WorldWideScience

Sample records for hyalomma marginatum rufipes

  1. First report of adult Hyalomma marginatum rufipes (vector of Crimean-Congo haemorrhagic fever virus on cattle under a continental climate in Hungary

    Directory of Open Access Journals (Sweden)

    Hornok Sándor

    2012-08-01

    Full Text Available Abstract Background South Hungary is being monitored for the northward spreading of thermophilic ixodid species, therefore ticks were collected from cattle and wild ruminants (red, fallow and roe deer in the autumn of 2011. Findings Besides indigenous species (1185 Dermacentor reticulatus and 976 Ixodes ricinus, two Hyalomma marginatum rufipes males were found on two cows, in September eight days apart. Conclusions This is the northernmost autochthonous infestation of the type host (cattle with H. m. rufipes, vector of Crimean-Congo haemorrhagic fever virus. The present findings are suggestive of the moulting success of this Afro-Mediterranean tick species in a continental climate in Central Europe.

  2. In vitro investigation of the toxic effects of extracts of Allium sativum bulbs on adults of Hyalomma marginatum rufipes and Rhipicephalus pulchellus

    Directory of Open Access Journals (Sweden)

    F. Nchu

    2005-06-01

    Full Text Available The toxic effects of the extracts of Allium sativum (Garlic were evaluated against adults of Hyalomma marginatum rufipes and Rhipicephalus pulchellus using three types (Types A, B and C of contact toxicity bioassays. A. sativum bulbs were extracted with acetone, ethanol and dichloromethane (DCM solvents. Among these three solvents, it is the DCM extract of A. sativum that appears to have anti-tick activity. In the Type A contact toxicity bioassay, DCM extracts of A. sativum demonstrated a high acaricidal bioactivity against H. m. rufipes with 100 % of ticks killed in less than an hour, and toxicity persisted to the second day. A weak acaricidal activity of aqueous extracts of A. sativum was observed in the Type B contact toxicity bioassay. In the Type C contact toxicity bioassay, a concentration of 24 % w/v of DCM extracts of garlic in sunflower oil (Helianthus annuus had killed 100% of H. m. rufipes (LC50= 5.9 % w/v and R. pulchellus (LC50 = 10.3 % w/v by 24 hours post-treatment of ticks. The results obtained from this study suggest that DCM extract of A. sativum is a potential source of novel acaricidal agents.

  3. Transovarial Transmission of Babesia Ovis by Rhipicephalus Sanguineus and Hyalomma Marginatum

    Directory of Open Access Journals (Sweden)

    E Nouroozi

    2010-09-01

    Full Text Available Background: Rhipicephalus sanguineus and Hyalomma marginatum are the most common spe­cies in sheep herds in Northeast of Iran. There is preliminary evidence that these species may be the vectors of Babesia ovis in Iran. We carried out two experiments in Mashhad area, Khorasan Razavi Province to determine whether B. ovis could be transovarially transmitted by R. san­guineus and H. marginatum.Methods: In experiment 1, adults of laboratory reared H. marginatum and R.sanguineus were infected with B. ovis isolated from naturally infected sheep in Mashhad area by feeding the ticks on the sheep inoculated intravenously by infected blood samples. The inoculated sheep showed clinical signs with parasitaemia while the adult ticks were engorging on them. The engorged fe­males were collected and kept at 28°C and 85% relative humidity in incubator. Then, larval, nym­phal and adult stages derived from engorged females were used to infest the clean sheep. In experiment 2, two splenectomized sheep were infested only with the same adult ticks of two spe­cies.Results: Examination of smears and PCR of blood samples to detect of B. ovis in infested sheep in two experiments were negative.Conclusion: It seems that R. sanguineus and H. marginatum can not transovarially transmit B. ovis in sheep.

  4. Repellent activities of dichloromethane extract of Allium sativum (garlic (Liliaceae against Hyalomma rufipes (Acari

    Directory of Open Access Journals (Sweden)

    Felix Nchu

    2016-02-01

    Full Text Available Dichloromethane (DCM extract of garlic (Allium sativum Linn. bulbs was assessed for its repellent effect against the hard tick, Hyalomma rufipes (Acari: Ixodidae using two tick behavioural bioassays; Type A and Type B repellency bioassays, under laboratory conditions. These bioassays exploit the questing behaviour of H. rufipes, a tick that in nature displays ambush strategy, seeking its host by climbing up on vegetation and attaching to a passing host. One hundred microlitres (100 µL of the test solution containing DCM extract of garlic bulbs and DCM at concentrations of 0.35%, 0.7% or 1.4% w/v were evaluated. DCM only was used for control. Tick repellency increased significantly (R2 = 0.98 with increasing concentration (40.03% – 86.96% yielding an EC50 of 0.45% w/v in Type B repellency bioassay. At concentration of 1.4% w/v, the DCM extract of garlic bulbs produced high repellency index of 87% (male ticks and 87.5% (female ticks in the Type A repellency bioassay. Only 4% avoidance of male ticks or female ticks was recorded in the Type B repellency bioassay. In the corresponding controls, the mean numbers of non-repelled male or female ticks were 80% and 41 males or 38 females of 50 ticks in the Type A and Type B repellency bioassays, respectively. The variations in the results could be attributed to the difference in tick repellent behaviours that were assessed by the two repellency bioassays; the Type A repellency bioassay assessed repellent effect of garlic extracts without discriminating between deterrence and avoidance whereas the Type B repellency bioassay only assessed avoidance response. Generally, DCM extract of garlic was repellent against H. rufipes, albeit weak tick repellency was obtained in the Type B repellency bioassay. Furthermore, this study established that the tick repellent activity of garlic extracts is predominantly by deterrence.

  5. Repellent activities of dichloromethane extract of Allium sativum (garlic) (Liliaceae) against Hyalomma rufipes (Acari).

    Science.gov (United States)

    Nchu, Felix; Magano, Solomon R; Eloff, Jacobus N

    2016-12-02

    Dichloromethane (DCM) extract of garlic (Allium sativum Linn.) bulbs was assessed for its repellent effect against the hard tick, Hyalomma rufipes (Acari: Ixodidae) using two tick behavioural bioassays; Type A and Type B repellency bioassays, under laboratory conditions. These bioassays exploit the questing behaviour of H. rufipes, a tick that in nature displays ambush strategy, seeking its host by climbing up on vegetation and attaching to a passing host. One hundred microlitres (100 µL) of the test solution containing DCM extract of garlic bulbs and DCM at concentrations of 0.35%, 0.7% or 1.4% w/v were evaluated. DCM only was used for control. Tick repellency increased significantly (R2 = 0.98) with increasing concentration (40.03% - 86.96%) yielding an EC50 of 0.45% w/v in Type B repellency bioassay. At concentration of 1.4% w/v, the DCM extract of garlic bulbs produced high repellency index of 87% (male ticks) and 87.5% (female ticks) in the Type A repellency bioassay. Only 4% avoidance of male ticks or female ticks was recorded in the Type B repellency bioassay. In the corresponding controls, the mean numbers of non-repelled male or female ticks were 80% and 41 males or 38 females of 50 ticks in the Type A and Type B repellency bioassays, respectively. The variations in the results could be attributed to the difference in tick repellent behaviours that were assessed by the two repellency bioassays; the Type A repellency bioassay assessed repellent effect of garlic extracts without discriminating between deterrence and avoidance whereas the Type B repellency bioassay only assessed avoidance response. Generally, DCM extract of garlic was repellent against H. rufipes, albeit weak tick repellency was obtained in the Type B repellency bioassay. Furthermore, this study established that the tick repellent activity of garlic extracts is predominantly by deterrence.

  6. Molecular analysis of Crimean-Congo hemorrhagic fever virus and Rickettsia in Hyalomma marginatum ticks removed from patients (Spain) and birds (Spain and Morocco), 2009-2015.

    Science.gov (United States)

    Palomar, Ana M; Portillo, Aránzazu; Mazuelas, David; Roncero, Lidia; Arizaga, Juan; Crespo, Ariñe; Gutiérrez, Óscar; Márquez, Francisco J; Cuadrado, Juan F; Eiros, José M; Oteo, José A

    2016-07-01

    Crimean-Congo hemorrhagic fever virus (CCHFV) was detected in Spain in 2010. The presence of CCHFV in Hyalomma marginatum ticks from migratory birds passing through Morocco during the spring migration strengthened the hypothesis of the arrival of infected ticks transported by birds to the Iberian Peninsula. Furthermore, Hyalomma species are vectors of bacterial infections such as spotted fever rickettsioses. CCHFV and Rickettsia were screened in Hyalomma ticks from Spain attached to patients (n=12) and birds (n=149). In addition, Rickettsia was investigated in 52 Hyalomma ticks from Morocco (previously reported as CCHFV-infected). No sample collected in Spain showed an infection with CCHFV. Two ticks removed from patients (16.7%), as well as 47 (31.5%) and 4 (7.7%) from birds, collected in Spain and Morocco respectively, were infected with Rickettsia aeschlimannii. Rickettsia sibirica subsp. mongolitimonae was also found in 2 ticks from birds collected in Spain (1.3%). The risk of CCHFV-infected ticks attached to migratory birds to reach the North of Spain is low. This study corroborates the presence of R. aeschlimannii in Spain and Morocco, and supports that H. marginatum can be a potential vector of R. sibirica subsp. mongolitimonae in the Iberian Peninsula.

  7. The complete sequence of a West Nile virus lineage 2 strain detected in a Hyalomma marginatum marginatum tick collected from a song thrush (Turdus philomelos) in eastern Romania in 2013 revealed closest genetic relationship to strain Volgograd 2007.

    Science.gov (United States)

    Kolodziejek, Jolanta; Marinov, Mihai; Kiss, Botond J; Alexe, Vasile; Nowotny, Norbert

    2014-01-01

    In this study the first complete sequence of the West Nile virus (WNV) lineage 2 strain currently circulating in Romania was determined. The virus was detected in a Hyalomma marginatum marginatum tick collected from a juvenile song thrush (Turdus philomelos) in the Romanian Danube Delta close to the city of Tulcea, end of August 2013. Our finding emphasizes the role of ticks in introduction and maintenance of WNV infections. Sequence analyses revealed close genetic relationship of the Romanian WNV strain to strain Reb_Volgograd_07_H, which was isolated from human brain tissue during an outbreak of West Nile neuroinvasive disease (WNND) in Russia in 2007. In 2010 the Eastern European lineage 2 WNV caused an outbreak of human WNND in Romania. Partial sequences from subsequent years demonstrated that this WNV strain became endemic in Eastern Europe and has been causing outbreaks of varying sizes in southern Russia since 2007 and in Romania since 2010.

  8. Colonization and Containment of Hyalomma Marginatum Rufipes for Studies on the Transmission of Crimean-Congo Hemorrhagic Fever

    Science.gov (United States)

    1987-07-31

    Russian) Tabl. anal. Faune URSS 4 125pp Olenev, NO. 1931 Die Zecken (Ixodidea) der fauna Russlands. Zeits chr. Parasitenk. 4(1) 126-139 Olenev, NO. 1931...Parasitenk 4 126 Olenev, NO. 1931 Mag. Paras. Zool. Acad. Scien. URSS . 2 249 q Oliver, JH. 1972 Cytogenetics of ticks (Acari: Ixodoidea). 8. Chr...USA. Pomeranzev, BI. 1946 Tableaux analytiques Faunne URSS . Publ. Ins. Zool. Acad. Science. Popov, GV, Levi, VD, Vasilenko, SM, and Chumakov, MP

  9. Screening for bacterial DNA in the hard tick Hyalomma marginatum (Ixodidae from Socotra Island (Yemen: detection of Francisella-like endosymbiont

    Directory of Open Access Journals (Sweden)

    M. Montagna

    2012-12-01

    Full Text Available Thirty-four adult ticks collected from livestock on Socotra Island (Yemen were identified as Hyalomma marginatum using traditional morphological characteristics. Morphological identification was confirmed for all the collected specimens using a molecular approach targeting a fragment of the mitochondrial gene 12S rRNA. All the specimens were examined for the presence of tick-borne pathogens and the tick endosymbiont Candidatus Midichloria mitochondrii using polymerase chain reaction. Three specimens out of the 34 analyzed tested positive to the presence of Francisella spp. leading to the first detection of these bacteria in H. marginatum on Socotra Island. The phylogenetic analyses conducted on a 660 bp fragment of the ribosomal gene 16S rRNA of Francisella spp. (including F. philomiragia as outgroup, the four subspecies of F. tularensis and the Francisella-like endosymbiont of ticks confirm that the newly detected Francisella strains cluster into the Francisella-like endosymbionts of ticks. Interestingly, the detected Francisella-like endosymbiont, shows a different genotype to that previously isolated from H. marginatum collected in Bulgaria. No specimen was positive for the presence of Rickettsia spp., Coxiella burnetii, Borrelia burgdorferi or M. mitochondrii.

  10. Effect of various levels of dietary Jatropha curcas seed meal on rabbits infested by the adult ticks of Hyalomma marginatum marginatum I. Animal performance, anti-tick feeding and haemogram.

    Science.gov (United States)

    Abdel-Shafy, Sobhy; Nasr, Soad M; Abdel-Rahman, Hashem H; Habeeb, Salwa M

    2011-02-01

    The goal of this study was to investigate the use of Jatropha curcas seed meal (JCSM) in different levels as acaricide in diet of rabbits experimentally infested by Hyalomma marginatum marginatum then determining animal performance, anti-tick feeding and its effects on haemogram of rabbits. Thirty healthy mixed-breed rabbits were randomly divided into five equal groups. The first group was kept as a control fed soya bean meal (20%) as a source of protein. Groups from the second to the fifth fed diets contained 2.5%, 5%, 7.5% and 10% of JCSM instead of soya bean meal as a source of protein, respectively. Feeding and watering were given freely throughout the study. Animal performance for treatment groups were recorded from the 1st week up to the 6th week. Then each group divided into two subgroups, and the ticks were introduced to all of one subgroup and the other kept as control, following them until dropped at the end of the 8th week for all groups of the experiment. Feeding and reproductive performance of the adult tick females were determined. Blood samples were collected and analysed for haematological examination at the 0, 6th and 8th weeks post-treatment from all animals. Result revealed that rabbits received diets containing 5%, 7.5% and 10% had significantly (P Egg mass and reproductive index per female were marked increase (P drop in the group received 7.5% JCSM. Also, monocytosis was recorded in 7.5% and 10% JCSM groups. In conclusion, JCSM could be use in the treatment of ectoparasites at level less than 10% in diet. Further investigations should be done to detoxification the Jatropha seed meal to decrease the level of its toxicity.

