International Nuclear Information System (INIS)
Ribeiro da Silva, Manuel A.V.; Amaral, Luisa M.P.F.; Santos, Ana Filipa L.O.M.
2008-01-01
The standard (p 0 = 0.1 MPa) molar energies of combustion, Δ c U m 0 , for the crystalline 2-thiophenecarboxylic acid hydrazide and 2-furancarboxylic acid hydrazide were determined, at the temperature of 298.15 K, by rotating bomb and static bomb combustion calorimetry, respectively. For these compounds, the standard molar enthalpies of sublimation, Δ cr g H m 0 , at T = 298.15 K, were derived by the Clausius-Clapeyron equation, from the temperature dependence of the vapour pressures of these compounds, measured by the Knudsen effusion mass-loss technique. The results are presented in a table. The values were used to derive the standard molar enthalpies of formation of the title compounds in their gaseous phases and the results are discussed in terms of energetic effects of the introduction of the -CONHNH 2 group in the thiophene and furan rings. Using estimated values for the heat capacity differences between the gas and the crystal phases of the studied compounds, the standard (p 0 = 0.1 MPa) molar enthalpies, entropies, and Gibbs energies of sublimation, at T = 298.15 K, were derived
2-Thiophenecarboxylic acid hydrazide Derivatives: Synthesis and Anti-Tuberculosis Studies
Fahmi, M. R. G.; Khumaidah, L.; Ilmiah, T. K.; Fadlan, A.; Santoso, M.
2018-04-01
One of the most frequent and widespread infectious diseases especially in developing countries is tuberculosis (TB). The number of TB drug resistant tend to increase, and there has been no new TB drug introduce since the 1960s. Six 2-Thiophenecarboxylic acid hydrazide derivatives were synthesized in 90-97% yields, and 2-thiophenecarbonylhydrazone-5, 7-dibromoisatin showed the highest activity in inhibiting M. tuberculosis H37Rv.
Khattab, Sherine Nabil; Haiba, Nesreen Saied; Asal, Ahmed Mosaad; Bekhit, Adnan A; Guemei, Aida A; Amer, Adel; El-Faham, Ayman
2017-02-15
A new small library of 2-aminobenzoyl amino acid hydrazide derivatives and quinazolinones derivatives was synthesized and fully characterized by IR, NMR, and elemental analysis. The activity of the prepared compounds on the growth of Leishmania aethiopica promastigotes was evaluated. 2-Benzoyl amino acid hydrazide showed higher inhibitory effect than the quinazoline counterpart. The in vitro antipromastigote activity demonstrated that compounds 2a, 2b, 2f and 4a had IC 50 better than standard drug miltefosine and comparable activity to amphotericin B deoxycholate, which indicates their high antileishmanial activity against Leishmania. aethiopica. Among the prepared compounds; 2-amino-N-(6-hydrazinyl-6-oxohexyl)benzamide 2f (IC 50 =0.051μM) has the best activity, 154 folds more active than reference standard drug miltefosine (IC 50 =7.832μM), and half fold the activity of amphotericin B (IC 50 =0.035μM). In addition, this compound was safe and well tolerated by experimental animals orally up to 250mg/kg and parenterally up to 100mg/kg. Copyright © 2017 Elsevier Ltd. All rights reserved.
Octanoic Hydrazide-Linked Chitooligosaccharides-2,5-Anhydro-d-Mannofuranose
Directory of Open Access Journals (Sweden)
Amani Moussa
2016-08-01
Full Text Available Chitooligosaccharide with one 2,5-anhydro-d-mannofuranose unit at the reducing end (COSamf was prepared by nitrous acid depolymerization of chitosan. The reducing-end functionalization of COSamf by reductive amination with octanoic hydrazide in the presence of NaBH3CN was achieved in high yield. The chemical structure of the targeted octanoic hydrazide-linked COSamf was fully characterized by NMR spectroscopy and MALDI-TOF mass spectrometry. This synthesis opens the way to a new generation of COSamf derivatives with potential amphiphilic properties.
Directory of Open Access Journals (Sweden)
Ayman El-Faham
2015-08-01
Full Text Available Eight novel N′-(2-oxoindolin-3-ylidene-2-propylpentane hydrazide-hydrazone derivatives 4a–h were synthesized and fully characterized by IR, NMR (1H-NMR and 13C-NMR, elemental analysis, and X-ray crystallography. The cyto-toxicity and in vitro anti-cancer evaluation of the prepared compounds have been assessed against two different human tumour cell lines including human liver (HepG2 and leukaemia (Jurkat, as well as in normal cell lines derived from human embryonic kidney (HEK293 using MTT assay. The compounds 3e, 3f, 4a, 4c, and 4e revealed promising anti-cancer activities in tested human tumour cells lines (IC50 values between 3 and 7 μM as compared to the known anti-cancer drug 5-Fluorouracil (IC50 32–50 μM. Among the tested compounds, 4a showed specificity against leukaemia (Jurkat cells, with an IC50 value of 3.14 μM, but this compound was inactive in liver cancer and normal cell lines.
Generation of N-Heterocycles via Tandem Reactions of N '-(2-Alkynylbenzylidene)hydrazides.
Qiu, Guanyinsheng; Wu, Jie
2016-02-01
As a powerful synthon, N '-(2-alkynylbenzylidene)hydrazides have been utilized efficiently for the construction of N-heterocycles. Since N '-(2-alkynylbenzylidene)hydrazides can easily undergo intramolecular 6-endo cyclization promoted by silver triflate or electrophiles, the resulting isoquinolinium-2-yl amides can proceed through subsequent transformations including [3 + 2] cycloaddition, nucleophilic addition, and [3 + 3] cycloaddition. Several unexpected rearrangements via radical processes were observed in some cases, which afforded nitrogen-containing heterocycles with molecular complexity. Reactive partners including internal alkynes, arynes, ketenimines, ketenes, allenoates, and activated alkenes reacted through [3 + 2] cycloaddition and subsequent aromatization, leading to diverse H-pyrazolo[5,1-a]isoquinolines with high efficiency. Nucleophilic addition to the in situ generated isoquinolinium-2-yl amide followed by aromatization also produced H-pyrazolo[5,1-a]isoquinoline derivatives when terminal alkynes, carbonyls, enamines, and activated methylene compounds were used as nucleophiles. Isoquinoline derivatives were obtained when indoles or phosphites were employed as nucleophiles in the reactions of N '-(2-alkynylbenzylidene)hydrazides. A tandem 6-endo cyclization and [3 + 3] cycloaddition of cyclopropane-1,1-dicarboxylates with N '-(2-alkynylbenzylidene)hydrazides was observed as well. Small libraries of these compounds were constructed. Biological evaluation suggested that some compounds showed promising activities for inhibition of CDC25B, TC-PTP, HCT-116, and PTP1B. © 2015 The Chemical Society of Japan & Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Sherine N. Khattab
2005-09-01
Full Text Available The coupling reaction of benzoic acid and nicotinic acid hydrazides with N- protected L-amino acids including valine, leucine, phenylalanine, glutamic acid and tyrosine is reported. The target compounds, N-Boc-amino acid-(N`-benzoyl- and N- Boc-amino acid-(N`-nicotinoyl hydrazides 5a-5e and 6a-6e were prepared in very high yields and purity using N-[(dimethylamino-1H-1,2,3-triazolo[4,5-b]pyridin-1-yl- methylene]-N-methyl-methanaminium hexafluorophosphate N-oxide (HATU as coupling reagent. The antimicrobial activity of the Cu and Cd complexes of the designed compounds was tested. The products were deprotected affording the corresponding amino acid-(N`-benzoyl hydrazide hydrochloride salts (7a-7e and amino acid-(N`- nicotinoyl hydrazide hydrochloride salts (8a-8e. These compounds and their Cu and Cd complexes were also tested for their antimicrobial activity. Several compounds showed comparable activity to that of ampicillin against S. aureus and E. coli.
A Photolabile Linker for the Solid-Phase Synthesis of Peptide Hydrazides and Heterocycles
DEFF Research Database (Denmark)
Qvortrup, Katrine; Komnatnyy, Vitaly V.; Nielsen, Thomas Eiland
2014-01-01
A photolabile hydrazine linker for the solid-phase synthesis of peptide hydrazides and hydrazine-derived heterocycles is presented. The developed protocols enable the efficient synthesis of structurally diverse peptide hydrazides derived from the standard amino adds, including those with side......-chain protected residues at the C-terminal of the resulting peptide hydrazide, and are useful for the synthesis of dihydropyrano[2,3-c]pyrazoles. The linker is compatible with most commonly used coupling reagents and protecting groups for solid-phase peptide synthesis....
Directory of Open Access Journals (Sweden)
Vinokurova Ludmila G
2001-08-01
Full Text Available Abstract Background Hydrophobic polystyrene is the most common material for solid phase immunoassay. Proteins are immobilized on polystyrene by passive adsorption, which often causes considerable denaturation. Biological macromolecules were found to better retain their functional activity when immobilized on hydrophilic materials. Polyacrylamide is a common material for solid-phase carriers of biological macromolecules, including immunoreagents used in affinity chromatography. New macroformats for immunoassay modified with activated polyacrylamide derivatives seem to be promising. Results New polymeric matrices for immunoassay in the form of 0.63-cm balls which contain hydrazide functional groups on hydrophilic polymer spacer arms at their surface shell are synthesized by modification of aldehyde-containing polystyrene balls with hydrazide derivatives of poly(methacrylic acid. The beads contain up to 0.31 μmol/cm2 active hydrazide groups accessible for covalent reaction with periodate-oxidized antibodies. The matrices obtained allow carrying out the oriented antibody immobilization, which increases the functional activity of immunosorbents. Conclusions An efficient site-directed antibody immobilization on a macrosupport is realized. The polymer hydrophilic spacer arms are the most convenient and effective tools for oriented antibody coupling with molded materials. The suggested scheme can be used for the modification of any other solid supports containing electrophilic groups reacting with hydrazides.
Directory of Open Access Journals (Sweden)
Gamil A.A. Al-Hazmi
2017-02-01
Full Text Available A series of Ni(II–hydrazide complexes were prepared using derivatives of hydrazide ligands. The variation of organic ligand elaborates the mode of coordination of the organic compound referring to the addition of coordinating sites besides the NH–NH–CO group. The octahedral configuration is the major form proposed with most isolated complexes. Mass spectra were used to assure the molecular formula proposed based on the elemental analysis data for most investigated compounds. Thermal analysis as well as kinetic data supports the formula of all investigated complexes especially the presence of coordinating water molecules with most of them. Electrochemical measurements assert the stability of Ni(II oxidation state during the complexation which may be affected during the coordination reaction. pH metric studies as well as the molecular modeling optimization reflect a shadow on the stability of the isolated complexes in solution or in solid state, respectively.
Synthesis of novel 2,5-disubstituted-1,3,4-selenadiazoles from fatty acid hydrazides
Directory of Open Access Journals (Sweden)
Himani Varshney
2018-01-01
Full Text Available A series of novel unsaturated hydroxy and non-hydroxy fatty acid residue substituted 1,3,4-selenadiazoles were described here. These derivatives were synthesized from the reaction of fatty acid hydrazide 1(a–d with acetyl chloride in the presence of anhydrous sodium carbonate in tetrahydrofuran and water at 0 °C, to form N′-acetyl undec-10-enoic hydrazide 2a, N′-acetyl-(9Z-octadec-9-enoic hydrazide 2b, N′-acetyl-(9Z, 12R-12-hydroxy-9-enoic hydrazide 2c, and N′-acetyl-(9R, 12Z-9-hydroxy-12-enoic hydrazide 2d. Then these hydrazines (dicarbonyl compound on reaction with Woollin’s reagent (WR in toluene led to the corresponding 2-(dec-9′-enyl-5-methyl-1,3,4-selenadiazole 3a, 2-[(8′Z-heptadec-8′-enyl]-5-methyl-1,3,4-selenadiazole 3b, 2-[(8′Z, 11′R-11′-hydroxy-octadec-8′-enyl]-5-methyl-1,3,4-selenadiazole 3c, and 2-[(8′R, 11′Z-8′-hydroxy-octadec-11′-enyl]-5-methyl-1,3,4-selenadiazole 3d, respectively. These synthesized compounds were characterized on the basis of IR, 1H NMR, 13C NMR, mass spectra and elemental analysis results.
Geng, Tong-Mou; Wang, Xie; Wang, Zhu-Qing; Chen, Tai-Jie; Zhu, Hai; Wang, Yu
2015-03-01
Two rhodamine derivatives, N-mono-maleic acid amide-N'-rhodamine B hydrazide (MRBH) and N-mono-succinic acid amide-N'-rhodamine 6G hydrazide (SR6GH), were synthesized by amidation with maleic anhydride (MAH), succinic anhydride (SAH) and rhodamine B hydrazide, rhodamine 6G hydrazide, which were identified by FTIR, (1)H NMR and elemental analysis. Two water-soluble fluorescent materials (PVA-MRBH and PVA-SR6GH) were prepared via esterification reaction with N-mono-maleic acyl chloride amide-N'-rhodamine B hydrazide (MRBHCl) or N-mono-maleic acyl chloride amide-N'-rhodamine 6G hydrazide (SR6GHCl) and poly(vinyl alcohol) (PVA) in DMSO solution. The sensing behaviors of PVA-MRBH and PVA-SR6GH were explored by recording the fluorescence spectra in completely aqueous solution. Upon the addition of Cu(2+) and Fe(3+) ions to the aqueous solution of PVA-MRBH, visual color change from rose pink to amaranth and orange for Cu(2+) and Fe(3+) ions, respectively, and fluorescence quenching were observed. Titration of Cu(2+), Fe(3+), Cr(3+) or Hg(2+) into the aqueous solution of PVA-SR6GH, although they induced fluorescence enhancement, only Fe(3+) made the color changing from colorless to yellow. Moreover, other metal ions did not induce obvious changes to color and the fluorescence spectra.
Structure Activity Relationship of Brevenal Hydrazide Derivatives
Directory of Open Access Journals (Sweden)
Allan Goodman
2014-03-01
Full Text Available Brevenal is a ladder frame polyether produced by the dinoflagellate Karenia brevis. This organism is also responsible for the production of the neurotoxic compounds known as brevetoxins. Ingestion or inhalation of the brevetoxins leads to adverse effects such as gastrointestinal maladies and bronchoconstriction. Brevenal shows antagonistic behavior to the brevetoxins and shows beneficial attributes when administered alone. For example, in an asthmatic sheep model, brevenal has been shown to increase tracheal mucosal velocity, an attribute which has led to its development as a potential treatment for Cystic Fibrosis. The mechanism of action of brevenal is poorly understood and the exact binding site has not been elucidated. In an attempt to further understand the mechanism of action of brevenal and potentially develop a second generation drug candidate, a series of brevenal derivatives were prepared through modification of the aldehyde moiety. These derivatives include aliphatic, aromatic and heteroaromatic hydrazide derivatives. The brevenal derivatives were tested using in vitro synaptosome binding assays to determine the ability of the compounds to displace brevetoxin and brevenal from their native receptors. A sheep inhalation model was used to determine if instillation of the brevenal derivatives resulted in bronchoconstriction. Only small modifications were tolerated, with larger moieties leading to loss of affinity for the brevenal receptor and bronchoconstriction in the sheep model.
Directory of Open Access Journals (Sweden)
Fakhry A. El-Bassiouny
2011-07-01
Full Text Available The behavior of 2-ethoxy-(4H-3,1-benzoxazin-4-one (1 towards nitrogen nucleo-philes, e.g. ethanolamine, aromatic amines (namely: p-toluidine, p-anisidine, p-hydroxyaniline, o-hydroxyaniline, o-bromoaniline, o-phenylenediamine, p-phenylene- diamine, o-tolidinediamine p-aminobenzoic acid, glucosamine hydrochloride, 2-amino- nicotinic acid, 1-naphthalenesulfonic acid hydrazide, n-decanoic acid hydrazide, benzoic acid hydrazide, semicarbazide, aminoacids (e.g. D,L-alanine, L-asparagine, L-arginine and derivatives of 2-aminothiodiazole has been investigated. The behavior of the benzoxazinone towards a selected sulfur nucleophile, L-cysteine, has also been discussed. Formation of an amidine salt as a reaction intermediate has been assumed. The effect of solvent in some reactions has been elucidated. The structures of all the novel quinazoline and quinazolinone derivatives, obtained by heterocyclic ring opening and ring closure were inferred by the IR, MS as well as 1H-NMR spectral analysis. Moreover, the antimicrobial potential of some of the new synthesized derivatives has been evaluated.
International Nuclear Information System (INIS)
Azizov, M.M.; Kushakbaev, A.; Parpiev, N.A.
1977-01-01
Oxychloride complexes of molybdenum (5) with polyfunctional ligands (L), namely with nicotinamide (NA), isonicotinic acid hydrazide (INH) and its derivatives (ftivazide, saluzide and larusan) have been synthesized and investigated. In ethanol all the ligands independently of their molar ratio form with MoCl 5 a non-electrolite compound MoOCl 3 xL 2 . Infrared spectra of the complexes suggest that in Mo(5) complexeS with NA and INH the central atom is bound through the pyridine nitrogen, whereas in the complexes with INH derivatives it is bound throught the carbonyl group oxygen
Synthesis and Herbicidal Activity of New Hydrazide and Hydrazonoyl Derivatives
Directory of Open Access Journals (Sweden)
František Šeršeň
2015-08-01
Full Text Available Three new hydrazide and five new hydrazonoyl derivatives were synthesized. The chemical structures of these compounds were confirmed by 1H-NMR, IR spectroscopy and elemental analysis. The prepared compounds were tested for their activity to inhibit photosynthetic electron transport in spinach chloroplasts and growth of the green algae Chlorella vulgaris. IC50 values of these compounds varied in wide range, from a strong to no inhibitory effect. EPR spectroscopy showed that the active compounds interfered with intermediates Z•/D•, which are localized on the donor side of photosystem II. Fluorescence spectroscopy suggested that the mechanism of inhibitory action of the prepared compounds possibly involves interactions with aromatic amino acids present in photosynthetic proteins.
2014-01-01
anticancer, antifungal, antiviral, antitumoral, antibacterial and antimalarial activities [11-13]. Recently, our group has been investigating the...ABSTRACT A series of novel hydrazide-hydrazone derivatives were synthesized and evaluated for their larvicidal and adult topical activity against...4b) showed noteworthy larvacidal activity against Aedes aegypti. Dose-response data of compound 4b showed LC50 and LC90 values of 30.5 (15.4 – 22.7
Directory of Open Access Journals (Sweden)
Kamal Bouhadir
2017-10-01
Full Text Available Naphthoquinones are medicinally important molecules with a diverse array of biological properties such as antimicrobial, antifungal, antiviral, anti-inflammatory, anti-artherosclerotic and anticarcinogenic activities. In this study, we report the simple and direct preparation of a new group of novel menadione-hydrazone conjugates by reaction of 2-methyl-1,4-naphthoquinones with several aliphatic, aromatic and nucleobase hydrazides. The menadione-hydrazone conjugates were produced in excellent yields and characterized by IR, NMR and HRMS. The menadione derivatives were tested for their anticancer effects against human colon cancer HCT116 and human breast cancer MCF-7 cell lines. Interestingly, the molecules displayed disparate activities against both cell lines; the menadione hydrazones derived from the lipophilic myristic hydrazide and stearic hydrazide exhibited the most potent activity against HCT116 cell lines with IC50 of 89 and 64 μM. The most effective compounds against MCF-7 cells were the lauric hydrazide and benzoic hydrazide-derived menadione hydrazones with IC50 of 56 µM.
Liu, Qing; Fei, Qiang; Fei, Yanqun; Fan, Qian; Shan, Hongyan; Feng, Guodong; Huan, Yanfu
2015-12-05
A novel isonicotic acid hydrazide Schiff base derivative N'-(3,5-di-tert-butyl-2-hydroxy-benzylidene) isonicotinohydrazide (DHIH) has been synthesized and developed as a high selective and sensitive colorimetric probe for Cu(2+) determination. Addition of Cu(2+) to the solution of DHIH resulted in a rapid color change from colorless to yellow together with an obvious new absorption band appeared at the range of 400-440 nm by forming a 1:1 complex. Experimental results indicated that the DHIH could provide absorption response to Cu(2+) with a linear dynamic range from 1.0×10(-5) to 1.0×10(-4)mol/L. The detection limit of Cu(2+) was 5.24×10(-7)mol/L with good tolerance of other metal ions. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Nouri Neamati
2008-10-01
Full Text Available HIV-1 integrase (IN is an attractive and validated target for the development of novel therapeutics against AIDS. In the search for new IN inhibitors, we designed and synthesized three series of bis-amide and hydrazide-containing derivatives of malonic acid. We performed a docking study to investigate the potential interactions of the title compounds with essential amino acids on the IN active site.
Gwaram, Nura Suleiman; Ali, Hapipah Mohd; Abdulla, Mahmood Ameen; Buckle, Michael J C; Sukumaran, Sri Devi; Chung, Lip Yong; Othman, Rozana; Alhadi, Abeer A; Yehye, Wageeh A; Hadi, A Hamid A; Hassandarvish, Pouya; Khaledi, Hamid; Abdelwahab, Siddig Ibrahim
2012-02-28
Alzheimer's disease (AD) is the most common form of dementia among older people and the pathogenesis of this disease is associated with oxidative stress. Acetylcholinesterase inhibitors with antioxidant activities are considered potential treatments for AD. Some novel ketone derivatives of gallic hydrazide-derived Schiff bases were synthesized and examined for their antioxidant activities and in vitro and in silico acetyl cholinesterase inhibition. The compounds were characterized using spectroscopy and X-ray crystallography. The ferric reducing antioxidant power (FRAP) and 2,2-diphenyl-1-picrylhydrazyl (DPPH) assays revealed that all the compounds have strong antioxidant activities. N-(1-(5-bromo-2-hydroxyphenyl)-ethylidene)-3,4,5-trihydroxybenzohydrazide (2) was the most potent inhibitor of human acetyl cholinesterase, giving an inhibition rate of 77% at 100 μM. Molecular docking simulation of the ligand-enzyme complex suggested that the ligand may be positioned in the enzyme's active-site gorge, interacting with residues in the peripheral anionic subsite (PAS) and acyl binding pocket (ABP). The current work warrants further preclinical studies to assess the potential for these novel compounds for the treatment of AD.
Synthesis of 2-[11C]cyano-isonicotinic acid hydrazide
International Nuclear Information System (INIS)
Somwardhana, C.W.; Sajjad, M.; Lambrecht, R.M.
1990-01-01
Isonicotinic acid hydrazide (isoniazid), a drug used in treating tuberculosis has been labelled with carbon-11 at the 2-position. The labelling synthesis starts with methyl isonicotinate treated with dimethyl sulfate. The resulting salt solution is loaded onto silica gel and dried, followed by treatment with carbon-11 labelled hydrocyanic acid. Work-up gave the labelled compound with an average 32% radiochemical yield. Subsequent treatment with hydrazine hydrate yielded isoniazid
Synthesis and anticandidal activity of some imidazopyridine derivatives.
Kaplancikli, Zafer Asim; Turan-Zitouni, Gülhan; Ozdemir, Ahmet; Revial, Gilbert
2008-12-01
New hydrazide derivatives of imidazo[1,2-a]pyridine have been synthesized and evaluated for anticandidal activity. The reaction of imidazo[1,2-a]pyridine-2-carboxylic acid hydrazides with various benzaldehydes gave N-(benzylidene)imidazo[ 1,2-a]pyridine-2-carboxylic acid hydrazide derivatives. Their anticandidal activities against Candida albicans and Candida glabrata (isolates obtained from Osmangazi University, Faculty of Medicine, Eskisehir, Turkey), Candida albicans (ATCC 90028), Candida utilis (NRLL Y-900), Candida tropicalis (NRLL Y-12968), Candida krusei (NRLL Y-7179), Candida zeylanoides (NRLL Y-1774), and Candida parapsilosis (NRLL Y-12696) were investigated.
Directory of Open Access Journals (Sweden)
P. Preethi Kumari
2017-07-01
Full Text Available The influence of an aromatic hydrazide derivative, 2-(3,4,5-trimethoxybenzylidene hydrazinecarbothioamide (TMBHC as corrosion inhibitor on mild steel in 1 M hydrochloric acid was studied by Tafel polarization and electrochemical impedance spectroscopy (EIS technique. The results showed that the inhibition efficiency (% IE of TMBHC increased with increasing inhibitor concentrations and also with increase in temperatures. TMBHC acted as a mixed type of inhibitor and its adsorption on mild steel surface was found to follow Langmuir’s adsorption isotherm. The evaluation of thermodynamic and activation parameters indicated that the adsorption of TMBHC takes place through chemisorption. The formation of protective film was further confirmed by scanning electron microscopy (SEM.
Amides and Hydrazides from Amine and Hydrazine Hydrochlorides.
Shama, Sami A.; Tran, Thuan L.
1978-01-01
This safe and efficient procedure for the synthesis of N-substituted amides and hydrazides is a modification of the Schotten-Bausmann procedure in which the amine or hydrazide is replaced by the corresponding hydrochloride salt, and the use of alkali is eliminated. (Author/BB)
International Nuclear Information System (INIS)
Abbasi, M.A.; Shah, S.A.H.; Siddiqui, S.Z.; Khan, K.M.
2017-01-01
In the current research work, (E)-N'-[1-(2,4-dihydroxyphenyl)ethylidene]substituted hydrazides were synthesized in a couple of steps and their enzyme inhibition potential was analyzed. Firstly 2,4-hydroxyacetophenone (1) was reacted with hydrated hydrazine (2) under stirring to yield (E)-4-(1-hydrazonoethyl)benzene-1,3-diol (3) which was further reacted with different acid halides, (4a-i) to afford (E)-[1-(2,4-dihydroxyphenyl)ethylidene]substituted hydrazides (5a-i). These synthesized compounds were characterized by EI-MS, 1H-NMR spectral techniques and were also evaluated against a-glucosidase and butyrylcholinesterase enzymes. The synthesized compounds were found to be acceptable inhibitors of a-glucosidase and decent inhibition against butyrylcholinesterase. (author)
Energy Technology Data Exchange (ETDEWEB)
Strecker, Ruben, E-mail: Ruben.Strecker@cos.uni-heidelberg.de [Aquatic Ecology and Toxicology Section, Center for Organismal Studies, University of Heidelberg, Im Neuenheimer Feld 230, D-69120 Heidelberg (Germany); Weigt, Stefan, E-mail: stefan.weigt@merckgroup.com [Institute of Toxicology, Merck KGaA, 64293 Darmstadt (Germany); Braunbeck, Thomas, E-mail: braunbeck@uni-hd.de [Aquatic Ecology and Toxicology Section, Center for Organismal Studies, University of Heidelberg, Im Neuenheimer Feld 230, D-69120 Heidelberg (Germany)
2013-04-15
In order to investigate teratogenic effects, especially on cartilage and bone formation, zebrafish embryos were exposed for 144 h to the dithiocarbamate pesticide disulfiram (20–320 μg/L) and acetic acid hydrazide (0.375–12 g/L), a degradation product of isoniazid. After fixation and full-mount staining, disulfiram could be shown to induce strong cartilage malformations after exposure to ≥ 80 μg/L, whereas acetic acid hydrazide caused cartilage alterations only from 1.5 g/L. Undulating notochords occurred after exposure to disulfiram even at the lowest test concentration of 20 μg/L, whereas at the two lowest concentrations of acetic acid hydrazide (0.375 and 0.75 g/L) mainly fractures of the notochord were observed. Concentrations of acetic acid hydrazide ≥ 1.5 g/L resulted in undulated notochords similar to disulfiram. Cartilages and ossifications of the cranium, including the cleithrum, were individually analyzed assessing the severity of malformation and the degree of ossification in a semi-quantitative approach. Cartilages of the neurocranium such as the ethmoid plate proved to be more stable than cartilages of the pharyngeal skeleton such as Meckel's cartilage. Hence, ossification proved significantly more susceptible than cartilage. The alterations induced in the notochord as well as in the cranium might well be of ecological relevance, since notochord malformation is likely to result in impaired swimming and cranial malformation might compromise regular food uptake. - Highlights: ► Disulfiram and acetic acid hydrazide as notochord, cartilage and bone teratogens ► Zebrafish embryos to model effects on single cartilages and bones in the head ► LC50 calculation and head length measurements after six days post-fertilization ► Lethality, head length and teratogenic effects are dose-dependent. ► Cartilages of the neurocranium are the most stable elements in the head.
International Nuclear Information System (INIS)
Strecker, Ruben; Weigt, Stefan; Braunbeck, Thomas
2013-01-01
In order to investigate teratogenic effects, especially on cartilage and bone formation, zebrafish embryos were exposed for 144 h to the dithiocarbamate pesticide disulfiram (20–320 μg/L) and acetic acid hydrazide (0.375–12 g/L), a degradation product of isoniazid. After fixation and full-mount staining, disulfiram could be shown to induce strong cartilage malformations after exposure to ≥ 80 μg/L, whereas acetic acid hydrazide caused cartilage alterations only from 1.5 g/L. Undulating notochords occurred after exposure to disulfiram even at the lowest test concentration of 20 μg/L, whereas at the two lowest concentrations of acetic acid hydrazide (0.375 and 0.75 g/L) mainly fractures of the notochord were observed. Concentrations of acetic acid hydrazide ≥ 1.5 g/L resulted in undulated notochords similar to disulfiram. Cartilages and ossifications of the cranium, including the cleithrum, were individually analyzed assessing the severity of malformation and the degree of ossification in a semi-quantitative approach. Cartilages of the neurocranium such as the ethmoid plate proved to be more stable than cartilages of the pharyngeal skeleton such as Meckel's cartilage. Hence, ossification proved significantly more susceptible than cartilage. The alterations induced in the notochord as well as in the cranium might well be of ecological relevance, since notochord malformation is likely to result in impaired swimming and cranial malformation might compromise regular food uptake. - Highlights: ► Disulfiram and acetic acid hydrazide as notochord, cartilage and bone teratogens ► Zebrafish embryos to model effects on single cartilages and bones in the head ► LC50 calculation and head length measurements after six days post-fertilization ► Lethality, head length and teratogenic effects are dose-dependent. ► Cartilages of the neurocranium are the most stable elements in the head
International Nuclear Information System (INIS)
Pradana Perez, J.A.; Alegria, J.S. Durand; Hernando, P. Fernandez; Sierra, A. Narros
2005-01-01
This paper proposes a new chemiluminescent flow injection analysis (FIA) method for the determination of vanadium(IV) ions in aqueous media. The method is based on the chemiluminescent reaction that occurs between cinchomeronic hydrazide (CH) and hydrogen peroxide in a strongly alkaline medium, in which vanadium(IV) acts as a catalyst. The chemical and physical variables involved in the flow injection system are optimised using a modified simplex method. Vanadium ions can be detected in the 0.08 and 1.00 μg mL -1 range; the detection limit for a signal-to-noise ratio of 3 is 0.08 μg mL -1 . Great variations in the quantum yield were observed when cobalt(II), chromium(III), copper(II) and/or nickel(II) were present in the reaction medium. The proposed method is selective and simple, and can be successfully used to analyse water samples without the need for separation or preconcentration processes
Energy Technology Data Exchange (ETDEWEB)
Borchhardt, Deise M.; Oliva, Glaucius; Andricopulo, Adriano D. [Universidade de Sao Paulo, Sao Carlos (USP), SP (Brazil). Centro de Biotecnologia Molecular Estrutural. Lab. de Quimica Medicinal e Computacional; Mascarello, Alessandra; Chiaradia, Louise Domeneghini; Nunes, Ricardo J.; Yunes, Rosendo A. [Universidade Federal de Santa Catarina (UFSC), Florianopolis, SC (Brazil). Centro de Ciencias Fisicas e Matematicas. Lab. Estrutura e Atividade
2010-07-01
Chagas' disease, a parasitic infection widely distributed throughout Latin America, is a major public health problem with devastating consequences in terms of human morbidity and mortality. The enzyme cruzain is the major cysteine protease from Trypanosoma cruzi, the etiologic agent of American trypanosomiasis or Chagas' disease, and has been selected as an attractive target for the development of novel trypanocidal drugs. In the present work, we describe the synthesis and inhibitory effects of a series of thirty-three chalcone and seven hydrazide derivatives against the enzyme cruzain from T. cruzi. Most of the compounds showed promising in vitro inhibition (IC{sub 50} values in the range of 20-60 {mu}M), which suggest the potential of these compounds as lead candidates for further development. Twelve compounds have not been reported before, and four of them (7, 13, 16 e 18) are among the most potent inhibitors of the series. (author)
Morpurgo, L; Befani, O; Sabatini, S; Mondovì, B; Artico, M; Corelli, F; Massa, S; Stefancich, G; Avigliano, L
1988-01-01
The carbonyl cofactor of bovine serum amine oxidase, recently identified as pyrroloquinoline quinone [Ameyama, Hayashi, Matsushita, Shinagawa & Adachi (1984) Agric. Biol. Chem. 48, 561-565; Lobenstein-Verbeek, Jongejan, Frank & Duine (1984) FEBS Lett. 170, 305-309], reacts stoichiometrically and irreversibly with hydrazides of phenylacetic acid and of benzoic acid. With the phenylacetic hydrazides a reversible intermediate step was detected by competition with substrate, carbonylic reagents or phenylhydrazine, a typical inhibitor of the enzyme. All hydrazides form an intense broad band with maximum absorbance in a narrow wavelength range (350-360 nm), irrespective of the acyl group, suggesting that the transition is located on the organic cofactor. A different situation is found with some phenylhydrazines, where extended conjugation can occur between the cofactor and the phenyl pi-electron system via the azo group, as shown by the lower energy and higher intensity of the transition. In this case the transition is sensitive to substituents in the phenyl ring. The c.d. spectrum of the adducts is influenced by the type of hydrazide (derived from phenylacetic acid or benzoic acid), by pH and by NN-diethyldithiocarbamate binding to copper, probably as a result of shifts of equilibria between hydrazone-azo tautomers. PMID:3146976
Rizk, Sameh A.; El-Naggar, Abeer M.; El-Badawy, Azza A.
2018-03-01
A series of 5-cyano-2-thiouracil derivatives, containing diverse hydrophobic groups in the 2-, 4- and 6-positions, were synthesized through one pot reaction of thiophene 2-carboxaldehyde, ethylcyanoacetate and thiourea using classic reflux-based method as well as microwave-assisted methods. Such prepared compounds were reacted with different electrophilic reagents to synthesize potent anti-microbial agents, e.g. 1,3,4-thiadiazinopyrimidine, hydrazide and triazolopyrimidine derivatives (compounds 4a-e, 9 and 10-12) respectively. The density functional theory (DFT) was then applied to explore the structural and electronic characteristics of these materials. It is found that compound 12 exhibited the highest antibacterial and antifungal activity against C. Albicans showing six-fold increasing biological affinity compared to that of Colitrimazole drug with MIC values 7.8 and 49 μg/mL, respectively. All the synthesized compounds have been characterized based on their elemental analyses and spectral data. Such compounds can be submitted to in vivo antimicrobial studies in future works.
Directory of Open Access Journals (Sweden)
Abd El-Galil M. Khalil
2016-03-01
Full Text Available Dibenzobarallene was used as a key intermediate for the synthesis of 2-(3-hydroxy-2-naphthoyl-3,4,4a,5,10,10a-hexahydro-1H-5,10-benzenobenzo[g]phthalazine-1,4-dione (2. The previous compound was coupled with the appropriate diazonium chloride to give the corresponding 4-arylazo-2-naphthol derivatives 3a–l. Also, nitration, nitrosation and bromination of compound 2 afforded the corresponding nitro, nitroso and bromo derivatives 4–6, respectively. The synthesized compounds were established and evaluated as antibacterial agents. The results showed clearly that compounds 2, 3a, 3c, 3d, 3g, 3i, 4, 5 and 6 exhibited interesting high activities compared with reference drugs. Also, these compounds were applied to polyester as disperse dyes in which their color measurement and fastness properties were evaluated.
Chamkasem, Narong
2017-08-30
A simple high-throughput liquid chromatography/tandem mass spectrometry (LC-MS-MS) method was developed for the determination of maleic hydrazide, glyphosate, fosetyl aluminum, and ethephon in grapes using a reversed-phase column with weak anion-exchange and cation-exchange mixed mode. A 5 g test portion was shaken with 50 mM HOAc and 10 mM Na 2 EDTA in 1/3 (v/v) MeOH/H 2 O for 10 min. After centrifugation, the extract was passed through an Oasis HLB cartridge to retain suspended particulates and nonpolar interferences. The final solution was injected and directly analyzed in 17 min by LC-MS-MS. Two MS-MS transitions were monitored in the method for each target compound to achieve true positive identification. Four isotopically labeled internal standards corresponding to each analyte were used to correct for matrix suppression effects and/or instrument signal drift. The linearity of the detector response was demonstrated in the range from 10 to 1000 ng/mL for each analyte with a coefficient of determination (R 2 ) of ≥0.995. The average recovery for all analytes at 100, 500, and 2000 ng/g (n = 5) ranged from 87 to 111%, with a relative standard deviation of less than 17%. The estimated LOQs for maleic hydrazide, glyphosate, fosetyl-Al, and ethephon were 38, 19, 29, and 34 ng/g, respectively.
International Nuclear Information System (INIS)
Gomes, Dominique; Pinto, Jose Carlos; Borges, Cristiano P.; Nunes, Suzana P.
2001-01-01
Samples of an aromatic poly(hydrazide) were synthesized through low temperature solution polycondensation reactions. Monomers were characterized by nuclear magnetic resonance (NMR) and thermal analysis. The polymer material was characterized by intrinsic viscosity measurements and by NMR. The thermal behavior of the polymer samples was studied by thermal gravimetric analysis (TGA) and differential scanning calorimetry (DSC). The effect of various factors that influence the course of the polymerization reaction, such as concentration of monomer and electrolyte (LiCl) in the reaction medium, purity of the monomers, reaction temperature and reaction time, were investigated. Reaction conditions were then optimized in order to allow the preparation of high molecular weight polymer resins. Values of intrinsic viscosity obtained for the poly(hydrazide) in N-methyl-2-pyrrolidone were as high as 1.51 dL/g. (author)
Brne, P; Lim, Y-P; Podgornik, A; Barut, M; Pihlar, B; Strancar, A
2009-03-27
Convective interaction media (CIM; BIA Separations) monoliths are attractive stationary phases for use in affinity chromatography because they enable fast affinity binding, which is a consequence of convectively enhanced mass transport. This work focuses on the development of novel CIM hydrazide (HZ) monoliths for the oriented immobilization of antibodies. Adipic acid dihydrazide (AADH) was covalently bound to CIM epoxy monoliths to gain hydrazide groups on the monolith surface. Two different antibodies were afterwards immobilized to hydrazide functionalized monolithic columns and prepared columns were tested for their selectivity. One column was further tested for the dynamic binding capacity.
Hayama, Tadashi; Katoh, Kenji; Aoki, Takayoshi; Itoyama, Miki; Todoroki, Kenichiro; Yoshida, Hideyuki; Yamaguchi, Masatoshi; Nohta, Hitoshi
2012-11-28
A method to measure the concentrations of microcystins (MCs) in water samples has been developed by incorporating pre-column fluorescence derivatization and liquid chromatography (LC). A solid-phase extraction for pretreatment was used to extract the MCs in water samples. The MCs were derivatized with excimer-forming 4-(1-pyrene)butanoic acid hydrazide (PBH). The MCs could then be detected by fluorescence after separation with a pentafluorophenyl (PFP)-modified superficially porous (core shell) particle LC column. The derivatization reactions of MCs with PBH proceeded easily in the presence of 4,6-dimethoxy-1,3,5-triazin-2-yl-4-methylmorpholinium (DMT-MM) as a condensation reagent, and the resulting derivatives could be easily separated on the PFP column. The derivatives were selectively detected at excimer fluorescence wavelengths (440-540 nm). The instrument detection limit and the instrument quantification limit of the MCs standards were 0.4-1.2 μg L(-1) and 1.4-3.9 μg L(-1), respectively. The method was validated at 0.1 and 1.0 μg L(-1) levels in tap and pond water samples, and the recovery of MCs was between 67 and 101% with a relative standard deviation of 11%. The proposed method can be used to quantify trace amounts of MCs in water samples. Copyright © 2012 Elsevier B.V. All rights reserved.
Institute of Scientific and Technical Information of China (English)
YUE Xuyi; QIU Xiaolong; QING Fengling
2009-01-01
Indium-mediated gem-difluoroallylation of aldehyde-derived N-acylhydrazones 1a-1q and 4a-4g with 3-bromo-3,3-difluoropropene 2 afforded a,a-difluorohomoallylic hydrazides 3a-3q and 5a-5g in high yields, re-spectively. Functional groups such as nitro, phenolic hydroxyl, benzyloxy and even C=C bonds of a,fl-unsaturated aldehydes were compatible under this mild and operationally simple gem-difluoroallylic reaction condition. By means of substitution of Zn powder for indium, gem-difluoroallylation of ketone-derived N-acylhydrazones 6a-6d also provided the corresponding a,a-difluorohomoallylic hydrazides 7a-7d in medium yields. The N-N bond cleavage of the hydrazide 3a proceeded smoothly to give the corresponding primary gem-difluorohomoallylic amine 8, which could be converted to gem-difluoro-δ-substituted α,β-unsaturated lactam 11 via acryloylation fol-lowed by ring closing metathesis (RCM) reaction.
Complexes of rare earths with hydrazide of salicylic acid
Energy Technology Data Exchange (ETDEWEB)
Abashmadze, M Sh; Pirtskhalava, N I; Kharitonov, Yu Ya; Machkhoshvili, R I [Tbilisskij Gosudarstvennyj Univ. (USSR); AN SSSR, Moscow. Inst. Obshchej i Neorganicheskoj Khimii; Moskovskij Khimiko-Tekhnologicheskij Inst. (USSR))
1978-10-01
Complex compounds M(HOC/sub 6/H/sub 4/CONNH/sub 2/)/sub 3/ xnH/sub 2/O, where M is one of the following metals and n=0 or 1, have been obtained in the reactions of salts (chlorides or nitrates) of praseodymium, neodymium, europium, gadolinium, erbium, thulium or lutecium with salicylic acid hydrazide in a weakly alkaline medium. Some properties and infrared absorption spectra of the compounds obtained have been studied.
G{sub 2} radiosensitivity of cells derived from cancer-prone individuals
Energy Technology Data Exchange (ETDEWEB)
Darroudi, F.; Vyas, R.C.; Vermeulen, S.; Natarajan, A.T. [J.A. Cohen Institute of Radiopathology and Radiation Protection, Interuniversity Institute, Leiden (Netherlands)
1995-04-01
The potential of enhanced chromatid damage, observed after X-irradiation of G{sub 2} phase, has been used to detect individuals genetically predisposed to cancer, utilising fibroblasts/lymphocytes from these patients as well as fibroblasts derived from human tumours. Fibroblasts and/or lymphocyte samples of two autosomal recessive syndromes (xeroderma pigmentosum (XP), Fanconi`s anaemia (FA)) and one congenital or acquired disorder, aplastic anaemia (AA), were employed for the G{sub 2} radiosensitivity assay. In addition, we have estimated the frequencies of spontaneously occurring chromosomal aberrations as well as G{sub 2} radiosensitivity of eight samples of fibroblasts/fibroblast-like cells (two normal, two colorectal carcinoma, two Wilms` tumour, one retinoblastoma and one polyposis coli), and three samples of lymphocytes (two normal and one from a lymphoma patient). The results obtained indicate that there were no differences between fibroblast cells derived from patients or tumours, except FA patients, in the frequency of spontaneously occurring chromosomal aberrations when compared to normal cells. Following X-irradiation we did not observe any significantly increased G{sub 2} radiosensitivity in FA and XP cells. Lymphocytes from AA and lymphoma patients, and all tumour cell lines except retinoblastoma, responded with increased frequencies of aberrations following G{sub 2} X-irradiation in comparison to cells derived from normal individuals. In our hands, the G{sub 2} sensitivity assay could not always discriminate cells from cancer-prone individuals from those of controls.
Soares, Roberta Reis; da Silva, José Marcio Fernandes; Carlos, Bianca Cecheto; da Fonseca, Camila Campos; de Souza, Laila Salomé Araújo; Lopes, Fernanda Valério; de Paula Dias, Rafael Mafra; Moreira, Paulo Otávio Lourenço; Abramo, Clarice; Viana, Gustavo Henrique Ribeiro; de Pila Varotti, Fernando; da Silva, Adilson David; Scopel, Kézia Katiani Gorza
2015-06-01
Malaria continues to be an important public health problem in the world. Nowadays, the widespread parasite resistance to many drugs used in antimalarial therapy has made the effective treatment of cases and control of the disease a constant challenge. Therefore, the discovery of new molecules with good antimalarial activity and tolerance to human use can be really important in the further treatment of the disease. In this study we have investigated the antiplasmodial activity of 10 synthetic compounds derived from quinoline, five of them combined to sulfonamide and five to the hydrazine or hydrazide group. The compounds were evaluated according to their cytotoxicity against HepG2 and HeLa cell lines, their antimalarial activity against CQ-sensitive and CQ-resistant Plasmodium falciparum strains and, finally, their schizonticide blood action in mice infected with Plasmodium berghei NK65. The compounds exhibited no cytotoxic action in HepG2 and HeLa cell lines when tested up to a concentration of 100 μg/mL. In addition, the hydrazine or hydrazide derivative compounds were less cytotoxic against cell lines and more active against CQ-sensitive and CQ-resistant P. falciparum strains, showing high SI (>1000 when SI was calculated using the CC50 from the 3D7 strain as reference). When tested in vivo, the hydrazine derivative 1f compound showed activity against the development of blood parasites similar to that observed with CQ, the reference drug. Interestingly, the 1f compound demonstrated the best LipE value (4.84) among all those tested in vivo. Considering the in vitro and in vivo activities of the compounds studied here and the LipE values, we believe the 1f compound to be the most promising molecule for further studies in antimalarial chemotherapy. Copyright © 2015 Elsevier Ltd. All rights reserved.
A Benzothiazole Derivative (5g) Induces DNA Damage And Potent G2/M Arrest In Cancer Cells.
Hegde, Mahesh; Vartak, Supriya V; Kavitha, Chandagirikoppal V; Ananda, Hanumappa; Prasanna, Doddakunche S; Gopalakrishnan, Vidya; Choudhary, Bibha; Rangappa, Kanchugarakoppal S; Raghavan, Sathees C
2017-05-31
Chemically synthesized small molecules play important role in anticancer therapy. Several chemical compounds have been reported to damage the DNA, either directly or indirectly slowing down the cancer cell progression by causing a cell cycle arrest. Direct or indirect reactive oxygen species formation causes DNA damage leading to cell cycle arrest and subsequent cell death. Therefore, identification of chemically synthesized compounds with anticancer potential is important. Here we investigate the effect of benzothiazole derivative (5g) for its ability to inhibit cell proliferation in different cancer models. Interestingly, 5g interfered with cell proliferation in both, cell lines and tumor cells leading to significant G2/M arrest. 5g treatment resulted in elevated levels of ROS and subsequently, DNA double-strand breaks (DSBs) explaining observed G2/M arrest. Consistently, we observed deregulation of many cell cycle associated proteins such as CDK1, BCL2 and their phosphorylated form, CyclinB1, CDC25c etc. Besides, 5g treatment led to decreased levels of mitochondrial membrane potential and activation of apoptosis. Interestingly, 5g administration inhibited tumor growth in mice without significant side effects. Thus, our study identifies 5g as a potent biochemical inhibitor to induce G2/M phase arrest of the cell cycle, and demonstrates its anticancer properties both ex vivo and in vivo.
Yu. V. Martynenko; M. S. Kazunin; E. А. Selivanova; S. I. Kovalenko
2016-01-01
The combination of different «pharmacophore» components in one structure connected via «linker» functional groups is one of the major and justified approaches for the synthesis of new biologically active substances. In this area (3Н-quinazoline-4-yliden)hydrazides (1,3-dioxo-1,3-dihydro-2H-іsoindol-2-yl-)alkyl-(aralkyl-, aryl-)carboxylic acids are the most interesting compounds. They contain quinazoline and іsoindole fragments united through аlkyl, аlkaryl and аryl groups and furthermore can ...
Energy Technology Data Exchange (ETDEWEB)
Bhat, J. Ishwara [Mangalore Univ., Karnataka (India); Alva, Vijaya D. P. [Shree Devi Institute of Technology, Karnataka (India)
2014-02-15
The corrosion behavior of aluminum and mild steel in hydrochloric acid medium was studied using a nicotinic acid hydrazide as inhibitor by potentiodynamic polarization, electrochemical impedance spectroscopy technique and gravimetric methods. The effects of inhibitor concentration and temperature were investigated. The experimental results suggested, nicotinic acid hydrazide is a good corrosion inhibitor for both aluminum and mild steel in hydrochloric acid medium and the inhibition efficiency increased with increase in the inhibitor concentration. The polarization studies revealed that nicotinic acid hydrazide exhibits mixed type of inhibition. The inhibition was assumed to occur via adsorption of the inhibitor molecules on the aluminum and mild steel surface and inhibits corrosion by blocking the reaction sites on the surface of aluminum.
International Nuclear Information System (INIS)
Bhat, J. Ishwara; Alva, Vijaya D. P.
2014-01-01
The corrosion behavior of aluminum and mild steel in hydrochloric acid medium was studied using a nicotinic acid hydrazide as inhibitor by potentiodynamic polarization, electrochemical impedance spectroscopy technique and gravimetric methods. The effects of inhibitor concentration and temperature were investigated. The experimental results suggested, nicotinic acid hydrazide is a good corrosion inhibitor for both aluminum and mild steel in hydrochloric acid medium and the inhibition efficiency increased with increase in the inhibitor concentration. The polarization studies revealed that nicotinic acid hydrazide exhibits mixed type of inhibition. The inhibition was assumed to occur via adsorption of the inhibitor molecules on the aluminum and mild steel surface and inhibits corrosion by blocking the reaction sites on the surface of aluminum
Directory of Open Access Journals (Sweden)
Mohammed F. Hamza
2017-05-01
Full Text Available A new magnetic functionalized derivative of chitosan is synthesized and characterized for the sorption of metal ions (environmental applications and metal valorization. The chemical modification of the glycine derivative of chitosan consists of: activation of the magnetic support with epichlorohydrin, followed by reaction with either glycine to produce the reference material (i.e., Gly sorbent or glycine ester hydrochloride, followed by hydrazinolysis to synthesize the hydrazide functionalized sorbent (i.e., HGly sorbent. The materials are characterized by titration, elemental analysis, FTIR analysis (Fourrier-transform infrared spectrometry, TGA analysis (thermogravimetric analysis and with SEM-EDX (scanning electron microscopy coupled to energy dispersive X-ray analysis. The sorption performances for U(VI, Cu(II, and Zn(II are tested in batch systems. The sorption performances are compared for Gly and HGly taking into account the effect of pH, the uptake kinetics (fitted by the pseudo-second order rate equation, and the sorption isotherms (described by the Langmuir and the Sips equations. The sorption capacities of the modified sorbent reach up to 1.14 mmol U g−1, 1.69 mmol Cu g−1, and 0.85 mmol Zn g−1. In multi-metal solutions of equimolar concentration, the chemical modification changes the preferences for given metal ions. Metal ions are desorbed using 0.2 M HCl solutions and the sorbents are re-used for five cycles of sorption/desorption without significant loss in performances.
Selenium dioxide catalysed oxidation of acetic acid hydrazide
Indian Academy of Sciences (India)
The mechanism of the reaction involves prior complex formation between the catalyst and substrate, hydrazide, followed by its oxidation by diprotonated bromate in a slow step. Acetic acid was found to be the oxidation product. Other kinetic data like effect of solvent polarity and ionic strength on the reaction support the ...
Energy Technology Data Exchange (ETDEWEB)
Tai, Xi-Shi, E-mail: taixs@wfu.edu.cn [Weifang University, College of Chemistry and Chemical Engineering (China); Wang, Xin [Qinghai Normal University, Department of Chemistry (China)
2017-03-15
A new Ca(II) coordination polymer, ([CaL(H{sub 2}O){sub 4}] · (H{sub 2}O){sub 4}){sub n} (L = 4-formyl-1,3-benzenedisulfonate-2-furoic acid hydrazide) has been prepared by one-pot synthesis method. And it was characterized by elemental analysis, IR and thermal analysis. The result of X-ray single-crystal diffraction analysis shows that the Ca(II) complex molecules form one-dimensional chain structure by the bridging oxygen atoms. The anti-tumor activity of L ligand and the Ca(II) coordination polymer has also been studied.
Directory of Open Access Journals (Sweden)
Deena Al-Kadi
2016-01-01
Full Text Available We introduce the notion of fq-derivation as a new derivation of G-algebra. For an endomorphism map f of any G-algebra X, we show that at least one fq-derivation of X exists. Moreover, for such a map, we show that a self-map dqf of X is fq-derivation of X if X is an associative medial G-algebra. For a medial G-algebra X, dqf is fq-derivation of X if dqf is an outside fq-derivation of X. Finally, we show that if f is the identity endomorphism of X then the composition of two fq-derivations of X is a fq-derivation. Moreover, we give a condition to get a commutative composition.
DEFF Research Database (Denmark)
Syberg, Kristian; Binderup, Mona-Lise; Cedergreen, Nina
2015-01-01
Assessment of genotoxic properties of chemicals is mainly conducted only for single chemicals, without taking mixture genotoxic effects into consideration. The current study assessed mixture effects of the three known genotoxic chemicals, 2,4-dichlorophenoxyacetic acid (2,4-D), acrylamide (AA......), and maleic hydrazide (MH), in an experiment with a fixed ratio design setup. The genotoxic effects were assessed with the single-cell gel electrophoresis assay (comet assay) for both single chemicals and the ternary mixture. The concentration ranges used were 0-1.4, 0-20, and 0-37.7 mM for 2,4-D, AA, and MH......, respectively. Mixture toxicity was tested with a fixed ratio design at a 10:23:77% ratio for 2.4-D:AA:MH. Results indicated that the three chemicals yielded a synergistic mixture effect. It is not clear which mechanisms are responsible for this interaction. A few possible interactions are discussed...
Abdullah, Mohammed A A; Abuo-Rahma, Gamal El-Din A A; Abdelhafez, El-Shimaa M N; Hassan, Heba A; Abd El-Baky, Rehab M
2017-02-01
New hydroxamic acid, hydrazide and amide derivatives of ciprofloxacin in addition to their analogues of levofloxacin were prepared and identified by different spectroscopic techniques. Some of the prepared compounds revealed good activity against the urease splitting bacteria, Proteus mirabilis. The urease inhibitory activity was investigated using indophenol method. Most of the tested compounds showed better activity than the reference acetohydroxamic acid (AHA). The ciprofloxacin hydrazide derivative 3a and levofloxacin hydroxamic acid 7 experienced the highest activity (IC 50 =1.22μM and 2.20μM, respectively). Molecular docking study revealed high spontaneous binding ability of the tested compounds to the active site of urease. Copyright © 2016 Elsevier Inc. All rights reserved.
A simple rhodamine hydrazide-based turn-on fluorescent probe for HOCl detection.
Zhang, Zhen; Zou, Yuan; Deng, Chengquan; Meng, Liesu
2016-06-01
Hypochlorous acid (HOCl) plays a crucial role in daily life and mediates a variety of physiological processes, however, abnormal levels of HOCl have been associated with numerous human diseases. It is therefore of significant interest to establish a simple, selective, rapid and sensitive fluorogenic method for the detection of HOCl in environmental and biological samples. A hydrazide-containing fluorescent probe based on a rhodamine scaffold was facilely developed that could selectively detect HOCl over other biologically relevant reactive oxygen species, reactive nitrogen species and most common metal ions in vitro. Via an irreversible oxidation-hydrolysis mechanism, and upon HOCl-triggered opening of the intramolecular spirocyclic ring during detection, the rhodamine hydrazide-based probe exhibited large fluorescence enhancement in the emission spectra with a fast response, low detection limit and comparatively wide pH detection range in aqueous media. The probe was further successfully applied to monitoring trace HOCl in tap water and imaging both exogenous and endogenous HOCl within living cells. It is anticipated that this simple and useful probe might be an efficient tool with which to facilitate more HOCl-related chemical and biological research. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.
Ahmed, Riyadh M.; Yousif, Enaam I.; Al-Jeboori, Mohamad J.
2013-01-01
New monomeric cobalt and cadmium complexes with Schiff-bases, namely, N′-[(E)-(3-hydroxy-4-methoxyphenyl)methylidene]furan-2-carbohydrazide (L1) and N′-[(E)-(3-hydroxy-4-methoxyphenyl)methylidene]thiophene-2-carbohydrazide (L2) are reported. Schiff-base ligands L1 and L2 were derived from condensation of 3-hydroxy-4-methoxybenzaldehyde (iso-vanillin) with furan-2-carboxylic acid hydrazide and thiophene-2-carboxylic acid hydrazide, respectively. Complexes of the general formula [M(L)2]Cl2 (where M = Co(II) or Cd(II), L = L1 or L2) have been obtained from the reaction of the corresponding metal chloride with the ligands. The ligands and their metal complexes were characterised by spectroscopic methods (FTIR, UV-Vis, 1H, and 13C NMR spectra), elemental analysis, metal content, magnetic measurement, and conductance. These studies revealed the formation of four-coordinate complexes in which the geometry about metal ion is tetrahedral. Biological activity of the ligands and their metal complexes against gram positive bacterial strain Bacillus (G+) and gram negative bacteria Pseudomonas (G−) revealed that the metal complexes become less resistive to the microbial activities as compared to the free ligands. PMID:24027449
Sequence distribution of acetaldehyde-derived N2-ethyl-dG adducts along duplex DNA.
Matter, Brock; Guza, Rebecca; Zhao, Jianwei; Li, Zhong-ze; Jones, Roger; Tretyakova, Natalia
2007-10-01
Acetaldehyde (AA) is the major metabolite of ethanol and may be responsible for an increased gastrointestinal cancer risk associated with alcohol beverage consumption. Furthermore, AA is one of the most abundant carcinogens in tobacco smoke and induces tumors of the respiratory tract in laboratory animals. AA binding to DNA induces Schiff base adducts at the exocyclic amino group of dG, N2-ethylidene-dG, which are reversible on the nucleoside level but can be stabilized by reduction to N2-ethyl-dG. Mutagenesis studies in the HPRT reporter gene and in the p53 tumor suppressor gene have revealed the ability of AA to induce G-->A transitions and A-->T transversions, as well as frameshift and splice mutations. AA-induced point mutations are most prominent at 5'-AGG-3' trinucleotides, possibly a result of sequence specific adduct formation, mispairing, and/or repair. However, DNA sequence preferences for the formation of acetaldehyde adducts have not been previously examined. In the present work, we employed a stable isotope labeling-HPLC-ESI+-MS/MS approach developed in our laboratory to analyze the distribution of acetaldehyde-derived N2-ethyl-dG adducts along double-stranded oligodeoxynucleotides representing two prominent lung cancer mutational "hotspots" and their surrounding DNA sequences. 1,7,NH 2-(15)N-2-(13)C-dG was placed at defined positions within DNA duplexes derived from the K-ras protooncogene and the p53 tumor suppressor gene, followed by AA treatment and NaBH 3CN reduction to convert N2-ethylidene-dG to N2-ethyl-dG. Capillary HPLC-ESI+-MS/MS was used to quantify N2-ethyl-dG adducts originating from the isotopically labeled and unlabeled guanine nucleobases and to map adduct formation along DNA duplexes. We found that the formation of N2-ethyl-dG adducts was only weakly affected by the local sequence context and was slightly increased in the presence of 5-methylcytosine within CG dinucleotides. These results are in contrast with sequence
Synthesis and Antibacterial Activities of New Metronidazole and Imidazole Derivatives
Directory of Open Access Journals (Sweden)
Abdul Jabar Kh. Atia
2009-07-01
Full Text Available New imidazole ring derivatives comprising 1,3-oxazoline, Schiff's bases, thiadiazole, oxadiazole and 1,2,4-triazole moieties are reported. 3-Aminobiimidazol-4-one compounds 7a-c were synthesized by the reaction of compounds 6a-c with hydrazine hydrate. Biimidazole esters 9a-c were converted into biimidazole hydrazide esters 10a-c. Compounds 7a-c and 10a-c were converted into a variety of derivatives.
Energy Technology Data Exchange (ETDEWEB)
Hunter, R; Welkie, G W
1977-04-01
Corn roots were treated for 1 hr in a modified Hoagland's solution containing 8 mg/l Cu/sup 2 +/ and either simultaneously or subsequently with various substances, in order to test theories of copper toxicity to roots. Post treatment with IAA, niacin amide, thiamin, or sucrose had no effect on subsequent growth. Addition of excess KCl and succinic acid-2,2-dimethyl hydrazide (an inhibitor of ethylene production) to the copper solution doubled average growth and increased recovery from 27 to 87%. A rinse with EDTA resulted in resumption of normal growth rates and 100% recovery if performed 1 hr after Cu treatment, but this effect was gradually lost in the following 6 to 12 hr. Copper toxicity was increasingly severe as pH of the Cu treating medium increased. Results are not consistent with any theory tested, but they do suggest there is an initial phase of copper-stress which lasts 3 to 6 hr, followed by plant reaction that results in irreversible cessation of growth.
Tabanca, Nurhayat; Ali, Abbas; Bernier, Ulrich R; Khan, Ikhlas A; Kocyigit-Kaymakcioglu, Bedia; Oruç-Emre, Emine E; Unsalan, Seda; Rollas, Sevim
2013-06-01
Taking into account the improvement in insecticidal activity by the inclusion of fluorine in the hydrazone moiety, the authors synthesized new 4-fluorobenzoic acid hydrazides and 3-acetyl-2,5-disubstituted-2,3-dihydro-1,3,4-oxadiazoles, substituting a phenyl group or a heteroaryl ring carrying one or two atoms of F, Cl and Br, and investigated their biting deterrent and larvicidal activities against Aedes aegypti for the first time. The compound 3-acetyl-5-(4-fluorophenyl)-2-[4-(dimethylamino)phenyl]-2,3-dihydro-1,3,4-oxadiazole (17) produced the highest biting deterrent activity (BDI = 1.025) against Ae. Aegypti, followed by 4-fluorobenzoic acid [(phenyl)methylene] hydrazide (1). These activity results were similar to those of N,N-diethyl-meta-toluamide (DEET), which showed a proportion not biting of 0.8-0.92. When compounds 1 and 17 were tested on cloth worn on human volunteers, compound 1 was not repellent for some volunteers until present in excess of 500 nmol cm(-2) , while compound 17 was not repellent at the highest concentration tested (1685 nmol cm(-2) ). In the larvicidal screening bioassays, only compounds 10, 11, 12 and 17 showed 100% mortality at the highest screening dose of 100 ppm against Ae. aegypti larvae. Compounds 11 and 12 with LD50 values of 24.1 and 30.9 ppm showed significantly higher mortality than 10 (80.3 ppm) and 17 (58.7 ppm) at 24-h post-treatment. The insecticidal and biting deterrent activities were correlated with the presence of a halogen atom on the phenyl or heteroaryl substituent of the hydrazone moiety. © 2012 Society of Chemical Industry.
Directory of Open Access Journals (Sweden)
Steingrimur Stefansson
2012-01-01
Full Text Available Many carbon nanotube field-effect transistor (CNT-FET studies have used immobilized antibodies as the ligand binding moiety. However, antibodies are not optimal for CNT-FET detection due to their large size and charge. Their size can prevent ligands from reaching within the Debye length of the CNTs and a layer of charged antibodies on the circuits can drown out any ligand signal. In an attempt to minimize the antibody footprint on CNT-FETs, we examined whether pyrene hydrazide modification of antibody carbohydrates could reduce the concentration required to functionalize CNT circuits. The carbohydrates are almost exclusively on the antibody Fc region and this site-specific modification could mediate uniform antibody orientation on the CNTs. We compared the hydrazide modification of anti-E. coli O157:H7 polyclonal antibodies to pyrenebutanoic acid succinimidyl ester-coated CNTs and carbodiimide-mediated antibody CNT attachment. Our results show that the pyrene hydrazide modification was superior to those methods with respect to bacteria detection and less than 1 nM labeled antibody was required to functionalize the circuits.
Evaluation of colorimetric BCA-based quantification of hydrazide groups on magnetic particles
Czech Academy of Sciences Publication Activity Database
Svobodová, Z.; Jankovičová, B.; Plichta, Zdeněk; Horák, Daniel; Bílková, Z.
2018-01-01
Roč. 2018, 19 April (2018), s. 1-5, č. článku 5492893. ISSN 2314-4920 Institutional support: RVO:61389013 Keywords : magnetic particles * bicinchoninic acid (BCA) * hydrazide group Subject RIV: CD - Macromolecular Chemistry OBOR OECD: Polymer science Impact factor: 0.761, year: 2016
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Institute of Scientific and Technical Information of China (English)
FENG,Dai-Jun; WANG,Peng; LI,Xiao-Qiang; LI,Zhan-Ting
2006-01-01
A new series of hydrogen bonding-driven heterodimers have been self-assembled in chloroform from hydrazide-based monomers. Additional intermolecular donor-acceptor interaction between the electron-rich bis(p-phenylene)-34-crown-10 unit and the electron-deficient naphthalene diimide unit has been utilized to increase the stability of the dimmers, and pronounced cooperativity of the two discrete non-covalent forces to stabilize the dimer has been revealed by the quantitative 1H (2D) NMR and UV-Vis experiments.
Jaeger, Doris; Schoiswohl, Gabriele; Hofer, Peter; Schreiber, Renate; Schweiger, Martina; Eichmann, Thomas O.; Pollak, Nina M.; Poecher, Nadja; Grabner, Gernot F.; Zierler, Kathrin A.; Eder, Sandra; Kolb, Dagmar; Radner, Franz P.W.; Preiss-Landl, Karina; Lass, Achim; Zechner, Rudolf; Kershaw, Erin E.; Haemmerle, Guenter
2015-01-01
Background & Aims Adipose tissue (AT)-derived fatty acids (FAs) are utilized for hepatic triacylglycerol (TG) generation upon fasting. However, their potential impact as signaling molecules is not established. Herein we examined the role of exogenous AT-derived FAs in the regulation of hepatic gene expression by investigating mice with a defect in AT-derived FA supply to the liver. Methods Plasma FA levels, tissue TG hydrolytic activities and lipid content were determined in mice lacking the lipase co-activator comparative gene identification-58 (CGI-58) selectively in AT (CGI-58-ATko) applying standard protocols. Hepatic expression of lipases, FA oxidative genes, transcription factors, ER stress markers, hormones and cytokines were determined by qRT-PCR, Western blotting and ELISA. Results Impaired AT-derived FA supply upon fasting of CGI-58-ATko mice causes a marked defect in liver PPARα-signaling and nuclear CREBH translocation. This severely reduced the expression of respective target genes such as the ATGL inhibitor G0/G1 switch gene-2 (G0S2) and the endocrine metabolic regulator FGF21. These changes could be reversed by lipid administration and raising plasma FA levels. Impaired AT-lipolysis failed to induce hepatic G0S2 expression in fasted CGI-58-ATko mice leading to enhanced ATGL-mediated TG-breakdown strongly reducing hepatic TG deposition. On high fat diet, impaired AT-lipolysis counteracts hepatic TG accumulation and liver stress linked to improved systemic insulin sensitivity. Conclusions AT-derived FAs are a critical regulator of hepatic fasting gene expression required for the induction of G0S2-expression in the liver to control hepatic TG-breakdown. Interfering with AT-lipolysis or hepatic G0S2 expression represents an effective strategy for the treatment of hepatic steatosis. PMID:25733154
International Nuclear Information System (INIS)
Zhou, Yao; Zhao, Hong-Ye; Han, Kai-Lin; Yang, Yao; Song, Bin-Bin; Guo, Qian-Nan; Fan, Zhen-Chuan; Zhang, Yong-Min; Teng, Yu-Ou; Yu, Peng
2014-01-01
Highlights: • 5-(2-Carboxyethenyl) isatin derivative (HKL 2H) inhibited K562’s proliferation. • HKL 2H caused the morphology change of G 2 /M phase arrest and typical apoptosis. • HKL 2H induced G2/M cell cycle phase arrest in K562 cells. • HKL 2H induced apoptosis in K562 cells through the mitochondrial pathway. - Abstract: Our previous study successfully identified that the novel isatin derivative (E)-methyl 3-(1-(4-methoxybenzyl)-2,3-dioxoindolin-5-yl) acrylate (HKL 2H) acts as an anticancer agent at an inhibitory concentration (IC 50 ) level of 3 nM. In this study, the molecular mechanism how HKL 2H induces cytotoxic activity in the human chronic myelogenous leukemia K562 cells was investigated. Flow cytometric analysis showed that the cells were arrested in the G 2 /M phase and accumulated subsequently in the sub-G 1 phase in the presence of HKL 2H. HKL 2H treatment down-regulated the expressions of CDK1 and cyclin B but up-regulated the level of phosphorylated CDK1. Annexin-V staining and the classic DNA ladder studies showed that HKL 2H induced the apoptosis of K562 cells. Our study further showed that HKL 2H treatment caused the dissipation of mitochondrial membrane potential, activated caspase-3 and lowered the Bcl-2/Bax ratio in K562 cells, suggesting that the HKL 2H-causing programmed cell death of K562 cells was caused via the mitochondrial apoptotic pathway. Taken together, our data demonstrated that HKL 2H, a 5-(2-carboxyethenyl) isatin derivative, notably induces G 2 /M cell cycle arrest and mitochondrial-mediated apoptosis in K562 cells, indicating that this compound could be a promising anticancer candidate for further investigation
Directory of Open Access Journals (Sweden)
T. K. Chaitra
2016-01-01
Full Text Available Three new thiazole based pyridine derivatives 5-(4-methoxy-phenyl-thiazole-2-carboxylic acid pyridin-2-ylmethylene-hydrazide (2-MTPH, 5-(4-methoxy-phenyl-thiazole-2-carboxylic acid pyridin-3-ylmethylene-hydrazide (3-MTPH, and 5-(4-methoxy-phenyl-thiazole-2-carboxylic acid pyridin-4-ylmethylene-hydrazide (4-MTPH were synthesized and characterized. Corrosion inhibition performance of the prepared compounds on mild steel in 0.5 M HCl was studied using gravimetric, potentiodynamic polarisation, and electrochemical impedance techniques. Inhibition efficiency has direct relation with concentration and inverse relation with temperature. Thermodynamic parameters for dissolution and adsorption process were evaluated. Polarisation study reveals that compounds act as both anodic and cathodic inhibitors with emphasis on the former. Impedance study shows that decrease in charge transfer resistance is responsible for effective protection of steel surface by inhibitors. The film formed on the mild steel was investigated using FTIR, SEM, and EDX spectroscopy. Quantum chemical parameters like EHOMO, ELUMO, ΔE, hardness, softness, and ionisation potential were calculated. Higher value of EHOMO and lower value of ΔE indicate the better inhibition efficiency of the compounds. Lower ionisation potential of inhibitors indicates higher reactivity and lower chemical stability.
Synthesis and Antimicrobial Activities of Some Novel Quinoxalinone Derivatives
Directory of Open Access Journals (Sweden)
Y. A. Ammar
2000-06-01
Full Text Available Condensation of 4-benzoyl-1,2-phenylenediamine with sodium pyruvate in acetic acid furnished two products which were identified as 6-benzoyl and 7-benzoyl-3-methyl-2(1Hquinoxalinones (1a,b. Fusion of 1a with aromatic aldehydes furnished the styryl derivatives 2a-c. Alkylation of 1a,b with dimethyl sulphate or ethyl chloroacetate produced the N-alkyl derivatives 3a,b and 4a,b. Hydrazinolysis of the ester derivative 4a with hydrazine hydrate afforded the hydrazide derivative 5 which underwent condensation with aldehydes to give the corresponding hydrazone derivatives 6a,b. In addition, chlorination of 1a with thionyl chloride afforded the 2-chloro derivative 7 which was subjected to reaction with sodium azide and n-butylamine to yield the corresponding tetrazolo (8 and n-butylamino (9 derivatives, respectively. The structures of the compounds prepared were confirmed by analytical and spectral data. Also, some of the synthesized compounds were screened for antimicrobial activity.
International Nuclear Information System (INIS)
Ikram, M.; Rehman, S.; Khan, K.
2013-01-01
The hydrazide ligand 2-amino-(N-aminobezoyl)benzohydrazide (ABH) have been synthesized and characterized by 1H-NMR, 13C-NMR, ES+-MS, elemental analyses and infrared studies. The ligand was complexed with Ni(II), Cu(II) and Zn(II) metal ions and were characterized by analytical and spectroscopic methods including elemental analyses, ES+-MS, conductance, infrared, UV-Visible and magnetic susceptibilities studies. Infrared spectra show that the ligand form complexes through -NH2 and carbonyl moieties, the elemental studies suggested the M(ABH)X2 composition of the coordination compounds. The synthesized complexes were studied for their biological activities against gram negative bacteria including Escherichia coli, Salmonella typhi, Enterobacter aerogenes, Proteus vulgaris, Pseudomonas aeruginosa, Gram positive bacterial strains like Staphylococcus aureus and fungus like Candida albican. These activities show that the metal complexes are more active to the tested microbes as compared to neat ligand. (author)
Huang, Junfeng; Wan, Hao; Yao, Yating; Li, Jinan; Cheng, Kai; Mao, Jiawei; Chen, Jin; Wang, Yan; Qin, Hongqiang; Zhang, Weibing; Ye, Mingliang; Zou, Hanfa
2015-10-20
Selective enrichment of glycopeptides from complex sample followed by cleavage of N-glycans by PNGase F to expose an easily detectable mark on the former glycosylation sites has become the popular protocol for comprehensive glycoproteome analysis. On account of the high enrichment specificity, hydrazide chemistry based solid-phase extraction of N-linked glycopeptides technique has sparked numerous interests. However, the enzymatic release of glycopeptides captured by hydrazide beads through direct incubation of the beads with PNGase F is not efficient due to the inherent steric hindrance effect. In this study, we developed a hydroxylamine assisted PNGase F deglycosylation (HAPD) method using the hydroxylamine to release glycopeptides captured on the hydrazide beads through the cleavage of hydrazone bonds by transamination followed with the PNGase F deglycosylation of the released glycopeptides in the free solution. Because of the homogeneous condition for the deglycosylation, the recovery of deglycosylated peptides (deglycopeptides) was improved significantly. It was found that 27% more N-glycosylation sites were identified by the HAPD strategy compared with the conventional method. Moreover, the ratio of identified N-terminal glycosylated peptides was improved over 5-fold.
