healthy" balanced diet rich in fruit, vegetable and complex carbohydrates. So far, the evidence based data of this new concept is, however, a controversial issue. Georg Thieme Verlag KG Stuttgart · New York.

  19. Shifted excitation Raman difference spectroscopy for authentication of cheese and cheese analogues

    Science.gov (United States)

    Sowoidnich, Kay; Kronfeldt, Heinz-Detlef

    2016-04-01

    Food authentication and the detection of adulterated products are recent major issues in the food industry as these topics are of global importance for quality control and food safety. To effectively address this challenge requires fast, reliable and non-destructive analytical techniques. Shifted Excitation Raman Difference Spectroscopy (SERDS) is well suited for identification purposes as it combines the chemically specific information obtained by Raman spectroscopy with the ability for efficient fluorescence rejection. The two slightly shifted excitation wavelengths necessary for SERDS are realized by specially designed microsystem diode lasers. At 671 nm the laser (optical power: 50 mW, spectral shift: 0.7 nm) is based on an external cavity configuration whereas an emission at 783 nm (optical power: 110 mW, spectral shift: 0.5 nm) is achieved by a distributed feedback laser. To investigate the feasibility of SERDS for rapid and nondestructive authentication purposes four types of cheese and three different cheese analogues were selected. Each sample was probed at 8 different positions using integration times of 3-10 seconds and 10 spectra were recorded at each spot. Principal components analysis was applied to the SERDS spectra revealing variations in fat and protein signals as primary distinction criterion between cheese and cheese analogues for both excitation wavelengths. Furthermore, to some extent, minor compositional differences could be identified to discriminate between individual species of cheese and cheese analogues. These findings highlight the potential of SERDS for rapid food authentication potentially paving the way for future applications of portable SERDS systems for non-invasive in situ analysis.

  20. Cost effective shift schedules enhance utility operations

    International Nuclear Information System (INIS)

    Coleman, R.M.

    1995-01-01

    This article describes how new shift scheduling concepts can save utility operations millions of dollars every year and yet maintain safety and improve employee morale. The key to scheduling is to define and match the work load. This includes discretionary as well as daily, weekly, and yearly core work loads. In most power plants the overall work load (including maintenance, operations, materials handling, etc.) on day shift is greater than on other shifts, hence an unbalanced schedule would be appropriate

  1. Stochastic dynamical models for ecological regime shifts

    DEFF Research Database (Denmark)

    Møller, Jan Kloppenborg; Carstensen, Jacob; Madsen, Henrik

    the physical and biological knowledge of the system, and nonlinearities introduced here can generate regime shifts or enhance the probability of regime shifts in the case of stochastic models, typically characterized by a threshold value for the known driver. A simple model for light competition between...... definition and stability of regimes become less subtle. Ecological regime shifts and their modeling must be viewed in a probabilistic manner, particularly if such model results are to be used in ecosystem management....

  2. Time Zones, Shift Working and International Outsourcing

    OpenAIRE

    Matsuoka, Yuji; Fukushima, Marcelo

    2009-01-01

    We build a trade model with two identical countries located in different time zones and a monopolistically competitive sector of which production requires differentiated goods produced in two successive stages. We introduce shift working disutility and allow consumers to choose between day and night shifts. Shift working disutility raises the cost of night production and firms can reduce costs by “virtually” outsourcing foreign labor. We found that firms only outsource if relat...

  3. Examining paid sickness absence by shift workers.

    Science.gov (United States)

    Catano, V M; Bissonnette, A B

    2014-06-01

    Shift workers are at greater risk than day workers with respect to psychological and physical health, yet little research has linked shift work to increased sickness absence. To investigate the relationship between shift work and sickness absence while controlling for organizational and individual characteristics and shift work attributes that have confounded previous research. The study used archive data collected from three national surveys in Canada, each involving over 20000 employees and 6000 private-sector firms in 14 different occupational groups. The employees reported the number of paid sickness absence days in the past 12 months. Data were analysed using both chi-squared statistics and hierarchical regressions. Contrary to previous research, shift workers took less paid sickness absence than day workers. There were no differences in the length of the sickness absence between both groups or in sickness absence taken by female and male workers whether working days or shifts. Only job tenure, the presence of a union in the workplace and working rotating shifts predicted sickness absence in shift workers. The results were consistent across all three samples. In general, shift work does not seem to be linked to increased sickness absence. However, such associations may be true for specific industries. Male and female workers did not differ in the amount of sickness absence taken. Rotating shifts, regardless of industry, predicted sickness absence among shift workers. Consideration should be given to implementing scheduled time off between shift changes. © The Author 2014. Published by Oxford University Press on behalf of the Society of Occupational Medicine. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  4. Gas transmission : a paradigm shift

    International Nuclear Information System (INIS)

    Cornelson, D.W.

    1997-01-01

    The evolution of energy markets in North America was discussed. The investment opportunities that are possible in a deregulated energy market, be it in production or in the generation of energy commodities, in the development of midstream infrastructure, or in the provision of energy services, were outlined. Deregulation of crude oil, natural gas and electricity has resulted in significant changes in the structure of energy markets and the way in which customers are served. One of the advantages of competition regarding power generation is that it has turned energy into a commodity which has resulted in greater customer choice and efficiency. As one example of midstream infrastructure development, the Alliance Pipeline project was described. This project was conceived as a means to enhance the value of western Canadian natural gas. The 1,900 mile pipeline will run from British Columbia, through Alberta into Chicago where it will interconnect with the North American gas transmission grid. The pipeline is an efficient means of transporting energy from Western Canada to North American markets, and Alliance, as a lowest cost transporter, will continue to put pressure on the traditional infrastructure to become even more competitive at the margin. As such, Alliance represents a paradigm shift in energy transportation, and serves as an excellent example of the type of investment opportunity that a deregulated market can provide. It was suggested that innovation and competition in a deregulated North American energy market will continue to increase. As electricity is deregulated, the energy market will respond more quickly to changes in supply and demand than it did in the past, in an effort to satisfy the needs of investors and customers. This will provide increased opportunities for restructuring and further competition

  5. Exploring the effects of task shifting for HIV through a systems thinking lens: the case of Burkina Faso.

    Science.gov (United States)

    Yaya Bocoum, Fadima; Kouanda, Seni; Kouyaté, Bocar; Hounton, Sennen; Adam, Taghreed

    2013-10-22

    While the impact of task shifting on quality of care and clinical outcomes has been demonstrated in several studies, evidence on its impact on the health system as a whole is limited. This study has two main objectives. The first is to conceptualize the wider range of effects of task shifting through a systems thinking lens. The second is to explore these effects using task shifting for HIV in Burkina Faso as a case study. We used a case study approach, using qualitative research methods. Data sources included document reviews, reviews of available data and records, as well as interviews with key informants and health workers. In addition to the traditional measures of impact of task shifting on health outcomes, our study identified 20 possible effects of the strategy on the system as a whole. Moreover, our analysis highlighted the importance of differentiating between two types of health systems effects. The first are effects inherent to the task shifting strategy itself, such as job satisfaction or better access to health services. The second are effects due to health system barriers, for example the unavailability of medicines and supplies, generating a series of effects on the various components of the health system, e.g., staff frustration.Among the health systems effects that we found are positive, mostly unintended, effects and synergies such as increased health workers' sense of responsibility and worthiness, increased satisfaction due to using the newly acquired skills in other non-HIV tasks, as well as improved patient-provider relationships. Among the negative unintended effects are staff frustration due to lack of medicines and supplies or lack of the necessary infrastructure to be able to perform the new tasks. Our analysis highlights the importance of adopting a systems thinking approach in designing, implementing and evaluating health policies to mitigate some of the design issues or system bottle-necks that may impede their successful implementation

  6. Goos-Haenchen shift in complex crystals

    Energy Technology Data Exchange (ETDEWEB)

    Longhi, Stefano; Della Valle, Giuseppe; Staliunas, Kestutis [Dipartimento di Fisica, Politecnico di Milano, Piazza Leonardo da Vinci 32, I-20133 Milano (Italy); Departament de Fisica i Enginyeria Nuclear, Instituci Catalana de Recerca i Estudis Avanats (ICREA), Universitat Politcnica de Catalunya, Colom 11, E-08222 Terrassa, Barcelona (Spain)

    2011-10-15

    The Goos-Haenchen (GH) effect for wave scattering from complex PT-symmetric periodic potentials (complex crystals) is theoretically investigated, with specific reference to optical GH shift in photonic crystal slabs with a sinusoidal periodic modulation of both real and imaginary parts of the dielectric constant. The analysis highlights some distinct and rather unique features as compared to the GH shift found in ordinary crystals. In particular, as opposed to GH shift in ordinary crystals, which is large at the band gap edges, in complex crystals the GH shift can be large inside the reflection (amplification) band and becomes extremely large as the PT symmetry-breaking threshold is approached.

  7. Reduced Tolerance to Night Shift in Chronic Shift Workers: Insight From Fractal Regulation.

    Science.gov (United States)

    Li, Peng; Morris, Christopher J; Patxot, Melissa; Yugay, Tatiana; Mistretta, Joseph; Purvis, Taylor E; Scheer, Frank A J L; Hu, Kun

    2017-07-01

    Healthy physiology is characterized by fractal regulation (FR) that generates similar structures in the fluctuations of physiological outputs at different time scales. Perturbed FR is associated with aging and age-related pathological conditions. Shift work, involving repeated and chronic exposure to misaligned environmental and behavioral cycles, disrupts circadian coordination. We tested whether night shifts perturb FR in motor activity and whether night shifts affect FR in chronic shift workers and non-shift workers differently. We studied 13 chronic shift workers and 14 non-shift workers as controls using both field and in-laboratory experiments. In the in-laboratory study, simulated night shifts were used to induce a misalignment between the endogenous circadian pacemaker and the sleep-wake cycles (ie, circadian misalignment) while environmental conditions and food intake were controlled. In the field study, we found that FR was robust in controls but broke down in shift workers during night shifts, leading to more random activity fluctuations as observed in patients with dementia. The night shift effect was present even 2 days after ending night shifts. The in-laboratory study confirmed that night shifts perturbed FR in chronic shift workers and showed that FR in controls was more resilience to the circadian misalignment. Moreover, FR during real and simulated night shifts was more perturbed in those who started shift work at older ages. Chronic shift work causes night shift intolerance, which is probably linked to the degraded plasticity of the circadian control system. © Sleep Research Society 2017. Published by Oxford University Press on behalf of the Sleep Research Society. All rights reserved. For permissions, please e-mail journals.permissions@oup.com.

  8. Attitudes towards rotating shift work in clinical nurses: a Q-methodology study.

    Science.gov (United States)

    Ha, Eun-Ho

    2015-09-01

    To identify clinical nurses' attitudes towards rotating shift work. Many hospitals worldwide employ rotating shift work patterns to staff their facilities. Attitudes of clinical nurses towards rotating shift work vary. To understand clinical nurses' attitudes towards rotating shift work, Q-methodology, a method for the analysis of subjective viewpoints with the strengths of both qualitative and quantitative methods, was used. Forty-six selected Q-statements from each of the 39 participants were classified into a normal distribution using an 11-point bipolar scale. The collected data were analysed using pc-QUANL program. Three discrete factors emerged as follows: factor I (rotating shift work is frustrating: objectionable perspective), factor II (rotating shift work is satisfactory: constructive perspective) and factor III (rotating shift work is problematic, but necessary: ambivalent perspective). The subjective viewpoints of the three identified factors can be applied in developing various roster designs for nurses engaging in rotating shift work. The findings provide the baseline for nurse leaders in helping nurses adjust and deal with rotating shift work. © 2015 John Wiley & Sons Ltd.

  9. Rotating shift work associated with obesity in men from northeastern Ontario.

    Science.gov (United States)

    Grundy, Anne; Cotterchio, Michelle; Kirsh, Victoria A; Nadalin, Victoria; Lightfoot, Nancy; Kreiger, Nancy

    2017-08-01

    While some studies have suggested associations between shift work and obesity, few have been population-based or considered multiple shift schedules. Since obesity is linked with several chronic health conditions, understanding which types of shift work influence obesity is important and additional work with more detailed exposure assessment of shift work is warranted. Using multivariate polytomous logistic regression, we investigated the associations between shift work (evening/night, rotating and other shift schedules) and overweight and obesity as measured by body mass index cross-sectionally among 1561 men. These men had previously participated as population controls in a prostate cancer case-control study conducted in northeastern Ontario from 1995 to 1999. We obtained information on work history (including shift work), height and weight from the existing self-reported questionnaire data. We observed an association for ever (vs. never) having been employed in rotating shift work for both the overweight (OR [odds ratio] = 1.34; 95% CI [confidence interval]: 1.05-1.73) and obese (OR = 1.57; 95% CI: 1.12-2.21) groups. We also observed nonsignificant associations for ever (vs. never) having been employed in permanent evening/night shifts. In addition, we found a significant trend of increased risk for both overweight and obesity with increasing duration of rotating shift work. Both the positive association between rotating shift work and obesity and the suggested positive association for permanent evening/night shift work in this study are consistent with previous findings. Future population-based research that is able to build on our results while examining additional shift work characteristics will further clarify whether some shift patterns have a greater impact on obesity than others.

  10. Rotating shift work associated with obesity in men from northeastern Ontario

    Directory of Open Access Journals (Sweden)

    Anne Grundy

    2017-08-01

    Full Text Available Introduction: While some studies have suggested associations between shift work and obesity, few have been population-based or considered multiple shift schedules. Since obesity is linked with several chronic health conditions, understanding which types of shift work influence obesity is important and additional work with more detailed exposure assessment of shift work is warranted. Methods: Using multivariate polytomous logistic regression, we investigated the associations between shift work (evening/night, rotating and other shift schedules and overweight and obesity as measured by body mass index cross-sectionally among 1561 men. These men had previously participated as population controls in a prostate cancer case-control study conducted in northeastern Ontario from 1995 to 1999. We obtained information on work history (including shift work, height and weight from the existing self-reported questionnaire data. Results: We observed an association for ever (vs. never having been employed in rotating shift work for both the overweight (OR [odds ratio] = 1.34; 95% CI [confidence interval]: 1.05–1.73 and obese (OR = 1.57; 95% CI: 1.12–2.21 groups. We also observed nonsignificant associations for ever (vs. never having been employed in permanent evening/night shifts. In addition, we found a significant trend of increased risk for both overweight and obesity with increasing duration of rotating shift work. Conclusion: Both the positive association between rotating shift work and obesity and the suggested positive association for permanent evening/night shift work in this study are consistent with previous findings. Future population-based research that is able to build on our results while examining additional shift work characteristics will further clarify whether some shift patterns have a greater impact on obesity than others.

  11. Monitoring of the sleep patterns of shift workers in the automotive industry.

    Science.gov (United States)

    Kawada, Tomoyuki; Shimizu, Takako; Kuratomi, Yushiro; Suto, Sachiko; Kanai, Tomoe; Nishime, Akemi; Nakano, Noriko

    2011-01-01

    The effect of shift schedules on the amount of sleep that workers receive is an important factor in workplace health and safety as well as the employees' overall quality of life. The objective of this study is to compare sleep period among workers engaging in each of the three-shift work. The amount of sleep (sleep period) that male workers with rotating shift schedules received was measured using accelerometers. The mean age of the 16 male workers enrolled in this study was 54.3 years (one standard deviation, 6.7 years). Thirteen participants ranged in age from 51 to 60 years of age, and the other three participants were 32, 48, and 50 years old. Work shifts were rotated on a weekly basis and were categorized into three periods: shift-1 (8:00 to 17:00), shift-2 (15:00 to 23:50), and shift-3 (23:30 to 8:15). Each work week consisted of 5 days. No significant differences were observed in the mean sleep period for each of the three shifts. However, the sleep periods during shift-1 or shift-2 tended to be longer than that obtained during shift-3. No effect of age on the length of the sleep period was observed. Rotating shift-work did not affect the amount of sleep that workers obtained. However, a comparison with previous study results suggests that morning shifts (starting at 6 AM) and day shifts (starting at 8 AM) may have different effects on sleep time.

  12. Primary selection into shift work and change of cardiovascular risk profile.

    Science.gov (United States)

    Yong, Mei; Germann, Christina; Lang, Stefan; Oberlinner, Christoph

    2015-05-01

    A potential "healthy shift worker effect" may bias the studied effect of shift work on health. The observed differences among shift and day workers in health behavior and health outcomes can be caused by: (i) primary selection, (ii) the influence from the shift work-related environment, and (iii) the impact of shift work. We aimed to study these potential sources. A cohort of 4754 male trainees who had finished their professional training and started their career in production in a chemical company between 1995 and 2012 was identified. Among them, 1348 (28%) were involved in rotating shift work and 3406 (72%) in day work. Information on health behavior and risk factors for cardiovascular diseases was retrieved from the medical examinations. This information was then compared (i) at the beginning of training, (ii) at the end of training, and (iii) 3 years after the employment, in relation to the working time. At the beginning of the training, the prevalence of smokers was higher among future shift workers (26% versus 21%), from 1995 to 2012. During the training and the first three years of employment, a marginal decline of systolic blood pressure and an elevation of triglyceride were related with shift work. No difference was found with respect to other risk factors for cardiovascular diseases. Our findings do not support a primary selection in favor of shift workers. An impact of shift work on the risk profile of cardiovascular diseases was not indicated in the observation period.

  13. Fixed or Rotating Night Shift Work Undertaken by Women: Implications for Fertility and Miscarriage.

    Science.gov (United States)

    Fernandez, Renae C; Marino, Jennifer L; Varcoe, Tamara J; Davis, Scott; Moran, Lisa J; Rumbold, Alice R; Brown, Hannah M; Whitrow, Melissa J; Davies, Michael J; Moore, Vivienne M

    2016-03-01

    This review summarizes the evidence concerning effects of night shift work on women's reproductive health, specifically difficulty in conceiving and miscarriage. We distinguish between fixed night shift and rotating night shift, as the population subgroups exposed, the social and biological mechanisms, and the magnitude of effects are likely to differ; of note, women working fixed night shift are known to have high tolerance for this schedule. We identified two relevant systematic reviews with meta-analyses and five additional studies. Night shift work may give rise to menstrual cycle disturbances, but effect sizes are imprecise. Endometriosis may be elevated in night shift workers, but evidence is only preliminary. Adequate data are lacking to assess associations between night shift work and infertility or time to pregnancy. The weight of evidence begins to point to working at night, whether in fixed or rotating shifts, as a risk factor for miscarriage. There are many methodological problems with this literature, with substantial variation in the definitions of night shift and schedule types making comparisons between studies difficult and pooling across studies questionable. Nevertheless, there appears to be grounds for caution and counselling where women have concerns about night shift work and their reproductive health. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

  14. Effects of extended work shifts and shift work on patient safety, productivity, and employee health.

    Science.gov (United States)

    Keller, Simone M

    2009-12-01

    It is estimated 1.3 million health care errors occur each year and of those errors 48,000 to 98,000 result in the deaths of patients (Barger et al., 2006). Errors occur for a variety of reasons, including the effects of extended work hours and shift work. The need for around-the-clock staff coverage has resulted in creative ways to maintain quality patient care, keep health care errors or adverse events to a minimum, and still meet the needs of the organization. One way organizations have attempted to alleviate staff shortages is to create extended work shifts. Instead of the standard 8-hour shift, workers are now working 10, 12, 16, or more hours to provide continuous patient care. Although literature does support these staffing patterns, it cannot be denied that shifts beyond the traditional 8 hours increase staff fatigue, health care errors, and adverse events and outcomes and decrease alertness and productivity. This article includes a review of current literature on shift work, the definition of shift work, error rates and adverse outcomes related to shift work, health effects on shift workers, shift work effects on older workers, recommended optimal shift length, positive and negative effects of shift work on the shift worker, hazards associated with driving after extended shifts, and implications for occupational health nurses. Copyright 2009, SLACK Incorporated.

  15. Identifying future competitive business strategies for the U.S. furniture industry: Benchmarking and paradigm shifts

    Science.gov (United States)

    Albert Schuler; Urs Buehlmann

    2003-01-01

    This paper describes benchmarking activities undertaken to provide a basis for comparing the U.S. wood furniture industry with other nations that have a globally competitive furniture manufacturing industry. The second part of this paper outlines and discusses strategies that have the potential to help the U.S. furniture industry survive and thrive in a global business...

  16. Scheduling nurses’ shifts at PGI Cikini Hospital

    Science.gov (United States)

    Nainggolan, J. C. T.; Kusumastuti, R. D.