  11. Influence of laboratory animal hosts on the life cycle of Hyalomma marginatum and implications for an in vivo transmission model for Crimean-Congo hemorrhagic fever virus

    Directory of Open Access Journals (Sweden)

    Aysen eGargili

    2013-08-01

    Full Text Available Crimean-Congo hemorrhagic fever virus (CCHFV is one of the most geographically widespread arboviruses and causes a severe hemorrhagic syndrome in humans. The virus circulates in nature in a vertebrate-tick cycle and ticks of the genus Hyalomma are the main vectors and reservoirs. Although the tick vector plays a central role in the maintenance and transmission of CCHFV in nature, comparatively little is known of CCHFV-tick interactions. This is mostly due to the fact that establishing tick colonies is laborious, and working with CCHFV requires a biosafety level 4 laboratory (BSL4 in many countries. Nonetheless, an in vivo transmission model is essential to understand the epidemiology of the transmission cycle of CCHFV. In addition, important parameters such as vectorial capacity of tick species, levels of infection in the host necessary to infect the tick, and aspects of virus transmission by tick bite including the influence of tick saliva, cannot be investigated any other way. Here, we evaluate the influence of different laboratory animal species as hosts supporting the life cycle of Hyalomma marginatum, a two-host tick. Rabbits were considered the host of choice for the maintenance of the uninfected colonies due to high larval attachment rates, shorter larval-nymphal feeding times, higher nymphal molting rates, high egg hatching rates and higher conversion efficiency index. Furthermore, we describe the successful establishment of an in vivo transmission model CCHFV in a BSL4 biocontainment setting using interferon knockout mice. This will give us a new tool to study the transmission and interaction of CCHFV with its tick vector.

  12. Influence of laboratory animal hosts on the life cycle of Hyalomma marginatum and implications for an in vivo transmission model for Crimean-Congo hemorrhagic fever virus.

    Science.gov (United States)

    Gargili, Aysen; Thangamani, Saravanan; Bente, Dennis

    2013-01-01

    Crimean-Congo hemorrhagic fever virus (CCHFV) is one of the most geographically widespread arboviruses and causes a severe hemorrhagic syndrome in humans. The virus circulates in nature in a vertebrate-tick cycle and ticks of the genus Hyalomma are the main vectors and reservoirs. Although the tick vector plays a central role in the maintenance and transmission of CCHFV in nature, comparatively little is known of CCHFV-tick interactions. This is mostly due to the fact that establishing tick colonies is laborious, and working with CCHFV requires a biosafety level 4 laboratory (BSL4) in many countries. Nonetheless, an in vivo transmission model is essential to understand the epidemiology of the transmission cycle of CCHFV. In addition, important parameters such as vectorial capacity of tick species, levels of infection in the host necessary to infect the tick, and aspects of virus transmission by tick bite including the influence of tick saliva, cannot be investigated any other way. Here, we evaluate the influence of different laboratory animal species as hosts supporting the life cycle of Hyalomma marginatum, a two-host tick. Rabbits were considered the host of choice for the maintenance of the uninfected colonies due to high larval attachment rates, shorter larval-nymphal feeding times, higher nymphal molting rates, high egg hatching rates, and higher conversion efficiency index (CEI). Furthermore, we describe the successful establishment of an in vivo transmission model for CCHFV in a BSL4 biocontainment setting using interferon knockout mice. This will give us a new tool to study the transmission and interaction of CCHFV with its tick vector.

  13. Ticks (Ixodida) from the collection of the Natural History Department, Museum of Upper Silesia in Bytom, Poland - A contribution to knowledge on tick fauna and the first record of Hyalomma marginatum presence in Poland.

    Science.gov (United States)

    Cuber, Piotr Krzysztof

    2016-06-02

    There is no doubt that museum collections provide a wide variety of information on ticks. The tick collection at the Natural History Department of the Museum of Upper Silesia in Bytom consists only of 37 specimens as the department is focused mainly on building collections of insects and birds. However, this does not mean that such collection cannot contribute to our knowledge about these arthropods. The most valuable results of studies on the museum's tick collection concerned Polish fauna. There are specimens of I. ricinus dating back as far as 1930-1948, which are the first known records of the presence of this tick in the Upper Silesia. Two specimens collected in copula in 1941 might be the earliest record of the mating behaviour of this species in Poland. The most important result was the detection of 2 cases of H. marginatum presence in Poland, which by far are the oldest documented cases of its presence in this country.

  14. DISTRIBUTION AND ECOLOGICAL CHARACTERISTICS OF HYALOMMA IXODID TICKS IN THE ECOSYSTEMS OF THE STAVROPOL REGION

    Directory of Open Access Journals (Sweden)

    V. I. Trukhachev

    2016-01-01

    Full Text Available Aim. To determine the characteristics of the modern dissemination, distribution and seasonal activity of Hyalomma ixodid ticks in the Stavropol region.Methods. The study of the spread of Ixodes Hyalomma ticks was conducted in all administrative districts of the Stavropol Territory in the period of 2000-2015. Collection of ixodid ticks in natural habitats, home to wild mammals and birds, was carried out according to conventional techniques.Results. Hyalomma marginatum is a two-host tick. In the region, H. marginatum of an adult stage becomes active in early spring (late March - early April; appearance of the larvae is observed in early July; the nymphs in the third decade of July. The peculiarity of biological development of H. scupense is the activation of adult species in the cold season (winter; development is only of one-host cycle. The peak number of ticks of an adult stage in cattle falls on the last days of January and February.Conclusion. Hyalomma ixodid ticks in the Stavropol region are distributed mosaicly, with the dominance of some species depending on climatic and landscape-geographical features of the territories they inhabit. The dominant species are H. marginatum and H. scupense, but H. anatolicum tick species occur sporadically in the east region.

  15. First detection of Babesia occultans in Hyalomma ticks from Tunisia.

    Science.gov (United States)

    Ros-García, A; M'Ghirbi, Y; Bouattour, A; Hurtado, A

    2011-04-01

    Descriptions of Babesia occultans have previously been restricted to sub-Saharan Africa. Here, we report the finding, for the first time, of this low or non-pathogenic bovine Babesia species in Tunisia, northern Africa. B. occultans DNA was detected by molecular methods in Hyalomma marginatum unfed ticks collected in 3 bioclimatic regions of Tunisia. The near-full-length 18S rRNA gene was sequenced and compared with related sequences retrieved from GenBank. Phylogenetic analysis indicated that other sequences deposited as Babesia sp. could also correspond to B. occultans, suggesting that this species may have a wide distribution in Mediterranean and Asiatic regions, and not only in sub-Saharan Africa as previously described. A B. occultans-specific Reverse Line Blot (RLB) oligonucleotide probe was designed for future epidemiological studies that would help to clarify this possibility.

  16. A case of multiple keratoacanthoma centrifugum marginatum.

    Science.gov (United States)

    Mangas, Cristina; Bielsa, Isabel; Ribera, Miquel; Fernández-Figueras, Ma Teresa; Ferrándiz, Carlos

    2004-05-01

    Keratoacanthoma centrifugum marginatum is a rare variety of keratoacanthoma, usually presented and classified as solitary keratoacanthoma. Reported cases of multiple keratoacanthoma centrifugum marginatum are exceptional in the literature. A 21-year-old man presented for evaluation of erythematous papules and plaques on both legs that had had a peripheral growth over the past year. Clinical and histologic examination showed typical features of keratoacanthoma centrifugum marginatum. Owing to the multiplicity and size of the lesions, treatment with oral isotretinoin was started. It was ineffective. Subsequent treatment with methotrexate combined with oral prednisone led to the regression of all lesions. The exceptional case of a man with multiple keratoacanthoma centrifugum marginatum is reported. Treatment with methotrexate combined with oral prednisone was effective. This case illustrates how some variants of keratoacanthomas do not really fit into the current classification and how complex the treatment of these tumors is.

  17. ИЗУЧЕНИЕ БИОЛОГО-ЭКОЛОГИЧЕСКИХ ОСОБЕННОСТЕЙ КЛЕЩА СЕМЕЙСТВА IXODIDAE, РОДА HYA-LOMMA H. MARGINATUM

    OpenAIRE

    Амирханова, С.

    2008-01-01

    Изучен жизненный цикл и выживаемость отдельных стадий клеща H. marginatum как в природных, так и в лабораторных условиях. В результате исследований нами уточнены температурные границы активации клеща H. marginatum в Дагестане, сроки превращения стадии личинок в нимф, имаго в зависимости от температурных показателей и степени насыщенности крови самками, влияние температуры на процесс овогенеза....

  18. Chemical examination of the brown alga Stoechospermum marginatum (C. Agardh)

    Digital Repository Service at National Institute of Oceanography (India)

    Wahidullah, S.; DeSouza, L.; Kamat, S.Y.

    The crude methalonic extract of marine algae Stoechospermum marginatum from west coast of India was found to have spasmolytic activity. Search for the pharmacologically active compounds led to the isolation of steroids, fatty acids and an ester...

  19. Erythema Marginatum as an Unusual Presentation for Kawasaki Disease

    Directory of Open Access Journals (Sweden)

    I. Sedighi

    2008-10-01

    Full Text Available Introduction: Kawasaki disease is an acute, systemic vacuity that predominantly manifests in infants and young children. Severe systemic inflammation and vacuities can cause cardiovascular involvement, particularly coronary artery injury that includes dilatation or aneurysm. The final goal of treatment for acute Kawasaki disease، therefore، is to diminish systemic inflammation and vacuities as soon as possible, thereby, preventing progression to coronary artery injury and thrombosis.Case Report: In this report we present a case of Kawasaki disease in a 7-year-old boy with prolonged fever and cervical adenopathy presented with erythema marginatum as a first skin presentation. We treated the patient with intravenous gamma-globulin (IVIG by six day after admission. He developed cardiac and pulmonary involvement two days later.Conclusion: Any skin rash is described in Kawasaki disease except for bullous and vesicular lesions. The common skin manifestation of Kawasaki disease are erythematous and maculopapular rash, although it may appear urticarial, scarlatiniform, erythema multiforme-like, or as erythroderma. Erythema marginatum had a limited differential diagnosis in pediatric patients. The major cause of erythema marginatum is rheumatic fever but there is no report of erythema marginatum in face and cervical region and Kawasaki disease should be considered in differential diagnosis of erythema marginatum in face and neck.

  20. Optimizing of Harpalus rufipes (Coleoptera, Carabidae diet under laboratory conditions

    Directory of Open Access Journals (Sweden)

    D. Y. Reshetniak

    2013-03-01

    Full Text Available Development of the laboratory breeding technology of insects that damage agricultural crops can help in the pest control. Harpalus rufipes (De Geer, 1774 were fed by the following types of products: fresh frozen chicken and pork, cooked sausage "Doctor", cheese "Russian", boiled wheat and buckwheat. In the experiment, 56 adult specimens were kept individually in plastic containers during five days. In the same conditions 8 control test products were placed to determine the percentage of its mass loss due to desiccation. Keeping in a laboratory and feeding of H. rufipes (De Geer by common human food is possible. Throughout the experiment, there were considerable variations in the consumption of food between individuals. Specimens of an average weight of 148.2 ± 45.6 mg consumed daily 71.4 ± 99.4 mg of fresh-frozen chicken and 77.2 ± 112.8 mg of the pork meat (48.1% and 52.1% of the body weight, respectively. Cheese and sausage were consumed in approximately the same amounts (73.1 ± 81.3 and 44.9 ± 66.0 mg daily, or 49.3% and 30.3% of the body weight, respectively. Low protein crop ration (wheat and buckwheat provided the increase of the food intake (103.5 ± 108.5 and 79.8 ± 91.5 mg or 69.9% and 53.9% of the body weight, respectively. Chicken, pork meat and sausage contributed the weight gain, which amounts to about 0.43–0.82 mg (0.29–0.56% of initial body weight. A significant increase in body weight was observed for specimens feed by cheese (the weight gain was 3.14 ± 18.3 mg, 2.12%, by wheat (8.71 ± 21.33 mg, 5.87%, and buckwheat (2.73 ± 13.75 mg, 1.84% of the body weight. Starving individuals of H. rufipes that had an access to drinking water lost 2.6 ± 3.6 mg of the wet weight daily (1.76% of the body weight. That low rate of basal metabolism ensures the species survival during unfavourable parts of the seasons (summer drought, long autumn rains, etc.. Thus, the changes of body weights in imagoes of similar diets are evaluated

  1. Urticaria and Prodromal Symptoms Including Erythema Marginatum in Danish Patients with Hereditary Angioedema

    DEFF Research Database (Denmark)

    Rasmussen, Eva R; Valente de Freitas, Priscila; Bygum, Anette

    2015-01-01

    Erythema marginatum is a characteristic skin rash seen in patients with hereditary angioedema (HAE); however, it can be confused with urticaria, leading to delay in correct diagnosis. The aim of this study was to clarify how often erythema marginatum is misinterpreted as urticaria, potentially...

  2. Urticaria and Prodromal Symptoms Including Erythema Marginatum in Danish Patients with Hereditary Angioedema.

    Science.gov (United States)

    Rasmussen, Eva R; de Freitas, Priscila Valente; Bygum, Anette

    2016-03-01

    Erythema marginatum is a characteristic skin rash seen in patients with hereditary angioedema (HAE); however, it can be confused with urticaria, leading to delay in correct diagnosis. The aim of this study was to clarify how often erythema marginatum is misinterpreted as urticaria, potentially leading physicians to refrain from testing for HAE. Few studies have been published on urticaria and prodromal symptoms in HAE, thus the incidence of these parameters were also investigated. A total of 87 patients affiliated to the national HAE Centre were included. Retrospective and prospective data on skin eruptions and prodromal symptoms were collected. Fifty-six percent of 87 patients had a positive history of erythema marginatum. Half of the patients had experienced erythema marginatum being misinterpreted as urticaria. The most prevalent other prodromal symptoms were other skin symptoms, malaise, psychological changes, fatigue and gastrointestinal symptoms. HAE patients with erythema marginatum have a longer diagnostic delay, presumably caused by misinterpretation of the rash as urticaria.