Energy Technology Data Exchange (ETDEWEB)
Zhou, Yao; Zhao, Hong-Ye; Han, Kai-Lin; Yang, Yao; Song, Bin-Bin; Guo, Qian-Nan [Key Laboratory of Industrial Microbiology, Ministry of Education, College of Biotechnology, Tianjin University of Science and Technology, Tianjin 300457 (China); Tianjin Key Laboratory of Industry Microbiology, College of Biotechnology, Tianjin University of Science and Technology, Tianjin 300457 (China); Fan, Zhen-Chuan [Key Laboratory of Food Nutrition and Safety (Tianjin University of Science and Technology), Ministry of Education, Tianjin 300457 (China); Obesita and Algaegen LLC, College Station, TX 77845 (United States); Zhang, Yong-Min [Université Pierre et Marie Curie-Paris 6, Institut Parisien de Chimie Moléculaire UMR CNRS 8232, 4 Place Jussieu, 75005 Paris (France); Teng, Yu-Ou, E-mail: tyo201485@tust.edu.cn [Key Laboratory of Industrial Microbiology, Ministry of Education, College of Biotechnology, Tianjin University of Science and Technology, Tianjin 300457 (China); Tianjin Key Laboratory of Industry Microbiology, College of Biotechnology, Tianjin University of Science and Technology, Tianjin 300457 (China); Yu, Peng, E-mail: yupeng@tust.edu.cn [Key Laboratory of Industrial Microbiology, Ministry of Education, College of Biotechnology, Tianjin University of Science and Technology, Tianjin 300457 (China); Tianjin Key Laboratory of Industry Microbiology, College of Biotechnology, Tianjin University of Science and Technology, Tianjin 300457 (China)
2014-08-08
Highlights: • 5-(2-Carboxyethenyl) isatin derivative (HKL 2H) inhibited K562’s proliferation. • HKL 2H caused the morphology change of G{sub 2}/M phase arrest and typical apoptosis. • HKL 2H induced G2/M cell cycle phase arrest in K562 cells. • HKL 2H induced apoptosis in K562 cells through the mitochondrial pathway. - Abstract: Our previous study successfully identified that the novel isatin derivative (E)-methyl 3-(1-(4-methoxybenzyl)-2,3-dioxoindolin-5-yl) acrylate (HKL 2H) acts as an anticancer agent at an inhibitory concentration (IC{sub 50}) level of 3 nM. In this study, the molecular mechanism how HKL 2H induces cytotoxic activity in the human chronic myelogenous leukemia K562 cells was investigated. Flow cytometric analysis showed that the cells were arrested in the G{sub 2}/M phase and accumulated subsequently in the sub-G{sub 1} phase in the presence of HKL 2H. HKL 2H treatment down-regulated the expressions of CDK1 and cyclin B but up-regulated the level of phosphorylated CDK1. Annexin-V staining and the classic DNA ladder studies showed that HKL 2H induced the apoptosis of K562 cells. Our study further showed that HKL 2H treatment caused the dissipation of mitochondrial membrane potential, activated caspase-3 and lowered the Bcl-2/Bax ratio in K562 cells, suggesting that the HKL 2H-causing programmed cell death of K562 cells was caused via the mitochondrial apoptotic pathway. Taken together, our data demonstrated that HKL 2H, a 5-(2-carboxyethenyl) isatin derivative, notably induces G{sub 2}/M cell cycle arrest and mitochondrial-mediated apoptosis in K562 cells, indicating that this compound could be a promising anticancer candidate for further investigation.
5-Nitroimidazole Derivatives and their Antimicrobial Activity
International Nuclear Information System (INIS)
Khan, K.M.; Salar, U.; Yousuf, S.; Naz, F.
2016-01-01
5-Nitroimidazole derivatives 2-8 were synthesized from secnidazole. The syntheses were accomplished in two steps which start from the oxidation of secnidazole to the secnidazolone 1. Secnidazolone 1 was converted into its hydrazone derivative 2-8 by treating with different substituted acid hydrazide. Compounds 2-8 were evaluated for their antimicrobial activity against Gram-positive and Gram-negative bacteria, compounds 3 and 4 showed the significant activity against Staphylococcus epidermidis, however, compound 2 showed good inhibitions against Corynebacterium diphtheria when compared with the standard. Compound 3 showed good inhibitory potential against tested Gram-negative bacterial strains i.e. Enterobacter aerogene, Escherichia coli, Salmonella typhi, Salmonella paratyphi A, Shigella flexeneri and Vibrio choleriae. All synthetic derivatives were also tested against eight fungal stains, however, they were weekly active against Aspergillus flavus and Candida albican. The synthesized compounds were characterized by different spectroscopy techniques. (author)
Waight, Jeremy D.; Hu, Qiang; Miller, Austin; Liu, Song; Abrams, Scott I.
2011-01-01
Myeloid-derived suppressor cells (MDSC) are induced under diverse pathologic conditions, including neoplasia, and suppress innate and adaptive immunity. While the mechanisms by which MDSC mediate immunosuppression are well-characterized, details on how they develop remain less understood. This is complicated further by the fact that MDSC comprise multiple myeloid cell types, namely monocytes and granulocytes, reflecting diverse stages of differentiation and the proportion of these subpopulations vary among different neoplastic models. Thus, it is thought that the type and quantities of inflammatory mediators generated during neoplasia dictate the composition of the resultant MDSC response. Although much interest has been devoted to monocytic MDSC biology, a fundamental gap remains in our understanding of the derivation of granulocytic MDSC. In settings of heightened granulocytic MDSC responses, we hypothesized that inappropriate production of G-CSF is a key initiator of granulocytic MDSC accumulation. We observed abundant amounts of G-CSF in vivo, which correlated with robust granulocytic MDSC responses in multiple tumor models. Using G-CSF loss- and gain-of-function approaches, we demonstrated for the first time that: 1) abrogating G-CSF production significantly diminished granulocytic MDSC accumulation and tumor growth; 2) ectopically over-expressing G-CSF in G-CSF-negative tumors significantly augmented granulocytic MDSC accumulation and tumor growth; and 3) treatment of naïve healthy mice with recombinant G-CSF protein elicited granulocytic-like MDSC remarkably similar to those induced under tumor-bearing conditions. Collectively, we demonstrated that tumor-derived G-CSF enhances tumor growth through granulocytic MDSC-dependent mechanisms. These findings provide us with novel insights into MDSC subset development and potentially new biomarkers or targets for cancer therapy. PMID:22110722
Energy Technology Data Exchange (ETDEWEB)
Beck, Paulo; Santos, Juliane M. dos; D' Oca, Marcelo G. M.; Piovesan, Luciana A., E-mail: lpiovesan@gmail.com [Universidade Federal do Rio Grande (UFRS), RS (Brazil). Escola de Quimica e Alimentos; Kuhn, Bruna L.; Moreira, Dayse N.; Flores, Alex F.C.; Martins, Marcos A.P. [Universidade Federal de Santa Maria (UFSM), RS (Brazil). Dept. de Quimica
2012-11-15
A series of new fatty N-acyl trihalomethylated pyrazoline derivatives from fatty acid methyl esters was synthesized by the cyclo condensation of respective fatty hydrazides with 4-alkoxy- 1,1,1-trial omethyl-3-alquen-2-ones. Efficient and regiospecific cyclizations catalyzed by BF{sub 3}-MeOH gave the desired products in good to excellent yields and at high purity. (author)
Energy Technology Data Exchange (ETDEWEB)
Peng, Donglai; Hu, Bin; Kang, Mengmeng [Henan Provincial Key Laboratory of Surface and Interface Science, Zhengzhou University of Light Industry, No. 136, Science Avenue, Zhengzhou 450001 (China); Wang, Minghua [Henan Collaborative Innovation Center of Environmental Pollution Control and Ecological Restoration, Zhengzhou University of Light Industry, No.136, Science Avenue, Zhengzhou 450001 (China); He, Linghao [Henan Provincial Key Laboratory of Surface and Interface Science, Zhengzhou University of Light Industry, No. 136, Science Avenue, Zhengzhou 450001 (China); Zhang, Zhihong, E-mail: mainzhh@163.com [Henan Provincial Key Laboratory of Surface and Interface Science, Zhengzhou University of Light Industry, No. 136, Science Avenue, Zhengzhou 450001 (China); Henan Collaborative Innovation Center of Environmental Pollution Control and Ecological Restoration, Zhengzhou University of Light Industry, No.136, Science Avenue, Zhengzhou 450001 (China); Fang, Shaoming, E-mail: mingfang@zzuli.edu.cn [Henan Provincial Key Laboratory of Surface and Interface Science, Zhengzhou University of Light Industry, No. 136, Science Avenue, Zhengzhou 450001 (China); Henan Collaborative Innovation Center of Environmental Pollution Control and Ecological Restoration, Zhengzhou University of Light Industry, No.136, Science Avenue, Zhengzhou 450001 (China)
2016-12-30
Highlights: • An electrochemical sensor based on gold nanoparticles modified with rhodamine B hydrazide (AuNPs-RBH) was developed. • The sensor was applied in the highly sensitive and selective detection of Cu{sup 2+} in water. • The electrochemical sensor displays excellent regeneration, stability, and practicability for Cu{sup 2+} detection. • EIS was used to determine Cu{sup 2+} ions in an aqueous solution with the developed AuNPs-RBH-based electrochemical sensor. - Abstract: An electrochemical sensor based on gold nanoparticles (Au NPs) modified with rhodamine B hydrazide (RBH) (AuNPs-RBH) was developed and applied in the highly sensitive and selective detection of Cu{sup 2+} in water. RBH molecules were bounded onto the surface of AuNPs via the strong interaction between the amino groups and Au NPs. The chemical structure variations were characterized by X-ray photoelectron spectroscopy and fluoresence spectroscopy. Additionally, electrochemical impedance spectroscopy was used to determine Cu{sup 2+} ions in an aqueous solution with the developed AuNPs-RBH-based electrochemical sensor. Results show that the fabricated sensor exhibits good electrochemical performance because of the presence of Au NPs and high affinity with the Cu{sup 2+} resulting from the strong coordination chemistry between Cu{sup 2+} and RBH. The as-developed sensor towards detecting Cu{sup 2+} has a detection limitation of 12.5 fM within the concentration range of 0.1 pM–1 nM by using the electrochemical impedance technique. It also displays excellent selectivity, regeneration, stability, and practicability for Cu{sup 2+} detection. Therefore, the new strategy of the RBH-based electrochemical sensor exhibits great potential application in environment treatment and protection.
Thermal stability and degradation behavior of novel wholly aromatic azo polyamide-hydrazides
International Nuclear Information System (INIS)
Al-Ghamdia, R.F.; Fahmib, M.M.; Mohamed, N.A.
2005-01-01
Thermal stability and degradation behavior of a series of novel wholly aromatic azo polyamide-hydrazides have been investigated in nitrogen and in air atmospheres using differential scanning ealorimetry, thermogravimetry, infrared spectroscopy and elemental analysis. The influences of controlled structural variations and molecular weight on the thermal stability and degradation behavior of this series of polymers have also been studied. The structural differences were achieved by varying the content of para- and meta substituted phenylene rings incorporated within this series. The polymers were prepared by a low temperature solution polycondensation reaction of p aminosalicylic acid hydrazide and an equimolar amount of 4,4-azo dibenzoyl chloride [4,4 ADBC] or 3,3-azo dibenzoyl chloride [3,3ADBC] or mixtures of various molar ratios of 4,4ADBC and 3,3ADBC in anhydrous N,N- dimethyl acetamide [DMAc] containing lithium chloride as a solvent at -10 degree C. The results clearly reveal that these polymers are characterized by high thermal stability. Their weight loss occurred in three distinctive steps. The first was small and assigned to the evaporation of absorbed moisture. The second was appreciable and was attributed to the cyclo dehydration reaction of the hydrazide groups into 1,3,4-oxadiazole rings by losing water, combined with elimination of azo groups by losing molecular nitrogen. This is not a true degradation but rather a thermo-chemical transformation reaction of the azo polyamide-hydrasdes into the corresponding polyamide-l,3,4-oxadiazoles. The third was relatively severe and sharp, particularly in air, and corresponded to the decomposition of the resulting polyamide-l, 3,4-oxadiazoles. In both degradation atmospheres, the improved resistance to high temperatures was always associated with increased content of para- phenylene moieties of the investigated polymer. Further, with exception of 160-200 degree C temperature range, where the lower molecular weight
Manzano, Carlos M.; Bergamini, Fernando R. G.; Lustri, Wilton R.; Ruiz, Ana Lúcia T. G.; de Oliveira, Ellen C. S.; Ribeiro, Marcos A.; Formiga, André L. B.; Corbi, Pedro P.
2018-02-01
Palladium(II) and platinum(II) complexes with a hydrazide derivative of ibuprofen (named HIB) were synthesized and characterized by chemical and spectroscopic methods. Elemental and thermogravimetric analyses, as well as ESI-QTOF-MS studies for both complexes, confirmed a 1:2:2 metal/HIB/Cl- molar ratio. The crystal structure of the palladium(II) complex was solved by single crystal X-ray diffractometric analysis, which permitted identifying the coordination formula [PdCl2(HIB)2]. Crystallographic studies also indicate coordination of HIB to the metal by the NH2 group. Nuclear magnetic resonance and infrared spectroscopies reinforced the coordination observed in the crystal structure and suggested that the platinum(II) complex presents similar coordination modes and structure when compared with the Pd(II) complex. The complexes had their structures optimized with the aid of DFT methods. In vitro antiproliferative assays showed that the [PdCl2(HIB)2] complex is active over ovarian cancer cell line OVCAR-03, while biophysical studies indicated its capacity to interact with CT-DNA. The complexes were inactive over Staphylococcus aureus, Escherichia coli and Pseudomonas aeruginosa bacterial strains.
Effect of maleic hydrazide and waxing on quality and shelf life of papaya (carica papaya L.) fruits
International Nuclear Information System (INIS)
Abu-Goukh, A. A.; Shattir, A. E.
2012-01-01
The effect of post harvest treatment of maleic hydrazide (MH) with and with out waxing on the quality and shelf-life of Baladi and Ekostika I papaya fruits at 18 ±1°C and 85%-90% relative humidity was evaluated. Maleic hydrazide at 250 and 500 ppm significantly delayed fruit ripening by two and three days in both papaya cultivars, respectively, compared with untreated fruits. The higher the concentration, the more was the delay in fruit ripening. The results also showed that waxing addition to MH resulted in a delay of two more days in fruit ripening that treatment with MH alone. The effect of MH and waxing treatments in delaying papaya fruits ripening was manifested in retarded respiratory climacteric, reduced weight loss and delayed fruit softening and increase in total soluble solids and ascorbic acid content.(Author)
Directory of Open Access Journals (Sweden)
Pandurangappa Malingappa
2014-01-01
Full Text Available A new chemosensor has been used to monitor atmospheric nitrogen oxides [NO + NO 2 ] at parts per billion (ppb level. It is based on the catalytic reaction of nitrogen oxides with rhodamine B hydrazide (RBH to produce a colored compound through the hydrolysis of the amide bond of the molecule. A simple colorimeter has been used to monitor atmospheric nitrogen dioxide at ppb level. The air samples were purged through a sampling cuvette containing RBH solution using peristaltic pump. The proposed method has been successfully applied to monitor the ambient nitrogen dioxide levels at traffic junction points within the city limits and the results obtained are compared with the standard Griess-Ilosvay method.
A multi-functional guanine derivative for studying the DNA G-quadruplex structure.
Ishizuka, Takumi; Zhao, Pei-Yan; Bao, Hong-Liang; Xu, Yan
2017-10-23
In the present study, we developed a multi-functional guanine derivative, 8F G, as a G-quadruplex stabilizer, a fluorescent probe for the detection of G-quadruplex formation, and a 19 F sensor for the observation of the G-quadruplex. We demonstrate that the functional nucleoside bearing a 3,5-bis(trifluoromethyl)benzene group at the 8-position of guanine stabilizes the DNA G-quadruplex structure and fluoresces following the G-quadruplex formation. Furthermore, we show that the functional sensor can be used to directly observe DNA G-quadruplexes by 19 F-NMR in living cells. To our knowledge, this is the first study showing that the nucleoside derivative simultaneously allows for three kinds of functions at a single G-quadruplex DNA. Our results suggest that the multi-functional nucleoside derivative can be broadly used for studying the G-quadruplex structure and serves as a powerful tool for examining the molecular basis of G-quadruplex formation in vitro and in living cells.
Meiotic changes in Vicia faba L. subsequent to treatments of hydrazine hydrate and maleic hydrazide
Directory of Open Access Journals (Sweden)
Shaheen Husain
2013-01-01
Full Text Available Assessing the impact of mutagens for creating variations in crops like faba bean (Vicia faba L. is an important criterion in the contemporary world where food insecurity and malnutrition is alarming at the doors of various nations. Impact of two chemical mutagens viz. hydrazine hydrate (HZ and maleic hydrazide (MH on the two varieties (NDF-1 and HB-405 of Vicia faba were analysed in terms of meiotic behavior and pollen sterility. Since there are not enough data about the effect of these mutagens on the chromosomal behaviors of Vicia faba, this study presents the role of hydrazine hydrate and maleic hydrazide as well as various types of chromosomal aberrations in crop improvement. The lower concentration of mutagens showed less pollen sterility compared to the higher concentrations. Manipulation of plant structural component to induce desirable alternations provides valuable material for the breeders and could be used favorably for increasing mutation rate and obtaining a desirable spectrum of mutation in faba beans based on preliminary studies of cell division.
Two rhodamine 6G derivative compounds: a structural and fluorescence single-crystal study.
Di Paolo, Matias; Bossi, Mariano L; Baggio, Ricardo; Suarez, Sebastián A
2016-10-01
The synthesis, characterization, structural analysis and fluorescence properties of two rhodamine 6G derivatives are described, namely a propargylamine derivative, 3',6'-bis(ethylamino)-2',7'-dimethyl-2-(methylcyanide)spiro[isoindole-1,9'-xanthen]-3(2H)-one (I), and a γ-aminobutyric acid (GABA) derivative, 3',6'-bis(ethylamino)-2',7'-dimethyl-3-oxospiro[isoindole-1,9'-xanthen]-2(3H)-yl)butyricacid (II). Both structures are compared with four similar ones from the Cambridge Structural Database (CSD), and the interactions involved in the stabilization are analyzed using the atoms in molecules (AIM) theory. Finally, a single-crystal in-situ reaction study is presented, carried out by fluorescence methods, which enabled the `opening' of the spirolactam ring in the solid phase.
Directory of Open Access Journals (Sweden)
Mustapha C. Mandewale
2018-02-01
Full Text Available The quinoline hydrazone ligands were synthesized through multi-step reactions. The 2-hydroxy-3-formylquinoline derivatives (1a–1c were prepared from acetanilide derivatives as starting materials using Vilsmeier–Haack reaction. Then the condensation of 2-hydroxy-3-formylquinoline derivatives with hydrazide derivatives (2a–2c yielded quinoline hydrazone ligands (3a–3i. The synthesis of a new series of Zn(II complexes carried out by refluxing with these quinoline hydrazone ligands (3a–3i is reported. The molecular structures of the ligands (3a–3i and the Zn complexes were characterized by elemental analysis and spectral studies like FT-IR, 1H and 13C NMR, MS, UV–Visible and fluorescence. The preliminary results of antituberculosis study showed that most of the Zn(II complexes 4a–4i demonstrated very good antituberculosis activity while the ligands 3a–3i showed moderate activity. Among the tested compounds 4e and 4g were found to be most active with minimum inhibitory concentration (MIC of 8.00μM and 7.42 μM respectively against Mycobacterium tuberculosis (H37 RV strain ATCC No-27294 which is comparable to “first and second line” drugs used to treat tuberculosis.
El-Sawy, Eslam R; Ebaid, Manal S; Abo-Salem, Heba M; El-Hallouty, Salwa; Kassem, Emad M; Mandour, Adel H
2014-05-01
A novel series of 4-methoxy, and 4,9-dimethoxy-5-substituted furo[2,3-g]-1,2,3-benzoxathiazine-7,7-dioxide derivatives 3a,b, 10a-g and 11a-g were prepared in good yields via the reaction of 4-methoxy (1a) and 4,7-dimethoxy-5-acetyl-6-hydroxybenzofurans (1b) and their α,β-unsaturated keto derivatives 6a-g and 7a-g with chlorosulfonyl isocyanate (CSI). On the other hand, N-chlorosulfonyl carbamate derivatives 4a,b, 12a,b and 13a,b were prepared and allowed to react with piperidine to give the corresponding N-piperidinosulfonyl carbamate derivatives 5a,b, 14a,b and 15a,b, respectively. Sixteen new target compounds 3a,b, 10a-g, and 11a-g were tested for their DPPH radical-scavenging, and in vitro antiproliferative activity against A-549, MCF7 and HCT-116 cancer cell lines. Compounds 10a, 11c, 11e, and 11g showed moderate DPPH radical-scavenging activity compared to ascorbic acid at 100 μg/mL. 4,9-Dimethoxy-5-substituted styrylfuro[3,2-g]-1,2,3-benzoxathiazine-7,7-dioxides 11a, 11b, and 11c were found to be highly active against A-549 and HCT-116 cancer cell lines with IC50 values ranging from 0.02 to 0.08 μmol/mL compared to doxorubicin with IC50 = 0.04 and 0.06 μmol/mL, respectively.
Physico-chemical studies of some aminobenzoic acid hydrazide complexes
Directory of Open Access Journals (Sweden)
S. ABD EL HALEEM
2004-04-01
Full Text Available The stability constants and related thermodynamic functions characterizing the formation of divalent Ni, Cu, Zn, Cd and Hg complexes with o- and p-aminobenzoic acid hydrazide were determined potentiometrically at different temperatures. The formations of the complexes are endothermic processes. The formed bonds are mainly electrostatic. Conductometric titration was carried out to determine the stoichiometry and stability of the formed complexes. The structures of complexes were characterized by their IR, 1H-NMR and 13C-NMR spectra, as well as X-ray diffractograms. The coordination process takes place through the carbonyl group and the terminal hydrazinic amino group. The thermal stability of the complexes was followed in the temperature range 20600ºC.
Bai, Haihong; Pan, Yiting; Guo, Cong; Zhao, Xinyuan; Shen, Bingquan; Wang, Xinghe; Liu, Zeyuan; Cheng, Yuanguo; Qin, Weijie; Qian, Xiaohong
2017-08-15
Protein N-glycosylation is one of the most important post-translational modifications, participating in many key biological and pathological processes. Large-scale and precise identification of N-glycosylated proteins and peptides is especially beneficial for understanding their biological functions and for discovery of new clinical biomarkers and therapeutic drug targets. However, protein N-glycosylation is microheterogeneous and low abundant in living organisms, therefore specific enrichment of N-glycosylated proteins/peptides before mass spectrometry analysis is a prerequisite. In this work, we developed a new type of polymer hybrid graphene oxide (GO) by in situ growth of hydrazide-functionalized hydrophilic polymer chains on the GO surface (GO-PAAH) for selective N-glycopeptide enrichment and identification by mass spectrometry. The densely attached and low steric hindrance hydrazide groups as well as the highly hydrophilic nature of GO-PAAH facilitate N-glycopeptide enrichment by the combination of hydrazide capturing and HILIC interaction. Taking advantage of the unique features of GO-PAAH, all of the three N-glycopeptides of bovine fetuin were successfully enriched and identified with significantly enhanced signal intensities from a digest mixture of bovine fetuin and bovine serum albumin at a mass ratio of 1:100, demonstrating the excellent enrichment selectivity of GO-PAAH. Furthermore, a total of 507 N-glycosylation sites and 480 N-glycopeptides in 232 N-glycoproteins were enriched and identified from 10μL of human serum by three replicates using this novel enrichment material, which is nearly two times higher than the commercial hydrazide resin based method (280 N-glycosylation sites, 261 N-glycopeptides and 144 N-glycoproteins in three experiments). Among the identified, 95 N-glycosylation sites were not reported in the Uniprot database, and 106 N-glycoproteins were disease related in the Nextprot database, indicating the potential of this new
Derivation of the Verlinde formula from Chern-Simons theory and the G/G model
International Nuclear Information System (INIS)
Blau, M.; Thompson, G.
1993-01-01
We give a derivation of the Verlinde formula for the G k WZW model from Chern-Simons theory, without taking recourse to CFT, by calculating explicitly the partition function Z ΣxS 1 of Σ x S 1 with an arbitrary number of labelled punctures. By what is essentially a suitable gauge choice, Z ΣxS 1 is reduced to the partition function of an abelian topological field theory on Σ (a deformation of non-abelian BF and Yang-Mills theory) whose evaluation is straightforward. This relates the Verlinde formula to the Ray-Singer torsion of Σ x S 1 . We derive the G k /G k model from Chern-Simons theory, proving their equivalence, and give an alternative derivation of the Verlinde formula by calculating the G k /G k path integral via a functional version of the Weyl integral formula. From this point of view the Verlinde formula arises from the corresponding jacobian, the Weyl determinant. Also, a novel derivation of the shift k → k + h is given, based on the index of the twisted Dolbeault complex. (orig.)
International Nuclear Information System (INIS)
Du Kejun; Chai Yubo; Hou Lichao; Chang Wenhui; Chen Suming; Luo Wenjing; Cai Tongjian; Zhang Xiaonan; Chen Nanchun; Chen Yaoming; Chen Jingyuan
2008-01-01
Lipopolysaccharide (LPS) is the toxic determinant for Gram-negative bacterium infection. The individual response to LPS was related to its gene background. It is necessary to identify new molecules and signaling transduction pathways about LPS. The present study was undertaken to evaluate the effects of a novel environmental lipopolysaccharide-responding (Elrg) gene on the regulation of proliferation and cell cycle of the hepatoma-derived cell line, HepG2. By means of RT-PCR, the new molecule of Elrg was generated from a human dental pulp cell cDNA library. Expression level of Elrg in HepG2 cells was remarkably upgraded by the irritation of LPS. Localization of Elrg in HepG2 cells was positioned mainly in cytoplasm. HepG2 cells were markedly arrested in the G1 phase by over-expressing Elrg. The percentage of HepG2 cells in G1 phase partly decreased after Elrg-siRNA. In conclusion, Elrg is probably correlative with LPS responding. Elrg is probably a new protein in cytoplasm which plays an important role in regulating cell cycle. The results will deepen our understanding about the potential effects of Elrg on the human hepatoma-derived cell line HepG2
International Nuclear Information System (INIS)
Parshad, R.; Gantt, R.; Sanford, K.K.; Jones, G.M.; Tarone, R.E.
1982-01-01
A line of normal human skin fibroblasts (KD) differed from its malignant derivative (HUT-14) in the extent of cytogenetic damage induced by X-irradiation during G 2 phase. Malignant cells had significantly more chromatid breaks and gaps after exposure to 25, 50, or 100 rad. Results from alkaline elution of cellular DNA immediately after irradiation showed that the normal and malignant cells in asynchronous population were equally sensitive to DNA single-strand breakage by X-irradiation. Caffeine or #betta#-cytosine arabinoside (ara-C), inhibitors of DNA repair, when added directly following G 2 phase exposure, significantly increased the incidence of radiation-induced chromatid damage in the normal cells. In contrast, similar treatment of the malignant cells had little influence. Ara-C differed from caffeine in its effects; whereas both agents increased the frequency of chromatid breaks and gaps, only ara-C increased the frequency of gaps to the level observed in the irradiated malignant cells. Addition of catalase, which destroys H 2 O 2 , or mannitol, a scavenger of the derivative free hydroxyl radical (.OH), to the cultures of malignant cells before, during, and following irradiation significantly reduced the chromatid damage; and catalase prevented formation of chromatid gaps. The DNA damage induced by X-ray during G 2 phase in the normal KD cells was apparently repaired by a caffeine- and ara-C-sensitive mechanism(s) that was deficient or absent in their malignant derivatives
Bao, Yishu; Yang, Xiuqin; Zhou, Qingfa; Yang, Fulai
2018-04-06
A highly regio- and stereoselective synthesis of β-haloalkenyl sulfides using commercially available ketones and sulfonyl hydrazides as starting materials has been developed. This protocol obviates the need for alkynes and traditional sulfenylating agents and therefore opens up a new door to construct β-iodoalkenyl sulfides in a highly simple manner. This study reveals that ketones could be used as vinyl iodide precursors in organic synthesis.
International Nuclear Information System (INIS)
Block, Martin M.; Durand, Loyal; McKay, Douglas W.
2008-01-01
We derive a second-order linear differential equation for the leading-order gluon distribution function G(x,Q 2 )=xg(x,Q 2 ) which determines G(x,Q 2 ) directly from the proton structure function F 2 p (x,Q 2 ). This equation is derived from the leading-order evolution equation for F 2 p (x,Q 2 ), and does not require knowledge of either the individual quark distributions or the gluon evolution equation. Given an analytic expression that successfully reproduces the known experimental data for F 2 p (x,Q 2 ) in a domain x min (Q 2 )≤x≤x max (Q 2 ), Q min 2 ≤Q 2 ≤Q max 2 of the Bjorken variable x and the virtuality Q 2 in deep inelastic scattering, G(x,Q 2 ) is uniquely determined in the same domain. We give the general solution and illustrate the method using the recently proposed Froissart-bound-type parametrization of F 2 p (x,Q 2 ) of E. L. Berger, M. M. Block and C.-I. Tan [Phys. Rev. Lett. 98, 242001 (2007)]. Existing leading-order gluon distributions based on power-law descriptions of individual parton distributions agree roughly with the new distributions for x > or approx. 10 -3 as they should, but are much larger for x -3 .
Directory of Open Access Journals (Sweden)
Galih Satrio Putra
2017-08-01
Full Text Available The development of anticancer drugs from ethyl p-methoxycinnamate (EPMC derivatives continues to obtain compounds that have high ability of cancer cells apoptosis and minimal side effects. p-Methoxycinnamoyl hydrazide derivate compounds from EPMC structure modification were docked into the ligand-binding pocket of Check point kinase 1 enzymes (2YWP and the aromatase enzyme (3S7S using software Molegro Virtual Docker (MVD Ver.5.5. We compared the Rerank score of native ligand with derivate compounds of p-Methoxycinnamoyl hydrazide. Rerank scores of compounds 4b and 4c (-99.98 Kcal/mol and -99.80 Kcal/mol were lower than the native ligand A42 in inhibiting the enzyme checkpoint kinase 1. Rerank values of p-Methoxycinnamoyl hydrazide derivate compounds were greater than the native ligand EXM in inhibiting the enzyme aromatase. p-Methoxycinnamoyl hydrazide derivate compounds, especially compounds 4b and 4c, had anticancer mechanism by inhibiting the enzyme pathway checkpoint kinase 1 and had not activity in inhibiting the aromatase enzyme.
Novel one-pot process for the synthesis of ethyl 2-imino-4-methyl-2,3-dihydrothiazole-5-carboxylates
Directory of Open Access Journals (Sweden)
Beyzaei Hamid
2015-01-01
Full Text Available A facile one-pot two-step process for the synthesis of ethyl 2-imino-4-methyl-2,3-dihydrothiazole-5-carboxylates via the cyclocondensation of ethyl 2-thiocyanatoacetoacetate with a variety of hydrazine and hydrazide derivatives has been developed. Ethyl 2-thiocyanatoacetoacetate itself has been synthesized as intermediate from the reaction of ethyl 2-chloroacetoacetate with potassium thiocyanate (KSCN. The molecular structures of these newly synthesized compounds were elucidated on the basis of elemental analysis and spectral data.
International Nuclear Information System (INIS)
Parshad, R.; Gantt, R.; Sanford, K.K.; Jones, G.M.; Tarone, R.E.
1982-01-01
A line of normal human skin fibroblasts (KD) differed from its malignant derivative (HUT-14) in the extent of cytogenetic damage induced by X-irradiation during G2 phase. Malignant cells had significantly more chromatid breaks and gaps after exposure to 25, 50, or 100 rad. The gaps may represent single-strand breaks. Results from alkaline elution of cellular DNA immediately after irradiation showed that the normal and malignant cells in asynchronous population were equally sensitive to DNA single-strand breakage by X-irradiation. Caffeine or beta-cytosine arabinoside (ara-C), inhibitors of DNA repair, when added directly following G2 phase exposure, significantly increased the incidence of radiation-induced chromatid damage in the normal cells. In contrast, similar treatment of the malignant cells had little influence. Ara-C differed from caffeine in its effects; whereas both agents increased the frequency of chromatid breaks and gaps, only ara-C increased the frequency of gaps to the level observed in the irradiated malignant cells. Addition of catalase, a scavenger of the derivative free hydroxyl radical (.OH), to the cultures of malignant cells before, during, and following irradiation significantly reduced the chromatid damage; and catalase prevented formation of chromatid gaps. The DNA damage induced by X-ray during G2 phase in the normal KD cells was apparently repaired by a caffeine- and ara-C-sensitive mechanism(s) that was deficient or absent in their malignant derivatives
Synthesis and antimycobacterial activity of isoniazid derivatives from renewable fatty acids.
Rodrigues, Marieli O; Cantos, Jéssica B; D'Oca, Caroline R Montes; Soares, Karina L; Coelho, Tatiane S; Piovesan, Luciana A; Russowsky, Dennis; da Silva, Pedro A; D'Oca, Marcelo G Montes
2013-11-15
This work describes the synthesis of a series of fatty acid hydrazide derivatives of isoniazid (INH). The compounds were tested against Mycobacterium tuberculosis H37Rv (ATCC 27294) as well as INH-resistant (ATCC 35822 and 1896 HF) and rifampicin-resistant (ATCC 35338) M. tuberculosis strains. The fatty acid derivatives of INH showed high antimycobacterial potency against the studied strains, which is desirable for a pharmaceutical compound, suggesting that the increased lipophilicity of isoniazid plays an important role in its antimycobacterial activity. Copyright © 2013 Elsevier Ltd. All rights reserved.
Sekimoto, Masashi; Sumi, Haruna; Hosaka, Takuomi; Umemura, Takashi; Nishikawa, Akiyoshi; Degawa, Masakuni
2016-11-01
The ability of nine cooked food-derived heterocyclic aromatic amines (HCAs), such as 3-amino-1,4-dimethyl-5H-pyrido[4,3-b]indole (Trp-P-1), 3-amino-1-methyl-5H-pyrido[4,3-b]indole (Trp-P-2), 2-amino-6-methylpyrido[12-a:3',2'-d]imidazole (Glu-P-1), 2-amino-pyrido[12-a:3',2'-d]imidazole hydrochloride (Glu-P-2), 2-amino-9H-pyrido[2,3-b]indole (AαC), 2-amino-3-methyl-9H-pyrido[2,3-b]indole (MeAαC), 2-amino-3-methylimidazo[4,5-f]quinolone (IQ), 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx) and 2-amino-1-methyl-6-phenyl-1H-imidazo[4,5-b]pyridine (PhIP), to activate human aryl hydrocarbon receptor (hAhR) was examined using a HepG2-A10 cell line, which has previously established from human hepatocarcinoma-derived HepG2 cells for use in hAhR-based luciferase reporter gene assays. Trp-P-1, Trp-P-2, AαC, MeAαC, IQ and MeIQx showed a definite ability to induce not only luciferase (hAhR activation) in HepG2-A10 cells but also cytochrome P450 (CYP)1A1/1A2 mRNAs in HepG2 cells, while such the ability of Glu-P-1, Glu-P-2, and PhIP was very low. In addition, all the HCAs examined, especially MeAαC and MeIQx, had a definite capacity for inhibiting the activity of ethoxyresorfin O-deethylase (CYP1As, especially CYP1A1). The present findings demonstrate that all the HCAs examined have the ability to activate hAhR and its target genes, and further confirm that these HCAs become good substrates for human CYP1A subfamily enzyme(s). Copyright © 2016 Elsevier Ltd. All rights reserved.
Neuron-derived IgG protects neurons from complement-dependent cytotoxicity.
Zhang, Jie; Niu, Na; Li, Bingjie; McNutt, Michael A
2013-12-01
Passive immunity of the nervous system has traditionally been thought to be predominantly due to the blood-brain barrier. This concept must now be revisited based on the existence of neuron-derived IgG. The conventional concept is that IgG is produced solely by mature B lymphocytes, but it has now been found to be synthesized by murine and human neurons. However, the function of this endogenous IgG is poorly understood. In this study, we confirm IgG production by rat cortical neurons at the protein and mRNA levels, with 69.0 ± 5.8% of cortical neurons IgG-positive. Injury to primary-culture neurons was induced by complement leading to increases in IgG production. Blockage of neuron-derived IgG resulted in more neuronal death and early apoptosis in the presence of complement. In addition, FcγRI was found in microglia and astrocytes. Expression of FcγR I in microglia was increased by exposure to neuron-derived IgG. Release of NO from microglia triggered by complement was attenuated by neuron-derived IgG, and this attenuation could be reversed by IgG neutralization. These data demonstrate that neuron-derived IgG is protective of neurons against injury induced by complement and microglial activation. IgG appears to play an important role in maintaining the stability of the nervous system.
Abd El-Hafeez, Amer Ali; Fujimura, Takashi; Kamei, Rikiya; Hirakawa, Noriko; Baba, Kenji; Ono, Kazuhisa; Kawamoto, Seiji
2017-07-14
Perilla frutescens is an Asian dietary herb consumed as an essential seasoning in Japanese cuisine as well as used for a Chinese medicine. Here, we report that a newly found methoxyflavanone derivative from P. frutescens (Perilla-derived methoxyflavanone, PDMF; 8-hydroxy-5,7-dimethoxyflavanone) shows carcinostatic activity on human lung adenocarcinoma, A549. We found that treatment with PDMF significantly inhibited cell proliferation and decreased viability through induction of G 2 /M cell cycle arrest and apoptosis. The PDMF stimulation induces phosphorylation of tumor suppressor p53 on Ser15, and increases its protein amount in conjunction with up-regulation of downstream cyclin-dependent kinase inhibitor p21 Cip1/Waf1 and proapoptotic caspases, caspase-9 and caspase-3. We also found that small interfering RNA knockdown of p53 completely abolished the PDMF-induced G 2 /M cell cycle arrest, and substantially abrogated its proapoptotic potency. These results suggest that PDMF represents a useful tumor-preventive phytochemical that triggers p53-driven G 2 /M cell cycle arrest and apoptosis.
Microwave-Assisted Synthesis of Some 1H-1,2,4-Triazol-3-one ...
African Journals Online (AJOL)
NICO
ester, hydrazide, oxadiazole and acetic acid derivatives of. 1,2,4-triazol-3-one by using microwave irradiation and conven- tional heating. Our research group has ..... 1 equiv. of. NaOH in absolute ethanol for 4 h. Then, the mixture was cooled at room temperature , poured into cold water and acidified to. pH 5 with conc. HCl.
Directory of Open Access Journals (Sweden)
Pramilla Sah
2014-04-01
Full Text Available 5-(4-Chlorophenyl amino-2-mercapto-1,3,4-thiadiazole (I was refluxed with formaldehyde and ammonium chloride in ethanol yielding the Mannich base 5-(4-chloro phenyl amino-3-aminomethyl-2-mercapto-1,3,4-thiadiazole (II. Esterification with 4-chloro-(2,6-dinitro phenoxy-ethyl acetate (III under anhydrous conditions gave the intermediate (IV. Subsequent hydrazinolysis with hydrazine hydrate gave the corresponding hydrazide 3-amino methyl-5-(4-chloro phenyl amino-2-mercapto-4′-(2′,6′-dinitro phenoxy-acetyl hydrazide (V. The hydrazide was converted into the Schiff bases (VIa–b by reacting with 2-chlorobenzaldehyde and 3-methoxy-4-hydroxy benzaldehyde in presence of methanol containing 2–3 drops of acetic acid. Diazotisation with aromatic amines, sulphanilic acid and sulphur drugs gave the formazans (VIIa–g respectively. Chemical structures have been established by elemental analysis and the spectral techniques of FTIR, 1H NMR and mass. Antimicrobial activity (in vitro was evaluated against the two pathogenic bacterial strains. Escherichia coli and Salmonella typhi, three fungal strains Aspergillus niger, Penicillium species and Candida albicans. The compounds have shown moderate activity.
Xanthene and Xanthone Derivatives as G-Quadruplex Stabilizing Ligands
Directory of Open Access Journals (Sweden)
Alessandro Altieri
2013-10-01
Full Text Available Following previous studies on anthraquinone and acridine-based G-quadruplex ligands, here we present a study of similar aromatic cores, with the specific aim of increasing G-quadruplex binding and selectivity with respect to duplex DNA. Synthesized compounds include two and three-side chain xanthone and xanthene derivatives, as well as a dimeric “bridged” form. ESI and FRET measurements suggest that all the studied molecules are good G-quadruplex ligands, both at telomeres and on G-quadruplex forming sequences of oncogene promoters. The dimeric compound and the three-side chain xanthone derivative have been shown to represent the best compounds emerging from the different series of ligands presented here, having also high selectivity for G-quadruplex structures with respect to duplex DNA. Molecular modeling simulations are in broad agreement with the experimental data.
B.S.A.Andrews; B.Sreenivas Rao; Som Shankar Dubey; B.Venkata Kiran
2010-01-01
Inspite of the beautiful red coloured oxidized product of O-anisidine, the studies on its application in analytical techniques are scanty. So, authors have taken up the investigation on the utility of O-anisidine as a new Analytical reagent in the bromatometric-Indicator reaction. The detailed reaction on the potassium bromate and OAnisidine has enabled the authors to utilize O-Anisidine in titration of Ascorbic Acid and Isonicitonic Acid Hydrazide. Suitable conditions has been established wi...
Morpurgo, Simone
2007-01-01
The principles of symmetry and group theory are applied to the zero-order wavefunctions associated with the strong-field t[subscript 2g][superscript 2] configuration and their symmetry-adapted linear combinations (SALC) associated with the generated energy terms are derived. This approach will enable students to better understand the use of…
Wang, Chuanxian; Qu, Li; Liu, Xia; Zhao, Chaomin; Zhao, Fengjuan; Huang, Fuzhen; Zhu, Zhenou; Han, Chao
2017-02-01
An analytical method has been developed for the detection of a metabolite of nifursol, 3,5-dinitrosalicylic acid hydrazide, in foodstuffs of animal origin (chicken liver, pork liver, lobster, shrimp, eel, sausage, and honey). The method combines liquid chromatography and tandem mass spectrometry with liquid-liquid extraction. Samples were hydrolyzed with hydrochloric acid and derivatized with 2-nitrobenzaldehyde at 37°C for 16 h. The solutions of derivatives were adjusted to pH 7.0-7.5, and the metabolite was extracted with ethyl acetate. 3,5-Dinitrosalicylic acid hydrazide determination was performed in the negative electrospray ionization method. Both isotope-labeled internal standard and matrix-matched calibration solutions were used to correct the matrix effects. Limits of quantification were 0.5 μg/kg for all samples. The average recoveries, measured at three concentration levels (0.5, 2.0, and 10 μg/kg) were in the range of 75.8-108.4% with relative standard deviations below 9.8%. The developed method exhibits a high sensitivity and selectivity for the routine determination and confirmation of the presence of a metabolite of nifursol in foodstuffs of animal origin. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Alvarez-Moya Carlos; Santerre-Lucas Anne; Zúñiga-González Guillermo; Torres-Bugarín Olivia; Padilla-Camberos Eduardo; Feria-Velasco Alfredo
2001-01-01
Objective. To assess the genotoxic activity of N-nitroso diethylamine (NDEA), maleic hydrazide (MH), and ethyl methane sulfonate (EMS) using two systems: the comet assay on nuclei from Tradescantia, and the pink mutation test on Tradescantia staminal hairs (clone 4430). Material and Methods. Tradescantia cups was obtained from Laboratorio de Citogenética y Mutagénesis del Centro de Ciencias de la Atmósfera de la Universidad Nacional Autónoma de México and treated with: N-nitroso diethylamine ...
Directory of Open Access Journals (Sweden)
Chengzhang Wang
2017-12-01
Full Text Available Gallnut water extract (GWE enriches 80~90% of gallnut tannic acid (TA. In order to study the biodegradation of GWE into gallic acid (GA, the LHS-1 strain, a variant of Aspergillus niger, was chosen to determine the optimal degradation parameters for maximum production of GA by the response surface method. Pyrolysis–gas chromatography–mass spectrometry (Py-GC/MS was first applied to appraise benzene ring derivatives of fermented GWE (FGWE pyrolysis by comparison with the pyrolytic products of a tannic acid standard sample (TAS and GWE. The results showed that optimum conditions were at 31 °C and pH of 5, with a 50-h incubation period and 0.1 g·L−1 of TA as substrate. The maximum yields of GA and tannase were 63~65 mg·mL−1 and 1.17 U·mL−1, respectively. Over 20 kinds of compounds were identified as linear hydrocarbons and benzene ring derivatives based on GA and glucose. The key benzene ring derivatives were 3,4,5-trimethoxybenzoic acid methyl ester, 3-methoxy-1,2-benzenediol, and 4-hydroxy-3,5-dimethoxy-benzoic acid hydrazide.
Wang, Chengzhang; Li, Wenjun
2017-12-20
Gallnut water extract (GWE) enriches 80~90% of gallnut tannic acid (TA). In order to study the biodegradation of GWE into gallic acid (GA), the LHS-1 strain, a variant of Aspergillus niger , was chosen to determine the optimal degradation parameters for maximum production of GA by the response surface method. Pyrolysis-gas chromatography-mass spectrometry (Py-GC/MS) was first applied to appraise benzene ring derivatives of fermented GWE (FGWE) pyrolysis by comparison with the pyrolytic products of a tannic acid standard sample (TAS) and GWE. The results showed that optimum conditions were at 31 °C and pH of 5, with a 50-h incubation period and 0.1 g·L -1 of TA as substrate. The maximum yields of GA and tannase were 63~65 mg·mL -1 and 1.17 U·mL -1 , respectively. Over 20 kinds of compounds were identified as linear hydrocarbons and benzene ring derivatives based on GA and glucose. The key benzene ring derivatives were 3,4,5-trimethoxybenzoic acid methyl ester, 3-methoxy-1,2-benzenediol, and 4-hydroxy-3,5-dimethoxy-benzoic acid hydrazide.
A quasi-parafermionic realization of G2 and Uq(G2)
International Nuclear Information System (INIS)
Frappat, L.
1991-09-01
A construction of the exceptional Lie algebra G 2 and of the corresponding quantum algebra U q (G 2 ) is presented, using quasi-parafermionic creation and annihilation operators and their quantum analogue. As a by-product, a new realization of U q (A 2 ) is found. (author) 7 refs
The MAP, M/G1,G2/1 queue with preemptive priority
Directory of Open Access Journals (Sweden)
Bong Dae Choi
1997-01-01
Full Text Available We consider the MAP, M/G1,G2/1 queue with preemptive resume priority, where low priority customers arrive to the system according to a Markovian arrival process (MAP and high priority customers according to a Poisson process. The service time density function of low (respectively: high priority customers is g1(x (respectively: g2(x. We use the supplementary variable method with Extended Laplace Transforms to obtain the joint transform of the number of customers in each priority queue, as well as the remaining service time for the customer in service in the steady state. We also derive the probability generating function for the number of customers of low (respectively, high priority in the system just after the service completion epochs for customers of low (respectively, high priority.
A Selective G-Quadruplex DNA-Stabilizing Ligand Based on a Cyclic Naphthalene Diimide Derivative
Directory of Open Access Journals (Sweden)
Md. Monirul Islam
2015-06-01
Full Text Available A cyclic naphthalene diimide (cyclic NDI, 1, carrying a benzene moiety as linker chain, was synthesized and its interaction with G-quadruplex DNAs of a-core and a-coreTT as a human telomeric DNA, c-kit and c-myc as DNA sequence at promoter region, or thrombin-binding aptamer (TBA studied based on UV-VIS and circular dichroism (CD spectroscopic techniques, thermal melting temperature measurement, and FRET-melting assay. The circular dichroism spectra showed that 1 induced the formation of different types of G-quadruplex DNA structure. Compound 1 bound to these G-quadruplexes with affinities in the range of 106–107 M−1 order and a 2:1 stoichiometry. Compound 1 showed 270-fold higher selectivity for a-core than dsDNA with a preferable a-core binding than a-coreTT, c-kit, c-myc and TBA in the presence of K+, which is supported by thermal melting studies. The FRET-melting assay also showed that 1 bound preferentially to human telomeric DNA. Compound 1 showed potent inhibition against telomerase activity with an IC50 value of 0.9 μM and preferable binding to G-quadruplexes DNA than our previously published cyclic NDI derivative 3 carrying a benzene moiety as longer linker chain.
Incorporation of fluconazole in copolymer PMMA-g-PEG derivatives
International Nuclear Information System (INIS)
Silveira, B.M.; Santos, V.M.R. dos; Novack, K.M.; Lopes, S.A.
2014-01-01
The graft copolymer PMMA-g-PEG went through chemical transformations in its chain through acetylation, halogenation, methylation and esterification followed by hydrolysis reactions. Subsequently, the copolymer PMMA-g-PEG derivatives passed through the process of emulsification and incorporation of the drug fluconazole. Derivatives copolymers were characterized by infrared spectroscopy (FTIR), X-ray diffraction (XRD) and scanning electron microscopy (SEM) after incorporation in order to evaluate their effectiveness. The efficiency of incorporation was observed and it was also verified that the complexity of polymer chain influence in the incorporated fluconazole content. (author)
Directory of Open Access Journals (Sweden)
Dinesh R. Panchasara
2009-01-01
Full Text Available Perimidine-1-acetic acid hydrazide (1 undergoes facile condensation with aromatic aldehydes to afford the corresponding azomethine (i.e. Schiff base derivatives (2a-h in good yield. Cyclocondensation of compounds (2a-h with chloro acetyl chloride affords 3-chloro-1-(4-perimidine methylcarbonylamino-4-phenyl-azetidin-2-ones (3a-h. The structures of these compounds were established on the basis of analytical and spectral data. The newly synthesized compounds were evaluated for their antibacterial and antifungal activities.
Directory of Open Access Journals (Sweden)
Shamsuzzaman
2015-07-01
Full Text Available In the present study steroidal derivatives, 3β-[5′-mercapto-1′,3′,4′-oxadiazole-2-yl]methoxy cholest-5-ene 2, 3β-[2′,5′-dimethylpyrrole-1-yl]aminocarbonylmethoxycholest-5-ene 3 and 3β-[3′,5′-dimethyl pyrazole-1-yl]carbonylmethoxycholest-5-ene 4 have been synthesized from cholest-5-en-3β-O-acetyl hydrazide 1 using CS2/KOH, acetonyl acetone and acetyl acetone, respectively as reagents and are characterized by IR, 1H NMR,13C NMR, MS and elemental analysis. Compounds 2–4 were also evaluated for anticancer activity against human leukemia cell line (HL-60 by MTT assay and compound 4 displayed the promising behavior by showing better anticancer activity.
Directory of Open Access Journals (Sweden)
Li-Na Zhu
Full Text Available The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl-21H,23H-porphyrin (TMPyP4, interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinylethoxy]phenyl} porphyrin (TMPipEOPP, with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.
Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming
2012-01-01
The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.
Chen, Yu; Wang, Yingying; Chen, Jinjin; Zhang, Tianzhen; Zhou, Baoliang
2015-01-01
Gossypium herbaceum, a cultivated diploid cotton species (2n = 2x = 26, A1A1), has favorable traits such as excellent drought tolerance and resistance to sucking insects and leaf curl virus. G. australe, a wild diploid cotton species (2n = 2x = 26, G2G2), possesses numerous economically valuable characteristics such as delayed pigment gland morphogenesis (which is conducive to the production of seeds with very low levels of gossypol as a potential food source for humans and animals) and resistance to insects, wilt diseases and abiotic stress. Creating synthetic allotetraploid cotton from these two species would lay the foundation for simultaneously transferring favorable genes into cultivated tetraploid cotton. Here, we crossed G. herbaceum (as the maternal parent) with G. australe to produce an F1 interspecific hybrid and doubled its chromosome complement with colchicine, successfully generating a synthetic tetraploid. The obtained tetraploid was confirmed by morphology, cytology and molecular markers and then self-pollinated. The S1 seedlings derived from this tetraploid gradually became flavescent after emergence of the fifth true leaf, but they were rescued by grafting and produced S2 seeds. The rescued S1 plants were partially fertile due to the existence of univalents at Metaphase I of meiosis, leading to the formation of unbalanced, nonviable gametes lacking complete sets of chromosomes. The S2 plants grew well and no flavescence was observed, implying that interspecific incompatibility, to some extent, had been alleviated in the S2 generation. The synthetic allotetraploid will be quite useful for polyploidy evolutionary studies and as a bridge for transferring favorable genes from these two diploid species into Upland cotton through hybridization. PMID:25879660
Flavokawain derivative FLS induced G2/M arrest and apoptosis on breast cancer MCF-7 cell line
Directory of Open Access Journals (Sweden)
Ali NM
2016-06-01
Full Text Available Norlaily Mohd Ali,1 M Nadeem Akhtar,2 Huynh Ky,3 Kian Lam Lim,1 Nadiah Abu,4 Seema Zareen,2 Wan Yong Ho,5 Han Kiat Alan-Ong,1 Sheau Wei Tan,6 Noorjahan Banu Alitheen,4 Jamil bin Ismail,2 Swee Keong Yeap,6 Tunku Kamarul7 1Faculty of Medicine and Health Sciences, Universiti Tunku Abdul Rahman, Selangor, 2Department of Industrial Biotechnology, Faculty of Industrial Sciences & Technology, Universiti Malaysia Pahang, Pahang, Malaysia; 3Department of Agriculture Genetics and Breeding, College of Agriculture and Applied Biology, Cantho University, CanTho City, Vietnam; 4Department of Cell and Molecular Biology, Faculty of Biotechnology and Biomolecular Sciences, Universiti Putra Malaysia, 5School of Biomedical Sciences, The University of Nottingham Malaysia Campus, 6Institute of Bioscience, Universiti Putra Malaysia, Selangor, 7Tissue Engineering Group, National Orthopaedic Centre of Excellence for Research and Learning, Department of Orthopaedic Surgery, Faculty of Medicine, University Malaya, Kuala Lumpur, Malaysia Abstract: Known as naturally occurring biologically active compounds, flavokawain A and B are the leading chalcones that possess anticancer properties. Another flavokawain derivative, (E-1-(2'-Hydroxy-4',6'-dimethoxyphenyl-3-(4-methylthiophenylprop-2-ene-1-one (FLS was characterized with 1H-nuclear magnetic resonance, electron-impact mas spectrometry, infrared spectroscopy, and ultraviolet (1H NMR, EI-MS, IR, and UV spectroscopic techniques. FLS cytotoxic efficacy against human cancer cells (MCF-7, MDA-MB-231, and MCF-10A resulted in the reduction of IC50 values in a time- and dose-dependent mode with high specificity on MCF-7 (IC50 of 36 µM at 48 hours against normal breast cell MCF-10A (no IC50 detected up to 180 µM at 72 hours. Light, scanning electron, and fluorescent microscopic analysis of MCF-7 cell treated with 36 µM of FLS displayed cell shrinkage, apoptotic body, and DNA fragmentation. Additionally, induction of G2/M cell
Toric geometry of G2-manifolds
DEFF Research Database (Denmark)
Madsen, Thomas Bruun; Swann, Andrew Francis
We consider G2-manifolds with an effective torus action that is multi-Hamiltonian for one or more of the defining forms. The case of T3-actions is found to be distinguished. For such actions multi-Hamiltonian with respect to both the three- and four-form, we derive a Gibbons-Hawking type ansatz...
Zhang, Jian; Zhao, Lei; Zhu, Chun; Wu, Zengxue; Zhang, Guoping; Gan, Xiuhai; Liu, Dengyue; Pan, Jianke; Hu, Deyu; Song, Baoan
2017-06-14
A series of vanillin derivatives incorporating a bis(2-hydroxyethyl)dithioacetal moiety was designed and synthesized via a facile method. A plausible reaction pathway was proposed and verified by computational studies. Bioassay results demonstrated that target compounds possessed good to excellent activities against potato virus Y (PVY) and cucumber mosaic virus (CMV), of which, compound 6f incorporating a bis(2-hydroxyethyl)dithioacetal moiety, exhibited the best curative and protection activities against PVY and CMV in vivo, with 50% effective concentration values of 217.6, 205.7 μg/mL and 206.3, 186.2 μg/mL, respectively, better than those of ribavirin (848.0, 808.1 μg/mL and 858.2, 766.5 μg/mL, respectively), dufulin (462.6, 454.8 μg/mL and 471.2, 465.4 μg/mL, respectively), and ningnanmycin (440.5, 425.3 μg/mL and 426.1, 405.3 μg/mL, respectively). Current studies provide support for the application of vanillin derivatives incorporating bis(2-hydroxyethyl)dithioacetal as new antiviral agents.
Directory of Open Access Journals (Sweden)
Huai-Xin Cao
2009-01-01
Full Text Available We discuss the superstability of generalized module left derivations and generalized module derivations on a Banach module. Let 𝒜 be a Banach algebra and X a Banach 𝒜-module, f:X→X and g:𝒜→𝒜. The mappings Δf,g1, Δf,g2, Δf,g3, and Δf,g4 are defined and it is proved that if ∥Δf,g1(x,y,z,w∥ (resp., ∥Δf,g3(x,y,z,w,α,β∥ is dominated by φ(x,y,z,w, then f is a generalized (resp., linear module-𝒜 left derivation and g is a (resp., linear module-X left derivation. It is also shown that if ∥Δf,g2(x,y,z,w∥ (resp., ∥Δf,g4(x,y,z,w,α,β∥ is dominated by φ(x,y,z,w, then f is a generalized (resp., linear module-𝒜 derivation and g is a (resp., linear module-X derivation.
Aouad, Mohamed Reda; Messali, Mouslim; Rezki, Nadjet; Ali, Adeeb Al-Sheikh; Lesimple, Alain
2015-01-01
(1,4,5-Triphenylimidazol-2-yl-thio)butyric acid hydrazide (3) was obtained via alkylation of 1,4,5-triphenylimidazol-2- thiol (1) with ethylbromobutyrate, followed by addition of hydrazine hydrate. Treatment of acid hydrazide 3 with carbon disulfide
Synthesis and biological evaluation of new pyrazolo[3,4-d]pyrimidine derivatives
Directory of Open Access Journals (Sweden)
Asma Agrebi
2014-05-01
Full Text Available Several new pyrazolopyrimidine compounds were achieved from aminocyanopyarazole 1. The starting material 1 was initially coupled with orthoester at refluxed with various primary amines, ammonia, hydrazines and hydroxylamine to furnish a series of pyrazolo[3,4-d]pyrimidines. The reaction of imidate 2a-b with hydrazide derivatives led to the formation of pyrazolo[3,4-d][1,2,4]triazolo[4,3-c]pyrimidines. Some of the synthesized compounds 3a and 4c were evaluated for their anti-inflammatory, antipyretic and nociceptive activities. We start by studing the toxicity of these two molecules by measuring the corresponding DL50. The DL50 of 3a and 4c are estimated to 1333.2mg / kg and 1593.5mg / kg respectively. Pharmacological evaluation showed that compounds 3a and 4c at doses (5.5-22.2 mg / Kg, i.p exhibited anti-inflammatory activities compared to Ibuprofen (150 mg / Kg, i.p, used as a refer ence drug. Further, our study showed that the injection of derived pyrazolopyrimidines on hyperthermic animal leads to a decrease in temperature after 1 hours of treatment compared to paracetamol used as reference. In addition, the injection of derived pyrazolopyrimidines at different doses contains a potent nociceptive activity. This effect is dose-dependent compared to aspirin.
Benzo[g]quinazolin-based scaffold derivatives as dual EGFR/HER2 inhibitors.
Ghorab, Mostafa M; Alsaid, Mansour S; Soliman, Aiten M; Al-Mishari, Abdullah A
2018-12-01
Targeting EGFR has proven to be beneficial in the treatment of several types of solid tumours. So, a series of novel 2-(4-oxo-3-(4-sulfamoylphenyl)-3,4-dihydrobenzo[g]quinazolin-2-ylthio)-N-substituted acetamide 5-19 were synthesised from the starting material 4-(2-mercapto-4-oxobenzo[g]quinazolin-3(4H)-yl) benzenesulfonamide 4, to be evaluated as dual EGFR/HER2 inhibitors. The target compounds 5-19, were screened for their cytotoxic activity against A549 lung cancer cell line. The percentage inhibition of EGFR enzyme was measured and compared with erlotinib as the reference drug. Compounds 6, 8, 10, and 16 showed excellent EGFR inhibitory activity and were further selected for screening as dual EGFR/HER2 inhibitors. The four selected compounds showed IC 50 ranging from 0.009 to 0.026 µM for EGFR and 0.021 to 0.069 µM for the HER2 enzyme. Compound 8 was found to be the most potent in this study with IC 50 0.009 and 0.021 µM for EGFR and HER2, respectively.
Sekine, Mitsuo; Kadokura, Michinori; Satoh, Takahiko; Seio, Kohji; Wada, Takeshi; Fischer, Utz; Sumpter, Vicki; Lührmann, Reinhard
1996-06-26
The 5'-terminal TMG-capped triribonucleotide, m(3)(2,2,7)G(5)(')pppAmpUmpA, has been synthesized by condensation of an appropriately protected triribonucleotide derivative of ppAmpUmpA with a new TMG-capping reagent. During this total synthesis, it was found that the regioselective 2'-O-methylation of 3',5'-O-(1,1,3,3-tetraisopropyldisiloxane-1,3-diyl)-N-(4-monomethoxytrityl)adenosine was achieved by use of MeI/Ag(2)O without affecting the base moiety. A new route to 2-N,2-N-dimethylguanosine from guanosine via a three-step reaction has also been developed by reductive methylation using paraformaldehyde and sodium cyanoborohydride. These key intermediates were used as starting materials for the construction of a fully protected derivative of pAmpUmpA and a TMG-capping reagent of Im-pm(3)(2,2,7)G. The target TMG-capped tetramer, m(3)(2,2,7)G(5)(')pppAmpUmpA, was synthesized by condensation of a partially protected triribonucleotide 5'-terminal diphosphate species, ppA(MMTr)mpUmpA, with Im-pm(3)(2,2,7)G followed by treatment with 80% acetic acid. The structure of m(3)(2,2,7)G(5)(')pppAmpUmpA was characterized by (1)H and (31)P NMR spectroscopy as well as enzymatic assay using snake venom phosphodiesterase, calf intestinal phosphatase, and nuclease P1.
Alvarez-Moya, C; Santerre-Lucas, A; Zúñiga-González, G; Torres-Bugarín, O; Padilla-Camberos, E; Feria-Velasco, A
2001-01-01
To assess the genotoxic activity of N-nitroso diethylamine (NDEA), maleic hydrazide (MH), and ethyl methane sulfonate (EMS) using two systems: the comet assay on nuclei from Tradescantia, and the pink mutation test on Tradescantia staminal hairs (clone 4430). Tradescantia cups was obtained from Laboratorio de Citogenética y Mutagénesis del Centro de Ciencias de la Atmósfera de la Universidad Nacional Autónoma de México and treated with: N-nitroso diethylamine (NDEA) at 1, 5, 10 mM, maleic hydrazide (MH) at 1, 5, 10 mM and ethyl methane sulfonate (EMS) at 15, 30 and 45 mM; and used in both pink mutation assay and comet assay using cellular nuclei from Tradescantia staminal hairs. The observation of staminal hair was realized along eight days (6-14) after treatment), flowers produced day 14 after treatment were utilized done according to Underbrink. In previous reports on plants, were comet assay was used, breaking cellular wall and separating by centrifugation gradient are necessary. Here, nuclei from staminal hairs were obtained by squashing the cells (is not necessary to utilize to break special procedure cellular wall), collected using a nylon mesh of 80 Mm and next the comet assay was applied. Student's T test was the statistical test used for analyzing the comet assay data. Both assays showed a great sensitivity to the studied mutagens. A relationship between the dose-pink event and the dose-tail length was evident. Even though the Tradescantia mutation assay is a sensitive test with MH and EMS, low doses of NDEA were not able to induce a significant increase in the pink event frequencies; however, the comet assay was able to detect the mutagenic effect of NDEA at the same dose. Thus, it is clear that the comet assay is highly sensitive to the lowest dose of chemical mutagens. The comet assay on nuclei from Tradescantia staminal hairs is a useful tool to monitor genotoxic agents; it is simple, highly sensitive, and faster than the pink mutation test.
High solute rejecting membranes for reverse osmosis: Polyetheramide hydrazide
International Nuclear Information System (INIS)
Bindal, R.C.; Ramachandhran, V.; Misra, B.M.; Ramani, M.P.S.
1991-01-01
Synthesis of benzhydrazide polymers and determination of reverse osmosis properties of their membranes were reported earlier. Their performance was not adequate for seawater desalination or for high radioactive decontamination factors (DF). The same hydrazide polymers modified by incorporation of additional monomers with ether linkages were synthesized by low temperature polycondensation of freshly prepared m-amino benzhydrazide, p-amino benzhydrazide, and 4,4'-diamino diphenyl ether, with isophthaloyl chloride and terephthaloyl chloride in dimethyl acetamide solvent. A series of film-forming polymers prepared by altering the molar ratios of the reacting monomers were characterized in terms of percent moisture regain, inherent viscosity, solubility parameters, and interfacial sorption characteristics. Asymmetric membranes prepared from these polymer samples were characterized in terms of the pure water permeability constant and the solute transport parameter, and were tested for their reverse osmosis performance. An optimum mole ratio of reaching monomers has been identified for the synthesis of polymer and the resulting membrane offered the best performance for reverse osmosis (salt rejection as high as 99.4% for 3.5% sodium chloride solution). The incorporation of aromatic ether linkages in the polyamide benzhydrazide polymeric chains appears to alter the polar and nonpolar character of the bulk polymer, and also the membrane solution interface characteristics, resulting in enhanced solute separation. These membranes appear to be potential candidates for single-stage seawater desalination and also for a variety of industrial effluent treatment applications for significantly high DF radioactive effluent treatment
Plasminogen activator inhibitor-1 4G/5G polymorphism is associated with type 2 diabetes risk
Zhao, Luqian; Huang, Ping
2013-01-01
A number of studies were performed to assess the association between plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism and susceptibility to type 2 diabetes (T2DM). However, the results were inconsistent and inconclusive. In the present study, the possible association was investigated by a meta-analysis. Eligible articles were identified for the period up to June 2013. Pooled odds ratios (OR) with 95% confidence intervals (CI) were appropriately derived from random-effects models or fixed-effects models. Fourteen case-control studies with a total of 2487 cases and 3538 controls were eligible. In recessive model, PAI-1 4G/5G polymorphism was associated with T2DM risk (OR = 1.23; 95% CI 1.07-1.41; P = 0.004). In the subgroup analysis by ethnicity, a significant association was found among Asians (OR = 1.27; 95% CI 1.08-1.51; P = 0.005). This meta-analysis suggested that PAI-1 4G/5G polymorphism may be associated with T2DM development. PMID:24040470
Synthesis and biological activity of pyridazine amides, hydrazones and hydrazides.
Buysse, Ann M; Yap, Maurice Ch; Hunter, Ricky; Babcock, Jonathan; Huang, Xinpei
2017-04-01
Optimization studies on compounds initially designed to be herbicides led to the discovery of a series of [6-(3-pyridyl)pyridazin-3-yl]amides exhibiting aphicidal properties. Systematic modifications of the amide moiety as well as the pyridine and pyridazine rings were carried out to determine if these changes could improve insecticidal potency. Structure-activity relationship (SAR) studies showed that changes to the pyridine and pyridazine rings generally resulted in a significant loss of insecticidal potency against green peach aphids [Myzus persicae (Sulzer)] and cotton aphids [(Aphis gossypii (Glover)]. However, replacement of the amide moiety with hydrazines, hydrazones, or hydrazides appeared to be tolerated, with small aliphatic substituents being especially potent. A series of aphicidal [6-(3-pyridyl)pyridazin-3-yl]amides were discovered as a result of random screening of compounds that were intially investigated as herbicides. Follow-up studies of the structure-activity relationship of these [6-(3-pyridyl)pyridazin-3-yl]amides showed that biosteric replacement of the amide moiety was widely tolerated suggesting that further opportunities for exploitation may exist for this new area of insecticidal chemistry. Insecticidal efficacy from the original hit, compound 1, to the efficacy of compound 14 produced greater than 10-fold potency improvement against Aphis gossypii and greater than 14-fold potency improvement against Myzus persicae. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Directory of Open Access Journals (Sweden)
HJ Sung
2008-04-01
Full Text Available Synthetic biomaterials can be used as instructive biological milieus to guide cellular behaviour and function. To further realize this application, we synthesized a series of structurally similar hydrogels and tested their ability to modulate angiogenesis. Hydrogels were synthesized from poly(DTE-co-x% DT carbonate crosslinked by y% poly(ethylene glycol (PEG. Hydrogel desaminotyrosyl tyrosine (DT contents (x% ranged from 10-100%, and crosslink densities (y% PEG-crosslinker ranged from 5-80%. The hydrogels were fashioned into porous scaffolds with highly interconnected macro- and micro-pore (>100 and <10 mm in diameter, respectively architecture using poly(DTE-co-10%DT carbonate crosslinked with 8% PEG. Under physiological conditions (in vitro, the hydrogels degraded into three major products: desaminotyrosyl-tyrosine ethyl ester (DTE, desaminotyrosyl tyrosine (DT, and poly(ethylene glycol-di-DT-hydrazide (PEG-di-DT hydrazide. Increasing either DT content or crosslink density brought quickened degradation. Because DT and DTE, two of the three major degradation products, have not demonstrated any noticeable cytotoxicity or angiogenic effect in previous studies, we measured the cytotoxicity of PEG-di-DT hydrazide, the third major degradation product. We found that PEG-di-DT hydrazide only displayed significant cytotoxicity at the high concentration of 100 mg/mL. Interestingly, PEG-di-DT hydrazide and its further degradation product PEG-dihydrazide stimulated in vitro endothelial cell migration and tubulogenesis, which is comparable to results found with FGF-beta treatment. Subcutaneous implantation of the PEG-crosslinked poly(DTE-co-10%DT carbonate scaffolds into the backs of rats elicited greater tissue growth over time and superior vascularization than poly(DTE carbonate implantation. These results show that this new class of biomaterials has a strong potential to modulate angiogenesis.
Yalçın, Ergin; Duyar, Halil; Ihmels, Heiko; Seferoğlu, Zeynel
2018-05-01
An improved microwave-induced synthesis of five ethidium derivatives (Ethidium derivatives, 2a-d) is presented. As the derivatives 2a-d have been proposed previously to be telomerase inhibitors, the binding interactions of these ethidium derivatives with G-quadruplex DNA were evaluated by means of photometric and fluorimetric titration, thermal DNA denaturation, CD and 1H NMR spectroscopy. In particular, the compound bearing 3,8-bis(pyrrolidin-1-yl)propanamido substituent 2a exhibits high selectivity for G-quadruplex DNA relative to duplex DNA.
Free radical generation from an aniline derivative in HepG2 cells: a possible captodative effect.
Horinouchi, Yuya; Summers, Fiona A; Ehrenshaft, Marilyn; Mason, Ronald P
2015-01-01
Xenobiotic metabolism can induce the generation of protein radicals, which are believed to play an important role in the toxicity of chemicals and drugs. It is therefore important to identify chemical structures capable of inducing macromolecular free radical formation in living cells. In this study, we evaluated the ability of four structurally related environmental chemicals, aniline, nitrosobenzene, N,N-dimethylaniline, and N,N-dimethyl-4-nitrosoaniline (DMNA), to induce free radicals and cellular damage in the hepatoma cell line HepG2. Cytotoxicity was assessed using lactate dehydrogenase assays, and morphological changes were observed using phase contrast microscopy. Protein free radicals were detected by immuno-spin trapping using in-cell western experiments and confocal microscopy to determine the subcellular locale of free radical generation. DMNA induced free radical generation, lactate dehydrogenase release, and morphological changes in HepG2 cells, whereas aniline, nitrosobenzene, N,N-dimethylaniline did not. Confocal microscopy showed that DMNA induced free radical generation mainly in the cytosol. Preincubation of HepG2 cells with N-acetylcysteine and 2,2'-dipyridyl significantly prevented free radical generation on subsequent incubation with DMNA, whereas preincubation with apocynin and dimethyl sulfoxide had no effect. These results suggest that DMNA is metabolized to reactive free radicals capable of generating protein radicals which may play a critical role in DMNA toxicity. We propose that the captodative effect, the combined action of the electron-releasing dimethylamine substituent, and the electron-withdrawing nitroso substituent, leads to a thermodynamically stabilized radical, facilitating enhanced protein radical formation by DMNA. Copyright © 2014 Elsevier Inc. All rights reserved.
Cunha de Padua, Monique Meyenberg; Suter Correia Cadena, Silvia Maria; de Oliveira Petkowicz, Carmen Lucia; Martinez, Glaucia Regina; Rodrigues Noleto, Guilhermina
2017-08-01
This study evaluated the effects of native galactomannan from Schizolobium amazonicum seeds and its sulfated forms on certain metabolic parameters of HepG2 cells. Aqueous extraction from S. amazonicum seeds furnished galactomannan with 3.2:1 Man:Gal ratio (SAGM) and molar mass of 4.34×10 5 g/mol. The SAGM fraction was subjected to sulfation using chlorosulfonic acid to obtain SAGMS1 and SAGMS2 with DS of 0.4 and 0.6, respectively. Cytotoxicity of SAGM, SAGMS1, and SAGMS2 was evaluated in human hepatocellular carcinoma cells (HepG2). After 72h, SAGM decreased the viability of HepG2 cells by 50% at 250μg/mL, while SAGMS1 reduced it by 30% at the same concentration. SAGM, SAGMS1, and SAGMS2 promoted a reduction in oxygen consumption and an increase in lactate production in non-permeabilized HepG2 cells after 72h of treatment. These results suggest that SAGM, SAGMS1, and SAGMS2 could be recognized by HepG2 cells and might trigger alterations that impair its survival. These effects could be implicated in the modification of the oxidative phosphorylation process in HepG2 cells and activation of the glycolytic pathway. Copyright © 2017 Elsevier B.V. All rights reserved.
Structure of human ubiquitin-conjugating enzyme E2 G2 (UBE2G2/UBC7)
International Nuclear Information System (INIS)
Arai, Ryoichi; Yoshikawa, Seiko; Murayama, Kazutaka; Imai, Yuzuru; Takahashi, Ryosuke; Shirouzu, Mikako; Yokoyama, Shigeyuki
2006-01-01
The crystal structure of human UBE2G2/UBC7 was solved at 2.56 Å resolution. The superimposition of UBE2G2 on UbcH7 in a c-Cbl–UbcH7–ZAP70 ternary complex suggested that the two loop regions of UBE2G2 interact with the RING domain in a similar way as UbcH7. The human ubiquitin-conjugating enzyme E2 G2 (UBE2G2/UBC7) is involved in protein degradation, including a process known as endoplasmic reticulum-associated degradation (ERAD). The crystal structure of human UBE2G2/UBC7 was solved at 2.56 Å resolution. The UBE2G2 structure comprises a single domain consisting of an antiparallel β-sheet with four strands, five α-helices and two 3 10 -helices. Structural comparison of human UBE2G2 with yeast Ubc7 indicated that the overall structures are similar except for the long loop region and the C-terminal helix. Superimposition of UBE2G2 on UbcH7 in a c-Cbl–UbcH7–ZAP70 ternary complex suggested that the two loop regions of UBE2G2 interact with the RING domain in a similar way to UbcH7. In addition, the extra loop region of UBE2G2 may interact with the RING domain or its neighbouring region and may be involved in the binding specificity and stability
A study of the excited 1Σ+sub(g) states in Na2
International Nuclear Information System (INIS)
Taylor, A.J.; Jones, K.M.; Schawlow, A.L.
1981-01-01
Using the technique of two-step polarization labeling spectroscopy seven excited 1 Σ + sub(g) states in Na 2 have been found. Molecular constants are derived from a Dunham expansion. Tentative assignments are made to the 3p + 3p, 3s + nd and 3s + ns atomic asymptotes. (orig.)
The Use of Maleic Hydrazide for Effective Hybridization of Setaria viridis.
Directory of Open Access Journals (Sweden)
Govinda Rizal
Full Text Available An efficient method for crossing green foxtail (Setaria viridis is currently lacking. S. viridis is considered to be the new model plant for the study of C4 system in monocots and so an effective crossing protocol is urgently needed. S. viridis is a small grass with C4-NADP (ME type of photosynthesis and has the advantage of having small genome of about 515 Mb, small plant stature, short life cycle, multiple tillers, and profuse seed set, and hence is an ideal model species for research. The objectives of this project were to develop efficient methods of emasculation and pollination, and to speed up generation advancement. We assessed the response of S. viridis flowers to hot water treatment (48°C and to different concentrations of gibberellic acid, abscisic acid, maleic hydrazide (MH, and kinetin. We found that 500 μM of MH was effective in the emasculation of S. viridis, whilst still retaining the receptivity of the stigma to pollination. We also report effective ways to accelerate the breeding cycle of S. viridis for research through the germination of mature as well as immature seeds in optimized culture media. We believe these findings will be of great interest to researchers using Setaria.