    2018-03-01

    Hospitals play an essential role in the community by providing medical services to the public. In order to provide high quality medical services, hospitals must manage their resources (including nurses) effectively and efficiently. Scheduling of nurses’ work shifts, in particular, is crucial, and must be conducted carefully to ensure availability and fairness. This research discusses the job scheduling system for nurses in PGI Cikini Hospital, Jakarta with Goal Programming approach. The research objectives are to identify nurse scheduling criteria and find the best schedule that can meet the criteria. The model has hospital regulations (including government regulations) as hard constraints, and nurses’ preferences as soft constraints. We gather primary data (hospital regulations and nurses’ preferences) through interviews with three Head Nurses and distributing questionnaires to fifty nurses. The results show that on the best schedule, all hard constraints can be satisfied. However, only two out of four soft constraints are satisfied. Compared to current scheduling practice, the resulting schedule ensures the availability of nurses as it satisfies all hospital’s regulations and it has a higher level of fairness as it can accommodate some of the nurses’ preferences.

  17. Forest production responses to irrigation and fertilization are not explained by shifts in allocation

    Science.gov (United States)

    David R. Coyle; Mark D. Coleman

    2005-01-01

    Production increases in intensively managed forests have been obtained by improving resource availability through water and nutrient amendments. Increased stem production has been attributed to shifts in growth from roots to shoot, and such shifts would have important implications for below ground carbon sequestration. We examined above and below ground growth and...

  18. How does a modal shift from short car trips to cycling affect road safety?

    NARCIS (Netherlands)

    Schepers, J. P.; Heinen, E.

    Governments aim to promote a shift from car to bicycle, but concerns about road safety seem to represent an important argument against this encouragement. This study examines the road safety impact of a modal shift from short car trips to cycling in Dutch municipalities. The road safety effect is

  19. Nuclear polarization contribution to the Lamb-shift in heavy atoms

    International Nuclear Information System (INIS)

    Plunien, G.; Mueller, B.; Greiner, W.

    1988-08-01

    The energy shift of the 1s 1/2 -state in 238 92 U due to virtual excitation of nuclear rotational modes is shown to be considerable correction for atomic high precision experiments. In contrast to this nuclear polarization effects are of minor importance for Lamb-shift studies in 208 82 Pb. (orig.)

  20. Age-related differences in the control of weight-shifting within the surface of support

    NARCIS (Netherlands)

    de Vries, E.; Caljouw, S.R.; Coppens, M.J.M.; Postema, K.; Verkerke, Gijsbertus Jacob; Lamoth, C.J.C.

    2014-01-01

    BACKGROUND AND AIM: An important reason for falling in elderly is incorrect weight-shifting¹. In many daily life activities quick and accurate weight-shifting is needed to maintain balance, especially in situations when balance is suddenly disturbed and anticipation on the upcoming movement is

  1. Sleep Strategies of Night-Shift Nurses on Days Off: Which Ones are Most Adaptive?

    Science.gov (United States)

    Petrov, Megan E; Clark, C Brendan; Molzof, Hylton E; Johnson, Russell L; Cropsey, Karen L; Gamble, Karen L

    2014-01-01

    To determine the off-shift sleep strategies of bi-ethnic night-shift nurses, the relationship between these sleep strategies and adaptation to shift work, and identify the participant-level characteristics associated with a given sleep strategy. African-American and non-Hispanic White female, night-shift nurses from an academic hospital were recruited to complete a survey on sleep-wake patterns (n = 213). Participants completed the standard shiftwork index and the biological clocks questionnaire to determine sleep strategies and adaptation to night-shift work. In addition, chronotype was determined quantitatively with a modified version of the Munich ChronoType Questionnaire. Most participants worked ~3 consecutive 12-h night-shifts followed by several days off. Five sleep strategies used on days off were identified: (a) night stay, (b) nap proxy, (c) switch sleeper, (d) no sleep, and (e) incomplete switcher. Nap proxy and no sleep types were associated with poorer adaptation to night-shift work. The switch sleeper and incomplete switcher types were identified as more adaptive strategies that were associated with less sleep disturbance, a later chronotype, and less cardiovascular problems. Behavioral sleep strategies are related to adaptation to a typical night-shift schedule among hospital nurses. Nurses are crucial to the safety and well-being of their patients. Therefore, adoption of more adaptive sleep strategies may reduce sleep/wake dysregulation in this population, and improve cardiovascular outcomes.

  2. Shifting problems and shifting policies to reduce student drop-out

    DEFF Research Database (Denmark)

    Jørgensen, Christian Helms

    2016-01-01

    , as well as the policies that have been implemented in pursuit of improving student retention. The review identifies two pervasive ways in which the drop-out problem has been framed in both policy and research. The first locates the drop-out problem with individual students, while the second locates...... finds that the rate of student drop-out has been a cause for ongoing concern among policy makers for more than a century, and that the framing of the problem has shifted considerably over time. The problem has variously been placed with the individual apprentice, the basic structure of vocational......Education policy generally places a premium on raising the level of education attained by the young generation ultimately heading towards the labour market. While the rate of enrolment in post-compulsory education has risen in most countries, so too has the rate of drop-out, in particular from...

  3. Nonradioactive RNA mobility shift with chemiluminescent detection ...

    African Journals Online (AJOL)

    hesham

    RNA mobility shift is one among many procedures used to study RNA-protein interaction. Yet, there are some limitations for the radioactive RNA mobility shift including; 1) the risk of using radiolabeled nucleotides, 2) the long time to get the results; this could range from days to weeks, and 3) its high cost as compared to ...

  4. Pole Inflation - Shift Symmetry and Universal Corrections

    NARCIS (Netherlands)

    Broy, Benedict J.; Galante, Mario; Roest, Diederik; Westphal, Alexander

    2015-01-01

    An appealing explanation for the Planck data is provided by inflationary models with a singular non-canonical kinetic term: a Laurent expansion of the kinetic function translates into a potential with a nearly shift-symmetric plateau in canonical fields. The shift symmetry can be broken at large

  5. Machiavellianism, Discussion Time, and Group Shift

    Science.gov (United States)

    Lamm, Helmut; Myers, David G.

    1976-01-01

    Social-emotional and rational-cognitive explanations of group risky shift on choice dilemmas (hypothetical life situations) were evaluated by comparing shift in groups of low Mach (emotional) and high Mach (non-emotional) subjects. Effects of Machiavellian beliefs on social functioning are examined. Group composition was not observed to affect…

  6. Gain Shift Corrections at Chi-Nu

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Tristan Brooks [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Univ. of Massachusetts, Lowell, MA (United States). Dept. of Physics and Applied Physics; Devlin, Matthew James [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-08-30

    Ambient conditions have the potential to cause changes in liquid scintillator detector gain that vary with time and temperature. These gain shifts can lead to poor resolution in both energy as well as pulse shape discrimination. In order to correct for these shifts in the Chi-Nu high energy array, a laser system has been developed for calibration of the pulse height signals.

  7. Lamb Shift in Nonrelativistic Quantum Electrodynamics.

    Science.gov (United States)

    Grotch, Howard

    1981-01-01

    The bound electron self-energy or Lamb shift is calculated in nonrelativistic quantum electrodynamics. Retardation is retained and also an interaction previously dropped in other nonrelativistic approaches is kept. Results are finite without introducing a cutoff and lead to a Lamb shift in hydrogen of 1030.9 MHz. (Author/JN)

  8. Shifting identities : the musician as theatrical perfomer

    NARCIS (Netherlands)

    Hübner, Falk

    2013-01-01

    The artistic PhD research "Shifting Identities" investigates the musicians' professional identity and how this identity might shift when musicians start acting as theatrical performers. In most of the theatrical situations where musicians "perform", their profession is extended by additional tasks

  9. Social Change and Language Shift: South Africa.

    Science.gov (United States)

    Kamwangamalu, Nkonko M.

    2003-01-01

    Examines language shift from majority African languages, such as Sotho, Xhosa, and Zulu to English in South Africa. Examines the extent to which sociopolitical changes that have taken place in South Africa have impacted everyday linguistic interaction and have contributed to language shift from the indigenous African language to English,…

  10. Hippocampal theta frequency shifts and operant behaviour

    NARCIS (Netherlands)

    Lopes da Silva, F.H.; Kamp, A.

    1. 1. A shift of hippocampal dominant theta frequency to 6 c/sec has been demonstrated in the post-reward period in two dogs, which occurs consistently related in time to a well defined behavioural pattern in the course of an operant conditioning paradigm. 2. 2. The frequency shift was detected and

  11. Lambda shifted photonic crystal cavity laser

    DEFF Research Database (Denmark)

    Schubert, Martin; Skovgård, Troels Suhr; Ek, Sara

    2010-01-01

    We propose and demonstrate an alternative type of photonic crystal laser design that shifts all the holes in the lattice by a fixed fraction of the targeted emission wavelength. The structures are realized in InGaAsP =1.15 with InGaAsP quantum wells =1.52 as gain material. Cavities with shifts of...

  12. Multiscale regime shifts and planetary boundaries

    NARCIS (Netherlands)

    Hughes, T.P.; Carpenter, S.; Rockstrom, J.; Scheffer, M.; Walker, B.

    2013-01-01

    Life on Earth has repeatedly displayed abrupt and massive changes in the past, and there is no reason to expect that comparable planetary-scale regime shifts will not continue in the future. Different lines of evidence indicate that regime shifts occur when the climate or biosphere transgresses a

  13. The role of Amazonian anthropogenic soils in shifting cultivation: learning from farmers' rationales

    Directory of Open Access Journals (Sweden)

    André B. Junqueira

    2016-03-01

    Full Text Available We evaluated farmers' rationales to understand their decision making in relation to the use of fertile anthropogenic soils, i.e., Amazonian dark earths (ADE, and for dealing with changes in shifting cultivation in Central Amazonia. We analyzed qualitative information from 196 interviews with farmers in 21 riverine villages along the Madeira River. In order to decide about crop management options to attain their livelihood objectives, farmers rely on an integrated and dynamic understanding of their biophysical and social environment. Farmers associate fallow development with higher crop yields and lower weed pressure, but ADE is always associated with high yields and high weeding requirements. Amazonian dark earths are also seen as an opportunity to grow different crops and/or grow crops in more intensified management systems. However, farmers often maintain simultaneously intensive swiddens on ADE and extensive swiddens on nonanthropogenic soils. Farmers acknowledge numerous changes in their socioeconomic environment that affect their shifting cultivation systems, particularly their growing interaction with market economies and the incorporation of modern agricultural practices. Farmers considered that shifting cultivation systems on ADE tend to be more prone to changes leading to intensification, and we identified cases, e.g., swiddens used for watermelon cultivation, in which market demand led to overintensification and resulted in ADE degradation. This shows that increasing intensification can be a potential threat to ADE and can undermine the importance of these soils for agricultural production, for the conservation of agrobiodiversity, and for local livelihoods. Given that farmers have an integrated knowledge of their context and respond to socioeconomic and agro-ecological changes in their environment, we argue that understanding farmers' knowledge and rationales is crucial to identify sustainable pathways for the future of ADE and of

  14. Shifting mindsets: a realist synthesis of evidence from self-management support training.

    Science.gov (United States)

    Davies, Freya; Wood, Fiona; Bullock, Alison; Wallace, Carolyn; Edwards, Adrian

    2018-03-01

    Accompanying the growing expectation of patient self-management is the need to ensure health care professionals (HCPs) have the required attitudes and skills to provide effective self-management support (SMS). Results from existing training interventions for HCPs in SMS have been mixed and the evidence base is weaker for certain settings, including supporting people with progressive neurological conditions (PNCs). We set out to understand how training operates, and to identify barriers and facilitators to training designed to support shifts in attitudes amongst HCPs. We undertook a realist literature synthesis focused on: (i) the influence of how HCPs, teams and organisations view and adopt self-management; and (ii) how SMS needs to be tailored for people with PNCs. A traditional database search strategy was used alongside citation tracking, grey literature searching and stakeholder recommendations. We supplemented PNC-specific literature with data from other long-term conditions. Key informant interviews and stakeholder advisory group meetings informed the synthesis process. Realist context-mechanism-outcome configurations were generated and mapped onto the stages described in Mezirow's Transformative Learning Theory. Forty-four original articles were included (19 relating to PNCs), from which seven refined theories were developed. The theories identified important training elements (evidence provision, building skills and confidence, facilitating reflection and generating empathy). The significant influence of workplace factors as possible barriers or facilitators was highlighted. Embracing SMS often required challenging traditional professional role boundaries. The integration of SMS into routine care is not an automatic outcome from training. A transformative learning process is often required to trigger the necessary mindset shift. Training should focus on how individual HCPs define and value SMS and how their work context (patient group and organisational

  15. Shift work and age in the offshore petroleum industry

    OpenAIRE

    Waage, Siri; Pallesen, Ståle; Moen, Bente Elisabeth; Bjorvatn, Bjørn

    2010-01-01

    Background. Shift work is associated with sleep and health problems. Tolerance to shift work is reported to decrease with age. Shift work tolerance should be considered in different shift work populations. The aim of the study was to examine the relationship between age, shift work exposure, shift type, and morningness and sleep/health problems in oil rig shift workers. Material and methods. A total of 199 workers participated. They worked either two weeks of 12-h day shifts (n = 96) or tw...

  16. Does workplace health promotion reach shift workers?

    DEFF Research Database (Denmark)

    Nabe-Nielsen, Kirsten; Garde, Anne Helene; Clausen, Thomas

    2015-01-01

    OBJECTIVES: One reason for health disparities between shift and day workers may be that workplace health promotion does not reach shift workers to the same extent as it reaches day workers. This study aimed to investigate the association between shift work and the availability of and participation...... in workplace health promotion. METHODS: We used cross-sectional questionnaire data from a large representative sample of all employed people in Denmark. We obtained information on the availability of and participation in six types of workplace health promotion. We also obtained information on working hours, ie......). RESULTS: In the general working population, fixed evening and fixed night workers, and employees working variable shifts including night work reported a higher availability of health promotion, while employees working variable shifts without night work reported a lower availability of health promotion...

  17. Doppler interpretation of quasar red shifts.

    Science.gov (United States)

    Zapolsky, H S

    1966-08-05

    The hypothesis that the quasistellar sources (quasars) are local objects moving with velocities close to the speed of light is examined. Provided there is no observational cutoff on apparent bolometric magnitude for the quasars, the transverse Doppler effect leads to the expectation of fewer blue shifts than red shifts for an isotropic distribution of velocities. Such a distribution also yields a function N(z), the number of objects with red shift less than z which is not inconsistent with the present data. On the basis of two extreme assumptions concerning the origin of such rapidly moving sources, we computed curves of red shift plotted against magnitude. In particular, the curve obtained on the assumption that the quasars originated from an explosion in or nearby our own galaxy is in as good agreement with the observations as the curve of cosmological red shift plotted against magnitude.

  18. Depression in hemodialysis patients: the role of dialysis shift

    Directory of Open Access Journals (Sweden)

    Flavio Teles

    2014-03-01

    Full Text Available OBJECTIVE: Depression is the most important neuropsychiatric complication in chronic kidney disease because it reduces quality of life and increases mortality. Evidence demonstrating the association between dialysis shift and depression is lacking; thus, obtaining such evidence was the main objective of this study. METHOD: This cross-sectional study included patients attending a hemodialysis program. Depression was diagnosed using Beck's Depression Inventory. Excessive daytime sleepiness was evaluated using the Epworth Sleepiness Scale. RESULTS: A total of 96 patients were enrolled (55 males, age 48±14 years. Depression and excessive daytime sleepiness were observed in 42.7% and 49% of the patients, respectively. When comparing variables among the three dialysis shifts, there were no differences in age, dialysis vintage, employment status, excessive daytime sleepiness, hemoglobin, phosphorus levels, or albumin levels. Patients in the morning shift were more likely to live in rural areas (p<0.0001, although patients in rural areas did not have a higher prevalence of depression (p= 0.30. Patients with depression were more likely to be dialyzed during the morning shift (p= 0.008. Independent risk factors for depression were age (p<0.03, lower levels of hemoglobin (p<0.01 and phosphorus (p<0.01, and dialysis during the morning shift (p= 0.0009. The hospitalization risk of depressive patients was 4.5 times higher than that of nondepressive patients (p<0.008. CONCLUSION: These data suggest that depression is associated with dialysis shift, higher levels of phosphorus, and lower levels of hemoglobin. The results highlight the need for randomized trials to determine whether this association occurs by chance or whether circadian rhythm disorders may play a role.

  19. Shift work, light at night, and the risk of breast cancer.

    Science.gov (United States)

    Reed, Virginia A

    2011-01-01

    Studies of the effect of shift work have identified several negative health outcomes, most notably breast cancer. Disruption of circadian rhythm by exposure to light at night has been identified as the mechanism likely responsible for this outcome. This article recommends that health care institutions work with occupational health nurses to develop and implement hazard communication and policies concerning shift work, exposure to light at night, and increased risk for negative health outcomes, particularly breast cancer. 2011, SLACK Incorporated.

  20. The impact of night-shift work on platelet function in healthy medical staff.

    Science.gov (United States)

    Nakao, Tomoko; Yasumoto, Atsushi; Tokuoka, Suzumi; Kita, Yoshihiro; Kawahara, Takuya; Daimon, Masao; Yatomi, Yutaka

    2018-04-18

    Rotating shift work has been reported to increase the risk of cardiovascular diseases. Vascular endothelial dysfunction and platelet activation are among the leading causes of thrombus formation in patients with myocardial infarction or stroke. Endothelial function has been shown to be impaired immediately after night-shift work; however, it is not known whether platelets are also activated. The aim of this study was to investigate the acute impact of night-shift work on platelet function. This observational study included 11 healthy medical staff members (seven women, median age 32 years). We examined each subject's platelet aggregation rates and the serum concentrations of eicosanoid mediators after night-shift work and on day-shift work without preceding night-shift work (baseline). Platelet aggregation did not differ from baseline levels after night-shift work. However, serum cyclooxygenase (COX)-metabolized eicosanoid mediators, particularly thromboxane (Tx) B 2 (a stable metabolite of TxA 2 and the most important marker of platelet activation), were significantly higher after the night-shift than at baseline (median 65.3 vs 180.4 ng/ml). Although platelet aggregation did not increase, there was an increase in serum COX-metabolized eicosanoid mediators such as TxB 2 in healthy medical staff after night-shift work. This platelet hypersensitivity may be one of the mechanisms underlying the significant association between night-shift work and adverse cardiovascular outcomes.

  1. Sleep and need for recovery in shift workers: do chronotype and age matter?

    Science.gov (United States)

    van de Ven, Hardy A; van der Klink, Jac J L; Vetter, Céline; Roenneberg, Till; Gordijn, Marijke; Koolhaas, Wendy; de Looze, Michiel P; Brouwer, Sandra; Bültmann, Ute

    2016-01-01

    This study examined associations of chronotype and age with shift-specific assessments of main sleep duration, sleep quality and need for recovery in a cross-sectional study among N = 261 industrial shift workers (96.6% male). Logistic regression analyses were used, adjusted for gender, lifestyle, health, nap behaviour, season of assessment and shift schedule. Shift workers with latest versus earliest chronotype reported a shorter sleep duration (OR 11.68, 95% CI 3.31-41.17) and more awakenings complaints (OR 4.84, 95% CI 4.45-11.92) during morning shift periods. No associations were found between chronotype, sleep and need for recovery during evening and night shift periods. For age, no associations were found with any of the shift-specific outcome measures. The results stress the importance of including the concept of chronotype in shift work research and scheduling beyond the concept of age. Longitudinal research using shift-specific assessments of sleep and need for recovery are needed to confirm these results. Chronotype seems to better explain individual differences in sleep than age. In view of ageing societies, it might therefore be worthwhile to further examine the application of chronotype for individualised shift work schedules to facilitate healthy and sustainable employment.

  2. Development of a personal obligation to shift electricity use: Initial determinants and maintenance over time

    Energy Technology Data Exchange (ETDEWEB)

    Linz, D.; Heberlein, T.

    1984-03-01

    The present study is an attempt to determine if the beliefs which underly the formation of an obligation to shift electricity use among household consumers also contribute to maintenance of the obligation over time. Utility customer beliefs about and obligation toward shifting electricity use in their households from on-peak to off-peak times were examined in 1977, when the customers had no behavioral experience with electricity shifting. In 1979, after two years of experience with shifting appliance use from on-peak to off-peak times, customers were again surveyed and the same variables measured. The results indicated that the formation of a feeling of obligation to shift electricity in 1977 use was marginally dependent on other beliefs. By 1979, these variables were completely supplanted by the subjects' self-perception of their shifting behavior. While cognitive variables are important in the initial formation of a personal obligation to engage in shifting electricity use, the perpetuation of a feeling of obligation to shift over a period of years depends on perception of how often electricity shifting was undertaken and how much electricity had been shifted from on- to off-peak times.