  3. Behavioural Studies of Harpalus rufipes De Geer: an Important Weed Seed Predator in Northeastern US Agroecosystems

    Directory of Open Access Journals (Sweden)

    Sara Harrison

    2012-01-01

    Full Text Available Harpalus rufipes, a member of the Carabidae, is the most common granivorous invertebrate in Maine agroecosystems. While previous research demonstrated a positive correlation between H. rufipes activity-density and weed seed predation, little is known about the behaviour of this seed predator. We conducted mesocosm experiments to examine seed burial, soil surface conditions, and seed mass effects while tracking H. rufipes movement using a video camera, capture card, and EthoVision software. H. rufipes showed a preference (<0.001, for seeds on the soil surface compared to those half or fully buried. Species with larger seeds were preferred, but Amaranthus retroflexus, which had the smallest seeds, had the highest feeding efficiency (i.e., seeds eaten per distance travelled. Undisturbed soil resulted in highest predation rates, presumably because seeds were easier to detect relative to disturbed soil. Video-tracking measurements of duration within areas of particular seeds, and efficiency of seed predation, indicate that H. rufipes behaviour is prey dependent.

  4. Cytogenetic studies on populations of Camponotus rufipes (Fabricius, 1775) and Camponotus renggeri Emery, 1894 (Formicidae: Formicinae).

    Science.gov (United States)

    Aguiar, Hilton Jeferson Alves Cardoso de; Barros, Luísa Antônia Campos; Alves, Danúbia Rodrigues; Mariano, Cléa Dos Santos Ferreira; Delabie, Jacques Hubert Charles; Pompolo, Silvia das Graças

    2017-01-01

    Two valid ant species, Camponotus rufipes and Camponotus renggeri, have recently been the subject of a broad discussion with reference to taxa synonymization. Both species are quite common among the Neotropical myrmecofauna and share some unique traits, such as the shape of the scape and the pilosity patterns of the tibiae and scapes. A single morphological trait can help distinguish these species; however, only a combination of different approaches can enlighten our view of the complex phylogenetic relationships prevailing in the different populations of these two taxa. Therefore, focusing on the taxonomic issues concerning these two species, a cytogenetic survey including 10 populations of C. rufipes and two populations of C. renggeri was performed. In order to better understand the extent of the relationship between C. rufipes and C. renggeri, two common Neotropical Camponotus species, C. atriceps and C. cingulatus were taken as outgroups. All four species of Camponotus that were studied had 2n = 40 chromosomes (4sm+34st+2t); however, the abundance of chromosome rearrangements observed, combined with several chromosome markers, suggest that C. rufipes and C. renggeri are two good distinct species although closely related. The already reported chromosome translocation 2n = 39 (1m+4sm+32st+2t) for C. rufipes has been found in different populations as in the unprecedented chromosome inversions found both in C. rufipes and in C. renggeri populations. Within the C. renggeri chromosome inversions, both the heterozygous state 2n = 40 (1m+3sm+34st+2t) and the homozygous state, 2n = 40 (2m+2sm+34st+2t) were identified. However, only heterozygous specimens for chromosome inversions were found among C. rufipes, with karyotype configurations distinct from those found in C. renggeri, with 2n = 40 (1m+4sm+34st+2t). None of the populations studied showed signs of mosaic individuals. With respect to rDNA clusters, the 18S rDNA seemed to be more restricted inside the genome, as

  5. Distribution and ecology of ticks (Acari: Ixodidae) infesting livestock in Tunisia: an overview of eighth years field collections.

    Science.gov (United States)

    Bouattour, A; Darghouth, M A; Daoud, A

    1999-09-01

    Ticks (Ixodidae) play a significant role as vectors of pathogens of domestic animals in Tunisia. The major losses caused by ticks are related to transmission of protozoan parasites. These include agents of tropical theileriosis and babesiosis in ruminants. Since 1991, we conducted research studies on tick population of livestock in Tunisia. This overview reports a synthesis on tick distribution, their biology and their role as vectors of pathogens in domestic animals, particularly cattle. During the whole period of the study about 15,000 tick specimens were collected from different zones of the country. A total of 14 species were identified. Hyalomma detritum detritum was the most abundant and important (vector of Theileria annulata) species infesting cattle. Hyalomma dromedarii and Hyalomma impeltatum were collected on domestic ruminants in the arid and desertic zones. Hyalomma marginatum marginatum and Hyalomma anatolicum excavatum were widespread and found on livestock hosts. Ixodes ricinus, vector of Babesia divergens and Borrelia burgdorferi sl, colonises mainly the humid zone. Boophilus annulatus and Rhipicephalus bursa infesting cattle, sheep and goats were found in the sub-humid and semi-arid zones. Haemaphysalis sulcata and Hae. punctata were collected in humid and sub-humid zones on cattle and sheep. Rhipicephalus turanicus were collected in different regions, on different animal species. Rhipicephalus sanguineus, tick of dogs, were often collected on livestock. Only few specimens of Hyalomma marginatum rufipes and Hyalomma franchinii were collected.

  6. Urticaria and Prodromal Symptoms Including Erythema Marginatum in Danish Patients with Hereditary Angioedema

    DEFF Research Database (Denmark)

    Rasmussen, Eva R; Valente de Freitas, Priscila; Bygum, Anette

    2016-01-01

    Erythema marginatum is a characteristic skin rash seen in patients with hereditary angioedema (HAE); however, it can be confused with urticaria, leading to delay in correct diagnosis. The aim of this study was to clarify how often erythema marginatum is misinterpreted as urticaria, potentially...... leading physicians to refrain from testing for HAE. Few studies have been published on urticaria and prodromal symptoms in HAE, thus the incidence of these parameters were also investigated. A total of 87 patients affiliated to the national HAE Centre were included. Retrospective and prospective data...... on skin eruptions and prodromal symptoms were collected. Fifty-six percent of 87 patients had a positive history of erythema marginatum. Half of the patients had experienced erythema marginatum being misinterpreted as urticaria. The most prevalent other prodromal symptoms were other skin symptoms, malaise...

  7. Marks caused by the scavenging activity of Necrobia rufipes (Coleoptera: Cleridae) under laboratory conditions.

    Science.gov (United States)

    Zanetti, Noelia I; Visciarelli, Elena C; Centeno, Néstor D

    2015-07-01

    Insects are an important group involved in carrion consumption and are thus of forensic interest. In the laboratory we studied the taphonomic marks that Necrobia rufipes (Cleridae) can produce. Pig trotters were exposed to adult beetles at 21 ± 3 °C and 12:12 h day/night cycle. We made observations and took photographs every 4-5 days for 12 months. Marks were noted after a month. We found scratches, pits, holes, and tunnels in several kinds of tissue such as integumental, connective and muscular. This work contributes preliminary data of significant application in biology, ecology, anthropology and forensics. Until now, no study has provided taphonomic information with N. rufipes. Copyright © 2015 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  8. Structure and antiviral activity of sulfated fucans from Stoechospermum marginatum.

    Science.gov (United States)

    Adhikari, Utpal; Mateu, Cecilia G; Chattopadhyay, Kausik; Pujol, Carlos A; Damonte, Elsa B; Ray, Bimalendu

    2006-11-01

    A sulfated fucan containing fraction (SmWE) was isolated from water extract of the brown seaweed Stoechospermum marginatum collected from the Arabian Sea. Anion exchange chromatography of the crude fraction results in the production of a sulfated fucan (F3) having a molecular mass of 40 kDa and specific rotation [alpha]D(30) - 124 degrees (c 0.5, H2O). NMR spectroscopic studies and methylation analysis suggested that the polymer consists of a backbone of (1-->4)- and (1-->3)-linked-alpha-L-fucopyranosyl residues that are substituted at C-2 and C-3, and that fucosyl residues are sulfated mostly at C-2 and/or C-4. SmWE and F3 were selective inhibitors of herpes simplex virus type 1 (strain F, thymidine kinase-deficient strains field and B2006 and syncytial variants arising after selection with a natural carrageenan syn 13-8 and 14-1) and type 2 (strain MS) in Vero cells, with antiviral effective concentration 50% (EC50) values in the range 0.63-10.0 microg/ml. The compounds were highly selective due to the lack of cytotoxicity. The antiviral activity was dependent on the presence of the sulfated fucans during the adsorption period. No direct inactivating effect on virions was observed in a virucidal assay. The absence of anticoagulant activity at concentrations near EC50 confirmed that there was no correlation between the antiviral and anticoagulant properties.

  9. Seasonal dynamic of the occurrence of the gregarines infection of Harpalus rufipes (Coleoptera, Carabidae in agroecosystem

    Directory of Open Access Journals (Sweden)

    D. Y. Reshetnyak

    2015-08-01

    Full Text Available Relationships in the “parasite-host” system are closely interrelated and occur at all levels from the molecular to behavioral and population ones. There are two models of realization of these relations. The first case is when the parasites are uniformly distributed in the host population. High extensiveness of invasion is accompanied by its low intensity. The second case is when a part of host population is infected with parasites, but the negative impact is manifested to the maximum extent. Invasion of the ground beetle Harpalus rufipes (De Geer, 1774, dwelling in sweet corn agroecosystems located in the vicinity of Dnipropetrovsk near Doslidnoe village, by several gregarines species is investigated in this study. H. rufipes is an abundant, ubiquitous species, living in extremely wide range of terrestrial ecosystems, with especially high populations inhabiting anthropogenically transformed environments. H. rufipes has a wide range of feeding. This species is distributed in the Central and Eastern Europe, and introduced to North America. Gregarines were found in the intestines of 20 individuals of H. rufipes from 190 (10.5%: Gregarina ovata Dufour, 1828, G. steini Berndt, 1902, G. amarae (Hammerschmidt, 1839 Frantzius, 1848, Clitellocephalus ophoni (Tuzet and Ormieres, 1956 Clopton, 2002, Torogregarina sphinx Clopton, 1998, Gigaductus macrospora Filipponi, 1948 and G. elongatus (Moriggi, 1943 Filipponi, 1948. There is high level of infestation of C. ophoni and G. steini. At the same time, not more than three species of the gregarines were localized in the beetle body. Seasonal dynamic of occurrence of the gregarines is as follows. Maximal indices of occurrence are found at the end of August (22.2% and minimal ones at the end of June (4.8%. The highest total number of gregarines (383 ind. is recorded at the end of August, the lowest one is fixed at the beginning of September (33 ind.. Indices of gregarine species dominance are as follows

  10. Identification of rickettsial pathogens in ixodid ticks in northern Senegal.

    Science.gov (United States)

    Sambou, Masse; Faye, Ngor; Bassène, Hubert; Diatta, Georges; Raoult, Didier; Mediannikov, Oleg

    2014-09-01

    The spotted fevers, caused by the Rickettsia bacteria, are a group of emerging diseases that are responsible for significant human morbidity. In Africa, the distribution of different species of Rickettsia in their tick vectors is poorly studied. We have collected 1169 hard ticks from 5 different species in the northern Senegal, close to the Saharan border. In a far northern collection site, corresponding to the Rickettsia africae distribution area, we collected three Amblyomma variegatum ticks infected by R. africae. Rickettsia africae was also identified in a Hyalomma marginatum rufipes tick, which may represent the secondary host for the pathogen. Rickettsia aeschlimannii was identified in H. m. rufipes, Rhipicephalus evertsi evertsi, and Hyalomma impeltatum ticks.

  11. Morphometric Study on Male Specimens of Hyalomma anatolicum (Acari: Ixodidae in West of Iran

    Directory of Open Access Journals (Sweden)

    A Hosseini

    2011-12-01

    Conclusion: Morphometric variation in Hyalomma spp is poorly studied. The variation in range and quantity of the mor­phometric parameters of H.anatolicum ‎underlies that the correct recognition and key construction for Hyalomma spe­cies dependes ‎on a complement morphometric study on the other species.

  12. On the potential roles of ticks and migrating birds in the ecology of West Nile virus

    Directory of Open Access Journals (Sweden)

    Karl Hagman

    2014-01-01

    Full Text Available Background: Mosquitoes are the primary vectors of West Nile virus (WNV. Ticks have, however, been suggested to be potential reservoirs of WNV. To investigate their role in the spread of the virus, ticks, which had been collected from birds migrating northward from Africa to Europe, were analyzed for the potential presence of WNV RNA. Methods: On the Mediterranean islands of Capri and Antikythira, a total of 14,824 birds were captured and investigated from which 747 ticks were collected. Results and conclusions: Most of the identified ticks (93% were nymphs and larvae of Hyalomma marginatum sensu lato (s.l., most of which were or appear to be Hyalomma rufipes. Of these ticks, 729 were individually screened for WNV RNA. None of the ticks was found to be WNV positive. Thus, there was no evidence that H. marginatum s.l. ticks play a role in the spread of WNV from Africa to Europe.

  13. Anti-proliferative and angio-suppressive effect of Stoechospermum marginatum (C. Agardh) Kutzing extract using various experimental models.

    Digital Repository Service at National Institute of Oceanography (India)

    Vinayak, R.C.; Puttananjaiah, S.; Chatterji, A.; Salimath, B.

    , hindering the recognition of competent dietary-based chemo preventive approaches. The aim of this research was to establish the antiproliferative potency and angiosuppressive mode of action of Stoechospermum marginatum seaweed methanolic extract using...

  14. Trail-Laying Behaviour as a Function of Resource Quality in the Ant Camponotus rufipes

    Directory of Open Access Journals (Sweden)

    Pablo E. Schilman

    2011-01-01

    Full Text Available Chemical trails have been shown to act as an orientation cue in some ant species. Here, I report that the trail-laying behaviour in the nectar-feeding ant, Camponotus rufipes, varies with the concentration of the sucrose solutions collected. Single workers collected solutions of different sucrose concentrations (5%, 20%, and 40% in weight during 4 consecutive visits to the resource, and their trail-marking behaviour was recorded on soot-coated slides during their first and last visits. Results suggest that these chemical trails provide both an orientation cue between the nest and the food source, as previously suggested for Camponotus ants, as well as information about food quality.

  15. Hyalomma anatolicum anatolicum and Hyalomma dromedarii (Acari: Ixodidae) imbibe bovine blood in vitro by utilizing an artificial feeding system.