Directory of Open Access Journals (Sweden)
Stefania-Felicia Barbuceanu
2014-06-01
Full Text Available In the present investigation, new hydrazinecarbothioamides 4–6 were synthesized by reaction of 4-(4-X-phenylsulfonylbenzoic acids hydrazides (X= H, Cl, Br 1–3 with 2,4-difluorophenyl isothiocyanate and further these were treated with sodium hydroxide to obtain 1,2,4-triazole-3-thione derivatives 7–9. The reaction of 7–9 with α-halogenated ketones, in basic media, afforded new S-alkylated derivatives 10–15. The structures of the synthesized compounds have been established on the basis of 1H-NMR, 13C-NMR, IR, mass spectral studies and elemental analysis. The antioxidant activity of all compounds has been screened. Hydrazinecarbothioamides 4–6 showed excellent antioxidant activity and 1,2,4-triazole-3-thiones 7–9 showed good antioxidant activity using the DPPH method.
BPS states in N = 2 supersymmetric G2 and F4 models
Ahl Laamara, R.; Mellal, O.; Saidi, E. H.
2017-07-01
In BPS quiver theory of N = 2 supersymmetric pure gauge models with gauge invariance G, primitive BPS quivers Q0G are of two types: Q0ADE and Q0BCFG. In this study, we first show that Q0ADE have outer-automorphism symmetries inherited from the outer-automorphisms of the Dynkin diagrams of ADE Lie algebras. Then, we extend the usual folding operation of Dynkin diagrams ADE → BCFG to obtain the two following things: (i) relate Q0BCFG quivers and their mutations to the Q0ADE ones and their mutations; and (ii) link the BPS chambers of the N = 2ADE theories with the corresponding BCFG ones. As an illustration of this construction, we derive the BPS and anti-BPS states of the strong chambers QstgG2 and QstgF4 of the 4d N = 2 pure G2 and F4 gauge models.
Experimental Determination of Third Derivative of the Gibbs Free Energy, G II
DEFF Research Database (Denmark)
Koga, Yoshikata; Westh, Peter; Inaba, Akira
2010-01-01
We have been evaluating third derivative quantities of the Gibbs free energy, G, by graphically differentiating the second derivatives that are accessible experimentally, and demonstrated their power in elucidating the mixing schemes in aqueous solutions. Here we determine directly one of the third...
Karman, Tijs; van der Avoird, Ad; Groenenboom, Gerrit C
2017-08-28
We compute four-dimensional diabatic potential energy surfaces and transition dipole moment surfaces of O 2 -O 2 , relevant for the theoretical description of collision-induced absorption in the forbidden X 3 Σ g - → a 1 Δ g and X 3 Σ g - → b 1 Σ g + bands at 7883 cm -1 and 13 122 cm -1 , respectively. We compute potentials at the multi-reference configuration interaction (MRCI) level and dipole surfaces at the MRCI and complete active space self-consistent field (CASSCF) levels of theory. Potentials and dipole surfaces are transformed to a diabatic basis using a recent multiple-property-based diabatization algorithm. We discuss the angular expansion of these surfaces, derive the symmetry constraints on the expansion coefficients, and present working equations for determining the expansion coefficients by numerical integration over the angles. We also present an interpolation scheme with exponential extrapolation to both short and large separations, which is used for representing the O 2 -O 2 distance dependence of the angular expansion coefficients. For the triplet ground state of the complex, the potential energy surface is in reasonable agreement with previous calculations, whereas global excited state potentials are reported here for the first time. The transition dipole moment surfaces are strongly dependent on the level of theory at which they are calculated, as is also shown here by benchmark calculations at high symmetry geometries. Therefore, ab initio calculations of the collision-induced absorption spectra cannot become quantitatively predictive unless more accurate transition dipole surfaces can be computed. This is left as an open question for method development in electronic structure theory. The calculated potential energy and transition dipole moment surfaces are employed in quantum dynamical calculations of collision-induced absorption spectra reported in Paper II [T. Karman et al., J. Chem. Phys. 147, 084307 (2017)].
A light-up probe targeting for Bcl-2 2345 G-quadruplex DNA with carbazole TO
Gu, Yingchun; Lin, Dayong; Tang, Yalin; Fei, Xuening; Wang, Cuihong; Zhang, Baolian; Zhou, Jianguo
2018-02-01
As its significant role, the selective recognition of G-quadruplex with specific structures and functions is important in biological and medicinal chemistry. Carbazole derivatives have been reported as a kind of fluorescent probe with many excellent optical properties. In the present study, the fluorescence of the dye (carbazole TO) increased almost 70 fold in the presence of bcl-2 2345 G4 compared to that alone in aqueous buffer condition with almost no fluorescence and 10-30 fold than those in the presence of other DNAs. The binding study results by activity inhibition of G4/Hemin peroxidase experiment, NMR titration and molecular docking simulation showed the high affinity and selectivity to bcl-2 2345 G4 arises from its end-stacking interaction with G-quartet. It is said that a facile approach with excellent sensitive, good selectivity and quick response for bcl-2 2345 G-quadruplex was developed and may be used for antitumor recognition or antitumor agents.
Diazaquinomycins E–G, Novel Diaza-Anthracene Analogs from a Marine-Derived Streptomyces sp.
Directory of Open Access Journals (Sweden)
Michael W. Mullowney
2014-06-01
Full Text Available As part of our program to identify novel secondary metabolites that target drug-resistant ovarian cancers, a screening of our aquatic-derived actinomycete fraction library against a cisplatin-resistant ovarian cancer cell line (OVCAR5 led to the isolation of novel diaza-anthracene antibiotic diazaquinomycin E (DAQE; 1, the isomeric mixture of diazaquinomycin F (DAQF; 2 and diazaquinomycin G (DAQG; 3, and known analog diazaquinomycin A (DAQA; 4. The structures of DAQF and DAQG were solved through deconvolution of X-Ray diffraction data of their corresponding co-crystal. DAQE and DAQA exhibited moderate LC50 values against OVCAR5 of 9.0 and 8.8 μM, respectively. At lethal concentrations of DAQA, evidence of DNA damage was observed via induction of apoptosis through cleaved-PARP. Herein, we will discuss the isolation, structure elucidation, and biological activity of these secondary metabolites.
Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins
International Nuclear Information System (INIS)
Tee, Thiam-Tsui; Cheah, Yew-Hoong; Meenakshii, Nallappan; Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie
2012-01-01
Highlights: ► We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. ► Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. ► Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. ► DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. ► DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X L expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.
Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins
Energy Technology Data Exchange (ETDEWEB)
Tee, Thiam-Tsui, E-mail: thiamtsu@yahoo.com [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Cheah, Yew-Hoong [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Bioassay Unit, Herbal Medicine Research Center, Institute for Medical Research, Jalan Pahang, Kuala Lumpur (Malaysia); Meenakshii, Nallappan [Biology Department, Faculty of Science, Universiti Putra Malaysia, 43400 Serdang, Selangor (Malaysia); Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)
2012-04-20
Highlights: Black-Right-Pointing-Pointer We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. Black-Right-Pointing-Pointer Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. Black-Right-Pointing-Pointer Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. Black-Right-Pointing-Pointer DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. Black-Right-Pointing-Pointer DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X{sub L} expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.
Energy Technology Data Exchange (ETDEWEB)
Silveira, B.M.; Santos, V.M.R. dos; Novack, K.M.; Lopes, S.A., E-mail: vmrebello@yahoo.com.br [Universidade Federal de Ouro Preto (UFOP), MG (Brazil)
2014-07-01
The graft copolymer PMMA-g-PEG went through chemical transformations in its chain through acetylation, halogenation, methylation and esterification followed by hydrolysis reactions. Subsequently, the copolymer PMMA-g-PEG derivatives passed through the process of emulsification and incorporation of the drug fluconazole. Derivatives copolymers were characterized by infrared spectroscopy (FTIR), X-ray diffraction (XRD) and scanning electron microscopy (SEM) after incorporation in order to evaluate their effectiveness. The efficiency of incorporation was observed and it was also verified that the complexity of polymer chain influence in the incorporated fluconazole content. (author)
G 2 reactor project; Projet de pile a double fin: G 2
Energy Technology Data Exchange (ETDEWEB)
Ailleret, [Electricite de France (EDF), Dir. General des Etudes de Recherches, 75 - Paris (France); Taranger, P; Yvon, J [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1955-07-01
The CEA actually constructs the G-2 reactor core working with natural uranium, which will use graphite as moderator, and gas under pressure as cooling fluid. This report presents the specificity of the new reactor: - the different elements of the reactor core, - the control and the security of the reactor, - the renewal of the fuel, - the biologic surrounding wall, - and the cooling circuit. (M.B.) [French] le Commissariat a l'Energie Atomique construit actuellement la pile G-2 a Uranium naturel, qui utilisera le graphite comme moderateur, et le gaz sous pression comme fluide de refroidissement. Ce rapport presente les specificite du nouveau reacteur: - les differents elements de la pile, - le controle et la securite du reacteur, - le renouvellement du combustible, - l'enceinte biologique, - et le circuit de refroidissement. (M.B.)
Usui, Daiki; Inaba, Satomi; Kamatari, Yuji O; Ishiguro, Naotaka; Oda, Masayuki
2017-09-02
The monoclonal antibody, G2, specifically binds to the immunogen peptide derived from the chicken prion protein, Pep18mer, and two chicken proteins derived peptides, Pep8 and Pep395; G2 binds with equal affinity to Pep18mer. The amino acid sequences of the three peptides are completely different, and so the recognition mechanism of G2 is unique and interesting. We generated a single-chain Fv (scFv) antibody of G2, and demonstrated its correct folding with an antigen binding function similar to intact G2 antibody. We also generated a Pro containing mutant of G2 scFv at residue 95 of the light chain, and analyzed its antigen binding using a surface plasmon biosensor. The mutant lost its binding ability to Pep18mer, but remained those to Pep8 and Pep395. The results clearly indicate residue 95 as being critical for multispecific antigen binding of G2 at the site generated from the junctional diversity introduced at the joints between the V and J gene segments. Copyright © 2017 Elsevier Inc. All rights reserved.
The G2 spinorial geometry of supersymmetric IIB backgrounds
International Nuclear Information System (INIS)
Gran, U; Gutowski, J; Papadopoulos, G
2006-01-01
We solve the Killing spinor equations of supersymmetric IIB backgrounds which admit one supersymmetry and the Killing spinor has stability subgroup G 2 in Spin(9, 1) x U(1). We find that such backgrounds admit a timelike Killing vector field and the geometric structure of the spacetime reduces from Spin(9, 1) x U(1) to G 2 . We determine the type of G 2 structure that the spacetime admits by computing the covariant derivatives of the spacetime forms associated with the Killing spinor bilinears. We also solve the Killing spinor equations of backgrounds with two supersymmetries and Spin(7) x R 8 -invariant spinors, and four supersymmetries with SU(4) x R 8 - and with G 2 -invariant spinors. We show that the Killing spinor equations factorize in two sets, one involving the geometry and the 5-form flux, and the other the 3-form flux and the scalars. In the Spin(7) x R 8 and SU(4) x R 8 cases, the spacetime admits a parallel null vector field and so the spacetime metric can be locally described in terms of Penrose coordinates adapted to the associated rotation free, null, geodesic congruence. The transverse space of the congruence is a Spin(7) and a SU(4) holonomy manifold, respectively. In the G 2 case, all the fluxes vanish and the spacetime is the product of a three-dimensional Minkowski space with a holonomy G 2 manifold
Hoang, Tuan K A; Webb, Michael I; Mai, Hung V; Hamaed, Ahmad; Walsby, Charles J; Trudeau, Michel; Antonelli, David M
2010-08-25
In this paper we demonstrate that the Kubas interaction, a nondissociative form of weak hydrogen chemisorption with binding enthalpies in the ideal 20-30 kJ/mol range for room-temperature hydrogen storage, can be exploited in the design of a new class of hydrogen storage materials which avoid the shortcomings of hydrides and physisorpion materials. This was accomplished through the synthesis of novel vanadium hydrazide gels that use low-coordinate V centers as the principal Kubas H(2) binding sites with only a negligible contribution from physisorption. Materials were synthesized at vanadium-to-hydrazine ratios of 4:3, 1:1, 1:1.5, and 1:2 and characterized by X-ray powder diffraction, X-ray photoelectron spectroscopy, nitrogen adsorption, elemental analysis, infrared spectroscopy, and electron paramagnetic resonance spectroscopy. The material with the highest capacity possesses an excess reversible storage of 4.04 wt % at 77 K and 85 bar, corresponding to a true volumetric adsorption of 80 kg H(2)/m(3) and an excess volumetric adsorption of 60.01 kg/m(3). These values are in the range of the ultimate U.S. Department of Energy goal for volumetric density (70 kg/m(3)) as well as the best physisorption material studied to date (49 kg H(2)/m(3) for MOF-177). This material also displays a surprisingly high volumetric density of 23.2 kg H(2)/m(3) at room temperature and 85 bar--roughly 3 times higher than that of compressed gas and approaching the DOE 2010 goal of 28 kg H(2)/m(3). These materials possess linear isotherms and enthalpies that rise on coverage and have little or no kinetic barrier to adsorption or desorption. In a practical system these materials would use pressure instead of temperature as a toggle and can thus be used in compressed gas tanks, currently employed in many hydrogen test vehicles, to dramatically increase the amount of hydrogen stored and therefore the range of any vehicle.
Economic impact of V2G technology in a smart microgrid
Anastasiadis, Anestis G.; Polyzakis, Apostolos; Vokas, Georgios A.
2018-05-01
With serious concerns on global warming and energy crisis, there are plenty of motivations for developing and commercializing plug-in Electric Vehicles (EVs). It is believed that substitution of EVs for conventional fuel vehicles can help reduce the greenhouse gases emission, increase the energy efficiency, enhance the integration of renewable energy, and so forth. These advantages originate from the double role of the electrical vehicle's battery. Thus, it may constitute firstly a controllable load that we are able to optimally control at convenient time frames and secondly, it may store and inject energy, acting as a storage device. Nowadays, a number of EVs use power grids around the world to charge and discharge their batteries. Smart Microgrids (SMs) seem to be the best solution for the management of modern Low Voltage (LV) grids with Distributed Energy Resources (DER) and EVs. Among these technologies, EVs pose both a risk by increasing the peak load as well as an opportunity for the existing energy management systems by charging and discharging electricity with the help of Vehicle-to-Grid (V2G) technology. The key to the implementation of V2G is how to effectively integrate information into energy conversion, transmission and distribution. V2G should be carried out within the framework of SM, so that the status information of power grid can be perceived. In this paper, a Low Voltage (LV) SM derived from an interconnection bus is considered which is characterized by the presence of DERs units and EVs. Firstly, an overview of plug in EV technologies is examined and then the main purpose of the paper is to investigate the effects of V2G charging and discharging strategies in a SM. With EVs and absence of DERs is considered as the base case. For each scenario, two different charging technologies are examined (Dump Charging and V2G) in terms of operational cost. All data are taken from Hellenic Distribution/Transmission System Operators and Hellenic Operator of
International Nuclear Information System (INIS)
Xiao, Ling-Zhi; Ichikawa, Sadao
1995-01-01
Mutagenic interactions between maleic hydrazide (MH; a promutagen known to be activated into a mutagen in plant cells) and X rays were studied in the stamen hairs of Tradescantia clone BNL 4430, a blue/pink heterozygote. The young inflorescence-bearing shoots with roots cultivated in the nutrient solution circulating growth chamber were used as tester plants. After determining dose-response curves for X rays and for MH, nine combined treatments with MH (0.5 and 1 mM) and X rays (292 to 1,240 mGy) were conducted, exposing to X rays either 20 or 44 h before, at the midpoint of, or 2 or 44 h after the MH treatments for 4h. Clear synergistic effects in inducing somatic pink mutations were detected when X rays were given before the MH treatments. On the contrary, however, antagonistic effects were often observed when X-ray treatments were carried out during or after the MH treatments. The synergistic effects detected were thought to be the results of interactions between DNA strand breaks (and the resultant chromosomal breaks) induced by X rays and those by MH, whereas the antagonistic effects observed were presumed to have resulted from X-ray-caused inhibition of the activation of MH in the stamen-hair cells. (author)
DEFF Research Database (Denmark)
Jørgensen, Christel Thea; Pedersen, Christian; Søtofte, Inger
1998-01-01
The new 2,3-Aziridino-2,3-dideoxyhexonamides 3 and 11 were prepared by a three-step procedure from commercially available D-glucono-1,5-lactone and D-gulono-1,4-lactone, respectively. The lactones were converted into methyl 3,4;5,6-di-O-isopropylidene-2-Omesyl esters 2 and 10, which upon treatmen...... with ammonia formed the title aziridino compounds. These were reductively cleaved by hydrazine to give 3-amino-2,3-dideoxyhexonic hydrazides 13 and 15, which were easily converted into corresponding lactone 14 and acid 16, respectively....
Indoor radio planning a practical guide for 2G, 3G and 4G
Tolstrup, Morten
2015-01-01
Why is high performance indoor wireless service needed, and how is it best implemented? As the challenge of providing better service and higher data speeds and quality for mobile applications intensifies, ensuring adequate in-building and tunnel coverage and capacity is increasingly important. A unique, single-source reference on the theoretical and practical knowledge behind indoor and tunnel radio planning, this book provides a detailed overview of mobile networks systems, coverage and capacity solutions with 2G, 3G and 4G cellular system technologies as a backdrop. All of the available s
A microwave-catalyzed rapid, efficient and ecofriendly synthesis of substituted pyrazol-5-ones
Directory of Open Access Journals (Sweden)
RAHUL P. GAVANDE
2003-10-01
Full Text Available A series of 1-(3,4-dihydro-3-oxo-2H-1,4-benzoxazine-2-carbonyl-3-methyl-4-(substituted phenylhydrazono-2-pyrazolin-5-ones have been synthesized by the reaction of 2H-3,4-dihydro-3-oxo-1,4-benzoxazine-2-carboxylic acid hydrazide with substituted acetoacetic ester derivatives using acetic acid as solvent under microwave irradiation (MWI, as well as by conventional methods. The reaction rate is enhanced tremendously and the yields are improved under MWI as compared to conventional methods.
[5-(1,3-Diphenyl-1H-pyrazol-4-yl-3-phenyl-4,5-dihydropyrazol-1-yl](pyridin-4-ylmethanone
Directory of Open Access Journals (Sweden)
Tarawanti Verma
2011-01-01
Full Text Available A novel pyrazoline derivative 2 was synthesized by reaction of an α,β-unsaturated ketone 1 with isonicotinic acid hydrazide (INH in glacial acetic acid. The structure of the title compound 2 was established on basis of IR, 1H-NMR, 13C-NMR and mass spectral data.
Thermochemical properties of two benzimidazole derivatives: 2-Phenyl- and 2-benzylbenzimidazole
International Nuclear Information System (INIS)
Ribeiro da Silva, Manuel A.V.; Ribeiro da Silva, Maria das Dores M.C.; Amaral, Luisa M.P.F.; Elguero, Jose; Jimenez, Pilar; Roux, Maria Victoria; Davalos, Juan Z.; Temprado, Manuel; Cabildo, Pilar; Claramunt, Rosa M.; Mo, Otilia; Yanez, Manuel
2005-01-01
The standard (p 0 =0.1MPa) molar enthalpy of formation for gaseous 2-phenylbenzimidazole (2-PhBIM) and 2-benzylbenzimidazole (2-BzBIM) were derived from the standard molar enthalpies of combustion, at T=298.15K, measured by static bomb calorimetry, and the standard molar enthalpy of sublimation, at T=298.15K, measured by Calvet microcalorimetry in the case of 2-phenylbenzimidazole or derived from the variation of the vapour pressures, determined by the Knudsen effusion technique, with temperatures between (393 and 412)K for 2-benzylbenzimidazole. Heat capacities, in the temperature ranges from (268.15 to 322.10)K for 2-phenylbenzimidazole and (270.15 to 316.02)K for 2-benzylbenzimidazole, were also measured with a differential scanning calorimeter. Δ c H m 0 (cr)/kJ.mol -1 Δ cr g H m 0 (T=298.15K)/kJ.mol -1 2-Phenylbenzimidazole (2-PhBIM)-6679.8+/-0.9123.0+/-1.72-Benzylbenzimidazole (2-BzBIM)-7327.1+/-4.0136.2+/-0.5
Synthesis and fungicidal activity of pyrazole derivatives containing 1,2,3,4-tetrahydroquinoline.
Lei, Peng; Zhang, Xuebo; Xu, Yan; Xu, Gaofei; Liu, Xili; Yang, Xinling; Zhang, Xiaohe; Ling, Yun
2016-01-01
Take-all of wheat, caused by the soil-borne fungus Gaeumannomyces graminis var. tritici, is one of the most important and widespread root diseases. Given that take-all is still hard to control, it is necessary to develop new effective agrochemicals. Pyrazole derivatives have been often reported for their favorable bioactivities. In order to discover compounds with high fungicidal activity and simple structures, 1,2,3,4-tetrahydroquinoline, a biologically active group of natural products, was introduced to pyrazole structure. A series of pyrazole derivatives containing 1,2,3,4-tetrahydroquinoline were synthesized, and their fungicidal activities were evaluated. The bioassay results demonstrated that the title compounds displayed obvious fungicidal activities at a concentration of 50 μg/mL, especially against V. mali, S. sclerotiorum and G. graminis var. tritici. The inhibition rates of compounds 10d, 10e, 10h, 10i and 10j against G. graminis var. tritici were all above 90 %. Even at a lower concentration of 16.7 μg/mL, compounds 10d and 10e exhibited satisfied activities of 100 % and 94.0 %, respectively. It is comparable to that of the positive control pyraclostrobin with 100 % inhibition rate. A series of pyrazole derivatives containing 1,2,3,4-tetrahydroquinoline were synthesized and their structures were confirmed by (1)H NMR, (13)C NMR, IR spectrum and HRMS or elemental analysis. The crystal structure of compound 10g was confirmed by X-ray diffraction. Bioassay results indicated that all title compounds exhibited obvious fungicidal activities. In particular, compounds 10d and 10e showed comparable activities against G. graminis var. tritici with the commercial fungicide pyraclostrobin at the concentration of 16.7 μg/mL.Graphical abstractA series of pyrazole derivatives containing 1,2,3,4-tetrahydroquinoline were designed and synthesized. Bioassay results indicated that all these compounds exhibited obvious fungicidal activities.
Directory of Open Access Journals (Sweden)
Chang-Jing Wu
2015-04-01
Full Text Available Introduction of neomycin-resistance into a marine-derived, wild-type Penicillium purpurogenum G59 resulted in activation of silent biosynthetic pathways for the secondary metabolite production. Upon treatment of G59 spores with neomycin and dimethyl sulfoxide (DMSO, a total of 56 mutants were obtained by single colony isolation. The acquired resistance of mutants to neomycin was testified by the resistance test. In contrast to the G59 strain, the EtOAc extracts of 28 mutants inhibited the human cancer K562 cells, indicating that the 28 mutants have acquired the capability to produce bioactive metabolites. HPLC-photodiode array detector (PDAD-UV and HPLC-electron spray ionization (ESI-MS analyses further indicated that diverse secondary metabolites have been newly produced in the bioactive mutant extracts. Followed isolation and characterization demonstrated that five bioactive secondary metabolites, curvularin (1, citrinin (2, penicitrinone A (3, erythro-23-O-methylneocyclocitrinol (4 and 22E-7α-methoxy-5α, 6α-epoxyergosta-8(14,22-dien-3β-ol (5, were newly produced by a mutant, 4-30, compared to the G59 strain. All 1–5 were also not yet found in the secondary metabolites of other wild type P. purpurogenum strains. Compounds 1–5 inhibited human cancer K562, HL-60, HeLa and BGC-823 cells to varying extents. Both present bioassays and chemical investigations demonstrated that the introduction of neomycin-resistance into the marine-derived fungal G59 strain could activate silent secondary metabolite production. The present work not only extended the previous DMSO-mediated method for introducing drug-resistance in fungi both in DMSO concentrations and antibiotics, but also additionally exemplified effectiveness of this method for activating silent fungal secondary metabolites. This method could be applied to other fungal isolates to elicit their metabolic potentials to investigate secondary metabolites from silent biosynthetic pathways.
Giallongo, Cesarina; Tibullo, Daniele; Parrinello, Nunziatina L; La Cava, Piera; Di Rosa, Michelino; Bramanti, Vincenzo; Di Raimondo, Cosimo; Conticello, Concetta; Chiarenza, Annalisa; Palumbo, Giuseppe A; Avola, Roberto; Romano, Alessandra; Di Raimondo, Francesco
2016-12-27
Granulocytic-Myeloid-derived suppressor cells (G-MDSC) are increased in Multiple Myeloma (MM) patients but the mechanisms of G-MDSC generation are still unknown. There are many evidences of the role of mesenchymal stem cells (MSC) in promoting MM cell growth, survival and drug-resistance. We here used a specific experimental model in vitro to evaluate the ability of MSC to induce G-MDSC. We found that although MSC derived from healthy donors (HD), MGUS and MM were able to generate the same amount of MDSC, only MM-MSC-educated G-MDSC exhibited suppressive ability. In addition, in comparison with MSC derived from HD, MM-MSC produce higher amount of immune-modulatory factors that could be involved in MDSC induction. Compared to G-MDSC obtained from co-culture models with MSC from healthy subjects, both MGUS and MM-MSC-educated G-MDSC showed increase of immune-modulatory factors. However, only MM-MSC educated G-MDSC 1) up-regulated immune-suppressive factors as ARG1 and TNFα, 2) expressed higher levels of PROK2, important in angiogenesis and inflammatory process, and 3) showed ability to digest bone matrix.Our data demonstrate that MM-MSC are functionally different from healthy subjects and MGUS-MSC, supporting an evolving concept regarding the contribution of MM-MSC to tumor development and progression.
The effect of progesterone and 17-β estradiol on membrane-bound HLA-G in adipose derived stem cells.
Moslehi, Akram; Hashemi-Beni, Batool; Moslehi, Azam; Akbari, Maryam Ali; Adib, Minoo
2016-07-01
Membrane-bound HLA-G (mHLA-G) discovery on adipose derived stem cells (ADSCs) as a tolerogenic and immunosuppressive molecule was very important. Many documents have shown that HLA-G expression can be controlled via some hormones such as progesterone (P4) and estradiol (E2). Therefore, this study was designed to evaluate progesterone and estradiol effects on mHLA-G in ADSCs at restricted and combination concentrations. Three independent cell lines were cultured in complete free phenol red DMEM and subcultured to achieve suffi cient cells. These cells were treated with P4, E2 and P4 plus E2 at physiologic and pregnancy concentrations for 3 days in cell culture conditions. The HLA-G positive ADSCs was measured via monoclonal anti HLA-G-FITC/MEMG-09 by means of flow cytometry in nine groups. Data were analyzed by one way ANOVA and Tukey's post hoc tests. There were no signifi cant values of the mean percentage of HLA-G positive cells in E2-treated and the combination of P4 plus E2-treated ADSCs compared to control cells (p value>0.05) but P4 had a signifi cant increase on mHLA-G in ADSCs (p value<0.05). High P4 concentration increased mHLA-G but E2 and the combination of P4 plus E2 could not change mHLA-G on ADSCs.
Sr and Pb isotopic composition of five USGS glasses (BHVO-2G, BIR-1G, BCR-2G, TB-1G, NKT-1G)
Elburg, M.A.; Vroon, P.Z.; van der Wagt, R.A.C.A.; Tchalikian, A.
2005-01-01
Sr isotopic compositions and Rb/Sr ratios of three USGS glasses (BHVO-2G, BIR-1G, BCR-2G) are identical to those of the original USGS reference materials. NKT-1G and TB-1G give values of 0.70351 and 0.70558, respectively. Pb isotopic ratios were measured by the standard-sample bracketing technique
The Vaporization of B2O3(l) to B2O3(g) and B2O2(g)
Jacobson, Nathan S.; Myers, Dwight L.
2011-01-01
The vaporization of B2O3 in a reducing environment leads to formation of both B2O3(g) and B2O2(g). While formation of B2O3(g) is well understood, many questions about the formation of B2O2(g) remain. Previous studies using B(s) + B2O3(l) have led to inconsistent thermodynamic data. In this study, it was found that after heating, B(s) and B2O3(l) appear to separate and variations in contact area likely led to the inconsistent vapor pressures of B2O2(g). To circumvent this problem, an activity of boron is fixed with a two-phase mixture of FeB and Fe2B. Both second and third law enthalpies of formation were measured for B2O2(g) and B2O3(g). From these the enthalpies of formation at 298.15 K are calculated to be -479.9 +/- 41.5 kJ/mol for B2O2(g) and -833.4 +/- 13.1 kJ/mol for B2O3(g). Ab initio calculations to determine the enthalpies of formation of B2O2(g) and B2O3(g) were conducted using the W1BD composite method and show good agreement with the experimental values.
International Nuclear Information System (INIS)
Modak, Arindam; Bhaumik, Asim
2015-01-01
Microporous carbon having Brunauer-Emmett-Teller (BET) surface area of 2186 m"2 g"−"1 and micropore volume of 0.85 cm"3 g"−"1 has been synthesized via KOH induced high temperature carbonization of a non-conjugated hypercrosslinked organic polymer. Owing to the templating and activation by KOH, we have succeeded in making a microporous carbon from this porous polymer and the resultant carbon material showed high uptake for CO_2 (7.6 mmol g"−"1) and CH_4 (2.4 mmol g"−"1) at 1 atm, 273 K together with very good selectivity for the CO_2/N_2 (30.2) separation. Furthermore, low pressure (1 atm) H_2 (2.6 wt%, 77 K) and water uptake (57.4 wt%, 298 K) ability of this polymer derived porous activated carbon is noteworthy. - Graphical abstract: Microporous carbon with BET surface area of 2186 m"2 g"−"1 has been synthesized via KOH activation of a porous organic polymer and it showed high uptake for CO_2 (7.6 mmol g"−"1), CH_4 (2.4 mmol g"−"1) and H_2 (2.6 wt%) at 1 atm together with very good selectivity for CO_2. - Highlights: • Porous carbon from hypercrosslinked organic polymer. • KOH activated carbon with BET surface area 2186 m"2 g"−"1. • High CO2 uptake (7.6 mmol g"−"1) and CO_2/N_2 selectivity (30.2). • Porous carbon also showed high H_2 (2.6 wt%) and H_2O (57.4 wt%) uptakes.
Zhang, Peng; Li, Xiao-Ming; Mao, Xin-Xin; Mándi, Attila; Kurtán, Tibor; Wang, Bin-Gui
2016-01-01
A new indolyl-6,10b-dihydro-5a H -[1]benzofuro[2,3- b ]indole derivative, varioloid A ( 1 ), was isolated from the marine alga-derived endophytic fungus Paecilomyces variotii EN-291. Its structure was elucidated on the basis of extensive analysis of 1D and 2D NMR data and the absolute configuration was determined by time-dependent density functional theory-electronic circular dichroism (TDDFT-ECD) calculations. A similar compound, whose planar structure was previously described but the relative and absolute configurations and 13 C NMR data were not reported, was also identified and was tentatively named as varioloid B ( 2 ). Both compounds 1 and 2 exhibited cytotoxicity against A549, HCT116, and HepG2 cell lines, with IC 50 values ranging from 2.6 to 8.2 µg/mL.
Directory of Open Access Journals (Sweden)
Anees A Siddiqui
2010-01-01
Full Text Available Background : Pain is an unpleasant and subjective sensation that results from a harmful sensorial stimulation, which alerts the body about current or potential damage to its tissues and organs. Fever is a complex physiological response triggered by infections or aseptic stimuli. Elevation in body temperature occurs when the concentration of prostaglandin E 2 (PGE 2 increases within parts of the brain. Triazole derivatives have been found to possess various pharmacological and biological activities, such as, anti-inflammatory, analgesics, antipyretic, and antifungal. Materials and Methods : Various 4-[{1-(arylmethylidene}-amino]-3-(4-pyridyl-5-mercapto-4H-1,2,4-triazole derivatives were synthesized by a sequence of reactions starting from isonicotinic acid hydrazide. The synthesized compounds were screened for in-vivo analgesic by the tail-flick method and anti-pyretic activities at a dose of 25 and 100 mg/kg body weight respectively. The antipyretic activity was evaluated using Brewer′s yeast induced pyrexia in rats. Fever was induced by subcutaneously injecting 20 ml/kg of 20% aqueous suspension of Brewer′s yeast in normal saline. Results and Discussion : The analgesic screening results revealed that the compounds 3b, 3c, and 3d exhibited excellent analgesic activity at 60 and 90 minutes compared to the standard drug (Analgin. Results revealed that the compounds 3a, 3e, and 3f significantly decreased the temperature of pyretic (P<0.001 rats at one, three and six hours after compound administration as compared to Aspirin (standard drug. Conclusion : Compounds 3b, 3c, and 3d exhibited significant analgesic activity comparable with the standard drug analgin, using the tail flick model. Compounds 3a, 3e, and 3f showed significant anti-pyretic activities comparable with the standard drug aspirin using the yeast-induced pyrexia model.
Directory of Open Access Journals (Sweden)
Ariel Venezian
2017-05-01
Full Text Available Broomrapes (Phelipanche spp. and Orobanche spp. are holoparasitic plants that cause tremendous losses of agricultural crops worldwide. Broomrape control is extremely difficult and only amino acid biosynthesis-inhibiting herbicides present an acceptable control level. It is expected that broomrape resistance to these herbicides is not long in coming. Our objective was to develop a broomrape control system in tomato (Solanum lycopersicum L. based on the plant growth regulator maleic hydrazide (MH. Petri-dish and polyethylene-bag system experiments revealed that MH has a slight inhibitory effect on Phelipanche aegyptiaca seed germination but is a potent inhibitor of the first stages of parasitism, namely attachment and the tubercle stage. MH phytotoxicity toward tomato and its P. aegyptiaca-control efficacy were tested in greenhouse experiments. MH was applied at 25, 50, 75, 150, 300, and 600 g a.i. ha-1 to tomato foliage grown in P. aegyptiaca-infested soil at 200 growing degree days (GDD and again at 400 GDD. The treatments had no influence on tomato foliage or root dry weight. The total number of P. aegyptiaca attachments counted on the roots of the treated plants was significantly lower at 75 g a.i. ha-1 and also at higher MH rates. Phelipanche aegyptiaca biomass was close to zero at rates of 150, 300, and 600 g a.i. ha-1 MH. Field experiments were conducted to optimize the rate, timing and number of MH applications. Two application sequences gave superior results, both with five split applications applied at 100, 200, 400, 700, and 1000 GDD: (a constant rate of 400 g a.i. ha-1; (b first two applications at 270 g a.i. ha-1 and the next three applications at 540 g a.i. ha-1. Based on the results of this study, MH was registered for use in Israel in 2013 with the specified protocol and today, it is widely used by most Israeli tomato growers.
Chan, Anita S Y; Mudhar, Hardeep; Shen, Sunny Yu; Lang, Stephanie S; Fernando, Malee; Hilmy, Maryam Hazly; Guppy, Naomi Jayne; Rennie, Ian; Dunkley, Lisa; Al Jajeh, Issam
2017-11-01
To determine the role of serum and tissue IgG2 in orbital biopsies with the histological features of IgG4-related disease (IgG4-RD) in comparison with non-IgG4-related orbital inflammatory disorders (OID), including autoimmune disorders. This is an international (Sheffield, UK, and Singapore) collaborative, retrospective case review of 69 patients (38 from Singapore National Eye Centre and 31 from Royal Hallamshire Hospital, Sheffield) with orbital inflammatory biopsies between 2002 and 2016. Clinical information and histology were reviewed and cases were classified into three groups: Group 1: IgG4-RD orbital inflammation (n=43); Group 2: idiopathic OID (n=12) and Group 3: autoimmune OID (n=14). Serum IgG1, IgG2, IgG3 and IgG4 levels were collated where available and immunohistochemistry (IHC) for tissue IgG2 plasma cells was performed. Dual IHC showed IgG2 plasma cells as a distinct population from IgG4 plasma cells. Significant (twofold) serum IgG2 elevation was noted among IgG4-RD (group 1), idiopathic (group 2) and autoimmune OID (group 3). Similarly, significant elevation of tissue IgG2 plasma cells was also seen among IgG4-RD (group 1), idiopathic and autoimmune OID (groups 2 and 3). Significant elevations of serum IgG2 and tissue IgG2 plasma cells are present in orbital IgG4-RD in comparison with non-IgG4 orbital inflammation (idiopathic and autoimmune OID), suggesting that IgG2 may play a role in IgG4-RD. A serum IgG2 cut-off >5.3 g/L was found to be 80% sensitive and 91.7% specific for orbital IgG4-RD, with an accuracy of 0.90. Tissue IgG2 and IgG4 subclass reporting may provide additional insight regarding the 'IgG4-RD' pathogenesis. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Myeloperoxidase-derived oxidants induce blood-brain barrier dysfunction in vitro and in vivo.
Directory of Open Access Journals (Sweden)
Andreas Üllen
Full Text Available Peripheral leukocytes can exacerbate brain damage by release of cytotoxic mediators that disrupt blood-brain barrier (BBB function. One of the oxidants released by activated leukocytes is hypochlorous acid (HOCl formed via the myeloperoxidase (MPO-H2O2-Cl(- system. In the present study we examined the role of leukocyte activation, leukocyte-derived MPO and MPO-generated oxidants on BBB function in vitro and in vivo. In a mouse model of lipopolysaccharide (LPS-induced systemic inflammation, neutrophils that had become adherent released MPO into the cerebrovasculature. In vivo, LPS-induced BBB dysfunction was significantly lower in MPO-deficient mice as compared to wild-type littermates. Both, fMLP-activated leukocytes and the MPO-H2O2-Cl(- system inflicted barrier dysfunction of primary brain microvascular endothelial cells (BMVEC that was partially rescued with the MPO inhibitor 4-aminobenzoic acid hydrazide. BMVEC treatment with the MPO-H2O2-Cl(- system or activated neutrophils resulted in the formation of plasmalogen-derived chlorinated fatty aldehydes. 2-chlorohexadecanal (2-ClHDA severely compromised BMVEC barrier function and induced morphological alterations in tight and adherens junctions. In situ perfusion of rat brain with 2-ClHDA increased BBB permeability in vivo. 2-ClHDA potently activated the MAPK cascade at physiological concentrations. An ERK1/2 and JNK antagonist (PD098059 and SP600125, respectively protected against 2-ClHDA-induced barrier dysfunction in vitro. The current data provide evidence that interference with the MPO pathway could protect against BBB dysfunction under (neuroinflammatory conditions.
Directory of Open Access Journals (Sweden)
Sophie eDe Grauwe
2014-10-01
Full Text Available In this fMRI long-lag priming study, we investigated the processing of Dutch semantically transparent, derived prefix verbs. In such words, the meaning of the word as a whole can be deduced from the meanings of its parts, e.g. wegleggen ‘put aside’. Many behavioral and some fMRI studies suggest that native (L1 speakers decompose transparent derived words. The brain region usually implicated in morphological decomposition is the left inferior frontal gyrus (LIFG. In non-native (L2 speakers, the processing of transparent derived words has hardly been investigated, especially in fMRI studies, and results are contradictory: Some studies find more reliance on holistic (i.e. non-decompositional processing by L2 speakers; some find no difference between L1 and L2 speakers. In this study, we wanted to find out whether Dutch transparent derived prefix verbs are decomposed or processed holistically by German L2 speakers of Dutch. Half of the derived verbs (e.g. omvallen ‘fall down’ were preceded by their stem (e.g. vallen ‘fall’ with a lag of 4 to 6 words (‘primed’; the other half (e.g. inslapen ‘fall asleep’ were not (‘unprimed’. L1 and L2 speakers of Dutch made lexical decisions on these visually presented verbs. Both ROI analyses and whole-brain analyses showed that there was a significant repetition suppression effect for primed compared to unprimed derived verbs in the LIFG. This was true both for the analyses over L2 speakers only and for the analyses over the two language groups together. The latter did not reveal any interaction with language group (L1 vs. L2 in the LIFG. Thus, L2 speakers show a clear priming effect in the LIFG, an area that has been associated with morphological decomposition. Our findings are consistent with the idea that L2 speakers engage in decomposition of transparent derived verbs rather than processing them holistically.
Possible detection of an emission feature near 584 A in the direction of G191-B2B
Green, James; Bowyer, Stuart; Jelinsky, Patrick
1990-01-01
A possible spectral emission feature is reported in the direction of the nearby hot white dwarf G191-B2B at 581.5 + or - 6 A with a significance of 3.8 sigma. This emission has been identified as He I 584.3 A. The emission cannot be due to local geocoronal emission or interplanetary backscatter of solar He I 584 A emission because the feature is not detected in a nearby sky exposure. Possible sources for this emission are examined, including the photosphere of G191-B2B, the comparison star G191-B2A, and a possible nebulosity near or around G191-B2B. The parameters required to explain the emission are derived for each case. All of these explanations require unexpected physical conditions; hence we believe this result must receive confirming verification despite the statistical likelihood of the detection.
Possible detection of an emission feature near 584 A in the direction of G191-B2B
International Nuclear Information System (INIS)
Green, J.; Bowyer, S.; Jelinsky, P.
1990-01-01
A possible spectral emission feature is reported in the direction of the nearby hot white dwarf G191-B2B at 581.5 + or - 6 A with a significance of 3.8 sigma. This emission has been identified as He I 584.3 A. The emission cannot be due to local geocoronal emission or interplanetary backscatter of solar He I 584 A emission because the feature is not detected in a nearby sky exposure. Possible sources for this emission are examined, including the photosphere of G191-B2B, the comparison star G191-B2A, and a possible nebulosity near or around G191-B2B. The parameters required to explain the emission are derived for each case. All of these explanations require unexpected physical conditions; hence we believe this result must receive confirming verification despite the statistical likelihood of the detection. 15 refs
International Nuclear Information System (INIS)
Freitas, Vera L.S.; Gomes, José R.B.; Ribeiro da Silva, Maria D.M.C.
2012-01-01
Highlights: ► Energetics of 9-R-xanthene derivatives (R=OH, COOH, CONH 2 ). ► Δ f H m o (cr) of three xanthenes derivatives was measured by static bomb calorimetry. ► Δ cr g H m o of xanthenes derivatives was derived Knudsen effusion technique. ► Molecular orbital calculations for xanthene derivatives were done by G3(MP2)//B3LYP. - Abstract: In the present work, the standard (p° = 0.1 MPa) molar enthalpies of formation of xanthydrol, 9-xanthenecarboxylic acid and 9-xanthenecarboxamide, in the gaseous state, at T = 298.15 K, were determined by experimental and computational studies. The experimental techniques used were the static-bomb combustion calorimetry, which enabled the determination of the standard molar enthalpy of formation, in the crystalline state, and the vacuum drop microcalorimetric and the Knudsen effusion techniques used to derive the enthalpy of sublimation. For comparison purposes, we performed standard ab initio molecular orbital calculations, using the G3(MP2)//B3LYP composite procedure, of the enthalpies of several homodesmotic reactions, allowing to extract the standard molar enthalpies of formation, in the gaseous state, of the three xanthene derivatives considered in this work. The calculated results are in good agreement with the experimental data.
The Infinitesimal Moduli Space of Heterotic G 2 Systems
de la Ossa, Xenia; Larfors, Magdalena; Svanes, Eirik E.
2018-06-01
Heterotic string compactifications on integrable G 2 structure manifolds Y with instanton bundles {(V,A), (TY,\\tilde{θ})} yield supersymmetric three-dimensional vacua that are of interest in physics. In this paper, we define a covariant exterior derivative D and show that it is equivalent to a heterotic G 2 system encoding the geometry of the heterotic string compactifications. This operator D acts on a bundle Q}=T^*Y \\oplus End(V) \\oplus End(TY)} and satisfies a nilpotency condition \\check{{D^2=0} , for an appropriate projection of D. Furthermore, we determine the infinitesimal moduli space of these systems and show that it corresponds to the finite-dimensional cohomology group H^1_{D}(Q). We comment on the similarities and differences of our result with Atiyah's well-known analysis of deformations of holomorphic vector bundles over complex manifolds. Our analysis leads to results that are of relevance to all orders in the {α'} expansion.
Al-Deeb, Omar A; Al-Omar, Mohamed A; El-Brollosy, Nasser R; Habib, Elsayed E; Ibrahim, Tarek M; El-Emam, Ali A
2006-01-01
The reaction of 3-(1-adamantyl)-4-substituted-1,2,4-triazoline-5-thiones 3a-g with sodium chloroacetate, in ethanolic sodium hydroxide yielded the corresponding N1-acetic acid derivatives 4a-g. The interaction of 3a-g with ethyl 2-bromopropionate in acetone, in the presence of potassium carbonate, yielded the corresponding N1-ethyl propionate derivatives 5a-g, which upon hydrolysis with aqueous sodium hydroxide afforded the corresponding propionic acid derivatives 6a-g. Similarly, the reaction of 3-(1-adamantyl)-4-amino-1,2,4-triazoline-5-thione 7 with sodium chloroacetate in ethanolic sodium hydroxide yielded the corresponding N1-acetic acid derivative 8. On the other hand, the reaction of 2-(1-adamantyl)-1,3,4-oxadiazoline-5-thione 9 with sodium chloroacetate yielded the corresponding S-acetic acid derivative 10. Compounds 4a-g, 5b, 5c, 5g, 6a-g, 8 and 10 were tested for in vitro activities against a panel of Gram-positive and Gram-negative bacteria and the yeast-like pathogenic fungus Candida albicans. Several derivatives produced good or moderate activities particularly against Bacillus subtilis. In addition, the in vivo anti-inflammatory activities of these compounds were determined using the carrageenin-induced paw oedema method in rats. Compounds 4a, 4b, 4e, 4f, 6f, 6g and 10 produced good dose-dependent anti-inflammatory activities.
Directory of Open Access Journals (Sweden)
Peng Zhang
2016-09-01
Full Text Available A new indolyl-6,10b-dihydro-5aH-[1]benzofuro[2,3-b]indole derivative, varioloid A (1, was isolated from the marine alga-derived endophytic fungus Paecilomyces variotii EN-291. Its structure was elucidated on the basis of extensive analysis of 1D and 2D NMR data and the absolute configuration was determined by time-dependent density functional theory-electronic circular dichroism (TDDFT-ECD calculations. A similar compound, whose planar structure was previously described but the relative and absolute configurations and 13C NMR data were not reported, was also identified and was tentatively named as varioloid B (2. Both compounds 1 and 2 exhibited cytotoxicity against A549, HCT116, and HepG2 cell lines, with IC50 values ranging from 2.6 to 8.2 µg/mL.
Dynamics of isolated magnetic bright points derived from Hinode/SOT G-band observations
Utz, D.; Hanslmeier, A.; Muller, R.; Veronig, A.; Rybák, J.; Muthsam, H.
2010-02-01
Context. Small-scale magnetic fields in the solar photosphere can be identified in high-resolution magnetograms or in the G-band as magnetic bright points (MBPs). Rapid motions of these fields can cause magneto-hydrodynamical waves and can also lead to nanoflares by magnetic field braiding and twisting. The MBP velocity distribution is a crucial parameter for estimating the amplitudes of those waves and the amount of energy they can contribute to coronal heating. Aims: The velocity and lifetime distributions of MBPs are derived from solar G-band images of a quiet sun region acquired by the Hinode/SOT instrument with different temporal and spatial sampling rates. Methods: We developed an automatic segmentation, identification and tracking algorithm to analyse G-Band image sequences to obtain the lifetime and velocity distributions of MBPs. The influence of temporal/spatial sampling rates on these distributions is studied and used to correct the obtained lifetimes and velocity distributions for these digitalisation effects. Results: After the correction of algorithm effects, we obtained a mean MBP lifetime of (2.50 ± 0.05) min and mean MBP velocities, depending on smoothing processes, in the range of (1-2) km~s-1. Corrected for temporal sampling effects, we obtained for the effective velocity distribution a Rayleigh function with a coefficient of (1.62 ± 0.05) km~s-1. The x- and y-components of the velocity distributions are Gaussians. The lifetime distribution can be fitted by an exponential function.
Energy Technology Data Exchange (ETDEWEB)
Meiffren, J; Dupay, F [Commissariat a l' Energie Atomique, Centre de Production de Plutonium, Marcoule (France). Centre d' Etudes Nucleaires
1965-07-01
The main objective of this study is to publicise the data obtained during five years operation of the reactor G2 and G3 at Marcoule as far as the cooling gas is concerned, from storage of reserves up to its slow escape into the atmosphere, and including all the stages of its practical use, its chemical examination, its nuclear behaviour and its possible physicochemical transformation. This work can not only yield information about the operations carried out at Marcoule but can also provide useful suggestions for improving the sealing and for decreasing the activity of the pressurized gas circuits in reactors similar to G2/G3. (authors) [French] Le but principal de cette etude est de diffuser les connaissances acquises au cours de cinq annees d'exploitation des reacteurs G2 et G3 de Marcoule en ce qui concerne le gaz de refroidissement, depuis son stockage d'appoint jusqu'a son echappement lent dans l'atmosphere, en passant par tous les stades de son utilisation pratique, de son etude chimique, de son comportement nucleaire, eventuellement de ses transformations physico-chimiques. Cette etude peut, non seulement renseigner sur les operations effectuees couramment a Marcoule, mais egalement donner des suggestions interessantes pour l'amelioration de l'etancheite et la diminution de l'activite des circuits de gaz en pression dans des reacteurs analogues a G2/G3. (auteurs)
Forslund, Carina; Aspenberg, Per
2003-01-01
Achilles tendon ruptures in humans might be treated more efficiently with the help of a growth factor. Cartilage-derived morphogenetic protein-2 has been shown to induce formation of tendon-like tissue. Cartilage-derived morphogenetic protein-2 has a positive effect on mechanical parameters for tendon healing in a rabbit model with Achilles tendon transection. Controlled laboratory study. The right Achilles tendon of 40 rabbits was transected without tendon suture. Cartilage-derived morphogenetic protein-2 (10 micro g) or vehicle control (acetate buffer) was injected locally 2 hours postoperatively. All tendons were tested biomechanically at 8 and 14 days, and treated tendons were histologically and radiographically evaluated at 56 days. At 14 days, both failure load and stiffness of treated tendons were increased by 35%. The treated tendons had significantly larger callus size at 8 and 14 days. Histologic and radiographic examination showed no signs of ossification in the treated tendons after 56 days. A single injection of cartilage-derived morphogenetic protein-2 led to a stronger and stiffer tendon callus than that in the controls without inducing bone formation. Similar results from a larger animal model would suggest a possible future use of cartilage-derived morphogenetic protein-2 in the treatment of human Achilles tendon ruptures.
Directory of Open Access Journals (Sweden)
Márta Palkó
2011-09-01
Full Text Available all-endo-3-amino-5-hydroxybicyclo[2.2.2]octane-2-carboxylic acid (13 and all-endo-5-amino-6-(hydroxymethylbicyclo[2.2.2]octan-2-ol (10 were prepared via dihydro-1,3-oxazine or g-lactone intermediates by the stereoselective functionalization of an N-protected derivative of endo-3-aminobicyclo[2.2.2]oct-5-ene-2-carboxylic acid (2. Ring closure of b-amino ester 4 resulted in tricyclic pyrimidinones 15 and 16. The structures, stereochemistry and relative configurations of the synthesized compounds were determined by IR and NMR.
Reactions of small negative ions with O2(a 1[Delta]g) and O2(X 3[Sigma]g-)
Midey, Anthony; Dotan, Itzhak; Seeley, J. V.; Viggiano, A. A.
2009-02-01
The rate constants and product ion branching ratios were measured for the reactions of various small negative ions with O2(X 3[Sigma]g-) and O2(a 1[Delta]g) in a selected ion flow tube (SIFT). Only NH2- and CH3O- were found to react with O2(X) and both reactions were slow. CH3O- reacted by hydride transfer, both with and without electron detachment. NH2- formed both OH-, as observed previously, and O2-, the latter via endothermic charge transfer. A temperature study revealed a negative temperature dependence for the former channel and Arrhenius behavior for the endothermic channel, resulting in an overall rate constant with a minimum at 500 K. SF6-, SF4-, SO3- and CO3- were found to react with O2(a 1[Delta]g) with rate constants less than 10-11 cm3 s-1. NH2- reacted rapidly with O2(a 1[Delta]g) by charge transfer. The reactions of HO2- and SO2- proceeded moderately with competition between Penning detachment and charge transfer. SO2- produced a SO4- cluster product in 2% of reactions and HO2- produced O3- in 13% of the reactions. CH3O- proceeded essentially at the collision rate by hydride transfer, again both with and without electron detachment. These results show that charge transfer to O2(a 1[Delta]g) occurs readily if the there are no restrictions on the ion beyond the reaction thermodynamics. The SO2- and HO2- reactions with O2(a) are the only known reactions involving Penning detachment besides the reaction with O2- studied previously [R.S. Berry, Phys. Chem. Chem. Phys., 7 (2005) 289-290].
Wang, Jin-Yu; Wang, Xin-Ting; Wang, Lin-Lin; Jia, Cun-Xian
2015-01-01
Suicide is an important public problem, the mechanism of which has not been clarified. Many studies have focused on the molecular, biological and genetic mechanisms of suicide. Brain-derived neurotrophic factor (BDNF) G196A is one of the most leading loci in recent studies, but the results are inconsistent. We conducted a 1:1 age- and sex-matched case-control study in rural areas of Shandong Province, China. A total of 365 pairs of cases and controls were finally recruited into our study. The adjusted odds ratios (AORs) of BDNF 196G/G and their 95% confidence intervals (CIs) were calculated by multivariate conditional logistic regression models. No association between BDNF polymorphisms and attempted suicide was found in the overall population. However, the BDNF 196G/G genotype was significantly related to attempted suicide in the elderly population (AOR = 7.85, 95% CI: 1.12-54.90, p = 0.038), while the associations were not significant in young and middle-aged groups. Our study suggests that the BDNF 196G/G genotype increases the risk of attempted suicide in elderly people. © 2015 S. Karger AG, Basel.
Chen, Wenxia; Yan, Yongbin; Song, Chundong; Ding, Ying; Du, Tao
2017-12-14
Studies have demonstrated that microvesicles (MVs) derived from human Wharton's Jelly mesenchymal stromal cells (hWJMSCs) could ameliorate renal ischemia/reperfusion injury (IRI); however, the underlying mechanisms were not clear yet. Here, MVs were isolated and injected intravenously into rats immediately after ischemia of the left kidney, and Erk1/2 activator hepatocyte growth factor (HGF) or inhibitor U0126 was administrated. Tubular cell proliferation and apoptosis were identified by Ki67 or terminal-deoxynucleotidyl transferase-mediated nick end labeling immunostaining. Masson's tri-chrome straining and alpha-smooth muscle actin staining were used for assessing renal fibrosis. The mRNA or protein expression in the kidney was measured by quantitative reverse transcription-PCR or Western blot, respectively. The total collagen concentration was also determined. In vitro , NRK-52E cells that treated with MVs under hypoxia injury and with HGF or U0126 administration were used, and cell cycle analysis was performed. The effects of hWJMSC-MVs on enhancing the proliferation and mitigating the apoptosis of renal cells, abrogating IRI-induced fibrosis, improving renal function, decreasing collagen deposition, and altering the expression levels of epithelial-mesenchymal transition and cell cycle-related proteins in IRI rats were found. In vitro experiment showed that hWJMSC-MVs could induce G2/M cell cycle arrest and decrease the expression of collagen deposition-related proteins in NRK-52E cells after 24 or 48 h. However, U0126 treatment reversed these effects. In conclusion, MVs derived from hWJMSCs ameliorate IR-induced renal fibrosis by inducing G2/M cell cycle arrest via Erk1/2 signaling. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.
Developing the Precision Magnetic Field for the E989 Muon g{2 Experiment
Energy Technology Data Exchange (ETDEWEB)
Smith, Matthias W. [Washington U., Seattle
2017-01-01
The experimental value of $(g\\hbox{--}2)_\\mu$ historically has been and contemporarily remains an important probe into the Standard Model and proposed extensions. Previous measurements of $(g\\hbox{--}2)_\\mu$ exhibit a persistent statistical tension with calculations using the Standard Model implying that the theory may be incomplete and constraining possible extensions. The Fermilab Muon g-2 experiment, E989, endeavors to increase the precision over previous experiments by a factor of four and probe more deeply into the tension with the Standard Model. The $(g\\hbox{--}2)_\\mu$ experimental implementation measures two spin precession frequencies defined by the magnetic field, proton precession and muon precession. The value of $(g\\hbox{--}2)_\\mu$ is derived from a relationship between the two frequencies. The precision of magnetic field measurements and the overall magnetic field uniformity achieved over the muon storage volume are then two undeniably important aspects of the e xperiment in minimizing uncertainty. The current thesis details the methods employed to achieve magnetic field goals and results of the effort.
Chen, Qiongyu; Chen, Jizhang; Zhou, Yuyang; Song, Chao; Tian, Qinghua; Xu, Junling; Wong, Ching-Ping
2018-05-01
The rational construction of heterostructured electrode materials that deliver superior performances to their individual counterparts offers an attractive strategy for supercapacitors. Herein, we anchor low-crystalline nanostructured MnO2 onto soybean stalk-derived carbon matrix through chemical activation and subsequent hydrothermal reaction. The highly porous and conductive matrix can effectively enhance pseudocapacitive kinetics of nanostructured MnO2. Therefore, the obtained nanocomposite exhibits high specific capacitance (384.9 F g-1 at a current density of 0.5 A g-1), great rate capability (185.0 F g-1 at 20 A g-1), and superior cyclability (90.7% capacitance retention after 5000 cycles). Using this nanocomposite as the positive electrode material, an asymmetric supercapacitor (ASC) is assembled, and achieves high specific energy of 34.2 Wh kg-1 and high specific power of 9.58 kW kg-1. The results of this study demonstrate great potential of combining biomass-derived porous carbon with metal oxides.
G2 and G3 reactors design; Description des reacteurs G2 et G3
Energy Technology Data Exchange (ETDEWEB)
Herreng,; Ertaud,; Pasquet, [Societe Alsacienne de Constructions Mecaniques (France)
1958-07-01
'FRANCE ATOME' Manufacturers Party has been entrusted with the G2 and G3 reactors engineering by the french A.E.C., for the first-five-year french project. Although these reactors are essentially plutonium generators, everyone has been linked with a power station which is supposed to supply with 40 MW, 'Electricite de France' has taken the liability upon itself. The reactor core includes most of G1 reactor parts (central gap excluded): horizontal channels, graphite parallelepipedic bricks stacking, steel thermal shield. The cooling is provided with CO{sub 2} under a 15 atmospheres pressure. This pressure is kept steady in a press-stressed concrete packing-case which is a cylinder horizontally shaped. Steel strips tightened encircle the concrete cylinder; itself protected by sole-plates. The cylinder bottom has brought about unusual problems which have been solved by the choice of an hemispheric shape. Packing-case tightness is provided by a 30 mm iron-plate connected with the inner wall of concrete. One of the reactor's special characteristics is the possibility of loading and unloading while operating. On loading side, barrel locks, each weighting 50 tons, allow new cans, at a pressure of 15 atmospheres, to pass. The cans process almost in a steady way through the channel, and finally drop down through bent spouts, then through spiral toboggans into a new lock. The cooling CO{sub 2} flow is provided with 3 turbo-bellows, these are actuated by average pressure-steam, obtained from exchangers. Every reactor supplies 4 exchangers which have been very difficult to build and to set up. The secondary cycle is standard and contains 3 stages (pressure 10,3: 2 and 0,5 kg/cm{sup 2}). Steam can be condensed in the event of a group turbo-generator stopping, with no modifion for the normal operating conditions of the reactor. Auxiliary circuits have to assure the continuous purifying of cooling CO{sub 2}, its storage and drain. 49 boron carbide rods are used to control the
g-factor of the 7/2+ isomeric bandhead in 175 W
International Nuclear Information System (INIS)
Ionescu-Bujor, M.; Iordachescu, A.; Marginean, N.; Brandolini, F.; Pavan, P.; Lenzi, S.M.; De Poli, M.; Gadea, A.; Martinez, T.; Medina, N.H.; Ribas, R.V.; Podolyak, Zs.
2000-01-01
Considerable effort is presently devoted to the investigation of the high-K isomers of multi-quasiparticle intrinsic structure systematically found in the deformed nuclei with Z=72-76 of the A ≅ 180 mass region. The configuration assignments for these isomers are based on measured static moments, as well as, on experimental branching ratios in the associated bands, from which (g K - g R )/Q 0 are derived. In the multi-quasiparticle state g-factor calculations, values taken from neighbouring odd-mass nuclei are generally used for the proton and neutron deformed single-particle g-factors. A good knowledge of these quantities is required for reliable high-K state g-factor evaluations. In the present work we report on the g-factor measurement for the low-lying J π = 7/2 + isomer bandhead in 175 W described by the neutron 7/2 + [633] Nilsson orbital. The isomeric state was populated in the 164 Dy( 16 O,5n) 175 W reaction using the 83 MeV pulsed 16 O beam (pulse width 1.5 ns, repetition period 800 ns) delivered by the LNL XTU-Tandem. The target consisted of 0.5 mg/cm 2 metallic 164 Dy on thick Pb backing which stopped the recoiling 175 W nuclei and the 16 O beam. The target was placed in an external magnetic field of 27.2(6) kG whose direction was periodically reversed. The 7/2 + isomeric state with T 1/2 = 216(6) ns and E x =234.9 keV de-excites by a dipole transition of 130.9 keV to the 5/2 - level. The angular distribution of the 130.9 keV gamma-ray has been observed time-differentially by using two planar Ge detectors placed at ± 135 angle with respect to the beam direction. The background corrected time spectra I(t,θ) obtained for the magnetic field direction up and down were used to form the experimental modulation ratio R exp (t)=[I↑(t,θ) - I ↓ (t,θ)]/[I↑(t,θ) + I ↓ (t,θ)]. The modulation pattern revealed Larmor oscillations with an amplitude strongly attenuated in time. The observed damping of the anisotropy has been attributed to quadrupole
Irradiated graphite studies prior to decommissioning of G1, G2 and G3 reactors
International Nuclear Information System (INIS)
Bonal, J.P.; Vistoli, J.Ph.; Combes, C.
2005-01-01
G1 (46 MW th ), G2 (250 MW th ) and G3 (250 MW th ) are the first French plutonium production reactors owned by CEA (Commissariat a l'Energie Atomique). They started to be operated in 1956 (G1), 1959 (G2) and 1960 (G3); their final shutdown occurred in 1968, 1980 and 1984 respectively. Each reactor used about 1200 tons of graphite as moderator, moreover in G2 and G3, a 95 tons graphite wall is used to shield the rear side concrete from neutron irradiation. G1 is an air cooled reactor operated at a graphite temperature ranging from 30 C to 230 C; G2 and G3 are CO 2 cooled reactors and during operation the graphite temperature is higher (140 C to 400 C). These reactors are now partly decommissioned, but the graphite stacks are still inside the reactors. The graphite core radioactivity has decreased enough so that a full decommissioning stage may be considered. Conceming this decommissioning, the studies reported here are: (i) stored energy in graphite, (ii) graphite radioactivity measurements, (iii) leaching of radionuclide ( 14 C, 36 Cl, 63 Ni, 60 Co, 3 H) from graphite, (iv) chlorine diffusion through graphite. (authors)
G{sub 2}-structures and quantization of non-geometric M-theory backgrounds
Energy Technology Data Exchange (ETDEWEB)
Kupriyanov, Vladislav G. [Centro de Matemática, Computação e Cognição, Universidade de Federal do ABC,Santo André, SP (Brazil); Tomsk State University,Tomsk (Russian Federation); Szabo, Richard J. [Department of Mathematics, Heriot-Watt University,Colin Maclaurin Building, Riccarton, Edinburgh EH14 4AS (United Kingdom); Maxwell Institute for Mathematical Sciences,Edinburgh (United Kingdom); The Higgs Centre for Theoretical Physics,Edinburgh (United Kingdom)
2017-02-20
We describe the quantization of a four-dimensional locally non-geometric M-theory background dual to a twisted three-torus by deriving a phase space star product for deformation quantization of quasi-Poisson brackets related to the nonassociative algebra of octonions. The construction is based on a choice of G{sub 2}-structure which defines a nonassociative deformation of the addition law on the seven-dimensional vector space of Fourier momenta. We demonstrate explicitly that this star product reduces to that of the three-dimensional parabolic constant R-flux model in the contraction of M-theory to string theory, and use it to derive quantum phase space uncertainty relations as well as triproducts for the nonassociative geometry of the four-dimensional configuration space. By extending the G{sub 2}-structure to a Spin(7)-structure, we propose a 3-algebra structure on the full eight-dimensional M2-brane phase space which reduces to the quasi-Poisson algebra after imposing a particular gauge constraint, and whose deformation quantisation simultaneously encompasses both the phase space star products and the configuration space triproducts. We demonstrate how these structures naturally fit in with previous occurences of 3-algebras in M-theory.
A Precise Measurement of the Spin Structure Functions G**P(2) G**D(2) from SLAC Experiment E155X
Energy Technology Data Exchange (ETDEWEB)
McNulty, D
2003-12-18
A precision measurement of the deep inelastic polarized structure functions g{sub 2}{sup p} (x, Q{sup 2}) and g{sub 2}{sup d} (x, Q{sup 2}) and the virtual photon asymmetries A{sub 2}{sup p}(x, Q{sup 2}) and A{sub 2}{sup d}(x, Q{sup 2}) has been made by the E155x collaboration in the ranges 0.02 < x < 0.8 and 0.7 (GeV/c){sup 2} < Q{sup 2} < 20 (GeV/c){sup 2}. The transverse asymmetry (A{sub {perpendicular}}) was measured at SLAC using 29.1 and 32.3 GeV longitudinally polarized electrons incident on transversely polarized target protons and deuterons; the scattered electrons were detected by three fixed angle spectrometers at 2.75{sup o}, 5.5{sup o}, and 10.5{sup o} from the beam line. g{sub 2} was extracted using the measured A{sub {perpendicular}}, an E155 phenomenological fit to g{sub 1}/F{sub 1}, and the SLAC fit to R(x, Q{sup 2}); the function F{sub 1} was obtained from the most recent NMC fit to F{sub 2}(x, Q{sup 2}). The errors on g{sub 2} for both proton and deuteron are more than three times smaller than those of the previously existing world data set, thus enabling the data to resolve clearly between g{sub 2}{sup ww} and zero as well as make distinctions between various models. In addition, the Burkhardt-Cottingham and Efremov-Leader-Teryaev sum rules were evaluated over the measured kinematic region, as well as the d{sub 2} twist-3 matrix element for the proton and neutron.
Li, Cynthia H; Narhi, Linda O; Wen, Jie; Dimitrova, Mariana; Wen, Zai-qing; Li, Jenny; Pollastrini, Joseph; Nguyen, Xichdao; Tsuruda, Trace; Jiang, Yijia
2012-12-18
The circulation half-life of a potential therapeutic can be increased by fusing the molecule of interest (an active peptide, the extracellular domain of a receptor, an enzyme, etc.) to the Fc fragment of a monoclonal antibody. For the fusion protein to be a successful therapeutic, it must be stable to process and long-term storage conditions, as well as to physiological conditions. The stability of the Fc used is critical for obtaining a successful therapeutic protein. The effects of pH, temperature, and salt on the stabilities of Escherichia coli- and Chinese hamster ovary cell (CHO)-derived IgG1 Fc high-order structure were probed using a variety of biophysical techniques. Fc molecules derived from both E. coli and CHO were compared. The IgG1 Fc molecules from both sources (glycosylated and aglycosylated) are folded at neutral pH and behave similarly upon heat- and low pH-induced unfolding. The unfolding of both IgG1 Fc molecules occurs via a multistep unfolding process, with the tertiary structure and C(H)2 domain unfolding first, followed by changes in the secondary structure and C(H)3 domain. The acid-induced unfolding of IgG1 Fc molecules is only partially reversible, with the formation of high-molecular weight species. The CHO-derived Fc protein (glycosylated) is more compact (smaller hydrodynamic radius) than the E. coli-derived protein (aglycosylated) at neutral pH. Unfolding is dependent on pH and salt concentration. The glycosylated C(H)2 domain melts at a temperature 4-5 °C higher than that of the aglycosylated domain, and the low-pH-induced unfolding of the glycosylated Fc molecule occurs at a pH ~0.5 pH unit lower than that of the aglycosylated protein. The difference observed between E. coli- and CHO-derived Fc molecules primarily involves the C(H)2 domain, where the glycosylation of the Fc resides.
Directory of Open Access Journals (Sweden)
María Garcés Quílez
2018-04-01
Full Text Available In response to climate change, which is caused by the increasing pollution of the environment and leads to the deterioration of human health, future electricity generations should reduce reliance on fossil fuels by growing the use of clean and renewable energy generation sources and by using clean vehicle technologies. Battery storage systems have been recognized as one of the most promising approaches for supporting the renewable energy generation sources and cleanly powering vehicles instead of burning gasoline and diesel fuel. However, the cost of batteries is still a prominent barrier for their use in stationary and traction applications. As a rule, the cost of batteries can be decreased by lowering material costs, enhancing process efficiencies, and increasing production volume. Another more effective solution is called Vehicle-to-grid (V2G application. In V2G application, the battery system can be used to support the grid services, whereas the battery is still in the vehicle. To make a battery system economically viable for V2G/G2V applications, an effective power-electronics converter should be selected as well. This converter should be supported by an advanced control strategy. Therefore, this article provides a detailed technical assessment and review of V2G/G2V concepts, in conjunction with various power-electronics converter topologies. In this paper, modeling and detailed control strategies are fully designed and investigated in terms of dynamic response and harmonics. Furthermore, an extensive design and analysis of charging systems for low-duty/high-duty vehicles are also presented.
Pappas, Iraklis; Chirik, Paul J
2016-10-03
The hydrogenolysis of titanium-nitrogen bonds in a series of bis(cyclopentadienyl) titanium amides, hydrazides and imides by proton coupled electron transfer (PCET) is described. Twelve different N-H bond dissociation free energies (BDFEs) among the various nitrogen-containing ligands were measured or calculated, and effects of metal oxidation state and N-ligand substituent were determined. Two metal hydride complexes, (η 5 -C 5 Me 5 )(py-Ph)Rh-H (py-Ph = 2-pyridylphenyl, [Rh]-H) and (η 5 -C 5 R 5 )(CO) 3 Cr-H ([Cr] R -H, R= H, Me) were evaluated for formal H atom transfer reactivity and were selected due to their relatively weak M-H bond strengths yet ability to activate and cleave molecular hydrogen. Despite comparable M-H BDFEs, disparate reactivity between the two compounds was observed and was traced to the vastly different acidities of the M-H bonds and overall redox potentials of the molecules. With [Rh]-H, catalytic syntheses of ammonia, silylamine and N,N-dimethylhydrazine have been accomplished from the corresponding titanium(IV) complex using H 2 as the stoichiometric H atom source. The data presented in this study provides the thermochemical foundation for the synthesis of NH 3 by proton coupled electron transfer at a well-defined transition metal center.
Directory of Open Access Journals (Sweden)
Junbang Wang
2014-03-01
Full Text Available Gross primary production (GPP plays an important role in the net ecosystem exchange of CO2 between the atmosphere and terrestrial ecosystems. It is particularly important to monitor GPP in Southeast Asia because of increasing rates of tropical forest degradation and deforestation in the region in recent decades. The newly available, improved, third generation Normalized Difference Vegetation Index (NDVI3g from the Global Inventory Modelling and Mapping Studies (GIMMS group provides a long temporal dataset, from July 1981 to December 2011, for terrestrial carbon cycle and climate response research. However, GIMMS NDVI3g-based GPP estimates are not yet available. We applied the GLOPEM-CEVSA model, which integrates an ecosystem process model and a production efficiency model, to estimate GPP in Southeast Asia based on three independent results of the fraction of photosynthetically active radiation absorbed by vegetation (FPAR from GIMMS NDVI3g (GPPNDVI3g, GIMMS NDVI1g (GPPNDVI1g, and the Moderate Resolution Imaging Spectroradiometer (MODIS MOD15A2 FPAR product (GPPMOD15. The GPP results were validated using ground data from eddy flux towers located in different forest biomes, and comparisons were made among the three GPPs as well as the MOD17A2 GPP products (GPPMOD17. Based on validation with flux tower derived GPP estimates the results show that GPPNDVI3g is more accurate than GPPNDVI1g and is comparable in accuracy with GPPMOD15. In addition, GPPNDVI3g and GPPMOD15 have good spatial-temporal consistency. Our results indicate that GIMMS NDVI3g is an effective dataset for regional GPP simulation in Southeast Asia, capable of accurately tracking the variation and trends in long-term terrestrial ecosystem GPP dynamics.
Measuring the performance of G2G services in Iran
Zarei, Behrouz; Safdari, Maryam
To highlight the growth of e-government and the importance of its services it is essential to evaluate the performance of the service delivery to customers. Research indicates that traditional performance indexes are not suitable for this evaluation; moreover, it is noticeable that the e-government services are intangible and invisible. Among different e-government services, measurement of quality government to government (G2G) services has been less attractive for researchers while crucial for government policy-makers. This calls for a better understanding of the specific needs of users of these services in order to provide appropriate type and level of services that meets those needs. In this paper, the performance of the G2G services is measured in the Iranian context. For this purpose, SERVQUAL, which is a well-known method for assessing service quality, is employed. This study proposes and tests a five-factor of SERVQUAL instrument to explain user satisfaction and gap analysis, between expectations and perceptions of its customers, consisting thirty ministries and main governmental organizations. Based on a Chi-square test, factor analysis, gap analysis and correlations, it is concluded the gap between expectations and perceptions of G2G customers is significant and customer satisfaction of G2G services is at low level.
Energy Technology Data Exchange (ETDEWEB)
Liu Ge [Department of Chemistry, Chifeng University, Chifeng 024000 (China); Shao Jie, E-mail: njshao@live.c [Department of Chemistry and Materials Science, Nanjing Forestry University, Nanjing 210037 (China)
2011-07-15
A C{sub 2}-symmetric fluorescence and colorimetric anion sensor (1) based on pyrrole derivative was designed and synthesized according to binding site-signaling subunit approach. The compound 1 was easily prepared by reaction of pyrrole-2,5-dicarboxaldehyde with 4-nitrophenylhydrazine in ethanol (yield=78%). In DMSO, the sensor 1 exhibited a visible color change from red to brown upon exposure to anions such as AcO{sup -} and F{sup -}; however, no obvious color changes were observed when the other tested anions (e. g. H{sub 2}PO{sub 4}{sup -}, Cl{sup -}, Br{sup -} and I{sup -}) were added. There was a significant redshift ({Delta}{lambda}{sub max}=160 nm) in UV-vis spectrum during UV-vis spectral titrations. In particular, the sensor 1 showed ratiometric fluorescence responses to anions. - Highlights: {yields} C{sub 2}-symmetric fluorescence and colorimetric anion sensor based on pyrrole derivative was designed and synthesized according to binding site-signaling subunit approach. {yields} The sensor was easily prepared by reaction of pyrrole-2,5-dicarboxaldehyde with 4-nitrophenylhydrazine in ethanol (yield=78%). {yields} In DMSO, the sensor exhibited a visible color change from red to brown upon exposure to anions such as AcO{sup -} and F{sup -}, however, no obvious color changes were observed when the other anions tested (e. g. H{sub 2}PO{sub 4}{sup -}, Cl{sup -}, Br{sup -} and I{sup -}) were added. {yields} The sensor showed ratiometric fluorescence responses to anions.