  3. The Atmospheric Oxidation of Volatile Organic Compounds Through Hydrogen Shift Reactions

    DEFF Research Database (Denmark)

    Knap, Hasse Christian

    a radical is denoted as a H-shift reaction. Quantum chemical calculations were carried out to investigate the potential energy surface of the H-shift reactions and the subsequent decomposition pathways. The transition state theory including the Eckart quantum tunneling correction have been used to calculate...... the reaction rate constants of the H-shift reactions. The autoxidation of volatile organic compounds is an important oxidation mechanism that produces secondary organic aerosols (SOA) and recycles hydroxyl (OH) radicals. The autoxidation cycle produces a second generation peroxy radical (OOQOOH) through...... a series of H-shift reactions and O2 attachments. I have investigated the H-shift reactions in two OOQOOH radicals (hydroperoxy peroxy radicals and hydroperoxy acyl peroxy radicals). The H-shift reaction rate constants have been compared with the bimolecular reaction rate constants of the peroxy radicals...

  4. Identifying airborne fungi in Seoul, Korea using metagenomics.

    Science.gov (United States)

    Oh, Seung-Yoon; Fong, Jonathan J; Park, Myung Soo; Chang, Limseok; Lim, Young Woon

    2014-06-01

    Fungal spores are widespread and common in the atmosphere. In this study, we use a metagenomic approach to study the fungal diversity in six total air samples collected from April to May 2012 in Seoul, Korea. This springtime period is important in Korea because of the peak in fungal spore concentration and Asian dust storms, although the year of this study (2012) was unique in that were no major Asian dust events. Clustering sequences for operational taxonomic unit (OTU) identification recovered 1,266 unique OTUs in the combined dataset, with between 223᾿96 OTUs present in individual samples. OTUs from three fungal phyla were identified. For Ascomycota, Davidiella (anamorph: Cladosporium) was the most common genus in all samples, often accounting for more than 50% of all sequences in a sample. Other common Ascomycota genera identified were Alternaria, Didymella, Khuskia, Geosmitha, Penicillium, and Aspergillus. While several Basidiomycota genera were observed, Chytridiomycota OTUs were only present in one sample. Consistency was observed within sampling days, but there was a large shift in species composition from Ascomycota dominant to Basidiomycota dominant in the middle of the sampling period. This marked change may have been caused by meteorological events. A potential set of 40 allergy-inducing genera were identified, accounting for a large proportion of the diversity present (22.5᾿7.2%). Our study identifies high fungal diversity and potentially high levels of fungal allergens in springtime air of Korea, and provides a good baseline for future comparisons with Asian dust storms.

  5. Lamb shift in quantum electrodynamics (semiclassical theory)

    International Nuclear Information System (INIS)

    Blaive, B.; Boudet, R.

    1989-01-01

    This paper aims to bring some arguments to the proof of the Barut and Van Huele formula, which gives the Lamb shift in the semi-classical theory model: by shortening the calculation owing to the use of a decomposition of the self-potential of the electron; by eliminating the appeal to a divergent series; by bringing justifications and clarifications on some important points of the proof. The effective calculation of the coefficients of the formula is achieved for some of them, and the general analytical form of these coefficients is explicited. It is also proved that the B. and V.H. formula must give results at least as close to the experiment as those of the Bethe formula, which is obtained in Quantum Theory of Fields. Finally one shows that the B. and V.H. formula provides a justification de facto for the cut-off which is used for associating finite numbers to the divergent integrals of the Bethe formula [fr

  6. Scheduling Aircraft Landings under Constrained Position Shifting

    Science.gov (United States)

    Balakrishnan, Hamsa; Chandran, Bala

    2006-01-01

    Optimal scheduling of airport runway operations can play an important role in improving the safety and efficiency of the National Airspace System (NAS). Methods that compute the optimal landing sequence and landing times of aircraft must accommodate practical issues that affect the implementation of the schedule. One such practical consideration, known as Constrained Position Shifting (CPS), is the restriction that each aircraft must land within a pre-specified number of positions of its place in the First-Come-First-Served (FCFS) sequence. We consider the problem of scheduling landings of aircraft in a CPS environment in order to maximize runway throughput (minimize the completion time of the landing sequence), subject to operational constraints such as FAA-specified minimum inter-arrival spacing restrictions, precedence relationships among aircraft that arise either from airline preferences or air traffic control procedures that prevent overtaking, and time windows (representing possible control actions) during which each aircraft landing can occur. We present a Dynamic Programming-based approach that scales linearly in the number of aircraft, and describe our computational experience with a prototype implementation on realistic data for Denver International Airport.

  7. Identifiability in stochastic models

    CERN Document Server

    1992-01-01

    The problem of identifiability is basic to all statistical methods and data analysis, occurring in such diverse areas as Reliability Theory, Survival Analysis, and Econometrics, where stochastic modeling is widely used. Mathematics dealing with identifiability per se is closely related to the so-called branch of ""characterization problems"" in Probability Theory. This book brings together relevant material on identifiability as it occurs in these diverse fields.

  8. Permutation importance: a corrected feature importance measure.

    Science.gov (United States)

    Altmann, André; Toloşi, Laura; Sander, Oliver; Lengauer, Thomas

    2010-05-15

    In life sciences, interpretability of machine learning models is as important as their prediction accuracy. Linear models are probably the most frequently used methods for assessing feature relevance, despite their relative inflexibility. However, in the past years effective estimators of feature relevance have been derived for highly complex or non-parametric models such as support vector machines and RandomForest (RF) models. Recently, it has been observed that RF models are biased in such a way that categorical variables with a large number of categories are preferred. In this work, we introduce a heuristic for normalizing feature importance measures that can correct the feature importance bias. The method is based on repeated permutations of the outcome vector for estimating the distribution of measured importance for each variable in a non-informative setting. The P-value of the observed importance provides a corrected measure of feature importance. We apply our method to simulated data and demonstrate that (i) non-informative predictors do not receive significant P-values, (ii) informative variables can successfully be recovered among non-informative variables and (iii) P-values computed with permutation importance (PIMP) are very helpful for deciding the significance of variables, and therefore improve model interpretability. Furthermore, PIMP was used to correct RF-based importance measures for two real-world case studies. We propose an improved RF model that uses the significant variables with respect to the PIMP measure and show that its prediction accuracy is superior to that of other existing models. R code for the method presented in this article is available at http://www.mpi-inf.mpg.de/ approximately altmann/download/PIMP.R CONTACT: altmann@mpi-inf.mpg.de, laura.tolosi@mpi-inf.mpg.de Supplementary data are available at Bioinformatics online.

  9. [Sleep quality of nurses working in shifts - Hungarian adaptation of the Bergen Shift Work Sleep Questionnaire].

    Science.gov (United States)

    Fusz, Katalin; Tóth, Ákos; Fullér, Noémi; Müller, Ágnes; Oláh, András

    2015-12-06

    Sleep disorders among shift workers are common problems due to the disturbed circadian rhythm. The Bergen Shift Work Sleep Questionnaire assesses discrete sleep problems related to work shifts (day, evening and night shifts) and rest days. The aim of the study was to develop the Hungarian version of this questionnaire and to compare the sleep quality of nurses in different work schedules. 326 nurses working in shifts filled in the questionnaire. The authors made convergent and discriminant validation of the questionnaire with the Athens Insomnia Scale and the Perceived Stress Questionnaire. The questionnaire based on psychometric characteristics was suitable to assess sleep disorders associated with shift work in a Hungarian sample. The frequency of discrete symptoms significantly (pshifts. Nurses experienced the worst sleep quality and daytime fatigue after the night shift. Nurses working in irregular shift system had worse sleep quality than nurses working in regular and flexible shift system (pworking in shifts should be assessed with the Hungarian version of the Bergen Shift Work Sleep Questionnaire on a nationally representative sample, and the least burdensome shift system could be established.

  10. Non-occupational physical activity levels of shift workers compared with non-shift workers

    NARCIS (Netherlands)

    Loef, Bette; Hulsegge, Gerben; Wendel-Vos, G C Wanda; Verschuren, W M Monique; Vermeulen, Roel C H; Bakker, Marije F.; van der Beek, Allard J.; Proper, Karin I

    2017-01-01

    OBJECTIVES: Lack of physical activity (PA) has been hypothesised as an underlying mechanism in the adverse health effects of shift work. Therefore, our aim was to compare non-occupational PA levels between shift workers and non-shift workers. Furthermore, exposure-response relationships for

  11. Shift work a reality in life and health nurses

    Directory of Open Access Journals (Sweden)

    Mª Mercedes Gago López

    2013-05-01

    Full Text Available The need to provide care 24 hours of the day, 365 days of the year, means for nurses, compulsory work in a system of rotating shifts, including the realization of nights. This system has repercussions on the life, health and well-being of nurses.In order to identify evidence on the relationship between the work to shift and/or night the health and well-being of nurses and develop recommendations to improve the adaptation to the system of rotating shifts and/or night, have carried out a review of the literature.After detailed analysis of the literature, we can conclude that the quality of the care provided is in direct relation to the health and well-being of the nursing professional. Implement measures to reduce the physical, psychic, social and family wear must be priority, being necessary to educate professionals, families, society and business. Among the recommendations highlight, those directed to the company; set realistic goals, to reduce workloads in the night shift adapting them to the actual number of nurses, flexible schedules and recommendations addressed to the professional related: diet, sleep, exercise, family life and social hygiene. The implementation of these measures will mean: increase satisfaction, reduce absenteeism, increase productivity, reduce the number of errors and decrease spending.

  12. Shift from bird to butterfly pollination in Clivia (Amaryllidaceae).

    Science.gov (United States)

    Kiepiel, Ian; Johnson, Steven D

    2014-01-01

    Pollinator shifts have been implicated as a driver of divergence in angiosperms. We tested the hypothesis that there was a transition from bird- to butterfly pollination in the African genus Clivia (Amaryllidaceae) and investigated how floral traits may have been either modified or retained during this transition. We identified pollinators using field observations, correlations between lepidopteran wing scales and pollen on stigmas, and single-visit and selective exclusion experiments. We also quantified floral rewards and advertising traits. The upright trumpet-shaped flowers of C. miniata were found to be pollinated effectively by swallowtail butterflies during both nectar-feeding and brush visits. These butterflies transfer pollen on their wings, as evidenced by positive correlations between wing scales and pollen loads on stigmas. All other Clivia species have narrow pendulous flowers that are visited by sunbirds. Selective exclusion of birds and large butterflies from flowers of two Clivia species resulted in a significant decline in seed production. From the distribution of pollination systems on available phylogenies, it is apparent that a shift took place from bird- to butterfly pollination in Clivia. This shift was accompanied by the evolution of trumpet-shaped flowers, smaller nectar volume, and emission of scent, while flower color and nectar chemistry do not appear to have been substantially modified. These results are consistent with the idea that pollinator shifts can explain major floral modifications during plant diversification.

  13. Investigation of Innervation Zone Shift with Continuous Dynamic Muscle Contraction

    Directory of Open Access Journals (Sweden)

    Ken Nishihara

    2013-01-01

    Full Text Available Innervation zone (IZ has been identified as the origin of action potential propagation in isometric contraction. However, IZ shifts with changes in muscle length during muscle activity. The IZ shift has been estimated using raw EMG signals. This study aimed to investigate the movement of IZ location during continuous dynamic muscle contraction, using a computer program. Subjects flexed their elbow joint as repetitive dynamic muscle contractions. EMG signals were recorded from the biceps brachii muscle using an eight-channel surface electrode array. Approximately 100 peaks from EMG signals were detected for each channel and summed to estimate the IZ location. For each subject, the estimated IZ locations were subtracted from the IZ location during isometric contractions with the elbow flexed at 90°. The results showed that the IZ moved significantly with elbow joint movement from 45° to 135°. However, IZ movement was biased with only a 3.9 mm IZ shift on average when the elbow angle was acute but a 16 mm IZ shift on average when it was obtuse. The movement of IZ location during continuous dynamic muscle contraction can be investigated using this signal processing procedure without subjective judgment.

  14. Sleep loss and circadian disruption in shift work: health burden and management.

    Science.gov (United States)

    Rajaratnam, Shantha M W; Howard, Mark E; Grunstein, Ronald R

    2013-10-21

    About 1.5 million Australians are shift workers. Shift work is associated with adverse health, safety and performance outcomes. Circadian rhythm misalignment, inadequate and poor-quality sleep, and sleep disorders such as sleep apnoea, insomnia and shift work disorder (excessive sleepiness and/or insomnia temporally associated with the work schedule) contribute to these associations. Falling asleep at work at least once a week occurs in 32%-36% of shift workers. Risk of occupational accidents is at least 60% higher for non-day shift workers. Shift workers also have higher rates of cardiometabolic diseases and mood disturbances. Road and workplace accidents related to excessive sleepiness, to which shift work is a significant contributor, are estimated to cost $71-$93 billion per annum in the United States. There is growing evidence that understanding the interindividual variability in sleep-wake responses to shift work will help detect and manage workers vulnerable to the health consequences of shift work. A range of approaches can be used to enhance alertness in shift workers, including screening and treating sleep disorders, melatonin treatment to promote sleep during the daytime, and avoidance of inappropriate use of sedatives and wakefulness-promoters such as modafinil and caffeine. Short naps, which minimise sleep inertia, are generally effective. Shifting the circadian pacemaker with appropriately timed melatonin and/or bright light may be used to facilitate adjustment to a shift work schedule in some situations, such as a long sequence of night work. It is important to manage the health risk of shift workers by minimising vascular risk factors through dietary and other lifestyle approaches.

  15. Split-shift work in relation to stress, health and psychosocial work factors among bus drivers.

    Science.gov (United States)

    Ihlström, Jonas; Kecklund, Göran; Anund, Anna

    2017-01-01

    Shift work has been associated with poor health, sleep and fatigue problems and low satisfaction with working hours. However, one type of shift working, namely split shifts, have received little attention. This study examined stress, health and psychosocial aspects of split-shift schedules among bus drivers in urban transport. A questionnaire was distributed to drivers working more than 70% of full time which 235 drivers in total answered. In general, drivers working split-shift schedules (n = 146) did not differ from drivers not working such shifts (n = 83) as regards any of the outcome variables that were studied. However, when individual perceptions towards split-shift schedules were taken into account, a different picture appeared. Bus drivers who reported problems working split shifts (36%) reported poorer health, higher perceived stress, working hours interfering with social life, lower sleep quality, more persistent fatigue and lower general work satisfaction than those who did not view split shifts as a problem. Moreover, drivers who reported problems with split shifts also perceived lower possibilities to influence working hours, indicating lower work time control. This study indicates that split shifts were not associated with increased stress, poorer health and adverse psychosocial work factors for the entire study sample. However, the results showed that individual differences were important and approximately one third of the drivers reported problems with split shifts, which in turn was associated with stress, poor health and negative psychosocial work conditions. More research is needed to understand the individual and organizational determinants of tolerance to split shifts.

  16. Investigation Effect of Shift Work on Job Burnout and Depression, Anxiety, Stress Scale in Military Personnel

    Directory of Open Access Journals (Sweden)

    Ayoub Ghanbary Sartang

    2018-06-01

    Full Text Available Shift work has been recognized as an important tool for organizing of work in developing countries. The disturbed depression, stress accident are the most common health‐related effects of shift work. The military personnel shift worker during work, are exposed to stress and psychological pressure that certainly affect the efficiency of their work. The aim of this study was to Investigation Effect of shift work on job burnout and Depression, Anxiety, Stress Scale in military personnel. This cross-sectional study was carried out on 100 military personnel male in Southern Iran. Respondents were divided into two groups based on their working schedule (50 shift work personnel / 50 day work personnel. Data collection tools were a Depression, Anxiety, and Stress Scale (DASS-21, demographic characteristics and Maslach job burnout questionnaire. Convenience sampling was used as sampling method. Finally, Data analysis was performed with SPSS (version 20, descriptive statistics, One Way Anova test, ANCOVA and t-independent test. The results of showed that shift work has an impact on burnout and DASS-21 and mean obtained score for DASS-21 and job burnout in shift workers are more day work individuals. Analysis of variance test showed significant difference between job burnout in day workers and shift workers and job burnout were more in shift workers. Also significant difference between DASS-21 in day workers and shift workers and DASS-21 was more in shift workers. This study showed that shift work has an impact on burnout and scale DASS-21 shall is taken to Intervention actions in shift works.

  17. From Metrosexual to Retrosexual: The Importance of Shifting Male Gender Roles to Feminism

    OpenAIRE

    Anderson, Katherine Noel

    2008-01-01

    The study of gender in feminism should not only concentrate on female gender roles and queer transgressions of established gender roles, but should also include an in-depth discussion on male gender roles as they exist in society. This paper focuses on the metrosexual and the retrosexual trends which have recently affected the male gender role in society. The emergence of the metrosexual in the 1990s through 2005 was a profound change in the traditional male gender role which allowed men to ...

  18. Regime shifts in shallow lakes: the importance of seasonal fish migration

    DEFF Research Database (Denmark)

    Brönmark, Christer; Brodersen, Jakob; Chapman, Ben B.

    2010-01-01

    . Our earlier research shows that a large proportion of zooplanktivorous fish populations in shallow lakes undertake seasonal migrations where they leave the lake during winter and migrate back to the lake in spring. Based on our past research, we propose a number of scenarios of how feedback processes...... properties, including piscivore abundance and zooplankton productivity, affect the individual state of zooplanktivorous fish, such as growth rate or condition. Individual state, in turn, affects the relative proportion and timing of migrating zooplanktivorous fish. This change, in turn, may stabilize states...... between the individual and ecosystem levels may affect stability of alternative stable states in shallow lakes when mediated by fish migration. Migration effects on shallow lakes result from processes at different scales, from the individual to the ecosystem. Our earlier research has shown that ecosystem...

  19. Shape-Shifting Droplet Networks.

    Science.gov (United States)

    Zhang, T; Wan, Duanduan; Schwarz, J M; Bowick, M J

    2016-03-11

    We consider a three-dimensional network of aqueous droplets joined by single lipid bilayers to form a cohesive, tissuelike material. The droplets in these networks can be programed to have distinct osmolarities so that osmotic gradients generate internal stresses via local fluid flows to cause the network to change shape. We discover, using molecular dynamics simulations, a reversible folding-unfolding process by adding an osmotic interaction with the surrounding environment which necessarily evolves dynamically as the shape of the network changes. This discovery is the next important step towards osmotic robotics in this system. We also explore analytically and numerically how the networks become faceted via buckling and how quasi-one-dimensional networks become three dimensional.

  20. SHIFTING POSITIONS ON HOPE VALUE

    Directory of Open Access Journals (Sweden)

    Grzesik Chris

    2017-09-01

    Full Text Available The aim of this article is to shed some light on the difficulty, and at the same time, the unavoidable change towards the embracing by valuers in Poland, of one of the most fundamental principles of property valuation, being “highest and best use” and “hope value”. Both are inherently linked to the interpretation of “market value”. The article offers a detailed analysis of international practice and the most important developments concerning professional standards for property valuers in Poland. The considerations presented herein focus mostly on issues arising out of the interpretation of “market value”. While the legal wording of its Polish definition could be considered similar to the one presented in internationally recognised valuation standards, Polish practice concerning assumptions about the use of a property at the date of valuation is very different.

  1. Non-occupational physical activity levels of shift workers compared with non-shift workers.

    Science.gov (United States)

    Loef, Bette; Hulsegge, Gerben; Wendel-Vos, G C Wanda; Verschuren, W M Monique; Vermeulen, Roel C H; Bakker, Marije F; van der Beek, Allard J; Proper, Karin I

    2017-05-01

    Lack of physical activity (PA) has been hypothesised as an underlying mechanism in the adverse health effects of shift work. Therefore, our aim was to compare non-occupational PA levels between shift workers and non-shift workers. Furthermore, exposure-response relationships for frequency of night shifts and years of shift work regarding non-occupational PA levels were studied. Data of 5980 non-shift workers and 532 shift workers from the European Prospective Investigation into Cancer and Nutrition-Netherlands (EPIC-NL) were used in these cross-sectional analyses. Time spent (hours/week) in different PA types (walking/cycling/exercise/chores) and intensities (moderate/vigorous) were calculated based on self-reported PA. Furthermore, sports were operationalised as: playing sports (no/yes), individual versus non-individual sports, and non-vigorous-intensity versus vigorous-intensity sports. PA levels were compared between shift workers and non-shift workers using Generalized Estimating Equations and logistic regression. Shift workers reported spending more time walking than non-shift workers (B=2.3 (95% CI 1.2 to 3.4)), but shift work was not associated with other PA types and any of the sports activities. Shift workers who worked 1-4 night shifts/month (B=2.4 (95% CI 0.6 to 4.3)) and ≥5 night shifts/month (B=3.7 (95% CI 1.8 to 5.6)) spent more time walking than non-shift workers. No exposure-response relationships were found between years of shift work and PA levels. Shift workers spent more time walking than non-shift workers, but we observed no differences in other non-occupational PA levels. To better understand if and how PA plays a role in the negative health consequences of shift work, our findings need to be confirmed in future studies. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  2. MR chemical shift imaging of human atheroma

    International Nuclear Information System (INIS)

    Mohiaddin, R.H.; Underwood, R.; Firmin, D.; Abdulla, A.K.; Rees, S.; Longmore, D.