    Science.gov (United States)

    Tajeri, S; Razmi, G R

    2011-08-25

    Hard ticks have great importance because of blood feeding and transmitting dangerous human and animal diseases. Each year, they cause a lot of economical damage to the livestock industry. Control of ticks and tick-borne diseases is a major priority in most parts of the world and many studies have been done in this field. We know that studying haemoparasites and assessing the effect of different compounds on ticks requires a lot of money, support and sometimes it is time consuming. Considering all of these problems, today, in some research laboratories throughout the world, artificial in vitro feeding of ticks has become common. Development and application of such methods provide a cheap and accessible background for investigating haemoparasitic diseases under controlled conditions. For the first time we report successful in vitro feeding of two important ixodid ticks of the genus Hyalomma. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. Transstadial transmission of Borrelia turcica in Hyalomma aegyptium ticks.

    Science.gov (United States)

    Kalmár, Zsuzsa; Cozma, Vasile; Sprong, Hein; Jahfari, Setareh; D'Amico, Gianluca; Mărcuțan, Daniel I; Ionică, Angela M; Magdaş, Cristian; Modrý, David; Mihalca, Andrei D

    2015-01-01

    Borrelia turcica comprises the third major group of arthropod-transmitted borreliae and is phylogenetically divergent from other Borrelia groups. The novel group of Borrelia was initially isolated from Hyalomma aegyptium ticks in Turkey and it was recently found in blood and multiple organs of tortoises exported from Jordan to Japan. However, the ecology of these spirochetes and their development in ticks or the vertebrate hosts were not investigated in detail; our aims were to isolate the pathogen and to evaluate the possibility of transstadial transmission of Borrelia turcica by H. aegyptium ticks. Ticks were collected from Testudo graeca tortoises during the summer of 2013 from southeastern Romania. Engorged nymphs were successfully molted to the adult stage. Alive B. turcica was isolated from molted ticks by using Barbour-Stoenner-Kelly (BSK) II medium. Four pure cultures of spirochetes were obtained and analyzed by PCR and sequencing. Sequence analysis of glpQ, gyrB and flaB revealed 98%-100% similarities with B. turcica. H. aegyptium ticks collected from T. graeca tortoises were able to pass the infection with B. turcica via transstadial route, suggesting its vectorial capacity.

  17. Reproductive Behavior and Basic Biology of the Oriental Bamboo-Inhabiting Anoplomus rufipes and a Comparison with Frugivorous Dacinae Fruit Flies

    Science.gov (United States)

    Kovac, Damir

    2015-01-01

    The reproductive behaviors and mating systems of the fruit-infesting species of the Dacinae tribes Ceratitidini and Dacini are increasingly well understood, while in the non-frugivorous tribe Gastrozonini, data are lacking. In the present study, the reproductive behavior of Anoplomus rufipes from North Thailand was studied in the field, other behaviors also in the laboratory. A. rufipes mated on young bamboo plants growing in areas destroyed by fire. Exudates of extrafloral nectaries produced by the young bamboo plants provided food for the females. Factors affecting the choice of the mating site were favorable microclimatic conditions and food. Courtship behavior was performed on the upper sides of bamboo leaves and included pheromone calling (abdominal elevation, anal pouch eversion, abdominal pleural distention), anal dabbing, looping flights and a specific lofting/body swaying behavior. The males searched individually for females or formed leks containing up to four males. The reproductive behaviors and lek formation of A. rufipes are compared to other Dacinae (Ceratitis, Bactrocera), and their functions are discussed. Hitherto unknown data on the general biology of A. rufipes are also included. A. rufipes larvae infested living bamboo shoots of Cephalostachyum pergracile, and the observed behaviors of the adults included locomotion, grooming, feeding, oral droplet deposition, bubbling and agonistic behavior. PMID:26512699

  18. Sydenham's chorea and erythema marginatum as the first clinical presentation of acute rheumatic fever

    Directory of Open Access Journals (Sweden)

    Farhang Babamahmoodi

    2009-01-01

    Full Text Available (Received 5 February, 2009 ; Accepted 13 Jan, 2010AbstractAcute rheumatic fever is an acute systemic disease due to autoimmune reaction against some of BHSA. Similarity between bacterial antigens and cardiaciovascular tissue, synovial membrane, joints and subcutaneous tissues and cerebral basal ganglions are the causes of autoimmune reactions and manifestation of the disease. Most of the ARF occur in children (5-14 years old followed by streptococcal pharyngitis and the disease is very rare in adults.Sydenham's chorea is a late manifestation of ARF and one of the John's diagnostic criteria that is usually revealed when the other criteria are absent. There is often a long latent period between clinical manifestations of the ARF and the onset of chorea as an uncommon initial presentation of acute rheumatic fever. We report the clinical findings, investigations and the course of clinical development of a seventeen-year-old girl, who presented with acute onset of abnormal involuntary movements in her right hand for two days before her admission. She had sore throat and fever three weeks before development of these new problems. Her complaints disappeared with proper treatment. The considerable findings in this case report was co-incidence of Sydenham's chorea with erythema marginatum, fever, severe mitral valve insufficiency, arthralgia in an adult patient that is a very rare case. She was discharged after a 10-day treatment regime.Key words: Acute rheumatic fever, sydenham's chorea, erythema marginatumJ Mazand Univ Med Sci 2009; 20(74: 91-97 (Persian.

  19. Morphometric Study on Male Specimens of Hyalomma Anatolicum (Acari: Ixodidae in West of Iran

    Directory of Open Access Journals (Sweden)

    M Abdigoudarzi

    2011-12-01

    Full Text Available Background: Hyalomma anatolicum is the well-known hard tick, which is one of the most important livestock and hu­man pathogens vector, wide range in host and distributed in all over the Hyalomma geographic fauna as well as in Iran. Taxonomy of the Hyalomma ssp. is debatable whereas their identification is a problematic work. The reasons for this claim is time consuming Delpy’s researches in Iran also Schulze School, Feldman-Muhsam and the Russian tick workers. We would like to understand morphometric variation in the field collected H. anatolicum in Iran also validat­ing some morphologic quantitative and qualitative characters.Methods: A total 247 field-collected tick specimens from different geographical regions in west of Iran includes Khuzestan and Lorestan Provinces were studied. The morphologic characters of the ticks were measured by the cali­brated stereomicroscope ‎armed scaled lens. The measurements were analyzed using SPSS ‎for windows, version 16 on an IBM PC, ‎so varied shapes of species in different geographic ‎regions were drawn by the ‎aid of a drawing tube con­nected to a light stereomicroscope.‎Results: One way ANOVA test revealed significant differences among the quantitative parameters in five zones (P<‎‎ 0.‎‎00‎‎1‎ also each zone to other zone by Post Hoc Tests e.g. LSD. No significant differences in the lateral grooves length/conscutum length ratio parameter were found.Conclusion: Morphometric variation in Hyalomma spp is poorly studied. The variation in range and quantity of the mor­phometric parameters of H.anatolicum ‎underlies that the correct recognition and key construction for Hyalomma spe­cies dependes ‎on a complement morphometric study on the other species.

  20. Preliminary survey of ticks (Acari : Ixodidae on cattle in northern Sudan

    Directory of Open Access Journals (Sweden)

    D.A. Salih

    2004-11-01

    Full Text Available In a cross sectional survey conducted during the period June 2001 to July 2002, the geographical distribution of ticks on cattle in the Sudan was determined. Seventeen locations were surveyed from Northern, Central, Eastern, Western, Blue Nile and White Nile Provinces. Total body collections of ticks were made from 20 cattle at each location. Four tick genera and 11 species were identified. The tick species collected included Amblyomma lepidum, Amblyomma variegatum, Boophilus decoloratus, Hyalomma anatolicum anatolicum, Hyalomma dromedarii, Hyalomma impeltatum, Hyalomma marginatum rufipes, Hyalomma truncatum, Rhipicephalus evertsi evertsi, Rhipicephalus sanguineus group and Rhipicephalus simus simus. Major ecological changes have occurred due to extensive animal movement, deforestation, desertification and establishment of large mechanized agricultural schemes. These factors have certainly affected the distribution of ticks and tick-borne diseases in the Sudan. The absence of A. variegatum and A. lepidum in northern Sudan was not surprising, since these tick species are known to survive in humid areas and not in the desert and semi-desert areas of northern Sudan. The absence of B. annulatus in northern and central Sudan is in accordance with the finding that this tick species is restricted to the southern parts of the central Sudan. The presence of H. anatolicum anatolicum in Um Benin in relatively high abundance is an interesting finding. The present finding may indicate that the southern limit of this species has changed and moved southwards to latitude 13o N. It is concluded that major changes in tick distribution have taken place in the Sudan

  1. Keratoacanthoma centrifugum marginatum: unresponsive to oral retinoid and successfully treated with wide local excision.

    Directory of Open Access Journals (Sweden)

    Kapildev Das

    2010-01-01

    Full Text Available We describe a case of a 65-year-old male presenting with a large plaque with a rolled-out interrupted margin, atrophic center, and island of normal skin over the left arm. It grew peripherally with central healing, and there was a history of recurrence after inadequate excision. Investigations ruled out other clin­ical mimickers; namely, squamous cell carcinoma, lupus vulgaris, botryomycosis, and blastomycosis-like pyoderma. Histopathological sections showed irregularly shaped craters filled with keratin and epithelial pearl but no evidence of granuloma or cellular atypia. Clinico­pathological correlation proved the lesion to be keratoacanthoma centrifugum marginatum (KCM, a rare variant of keratoacanthoma, which spreads centrifugally, attains a huge size, and never involutes spontaneously. Treatment of KCM has been a problem always and, in our case, systemic retinoid (acitretin for three months proved ineffective. The patient also had a history of recurrence following surgical intervention previously, necessitating wide excision to achieve complete clearance of tumor cells. Hence, after failure of retinoid therapy, the decision of excision with a 1-centimeter margin was taken and the large defect was closed by a split thickness skin graft. The graft uptake was satisfactory, and the patient is being followed-up presently and shows no signs of recurrence after six months, highlighting wide local excision as a useful treatment option.

  2. Genetic relationship among Camponotus rufipes Fabricius (Hymenoptera: Formicidae nests by RAPD molecular markers - doi: 10.4025/actascibiolsci.v35i1.10913

    Directory of Open Access Journals (Sweden)

    Alexandre Wagner Silva Hilsdorf

    2012-12-01

    Full Text Available Random amplified polymorphic DNA (RAPD markers were used to investigate the genetic relationship among nests of the carpenter ant, Camponotus rufipes, located in the same area. Five random oligodecamers were used to amplify DNA from 108 ant workers collected from six nests. A total of 47 RAPD markers were identified, which revealed low levels of genetic differentiation among nests (Fst = 0.00218 and a low average Shannon index (0.3727 among workers within nests. These results together suggest that the C. rufipes nest may be formed by a single, once-mated queen and that nests produced by queens that are genetically related tend to keep their nests in close proximity to one other.

  3. Variations in free radical scavenging activities and antioxidant responses in salivary glands of Hyalomma anatolicum anatolicum and Hyalomma dromedarii (Acari: Ixodidae ticks

    Directory of Open Access Journals (Sweden)

    Mayukh Ghosh

    2014-10-01

    Full Text Available Aim: Hyalomma anatolicum anatolicum and Hyalomma dromedarii ticks are of major economic importance in the livestock sector as the vector of tropical theileriosis causing huge production loss, mostly in tropical countries. The release of different reactive oxygen and nitrogen species by exogenous and endogenous means can potentially induce oxidative damage to the ticks during their prolonged feeding on their vertebrate hosts. Hence, ticks need an effective free radical scavenging and antioxidant defense system for their successful feeding of a blood meal. Therefore, the present study was undertaken to evaluate the interspecies variations in antioxidant response, free radical scavenging, and anti-inflammatory activities in salivary gland extracts (SGE of the two species as they differ considerably in relation to feeding behavior and host specificity. Materials and Methods: Tick salivary glands were dissected out under ice from semi-fed female ticks of both the species and homogenized at low temperature to prepare SGE. SGE was stored at −40°C for analysis of free radical scavenging activities and antioxidant status. Results: Significant depletion in reduced glutathione concentrations, malondialdehyde level and elevation in free radical scavenging activity, superoxide dismutase, anti-inflammatory activity were found in SGE of engorging female H. dromedarii ticks as compared to H. a. anatolicum. Conclusion: Higher antioxidant status and free radical scavenging activities in H. dromedarii might have enabled these ticks to suck more blood from the host in spite of continuous host’s immune responses. These findings about tick biology will help in improving tick control strategies.

  4. A review of Hyalomma scupense (Acari, Ixodidae in the Maghreb region: from biology to control

    Directory of Open Access Journals (Sweden)

    2014-01-01

    Full Text Available Hyalomma scupense (syn. Hyalomma detritum is a two-host domestic endophilic tick of cattle and secondarily other ungulates in the Maghreb region (Africa. This species transmits several pathogens, among which two are major livestock diseases: Theileria annulata and Theileria equi. Various other pathogens are also transmitted by this tick species, such as Anaplasma phagocytophilum and Ehrlichia bovis. Hyalomma scupense is common in sub-humid and semi-arid areas of several regions in the world, mainly in the Maghreb region. In this region, adults attach to animals during the summer season; larvae and nymphs attach to their hosts during autumn, but there is a regional difference in H. scupense phenology. There is an overlap between immature and adult ticks, leading in some contexts to a dramatic modification of the epidemiology of tick-borne diseases. This tick species attaches preferentially to the posterior udder quarters and thighs. Tick burdens can reach 130 ticks per animal, with a mean of 60 ticks. Calves are 70 times less infested than adult cattle. The control can be implemented through six options: (i rehabilitation of the farm buildings by roughcasting and smoothing the outer and inner surfaces of the enclosures and walls. This control option should be recommended to be combined with a thorough cleaning of the farm and its surrounding area. With regard to Theileria annulata infection, this control option is the most beneficial. (ii Acaricide application to animals during the summer season, targeting adults. (iii Acaricide application during the autumn period for the control of the immature stages. (iv Acaricide application to the walls: many field veterinarians have suggested this option but it is only partially efficient since nymphs enter deep into the cracks and crevices. It should be used if there is a very high tick burden or if there is a high risk of tick-borne diseases. (v Manual tick removal: this method is not efficient since the

  5. Facial nerve paralysis due to intra-aural Hyalomma tick infestation.

    Science.gov (United States)

    Doğan, Müzeyyen; Devge, Cem; Tanrıöver, Ozlem; Pata, Yavuz Selim; Sönmezoğlu, Meral

    2012-01-01

    We present the case of a 33 year-old man from a village of the north-eastern part of central Anatolia admitted to the otolaryngology department of Yeditepe University Hospital with right facial asymmetry and pain on the right ear. A tick of the genus Hyalomma was observed in the external auditory canal of the right ear and it was removed with fine cup forceps under otomicroscopy. We are of the opinion that in patients presenting with sudden acute ear pain and facial palsy, the ear canal should be examined to exclude an infestation by ticks.