MoS{sub 2}/cotton-derived carbon fibers with enhanced cyclic performance for sodium-ion batteries
Energy Technology Data Exchange (ETDEWEB)
Li, Xiang [School of Materials Science and Engineering, Guangdong Provincial Key Laboratory of Advanced Energy Storage Materials, South China University of Technology, Guangzhou, 510641 (China); Yang, Yan [School of Electrical Engineering, Southwest Jiaotong University, Chengdu, 610031 (China); Liu, Jiangwen; Ouyang, Liuzhang; Liu, Jun; Hu, Renzong [School of Materials Science and Engineering, Guangdong Provincial Key Laboratory of Advanced Energy Storage Materials, South China University of Technology, Guangzhou, 510641 (China); Yang, Lichun, E-mail: mslcyang@scut.edu.cn [School of Materials Science and Engineering, Guangdong Provincial Key Laboratory of Advanced Energy Storage Materials, South China University of Technology, Guangzhou, 510641 (China); Zhu, Min [School of Materials Science and Engineering, Guangdong Provincial Key Laboratory of Advanced Energy Storage Materials, South China University of Technology, Guangzhou, 510641 (China)
2017-08-15
Highlights: • MoS{sub 2} nanosheets vertically grow on cotton-derived carbon microfibers. • The carbon fibers facilitate charge transfer and structure stabilization. • The MoS{sub 2}/CDCFs exhibit enhanced cyclic performance for reversible Na{sup +} storage. - Abstract: Carbon fibers derived from bio-template are low cost and environmental benign, therefore have attracted much attention in energy storage materials. In this work, we successfully fabricated MoS{sub 2}/cotton-derived carbon fibers (MoS{sub 2}/CDCFs) via hydrothermal route followed by carbonization process. In the composite of MoS{sub 2}/CDCFs, MoS{sub 2} nanosheets vertically grow on the carbon fibers which offer fast ways for electron transfer and at the same time act as robust support to buffer the volume changes of MoS{sub 2} nanosheets during discharge/charge cycles. As anode materials for sodium-ion batteries, MoS{sub 2}/CDCFs exhibit good rate performance and markedly enhanced cyclic stability due to the conductive support of CDCFs. At a current density of 0.1 A g{sup −1}, the MoS{sub 2}/CDCFs-1 shows an initial reversible capacity of 504.9 mAh g{sup −1}, and maintains 444.5 mAh g{sup −1} after 50 cycles. Even when the current density increases to 0.5 A g{sup −1}, it maintains 323.1 mAh g{sup −1} after 150 cycles, which is much higher than the capacity retention of 149.6 mAh g{sup −1} for the bare MoS{sub 2} nanosheets. The improved electrochemical performance verifies the effective strategy of using cotton as carbon source to construct hierarchical composites for sodium-ion batteries.
Synthesis and structure of new 4-amino-5-(2-R1-phenyl-1,2,4-triazole-3-thiol alkilderivatives
Directory of Open Access Journals (Sweden)
Ye. S. Pruglo
2017-08-01
Full Text Available Chemistry of heterocyclic systems is a separate branch of organic chemistry with a long history and future prospects. The ring system of 1,2,4-triazole continuously attracts the interest of chemists, pharmacologists and pharmacists in finding medicinal compounds through its universal potential interactions with biological systems. Today it is known that 1,2,4-triazole derivatives have antibacterial, antifungal, antiinflammatory, anticonvulsant, antiviral, antituberculosis, antioxidant, anticancer and antitumor activities. They also have analgesic, local anesthetic, antimalarial, antiproliferative effects, antihypertensive, antidepressant, sedative, antihistamine, hepatoprotective, hypoglycemic, diuretic, antipyretic and countless number of action types. Therefore, the search of biologically active remedies and creating of new drugs on its base is highly efficient topical issue of medical and pharmaceutical work. The purpose of these studies is the synthesis, establishment of physical-chemical parameters of new 4-amino-5-(2-R1-phenyl-1,2,4-triazole-3-thiol alkylderivatives. Materials and methods. The studying of physical and chemical properties of compounds was made in accordance with the methods described in the State Pharmacopoeia of Ukraine 2.0. The melting point was determined on an automatic gear MPA100. The elemental composition of the compounds was set on the analyzer Elementar Vario EL cube. 1H NMR spectra were recorded using the spectrometer Varian Mercury VX-200 (1H, 200 MHz and decrypted by a computer program SpinWorks 3.1.8. Chromatography-mass spectral studies were carried out in the gas-liquid chromatograph Agilent 1260 Infinity HPLC equipped with a mass spectrometer Agilent 6120 (in electrospray ionization (ESI. Results. 4-amino-5-phenyl-4H-1,2,4-triazole-3-thiol and 4-amino-5-(2-bromophenyl-4H-1,2,4-triazol-3-thiol were used as the initial materials. These compounds were obtained by reaction of benzoic acid hydrazide and 2
A monoclinic polymorph of (1E,5E)-1,5-bis-(2-hy-droxy-benzyl-idene)thio-carbono-hydrazide.
Schmitt, Bonell; Gerber, Thomas; Hosten, Eric; Betz, Richard
2011-08-01
The title compound, C(15)H(14)N(4)O(2)S, is a derivative of thio-ureadihydrazide. In contrast to the previously reported polymorph (ortho-rhom-bic, space group Pbca, Z = 8), the current study revealed monoclinic symmetry (space group P2(1)/n, Z = 4). The mol-ecule shows non-crystallographic C(2) as well as approximate C(s) symmetry. Intra-molecular bifurcated O-H⋯(N,S) hydrogen bonds, are present. In the crystal, inter-molecular N-H⋯S hydrogen bonds and C-H⋯π contacts connect the mol-ecules into undulating chains along the b axis. The shortest centroid-centroid distance between two aromatic systems is 4.5285 (12) Å.
Xiao, Ni; Deng, Jian; Huang, Kaihui; Ju, Saiqin; Hu, Canhui; Liang, Jun
2014-07-15
Two novel methods, first derivative spectrophotometric method ((1)D) and first derivative ratio spectrophotometric method ((1)DR), have been developed for the simultaneous trace determination of rhodamine B (RhB) and rhodamine 6G (Rh6G) in food samples after dispersive liquid-liquid microextraction (DLLME). The combination of derivative spectrophotometric techniques and DLLME procedure endows the presented methods with enhanced sensitivity and selectivity. Under optimum conditions, the linear calibration curves ranged from 5 to 450 ng mL(-1), with the correlation coefficients (r) of 0.9997 for RhB and 0.9977 for Rh6G by (1)D method, and 0.9987 for RhB and 0.9958 for Rh6G by (1)DR method, respectively. The calculated limits of detection (LODs) based on the variability of the blank solutions (S/N = 3 criterion) for 11 measurements were in the range of 0.48-1.93 ng mL(-1). The recoveries ranged from 88.1% to 111.6% (with RSD less than 4.4%) and 91.5-110.5% (with RSD less than 4.7%) for (1)D and (1)DR method, respectively. The influence of interfering substances such as foreign ions and food colorants which might be present in the food samples on the signals of RhB and Rh6G was examined. The developed methods have been successfully applied to the determination of RhB and Rh6G in black tea, red wine and chilli powder samples with the characteristics of simplicity, cost-effectiveness, environmental friendliness, and could be valuable for routine analysis. Copyright © 2014 Elsevier B.V. All rights reserved.
Functional analysis of two PLA2G2A variants associated with secretory phospholipase A2-IIA levels.
Directory of Open Access Journals (Sweden)
Holly J Exeter
Full Text Available Secretory phospholipase A2 group IIA (sPLA2-IIA has been identified as a biomarker of atherosclerosis in observational and animal studies. The protein is encoded by the PLA2G2A gene and the aim of this study was to test the functionality of two PLA2G2A non-coding SNPs, rs11573156 C>G and rs3767221 T>G where the rare alleles have been previously associated with higher and lower sPLA2-IIA levels respectively.Luciferase assays, electrophoretic mobility shift assays (EMSA, and RNA expression by RT-PCR were used to examine allelic differences. For rs3767221 the G allele showed ∼55% lower luciferase activity compared to the T allele (T = 62.1 (95% CI 59.1 to 65.1 G = 27.8 (95% CI 25.0 to 30.6, p = 1.22×10⁻³⁵, and stronger EMSA binding of a nuclear protein compared to the T-allele. For rs11573156 C >G there were no luciferase or EMSA allelic differences seen. In lymphocyte cell RNA, from individuals of known rs11573156 genotype, there was no allelic RNA expression difference for exons 5 and 6, but G allele carriers (n = 7 showed a trend to lower exon 1-2 expression compared to CC individuals. To take this further, in the ASAP study (n = 223, an rs11573156 proxy (r² = 0.91 showed ∼25% higher liver expression of PLA2G2A (1.67×10⁻¹⁷ associated with the G allele. However, considering exon specific expression, the association was greatly reduced for exon 2 (4.5×10⁻⁵ compared to exons 3-6 (10⁻¹⁰ to 10⁻²⁰, suggesting rs11573156 G allele-specific exon 2 skipping.Both SNPs are functional and provide useful tools for Mendelian Randomisation to determine whether the relationship between sPLA2-IIA and coronary heart disease is causal.
Electronic spectra and DFT calculations of some pyrimido[1,2-a]benzimidazole derivatives
Elshakre, Mohamed E.; Moustafa, H.; Hassaneen, Huwaida. M. E.; Moussa, Abdelrahim. Z.
2015-06-01
Ground state properties of 2,4-diphenyl-1,4-dihydrobenzo[4,5]imidazo[1,2-a]pyrimidine, compound 1, and its derivatives are investigated experimentally and theoretically in Dioxane and DMF. The calculations show that all the studied compounds (1-7) are non-planar, resulting in a significant impact on the electronic and structural properties. The ground state properties of compounds 1-7 at B3LYP/6-311G (d, p) show that compound 5 has the lowest EHOMO, ELUMO, and ΔE indicating highest reactivity. Compound 7 is found to have the highest polarity. The observed UV spectra in Dioxane and DMF of compounds 1-4 show 2 bands, while compounds 5-7 show 4 bands in both solvents. Band maxima (λmax) and intensities of the spectra are found to have solvent dependence reflected as blue and red shifts. The theoretical spectra computed at TD-B3LYP/6-311G (d, p) in gas phase, Dioxane and DMF indicate a good agreement with the observed spectra.
Directory of Open Access Journals (Sweden)
Luciane Mie Kawashima
2006-09-01
Full Text Available Levantamentos de ocorrência de micotoxinas em alimentos foram realizados nas últimas duas décadas nas regiões Sudeste e Sul do Brasil. Levantamentos em alimentos comercializados em outras regiões têm-se limitado a aflatoxinas em amendoim e castanhas do Brasil. O presente trabalho pesquisou a presença de fumonisina B1, aflatoxinas B1, B2, G1 e G2, ocratoxina A e zearalenona em 74 amostras de produtos a base de milho adquiridas no comércio da cidade de Recife, PE, durante o período de 1999 a 2001. Fumonisina B1 foi determinada por cromatografia líquida de alta eficiência com detecção por fluorescência e as demais toxinas foram determinadas por cromatografia em camada delgada. Fumonisina B1 foi encontrada em 94,6% das amostras em concentrações variando de 20 a 8600 µg/kg. Apenas 5 amostras continham aflatoxina B1 e o teor máximo encontrado foi 20 µg/kg. Duas amostras ultrapassaram o limite de 20 µg/kg para a somatória das aflatoxinas B1, B2, G1 e G2 (farinha de milho pré-cozida com 21,5 µg/kg e quirera (xerém com 23,3 µg/kg. As aflatoxinas G1 e G2, ocratoxina A e zearalenona não foram detectadas em nenhuma das amostras. Todas as amostras contaminadas com aflatoxinas também apresentaram fumonisina B1.Research concerning the presence of mycotoxin in food has been conducted in the Southwest and South regions of Brazil over the last two decades. Research in other regions has been limited to aflatoxin in peanuts and Brazil nuts. The aim of this work is to study the presence of fumonisin B1, aflatoxins B1, B2, G1, and G2, ochratoxin A and zearalenone in 74 samples of corn products acquired in shops and food markets in the city of Recife (PE from 1999 to 2001. Fumonisin B1 was determined by high performance liquid chromatography and fluorescence was detected. The other toxins were determined by thin layer chromatography. Fumonisin B1 was found in 94.6% of the samples in levels from 20 to 8600 µg/kg. Only 5 samples contained
International Nuclear Information System (INIS)
Cacciatori, Sergio L.; Cerchiai, Bianca L.; Della Vedova, Alberto; Ortenzi, Giovanni; Scotti, Antonio
2005-01-01
We provide a simple coordinatization for the group G 2 , which is analogous to the Euler coordinatization for SU(2). We show how to obtain the general element of the group in a form emphasizing the structure of the fibration of G 2 with fiber SO(4) and base H, the variety of quaternionic subalgebras of octonions. In particular this allows us to obtain a simple expression for the Haar measure on G 2 . Moreover, as a by-product it yields a concrete realization and an Einstein metric for H
Synthesis and anticonvulsant activity of some 2-pyrazolines derived from chalcones
Directory of Open Access Journals (Sweden)
Nagihan Beyhan
2017-05-01
All compounds were tested for their anticonvulsant activity using pentylenetetrazole induced seizure (PTZ and maximal electroshock seizure (MES tests in mice at a dose level of 50 mg/kg. Among the 2-pyrazoline-1-carbothioamide derivatives, 5-(2,6-dichlorophenyl-3-(thiophen-2-yl-4,5-dihydro-1H-pyrazole-1-carbothioamide (2e reduced grade-5 seizure activity and also increased survival rate in PTZ test. In MES test, 5-(4-methoxyphenyl-3-[4-(methylsulphonylphenyl]-4,5-dihydro-1H-pyrazole-1-carbothioamide(2g has not only decreased seizure severity, but also increased survival rate. Among the 2-pyrazoline-1-carboxamide derivatives, 3-(5-bromothiophen-2-yl-N-(4-chlorophenyl-5-(2,6-dichlorophenyl-4,5-dihydro-1H-pyrazole-1-carboxamide (3d having 5-bromothiophen and 2,6-dichlorophenyl moieties and N-(4-chlorophenyl-5-(2,6-dichlorophenyl-3-(5-chlorothiophen-2-yl-4,5-dihydro-1H-pyrazole-1-carboxamide (3e having 5-chlorothiophen and 2,6-dichlorophenyl moieties showed remarkable activities in PTZ test. Among all tested derivatives, compound 3d was found to be the most active one and reduced grade-5 seizure severity and also increased survival rate.
Edwards, Noel; Anderson, Catriona M H; Gatfield, Kelly M; Jevons, Mark P; Ganapathy, Vadivel; Thwaites, David T
2011-01-01
The H(+)-coupled amino acid transporter PAT2 (SLC36A2) transports the amino acids proline, glycine, alanine and hydroxyproline. A physiological role played by PAT2 in amino acid reabsorption in the renal proximal tubule is demonstrated by mutations in SLC36A2 that lead to an iminoglycinuric phenotype (imino acid and glycine uria) in humans. A number of proline, GABA and tryptophan derivatives were examined to determine if they function either as transported substrates or non-transported inhibitors of PAT2. The compounds were investigated following heterologous expression of rat PAT2 in Xenopus laevis oocytes. PAT2 function was characterised by: radiotracer uptake and competition (cis-inhibition) studies; radiotracer efflux and trans-stimulation; and measurement of substrate-induced positive inward current by two-electrode voltage-clamp. In general, the proline derivatives appeared to be transported substrates and the relative ability to induce current flow was closely related to the inhibitory effects on PAT2-mediated l-[(3)H]proline uptake. In contrast, certain heterocyclic GABA derivatives (e.g. l-pipecolic acid) were translocated only slowly. Finally, the tryptophan derivatives inhibited PAT2 function but did not undergo transport. l-Proline uptake was inhibited by 5-hydroxy-l-tryptophan (IC(50) 1.6±0.4mM), α-methyl-d,l-tryptophan (3.5±1.5mM), l-tryptophan, 1-methyl-l-tryptophan and indole-3-propionic acid. Although neither 5-hydroxy-l-tryptophan nor α-methyl-d,l-tryptophan were able to elicit inward current in PAT2-expressing oocytes both reduced the current evoked by l-proline. 5-Hydroxy-l-tryptophan and α-methyl-d,l-tryptophan were unable to trans-stimulate l-proline efflux from PAT2-expressing oocytes, confirming that the two compounds act as non-transported blockers of PAT2. These two tryptophan derivatives should prove valuable experimental tools in future investigations of the physiological roles of PAT2. Copyright © 2010 Elsevier B.V. All rights
Synthesis and Antibacterial Evaluation of New N-acylhydrazone Derivatives from Dehydroabietic Acid
Directory of Open Access Journals (Sweden)
Chenhai Gu
2012-04-01
Full Text Available A series of new N-acylhydrazone derivatives were synthesized in good yields through the reactions of dehydroabietic acid hydrazide with a variety of substituted arylaldehydes. The structures of the synthesized compounds were confirmed by IR, 1H- and 13C-NMR, ESI-MS, elemental analysis and single crystal X-ray diffraction. From the crystal structure of compound 4l, the C=N double bonds of these N-acylhydrazones showed (E-configuration, while the NMR data of compounds 4a–q indicated the existence of two rotamers for each compound in solution. The target compounds were evaluated for their antibacterial activities against four microbial strains. The result suggested that several compounds exhibited pronounced antibacterial activities. Particularly, compound 4p exhibited good antibacterial activity against Staphylococcus aureus and Bacillus subtilis comparable to positive control. The possible antibacterial metabolism and the strategy for further optimization of this compound were also discussed.
Toledo, Thaís Regina; Dejani, Naiara N.; Monnazzi, Luis Gustavo Silva; Kossuga, Miriam H.; Berlinck, Roberto G. S.; Sette, Lara D.; Medeiros, Alexandra I.
2014-01-01
Very little is known about the immunomodulatory potential of secondary metabolites isolated from marine microorganisms. In the present study, we characterized pyrenocine A, which is produced by the marine-derived fungus Penicillium paxilli Ma(G)K and possesses anti-inflammatory activity. Pyrenocine A was able to suppress, both pretreatment and posttreatment, the LPS-induced activation of macrophages via the inhibition of nitrite production and the synthesis of inflammatory cytokines and PGE2. Pyrenocine A also exhibited anti-inflammatory effects on the expression of receptors directly related to cell migration (Mac-1) as well as costimulatory molecules involved in lymphocyte activation (B7.1). Nitrite production was inhibited by pyrenocine A in macrophages stimulated with CpG but not Poly I:C, suggesting that pyrenocine A acts through the MyD88-dependent intracellular signaling pathway. Moreover, pyrenocine A is also able to inhibit the expression of genes related to NFκB-mediated signal transduction on macrophages stimulated by LPS. Our results indicate that pyrenocine A has promissory anti-inflammatory properties and additional experiments are necessary to confirm this finding in vivo model. PMID:24574582
Liu, Xinyi; Uemura, Akiyoshi; Fukushima, Yoko; Yoshida, Yutaka; Hirashima, Masanori
2016-11-22
The vertebrate circulatory system is composed of closely related blood and lymphatic vessels. It has been shown that lymphatic vascular patterning is regulated by blood vessels during development, but its molecular mechanisms have not been fully elucidated. Here, we show that the artery-derived ligand semaphorin 3G (Sema3G) and the endothelial cell receptor PlexinD1 play a role in lymphatic vascular patterning. In mouse embryonic back skin, genetic inactivation of Sema3G or PlexinD1 results in abnormal artery-lymph alignment and reduced lymphatic vascular branching. Conditional ablation in mice demonstrates that PlexinD1 is primarily required in lymphatic endothelial cells (LECs). In vitro analyses show that Sema3G binds to neuropilin-2 (Nrp2), which forms a receptor complex with PlexinD1. Sema3G induces cell collapse in an Nrp2/PlexinD1-dependent manner. Our findings shed light on a molecular mechanism by which LECs are distributed away from arteries and form a branching network during lymphatic vascular development. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.
Tan, Wei; Yi, Long; Zhu, Zhentao; Zhang, Lulu; Zhou, Jiang; Yuan, Gu
2018-03-01
A guanine-rich human mature microRNA, miR-1587, was discovered to form stable intramolecular G-quadruplexes in the presence of K + , Na + and low concentration of NH 4 + (25mM) by electrospray ionization mass spectrometry (ESI-MS) combined with circular dichroism (CD) spectroscopy. Furthermore, under high concentration of NH 4 + (100mM) or molecular crowding environments, miR-1587 formed a dimeric G-quadruplex through 3'-to-3' stacking of two monomeric G-quadruplex subunits with one ammonium ion sandwiched between the interfaces. Specifically, two synthesized jatrorrhizine derivatives with terminal amine groups could also induce the dimerization of miR-1587 G-quadruplex and formed 1:1 and 2:1 complexes with the dimeric G-quadruplex. In contrast, jatrorrhizine could bind with the dimeric miR-1587 G-quadruplex, but could not induce dimerization of miR-1587 G-quadruplex. These results provide a new strategy to regulate the functions of miR-1587 through induction of G-quadruplex formation and dimerization. Copyright © 2017 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Hall, Vanessa Jane; Jacobsen, J.; Gunnarsson, A.
2011-01-01
Production of hemizygous and homozygous embryonic stem cell-derived neural progenitor cells from the transgenic alszheimer göttingen minipis......Production of hemizygous and homozygous embryonic stem cell-derived neural progenitor cells from the transgenic alszheimer göttingen minipis...
Energy Technology Data Exchange (ETDEWEB)
Estournel, R [Commissariat a l' Energie Atomique. Centre de Production de Plutonium de Marcoule, 30 - Chusclan (France)
1962-07-01
In a reactor of the G 2-G 3 type, tritium can be formed by the neutronic bombardment of many elements present in the core. Tritium was found to be present in the cooling circuits of the reactors G 2 and G 3 in the water coming from the regeneration of the CO{sub 2} dehydrating columns. (author) [French] Dans un reacteur du type G 2 - G 3, le tritium peut etre forme par le bombardement. neutronique de nombreux elements existant dans le c r. La presence de tritium dans les circuits de refroidissement des reacteurs G 2 - G 3 a ete mis en evidence dans l'eau provenant de la regeneration des colonnes de deshydratation du CO{sub 2}. (auteur)
A weak lensing analysis of the PLCK G100.2-30.4 cluster
Radovich, M.; Formicola, I.; Meneghetti, M.; Bartalucci, I.; Bourdin, H.; Mazzotta, P.; Moscardini, L.; Ettori, S.; Arnaud, M.; Pratt, G. W.; Aghanim, N.; Dahle, H.; Douspis, M.; Pointecouteau, E.; Grado, A.
2015-07-01
We present a mass estimate of the Planck-discovered cluster PLCK G100.2-30.4, derived from a weak lensing analysis of deep Subaru griz images. We perform a careful selection of the background galaxies using the multi-band imaging data, and undertake the weak lensing analysis on the deep (1 h) r -band image. The shape measurement is based on the Kaiser-Squires-Broadhurst algorithm; we adopt the PSFex software to model the point spread function (PSF) across the field and correct for this in the shape measurement. The weak lensing analysis is validated through extensive image simulations. We compare the resulting weak lensing mass profile and total mass estimate to those obtained from our re-analysis of XMM-Newton observations, derived under the hypothesis of hydrostatic equilibrium. The total integrated mass profiles agree remarkably well, within 1σ across their common radial range. A mass M500 ~ 7 × 1014M⊙ is derived for the cluster from our weak lensing analysis. Comparing this value to that obtained from our reanalysis of XMM-Newton data, we obtain a bias factor of (1-b) = 0.8 ± 0.1. This is compatible within 1σ with the value of (1-b) obtained in Planck 2015 from the calibration of the bias factor using newly available weak lensing reconstructed masses. Based on data collected at Subaru Telescope (University of Tokyo).
Synthesis of 2-phenylamino-thiazole derivatives as antimicrobial agents
Directory of Open Access Journals (Sweden)
Dominique Serge Ngono Bikobo
2017-11-01
Full Text Available A series of 10 new N-phenyl-4-(4-(thiazol-2-yl-phenyl-thiazol-2-amine derivatives (3a–j and 4 new 5-(2-(phenylamino-thiazol-4-yl-benzamide ethers (3′a–d were synthesized from 4-(2-phenylamino-thiazol-4-yl-benzothioamide and 2-hydroxy-5-(2-(phenylamino-thiazol-4-yl-benzamide with several α-halo-ketones, by the Hantzsch reaction. All compounds were characterized by elemental analysis and spectral data (MS, FT-IR and NMR. The final 14 substances were screened for antimicrobial activity, against two Gram-positive, one Gram-negative bacterial strains, and two fungal strains. Some of the synthesized molecules were more potent than the reference drugs, against the pathogenic strains used. The antibacterial activity of compounds was more pronounced against the Gram-positive strains. Compound 3e manifested the highest growth inhibitory effect against all pathogens tested (MIC of 31.25 μg/mL against the Gram-positive bacterial strains and 7.81 μg/mL against the Candida strains.
Lakshmanan, Sivalingam; Govindaraj, Dharman; Ramalakshmi, Narayanan; Antony, S. Arul
2017-12-01
Green and highly efficient one-pot three component approach for the synthesis of benzo[g]quinazoline derivatives (6a-g) using Choline chloride-urea (DES). Synthesized compounds 6b and 6g showed the most potent biological activity against A549 lung cancer cell line. Docking simulation was performed to position compounds 6b and 6g showed the greater affinity for anaplastic lymphoma kinase (ALK) receptor. Quantum chemical studies were carried out on these compounds to understand the structural features essential for activity using DFT/6-31G level of theory.
Brunner, Stefan; Huber, Bruno C; Fischer, Rebekka; Groebner, Michael; Hacker, Marcus; David, Robert; Zaruba, Marc-Michael; Vallaster, Marcus; Rischpler, Christoph; Wilke, Andrea; Gerbitz, Armin; Franz, Wolfgang-Michael
2008-06-01
Besides its classical function in the field of autologous and allogenic stem cell transplantation, granulocyte colony-stimulating factor (G-CSF) was shown to have protective effects after myocardial infarction (MI) by mobilization of bone marrow-derived progenitor cells (BMCs) and in addition by activation of multiple signaling pathways. In the present study, we focused on the impact of G-CSF on migration of BMCs and the impact on resident cardiac cells after MI. Mice (C57BL/6J) were sublethally irradiated, and BM from green fluorescent protein (GFP)-transgenic mice was transplanted. Coronary artery ligation was performed 10 weeks later. G-CSF (100 microg/kg) was daily injected for 6 days. Subpopulations of enhanced GFP(+) cells in peripheral blood, bone marrow, and heart were characterized by flow cytometry. Growth factor expression in the heart was analyzed by quantitative real-time polymerase chain reaction. Perfusion was investigated in vivo by gated single photon emission computed tomography (SPECT). G-CSF-treated animals revealed a reduced migration of c-kit(+) and CXCR-4(+) BMCs associated with decreased expression levels of the corresponding growth factors, namely stem cell factor and stromal-derived factor-1 alpha in ischemic myocardium. In contrast, the number of resident cardiac Sca-1(+) cells was significantly increased. However, SPECT-perfusion showed no differences in infarct size between G-CSF-treated and control animals 6 days after MI. Our study shows that G-CSF treatment after MI reduces migration capacity of BMCs into ischemic tissue, but increases the number of resident cardiac cells. To optimize homing capacity a combination of G-CSF with other agents may optimize cytokine therapy after MI.
4-cyano-3-hydroxybutanoyl hydrazines, derivatives and process for the preparation thereof
Energy Technology Data Exchange (ETDEWEB)
Hollingsworth, Rawle I. (Haslett, MI); Wang, Guijun (East Lansing, MI)
2000-01-01
Novel 4-cyano-3-hydroxybutanoyl hydrazides (10), particularly R-chiral intermediates are described. The intermediates are useful in preparing (R)-3-hydroxy-4-trimethylaminobutyric acid (L-carnitine) and R-4-amino-3-hydroxybutyric acid (GABOB) and chiral chemical intermediates which are medically useful.
Bio-derived three-dimensional hierarchical carbon-graphene-TiO2 as electrode for supercapacitors.
Jiang, Lili; Ren, Zhifeng; Chen, Shuo; Zhang, Qinyong; Lu, Xiong; Zhang, Hongping; Wan, Guojiang
2018-03-13
This paper reports a novel loofah-derived hierarchical scaffold to obtain three-dimensional biocarbon-graphene-TiO 2 (BC-G-TiO 2 ) composite materials as electrodes for supercapacitors. The loofah scaffold was first loaded with G and TiO 2 by immersing, squeezing, and loosening into the mixed solution of graphene oxide and titania, and then carbonized at 900 °C to form the BC-G-TiO 2 composite. The synergistic effects of the naturally hierarchical biocarbon structure, graphene, and TiO 2 nanoparticles on the electrochemical properties are analyzed. The biocarbon provides a high interconnection and an easy accessibility surface for the electrolyte. Graphene bridged the BC and TiO 2 nanoparticles, improved the conductivity of the BC-G-TiO 2 composite, and increased the electron transfer efficiency. TiO 2 nanoparticles also contributed to the pesudocapacitance and electrochemical stability.
Bonding in d9 complexes derived from EPR: Application to CuCl2-4, CuBr2-4, and CdCl2:Cu2+
Aramburu, J. A.; Moreno, M.
1985-12-01
In this work are reported the theoretical expressions for the [g], hyperfine, and superhyperfine (shf) tensors of a d9 square-planar complex within a molecular orbital (MO) scheme. These expressions include contributions arising from crystal field and charge transfer excitations calculated up to third and second order perturbations, respectively. This makes the present framework more general than those previously used. Through those expressions we have derived from the experimental EPR and optical data the MO coefficients corresponding to the valence b1g(x2-y2), b2g(xy), and eg(xz,yz) levels and also the core polarization contribution K to the hyperfine tensor for the systems CuCl2-4, CuBr2-4, and CdCl2:Cu2+. The 3d charge obtained for CuCl2-4 is equal to 0.61, 0.83, and 0.85 for the antibonding 3b1g, 2b2g, and 2eg levels, respectively. These figures are much closer to the Xα results by Bencini and Gatteschi [J. Am. Chem. Soc. 105, 5535 (1983)] than to those by Desjardins et al. [J. Am. Chem. Soc. 105, 4590 (1983)]. The σ and π covalency for CuBr2-4 are both higher than for CuCl2-4 in accord to the lower electronegativity for bromine. However, only for the antibonding 3b1g level of CuBr2-4 have we obtained an electronic charge lying mainly on ligands. The covalency of CdCl2:Cu2+ is smaller than that found for CuCl2-4, a fact associated to a higher metal-ligand distance for the former. Evidence of this statement are also given from the analysis of crystal-field spectra and isotropic shf constant. The values of K derived for CuCl2-4 (128.1×10-4 cm-1), CuBr2-4 (103.6×10-4 cm-1), and CdCl2:Cu2+ (123.9×10-4 cm-1) point out the dependence of K on the equatorial covalency but also on the existence of axial ligands. The [g] tensor of CuBr2-4 is dominated by the charge transfer contribution while the crystal field one is negative. Finally an analysis of the importance of each one of the involved contributions to the spin-Hamiltonian parameters is reported for the
Chemopreventive effect of chalcone derivative, L2H17, in colon cancer development
International Nuclear Information System (INIS)
Xu, Shanmei; Chen, Minxiao; Chen, Wenbo; Hui, Junguo; Ji, Jiansong; Hu, Shuping; Zhou, Jianmin; Wang, Yi; Liang, Guang
2015-01-01
Colon cancer is the third most commonly diagnosed cancer and the second leading cause of cancer mortality worldwide. Chalcone and its derivatives are reported to exhibit anti-cancer effects in several cancer cell lines, including colon cancer cells. In addition, chalcones have advantages such as poor interaction with DNA and low risk of mutagenesity. In our previous study, a group of chalcone derivatives were synthesized and exhibited strong anti-inflammatory activities. In this study, we evaluated the anti-cancer effects of the chalcone derivative, L2H17, in colon cancer cells. The cytotoxicities of L2H17 on various colon cancer cell lines were investigated by MTT and clonogenic assay. Cell cycle and apoptosis analysis were performed to evaluate the molecular mechanism of L2H17-mediated inhibition of tumor growth. Also, scratch wound and matrigel invasion experiments were performed to estimate the cell migration and invasion after L2H17 treatment. Finally, we observed the anti-colon cancer effects of L2H17 in vivo. Our data show that compound L2H17 exhibited selective cytotoxic effect on colon cancer cells, via inducing G0/G1 cell cycle arrest and apoptosis in CT26.WT cells. Furthermore, L2H17 treatment decreased cell migration and invasion of CT26.WT cells. In addition, L2H17 possessed marked anti-tumor activity in vivo. The molecular mechanism of L2H17-mediated inhibition of tumor promotion and progression were function through inactivated NF-κB and Akt signaling pathways. All these findings show that L2H17 might be a potential growth inhibitory chalcones derivative for colon cancer cells
Directory of Open Access Journals (Sweden)
Jaime Pérez-Villanueva
2017-10-01
Full Text Available Indazole is considered a very important scaffold in medicinal chemistry. It is commonly found in compounds with diverse biological activities, e.g., antimicrobial and anti-inflammatory agents. Considering that infectious diseases are associated to an inflammatory response, we designed a set of 2H-indazole derivatives by hybridization of cyclic systems commonly found in antimicrobial and anti-inflammatory compounds. The derivatives were synthesized and tested against selected intestinal and vaginal pathogens, including the protozoa Giardia intestinalis, Entamoeba histolytica, and Trichomonas vaginalis; the bacteria Escherichia coli and Salmonella enterica serovar Typhi; and the yeasts Candida albicans and Candida glabrata. Biological evaluations revealed that synthesized compounds have antiprotozoal activity and, in most cases, are more potent than the reference drug metronidazole, e.g., compound 18 is 12.8 times more active than metronidazole against G. intestinalis. Furthermore, two 2,3-diphenyl-2H-indazole derivatives (18 and 23 showed in vitro growth inhibition against Candida albicans and Candida glabrata. In addition to their antimicrobial activity, the anti-inflammatory potential for selected compounds was evaluated in silico and in vitro against human cyclooxygenase-2 (COX-2. The results showed that compounds 18, 21, 23, and 26 display in vitro inhibitory activity against COX-2, whereas docking calculations suggest a similar binding mode as compared to rofecoxib, the crystallographic reference.
Kaneko, Mika K; Itai, Shunsuke; Yamada, Shinji; Kato, Yukinari
2018-04-09
Esophageal cancer is one of the highly malignant cancers. It comprises two of the most common histological tumor types: squamous cell carcinoma (SCC) and adenocarcinoma. SCC accounts for about 90% of esophageal cancers. Despite developments in treatment strategies, the prognosis and survival rate remain poor. Podocalyxin (PODXL) is a highly glycosylated type-I transmembrane protein. It is expressed in normal tissues such as kidney, heart, breast, and pancreas. Upregulation of PODXL correlates with tumor progression, invasion, and metastasis. Therefore, this glycoprotein could be a potential biomarker for predicting the prognosis of some cancers, for instance, brain, colorectal, oral, lung, bladder, prostate, and ovarian cancers. We previously developed a specific and sensitive anti-PODXL monoclonal antibody (mAb), PcMab-47 (mouse IgG 1 , kappa) and its mouse IgG 2a -type (47-mG 2a ). We showed their utility in immunohistochemical analysis of oral cancers. Herein, we demonstrate that PcMab-47 and 47-mG 2a can also be used to detect esophageal squamous cell carcinoma (ESCC) with this technique. These two antibodies, respectively, stained 123/130 (94.6%) and 127/130 (97.7%) ESCC cases, indicating that they can detect PODXL with high sensitivity in this carcinoma. Of more than 3+ cases, 47-mG 2a was more effective than PcMab-47, respectively, staining 56/127 (44.1%) and 41/123 (33.3%). Therefore, 47-mG 2a can be used for the detection of PODXL in ESCC using immunohistochemical analysis.
Liu, Pengliang; Jin, Long; Zhao, Lirui; Long, Keren; Song, Yang; Tang, Qianzi; Ma, Jideng; Wang, Xun; Tang, Guoqing; Jiang, Yanzhi; Zhu, Li; Li, Xuewei; Li, Mingzhou
2018-05-31
Natural antisense transcripts (NATs) are widely present in mammalian genomes and act as pivotal regulator molecules to control gene expression. However, studies on the NATs of pigs are relatively rare. Here, we identified a novel antisense transcript, designated PLA2G16-AS, transcribed from the phospholipase A2 group XVI locus (PLA2G16) in the porcine genome, which is a well-known regulatory molecule of fat deposition. PLA2G16-AS and PLA2G16 were dominantly expressed in porcine adipose tissue, and were differentially expressed between Tibetan pigs and Rongchang pigs. In addition, PLA2G16-AS has a weak sequence conservation among different vertebrates. PLA2G16-AS was also shown to form an RNA-RNA duplex with PLA2G16, and to regulate PLA2G16 expression at the mRNA level. Moreover, the overexpression of PLA2G16-AS increased the stability of PLA2G16 mRNA in porcine cells. We envision that our findings of a NAT for a regulatory gene associated with lipolysis might further our understanding of the molecular regulation of fat deposition. Copyright © 2017. Published by Elsevier B.V.
Exceptional confinement in G(2) gauge theory
International Nuclear Information System (INIS)
Holland, K.; Minkowski, P.; Pepe, M.; Wiese, U.-J.
2003-01-01
We study theories with the exceptional gauge group G(2). The 14 adjoint 'gluons' of a G(2) gauge theory transform as {3}, {3-bar} and {8} under the subgroup SU(3), and hence have the color quantum numbers of ordinary quarks, anti-quarks and gluons in QCD. Since G(2) has a trivial center, a 'quark' in the {7} representation of G(2) can be screened by 'gluons'. As a result, in G(2) Yang-Mills theory the string between a pair of static 'quarks' can break. In G(2) QCD there is a hybrid consisting of one 'quark' and three 'gluons'. In supersymmetric G(2) Yang-Mills theory with a {14} Majorana 'gluino' the chiral symmetry is Z(4) χ . Chiral symmetry breaking gives rise to distinct confined phases separated by confined-confined domain walls. A scalar Higgs field in the {7} representation breaks G(2) to SU(3) and allows us to interpolate between theories with exceptional and ordinary confinement. We also present strong coupling lattice calculations that reveal basic features of G(2) confinement. Just as in QCD, where dynamical quarks break the Z(3) symmetry explicitly, G(2) gauge theories confine even without a center. However, there is not necessarily a deconfinement phase transition at finite temperature
The H,G_1,G_2 photometric system with scarce observational data
Penttilä, A.; Granvik, M.; Muinonen, K.; Wilkman, O.
2014-07-01
The H,G_1,G_2 photometric system was officially adopted at the IAU General Assembly in Beijing, 2012. The system replaced the H,G system from 1985. The 'photometric system' is a parametrized model V(α; params) for the magnitude-phase relation of small Solar System bodies, and the main purpose is to predict the magnitude at backscattering, H := V(0°), i.e., the (absolute) magnitude of the object. The original H,G system was designed using the best available data in 1985, but since then new observations have been made showing certain features, especially near backscattering, to which the H,G function has troubles adjusting to. The H,G_1,G_2 system was developed especially to address these issues [1]. With a sufficient number of high-accuracy observations and with a wide phase-angle coverage, the H,G_1,G_2 system performs well. However, with scarce low-accuracy data the system has troubles producing a reliable fit, as would any other three-parameter nonlinear function. Therefore, simultaneously with the H,G_1,G_2 system, a two-parameter version of the model, the H,G_{12} system, was introduced [1]. The two-parameter version ties the parameters G_1,G_2 into a single parameter G_{12} by a linear relation, and still uses the H,G_1,G_2 system in the background. This version dramatically improves the possibility to receive a reliable phase-curve fit to scarce data. The amount of observed small bodies is increasing all the time, and so is the need to produce estimates for the absolute magnitude/diameter/albedo and other size/composition related parameters. The lack of small-phase-angle observations is especially topical for near-Earth objects (NEOs). With these, even the two- parameter version faces problems. The previous procedure with the H,G system in such circumstances has been that the G-parameter has been fixed to some constant value, thus only fitting a single-parameter function. In conclusion, there is a definitive need for a reliable procedure to produce
A NEW COPPER (II)-IMIDAZOLE DERIVATIVE EFFECTIVELY INHIBITS REPLICATION OF DENV-2 IN VERO CELL
Sucipto, Teguh Hari; Churrotin, Siti; Setyawati, Harsasi; Martak, Fahimah; Mulyatno, Kris Cahyo; Amarullah, Ilham Harlan; Kotaki, Tomohiro; Kameoka, Masanori; Yotopranoto, Subagyo; Soegijanto, and Soegeng
2018-01-01
Background: Dengue is a kind of infectious disease that was distributed in the tropical and sub-tropical areas. To date, there is no clinically approved dengue vaccine or antiviral for humans, even though there have been great efforts towards this end. Therefore, finding the effective compound against dengue virus (DENV) replication is very important. Among the complex compounds, copper(II)-imidazole derivatives are of interest because of their biological and medicinal benefits. Materials and Methods: In the present study, antiviral activity of [Cu(2,4,5-triphenylimidazole)2]n, was evaluated against different stages of dengue virus type 2 (DENV-2) replication in Vero cell using focus forming unit reduction assay and quantitative ELISA. Results: [Cu(2,4,5-triphenylimidazole)2]n inhibited DENV-2 replication in Vero cells with IC50 = 2.3 μg/ml and SI= 19.42 when cells were treated 2 days after virus infection, whereas its CC50 for cytotoxicity to Vero cells was 44.174 μg/ml. Conclusion: The compound has high anti-DENV2 activity, less toxicity, and a high possibility to be considered a drug candidate. PMID:29619441
International Nuclear Information System (INIS)
Parshad, R.; Sanford, K.K.; Jones, G.M.
1985-01-01
The authors reported previously that human cells after neoplastic transformation in culture had acquired an increased susceptibility to chromatid damage induced by x-irradiation during the G2 phase of the cell cycle. Evidence suggested that this results from deficient DNA repair during G2 phase. Cells derived from human tumors also showed enhanced G2-phase chromosomal radiosensitivity. Furthermore, skin fibroblasts from individuals with genetic diseases predisposing to a high risk of cancer, including ataxia-telangiectasia, Bloom syndrome, Fanconi anemia, and xeroderma pigmentosum exhibited enhanced G2-phase chromosomal radiosensitivity. The present study shows that apparently normal skin fibroblasts from individuals with familial cancer--i.e., from families with a history of neoplastic disease--also exhibit enhanced G2-phase chromosomal radiosensitivity. This radiosensitivity appears, therefore, to be associated with both a genetic predisposition to cancer and a malignant neoplastic state. Furthermore, enhanced G2-phase chromosomal radiosensitivity may provide the basis for an assay to detect genetic susceptibility to cancer
Directory of Open Access Journals (Sweden)
Pee-Win Chong
2014-01-01
Full Text Available Sedentary lifestyle and caloric overconsumption are the key determinants of the escalating obesity prevalence. Reducing dietary fat absorption may help to induce a negative energy balance and thus help in managing weight problem. Apart from approved drug therapies, weight problems may also be aided with alternative and natural treatments. This paper compiled and reviewed the efficacy and safety of Litramine IQP-G-002AS, an Opuntia ficus-indica (OFI derived fiber, in reducing dietary fat absorption and promoting weight loss. Evidence reviewed shows that Litramine IQP-G-002AS displays efficacy in promoting fat excretion and weight loss in four randomized, placebo-controlled clinical studies (including an unpublished pilot study. With a daily dosage of 3 g over a seven-day period, Litramine IQP-G-002AS showed an increased faecal fat excretion compared with placebo (15.8% (SD 5.8% versus 4.6% (SD 3.1%; P < 0.001. In a 12-week study, significant greater weight loss (3.8 kg (SD 1.8 kg versus 1.4 kg (SD 2.6 kg; P < 0.001 was observed in overweight and obese subjects treated with Litramine IQP-G-002AS as compared to placebo. No relevant gastrointestinal side effects have been reported for Litramine IQP-G-002AS at the dosages studied.
Directory of Open Access Journals (Sweden)
Lamiaa A. Shaala
2016-08-01
Full Text Available As a part of our ongoing effort to allocate marine microbial bioactive leads, a tunicate-derived actinomycete, Streptomyces sp. Did-27, was investigated. Three new 2(1H-pyrazinones derivatives, (S-6-(sec-butyl-3-isopropylpyrazin-2(1H-one (1, (S-3-(sec-butyl-6-isopropylpyrazin-2(1H-one (2 and (S-6-(sec-butyl-3-isobutylpyrazin-2(1H-one (3, together with the known (1H-pyrazinones analogues deoxymutaaspergillic acid (4, 3,6-diisobutyl-2(1H-pyrazinone (5 and 3,6-di-sec-butyl-2(1H-pyrazinone (6, and the diketopiperazine alkaloids cyclo(6-OH-d-Pro-l-Phe (7, bacillusamide B (8, cyclo(l-Pro-l-Leu and cyclo(l-Pro-l-Ile (10 were isolated from this strain. The structures of the compounds were determined by study of their one- and two-dimensional NMR spectra as well as high-resolution mass spectral determinations. Compound 4 was reported previously as a synthetic product, while compound 6 was reported as 2-hydroxy-3,6-di-sec-butylpyrazine. Herein, we report the complete NMR data for compounds 4 and 6. The compounds were evaluated for their cytotoxic activities against three cell lines. Compound 5 showed potent and selective activity against HCT-116 cell line with IC50 of 1.5 μg/mL, while 1–10 showed variable cytotoxic activities against these cancer cell lines. These results provide further understanding about the chemistry and bioactivities of the alkylated 2(1H-pyrazinone derivatives.
Directory of Open Access Journals (Sweden)
Li-Jun Wang
2015-02-01
Full Text Available A series of bromophenol derivatives containing indolin-2-one moiety were designed and evaluated that for their anticancer activities against A549, Bel7402, HepG2, HeLa and HCT116 cancer cell lines using MTT assay in vitro. Among them, seven compounds (4g–4i, 5h, 6d, 7a, 7b showed potent activity against the tested five human cancer cell lines. Wound-healing assay demonstrated that compound 4g can be used as a potent compound for inactivating invasion and metastasis by inhibiting the migration of cancer cells. The structure–activity relationships (SARs of bromophenol derivatives had been discussed, which were useful for exploring and developing bromophenol derivatives as novel anticancer drugs.
Novel 2-Thioxanthine and Dipyrimidopyridine Derivatives: Synthesis and Antimicrobial Activity
Directory of Open Access Journals (Sweden)
Samar El-kalyoubi
2015-10-01
Full Text Available Several fused imidazolopyrimidines were synthesized starting from 6-amino-1-methyl-2-thiouracil (1 followed by nitrosation, reduction and condensation with different aromatic aldehydes to give Schiff’s base. The dehydrocyclization of Schiff’s bases using iodine/DMF gave Compounds 5a–g. The methylation of 5a–g using a simple alkylating agent as dimethyl sulfate ((CH32SO4 gave either monoalkylated imidazolopyrimidine 6a–g at room temperature or dialkylated derivatives 7a–g on heating 6a–g with ((CH32SO4. On the other hand, treatment of 1 with different aromatic aldehydes in absolute ethanol in the presence of conc. hydrochloric acid at room temperature and/or reflux with acetic acid afforded bis-5,5́-diuracylmethylene 8a–e, which cyclized on heating with a mixture of acetic acid/HCl (1:1 to give 9a–e. Compounds 9a–e can be obtained directly by refluxing of Compound 1 with a mixture of acetic acid/HCl. The synthesized new compounds were screened for antimicrobial activity, and the MIC was measured.
Ghosh, Soumen; Khan, Mehebub Ali; Ganguly, Aniruddha; Masum, Abdulla Al; Alam, Md. Akhtarul; Guchhait, Nikhil
2018-02-01
Two amido-schiff bases (3-Hydroxy-naphthalene-2-carboxylic acid pyren-1-ylmethylene-hydrazide and Naphthalene-2-carboxylic acid pyren-1-ylmethylene-hydrazide) have been synthesized having a common structural unit and only differs by a -OH group in the naphthalene ring. Both of them can detect Cu2 + ion selectively in semi-aqueous medium in distinctly different output modes (one detects Cu2 + by naked-eye color change where as the other detects Cu2 + by fluorescence enhancement). The difference in the binding of Cu 2 + with the compounds is the reason for this observation. The detection limit is found to be micromolar region for compound which contains -OH group whereas the compound without -OH group detects copper in nano-molar region. DFT calculations have been performed in order to demonstrate the structure of the compounds and their copper complexes. Practical utility has been explored by successful paper strip response of both the compounds. The biological applications have been evaluated in RAW 264.7.
Tassis, Panagiotis D; Tsakmakidis, Ioannis; Papatsiros, Vassileios G; Koulialis, Dimitrios; Nell, Tom; Brellou, Georgia; Tzika, Eleni D
2017-04-07
Mycoplasma hyopneumoniae (M. hyo) and Porcine Circovirus Type 2 (PCV2) are major pathogens that cause significant health problems in swine worldwide. Maternal derived immunity (MDI) has been suggested as a significant immediate defence factor for newborn piglets and may interfere with piglet's vaccination-induced immunity. The study aimed to assess the efficacy of a novel combination vaccine (consisting of PCV2 subunits and inactivated M. hyo strain J), against PCV2 and M. hyo natural infection [Porcilis ® PCV M Hyo (MSD Animal Health, Boxmeer, the Netherlands)], in the presence of strong maternally derived PCV2 immunity (antibody titre averaged 11.08 log 2 ), under field conditions. The study was performed according to a controlled, randomized and blinded design in a Greek swine unit with Enzootic Pneumonia (EP) and subclinical PCV2 infection. In total, 600 healthy three-week-old suckling piglets were allocated randomly, either to treatment (vaccinated with the test product) or control group (injected with sterile buffered saline). Vaccination significantly reduced the severity of lung lesions at slaughter (lesions of cranio-ventral pulmonary consolidation) (P pigs. Furthermore, 25 g higher average daily weight gain (ADWG) was observed during the finishing phase (P < 0.001) and 18 g greater ADWG overall (P < 0.001). Results of LLS, PCV2 viremia and ADWG support the test product's efficacy in the face of strong maternally derived PCV2 immunity.
Arora, Satyam; Doda, Veena; Kotwal, Urvershi; Dogra, Mitu
2016-02-01
Platelet derived biomaterials represent a key source of cytokines and growth factors extensively used for tissue regeneration; wound healing and tissue repair. Our study was to quantify platelets and growth factors released by PRP when prepared at different centrifugal force (g) and time. Our study was approved by the institutional ethical committee. One hundred millilitres of whole blood (WB) was collected in bag with CPDA as the anticoagulant(AC); (14 mL for 100 mL WB ratio). Nine aliquots of 10 mL each were made from the bag and set of three aliquots were made a group. PRP was prepared at varying centrifugal force (group A: -110 g, group B: -208 g & group C: -440 g) & time (1: -5 min, 2: -10 min & 3: -20 min). Contents of each PRP prepared were analysed. Commercial sandwich ELISA kits were used to quantify the concentrations of CD62P (Diaclone SAS; France), Platelet derived growth factors-AB (Qayee-Bio; China), transforming growth factor-β1 (DRG; Germany) and vascular endothelial growth factor (Boster Immuno Leader; USA) released in each PRP prepared. Eight volunteers were enrolled in the study (24-30 years). The baseline blood counts of all the volunteers were comparable (p ≥ 0.05). Mean ± SD of platelet yield of all nine groups ranged from 17.2 ± 4.2% to 78.7 ± 5.7%. Each PRP was activated with calcified thromboplastin to quantify the growth factors released by them. Significantly higher (p < 0.05) transforming growth factor-β1 and vascular endothelial growth factor were released compared to the baseline. Our study highlights the variation in both force (g) and time results in changes at cellular level and growth factor concentrations. Copyright © 2016 Elsevier Ltd. All rights reserved.
Temperature duality on Riemann surface and cosmological solutions for genus g = 1 and 2
International Nuclear Information System (INIS)
Yan Jun; Wang Shunjin
1999-01-01
A bosonic string model at finite temperature on the gravitation g μν and the dilaton φ background field is examined. Moreover, the duality relation of energy momentum tensor on high genus Riemann surface is derived. At the same time, the temperature duality invariance for the action of string gas matter is proved in 4-D Robertson-Walker metric, the string cosmological solutions and temperature duality of the equations of motion for genus g = 1 and 2 are also investigated
Energy Technology Data Exchange (ETDEWEB)
Modak, Arindam; Bhaumik, Asim, E-mail: msab@iacs.res.in
2015-12-15
Microporous carbon having Brunauer-Emmett-Teller (BET) surface area of 2186 m{sup 2} g{sup −1} and micropore volume of 0.85 cm{sup 3} g{sup −1} has been synthesized via KOH induced high temperature carbonization of a non-conjugated hypercrosslinked organic polymer. Owing to the templating and activation by KOH, we have succeeded in making a microporous carbon from this porous polymer and the resultant carbon material showed high uptake for CO{sub 2} (7.6 mmol g{sup −1}) and CH{sub 4} (2.4 mmol g{sup −1}) at 1 atm, 273 K together with very good selectivity for the CO{sub 2}/N{sub 2} (30.2) separation. Furthermore, low pressure (1 atm) H{sub 2} (2.6 wt%, 77 K) and water uptake (57.4 wt%, 298 K) ability of this polymer derived porous activated carbon is noteworthy. - Graphical abstract: Microporous carbon with BET surface area of 2186 m{sup 2} g{sup −1} has been synthesized via KOH activation of a porous organic polymer and it showed high uptake for CO{sub 2} (7.6 mmol g{sup −1}), CH{sub 4} (2.4 mmol g{sup −1}) and H{sub 2} (2.6 wt%) at 1 atm together with very good selectivity for CO{sub 2}. - Highlights: • Porous carbon from hypercrosslinked organic polymer. • KOH activated carbon with BET surface area 2186 m{sup 2} g{sup −1}. • High CO2 uptake (7.6 mmol g{sup −1}) and CO{sub 2}/N{sub 2} selectivity (30.2). • Porous carbon also showed high H{sub 2} (2.6 wt%) and H{sub 2}O (57.4 wt%) uptakes.
Denel-Bobrowska, Marta; Łukawska, Małgorzata; Bukowska, Barbara; Gajek, Arkadiusz; Oszczapowicz, Irena; Marczak, Agnieszka
2018-02-01
Oxazolinodoxorubicin (O-DOX) and oxazolinodaunorubicin (O-DAU) are derivatives of anthracyclines (DOX and DAU) with a modified daunosamine moiety. We aimed to clarify their mechanisms of action by investigating intracellular accumulation and effects on the cell cycle, phosphatidylserine externalization, and proteasome 20S activity. Experimental model consisted of SKOV-3, A549 and HepG2 cells. Compounds were used at the concentration of 80nM. Intracellular accumulation, drug uptake, and proteasome 20S activity were evaluated by fluorimetric methods. The effects on the cell cycle and phosphatidylserine externalization were measured by flow cytometry. O-DOX was equivalent to DOX in terms of inducing G2/M arrest, but O-DAU was less potent in SKOV-3, HepG2, and A549 cells. O-DOX had the greatest effect on initiating apoptosis in all tested cells. Externalization of phosphatidylserine was significantly higher following O-DOX treatment compared with control cells and cells incubated with DOX. The intracellular accumulation and uptake of the derivatives were similar to those of the reference drugs. Tested compounds are able to activate proteasome 20S activity. Our results extended the understanding of the toxicity, mechanism of action, and biochemical properties of oxazoline derivatives of doxorubicin and daunorubicin, including their effects on cell cycle, apoptosis and DNA degradation. Copyright © 2017 Elsevier Ltd. All rights reserved.
An experimentally derived magnetic moment for the f7/2 proton in trans-lead nuclei
International Nuclear Information System (INIS)
Stuchbery, A.E.; Byrne, A.P.; Dracoulis, G.D.
1992-12-01
An experimental value for the g-factor of the 1f 7/2 proton is derived from the measured magnetic moment of the 14 + 1 state in 214 Ra using the multiparticle octupole coupling model. The result, g(f 7/2 ) = 1.41(2), is smaller than anticipated by theories which assume first order core polarization corrections to the proton spin g-factor together with an anomalous orbital magnetism of about 0.12. The experimental value suggests the proton spin g-factor g s may be quenched, in this orbital, to about half the bare-nucleon value, similar to that found for the 0h 9/2 and 0i 13/2 protons, or, alternatively, that the anomalous orbital magnetism is much reduced for the 1f 7/2 orbital. 15 refs., 2 tabs
David, L.; Bhandavat, R.; Barrera, U.; Singh, G.
2015-04-01
A facile process is demonstrated for the synthesis of layered SiCN-MoS2 structure via pyrolysis of polysilazane functionalized MoS2 flakes. The layered morphology and polymer to ceramic transformation on MoS2 surfaces was confirmed by use of electron microscopy and spectroscopic techniques. Tested as thick film electrode in a Li-ion battery half-cell, SiCN-MoS2 showed the classical three-stage reaction with improved cycling stability and capacity retention than neat MoS2. Contribution of conversion reaction of Li/MoS2 system on overall capacity was marginally affected by the presence of SiCN while Li-irreversibility arising from electrolyte decomposition was greatly suppressed. This is understood as one of the reasons for decreased first cycle loss and increased capacity retention. SiCN-MoS2 in the form of self-supporting paper electrode (at 6 mg.cm-2) exhibited even better performance, regaining initial charge capacity of approximately 530 mAh.g-1 when the current density returned to 100 mA.g-1 after continuous cycling at 2400 mA.g-1 (192 mAh.g-1). MoS2 cycled electrode showed mud-cracks and film delamination whereas SiCN-MoS2 electrodes were intact and covered with a uniform solid electrolyte interphase coating. Taken together, our results suggest that molecular level interfacing with precursor-derived SiCN is an effective strategy for suppressing the metal-sulfide/electrolyte degradation reaction at low discharge potentials.
Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu
2014-10-01
Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.
Moya, Bartolome; Barcelo, Isabel M; Bhagwat, Sachin; Patel, Mahesh; Bou, German; Papp-Wallace, Krisztina M; Bonomo, Robert A; Oliver, Antonio
2017-06-01
Zidebactam and WCK 5153 are novel β-lactam enhancers that are bicyclo-acyl hydrazides (BCH), derivatives of the diazabicyclooctane (DBO) scaffold, targeted for the treatment of serious infections caused by highly drug-resistant Gram-negative pathogens. In this study, we determined the penicillin-binding protein (PBP) inhibition profiles and the antimicrobial activities of zidebactam and WCK 5153 against Pseudomonas aeruginosa , including multidrug-resistant (MDR) metallo-β-lactamase (MBL)-producing high-risk clones. MIC determinations and time-kill assays were conducted for zidebactam, WCK 5153, and antipseudomonal β-lactams using wild-type PAO1, MexAB-OprM-hyperproducing ( mexR ), porin-deficient ( oprD ), and AmpC-hyperproducing ( dacB ) derivatives of PAO1, and MBL-expressing clinical strains ST175 ( bla VIM-2 ) and ST111 ( bla VIM-1 ). Furthermore, steady-state kinetics was used to assess the inhibitory potential of these compounds against the purified VIM-2 MBL. Zidebactam and WCK 5153 showed specific PBP2 inhibition and did not inhibit VIM-2 (apparent K i [ K i app ] > 100 μM). MICs for zidebactam and WCK 5153 ranged from 2 to 32 μg/ml (amdinocillin MICs > 32 μg/ml). Time-kill assays revealed bactericidal activity of zidebactam and WCK 5153. LIVE-DEAD staining further supported the bactericidal activity of both compounds, showing spheroplast formation. Fixed concentrations (4 or 8 μg/ml) of zidebactam and WCK 5153 restored susceptibility to all of the tested β-lactams for each of the P. aeruginosa mutant strains. Likewise, antipseudomonal β-lactams (CLSI breakpoints), in combination with 4 or 8 μg/ml of zidebactam or WCK 5153, resulted in enhanced killing. Certain combinations determined full bacterial eradication, even with MDR MBL-producing high-risk clones. β-Lactam-WCK enhancer combinations represent a promising β-lactam "enhancer-based" approach to treat MDR P. aeruginosa infections, bypassing the need for MBL inhibition. Copyright © 2017
Comparison of gene expression profiles of HepG2 cells exposed to Crambescins C1 and A1
Directory of Open Access Journals (Sweden)
María R. Sánchez
2014-06-01
Full Text Available Crambescins are guanidine alkaloids firstly isolated in the early 90s from the encrusting Mediterranean sponge Crambe crambe (Schmidt, 1862 (Bondu et al., 2012, Laville et al., 2009, Berlinck et al., 1990. C. crambe derivatives are divided in two families named crambescins and crambescidins (Gerlinck et al., 1992. Although data on the bioactivity of these compounds is scarce, crambescidins have recognized cytotoxic, antifungal, antioxidant, antimicrobial and antiviral activities (Buscema and Van de Vyver, 1985, Jares-Erijman., 1998, Olszewski et al., 2004, Lazaro et al., 2006, Suna et al., 2007, AOKI et al., 2004. Recently we have carefully evaluated the cytotoxic activity of C816 over several human tumor cell types and characterized some of the cellular mechanisms responsible of the anti-proliferative effect of this compound on human liver-derived tumor cells (Rubiolo et al., 2013. Taking this into account, and to better understand the mechanism of action of crambescins and their potential as therapeutic agents, we made a comparative gene expression profiling of HepG2 cells after crambescin C1 (C1 and crambescin A1 (CA1 exposures. Results have shown that C1 induces genes involved in sterol and glucose metabolisms and metabolism involving growth factors. It also down regulates genes mainly involved in cell cycle control, DNA replication, recombination and repair, and drug metabolism. Flow cytometry assays revealed that C1 produces a G0/G1 arrest in HepG2 cell cycle progression. CA1 also down-regulates genes involved in cell cycle regulation, DNA recombination and pathways related to tumor cells proliferation with lower potency when compared to C1.
Application of Aura OMI L2G Products Compared with NASA MERRA-2 Assimilation
Zeng, Jian; Shen, Suhung; Wei, Jennifer; Johnson, James E.; Su, Jian; Meyer, David J.
2018-01-01
The Ozone Monitoring Instrument (OMI) is one of the instruments aboard NASA's Aura satellite. It measures ozone total column and vertical profile, aerosols, clouds, and trace gases including NO2, SO2, HCHO, BrO, and OClO using absorption in the ultraviolet electromagnetic spectrum (280 - 400 nm). OMI Level-2G (L2G) products are based on the pixel-level OMI granule satellite measurements stored within global 0.25 deg. X 0.25 deg. grids, therefore they conserve all the Level 2 (L2) spatial and temporal details for 24 hours of scientific data in one file. The second Modern-Era Retrospective analysis for Research and Applications (MERRA-2) is NASA's atmospheric reanalysis, using an upgraded version of Goddard Earth Observing System Model, version 5 (GEOS-5) data assimilation system. MERRA-2 includes aerosol data reanalysis and improved representations of stratospheric ozone, compared with its predecessor MERRA, in both instantaneous and time-averaged collections. It is found that simply comparing satellite Level-3 products might cause biases, due to lack of detailed temporal and original retrieval information. It is therefore preferable to inter-compare or implement satellite derived physical quantities directly with/to model assimilation with as high temporal and spatial resolutions as possible. This study will demonstrate utilization of OMI L2G daily aerosol and ozone products by comparing them with MERRA-2 hourly aerosol/ozone simulations, matched in both space and time aspects. Both OMI and MERRA-2 products are accessible online through NASA Goddard Earth Sciences Data Information Services Center (GES DISC, https://disc.gsfc.nasa.gov/).
Directory of Open Access Journals (Sweden)
Henning Hopf
2015-04-01
Full Text Available The two isomeric bis(isocyanates 4,12- and 4,16-di-isocyanato[2.2]paracyclophane, 16 and 28, have been prepared from their corresponding diacids by simple routes. The two isomers are versatile intermediates for the preparation of various cyclophanes bearing substituents with nitrogen-containing functional groups, e.g., the pseudo-ortho diamine 8, the bis secondary amine 23, and the crownophanes 18 and 19. Several of these new cyclophane derivatives (18, 19, 22, 26, 28 have been characterized by X-ray structural analysis.
Barcelo, Isabel M.; Bhagwat, Sachin; Patel, Mahesh; Bou, German; Papp-Wallace, Krisztina M.; Bonomo, Robert A.; Oliver, Antonio
2017-01-01
ABSTRACT Zidebactam and WCK 5153 are novel β-lactam enhancers that are bicyclo-acyl hydrazides (BCH), derivatives of the diazabicyclooctane (DBO) scaffold, targeted for the treatment of serious infections caused by highly drug-resistant Gram-negative pathogens. In this study, we determined the penicillin-binding protein (PBP) inhibition profiles and the antimicrobial activities of zidebactam and WCK 5153 against Pseudomonas aeruginosa, including multidrug-resistant (MDR) metallo-β-lactamase (MBL)-producing high-risk clones. MIC determinations and time-kill assays were conducted for zidebactam, WCK 5153, and antipseudomonal β-lactams using wild-type PAO1, MexAB-OprM-hyperproducing (mexR), porin-deficient (oprD), and AmpC-hyperproducing (dacB) derivatives of PAO1, and MBL-expressing clinical strains ST175 (blaVIM-2) and ST111 (blaVIM-1). Furthermore, steady-state kinetics was used to assess the inhibitory potential of these compounds against the purified VIM-2 MBL. Zidebactam and WCK 5153 showed specific PBP2 inhibition and did not inhibit VIM-2 (apparent Ki [Ki app] > 100 μM). MICs for zidebactam and WCK 5153 ranged from 2 to 32 μg/ml (amdinocillin MICs > 32 μg/ml). Time-kill assays revealed bactericidal activity of zidebactam and WCK 5153. LIVE-DEAD staining further supported the bactericidal activity of both compounds, showing spheroplast formation. Fixed concentrations (4 or 8 μg/ml) of zidebactam and WCK 5153 restored susceptibility to all of the tested β-lactams for each of the P. aeruginosa mutant strains. Likewise, antipseudomonal β-lactams (CLSI breakpoints), in combination with 4 or 8 μg/ml of zidebactam or WCK 5153, resulted in enhanced killing. Certain combinations determined full bacterial eradication, even with MDR MBL-producing high-risk clones. β-Lactam–WCK enhancer combinations represent a promising β-lactam “enhancer-based” approach to treat MDR P. aeruginosa infections, bypassing the need for MBL inhibition. PMID:28289035
Measurement of the Proton and Deuteron Spin Structure Functions g2 and Asymmetry A2
International Nuclear Information System (INIS)
Perry Anthony; Arnold, R.G.; Todd Averett; Band, H.R.; Berisso, M.C.; Borel, H.; Peter Bosted; Stephen Bueltmann; M. Buenerd; T. Chupp; Steve Churchwell; G.R. Court; Donald Crabb; Donal Day; Piotr Decowski; P. DePietro; Robin D. Erbacher; R. Erickson; Andrew Feltham; Helene Fonvieille; Emil Frlez; R. Gearhart; V. Ghazikhanian; Javier Gomez; Keith Griffioen; C. Harris; M.A. Houlden; E.W. Hughes; Charles Hyde-Wright; G. Igo; Sebastien Incerti; John Jensen; J.K. Johnson; Paul King; Yu.G. Kolomensky; Sebastian Kuhn; Richard Lindgren; R.M. Lombard-Nelsen; Jacques Marroncle; James Mccarthy; Paul McKee; W. Meyer; Gregory Mitchell; Joseph Mitchell; Michael Olson; S. Penttila; Gerald Peterson; Gerassimos Petratos; R. Pitthan; Dinko Pocanic; R. Prepost; C. Prescott; Liming Qin; Brian Raue; D. Reyna; L.S. Rochester; Stephen Rock; Oscar Rondon-Aramayo; Franck Sabatie; Ingo Sick; T. Smith; L. Sorrell; F. Staley; S. St. Lorant; L.M. Stuart; Z. Szalata; Y. Terrien; William Tobias; Luminita Todor; T. Toole; S. Trentalange; Dieter Walz; Robert Welsh; Frank Wesselmann; T.R. Wright; C.C. Young; Markus Zeier; Hong Guo Zhu; Benedikt Zihlmann
1999-01-01
We have measured the spin structure functions g 2 p and g 2 d and the virtual photon asymmetries A 2 p and A 2 d over the kinematic range 0.02 2 (le) 30(GeV/c) 2 by scattering 38.8 GeV longitudinally polarized electrons from transversely polarized NH 3 and 6 LiD targets.The absolute value of A 2 is significantly smaller than the √R positivity limit over the measured range, while g 2 is consistent with the twist-2 Wandzura-Wilczek calculation. We obtain results for the twist-3 reduced matrix elements d 2 p , d 2 d and d 2 n . The Burkhardt-Cottingham sum rule integral (g 2 (x)dx) is reported for the range 0.02 (le) x (le) 0.8
ICT, Policy, Politics, and Democracy: An Integrated Framework for G2G Implementation
Directory of Open Access Journals (Sweden)
Iliana Mizinova
2006-12-01
Full Text Available This research approaches the issue of G2G digitization using an integrated policy dynamics model. The essence of the contradictions in the G2G integration discourse is followed by a description of two policy paradigms that are then incorporated into an integrated or synthetic framework to evaluate the specifics of the G2G implementation in DHS and HUD. Speculations are made about the implications of this study for the democratic principles of government rule.
International Nuclear Information System (INIS)
Vladimirov, V.G.; Chigareva, N.G.; Belen'kaya, I.A.; Strel'nikov, Yu.E.
1977-01-01
The ability of some benzo-2,1,3-tiadiazole derivatives to form methemoglobin in blood has been investigated. It has been shown that 30 min after intraperitoneal administration to mice of radioprotective doses of the preparations, the methemoglobin level in blood does not exceed 5%. After administration of a toxic dose of 4-aminobenzo-2,1,3-tiadiazole, the amount of methemoglobin in the mouse blood makes 14%. After per os administration of 4-aminobenzo-2,1,3-tiadiazole to dogs methemoglobin content of blood makes almost 50% which can provide a radioprotective action of this compound. Using substances preventing oxidation of hemoglobin to methemoglobin (isonicotinic acid hydrazide and 2-methoxy-9-phenazin sulphate) it has been shown that methemoglobin, formed in the mouse blood, does not play a leading part in manifestation of radioprotective and toxic properties of 4-aminobenzo-2,1,3-tiadiazole
DEFF Research Database (Denmark)
Gabrielsen, Martin Vahl
2005-01-01
on conversion of nifursol and its metabolites with an intact 3,5-dinitrosalicylic acid hydrazide (DNSH) side chain to the 2-nitrophenyl analogue of nifursol (NPDNSH) by treatment with dilute hydrochloric acid and 2-nitrobenzaldehyde. Nifuroxazide (salicylic acid (5-nitrofurfurylidene) hydrazide) added......Nifursol (3,5-dinitrosalicylic acid (5-nitrofurfurylidene) hydrazide) is mainly used as a feed additive for the prevention of blackhead disease in turkeys. The objective of the present work was to establish information on nifursol residues in turkey and chicken meat. The analytical method was based...
Non-orthogonally transitive G2 spike solution
International Nuclear Information System (INIS)
Lim, Woei Chet
2015-01-01
We generalize the orthogonally transitive (OT) G 2 spike solution to the non-OT G 2 case. This is achieved by applying Geroch’s transformation on a Kasner seed. The new solution contains two more parameters than the OT G 2 spike solution. Unlike the OT G 2 spike solution, the new solution always resolves its spike. (fast track communication)
Li, Shuai; Guo, Lianyi
2018-01-01
Objective To investigate the mechanisms of pseudolaric acid B (PAB) blocks cell cycle and inhibits invasion and migration in human hepatoma HepG2 cells. Methods The proliferation effect of PAB on HepG2 cells was evaluated by MTT assay. The effect of PAB on the cell cycle of HepG2 cells was analyzed by flow cytometry. Immunofluorescence cytochemical staining was applied to observe the effect of PAB on the α-tubulin polymerization and expression in HepG2 cells. Transwell TM chamber invasion assay and wound healing assay were performed to detect the influence of PAB on the migration and invasion ability of HepG2 cells. Western blotting was used to determine the expressions of α-tubulin, E-cadherin and MMP-9 in HepG2 cells after treated with PAB. Results PAB inhibited the proliferation of HepG2 cells in a dose-dependent manner and blocked the cell cycle in G2/M phase. PAB significantly changed the polymerization and decreased the expression of α-tubulin. The capacities of invasion and migration of HepG2 cells treated by PAB were significantly depressed. The protein levels of α-tubulin and MMP-9 decreased while the E-cadherin protein level increased. Conclusion PAB can inhibits the proliferation of HepG2 cells by down-regulating the expression of α-tubulin and influencing its polymerization, arresting HepG2 cells in G2/M phase. Meanwhile, PAB also can inhibit the invasion and migration of HepG2 cells by lowering cytoskeleton α-tubulin and MMP-9, and increasing E-cadherin.
Guillon, Jean; Cohen, Anita; Gueddouda, Nassima Meriem; Das, Rabindra Nath; Moreau, Stéphane; Ronga, Luisa; Savrimoutou, Solène; Basmaciyan, Louise; Monnier, Alix; Monget, Myriam; Rubio, Sandra; Garnerin, Timothée; Azas, Nadine; Mergny, Jean-Louis; Mullié, Catherine; Sonnet, Pascal
2017-12-01
Novel series of bis- and tris-pyrrolo[1,2-a]quinoxaline derivatives 1 were synthesized and tested for in vitro activity upon the intraerythrocytic stage of W2 and 3D7 Plasmodium falciparum strains. Biological results showed good antimalarial activity with IC 50 in the μM range. In attempting to investigate the large broad-spectrum antiprotozoal activities of these new derivatives, their properties toward Leishmania donovani were also investigated and revealed their selective antiplasmodial profile. In parallel, the in vitro cytotoxicity of these molecules was assessed on the human HepG2 cell line. Structure-activity relationships of these new synthetic compounds are discussed here. The bis-pyrrolo[1,2-a]quinoxalines 1n and 1p were identified as the most potent antimalarial candidates with selectivity index (SI) of 40.6 on W2 strain, and 39.25 on 3D7 strain, respectively. As the telomeres of the parasite could constitute an attractive target, we investigated the possibility of targeting Plasmodium telomeres by stabilizing the Plasmodium telomeric G-quadruplexes through a FRET melting assay by our new compounds.
International Nuclear Information System (INIS)
Lee, S. Y.; Hong, Y. D.; Choi, S. J.
2007-01-01
Recently, radioimmunotherapy (RIT), which uses a monoclonal antibody in addition to a radionuclide to deliver radiation to the sites of a disease, has been extensively studied in this population. To label an antibody with radionuclides it is necessary to introduce a bifunctional chelating agent (BFCA) such a DTPA since it can not be directly labeled to a radionuclide. Therefore, developing a better BFCA for chelating biomolecule and radionuclide has been of major interest in developing radioimmunotherapeutic agents. Thereby, we describe the entantiospecific synthesis of a DTPA analogue which is derived from L-cysteine via bis N-alkylation. And the prepared DTPA derivative was conjugated with human Immunoglobulin G, and a characterization of the immunoconjugate was carried out. N, N-Bis[(tert-butoxycarbonyl)methyl]-2-ethanolamine, N, N-Bis[(tert-butoxycarbony)methyl]-2-bromoethyl-amine, 2-(4-N-Boc-aminophenyl) ethanol, 1-(4-N-Boc-aminophenyl)-2-bromoethane, S-((4-N-Boc-arninophenyl)-1-ethyl)-cysteine methylester, S-(N-Boc-aminophenyl)-Cys(tBu4-DTPA) methylester, -aminophenylethyl-Cys-DTPA, isothiocyanate-cysteine-DTPA, Immunoconjugation with IgG. The optimal molar DTPA derivative to IgG conjugation ratio was 1: 1. At higher amounts of DTPA derivative, amounts of unbounded DTPA derivative increased, and the immunoactivities of immunoconjugates reduced. Gel electrophoresis analysis of the immunoconjugates showed no degradation products or other impurities. This demonstrates the stability of the IgG in DTPA derivative. We established the preparation of an amino acid based DTPA by producing 4-Ethylaniline-DTPA-L-Cysteine. At the same molar this DTPA derivative to IgG, the immunoconjugate has stable molecular structure. In conclusion, 4-Ethylaniline-DTPA-L-Cysteine as a BFCA will show good properties for preparing a specific regional delivery system such as in radiopharmaceuticals, as a radiotracer, and NMR contrasting agents
Liu, Ying; Cheng, Yajun; Li, Jinwei; Wang, Yuanpeng; Liu, Yuanfa
2018-05-23
In the present study, effects of cis-9,10-epoxy stearic acid (ESA) generated by the thermal oxidation of oleic acid on HepG2 cells, including cytotoxicity, apoptosis, and oxidative stress, were investigated. Our results revealed that ESA decreased the cell viability and induced cell death. Cell cycle analysis with propidium iodide staining showed that ESA induced cell cycle arrest at the G0/G1 phase in HepG2 cells. Cell apoptosis analysis with annexin V and propidium iodide staining demonstrated that ESA induced HepG2 cell apoptotic events in a dose- and time-dependent manner; the apoptosis of cells after treated with 500 μM ESA for 12, 24, and 48 h was 32.16, 38.70, and 65.80%, respectively. Furthermore, ESA treatment to HepG2 cells resulted in an increase in reactive oxygen species and malondialdehyde (from 0.84 ± 0.02 to 8.90 ± 0.50 nmol/mg of protein) levels and a reduction in antioxidant enzyme activity, including superoxide dismutase (from 1.34 ± 0.27 to 0.10 ± 0.007 units/mg of protein), catalase (from 100.04 ± 5.05 to 20.09 ± 3.00 units/mg of protein), and glutathione peroxidase (from 120.44 ± 7.62 to 35.84 ± 5.99 milliunits/mg of protein). These findings provide critical information on the effects of ESA on HepG2 cells, particularly cytotoxicity and oxidative stress, which is important for the evaluation of the biosafety of the oxidative product of oleic acid.