    1988-01-01

    The lipid content of atheromatous plaques has been measured with chemical shift MR imaging by taking advantage of the different resonance frequencies of protons in lipid and water. Fifteen postmortem aortic specimens of the human descending aorta and the aortae of seven patients with documented peripheral vascular disease were studied at 0.5 T. Spin-echo images were used to localize the lesions before acquisition of the chemical shift images. The specimens were examined histologically, and the lipid distribution in the plaque showed good correlation with the chemical shift data. Validation in vivo and clinical applications remain to be established

  3. Giant Lamb shift in photonic crystals

    International Nuclear Information System (INIS)

    Wang Xuehua; Kivshar, Yuri S.; Gu Benyuan

    2004-01-01

    We obtain a general result for the Lamb shift of excited states of multilevel atoms in inhomogeneous electromagnetic structures and apply it to study atomic hydrogen in inverse-opal photonic crystals. We find that the photonic-crystal environment can lead to very large values of the Lamb shift, as compared to the case of vacuum. We also suggest that the position-dependent Lamb shift should extend from a single level to a miniband for an assembly of atoms with random distribution in space, similar to the velocity-dependent Doppler effect in atomic/molecular gases

  4. Forecasting interest rates with shifting endpoints

    DEFF Research Database (Denmark)

    Van Dijk, Dick; Koopman, Siem Jan; Wel, Michel van der

    2014-01-01

    We consider forecasting the term structure of interest rates with the assumption that factors driving the yield curve are stationary around a slowly time-varying mean or ‘shifting endpoint’. The shifting endpoints are captured using either (i) time series methods (exponential smoothing) or (ii......) long-range survey forecasts of either interest rates or inflation and output growth, or (iii) exponentially smoothed realizations of these macro variables. Allowing for shifting endpoints in yield curve factors provides substantial and significant gains in out-of-sample predictive accuracy, relative...... to stationary and random walk benchmarks. Forecast improvements are largest for long-maturity interest rates and for long-horizon forecasts....

  5. Search for Higgs shifts in white dwarfs

    Energy Technology Data Exchange (ETDEWEB)

    Onofrio, Roberto [Dipartimento di Fisica e Astronomia " Galileo Galilei," Università di Padova, Via Marzolo 8, I-35131 Padova (Italy); Wegner, Gary A., E-mail: onofrior@gmail.com, E-mail: gary.a.wegner@dartmouth.edu [Department of Physics and Astronomy, Dartmouth College, 6127 Wilder Laboratory, Hanover, NH 03755 (United States)

    2014-08-20

    We report on a search for differential shifts between electronic and vibronic transitions in carbon-rich white dwarfs BPM 27606 and Procyon B. The absence of differential shifts within the spectral resolution and taking into account systematic effects such as space motion and pressure shifts allows us to set the first upper bound of astrophysical origin on the coupling between the Higgs field and the Kreschmann curvature invariant. Our analysis provides the basis for a more general methodology to derive bounds to the coupling of long-range scalar fields to curvature invariants in an astrophysical setting complementary to the ones available from high-energy physics or table-top experiments.

  6. Beta-shifts, their languages and computability

    DEFF Research Database (Denmark)

    Simonsen, Jakob Grue

    2011-01-01

    they give into the dynamics of the underlying system. We prove that the language of the ß-shift is recursive iff ß is a computable real number. That fact yields a precise characterization of the reals: The real numbers ß for which we can compute arbitrarily good approximations—hence in particular......For every real number ß >1, the ß-shift is a dynamical system describing iterations of the map x ¿ ßx mod 1 and is studied intensively in number theory. Each ß-shift has an associated language of finite strings of characters; properties of this language are studied for the additional insight...

  7. Do working environment interventions reach shift workers?

    DEFF Research Database (Denmark)

    Nabe-Nielsen, Kirsten; Jørgensen, Marie Birk; Garde, Anne Helene

    2016-01-01

    PURPOSE: Shift workers are exposed to more physical and psychosocial stressors in the working environment as compared to day workers. Despite the need for targeted prevention, it is likely that workplace interventions less frequently reach shift workers. The aim was therefore to investigate whether...... the reach of workplace interventions varied between shift workers and day workers and whether such differences could be explained by the quality of leadership exhibited at different times of the day. METHODS: We used questionnaire data from 5361 female care workers in the Danish eldercare sector...

  8. Soft theorems for shift-symmetric cosmologies

    Science.gov (United States)

    Finelli, Bernardo; Goon, Garrett; Pajer, Enrico; Santoni, Luca

    2018-03-01

    We derive soft theorems for single-clock cosmologies that enjoy a shift symmetry. These so-called consistency conditions arise from a combination of a large diffeomorphism and the internal shift symmetry and fix the squeezed limit of all correlators with a soft scalar mode. As an application, we show that our results reproduce the squeezed bispectrum for ultra-slow-roll inflation, a particular shift-symmetric, nonattractor model which is known to violate Maldacena's consistency relation. Similar results have been previously obtained by Mooij and Palma using background-wave methods. Our results shed new light on the infrared structure of single-clock cosmological spacetimes.

  9. [THE INFLUENCE OF SHIFT WORK ON WORKER'S HEALTH STATUS (REVIEW)].

    Science.gov (United States)

    Chernikova, E F

    2015-01-01

    The article provides an overview of domestic and foreign works on the impact of the replaceable labor on the efficiency, general state of health, the health and the dream of workers. Many hours shifts and overtime work were found to disturb likely familiar rhythms (sleep, wakefulness, performance), change the metabolic and hormonal metabolisms, reducing the recovery period between duties, contribute to more rapid development of fatigue. The consequence of circadian dyschrony may be the development of diseases of the cardiovascular system and cancer incidence. Studies have shown that sleep disorders are associated with metabolic changes, and particularly, obesity. In persons working in shifts, there are more often registered as individual features of the metabolic syndrome and the whole syndrome. It is noted that persons forming this group are at higher risk of developing diseases of the gastrointestinal tract. Thus, the problem of shift work is presented to be very important. Knowledge of ways and mechanisms that explain the impact of shift work on health is necessary to evaluate the professional risk. In the system of health measures the attention should be given to the rationalization of work and rest regimens, prevention of fatigue, struggle with sleep disorders and obesity.

  10. Climate change, elevational range shifts, and bird extinctions.

    Science.gov (United States)

    Sekercioglu, Cagan H; Schneider, Stephen H; Fay, John P; Loarie, Scott R

    2008-02-01

    Limitations imposed on species ranges by the climatic, ecological, and physiological effects of elevation are important determinants of extinction risk. We modeled the effects of elevational limits on the extinction risk of landbirds, 87% of all bird species. Elevational limitation of range size explained 97% of the variation in the probability of being in a World Conservation Union category of extinction risk. Our model that combined elevational ranges, four Millennium Assessment habitat-loss scenarios, and an intermediate estimate of surface warming of 2.8 degrees C, projected a best guess of 400-550 landbird extinctions, and that approximately 2150 additional species would be at risk of extinction by 2100. For Western Hemisphere landbirds, intermediate extinction estimates based on climate-induced changes in actual distributions ranged from 1.3% (1.1 degrees C warming) to 30.0% (6.4 degrees C warming) of these species. Worldwide, every degree of warming projected a nonlinear increase in bird extinctions of about 100-500 species. Only 21% of the species predicted to become extinct in our scenarios are currently considered threatened with extinction. Different habitat-loss and surface-warming scenarios predicted substantially different futures for landbird species. To improve the precision of climate-induced extinction estimates, there is an urgent need for high-resolution measurements of shifts in the elevational ranges of species. Given the accelerating influence of climate change on species distributions and conservation, using elevational limits in a tested, standardized, and robust manner can improve conservation assessments of terrestrial species and will help identify species that are most vulnerable to global climate change. Our climate-induced extinction estimates are broadly similar to those of bird species at risk from other factors, but these estimates largely involve different sets of species.

  11. Third ventricle midline shift on computed tomography as an alternative to septum pellucidum shift

    International Nuclear Information System (INIS)

    Santiago, Carlos Francis A.; Oropilla, Jean Quint L; Alvarez, Victor M.

    2000-01-01

    The cerebral midline shift is measured using the displacement from midline of the third ventricle. It is an easily determined criterion from which CT scans of patients with spontaneous intracerebral hematoma may be investigated. Midline shift is a significant criteria in which to gauge the neurological status of patients. In a retrospective study of 32 patients with spontaneous unilateral intracerebral hemorrhage, a midline third ventricle shift correlated well with septum pellucidum shift. A greater than 7 mm midline third ventricle shift was associated with a significantly lower Glasgow Coma scale score compared a shift less than 7mm. For the septum pellucidum, a greater than 10 mm shift was similarly associated with a significantly lower Glasgow Coma scale score. (Author)

  12. Task-shifting: The crucial role of medical doctors in reducing ...

    African Journals Online (AJOL)

    Task-shifting in surgery raises important ethical issues, as patient risk ... oppressive political climate, including insecurity and threat of ... of job description, unsatisfactory organization and ... provincial level with commitment to return after having.

  13. Measuring Light at Night and Melatonin Levels in Shift Workers: A Review of the Literature.

    Science.gov (United States)

    Hunter, Claudia M; Figueiro, Mariana G

    2017-07-01

    Shift work, especially that involving rotating and night shifts, is associated with an increased risk of diseases, including cancer. Attempts to explain the association between shift work and cancer in particular have focused on the processes of melatonin production and suppression. One hypothesis postulates that exposure to light at night (LAN) suppresses melatonin, whose production is known to slow the development of cancerous cells, while another proposes that circadian disruption associated with shift work, and not just LAN, increases health risks. This review focuses on six studies that employed quantitative measurement of LAN and melatonin levels to assess cancer risks in shift workers. These studies were identified via searching the PubMed database for peer-reviewed, English-language articles examining the links between shift work, LAN, and disease using the terms light at night, circadian disruption, health, risk, cancer, shift work, or rotating shift. While the results indicate a growing consensus on the relationship between disease risks (particularly cancer) and circadian disruption associated with shift work, the establishment of a direct link between LAN and disease has been impeded by contradictory studies and a lack of consistent, quantitative methods for measuring LAN in the research to date. Better protocols for assessing personal LAN exposure are required, particularly those employing calibrated devices that measure and sample exposure to workplace light conditions, to accurately assess LAN's effects on the circadian system and disease. Other methodologies, such as measuring circadian disruption and melatonin levels in the field, may also help to resolve discrepancies in the findings.

  14. Shifts in climate suitability for wine production as a result of climate change in a temperate climate wine region of Romania

    Science.gov (United States)

    Irimia, Liviu Mihai; Patriche, Cristian Valeriu; Quenol, Hervé; Sfîcă, Lucian; Foss, Chris

    2018-02-01

    Climate change is causing important shifts in the suitability of regions for wine production. Fine scale mapping of these shifts helps us to understand the evolution of vineyard climates, and to find solutions through viticultural adaptation. The aim of this study is to identify and map the structural and spatial shifts that occurred in the climatic suitability for wine production of the Cotnari wine growing region (Romania) between 1961 and 2013. Discontinuities in trends of temperature were identified, and the averages and trends of 13 climatic parameters for the 1961 to 1980 and 1981 to 2013 time periods were analysed. Using the averages of these climatic parameters, climate suitability for wine production was calculated at a resolution of 30 m and mapped for each time period, and the changes analysed. The results indicate shifts in the area's historic climatic profile, due to an increase of heliothermal resources and precipitation constancy. The area's climate suitability for wine production was modified by the loss of climate suitability for white table wines, sparkling wines and wine for distillates; shifts in suitability to higher altitudes by about 67 m, and a 48.6% decrease in the area suitable for quality white wines; and the occurrence of suitable climates for red wines at lower altitudes. The study showed that climate suitability for wine production has a multi-level spatial structure, with classes requiring a cooler climate being located at a higher altitude than those requiring a warmer climate. Climate change has therefore resulted in the shift of climate suitability classes for wine production to higher altitudes.

  15. Adaptation to shift work: physiologically based modeling of the effects of lighting and shifts' start time.

    Directory of Open Access Journals (Sweden)

    Svetlana Postnova

    Full Text Available Shift work has become an integral part of our life with almost 20% of the population being involved in different shift schedules in developed countries. However, the atypical work times, especially the night shifts, are associated with reduced quality and quantity of sleep that leads to increase of sleepiness often culminating in accidents. It has been demonstrated that shift workers' sleepiness can be improved by a proper scheduling of light exposure and optimizing shifts timing. Here, an integrated physiologically-based model of sleep-wake cycles is used to predict adaptation to shift work in different light conditions and for different shift start times for a schedule of four consecutive days of work. The integrated model combines a model of the ascending arousal system in the brain that controls the sleep-wake switch and a human circadian pacemaker model. To validate the application of the integrated model and demonstrate its utility, its dynamics are adjusted to achieve a fit to published experimental results showing adaptation of night shift workers (n = 8 in conditions of either bright or regular lighting. Further, the model is used to predict the shift workers' adaptation to the same shift schedule, but for conditions not considered in the experiment. The model demonstrates that the intensity of shift light can be reduced fourfold from that used in the experiment and still produce good adaptation to night work. The model predicts that sleepiness of the workers during night shifts on a protocol with either bright or regular lighting can be significantly improved by starting the shift earlier in the night, e.g.; at 21:00 instead of 00:00. Finally, the study predicts that people of the same chronotype, i.e. with identical sleep times in normal conditions, can have drastically different responses to shift work depending on their intrinsic circadian and homeostatic parameters.

  16. Adaptation to shift work: physiologically based modeling of the effects of lighting and shifts' start time.

    Science.gov (United States)

    Postnova, Svetlana; Robinson, Peter A; Postnov, Dmitry D

    2013-01-01

    Shift work has become an integral part of our life with almost 20% of the population being involved in different shift schedules in developed countries. However, the atypical work times, especially the night shifts, are associated with reduced quality and quantity of sleep that leads to increase of sleepiness often culminating in accidents. It has been demonstrated that shift workers' sleepiness can be improved by a proper scheduling of light exposure and optimizing shifts timing. Here, an integrated physiologically-based model of sleep-wake cycles is used to predict adaptation to shift work in different light conditions and for different shift start times for a schedule of four consecutive days of work. The integrated model combines a model of the ascending arousal system in the brain that controls the sleep-wake switch and a human circadian pacemaker model. To validate the application of the integrated model and demonstrate its utility, its dynamics are adjusted to achieve a fit to published experimental results showing adaptation of night shift workers (n = 8) in conditions of either bright or regular lighting. Further, the model is used to predict the shift workers' adaptation to the same shift schedule, but for conditions not considered in the experiment. The model demonstrates that the intensity of shift light can be reduced fourfold from that used in the experiment and still produce good adaptation to night work. The model predicts that sleepiness of the workers during night shifts on a protocol with either bright or regular lighting can be significantly improved by starting the shift earlier in the night, e.g.; at 21:00 instead of 00:00. Finally, the study predicts that people of the same chronotype, i.e. with identical sleep times in normal conditions, can have drastically different responses to shift work depending on their intrinsic circadian and homeostatic parameters.

  17. Cancer: shift of the paradigm.

    Science.gov (United States)

    Lichtenstein, Anatoly V

    2008-12-01

    Cancer is usually considered to be a by-product of design limitations of a multicellular organism and its intrinsic fallibility. However, recent data prompt a revision of some established notions about carcinogenesis and form a new paradigm of carcinogenesis as a highly conserved biological phenomenon - a programmed death of an organism. This altruistic program, which is unleashed when mutagenesis surpasses a certain critical threshold, gives a population the important benefit acting as a guardian of the gene pool against the spread of certain mutant genes. A growing body of evidence supports this point of view: (i) epigenetic changes leading to cancer arise early, simultaneously in many cells and look like deterministic regulation; (ii) concept of cancer stem cell suggests a view of carcinogenesis not as vague transformation but as well known differentiation; (iii) tumor/host relations usually perceived as antagonistic are, in reality, synergistic; (iv) death of an individual from cancer is predetermined and results apparently from a specific activity (killer function) of cancer cell and (v) evolutionary conservation indicates that cancer comes with a general advantage that explains its evolutionary success. A holistic approach to carcinogenesis suggests new avenues of research and new therapeutic strategy.

  18. Identifying Strategic Scientific Opportunities

    Science.gov (United States)

    As NCI's central scientific strategy office, CRS collaborates with the institute's divisions, offices, and centers to identify research opportunities to advance NCI's vision for the future of cancer research.

  19. Shift manager workload assessment - A case study

    International Nuclear Information System (INIS)

    Berntson, K.; Kozak, A.; Malcolm, J. S.

    2006-01-01

    In early 2003, Bruce Power restarted two of its previously laid up units in the Bruce A generating station, Units 3 and 4. However, due to challenges relating to the availability of personnel with active Shift Manager licenses, an alternate shift structure was proposed to ensure the safe operation of the station. This alternate structure resulted in a redistribution of responsibility, and a need to assess the resulting changes in workload. Atomic Energy of Canada Limited was contracted to perform a workload assessment based on the new shift structure, and to provide recommendations, if necessary, to ensure Shift Managers had sufficient resources available to perform their required duties. This paper discusses the performance of that assessment, and lessons learned as a result of the work performed during the Restart project. (authors)

  20. Identifying Breast Cancer Oncogenes

    Science.gov (United States)

    2011-10-01

    cells we observed that it promoted transformation of HMLE cells, suggesting a tumor suppressive role of Merlin in breast cancer (Figure 4B). A...08-1-0767 TITLE: Identifying Breast Cancer Oncogenes PRINCIPAL INVESTIGATOR: Yashaswi Shrestha...Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std. Z39.18 W81XWH-08-1-0767 Identifying Breast Cancer Oncogenes Yashaswi Shrestha Dana-Farber

  1. Heuristic Approach for Balancing Shift Schedules

    International Nuclear Information System (INIS)

    Kim, Dae Ho; Yun, Young Su; Lee, Yong Hee

    2005-01-01

    In this paper, a heuristic approach for balancing shift schedules is proposed. For the shift schedules, various constraints which have usually been considered in realworld industry are used, and the objective is to minimize the differences of the workloads in each workgroup. The constraints and objective function are implemented in the proposed heuristic approach. Using a simple instance, the efficiency of the proposed heuristic approach is proved

  2. The electrophoretic mobility shift assay (EMSA)

    OpenAIRE

    sprotocols

    2015-01-01

    The electrophoretic mobility shift assay (EMSA), also known as “gel shift assay”, is used to examine the binding parameters and relative affinities of protein and DNA interactions. We produced recombinant CCA1 protein and tested its binding affinity for the promoter fragments that contain CBS (AAAAATCT) or evening element (EE, AAAATATCT) (1) using a modified procedure adopted from published protocols (2,3).

  3. Metabolic syndrome in fixed-shift workers

    OpenAIRE

    Raquel Canuto; Marcos Pascoal Pattussi; Jamile Block Araldi Macagnan; Ruth Liane Henn; Maria Teresa Anselmo Olinto

    2015-01-01

    OBJECTIVE To analyze if metabolic syndrome and its altered components are associated with demographic, socioeconomic and behavioral factors in fixed-shift workers. METHODS A cross-sectional study was conducted on a sample of 902 shift workers of both sexes in a poultry processing plant in Southern Brazil in 2010. The diagnosis of metabolic syndrome was determined according to the recommendations from Harmonizing the Metabolic Syndrome. Its frequency was evaluated according to the demographic ...

  4. Metabolic syndrome in fixed-shift workers

    OpenAIRE

    Canuto, Raquel; Pattussi, Marcos Pascoal; Macagnan, Jamile Block Araldi; Henn, Ruth Liane; Olinto, Maria Teresa Anselmo

    2015-01-01

    OBJECTIVE To analyze if metabolic syndrome and its altered components are associated with demographic, socioeconomic and behavioral factors in fixed-shift workers.METHODS A cross-sectional study was conducted on a sample of 902 shift workers of both sexes in a poultry processing plant in Southern Brazil in 2010. The diagnosis of metabolic syndrome was determined according to the recommendations from Harmonizing the Metabolic Syndrome. Its frequency was evaluated according to the demographic (...

  5. Health effects of the shift work system

    OpenAIRE

    Yüzügüllü, Didem Ata; Aytaç, Necdet; Akbaba, Muhsin

    2018-01-01

    Technological advances and the changes to methods ofproduction in many industrialized countries led to the introduction of shiftwork systems to ensure the continuity in operation of industries. Shift workhas long been known to disrupt circadian rhythm,sleep, and work-life balance.Alfredsson et al. carried out a study of 334 cases with myocardial infarctionand 882 controls, who were selected randomly from the general population in thesame region. The shift-work exposure was assessed from the o...