  6. Anti-inflammatory and antinociceptive effects of hydroalcoholic extract from Pseudobombax marginatum inner bark from caatinga potiguar.

    Science.gov (United States)

    Paiva, Dayane Carla Costa; dos Santos, Cliomar Alves; Diniz, Jaécio Carlos; Viana, Francisco Arnaldo; Thomazzi, Sara Maria; Falcão, Dayseanne Araujo

    2013-09-16

    The Pseudobombax marginatum (St Hil) Rob., Malvaceae, is mentioned in ethnobotanical studies. It is used as anti-inflammatory, for ulcers and gastritis, and back pain. To evaluate anti-inflammatory and antinociceptive activities a hydroalcoholic extract (HE) from inner bark was prepared. For the anti-inflammatory activity, carrageenan-induced paw edema and peritonitis models, and also myeloperoxidase assay were used. For the antinociceptiva activity acetic acid-induced writhing, hot plate and formalin tests were employed. The HE extract exhibited an intense inhibition in carrageenan-induced edema model and also in myeloperoxidase activity at the doses of 100 and 300 mg/kg. The leukocyte migration into the peritoneal cavity was also inhibited at the doses of 30, 100 and 300 mg/kg. A similar profile was observed against acid-induced abdominal contortions and in formalin second phase test at the doses of 30 and 100 mg/kg, but this treatment did not affect the behavior of animals in the hot plate test. The experimental data of the HE from Pseudobombax marginatum show anti-inflammatory and antinociceptiva activities, confirming the indication from traditional medicine; however further studies are required to define and isolate the active anti-inflammatory and antinociceptiva components from this active specie. © 2013 Elsevier Ireland Ltd. All rights reserved.

  7. Nutrient Content, Phytonutrient Composition, Alpha Amylase, Alpha Glucosidase Inhibition Activity and Antioxidant Activity of the Stoechospermum Marginatum Collected in Pre Monsoon Season

    Directory of Open Access Journals (Sweden)

    Reka Palanivel

    2017-03-01

    Full Text Available The objective of this study was to investigate the nutrient content, phytonutrient composition, physicochemical properties, alpha amylase and alpha glucosidase inhibition activity and antioxidant activity of the brown algae Stoechospermum marginatum collected from Gulf of Mannar, Tamil Nadu, India in pre monsoon season (June- September, 2015. Six and eight hours of ethanol and aqueous extract of Stoechospermum marginatum were used for phytonutrient screening, alpha amylase, alpha glucosidase inhibition activity and antioxidant activity. From the results of the study it is understood that Stoechospermum marginatum contain a high amount of carbohydrate, protein, crude fiber and phytonutrients like tannin, flavonoid, saponin, alkaloid, terpenoids, steroid and total phenolic content. The physicochemical properties namely Water absorption and Swelling power were very promising. Alpha amylase and alpha glucosidase inhibition activity was recorded to be high in both aqueous and ethanol extracts of eight hour extraction than in extracts taken from six hours extraction. Antioxidant activity was detected using DPPH, FRAP, beta carotene scavenging and H2O2 assay and found to have a high radical scavenging activity. Stoechospermum marginatum possess a valuable amount of total phenolic content and other phytonutrients and physicochemical properties, it may the reason for the potential inhibition of alpha amylase, alpha glucosidase and antioxidant activity. It is concluded from the study that the brown algae may be incorporated into foods to enhance their nutritional and therapeutic value.

  8. Toxicity of essential oils of Piper marginatum Jacq. against Tetranychus urticae Koch and Neoseiulus californicus (McGregor

    Directory of Open Access Journals (Sweden)

    Nicolle Ribeiro

    2016-03-01

    Full Text Available Tetranychus urticae Koch (Acari: Tetranychidae is an economically important pest of agricultural and ornamental crops worldwide. It has been shown that many of natural plant-based pesticides have fewer side effects compared with synthetic chemicals. The essential oils of plants have been broadly studied for pest-control, including toxic and repellent effects, antifeedant, ovicidal, and other properties. Essential oils from stems, flowers, and leaves of Piper marginatum Jacq. were evaluated in the laboratory regarding their acaricidal potential against the two-spotted spider mite (T. urticae and the results were compared with eugenol as a positive control. The oils were also evaluated with regard to the susceptibility of the natural enemy of T. urticae (Neoseiulus californicus McGregor. Based on LC50 estimates, oils from stems and flowers exhibited the same toxicity and differed significantly from the leaf oil with LC50 0.37, 0.56, and 3.77 μL L-1, respectively. None of the oils tested exhibited toxicity greater than or equal to that of the positive control. The oil mortality rate was significantly lower for N. californicus (50% to 70% than for T. urticae (> 95%. The P. marginatum oils also deterred oviposition. Among the chemical constituents tested, sesquiterpenes were more toxic with an LC50 of 2.89 μL L-1 than phenylpropanoids Z-asarone and E-asarone with LC50 6.64 and 8.51 μL L-1, respectively. The acaricidal properties, oviposition deterrence and selectivity make these oils strong candidates for use as the active ingredient in a plant-based acaricidal agent.

  9. Metarhizium anisopliae as a biological control agent against Hyalomma anatolicum (Acari: Ixodidae).

    Science.gov (United States)

    Suleiman, Elham A; Shigidi, M T; Hassan, S M

    2013-12-15

    In the Sudan, ticks and Tick-borne Diseases (TBDs) with subsequent costs of control and treatment are causing substantial economic loss. Control of ticks is mainly by chemical insecticides. The rising environmental hazards and problem of resistance has motivated research on biological agents as alternative methods of control. The present study aims at controlling livestock ticks using fungi for their unique mode of action besides their ability to adhere to the cuticle, to germinate and penetrate enzymatically. The study was conducted to evaluate the fungus Metarhizium anisopliae for tick control as an alternative mean to chemical acaricides. Pathogenicity of the fungus was tested on different developmental stages of the tick Hyalomma anatolicum. The fungus induced high mortality to flat immature stages. It, also, affected reproductive potential of the females. Egg laid, hatching percent, fertility and moulting percent of immature stages were significantly (p anisopliae to control ticks is discussed.

  10. Natural infection rates and transmission of Theileria annulata by Hyalomma anatolicum anatolicum ticks in the Sudan

    Directory of Open Access Journals (Sweden)

    D.A. Salih

    2005-09-01

    Full Text Available Hyalomma anatolicum anatolicum nymphs were collected from two localities in the Sudan: Eddamer in Northern Sudan and Wad-Medani in Central Sudan. They were allowed to moult to adult ticks, which were assessed for Theileria infection in their salivary glands using Feulgen stain. At Eddamer, 49.6 % of 123 ticks examined were infected with Theileria and the mean intensity of infection was 1.3 (i.e. the number of infected acini / number of infected ticks. At Wad-Medani, 8.6 % of 162 ticks were infected and the mean intensity of infection was 7.9. The prevalence of infection was higher in female than in male ticks at both localities. When adult H. a. anatolicum were applied onto two susceptible calves, both animals developed the severe form of theileriosis.

  11. Rickettsia africae in Hyalomma dromedarii ticks from sub-Saharan Algeria.

    Science.gov (United States)

    Kernif, Tahar; Djerbouh, Amel; Mediannikov, Oleg; Ayach, Bouhous; Rolain, Jean-Marc; Raoult, Didier; Parola, Philippe; Bitam, Idir

    2012-12-01

    Spotted fever group (SFG) rickettsioses are caused by obligate, intracellular Gram-negative bacteria of the genus Rickettsia. In recent years, several species and subspecies of rickettsias have been identified as emerging pathogens throughout the world, including sub-Saharan Africa. We report here the detection of Rickettsia africae, the agent responsible for African tick-bite fever, by amplification of fragments of gltA and ompA genes and multi-spacer typing from Hyalomma dromedarii ticks collected from the camel Camelus dromedarius in the Adrar and Béchar region (sub-Saharan Algeria). To date, R. africae has been associated mainly with Amblyomma spp. The role of H. dromedarii in the epidemiology of R. africae requires further investigation.

  12. Pro-toxic 1,2-Dehydropyrrolizidine alkaloid esters, including unprecedented 10-membered macrocyclic diesters, in the medicinally-used Alafia cf. caudata and Amphineurion marginatum (Apocynaceae: Apocynoideae: Nerieae and Apoc

    Science.gov (United States)

    The attraction of pyrrolizidine alkaloid-pharmacophagous insects indicated the presence of pro-toxic dehydropyrrolizidine alkaloids in Alafia cf. caudata Stapf (Nerieae: Alafinae) and Amphineurion marginatum (Roxb.) D.J. Middleton (Apocyneae: Amphineuriinae). Subsequently, monoesters of retronecine ...

  13. 小亚璃眼蜱和亚洲璃眼蜱对环形泰勒虫传播能力的研究%Studies on ability to transmit Theileria annulata with Hyalomma anatolicum anatolicum and Hyalomma asiaticum asiaticum

    Institute of Scientific and Technical Information of China (English)

    罗建勋; 殷宏; 关贵全; 马米玲; 张其才; 吕文顺

    2003-01-01

    将实验室培养的小亚璃眼蜱(Hyalomma anatolicum anatolicum)和亚洲璃眼蜱(Hyalomma asiaticum asiaticum)清洁幼虫和若虫饲喂于感染环形泰勒虫的牛体,收集饱血幼虫和若虫,用所孵化的若虫和成虫感染试验牛.结果显示,小亚璃眼蜱幼虫、若虫阶段感染,所发育之若虫、成虫均可传播环形泰勒虫;而亚洲璃眼蜱各阶段的传播试验结果均为阴性.

  14. Two cold-sensitive neurons within one sensillum code for different parameters of the thermal environment in the ant Camponotus rufipes.

    Science.gov (United States)

    Nagel, Manuel; Kleineidam, Christoph J

    2015-01-01

    Ants show high sensitivity when responding to minute temperature changes and are able to track preferred temperatures with amazing precision. As social insects, they have to detect and cope with thermal fluctuations not only for their individual benefit but also for the developmental benefit of the colony and its brood. In this study we investigate the sensory basis for the fine-tuned, temperature guided behaviors found in ants, specifically what information about their thermal environment they can assess. We describe the dose-response curves of two cold-sensitive neurons, associated with the sensillum coelocapitulum on the antenna of the carpenter ant Camponotus rufipes.One cold-sensitive neuron codes for temperature changes, thus functioning as a thermal flux-detector. Neurons of such type continuously provide the ant with information about temperature transients (TT-neuron). The TT-neurons are able to resolve a relative change of 37% in stimulus intensity (ΔT) and antennal scanning of the thermal environment may aid the ant's ability to use temperature differences for orientation.The second cold-sensitive neuron in the S. coelocapitulum responds to temperature only within a narrow temperature range. A temperature difference of 1.6°C can be resolved by this neuron type. Since the working range matches the preferred temperature range for brood care of Camponotus rufipes, we hypothesize that this temperature sensor can function as a thermal switch to trigger brood care behavior, based on absolute (steady state) temperature.

  15. The Camel Tick, Hyalomma (Hyalomma dromedarii Koch, 1844 (Ixodoidea: Ixodidae: Description of the Egg and Redescription of the Larva by Scanning Electron Microscopy

    Directory of Open Access Journals (Sweden)

    Ashraf Ahmed Montasser

    2006-01-01

    Full Text Available The present study describes the egg of Hyalomma (H. dromedarii for the first time and adds more features to the larva using Scanning Electron Microscopy (SEM in order to extend our knowledge on these acarine stages to be useful for further taxonomical or control studies. With the purpose of presenting exact description of acarine eggs, it is preferable to examine them both with and without SEM processing. SEM processing caused partial removal of the chorion which makes the egg shell clear and easily observed. The study revealed rough surface of egg shell which was surrounded by the chorion. The egg shell was perforated particularly at poles. The chorion appeared as a finely perforated cloth. Different forms of bumps were noticed between egg shell and chorion. Length, width, l/w ratio and pore diameter of the egg were measured. SEM investigation of the larva revealed smooth scutum with slight irregular ornamentation and horizontally folded extensible cuticle with vertical ridges. At least 2 types of cuticular openings were noticed on the extensible cuticle of the idiosoma. The first type was represented by 1 pair on dorsal side and 2 pairs on ventral one. It was surrounded with thick integumental ring and guarded with 2 internal lips. The second type was numerous, slit-like and without rings or lips. Dorsolateral plate of the hypostome carried numerous oval, tile-like and elevated denticles while ventral one carried 4 rows of posteriorly directed retrograde conical denticles. Mouth enclosed 2 cheliceral digits, each terminated with 3 lobes. Each lobe is supported with 2 or 3 conical denticles which were externally directed to the posterior. Haller`s organ on the tarsus of the first pair of legs consisted of anterior pit and posterior capsule. The pit contained 6 conical sensillae while the capsule opening had extensively branched margin. Measurements of the whole body, idiosoma, scutum, eye, capitulum, hypostome, palp, cuticular pores, legs and

  16. Molecular detection of Rickettsia africae, Rickettsia aeschlimannii, and Rickettsia sibirica mongolitimonae in camels and Hyalomma spp. ticks from Israel.

    Science.gov (United States)

    Kleinerman, Gabriela; Baneth, Gad; Mumcuoglu, Kosta Y; van Straten, Michael; Berlin, Dalia; Apanaskevich, Dmitry A; Abdeen, Ziad; Nasereddin, Abed; Harrus, Shimon

    2013-12-01

    In this study, we aimed to identify and genetically characterize spotted fever group (SFG) rickettsiae in ticks, domestic one-humped camels, and horses from farms and Bedouin communities in southern Israel. A total of 618 ixodid ticks (Hyalomma dromedarii, Hyalomma turanicum, Hyalomma excavatum, and Hyalomma impeltatum) collected from camels and horses, as well as 152 blood samples from 148 camels and four horses were included in the study. Initial screening for rickettsiae was carried out by targeting the gltA gene. Positive samples were further analyzed for rickettsial ompA, 17kDa, ompB, and 16S rRNA genes. Rickettsia aeschlimannii DNA was detected in the blood of three camels and 14 ticks (H. dromedarii, H. turanicum, and H. excavatum). Rickettsia africae was found in six ticks (H. turanicum, H. impeltatum, H. dromedarii, and H. excavatum). In addition, Rickettsia sibirica mongolitimonae was detected in one H. turanicum tick. These findings represent the first autochthonous detection of R. africae in Israel. Previous detections of R. africae in Asia were reported from the Sinai Peninsula (Egypt) and Istanbul, only. Furthermore, we report for the first time the finding of R. aeschlimannii in H. turanicum and H. excavatum ticks, as well as the first identification of R. sibirica mongolitimonae in H. turanicum ticks. The tick species identified to harbor R. africae and other SFG rickettsiae have been reported to occasionally feed on people, and, therefore, physicians should be aware of the possible exposure of local communities and travelers, especially those in contact with camels, to these tick-borne rickettsial pathogens.