Choi, Hyun Kyung; Ryu, Hwani; Son, A-Rang; Seo, Bitna; Hwang, Sang-Gu; Song, Jie-Young; Ahn, Jiyeon
2016-04-01
To identify novel small molecules that induce selective cancer cell death, we screened a chemical library containing 1040 compounds in HT29 colon cancer and CCD18-Co normal colon cells, using a phenotypic cell-based viability assay system with the Cell Counting Kit-8 (CCK-8). We discovered a novel anthraquinone derivative, N-(4-[{(9,10-dioxo-9,10-dihydro-1-anthracenyl)sulfonyl}amino]phenyl)-N-methylacetamide (IMP1338), which was cytotoxic against the human colon cancer cells tested. The MTT cell viability assay showed that treatment with IMP1338 selectively inhibited HCT116, HCT116 p53(-/-), HT29, and A549 cancer cell proliferation compared to that of Beas2B normal epithelial cells. To elucidate the cellular mechanism underlying the cytotoxicity of IMP1338, we examined the effect of IMP1338 on the cell cycle distribution and death of cancer cells. IMP1338 treatment significantly arrested the cell cycle at S and G2/M phases by DNA damage and led to apoptotic cell death, which was determined using FACS analysis with Annexin V/PI double staining. Furthermore, IMP1338 increased caspase-3 cleavage in wild-type p53, p53 knockout HCT116, and HT29 cells as determined using immunoblotting. In addition, IMP1338 markedly induced the phosphorylation of histone H2AX and Chk1 in both cell lines while the combination of 5-fluorouracil (5-FU) and radiation inhibited the viability of HCT116, HCT116 p53(-/-), and HT29 cells compared to 5-FU or radiation alone. Our findings indicated that IMP1338 induced p53-independent cell death through S and G2/M phase arrest as well as DNA damage. These results provide a basis for future investigations assessing the promising anticancer properties of IMP1338. Copyright © 2016. Published by Elsevier Masson SAS.
Yarusova, S. B.; Makarenko, N. V.; Gordienko, P. S.; Karpenko, M. A.; Novikova, E. S.
2018-03-01
Data on the effect temperature has on the kinetics of the removal of Co2+ and Ni2+ ions under static conditions by a sorbent based on a derivative of phytic acid fabricated from rice production waste are presented. It is shown that when the temperature is raised from 20 to 60°C, the sorption capacity of the sorbent based on phytic acid increases over the period of sorption and within 180 min reaches values of 1.4 mmol g-1 for Co2+ ions and 1.3 mmol g-1 for Ni2+ ions. It is established that for the investigated range of temperatures, order n of the sorption of Co2+ and Ni2+ ions is frame is best described by a kinetic model of a pseudo-second order, as is indicated by respective correlation coefficients.
Sun, Junyong; Mei, Han; Gao, Feng
2017-05-15
The rational surface functionalization of semiconducting polymer dots (Pdots) has attracted much attention to extend their applications in fabricating chemo/biosensing platform. In this study, a novel ratiometric fluorescent sensing platform using functionalized Pdots as probes for fluorescence signal transmission has been designed for sensing Cu(Ⅱ) and activity of alkaline phosphatase (ALP) with high selectivity and enhanced sensitivity. The highly fluorescent Pdots were firstly prepared with Poly[(9,9-dioctylfluorenyl-2,7-diyl)-co-(1,4-benzo-{2,1',3}-thiadiazole)] (PFBT) via nanoprecipitation method, and then assembled with non-fluorescent rhodamine B hydrazide (RB-hy), which shows special binding activity to Cu(Ⅱ), through adsorption process to obtain functionalized nanohybrids, Pdots@RB-hy. As thus, a FRET donors/acceptors pair, in which PFBT Pdots act as energy donors while RB-hy-Cu(II) complexes act as energy acceptors were constructed. On the basis of the varies in fluorescence intensities of donors/acceptors in the presence of different amounts of Cu(II), a ratiometric method for sensing Cu(II) has been proposed. The proposed ratiometric Cu(II) sensor shows a good linear detection range from 0.05 to 5μM with a detection limit of 15nM. Furthermore, using the Pdots@RB-hy-Cu(II) system as signal transducer, a ratiometric sensing for alkaline phosphatase (ALP) activity has also been established with pyrophosphate (PPi) as substrates. The constructed ratiometric sensor of ALP activity displays a linear detection range from 0.005 to 15UL -1 with a detection limit of 0.0018UL -1 . The sensor was further successfully used for ALP activity detection in human serum with satisfactory results. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Fernando R. Spilki
2004-09-01
Full Text Available This study aimed the in vitro growth characterization of a previously constructed Brazilian bovine herpesvirus 1.2a with a deletion in the glycoprotein E gene (BHV-1.2a gE-. The plaque sizes, penetration and growth kinetics of the Brazilian BHV-1.2a gE- were studied and compared with the parental virus, as well as with a BHV-1.1 gE- recombinant derived from an European BHV-1.1 strain. No statistical differences were observed between the gE- recombinants and the respective parental viruses penetration assays were performed. When single step growth curves were studied, no statistical differences were observed between gE- and parental viruses. However, it was observed that both gE- viruses were excreted from cells in significantly higher titres at 11 hours post infection in comparison with parental viruses. No statistical differences were observed when plaque sizes of parental viruses or gE- viruses we analyzed separately in each cell type. However, both gE- recombinants displayed a significantly reduced plaque areas on three different cell cultures, in comparison with parental viruses, indicating that the lack of gE had the same effect on both BHV-1 subtypes, manifested by a restricted cell-to-cell spread in infected cells.O presente estudo teve como objetivo a caracterização das propriedades de crescimento in vitro de uma amostra brasileira de herpesvírus bovino tipo 1.2a que apresenta uma deleção no gene que codifica a glicoproteína E (BHV-1.2a gE-. Os tamanhos de placa, cinética de penetração e cinética de multiplicação do vírus BHV-1.2a gE- foram estudados e comparados com o vírus parental, bem como com um vírus BHV-1.1 gE- recombinante, o qual é derivado de uma amostra européia de BHV-1.1. Em termos de cinética de penetração, não foram observadas diferenças significativas quando comparados os vírus gE- com os parentais. A determinação da cinética de multiplicação não demonstrou diferenças significativas entre os
Energy Technology Data Exchange (ETDEWEB)
Pascal,; Horowitz,; Bussac,; Joatton,; de Meux, De Lagge; Martin, [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1958-07-01
This paper points out the inventive properties of the frenchctors G2 and G3. These are dual purpose reactors, i.e. designed for the production of both plutonium and energy (30 electrical MW); in this respect, they can be considered as the start point of the french electrical energy produced from nuclear fuel. The following points are specially discussed in this paper: the choice of the prestressed concrete pressure vessel, the horizontal arrangement of the channels, the interest of neutron flux flattening, the advantages of the charging and discharging device working during pile operation. (author)Fren. [French] Les caracteres originaux des reacteurs fran is G2 et G3 sont decrits dans ce rapport. Ce sont des reacteurs a double fin, plutonigenes et aussi producteurs d'energie (30 MW electriques); ils constituent a ce titre le point de depart de la production fran ise d'electricite d'origine nucleaire. Sont discutes, en particulier, dans ce rapport: le choix du caisson en beton precontraint pour tenir la pression, la disposition horizontale des canaux, l'interet de l'aplatissement du flux neutronique, les avantages de l'appareil permettant le chargement et le dechargement du combustible sans arreter la pile. (auteur)
Directory of Open Access Journals (Sweden)
V. M. Odyntsova
2016-12-01
Full Text Available Lately adamantine containing substances have found wide use among the skeleton derivatives. The combination of adamantane and 1,2,4-triazole in one molecule creates significant preconditions to design new potential drugs with low toxicity and pronounced pharmacological activity. The aim of the research is the study of antimicrobial and antifungal activity of (5-(adamantane-1-yl-4-R-1,2,4-triazole-3-ylthiols substitutes. Materials and methods. Determination of antimicrobial and antifungal activity has been carried out by 2-fold serial dilutions method in liquid nutrient media. The substance of the antibacterial drug Trimethoprim has been applied as a control in determining antimicrobial activity of the compounds against the investigated strains of microorganisms. Results. According to the data of experiments the 5-(((5-(adamantane-1-yl-4-ethyl-4H-1,2,4-triazole-3-ylthiomethyl-4-ethyl-4H-1,2,4-triazole-3-thiol shows the same activity as Trimethoprim against P. aeruginosa (MIC is 62.5 µg/ml, MBC – 125 μg/ml, marked activity towards S. aureus (MIC is 15.6 μg/ml, MBC – 31.25 μg/ml while trimethoprim – 31.25 μg/ml, MBC – 62.5 µg/ml, greater fungistatic and fungicidal activity towards C. albicans, which amounted to 31.25 µg/ml, MFC – 62.5 µg/ml (while trimethoprim 62.5 µg/ml, MFC – 125 µg/ml. Reconstration of benzyldenhydrazide group to hydrazide one leads to the slight increase of bacteriostatic activity. Replacing the radical R from -Н to -C2H5 does not influence on the change of fungistatic activity. However, this resulted to the decrease in bacteriostatic activity against E. coli. The same is observed in relation to P. aeruginosa: from 62.5 μg/ml, MFC – 125 mcg/ml to 125 μg/ml, MFC – 125 µg/m respectively. Conclusion. The conducted study has showed that among the synthesized compounds there are some substances which strength of the antimicrobial and antifungal action in some cases exceeds the standard of comparison
Petersen, Gayle F; Hilbert, Bryan; Trope, Gareth; Kalle, Wouter; Strappe, Padraig
2014-12-01
Equine adipose-derived mesenchymal stem cells (EADMSC) provide a unique cell-based approach for treatment of a variety of equine musculoskeletal injuries, via regeneration of diseased or damaged tissue, or the secretion of immunomodulatory molecules. These capabilities can be further enhanced by genetic modification using lentiviral vectors, which provide a safe and efficient method of gene delivery. We investigated the suitability of lentiviral vector technology for gene delivery into EADMSC, using GFP expressing lentiviral vectors pseudotyped with the G glycoprotein from the vesicular stomatitis virus (V-GFP) or, for the first time, the baculovirus gp64 envelope protein (G-GFP). In this study, we produced similarly high titre V-GFP and G-GFP lentiviral vectors. Flow cytometric analysis showed efficient transduction using V-GFP; however G-GFP exhibited a poor ability to transduce EADMSC. Transduction resulted in sustained GFP expression over four passages, with minimal effects on cell viability and doubling time, and an unaltered chondrogenic differentiation potential. Copyright © 2014 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Rodier, J; Chassany, J; Guillermin, P [Commissariat a l' Energie Atomique, Centre de Production de Plutonium, Marcoule (France). Centre d' Etudes Nucleaires
1965-07-01
During this work and its preparation, which took place first at G. 2 and then at G. 3 over a period of 11 months, 15000 measurement results were obtained. Their analysis, together with a consideration of the organisation on the site and of the conclusions drawn from the experiment, shows the various factors which determine the importance of the radio-active dangers. (authors) [French] Au cours de ces travaux et de leur preparation, qui ont eu lieu successivement a G. 3 puis a G. 2, pendant 11 mois, 15 000 resultats de mesures ont ete obtenus. Leur etude, mise en parallele avec l'organisation du chantier et les enseignements tires de l'experience, met en evidence les divers facteurs conditionnant les niveaux de risques radioactifs. (auteurs)
Directory of Open Access Journals (Sweden)
Botao Feng
2013-01-01
Full Text Available A novel dual-wideband double-layer magnetoelectric dipole unidirectional antenna with a modified horned reflector for 2G/3G/LTE applications is proposed. Firstly, a double-layer electric dipole structure is presented to provide a dualwideband, whose folded lower layer mainly serves the lower frequency band while the inclined upper layer works for the upper frequency band. In addition, to reduce the size of the antenna and improve impedance matching, a new feeding structure designed with inverted U-shaped and tapered line is introduced. Finally, a modified horn-shaped reflector, instead of a ground plane, is employed to achieve stable and high gains. The antenna prototype can achieve a bandwidth of 24.4% (790 MHz–1010 MHz with a stable gain of 7.2 ± 0.6 dBi for the lower band, and a bandwidth of 67.3% (1.38 GHz–2.78 GHz with a gain of 7.5 ± 0.8 dBi for the upper band covering all the frequency bands for 2G/3G/LTE systems. To the best of our knowledge, it is the first double-layer magnetoelectric dipole antenna proposed. Compared with the existing ME dipole antennas, the proposed antenna, which is completely made of copper, can be easily fabricated at low cost and thus is practicable for 2G/3G/LTE applications.
Directory of Open Access Journals (Sweden)
Botao Feng
2014-01-01
Full Text Available A novel differentially driven dual-polarized dual-wideband complementary patch antenna with high isolation is proposed for 2G/3G/LTE applications. In order to generate dual-polarization and dual-wideband properties, a pair of biorthogonal dual-layer η-shaped tapered line feeding structures is utilized to feed two pairs of dual-layer U-shaped patches, respectively. The upper-layer U-shaped patches mainly serve the upper frequency band, while the lower-layer ones chiefly work for the lower frequency band. Besides, a horned reflector is introduced to improve radiation patterns and provide stable gain. The prototype antenna can achieve a bandwidth of 25.7% (0.78 GHz–1.01 GHz with a stable gain of 7.8±0.7 dBi for the lower band, and a bandwidth of 45.7% (1.69 GHz–2.69 GHz with a gain of 9.5±1.1 dBi for the upper band. Input isolation exceeding 30 dB has been obtained in the wide bandwidth. Thus, it can be potentially used as a base station antenna for 2G/3G/LTE networks.
Nakagawa, Hiroyuki; Matsuo, Yosuke; McCormick, Susan; Lim, Chee Wei
2018-05-01
A determination method previously validated for trichothecenes and zearalenone by means of liquid chromatography-tandem mass spectrometry (LC-MS/MS) was adapted for the quantification of T-2 toxin (T-2) as well as its glucoside and acetyl derivatives, T-2-3-glucoside (T-2-3G) and 3-acetyl-T-2 (3A-T-2). HT-2 toxin (HT-2) and its acetyl derivative 3-acetyl-HT-2 (3A-HT-2) were also included as the target chemicals. Staple flours (56 samples collected from the Singapore market) were examined for contamination from T-2 and/or HT-2 and their derivatives. Among them, 16 flours were found to be contaminated with T-2 and/or HT-2, whereas none was contaminated with T-2-3G and 3A-HT-2, except for trace 3A-T-2 detected in 2 rye samples. Rye flour samples were frequently contaminated with both T-2 and HT-2. Some of the reference materials (RMs) were further analyzed, and T-2-3G and 3A-T-2 were quantitatively detected in corn and wheat RMs. The ratio of T-2-3G to T-2 in the RMs seemed to be much lower than the ratio of deoxynivalenol-3-glucoside to deoxynivalenol usually reported in former studies. To the best of our knowledge, the natural contamination of 3A-T-2 in staple flour is reported here for the first time.
Jimenez-Sainz, MC; Murga, C; Kavelaars, A; Jurado-Pueyo, M; Krakstad, BF; Heijnen, CJ; Mayor, F; Aragay, AM
The G protein-coupled receptor kinase 2 (GRK2) phosphorylates and desensitizes ligand-activated G protein-coupled-receptors. Here, evidence is shown for a novel role of GRK2 in regulating chemokine-mediated signals. The presence of increased levels of GRK2 in human embryonic kidney (HEK) 293 cells
Directory of Open Access Journals (Sweden)
Jian-Chun Zhao
2014-06-01
Full Text Available The first total synthesis of marine-derived penicimonoterpene (±-1 has been achieved in four steps from 6-methylhept-5-en-2-one using a Reformatsky reaction as the key step to construct the basic carbon skeleton. A total of 24 new derivatives of 1 have also been designed and synthesized. Their structures were characterized by analysis of their 1H NMR, 13C NMR and HRESIMS data. Some of them showed significant antibacterial activity against Aeromonas hydrophila, Escherichia coli, Micrococcus luteus, Staphylococcus aureus, Vibrio anguillarum, V. harveyi and/or V. parahaemolyticus, and some showed activity against plant-pathogenic fungi (Alternaria brassicae, Colletotrichum gloeosporioides and/or Fusarium graminearum. Some of the derivatives exhibited antimicrobial MIC values ranging from 0.25 to 4 μg/mL, which were stronger than those of the positive control. Notably, Compounds 3b and 10 showed extremely high selectively against plant-pathogenic fungus F. graminearum (MIC 0.25 μg/mL and pathogenic bacteria E. coli (MIC 1 μg/mL, implying their potential as antimicrobial agents. SAR analysis of 1 and its derivatives indicated that modification of the carbon-carbon double bond at C-6/7, of groups on the allylic methylene unit and of the carbonyl group at C-1, effectively enhanced the antimicrobial activity.
Synthesis of 2-phosphaadamantane derivatives
International Nuclear Information System (INIS)
Zemlyanoi, V.N.; Aleksandrov, A.M.; Kukhar', V.P.
1986-01-01
The authors describe the synthesis and properties of 2-phosphadamantane derivatives. For the synthesis of 2-phosphaadamantane derivatives they decided to use the methodology of the synthesis of 2-thiaadamantane. The IR spectra were determined on CHCl 3 solutions with a Specord 711R spectrometer, the PMR spectra were determined on Tesla BS-467 (60 MHz) and Bruker WP-200 (200 MHz) spectrometers, external standard hexamethyldisiloxane, the 31 P NMR spectra were determined on Tesla BS-487 C (30 MHz) and Bruker WP-200 (81 MHz) spectrometers, external standard 85% phosphoric acid, and the mass spectra were determined on an MS-1302 spectrometer
Time- and concentration-dependent effects of resveratrol in HL-60 and HepG2 cells
DEFF Research Database (Denmark)
Stervbo, Ulrik; Vang, Ole; Bonnesen, Christine
2006-01-01
Resveratrol, a phytochemical present in grapes, has been demonstrated to inhibit tumourigenesis in animal models. However, the specific mechanism by which resveratrol exerts its anticarcinogenic effect has yet to be elucidated. In the present study, the inhibitory effects of resveratrol on cell...... proliferation and apoptosis were evaluated in the human leukaemia cell line HL-60 and the human hepatoma derived cell line HepG2. We found that after a 2 h incubation period, resveratrol inhibited DNA synthesis in a concentration-dependent manner. The IC50 value was 15 μM in both HL-60 and HepG2 cells. When...... the time of treatment was extended, an increase in IC50 value was observed; for example, at 24 h the IC50 value was 30 μM for HL-60 cells and 60 μM for HepG2 cells. Flow cytometry revealed that cells accumulated in different phases of the cell cycle depending on the resveratrol concentration. Furthermore...
Kocabalkanlı, Ayşe; Cihan-Üstündağ, Gökçe; Naesens, Lieve; Mataracı-Kara, Emel; Nassozi, Mebble; Çapan, Gültaze
2017-05-01
We report here the synthesis, structural characterization, and biological evaluation of novel diclofenac-based hydrazone (4a-f) and spirothiazolidinone (5a-f, 6a-f) derivatives designed as potential antimicrobial agents. The compounds were evaluated in vitro for their antiviral activity against a wide spectrum of DNA and RNA viruses. They were further screened in vitro against different strains of bacteria and fungi. The hydrazone derivatives, 4a and 4c-f, were found to be active against herpesviruses (HSV-1, HSV-2, and HSV-1 TK - ), vaccinia virus, and Coxsackie B4 virus, with EC 50 values between 6.6 µg/mL and 14.7 μg/mL, and the selectivity index values were greater than 10 for 4a and 4f. The newly synthesized compounds (4-6) were inactive against the bacterial and the fungal strains tested, at levels below 2500, 1250, or 625 μg/mL. Interestingly, the key intermediate 3 with a free hydrazide moiety displayed antifungal properties against Candida albicans and C. parapsilosis at MIC values of 4.88 µg/mL and 78.12 μg/mL, respectively. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Synthetic model of a new deoxybenzoin derivative from Deguelia hatschbachii A.M.G. Azevedo
International Nuclear Information System (INIS)
Magalhaes, A.F.; Magalhaes, E.G.; Trazzi, G.; Moraes, V.R. de S.
2005-01-01
In this paper we describe the synthesis of 2',4'-dimethoxy-8-(propyl-2-one)-deoxybenzoin, a new compound employed as a model for the comparison with the respective spectral data for 6',4-dihydroxy-3'-(3,3- dimethylallyl)-2 , 2 - dimethylchromene(5 , 6 : 5',4')-2'-methoxy-8-(propyl-2-one) deoxybenzoin, recently isolated from Deguelia hatschbachii A.M.G. Azevedo. Both compounds have a 'propyl-2-one' group attached to C-8 of the deoxybenzoin skeleton, for which there is no precedent in the literature. The Friedel-Crafts reaction of 1,3-dimethoxybenzene with phenylacetyl chloride furnished 2',4'-dimethoxydeoxybenzoin, that after reaction with allyl bromide gave 2',4'-dimethoxy-8-(allyl)-deoxybenzoin . Wacker oxidation gave the desired model compound in 15% overall yield. The corresponding spectral data reinforced the structure previously determined for the natural product. (author)
Li, Pengdong; Liu, Feilin; Wu, Chunling; Jiang, Wenyue; Zhao, Guifang; Liu, Li; Bai, Tingting; Wang, Li; Jiang, Yixu; Guo, Lili; Qi, Xiaojuan; Kou, Junna; Fan, Ruirui; Hao, Deshun; Lan, Shaowei; Li, Yulin; Liu, Jin Yu
2015-10-01
The use of human mesenchymal stem cells (hMSCs) in cell therapies has increased the demand for strategies that allow efficient cell scale-up. Preliminary data on the three-dimensional (3D) spinner culture describing the potential use of microcarriers for hMSCs culture scale-up have been reported. We exploited a rich source of autologous stem cells (human hair follicle) and demonstrated the robust in vitro long-term expansion of human hair follicle-derived mesenchymal stem cells (hHF-MSCs) by using CultiSpher(®)-G microcarriers. We analyzed the feasibility of 3D culture by using hHF-MSCs/CultiSpher(®)-G microcarrier constructs for its potential applicability in regenerative medicine by comparatively analyzing the performance of hHF-MSCs adhered to the CultiSpher(®)-G microspheres in 3D spinner culture and those grown on the gelatin-coated plastic dishes (2D culture), using various assays. We showed that the hHF-MSCs seeded at various densities quickly adhered to and proliferated well on the microspheres, thus generating at least hundreds of millions of hHF-MSCs on 1 g of CultiSpher(®)-G within 12 days. This resulted in a cumulative cell expansion of greater than 26-fold. Notably, the maximum and average proliferation rates in 3D culture were significantly greater than that of the 2D culture. However, the hHF-MSCs from both the cultures retained surface marker and nestin expression, proliferation capacity and differentiation potentials toward adipocytes, osteoblasts and smooth muscle cells and showed no significant differences as evidenced by Edu incorporation, cell cycle, colony formation, apoptosis, biochemical quantification and qPCR assays.
DEFF Research Database (Denmark)
Barfod, Lea; Nielsen, Morten A; Turner, Louise
2006-01-01
We raised specific antisera against recombinant VAR2CSA domains produced in Escherichia coli and in insect cells. All were reactive in enzyme-linked immunosorbent assay, but only insect cell-derived constructs induced immunoglobulin G (IgG) that was reactive with native VAR2CSA on the surface...
Corps G-2 Staff Competencies: A Desert Storm Case Study
2017-06-09
Department of the Army, Army Doctrine Reference Publication (ADRP) 2-0, Intelligence (Washington, DC: Government Printing Office, August 2012), 3-2...Washington, DC: Government Printing Office, August 2012), 5-9. Intelligence Operations The second key corps G-2 intelligence meta-competency...Publication (ADRP) 2-0, Intelligence (Washington, DC: Government Printing Office, 2016), 4-2 to 4-9. Intelligence Analysis The final corps G-2
Brain-derived neurotrophic factor (BDNF) and type 2 diabetes
DEFF Research Database (Denmark)
Krabbe, K. S.; Nielsen, A. R.; Krogh-Madsen, R.
2006-01-01
Aims/hypothesis Decreased levels of brain-derived neurotrophic factor (BDNF) have been implicated in the pathogenesis of Alzheimer's disease and depression. These disorders are associated with type 2 diabetes, and animal models suggest that BDNF plays a role in insulin resistance. We therefore...... explored whether BDNF plays a role in human glucose metabolism. Subjects and methods We included (Study 1) 233 humans divided into four groups depending on presence or absence of type 2 diabetes and presence or absence of obesity; and (Study 2) seven healthy volunteers who underwent both a hyperglycaemic...... and a hyperinsulinaemic-euglycaemic clamp. Results Plasma levels of BDNF in Study 1 were decreased in humans with type 2 diabetes independently of obesity. Plasma BDNF was inversely associated with fasting plasma glucose, but not with insulin. No association was found between the BDNF G196A (Val66Met) polymorphism...
Synthesis of Substituted α-Trifluoromethyl Piperidinic Derivatives
Directory of Open Access Journals (Sweden)
Sarah Rioton
2017-03-01
Full Text Available A comprehensive survey of pathways leading to the generation of α-trifluoromethyl monocyclic piperidinic derivatives is provided (65 references. These compounds have been synthesized either from 6-membered rings e.g., pipecolic acid or lactam derivatives by introduction a trifluoromethyl group, from pyridine or pyridinone derivatives by reduction, and from 5-membered rings e.g., prolinol derivatives by ring expansion, from linear amines by cyclization or from dienes/dienophiles by [4 + 2]-cycloaddition.
MicroRNA-122 mimic transfection contributes to apoptosis in HepG2 cells.
Huang, Hongyan; Zhu, Yueyong; Li, Shaoyang
2015-11-01
There is currently a requirement for effective treatment strategies for human hepatocellular carcinoma (HCC), a leading cause of cancer‑associated mortality. MicroRNA-122 (miR-122), a repressor of the endogenous apoptosis regulator Bcl‑w, is frequently downregulated in HCC. Thus, it is hypothesized that the activation of miR‑122 may induce selective hepatocellular apoptosis via caspase activation in a model of HCC. In the present study, an miR‑122 mimic transfection was performed in HepG2 cells, and used to investigate the role and therapeutic potential of miR‑122 in the regulation of HCC‑derived cell lines. The apoptotic rates of HepG2 cells were significantly increased following miR‑122 mimic transfection. Reverse transcription‑polymerase chain reaction analysis revealed that Bcl‑w mRNA was significantly reduced, while the mRNA levels of caspase‑9 and caspase‑3 were markedly increased. The immunocytochemistry results supported the mRNA trends. Collectively, the present results suggest that endogenous miR‑122 contributes to HepG2 apoptosis and that transfection of mimic miR‑122 normalizes apoptotic levels in a model of HCC.
The g0/g1 switch gene 2 is an important regulator of hepatic triglyceride metabolism.
Wang, Yinfang; Zhang, Yahui; Qian, Hang; Lu, Juan; Zhang, Zhifeng; Min, Xinwen; Lang, Mingjian; Yang, Handong; Wang, Nanping; Zhang, Peng
2013-01-01
Nonalcoholic fatty liver disease is associated with obesity and insulin resistance. Factors that regulate the disposal of hepatic triglycerides contribute to the development of hepatic steatosis. G0/G1 switch gene 2 (G0S2) is a target of peroxisome proliferator-activated receptors and plays an important role in regulating lipolysis in adipocytes. Therefore, we investigated whether G0S2 plays a role in hepatic lipid metabolism. Adenovirus-mediated expression of G0S2 (Ad-G0S2) potently induced fatty liver in mice. The liver mass of Ad-G0S2-infected mice was markedly increased with excess triglyceride content compared to the control mice. G0S2 did not change cellular cholesterol levels in hepatocytes. G0S2 was found to be co-localized with adipose triglyceride lipase at the surface of lipid droplets. Hepatic G0S2 overexpression resulted in an increase in plasma Low-density lipoprotein (LDL)/Very-Low-density (VLDL) lipoprotein cholesterol level. Plasma High-density lipoprotein (HDL) cholesterol and ketone body levels were slightly decreased in Ad-G0S2 injected mice. G0S2 also increased the accumulation of neutral lipids in cultured HepG2 and L02 cells. However, G0S2 overexpression in the liver significantly improved glucose tolerance in mice. Livers expressing G0S2 exhibited increased 6-(N-(7-nitrobenz-2-oxa-1-3-diazol-4-yl) amino)-6-deoxyglucose uptake compared with livers transfected with control adenovirus. Taken together, our results provide evidence supporting an important role for G0S2 as a regulator of triglyceride content in the liver and suggest that G0S2 may be a molecular target for the treatment of insulin resistance and other obesity-related metabolic disorders.
77 FR 40806 - Methoxyfenozide; Pesticide Tolerances
2012-07-11
...'-(3-hydroxy-2-methylbenzoyl) hydrazide, RH-151,055 glucose conjugate of RH-117,236; 3,5... or clastogenic potential was observed in the battery of genotoxicity studies on methoxyfenozide... methoxyfenozide [3,5-dimethylbenzoic acid N-tert-butyl-N'-(3-hydroxy-2-methylbenzoyl) hydrazide], the glucose...
O2(X3 Sigma- sub g) and O2(a1 Delta sub g) Charge Exchange with Simple Ions (Postprint)
2014-06-03
injected into a flow tube through a Venturi inlet. The ions were carried downstream by the helium buffer gas . The O2(X3−g )/O2(a 1g) mixture was added...However, for this study, the procedure needed to be modified as explained below. Most of the gas was pumped away by a roots blower and a small amount was...Publishing Articles you may be interested in Mutual neutralization of atomic rare- gas cations (Ne+, Ar+, Kr+, Xe+) with atomic halide anions (Cl−, Br−, I
Czech Academy of Sciences Publication Activity Database
Tabatabaee, M.; Taghinezhadkoshknou, A.; Dušek, Michal; Fejfarová, Karla
2015-01-01
Roč. 45, č. 10 (2015), 1506-1512 ISSN 1553-3174 Grant - others:AV ČR(CZ) Praemium Academiae Institutional support: RVO:68378271 Keywords : Schiff base ligand * cobalt complex * isonicotinic acid hydrazide Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.493, year: 2015
Jamil, Kaiser; Jayaraman, Archana; Ahmad, Javeed; Joshi, Sindhu; Yerra, Shiva Kumar
2017-09-01
Several reports document the role of tumor necrosis factor alpha ( TNF-α ) and lipid metabolism in the context of acute inflammation as a causative factor in obesity-associated insulin resistance and as one of the causative parameter of type 2 diabetes mellitus (T2DM). Our aim was to investigate the association between -308G/A and -238G/A polymorphisms located in the promoter region of the TNF-α gene in T2DM in the Indian population with bioinformatics analysis of TNF-α protein networking with an aim to find new target sites for the treatment of T2DM. Demographics of 100 diabetes patients and 100 healthy volunteers were collected in a structured proforma and 3 ml blood samples were obtained from the study group, after approval of Institutional Ethics Committee of the hospital (IEC). The information on clinical parameters was obtained from medical records. Genomic DNA was extracted; PCR-RFLP was performed using TNF-α primers specific to detect the presence of SNPs. Various bioinformatics tools such as STRING software were used to determine its network with other associated genes. The PCR-RFLP studies showed that among the -238G/A types the GG genotype was 87%, GA genotype was 12% and AA genotype was 1%. Almost a similar pattern of results was obtained with TNF-α -308G/A polymorphism. The results obtained were evaluated statistically to determine the significance. By constructing TNF-α protein interaction network we could analyze ontology and hubness of the network to identify the networking of this gene which may influence the functioning of other genes in promoting T2DM. We could identify new targets in T2DM which may function in association with TNF-α . Through hub analysis of TNF-α protein network we have identified three novel proteins RIPK1, BIRC2 and BIRC3 which may contribute to TNF- mediated T2DM pathogenesis. In conclusion, our study indicated that some of the genotypes of TNF-α -308G/A, -238G/A were not significantly associated to type 2 diabetes
Measurement of the Proton and Deuteron Spin Structure Functions G1 and G2
Energy Technology Data Exchange (ETDEWEB)
Tobias, Al
2003-04-02
The SLAC experiment E155 was a deep-inelastic scattering experiment that scattered polarized electrons off polarized proton and deuteron targets in the effort to measure precisely the proton and deuteron spin structure functions. The nucleon structure functions g{sub 1} and g{sub 2} are important quantities that help test our present models of nucleon structure. Such information can help quantify the constituent contributions to the nucleon spin. The structure functions g{sub 1}{sup p} and G{sub 1}{sup d} have been measured over the kinematic range 0.01 {le} x {le} 0.9 and 1 {le} Q{sup 2} {le} 40 GeV{sup 2} by scattering 48.4 GeV longitudinally polarized electrons off longitudinally polarized protons and deuterons. In addition, the structure functions g{sub 2}{sup p} and g{sub 2}{sup d} have been measured over the kinematic range 0.01 {le} x {le} 0.7 and 1 {le} Q{sup 2} {le} 17 GeV{sup 2} by scattering 38.8 GeV longitudinally polarized electrons off transversely polarized protons and deuterons. The measurements of g{sub 1} confirm the Bjorken sum rule and find the net quark polarization to be {Delta}{Sigma} = 0.23 {+-} 0.04 {+-} 0.6 while g{sub 2} is found to be consistent with the g{sub 2}{sup WW} model.
Penicyclones A-E, Antibacterial Polyketides from the Deep-Sea-Derived Fungus Penicillium sp. F23-2.
Guo, Wenqiang; Zhang, Zhenzhen; Zhu, Tianjiao; Gu, Qianqun; Li, Dehai
2015-11-25
Five new ambuic acid analogues, penicyclones A-E (1-5), were isolated from the extract of the deep-sea-derived fungus Penicillium sp. F23-2. The structures including the absolute configurations were established by interpretation of NMR and MS data, as well as the application of ECD, X-ray crystallography, and a chemical conversion, as well as the TDDFT-ECD calculations. Penicyclones A-E (1-5) exhibited antimicrobial activity against the Gram-positive bacterium Staphylococcus aureus with MIC values ranging from 0.3 to 1.0 μg/mL.
A Precision Measurement of the Spin Structure Function G(2)(P)
Energy Technology Data Exchange (ETDEWEB)
Benmouna, N
2004-01-05
The spin structure function g{sub 2}(x,Q{sup 2}) and the virtual photon asymmetry A{sub 2}(x,Q{sup 2}) were measured for the proton using deep inelastic scattering. The experiment was conducted at the Stanford Linear Accelerator Center (SLAC), where longitudinally polarized electrons at 29.1 and 32.3 GeV were scattered from a transversely polarized NH{sub 3} target. Large data sets were accumulated using three independent spectrometers covering a kinematic range 0.02 {le} x {le} 0.8 and 1 {le} Q{sup 2} {le} 20 (GeV/c){sup 2}. This new data is the first data precise enough to distinguish between current models for the proton. The structure function g{sub 2}{sup p} was found to be reasonably consistent with the twist-2 Wandzura-Wilczek calculation. The Q{sup 2} dependence of g{sub 2} approximately follows the Q{sup 2} dependence of g{sub 2}{sup WW}, although the data are not precise enough to rule out no Q{sup 2} dependence. The absolute value for A{sub 2}{sup p} was found to be significantly smaller than the Soffer limit over the measured range. The virtual photon asymmetry A{sub 2} was also found to be inconsistent with zero over much of the measured range.
Directory of Open Access Journals (Sweden)
Zhang Tengyue
2013-01-01
Full Text Available Abstract Background Mounting evidence has suggested that plasminogen activator inhibitor-1 (PAI-1 is a candidate for increased risk of diabetic retinopathy. Studies have reported that insertion/deletion polymorphism in the PAI-1 gene may influence the risk of this disease. To comprehensively address this issue, we performed a meta-analysis to evaluate the association of PAI-1 4G/5G polymorphism with diabetic retinopathy in type 2 diabetes. Methods Data were retrieved in a systematic manner and analyzed using Review Manager and STATA Statistical Software. Crude odds ratios (ORs with 95% confidence intervals (CIs were used to assess the strength of associations. Results Nine studies with 1, 217 cases and 1, 459 controls were included. Allelic and genotypic comparisons between cases and controls were evaluated. Overall analysis suggests a marginal association of the 4G/5G polymorphism with diabetic retinopathy (for 4G versus 5G: OR 1.13, 95%CI 1.01 to 1.26; for 4G/4G versus 5G/5G: OR 1.30, 95%CI 1.04 to 1.64; for 4G/4G versus 5G/5G + 4G/5G: OR 1.26, 95%CI 1.05 to 1.52. In subgroup analysis by ethnicity, we found an association among the Caucasian population (for 4G versus 5G: OR 1.14, 95% CI 1.00 to 1.30; for 4G/4G versus 5G/5G: OR 1.33, 95%CI 1.02 to 1.74; for 4G/4G versus 5G/5G + 4G/5G: OR 1.41, 95%CI 1.13 to 1.77. When stratified by the average duration of diabetes, patients with diabetes histories longer than 10 years have an elevated susceptibility to diabetic retinopathy than those with shorter histories (for 4G/4G versus 5G/5G: OR 1.47, 95%CI 1.08 to 2.00. We also detected a higher risk in hospital-based studies (for 4G/4G versus 5G/5G+4G/5G: OR 1.27, 95%CI 1.02 to 1.57. Conclusions The present meta-analysis suggested that 4G/5G polymorphism in the PAI-1 gene potentially increased the risk of diabetic retinopathy in type 2 diabetes and showed a discrepancy in different ethnicities. A higher susceptibility in patients with longer duration of
Zhang, Tengyue; Pang, Chong; Li, Ningdong; Zhou, Elaine; Zhao, Kanxing
2013-01-02
Mounting evidence has suggested that plasminogen activator inhibitor-1 (PAI-1) is a candidate for increased risk of diabetic retinopathy. Studies have reported that insertion/deletion polymorphism in the PAI-1 gene may influence the risk of this disease. To comprehensively address this issue, we performed a meta-analysis to evaluate the association of PAI-1 4G/5G polymorphism with diabetic retinopathy in type 2 diabetes. Data were retrieved in a systematic manner and analyzed using Review Manager and STATA Statistical Software. Crude odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of associations. Nine studies with 1, 217 cases and 1, 459 controls were included. Allelic and genotypic comparisons between cases and controls were evaluated. Overall analysis suggests a marginal association of the 4G/5G polymorphism with diabetic retinopathy (for 4G versus 5G: OR 1.13, 95%CI 1.01 to 1.26; for 4G/4G versus 5G/5G: OR 1.30, 95%CI 1.04 to 1.64; for 4G/4G versus 5G/5G + 4G/5G: OR 1.26, 95%CI 1.05 to 1.52). In subgroup analysis by ethnicity, we found an association among the Caucasian population (for 4G versus 5G: OR 1.14, 95% CI 1.00 to 1.30; for 4G/4G versus 5G/5G: OR 1.33, 95%CI 1.02 to 1.74; for 4G/4G versus 5G/5G + 4G/5G: OR 1.41, 95%CI 1.13 to 1.77). When stratified by the average duration of diabetes, patients with diabetes histories longer than 10 years have an elevated susceptibility to diabetic retinopathy than those with shorter histories (for 4G/4G versus 5G/5G: OR 1.47, 95%CI 1.08 to 2.00). We also detected a higher risk in hospital-based studies (for 4G/4G versus 5G/5G+4G/5G: OR 1.27, 95%CI 1.02 to 1.57). The present meta-analysis suggested that 4G/5G polymorphism in the PAI-1 gene potentially increased the risk of diabetic retinopathy in type 2 diabetes and showed a discrepancy in different ethnicities. A higher susceptibility in patients with longer duration of diabetes (more than 10 years) indicated a gene
Energy Technology Data Exchange (ETDEWEB)
Mohanraj, Maruthachalam; Ayyannan, Ganesan; Raja, Gunasekaran; Jayabalakrishnan, Chinnasamy, E-mail: drcjbstar@gmail.com
2016-12-01
The new ruthenium(II) complexes with hydrazone ligands, 4-Methyl-benzoic acid (2,4-dihydroxy-benzylidene)-hydrazide (HL{sup 1}), 4-Methoxy-benzoic acid (2,4-dihydroxy-benzylidene)-hydrazide (HL{sup 2}), 4-Bromo-benzoic acid (2,4-dihydroxy-benzylidene)-hydrazide (HL{sup 3}), were synthesized and characterized by various spectro analytical techniques. The molecular structures of the ligands were confirmed by single crystal X-ray diffraction technique. The DNA binding studies of the ligands and complexes were examined by absorption, fluorescence, viscosity and cyclic voltammetry methods. The results indicated that the ligands and complexes could interact with calf thymus DNA (CT-DNA) through intercalation. The DNA cleavage activity of the complexes was evaluated by gel electrophoresis assay, which revealed that the complexes are good DNA cleaving agents. The binding interaction of the ligands and complexes with bovine serum albumin (BSA) was investigated using fluorescence spectroscopic method. Antioxidant studies showed that the complexes have a strong radical scavenging properties. Further, the cytotoxic effect of the complexes examined on cancerous cell lines showed that the complexes exhibit significant anticancer activity. - Highlights: • Synthesis of ruthenium(II) hydrazone complexes • Molecular structure of the ligands was elucidated by single crystal X-ray diffraction method. • The ligands and complexes interact with CT-DNA via intercalation. • The complexes possess significant antioxidant activity against DPPH, OH and NO radicals. • The complex 6 shows higher IC{sub 50} value than the other complexes against cancer cells.
1974-01-01
The precise measurement of "g-2", the anomalous magnetic moment of the muon, required a special muon storage ring with electrostatic focussing and very accurate knowledge of the magnetic bending field. For more details see under photo 7405430.
Directory of Open Access Journals (Sweden)
Wei Chen
2015-01-01
Full Text Available The target of this paper is to establish the bid-ask pricing framework for the American contingent claims against risky assets with G-asset price systems on the financial market under Knightian uncertainty. First, we prove G-Dooby-Meyer decomposition for G-supermartingale. Furthermore, we consider bid-ask pricing American contingent claims under Knightian uncertainty, by using G-Dooby-Meyer decomposition; we construct dynamic superhedge strategies for the optimal stopping problem and prove that the value functions of the optimal stopping problems are the bid and ask prices of the American contingent claims under Knightian uncertainty. Finally, we consider a free boundary problem, prove the strong solution existence of the free boundary problem, and derive that the value function of the optimal stopping problem is equivalent to the strong solution to the free boundary problem.
G2 and Sgr A *: A Cosmic Fizzle at the Galactic Center
Energy Technology Data Exchange (ETDEWEB)
Morsony, Brian J. [Dept. of Astronomy, University of Maryland, 1113 Physical Sciences Complex, College Park, MD, 20742-2421 (United States); Gracey, Brandon T.; Workman, Jared C. [Dept. of Physical and Environmental Sciences, Colorado Mesa University, Grand Junction, CO, 81501 (United States); Yoon, DooSoo [Dept. of Astronomy, University of Wisconsin-Madison, 2535 Sterling Hall, 475 N. Charter Street, Madison, WI, 53706-1582 (United States)
2017-07-01
We carry out a series of simulations of G2-type clouds interacting with the black hole at the galactic center, to determine why no large changes in the luminosity of Sgr A * were seen, and to determine the nature of G2. We measure the accretion rate from the gas cloud onto Sgr A * for a range of simulation parameters, such as cloud structure, background structure, background density, grid resolution, and accretion radius. For a broad range of parameters, the amount of cloud material accreted is small relative to the amount of background material accreted. The total accretion rate is not significantly effected for at least 30 yr after periapsis. We find that reproducing observations of G2 likely requires two components for the object: an extended, cold gas cloud responsible for the Br- γ emission, and a compact core or dusty stellar object dominating the bolometric luminosity. In simulations, the bolometric and X-ray luminosity have a peak lasting from about one year before to one year after periapsis, a feature not detected in observations. Our simulated Br- γ emission is largely consistent with observations leading up to periapsis, with a slight increase in luminosity and a large increase in the FWHM of the line velocity. All emission from a gaseous component of G2 should fade rapidly after periapsis and be undetectable after one year, due to shock heating and expansion of the cloud. Any remaining emission should be from the compact component of G2.
Wigner effect in graphite stack: G2 and G3 reactors
International Nuclear Information System (INIS)
Artozoul, M.; L'Homme, M.
1982-11-01
This text describes work carried out between 1978 and 1980 by a COGEMA/CEA team responsible for a report on the feasibility, effectiveness and possible hazards likely to be encountered in the nuclear annealing of G2 and in changing the operating conditions of G3 [fr
International Nuclear Information System (INIS)
Hlaing, Nwe Ni; Sreekantan, Srimala; Hinode, Hirofumi; Kurniawan, Winarto; Thant, Aye Aye; Othman, Radzali; Mohamed, Abdul Rahman; Salime, Chris
2016-01-01
Recent years, CaO-based synthetic materials have been attracted attention as potential adsorbents for CO_2 capture mainly due to their high CO_2 adsorption capacity. In this study, micro/nanostructured aragonite CaCO_3 was synthesized by a simple hydrothermal method with using polyacrylamide (PAM). The structural, morphological and thermal properties of the synthesized sample were investigated by X-ray diffraction (XRD), field-emission scanning electron microscopy (FESEM) and thermogravimetry analysis (TG-DTA). The XRD and FESEM results showed that the obtained sample was aragonite CaCO_3 with aggregated nanorods and microspheres composed of nanorods. A TG-DTA apparatus with Thermoplus 2 software was used to investigate the effect of carbonation temperature on the CO_2 adsorption capacity of CaO derived from aragonite CaCO_3 sample. At 300 °C, the sample reached the CO_2 adsorption capacity of 0.098 g-CO_2/g-adsorbent, whereas the sample achieved the highest capacity of 0.682 g-CO_2/g-adsorbent at 700 °C. The results showed that the carbonation temperature significantly influenced on the CO_2 adsorption capacity of the CaO derived from aragonite CaCO_3.
Modulation of radiation-induced apoptosis and G2/M block in murine T-lymphoma cells
International Nuclear Information System (INIS)
Palayoor, S.T.; Macklis, R.M.; Bump, E.A.; Coleman, C.N.
1995-01-01
Radiation-induced apoptosis in lymphocyte-derived cell lines is characterized by endonucleolytic cleavage of cellular DNA within hours after radiation exposure. We have studied this phenomenon qualitatively (DNA gel electrophoresis) and quantitatively (diphenylamine reagent assay) in murine EL4 T-lymphoma cells exposed to 137 Cs γ irradiation. Fragmentation was discernible within 18-24 h after exposure. It increased with time and dose and reached a plateau after 8 Gy of γ radiation. We studied the effect of several pharmacological agents on the radiation-induced G 2 /M block and DNA fragmentation. The agents which reduced the radiation-induced G 2 /M-phase arrest (caffeine, theobromine, theophylline and 2-aminopurine) enhanced the degree of DNA fragmentation at 24 h. In contrast, the agents which sustained the radiation-induced G 2 /M-phase arrest (TPA, DBcAMP, IBMX and 3-aminobenzamide) inhibited the DNA fragmentation at 24 h. These studies on EL4 lymphoma cells are consistent with the hypothesis that cells with radiation-induced genetic damage are eliminated by apoptosis subsequent to a G 2 /M block. Furthermore, it may be possible to modulate the process of radiation-induced apoptosis in lymphoma cells with pharmacological agents that modify the radiation-induced G 2 /M block, and to use this effect in the treatment of patients with malignant disease. 59 refs., 7 figs
Directory of Open Access Journals (Sweden)
Juan Roberto Rodriguez-Madoz
Full Text Available The combination of defined factors with small molecules targeting epigenetic factors is a strategy that has been shown to enhance optimal derivation of iPSCs and could be used for disease modelling, high throughput screenings and/or regenerative medicine applications. In this study, we showed that a new first-in-class reversible dual G9a/DNMT1 inhibitor compound (CM272 improves the efficiency of human cell reprogramming and iPSC generation from primary cells of healthy donors and patient samples, using both integrative and non-integrative methods. Moreover, CM272 facilitates the generation of human iPSC with only two factors allowing the removal of the most potent oncogenic factor cMYC. Furthermore, we demonstrated that mechanistically, treatment with CM272 induces heterochromatin relaxation, facilitates the engagement of OCT4 and SOX2 transcription factors to OSKM refractory binding regions that are required for iPSC establishment, and enhances mesenchymal to epithelial transition during the early phase of cell reprogramming. Thus, the use of this new G9a/DNMT reversible dual inhibitor compound may represent an interesting alternative for improving cell reprogramming and human iPSC derivation for many different applications while providing interesting insights into reprogramming mechanisms.
Rodriguez-Madoz, Juan Roberto; San Jose-Eneriz, Edurne; Rabal, Obdulia; Zapata-Linares, Natalia; Miranda, Estibaliz; Rodriguez, Saray; Porciuncula, Angelo; Vilas-Zornoza, Amaia; Garate, Leire; Segura, Victor; Guruceaga, Elizabeth; Agirre, Xabier; Oyarzabal, Julen; Prosper, Felipe
2017-01-01
The combination of defined factors with small molecules targeting epigenetic factors is a strategy that has been shown to enhance optimal derivation of iPSCs and could be used for disease modelling, high throughput screenings and/or regenerative medicine applications. In this study, we showed that a new first-in-class reversible dual G9a/DNMT1 inhibitor compound (CM272) improves the efficiency of human cell reprogramming and iPSC generation from primary cells of healthy donors and patient samples, using both integrative and non-integrative methods. Moreover, CM272 facilitates the generation of human iPSC with only two factors allowing the removal of the most potent oncogenic factor cMYC. Furthermore, we demonstrated that mechanistically, treatment with CM272 induces heterochromatin relaxation, facilitates the engagement of OCT4 and SOX2 transcription factors to OSKM refractory binding regions that are required for iPSC establishment, and enhances mesenchymal to epithelial transition during the early phase of cell reprogramming. Thus, the use of this new G9a/DNMT reversible dual inhibitor compound may represent an interesting alternative for improving cell reprogramming and human iPSC derivation for many different applications while providing interesting insights into reprogramming mechanisms.
Brasca, Romina; Onaindia, María C.; Goicoechea, Héctor C.; Muñoz de la Peña, Arsenio; Culzoni, María J.
2016-01-01
A method for the detection and quantitation of Hg2+ in aqueous samples by fluorescence spectroscopy is presented. It consists of a turn-on sensor developed by coupling Gold nanoparticles (AuNPs) with the rhodamine 6G derivative FC1, in which the response is generated by a mercury-induced ring-opening reaction. The AuNPs were included in order to improve the sensitivity of the method towards the analyte, maintaining its high selectivity. The method was validated in terms of linearity, precision and accuracy, and applied to the quantitation of Hg2+ in Milli-Q and tap water with and without spiked analyte. The limit of detection and quantitation were 0.15 μg·L−1 and 0.43 μg·L−1, respectively, constituting a substantial improvement of sensitivity in comparison with the previously reported detection of Hg2+ with free FC1. PMID:27782059
Link invariant and $G_2$ web space
Sakamoto, Takuro; Yonezawa, Yasuyoshi
2017-01-01
In this paper, we reconstruct Kuperberg’s $G_2$ web space [5, 6]. We introduce a new web diagram (a trivalent graph with only double edges) and new relations between Kuperberg’s web diagrams and the new web diagram. Using the web diagrams, we give crossing formulas for the $R$-matrices associated to some irreducible representations of $U_q(G_2)$ and calculate $G_2$ quantum link invariants for generalized twist links.
O{sub 2}(X{sup 3}Σ{sub g}{sup −}) and O{sub 2}(a{sup 1}Δ{sub g}) charge exchange with simple ions
Energy Technology Data Exchange (ETDEWEB)
Ziółkowski, Marcin; Schatz, George C., E-mail: schatz@chem.northwestern.edu [Department of Chemistry, Northwestern University, Evanston, Illinois 60208-3113 (United States); Viggiano, A. A.; Midey, Anthony [Air Force Research Laboratory, Space Vehicles Directorate, 3500 Aberdeen Ave, Kirtland AFB, New Mexico 87117 (United States); Dotan, Itzhak [Air Force Research Laboratory, Space Vehicles Directorate, 3500 Aberdeen Ave, Kirtland AFB, New Mexico 87117 (United States); Open University of Israel, 108 Ravutski St., Raanana 43107 (Israel)
2014-06-07
We present theory and experiments which describe charge transfer from the X{sup 3}Σ{sub g}{sup −} and a{sup 1}Δ{sub g} states of molecular oxygen and atomic and molecular cations. Included in this work are new experimental results for O{sub 2}(a{sup 1}Δ{sub g}) and the cations O{sup +}, CO{sup +}, Ar{sup +}, and N{sub 2}{sup +}, and new theory based on complete active space self-consistent field method calculations and an extended Langevin model to calculate rate constants for ground and excited O{sub 2} reacting with the atomic ions Ar{sup +}, Kr{sup +}, Xe{sup +}, Cl{sup +}, and Br{sup +}. The T-shaped orientation of the (X − O{sub 2}){sup +} potential surface is used for the calculations, including all the low lying states up to the second singlet state of the oxygen molecule b{sup 1}Σ{sub g}{sup +}. The calculated rate constants for both O{sub 2}(X{sup 3}Σ{sub g}{sup −}) and O{sub 2}(a{sup 1}Δ{sub g}) show consistent trends with the experimental results, with a significant dependence of rate constant on charge transfer exothermicity that does not depend strongly on the nature of the cation. The comparisons with theory show that partners with exothermicities of about 1 eV have stronger interactions with O{sub 2}, leading to larger Langevin radii, and also that more of the electronic states are attractive rather than repulsive, leading to larger rate constants. Rate constants for charge transfer involving O{sub 2}(a{sup 1}Δ{sub g}) are similar to those for O{sub 2}(X{sup 3}Σ{sub g}{sup −}) for a given exothermicity ignoring the electronic excitation of the O{sub 2}(a{sup 1}Δ{sub g}) state. This means (and the electronic structure calculations support) that the ground and excited states of O{sub 2} have about the same attractive interactions with ions.
Visualizing Vpr-induced G2 arrest and apoptosis.
Directory of Open Access Journals (Sweden)
Tomoyuki Murakami
Full Text Available Vpr is an accessory protein of human immunodeficiency virus type 1 (HIV-1 with multiple functions. The induction of G2 arrest by Vpr plays a particularly important role in efficient viral replication because the transcriptional activity of the HIV-1 long terminal repeat is most active in G2 phase. The regulation of apoptosis by Vpr is also important for immune suppression and pathogenesis during HIV infection. However, it is not known whether Vpr-induced apoptosis depends on the ability of Vpr to induce G2 arrest, and the dynamics of Vpr-induced G2 arrest and apoptosis have not been visualized. We performed time-lapse imaging to examine the temporal relationship between Vpr-induced G2 arrest and apoptosis using HeLa cells containing the fluorescent ubiquitination-based cell cycle indicator2 (Fucci2. The dynamics of G2 arrest and subsequent long-term mitotic cell rounding in cells transfected with the Vpr-expression vector were visualized. These cells underwent nuclear mis-segregation after prolonged mitotic processes and then entered G1 phase. Some cells subsequently displayed evidence of apoptosis after prolonged mitotic processes and nuclear mis-segregation. Interestingly, Vpr-induced apoptosis was seldom observed in S or G2 phase. Likewise, visualization of synchronized HeLa/Fucci2 cells infected with an adenoviral vector expressing Vpr clearly showed that Vpr arrests the cell cycle at G2 phase, but does not induce apoptosis at S or G2 phase. Furthermore, time-lapse imaging of HeLa/Fucci2 cells expressing SCAT3.1, a caspase-3-sensitive fusion protein, clearly demonstrated that Vpr induces caspase-3-dependent apoptosis. Finally, to examine whether the effects of Vpr on G2 arrest and apoptosis were reversible, we performed live-cell imaging of a destabilizing domain fusion Vpr, which enabled rapid stabilization and destabilization by Shield1. The effects of Vpr on G2 arrest and subsequent apoptosis were reversible. This study is the first to
Dash, S; Kalkeri, G; McClure, H M; Garry, R F; Clejan, S; Thung, S N; Murthy, K K
2001-10-01
It was demonstrated previously that HepG2 cells produce negative strand RNA and virus-like particles after transfection with RNA transcribed from a full-length hepatitis C virus (HCV) cDNA clone [Dash et al. (1997) American Journal of Pathology, 151:363-373]. To determine in vivo infectivity of these in vitro synthesized viral particles, a chimpanzee was inoculated intravenously with HCV derived from HepG2 cells. The infected chimpanzee was examined serially for elevation of liver enzymes, for the presence of HCV RNA in the serum by reverse transcription nested polymerase chain reaction (RT-PCR), anti-HCV antibodies in the serum, and inflammation in the liver. The chimpanzee developed elevated levels of liver enzymes after the second week, but the levels fluctuated over a 10-week period. HCV RNA was detected in the serum of the chimpanzee at the second, seventh and ninth weeks after inoculation, and remained positive up to 25 weeks. Liver biopsies at Weeks 18 and 19 revealed of mild inflammation. Nucleotide sequence analysis of HCV recovered from the infected chimpanzee at the second and ninth weeks showed 100% sequence homology with the clone used for transfection studies. Serum anti-HCV antibodies were not detected by EIA during the 25 weeks follow-up period. These results suggest that intravenous administration of the virus-like particles derived from RNA-transfected HepG2 cells are infectious, and therefore, the pMO9.6-T7 clone is an infectious clone. These results provide new information that in vitro synthesized HCV particles produced from full-length HCV clone can cause infection in a chimpanzee. This study will facilitate the use of innovative approaches to the study of assembly of HCV particles and mechanisms of virus infectivity in cell culture. Copyright 2001 Wiley-Liss, Inc.
Directory of Open Access Journals (Sweden)
Hui Lei
2017-03-01
Full Text Available Four new compounds, including two isocoumarins, pestaloisocoumarins A and B (1, 2, one sesquiterpenoid degradation, isopolisin B (4, and one furan derivative, pestalotiol A (5, together with one known isocoumarin, gamahorin (3, and three chlorinated benzophenone derivatives, pestalachloride B (6, pestalachloride E (7 and a mixture of pestalalactone atropisomers (8a/8b, were isolated from a culture of the fungus Pestalotiopsis heterocornis associated with sponge Phakellia fusca. These new chemical structures were established using NMR and MS spectroscopic data, as well as single-crystal X-ray crystallographic analysis and CD Cotton effects. All of the isolated compounds were evaluated for their antimicrobial and cytotoxic activities. Isocoumarins 1–3, showed antibacterial activities against Gram-positive bacteria Staphylococcus aureus and Bacillus subtilis with MIC values ranging from 25 to 100 μg/mL and weak antifungal activities. Chlorinated benzophenone derivatives 6–8 exhibited antibacterial activities against S. aureus and B. subtilis with MIC values ranging from 3.0 to 50 μg/mL and cytotoxicities against four human cancer cell lines with IC50 values of 6.8–87.8 μM.
Directory of Open Access Journals (Sweden)
Periyasamy M. Mariappan
2016-09-01
Full Text Available There has been an increase in the potential use of wireless devices in healthcare domain for a variety of reasons. The most commonly used device is the cellular phone, which emits strong electromagnetic energy affecting thereby the functionality of the vital medical equipment such as ventilators, ECG monitors, cardiac monitors, and defibrillators. This prompted the healthcare concerns to restrict the use of these phones in the proximity of critical and non-critical care medical equipment. Due to the developments made in the design of medical equipment to comply with the EMC standards, the restriction had been slowly laid off. Still, the researchers are concerned about the electromagnetic interference with medical devices by cellular phones in the healthcare domain and recommend for conducting continuous research to study their interaction with medical equipment. This paper overviews the certain investigations carried out in the recent years to study the electromagnetic interference between medical devices and 2G/3G/4G LTE cellular phones. During the initial development of cellular phones, the 2G cellular phones had caused more interference that affects the function and operation of some medical devices. The possibility of interference from 3G cellular phones with medical devices was considerably lower than the 2G phones, but still exists. Furthermore, almost all of the 4G phones have little to no interference with the medical devices. Currently, with the development of the medical devices industry, the current medical devices are designed to operate safely under any conditions of usage. Finally, a careful analysis would require statistics on the frequency of adverse events across the healthcare system, which apparently do not exist.
Zhang, Min; Gu, Lei; Cheng, Chao; Zhu, Junru; Wu, Hao; Ma, Jiangfeng; Dong, Weiliang; Kong, Xiangping; Jiang, Min; Ouyang, Pingkai
2017-08-01
Chicory is an agricultural plant with considerable potential as a carbohydrate substrate for low-cost production of biochemicals. In this work, the production of mannitol by Leuconostoc pseudomesenteroides CTCC G123 from chicory-derived inulin hydrolysate was investigated. The bioconversion process initially suffered from the leakage of fructose to the phosphoketolase pathway, resulting in a low mannitol yield. When inulin hydrolysate was supplemented with glucose as a substrate for mannitol production in combination with aeration induction and nicotinic acid induced redox modulation strategies, the mannitol yield greatly improved. Under these conditions, significant improvement in the glucose consumption rate, intracellular NADH levels and mannitol dehydrogenase specific activity were observed, with mannitol production increasing from 64.6 to 88.1 g/L and overall yield increase from 0.69 to 0.94 g/g. This work demonstrated an efficient method for the production of mannitol from inulin hydrolysate with a high overall yield.
Zhang, Jie; Niu, Na; Wang, Mingyu; McNutt, Michael A; Zhang, Donghong; Zhang, Baogang; Lu, Shijun; Liu, Yuqing; Liu, Zhihui
2013-08-01
Oxidative and immune attacks from the environment or microglia have been implicated in the loss of dopaminergic neurons of Parkinson's disease. The role of IgG which is an important immunologic molecule in the process of Parkinson's disease has been unclear. Evidence suggests that IgG can be produced by neurons in addition to its traditionally recognized source B lymphocytes, but its function in neurons is poorly understood. In this study, extensive expression of neuron-derived IgG was demonstrated in dopaminergic neurons of human and rat mesencephalon. With an in vitro Parkinson's disease model, we found that neuron-derived IgG can improve the survival and reduce apoptosis of dopaminergic neurons induced by 6-hydroxydopamine toxicity, and also depress the release of NO from microglia triggered by 6-hydroxydopamine. Expression of TNF-α and IL-10 in microglia was elevated to protective levels by neuron-derived IgG at a physiologic level via the FcγR I and TLR4 pathways and microglial activation could be attenuated by IgG blocking. All these data suggested that neuron-derived IgG may exert a self-protective function by activating microglia properly, and IgG may be involved in maintaining immunity homeostasis in the central nervous system and serve as an active factor under pathological conditions such as Parkinson's disease. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.
A generalization of the Lie derivative
International Nuclear Information System (INIS)
Dolan, P.
1984-01-01
If X=xisup(i)deltasub(i) and Y=etasup(i)deltasub(i) are vector fields then it is well-known that the Lie derivative Poundsub(X)Y equivalent to [X,Y] (xisup(s)deltasub(s) etasup(s)deltasub(s)xisup(i))deltasub(i) is also a vector field under general coordinate transformations. A generalization of this result, due to previous workers, allows a definition of Poundsub(F)G, where F,G are arbitrary contravariant tensor fields. The formulae are linear in the first partial derivatives of F and G. An application to the theory of Killing-Yano tensor fields on Riemannian manifolds is given. (author)
KECK OBSERVATIONS OF THE GALACTIC CENTER SOURCE G2: GAS CLOUD OR STAR?
Energy Technology Data Exchange (ETDEWEB)
Phifer, K.; Meyer, L.; Ghez, A. M.; Witzel, G.; Yelda, S.; Boehle, A.; Morris, M. R.; Becklin, E. E. [Department of Physics and Astronomy, University of California, Los Angeles, CA 90095 (United States); Do, T. [Dunlap Institute for Astronomy and Astrophysics, University of Toronto, Toronto, Ontario, M5S 3H4 (Canada); Lu, J. R. [Institute for Astronomy, University of Hawaii, Hilo, HI 96720 (United States); Matthews, K., E-mail: ghez@astro.ucla.edu [Division of Physics, Mathematics, and Astronomy, California Institute of Technology, Pasadena, CA 91125 (United States)
2013-08-10
We present new observations and analysis of G2-the intriguing red emission-line object which is quickly approaching the Galaxy's central black hole. The observations were obtained with the laser guide star adaptive optics systems on the W. M. Keck I and II telescopes (2006-2012) and include spectroscopy (R {approx} 3600) centered on the hydrogen Br{gamma} line as well as K' (2.1 {mu}m) and L' (3.8 {mu}m) imaging. Analysis of these observations shows the Br{gamma} line emission has a positional offset from the L' continuum. This offset is likely due to background source confusion at L'. We therefore present the first orbital solution derived from Br{gamma} line astrometry, which, when coupled with radial velocity measurements, results in a later time of closest approach (2014.21 {+-} 0.14), closer periastron (130 AU, 1600 R{sub s}), and higher eccentricity (0.9814 {+-} 0.0060) compared to a solution using L' astrometry. It is shown that G2 has no K' counterpart down to K' {approx} 20 mag. G2's L' continuum and the Br{gamma} line emission appears unresolved in almost all epochs, which implies that the bulk of the emission resides in a compact region. The observations altogether suggest that while G2 has a gaseous component that is tidally interacting with the central black hole, there is likely a central star providing the self-gravity necessary to sustain the compact nature of this object.
Directory of Open Access Journals (Sweden)
Eman M. Flefel
2015-12-01
Full Text Available 1-(2,4-Dichlorophenyl-3-(4-fluorophenylpropen-1-one (1 was prepared and reacted with an active methylene compound (ethyl cyanoacetate in the presence of ammonium acetate to give the corresponding cyanopyridone 2. Compound 2 reacted with hydrazine hydrate, malononitrile, ethyl bromoacetate and phosphorous oxychloride to afford compounds 4 and 7–11, respectively. The 2-chloropyridine derivative 11 reacted with different primary amines, namely benzyl amine, piperonyl amine, 1-phenylethyl amine, and/or the secondary amines 2-methyl-pipridine and morpholine to give the corresponding derivatives 12–15. Hydrazinolysis of chloropyridine derivative 11 with hydrazine hydrate afforded the corresponding hydrazino derivative 17. Condensation of compound 17 with ethyl acetoacetate, acetylacetone, isatin and different aldehydes gave the corresponding derivatives 18–21. Some of newly synthesized compounds were screened for cytotoxic activity against three tumor cell lines. The results indicated that compounds 8 and 16 showed the best results, exhibiting the highest inhibitory effects towards the three tumor cell lines, which were higher than that of the reference doxorubicin and these compounds were non-cytotoxic towards normal cells (IC50 values > 100 μg/mL.
Directory of Open Access Journals (Sweden)
Lorenzo C. Visentin
2011-01-01
Full Text Available The compound (10E-2,2-dimethyl-3,4-dihydro-2H-benzo[g]chromene-5,10-dione-10-oxime (1 was synthesized from a-lapachone and hydroxylamine chloride in alkaline medium. Single-crystals suitable for X-ray diffraction measurements were grown from an ethanol solution, and the crystal structure of the title molecule is reported for the first time. The title molecule was also characterized by 1H- and 13C-NMR in CDCl3 solution, FTIR and MS. The crystal structure of 1 shows an E stereochemistry and dimers formed through classical hydrogen bonds.
Directory of Open Access Journals (Sweden)
Kayla A Boortz
Full Text Available Elevated fasting blood glucose (FBG has been associated with increased risk for development of type 2 diabetes. Single nucleotide polymorphisms (SNPs in G6PC2 are the most important common determinants of variations in FBG in humans. Studies using G6pc2 knockout mice suggest that G6pc2 regulates the glucose sensitivity of insulin secretion. G6PC2 and the related G6PC1 and G6PC3 genes encode glucose-6-phosphatase catalytic subunits. This study describes a functional analysis of 22 non-synonymous G6PC2 SNPs, that alter amino acids that are conserved in human G6PC1, mouse G6pc1 and mouse G6pc2, with the goal of identifying variants that potentially affect G6PC2 activity/expression. Published data suggest strong conservation of catalytically important amino acids between all four proteins and the related G6PC3 isoform. Because human G6PC2 has very low glucose-6-phosphatase activity we used an indirect approach, examining the effect of these SNPs on mouse G6pc1 activity. Using a novel in situ functional assay for glucose-6-phosphatase activity we demonstrate that the amino acid changes associated with the human G6PC2 rs144254880 (Arg79Gln, rs149663725 (Gly114Arg and rs2232326 (Ser324Pro SNPs reduce mouse G6pc1 enzyme activity without affecting protein expression. The Arg79Gln variant alters an amino acid mutation of which, in G6PC1, has previously been shown to cause glycogen storage disease type 1a. We also demonstrate that the rs368382511 (Gly8Glu, rs138726309 (His177Tyr, rs2232323 (Tyr207Ser rs374055555 (Arg293Trp, rs2232326 (Ser324Pro, rs137857125 (Pro313Leu and rs2232327 (Pro340Leu SNPs confer decreased G6PC2 protein expression. In summary, these studies identify multiple G6PC2 variants that have the potential to be associated with altered FBG in humans.
Inhibition of G0/G1 Switch 2 Ameliorates Renal Inflammation in Chronic Kidney Disease
Directory of Open Access Journals (Sweden)
Naoya Matsunaga
2016-11-01
Full Text Available Chronic kidney disease (CKD is a global health problem, and novel therapies to treat CKD are urgently needed. Here, we show that inhibition of G0/G1 switch 2 (G0s2 ameliorates renal inflammation in a mouse model of CKD. Renal expression of chemokine (C-C motif ligand 2 (Ccl2 was increased in response to p65 activation in the kidneys of wild-type 5/6 nephrectomy (5/6Nx mice. Moreover, 5/6Nx Clk/Clk mice, which carry homozygous mutations in the gene encoding circadian locomotor output cycles kaput (CLOCK, did not exhibit aggravation of apoptosis or induction of F4/80-positive cells. The renal expression of G0s2 in wild-type 5/6Nx mice was important for the transactivation of Ccl2 by p65. These pathologies were ameliorated by G0s2 knockdown. Furthermore, a novel small-molecule inhibitor of G0s2 expression was identified by high-throughput chemical screening, and the inhibitor suppressed renal inflammation in 5/6Nx mice. These findings indicated that G0s2 inhibitors may have applications in the treatment of CKD.
Intrinsic and extrinsic defects in a family of coal-derived graphene quantum dots
Singamaneni, Srinivasa Rao; van Tol, Johan; Ye, Ruquan; Tour, James M.
2015-11-01
In this letter, we report on the high frequency (239.2 and 336 GHz) electron spin resonance (ESR) studies performed on graphene quantum dots (GQDs), prepared through a wet chemistry route from three types of coal: (a) bituminous, (b) anthracite, and (c) coke; and from non-coal derived GQDs. The microwave frequency-, power-, and temperature-dependent ESR spectra coupled with computer-aided simulations reveal four distinct magnetic defect centers. In bituminous- and anthracite-derived GQDs, we have identified two of them as intrinsic carbon-centered magnetic defect centers (a broad signal of peak to peak width = 697 (10-4 T), g = 2.0023; and a narrow signal of peak to peak width = 60 (10-4 T), g = 2.003). The third defect center is Mn2+ (6S5/2, 3d5) (signal width = 61 (10-4 T), g = 2.0023, Aiso = 93(10-4 T)), and the fourth defect is identified as Cu2+ (2D5/2, 3d9) (g⊥ = 2.048 and g‖ = 2.279), previously undetected. Coke-derived and non-coal derived GQDs show Mn2+ and two-carbon related signals, and no Cu2+ signal. The extrinsic impurities most likely originate from the starting coal. Furthermore, Raman, photoluminescence, and ESR measurements detected no noticeable changes in the properties of the bituminous GQDs after one year. This study highlights the importance of employing high frequency ESR spectroscopy in identifying the (magnetic) defects, which are roadblocks for spin relaxation times of graphene-based materials. These defects would not have been possible to probe by other spin transport measurements.
International Nuclear Information System (INIS)
Renard, C.; Vanderhaeghe, H.J.; Claes, P.J.; Zenebergh, A.; Tulkens, P.M.
1987-01-01
beta-Lactam antibiotics do not accumulate in phagocytes, probably because of their acidic character. We therefore synthesized a basic derivative of penicillin G, namely, 14 C-labeled N-(3-dimethylamino-propyl)benzylpenicillinamide (ABP), and studied its uptake and subcellular localization in J774 macrophages compared with that of 14 C-labeled penicillin G. Whereas the intracellular concentration (Ci) of penicillin G remained lower than its extracellular concentration (Ce), ABP reached a Ci/Ce ratio of 4 to 5. Moreover, approximately 50% of intracellular ABP was found associated with lysosomes after isopycnic centrifugation of cell homogenates in isoosmotic Percoll or hyperosmotic sucrose gradients. The behavior of ABP was thus partly consistent with the model of de Duve et al., in which they described the intralysosomal accumulation of weak organic bases in lysosomes. Although ABP is microbiologically inactive, our results show that beta-lactam antibiotics can be driven into cells by appropriate modification. Further efforts therefore may be warranted in the design of active compounds or prodrugs that may prove useful in the chemotherapy of intracellular infections
The BTNL2 G16071A gene polymorphism increases granulomatous disease susceptibility
Tong, Xiang; Ma, Yao; Niu, Xundong; Yan, Zhipeng; Liu, Sitong; Peng, Bo; Peng, Shifeng; Fan, Hong
2016-01-01
Abstract Objective: The butyrophilin-like 2 (BTNL2) G16071A gene polymorphism has been implicated in the susceptibility to granulomatous diseases, but the results were inconclusive. The objective of the current study was to precisely explore the relationship between BTNL2 G16071A gene polymorphism and granulomatous disease susceptibility by the meta-analysis including false-positive report probability (FPRP) test. Methods: A systematic literature search in the PubMed, Embase, and Wanfang databases, China National Knowledge Internet, and commercial Internet search engines was conducted to identify studies published up to April 1, 2016. The odds ratio (OR) with 95% confidence interval (CI) was used to assess the effect size. Statistical analysis was conducted using the STATA 12.0 software and FPRP test sheet. Results: In total, all 4324 cases and 4386 controls from 14 eligible studies were included in the current meta-analysis. By the overall meta-analysis, we found a significant association between BTNL2 G16071A gene polymorphism and granulomatous disease susceptibility (A vs G: OR = 1.25, 95% CI = 1.07–1.45, P = 0.005). The meta-regression analyses showed that a large proportion of the between-study heterogeneity was significantly attributed to the ethnicity (A vs G, P = 0.013) and the types of granulomatous diseases (A vs G, P = 0.002). By the subgroup meta-analysis, the BTNL2 G16071A gene polymorphism was associated with granulomatous disease susceptibility in Caucasians (A vs G: OR = 1.37, 95% CI = 1.18–1.58, P susceptibility (A vs G: OR = 1.52, 95% CI = 1.39–1.66, P susceptibility (A vs G, FPRP susceptibility among Caucasians (A vs G, FPRP susceptibility, especially increasing the sarcoidosis susceptibility. In addition, the polymorphism may be greatly associated with likelihood of granulomatous diseases among Caucasians. PMID:27472712
Miyazaki, K; Okamura, N; Kishimoto, Y; Lee, Y C
1986-01-01
A specific, sensitive and easily performed method for the determination of gangliosides in tissue was developed. After removal of water-soluble compounds, total lipids were extracted from tissue and then treated with 2,4-dinitrophenylhydrazine hydrochloride and dicyclohexylcarbodi-imide in dimethylformamide at 0 degrees C to form ganglioside hydrazides. After removal of excess reagents by column chromatography on silicic acid, the ganglioside 2,4-dinitrophenylhydrazides were eluted from the c...