  6. Management Ownership and Risk-Shifting Investment

    OpenAIRE

    Nobuyuki Teshima

    2012-01-01

    This study analyzes the relationship between management ownership and its risk-shifting incentive. We first present a simple model showing that the risk-shifting incentive of management of financially distressed firms increases as the management ownership of the firm increases. Empirically, we test the hypothesis that under the former Japanese Corporate Reorganization Law, firms with higher management ownership are more likely to use legal rather than private reorganization. Since the reorgan...

  7. Algorithm based on regional separation for automatic grain boundary extraction using improved mean shift method

    Science.gov (United States)

    Zhenying, Xu; Jiandong, Zhu; Qi, Zhang; Yamba, Philip

    2018-06-01

    Metallographic microscopy shows that the vast majority of metal materials are composed of many small grains; the grain size of a metal is important for determining the tensile strength, toughness, plasticity, and other mechanical properties. In order to quantitatively evaluate grain size in metals, grain boundaries must be identified in metallographic images. Based on the phenomenon of grain boundary blurring or disconnection in metallographic images, this study develops an algorithm based on regional separation for automatically extracting grain boundaries by an improved mean shift method. Experimental observation shows that the grain boundaries obtained by the proposed algorithm are highly complete and accurate. This research has practical value because the proposed algorithm is suitable for grain boundary extraction from most metallographic images.

  8. Tax Limitations and Revenue Shifting Strategies in Local Government

    DEFF Research Database (Denmark)

    Blom-Hansen, Jens; Bækgaard, Martin; Serritzlew, Søren

    2014-01-01

    subjected to tax limitations employ revenue-shifting strategies. In Denmark, however, these strategies are contingent on the specifics of the Danish intergovernmental system, which render central government grants an attractive object of revenue-shifting strategies. Our analysis thus helps identify......The literature on tax and expenditure limitations (TELs) shows how limiting the freedom of local governments to levy taxes may have considerable unexpected effects. Entities subjected to such limitations may, as their proponents hope, react by cutting expenditures and revenue, but they may also...... strategically change their revenue structure and increase reliance on income sources not subjected to limitations. However, these findings are overwhelmingly based on studies of state and local governments in the USA. Their relevance outside this empirical setting remains unclear. A study of Denmark, where...

  9. Elevated Extinction Rates as a Trigger for Diversification Rate Shifts: Early Amniotes as a Case Study

    Science.gov (United States)

    Brocklehurst, Neil; Ruta, Marcello; Müller, Johannes; Fröbisch, Jörg

    2015-01-01

    Tree shape analyses are frequently used to infer the location of shifts in diversification rate within the Tree of Life. Many studies have supported a causal relationship between shifts and temporally coincident events such as the evolution of “key innovations”. However, the evidence for such relationships is circumstantial. We investigated patterns of diversification during the early evolution of Amniota from the Carboniferous to the Triassic, subjecting a new supertree to analyses of tree balance in order to infer the timing and location of diversification shifts. We investigated how uneven origination and extinction rates drive diversification shifts, and use two case studies (herbivory and an aquatic lifestyle) to examine whether shifts tend to be contemporaneous with evolutionary novelties. Shifts within amniotes tend to occur during periods of elevated extinction, with mass extinctions coinciding with numerous and larger shifts. Diversification shifts occurring in clades that possess evolutionary innovations do not coincide temporally with the appearance of those innovations, but are instead deferred to periods of high extinction rate. We suggest such innovations did not cause increases in the rate of cladogenesis, but allowed clades to survive extinction events. We highlight the importance of examining general patterns of diversification before interpreting specific shifts. PMID:26592209

  10. Temperature dependence of 1H NMR chemical shifts and its influence on estimated metabolite concentrations.

    Science.gov (United States)

    Wermter, Felizitas C; Mitschke, Nico; Bock, Christian; Dreher, Wolfgang

    2017-12-01

    Temperature dependent chemical shifts of important brain metabolites measured by localised 1 H MRS were investigated to test how the use of incorrect prior knowledge on chemical shifts impairs the quantification of metabolite concentrations. Phantom measurements on solutions containing 11 metabolites were performed on a 7 T scanner between 1 and 43 °C. The temperature dependence of the chemical shift differences was fitted by a linear model. Spectra were simulated for different temperatures and analysed by the AQSES program (jMRUI 5.2) using model functions with chemical shift values for 37 °C. Large differences in the temperature dependence of the chemical shift differences were determined with a maximum slope of about ±7.5 × 10 -4  ppm/K. For 32-40 °C, only minor quantification errors resulted from using incorrect chemical shifts, with the exception of Cr and PCr. For 1-10 °C considerable quantification errors occurred if the temperature dependence of the chemical shifts was neglected. If 1 H MRS measurements are not performed at 37 °C, for which the published chemical shift values have been determined, the temperature dependence of chemical shifts should be considered to avoid systematic quantification errors, particularly for measurements on animal models at lower temperatures.

  11. Evidence of the shifting baseline syndrome in ethnobotanical research.

    Science.gov (United States)

    Hanazaki, Natalia; Herbst, Dannieli Firme; Marques, Mel Simionato; Vandebroek, Ina

    2013-11-14

    The shifting baseline syndrome is a concept from ecology that can be analyzed in the context of ethnobotanical research. Evidence of shifting baseline syndrome can be found in studies dealing with intracultural variation of knowledge, when knowledge from different generations is compared and combined with information about changes in the environment and/or natural resources. We reviewed 84 studies published between 1993 and 2012 that made comparisons of ethnobotanical knowledge according to different age classes. After analyzing these studies for evidence of the shifting baseline syndrome (lower knowledge levels in younger generations and mention of declining abundance of local natural resources), we searched within these studies for the use of the expressions "cultural erosion", "loss of knowledge", or "acculturation". The studies focused on different groups of plants (e.g. medicinal plants, foods, plants used for general purposes, or the uses of specific important species). More than half of all 84 studies (57%) mentioned a concern towards cultural erosion or knowledge loss; 54% of the studies showed evidence of the shifting baseline syndrome; and 37% of the studies did not provide any evidence of shifting baselines (intergenerational knowledge differences but no information available about the abundance of natural resources). The general perception of knowledge loss among young people when comparing ethnobotanical repertoires among different age groups should be analyzed with caution. Changes in the landscape or in the abundance of plant resources may be associated with changes in ethnobotanical repertoires held by people of different age groups. Also, the relationship between the availability of resources and current plant use practices rely on a complexity of factors. Fluctuations in these variables can cause changes in the reference (baseline) of different generations and consequently be responsible for differences in intergenerational knowledge. Unraveling

  12. Identifying Knowledge and Communication

    Directory of Open Access Journals (Sweden)

    Eduardo Coutinho Lourenço de Lima

    2006-12-01

    Full Text Available In this paper, I discuss how the principle of identifying knowledge which Strawson advances in ‘Singular Terms and Predication’ (1961, and in ‘Identifying Reference and Truth-Values’ (1964 turns out to constrain communication. The principle states that a speaker’s use of a referring expression should invoke identifying knowledge on the part of the hearer, if the hearer is to understand what the speaker is saying, and also that, in so referring, speakers are attentive to hearers’ epistemic states. In contrasting it with Russell’s Principle (Evans 1982, as well as with the principle of identifying descriptions (Donnellan 1970, I try to show that the principle of identifying knowledge, ultimately a condition for understanding, makes sense only in a situation of conversation. This allows me to conclude that the cooperative feature of communication (Grice 1975 and reference (Clark andWilkes-Gibbs 1986 holds also at the understanding level. Finally, I discuss where Strawson’s views seem to be unsatisfactory, and suggest how they might be improved.

  13. HEDIS Research Identifiable Files

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Healthcare Effectiveness Data and Information Set (HEDIS) is a tool used by more than 90 percent of Americas health plans to measure performance on important...

  14. Shift work and overall and cause-specific mortality in the Danish nurse cohort

    DEFF Research Database (Denmark)

    Jørgensen, Jeanette Therming; Karlsen, Sashia; Stayner, Leslie T.

    2017-01-01

    Objectives: Evidence of an effect of shift work on all-cause and cause-specific mortality is inconsistent. This study aims to examine whether shift work is associated with increased all-cause and cause-specific mortality.  Methods: We linked 28 731 female nurses (age ≥44 years), recruited in 1993...... or 1999 from the Danish nurse cohort where they reported information on shift work (night, evening, rotating, or day), to the Danish Register of Causes of Death to identify deaths up to 2013. We used Cox regression models with age as the underlying scale to examine the associations between night, evening......, and rotating shift work (compared to day shift work) and all-cause and cause-specific mortality in models adjusted for potentially confounding variables.  Results: Of 18 015 nurses included in this study, 1616 died during the study time period from the following causes: cardiovascular disease (N=217), cancer...

  15. By their own devices: invasive Argentine ants have shifted diet without clear aid from symbiotic microbes.

    Science.gov (United States)

    Hu, Yi; Holway, David A; Łukasik, Piotr; Chau, Linh; Kay, Adam D; LeBrun, Edward G; Miller, Katie A; Sanders, Jon G; Suarez, Andrew V; Russell, Jacob A

    2017-03-01

    The functions and compositions of symbiotic bacterial communities often correlate with host ecology. Yet cause-effect relationships and the order of symbiont vs. host change remain unclear in the face of ancient symbioses and conserved host ecology. Several groups of ants exemplify this challenge, as their low-nitrogen diets and specialized symbioses appear conserved and ancient. To address whether nitrogen-provisioning symbionts might be important in the early stages of ant trophic shifts, we studied bacteria from the Argentine ant, Linepithema humile - an invasive species that has transitioned towards greater consumption of sugar-rich, nitrogen-poor foods in parts of its introduced range. Bacteria were present at low densities in most L. humile workers, and among those yielding quality 16S rRNA amplicon sequencing data, we found just three symbionts to be common and dominant. Two, a Lactobacillus and an Acetobacteraceae species, were shared between native and introduced populations. The other, a Rickettsia, was found only in two introduced supercolonies. Across an eight-year period of trophic reduction in one introduced population, we found no change in symbionts, arguing against a relationship between natural dietary change and microbiome composition. Overall, our findings thus argue against major changes in symbiotic bacteria in association with the invasion and trophic shift of L. humile. In addition, genome content from close relatives of the identified symbionts suggests that just one can synthesize most essential amino acids; this bacterium was only modestly abundant in introduced populations, providing little support for a major role of nitrogen-provisioning symbioses in Argentine ant's dietary shift. © 2016 John Wiley & Sons Ltd.

  16. Biotic Stress Shifted Structure and Abundance of Enterobacteriaceae in the Lettuce Microbiome

    Science.gov (United States)

    Erlacher, Armin; Cardinale, Massimiliano; Grube, Martin; Berg, Gabriele

    2015-01-01

    Lettuce cultivars are not only amongst the most popular vegetables eaten raw, they are also involved in severe pathogen outbreaks world-wide. While outbreaks caused by Enterobacteriaceae species are well-studied, less is known about their occurrence in natural environments as well as the impact of biotic stress. Here, we studied the ecology of the human health-relevant bacterial family Enterobacteriaceae and assessed the impact of biotic disturbances by a soil-borne phytopathogenic fungus and Gastropoda on their structure and abundance in mesocosm and pot experiments. Using a polyphasic approach including network analyses of 16S rRNA gene amplicon libraries, quantitative PCR and complementary fluorescence in situ hybridization (FISH) microscopy we found substantial yet divergent Enterobacteriaceae communities. A similar spectrum of 14 genera was identified from rhizo- and phyllospheres but the abundance of Enterobacteriaceae was on average 3fold higher in phyllosphere samples. Both stress factors shifted the bacterial community of the leaf habitat, characterized by increases of species abundance and diversity. For the rhizosphere, we observed significant structural shifts of Enterobacteriaceae communities but also a high degree of resilience. These results could be confirmed by FISH microscopy but it was difficult to visualize phyllosphere communities. Additional inoculation experiments with Escherichia coli as model revealed their presence below the wax layer as well as in the endosphere of leaves. The observed presence influenced by stress factors and the endophytic life style of Enterobacteriaceae on lettuce can be an important aspect in relation to human health. PMID:25714833

  17. Biotic stress shifted structure and abundance of Enterobacteriaceae in the lettuce microbiome.

    Science.gov (United States)

    Erlacher, Armin; Cardinale, Massimiliano; Grube, Martin; Berg, Gabriele

    2015-01-01

    Lettuce cultivars are not only amongst the most popular vegetables eaten raw, they are also involved in severe pathogen outbreaks world-wide. While outbreaks caused by Enterobacteriaceae species are well-studied, less is known about their occurrence in natural environments as well as the impact of biotic stress. Here, we studied the ecology of the human health-relevant bacterial family Enterobacteriaceae and assessed the impact of biotic disturbances by a soil-borne phytopathogenic fungus and Gastropoda on their structure and abundance in mesocosm and pot experiments. Using a polyphasic approach including network analyses of 16S rRNA gene amplicon libraries, quantitative PCR and complementary fluorescence in situ hybridization (FISH) microscopy we found substantial yet divergent Enterobacteriaceae communities. A similar spectrum of 14 genera was identified from rhizo- and phyllospheres but the abundance of Enterobacteriaceae was on average 3fold higher in phyllosphere samples. Both stress factors shifted the bacterial community of the leaf habitat, characterized by increases of species abundance and diversity. For the rhizosphere, we observed significant structural shifts of Enterobacteriaceae communities but also a high degree of resilience. These results could be confirmed by FISH microscopy but it was difficult to visualize phyllosphere communities. Additional inoculation experiments with Escherichia coli as model revealed their presence below the wax layer as well as in the endosphere of leaves. The observed presence influenced by stress factors and the endophytic life style of Enterobacteriaceae on lettuce can be an important aspect in relation to human health.

  18. Biotic stress shifted structure and abundance of Enterobacteriaceae in the lettuce microbiome.

    Directory of Open Access Journals (Sweden)

    Armin Erlacher

    Full Text Available Lettuce cultivars are not only amongst the most popular vegetables eaten raw, they are also involved in severe pathogen outbreaks world-wide. While outbreaks caused by Enterobacteriaceae species are well-studied, less is known about their occurrence in natural environments as well as the impact of biotic stress. Here, we studied the ecology of the human health-relevant bacterial family Enterobacteriaceae and assessed the impact of biotic disturbances by a soil-borne phytopathogenic fungus and Gastropoda on their structure and abundance in mesocosm and pot experiments. Using a polyphasic approach including network analyses of 16S rRNA gene amplicon libraries, quantitative PCR and complementary fluorescence in situ hybridization (FISH microscopy we found substantial yet divergent Enterobacteriaceae communities. A similar spectrum of 14 genera was identified from rhizo- and phyllospheres but the abundance of Enterobacteriaceae was on average 3fold higher in phyllosphere samples. Both stress factors shifted the bacterial community of the leaf habitat, characterized by increases of species abundance and diversity. For the rhizosphere, we observed significant structural shifts of Enterobacteriaceae communities but also a high degree of resilience. These results could be confirmed by FISH microscopy but it was difficult to visualize phyllosphere communities. Additional inoculation experiments with Escherichia coli as model revealed their presence below the wax layer as well as in the endosphere of leaves. The observed presence influenced by stress factors and the endophytic life style of Enterobacteriaceae on lettuce can be an important aspect in relation to human health.

  19. Risk and contributing factors of ecosystem shifts over naturally vegetated land under climate change in China.

    Science.gov (United States)

    Yin, Yuanyuan; Tang, Qiuhong; Wang, Lixin; Liu, Xingcai

    2016-02-12

    Identifying the areas at risk of ecosystem transformation and the main contributing factors to the risk is essential to assist ecological adaptation to climate change. We assessed the risk of ecosystem shifts in China using the projections of four global gridded vegetation models (GGVMs) and an aggregate metric. The results show that half of naturally vegetated land surface could be under moderate or severe risk at the end of the 21(st) century under the middle and high emission scenarios. The areas with high risk are the Tibetan Plateau region and an area extended northeastward from the Tibetan Plateau to northeast China. With the three major factors considered, the change in carbon stocks is the main contributing factor to the high risk of ecosystem shifts. The change in carbon fluxes is another important contributing factor under the high emission scenario. The change in water fluxes is a less dominant factor except for the Tibetan Plateau region under the high emission scenario. Although there is considerable uncertainty in the risk assessment, the geographic patterns of the risk are generally consistent across different scenarios. The results could help develop regional strategies for ecosystem conservation to cope with climate change.

  20. Rapid Detection of Glycogen Synthase Kinase-3 Activity in Mouse Sperm Using Fluorescent Gel Shift Electrophoresis

    Directory of Open Access Journals (Sweden)

    Hoseok Choi

    2016-04-01

    Full Text Available Assaying the glycogen synthase kinase-3 (GSK3 activity in sperm is of great importance because it is closely implicated in sperm motility and male infertility. While a number of studies on GSK3 activity have relied on labor-intensive immunoblotting to identify phosphorylated GSK3, here we report the simple and rapid detection of GSK3 activity in mouse sperm using conventional agarose gel electrophoresis and a fluorescent peptide substrate. When a dye-tethered and prephosphorylated (primed peptide substrate for GSK3 was employed, a distinct mobility shift in the fluorescent bands on the agarose was observed by GSK3-induced phosphorylation of the primed peptides. The GSK3 activity in mouse testes and sperm were quantifiable by gel shift assay with low sample consumption and were significantly correlated with the expression levels of GSK3 and p-GSK3. We suggest that our assay can be used for reliable and rapid detection of GSK3 activity in cells and tissue extracts.

  1. Rapid Detection of Glycogen Synthase Kinase-3 Activity in Mouse Sperm Using Fluorescent Gel Shift Electrophoresis

    Science.gov (United States)

    Choi, Hoseok; Choi, Bomi; Seo, Ju Tae; Lee, Kyung Jin; Gye, Myung Chan; Kim, Young-Pil

    2016-01-01

    Assaying the glycogen synthase kinase-3 (GSK3) activity in sperm is of great importance because it is closely implicated in sperm motility and male infertility. While a number of studies on GSK3 activity have relied on labor-intensive immunoblotting to identify phosphorylated GSK3, here we report the simple and rapid detection of GSK3 activity in mouse sperm using conventional agarose gel electrophoresis and a fluorescent peptide substrate. When a dye-tethered and prephosphorylated (primed) peptide substrate for GSK3 was employed, a distinct mobility shift in the fluorescent bands on the agarose was observed by GSK3-induced phosphorylation of the primed peptides. The GSK3 activity in mouse testes and sperm were quantifiable by gel shift assay with low sample consumption and were significantly correlated with the expression levels of GSK3 and p-GSK3. We suggest that our assay can be used for reliable and rapid detection of GSK3 activity in cells and tissue extracts. PMID:27092510

  2. Paradigm shift in psychiatry: what may it involve?

    Science.gov (United States)

    Valent, Paul

    2018-02-01

    This study aims to examine the potential nature of an ongoing paradigm shift in psychiatry that has been suggested to be occurring. New findings in traumatology and neuroscience do form a potential platform for a paradigm shift. Prior conflicting paradigms are suggested to be due to biases arising from mental structures themselves. A new wholist perspective is proposed, which makes sense of and incorporates previous paradigms, and coheres recent understanding of right- and left-brain functioning and biopsychosocial traumatic processes and their ramifications. The perspective makes sense of the great variety of post-traumatic manifestations ranging from somatic to meaning-making dysfunctions. The wholist perspective may well be an important step in solidifying a fresh paradigmatic perspective in psychiatry.