  17. Ixodid ticks on cattle belonging to small-scale farmers at 4 communal grazing areas in South Africa

    Directory of Open Access Journals (Sweden)

    N.R. Bryson

    2002-07-01

    Full Text Available Ixodid ticks were collected during the period September 1991 to August 1993 from cattle belonging to small-scale farmers utilising 4 communal grazing areas. Three of these were in North West Province and 1 in Mpumalanga province, South Africa. Ten tick species were collected in North West Province and 7 in Mpumalanga. The adults of Amblyomma hebraeum, Rhipicephalus appendiculatus and Rhipicephalus evertsi evertsi were most numerous in North West Province, while in Mpumalanga Boophilus decoloratus comprised more than 75% of the total population. Amblyomma hebraeum was present on all grazing areas, and heavy infestations of adults occurred during the period October to May on 1 of these. Few B. decoloratus were collected in North West Province, chiefly because the sampling method was inadequate, and most of these were present during early summer (October to December and late summer and autumn (March to May. The initially low population of B. decoloratus in Mpumalanga increased substantially towards the conclusion of the survey, probably because of the cessation of dipping. Boophilus microplus was present in small numbers on 2 grazing areas in the North West Province. Adult Hyalomma marginatum rufipes reached peak numbers from December to February and Hyalomma truncatum from February to April in the North West Province. Only H. marginatum rufipes was collected in Mpumalanga. Rhipicephalus appendiculatus was present on all the grazing areas, with most adults present from December to April. Most adult Rhipicephalus evertsi evertsi were collected from September to April and Rhipicephalus simus was present during the period October-April.

  18. The dependence of Hyalomma aegyptium on its tortoise host Testudo graeca in Algeria.

    Science.gov (United States)

    Tiar, G; Tiar-Saadi, M; Benyacoub, S; Rouag, R; Široký, P

    2016-09-01

    Hyalomma aegyptium (Linnaeus, 1758) (Ixodida: Ixodidae) has recently been confirmed as a carrier of numerous pathogenic, including zoonotic, agents. Four environmentally distinct regions of Algeria, located between the humid coastal zone and the arid Saharan Atlas range, were selected in order to compare differences in tick abundance among localities, and the correlations between tick abundance and host population characteristics and other environmental conditions. Sampling was carried out during May and early June in 2010-2012. A total of 1832 H. aegyptium were removed from 201 tortoises. Adult ticks accounted for 52% of the collection. In the pre-adult stages, larvae were dominant. Data on prevalence, intensity (mean ± standard deviation, range) and abundance of tick infestation were calculated for each locality. Locally, prevalences reached 100%. The sex ratio was biased in favour of males (4.2). Intensities of infestation differed significantly among the localities studied for all developmental stages of the tick. The intensity of infestation by adult ticks was positively correlated to the size of the tortoise and with tortoise population density in the habitat. However, findings for immature tick stages were independent of both variables. No significant correlations between infestation intensities and the climatic parameters tested were found. Immature ticks were observed to prefer the front parts of their tortoise hosts, whereas the majority of adults were attached to the rear parts.

  19. Hyalomma aegyptium on Spur-thighed Tortoise (Testudo graeca in Urmia Region West Azerbaijan, Iran

    Directory of Open Access Journals (Sweden)

    M Tavassoli

    2007-05-01

    Full Text Available Background: Ticks are obligate blood feeders that parasitize a wide variety of animals. Hyalomma aegyptium, parasitize tortoises and other small wild life and livestock. This study was carried out to determine spur-thighed tortoise (Testudo graeca infestation to H. ageyptium in Urmia region West Azerbaijan of Iran. Methods: The study was carried out over a 16 month period from the spring of 2004 to the fall of 2005. A total of 32 tor¬toises were sampled. Results: The results indicated that 14 tortoises infected with ticks. A total of 117 ticks were collected from infested animals, the minimum and maximum tick infestation was 1-60. Ticks were attached to the axilla of fore and hind legs of tortoises. All ticks were determined to be H. aegyptium. Conclusion: H. aegyptium was the most common tick species in the study area. Due to tendency of some people to keeping tortoise as pet animal, more attention must be done to tortoise’s tick infestation. Due to existence of H. aegyptium on tor¬toises in this region more study will need to evaluate presence of this tick on other animal species and its role on transmis¬sion of diseases.

  20. [The importance of gamma irradiations with caesium-137 for Hyalomma anatolicum anatolicum (Metastigmata, Ixodidae) control].

    Science.gov (United States)

    Karaer, Zafer; Kar, Sirri; Düzgün, Ali; Güven, Esin; Pekmezci, Zafer; Emre, Zişan

    2006-01-01

    In this study, male ticks belonging to the Hyalomma anatolicum anatolicum species were subjected to gamma radiation doses of 5, 10, 15, 20 and 50 Gy, emitted by a gamma-ray source of Caesium 137. In females that fed with these male ticks, proportional to the increase in radiation dose, the period of feeding was found to shorten. A decrease was demonstrated in the number of engorged female ticks, engorgement weights, number of laying ticks and number of eggs. The hatching period of larvae from eggs was found to increase despite the decrease in the number of hatched larvae. Moreover no larvae were observed to hatch from any of the eggs of female ticks treated with a radiation dose of 50 Gy. Similarly, proportional to the applied dose of radiation, rates of viability and activity were observed to decrease in male ticks. In conclusion, taking into consideration the feeding periods and fertility rates of female ticks as indicators of male activity, this study has demonstrated that in combating with H. anatolicum anatolicum, radiation may be successful and a radiation dose of 10 Gy is most favorable.

  1. Plasticity of Daily Behavioral Rhythms in Foragers and Nurses of the Ant Camponotus rufipes: Influence of Social Context and Feeding Times

    Science.gov (United States)

    Mildner, Stephanie; Roces, Flavio

    2017-01-01

    Daily activities within an ant colony need precise temporal organization, and an endogenous clock appears to be essential for such timing processes. A clock drives locomotor rhythms in isolated workers in a number of ant species, but its involvement in activities displayed in the social context is unknown. We compared locomotor rhythms in isolated individuals and behavioral rhythms in the social context of workers of the ant Camponotus rufipes. Both forager and nurse workers exhibited circadian rhythms in locomotor activity under constant conditions, indicating the involvement of an endogenous clock. Activity was mostly nocturnal and synchronized with the 12:12h light-dark-cycle. To evaluate whether rhythmicity was maintained in the social context and could be synchronized with non-photic zeitgebers such as feeding times, daily behavioral activities of single workers inside and outside the nest were quantified continuously over 24 hours in 1656 hours of video recordings. Food availability was limited to a short time window either at day or at night, thus mimicking natural conditions of temporally restricted food access. Most foragers showed circadian foraging behavior synchronized with food availability, either at day or nighttime. When isolated thereafter in single locomotor activity monitors, foragers mainly displayed arrhythmicity. Here, high mortality suggested potential stressful effects of the former restriction of food availability. In contrast, nurse workers showed high overall activity levels in the social context and performed their tasks all around the clock with no circadian pattern, likely to meet the needs of the brood. In isolation, the same individuals exhibited in turn strong rhythmic activity and nocturnality. Thus, endogenous activity rhythms were inhibited in the social context, and timing of daily behaviors was flexibly adapted to cope with task demands. As a similar socially-mediated plasticity in circadian rhythms was already shown in honey

  2. Two cold-sensitive neurons within one sensillum code for different parameters of the thermal environment in the ant Camponotus rufipes

    Directory of Open Access Journals (Sweden)

    Manuel eNagel

    2015-09-01

    Full Text Available Ants show high sensitivity when responding to minute temperature changes and are able to track preferred temperatures with amazing precision. As social insects, they have to detect and cope with thermal fluctuations not only for their individual benefit but also for the developmental benefit of the colony and its brood. In this study we investigate the sensory basis for the fine-tuned, temperature guided behaviors found in ants, specifically what information about their thermal environment they can assess. We describe the dose-response curves of two cold-sensitive neurons, associated with the sensillum coelocapitulum on the antenna of the carpenter ant Camponotus rufipes.One cold-sensitive neuron codes for temperature changes, thus functioning as a thermal flux-detector. Neurons of such type continuously provide the ant with information about temperature transients (TT-neuron. The TT-neurons are able to resolve a relative change of 37% in stimulus intensity (ΔT and antennal scanning of the thermal environment may aid the ant’s ability to use temperature differences for orientation.The second cold-sensitive neuron in the S. coelocapitulum responds to temperature only within a narrow temperature range. A temperature difference of 1.6°C can be resolved by this neuron type. Since the working range matches the preferred temperature range for brood care of Camponotus rufipes, we hypothesize that this temperature sensor can function as a thermal switch to trigger brood care behavior, based on absolute (steady state temperature.

  3. Molecular detection of Rickettsia aeschlimannii in Hyalomma spp. ticks from camels (Camelus dromedarius) in Nigeria, West Africa.

    Science.gov (United States)

    Kamani, J; Baneth, G; Apanaskevich, D A; Mumcuoglu, K Y; Harrus, S

    2015-06-01

    Several species of the spotted fever group rickettsiae have been identified as emerging pathogens throughout the world, including in Africa. In this study, 197 Hyalomma ticks (Ixodida: Ixodidae) collected from 51 camels (Camelus dromedarius) in Kano, northern Nigeria, were screened by amplification and sequencing of the citrate synthase (gltA), outer membrane protein A (ompA) and 17-kDa antigen gene fragments. Rickettsia sp. gltA fragments were detected in 43.3% (42/97) of the tick pools tested. Rickettsial ompA gene fragments (189 bp and 630 bp) were detected in 64.3% (n = 27) and 23.8% (n = 10) of the gltA-positive tick pools by real-time and conventional polymerase chain reaction (PCR), respectively. The amplicons were 99-100% identical to Rickettsia aeschlimannii TR/Orkun-H and R. aeschlimannii strain EgyRickHimp-El-Arish in GenBank. Furthermore, 17-kDa antigen gene fragments of 214 bp and 265 bp were detected in 59.5% (n = 25) and 38.1% (n = 16), respectively, of tick pools, and sequences were identical to one another and 99-100% identical to those of the R. aeschlimannii strain Ibadan A1 in GenBank. None of the Hyalomma impressum ticks collected were positive for Rickettsia sp. DNA. Rickettsia sp. gltA fragments (133 bp) were detected in 18.8% of camel blood samples, but all samples were negative for the other genes targeted. This is the first report to describe the molecular detection of R. aeschlimannii in Hyalomma spp. ticks from camels in Nigeria.

  4. Gram-negative bacteria from the camel tick Hyalomma dromedarii (Ixodidae) and the chicken tick Argas persicus (Argasidae) and their antibiotic sensitivities.

    Science.gov (United States)

    Montasser, Ashraf A

    2005-04-01

    A total of nine species of gram-negative bacteria were isolated from organs and haemolymph of the hard tick Hyalomma (Hyalomma) dromedarii and the soft tick Argas (Persicargas) persicus. Four species namely Serratia liquefaciens, Stenotrophomonas maltophilia, Klebsiella ornithinolytica and Aeromonas hydrophila were isolated from H. dromedarii and five species namely Rahnella aquatilis, Pseudomonas fluorescens, Enterobacter cloacae, Chryseomonas luteola and Chryseobacterium meningosepticum were isolated from A. persicus. Isolated bacteria were identified using the analytical profile index 20E. Disk diffusion test was carried out on all isolated bacteria to determine antibiotic sensitivity of chloramphenicol, amoxillin/clavulanic acid, neomycin, streptomycin, triplesulphur tetracycline and nitrofurantion. The results were discussed.

  5. Hyalomma (Hyalommina) arabica sp. n. parasitizing goats and sheep in the Yemen Arab Republic and Saudi Arabia.

    Science.gov (United States)

    Pegram, R G; Hoogstraal, H; Wassef, H Y

    1982-02-01

    Hyalomma (Hyalommina) arabica sp. n. is described from 62 adults (29 males, 33 females) taken throughout the year from 23 goats and two sheep, mostly at 200 m altitude in the southern tihama foothills of Ta'izz Province, Yemen Arab Republic. One female from a goat at 2,300 m altitude in this Province may have attached to the host elsewhere and a male from Mecca, Saudi Arabia, was on a goat imported from an unknown source for the traditional religious pilgrimage feast. We postulate that the original host of adults was the Nubian ibex, Capra ibex nubiana F. Cuvier (Artiodactyla: Caprinae). This parasite is most closely related to H. (H.) kumari Sharif, which infests chiefly wild and domestic Caprinae from India to northwestern Iran and Tadzhik, SSR. It also shows relationships to H. (H.) punt Hoogstraal, Kaiser and Pedersen, which parasitizes gazelles and domestic mammals in Somalia and Ethiopia, but differs more widely from the third African-Arabian member of this subgenus, H. (H.) rhipicephaloides Neumann, which feeds on the Nubian ibex and gazelles in the Red Sea and Dead Sea areas. The Hyalomma subgenus Hyalommina now contains seven species, four confined to the Indian subcontinent (including Nepal, Burma, India, Sri Lanka, Pakistan, and Afghanistan) and Southwest Asia, and three in eastern Africa north of the equator and Arabia.

  6. Population dynamics of ticks infesting the one-humped camel (Camelus dromedarius) in central Tunisia.

    Science.gov (United States)

    Gharbi, Mohamed; Moussi, Nawfel; Jedidi, Mohamed; Mhadhbi, Moez; Sassi, Limam; Darghouth, Mohamed Aziz

    2013-12-01

    A tick population was monitored on 30 camels (Camelus dromedarius) over one year in Kairouan region, Central Tunisia. A total of 1630 ticks was collected and identified resulting in an estimate of different parasitological indicators. The ticks belonged to 2 genera and 5 species: Hyalomma impeltatum (53%) and Hyalomma dromedarii (45%) were the dominant species followed by Hyalomma excavatum (1%), Hyalomma marginatum (0.5%), and Rhipicephalus turanicus (0.5%) (pTunisia.