Two zebrafish G2A homologs activate multiple intracellular signaling pathways in acidic environment
Energy Technology Data Exchange (ETDEWEB)
Ichijo, Yuta; Mochimaru, Yuta [Laboratory of Cell Signaling Regulation, Department of Life Sciences, School of Agriculture, Meiji University, Kawasaki 214-8571 (Japan); Azuma, Morio [Laboratory of Regulatory Biology, Graduate School of Science and Engineering, University of Toyama, 3190-Gofuku, Toyama 930-8555 (Japan); Satou, Kazuhiro; Negishi, Jun [Laboratory of Cell Signaling Regulation, Department of Life Sciences, School of Agriculture, Meiji University, Kawasaki 214-8571 (Japan); Nakakura, Takashi [Department of Anatomy, Graduate School of Medicine, Teikyo University, 2-11-1 Itabashi-Ku, Tokyo 173-8605 (Japan); Oshima, Natsuki [Laboratory of Cell Signaling Regulation, Department of Life Sciences, School of Agriculture, Meiji University, Kawasaki 214-8571 (Japan); Mogi, Chihiro; Sato, Koichi [Laboratory of Signal Transduction, Institute for Molecular and Cellular Regulation, Gunma University, Maebashi 371-8512 (Japan); Matsuda, Kouhei [Laboratory of Regulatory Biology, Graduate School of Science and Engineering, University of Toyama, 3190-Gofuku, Toyama 930-8555 (Japan); Okajima, Fumikazu [Laboratory of Signal Transduction, Institute for Molecular and Cellular Regulation, Gunma University, Maebashi 371-8512 (Japan); Tomura, Hideaki, E-mail: tomurah@meiji.ac.jp [Laboratory of Cell Signaling Regulation, Department of Life Sciences, School of Agriculture, Meiji University, Kawasaki 214-8571 (Japan)
2016-01-01
Human G2A is activated by various stimuli such as lysophosphatidylcholine (LPC), 9-hydroxyoctadecadienoic acid (9-HODE), and protons. The receptor is coupled to multiple intracellular signaling pathways, including the G{sub s}-protein/cAMP/CRE, G{sub 12/13}-protein/Rho/SRE, and G{sub q}-protein/phospholipase C/NFAT pathways. In the present study, we examined whether zebrafish G2A homologs (zG2A-a and zG2A-b) could respond to these stimuli and activate multiple intracellular signaling pathways. We also examined whether histidine residue and basic amino acid residue in the N-terminus of the homologs also play roles similar to those played by human G2A residues if the homologs sense protons. We found that the zG2A-a showed the high CRE, SRE, and NFAT activities, however, zG2A-b showed only the high SRE activity under a pH of 8.0. Extracellular acidification from pH 7.4 to 6.3 ameliorated these activities in zG2A-a-expressing cells. On the other hand, acidification ameliorated the SRE activity but not the CRE and NFAT activities in zG2A-b-expressing cells. LPC or 9-HODE did not modify any activity of either homolog. The substitution of histidine residue at the 174{sup th} position from the N-terminus of zG2A-a to asparagine residue attenuated proton-induced CRE and NFAT activities but not SRE activity. The substitution of arginine residue at the 32nd position from the N-terminus of zG2A-a to the alanine residue also attenuated its high and the proton-induced CRE and NFAT activities. On the contrary, the substitution did not attenuate SRE activity. The substitution of the arginine residue at the 10th position from the N-terminus of zG2A-b to the alanine residue also did not attenuate its high or the proton-induced SRE activity. These results indicate that zebrafish G2A homologs were activated by protons but not by LPC and 9-HODE, and the activation mechanisms of the homologs were similar to those of human G2A. - Highlights: • Zebrafish two G2A homologs are proton
G+K 1Σ+/sub g/ double-minimum excited state of H2
International Nuclear Information System (INIS)
Glover, R.M.; Weinhold, F.
1977-01-01
We have obtained a Born--Oppenheimer potential curve for the previously uncharacterized third 1 Σ + /sub g/ state of H 2 , using a correlated 20-term wavefunction of generalized James--Coolidge type. We find this potential curve to have a double-minimum character, with the inner (Rydberg-like) and outer (''ionic'') wells having minima at about 1.99 and 3.30 bohr, respectively, and an intervening maximum at 2.76 bohr. Unlike the extensively studied E+F double-minimum state, the outer well here appears to be the deeper, by some 450 cm -1 in our calculation. The inner and outer minima can apparently be associated with spectral lines that in experimental tables have previously been attributed to distinct G and K electronic states. The appropriate spectroscopic term symbol of this combined state is accordingly G+K 1 Σ + /sub g/ (1ssigma3dsigma+2pπ 2 )
Energy Technology Data Exchange (ETDEWEB)
Boulinier, C; Faurot, P; Sagot, M; Teste du Bailler, A [Commissariat a l' Energie Atomique, Saclay (France).Centre d' Etudes Nucleaires
1961-07-01
After demonstrating the sensitivity of the distribution of power in a production reactor to a deformation caused by dissymmetries of reactivity in the reactor, the authors describe the method of neutron flux determination devised for the reactors G2 and G3 under working conditions; the detector used is a tungsten or nickel wire, the {gamma} activity of which is measured with an ionisation chamber. Several flux determinations are given as examples to illustrate the sensitivity of the method. (author) [French] Apres avoir mis en evidence la sensibilite de la repartition de la puissance dans un reacteur de production a une deformation provoquee par de faibles dissymetries de reactivite dans le reacteur, les auteurs decrivent la methode de releve du flux neutronique mise au point pour les reacteurs G2 et G3 en puissance; le detecteur utilise est un fil de tungstene ou de nickel dont l'activite {gamma} est mesuree a l'aide d'une chambre d'ionisation. Quelques releves de flux illustrant la sensibilite de la methode sont donnes a titre d'exemple. (auteur)
Chemical Constituents of a Marine-Derived Endophytic Fungus Penicillium commune G2M
Directory of Open Access Journals (Sweden)
Hui-Jiao Yan
2010-05-01
Full Text Available Cultivation of the endophytic fungus Penicillium commune, which was isolated from the semi-mangrove plant Hibiscus tiliaceus,afforded one new compound 1-O-(2,4-dihydroxy-6-methylbenzoyl-glycerol (1 along with thirteen known products, including 1-O-acetylglycerol (2, N-acetyltryptophan (3, 3-indolylacetic acid methyl ester (4, 1-(2,4-dihydroxy-3,5-dimethylphenylethanone (5, 2-(2,5-dihydroxyphenylacetic acid (6, (4R,5S-5-hydroxyhexan-4-olide (7, thymidine (8, uracil (9, thymine (10, ergosterol (11, β-sitosterol (12,β-daucosterol (13, and ergosta-7,22-dien-3β,5α,6β-triol (14. The structures of these compounds were established by detailed NMR spectroscopic analysis, as well as by comparison with literature data or with authentic samples.
Apfel, C; Banner, D W; Bur, D; Dietz, M; Hubschwerlen, C; Locher, H; Marlin, F; Masciadri, R; Pirson, W; Stalder, H
2001-06-07
Potent, selective, and structurally new inhibitors of the Fe(II) enzyme Escherichia coli peptide deformylase (PDF) were obtained by rational optimization of the weakly binding screening hit (5-chloro-2-oxo-1,4-dihydro-2H-quinazolin-3-yl)-acetic acid hydrazide (1). Three-dimensional structural information, gathered from Ni-PDF complexed with 1, suggested the preparation of two series of related hydroxamic acid analogues, 2-(2-oxo-1,4-dihydro-2H-quinazolin-3-yl)-N-hydroxy-acetamides (A) and 2-(2,2-dioxo-1,4-dihydro-2H-2lambda(6)-benzo[1,2,6]thiadiazin-3-yl)-N-hydroxy-acetamides (B), among which potent PDF inhibitors (37, 42, and 48) were identified. Moreover, two selected compounds, one from each series, 36 and 41, showed good selectivity for PDF over several endoproteases including matrix metalloproteases. However, these compounds showed only weak antibacterial activity.
International Nuclear Information System (INIS)
Hanif, Muhammad; Saleem, Muhammad; Rama, Nasim Hasan; Hussain, Muhammad Tahir; Zaib, Sumera; Aslam, Muhammad Adil M.; Iqbal, Jamshed; Jones, Peter G.
2012-01-01
A new series of 4-amino-5-aryl-3H-1,2,4-triazole-3-thiones, bearing various methoxybenzyl- and methoxyphenethyl groups, was synthesized by refluxing potassium hydrazinecarbodithioate salts in dilute aqueous solution of hydrazine hydrate. These salts were formed by the reaction of acid hydrazides and carbon disulfide in methanolic potassium hydroxide solution at 0-5 deg C. 4-Amino- 5-aryl-3H-1,2,4-triazole-3-thiones were condensed with different substituted aromatic acids to yield 3,6-disubstituted-1,2,4-triazolo[3,4-b]1,3,4-thiadiazoles. The structures of the synthesized compounds were characterized by infrared (IR), 1 H and 13 C nuclear magnetic resonance (NMR), elemental analysis and mass spectrometric (MS) studies. All the synthesized compounds were screened for their urease inhibition, antioxidant and antibacterial activities. Some compounds showed excellent urease inhibition activity, more than the standard drug. Others exhibited potent antioxidant activity. All the compounds showed significant antibacterial activities as compared to the standard drug. (author)
AFA 2G and AFA 3G fuel rod performance analysis
International Nuclear Information System (INIS)
Lu Huaquan; Liu Tong; Jiao Yongjun; Pang Hua
2002-01-01
For 18-months fuel cycle strategy in GNPJVC DAYA BAY unit 1/2, by means of COCCINEL, the fuel rod performance for AFA 3G and AFA 2G in transition cycle is analyzed. The design criteria which should be respected in fuel rod design are included and the design methodology is introduced. All the criteria mentioned are verified and met
Synthesis and Antibacterial Evaluation of New N-acylhydrazone Derivatives from Dehydroabietic Acid
Directory of Open Access Journals (Sweden)
Wen Gu
2012-04-01
Full Text Available A series of new N-acylhydrazone derivatives were synthesized in good yields through the reactions of dehydroabietic acid hydrazide with a variety of substituted arylaldehydes. The structures of the synthesized compounds were confirmed by IR, 1H- and 13C-NMR, ESI-MS, elemental analysis and single crystal X-ray diffraction. From the crystal structure of compound 4l, the C=N double bonds of these N-acylhydrazones showed (E-configuration, while the NMR data of compounds 4a–q indicated the existence of two rotamers for each compound in solution. The target compounds were evaluated for their antibacterial activities against four microbial strains. The result suggested that several compounds exhibited pronounced antibacterial activities. Particularly, compound 4p exhibited good antibacterial activity against Staphylococcus aureus and Bacillus subtilis comparable to positive control. The possible antibacterial metabolism and the strategy for further optimization of this compound were also discussed.
Kamal, Manal; El-Khayat, Waleed
2011-10-01
To evaluate whether serum angiogenesis markers such as angiopoietins (Ang-1, Ang-2) and their receptor (Tie-2) are altered in women with preeclampsia. We also performed genotyping to determine if the 4G/5G genotypes of -675 PAI-1 gene may play a role in the pathogenesis of preeclampsia. Sixty-eight pregnant women with preeclampsia were compared to 35 normotensive pregnant women and 24 normotensive nonpregnant women in a cross-sectional study. Using enzyme-linked immunosorbent assay, levels of serum Ang-1 and Ang-2, and Tie-2 were measured. A single base pair insertion/deletion 4G/5G polymorphism of the PAI-1 gene was determined by polymerase chain reaction. Serum levels of Ang-1 and Tie-2 were significantly different among the study groups (P = 0.001 and P = 0.025, respectively) being lower in the preeclamptic group. Positive significant correlation was found between Ang-2 and Tie-2, (r = 0.26, P = 0.024). The frequency of the genotypes (4G/5G, 4G/4G, and 5G/5G) differed among the groups (P = 0.001). Also, the mean of systolic and diastolic blood pressures differed significantly according to the PAI-1 genotype being higher in those bearing the 4G allele; P = 0.04 and P = 0.023, respectively. Sera Ang-1 and Ang-2, and Tie-2 as well as variants of 4G/5G of PAI-1 polymorphism have positive implications in the pathogenesis of preeclampsia.
Modulation of radiation-induced apoptosis and G{sub 2}/M block in murine T-lymphoma cells
Energy Technology Data Exchange (ETDEWEB)
Palayoor, S.T.; Macklis, R.M.; Bump, E.A.; Coleman, C.N. [Harvard Medical School, Boston, MA (United States)
1995-03-01
Radiation-induced apoptosis in lymphocyte-derived cell lines is characterized by endonucleolytic cleavage of cellular DNA within hours after radiation exposure. We have studied this phenomenon qualitatively (DNA gel electrophoresis) and quantitatively (diphenylamine reagent assay) in murine EL4 T-lymphoma cells exposed to {sup 137}Cs {gamma} irradiation. Fragmentation was discernible within 18-24 h after exposure. It increased with time and dose and reached a plateau after 8 Gy of {gamma} radiation. We studied the effect of several pharmacological agents on the radiation-induced G{sub 2}/M block and DNA fragmentation. The agents which reduced the radiation-induced G{sub 2}/M-phase arrest (caffeine, theobromine, theophylline and 2-aminopurine) enhanced the degree of DNA fragmentation at 24 h. In contrast, the agents which sustained the radiation-induced G{sub 2}/M-phase arrest (TPA, DBcAMP, IBMX and 3-aminobenzamide) inhibited the DNA fragmentation at 24 h. These studies on EL4 lymphoma cells are consistent with the hypothesis that cells with radiation-induced genetic damage are eliminated by apoptosis subsequent to a G{sub 2}/M block. Furthermore, it may be possible to modulate the process of radiation-induced apoptosis in lymphoma cells with pharmacological agents that modify the radiation-induced G{sub 2}/M block, and to use this effect in the treatment of patients with malignant disease. 59 refs., 7 figs.
The D2G2 project: a new software tool for nuclear engineering design in Canada
International Nuclear Information System (INIS)
Rheaume, P.; Lefebvre, J.F.; Roy, R.; Koclas, J.
2004-01-01
Nowadays, high quality neutronic simulation codes are readily available. The open source software suite DRAGON/DONJON is a good example. It is free, it has proven quality and correctness over the years and is still developed and maintained at Ecole Polytechnique de Montreal. However, most simulation codes have the following weaknesses: limited usability, poor maintainability, no internal data standardization and poor portability. The D2G2 project is a software development initiative which aims to create an upper layer software tool that annihilates the weakness of classic simulation codes. This paper presents D2G2Client's and D2G2Server's principal capabilities, how they interact and the libraries they use. (author)
Directory of Open Access Journals (Sweden)
Cesarina Giallongo
Full Text Available It is well known that mesenchymal stem cells (MSC have a role in promotion of tumor growth, survival and drug-resistance in chronic myeloid leukemia (CML. Recent reports indicated that a subpopulation of myeloid cells, defined as granulocyte-like myeloid-derived suppressor cells (G-MDSC is increased in these patients. So far, the role of MSC in MDSC expansion and activation into the BM microenvironment remains unexplored. To address this question, here we use a specific experimental model in vitro, co-culturing MSC with peripheral blood mononucleated cells (PBMC from normal individuals, in order to generate MSC-educated G-MDSC. Although MSC of healthy donors (HD and CML patients were able to generate the same amount of MDSC, only CML-MSC-educated G-MDSC exhibited suppressive ability on autologous T lymphocytes. In addition, compared with HD-MSC, CML-MSC over-expressed some immunomodulatory factors including TGFβ, IL6 and IL10, that could be involved in MDSC activation. CML-MSC-educated G-MDSC expressed higher levels of ARG1, TNFα, IL1β, COX2 and IL6 than G-MDSC isolated from co-culture with HD-MSC. Our data provide evidence that CML-MSC may play a critical role in tumor microenvironment by orchestrating G-MDSC activation and regulating T lymphocytes-mediated leukemia surveillance, thus contributing to CML immune escape.
Giallongo, Cesarina; Romano, Alessandra; Parrinello, Nunziatina Laura; La Cava, Piera; Brundo, Maria Violetta; Bramanti, Vincenzo; Stagno, Fabio; Vigneri, Paolo; Chiarenza, Annalisa; Palumbo, Giuseppe Alberto; Tibullo, Daniele; Di Raimondo, Francesco
2016-01-01
It is well known that mesenchymal stem cells (MSC) have a role in promotion of tumor growth, survival and drug-resistance in chronic myeloid leukemia (CML). Recent reports indicated that a subpopulation of myeloid cells, defined as granulocyte-like myeloid-derived suppressor cells (G-MDSC) is increased in these patients. So far, the role of MSC in MDSC expansion and activation into the BM microenvironment remains unexplored. To address this question, here we use a specific experimental model in vitro, co-culturing MSC with peripheral blood mononucleated cells (PBMC) from normal individuals, in order to generate MSC-educated G-MDSC. Although MSC of healthy donors (HD) and CML patients were able to generate the same amount of MDSC, only CML-MSC-educated G-MDSC exhibited suppressive ability on autologous T lymphocytes. In addition, compared with HD-MSC, CML-MSC over-expressed some immunomodulatory factors including TGFβ, IL6 and IL10, that could be involved in MDSC activation. CML-MSC-educated G-MDSC expressed higher levels of ARG1, TNFα, IL1β, COX2 and IL6 than G-MDSC isolated from co-culture with HD-MSC. Our data provide evidence that CML-MSC may play a critical role in tumor microenvironment by orchestrating G-MDSC activation and regulating T lymphocytes-mediated leukemia surveillance, thus contributing to CML immune escape.
Evaluation of the performance of hydrological variables derived from GLDAS-2 and MERRA-2 in Mexico
Real-Rangel, R. A.; Pedrozo-Acuña, A.; Breña-Naranjo, J. A.
2017-12-01
Hydrological studies have found in data assimilation systems and global reanalysis of land surface variables (e.g soil moisture, streamflow) a wide range of applications, from drought monitoring to water balance and hydro-climatology variability assessment. Indeed, these hydrological data sources have led to an improvement in developing and testing monitoring and prediction systems in poorly gauged regions of the world. This work tests the accuracy and error of land surface variables (precipitation, soil moisture, runoff and temperature) derived from the data assimilation reanalysis products GLDAS-2 and MERRA-2. Validate the performance of these data platforms must be thoroughly evaluated in order to consider the error of hydrological variables (i.e., precipitation, soil moisture, runoff and temperature) derived from the reanalysis products. For such purpose, a quantitative assessment was performed at 2,892 climatological stations, 42 stream gauges and 44 soil moisture probes located in Mexico and across different climate regimes (hyper-arid to tropical humid). Results show comparisons between these gridded products against ground-based observational stations for 1979-2014. The results of this analysis display a spatial distribution of errors and accuracy over Mexico discussing differences between climates, enabling the informed use of these products.
Cross sections for 12C+12C→12C(0+2)+12C(g.s.) using breathing mode doorways
International Nuclear Information System (INIS)
Ahmed, M.U.; Beres, W.P.
1982-01-01
A previously derived projection operator method is applied to the calculation of the cross section for 12 C+ 12 C→ 12 C(0 + 2 )+ 12 C(g.s.) with a breathing mode model being used to describe the 0 + 2 (7.68 MeV) state of 12 C. The relationship to processes leading to alpha particle channels is discussed. The cross section for 12 C+ 12 C→ 12 C(3 - )+ 12 C(g.s.) is also calculated and possible correlations with inelastic scattering to the 0 + 2 and 2 + states of 12 C are discussed. The results for both 0 + 2 and 3 - inelastic scattering are in reasonable agreement with experiment
Defective G2 repair in Down syndrome
International Nuclear Information System (INIS)
Pincheira, J.; Rodriguez, M.; Bravo, M.; Navarrete, M.H.; Lopez-Saez, J.F.
1994-01-01
Lymphocytes from both Down syndrome (DS) patients and age-matched control donors have been investigated to identify a possible disturbance in chromosomal G2 repair. Analyses of caffeine treatments during G2 have shown that the frequency of chromosomal aberrations is higher in DS lymphocytes than in normal lymphocytes. Likewise, G2 duration is longer in DS cells than in normal cells. In both control and DS lymphocytes, caffeine treatments increase the frequencies of chromatid breakages and decrease the average of G2 duration. The reversal of the caffeine potentiation effect by adenosine and niacinamide is higher in DS cells than in normal cells. Furthermore, ATP content per cell in DS lymphocytes is one third of that estimated in normal lymphocytes. The increase of ATP level produced by adenosine or niacinamide generally correlates with the reversal of the caffeine effect on chromosome aberrations. Under the experimental conditions tested, a good negative exponential correlation between ATP level and chromosome aberrations has been detected in both normal and DS lymphocytes which were or were not X-irradiated. Finally, we postulate a decrease in G2 repair capability of DS lymphocytes caused by a low availability of ATP and/or some other factor correlating with it. (au)
International Nuclear Information System (INIS)
Thomas, Asha B.; Nanda, Rabindra K.; Kothapalli, Lata P.; Deshpande, Avinash D.
2011-01-01
A series of isonicotinyl hydrazones and their 4-thiazolidinones have been synthesized by condensation of isonicotinic acid hydrazide with various aromatic aldehydes to yield Schiff's bases, followed by the cyclocondensation of Schiff's bases with 2-mercaptoacetic acid to yield their 4-thiazolidinones. The synthesized compounds have been characterized by their elemental, analytical and spectral studies. All these compounds were evaluated for their in vitro antimicrobial activity against a spectrum of non-resistant and resistant microbial organisms. These studies proved that compounds 5e,i against B. subtilis; 5e,f,h against B. anthracis; 5g,i against S. aureus showed good activity at lower concentrations. Compounds 5d-5i displayed significant activity against resistant strain of K. pneumonia with minimum inhibitory potency in the concentration range of 2-16 ug/ml
Energy Technology Data Exchange (ETDEWEB)
Pouthier, J; Rossi, J [Commissariat a l' Energie Atomique, Chusclan (France). Centre de Production de Plutonium de Marcoule
1968-07-01
The carbon dioxide cooling the reactors G2 - G3 contains activation gases and fission gases. It is of interest to know their concentration, for example to be able to deduce rapidly the norms which would have to be applied in the case of an incident in the circuit. Gas-phase chromatography is applied daily for carrying out analyses. The chromatogram has separate peaks due to tritium, argon 41, krypton 85 and the 133 and 135 isotopes of xenon. By integrating each peak it is possible to calculate the specific activity of each product. The construction of an apparatus for carrying out continuous measurements is under consideration. (authors) [French] Le gaz carbonique, refroidissant les reacteurs G2 - G3, contient des gaz d'activation et des gaz de fission. Il est interessant de connaitre leur teneur par exemple pour etre en mesure de deduire rapidement les normes qu'il y aurait lieu d'appliquer en cas d'incidents sur le circuit. La methode de chromatographie en phase gazeuse est employee quotidiennement pour faire des analyses. Le chromatogramme se presente sous forme de pics distincts dus au tritium, a l'argon 41, au krypton 85 et aux isotopes 133 et 135 du xenon. L'integration de chaque pic permet de calculer l'activite specifique de chaque compose. Il est envisage de construire un appareil pour des mesures en continu. (auteurs)
12 CFR 563g.2 - Offering circular requirement.
2010-01-01
... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Offering circular requirement. 563g.2 Section 563g.2 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY SECURITIES OFFERINGS § 563g.2 Offering circular requirement. (a) General. No savings association shall offer or sell, directly...
Tan, Meng-Chwan
2013-07-01
In part I, we extend our analysis in [arXiv:0807.1107], and show that a mathematically conjectured geometric Langlands duality for complex surfaces in [1], and its generalizations — which relate some cohomology of the moduli space of certain ("ramified") G-instantons to the integrable representations of the Langlands dual of certain affine (sub) G-algebras, where G is any compact Lie group — can be derived, purely physically, from the principle that the spacetime BPS spectra of string-dual M-theory compactifications ought to be equivalent. In part II, to the setup in part I, we introduce Omega-deformation via fluxbranes and add half-BPS boundary defects via M9-branes, and show that the celebrated AGT correspondence in [2, 3], and its generalizations — which essentially relate, among other things, some equivariant cohomology of the moduli space of certain ("ramified") G-instantons to the integrable representations of the Langlands dual of certain affine -algebras — can likewise be derived from the principle that the spacetime BPS spectra of string-dual M-theory compactifications ought to be equivalent. In part III, we consider various limits of our setup in part II, and connect our story to chiral fermions and integrable systems. Among other things, we derive the NekrasovOkounkov conjecture in [4] — which relates the topological string limit of the dual Nekrasov partition function for pure G to the integrable representations of the Langlands dual of an affine G-algebra — and also demonstrate that the Nekrasov-Shatashvili limit of the "fullyramified" Nekrasov instanton partition function for pure G is a simultaneous eigenfunction of the quantum Toda Hamiltonians associated with the Langlands dual of an affine G-algebra. Via the case with matter, we also make contact with Hitchin systems and the "ramified" geometric Langlands correspondence for curves.
Poudrier, J; Graber, P; Herren, S; Gretener, D; Elson, G; Berney, C; Gauchat, J F; Kosco-Vilbois, M H
1999-08-01
A functional IL-13R involves at least two cell surface proteins, the IL-13R alpha 1 and IL-4R alpha. Using a soluble form of the murine IL-13R alpha 1 (sIL-13R), we reveal several novel features of this system. The sIL-13R promotes proliferation and augmentation of Ag-specific IgM, IgG2a, and IgG2b production by murine germinal center (GC) B cells in vitro. These effects were enhanced by CD40 signaling and were not inhibited by an anti-IL4R alpha mAb, a result suggesting other ligands. In GC cell cultures, sIL-13R also promoted IL-6 production, and interestingly, sIL-13R-induced IgG2a and IgG2b augmentation was absent in GC cells isolated from IL-6-deficient mice. Furthermore, the effects of the sIL-13R molecule were inhibited in the presence of an anti-IL-13 mAb, and preincubation of GC cells with IL-13 enhanced the sIL-13R-mediated effects. When sIL-13R was injected into mice, it served as an adjuvant-promoting production to varying degrees of IgM and IgG isotypes. We thus propose that IL-13R alpha 1 is a molecule involved in B cell differentiation, using a mechanism that may involve regulation of IL-6-responsive elements. Taken together, our data reveal previously unknown activities as well as suggest that the ligand for the sIL-13R might be a component of the IL-13R complex or a counterstructure yet to be defined.
Ou, Xu; Li, Qi; Xu, Dan; Guo, Jiangna; Yan, Feng
2018-03-02
Nitrogen-doped porous carbon nanotubes@MnO 2 (N-CNTs@MnO 2 ) nanocomposites are prepared through the in situ growth of MnO 2 nanosheets on N-CNTs derived from polypyrrole nanotubes (PNTs). Benefiting from the synergistic effects between N-CNTs (high conductivity and N doping level) and MnO 2 nanosheets (high theoretical capacity), the as-prepared N-CNTs@MnO 2 -800 nanocomposites show a specific capacitance of 219 F g -1 at a current density of 1.0 A g -1 , which is higher than that of pure MnO 2 nanosheets (128 F g -1 ) and PNTs (42 F g -1 ) in 0.5 m Na 2 SO 4 solution. Meanwhile, the capacitance retention of 86.8 % (after 1000 cycles at 10 A g -1 ) indicates an excellent electrochemical performance of N-CNTs@MnO 2 prepared in this work. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
A turn-on fluorescent rhodamine-acyl hydrazide for selective detection of Cu"2"+ ions
International Nuclear Information System (INIS)
Yoon, Jung Won; Jeong, Hyuk; Lee, Min Hee
2017-01-01
We present a rhodamine-based probe that can detect Cu"2"+ ions via Cu"2"+-promoted hydrolysis in aqueous solutions. In solution, the probe is non-fluorescent and colorless, but gives a strong fluorescence at 586 nm and shows a color change to pink on the addition of Cu"2"+ ions. We demonstrate that the rhodamine-based probe undergoes Cu"2"+-promoted hydrolysis with a moderate reaction time (within 3 min) and provides a fluorescence off–on change, even in the presence of other competitive metal ions. The rhodamine-based probe shows a linear correlation between increasing fluorescence at 586 nm and the Cu"2"+ concentration, and can detect Cu"2"+ at nanomolar levels (10 nM) in CH_3CN:H_2O (v/v, 90:10)
Boughton, Andrew P; Yang, Pei; Tesmer, Valerie M; Ding, Bei; Tesmer, John J G; Chen, Zhan
2011-09-13
Few experimental techniques can assess the orientation of peripheral membrane proteins in their native environment. Sum Frequency Generation (SFG) vibrational spectroscopy was applied to study the formation of the complex between G protein-coupled receptor (GPCR) kinase 2 (GRK2) and heterotrimeric G protein β(1)γ(2) subunits (Gβγ) at a lipid bilayer, without any exogenous labels. The most likely membrane orientation of the GRK2-Gβγ complex differs from that predicted from the known protein crystal structure, and positions the predicted receptor docking site of GRK2 such that it would more optimally interact with GPCRs. Gβγ also appears to change its orientation after binding to GRK2. The developed methodology is widely applicable for the study of other membrane proteins in situ.
Yeap, SweeKeong; Akhtar, Muhammad Nadeem; Lim, Kian Lam; Abu, Nadiah; Ho, Wan Yong; Zareen, Seema; Roohani, Kiarash; Ky, Huynh; Tan, Sheau Wei; Lajis, Nordin; Alitheen, Noorjahan Banu
2015-01-01
Anthraquinones are an important class of naturally occurring biologically active compounds. In this study, anthraquinone derivative 1,3-dihydroxy-9,10-anthraquinone-2- carboxylic acid (DHAQC) (2) was synthesized with 32% yield through the Friedel-Crafts condensation reaction. The mechanisms of cytotoxicity of DHAQC (2) in human breast cancer MCF-7 cells were further investigated. Results from the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay showed that DHAQC (2) exhibited potential cytotoxicity and selectivity in the MCF-7 cell line, comparable with the naturally occurring anthraquinone damnacanthal. DHAQC (2) showed a slightly higher IC50 (inhibitory concentration with 50% cell viability) value in the MCF-7 cell line compared to damnacanthal, but it is more selective in terms of the ratio of IC50 on MCF-7 cells and normal MCF-10A cells. (selective index for DHAQC (2) was 2.3 and 1.7 for damnacanthal). The flow cytometry cell cycle analysis on the MCF-7 cell line treated with the IC50 dose of DHAQC (2) for 48 hours showed that DHAQC (2) arrested MCF-7 cell line at the G2/M phase in association with an inhibited expression of PLK1 genes. Western blot analysis also indicated that the DHAQC (2) increased BAX, p53, and cytochrome c levels in MCF-7 cells, which subsequently activated apoptosis as observed in annexin V/propidium iodide and cell cycle analyses. These results indicate that DHAQC (2) is a synthetic, cytotoxic, and selective anthraquinone, which is less toxic than the natural product damnacanthal, and which demonstrates potential in the induction of apoptosis in the breast cancer MCF-7 cell line.
Directory of Open Access Journals (Sweden)
Ya-Min Cheng
2016-09-01
Full Text Available Globally, cervical cancer is the most common malignancy affecting women. The main treatment methods for this type of cancer include conization or hysterectomy procedures. Sulforaphane (SFN is a natural, compound-based drug derived from dietary isothiocyanates which has previously been shown to possess potent anti-tumor and chemopreventive effects against several types of cancer. The present study investigated the effects of SFN on anti-proliferation and G2/M phase cell cycle arrest in cervical cancer cell lines (Cx, CxWJ, and HeLa. We found that cytotoxicity is associated with an accumulation of cells in the G2/M phases of the cell-cycle. Treatment with SFN led to cell cycle arrest as well as the down-regulation of Cyclin B1 expression, but not of CDC2 expression. In addition, the effects of GADD45β gene activation in cell cycle arrest increase proportionally with the dose of SFN; however, mitotic delay and the inhibition of proliferation both depend on the dosage of SFN used to treat cancer cells. These results indicate that SFN may delay the development of cancer by arresting cell growth in the G2/M phase via down-regulation of Cyclin B1 gene expression, dissociation of the cyclin B1/CDC2 complex, and up-regulation of GADD45β proteins.
Identification of Aquifex aeolicus tRNA (m2(2G26) methyltransferase gene.
Takeda, Hiroshi; Hori, Hiroyuki; Endo, Yaeta
2002-01-01
The modifications of N2,N2-dimethylguanine (m2(2)G) are found in tRNAs and rRNAs from eukarya and archaea. In tRNAs, modification at position G26 is generated by tRNA (m2(2)G26) methyltransferase, which is encoded by the corresponding gene, trm1. This enzyme catalyzes the methyl-transfer from S-adenosyl-L-methionine to the semi-conserved residue, G26, via the intermediate modified base, m2G26. Recent genome sequencing project has been reported that the putative trm1 is encoded in the genome of Aquifex aeolicus, a hyper-thermophilic eubacterium as only one exception among eubacteria. In order to confirm whether this bacterial trm1 gene product is a real tRNA (m2(2)G26) methyltransferase or not, we expressed this protein by wheat germ in vitro cell-free translation system. Our biochemical analysis clearly showed that this gene product possessed tRNA (m2(2)G26) methyltransferase activity.
Application of biomass-derived flexible carbon cloth coated with MnO2 nanosheets in supercapacitors
He, Shuijian; Chen, Wei
2015-10-01
Successful application of inexpensive energy storage devices lies in the exploitation of fabrication approaches that are based on cost-efficient materials and that can be easily scaled up. Here, inexpensive textile weaved by natural flax fiber is selected as raw material in preparing flexible and binder-free electrode material for supercapacitors. Although carbon fiber cloth obtained from the direct carbonization of flax textile exhibits a low specific capacitance of 0.78 F g-1, carbon fiber cloth electrode shows a very short relaxation time of 39.1 m s and good stability with almost 100% capacitance retaining after 104 cycles at 5 A g-1. To extend the application of the resulting carbon cloth in supercapacitor field, a layer of MnO2 nanosheets is deposited on the surface of carbon fiber via in situ redox reaction between carbon and KMnO4. The specific capacitance of MnO2 reaches 683.73 F g-1 at 2 A g-1 and still retains 269.04 F g-1 at 300 A g-1, indicating the excellent rate capacitance performance of the carbon cloth/MnO2 hybrids. The present study shows that carbon cloth derived from flax textile can provide a low-cost material platform for the facile, cost-efficient and large scale fabrication of binder-free electrode materials for energy storage devices.
Hou, Xiyan; Majik, Mahesh S.; Kim, Kyunglim; Pyee, Yuna; Lee, Yoonji; Alexander, Varughese; Chung, Hwa-Jin; Lee, Hyuk Woo; Chandra, Girish; Lee, Jin Hee; Park, Seul-gi; Choi, Won Jun; Kim, Hea Ok; Phan, Khai; Gao, Zhan-Guo; Jacobson, Kenneth A.; Choi, Sun; Lee, Sang Kook; Jeong, Lak Shin
2011-01-01
Truncated N6-substituted-4′-oxo- and 4′-thioadenosine derivatives with C2 or C8 substitution were studied as dual acting A2A and A3 adenosine receptor (AR) ligands. The lithiation-mediated stannyl transfer and palladium-catalyzed cross coupling reactions were utilized for functionalization of the C2 position of 6-chloropurine nucleosides. An unsubstituted 6-amino group and a hydrophobic C2 substituent were required for high affinity at the hA2AAR, but hydrophobic C8 substitution abolished binding at the hA2AAR. However, most of synthesized compounds displayed medium to high binding affinity at the hA3AR, regardless of C2 or C8 substitution, and low efficacy in a functional cAMP assay. Several compounds tended to be full hA2AAR agonists. C2 substitution probed geometrically through hA2AAR-docking, was important for binding in order of hexynyl > hexenyl > hexanyl. Compound 4g was the most potent ligand acting dually as hA2AAR agonist and hA3AR antagonist, which might be useful for treatment of asthma or other inflammatory diseases. PMID:22142423
Directory of Open Access Journals (Sweden)
Andreas Koeberle
2018-02-01
Full Text Available Age-related diseases, such as osteoarthritis, Alzheimer’s disease, diabetes, and cardiovascular disease, are often associated with chronic unresolved inflammation. Neutrophils play central roles in this process by releasing tissue-degenerative proteases, such as cathepsin G, as well as pro-inflammatory leukotrienes produced by the 5-lipoxygenase (5-LO pathway. Boswellic acids (BAs are pentacyclic triterpene acids contained in the gum resin of the anti-inflammatory remedy frankincense that target cathepsin G and 5-LO in neutrophils, and might thus represent suitable leads for intervention with age-associated diseases that have a chronic inflammatory component. Here, we investigated whether, in addition to BAs, other triterpene acids from frankincense interfere with 5-LO and cathepsin G. We provide a comprehensive analysis of 17 natural tetra- or pentacyclic triterpene acids for suppression of 5-LO product synthesis in human neutrophils. These triterpene acids were also investigated for their direct interference with 5-LO and cathepsin G in cell-free assays. Furthermore, our studies were expanded to 10 semi-synthetic BA derivatives. Our data reveal that besides BAs, several tetra- and pentacyclic triterpene acids are effective or even superior inhibitors of 5-LO product formation in human neutrophils, and in parallel, inhibit cathepsin G. Their beneficial target profile may qualify triterpene acids as anti-inflammatory natural products and pharmacological leads for intervention with diseases related to aging.
Koeberle, Andreas; Henkel, Arne; Verhoff, Moritz; Tausch, Lars; König, Stefanie; Fischer, Dagmar; Kather, Nicole; Seitz, Stefanie; Paul, Michael; Jauch, Johann; Werz, Oliver
2018-02-24
Age-related diseases, such as osteoarthritis, Alzheimer's disease, diabetes, and cardiovascular disease, are often associated with chronic unresolved inflammation. Neutrophils play central roles in this process by releasing tissue-degenerative proteases, such as cathepsin G, as well as pro-inflammatory leukotrienes produced by the 5-lipoxygenase (5-LO) pathway. Boswellic acids (BAs) are pentacyclic triterpene acids contained in the gum resin of the anti-inflammatory remedy frankincense that target cathepsin G and 5-LO in neutrophils, and might thus represent suitable leads for intervention with age-associated diseases that have a chronic inflammatory component. Here, we investigated whether, in addition to BAs, other triterpene acids from frankincense interfere with 5-LO and cathepsin G. We provide a comprehensive analysis of 17 natural tetra- or pentacyclic triterpene acids for suppression of 5-LO product synthesis in human neutrophils. These triterpene acids were also investigated for their direct interference with 5-LO and cathepsin G in cell-free assays. Furthermore, our studies were expanded to 10 semi-synthetic BA derivatives. Our data reveal that besides BAs, several tetra- and pentacyclic triterpene acids are effective or even superior inhibitors of 5-LO product formation in human neutrophils, and in parallel, inhibit cathepsin G. Their beneficial target profile may qualify triterpene acids as anti-inflammatory natural products and pharmacological leads for intervention with diseases related to aging.
Park, Jin Ha; Lee, Hyun Suk; Jang, Myung Duk; Han, Sung Wook; Kim, Seog K; Lee, Young-Ae
2018-06-01
The interaction of Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ (DPPZ = dipyrido[3,2-a:2', 3'-c]phenazine, phen = phenanthroline) with a G-quadruplex formed from 5'-G 2 T 2 G 2 TGTG 2 T 2 G 2-3 '(15-mer) was investigated. The well-known enhancement of luminescence intensity (the 'light-switch' effect) was observed for the [Ru(phen) 2 DPPZ] 2+ complexes upon formation of an adduct with the G-quadruplex. The emission intensity of the G-quadruplex-bound Λ-isomer was 3-fold larger than that of the Δ-isomer when bound to the G-quadruplex, which is opposite of the result observed in the case of double stranded DNA (dsDNA); the light switch effect is larger for the dsDNA-bound Δ-isomer. In the job plot of the G-quadruplex with Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ , a major inflection point for the two isomers was observed at x ≈ .65, which suggests a binding stoichiometry of 2:1 for both enantiomers. When the G base at the 8th position was replaced with 6-methyl isoxanthopterin (6MI), a fluorescent guanine analog, the excited energy of 6-MI transferred to bound Δ- or Λ-[Ru(phen) 2 DPPZ] 2+ , which suggests that at least a part of both Ru(II) enantiomers is close to or in contact with the diagonal loop of the G-quadruplex. A luminescence quenching experiment using [Fe(CN) 6 ] 4- for the G-quadruplex-bound Ru(II) complex revealed downward bending curves for both enantiomers in the Stern-Volmer plot, which suggests the presence of Ru(II) complexes that are both accessible and inaccessible to the quencher and may be related to the 2:1 binding stoichiometry.
The association between PAI-1 -675 4G/5G polymorphism and type 2 diabetes mellitus.
Chen, L; Li, S-Y; Liu, M
2017-08-15
In this study, we aimed to analyze the association between plasminogen activator inhibitor 1 (PAI-1) -675 4G/5G polymorphism and type 2 diabetes mellitus (T2DM) risk. We included in 187 T2DM patients and 186 heathy controls between 2014 and 2017 from Tianjin Gong An Hospital, China. All patients and controls were ethnically Chinese Han population. The primers and polymerase chain reaction (PCR) conditions were performed. Results from this case-control study suggested that PAI-1 -675 4G/5G polymorphism was not associated with T2DM risk in four genetic models. Additionally, PAI-1 -675 4G/5G polymorphism was not associated with clinical and laboratory characteristics, such as age, gender, body mass index, systolic blood pressure, diastolic blood pressure, total cholesterol, triglycerides, and HbA1c. In conclusion, this case-control study suggested that PAI-1 -675 4G/5G polymorphism was not associated with T2DM risk in this population.
Directory of Open Access Journals (Sweden)
Ahmet Bekir
2014-09-01
Full Text Available In this paper, the fractional partial differential equations are defined by modified Riemann–Liouville fractional derivative. With the help of fractional derivative and traveling wave transformation, these equations can be converted into the nonlinear nonfractional ordinary differential equations. Then G′G-expansion method is applied to obtain exact solutions of the space-time fractional Burgers equation, the space-time fractional KdV-Burgers equation and the space-time fractional coupled Burgers’ equations. As a result, many exact solutions are obtained including hyperbolic function solutions, trigonometric function solutions and rational solutions. These results reveal that the proposed method is very effective and simple in performing a solution to the fractional partial differential equation.
Studies on selected polymeric materials using the photoacoustic spectroscopic technique
International Nuclear Information System (INIS)
Singh, Hukum
2011-01-01
Polymethylmethacrylate—graft—polybisphenol—A-carbonate (PMMA-G-PC) with 50% grafting is synthesized. The graft co-polymerization of methylmethacrylate (0.036 mol · lit −1 ) onto polybisphenol—A-carbonate (0.5 g) in the presence of a redox couple formed from potassium persulphate (40 mol · lit −1 ) and thio-urea (30 mmol · lit −1 ) in aqueous nitric acid (0.18 M, 100 ml) in air at (45±2) °C for 3.0 h. Condensation of (PMMA-G-PC) with N- [p-(carboxyl phenyl amino acetic acid)] hydrazide (PCPH) affords polybisphenol-A-carbonate-graft-polymethylmethacrylate hydrazide (PCGH). The photoacoustic (PA) spectra of (PCGH) are recorded in a wavelength range from 200 nm to 800 nm at a modulation frequency of 22 Hz, and compared with those of pure polybisphenol-A-carbonate (PC), (PMMA-G-PC) and (PCPH). In the present work, a non-destructive and non-contact analytical method, namely the photoacoustic technique, is successfully implemented for optical and thermal characterization of selected polymeric materials. The indigenous PA spectrometer used in the present study consists of a 300-W xenon arc lamp, a lock-in amplifier, a chopper, a (1/8)-m monochromator controlled by computer and a home-made PA cell. (condensed matter: electronic structure, electrical, magnetic, and optical properties)
The Escherichia coli BolA Protein IbaG Forms a Histidine-Ligated [2Fe-2S]-Bridged Complex with Grx4.
Dlouhy, Adrienne C; Li, Haoran; Albetel, Angela-Nadia; Zhang, Bo; Mapolelo, Daphne T; Randeniya, Sajini; Holland, Ashley A; Johnson, Michael K; Outten, Caryn E
2016-12-13
Two ubiquitous protein families have emerged as key players in iron metabolism, the CGFS-type monothiol glutaredoxins (Grxs) and the BolA proteins. Monothiol Grxs and BolA proteins form heterocomplexes that have been implicated in Fe-S cluster assembly and trafficking. The Escherichia coli genome encodes members of both of these proteins families, namely, the monothiol glutaredoxin Grx4 and two BolA family proteins, BolA and IbaG. Previous work has demonstrated that E. coli Grx4 and BolA interact as both apo and [2Fe-2S]-bridged heterodimers that are spectroscopically distinct from [2Fe-2S]-bridged Grx4 homodimers. However, the physical and functional interactions between Grx4 and IbaG are uncharacterized. Here we show that co-expression of Grx4 with IbaG yields a [2Fe-2S]-bridged Grx4-IbaG heterodimer. In vitro interaction studies indicate that IbaG binds the [2Fe-2S] Grx4 homodimer to form apo Grx4-IbaG heterodimer as well as the [2Fe-2S] Grx4-IbaG heterodimer, altering the cluster stability and coordination environment. Additionally, spectroscopic and mutagenesis studies provide evidence that IbaG ligates the Fe-S cluster via the conserved histidine that is present in all BolA proteins and by a second conserved histidine that is present in the H/C loop of two of the four classes of BolA proteins. These results suggest that IbaG may function in Fe-S cluster assembly and trafficking in E. coli as demonstrated for other BolA homologues that interact with monothiol Grxs.
Synchronous motor with HTS-2G wires
Dezhin, D.; Ilyasov, R.; Kozub, S.; Kovalev, K.; Verzhbitsky, L.
2014-05-01
One of the applications of new high-temperature superconductor materials (HTS) is field coils for synchronous electrical machines. The use of YBCO 2G HTS tapes (HTS-2G) allows increasing of magnetic flux density in the air gap, which will increase the output power and reduce the dimensions of the motor. Such motors with improved characteristics can be successfully used in transportation as traction motor. In MAI-based "Center of Superconducting machines and devices" with the support of "Rosatom" has been designed and tested a prototype of the 50 kW synchronous motor with radial magnetic flux from a field-coils based on HTS-2G tapes. The experimental and theoretical results are presented.
Critical Elements of Vehicle-to-Grid (V2G) Economics
Energy Technology Data Exchange (ETDEWEB)
Steward, Darlene M. [National Renewable Energy Laboratory (NREL), Golden, CO (United States)
2017-09-07
This report explores the critical elements of V2G economics. Section 2 summarizes the elements and costs of a V2G system. Section 3 describes V2G revenue-generating services and the business cases for providing these services. Section 4 notes real-world V2G applications. Section 5 lists concerns related to V2G. Section 6 concludes and summarizes V2G cost and revenue elements.
Syntheses and anti-microbial evaluation of new quinoline scaffold derived pyrimidine derivatives
Directory of Open Access Journals (Sweden)
Shikha S. Dave
2016-09-01
Full Text Available A series of diversely substituted chalcones derived from a quinoline scaffold, e.g. (E-3-(2-chloroquinolin-3-yl-1-(2-hydroxyphenyl prop-2-en-1-one and its pyrimidine analogues e.g. 2-[2-amino-6-(2-chloroquinolin-3-yl-5,6-dihydropyrimidin-4-yl]phenols have been prepared by condensation of 2-chloro-3-formyl quinoline with differently substituted 2-hydroxy acetophenones and further treatment with guanidine carbonate. All the newly synthesized compounds have been evaluated for their in vitro growth inhibitory activity against Escherichia coli, Pseudomonas vulgaris, Bacillus subtilis, Staphylococcus aureus, Staphylococcus typhi, Candida albicans, Aspergillus niger and Pseudomonas chrysogenum.
Ozdemir, Ummuhan O.; Ozbek, Neslihan; Genc, Zuhal Karagoz; İlbiz, Firdevs; Gündüzalp, Ayla Balaban
2017-06-01
Silver(I) complexes of alkyl sulfonic acide hydrazides were newly synthesized as homologous series. Methanesulfonic acide hydrazide (L1), ethanesulfonic acide hydrazide (L2), propanesulfonic acide hydrazide (L3) and butanesulfonic acide hydrazide (L4) were used for complexation with Ag(I) ions. The silver complexes obtained in the mol ratio of 1:2 have the structural formula as Ag(L1)2NO3 (I), Ag(L2)2NO3 (II), Ag(L3)2NO3(III), (Ag(L4)2NO3 (IV). The Ag(I) complexes exhibit distorted linear two-fold coordination in [AgL2]+ cations with uncoordinated nitrates. Ligands are chelated with silver(I) ions through unsubstituted primary nitrogen in hydrazide group. Ag(I) complexes were characterized by using elemental analysis, spectroscopic methods (FT-IR, LC-MS), magnetic susceptibility and conductivity measurements. Silver(I) complexes were optimized using PBEPBE/LanL2DZ/DEF2SV basic set performed by DFT method with the Gaussian 09 program package. The geometrical parameters, frontier molecular orbitals (HOMOs and LUMOs) and molecular electrostatic potential (MEP) mapped surfaces of the optimized geometries were also determined by this quantum set. The anticancer activities of silver(I) complexes on MCF-7 human breast cancer cell line were investigated by comparing IC50 values. The antibacterial activities of complexes were studied against Gram positive bacteria; S. aureus ATCC 6538, B. subtilis ATCC 6633, B. cereus NRRL-B-3711, E. faecalis ATCC 29212 and Gram negative bacteria; E. coli ATCC 11230, P. aeruginosa ATCC 15442, K. pneumonia ATCC 70063 by using disc diffusion method. The inhibition activities of Ag(I) complexes on carbonic anhydrase II enzyme (hCA II) were also investigated by comparing IC50 and Ki values. The biological activity screening shows that Ag(I) complex of butanesulfonicacidehydrazide (IV) has the highest activity against tested breast cancer cell lines MCF-7, Gram positive/Gram negative bacteria and carbonic anhydrase II (hCA II) isoenzyme.
3-(2-Benzofuranyl)quinuclidin-2-ene derivatives: novel muscarinic antagonists.
Nordvall, G; Sundquist, S; Johansson, G; Glas, G; Nilvebrant, L; Hacksell, U
1996-08-16
A series of 26 derivatives of the novel muscarinic antagonist 3-(2-benzofuranyl)quinuclidin-2-ene (1) has been synthesized and evaluated for muscarinic and antimuscarinic properties. The affinity of the compounds was determined by competition experiments in homogenates of cerebral cortex, heart, parotid gland, and urinary bladder from guinea pigs using (-)-[3H]-3-quinuclidinyl benzilate as the radioligand, and the antimuscarinic-potency was determined in a functional assay on isolated guinea pig urinary bladder using carbachol as the agonist. The 5-fluorobenzofuranyl derivative was slightly more potent than 1. The 7-bromo-substituted 8 displayed a 14-fold tissue selectivity ratio for muscarinic receptors in the cortex versus the parotid gland. Comparative molecular field analysis and quantitative structure-activity relationship models were developed for this series of substituted benzofuranyl derivatives.
Almahboub, Sarah A; Narancic, Tanja; Devocelle, Marc; Kenny, Shane T; Palmer-Brown, William; Murphy, Cormac; Nikodinovic-Runic, Jasmina; O'Connor, Kevin E
2018-01-01
Terminal modification of peptides is frequently used to improve their hydrophobicity. While N-terminal modification with fatty acids (lipidation) has been reported previously, C-terminal lipidation is limited as it requires the use of linkers. Here we report the use of a biocatalyst for the production of an unnatural fatty amino acid, (S)-2-aminooctanoic acid (2-AOA) with enantiomeric excess > 98% ee and the subsequent use of 2-AOA to modify and improve the activity of an antimicrobial peptide. A transaminase originating from Chromobacterium violaceum was employed with a conversion efficiency 52-80% depending on the ratio of amino group donor to acceptor. 2-AOA is a fatty acid with amino functionality, which allowed direct C- and N-terminal conjugation respectively to an antimicrobial peptide (AMP) derived from lactoferricin B. The antibacterial activity of the modified peptides was improved by up to 16-fold. Furthermore, minimal inhibitory concentrations (MIC) of C-terminally modified peptide were always lower than N-terminally conjugated peptides. The C-terminally modified peptide exhibited MIC values of 25 μg/ml for Escherichia coli, 50 μg/ml for Bacillus subtilis, 100 μg/ml for Salmonella typhimurium, 200 μg/ml for Pseudomonas aeruginosa and 400 μg/ml for Staphylococcus aureus. The C-terminally modified peptide was the only peptide tested that showed complete inhibition of growth of S. aureus.
Energy Technology Data Exchange (ETDEWEB)
Wang, Lu; Aryal, Uma K.; Dai, Ziyu; Mason, Alisa C.; Monroe, Matthew E.; Tian, Zhixin; Zhou, Jianying; Su, Dian; Weitz, Karl K.; Liu, Tao; Camp, David G.; Smith, Richard D.; Baker, Scott E.; Qian, Weijun
2012-01-01
Protein glycosylation is known to play an essential role in both cellular functions and the secretory pathways; however, little information is available on the dynamics of glycosylated N-linked glycosites of fungi. Herein we present the first extensive mapping of glycosylated N-linked glycosites in industrial strain Aspergillus niger by applying an optimized solid phase enrichment of glycopeptide protocol using hydrazide modified magnetic beads. The enrichment protocol was initially optimized using mouse plasma and A. niger secretome samples, which was then applied to profile N-linked glycosites from both the secretome and whole cell lysates of A. niger. A total of 847 unique N-linked glycosites and 330 N-linked glycoproteins were confidently identified by LC-MS/MS. Based on gene ontology analysis, the identified N-linked glycoproteins in the whole cell lysate were primarily localized in the plasma membrane, endoplasmic reticulum, golgi apparatus, lysosome, and storage vacuoles. The identified N-linked glycoproteins are involved in a wide range of biological processes including gene regulation and signal transduction, protein folding and assembly, protein modification and carbohydrate metabolism. The extensive coverage of glycosylated N-linked glycosites along with identification of partial N-linked glycosylation in those enzymes involving in different biochemical pathways provide useful information for functional studies of N-linked glycosylation and their biotechnological applications in A. niger.
Directory of Open Access Journals (Sweden)
Igor V. Protasov
2013-09-01
$\\Delta(A=\\{g\\in G:|gA\\cap A|=\\infty\\}$. The mapping $\\Delta:\\mathcal{P}_G\\rightarrow\\mathcal{P}_G$, $A\\mapsto\\Delta(A$, is called a combinatorial derivation and can be considered as an analogue of the topological derivation $d:\\mathcal{P}_X\\rightarrow\\mathcal{P}_X$, $A\\mapsto A^d$, where $X$ is a topological space and $A^d$ is the set of all limit points of $A$. Content: elementary properties, thin and almost thin subsets, partitions, inverse construction and $\\Delta$-trajectories, $\\Delta$ and $d$.
Choudhary, Pooja; Loewen, Michele C
2016-01-01
Although well documented for mammalian G-protein-coupled receptors, alternate functionalities and associated alternate signalling remain to be unequivocally established for the Saccharomyces cerevisiae pheromone Ste2p receptor. Here, evidence supporting alternate functionalities for Ste2p is re-evaluated, extended and quantified. In particular, strong mating and constitutive signalling mutations, focusing on residues S254, P258 and S259 in TM6 of Ste2p, are stacked and investigated in terms of their effects on classical G-protein-mediated signal transduction associated with cell cycle arrest, and alternatively, their impact on downstream mating projection and zygote formation events. In relative dose response experiments, accounting for systemic and observational bias, mutational-derived functional differences were observed, validating the S254L-derived bias for downstream mating responses and highlighting complex relationships between TM6-mutation derived constitutive signalling and ligand-induced functionalities. Mechanistically, localization studies suggest that alterations to receptor trafficking may contribute to mutational bias, in addition to expected receptor conformational stabilization effects. Overall, these results extend previous observations and quantify the contributions of Ste2p variants to mediating cell cycle arrest versus downstream mating functionalities. © Crown copyright 2015.
Theoretical study of GC+/GC base pair derivatives
International Nuclear Information System (INIS)
Meng Fancui; Wang Huanjie; Xu Weiren; Liu Chengbu
2005-01-01
The geometries of R (R=CH 3 , CH 3 O, F, NO 2 ) substituted GC base pair derivatives and their cations have been optimized at B3LYP/6-31G* level and the substituent effects on the neutral and cationic geometric structures and energies have been discussed. The inner reorganization energies of various base pair derivatives and the native GC base pair have been calculated to discuss the substituent effects on the reorganization energy. NBO (natural bond orbital) analysis has been carried out on both the neutral and the cationic systems to investigate the differences of the charge distributions and the electronic structures. The outcomes indicate that 8-CH 3 O-G:C has the greatest reorganization energy and 8-NO 2 -G:C has the least, while the other substituted base pairs have a reorganization energy close to that of G:C. The one charge is mostly localized on guanine part after ionization and as high as 0.95e. The bond distances of N1-N3'andN2-O2' in the cationic base pair derivatives shortened and that of O6-N4' elongated as compared with the corresponding bond distances of the neutral GC base pair derivatives
Downlink power distributions for 2G and 3G mobile communication networks.
Colombi, Davide; Thors, Björn; Persson, Tomas; Wirén, Niklas; Larsson, Lars-Eric; Jonsson, Mikael; Törnevik, Christer
2013-12-01
Knowledge of realistic power levels is key when conducting accurate EMF exposure assessments. In this study, downlink output power distributions for radio base stations in 2G and 3G mobile communication networks have been assessed. The distributions were obtained from network measurement data collected from the Operations Support System, which normally is used for network monitoring and management. Significant amounts of data were gathered simultaneously for large sets of radio base stations covering wide geographical areas and different environments. The method was validated with in situ measurements. For the 3G network, the 90th percentile of the averaged output power during high traffic hours was found to be 43 % of the maximum available power. The corresponding number for 2G, with two or more transceivers installed, was 65 % or below.
2013-03-19
reader. Sp -1 was used as a control transcription factor to evaluate the toxicity of tested compounds in the same assay and parthenolide was used as a...enantiomers of chiral γ-Aryl-1H-1,2,4-triazole derivatives and Penicillium digitatum. J. Agric. Food Chem. 2009, 57, 6914–6919. 22. Crank, G.; Neville, M
Remarks on Hamiltonian structures in G2-geometry
International Nuclear Information System (INIS)
Cho, Hyunjoo; Salur, Sema; Todd, A. J.
2013-01-01
In this article, we treat G 2 -geometry as a special case of multisymplectic geometry and make a number of remarks regarding Hamiltonian multivector fields and Hamiltonian differential forms on manifolds with an integrable G 2 -structure; in particular, we discuss existence and make a number of identifications of the spaces of Hamiltonian structures associated to the two multisymplectic structures associated to an integrable G 2 -structure. Along the way, we prove some results in multisymplectic geometry that are generalizations of results from symplectic geometry
Aouad, Mohamed Reda
2015-05-23
(1,4,5-Triphenylimidazol-2-yl-thio)butyric acid hydrazide (3) was obtained via alkylation of 1,4,5-triphenylimidazol-2- thiol (1) with ethylbromobutyrate, followed by addition of hydrazine hydrate. Treatment of acid hydrazide 3 with carbon disulfide in an ethanolic potassium hydroxide solution gave the intermediate potassium dithiocarbazinate salt, which was cyclized to 4-amino-5-[(1,4,5-triphenylimidazol- -2-yl)thiopropyl]-2H-1,2,4-triazole-3-thione (4) in the presence of hydrazine hydrate. Condensation of compound 3 with alkyl/arylisothiocyanate afforded the corresponding 1-[4-(1,4,5-triphenylimidazol-2-ylthio)butanoyl]-4-alkyl/arylthiosemicarbazides (5-7), which upon refluxing with sodium hydroxide, yielded the corresponding 1,2,4-triazole - -3-thiols 8-10. Under acidic conditions, compounds 4-6 were converted to aminothiadiazoles 11-13. Moreover, the series of Schiff bases 14-18 were synthesized from the condensation of compound 3 with different aromatic aldehydes. The newly synthesized compounds were characterized by IR, 1H NMR, 13C NMR and mass spectral analyses. They were also preliminarily screened for their antimicrobial activity.
Synthesis of a 2-Furylpyrazoline Derivative Using Microwave Irradiation
Directory of Open Access Journals (Sweden)
Suban Syed Shafi
2009-08-01
Full Text Available A simple method for the synthesis of pyrazoline derivative containing furan moiety was developed. Thus, 5-(6-bromo-1,3-benzodioxol-5-yl-3-(2-furyl-1-(3-methyl-phenyl-4,5-dihydro-1H-pyrazole was synthesized using microwave irradiation and it was characterized by NMR, IR, and LCMS.
Supersymmetric M3-branes and G2 manifolds
International Nuclear Information System (INIS)
Cvetic, M.; Gibbons, G.W.; Lue, H.; Pope, C.N.
2002-01-01
We obtain a generalisation of the original complete Ricci-flat metric of G 2 holonomy on (R 4 xS 3 to a family with a nontrivial parameter λ. For generic λ the solution is singular, but it is regular when λ={-1,0,+1}. The case λ=0 corresponds to the original G 2 metric, and λ={-1,1} are related to this by an S 3 automorphism of the SU(2) 3 isometry group that acts on the S 3 xS 3 principal orbits. We then construct explicit supersymmetric M3-brane solutions in D=11 supergravity, where the transverse space is a deformation of this class of G 2 metrics. These are solutions of a system of first-order differential equations coming from a superpotential. We also find M3-branes in the deformed backgrounds of new G 2 holonomy metrics that include one found by A. Brandhuber, J. Gomis, S. Gubser and S. Gukov, and show that they also are supersymmetric
Supersymmetric M3-branes and G2 manifolds
Cvetič, M.; Gibbons, G. W.; Lü, H.; Pope, C. N.
2002-01-01
We obtain a generalisation of the original complete Ricci-flat metric of G2 holonomy on R4×S 3 to a family with a nontrivial parameter λ. For generic λ the solution is singular, but it is regular when λ={-1,0,+1}. The case λ=0 corresponds to the original G2 metric, and λ={-1,1} are related to this by an S3 automorphism of the SU(2) 3 isometry group that acts on the S3× S3 principal orbits. We then construct explicit supersymmetric M3-brane solutions in D=11 supergravity, where the transverse space is a deformation of this class of G2 metrics. These are solutions of a system of first-order differential equations coming from a superpotential. We also find M3-branes in the deformed backgrounds of new G2 holonomy metrics that include one found by A. Brandhuber, J. Gomis, S. Gubser and S. Gukov, and show that they also are supersymmetric.
10 CFR 2.700 - Scope of subpart G.
2010-01-01
... 10 Energy 1 2010-01-01 2010-01-01 false Scope of subpart G. 2.700 Section 2.700 Energy NUCLEAR... Formal Adjudications § 2.700 Scope of subpart G. The provisions of this subpart apply to and supplement... authorization for high-level radioactive waste repository noticed under §§ 2.101(f)(8) or 2.105(a)(5...
Xie, Yong; Chi, Hui-Wei; Guan, Ai-Ying; Liu, Chang-Ling; Ma, Hong-Juan; Cui, Dong-Liang
2014-12-31
A series of novel substituted 3-(pyridin-2-yl)benzenesulfonamide derivatives were designed and synthesized using 2-phenylpridines as the lead compound by intermediate derivatization methods in an attempt to obtain novel compound candidates for weed control. The herbicidal activity assay in glasshouse tests showed several compounds (II6, II7, II8, II9, II10, II11, III2, III3, III4, and III5) could efficiently control velvet leaf, youth-and-old age, barnyard grass, and foxtail at the 37.5 g/ha active substance. Especially, the activities of II6, II7, III2, and III4 were proved roughly equivalent to the saflufenacil and better than 95% sulcotrione at the same concentration. The result of the herbicidal activity assay in field tests demonstrated that II7 at 60 g/ha active substance could give the same effect as bentazon at 1440 g/ha active substance to control dayflower and nightshade, meanwhile II7 showed better activity than oxyfluorfen to control arrowhead and security to rice. The present work indicates that II7 may be a novel compound candidate for potential herbicide.
The (2p, 2p) 11Δg state of 6Li2: Fourier transform spectrum of the 11Δg-B1IIu transition
International Nuclear Information System (INIS)
Linton, C.; Martin, F.; Crozet, P.; Ross, A.J.; Bacis, R.
1993-01-01
The 1 1 Δ g -B 1 II u transition of 6 Li 2 has been observed in collisionally induced fluorescence following single frequency optical-optical double resonance excitation of the F 1 Σ g + state using a ring dye laser with DCM dye. Spectra of the s and a symmetry levels were obtained separately, at high resolution, in the near-infrared region using a Fourier transform spectrometer. The molecular constants (Dunham coefficients) of the 1 1 Δ g state have been calculated. Comparison of the constants and dissociation energy with ab initio calculations has shown that the 1 1 Δ g state correlates with Li(2p) + Li(2p) and has a dissociation energy of 9,579 ± 1 cm -1 . The energy transfer process responsible for excitation of the 1 1 Δ g state is discussed
Energy Technology Data Exchange (ETDEWEB)
Hlaing, Nwe Ni, E-mail: nwenihlaing76@gmail.com [School of Materials and Mineral Resources Engineering, Engineering Campus, Universiti Sains Malaysia, 14300 Nibong Tebal, Penang (Malaysia); Department of International Development Engineering, Tokyo Institute of Technology, 2-12-1 Ookayama, Meguro-ku, Tokyo (Japan); Department of Physics, University of Yangon, 11041 Kamayut, Yangon (Myanmar); Sreekantan, Srimala, E-mail: srimala@usm.my [School of Materials and Mineral Resources Engineering, Engineering Campus, Universiti Sains Malaysia, 14300 Nibong Tebal, Penang (Malaysia); Hinode, Hirofumi, E-mail: hinode@ide.titech.ac.jp; Kurniawan, Winarto, E-mail: Kurniawan.w.ab@m.titech.ac.jp [Department of International Development Engineering, Tokyo Institute of Technology, 2-12-1 Ookayama, Meguro-ku, Tokyo (Japan); Thant, Aye Aye, E-mail: a2thant@gmail.com [Department of Physics, University of Yangon, 11041 Kamayut, Yangon (Myanmar); Othman, Radzali, E-mail: radzali@utem.edu.my [Faculty of Manufacturing Engineering, Universiti Teknikal Malaysia Melaka, Hang Tuah Jaya, 76100 Durian Tunggal, Malacca (Malaysia); Mohamed, Abdul Rahman, E-mail: chrahman@eng.usm.my [Low Carbon Economy (LCE) Research Group, School of Chemical Engineering, Engineering Campus, Universiti Sains Malaysia, 14300 Nibong Tebal, Penang (Malaysia); Salime, Chris, E-mail: chris.salim@surya.ac.id [Environmental Engineering, Surya University, Tangerang, 15810 Banten (Indonesia)
2016-07-06
Recent years, CaO-based synthetic materials have been attracted attention as potential adsorbents for CO{sub 2} capture mainly due to their high CO{sub 2} adsorption capacity. In this study, micro/nanostructured aragonite CaCO{sub 3} was synthesized by a simple hydrothermal method with using polyacrylamide (PAM). The structural, morphological and thermal properties of the synthesized sample were investigated by X-ray diffraction (XRD), field-emission scanning electron microscopy (FESEM) and thermogravimetry analysis (TG-DTA). The XRD and FESEM results showed that the obtained sample was aragonite CaCO{sub 3} with aggregated nanorods and microspheres composed of nanorods. A TG-DTA apparatus with Thermoplus 2 software was used to investigate the effect of carbonation temperature on the CO{sub 2} adsorption capacity of CaO derived from aragonite CaCO{sub 3} sample. At 300 °C, the sample reached the CO{sub 2} adsorption capacity of 0.098 g-CO{sub 2}/g-adsorbent, whereas the sample achieved the highest capacity of 0.682 g-CO{sub 2}/g-adsorbent at 700 °C. The results showed that the carbonation temperature significantly influenced on the CO{sub 2} adsorption capacity of the CaO derived from aragonite CaCO{sub 3}.
International Nuclear Information System (INIS)
Shahzadi, T.; Akhtar, M.; Rehman, A.; Riaz, T.; Ashraf, M.
2013-01-01
This manuscript reports the synthesis of a series of new O-substituted derivatives of opuntiol (1) which is a naturally occurring compound isolated from a plant Opuntia dillenii Haw belonging to family Cactaceae. These derivatives 3a-t, were characterized by FAB-MS, IR, and 1H-NMR and then screened against acetylcholinesterase, butyrylcholinesterase, lipoxygenase and H-chymotrypsin enzymes. The screening results revealed that 6-(acetyloxy) methyl- 4-methoxy-2H-pyran-2-one (3b) and N-(2,5-dimethylphenyl)-2-((4-methoxy-6-oxo-2H-pyran-2-yl) methoxy)acetamide (3p) were found to be the inhibitor of butyrylcholinesterase while 6-(acetyloxy) methyl- 4-methoxy-2H-pyran-2-one (3b), 6-(ethoxymethyl)-4-methoxy-2H-pyran-2-one (3c), 4-methoxy-6-((phenylmethoxy)methyl)-2H-pyran-2-one (3g), 6-((2-bromoethyloxy)methyl)-4-methoxy-2H-pyran-2-one (3j), N-(5-chloro-2-ethoxyphenyl)-2-((4-methoxy-6-oxo-2H-pyran-2-yl)methoxy) acetamide (3r), N-(3,4-dimethylphenyl)-2-((4-methoxy-6-oxo-2H-pyran-2-yl)methoxy)acetamide (3s) N-(3,5-dimethylphenyl)-2-((4-methoxy-6-oxo-2H-pyran-2-yl)methoxy)acetamide (3t) were found to be active against H-chymotrypsin and among these 3s was the good inhibitor of this enzyme having IC50 value of 142.71 +- 0.22 micro moles/L. (author)
6-Chloro-N′-(2-hydroxy-1-naphthylmethylenenicotinohydrazide
Directory of Open Access Journals (Sweden)
Feng Zhi
2008-01-01
Full Text Available The title compound, C17H12ClN3O2, was synthesized by the Schiff base condensation reaction of 2-hydroxy-1-naphthaldehyde with 6-chloronicotinic acid hydrazide in a methanol solution. The molecule displays a trans configuration with respect to the C=N and C—N bonds. The dihedral angle between the naphthyl ring system and the pyridine ring is 7.6 (4°. There is an intramolecular O—H...N hydrogen bond. The crystal structure is stabilized by intermolecular N—H...O and C—H...O hydrogen bonds, forming chains running along the b axis.
Directory of Open Access Journals (Sweden)
Ebtehal S. Al-Abdullah
2011-04-01
Full Text Available The title compounds were prepared by reaction of 6-acetyltetralin (1 with different aromatic aldehydes 2a-c, namely 2,6-dichlorobenzaldehyde, 2,6-diflouro-benzaldehyde, and 3-ethoxy-4-hydroxybenzaldehyde, to yield the corresponding a,b-unsaturated ketones 3a-c. Compound 3b was reacted with hydrazine hydrate to yield the corresponding 2-pyrazoline 4, while compounds 3a,b reacted with thiourea to afford the 2-thioxopyrimidine derivatives 5a,b, respectively. The reaction of 1, and the aromatic aldehydes 2a-c with ethyl cyanoacetate, 2-cyano-thioacetamide or malononitrile in the presence of ammonium acetate yielded the corresponding 2-oxopyridines 6a,b, 2-thioxopyridines 7a-c or 2-iminopyridines 8a,b, respectively. The newly prepared compounds were evaluated for anticancer activity against two human tumor cell lines. Compound 3a showed the highest potency with IC50 = 3.5 and 4.5 μg/mL against a cervix carcinoma cell line (Hela and breast carcinoma cell line (MCF7, respectively.
Synthesis of new 3-(2-aminothiazol-4-yl-4-hydroxy-2H-chromen-2-one derivatives
Directory of Open Access Journals (Sweden)
S. SUKDOLAK
2006-06-01
Full Text Available Aminothiazole derivatives of 4-hydroxy-2H-chromen-2-one were prepared by the Hantzsch reaction1 using 3-(2-bromoacetyl-4-hydroxy-2H-chromen-2-one and thiourea derivatives. Starting compound for this synthesis 3-(2-bromoacetyl-4-hydroxy- 2H-chromen-2-one (1 was prepared previously.2 Also, for this synthesis we used thiourea derivatives (2a–j as compounds which possess groups with biological activity. Reactions are carried out in refluxing ethanol for a period of 30 – 45 min. Final products (3a–j are obtained in a high yield. Chemical structure of the obtained compounds was confirmed by elemental and structural analysis (IR and 1H NMR spectroscopy.
Xu, Li; Wang, Sheng; Lv, Yingnian; Son, Young-A; Cao, Derong
2014-07-15
A new photochromic diarylethene derivative bearing rhodamine 6G dimmer as a fluorescent molecular probe is designed and synthesized successfully. All the compounds are characterized by nuclear magnetic resonance and mass spectrometry. The bisthienylethene-rhodamine 6G dyad exhibit excellent phtochromism with reversibly color and fluorescence changes alternating irradiation with ultraviolet and visible light. Upon addition of Hg(2+), its color changes from colorless to red and its fluorescence is remarkably enhanced. Whereas other ions including K(+), Na(+), Ca(2+), Mg(2+), Fe(2+), Co(2+), Ni(2+), Cu(2+), Zn(2+), Mn(2+), Pb(2+), Ni(2+), Fe(3+), Al(3+), Cr(3+) and so on induce basically no spectral changes, which constitute a highly selective and sensitive photoswitchable fluorescent probe toward Hg(2+). Furthermore, by means of laser confocal scanning microscopy experiments, it is demonstrated that this probe can be applied for live cell imaging and monitoring Hg(2+) in living lung cancer cells with satisfying results, which shows its value of potential application in environmental and biological systems. Copyright © 2014 Elsevier B.V. All rights reserved.
Synthesis of D-fructose-derived spirocyclic 2-substituted-2-oxazoline ribosides
Directory of Open Access Journals (Sweden)
Madhuri Vangala
2015-11-01
Full Text Available The TMSOTf-mediated synthesis of β-configured spirocyclic 2-substituted-2-oxazoline ribosides was achieved using a “Ritter-like” reaction in toluene through nucleophilic addition of electron-rich nitriles to the oxacarbenium ion intermediate of 1,2;3,4-di-O-isopropylidene-β-D-psicofuranose derivatives with concomitant intramolecular trapping of the C2 hydroxymethyl group on the electrophilic nitrilium carbon. These carbohydrate-derived spirooxazolines are stable and were obtained in good yield with high stereoselectivity due to the conformational rigidity imparted by the 3,4-isopropylidene group.
Directory of Open Access Journals (Sweden)
A. Behring
2015-08-01
Full Text Available We calculate the massive flavor non-singlet Wilson coefficient for the heavy flavor contributions to the polarized structure function g1(x,Q2 in the asymptotic region Q2≫m2 to 3-loop order in Quantum Chromodynamics at general values of the Mellin variable N and the momentum fraction x, and derive heavy flavor corrections to the Bjorken sum-rule. Numerical results are presented for the charm quark contribution. Results on the structure function g2(x,Q2 in the twist-2 approximation are also given.