  3. Night shift work exposure profile and obesity: Baseline results from a Chinese night shift worker cohort

    Science.gov (United States)

    Feng, Wenting; Wang, Feng; Zhang, Liuzhuo; Wu, Zijun; Li, Zhimin; Zhang, Bo; He, Yonghua; Xie, Shaohua; Li, Mengjie; Fok, Joan P. C.; Tse, Gary; Wong, Martin C. S.; Tang, Jin-ling; Wong, Samuel Y. S.; Vlaanderen, Jelle; Evans, Greg; Vermeulen, Roel; Tse, Lap Ah

    2018-01-01

    Aims This study aimed to evaluate the associations between types of night shift work and different indices of obesity using the baseline information from a prospective cohort study of night shift workers in China. Methods A total of 3,871 workers from five companies were recruited from the baseline survey. A structured self-administered questionnaire was employed to collect the participants’ demographic information, lifetime working history, and lifestyle habits. Participants were grouped into rotating, permanent and irregular night shift work groups. Anthropometric parameters were assessed by healthcare professionals. Multiple logistic regression models were used to evaluate the associations between night shift work and different indices of obesity. Results Night shift workers had increased risk of overweight and obesity, and odds ratios (ORs) were 1.17 (95% CI, 0.97–1.41) and 1.27 (95% CI, 0.74–2.18), respectively. Abdominal obesity had a significant but marginal association with night shift work (OR = 1.20, 95% CI, 1.01–1.43). A positive gradient between the number of years of night shift work and overweight or abdominal obesity was observed. Permanent night shift work showed the highest odds of being overweight (OR = 3.94, 95% CI, 1.40–11.03) and having increased abdominal obesity (OR = 3.34, 95% CI, 1.19–9.37). Irregular night shift work was also significantly associated with overweight (OR = 1.56, 95% CI, 1.13–2.14), but its association with abdominal obesity was borderline (OR = 1.26, 95% CI, 0.94–1.69). By contrast, the association between rotating night shift work and these parameters was not significant. Conclusion Permanent and irregular night shift work were more likely to be associated with overweight or abdominal obesity than rotating night shift work. These associations need to be verified in prospective cohort studies. PMID:29763461

  4. Night shift work exposure profile and obesity: Baseline results from a Chinese night shift worker cohort.

    Science.gov (United States)

    Sun, Miaomiao; Feng, Wenting; Wang, Feng; Zhang, Liuzhuo; Wu, Zijun; Li, Zhimin; Zhang, Bo; He, Yonghua; Xie, Shaohua; Li, Mengjie; Fok, Joan P C; Tse, Gary; Wong, Martin C S; Tang, Jin-Ling; Wong, Samuel Y S; Vlaanderen, Jelle; Evans, Greg; Vermeulen, Roel; Tse, Lap Ah

    2018-01-01

    This study aimed to evaluate the associations between types of night shift work and different indices of obesity using the baseline information from a prospective cohort study of night shift workers in China. A total of 3,871 workers from five companies were recruited from the baseline survey. A structured self-administered questionnaire was employed to collect the participants' demographic information, lifetime working history, and lifestyle habits. Participants were grouped into rotating, permanent and irregular night shift work groups. Anthropometric parameters were assessed by healthcare professionals. Multiple logistic regression models were used to evaluate the associations between night shift work and different indices of obesity. Night shift workers had increased risk of overweight and obesity, and odds ratios (ORs) were 1.17 (95% CI, 0.97-1.41) and 1.27 (95% CI, 0.74-2.18), respectively. Abdominal obesity had a significant but marginal association with night shift work (OR = 1.20, 95% CI, 1.01-1.43). A positive gradient between the number of years of night shift work and overweight or abdominal obesity was observed. Permanent night shift work showed the highest odds of being overweight (OR = 3.94, 95% CI, 1.40-11.03) and having increased abdominal obesity (OR = 3.34, 95% CI, 1.19-9.37). Irregular night shift work was also significantly associated with overweight (OR = 1.56, 95% CI, 1.13-2.14), but its association with abdominal obesity was borderline (OR = 1.26, 95% CI, 0.94-1.69). By contrast, the association between rotating night shift work and these parameters was not significant. Permanent and irregular night shift work were more likely to be associated with overweight or abdominal obesity than rotating night shift work. These associations need to be verified in prospective cohort studies.

  5. Working the Night Shift: The Impact of Compensating Wages and Local Economic Conditions on Shift Choice

    OpenAIRE

    Colene Trent; Walter J. Mayer

    2014-01-01

    The theory of compensating differentials asserts that night shift workers should receive compensating wage differentials due to undesirable work conditions. In weak local economies, workers may have difficulty finding jobs; thus, these workers might be more likely to accept night shift work and be less concerned with the size of the compensating differential for night shifts. Using CPS data from 2001, this paper employs maximum likelihood estimation of an endogenous switching regression model...

  6. Change from an 8-hour shift to a 12-hour shift, attitudes, sleep, sleepiness and performance.

    Science.gov (United States)

    Lowden, A; Kecklund, G; Axelsson, J; Akerstedt, T

    1998-01-01

    The present study sought to evaluate the effect of a change from a rotating 3-shift (8-hour) to a 2-shift shift (12 hour) schedule on sleep, sleepiness, performance, perceived health, and well-being. Thirty-two shift workers at a chemical plant (control room operators) responded to a questionnaire a few months before a change was made in their shift schedule and 10 months after the change. Fourteen workers also filled out a diary, carried activity loggers, and carried out reaction-time tests (beginning and end of shift). Fourteen day workers served as a reference group for the questionnaires and 9 were intensively studied during a week with workdays and a free weekend. The questionnaire data showed that the shift change increased satisfaction with workhours, sleep, and time for social activities. Health, perceived accident risk, and reaction-time performance were not negatively affected. Alertness improved and subjective recovery time after night work decreased. The quick changes in the 8-hour schedule greatly increased sleep problems and fatigue. Sleepiness integrated across the entire shift cycle showed that the shift workers were less alert than the day workers, across workdays and days off (although alertness increased with the 12-hour shift). The change from 8-hour to 12-hour shifts was positive in most respects, possibly due to the shorter sequences of the workdays, the longer sequences of consecutive days off, the fewer types of shifts (easier planning), and the elimination of quick changes. The results may differ in groups with a higher work load.

  7. Identifying and Managing Risk.

    Science.gov (United States)

    Abraham, Janice M.

    1999-01-01

    The role of the college or university chief financial officer in institutional risk management is (1) to identify risk (physical, casualty, fiscal, business, reputational, workplace safety, legal liability, employment practices, general liability), (2) to develop a campus plan to reduce and control risk, (3) to transfer risk, and (4) to track and…

  8. Extrinsic regime shifts drive abrupt changes in regeneration dynamics at upper treeline in the Rocky Mountains, U.S.A.

    Science.gov (United States)

    Elliott, Grant P

    2012-07-01

    Given the widespread and often dramatic influence of climate change on terrestrial ecosystems, it is increasingly common for abrupt threshold changes to occur, yet explicitly testing for climate and ecological regime shifts is lacking in climatically sensitive upper treeline ecotones. In this study, quantitative evidence based on empirical data is provided to support the key role of extrinsic, climate-induced thresholds in governing the spatial and temporal patterns of tree establishment in these high-elevation environments. Dendroecological techniques were used to reconstruct a 420-year history of regeneration dynamics within upper treeline ecotones along a latitudinal gradient (approximately 44-35 degrees N) in the Rocky Mountains. Correlation analysis was used to assess the possible influence of minimum and maximum temperature indices and cool-season (November-April) precipitation on regional age-structure data. Regime-shift analysis was used to detect thresholds in tree establishment during the entire period of record (1580-2000), temperature variables significantly Correlated with establishment during the 20th century, and cool-season precipitation. Tree establishment was significantly correlated with minimum temperature during the spring (March-May) and cool season. Regime-shift analysis identified an abrupt increase in regional tree establishment in 1950 (1950-1954 age class). Coincident with this period was a shift toward reduced cool-season precipitation. The alignment of these climate conditions apparently triggered an abrupt increase in establishment that was unprecedented during the period of record. Two main findings emerge from this research that underscore the critical role of climate in governing regeneration dynamics within upper treeline ecotones. (1) Regional climate variability is capable of exceeding bioclimatic thresholds, thereby initiating synchronous and abrupt changes in the spatial and temporal patterns of tree establishment at broad

  9. Modelling a Nurse Shift Schedule with Multiple Preference Ranks for Shifts and Days-Off

    Directory of Open Access Journals (Sweden)

    Chun-Cheng Lin

    2014-01-01

    Full Text Available When it comes to nurse shift schedules, it is found that the nursing staff have diverse preferences about shift rotations and days-off. The previous studies only focused on the most preferred work shift and the number of satisfactory days-off of the schedule at the current schedule period but had few discussions on the previous schedule periods and other preference levels for shifts and days-off, which may affect fairness of shift schedules. As a result, this paper proposes a nurse scheduling model based upon integer programming that takes into account constraints of the schedule, different preference ranks towards each shift, and the historical data of previous schedule periods to maximize the satisfaction of all the nursing staff's preferences about the shift schedule. The main contribution of the proposed model is that we consider that the nursing staff’s satisfaction level is affected by multiple preference ranks and their priority ordering to be scheduled, so that the quality of the generated shift schedule is more reasonable. Numerical results show that the planned shifts and days-off are fair and successfully meet the preferences of all the nursing staff.

  10. Blue and red shifted temperature dependence of implicit phonon shifts in graphene

    Science.gov (United States)

    Mann, Sarita; Jindal, V. K.

    2017-07-01

    We have calculated the implicit shift for various modes of frequency in a pure graphene sheet. Thermal expansion and Grüneisen parameter which are required for implicit shift calculation have already been studied and reported. For this calculation, phonon frequencies are obtained using force constants derived from dynamical matrix calculated using VASP code where the density functional perturbation theory (DFPT) is used in interface with phonopy software. The implicit phonon shift shows an unusual behavior as compared to the bulk materials. The frequency shift is large negative (red shift) for ZA and ZO modes and the value of negative shift increases with increase in temperature. On the other hand, blue shift arises for all other longitudinal and transverse modes with a similar trend of increase with increase in temperature. The q dependence of phonon shifts has also been studied. Such simultaneous red and blue shifts in transverse or out plane modes and surface modes, respectively leads to speculation of surface softening in out of plane direction in preference to surface melting.

  11. Combined chemical shift changes and amino acid specific chemical shift mapping of protein-protein interactions

    Energy Technology Data Exchange (ETDEWEB)

    Schumann, Frank H.; Riepl, Hubert [University of Regensburg, Institute of Biophysics and Physical Biochemistry (Germany); Maurer, Till [Boehringer Ingelheim Pharma GmbH and Co. KG, Analytical Sciences Department (Germany); Gronwald, Wolfram [University of Regensburg, Institute of Biophysics and Physical Biochemistry (Germany); Neidig, Klaus-Peter [Bruker BioSpin GmbH, Software Department (Germany); Kalbitzer, Hans Robert [University of Regensburg, Institute of Biophysics and Physical Biochemistry (Germany)], E-mail: hans-robert.kalbitzer@biologie.uni-regensburg.de

    2007-12-15

    Protein-protein interactions are often studied by chemical shift mapping using solution NMR spectroscopy. When heteronuclear data are available the interaction interface is usually predicted by combining the chemical shift changes of different nuclei to a single quantity, the combined chemical shift perturbation {delta}{delta}{sub comb}. In this paper different procedures (published and non-published) to calculate {delta}{delta}{sub comb} are examined that include a variety of different functional forms and weighting factors for each nucleus. The predictive power of all shift mapping methods depends on the magnitude of the overlap of the chemical shift distributions of interacting and non-interacting residues and the cut-off criterion used. In general, the quality of the prediction on the basis of chemical shift changes alone is rather unsatisfactory but the combination of chemical shift changes on the basis of the Hamming or the Euclidian distance can improve the result. The corrected standard deviation to zero of the combined chemical shift changes can provide a reasonable cut-off criterion. As we show combined chemical shifts can also be applied for a more reliable quantitative evaluation of titration data.

  12. Postprandial metabolic profiles following meals and snacks eaten during simulated night and day shift work.

    Science.gov (United States)

    Al-Naimi, S; Hampton, S M; Richard, P; Tzung, C; Morgan, L M

    2004-01-01

    Shift workers are known to have an increased risk of developing cardiovascular disease (CVD) compared with day workers. An important factor contributing to this increased risk could be the increased incidence of postprandial metabolic risk factors for CVD among shift workers, as a consequence of the maladaptation of endogenous circadian rhythms to abrupt changes in shift times. We have previously shown that both simulated and real shift workers showed relatively impaired glucose and lipid tolerance if a single test meal was consumed between 00:00-02:00 h (night shift) compared with 12:00-14:00 h (day shift). The objective of the present study was to extend these observations to compare the cumulative metabolic effect of consecutive snacks/meals, as might normally be consumed throughout a period of night or day shift work. In a randomized crossover study, eight healthy nonobese men (20-33 yrs, BMI 20-25kg/m2) consumed a combination of two meals and a snack on two occasions following a standardized prestudy meal, simulating night and day shift working (total energy 2500 kcal: 40% fat, 50% carbohydrate, 10% protein). Meals were consumed at 01:00/ 13:00 h and 07:00/19:00h, and the snack at 04:00/16:00 h. Blood was taken after an overnight fast, and for 8 h following the first meal on each occasion, for the measurement of glucose, insulin, triacylglycerol (TAG), and nonesterified fatty acids (NEFA). RM-ANOVA (factors time and shift) showed a significant effect of shift for plasma TAG, with higher levels on simulated night compared to day shift (p effect of shift for plasma glucose, with higher plasma glucose at night (p = 0.08), and there was a time-shift interaction for plasma insulin levels (p shift. Inspection of the area under the plasma response curve (AUC) following each meal and snack revealed that the differences in lipid tolerance occurred throughout the study, with greatest differences occurring following the mid-shift snack. In contrast, glucose tolerance was

  13. Distributed Persistent Identifiers System Design

    Directory of Open Access Journals (Sweden)

    Pavel Golodoniuc

    2017-06-01

    Full Text Available The need to identify both digital and physical objects is ubiquitous in our society. Past and present persistent identifier (PID systems, of which there is a great variety in terms of technical and social implementation, have evolved with the advent of the Internet, which has allowed for globally unique and globally resolvable identifiers. PID systems have, by in large, catered for identifier uniqueness, integrity, and persistence, regardless of the identifier’s application domain. Trustworthiness of these systems has been measured by the criteria first defined by Bütikofer (2009 and further elaborated by Golodoniuc 'et al'. (2016 and Car 'et al'. (2017. Since many PID systems have been largely conceived and developed by a single organisation they faced challenges for widespread adoption and, most importantly, the ability to survive change of technology. We believe that a cause of PID systems that were once successful fading away is the centralisation of support infrastructure – both organisational and computing and data storage systems. In this paper, we propose a PID system design that implements the pillars of a trustworthy system – ensuring identifiers’ independence of any particular technology or organisation, implementation of core PID system functions, separation from data delivery, and enabling the system to adapt for future change. We propose decentralisation at all levels — persistent identifiers and information objects registration, resolution, and data delivery — using Distributed Hash Tables and traditional peer-to-peer networks with information replication and caching mechanisms, thus eliminating the need for a central PID data store. This will increase overall system fault tolerance thus ensuring its trustworthiness. We also discuss important aspects of the distributed system’s governance, such as the notion of the authoritative source and data integrity

  14. The development of shifting radioactive material

    International Nuclear Information System (INIS)

    Chen Haiteng; Chen Yonghong; Yin Fujun; Che Mingsheng; Hu Xiaodan; Yao Shouzhong

    2010-01-01

    In nuclear field, When the nuclear material shifting from the glove-box,use the technology of plastic welding package in accordance with tradition. There are some defects in this technology because of the plastic character, such as package pierced easily, wrapper not fitted storage for long term, etc. Because of this limit. Plastic shifting technology is only fit for shifting radwaste and nuclear material not need storage from radioactive close area to non-radioactive open area for long term.As the nuclear material exiting leak when shifting in plastic package,and the plastic material don't meet the need of storaging safely for long term.We research into a new technology of nuclear material shifting. When nuclear material is carried out from the glove box. It should be sealed by welding case, then it can be storaged safely for long term. At the same time, nuclear material wouldn't pollute the glove box outside.The study achieved well effect in apply. (authors)

  15. Choice Shift in Opinion Network Dynamics

    Science.gov (United States)

    Gabbay, Michael

    Choice shift is a phenomenon associated with small group dynamics whereby group discussion causes group members to shift their opinions in a more extreme direction so that the mean post-discussion opinion exceeds the mean pre-discussion opinion. Also known as group polarization, choice shift is a robust experimental phenomenon and has been well-studied within social psychology. In opinion network models, shifts toward extremism are typically produced by the presence of stubborn agents at the extremes of the opinion axis, whose opinions are much more resistant to change than moderate agents. However, we present a model in which choice shift can arise without the assumption of stubborn agents; the model evolves member opinions and uncertainties using coupled nonlinear differential equations. In addition, we briefly describe the results of a recent experiment conducted involving online group discussion concerning the outcome of National Football League games are described. The model predictions concerning the effects of network structure, disagreement level, and team choice (favorite or underdog) are in accord with the experimental results. This research was funded by the Office of Naval Research and the Defense Threat Reduction Agency.

  16. Do working environment interventions reach shift workers?

    Science.gov (United States)

    Nabe-Nielsen, Kirsten; Jørgensen, Marie Birk; Garde, Anne Helene; Clausen, Thomas

    2016-01-01

    Shift workers are exposed to more physical and psychosocial stressors in the working environment as compared to day workers. Despite the need for targeted prevention, it is likely that workplace interventions less frequently reach shift workers. The aim was therefore to investigate whether the reach of workplace interventions varied between shift workers and day workers and whether such differences could be explained by the quality of leadership exhibited at different times of the day. We used questionnaire data from 5361 female care workers in the Danish eldercare sector. The questions concerned usual working hours, quality of leadership, and self-reported implementation of workplace activities aimed at stress reduction, reorganization of the working hours, and participation in improvements of working procedures or qualifications. Compared with day workers, shift workers were less likely to be reached by workplace interventions. For example, night workers less frequently reported that they had got more flexibility (OR 0.5; 95 % CI 0.3-0.7) or that they had participated in improvements of the working procedures (OR 0.6; 95 % CI 0.5-0.8). Quality of leadership to some extent explained the lack of reach of interventions especially among fixed evening workers. In the light of the evidence of shift workers' stressful working conditions, we suggest that future studies focus on the generalizability of results of the present study and on how to reach this group and meet their needs when designing and implementing workplace interventions.

  17. [Shift and night work and mental health].

    Science.gov (United States)

    Sancini, Angela; Ciarrocca, Manuela; Capozzella, Assunta; Corbosiero, Paola; Fiaschetti, Maria; Caciari, Tiziana; Cetica, Carlotta; Scimitto, Lara; Ponticiello, Barnaba Giuseppina; Tasciotti, Zaira; Schifano, Maria Pia; Andreozzit, Giorgia; Tomei, Francesco; Tomei, Gianfranco

    2012-01-01

    Aim of our study was to evaluate the influence that shift work and night work could have on mental health. A review of literary articles from 1990 to 2011 on shift work and night work was carried out. The results of this review confirmed that the shift work and night work affect mental health with the onset of neuropsychological disorders such as mood disorders, anxiety, nervousness, depressive anxiety syndromes, chronic fatigue and chronic insomnia irritability, sleep disturbances, reduction in levels of attention, cognitive impairments, alteration of circadian rhythm. Night work and shift work cause severe desynchronization of the cronobiological rhythms and a disruption of social life with negative effects on performance at work, on health and on social relationships. In the light of these results and recognizing shift work and night work as risk factors for the health of workers is necessary to implement preventive and periodic health checks by the occupational doctor to ensure the health and safety of workers taking account of the different environmental and individual factors.

  18. Energy shift estimation of demand response activation on domestic refrigerators – A field test study

    DEFF Research Database (Denmark)

    Lakshmanan, Venkatachalam; Gudmand-Høyer, Kristian; Marinelli, Mattia

    2014-01-01

    This paper presents a method to estimate the amount of energy that can be shifted during demand response (DR) activation on domestic refrigerator. Though there are many methods for DR activation like load reduction, load shifting and onsite generation, the method under study is load shifting....... Electric heating and cooling equipment like refrigerators, water heaters and space heaters and coolers are preferred for such DR activation because of their energy storing capacity. Accurate estimation of available regulating power and energy shift is important to understand the value of DR activation...... at any time. In this paper a novel method to estimate the available energy shift from domestic refrigerators with only two measurements, namely fridge cool chamber temperature and compressor power consumption is proposed, discussed and evaluated....

  19. Night shift fatigue among anaesthesia trainees at a major metropolitan teaching hospital.

    Science.gov (United States)

    Lancman, B M

    2016-05-01

    Night shifts expose anaesthesia trainees to the risk of fatigue and, potentially, fatigue-related performance impairment. This study examined the workload, fatigue and coping strategies of anaesthesia trainees during night shifts. A blinded survey-based study was undertaken at a major single centre metropolitan teaching hospital in Australia. All ten anaesthesia trainees who worked night shifts participated. The survey collected data on duration of night shifts, workload, and sleep patterns. Fatigue was assessed using the Karolinska Sleepiness Scale (KSS). There were 93 night shifts generating data out of a potential 165. Trainees tended to sleep an increasing amount before their shift as the nights progressed from 1 to 5. Night 1 was identified as an 'at risk' night due to the amount of time spent awake before arriving at work (32% awake for U+003E8 hours); on all other nights trainees were most likely to have slept 6-8 hours. The KSS demonstrated an increase in sleepiness of 3 to 4 points on the scale from commencement to conclusion of a night shift. The Night 1 conclusion sleepiness was markedly worse than any other night with 42% falling into an 'at-risk' category. The findings demonstrate fatigue and inadequate sleep in anaesthesia trainees during night shifts in a major metropolitan teaching hospital. The data obtained may help administrators prepare safer rosters, and junior staff develop improved strategies to reduce the likelihood of fatigue.

  20. Internally readable identifying tag

    International Nuclear Information System (INIS)

    Jefferts, K.B.; Jefferts, E.R.