  7. HA03 as an Iranian Candidate Concealed Antigen for Vaccination against Hyalomma anatolicum anatolicum: Comparative Structural and In silico Studies

    Directory of Open Access Journals (Sweden)

    Mohammadi, A.

    2013-12-01

    Full Text Available In the last decades researchers had focused on developing a vaccine against tick based on protective antigen. Recombinant vaccines based on concealed antigen from Boophilus microplus have been developed in Australia and Cuba by the name of TICKGARD and GAVAC (De La Fuente and Kocan, 2006. Further studies on this antigen have shown some extent of protection against other species (De Vos et al., 2001. In Iran most important species is Hyalomma anatolicum and limited information about its control are available. This paper reports structural and polymorphic analysis of HA03 as an Iranian candidate concealed antigen of H. a. anatolicum deposited in Gen-Bank .(Aghaeipour et al. GQ228820. The comparison between this antigen and other mid gut concealed antigen that their characteristics are available in GenBank showed there are high rate of similarity between them. The HA03 amino acid sequence had a homology of around 89%, 64%, 56% with HA98, BM86, BM95 respectively. Potential of MHC class I and II binding region indicated a considerable variation between BM86 antigen and its efficiency against Iranian H. a. anatolicum. In addition, predicted major of hydrophobisity and similarity in N-glycosylation besides large amount of cystein and seven EGF like regions presented in protein structure revealed that value of HA03 as a new protective antigen and the necessity of the development, BM86 homolog of H. a. anatolicum HA03 based recombinant vaccine.

  8. The Midgut Bacterial Flora of Laboratory-Reared Hard Ticks, Haemaphysalis longicornis, Hyalomma asiaticum, and Rhipicephalus haemaphysaloides

    Institute of Scientific and Technical Information of China (English)

    LI Chun-hong; CAO Jie; ZHOU Yong-zhi; ZHANG Hou-shuang; GONG Hai-yan; ZHOU Jin-lin

    2014-01-01

    Ixodid ticks play an important role in the transmission of a variety of zoonoses of viral, bacterial and protozoan origin, and they also harbor a wealth of microorganisms. To gain more detailed insights into the potential interactions between bacterial lfora and tick-borne pathogens, we investigated the midgut bacterial lfora of laboratory-reared Haemaphysalis longicornis, Hyalomma asiaticum and Rhipicephalus haemaphysaloides. Based on morphological, biochemical, and 16S rDNA sequencing results, we identiifed 15 species belonging to 12 genera in the midgut of the three ticks. The bacterial communities were similar to those found in other studies of hematophagous arthropods. Kocuria sp. was the most frequently isolated species and its 16S rDNA gene sequence was very similar to Kocuria koreensis P31T. To our knowledge, this is the ifrst report of the bacterial lfora of tick midguts and the results show that there were many different bacterial species in each tick species. Among the most common genera, there may have been a novel species in the genus Kocuria. The results might be the ifrst step for looking for different aspects of the pathogen and tick interaction.

  9. Effect of Hyalomma Ticks (Acari: Ixodidae on Milk Production of Dairy Buffaloes (Bos Bubalus Bubalis of Punjab (Pakistan

    Directory of Open Access Journals (Sweden)

    M.U. Iqbal

    2010-02-01

    Full Text Available The objective of this study was to estimate economic losses in terms of milk production caused by tick infestation in dairy buffaloes (Bos bubalus bubalis of Punjab (Pakistan. To this end, six hundred Nili-Ravi buffaloes infested with Hyalomma ticks (Acari: Ixodidae were selected and divided into two equal groups viz; A & B. The animals of group A were treated with various doses of 5% cypermethrine pour-on (Cipermetriven, Ivan Labs, Spain while those of group B were treated with propylene glycol (Propandiol - (1, 2, Merck as a sham treatment. Average milk production (L and butter fat (% was recorded before and after treatment in order to calculate post-treatment increase in these parameters (if any. An average daily increase of 1.15L in milk yield per animal with 1.31% more fat was observed in acaricide- treated animals. A dose-dependent effect of acaricide was found on the number of ticks as well as milk production and fat. The results provided a baseline data for further research on economic impact of tick nuisance to the smallholder dairy farming systems of Pakistan.

  10. Laboratory assessment of acaricidal activity of Cymbopogon winterianus, Vitex negundo and Withania somnifera extracts against deltamethrin resistant Hyalomma anatolicum.

    Science.gov (United States)

    Singh, Nirbhay Kumar; Jyoti; Vemu, Bhaskar; Nandi, Abhijit; Singh, Harkirat; Kumar, Rajender; Dumka, V K

    2014-07-01

    Larval packet test was used for detection of resistance levels against cypermethrin and deltamethrin, the most commonly used synthetic pyrethroids, in the multi-host tick Hyalomma anatolicum collected from district Moga, Punjab (India). Results indicated the presence of level I resistance against deltamethrin (RF = 2.81), whereas the tick isolate was susceptible to cypermethrin (RF = 0.2). The aqueous and ethanolic extracts of leaves of Cymbopogon winterianus, Vitex negundo and Withania somnifera along with roots of Vitex negundo were assessed for their acaricidal activity against the larvae of deltamethrin resistant H. anatolicum. The efficacy was assessed by measuring per cent larval mortality and determination of LC50 values. The various ethanolic extracts produced a concentration dependent increase in larval tick mortality, whereas the aqueous extracts exhibited a much lower mortality. The highest mortality (93.7 ± 0.66 %) was observed at the 5.0 % concentration of ethanolic extract of leaves of C. winterianus and the lowest LC50 value (0.011 %) was recorded for ethanolic extracts of leaves of V. negundo. The results indicated that these plant extracts have potential to be developed as herbal acaricides.

  11. Comparative Study on the Content of Effective Components of Bupleurum marginatum before and after Processing%竹叶柴胡炮制前后有效成分含量比较

    Institute of Scientific and Technical Information of China (English)

    叶方; 杨光义; 杜士明; 王刚; 杜婷; 孙荣进

    2013-01-01

    Objective:To compare the content of effective components of Bupleurum marginatum from Northwest Hubei Province before and after processing by different methods.Method:The total saponins and volatile oil from B.marginatum processing with honey,wine and vinegar were extracted and the content of effective components was determined by UV-visible spectrophotometry.Result:The content of the total saponins and volatile oil of B.marginatum before and after processing by different methods had many sign changes.The content of the total saponins of B.marginatum increased after processing with honey roasted,but decreased after processing with wine and vinegar.The content varies in different processing methods,the consequent succession was as follows:processing with honey roasted > crude drug > processing with vinegar > processing with wine.The order of the content of total saponins was as follows:2.037 5%,1.519 6%,1.317 4% and 1.127 4%.The content of volatile oil of B.marginatum increased after processing by different methods.The result was as follows:processing with honey roasted > processing with wine > processing with vinegar > crude drug.The order of the content of total saponins was as follows:0.736%,0.689%,0.630% and 0.395%.Conclusion:The content of effective components of B.marginatum changed in varying degrees after processing,and it can be trusted that the B.marginatum was processed by different methods for medical purpose.%目的:分析比较鄂西北地区竹叶柴胡经不同方法炮制前后有效成分的含量变化情况.方法:将竹叶柴胡饮片经蜜制、酒制、醋制后,分别提取生品和几种炮制品中的总皂苷、挥发油,使用紫外-可见分光光度法测量炮制前后总皂苷和挥发油含量.结果:竹叶柴胡炮制前后柴胡皂苷和挥发油含量均发生了明显的变化.蜜制后总皂苷含量升高,酒制和醋制后总皂苷含量降低,含量高低依次为蜜柴胡>生柴胡>醋柴胡

  12. Partial characterization of a novel anti-inflammatory protein from salivary gland extract of Hyalomma anatolicum anatolicum (Acari: Ixodidae ticks

    Directory of Open Access Journals (Sweden)

    Mayukh Ghosh

    2015-06-01

    Full Text Available Aim: Hyalomma anatolicum anatolicum ticks transmit Theileria annulata, causative agent of tropical theileriosis to cattle and buffaloes causing a major economic loss in terms of production and mortality in tropical countries. Ticks have evolved several immune evading strategies to circumvent hosts’ rejection and achieve engorgement. Successful feeding of ticks relies on a pharmacy of chemicals located in their complex salivary glands and secreted saliva. These chemicals in saliva could inhibit host inflammatory responses through modulating cytokine secretion and detoxifying reactive oxygen species. Therefore, the present study was aimed to characterize anti-inflammatory peptides from salivary gland extract (SGE of H. a. anatolicum ticks with a view that this information could be utilized in raising vaccines, designing synthetic peptides or peptidomimetics which can further be developed as novel therapeutics. Materials and Methods: Salivary glands were dissected out from partially fed adult female H. a. anatolicum ticks and homogenized under the ice to prepare SGE. Gel filtration chromatography was performed using Sephadex G-50 column to fractionate the crude extract. Protein was estimated in each fraction and analyzed for identification of anti-inflammatory activity. Sodium dodecyl sulfate - polyacrylamide gel electrophoresis (SDS-PAGE was run for further characterization of protein in desired fractions. Results: A novel 28 kDa protein was identified in H. a. anatolicum SGE with pronounced anti-inflammatory activity. Conclusion: Purification and partial characterization of H. a. anatolicum SGE by size-exclusion chromatography and SDSPAGE depicted a 28 kDa protein with prominent anti-inflammatory activity.

  13. Biological Warfare Agents, Toxins, Vectors and Pests as Biological Terrorism Agents

    Science.gov (United States)

    2003-07-01

    synthesis of >100 amino acid polypeptides, advanced genetic manipulation). Toxins as terrorism agents: 1. Botulinum toxin 2. Ricin 3...marginatum 5. Hyalomma Anatolicum Anatolicum 6. Dermacentor spp. 7. Rhipicephalus spp. 8. Amblyomma spp. 9. Mansonia spp. 10. Culex spp. 11

  14. Zoonotic pathogens associated with Hyalomma aegyptium in endangered tortoises: evidence for host-switching behaviour in ticks?

    Directory of Open Access Journals (Sweden)

    Paștiu Anamaria I

    2012-12-01

    Full Text Available Abstract Background Hyalomma aegyptium is a hard-tick with a typical three-host life cycle. The main hosts are Palearctic tortoises of genus Testudo. However, other hosts can be used by immature ticks for feeding in natural conditions. Given this complex ecology and multiple host use, the circulation of pathogens by H. aegyptium between various hosts can be important from epidemiological point of view. The aim of this study was to evaluate the role of H. aegyptium as natural carrier of four important zoonotic pathogens. Methods From 2008 to 2011, 448 H. aegyptium ticks were collected from 45 Spur-thighed tortoises, Testudo graeca in Romania. DNA was extracted individually from each tick using a commercial kit. DNA was examined for the presence of specific sequences of Borrelia burgdorferi s.l., Anaplasma phagocytophilum, Ehrlichia canis and Coxiella burnetii by PCR, according to previously described protocols. Results PCR analysis of H. aegyptium revealed the presence of A. phagocytophilum (18.8%, E. canis (14.1% and C. burnetii (10%. 32.4% of the ticks were infected with at least one pathogen and 9.8% had co-infections. The stages most frequently infected were nymphs (50% followed by males (33.9% and females (27%. The number of tortoises which harboured infected ticks was 27/45 examined (60%. From all tested T. graeca, 40% harboured ticks infected with A. phagocytophilum, 46.7% had ticks infected with E. canis and 33.3% had ticks with C. burnetii. This study reports for the first time the presence of A. phagocytophilum and E. canis in H. aegyptium. Conclusions The presence and relatively high prevalence of three important zoonotic pathogens in H. aegyptium raises the question of their epidemiologic importance in disease ecology. As tortoises are unlikely to be reservoir hosts for A. phagocytophilum and E. canis and both these pathogens are common in H. aegyptium, this is an important indication for (1 a possible increased host

  15. Identification and characterization of microRNAs by deep-sequencing in Hyalomma anatolicum anatolicum (Acari: Ixodidae) ticks.

    Science.gov (United States)

    Luo, Jin; Liu, Guang-Yuan; Chen, Ze; Ren, Qiao-Yun; Yin, Hong; Luo, Jian-Xun; Wang, Hui

    2015-06-15

    Hyalomma anatolicum anatolicum (H.a. anatolicum) (Acari: Ixodidae) ticks are globally distributed ectoparasites with veterinary and medical importance. These ticks not only weaken animals by sucking their blood but also transmit different species of parasitic protozoans. Multiple factors influence these parasitic infections including miRNAs, which are non-coding, small regulatory RNA molecules essential for the complex life cycle of parasites. To identify and characterize miRNAs in H.a. anatolicum, we developed an integrative approach combining deep sequencing, bioinformatics and real-time PCR analysis. Here we report the use of this approach to identify miRNA expression, family distribution, and nucleotide characteristics, and discovered novel miRNAs in H.a. anatolicum. The result showed that miR-1-3p, miR-275-3p, and miR-92a were expressed abundantly. There was a strong bias on miRNA, family members, and nucleotide compositions at certain positions in H.a. anatolicum miRNA. Uracil was the dominant nucleotide, particularly at positions 1, 6, 16, and 18, which were located approximately at the beginning, middle, and end of conserved miRNAs. Analysis of the conserved miRNAs indicated that miRNAs in H.a. anatolicum were concentrated along three diverse phylogenetic branches of bilaterians, insects and coelomates. Two possible roles for the use of miRNA in H.a. anatolicum could be presumed based on its parasitic life cycle: to maintain a large category of miRNA families of different animals, and/or to preserve stringent conserved seed regions with active changes in other places of miRNAs mainly in the middle and the end regions. These might help the parasite to undergo its complex life style in different hosts and adapt more readily to the host changes. The present study represents the first large scale characterization of H.a. anatolicum miRNAs, which could further the understanding of the complex biology of this zoonotic parasite, as well as initiate miRNA studies

  16. Acaricide efficiency of amitraz / cypermethrin and abamectin pour-on preparations in game

    Directory of Open Access Journals (Sweden)

    J.S. Van der Merwe

    2005-09-01

    Full Text Available The efficacy of an amitraz / cypermethrin pour-on preparation (1 % w/v each was tested against natural tick infestations of buffaloes, eland and blesbok in three separate trials. The eland were also treated with a 0.02 % abamectin (w/v acaricidal pour-on preparation. The amitraz / cypermethrin pour-on was effective against Amblyomma hebraeum, Rhipicephalus evertsi evertsi, Rhipicephalus appendiculatus and Hyalomma marginatum rufipes on the buffaloes. Both acaricides were effective against R. appendiculatus and Rhipicephalus (Boophilus decoloratus in the eland. The amitraz / cypermethrin acaricide was effective against R. (Boophilus decoloratus in the blesbok. Ticks can cause damage to the skins, secondary infections, abscesses, anaemia, loss of condition, tick toxicosis and act as vectors of infectious diseases. Introduction of hosts and / or ticks from endemic to non-endemic areas because of translocation of game, may lead to severe losses. The pouron acaricides tested were effective against natural tick infestations and should always be used according to the manufacturer's instructions and efficacy claims.