Synthesis of Phthalimide Derivatives as Potential PPAR-γ Ligands
Directory of Open Access Journals (Sweden)
So Hyeon Eom
2016-06-01
Full Text Available Paecilocin A, a phthalide derivative isolated from the jellyfish-derived fungus Paecilomyces variotii, activates PPAR-γ (Peroxisome proliferator-activated receptor gamma in rat liver Ac2F cells. Based on a SAR (Structure-activity relationships study and in silico analysis of paecilocin A-mimetic derivatives, additional N-substituted phthalimide derivatives were synthesized and evaluated for PPAR-γ agonistic activity in both murine liver Ac2F cells and in human liver HepG2 cells by luciferase assay, and for adipogenic activity in 3T3-L1 cells. Docking simulation indicated PD6 was likely to bind most strongly to the ligand binding domain of PPAR-γ by establishing crucial H-bonds with key amino acid residues. However, in in vitro assays, PD1 and PD2 consistently displayed significant PPAR-γ activation in Ac2F and HepG2 cells, and adipogenic activity in 3T3-L1 preadipocytes.
Experimental study on the thermochemistry of 2,5-dimethylthiophene and its acetyl derivative
International Nuclear Information System (INIS)
Ribeiro da Silva, Manuel A.V.; Santos, Ana Filipa L.O.M.
2008-01-01
This paper reports the values of the standard (p 0 = 0.1 MPa) molar enthalpies of formation, in the gaseous phase, Δ f H m 0 (g), at T = 298.15 K, of 2,5-dimethylthiophene and 3-acetyl-2,5-dimethylthiophene as (50.6 ± 1.9) kJ . mol -1 and -(123.2 ± 2.7) kJ . mol -1 , respectively. These values were derived from experimental thermodynamic parameters, namely, the standard molar enthalpies of formation, in the liquid phase, Δ f H m 0 (l), at T = 298.15 K, obtained from the standard molar enthalpies of combustion, Δ c H m 0 , measured by rotating bomb combustion calorimetry, and from the standard molar enthalpies of vaporization, Δ l g H m 0 , at T = 298.15 K, measured by high temperature Calvet microcalorimetry. The results are interpreted in terms of enthalpic increments, molecular structure and compared with structurally similar compounds
Fawzy El-Sayed, Karim M; Dörfer, Christof; Ungefroren, Hendrick; Kassem, Neemat; Wiltfang, Jörg; Paris, Sebastian
2014-07-01
The objective of this study was to evaluate the effect of Emdogain (Enamel Matrix Derivative, EMD) and Bone Morphogenetic Protein-2 (BMP-2), either solely or in combination, on the gene expression and mineralized nodule formation of alveolar bone proper-derived stem/progenitor cells. Stem/progenitor cells were isolated from human alveolar bone proper, magnetically sorted using STRO-1 antibodies, characterized flowcytometrically for their surface markers' expression, and examined for colony formation and multilineage differentiation potential. Subsequently, cells were treated over three weeks with 100 μg/ml Emdogain (EMD-Group), or 100 ng/ml BMP-2 (BMP-Group), or a combination of 100 ng/ml BMP-2 and 100 μg/ml Emdogain (BMP/EMD-Group). Unstimulated stem/progenitor cells (MACS(+)-Group) and osteoblasts (OB-Group) served as controls. Osteogenic gene expression was analyzed using RTq-PCR after 1, 2 and 3 weeks (N = 3/group). Mineralized nodule formation was evaluated by Alizarin-Red staining. BMP and EMD up-regulated the osteogenic gene expression. The BMP Group showed significantly higher expression of Collagen-I, III, and V, Alkaline phosphatase and Osteonectin compared to MACS(+)- and OB-Group (p < 0.05; Two-way ANOVA/Bonferroni) with no mineralized nodule formation. Under in-vitro conditions, Emdogain and BMP-2 up-regulate the osteogenic gene expression of stem/progenitor cells. The combination of BMP-2 and Emdogain showed no additive effect and would not be recommended for a combined clinical stimulation. Copyright © 2013 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.
Institute of Scientific and Technical Information of China (English)
杜平; 孔军; 王贵涛; 赵新; 李光玉; 蒋锡夔; 黎占亭
2011-01-01
In a preliminary letter (Tetrahedron Lett. 2010, 51, 188), we reported two new hydrazide-based quadruple hydrogen-bonding motifs, this is, two monopodal (la and lb) and five dipodal (2a, 2b and 3a--3c) aromatic hydrazide derivatives, and the formation of supramolecular polymers and vesicles from the dipodal motifs in hydrocarbons. In this paper, we present a full picture on the properties of these hydrogen-bonding motifs with an emphasis on their self-assembling behaviors in aqueous media. SEM, AFM, TEM and fluorescent micrographs indicate that all the dipodal compounds also form vesicles in polar methanol and water-methanol (up to 50% of water) mixtures. Control experiments show that lb does not form vesicles in same media. Addition of lb to the solution of the dipodal compounds inhibits the latter's capacity of forming vesicles. At high concentrations, 3b and 3c also gelate discrete solvents, including hydrocarbons, esters, methanol, and methanol-water mixture. Concentration-dependent SEM investigations reveal that the vesicles of 3b and 3c fuse to form gels and the gel of 3c can de-aggregate to form the vesicles reversibly.
Directory of Open Access Journals (Sweden)
Mona A. Hosny
2012-01-01
Full Text Available We present a short and efficient synthesis of the title compounds starting with cheap and readily available camphor and derivatives of acetophenone. The optimized sequence allows the large-scale preparation of this new type of synthesis in a few steps. New 1,2,3-thiadiazole and 1,2,3-diazaphosphole derivatives 11-20, were prepared from the ketones 1-5 via the corresponding semicarbazones 6-10. The Hurd-Mori and Lalezari methods were used, respectively, for the preparation of these 1,2,3-thiadiazole and 1,2,3-diazaphospholene derivatives. These derivatives exhibit anticancer effect due to their high potential biological activity.
International Nuclear Information System (INIS)
Slanina, Z.
1986-01-01
Equilibrium constants of H 2 O(g) and D 2 O(g) associations to clusters (H 2 O) n (g) and (D 2 O) n (g) were calculated on the basis of the ab initio SCF CI MCY-B water-water pair potential. Populations of the components of equilibrium cluster mixtures were evaluated at various temperatures and pressures for both isotopomeric series. Differences between the H and D steam are pointed out and possible consequences are discussed. (author)
Selective cytotoxicity of PAMAM G5 core–PAMAM G2.5 shell tecto-dendrimers on melanoma cells
Directory of Open Access Journals (Sweden)
Schilrreff P
2012-07-01
Full Text Available Priscila Schilrreff,1 Cecilia Mundiña-Weilenmann,2 Eder Lilia Romero,1 Maria Jose Morilla11Programa de Nanomedicinas, Universidad Nacional de Quilmes, Buenos Aires, Argentina; 2Centro de Investigaciones Cardiovasculares, Universidad Nacional de La Plata, La Plata, ArgentinaBackground: The controlled introduction of covalent linkages between dendrimer building blocks leads to polymers of higher architectural order known as tecto-dendrimers. Because of the few simple steps involved in their synthesis, tecto-dendrimers could expand the portfolio of structures beyond commercial dendrimers, due to the absence of synthetic drawbacks (large number of reaction steps, excessive monomer loading, and lengthy chromatographic separations and structural constraints of high-generation dendrimers (reduction of good monodispersity and ideal dendritic construction due to de Gennes dense-packing phenomenon. However, the biomedical uses of tecto-dendrimers remain unexplored. In this work, after synthesizing saturated shell core–shell tecto-dendrimers using amine-terminated polyamidoamine (PAMAM generation 5 (G5 as core and carboxyl-terminated PAMAM G2.5 as shell (G5G2.5 tecto-dendrimers, we surveyed for the first time the main features of their interaction with epithelial cells.Methods: Structural characterization of G5G2.5 was performed by polyacrylamide gel electrophoresis, matrix-assisted laser desorption time-of-flight mass spectrometry, and microscopic techniques; their hydrodynamic size and Z-potential was also determined. Cellular uptake by human epidermal keratinocytes, colon adenocarcinoma, and epidermal melanoma (SK-Mel-28 cells was determined by flow cytometry. Cytotoxicity was determined by mitochondrial activity, lactate dehydrogenase release, glutathione depletion, and apoptosis/necrosis measurement.Results: The resultant 60%–67% saturated shell, 87,000-dalton G5G2.5 (mean molecular weight interacted with cells in a significantly different
Miyake, Kentaro; Murakami, Takashi; Kiyuna, Tasuku; Igarashi, Kentaro; Kawaguchi, Kei; Li, Yunfeng; Singh, Arun S; Dry, Sarah M; Eckardt, Mark A; Hiroshima, Yukihiko; Momiyama, Masashi; Matsuyama, Ryusei; Chishima, Takashi; Endo, Itaru; Eilber, Fritz C; Hoffman, Robert M
2018-01-01
Ewing's sarcoma is a recalcitrant tumor greatly in need of more effective therapy. The aim of this study was to determine the efficacy of eribulin on a doxorubicin (DOX)-resistant Ewing's sarcoma patient derived orthotopic xenograft (PDOX) model. The Ewing's sarcoma PDOX model was previously established in the right chest wall of nude mice from tumor resected form the patient's right chest wall. In the previous study, the Ewing's sarcoma PDOX was resistant to doxorubicin (DOX) and sensitive to palbociclib and linsitinib. In the present study, the PDOX models were randomized into three groups when the tumor volume reached 60 mm 3 : G1, untreated control (n = 6); G2, DOX treated (n = 6), intraperitoneal (i.p.) injection, weekly, for 2 weeks); G3, Eribulin treated (n = 6, intravenous (i.v.) injection, weekly for 2 weeks). All mice were sacrificed on day 15. Changes in body weight and tumor volume were assessed two times per week. Tumor weight was measured after sacrifice. DOX did not suppress tumor growth compared to the control group (P = 0.589), consistent with the previous results in the patient and PDOX. Eribulin regressed tumor size significantly compared to G1 and G2 (P = 0.006, P = 0.017) respectively. No significant difference was observed in body weight among any group. Our results demonstrate that eribulin is a promising novel therapeutic agent for Ewing's sarcoma. © 2017 Wiley Periodicals, Inc.
Mori, Yoshikazu; Hirokawa, Takatsugu; Aoki, Katsuyuki; Satomi, Hisanori; Takeda, Shuichi; Aburada, Masaki; Miyamoto, Ken-ichi
2008-05-01
We previously reported a quinoxalin-2-one compound (Compound 1) that had inhibitory activity equivalent to existing platelet-derived growth factor-beta receptor (PDGFbeta R) inhibitors. Lead optimization of Compound 1 to increase its activity and selectivity, using structural information regarding PDGFbeta R-ligand interactions, is urgently needed. Here we present models of the PDGFbeta R kinase domain complexed with quinoxalin-2-one derivatives. The models were constructed using comparative modeling, molecular dynamics (MD) and ligand docking. In particular, conformations derived from MD, and ligand binding site information presented by alpha-spheres in the pre-docking processing, allowed us to identify optimal protein structures for docking of target ligands. By carrying out molecular modeling and MD of PDGFbeta R in its inactive state, we obtained two structural models having good Compound 1 binding potentials. In order to distinguish the optimal candidate, we evaluated the structural activity relationships (SAR) between the ligand-binding free energies and inhibitory activity values (IC50 values) for available quinoxalin-2-one derivatives. Consequently, a final model with a high SAR was identified. This model included a molecular interaction between the hydrophobic pocket behind the ATP binding site and the substitution region of the quinoxalin-2-one derivatives. These findings should prove useful in lead optimization of quinoxalin-2-one derivatives as PDGFb R inhibitors.
Phenanthroline-2,9-bistriazoles as selective G-quadruplex ligands
DEFF Research Database (Denmark)
Nielsen, Mads Corvinius; Larsen, Anders Foller; Abdikadir, Faisal Hussein
2014-01-01
G-quadruplex (G4) ligands are currently receiving considerable attention as potential anticancer therapeutics. A series of phenanthroline-2,9-bistriazoles carrying tethered positive end groups has been synthesized and evaluated as G4 stabilizers. The compounds were efficiently assembled by copper......(I)-catalyzed azide-alkyne cycloaddition (CuAAC) in CH2Cl2 and water in the presence of a complexing agent. Characterization of the target compounds on telomeric and c-KIT G4 sequences led to the identification of guanidinium-substituted compounds as potent G4 DNA ligands with high selectivity over duplex DNA....... The diisopropylguanidium ligands exhibited high selectivity for the proto-oncogenic sequence c-KIT over the human telomeric sequence in the surface plasmon resonance (SPR) assay, whereas the compounds appeared potent on both G4 structures in the FRET melting temperature assay. The phenanthroline-2,9-bistriazole ligands...
G2E3 is a nucleo-cytoplasmic shuttling protein with DNA damage responsive localization
International Nuclear Information System (INIS)
Brooks, William S.; Banerjee, Sami; Crawford, David F.
2007-01-01
G2E3 was originally described as a G2/M-specific gene with DNA damage responsive expression. The presence of a conserved HECT domain within the carboxy-terminus of the protein indicated that it likely functions as a ubiquitin ligase or E3. Although HECT domains are known to function in this capacity for many proteins, we demonstrate that a portion of the HECT domain from G2E3 plays an important role in the dynamic subcellular localization of the protein. We have shown that G2E3 is a nucleo-cytoplasmic shuttling protein with nuclear export mediated by a novel nuclear export domain that functions independently of CRM1. In full-length G2E3, a separate region of the HECT domain suppresses the function of the NES. Additionally, G2E3 contains a nucleolar localization signal (NoLS) in its amino terminus. Localization of G2E3 to the nucleolus is a dynamic process, and the protein delocalizes from the nucleolus rapidly after DNA damage. Cell cycle phase-specific expression and highly regulated subcellular localization of G2E3 suggest a possible role in cell cycle regulation and the cellular response to DNA damage
Precision spectroscopy of the X1Σg+, v=0→1(J=0-2) rovibrational splittings in H2, HD and D2
Niu, M. L.; Salumbides, E. J.; Dickenson, G. D.; Eikema, K. S. E.; Ubachs, W.
2014-06-01
Accurate experimental values for the vibrational ground tone or fundamental vibrational energy splitting of H2, HD, and D2 are presented. Absolute accuracies of 2×10-4 cm-1 are obtained from Doppler-free laser spectroscopy applied in a collisionless environment. The vibrational splitting frequencies are derived from the combination difference between separate electronic excitations from the X1Σg+, v=0, J and v=1, J vibrational states to a common EF1Σg+, v=0, J state. The present work on rotational quantum states J=1,2 extends the results reported by Dickenson et al. on J=0 [Phys. Rev. Lett. 110 (2013) 193601]. The experimental procedures leading to this high accuracy are discussed in detail. A comparison is made with full ab initio calculations encompassing Born-Oppenheimer energies, adiabatic and non-adiabatic corrections, as well as relativistic corrections and QED-contributions. The present agreement between the experimental results and the calculations provides a stringent test on the application of quantum electrodynamics in molecules. Furthermore, the combined experimental-theoretical uncertainty can be interpreted to provide bounds to new interactions beyond the Standard Model of Physics or fifth forces between hadrons.
A study on the hemocompatibility of dendronized chitosan derivatives in red blood cells
Directory of Open Access Journals (Sweden)
Zhou YF
2015-05-01
Full Text Available Yanfang Zhou,1,* Jiemei Li,1,* Fang Lu,1 Junjie Deng,2 Jiahua Zhang,1 Peijie Fang,1 Xinsheng Peng,1 Shu-Feng Zhou3 1Guangdong Medical Universtity, Dongguan, Guangdong, People’s Republic of China; 2Department of Materials Science and Engineering, Drexel University, Philadelphia, PA, USA; 3Department of Pharmaceutical Sciences, College of Pharmacy, University of South Florida, Tampa, FL, USA *These authors contributed equally to this work Abstract: Dendrimers are hyperbranched macromolecules with well-defined topological structures and multivalent functionalization sites, but they may cause cytotoxicity due to the presence of cationic charge. Recently, we have introduced alkyne-terminated poly(amidoamine (PAMAM dendrons of different generations (G=2,3 into chitosan to obtain dendronized chitosan derivatives [Cs-g-PAMAM (G=2,3], which exhibited a better water solubility and enhanced plasmid DNA transfection efficiency. In this study, we attempted to examine the impact of Cs-g-PAMAM (G=2,3 at different concentrations (25 µg/mL, 50 µg/mL, and 100 µg/mL on the morphology, surface structure, and viability of rat red blood cells (RBCs. The results showed that treatment of RBCs with Cs-g-PAMAM (G=2,3 at 50 µg/mL and 100 µg/mL induced a slightly higher hemolysis than Cs, and Cs-g-PAMAM (G=3 caused a slightly higher hemolysis than Cs-g-PAMAM (G=2, but all values were <5.0%. Optical microscopic and atomic force microscopic examinations indicated that Cs-g-PAMAM (G=2,3 caused slight RBC aggregation and lysis. Treatment of RBCs with 100 µg/mL Cs-g-PAMAM (G=3 induced echinocytic transformation, and RBCs displayed characteristic irregular contour due to the folding of the periphery. Drephanocyte-like RBCs were observed when treated with 100 µg/mL Cs-g-PAMAM (G=3. Erythrocytes underwent similar shape transition upon treatment with Cs-g-PAMAM (G=2 or Cs. The roughness values (Rms of RBCs incubated with Cs-g-PAMAM (G=2,3 were significantly larger
Quench detection method for 2G HTS wire
International Nuclear Information System (INIS)
Marchevsky, M; Xie, Y-Y; Selvamanickam, V
2010-01-01
2G HTS conductors are increasingly used in various commercial applications and their thermal and electrical stability is an important reliability factor. Detection and prevention of quenches in 2G wire-based cables and solenoids has proven to be a difficult engineering task. This is largely due to a very slow normal zone propagation in coated conductors that leads to formation of localized hotspots while the rest of the conductor remains in the superconducting state. We propose an original method of quench and hotspot detection for 2G wires and coils that is based upon local magnetic sensing and takes advantage of 2G wire planar geometry. We demonstrate our technique experimentally and show that its sensitivity is superior to the known voltage detection scheme. A unique feature of the method is its capability to remotely detect instant degradation of the wire critical current even before a normal zone is developed within the conductor. Various modifications of the method applicable to practical device configurations are discussed.
Quench detection method for 2G HTS wire
Energy Technology Data Exchange (ETDEWEB)
Marchevsky, M; Xie, Y-Y; Selvamanickam, V, E-mail: maxmarche@gmail.co, E-mail: yxie@superpower-inc.co [SuperPower, Inc., 450 Duane Avenue, Schenectady, NY 12304 (United States)
2010-03-15
2G HTS conductors are increasingly used in various commercial applications and their thermal and electrical stability is an important reliability factor. Detection and prevention of quenches in 2G wire-based cables and solenoids has proven to be a difficult engineering task. This is largely due to a very slow normal zone propagation in coated conductors that leads to formation of localized hotspots while the rest of the conductor remains in the superconducting state. We propose an original method of quench and hotspot detection for 2G wires and coils that is based upon local magnetic sensing and takes advantage of 2G wire planar geometry. We demonstrate our technique experimentally and show that its sensitivity is superior to the known voltage detection scheme. A unique feature of the method is its capability to remotely detect instant degradation of the wire critical current even before a normal zone is developed within the conductor. Various modifications of the method applicable to practical device configurations are discussed.
Mork, Maureen E; Borras, Ester; Taggart, Melissa W; Cuddy, Amanda; Bannon, Sarah A; You, Y Nancy; Lynch, Patrick M; Ramirez, Pedro T; Rodriguez-Bigas, Miguel A; Vilar, Eduardo
2016-10-01
Constitutional mismatch repair deficiency syndrome (CMMRD) is a rare autosomal recessive predisposition to colorectal polyposis and other malignancies, often childhood-onset, that is caused by biallelic inheritance of mutations in the same mismatch repair gene. Here, we describe a patient with a clinical diagnosis of CMMRD based on colorectal polyposis and young-onset endometrial cancer who was identified to have two alterations in trans in PMS2: one known pathogenic mutation (c.1831insA; p.Ile611Asnfs*2) and one novel variant of uncertain significance (c.505C>G; p.Arg169Glu), a missense alteration. We describe the clinical and molecular features in the patient harboring this novel alteration c.505C>G, who meets clinical criteria for CMMRD and exhibits molecular evidence supporting a diagnosis of CMMRD. Although experimental validation is needed to confirm its pathogenicity, PMS2 c.505C>G likely has functional consequences that contributes to our patient's phenotype based on the patient's clinical presentation, tumor studies, and bioinformatics analysis.
Origin of photoluminescence in β -G a2O3
Ho, Quoc Duy; Frauenheim, Thomas; Deák, Peter
2018-03-01
β -G a2O3 , a candidate material for power electronics and UV optoelectronics, shows strong room-temperature photoluminescence (PL). In addition to the three well-known bands of as-grown samples in the UV, blue, and green, also red PL was observed upon nitrogen doping. This raises the possibility of applying β -G a2O3 nanostructures as white phosphors. Using an optimized, Koopmans-compliant hybrid functional, we show that most intrinsic point defects, as well as substitutional nitrogen, act as deep acceptors, and each of the observed PL bands can be explained by electron recombination with a hole trapped in one of them. We suggest this mechanism to be general in wide-band-gap semiconductors which can only be doped n -type. Calculations on the nitrogen acceptor reproduce the observed red luminescence accurately. Earlier we have shown that not only the energy, but the polarization properties of the UV band can be explained by self-trapped hole states. Here we find that the blue band has its origin mainly in singly negative Ga-O divacancies, and the green band is caused dominantly by interstitial O atoms (with minor contribution of Ga vacancies to both). These assignments can explain the experimentally observed dependence of the PL bands on free-electron concentration and stoichiometry. The information provided here paves the way for the conscious tuning of light emission from β -G a2O3 .
The potential role of G2- but not of G0-radiosensitivity for predisposition of prostate cancer
International Nuclear Information System (INIS)
Borgmann, Kerstin; Raabe, Annette; Reuther, Sebastian; Szymczak, Silke; Schlomm, Thorsten; Isbarn, Hendrik; Gomolka, Maria; Busjahn, Andreas; Bonin, Michael; Ziegler, Andreas; Dikomey, Ekkehard
2010-01-01
Purpose: Comparing the chromosomal radiosensitivity of prostate cancer patients with that of healthy donors. Materials and methods: The study was performed on 81 prostate cancer patients characterised by a clinical stage of predominantly pT2c or pT3a and a median age of 67 years. As healthy donors 60 male monozygotic twin pairs were recruited with a median age of 28 years. Chromosomal radiosensitivity was measured using both G0- and G2-assay. Results: No difference between healthy donors and prostate cancer patients was detected concerning G0-radiosensitivity, since medians were similar (Hodges-Lehmann estimate: -0.05, 95% CI: -0.18-0.08, p = 0.4167). However, a pronounced difference was determined for G2-radiosensitivity with prostate cancer patients showing a significantly higher sensitivity compared to healthy donors (Hodges-Lehmann estimate: -0.41, 95% CI: -0.53 to -0.30, p = 1.75 -9 ). Using the 90% quantile of G2-radiosensitivity in healthy donors as a threshold for discrimination the fraction of prostate cancer patients with elevated radiosensitivity increased to 49%. Conclusion: G2-, but not G0-radiosensitivity is a promising marker for predisposition of prostate cancer.
LoGerfo, Annalisa; Chico, Lucia; Borgia, Loredana; Petrozzi, Lucia; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Caldarazzo Ienco, Elena; Mancuso, Michelangelo; Siciliano, Gabriele
2014-01-01
Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: -653 A/G, -651 G/A, and -617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the -653 A/G, -651 G/A, and -617 C/A Nrf2 SNPs in ALS patients.
Reactions of POxCly- ions with O2(a 1[Delta]g), H2O, and Cl2 at 298 K
Midey, Anthony J.; Dotan, Itzhak; Viggiano, A. A.
2008-06-01
The rate constants and product branching ratios for the reactions of phosphorus oxychloride anions, POxCly- for x = 1-2 and y = 1-3, with O2(a 1[Delta]g), Cl2, and H2O have been measured in a selected ion flow tube (SIFT) at 298 K. A mixture of O2(a 1[Delta]g) in O2 has been produced using a recently designed chemical singlet oxygen generator (sparger) with an emission detection scheme adopted previously in our laboratory. The experiments continue a series of investigations into the oxidation reactions of POxCly- ions, searching for pathways to the terminal PO2- and PO3- ions observed in combustion chemistry with POCl3 present. None of the POxCly- ions react with H2O or O2(a 1[Delta]g). The O2(a 1[Delta]g) rate constants have a limit of <1 × 10-11 cm3 s-1, except for PO2Cl- where a limit of <5 × 10-11 cm3 s-1 has been determined. The H2O rate constants have limits of <1 × 10-11 cm3 s-1. All of the POxCly- ions react with Cl2, excluding PO3- and PO2Cl2-. Depending on the reactant ion, Cl-, Cl2- or PO2Cl2- product ions form.
Directory of Open Access Journals (Sweden)
Gadada Naganagowda
2014-01-01
Full Text Available Various novel Schiff base compounds have been synthesized by reaction of 2-hydroxy-4-pentadecylbenzaldehyde with substituted benzothiophene-2-carboxylic acid hydrazide and different substituted aromatic or heterocyclic amines in the presence of acetic acid in ethanol. The structures of all these compounds were confirmed by elemental analysis, IR, 1H-NMR, 13C-NMR, and mass spectral data and have been screened for antibacterial and antifungal activity.
Oracle JDeveloper 11gR2 Cookbook
Haralabidis, Nick
2012-01-01
"Oracle JDeveloper 11gR2 Cookbook" is a practical cookbook which goes beyond the basics with immediately applicable recipes for building ADF applications at an intermediate-to-advanced level. If you are a JavaEE developer who wants to go beyond the basics of building ADF applications with Oracle JDeveloper 11gR2 and get hands on with practical recipes, this book is for you. You should be comfortable with general Java development principles, the JDeveloper IDE, and ADF basics
Ishii, Kazuyuki; Itoya, Hatsumi; Miwa, Hideya; Fujitsuka, Mamoru; Ito, Osamu; Kobayashi, Nagao
2005-07-07
We have investigated the excited-state properties and singlet oxygen ((1)Delta(g)) generation mechanism in phthalocyanines (4M; M = H(2), Mg, or Zn) and in low-symmetry metal-free, magnesium, and zinc tetraazaporphyrins (TAPs), that is, monobenzo-substituted (1M), adjacently dibenzo-substituted (2AdM), oppositely dibenzo-substituted (2OpM), and tribenzo-substituted (3M) TAP derivatives, whose pi conjugated systems were altered by fusing benzo rings. The S(1)(x) and S(1)(y) states (these lowest excited singlet states are degenerate in D(4)(h) symmetry) split in the low-symmetry TAP derivatives. The excited-state energies were quantitatively determined from the electronic absorption spectra. The lowest excited triplet (T(1)(x)) energies were also determined from phosphorescence spectra, while the second lowest excited triplet (T(1)(y)) states were evaluated by using the energy splitting between the T(1)(x) and T(1)(y) states previously reported (Miwa, H.; Ishii, K.; Kobayashi, N. Chem. Eur. J. 2004, 10, 4422-4435). The singlet oxygen quantum yields (Phi(Delta)) are strongly dependent on the pi conjugated system. In particular, while the Phi(Delta) value of 2AdH(2) is smallest in our system, that of 2OpH(2), an isomer of 2AdH(2), is larger than that of 4Zn, in contrast to the heavy atom effect. The relationship between the molecular structure and Phi(Delta) values can be transformed into a relationship between the S(1)(x) --> T(1)(y) intersystem crossing rate constant (k(ISC)) and the energy difference between the S(1)(x) and T(1)(y) states (DeltaE(S)(x)(T)(y)). In each of the Zn, Mg, and metal-free compounds, the Phi(Delta)/tau(F) values (tau(F): fluorescence lifetime), which are related to the k(ISC) values, are proportional to exp(-DeltaE(S)(x)(T)(y)), indicating that singlet oxygen ((1)Delta(g)) is produced via the T(1)(y) state and that the S(1)(x) --> T(1)(y) ISC process follows the energy-gap law. From the viewpoint of photodynamic therapy, our methodology
Directory of Open Access Journals (Sweden)
Claire Laurens
2016-07-01
Full Text Available Objective: Recent data suggest that adipose triglyceride lipase (ATGL plays a key role in providing energy substrate from triglyceride pools and that alterations of its expression/activity relate to metabolic disturbances in skeletal muscle. Yet little is known about its regulation. We here investigated the role of the protein G0/G1 Switch Gene 2 (G0S2, recently described as an inhibitor of ATGL in white adipose tissue, in the regulation of lipolysis and oxidative metabolism in skeletal muscle. Methods: We first examined G0S2 protein expression in relation to metabolic status and muscle characteristics in humans. We next overexpressed and knocked down G0S2 in human primary myotubes to assess its impact on ATGL activity, lipid turnover and oxidative metabolism, and further knocked down G0S2 in vivo in mouse skeletal muscle. Results: G0S2 protein is increased in skeletal muscle of endurance-trained individuals and correlates with markers of oxidative capacity and lipid content. Recombinant G0S2 protein inhibits ATGL activity by about 40% in lysates of mouse and human skeletal muscle. G0S2 overexpression augments (+49%, p < 0.05 while G0S2 knockdown strongly reduces (−68%, p < 0.001 triglyceride content in human primary myotubes and mouse skeletal muscle. We further show that G0S2 controls lipolysis and fatty acid oxidation in a strictly ATGL-dependent manner. These metabolic adaptations mediated by G0S2 are paralleled by concomitant changes in glucose metabolism through the modulation of Pyruvate Dehydrogenase Kinase 4 (PDK4 expression (5.4 fold, p < 0.001. Importantly, downregulation of G0S2 in vivo in mouse skeletal muscle recapitulates changes in lipid metabolism observed in vitro. Conclusion: Collectively, these data indicate that G0S2 plays a key role in the regulation of skeletal muscle ATGL activity, lipid content and oxidative metabolism. Keywords: Lipid metabolism, Skeletal muscle, Lipolysis, Adipose triglyceride lipase
Directory of Open Access Journals (Sweden)
Xianyu Li
Full Text Available Cancer cell metastasis is a major cause of cancer death. Unfortunately, the underlying molecular mechanisms remain unknown, which results in the lack of efficient diagnosis, therapy and prevention approaches. Nevertheless, the dysregulation of the cancer cell secretome is known to play key roles in tumor transformation and progression. The majority of proteins in the secretome are secretory proteins and membrane-released proteins, and, mostly, the glycosylated proteins. Until recently, few studies have explored protein N-glycosylation changes in the secretome, although protein glycosylation has received increasing attention in the study of tumor development processes. Here, the N-glycoproteins in the secretome of two human hepatocellular carcinoma (HCC cell lines with low (MHCC97L or high (HCCLM3 metastatic potential were investigated with a in-depth characterization of the N-glycosites by combining two general glycopeptide enrichment approaches, hydrazide chemistry and zwitterionic hydrophilic interaction chromatography (zic-HILIC, with mass spectrometry analysis. A total of 1,213 unique N-glycosites from 611 N-glycoproteins were confidently identified. These N-glycoproteins were primarily localized to the extracellular space and plasma membrane, supporting the important role of N-glycosylation in the secretory pathway. Coupling label-free quantification with a hierarchical clustering strategy, we determined the differential regulation of several N-glycoproteins that are related to metastasis, among which AFP, DKK1, FN1, CD151 and TGFβ2 were up-regulated in HCCLM3 cells. The inclusion of the well-known metastasis-related proteins AFP and DKK1 in this list provides solid supports for our study. Further western blotting experiments detecting FN1 and FAT1 confirmed our discovery. The glycoproteome strategy in this study provides an effective means to explore potential cancer biomarkers.
Directory of Open Access Journals (Sweden)
Choi Hyun
2009-05-01
Full Text Available Abstract Background 3,3'-Diindolylmethane (DIM, an indole derivative produced in the stomach after the consumption of broccoli and other cruciferous vegetables, has been demonstrated to exert anti-cancer effects in both in vivo and in vitro models. We have previously determined that DIM (0 – 30 μmol/L inhibited the growth of HT-29 human colon cancer cells in a concentration-dependent fashion. In this study, we evaluated the effects of DIM on cell cycle progression in HT-29 cells. Methods HT-29 cells were cultured with various concentrations of DIM (0 – 30 μmol/L and the DNA was stained with propidium iodide, followed by flow cytometric analysis. [3H]Thymidine incorporation assays, Western blot analyses, immunoprecipitation and in vitro kinase assays for cyclin-dependent kinase (CDK and cell division cycle (CDC2 were conducted. Results The percentages of cells in the G1 and G2/M phases were dose-dependently increased and the percentages of cells in S phase were reduced within 12 h in DIM-treated cells. DIM also reduced DNA synthesis in a dose-dependent fashion. DIM markedly reduced CDK2 activity and the levels of phosphorylated retinoblastoma proteins (Rb and E2F-1, and also increased the levels of hypophosphorylated Rb. DIM reduced the protein levels of cyclin A, D1, and CDK4. DIM also increased the protein levels of CDK inhibitors, p21CIP1/WAF1 and p27KIPI. In addition, DIM reduced the activity of CDC2 and the levels of CDC25C phosphatase and cyclin B1. Conclusion Here, we have demonstrated that DIM induces G1 and G2/M phase cell cycle arrest in HT-29 cells, and this effect may be mediated by reduced CDK activity.
Choi, Hyun Ju; Lim, Do Young; Park, Jung Han Yoon
2009-05-29
3,3'-Diindolylmethane (DIM), an indole derivative produced in the stomach after the consumption of broccoli and other cruciferous vegetables, has been demonstrated to exert anti-cancer effects in both in vivo and in vitro models. We have previously determined that DIM (0 - 30 micromol/L) inhibited the growth of HT-29 human colon cancer cells in a concentration-dependent fashion. In this study, we evaluated the effects of DIM on cell cycle progression in HT-29 cells. HT-29 cells were cultured with various concentrations of DIM (0 - 30 micromol/L) and the DNA was stained with propidium iodide, followed by flow cytometric analysis. [3H]Thymidine incorporation assays, Western blot analyses, immunoprecipitation and in vitro kinase assays for cyclin-dependent kinase (CDK) and cell division cycle (CDC)2 were conducted. The percentages of cells in the G1 and G2/M phases were dose-dependently increased and the percentages of cells in S phase were reduced within 12 h in DIM-treated cells. DIM also reduced DNA synthesis in a dose-dependent fashion. DIM markedly reduced CDK2 activity and the levels of phosphorylated retinoblastoma proteins (Rb) and E2F-1, and also increased the levels of hypophosphorylated Rb. DIM reduced the protein levels of cyclin A, D1, and CDK4. DIM also increased the protein levels of CDK inhibitors, p21CIP1/WAF1 and p27KIPI. In addition, DIM reduced the activity of CDC2 and the levels of CDC25C phosphatase and cyclin B1. Here, we have demonstrated that DIM induces G1 and G2/M phase cell cycle arrest in HT-29 cells, and this effect may be mediated by reduced CDK activity.
Directory of Open Access Journals (Sweden)
2008-08-01
Full Text Available Background and the purpose of the study: Fluoroquinolones are an important group of antimicrobial agents that are used widely in the treatment of various infectious diseases. The purpose of the present study was to synthesize new N-piperazinyl quinolone derivatives with 5-chloro-2-theinyl group having possible antimicrobial activity. Methods: Reaction of ciprofloxacin (1, norfloxacin (2 and enoxacin (3 with α-bromoketone 10 or α-bromooxime derivatives 11a-c in DMF, in the presence of NaHCO3 at room temperature, afforded corresponding ketones 4a-c or oxime derivatives 5-7(a-c, respectively. Results and major conclusion: The synthesized compounds were tested against a series of Gram-positive and Gram-negative bacteria. The results of MIC tests against both Gram-positive and Gram-negative bacteria revealed that ciprofloxacin derivatives (compounds 4a, 5a, 6a and 7a were more active than norfloxacin and enoxacin analogues. Compound 5a, containing N-[2-(5-chlorothiophen-2-yl-2-hydroxyiminoethyl] residue provided a high in vitro antibacterial activity against Gram-positive bacteria, with MIC of 0.06, 0.125, 0.5 and 0.125 μg/mL against S. aureus, S. epidermidis, E. feacalis and B. subtilis, respectively. Its activity was found to be 4 to 8 times better than reference drug (ciprofloxacin against all Gram-positive bacteria with the exception of E. feacalis.
Sparapani, Silvia; Bellini, Stefania; Gunaratnam, Mekala; Haider, Shozeb M; Andreani, Aldo; Rambaldi, Mirella; Locatelli, Alessandra; Morigi, Rita; Granaiola, Massimiliano; Varoli, Lucilla; Burnelli, Silvia; Leoni, Alberto; Neidle, Stephen
2010-08-21
A bis-guanylhydrazone derivative of diimidazo[1,2-a:1,2-c]pyrimidine has unexpectedly been found to be a potent stabiliser of several quadruplex DNAs, whereas there is no significant interaction with duplex DNA. Molecular modeling suggests that the guanylhydrazone groups play an active role in quadruplex binding.
Hadronic light-by-light scattering in the muon g-2: A new short-distance constraint on pion exchange
International Nuclear Information System (INIS)
Nyffeler, Andreas
2009-01-01
Recently it was pointed out that for the evaluation of the numerically dominant pion-exchange contribution to the hadronic light-by-light scattering correction in the muon g-2, a fully off-shell pion-photon-photon form factor should be used. Following this proposal, we first derive a new short-distance constraint on the off-shell form factor which enters at the external vertex for the muon g-2 and show that it is related to the quark condensate magnetic susceptibility in QCD. We then evaluate the pion-exchange contribution in the framework of large-N C QCD using an off-shell form factor which fulfills all short-distance constraints. With a value for the magnetic susceptibility as estimated in the same large-N C framework, we obtain the result a μ LbyL;π 0 =(72±12)x10 -11 . Updating our earlier results for the contributions from the exchanges of the η and η ' using simple vector-meson dominance form factors, we obtain a μ LbyL;PS =(99±16)x10 -11 for the sum of all light pseudoscalars. Combined with available evaluations for the other contributions to hadronic light-by-light scattering this leads to the new estimate a μ LbyL;had =(116±40)x10 -11 .
Hatano, Manabu; Kuwashima, Naruo; Tatsumi, Tomohide; Dusak, Jill E; Nishimura, Fumihiko; Reilly, Karlyne M; Storkus, Walter J; Okada, Hideho
2004-01-01
Background A novel tyrosine kinase receptor EphA2 is expressed at high levels in advanced and metastatic cancers. We examined whether vaccinations with synthetic mouse EphA2 (mEphA2)-derived peptides that serve as T cell epitopes could induce protective and therapeutic anti-tumor immunity. Methods C57BL/6 mice received subcutaneous (s.c.) vaccinations with bone marrow-derived dendritic cells (DCs) pulsed with synthetic peptides recognized by CD8+ (mEphA2671–679, mEphA2682–689) and CD4+ (mEphA230–44) T cells. Splenocytes (SPCs) were harvested from primed mice to assess the induction of cytotoxic T lymphocyte (CTL) responses against syngeneic glioma, sarcoma and melanoma cell lines. The ability of these vaccines to prevent or treat tumor (s.c. injected MCA205 sarcoma or B16 melanoma; i.v. injected B16-BL6) establishment/progression was then assessed. Results Immunization of C57BL/6 mice with mEphA2-derived peptides induced specific CTL responses in SPCs. Vaccination with mEPhA2 peptides, but not control ovalbumin (OVA) peptides, prevented the establishment or prevented the growth of EphA2+ or EphA2-negative syngeneic tumors in both s.c. and lung metastasis models. Conclusions These data indicate that mEphA2 can serve as an attractive target against which to direct anti-tumor immunity. The ability of mEphA2 vaccines to impact EphA2-negative tumors such as the B16 melanoma may suggest that such beneficial immunity may be directed against alternative EphA2+ target cells, such as the tumor-associated vascular endothelial cells. PMID:15563374
Directory of Open Access Journals (Sweden)
Hatano Manabu
2004-11-01
Full Text Available Abstract Background A novel tyrosine kinase receptor EphA2 is expressed at high levels in advanced and metastatic cancers. We examined whether vaccinations with synthetic mouse EphA2 (mEphA2-derived peptides that serve as T cell epitopes could induce protective and therapeutic anti-tumor immunity. Methods C57BL/6 mice received subcutaneous (s.c. vaccinations with bone marrow-derived dendritic cells (DCs pulsed with synthetic peptides recognized by CD8+ (mEphA2671–679, mEphA2682–689 and CD4+ (mEphA230–44 T cells. Splenocytes (SPCs were harvested from primed mice to assess the induction of cytotoxic T lymphocyte (CTL responses against syngeneic glioma, sarcoma and melanoma cell lines. The ability of these vaccines to prevent or treat tumor (s.c. injected MCA205 sarcoma or B16 melanoma; i.v. injected B16-BL6 establishment/progression was then assessed. Results Immunization of C57BL/6 mice with mEphA2-derived peptides induced specific CTL responses in SPCs. Vaccination with mEPhA2 peptides, but not control ovalbumin (OVA peptides, prevented the establishment or prevented the growth of EphA2+ or EphA2-negative syngeneic tumors in both s.c. and lung metastasis models. Conclusions These data indicate that mEphA2 can serve as an attractive target against which to direct anti-tumor immunity. The ability of mEphA2 vaccines to impact EphA2-negative tumors such as the B16 melanoma may suggest that such beneficial immunity may be directed against alternative EphA2+ target cells, such as the tumor-associated vascular endothelial cells.
Down-link power distributions for 2G and 3G mobile communication networks
International Nuclear Information System (INIS)
Colombi, D.; Thors, B.; Persson, T.; Wiren, N.; Larsson, L. E.; Jonsson, M.; Toernevik, C.
2013-01-01
Knowledge of realistic power levels is key when conducting accurate EMF exposure assessments. In this study, down-link output power distributions for radio base stations in 2G and 3G mobile communication networks have been assessed. The distributions were obtained from network measurement data collected from the Operations Support System, which normally is used for network monitoring and management. Significant amounts of data were gathered simultaneously for large sets of radio base stations covering wide geographical areas and different environments. The method was validated with in situ measurements. For the 3G network, the 90. percentile of the averaged output power during high traffic hours was found to be 43 % of the maximum available power. The corresponding number for 2G, with two or more transceivers installed, was 65 % or below. (authors)
A turn-on fluorescent rhodamine-acyl hydrazide for selective detection of Cu{sup 2+} ions
Energy Technology Data Exchange (ETDEWEB)
Yoon, Jung Won; Jeong, Hyuk; Lee, Min Hee [Dept. of Chemistry, Sookmyung Women' s University, Seoul (Korea, Republic of)
2017-03-15
We present a rhodamine-based probe that can detect Cu{sup 2+} ions via Cu{sup 2+}-promoted hydrolysis in aqueous solutions. In solution, the probe is non-fluorescent and colorless, but gives a strong fluorescence at 586 nm and shows a color change to pink on the addition of Cu{sup 2+} ions. We demonstrate that the rhodamine-based probe undergoes Cu{sup 2+}-promoted hydrolysis with a moderate reaction time (within 3 min) and provides a fluorescence off–on change, even in the presence of other competitive metal ions. The rhodamine-based probe shows a linear correlation between increasing fluorescence at 586 nm and the Cu{sup 2+} concentration, and can detect Cu{sup 2+} at nanomolar levels (10 nM) in CH{sub 3}CN:H{sub 2}O (v/v, 90:10)
CERN PhotoLab
1974-01-01
The "g-2" muon storage ring, shortly before completion in June 1974. Bursts of pions (from a target, hit by a proton beam from the 26 GeV PS) are injected and polarized muons from their decay are captured on a stable orbit. When the muons decay too, their precession in the magnetic field of the storage ring causes a modulation of the decay-electron counting rate, from which the muon's anomalous magnetic moment can be determined. In 1977, the "g-2" magnets were modified to build ICE (Initial Cooling Experiment), a proton and antiproton storage ring for testing stochastic and electron cooling. Later on, the magnets had a 3rd life, when the ion storage ring CELSIUS was built from them in Uppsala. For later use as ICE, see 7711282, 7802099, 7809081,7908242.
Detection of 2-alkylcyclobutanones by labelling with fluorophene
International Nuclear Information System (INIS)
Moersel, J.T.; Schmiedl, D.
1993-01-01
Radiolysis of triglycerides results in radiolytic formation of 2-alkylcyclobutanone. Identification of such radiolysis products is attractive for both the detection of irradiation treatment of food and for quality assurance of irradiated foods. The authors demonstrated the model compound 2-dodecylcyclobutanone by the key compound 1-bromo-1-ethoxycyclopropane. Detection was effected by labelling the cyclobutanone with suitable fluorescent dies and by tracing them analytically by fluorescence detection using HPLC. 1-Pyrene-butyryl acid hydrazide (P-101) and 7-diethylaminecumarine-3-carbonylazide (D-1446) were used as fluorophores. Suitable model matrices resulted in a sensitive detection of dodecylcyclobutanone. (orig./UHE) [de
Genetic recombination and Cryptosporidium hominis virulent subtype IbA10G2.
Li, Na; Xiao, Lihua; Cama, Vitaliano A; Ortega, Ynes; Gilman, Robert H; Guo, Meijin; Feng, Yaoyu
2013-10-01
Little is known about the emergence and spread of virulent subtypes of Cryptosporidium hominis, the predominant species responsible for human cryptosporidiosis. We conducted sequence analyses of 32 genetic loci of 53 C. hominis specimens isolated from a longitudinally followed cohort of children living in a small community. We identified by linkage disequilibrium and recombination analyses only limited genetic recombination, which occurred exclusively within the 60-kDa glycoprotein gene subtype IbA10G2, a predominant subtype for outbreaks in industrialized nations and a virulent subtype in the study community. Intensive transmission of virulent subtype IbA10G2 in the study area might have resulted in genetic recombination with other subtypes. Moreover, we identified selection for IbA10G2 at a 129-kb region around the 60-kDa glycoprotein gene in chromosome 6. These findings improve our understanding of the origin and evolution of C. hominis subtypes and the spread of virulent subtypes.
[2-(2,4-dimethylphenylthio)phenyl] aniline and its amide derivatives ...
Indian Academy of Sciences (India)
YOGESH PATIL
2018-02-15
Feb 15, 2018 ... These derivatives could be considered as a precursor structure for further design of antituberculosis agent. Keywords. [2-(2,4-dimethylphenylthio)phenyl] aniline; antituberculosis activity; cytotoxicity. 1. Introduction. Tuberculosis (TB) is a contagious disease caused by the. Mycobacterium tuberculosis (MTB).
Canonical quantum theory of gravitational field with higher derivatives, 2
International Nuclear Information System (INIS)
Kawasaki, Shoichiro; Kimura, Tadahiko
1982-01-01
The asymptotic fields in a canonically quantized graviational field with higher derivatives are analyzed. A possible mechanism of the recovery of the physical S-matrix unitarity is discussed. The constraint nabla sub(μ)(B sup(μν) + (Beta /α)g sup(μν)B) = 0 due to the Bianchi identity on R sub(μν) is treated by Dirac's method. (author)
Khan, Wasim S; Adesida, Adetola B; Tew, Simon R; Lowe, Emma T; Hardingham, Timothy E
2010-06-01
Bone marrow-derived mesenchymal stem cells are a potential source of cells for the repair of articular cartilage defects. Hypoxia has been shown to improve chondrogenesis in some cells. In this study, bone marrow-derived stem cells were characterized and the effects of hypoxia on chondrogenesis investigated. Adherent bone marrow colony-forming cells were characterized for stem cell surface epitopes, and then cultured as cell aggregates in chondrogenic medium under normoxic (20% oxygen) or hypoxic (5% oxygen) conditions. The cells stained strongly for markers of adult mesenchymal stem cells, and a high number of cells were also positive for the pericyte marker 3G5. The cells showed a chondrogenic response in cell aggregate cultures and, in lowered oxygen, there was increased matrix accumulation of proteoglycan, but less cell proliferation. In hypoxia, there was increased expression of key transcription factor SOX6, and of collagens II and XI, and aggrecan. Pericytes are a candidate stem cell in many tissue, and our results show that bone marrow-derived mesenchymal stem cells express the pericyte marker 3G5. The response to chondrogenic culture in these cells was enhanced by lowered oxygen tension. This has important implications for tissue engineering applications of bone marrow-derived stem cells. (c) 2010 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.
Evolution of Positioning Techniques in Cellular Networks, from 2G to 4G
Directory of Open Access Journals (Sweden)
Rafael Saraiva Campos
2017-01-01
Full Text Available This review paper presents within a common framework the mobile station positioning methods applied in 2G, 3G, and 4G cellular networks, as well as the structure of the related 3GPP technical specifications. The evolution path through the generations is explored in three steps at each level: first, the new network elements supporting localization features are introduced; then, the standard localization methods are described; finally, the protocols providing specific support to mobile station positioning are studied. To allow a better understanding, this paper also brings a brief review of the cellular networks evolution paths.
Bis{2-hydroxyimino-N′-[1-(2-pyridyl)ethylidene]propanohydrazidato}zinc(II) dihydrate
Moroz, Yurii S.; Znovjyak, Kateryna O; Golenya, Iryna O.; Pavlova, Svetlana V.; Haukka, Matti
2010-01-01
The title compound, [Zn(C10H11N4O2)2]·2H2O, was prepared by the reaction between Zn(CH3COO)2·2H2O and 2-hydroxyimino-N′-[1-(2-pyridyl)ethylidene]propanohydrazide (Hpop). The central ZnII atom has a distorted tetragonal-bipyramidal coordination geometry formed by two amide O atoms and four N atoms of two azomethine and two pyridine groups. In the crystal, complex molecules form layers parallel to the crystallographic b direction. The layers are connected by O—H⋯N and O—H⋯O hydrogen bonds involving the solvent water molecules. PMID:21579695
Influence of earth's gravity on (g - 2) measurements
International Nuclear Information System (INIS)
Widom, A.; Chen, C.C.
1988-01-01
Experimental probes of the anomalous magnetic moment of the muon, which are sufficiently sensitive to probe electro-weak unification contributions to (g - 2), are also sufficiently sensitive to test an interesting feature of general relativity. The gravitational field of the earth produces a background space-time metric which will influence (g - 2) measurements
Directory of Open Access Journals (Sweden)
E. S. Pruglo
2013-06-01
Full Text Available INTRODUCTION. It is known that fever is a necessary defense response that activates the immune system, enhances phagocytosis, stimulates the formation of Interferon, antibody production, which leads to inhibition of reproduction of many viruses and bacteria. However, the raising of the temperature above 39 ° C is dangerous for adults and children of all ages. Despite the high efficacy of analgesics, antipyretics, their use is not always safe. Therefore, the search for new highly efficient drug with antipyretic action is an urgent problem nowadays. RESEARCH GOAL - was pharmacological antipyretics screening among first synthesized derivatives of 1,2,4-triazoles. MATERIALS AND METHODS of research. The experimental fever reproduced on white nonlinear rats by administering 2,4-dinitrophenol (2,4-DNP (disconnector of the oxidative phosphorylation at a dose of 20 mg / kg. Investigated substances were injected through 0.5 hours (T 0,5 after administration of 2,4-DNP, rectal body temperature for 1 hour (T1 was fixed. Initial rectal temperature (T0 recorded to intra-abdominal injection 2.4-DNF. Acetylsalicylic acid was used as a comparison reference drug at a dose of 100 mg / kg. The results were processed with modern statistical methods of analysis on a personal computer using standard software package Microsoft Office 2010 (Microsoft Excel and «STATISTICA ® for Windows 6.0». We used 3 levels of statistical significance of differences in outcomes research - p <0.05, p <0.01, and P <0.001. RESULTS AND DISCUSSION. A new antipyretics were identified with activity not less than in the standard for comparison - acetylsalicylic acid. Intraabdominal injection of 2,4-DNF in 0.5 hour caused a fever in rat in average from 37.480 to 38.580 Co (Δ 1,10 C. Most significantly retarded the body temperature in animals compound number 76 (ΔT 1,230 C, p <0.01, 86 (ΔT 1,140 C, p <0.001, 85 (ΔT 1,330 C, p <0.01, 87 (ΔT 1,010 S , p <0.01, it’s action were somewhat
NT2 derived neuronal and astrocytic network signalling.
Directory of Open Access Journals (Sweden)
Eric J Hill
Full Text Available A major focus of stem cell research is the generation of neurons that may then be implanted to treat neurodegenerative diseases. However, a picture is emerging where astrocytes are partners to neurons in sustaining and modulating brain function. We therefore investigated the functional properties of NT2 derived astrocytes and neurons using electrophysiological and calcium imaging approaches. NT2 neurons (NT2Ns expressed sodium dependent action potentials, as well as responses to depolarisation and the neurotransmitter glutamate. NT2Ns exhibited spontaneous and coordinated calcium elevations in clusters and in extended processes, indicating local and long distance signalling. Tetrodotoxin sensitive network activity could also be evoked by electrical stimulation. Similarly, NT2 astrocytes (NT2As exhibited morphology and functional properties consistent with this glial cell type. NT2As responded to neuronal activity and to exogenously applied neurotransmitters with calcium elevations, and in contrast to neurons, also exhibited spontaneous rhythmic calcium oscillations. NT2As also generated propagating calcium waves that were gap junction and purinergic signalling dependent. Our results show that NT2 derived astrocytes exhibit appropriate functionality and that NT2N networks interact with NT2A networks in co-culture. These findings underline the utility of such cultures to investigate human brain cell type signalling under controlled conditions. Furthermore, since stem cell derived neuron function and survival is of great importance therapeutically, our findings suggest that the presence of complementary astrocytes may be valuable in supporting stem cell derived neuronal networks. Indeed, this also supports the intriguing possibility of selective therapeutic replacement of astrocytes in diseases where these cells are either lost or lose functionality.
Acute toxicity of 5-(furan-2-yl, 2-metylfuran-3-yl-4-amino-1,2,4-triazole-3-thiol alkyl derivatives
Directory of Open Access Journals (Sweden)
D. M. Danilchenko
2017-09-01
Full Text Available The purpose of our work was the further exploration of the new 5-(furan-2-yl, 2-metylfuran-3-yl-4-amino-1,2,4-triazole-3-thiol alkyl derivatives’ acute toxicity, setting some patterns of alkyl substituents influence by the Sulfur atom on the acute toxicity. Research materials and methods. In this study we used first time synthesized 5-(furan-2-yl, 2-metylfuran-3-yl-4-amino-4H-1,2,4-triazole-3-thione derivatives. Acute toxicity was conducted on white rats weighing 160–250 g, which were injected once intraperitoneally with the investigated substances. The rats were received from the nursery of the Pharmacology and Toxicology Institute of Ukraine Medical Sciences Academy. The animals were kept on a standard diet with natural light mode "day-night". Results and their discussion. After the acute toxicity studies in a group of 5-(furan-2-yl, 2-metylfuran-3-yl-4-amino-4H-1,2,4-triazole 3-alkyl derivatives it was found that among all studied structures the most toxic was 2e, LD50 of which was 263 mg/kg, and the least toxic compound was 2a, LD50 of which was 1570 mg/kg, that belongs to the V toxicity class. After comparing the acute toxicity of well-known antimycotic agent fluconazole with the studied compounds it can be argued that most compounds are less toxic than the comparison drug fluconazole with the index of LD50 ˃320 mg/kg. It was found that the transition in a group from butyl to decyl, octyl, ventyl, propyl, nonyl and heptyl substituents in the molecule of 3-alkylthio 5-(furan-2-yl-4-amino-4H-1,2,4-triazole is accompanied by the toxicity increasing. Speaking about the 5-(2-metylfuran-3-yl-4-amino-4H-1,2,4-triazole 3-alkylthio derivatives we can find that this dependence is observed in a number from propyl, pentyl, nonil, butyl, heksyl, octyl and heptyl hydrocarbon chains. Conclusions. The investigated 3-alkylthio 5-(furan-2-yl, 2-metylfuran-3-yl-4-amino-4H-1,2,4-triazole derivatives belong to the IV-V toxicity class. The toxicity of 5
Synthesis of a radioiodinated antiestrogen glucuronide compound (TAM-G)
International Nuclear Information System (INIS)
Fazilet Zumrut Biber Muftuler; Perihan Unak; Cigdem Ichedef; Ilknur Demir
2011-01-01
Tamoxifen [TAM; ([Z]-2-[4-(1,2-diphenyl-1-di-butenyl)-phenoxy]-N,N-dimethylethanamine) has been used as an antiestrogen drug for treatment and prevention of human breast cancer. The aim of this study is conjugation of hydrophilic glucuronic acid to the starting substance TAM and labeling with 131 I using iodogen as oxidizing agent. The reactions are completed in three steps, including enzymatic reaction, with the following sub-steps; preparation of microsomal fraction from rat liver and subsequent purification of UDP-glucuronyl transferase (UDPGT), estimation of protein amount in microsomal samples and glucuronidation reaction. Synthesized glucuronide derivative (TAM-G) was purified using high performance liquid chromatography (HPLC). Mass spectroscopy of cold standard showed that the labeling most probably occurs in ortho position to the aromatic ring containing the ether group of TAM-G as expected. Radiochemical yield of the 131 I labeled TAM-G ([ 131 I]TAM-G) is determined by using Thin Layer Radio Chromatography (TLRC). The radiopharmaceutical potential of [ 131 I]TAM-G is examined by biodistribution studies that is run on normal female Albino Wistar rats. According to biodistribution results 131 I labeled TAM-G may be proposed as a new antiestrogen glucuronide imaging agent for breast and uterus. Electronic supplementary material. The online version of this article (doi:10.1007/s10967-010-0932-7) contains supplementary material, which is available to authorized users. (author)
Health physics during work on the G. 2 and G. 3 reactor exchanges
International Nuclear Information System (INIS)
Rodier, J.; Chassany, J.; Guillermin, P.
1965-01-01
During this work and its preparation, which took place first at G. 2 and then at G. 3 over a period of 11 months, 15000 measurement results were obtained. Their analysis, together with a consideration of the organisation on the site and of the conclusions drawn from the experiment, shows the various factors which determine the importance of the radio-active dangers. (authors) [fr
Ramadhaningtyas, Dillani Putri; Aryana, Nurhani; Aristiawan, Yosi; Styarini, Dyah
2017-11-01
The optimization of instrument condition and chromatographic separation for analysis of aflatoxin B1, B2, G1 and G2 using liquid chromatography tandem with mass spectrometer detector was conducted in the aim to provide more accurate and reliable analysis results. The aflatoxin known to be serious threat for human health as it is classified as the carcinogenic compounds. The aflatoxin B1, B2, G1 and G2 were selected due to its extensive contamination in various agricultural commodities. The best chromatographic separation was obtained using C-18 column with gradient elution of solvent 5 mM ammonium acetate and 0.1% formic acid in methanol at 7 minutes runtime analysis. The linearity of the detector showed satisfied results as the coefficient determination found to be 0.9994, 0.9996, 0.9998 and 0.9987 for aflatoxin B1, G1, B2, and G2 respectively in the range concentration from 1 to 20 ng/g. The quantifier ion selected for the aflatoxin B1, B2, G1 and G2 was m/z 285.1, 259, 243 and 313 respectively. The instrument precision at these quantifier ions also showed satisfied result with %RSD was around 3.4 to 6.8%. The optimized method present in this study can be used for further sample analysis.
Jada, S R; Matthews, C; Saad, M S; Hamzah, A S; Lajis, N H; Stevens, M F G; Stanslas, J
2008-01-01
Background and purpose: Andrographolide, the major phytoconstituent of Andrographis paniculata, was previously shown by us to have activity against breast cancer. This led to synthesis of new andrographolide analogues to find compounds with better activity than the parent compound. Selected benzylidene derivatives were investigated for their mechanisms of action by studying their effects on the cell cycle progression and cell death. Experimental approach: Microculture tetrazolium, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) and sulphorhodamine B (SRB) assays were utilized in assessing the in vitro growth inhibition and cytotoxicity of compounds. Flow cytometry was used to analyse the cell cycle distribution of control and treated cells. CDK1 and CDK4 levels were determined by western blotting. Apoptotic cell death was assessed by fluorescence microscopy and flow cytometry. Key results: Compounds, in nanomolar to micromolar concentrations, exhibited growth inhibition and cytotoxicity in MCF-7 (breast) and HCT-116 (colon) cancer cells. In the NCI screen, 3,19-(2-bromobenzylidene) andrographolide (SRJ09) and 3,19-(3-chloro-4-fluorobenzylidene) andrographolide (SRJ23) showed greater cytotoxic potency and selectivity than andrographolide. SRJ09 and SRJ23 induced G1 arrest and apoptosis in MCF-7 and HCT-116 cells, respectively. SRJ09 downregulated CDK4 but not CDK1 level in MCF-7 cells. Apoptosis induced by SRJ09 and SRJ23 in HCT-116 cells was confirmed by annexin V-FITC/PI flow cytometry analysis. Conclusion and implications: The new benzylidene derivatives of andrographolide are potential anticancer agents. SRJ09 emerged as the lead compound in this study, exhibiting anticancer activity by downregulating CDK4 to promote a G1 phase cell cycle arrest, coupled with induction of apoptosis. PMID:18806812
Experimental and computational thermochemistry of 1,4-benzodioxan and its 2-R derivatives
International Nuclear Information System (INIS)
Matos, M. Agostinha R.; Sousa, Clara C.S.; Morais, Victor M.F.
2008-01-01
The standard molar energies of combustion, at T = 298.15 K, of crystalline 1,4-benzodioxan-2-carboxylic acid and 1,4-benzodioxan-2-hydroxymethyl were measured by static bomb calorimetry in an oxygen atmosphere. The standard molar enthalpies of sublimation, at T = 298.15 K, were obtained by Calvet microcalorimetry. These values were used to derive the standard molar enthalpies of formation of the compounds in the gas phase at T = 298.15 K: 1,4-benzodioxan-2-carboxylic acid -(547.7 ± 3.0) kJ . mol -1 and 1,4-benzodioxan-2-hydroxymethyl -(374.2 ± 2.3) kJ . mol -1 . In addition, density functional theory calculations using the B3LYP hybrid exchange-correlation energy functional with extended basis sets, 6-311G** and cc-pVTZ, have been performed for the compounds studied. We have also tested two more accurate computational procedures involving multiple levels of electron structure theory in order to get reliable estimates of the thermochemical parameters of the compounds studied. The agreement between experiment and theory gives confidence to estimate the enthalpies of formation of other 2-R derivatives of 1,4-benzodioxan (R = -CH 2 COOH, -OH, -COCH 3 , -CHO, -CH 3 , -CN, and -NO 2 )
Directory of Open Access Journals (Sweden)
Belén Zarranz
2006-09-01
Full Text Available The in vitro antiplasmodial activity of some 3-trifluoromethyl-2-carbonylquinoxaline di-N-oxide derivatives is reported. The evaluation was performed on cultures of FcB1 strain (chloroquine-resistant of P. falciparum and the most interesting compounds were then evaluated on MCF7 tumor cells in order to evaluate an index of selectivity. The 7-methyl (2b, 4b, 5b, 6b and nonsubstituted (3c, 4c, 5c quinoxaline 1,4-dioxide derivatives presented the best level of activity.Neste artigo descreve-se a atividade anti-Plasmodium falciparum de derivados 3-trifluorometil-2-carbonilquinoxalinas di-N-óxidos (2a-6g. A avaliação das propriedades farmacológicas dos derivados 2a-6g foi realizada em modelo in vitro de inibição de cepas P. falciparum FcB1 (cloroquina resistente em cultura celular, e sobre culturas de células tumorais MCF7, com a finalidade de estabelecer o índice de seletividade para os compostos mais promissores. Os derivados 7-metil (2b, 4b, 5b, 6b e não-substituído (3c, 4c, 5c apresentaram o melhor perfil de atividade.
A novel chemo-enzymatic synthesis of hydrophilic phytosterol derivatives.
He, Wen-Sen; Hu, Di; Wang, Yu; Chen, Xue-Yan; Jia, Cheng-Sheng; Ma, Hai-Le; Feng, Biao
2016-02-01
In this study, a novel method was developed for chemo-enzymatic synthesis of hydrophilic phytosterol derivatives, phytosteryl polyethylene glycol succinate (PPGS), through an intermediate phytosteryl hemisuccinate (PSHS), which was first chemically prepared and subsequently coupled with polyethylene glycol (PEG) through lipase-catalyzed esterification. The chemical structure of intermediate and goal product were finally confirmed to be PSHS and PPGS by FT-IR, MS and NMR, suggesting that hydrophilic phytosterol derivatives were successfully synthesized. The effects of various parameters on the conversion of PSHS to PPGS were investigated and the highest conversion (>78%) was obtained under the selected conditions: 75 mmol/L PSHS, 1:2M ratio of PSHS to PEG, 50 g/L Novozym 435, 120 g/L 3 Å molecular sieves in tert-butanol, 55 °C, 96 h and 200 rpm. The solubility of phytosterols in water was significantly improved by coupling with PEG, facilitating the incorporation into a variety of foods containing water. Copyright © 2015 Elsevier Ltd. All rights reserved.
Jordan and left derivations on locally C*-algebras
International Nuclear Information System (INIS)
Shahzad, Naseer
2002-07-01
We show that left derivations as well as Jordan derivations on locally G*-algebras are always continuous. We also obtain some noncommutative extensions of the classical Singer-Wermer theorem for locally C*-algebras: (1) Every left derivation D on a locally (7*-algebra A is identically zero. (2) Every Jordan derivation D on a locally C*-algebra A which satisfies [D(x), x]D(x]=0 for all x in A, is identically zero. (author)
KhorshidAhmad, Tina; Acosta, Crystal; Cortes, Claudia; Lakowski, Ted M; Gangadaran, Surendiran; Namaka, Michael
2016-03-01
Multiple sclerosis (MS) is a chronic progressive, neurological disease characterized by the targeted immune system-mediated destruction of central nervous system (CNS) myelin. Autoreactive CD4+ T helper cells have a key role in orchestrating MS-induced myelin damage. Once activated, circulating Th1-cells secrete a variety of inflammatory cytokines that foster the breakdown of blood-brain barrier (BBB) eventually infiltrating into the CNS. Inside the CNS, they become reactivated upon exposure to the myelin structural proteins and continue to produce inflammatory cytokines such as tumor necrosis factor α (TNFα) that leads to direct activation of antibodies and macrophages that are involved in the phagocytosis of myelin. Proliferating oligodendrocyte precursors (OPs) migrating to the lesion sites are capable of acute remyelination but unable to completely repair or restore the immune system-mediated myelin damage. This results in various permanent clinical neurological disabilities such as cognitive dysfunction, fatigue, bowel/bladder abnormalities, and neuropathic pain. At present, there is no cure for MS. Recent remyelination and/or myelin repair strategies have focused on the role of the neurotrophin brain-derived neurotrophic factor (BDNF) and its upstream transcriptional repressor methyl CpG binding protein (MeCP2). Research in the field of epigenetic therapeutics involving histone deacetylase (HDAC) inhibitors and lysine acetyl transferase (KAT) inhibitors is being explored to repress the detrimental effects of MeCP2. This review will address the role of MeCP2 and BDNF in remyelination and/or myelin repair and the potential of HDAC and KAT inhibitors as novel therapeutic interventions for MS.
Du, Juan; Yu, Yifeng; Lv, Haijun; Chen, Chunlin; Zhang, Jian; Chen, Aibing
2018-01-01
Carbon materials have attracted great attention in CO2 capture and energy storage due to their excellent characteristics such as tunable pore structure, modulated surface properties and superior bulk conductivities, etc. Biomass, provided by nature with non-toxic, widespread, abundant, and sustainable advantages, is considered to be a very promising precursor of carbons for the view of economic, environmental, and societal issues. However, the preparation of high-performance biomass-derived carbons is still a big challenge because of the multistep process for their synthesis and subsequent activation. Herein, hierarchically porous structured carbon materials have been prepared by directly carbonizing dried cauliflowers without any addition of agents and activation process, featuring with large specific surface area, hierarchically porous structure and improved pore volume, as well as suitable nitrogen content. Being used as a solid-state CO2 adsorbent, the obtained product exhibited a high CO2 adsorption capacity of 3.1 mmol g-1 under 1 bar and 25 °C and a remarkable reusability of 96.7% retention after 20 adsorption/regeneration cycles. Our study reveals that choosing a good biomass source was significant as the unique structure of precursor endows the carbonized product with abundant pores without the need of any post-treatment. Used as an electrode material in electrochemical capacitor, the non-activated porous carbon displayed a fairly high specific capacitance of 228.9 F g-1 at 0.5 A g-1 and an outstanding stability of 99.2% retention after 5000 cycles at 5 A g-1. [Figure not available: see fulltext.
Ye, Fei; Li, Houfen; Yu, Hongtao; Chen, Shuo; Quan, Xie
2017-12-01
Protons tend to bond strongly with unsaturated-coordinate S element located at the edge of nano-MoS2 and are consequently reduced to H2. Therefore, increasing the active S atoms quantity will be a feasible approach to enhance hydrogen evolution. Herein we developed a porous TiO2 derived from metal organic frameworks (MOFs) as scaffold to restrict the growth and inhibit the aggregation of MoS2 nanosheets. As a result, the thickness of the prepared MoS2 nanosheets was less than 3 nm (1-4 layers), with more edges and active S atoms being exposed. This few-layer MoS2-porous TiO2 exhibits a H2 evolution rate of 897.5 μmol h-1 g-1, which is nearly twice as much as free-stand MoS2 nanosheets and twenty times more than physical mixture of MoS2 with porous TiO2. The high performance is attributed to that more active edge sites in few-layer MoS2-porous TiO2 are exposed than pure MoS2. This work provides a new method to construct MOFs derived porous structures for controlling MoS2 to expose active sites for HER.
Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.
2012-01-01
The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427
Directory of Open Access Journals (Sweden)
Xianwei Zhu
2014-01-01
Full Text Available We designed a novel molecular biosensing system for the detection of biotin, an important vitamin by the combination of fluorescent unnatural streptavidin with a commercialized biotin-(AC52-hydrazide. A fluorescent unnatural amino acid, BODIPY-FL-aminophenylalanine (BFLAF, was position-specifically incorporated into Trp120 of streptavidin by four-base codon method. Fluorescence of the Trp120BFLAF mutant streptavidin was enhanced by the addition of biotin-(AC52-hydrazide with the concentration dependent, whereas fluorescence enhancement was not observed at all by the addition of natural biotin. It was considered that the spacer tail of biotin-(AC52-hydrazide may disturb the fluorescence quenching of the Trp120BFLAF by Trp79 and Trp108 of the neighbor subunit. Therefore, biotin sensing was carried out by the competitive binding reaction of biotin-(AC52-hydrazide and natural biotin to the fluorescent mutant streptavidin. The fluorescence intensity decreased by increasing free biotin concentration. The result suggested that molecular biosensor for small ligand could be successfully designed by the pair of fluorescent mutant binding protein and ligand analogue.
Untapped Capabilities of 2G in Nigeria Telecom Space
Directory of Open Access Journals (Sweden)
Seyi Stephen OLOKEDE
2009-07-01
Full Text Available The advent of 3G wireless technologies is obviously relegating the 2G network, gradually pushing them into oblivion. The shortcomings of 2G are the platform that brought about the development of 3G but this does not justify it to be scrapped. This paper will analyze these shortcomings and try to bring out the potentials of the 2G system which can still be garnered. This analysis will be based on the technology used by the system, marketing and the consumers.
Directory of Open Access Journals (Sweden)
Annalisa LoGerfo
2014-01-01
Full Text Available Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS. The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2 pathways. We genotyped, in a cohort of ALS patients (n=145 and healthy controls (n=168, three SNPs in Nrf2 gene promoter: −653 A/G, −651 G/A, and −617 C/A and evaluated, in a subset (n=73 of patients, advanced oxidation protein products (AOPP, iron-reducing ability of plasma (FRAP, and plasma thiols (-SH as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P<0.05 and decreased levels of FRAP (P<0.001 have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the −653 A/G, −651 G/A, and −617 C/A Nrf2 SNPs in ALS patients.
Strong commutativity preserving generalized derivations on ...
African Journals Online (AJOL)
Let R be a non-commutative prime ring of characteristic different from 2, with right Utumi quotient ring U and extended centroid C and let F and G be generalized derivations of R such that F(x)G(y)-F(y)G(x) = [x; y], for all x; y ∈ S, where S is a subset of R. Here we will discuss the following cases: (a) S = [R;R];. b) S = L, where ...
Anti-Podocalyxin Monoclonal Antibody 47-mG2a Detects Lung Cancers by Immunohistochemistry.
Yamada, Shinji; Itai, Shunsuke; Kaneko, Mika K; Kato, Yukinari
2018-04-01
Lung cancer is one of the leading causes of cancer-related deaths in the world. Regardless of the advances in lung cancer treatments, the prognosis is still poor. Podocalyxin (PODXL) is a highly glycosylated type I transmembrane protein that is expressed in normal tissues, including the heart, pancreas, and breast. It is also found and used as a diagnostic marker in many cancers, such as renal, brain, breast, oral, and lung cancers. We previously developed specific and sensitive anti-PODXL monoclonal antibodies, PcMab-47 (mouse IgG 1 , kappa) and its mouse IgG 2a -type (47-mG 2a ), both of which were suitable for immunohistochemical analyses of oral cancers. In this study, we investigated the utility of PcMab-47 and 47-mG 2a for the immunohistochemical analyses of lung cancers. PcMab-47 stained 51/70 (72.9%) cases of lung cancer, whereas 47-mG 2a stained 59/70 (84.3%) cases, indicating that the latter antibody is more sensitive and is useful for detecting PODXL in lung cancers.
International Nuclear Information System (INIS)
Martins, Estefania M.N.; Andrade, Antero S.R.; Reis, Bernardo S.; Goes, Alfredo M.
2007-01-01
Paracoccidioides brasiliensis is the fungus agent of paracoccidioidomycosis, a deep-seated systemic infection of humans. Up to the moment no vaccine has still been reported. The potential of gamma radiation for pathogens attenuation and vaccine development was explored in this work. In our laboratory we developed radioattenuated yeast cells of P. brasiliensis and the aim of the present work was to evaluate the antibody production dynamics in mice immunized with this cells. Were analyzed the IgG antibodies titers as well as the type of response by analyzing the IgG1 and IgG2a antibody pattern in the course of infection. The mice were divided in two groups that were immunized one time and two times respectively. The mice infected with the virulent P. brasiliensis showed a high level of antibody production while the infection with the radioattenuated yeast did not significantly change the antibody level. The level of IgG raised in both immunized groups after the challenge. In the group immunized one time was not observed a significant difference between the levels of both subclasses when compared with the control. After the challenge of the group immunized two times the IgG2a levels increased significantly when analyzed 90 days post challenge. We concluded that a pattern related to the disease control was apparent in the group submitted to two immunizations. The mice had not developed a totally polarized pattern of TH1/TH2 response but a trend to a TH1 response was evident. (author)
Energy Technology Data Exchange (ETDEWEB)
Martins, Estefania M.N.; Andrade, Antero S.R. [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)]. E-mail: estefaniabio@yahoo.com.br; antero@cdtn.br; Reis, Bernardo S.; Goes, Alfredo M. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Bioquimica e Imunologia]. E-mail: brsgarbi@mono.icb.ufmg.br; goes@mono.icb.ufmg.br
2007-07-01
Paracoccidioides brasiliensis is the fungus agent of paracoccidioidomycosis, a deep-seated systemic infection of humans. Up to the moment no vaccine has still been reported. The potential of gamma radiation for pathogens attenuation and vaccine development was explored in this work. In our laboratory we developed radioattenuated yeast cells of P. brasiliensis and the aim of the present work was to evaluate the antibody production dynamics in mice immunized with this cells. Were analyzed the IgG antibodies titers as well as the type of response by analyzing the IgG1 and IgG2a antibody pattern in the course of infection. The mice were divided in two groups that were immunized one time and two times respectively. The mice infected with the virulent P. brasiliensis showed a high level of antibody production while the infection with the radioattenuated yeast did not significantly change the antibody level. The level of IgG raised in both immunized groups after the challenge. In the group immunized one time was not observed a significant difference between the levels of both subclasses when compared with the control. After the challenge of the group immunized two times the IgG2a levels increased significantly when analyzed 90 days post challenge. We concluded that a pattern related to the disease control was apparent in the group submitted to two immunizations. The mice had not developed a totally polarized pattern of TH1/TH2 response but a trend to a TH1 response was evident. (author)
Sayılan Özgün, Gülben; Özgün, Eray; Tabakçıoğlu, Kıymet; Süer Gökmen, Selma; Eskiocak, Sevgi; Çakır, Erol
2017-12-01
Apolipoprotein A-1, paraoxonase-1 and paraoxonase-3 are antioxidant and anti-atherosclerotic structural high-density lipoprotein proteins that are mainly synthesized by the liver. No study has ever been performed to specifically examine the effects of caffeine on paraoxonase enzymes and on liver apolipoprotein A-1 protein levels. To investigate the dose-dependent effects of caffeine on liver apolipoprotein A-1, paraoxonase-1 and paraoxonase-3 protein levels. In vitro experimental study. HepG2 cells were incubated with 0 (control), 10, 50 and 200 μM of caffeine for 24 hours. Cell viability was evaluated by 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide assay. Apolipoprotein A-1, paraoxonase-1 and paraoxonase-3 protein levels were measured by western blotting. We observed a significant increase on apolipoprotein A-1 and paraoxonase-1 protein levels in the cells incubated with 50 µM of caffeine and a significant increase on paraoxonase-1 protein level in the cells incubated with 200 µM of caffeine. Our study showed that caffeine does not change paraoxonase-3 protein level, but the higher doses used in our study do cause an increase in both apolipoprotein A-1 and paraoxonase-1 protein levels in liver cells.