    1980-01-01

    A method of identifying non-metallic objects by means of X-ray equipment is described in detail. A small metal pin with a number of grooves cut in a pre-determined equi-spaced pattern is implanted into the non-metallic object and by decoding the groove patterns using X-ray equipment, the object is uniquely identified. A specific example of such an application is in studying the migratory habits of fish. The pin inserted into the snout of the fish is 0.010 inch in diameter, 0.040 inch in length with 8 possible positions for grooves if spaced 0.005 inch apart. With 6 of the groove positions available for data, the capacity is 2 6 or 64 combinations; clearly longer pins would increase the data capacity. This method of identification is a major advance over previous techniques which necessitated destruction of the fish in order to recover the identification tag. (UK)

  1. New type shift operators for circular well potential in two dimensions

    International Nuclear Information System (INIS)

    Sun Guohua; Dong Shihai

    2010-01-01

    New type shift operators for circular well potential in two dimensions are identified. These so-called shift operators connect those quantum systems with the different potentials but with same energy spectrum. It should be noted that these operators depend on both the radial circular and angular variables r and φ. We find that the operators P ± =P x ±P y play the role of the shift operators. The radial linear momentum P r =-ih(∂)/(∂r) , the angular momentum L z =-ih(∂)/(∂φ) and the Hamiltonian form a complete set of commuting operators with the SO(2) symmetry.

  2. Identifying Breast Cancer Oncogenes

    Science.gov (United States)

    2010-10-01

    tyrosine kinases with an SH3, SH2 and catalytic domain, it lacks a native myristylation signal shared by most members of this class [14], [38]. The...therapeutics and consequently, improve clinical outcomes. We aim to identify novel drivers of breast oncogenesis. We hypothesize that a kinase gain-of...human mammary epithelial cells. A pBabe-Puro-Myr-Flag kinase open reading frame (ORF) library was screened in immortalized human mammary epithelial

  3. Rock disposal problems identified

    Energy Technology Data Exchange (ETDEWEB)

    Knox, R

    1978-06-01

    Mathematical models are the only way of examining the return of radioactivity from nuclear waste to the environment over long periods of time. Work in Britain has helped identify areas where more basic data is required, but initial results look very promising for final disposal of high level waste in hard rock repositories. A report by the National Radiological Protection Board of a recent study, is examined.

  4. From Product to Service Design: A Thinking Paradigm Shift

    Directory of Open Access Journals (Sweden)

    Liliana Rodriguez

    2014-12-01

    Full Text Available Society, industry and the economy are all experiencing changes caused by a shift from products to services. While a “problem-solving” approach is commonly used for the development of products, new design approaches are needed as the primary unit of exchange moves from goods to services.  This research argues that a fundamental transformation in the design world is taking place, manifested in a thinking paradigm shift from problem solving (designing products towards systems thinking (designing services. This paper draws on design literature to identify concepts of systems thinking and problem solving to help understand core elements in the shift from product to service design. It also reports on a series of semi-structured interviews with designers working in five design consultancies that have moved from product design to services design. The results show a change in the way designers think and approach projects when facing the challenges of designing services, confirming a movement from problem solving to systems thinking. However, systems thinking is not replacing problem solving but complementing it. The results also indicate that the growing complexity of the issues designers deal with influences the adoption of systems thinking in responding to service design challenges, as well as current changes in people’s ideas about sustainability and  society.

  5. Body size distributions signal a regime shift in a lake ...

    Science.gov (United States)

    Communities of organisms, from mammals to microorganisms, have discontinuous distributions of body size. This pattern of size structuring is a conservative trait of community organization and is a product of processes that occur at multiple spatial and temporal scales. In this study, we assessed whether body size patterns serve as an indicator of a threshold between alternative regimes. Over the past 7000 years, the biological communities of Foy Lake (Montana,USA) have undergone a major regime shift owing to climate change. We used a palaeoecological record of diatom communities to estimate diatom sizes, and then analysed the discontinuous distribution of organism sizes over time. We used Bayesian classification and regression tree models to determine that all time intervals exhibited aggregations of sizes separated by gaps in the distribution and found a significant change in diatom body size distributions approximately 150 years before the identified ecosystem regime shift. We suggest that discontinuity analysis is a useful addition to the suite of tools for the detection of early warning signals of regime shifts. Communities of organisms from mammals to microorganisms have discontinuous distributions of body size. This pattern of size structuring is a conservative trait of community organization and is a product of processes that occur at discrete spatial and temporal scales within ecosystems. Here, a paleoecological record of diatom community change is use

  6. Spectral Envelope Transformation in Singing Voice for Advanced Pitch Shifting

    Directory of Open Access Journals (Sweden)

    José L. Santacruz

    2016-11-01

    Full Text Available The aim of the present work is to perform a step towards more natural pitch shifting techniques in singing voice for its application in music production and entertainment systems. In this paper, we present an advanced method to achieve natural modifications when applying a pitch shifting process to singing voice by modifying the spectral envelope of the audio excerpt. To this end, an all-pole model has been selected to model the spectral envelope, which is estimated using a constrained non-linear optimization. The analysis of the global variations of the spectral envelope was carried out by identifying changes of the parameters of the model along with the changes of the pitch. With the obtained spectral envelope transformation functions, we applied our pitch shifting scheme to some sustained vowels in order to compare results with the same transformation made by using the Flex Pitch plugin of Logic Pro X and pitch synchronous overlap and add technique (PSOLA. This comparison has been carried out by means of both an objective and a subjective evaluation. The latter was done with a survey open to volunteers on our website.

  7. [Working time and sleep in nursing staff employed in "3 x 8" and "2 x 12" fast rotating shift schedules].

    Science.gov (United States)

    Castellini, G; Anelli, M M; Punzi, S; Boari, P; Camerino, D; Costa, G

    2011-01-01

    The study is aimed at assessing, in 200 nurses shift workers, the impact on sleep of two different working areas ("emergency" and "hospitalization") having the same "3 x 8" shift system, and of two different shift schedules at quick rotation ("2 x 12" and "3 x 8") in the same working area ("emergency"). Night and morning shifts prove to interfere to a greater extent with sleep in relation to both "2 x 12" and "3 x 8" shift systems as well as to the two operative areas. Hence the importance to consider in shift work planning, the direction of shift rotation and the length of the duty period according to the type of activity.

  8. Effects of extended work shifts on employee fatigue, health, satisfaction, work/family balance, and patient safety.

    Science.gov (United States)

    Estryn-Béhar, Madeleine; Van der Heijden, Beatrice I J M

    2012-01-01

    12-hour shifts are quickly spreading in Europe. From our multivariate analysis concerning 25,924 European nurses, including twenty explanatory variables simultaneously, we found that work schedule itself is not a major determinant factor. Nurses aim to choose or accept night shifts or 12-hour shift in order to reduce their work/home conflicts, however, at the expense of the patient's safety, as well as their own health and safety. Therefore, it is important to develop measures, such as extended child care, association of nurses to the elaboration of their rota, 9- or 10-hour shifts in the afternoon, allowing naps during night shifts, and reduction of changing shifts with short notice. Work schedules must be organized in order to allow time for shift handover, social support and team building.

  9. The affective shift model of work engagement.

    Science.gov (United States)

    Bledow, Ronald; Schmitt, Antje; Frese, Michael; Kühnel, Jana

    2011-11-01

    On the basis of self-regulation theories, the authors develop an affective shift model of work engagement according to which work engagement emerges from the dynamic interplay of positive and negative affect. The affective shift model posits that negative affect is positively related to work engagement if negative affect is followed by positive affect. The authors applied experience sampling methodology to test the model. Data on affective events, mood, and work engagement was collected twice a day over 9 working days among 55 software developers. In support of the affective shift model, negative mood and negative events experienced in the morning of a working day were positively related to work engagement in the afternoon if positive mood in the time interval between morning and afternoon was high. Individual differences in positive affectivity moderated within-person relationships. The authors discuss how work engagement can be fostered through affect regulation. (c) 2011 APA, all rights reserved.

  10. Special offer for early shift takers!

    CERN Multimedia

    Muriel

    Peter Jenni, spokesperson of the ATLAS collaboration, just made the following announcement. "Despite the few problems that we are encountering, which of course are unavoidable in such a large project, I am very pleased with the way the ATLAS experiment is taking shape. With the imminence of data taking, I would like to make a special gesture as a thank you to all of you who are working so hard for ATLAS to meet its many deadlines. The first 100 ATLAS members who will sign up for shifts will receive twice the standard OTSMOU credit." You can sign up for shifts as of April 1st by sending an e-mail to Atlas.Shifts@cern.ch.

  11. Application of the power-shift transformation

    Energy Technology Data Exchange (ETDEWEB)

    Beauchamp, J.J.; Kane, V.E.

    1984-01-01

    Some of the practical consequences of entertaining the power-shift transformation are examined for both analysis of variance and simple random sampling data. The appropriateness of different procedures for estimating the transformation parameters is also considered. Standard maximum likelihood (ml) estimation is shown not to be feasible for the joint estimation of the power-shift parameters. However, it is possible to compute local ml estimates for some problems, but special estimation methods may be necessary. An alternative weighted order statistic (wos) estimator is shown to be useful in some situations. Characteristics of ml and wos estimation for the power-shift transformation are examined by a Monte Carlo experiment. A Box and Cox (1964) example and several other data sets are used to illustrate the estimation procedures. 46 references, 5 figures, 1 table.

  12. Shift Work, Chronotype, and Melatonin Patterns among Female Hospital Employees on Day and Night Shifts.

    Science.gov (United States)

    Leung, Michael; Tranmer, Joan; Hung, Eleanor; Korsiak, Jill; Day, Andrew G; Aronson, Kristan J

    2016-05-01

    Shift work-related carcinogenesis is hypothesized to be mediated by melatonin; however, few studies have considered the potential effect modification of this underlying pathway by chronotype or specific aspects of shift work such as the number of consecutive nights in a rotation. In this study, we examined melatonin patterns in relation to shift status, stratified by chronotype and number of consecutive night shifts, and cumulative lifetime exposure to shift work. Melatonin patterns of 261 female personnel (147 fixed-day and 114 on rotations, including nights) at Kingston General Hospital were analyzed using cosinor analysis. Urine samples were collected from all voids over a 48-hour specimen collection period for measurement of 6-sulfatoxymelatonin concentrations using the Buhlmann ELISA Kit. Chronotypes were assessed using mid-sleep time (MSF) derived from the Munich Chronotype Questionnaire (MCTQ). Sociodemographic, health, and occupational information were collected by questionnaire. Rotational shift nurses working nights had a lower mesor and an earlier time of peak melatonin production compared to day-only workers. More pronounced differences in mesor and acrophase were seen among later chronotypes, and shift workers working ≥3 consecutive nights. Among nurses, cumulative shift work was associated with a reduction in mesor. These results suggest that evening-types and/or shift workers working ≥3 consecutive nights are more susceptible to adverse light-at-night effects, whereas long-term shift work may also chronically reduce melatonin levels. Cumulative and current exposure to shift work, including nights, affects level and timing of melatonin production, which may be related to carcinogenesis and cancer risk. Cancer Epidemiol Biomarkers Prev; 25(5); 830-8. ©2016 AACR. ©2016 American Association for Cancer Research.

  13. Validation of a Cephalad Fluid Shift Countermeasure

    Science.gov (United States)

    Macias, B.; Cole, C.; Kesari, S.; Hargens, A.; Stenger, M.; Ebert, D.; Lee, S. M. C.; Sargsyan, A.; Liu, J.

    2016-01-01

    INTRODUCTION: This project will provide critical data required to objectively determine how an optimized thigh cuff could be incorporated into the NASA integrated physiological countermeasure suite. This project will determine if thigh cuffs used during simulated spaceflight impact intracranial pressure (ICP), ocular structure and function, and intraocular pressure (IOP) using state of-the-art techniques. Additionally, some of the same methods, hardware, and protocols will be employed in the present investigation to enable direct comparisons to the International Space Station (ISS) "Fluid Shifts" experiment with Chibis-Lower Body Negative Pressure (LBNP). This study will determine the temporal physiological responses of thigh cuff application and removal on ocular and cerebral variables (including invasive ICP) in a microgravity analog. Furthermore, this proposed study will determine tissue pressure distribution applied by thigh cuffs in order to improve comfort, mobility, and efficacy of the countermeasure. Our specific aim is to determine the efficacy of a novel thigh cuff device to mitigate cephalad fluid shifts. We hypothesize that a thigh cuff countermeasure employed in a microgravity analog will temporarily reverse or attenuate ocular and cerebral-volume-pressure variables, approaching normal Earth-based seated posture, the most frequent posture assumed in daily life. In addition, we hypothesize that the magnitude of fluid and pressure redistribution using a thigh cuff countermeasure may require a longer exposure time than that of Chibis-LBNP (using ground-based data from our "Fluid Shifts" project). This project directly addresses Critical Path Roadmap Risks and Questions regarding "Risk of Spaceflight-Induced Intracranial Hypertension/Vision Alterations," and IRP Gap VIIP13: We need to identify preventative and treatment countermeasures to mitigate changes in ocular structure and function and intracranial pressure during spaceflight. METHODS: Noninvasive

  14. Directionality of recent bird distribution shifts and climate change in Great Britain.

    Science.gov (United States)

    Gillings, Simon; Balmer, Dawn E; Fuller, Robert J

    2015-06-01

    There is good evidence that species' distributions are shifting poleward in response to climate change and wide interest in the magnitude of such responses for scientific and conservation purposes. It has been suggested from the directions of climatic changes that species' distribution shifts may not be simply poleward, but this has been rarely tested with observed data. Here, we apply a novel approach to measuring range shifts on axes ranging through 360°, to recent data on the distributions of 122 species of British breeding birds during 1988-1991 and 2008-2011. Although previously documented poleward range shifts have continued, with an average 13.5 km shift northward, our analysis indicates this is an underestimate because it ignores common and larger shifts that occurred along axes oriented to the north-west and north-east. Trailing edges contracted from a broad range of southerly directions. Importantly, these results are derived from systematically collected data so confounding observer-effort biases can be discounted. Analyses of climate for the same period show that whilst temperature trends should drive species along a north-north-westerly trajectory, directional responses to precipitation will depend on both the time of year that is important for determining a species' distribution, and the location of the range margin. Directions of species' range centroid shift were not correlated with spatial trends in any single climate variable. We conclude that range shifts of British birds are multidirectional, individualistic and probably determined by species-specific interactions of multiple climate factors. Climate change is predicted to lead to changes in community composition through variation in the rates that species' ranges shift; our results suggest communities could change further owing to constituent species shifting along different trajectories. We recommend more studies consider directionality in climate and range dynamics to produce more

  15. Hardiness, psychosocial factors and shift work tolerance among nurses - a 2-year follow-up study.

    Science.gov (United States)

    Saksvik-Lehouillier, Ingvild; Bjorvatn, Bjørn; Magerøy, Nils; Pallesen, Ståle

    2016-08-01

    To examine the predictive power of the subfactors of hardiness (commitment, control and challenge) on shift work tolerance (measured with sleepiness, fatigue, anxiety and depression) over 2 years in nurses working shifts. We also investigated the direct effects of psychosocial variables such as role conflict, social support and fair leadership on shift work tolerance, as well as their moderating role on the relationship between hardiness and shift work tolerance. Several scholars have discussed the role of individual differences and psychosocial variables in predicting shift work tolerance. The conclusions are not clear. Longitudinal questionnaire study. A sample of Norwegian nurses employed in shift work including nights participated in this longitudinal questionnaire study: 1877 at baseline, 1228 at 1-year follow-up and 659 nurses at 2-year follow-up. Data were collected in three waves, first wave in 2008 and third in 2011 and were analysed with a series of hierarchical multiple regression analyses. We found that the subfactor commitment could predict fatigue over 1 year and anxiety and depression over 2 years. Challenge could predict anxiety over 1 year. Control was unrelated to shift work intolerance. Hardiness did not predict sleepiness. Social support, role conflict and fair leadership were important for some aspects of shift work tolerance; however, hardiness seemed to be more eminent for shift work tolerance than the psychosocial variables. Social support moderated the relationship between hardiness and shift work tolerance to some degree, but this interaction was weak. Hardiness can to some degree predict shift work tolerance over 2 years among nurses. © 2016 John Wiley & Sons Ltd.

  16. Very Long (> 48 hours) Shifts and Cardiovascular Strain in Firefighters: a Theoretical Framework.

    Science.gov (United States)

    Choi, Bongkyoo; Schnall, Peter L; Dobson, Marnie; Garcia-Rivas, Javier; Kim, Hyoungryoul; Zaldivar, Frank; Israel, Leslie; Baker, Dean

    2014-03-06

    Shift work and overtime have been implicated as important work-related risk factors for cardiovascular disease (CVD). Many firefighters who contractually work on a 24-hr work schedule, often do overtime (additional 24-hr shifts) which can result in working multiple, consecutive 24-hr shifts. Very little research has been conducted on firefighters at work that examines the impact of performing consecutive 24-hr shifts on cardiovascular physiology. Also, there have been no standard field methods for assessing in firefighters the cardiovascular changes that result from 24-hr shifts, what we call "cardiovascular strain". The objective of this study, as the first step toward elucidating the role of very long (> 48 hrs) shifts in the development of CVD in firefighters, is to develop and describe a theoretical framework for studying cardiovascular strain in firefighters on very long shifts (i.e., > 2 consecutive 24-hr shifts). The developed theoretical framework was built on an extensive literature review, our recently completed studies with firefighters in Southern California, e-mail and discussions with several firefighters on their experiences of consecutive shifts, and our recently conducted feasibility study in a small group of firefighters of several ambulatory cardiovascular strain biomarkers (heart rate, heart rate variability, blood pressure, salivary cortisol, and salivary C-reactive protein). The theoretical framework developed in this study will facilitate future field studies on consecutive 24-hr shifts and cardiovascular health in firefighters. Also it will increase our understanding of the mechanisms by which shift work or long work hours can affect CVD, particularly through CVD biological risk factors, and thereby inform policy about sustainable work and rest schedules for firefighters.

  17. Nuclear power plant shift technical advisor. Recommendations for position description, qualifications, education and training

    International Nuclear Information System (INIS)

    1981-01-01

    The purpose of this document is to describe the position and identify specific areas of formal education, plant-specific training and experience necessary to assure an advanced level of analytical ability on shift. These recommendations will provide a level of technical ability that is essential to improved operational safety and are consistent with regulatory requirements. This position was developed in conjunction with representatives of utilities, equipment vendors and engineering educators, giving consideration to specific contributions the function must make to shift operations

  18. Shift work in a security environment

    International Nuclear Information System (INIS)

    Longhouser, G.A. Jr.

    1993-01-01

    Human beings are diurnal species, normally active by day and asleep by night. Yet over thirty million Americans struggle with work schedules that include an off-normal work effort. The railroads, law enforcement, health services, Department of Defense, factory workers, chemical plants and public services, communications and utility workers must provide some form of around-the-clock effort. Shift work has been around since the advent of recorded history. There has always been a need for some type of off-normal service and assistance. The impact of shift work is replete with tales and factual evidence of an increased personnel error rate; disorders, both personal and family, and of course, increased accident events. In recent memory, the Three Mile Island Nuclear Plant incident, Union Carbide's explosion in Bhopal, and the Chernobyl Nuclear Plant catastrophe all occurred during off-normal working hours. Yet management overall has done little to correct the production-driven twelve hour, seven day week shift mentality of the nineteenth century. Most schedules in use today are nothing more than cosmetic variations of the old production schedules. This could be driven by a management consideration of the worker's response to change coupled with a reluctant buy-in of responsibility for the effects of change. Florida Power Corporation has developed for its nuclear security force, a unique work schedule which attempts to employ the sound principles of circadian rhythms coupled with a comprehensive training program to counter the problems associated with shift work. The results over the last four years have seen a marked reduction in the generic problems of personnel errors, absenteeism, unscheduled overtime and turnover rates. Utilization and understanding of this scheduling process for rotational shift work needs to be assessed to determine if the benefits are site specific or provide an expected response to the problems of shift work

  19. Breaking chaotic shift key communication via adaptive key identification

    International Nuclear Information System (INIS)

    Ren Haipeng; Han Chongzhao; Liu Ding

    2008-01-01

    This paper proposes an adaptive parameter identification method for breaking chaotic shift key communication from the transmitted signal in public channel. The sensitive dependence property of chaos on parameter mismatch is used for chaos adaptive synchronization and parameter identification. An index function about the synchronization error is defined and conjugate gradient method is used to minimize the index function and to search the transmitter's parameter (key). By using proposed method, secure key is recovered from transmitted signal generated by low dimensional chaos and hyper chaos switching communication. Multi-parameters can also be identified from the transmitted signal with noise

  20. Nuclear polarization shifts in light muonic atoms

    International Nuclear Information System (INIS)

    Rosenfelder, R.