Energy Technology Data Exchange (ETDEWEB)
Anthony, P.L.; Arnold, R.G.; Averett, T.; Band, H.R.; Benmouna, N.; Boeglin, W.; Borel, H.; Bosted, P.E.; Bueltmann, S.L.; Court, G.R.; Crabb, D.; Day, D.; Decowski, P.; DePietro, P.; Egiyan, H.; Erbacher, R.; Erickson, R.; Fatemi, R.; Frlez, E.; Griffioen, K.A.; Harris, C.; Hughes, E.W.; Hyde-Wright, C.; Igo, G.; Johnson, J.; King, P.; Kramer, K.; Kuhn, S.E.; Lawrence, D.; Liang, Y.; Lindgren, R.; Lombard-Nelsen, R.M.; McKee, P.; McNulty, D.E.; Meyer, W.; Mitchell, G.S.; Mitchell, J.; Olson, M.; Penttila, S.; Peterson, G.A.; Pitthan, R.; Pocanic, D.; Prepost, R.; Prescott, C.; Raue, B.A.; Reyna, D.; Ryan, P.; Rochester, L.S.; Rock, S.; Rondon-Aramayo, O.; Sabatie, F.; Smith, T.; Sorrell, L.; Lorant, S.St.; Szalata, Z.; Terrien, Y.; Tobias, A.; Toole, T.; Trentalange, S.; Wesselmann, F.R.; Wright, T.R.; Zeier, M.; Zhu, H.; Zihlmann, B
2003-01-30
We have measured the spin structure functions g{sub 2}{sup p} and g{sub 2}{sup d} and the virtual photon asymmetries A{sub 2}{sup p} and A{sub 2}{sup d} over the kinematic range 0.02{<=}x{<=}0.8 and 0.7{<=}Q{sup 2}{<=}20 GeV{sup 2} by scattering 29.1 and 32.3 GeV longitudinally polarized electrons from transversely polarized NH{sub 3} and {sup 6}LiD targets. Our measured g{sub 2} approximately follows the twist-2 Wandzura-Wilczek calculation. The twist-3 reduced matrix elements d{sub 2}{sup p} and d{sub 2}{sup n} are less than two standard deviations from zero. The data are inconsistent with the Burkhardt-Cottingham sum rule if there is no pathological behavior as x{yields}0. The Efremov-Leader-Teryaev integral is consistent with zero within our measured kinematic range. The absolute value of A{sub 2} is significantly smaller than the A{sub 2}<{radical}(R(1+A{sub 1})/2) limit.
Meta-Analysis of TNF 308 G/A Polymorphism and Type 2 Diabetes Mellitus
Feng, Ren-Nan; Zhao, Chen; Sun, Chang-Hao; Li, Ying
2011-01-01
BACKGROUND AND OBJECTIVES: Many investigations have focused the association between TNF 308 G/A polymorphism and risk for type 2 diabetes mellitus (T2DM). However, the sample sizes of most of the studies were small. The aim of this study is to evaluate the precise association between this variant and risk for T2DM in a large-scale meta-analysis. METHODS: All publications were searched on the association between TNF 308 G/A polymorphism and T2DM. The key words were as follows: diabetes, tumor ...
A new derivation of Dirac's magnetic monopole strength
International Nuclear Information System (INIS)
Panat, P V
2003-01-01
A new derivation of the strength of Dirac's magnetic monopole is presented which does not require an explicit form of the magnetic induction in terms of g, the magnetic pole strength. The derivation essentially uses a modification of Faraday's law of induction and quantization of angular momentum
Meta-analysis of TNF 308 G/A polymorphism and type 2 diabetes mellitus.
Directory of Open Access Journals (Sweden)
Ren-Nan Feng
Full Text Available BACKGROUND AND OBJECTIVES: Many investigations have focused the association between TNF 308 G/A polymorphism and risk for type 2 diabetes mellitus (T2DM. However, the sample sizes of most of the studies were small. The aim of this study is to evaluate the precise association between this variant and risk for T2DM in a large-scale meta-analysis. METHODS: All publications were searched on the association between TNF 308 G/A polymorphism and T2DM. The key words were as follows: diabetes, tumor necrosis factor and polymorphism/variant/genotype. This meta-analysis was assessed by Review manager 5.0. RESULTS: There were 18 studies identified. The odds ratios (ORs and 95% confidence intervals (CI for GA+AA versus GG genotype of TNF 308 G/A polymorphism were 1.03 (0.95-1.12, 1.03 (0.94-1.13 and 1.03 (0.78-1.36 in overall, Caucasian and Asian populations, respectively. The sensitivity analysis further strengthened the validity of this association. No publication bias or heterogeneity was observed in this study. CONCLUSION: In summary, there was no significant association detected between the TNF 308 G/A polymorphism and risk for T2DM.
Recognition of the group G2(5 by the prime graph
Directory of Open Access Journals (Sweden)
Parivash Nosratpour
2014-05-01
Full Text Available Let $G$ be a finite group. The prime graph of $G$ is a graph $\\Gamma(G$ with vertex set $\\pi(G$, the set of all prime divisors of $|G|$, and two distinct vertices $p$ and $q$ are adjacent by an edge if $G$ has an element of order $pq$. In this paper we prove that if $\\Gamma(G=\\Gamma(G_2(5$, then $G$ has a normal subgroup $N$ such that $\\pi(N\\subseteq\\{2,3,5\\}$ and $G/N\\cong G_2(5$.
A high-performance carbon derived from polyaniline for supercapacitors
Energy Technology Data Exchange (ETDEWEB)
Yan, Jun [Harbin Engineering University, Harbin (China). Key Laboratory of Superlight Materials and Surface Technology; College of Automation, Harbin Engineering University, Harbin (China); Wei, Tong; Fan, Zhuangjun; Li, Tianyou [Harbin Engineering University, Harbin (China). Key Laboratory of Superlight Materials and Surface Technology; Qiao, Wenming [Harbin Engineering University, Harbin (China). Coll. of Material Science and Chemical Engineering; Zhang, Lijun; Zhao, Qiankun [College of Automation, Harbin Engineering University, Harbin (China)
2010-10-15
Activated carbon derived from rod-shaped polyaniline (the diameter of 170 nm) was synthesized by carbonization and subsequent activation with KOH. The obtained activated carbon exhibits a high specific capacitance (455 F g{sup -1}) and remarkable rate capability due to its high specific surface area (1976 m{sup 2}g{sup -1}), narrow pore size distribution (< 3 nm) as well as short diffusion length. It is indicated that the promising synthetic method used in this work can pave the way for designing new carbon based materials from different polymers for high-performance energy applications. (author)
van de Geer, A; Gazendam, R P; Tool, A T J; van Hamme, J L; de Korte, D; van den Berg, T K; Zeerleder, S S; Kuijpers, T W
2017-02-01
Buffy coat-derived granulocytes have been described as an alternative to the apheresis product from donors pretreated with dexamethasone and granulocyte colony-stimulating factor (G-CSF). The latter is - dependent on the local and national settings - obtained following a demanding and time-consuming procedure, which is undesirable in critically ill septic patients. In contrast, buffy coat-derived products have a large volume and are often heavily contaminated with red cells and platelets. We developed a new pooled buffy coat-derived product with high purity and small volume, and performed a comprehensive functional characterization of these granulocytes. We pooled ten buffy coats following the production of platelet concentrates. Saline 0·9% was added to decrease the viscosity and the product was split into plasma, red cells and a 'super' buffy coat. Functional data of the granulocytes were compared to those obtained with granulocytes from healthy controls and G-CSF/dexamethasone-pretreated donors. Buffy coat-derived granulocytes showed adhesion, chemotaxis, reactive oxygen species production, degranulation, NETosis and in vitro killing of Staphylococcus aureus, Escherichia coli and Aspergillus species comparable to control and G-CSF/dexamethasone-derived granulocytes. Candida killing was superior compared to G-CSF/dexamethasone-derived granulocytes. Immunophenotyping was normal; especially no signs of activation in the buffy coat-derived granulocytes were seen. Viability was reduced. Buffy coats are readily available in the regular blood production process and would take away the concerns around the apheresis product. The product described appears a promising alternative for transfusion purposes. © 2017 International Society of Blood Transfusion.
Directory of Open Access Journals (Sweden)
Sheyu Li
2016-11-01
Full Text Available Background/Aims: The aim of this study was to assess the association between circulating cell-derived microparticles (MPs and type 2 diabetes mellitus (T2DM. Methods: A literature search was performed systematically in PubMed and Embase to identify available case-control or cross-sectional studies that compared different types of cell-derived MPs in patients with T2DM and non-diabetic controls. Pooled standardized mean differences (SMDs of each MP type were pooled using meta-analysis. Results: Forty-eight studies involving 2,460 patients with T2DM and 1,880 non-diabetic controls were included for systematic review and 34 of which were included for quantitative study by meta-analysis. In the overall analysis, the levels of circulating total MPs (TMPs, platelet-derived MPs (PMPs, monocyte-derived MPs (MMPs and endothelium-derived MPs (EMPs were significantly higher in T2DM patients than those in controls (TMPs: SMD, 0.64; 95%CI, 0.12∼1.15; P=0.02; PMPs: SMD, 1.19; 95%CI, 0.88∼1.50; P Conclusions: The counts of TMPs, PMPs, MMPs and EMPs elevated in patients with T2DM. And cell-derived MPs may play a role in the pathogenesis of T2DM.
Li, Zhe; Lech, Christopher Jacques; Phan, Anh Tuân
2014-01-01
G-quadruplex-forming oligonucleotides containing modified nucleotide chemistries have demonstrated promising pharmaceutical potential. In this work, we systematically investigate the effects of sugar-modified guanosines on the structure and stability of a (4+0) parallel and a (3+1) hybrid G-quadruplex using over 60 modified sequences containing a single-position substitution of 2′-O-4′-C-methylene-guanosine (LNAG), 2′-deoxy-2′-fluoro-riboguanosine (FG) or 2′-deoxy-2′-fluoro-arabinoguanosine (FANAG). Our results are summarized in two parts: (I) Generally, LNAG substitutions into ‘anti’ position guanines within a guanine-tetrad lead to a more stable G-quadruplex, while substitutions into ‘syn’ positions disrupt the native G-quadruplex conformation. However, some interesting exceptions to this trend are observed. We discover that a LNAG modification upstream of a short propeller loop hinders G-quadruplex formation. (II) A single substitution of either FG or FANAG into a ‘syn’ position is powerful enough to perturb the (3+1) G-quadruplex. Substitution of either FG or FANAG into any ‘anti’ position is well tolerated in the two G-quadruplex scaffolds. FANAG substitutions to ‘anti’ positions are better tolerated than their FG counterparts. In both scaffolds, FANAG substitutions to the central tetrad layer are observed to be the most stabilizing. The observations reported herein on the effects of LNAG, FG and FANAG modifications on G-quadruplex structure and stability will enable the future design of pharmaceutically relevant oligonucleotides. PMID:24371274
Directory of Open Access Journals (Sweden)
Benedetta Maggio
2016-02-01
Full Text Available A FRET-based random screening assay was used to generate hit compounds as sortase A inhibitors that allowed us to identify ethyl 3-oxo-2-(2-phenylhydrazinylidenebutanoate as an example of a new class of sortase A inhibitors. Other analogues were generated by changing the ethoxycarbonyl function for a carboxy, cyano or amide group, or introducing substituents in the phenyl ring of the ester and acid derivatives. The most active derivative found was 3-oxo-2-(2-(3,4dichlorophenylhydrazinylidenebutanoic acid (2b, showing an IC50 value of 50 µM. For a preliminary assessment of their antivirulence properties the new derivatives were tested for their antibiofilm activity. The most active compound resulted 2a, which showed inhibition of about 60% against S. aureus ATCC 29213, S. aureus ATCC 25923, S. aureus ATCC 6538 and S. epidermidis RP62A at a screening concentration of 100 µM.
Kurogochi, Masaki; Mori, Masako; Osumi, Kenji; Tojino, Mami; Sugawara, Shu-Ichi; Takashima, Shou; Hirose, Yuriko; Tsukimura, Wataru; Mizuno, Mamoru; Amano, Junko; Matsuda, Akio; Tomita, Masahiro; Takayanagi, Atsushi; Shoda, Shin-Ichiro; Shirai, Takashi
2015-01-01
Many therapeutic antibodies have been developed, and IgG antibodies have been extensively generated in various cell expression systems. IgG antibodies contain N-glycans at the constant region of the heavy chain (Fc domain), and their N-glycosylation patterns differ during various processes or among cell expression systems. The Fc N-glycan can modulate the effector functions of IgG antibodies, such as antibody-dependent cellular cytotoxicity (ADCC) and complement dependent cytotoxicity (CDC). To control Fc N-glycans, we performed a rearrangement of Fc N-glycans from a heterogeneous N-glycosylation pattern to homogeneous N-glycans using chemoenzymatic approaches with two types of endo-β-N-acetyl glucosaminidases (ENG'ases), one that works as a hydrolase to cleave all heterogeneous N-glycans, another that is used as a glycosynthase to generate homogeneous N-glycans. As starting materials, we used an anti-Her2 antibody produced in transgenic silkworm cocoon, which consists of non-fucosylated pauci-mannose type (Man2-3GlcNAc2), high-mannose type (Man4-9GlcNAc2), and complex type (Man3GlcNAc3-4) N-glycans. As a result of the cleavage of several ENG'ases (endoS, endoM, endoD, endoH, and endoLL), the heterogeneous glycans on antibodies were fully transformed into homogeneous-GlcNAc by a combination of endoS, endoD, and endoLL. Next, the desired N-glycans (M3; Man3GlcNAc1, G0; GlcNAc2Man3GlcNAc1, G2; Gal2GlcNAc2Man3GlcNAc1, A2; NeuAc2Gal2GlcNAc2Man3GlcNAc1) were transferred from the corresponding oxazolines to the GlcNAc residue on the intact anti-Her2 antibody with an ENG'ase mutant (endoS-D233Q), and the glycoengineered anti-Her2 antibody was obtained. The binding assay of anti-Her2 antibody with homogenous N-glycans with FcγRIIIa-V158 showed that the glycoform influenced the affinity for FcγRIIIa-V158. In addition, the ADCC assay for the glycoengineered anti-Her2 antibody (mAb-M3, mAb-G0, mAb-G2, and mAb-A2) was performed using SKBR-3 and BT-474 as target cells, and
Directory of Open Access Journals (Sweden)
Masaki Kurogochi
Full Text Available Many therapeutic antibodies have been developed, and IgG antibodies have been extensively generated in various cell expression systems. IgG antibodies contain N-glycans at the constant region of the heavy chain (Fc domain, and their N-glycosylation patterns differ during various processes or among cell expression systems. The Fc N-glycan can modulate the effector functions of IgG antibodies, such as antibody-dependent cellular cytotoxicity (ADCC and complement dependent cytotoxicity (CDC. To control Fc N-glycans, we performed a rearrangement of Fc N-glycans from a heterogeneous N-glycosylation pattern to homogeneous N-glycans using chemoenzymatic approaches with two types of endo-β-N-acetyl glucosaminidases (ENG'ases, one that works as a hydrolase to cleave all heterogeneous N-glycans, another that is used as a glycosynthase to generate homogeneous N-glycans. As starting materials, we used an anti-Her2 antibody produced in transgenic silkworm cocoon, which consists of non-fucosylated pauci-mannose type (Man2-3GlcNAc2, high-mannose type (Man4-9GlcNAc2, and complex type (Man3GlcNAc3-4 N-glycans. As a result of the cleavage of several ENG'ases (endoS, endoM, endoD, endoH, and endoLL, the heterogeneous glycans on antibodies were fully transformed into homogeneous-GlcNAc by a combination of endoS, endoD, and endoLL. Next, the desired N-glycans (M3; Man3GlcNAc1, G0; GlcNAc2Man3GlcNAc1, G2; Gal2GlcNAc2Man3GlcNAc1, A2; NeuAc2Gal2GlcNAc2Man3GlcNAc1 were transferred from the corresponding oxazolines to the GlcNAc residue on the intact anti-Her2 antibody with an ENG'ase mutant (endoS-D233Q, and the glycoengineered anti-Her2 antibody was obtained. The binding assay of anti-Her2 antibody with homogenous N-glycans with FcγRIIIa-V158 showed that the glycoform influenced the affinity for FcγRIIIa-V158. In addition, the ADCC assay for the glycoengineered anti-Her2 antibody (mAb-M3, mAb-G0, mAb-G2, and mAb-A2 was performed using SKBR-3 and BT-474 as target
Holme, Daniel; Findlow, Helen; Sow, Samba O.; Idoko, Olubukola T.; Preziosi, Marie-Pierre; Carlone, George; Plikaytis, Brian D.; Borrow, Ray
2015-01-01
Background. A group A meningococcal conjugate vaccine, PsA-TT, was licensed in 2010 and was previously studied in a phase 2 clinical trial to evaluate its safety and immunogenicity in African children 12–23 months of age. Methods. Subjects received either PsA-TT; meningococcal group A, C, W, Y polysaccharide vaccine (PsACWY); or Haemophilus influenzae type b conjugate vaccine (Hib-TT). Forty weeks following primary vaccination, the 3 groups were further randomized to receive either PsA-TT, one-fifth dose of PsACWY, or Hib-TT. Group A–specific immunoglobulin G (IgG) subclass response was characterized using an enzyme-linked immunosorbent assay. Results. The predominant IgG subclass response, regardless of vaccine, was IgG1. One month following primary vaccination, the geometric mean concentrations (GMCs) of IgG1 and IgG2 in the PsA-TT group were 21.73 µg/mL and 6.27 µg/mL, whereas in the PsACWY group the mean GMCs were 2.01 µg/mL and 0.97 µg/mL, respectively (P Group A–specific IgG1 and IgG2 GMCs remained greater in the PsA-TT group than in the PsACWY group 40 weeks following primary vaccination (P vaccines. Conclusions. Vaccination of African children aged 12–24 months with either PsA-TT or PsACWY elicited a predominantly IgG1 response. The IgG1:IgG2 mean ratio decreased following successive vaccination with PsACWY, indicating a shift toward IgG2, suggestive of the T-cell–independent immune response commonly associated with polysaccharide antigens. Clinical Trials Registration. SRCTN78147026. PMID:26553689
Spitzer/IRAC observations of the variability of Sgr A* and the object G2 at 4.5 μm
Energy Technology Data Exchange (ETDEWEB)
Hora, J. L.; Ashby, M. L. N.; Fazio, G. G.; Smith, H. A.; Willner, S. P. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Witzel, G.; Becklin, E. E.; Ghez, A.; Meyer, L.; Morris, M. R. [University of California, Los Angeles, CA 90095 (United States); Carey, S.; Ingalls, J. [Spitzer Science Center, California Institute of Technology, Pasadena, CA 91125 (United States)
2014-10-01
We present the first detection from the Spitzer Space Telescope of 4.5 μm variability from Sgr A*, the emitting source associated with the Milky Way's central black hole. The >23 hr continuous light curve was obtained with the Infrared Array Camera (IRAC) instrument in 2013 December. The result characterizes the variability of Sgr A* prior to the closest approach of the tidally deformed G2 object, a putative infalling gas cloud that orbits close to Sgr A*. The high stellar density at the location of Sgr A* produces a background of ∼250 mJy at 4.5 μm in each pixel with a large pixel-to-pixel gradient, but the light curve for the highly variable Sgr A* source was successfully measured by modeling and removing the variations due to pointing wobble. The observed flux densities range from the noise level of ∼0.7 mJy rms in a 6.4 s measurement to ≳10 mJy. Emission was seen above the noise level ∼34% of the time. The light-curve characteristics, including the flux density distribution and structure function, are consistent with those previously derived at shorter infrared wavelengths. We see no evidence in the light curve for activity attributable to the G2 interaction at the observing epoch, ∼100 days before the expected G2 periapsis passage. The IRAC light curve is more than a factor of two longer than any previous infrared observation, improving constraints on the timescale of the break in the power spectral distribution of Sgr A* flux densities. The data favor the longer of the two previously published values for the timescale.
Raman spectra of iodine-derivatives of tyrosine and thyronine
International Nuclear Information System (INIS)
Loh, E.
1974-01-01
The Raman spectra of the iodine derivatives of tyrosine and thyronine in the form of compressed crystalline powders have been excited by 4880 A Argon laser on rotating samples at room temperature. The strong peaks in the low-frequency, -1 , region may be described by analogous vibrations of benzene as: I. the C-I out-of-plane bendings of E 1 sub(g) mode from 100 cm -1 to 180 cm -1 ; II. the C-I in-plane bendings of E 2 sub(g) and A 2 sub(g) mode from 190 cm -1 to 330 cm -1 and III. the C-I stretchings of E 2 sub(g) mode from 330 cm -1 to 400 cm -1 . In 3,3',5-triiodo-derivatives, the number of both the C-I in-plane bendings and C-I stretchings on the inner phenyl ring approximately doubles from thet of diiodo-derivatives. This doubling in number of peaks is presumably due to the modulation caused by the libration, which is associated with the C-I out-of-plane bending at position 3', of the outer phenyl ring
Possible Origin for Porphin Derivatives in Prebiotic Chemistry a Computational Study
Aylward, Nigel; Bofinger, Neville
2005-08-01
A set of chemical reactions is postulated to account for the formation of the macrocyclic porphin structure, basic to the pyrrole derivatives chlorophyll, protoporphyrin, heme and bilirubin, important in photosynthesis, respiration and digestion. A set of equations is given for the prebiotic synthesis of porphin derivatives from the simple molecules; cyanoacetylene, diacetylene, carbon monoxide and ammonia that have been detected in space. A number of isomers of hydrogenated porphin arise which may lose hydrogen to give ultimately porphin and its dehydrogenated derivative. The reactions, while not unique, provide a pathway which has been shown to be feasible from the overall enthalpy changes in the ZKE approximation at the HF and MP2/6-31G* level
Tang, Qin; Bairi, Partha; Shrestha, Rekha Goswami; Hill, Jonathan P; Ariga, Katsuhiko; Zeng, Haibo; Ji, Qingmin; Shrestha, Lok Kumar
2017-12-27
Fullerene C 60 microbelts were fabricated using the liquid-liquid interfacial precipitation method and converted into quasi 2D mesoporous carbon microbelts by heat treatment at elevated temperatures of 900 and 2000 °C. The carbon microbelts obtained by heat treatment of fullerene C 60 microbelts at 900 °C showed excellent electrochemical supercapacitive performance, exhibiting high specific capacitances ca. 360 F g -1 (at 5 mV s -1 ) and 290 F g -1 (at 1 A g -1 ) because of the enhanced surface area and the robust mesoporous framework structure. Additionally, the heat-treated carbon microbelt showed good rate performance, retaining 49% of capacitance at a high scan rate of 10 A g -1 . The carbon belts exhibit super cyclic stability. Capacity loss was not observed even after 10 000 charge/discharge cycles. These results demonstrate that the quasi 2D mesoporous carbon microbelts derived from a π-electron-rich carbon source, fullerene C 60 crystals, could be used as a new candidate material for electrochemical supercapacitor applications.
Intrinsic and extrinsic defects in a family of coal-derived graphene quantum dots
Energy Technology Data Exchange (ETDEWEB)
Singamaneni, Srinivasa Rao, E-mail: ssingam@ncsu.edu, E-mail: tour@rice.edu [Materials Science Division, Army Research Office, Research Triangle Park, North Carolina 27709 (United States); Department of Material Science and Engineering, North Carolina State University, Raleigh, North Carolina 27695 (United States); Tol, Johan van [National High Magnetic Field Laboratory, Florida State University, 1800 E. Paul Dirac Drive, Tallahassee, Florida 32310 (United States); Ye, Ruquan [Department of Chemistry, Rice University, MS-222, 6100 Main Street, Houston, Texas 77005 (United States); Tour, James M., E-mail: ssingam@ncsu.edu, E-mail: tour@rice.edu [Department of Chemistry, Rice University, MS-222, 6100 Main Street, Houston, Texas 77005 (United States); Department of Materials Science and NanoEngineering, Rice University, MS-222, 6100 Main Street, Houston, Texas 77005 (United States); Smalley Institute for Nanoscale Science and Technology, Rice University, MS-222, 6100 Main Street, Houston, Texas 77005 (United States)
2015-11-23
In this letter, we report on the high frequency (239.2 and 336 GHz) electron spin resonance (ESR) studies performed on graphene quantum dots (GQDs), prepared through a wet chemistry route from three types of coal: (a) bituminous, (b) anthracite, and (c) coke; and from non-coal derived GQDs. The microwave frequency-, power-, and temperature-dependent ESR spectra coupled with computer-aided simulations reveal four distinct magnetic defect centers. In bituminous- and anthracite-derived GQDs, we have identified two of them as intrinsic carbon-centered magnetic defect centers (a broad signal of peak to peak width = 697 (10{sup −4} T), g = 2.0023; and a narrow signal of peak to peak width = 60 (10{sup −4} T), g = 2.003). The third defect center is Mn{sup 2+} ({sup 6}S{sub 5/2}, 3d{sup 5}) (signal width = 61 (10{sup −4} T), g = 2.0023, A{sub iso} = 93(10{sup −4} T)), and the fourth defect is identified as Cu{sup 2+} ({sup 2}D{sub 5/2}, 3d{sup 9}) (g{sub ⊥} = 2.048 and g{sub ‖} = 2.279), previously undetected. Coke-derived and non-coal derived GQDs show Mn{sup 2+} and two-carbon related signals, and no Cu{sup 2+} signal. The extrinsic impurities most likely originate from the starting coal. Furthermore, Raman, photoluminescence, and ESR measurements detected no noticeable changes in the properties of the bituminous GQDs after one year. This study highlights the importance of employing high frequency ESR spectroscopy in identifying the (magnetic) defects, which are roadblocks for spin relaxation times of graphene-based materials. These defects would not have been possible to probe by other spin transport measurements.
Liu, Junhua; Chen, Dakai; Liu, Peng; He, Mengna; Li, Jia; Li, Jingya; Hu, Lihong
2014-05-22
Adenosine 5'-monophosphate-activated protein kinase (AMPK) has been demonstrated as a promising drug target due to its regulatory function in glucose and lipid metabolism. 20(S)-protopanoxadiol (PPD) was firstly identified from high throughput screening as a small molecule activator of AMPK subtype α2β1γ1. In order to enhance its potency on AMPK, a series of PPD derivatives were synthesized and evaluated. Structure-activity relationship study showed that the amine derivatives at the 24-position (groups I-VI) can improve the potency (EC50: 0.7-2.3 μM) and efficacy (fold: 2.5-3.8). Among them, compounds 12 and 13 exhibited the best potency (EC50: 1.2 and 0.7 μM) and efficacy (fold: 3.7 and 3.8). Further study suggested the mechanism of AMPK activation may functioned at the allosteric position, resulting the inhibition of the lipid synthesis in HepG2 cell model. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Klécia Marília S de Melo Cassemiro
Full Text Available A type 2 vaccine-derived poliovirus (VDPV, differing from the Sabin 2 strain at 8.6% (78/903 of VP1 nucleotide positions, was isolated from seawater collected from a seaport in São Paulo State, Brazil. The P1/capsid region is related to the Sabin 2 strain, but sequences within the 5'-untranslated region and downstream of the P1 region were derived from recombination with other members of Human Enterovirus Species C (HEV-C. The two known attenuating mutations had reverted to wild-type (A481G in the 5'-UTR and Ile143Thr in VP1. The VDPV isolate had lost the temperature sensitive phenotype and had accumulated amino acid substitutions in neutralizing antigenic (NAg sites 3a and 3b. The date of the initiating OPV dose, estimated from the number of synonymous substitutions in the capsid region, was approximately 8.5 years before seawater sampling, a finding consistent with a long time of virus replication and possible transmission among several individuals. Although no closely related type 2 VDPVs were detected in Brazil or elsewhere, this VDPV was found in an area with a mobile population, where conditions may favor both viral infection and spread. Environmental surveillance serves as an important tool for sensitive and early detection of circulating poliovirus in the final stages of global polio eradication.
Lau, Hooi Hong; Murney, Regan; Yakovlev, Nikolai L; Novoselova, Marina V; Lim, Su Hui; Roy, Nicole; Singh, Harjinder; Sukhorukov, Gleb B; Haigh, Brendan; Kiryukhin, Maxim V
2017-11-01
The benefits of various functional foods are often negated by stomach digestion and poor targeting to the lower gastrointestinal tract. Layer-by-Layer assembled protein-tannic acid (TA) films are suggested as a prospective material for microencapsulation of food-derived bioactive compounds. Bovine serum albumin (BSA)-TA and pepsin-TA films demonstrate linear growth of 2.8±0.1 and 4.2±0.1nm per bi-layer, correspondingly, as shown by ellipsometry. Both multilayer films are stable in simulated gastric fluid but degrade in simulated intestinal fluid. Their corresponding degradation constants are 0.026±0.006 and 0.347±0.005nm -1 min -1 . Milk proteins possessing enhanced adhesion to human intestinal surface, Immunoglobulin G (IgG) and β-Lactoglobulin (BLG), are explored to tailor targeting function to BSA-TA multilayer film. BLG does not adsorb onto the multilayer while IgG is successfully incorporated. Microcapsules prepared from the multilayer demonstrate 2.7 and 6.3 times higher adhesion to Caco-2 cells when IgG is introduced as an intermediate and the terminal layer, correspondingly. This developed material has a great potential for oral delivery of numerous active food-derived ingredients. Copyright © 2017 Elsevier Inc. All rights reserved.
A genetic screen identifies BRCA2 and PALB2 as key regulators of G2 checkpoint maintenance
DEFF Research Database (Denmark)
Menzel, Tobias; Nähse-Kumpf, Viola; Kousholt, Arne Nedergaard
2011-01-01
To identify key connections between DNA-damage repair and checkpoint pathways, we performed RNA interference screens for regulators of the ionizing radiation-induced G2 checkpoint, and we identified the breast cancer gene BRCA2. The checkpoint was also abrogated following depletion of PALB2......, an interaction partner of BRCA2. BRCA2 and PALB2 depletion led to premature checkpoint abrogation and earlier activation of the AURORA A-PLK1 checkpoint-recovery pathway. These results indicate that the breast cancer tumour suppressors and homologous recombination repair proteins BRCA2 and PALB2 are main...
Multifaceted Strategy for the Synthesis of Diverse 2,2'-Bithiophene Derivatives
Directory of Open Access Journals (Sweden)
Stanisław Krompiec
2015-03-01
Full Text Available New catalytically or high pressure activated reactions and routes, including coupling, double bond migration in allylic systems, and various types of cycloaddition and dihydroamination have been used for the synthesis of novel bithiophene derivatives. Thanks to the abovementioned reactions and routes combined with non-catalytic ones, new acetylene, butadiyne, isoxazole, 1,2,3-triazole, pyrrole, benzene, and fluoranthene derivatives with one, two or six bithiophenyl moieties have been obtained. Basic sources of crucial substrates which include bithiophene motif for catalytic reactions were 2,2'-bithiophene, gaseous acetylene and 1,3-butadiyne.
Ponatinib promotes a G1 cell-cycle arrest of merlin/NF2-deficient human schwann cells.
Petrilli, Alejandra M; Garcia, Jeanine; Bott, Marga; Klingeman Plati, Stephani; Dinh, Christine T; Bracho, Olena R; Yan, Denise; Zou, Bing; Mittal, Rahul; Telischi, Fred F; Liu, Xue-Zhong; Chang, Long-Sheng; Welling, D Bradley; Copik, Alicja J; Fernández-Valle, Cristina
2017-05-09
Neurofibromatosis type 2 (NF2) is a genetic syndrome that predisposes individuals to multiple benign tumors of the central and peripheral nervous systems, including vestibular schwannomas. Currently, there are no FDA approved drug therapies for NF2. Loss of function of merlin encoded by the NF2 tumor suppressor gene leads to activation of multiple mitogenic signaling cascades, including platelet-derived growth factor receptor (PDGFR) and SRC in Schwann cells. The goal of this study was to determine whether ponatinib, an FDA-approved ABL/SRC inhibitor, reduced proliferation and/or survival of merlin-deficient human Schwann cells (HSC). Merlin-deficient HSC had higher levels of phosphorylated PDGFRα/β, and SRC than merlin-expressing HSC. A similar phosphorylation pattern was observed in phospho-protein arrays of human vestibular schwannoma samples compared to normal HSC. Ponatinib reduced merlin-deficient HSC viability in a dose-dependent manner by decreasing phosphorylation of PDGFRα/β, AKT, p70S6K, MEK1/2, ERK1/2 and STAT3. These changes were associated with decreased cyclin D1 and increased p27Kip1levels, leading to a G1 cell-cycle arrest as assessed by Western blotting and flow cytometry. Ponatinib did not modulate ABL, SRC, focal adhesion kinase (FAK), or paxillin phosphorylation levels. These results suggest that ponatinib is a potential therapeutic agent for NF2-associated schwannomas and warrants further in vivo investigation.
Radioimmunoassay of measles virus hemagglutinin protein G
International Nuclear Information System (INIS)
Lund, G.A.; Salmi, A.A.
1982-01-01
Guinea pig and rabbit antisera from animals immunized with purified measles virus hemagglutinin (G) protein were used to establish a solid-phase four-layer radioimmunoassay for quantitative measurement of the G protein. The sensitivity of the assay was 2 ng of purified G protein, and 200 μg of protein from uninfected Vero cells neither decreased the sensitivity nor reacted non-specifically in the assay. Radioimmunoassay standard dose-response curves were established and unknown values interpolated from these using the logit program of a desktop computer. Using this procedure, a measles virus growth curve in infected Vero cells was determined by measurement of G protein production. Under these same conditions, hemagglutination was not sensitive enough to detect early hemagglutinin production. Viral antigens in canine distemper virus, Newcastle disease virus, parainfluenza viruses 1-4, simian virus 5, and respiratory syncytial virus-infected cell lysates did not cross-react in the radioimmunoassay. A small degree of cross-reactivity was detected with mumps viral antigens, both with Vero cell-derived (wild-type strain) and egg-derived (Enders strain) purified virus preparations and with a cell lysate antigen prepared from wild-type mumps virus-infected Vero cells. (Auth.)
Radioimmunoassay of measles virus hemagglutinin protein G
Energy Technology Data Exchange (ETDEWEB)
Lund, G A; Salmi, A A [Turku Univ. (Finland)
1982-08-01
Guinea pig and rabbit antisera from animals immunized with purified measles virus hemagglutinin (G) protein were used to establish a solid-phase four-layer radioimmunoassay for quantitative measurement of the G protein. The sensitivity of the assay was 2 ng of purified G protein, and 200 ..mu..g of protein from uninfected Vero cells neither decreased the sensitivity nor reacted non-specifically in the assay. Radioimmunoassay standard dose-response curves were established and unknown values interpolated from these using the logit program of a desktop computer. Using this procedure, a measles virus growth curve in infected Vero cells was determined by measurement of G protein production. Under these same conditions, hemagglutination was not sensitive enough to detect early hemagglutinin production. Viral antigens in canine distemper virus, Newcastle disease virus, parainfluenza viruses 1-4, simian virus 5, and respiratory syncytial virus-infected cell lysates did not cross-react in the radioimmunoassay. A small degree of cross-reactivity was detected with mumps viral antigens, both with Vero cell-derived (wild-type strain) and egg-derived (Enders strain) purified virus preparations and with a cell lysate antigen prepared from wild-type mumps virus-infected Vero cells.
Ma, Weiguang; Wang, Lingnan; Zhang, Nan; Han, Dongxue; Dong, Xiandui; Niu, Li
2015-01-01
Herein, a novel photoelectrochemical platform with WS2/TiO2 composites as optoelectronic materials was designed for selective detection of o-diphenol and its derivatives without any biomolecule auxiliary. First, catechol was chosen as a model compound for the discrimination from resorcinol and hydroquinone; then several o-diphenol derivatives such as dopamine, caffeic acid, and catechin were also detected by employing this proposed photoelectrochemical sensor. Finally, the mechanism of such a selective detection has been elaborately explored. The excellent selectivity and high sensitivity should be attributed to two aspects: (i) chelate effect of adjacent double oxygen atoms in the o-diphenol with the Ti(IV) surface site to form a five/six-atom ring structure, which is considered as the key point for distinction and selective detection. (ii) This selected WS2/TiO2 composites with proper band level between WS2 and TiO2, which could make the photogenerated electron and hole easily separated and results in great improvement of sensitivity. By employing such a photoelectrochemical platform, practical samples including commercial clinic drugs and human urine samples have been successfully performed for dopamine detection. This biomolecule-free WS2/TiO2 based photoelectrochemical platform demonstrates excellent stability, reproducibility, remarkably convenient, and cost-effective advantages, as well as low detection limit (e.g., 0.32 μmol L(-1) for dopamine). It holds great promise to be applied for detection of o-diphenol kind species in environment and food fields.
Sovacool, Benjamin K.; Noel, Lance; Axsen, Jonn; Kempton, Willett
2018-01-01
Vehicle-to-grid (V2G) refers to efforts to bi-directionally link the electric power system and the transportation system in ways that can improve the sustainability and security of both. A transition to V2G could enable vehicles to simultaneously improve the efficiency (and profitability) of electricity grids, reduce greenhouse gas emissions for transport, accommodate low-carbon sources of energy, and reap cost savings for owners, drivers, and other users. To understand the recent state of this field of research, here we conduct a systematic review of 197 peer-reviewed articles published on V2G from 2015 to early 2017. We find that the majority of V2G studies in that time period focus on technical aspects of V2G, notably renewable energy storage, batteries, or load balancing to minimize electricity costs, in some cases including environmental goals as constraints. A much lower proportion of studies focus on the importance of assessing environmental and climate attributes of a V2G transition, or on the role of consumer acceptance and knowledge of V2G systems. Further, there is need for exploratory work on natural resource use and externalities, discourses and narratives as well as social justice, gender, and urban resilience considerations. These research gaps need to be addressed if V2G is to achieve the societal transition its advocates seek.
G(2) Holonomy Spaces from Invariant Three-Forms
Brandhuber, Andreas
2001-01-01
We construct several new G(2) holonomy metrics that play an important role in recent studies of geometrical transitions in compactifications of M-theory to four dimensions. In type IIA string theory these metrics correspond to D6 branes wrapped on the three-cycle of the deformed conifold and the resolved conifold with two-form RR flux on the blown-up two-sphere, which are related by a conifold transition. We also study a G(2) metric that is related in type IIA to the line bundle over S^2 x S^...
Bartnes, K; Hannestad, K
2000-04-01
Peptide epitopes derived from immunoglobulin variable regions represent tumour-specific antigens on B-cell neoplasms and can be recognized by syngeneic, major histocompatibility complex (MHC) class II-restricted T cells. Immunoglobulin peptide/MHC class II complexes may also be involved in autoimmunity and CD4+ T-cell-mediated B-cell regulation. Thus, the IgG2a(b) H-chain allopeptide gamma2a(b) 435-451 presented on I-Ad mimics the epitope implicated in herpes simplex virus-induced autoimmune stromal keratitis and is the target of T helper 1 (Th1) clones that suppress IgG2a(b) production in vivo. We here report that spleen and thymus cells constitutively present the autologous gamma2a(b) epitope to a gamma2a(b) 435-451/I-A(d) reactive T-cell hybridoma as a function of the animal housing conditions (specific pathogen-free or not) and the serum levels of IgG2a(b). Constitutive presentation in the spleen was predominantly performed by dendritic cells. Whereas spleen cells poorly presented native IgG2a(b) to a gamma2a(b) 435-451/I-A(d) reactive T-cell hybridoma, IgG2a(b) in the form of immune complexes were presented > 200-fold more efficiently owing to internalization via low-affinity FcgammaR on macrophages. The antigenicity could also be improved by homotypic aggregation and by targeting IgG2a(b) to complement receptors on the A20 B-cell lymphoma. Mice without detectable IgG2a(b)-containing immune complexes typically exhibited minimal constitutive presentation. Nevertheless, native IgG2a(b) can sensitize antigen-presenting cells in vivo, as mice that were devoid of immune complexes and carried an IgG2a(b)-producing tumour did present constitutively, even at physiological IgG2a(b) serum levels. Whereas the amounts of IgG released from most B-cell lymphomas may be too low to allow spontaneous priming of tumour-specific MHC class II-restricted T cells, administration of tumour immunoglobulin in aggregated form might improve the efficacy of idiotype vaccination.
Directory of Open Access Journals (Sweden)
Hui Zhang
Full Text Available Melittin is a water-soluble toxic peptide derived from the venom of the bee. Although many studies show the anti-tumor activity of melittin in human cancer including glioma cells, the underlying mechanisms remain elusive. Here the effect of melittin on human hepatocelluar carcinoma HepG2 cell proliferation in vitro and further mechanisms was investigated. We found melittin could inhibit cell proliferation in vitro using Flow cytometry and MTT method. Besides, we discovered that melittin significantly downregulated the expressions of CyclinD1 and CDK4. Results of western Blot and Real-time PCR analysis indicated that melittin was capable to upregulate the expression of PTEN and attenuate histone deacetylase 2 (HDAC2 expression. Further studies demonstrated that knockdown of HDAC2 completely mimicked the effects of melittin on PTEN gene expression. Conversely, it was that the potential utility of melittin on PTEN expression was reversed in cells treated with a recombinant pEGFP-C2-HDAC2 plasmid. In addition, treatment with melittin caused a downregulation of Akt phosphorylation, while overexpression of HDAC2 promoted Akt phosphorylation. These findings suggested that the inhibitory of cell growth by melittin might be led by HDAC2-mediated PTEN upregulation, Akt inactivation, and inhibition of the PI3K/Akt signaling pathways.
Wan, Hao; Xiong, Hao; Liu, Xiaohe; Chen, Gen; Zhang, Ning; Wang, Haidong; Ma, Renzhi; Qiu, Guanzhou
2018-05-23
On account of its high theoretical capacity, silicon (Si) has been regarded as a promising anode material for Li-ion batteries. Extracting Si content from earth-abundant and low-cost aluminosilicate minerals, rather than from artificial silica (SiO2) precursors, is a more favorable and practical method for the large-scale application of Si anodes. In this work, three-dimensionally interconnected (3D-interconnected) Si frameworks with a branch diameter of ∼15 nm are prepared by the reduction of amorphous SiO2 nanotubes derived from natural halloysite clay. Benefiting from their nanostructure, the as-prepared 3D-interconnected Si frameworks yield high reversible capacities of 2.54 A h g-1 at 0.1 A g-1 after 50 cycles, 1.87 A h g-1 at 0.5 A g-1 after 200 cycles, and 0.97 A h g-1 at 2 A g-1 after a long-term charge-discharge process of 500 cycles, remarkably outperforming the commercial Si material. Further, when the as-prepared Si frameworks and commercial LiCoO2 cathodes are paired in full cells, a high anode capacity of 0.98 A h g-1 is achieved after 100 cycles of rapid charge/discharge at 2 A g-1. This work provides a new strategy for the synthesis of high-capacity Si anodes derived from natural aluminosilicate clay.
Cohomological descent theory for a morphism of stacks and for equivariant derived categories
International Nuclear Information System (INIS)
Elagin, Alexei D
2011-01-01
In the paper, we find necessary and sufficient conditions under which, if X→S is a morphism of algebraic varieties (or, in a more general case, of stacks), the derived category of S can be recovered by using the tools of descent theory from the derived category of X. We show that for an action of a linearly reductive algebraic group G on a scheme X this result implies the equivalence of the derived category of G-equivariant sheaves on X and the category of objects in the derived category of sheaves on X with a given action of G on each object. Bibliography: 18 titles.
Jain, Prateek; Jain, Trapti
2016-04-01
The objective of this paper is to examine the vehicle-to-grid (V2G) power capability of aggregated electric vehicles (EV) in the manner that they are being adopted by the consumers with their growing infiltration in the vehicles market. The proposed modeling of V2G and grid-to-vehicle (G2V) energy profiles blends the heterogeneous attributes namely, driven mileages, arrival and departure times, travel and parking durations, and speed dependent energy consumption of mobility trends. Three penetration percentages of 25 %, 50 % and 100 % resulting in varied compositions of battery electric vehicle (BEV) and plug-in hybrid electric vehicle (PHEV) in the system, as determined by the consumers' acceptance, have been considered to evaluate the grid capacity for V2G. Distinct charge-discharge powers have been selected as per charging standards to match contemporary vehicles and infrastructure requirements. Charging and discharging approaches have been devised to replicate non-linear characteristics of Li-ion battery. Effects of simultaneous conjunction of V2G and G2V power curves with daily conventional load profile are quantified drawn upon workplace-discharging home-charging scheme. Results demonstrated a marked drop in load and hence in market price during morning hours which is hurriedly overcompensated by the hike during evening hours with rising penetration level and charge-discharge power.
Potential radiosensitizing agents. 5. 2-Substituted benzimidazole derivatives
International Nuclear Information System (INIS)
Gupta, R.P.; Larroquette, C.A.; Agrawal, K.C.
1982-01-01
A series of 2-substituted benzimidazoles and their derivatives have been synthesized and tested for their ability to selectively sensitize hypoxic Chinese hamster cells (V-79) toward the lethal effect of ionizing radiation. These compounds were prepared by reacting the 2-substituted benzimidazoles with 1,2-epoxy-3-methoxypropane in the presence of potassium carbonate. Reaction of the 2-nitro and 2-methylfonyl analogue with the epoxide also yielded a cyclized material, which was confirmed to be a benzimidazo[2,1-b]oxazole. In an attempt to increase the electron affinity, 5- or 6-nitro-2-substituted-benzimidazoles were also synthesized and then reacted with the epoxide to yield the corresponding 1-substituted derivatives. The results of the biological tests for the radiosensitizing activity of these agents against Chinese hamster cells (V-79) in culture indicated that the 2-nitro-substituted analogues were the most effective sensitizers in this series
26 CFR 1.642(g)-2 - Deductions included.
2010-04-01
... tax purposes. Section 642(g) has no application to deductions for taxes, interest, business expenses... 642(g) is applicable to deductions for interest, business expenses, and other items not accrued at the... administration expenses under section 2053(a)(2). Although deductible under section 2053(a)(3) in determining the...
[Central muscle relaxant activities of 2-methyl-3-aminopropiophenone derivatives].
Kontani, H; Mano, A; Koshiura, R; Yamazaki, M; Shimada, Y; Oshita, M; Morikawa, K; Kato, H; Ito, Y
1987-02-01
In this experiment, we synthetized new 2-methyl-3-aminopropiophenone (MP) derivatives, whose structure is known to have central muscle relaxant activities, and quinolizidine and indan . tetralin derivatives derived from MP by cyclization, and we investigated the central muscle relaxant activity. Among the quinolizidine derivatives, there was a very strong central depressant agent, trans (3H, 9aH)-3-(p-chloro) benzoyl-quinolizidine (HSR-740), and among the indan . tetralin derivatives, there was an excitant agents, trans (1H, 2H)-5-methoxy-3, 3-dimethyl-2-piperidinomethyl indan-1-ol (HSR-719). From the results, these derivatives were not considered to be adequate for central muscle relaxant. Among the MP derivatives, (4'-chloro-2'-methoxy-3-piperidino) propiophenone HCl (HSR-733) and (4'-ethyl-2-methyl-3-pyrrolidino) propiophenone HCl (HSR-770) strongly inhibited the cooperative movement in the rotating rod method using mice, and it exerted almost the same depressant activity on the cross extensor reflex using alpha-chloralose anesthetized rats. However, the inhibitory effects of HSR-733 on the anemic decerebrate rigidity and the rigidity induced by intracollicular decerebration in rats were weaker than those of HSR-770 and eperisone. In spinal cats, at a low dose (5 mg/kg, i.v.), HSR-733 depressed monosynaptic and dorsal root reflex potentials as compared with polysynaptic reflex potentials, and inhibitory effects of HSR-733 on these three reflex potentials were more potent than those of eperisone and HSR-770. Although HSR-770 acts on the spinal cord and supraspinal level on which eperisone has been reported to act, HSR-733 may mainly act on the spinal cord. These results indicate that the MP derivative with a 2-methyl group may be suitable as a central muscle relaxant. HSR-770, which has equipotent muscle relaxant activity to eperisone, exerted strong inhibitory effects on oxotremorine-induced tremor and weak inhibitory effects on spontaneous motor activity in the
Directory of Open Access Journals (Sweden)
Wenda Wu
2015-01-01
Full Text Available Trichothecene mycotoxins, potent translational inhibitors that are associated with human food poisonings and damp-building illnesses, are of considerable concern to animal and human health. Food refusal is a hallmark of exposure of experimental animals to deoxynivalenol (DON and other Type B trichothecenes but less is known about the anorectic effects of foodborne Type A trichothecenes (e.g., T-2 toxin, HT-2 toxin, airborne Type D trichothecenes (e.g., satratoxin G [SG] or functionally analogous metabolites that impair protein synthesis. Here, we utilized a well-described mouse model of food intake to compare the anorectic potencies of T-2 toxin, HT-2 toxin, and SG to that of emetine, a medicinal alkaloid derived from ipecac that inhibits translation. Intraperitoneal (IP administration with T-2 toxin, HT-2 toxin, emetine and SG evoked anorectic responses that occurred within 0.5 h that lasted up to 96, 96, 3 and 96 h, respectively, with lowest observed adverse effect levels (LOAELs being 0.1, 0.1, 2.5 and 0.25 mg/kg BW, respectively. When delivered via natural routes of exposure, T-2 toxin, HT-2 toxin, emetine (oral and SG (intranasal induced anorectic responses that lasted up to 48, 48, 3 and 6 h, respectively with LOAELs being 0.1, 0.1, 0.25, and 0.5 mg/kg BW, respectively. All four compounds were generally much more potent than DON which was previously observed to have LOAELs of 1 and 2.5 mg/kg BW after IP and oral dosing, respectively. Taken together, these anorectic potency data will be valuable in discerning the relative risks from trichothecenes and other translational inhibitors of natural origin.
DEFF Research Database (Denmark)
Theilade, Juliane; Lerche Hansen, Jakob; Haunsø, Stig
2002-01-01
G protein-coupled receptor kinase 2 (GRK2) phosphorylates G protein-coupled receptors resulting in uncoupling from G proteins. Receptors modulate GRK2 expression, however the mechanistic basis for this effect is largely unknown. Here we report a novel mechanism by which receptors use...
Yang, Yiqiong; Dong, Han; Wang, Yin; He, Chi; Wang, Yuxin; Zhang, Xiaodong
2018-02-01
A series of octahedral structure Cu-BTC derivatives were successfully achieved through direct calcination of copper based metal organic framework Cu-BTC under different atmosphere (CO reaction gas, oxidizing gas O2, reducing gas H2, inert gas Ar). The Cu-BTC derivatives were characterized by X-ray diffraction (XRD), scanning electron microscope (SEM), transmission electron microscopy (TEM), high-resolution transmission electron microscopy (HRTEM), laser Raman spectroscopy (LRS), N2 adsorption-desorption isotherm, element analysis, H2-temperature program reduction (H2-TPR) and X-ray photoelectron spectroscopic (XPS). It is found that Cu-BTC derivative derived from MOF calcined under reaction gas/O2 (Cu-BTC-CO/Cu-BTC-O) only retain Cu2O and CuO species. In addition, a weak Cu-BTC structure and Cu particles were observed on Cu-BTC derivative derived from MOF calcined under H2 (Cu-BTC-H). Obviously differently, Cu-BTC derivative derived from MOF calcined under Ar (Cu-BTC-Ar) still retains good MOF structure. The catalytic performance for CO oxidation over Cu-BTC derivatives was studied. It was found that Cu-BTC-CO showed a smaller specific surface area (8.0 m2/g), but presented an excellent catalytic performance, long-term stability and cycling stability with a complete CO conversion temperature (T100) of 140 °C, which was ascribed to the higher Cu2O/CuO ratio, good low temperature reduction behavior and a high quantity of surface active oxygen species.
Supersymmetric M3-branes and G{sub 2} manifolds
Energy Technology Data Exchange (ETDEWEB)
Cvetic, M. E-mail: cvetic@cvetic.hep.upenn.edu; Gibbons, G.W.; Lue, H.; Pope, C.N
2002-01-07
We obtain a generalisation of the original complete Ricci-flat metric of G{sub 2} holonomy on R{sup 4}xS{sup 3} to a family with a nontrivial parameter {lambda}. For generic {lambda} the solution is singular, but it is regular when {lambda}={l_brace}-1,0,+1{r_brace}. The case {lambda}=0 corresponds to the original G{sub 2} metric, and {lambda}={l_brace}-1,1{r_brace} are related to this by an S{sub 3} automorphism of the SU(2){sup 3} isometry group that acts on the S{sup 3}xS{sup 3} principal orbits. We then construct explicit supersymmetric M3-brane solutions in D=11 supergravity, where the transverse space is a deformation of this class of G{sub 2} metrics. These are solutions of a system of first-order differential equations coming from a superpotential. We also find M3-branes in the deformed backgrounds of new G{sub 2} holonomy metrics that include one found by A. Brandhuber, J. Gomis, S. Gubser and S. Gukov, and show that they also are supersymmetric.
Li, Sheyu; Wei, Jia; Zhang, Chenghui; Li, Xiaodan; Meng, Wentong; Mo, Xianming; Zhang, Qianying; Liu, Qilin; Ren, Kaiyun; Du, Rong; Tian, Haoming; Li, Jianwei
2016-01-01
The aim of this study was to assess the association between circulating cell-derived microparticles (MPs) and type 2 diabetes mellitus (T2DM). A literature search was performed systematically in PubMed and Embase to identify available case-control or cross-sectional studies that compared different types of cell-derived MPs in patients with T2DM and non-diabetic controls. Pooled standardized mean differences (SMDs) of each MP type were pooled using meta-analysis. Forty-eight studies involving 2,460 patients with T2DM and 1,880 non-diabetic controls were included for systematic review and 34 of which were included for quantitative study by meta-analysis. In the overall analysis, the levels of circulating total MPs (TMPs), platelet-derived MPs (PMPs), monocyte-derived MPs (MMPs) and endothelium-derived MPs (EMPs) were significantly higher in T2DM patients than those in controls (TMPs: SMD, 0.64; 95%CI, 0.12∼1.15; P=0.02; PMPs: SMD, 1.19; 95%CI, 0.88∼1.50; P <0.00001; MMPs: SMD, 0.92; 95%CI, 0.66∼1.17; P <0.00001; EMPs: SMD, 0.73; 95%CI, 0.50∼0.96; P <0.00001). Meanwhile, no significant difference was shown in leukocyte-derived MPs (LMPs) level between diabetic and non-diabetic groups (SMD, 0.37; 95%CI, -0.15∼0.89; P=0.17). The counts of TMPs, PMPs, MMPs and EMPs elevated in patients with T2DM. And cell-derived MPs may play a role in the pathogenesis of T2DM. © 2016 The Author(s) Published by S. Karger AG, Basel.
Zou, Kang-Yu; Liu, Yi-Chen; Jiang, Yi-Fan; Yu, Cheng-Yan; Yue, Man-Li; Li, Zuo-Xi
2017-06-05
Herein three novel cobalt metal-organic frameworks (Co-MOFs) with similar ingredients, [Co(bib)(o-bdc)] ∞ (1), [Co 2 (bib) 2 (m-bdc) 2 ] ∞ (2), and {[Co(bib)(p-bdc)(H 2 O)](H 2 O) 0.5 } ∞ (3), have been synthesized from the reaction of cobalt nitrate with 1,4-bis(imidazol-1-yl)benzene (bib) and structure-related aromatic acids (1,2-benzenedicarboxylic acid = o-bdc, 1,3-benzenedicarboxylic acid = m-bdc, and 1,4-benzenedicarboxylic acid = p-bdc) by the solvothermal method. It is aimed to perform systematic research on the relationship among the conformation of benzoate acid, lattice dimension of Co-MOF, and pore diameter of MOF-derived carbon composite. Through the precursor strategy, Co-MOFs 1-3 have been utilized to synthesize porous cobalt@carbon nanotube composites (Co@CNTs). After the in situ gas-sulfurization, secondary composites CoS 2 @CNTs were successfully obtained, which kept similar morphologies of corresponding Co@CNTs without destroying previous highly dispersed structures. Co-MOFs and two series of composites (Co@CNTs and CoS 2 @CNTs) have been well characterized. Topology and Brunauer-Emmett-Teller analyses elucidate that the bdc 2- ion could control the pore diameters of MOF-derived carbon composites by adjusting the lattice dimension of Co-MOFs. The systematic studies on electrochemical properties demonstrate that (p)-CoS 2 @CNT possesses hierarchical morphology, moderate specific surface area, proper pore diameter distribution, and high graphitization, which lead to remarkable specific capacitances (839 F g -1 at 5 mV s -1 and 825 F g -1 at 0.5 A g -1 ) in 2 M potassium hydroxide solution. In addition, the (p)-CoS 2 @CNT electrode exhibits good electrochemical stability and still retains 82.9% of initial specific capacitance at the current density of 1 A g -1 after 5000 cycles.
The dopamine D2 receptor can directly recruit and activate GRK2 without G protein activation.
Pack, Thomas F; Orlen, Margo I; Ray, Caroline; Peterson, Sean M; Caron, Marc G
2018-04-20
The dopamine D2 receptor (D2R) is a G protein-coupled receptor (GPCR) that is critical for many central nervous system functions. The D2R carries out these functions by signaling through two transducers: G proteins and β-arrestins (βarrs). Selectively engaging either the G protein or βarr pathway may be a way to improve drugs targeting GPCRs. The current model of GPCR signal transduction posits a chain of events where G protein activation ultimately leads to βarr recruitment. GPCR kinases (GRKs), which are regulated by G proteins and whose kinase action facilitates βarr recruitment, bridge these pathways. Therefore, βarr recruitment appears to be intimately tied to G protein activation via GRKs. Here we sought to understand how GRK2 action at the D2R would be disrupted when G protein activation is eliminated and the effect of this on βarr recruitment. We used two recently developed biased D2R mutants that can preferentially interact either with G proteins or βarrs as well as a βarr-biased D2R ligand, UNC9994. With these functionally selective tools, we investigated the mechanism whereby the βarr-preferring D2R achieves βarr pathway activation in the complete absence of G protein activation. We describe how direct, G protein-independent recruitment of GRK2 drives interactions at the βarr-preferring D2R and also contributes to βarr recruitment at the WT D2R. Additionally, we found an additive interaction between the βarr-preferring D2R mutant and UNC9994. These results reveal that the D2R can directly recruit GRK2 without G protein activation and that this mechanism may have relevance to achieving βarr-biased signaling. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Sidra Islam
Full Text Available Glycoxidation plays a crucial role in diabetes and its associated complications. Among the glycoxidation agents, methylglyoxal (MG is known to have very highglycationpotential witha concomitant generation of reactive oxygen species (ROS during its synthesis and degradation. The presentstudy probes the MG and ROSinduced structural damage to immunoglobulin G (IgG and alterations in its immunogenicity in diabetes type 2 patients (T2DM. Human IgG was first glycated with MG followed by hydroxyl radical (OH• modification. Glycoxidation mediated effects on IgG were evaluated by various physicochemical techniques likeultraviolet (UV and fluorescence spectroscopy, 8-anilinonaphthalene-1-sulfonic acid (ANS binding studies, carbonyl andfree sulfhydryl groups assay, matrix assisted laser desorption ionization mass spectrometry-time of flight (MALDI-TOF, red blood cell (RBC haemolysis assay, Congored (CR staining analysis and scanning electron microscopy (SEM. The results revealed hyperchromicityin UV, advanced glycation end product (AGEspecific and ANS fluorescence, quenching in tyrosine and tryptophan fluorescence intensity,enhanced carbonyl content,reduction in free sulfhydryl groups,pronounced shift in m/z value of IgGand decrease in antioxidant activity in RBC induced haemolysis assayupon glycoxidation. SEM and CRstaining assay showed highly altered surface morphology in glycoxidised sample as compared to the native. Enzyme linked immunosorbent assay (ELISA and band shift assay were performed to assess the changes in immunogenicity of IgG upon glyoxidation and its role in T2DM. The serum antibodies derived from T2DM patients demonstrated strong affinity towards OH• treated MG glycatedIgG (OH•-MG-IgG when compared to native IgG (N-IgG or IgGs treated with MG alone (MG-IgG or OH• alone (OH•-IgG. This study shows the cumulating effect of OH• on the glycation potential of MG. The results point towards the modification of IgG in diabetes patients
Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E
2012-12-04
The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.
Energy Technology Data Exchange (ETDEWEB)
Luecke-Huhle, C.; Comper, W.; Hieber, L.; Pech, M.
1982-06-01
Survival and G2 delay following exposure to either /sup 60/Cobalt-..gamma..-rays or /sup 241/Americium-..cap alpha..-particles were studied in eight mammalian cell lines of human and animal origin including human fibroblasts from normal individuals and from patients with Ataxia telangiectasia or Fanconi's anemia. For both endpoints the effectiveness of alpha particle was greater as compared to ..gamma..-rays. RBE values for G2 delay (4.6-9.2) were in general comparable to RBE values derived from initial slopes of survival curves but higher compared to the ratio of mean inactivation doses. Ataxia cells were particularly sensitive to cell killing by ..gamma..-irradiation, however, showed average sensitivity to ..cap alpha..-particles of high LET. With the exception of Ataxia cells, cell killing and G2 delay seem to be related processes if individual cell cycle parameters are taken into account.
G2S: A web-service for annotating genomic variants on 3D protein structures.
Wang, Juexin; Sheridan, Robert; Sumer, S Onur; Schultz, Nikolaus; Xu, Dong; Gao, Jianjiong
2018-01-27
Accurately mapping and annotating genomic locations on 3D protein structures is a key step in structure-based analysis of genomic variants detected by recent large-scale sequencing efforts. There are several mapping resources currently available, but none of them provides a web API (Application Programming Interface) that support programmatic access. We present G2S, a real-time web API that provides automated mapping of genomic variants on 3D protein structures. G2S can align genomic locations of variants, protein locations, or protein sequences to protein structures and retrieve the mapped residues from structures. G2S API uses REST-inspired design conception and it can be used by various clients such as web browsers, command terminals, programming languages and other bioinformatics tools for bringing 3D structures into genomic variant analysis. The webserver and source codes are freely available at https://g2s.genomenexus.org. g2s@genomenexus.org. Supplementary data are available at Bioinformatics online. © The Author (2018). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Directory of Open Access Journals (Sweden)
Vinayak M. Naik
2011-01-01
Full Text Available A few eight coordinated complexes of lanthanide(III nitrate with 2-benzimidazolyl mercaptoaceto hydrazone ligand (LH2 with the general formula [Ln(LH2NO2]H2O (where Ln = La, Pr, Nd, Sm and Gd have been synthesized and characterized by elemental analysis, magnetic susceptibility, molar conductance, UV-Visible, IR and 1H NMR spectral studies. The experimental data sustain stoichiometry of 1:2 (metal/ligand for the complexes. The spectral data shows that the ligand reacts in keto form and behaves as monobasic terdentate in nature. The nitrate appears to coordinate in the bidentate fashion to the metal ion. The thermal stabilities of the complexes have been studied by TGA and their kinetic parameters were calculated using Coats-Redfern and MKN methods. The antimicrobial activity studies have been under taken and results are discussed.
Investigation of Load Sharing in Hybrid (2G/3G) Mobile Networks
Martynas Stirbys; Karolis Žvinys
2015-01-01
The main purpose of this work is to investigate load sharing methods for 2G/3G cellular networks in order to determine their impact on the network and users. One of the study aims is to analyze the performance of the methods. Moreover the paper provides an overview of the methods circumstances, limitations. Directed Retry and Load Based Handover methods were chosen. Data was obtained from real Lithuanian mobile operator’s network. The paper also discusses the changes in Key Performance Indica...
g-factor of the ground state of 73Se
International Nuclear Information System (INIS)
Nishimura, Katsuhiko; Ohya, Susumu; Mutsuro, Naoshi
1987-01-01
Nuclear magnetic resonance on oriented 73 Se in an iron host has been observed at about 7mK. From resonance-shift measurement, the magnetic hyperfine-splitting frequency μ M , g-factor and magnetic hyperfine field were derived as μ M =102.61(3)MH z , |g(9/2 + )|=0.188(16) and B HF ( 73 SeFe)=716(81)kG. The experimental values of the g-factors of the g 9/2 neutron states, in the neighborhood of the neutron number 40, are compared with the theoretical values based on the core-polarization model. (author)
Odd-even staggering in the πg9/2νg9/2 band in 72Br
International Nuclear Information System (INIS)
Fotiades, N.; Cizewski, J.A.; Lister, C.J.; Davids, C.N.; Janssens, R.V.; Seweryniak, D.; Carpenter, M.P.; Khoo, T.L.; Lauritsen, T.; Nisius, D.; Reiter, P.; Uusitalo, J.; Wiedenhover, I.; Macchiavelli, A.O.; MacLeod, R.W.
1999-01-01
High-spin positive-parity states in 72 Br have been studied using the 16 O+ 58 Ni reaction. The πg 9/2 νg 9/2 decoupled band in 72 Br has been observed up to ∼10 MeV excitation energy and the expected odd-even staggering has been delineated. A larger signature splitting is observed for this band in 72 Br than in the same collective structures in the heavier 74,76,78 Br. No signature inversion at low spin is observed for this band in 72 Br, in contrast to the heavier isotopes, 74,76,78 Br, in which signature inversion is observed below ∼10ℎ. The observations are in general agreement with theoretical models in this mass region which predict no signature inversion for nuclei with less than 39 protons and neutrons. copyright 1999 The American Physical Society
D'Silva, Mary Hydrina; Swer, Rijied Thompson; Anbalagan, J; Rajesh, Bhargavan
2017-07-01
The increasing scientific evidence of various health hazards on exposure of Radiofrequency Radiation (RFR) emitted from both the cell phones and base stations have caused significant media attention and public discussion in recent years. The mechanism of interaction of RF fields with developing tissues of children and fetuses may be different from that of adults due to their smaller physical size and variation in tissue electromagnetic properties. The present study may provide an insight into the basic mechanisms by which RF fields interact with developing tissues in an embryo. To evaluate the possible tissue and DNA damage in developing liver of chick embryo following chronic exposure to Ultra-High Frequency/Radiofrequency Radiation (UHF/RFR) emitted from 2G and 3G cell phone. Fertilized chick embryos were incubated in four groups. Group A-experimental group exposed to 2G radiation (60 eggs), Group B- experimental group exposed to 3G radiation (60 eggs), Group C- sham exposed control group (60 eggs) and Group D- control group (48 eggs). On completion of scheduled duration, the embryos were collected and processed for routine histological studies to check structural changes in liver. The nuclear diameter and karyorrhexis changes of hepatocytes were analysed using oculometer and square reticule respectively. The liver procured from one batch of eggs from all the four groups was subjected to alkaline comet assay technique to assess DNA damage. The results were compared using one-way ANOVA test. In our study, the exposure of developing chick embryos to 2G and 3G cell phone radiations caused structural changes in liver in the form of dilated sinusoidal spaces with haemorrhage, increased vacuolations in cytoplasm, increased nuclear diameter and karyorrhexis and significantly increased DNA damage. The chronic exposure of chick embryo liver to RFR emitted from 2G and 3G cell phone resulted in various structural changes and DNA damage. The changes were more pronounced in 3
The Muon $g$-$2$ Experiment at Fermilab
Energy Technology Data Exchange (ETDEWEB)
Gohn, Wesley [Kentucky U.
2017-12-29
A new measurement of the anomalous magnetic moment of the muon, $a_{\\mu} \\equiv (g-2)/2$, will be performed at the Fermi National Accelerator Laboratory with data taking beginning in 2017. The most recent measurement, performed at Brookhaven National Laboratory (BNL) and completed in 2001, shows a 3.5 standard deviation discrepancy with the standard model value of $a_\\mu$. The new measurement will accumulate 21 times the BNL statistics using upgraded magnet, detector, and storage ring systems, enabling a measurement of $a_\\mu$ to 140 ppb, a factor of 4 improvement in the uncertainty the previous measurement. This improvement in precision, combined with recent improvements in our understanding of the QCD contributions to the muon $g$-$2$, could provide a discrepancy from the standard model greater than 7$\\sigma$ if the central value is the same as that measured by the BNL experiment, which would be a clear indication of new physics.
Novel microwave-assisted synthesis of porous g-C3N4/SnO2 nanocomposite for solar water-splitting
Seza, A.; Soleimani, F.; Naseri, N.; Soltaninejad, M.; Montazeri, S. M.; Sadrnezhaad, S. K.; Mohammadi, M. R.; Moghadam, H. Asgari; Forouzandeh, M.; Amin, M. H.
2018-05-01
Highly porous nanocomposites of graphitic-carbon nitride and tin oxide (g-C3N4/SnO2) were prepared through simple pyrolysis of urea molecules under microwave irradiation. The initial amount of tin was varied in order to investigate the effect of SnO2 content on preparation and properties of the composites. The synthesized nanocomposites were well-characterized by XRD, FE-SEM, HR-TEM, BET, FTIR, XPS, DRS, and PL. A homogeneous distribution of SnO2 nanoparticles with the size of less than 10 nm on the porous C3N4 sheets could be obtained, suggesting that in-situ synthesis of SnO2 nanoparticles was responsible for the formation of g-C3N4. The process likely occurred by the aid of the large amounts of OH groups formed on the surfaces of SnO2 nanoparticles during the polycondensation reactions of tin derivatives which could facilitate the pyrolysis of urea to carbon nitride. The porous nanocomposite prepared with initial tin amount of 0.175 g had high specific surface area of 195 m2 g-1 which showed high efficiency photoelectrochemical water-splitting ability. A maximum photocurrent density of 33 μA cm-2 was achieved at an applied potential of 0.5 V when testing this nanocomposite as photo-anode in water-splitting reactions under simulated visible light irradiation, introducing it as a promising visible light photoactive material.
Overview of the Fermilab Muon g-2 Experiment
Energy Technology Data Exchange (ETDEWEB)
Kim, SeungCheon [Cornell U., Phys. Dept.
2015-01-01
The measurement of the anomalous magnetic moment of muon provides a precision test of the Standard Model. The Brookhaven muon g-2 experiment (E821) measured the muon magnetic moment anomaly with 0.54 ppm precision, a more than 3 deviation from the Standard Model predictions, spurring speculation about the possibility of new physics. The new g-2 experiment at Fermilab (E989) will reduce the combined statistical and systematic error of the BNL experiment by a factor of 4. An overview of the new experiment is described in this article.
The g$p\\atop{2}$ Experiment: A Measurement of the Proton's Spin Structure Functions
Energy Technology Data Exchange (ETDEWEB)
Zielinski, Ryan B. [Univ. of New Hampshire, Durham, NH (United States)
2017-09-01
The E08-027 (g$p\\atop{2}$) experiment measured the spin structure functions of the proton at Jefferson Laboratory in Newport News, Va. Longitudinally polarized electrons were scattered from a transversely and longitudinally polarized solid ammonia target in Hall A, with the polarized NH$_3$ acting as an effective proton target. Focusing on small scattering angle events at the electron energies available at Jefferson Lab, the experiment covered a kinematic phase space of 0.02 GeV$^2$ $< Q^2 <$ 0.20 GeV$^2$ in the proton's resonance region. The spin structure functions, $g_{1}^p(x,Q^2)$ and $g_{2}^p(x,Q^2)$ , are extracted from an inclusive polarized cross section measurement of the electron-proton interaction. Integrated moments of $g_1(x,Q^2)$ are calculated and compared to theoretical predictions made by Chiral Perturbation Theory. The $g_1(x,Q^2)$ results are in agreement with previous measurements, but include a significant increase in statistical precision. The spin structure function contributions to the hyperfine energy levels in the hydrogen atom are also investigated. The $g_2(x,Q^2)$ measured contribution to the hyperfine splitting is the first ever experimental determination of this quantity. The results of this thesis suggest a disagreement of over 100% with previously published model results.
A monoclinic polymorph of (1E,5E)-1,5-bis(2-hydroxybenzylidene)thiocarbonohydrazide
Schmitt, Bonell; Gerber, Thomas; Hosten, Eric; Betz, Richard
2011-01-01
The title compound, C15H14N4O2S, is a derivative of thioureadihydrazide. In contrast to the previously reported polymorph (orthorhombic, space group Pbca, Z = 8), the current study revealed monoclinic symmetry (space group P21/n, Z = 4). The molecule shows non-crystallographic C 2 as well as approximate C s symmetry. Intramolecular bifurcated O—H⋯(N,S) hydrogen bonds, are present. In the crystal, intermolecular N—H⋯S hydrogen bonds and C—H⋯π contacts connect the molecules into undulating chains along the b axis. The shortest centroid–centroid distance between two aromatic systems is 4.5285 (12) Å. PMID:22091213
Energy Technology Data Exchange (ETDEWEB)
Hoffman, Adam J., E-mail: adamhoff@umich.edu; Lee, John C., E-mail: jcl@umich.edu
2016-02-15
A new time-dependent Method of Characteristics (MOC) formulation for nuclear reactor kinetics was developed utilizing angular flux time-derivative propagation. This method avoids the requirement of storing the angular flux at previous points in time to represent a discretized time derivative; instead, an equation for the angular flux time derivative along 1D spatial characteristics is derived and solved concurrently with the 1D transport characteristic equation. This approach allows the angular flux time derivative to be recast principally in terms of the neutron source time derivatives, which are approximated to high-order accuracy using the backward differentiation formula (BDF). This approach, called Source Derivative Propagation (SDP), drastically reduces the memory requirements of time-dependent MOC relative to methods that require storing the angular flux. An SDP method was developed for 2D and 3D applications and implemented in the computer code DeCART in 2D. DeCART was used to model two reactor transient benchmarks: a modified TWIGL problem and a C5G7 transient. The SDP method accurately and efficiently replicated the solution of the conventional time-dependent MOC method using two orders of magnitude less memory.
International Nuclear Information System (INIS)
Hoffman, Adam J.; Lee, John C.
2016-01-01
A new time-dependent Method of Characteristics (MOC) formulation for nuclear reactor kinetics was developed utilizing angular flux time-derivative propagation. This method avoids the requirement of storing the angular flux at previous points in time to represent a discretized time derivative; instead, an equation for the angular flux time derivative along 1D spatial characteristics is derived and solved concurrently with the 1D transport characteristic equation. This approach allows the angular flux time derivative to be recast principally in terms of the neutron source time derivatives, which are approximated to high-order accuracy using the backward differentiation formula (BDF). This approach, called Source Derivative Propagation (SDP), drastically reduces the memory requirements of time-dependent MOC relative to methods that require storing the angular flux. An SDP method was developed for 2D and 3D applications and implemented in the computer code DeCART in 2D. DeCART was used to model two reactor transient benchmarks: a modified TWIGL problem and a C5G7 transient. The SDP method accurately and efficiently replicated the solution of the conventional time-dependent MOC method using two orders of magnitude less memory.