    1983-01-01

    A consistent nonrelativistic expression for the energy shift in muonic atoms due to second-order processes is derived under the assumption that the muon is weakly bound. The transverse contribution is shown to be finite only if the two-photon ('seagull') amplitude is taken into account as required by gauge invariance. Numerical results are presented for muonic 12 C using a recently developed model for the nuclear response function. The total transverse contributions to the energy shift are found to be small although dependent to some extent on the detailed high-momentum behaviour of the seagull term. (orig.)

  1. Lamb shift in the muonic deuterium atom

    Energy Technology Data Exchange (ETDEWEB)

    Krutov, A. A.; Martynenko, A. P. [Samara State University, Pavlov street 1, 443011, Samara (Russian Federation); Samara State University, Pavlov Street 1, 443011, Samara, Russia and Samara State Aerospace University named after academician S.P. Korolyov, Moskovskoye Shosse 34, 443086, Samara (Russian Federation)

    2011-11-15

    We present an investigation of the Lamb shift (2P{sub 1/2}-2S{sub 1/2}) in the muonic deuterium ({mu}D) atom using the three-dimensional quasipotential method in quantum electrodynamics. The vacuum polarization, nuclear-structure, and recoil effects are calculated with the account of contributions of orders {alpha}{sup 3}, {alpha}{sup 4}, {alpha}{sup 5}, and {alpha}{sup 6}. The results are compared with earlier performed calculations. The obtained numerical value of the Lamb shift at 202.4139 meV can be considered a reliable estimate for comparison with forthcoming experimental data.

  2. Lamb shift in helium-like uranium

    International Nuclear Information System (INIS)

    Munger, C.T. Jr.

    1987-01-01

    The author reports an experimental value of 70.4 (8.3) ev for the one-electron Lamb shift in uranium, in agreement with the theoretical value of 75.3 (0.4) ev. He extracts the Lamb shift from a beam-foil time-of-flight measurement of the 54.4 (3.4) ps lifetime of the 1s2p/sub 1/2/ 3 P 0 state of helium-like (two electron) uranium

  3. Sleep, immunity and shift workers: A review

    Directory of Open Access Journals (Sweden)

    Carlos Mauricio Oliveira de Almeida

    2016-07-01

    Full Text Available To date, shift workers represent between 15% and 25% of the modern day workforce. Work time poses a great challenge to workers as it requires that they balance productivity and sleep time between shifts. As a result, these workers experience chronic sleep deprivation with increased fatigue and drowsiness due to this sleep deprivation. The impact of this kind of work on the immune system is not yet known. We conducted a literature review with the aim of evaluating articles on this specific type of work's effects on sleep and immunity.

  4. Abdominal rectus muscle atrophy and midline shift after colostomy creation.

    Science.gov (United States)

    Timmermans, Lucas; Deerenberg, Eva B; van Dijk, Sven M; Lamme, Bas; Koning, Anton H; Kleinrensink, Gert-Jan; Jeekel, Johannes; Lange, Johan F

    2014-04-01

    Incisional hernia (IH) can be attributed to multiple factors. The presence of a parastomal hernia has shown to be a risk factor for IH after midline laparotomy. Our hypothesis is that this increased risk of IH may be caused by changes in biomechanical forces, such as midline shift to the contralateral side of the colostomy owing to decreased restraining forces at the site of the colostomy, and left abdominal rectus muscle (ARM) atrophy owing to intercostal nerve damage. Patients were selected if they underwent end-colostomy via open operation between 2004 and 2011. Patients were eligible if computed tomography (CT) had been performed postoperatively. If available, preoperative CTs were collected for case-control analyses. Midline shift was measured using V-scope application in the I-space, a CAVE-like virtual reality system. For the ARM atrophy hypothesis, measurements of ARM were performed at the level of colostomy, and 3 and 8 cm cranial and caudal of the colostomy. Postoperative CT were available for 77 patients; of these patients, 30 also had a preoperative CT. Median follow-up was 19 months. A mean shift to the right side was identified after preoperative and postoperative comparison; from -1.3 ± 4.6 to 2.1 ± 9.3 (P = .043). Furthermore, during rectus muscle measurements, a thinner left ARM was observed below the level of colostomy. Creation of a colostomy alters the abdominal wall. Atrophy of the left ARM was seen caudal to the level of the colostomy, and a midline shift to the right side was evident on CT. These changes may explain the increased rate of IH after colostomy creation. Copyright © 2014 Mosby, Inc. All rights reserved.

  5. The legacy of large regime shifts in shallow lakes.

    Science.gov (United States)

    Ramstack Hobbs, Joy M; Hobbs, William O; Edlund, Mark B; Zimmer, Kyle D; Theissen, Kevin M; Hoidal, Natalie; Domine, Leah M; Hanson, Mark A; Herwig, Brian R; Cotner, James B

    2016-12-01

    Ecological shifts in shallow lakes from clear-water macrophyte-dominated to turbid-water phytoplankton-dominated are generally thought of as rapid short-term transitions. Diatom remains in sediment records from shallow lakes in the Prairie Pothole Region of North America provide new evidence that the long-term ecological stability of these lakes is defined by the legacy of large regime shifts. We examine the modern and historical stability of 11 shallow lakes. Currently, four of the lakes are in a clear-water state, three are consistently turbid-water, and four have been observed to change state from year to year (transitional). Lake sediment records spanning the past 150-200 yr suggest that (1) the diatom assemblage is characteristic of either clear or turbid lakes, (2) prior to significant landscape alteration, all of the lakes existed in a regime of a stable clear-water state, (3) lakes that are currently classified as turbid or transitional have experienced one strong regime shift over the past 150-200 yr and have since remained in a regime where turbid-water predominates, and (4) top-down impacts to the lake food-web from fish introductions appear to be the dominant driver of strong regime shifts and not increased nutrient availability. Based on our findings we demonstrate a method that could be used by lake managers to identify lakes that have an ecological history close to the clear-turbid regime threshold; such lakes might more easily be returned to a clear-water state through biomanipulation. The unfortunate reality is that many of these lakes are now part of a managed landscape and will likely require continued intervention. © 2016 by the Ecological Society of America.

  6. Age and individual sleep characteristics affect cognitive performance in anesthesiology residents after a 24-hour shift.

    Science.gov (United States)

    Tadinac, Meri; Sekulić, Ante; Hromatko, Ivana; Mazul-Sunko, Branka; Ivancić, Romina

    2014-03-01

    Previous research has shown that both shift work and sleep deprivation have an adverse influence on various aspects of human cognitive performance. The aim of this study was to explore changes in cognitive functioning and subjective sleepiness of anesthesiology residents after a 24-hour shift. Twenty-six anesthesiology residents completed a set of psychological instruments at the beginning and at the end of the shift, as well as a questionnaire regarding information about the shift, Stanford Sleepiness Scale, and Circadian Type Questionnaire. There was a significant decline in cognitive performance measured by the Auditory Verbal Learning Test after the shift. The effect was stronger in older participants and in those with high scores on rigidity of sleep scale and low scores on the ability to overcome sleepiness scale. There were no differences in the digits forward test (a measure of concentration), while digits backward test (a measure of working memory) even showed an improved performance after the shift. Although participants reported being significantly sleepier after the shift, the subjective sleepiness did not correlate with any of the objective measures of cognitive performance. In conclusion, the performance in short tasks involving concentration and working memory was not impaired, while performance in long-term and monotone tasks declined after sleep deprivation, and the magnitude of this decline depended on the specific individual characteristics of sleep and on age Surprisingly, age seemed to have an important impact on cognitive functions after shift work even in the relatively age-homogeneous population of young anesthesiology residents.

  7. ORCID: Author Identifiers for Librarians

    Directory of Open Access Journals (Sweden)

    Robyn B. Reed

    2017-10-01

    Full Text Available Generating accurate publication lists by researchers can be challenging when faced with scholars who have common names or who have published under name variations. This article describes ORCID and the goal of generating author identifiers for scholars to connect their research outputs. Included are the reasons for having author identifiers as well as the types of information within individual profiles. This article includes information on how academic libraries are playing a role with ORCID initiatives as well as describing how publishers, institutions, and funders are employing ORCID in their workflows. Highlighted is material on academic institutions in Pennsylvania using ORCID. The purpose of the article is to provide an overview of ORCID and its uses to inform librarians about this important initiative.

  8. Contributors to shift work tolerance in South Korean nurses working rotating shift.

    Science.gov (United States)

    Jung, Hye-Sun; Lee, Bokim

    2015-05-01

    Shift workers have rapidly increased in South Korea; however, there is no published research exploring shift work tolerance among South Korean workers. This study aimed to investigate factors related to shift work tolerance in South Korean nurses. The sample comprised of 660 nurses who worked shifts in a large hospital in South Korea. A structured questionnaire included following comprehensive variables: demographic (age and number of children), individual (morningness and self-esteem), psychosocial (social support and job stress), lifestyle (alcohol consumption, physical activity, and BMI), and working condition factors (number of night shifts and working hours). Shift work tolerance was measured in terms of insomnia, fatigue, and depression. The results of hierarchical regressions indicate that all variables, except for three, number of children, BMI, and working hours, were related to at least one of the symptoms associated with shift work tolerance. Based on these results, we offer some practical implications to help improve shift work tolerance of workers. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Identifying phenomenal consciousness.

    Science.gov (United States)

    Schier, Elizabeth

    2009-03-01

    This paper examines the possibility of finding evidence that phenomenal consciousness is independent of access. The suggestion reviewed is that we should look for isomorphisms between phenomenal and neural activation spaces. It is argued that the fact that phenomenal spaces are mapped via verbal report is no problem for this methodology. The fact that activation and phenomenal space are mapped via different means does not mean that they cannot be identified. The paper finishes by examining how data addressing this theoretical question could be obtained.

  10. Are All Pixels Equally Important?

    CERN Multimedia

    CERN. Geneva

    2015-01-01

    When we look at our environment, we primarily pay attention to visually distinctive objects. We refer to these objects as visually important or salient. For efficient visual processing, the human visual system identifies salients objects and dedicates most of its processing resources to them. An analogous resource allocation can be performed by salient-object detection algorithms, which identify objects of interest in an image. Consequently, thanks to salient-object detection, complex visual computing operations can focus on the important parts of the visual data and can save time and resources. About the speaker Dr. Gokhan Yildirim is a research assistant in the School of Computer and Communication Sciences (IC) at the École Polytechnique Fédérale de Lausanne (EPFL). His research interests include image understanding, multimedia, pattern recognition, machine learning, salient-object detection on images & videos and its applications on image proces...

  11. Rainbow-shift mechanism behind discrete optical-potential ambiguities

    International Nuclear Information System (INIS)

    Brandan, M.E.; McVoy, K.W.

    1991-01-01

    Some years ago, Drisko et al. suggested that the discrete ambiguity often encountered for elastic scattering optical potentials could be understood as being due to the interior or small-l S-matrix elements for two ''equivalent'' potentials differing in phase by 2π, l-by-l. We point out that the absence of this phase change for peripheral partial waves is equally essential, and suggest that a deeper understanding of the ambiguity may be achieved by viewing it as a consequence of a farside interference between interior and peripheral partial waves. It is this interference which produces the broad ''Airy maxima'' of a nuclear rainbow, and we show that a Drisko-type phase-shift increment δ l →(δ l +π) for low-l phases relative to the high-l ones is exactly what is needed to shift a farside rainbow pattern by one Airy maximum, thus providing an equivalent ''rainbow-shift'' interpretation of the discrete ambiguity. The physical importance of both interpretations lies in the fact that the existence of discrete ambiguities (as well as of nuclear rainbows) is explicit evidence for low-l transparency in nucleus-nucleus collisions. The essential role played by low partial waves explains why peripheral reactions have generally not proven helpful in resolving this ambiguity

  12. Increased diversification rates follow shifts to bisexuality in liverworts.

    Science.gov (United States)

    Laenen, Benjamin; Machac, Antonin; Gradstein, S Robbert; Shaw, Blanka; Patiño, Jairo; Désamoré, Aurélie; Goffinet, Bernard; Cox, Cymon J; Shaw, A Jonathan; Vanderpoorten, Alain

    2016-05-01

    Shifts in sexual systems are one of the key drivers of species diversification. In contrast to angiosperms, unisexuality prevails in bryophytes. Here, we test the hypotheses that bisexuality evolved from an ancestral unisexual condition and is a key innovation in liverworts. We investigate whether shifts in sexual systems influence diversification using hidden state speciation and extinction analysis (HiSSE). This new method compares the effects of the variable of interest to the best-fitting latent variable, yielding robust and conservative tests. We find that the transitions in sexual systems are significantly biased toward unisexuality, even though bisexuality is coupled with increased diversification. Sexual systems are strongly conserved deep within the liverwort tree but become much more labile toward the present. Bisexuality appears to be a key innovation in liverworts. Its effects on diversification are presumably mediated by the interplay of high fertilization rates, massive spore production and long-distance dispersal, which may separately or together have facilitated liverwort speciation, suppressed their extinction, or both. Importantly, shifts in liverwort sexual systems have the opposite effect when compared to angiosperms, leading to contrasting diversification patterns between the two groups. The high prevalence of unisexuality among liverworts suggests, however, a strong selection for sexual dimorphism. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  13. Transformational Change and Regime Shifts in the Circumpolar Arctic

    Directory of Open Access Journals (Sweden)

    Annika E. Nilsson

    2016-11-01

    Full Text Available The Arctic is changing rapidly, and there are many indications that the region is in the midst of transformational change. While some of the focus relates to impacts of climate change, rapid economic development and the potential for shifts in political and social structures in the region have also been in the limelight. This article looks at the circumpolar Arctic as a potential case of a regime shift in a large-scale social–ecological system that includes reinforcing feedbacks. A special focus is placed on governance structures, as these play an important role in social negotiations on the relationship between societies and the environment. While climate change is often portrayed as a driver of social change in the Arctic, it does not appear that the ongoing changes in the biophysical features of the Arctic region have rocked current circumpolar governance structures out of kilter. On the contrary, the ongoing climate-related changes, in particular sea ice decline, appear to have reinforced political commitment to existing legal structures. Major past social regime shifts have mainly been related to access to resources and national identity ideology, with political dynamics reinforced at times by military security considerations.

  14. Shift Work and Health: Current Problems and Preventive Actions

    Directory of Open Access Journals (Sweden)

    Giovanni Costa

    2010-12-01

    Full Text Available The paper gives an overview of the problems to be tackled nowadays by occupational health with regards to shift work as well as the main guidelines at organizational and medical levels on how to protect workers’ health and well-being. Working time organization is becoming a key factor on account of new technologies, market globalization, economic competition, and extension of social services to general populations, all of which involve more and more people in continuous assistance and control of work processes over the 24 hours in a day. The large increase of epidemiological and clinical studies on this issue document the severity of this risk factor on human health and well being, at both social and psychophysical levels, starting from a disruption of biological circadian rhythms and sleep/wake cycle and ending in several psychosomatic troubles and disorders, likely also including cancer, and extending to impairment of performance efficiency as well as family and social life. Appropriate interventions on the organization of shift schedules according to ergonomic criteria and careful health surveillance and social support for shift workers are important preventive and corrective measures that allow people to keep working without significant health impairment.

  15. SeaQuest/E906 Shift Alarm System

    Science.gov (United States)

    Kitts, Noah

    2014-09-01

    SeaQuest, Fermilab E906, is a fixed target experiment that measures the Drell-Yan cross-section ratio of proton-proton to proton-deuterium collisions in order to extract the sea anti-quark structure of the proton. SeaQuest will extend the measurements made by E866/NuSea with greater precision at higher Bjorken-x. The continuously running experiment is always being monitored. Those on shift must keep track of all of the detector readouts in order to make sure the experiment is running correctly. As an experiment that is still in its early stages of running, an alarm system for people on shift is being created to provide warnings, such as a plot showing a detector's performance is sufficiently different to need attention. This plan involves python scripts that track live data. When the data shows a problem within the experiment, a corresponding alarm ID is sent to the MySQL database which then sets off an alarm. These alarms, which will alert the person on shift through both an audible and visual response, are important for ensuring that issues do not go unnoticed, and to help make sure the experiment is recording good data.

  16. Association between depressive symptoms and morningness-eveningness, sleep duration and rotating shift work in Japanese nurses.

    Science.gov (United States)

    Togo, Fumiharu; Yoshizaki, Takahiro; Komatsu, Taiki

    2017-01-01

    Higher depressive symptoms have been reported in rotating shift workers compared with day workers. Depressive symptoms in adults who do not engage in night work have also been shown to be associated with chronotype and sleep duration. This study examines associations between depressive symptoms, morningness-eveningness (i.e. the degree to which people prefer to be active in the morning or the evening), sleep duration and rotating shift work. Japanese nurses (1252 day workers and 1780 rotating shift workers, aged 20-59) were studied using a self-administered questionnaire. The questionnaire covered depressive symptoms, morningness-eveningness, sleep habits and demographic characteristics of the participants. The Center for Epidemiologic Studies Depression Scale (CES-D) was used to determine the levels of depressive symptoms. A Japanese version of the Morningness-Eveningness Questionnaire (MEQ) was used to measure morningness-eveningness. The CES-D score of shift workers was significantly (p shift workers than in day workers. Sleep duration on the day shift was significantly (p shift workers than in day workers. Simple linear regression revealed that the MEQ score, sleep duration on the day shift and current work shift (i.e. rotating shift work) were significantly (p shift work was not. These associations between the MEQ score, the sleep duration and the CES-D score were also confirmed in both day workers and shift workers when the groups were analyzed separately. These results suggest that greater eveningness and shorter sleep duration on the day shift were independently associated with higher levels of depressive symptoms, which may explain associations between rotating shift workers and depressive symptoms. These findings have important implications for the development of novel strategies for preventing poor mental health in day workers and rotating shift workers.

  17. ECOPHARMACOVIGILANCE: ITS IMPORTANCE AND CHALLENGES

    OpenAIRE

    Dr. Bhavana Srivastava

    2014-01-01

    Active pharmaceutical ingredients represent a group of emerging environmental contamination. Even in trace amounts, they are of great concern due to then continuous introduction into the environment, their impact an ecosystem and human and vetenery health is of great importance. This has given birth to the science of Ecopharmacovigilance (EPV). It aims to ensure that significant environmental issues associated with pharmaceuticals in the environment are identified and managed appropriately. ...

  18. Work shift duration: a review comparing eight hour and 12 hour shift systems.

    Science.gov (United States)

    Smith, L; Folkard, S; Tucker, P; Macdonald, I

    1998-04-01

    Shiftwork is now a major feature of working life across a broad range of industries. The features of the shift systems operated can impact on the wellbeing, performance, and sleep of shiftworkers. This paper reviews the current state of knowledge on one major characteristic of shift rotas-namely, shift duration. Evidence comparing the relative effects of eight hour and 12 hour shifts on fatigue and job performance, safety, sleep, and physical and psychological health are considered. At the organisational level, factors such as the mode of system implementation, attitudes towards shift rotas, sickness absence and turnover, overtime, and moonlighting are discussed. Manual and electronic searches of the shiftwork research literature were conducted to obtain information on comparisons between eight hour and 12 hour shifts. The research findings are largely equivocal. The bulk of the evidence suggests few differences between eight and 12 hour shifts in the way they affect people. There may even be advantages to 12 hour shifts in terms of lower stress levels, better physical and psychological wellbeing, improved durations and quality of off duty sleep as well as improvements in family relations. On the negative side, the main concerns are fatigue and safety. It is noted that a 12 hour shift does not equate with being active for only 12 hours. There can be considerable extension of the person's time awake either side of the shift. However, the effects of longer term exposure to extended work days have been relatively uncharted in any systematic way. Longitudinal comparative research into the chronic impact of the compressed working week is needed.

  19. The importance of coughs

    African Journals Online (AJOL)

    2012-03-14

    Mar 14, 2012 ... how important it can be. It is at best ... e. rise of intrathoracic pressure up to 200mm Hg., f. glottic opening and ... The differential diagnosis may be reviewed from knowledge .... cigarette smoking is an important example. 3.

  20. Atom-solid binding energy shifts for K 2p and Rb 3d sublevels

    International Nuclear Information System (INIS)

    Holappa, M.; Aksela, S.; Patanen, M.; Urpelainen, S.; Aksela, H.

    2011-01-01

    Highlights: → Binding energy shifts between atom and solid. K 2p and Rb 3d sublevels were studied. → Simultaneous measurements give accurate results. → Results can be used as a reference for cluster studies. - Abstract: Binding energy shifts between free and solid state atoms for K 2p and Rb 3d photolines have been determined by measuring the vapor and solid state spectra simultaneously in similar experimental conditions applying synchrotron radiation excited photoelectron spectroscopy. This method has the important benefit that the work function is not needed to correct for different reference energy levels, therefore much more accurate values for binding energy shifts are obtained.