  17. Acaricide efficiency of amitraz/cypermethrin and abamectin pour-on preparations in game.

    Science.gov (United States)

    Van Der Merwe, J S; Smit, F J; Durand, A M; Krüger, L P; Michael, L M

    2005-12-01

    The efficacy of an amitraz/cypermethrin pour-on preparation (1% w/v each) was tested against natural tick infestations of buffaloes, eland and blesbok in three separate trials. The eland were also treated with a 0.02% abamectin (w/v) acaricidal pour-on preparation. The amitraz/cypermethrin pour-on was effective against Amblyomma hebraeum, Rhipicephalus evertsi evertsi, Rhipicephalus appendiculatus and Hyalomma marginatum rufipes on the buffaloes. Both acaricides were effective against R. appendiculatus and Rhipicephalus (Boophilus) decoloratus in the eland. The amitraz/cypermethrin acaricide was effective against R. (Boophilus) decoloratus in the blesbok. Ticks can cause damage to the skins, secondary infections, abscesses, anaemia, loss of condition, tick toxicosis and act as vectors of infectious diseases. Introduction of hosts and/or ticks from endemic to non-endemic areas because of translocation of game, may lead to severe losses. The pouron acaricides tested were effective against natural tick infestations and should always be used according to the manufacturer's instructions and efficacy claims.

  18. Tick-borne rickettsiae in Guinea and Liberia.

    Science.gov (United States)

    Mediannikov, Oleg; Diatta, Georges; Zolia, Yah; Balde, Mamadou Cellou; Kohar, Henry; Trape, Jean-François; Raoult, Didier

    2012-02-01

    While the high seroprevalence for the rickettsiae that cause spotted fevers and the multiple pathogenic rickettsiae is known, the data on the distribution of rickettsial diseases in Africa are often incomplete. We collected ticks from domestic or wild animals (generally a source of bushmeat) that were in contact with humans in 2 neighboring countries of tropical West Africa, Guinea and Liberia. In total, 382 ticks representing 6 species were collected in Liberia and 655 ticks representing 7 species were collected in Guinea. We found rickettsiae in 9 different species of ticks from both countries. Rickettsia africae was found in 93-100% of Amblyomma variegatum, in 14-93% of Rhipicephalus (B.) geigyi, Rh. (B.) annulatus, and Rh. (B.) decoloratus, and in several Hyalomma marginatum rufipes and Haemaphysalis paraleachi. A genetic variant of R. africae was found in Amblyomma compressum. R. massiliae was found in 10/61 (16%) of Rh. senegalensis ticks and in 2% of Haemaphysalis paraleachi ticks collected from dogs. We identified a new rickettsia in one of 44 (2%) Ixodes muniensis collected from a dog in Liberia. As this rickettsia is not yet isolated, we propose the provisional name "Candidatus Rickettsia liberiensis" (for the West African country where the host tick was collected).

  19. Ticks (Acari: Ixodidae) associated with wildlife and vegetation of Haller park along the Kenyan coastline.

    Science.gov (United States)

    Wanzala, W; Okanga, S

    2006-09-01

    This artcile describes the results obtained from a tick survey conducted in Haller park along the Kenyan coastline. The survey aimed at evaluating tick-host associations, assessing tick population density, and providing baseline information for planning future tick control and management in the park. Ticks (2,968) were collected by handpicking from eight species of wildlife and by dragging in 14 selected sites within the park. A considerable proportion of ticks were also collected from leaves, stems, and bark of most dominant trees, namely, Casuarina equisetifolia L. (Forst. and Forst.), Cocos nucifera L., Adansonia digitata L., Musa paradisiaca L., and Azadiracta indica Adr. Juss. Dragging was conducted in sites predominantly occupied by Cynodon dactylon L. (Pers.), Cenchrus ciliaris L., Stenotaphrum dimidiatum L. (Kuntze.) Brongn., and Brachiaria xantholeuca Hack. Ex Schinz Stapf. and Loudetia kagerensis K. Schum. Hutch. Eight tick species were identified, and the collection included Rhipicephalus pravus Dönitz 1910, Rhipicephalus pulchellus Gerstäcker 1873, Hyalomma marginatum rufipes Koch 1844, Amblyomma gemma Dönitz 1910, Amblyomma hebraeum Koch 1844, Amblyomma sparsum Neumann 1899, Amblyomma nuttalli Dönitz 1909, and Boophilus decoloratus Koch 1844. Given that the identified tick species are known to parasitize humans as well as livestock, there exist risks of emergence of zoonotic infections mediated by tick vectors. In the recreational environment of Haller park, where tick vectors share habitats with hosts, there is a need to develop sustainable and effective tick control and management strategies to minimize economic losses that tick infestation may cause.

  20. Arthropod parasites of Nubian ibexes (Capra ibex nubiana) and gazelles (Gazella gazella) in Israel.

    Science.gov (United States)

    Yeruham, I; Rosen, S; Hadani, A; Braverman, Y

    1999-06-15

    In a 20-year survey the following ectoparasites were collected from Nubian ibexes: larvae of an unidentified Oestrus sp. collected from the nasal cavities, sinuses and horns, hippoboscid flies (Lipoptena chalcomelaena) specific to the Nubian ibex, blood sucking lice (Linognathus africanus) and unidentified biting lice (Damalinia sp.). Ibexes were severely infested with the cattle tick, Boophilus annulatus; a few Hyalomma anatolicum excavatum ticks were also collected. In five ibexes kept in two zoos, showing otitis, Psoroptes cuniculi, was identified, and from skin scrpaings of nine animals with severe dermatitis in three other zoos, Sarcoptes scabiei was isolated. Infestation of Nubian ibexes with sucking and biting lice as well as H. anatolicum excavatum is reported for the first time. The ectoparasites collected from gazelles were: hippoboscid flies (Lipoptena capreoli), calliphorid flies (Lucilia sericata and Calliphora sp.), sucking lice (Linognathus africanus and Solenopotes capillatus) and unidentified biting lice (Damalinia sp.), fleas (Ctenocephalides felis felis), and ticks, B. annulatus, Rhipicepahlus bursa, Rhipicephalus turanicus, H. anatolicum excavatum and H. marginatum rufipes. In skin scrapings of four gazelles with local dermatitis in the fetlocks Chorioptes bovis was identified. Neoschoengastia sp. was found in craters between the claws in three gazelles.

  1. Identification and Mechanistic Analysis of a Novel Tick-Derived Inhibitor of Thrombin.

    Directory of Open Access Journals (Sweden)

    Willy Jablonka

    Full Text Available A group of peptides from the salivary gland of the tick Hyalomma marginatum rufipes, a vector of Crimean Congo hemorrhagic fever show weak similarity to the madanins, a group of thrombin-inhibitory peptides from a second tick species, Haemaphysalis longicornis. We have evaluated the anti-serine protease activity of one of these H. marginatum peptides that has been given the name hyalomin-1. Hyalomin-1 was found to be a selective inhibitor of thrombin, blocking coagulation of plasma and inhibiting S2238 hydrolysis in a competitive manner with an inhibition constant (Ki of 12 nM at an ionic strength of 150 mM. It also blocks the thrombin-mediated activation of coagulation factor XI, thrombin-mediated platelet aggregation, and the activation of coagulation factor V by thrombin. Hyalomin-1 is cleaved at a canonical thrombin cleavage site but the cleaved products do not inhibit coagulation. However, the C-terminal cleavage product showed non-competitive inhibition of S2238 hydrolysis. A peptide combining the N-terminal parts of the molecule with the cleavage region did not interact strongly with thrombin, but a 24-residue fragment containing the cleavage region and the C-terminal fragment inhibited the enzyme in a competitive manner and also inhibited coagulation of plasma. These results suggest that the peptide acts by binding to the active site as well as exosite I or the autolysis loop of thrombin. Injection of 2.5 mg/kg of hyalomin-1 increased arterial occlusion time in a mouse model of thrombosis, suggesting this peptide could be a candidate for clinical use as an antithrombotic.

  2. [Comparison of the ability to fertilize females by Hyalomma anatolicum anatolicum males irradiated with gamma radiation from caesium 137 with non-irradiated males].

    Science.gov (United States)

    Karaer, Zafer; Kar, Sirri; Düzgün, Ali; Güven, Esin; Cakmak, Ayşe; Emre, Zişan; Nalbantoğlu, Serpil; Saribaş, Taner; Akçay, Aytaç

    2009-01-01

    In this study, Hyalomma anatolicum anatolicum male ticks were subjected to gamma radiation with a dose of 10 Gy emitted by a gamma-ray source of Caesium 137. Female ticks were divided into 3 groups and placed in rabbit ears to feed. In the first group, the females fed with normal and irradiated males, in the second group females fed only with irradiated males and in last group females fed with normal males. Biological parameters such as the feeding period, weights, period of time from dropping until egg-laying began, the number of eggs and the number of larva hatching from eggs were recorded. With the results of statistical analysis it was found that the average egg laying period of females in the second group was clearly less (22.77 days) than other groups and the difference between these groups was statistically important (P < 0.05). After evaluation of numbers of larva, also there was a statistically important difference between the groups and the average number of larva was clearly higher (2519.30) in third group than other groups. In conclusion, in this study it was found that irradiated males could not compete with normal males in mating with females and because of this they couldn't affect the feeding and reproductivity of females.

  3. First survey of hard ticks (Acari:Ixodidae) on cattle, sheep and goats in Boeen Zahra and Takistan counties, Iran

    Institute of Scientific and Technical Information of China (English)

    Masoomeh Shemshad; Khadijeh Shemshad; Mohammad Mehdi Sedaghat; Majid Shokri; Alireza Barmaki; Mojgan Baniardalani; Javad Rafinejad

    2012-01-01

    Objective: To carry out the distribution survey of hard ticks of livestock in Boeen Zahra and Takistan counties of Qazvin province from April 2010 to September 2010. Methods:Nearly about 2 638 sheep, 461 goats and 318 cattle of 38 herds in different geographical areas were searched for tick infestation. Results:The species compositions collected from the livestock of Boeen Zahra and Takistan were Haemaphysalis concinna (0.63%), Haemaphysalis sulcata (12.66%), Hyalomma anatolicum (3.80%), Hyalomma asiaticum (3.16%), Hyalomma detritum (5.70%), Hyalomma dromedarii (28.48%), Hyalomma marginatum (13.29%), Hyalomma schulzei (1.89%), Rhipicephalus bursa (3.16%) and Rhipicephalus sanguineus (3.16%), and for Takistan’s livestock were Hyalomma dromedarii (9.86%), Hyalomma marginatum (13.29%), Hyalomma schulzei (1.89%) and Rhipicephalus sanguineus (3.16%), respectively. Hard ticks compositions in different topographic areas were different. Hyalomma species had the most prevalence in the areas. Conclusions:The veterinary and public health investigation of the above species should be taken.

  4. Photosensitizers in the fight against ticks: safranin as a novel photodynamic fluorescent acaricide to control the camel tick Hyalomma dromedarii (Ixodidae).

    Science.gov (United States)

    Khater, Hanem; Hendawy, Nabil; Govindarajan, Marimuthu; Murugan, Kadarkarai; Benelli, Giovanni

    2016-10-01

    Ticks transmit more pathogen species than any other group of blood-feeding arthropods worldwide, affecting humans, livestock, and companion animals. Hyalomma dromedarii is the predominant tick species infesting camels, and its effective control is of pivotal importance. In this research, we compared the phytoefficacy of safranin (SF), a fluorescent dye applied as an acaricide for the first time, to that of tetramethrin (TM) against engorged females of H. dromedarii through in vitro immersion bioassays. Furthermore, the effect of SF exposure was evaluated on the reproductive potential of surviving tick females. Different concentrations of SF (0.03, 0.06, 0.3, 1, and 4 % w:v) and TM (0.03, 0.13, 0.5, 2, and 4 %) were prepared in distilled water and administered to engorged females of H. dromedarii. SF-treated ticks were illuminated with a light source for 30 min post-treatment (PT). Photophysical properties of SF were studied, and the relative efficacy of the used light source and sunlight was calculated. Results showed that the minimum least concentration that causes 100 % acaricidal effect was 4 % PT with SF and TM, for 8 and 48 h, respectively. LC50 values 8 and 24 h PT were 0.08, 0.03 and 0.78, 0.20 %, respectively. Comparing LC50 and LC90 2 h PT, SF was 33 and 22 times more potent than TM. LT50 of 4 % SF and TM were 0.80 and 2.17 h, respectively. Treatment with the lowest concentrations of SF and TM induced reduction of the number of ovipositing females, eggs per female, ticks laying viable eggs, and hatched eggs. Overall, our results highlighted that SF is highly effective if compared to TM, allowing use to candidate it for the development of novel and safer acaricides.

  5. Morphological and molecular identification of the brown dog tick Rhipicephalus sanguineus and the camel tick Hyalomma dromedarii (Acari: Ixodidae vectors of Rickettsioses in Egypt

    Directory of Open Access Journals (Sweden)

    Hend H. A. M. Abdullah

    2016-10-01

    Full Text Available Aim: Rickettsioses have an epidemiological importance that includes pathogens, vectors, and hosts. The dog tick Rhipicephalus sanguineus and the camel tick Hyalomma dromedarii play important roles as vectors and reservoirs of Rickettsiae. The aim of this study was to determine the prevalence of Rickettsiae in ixodid ticks species infesting dogs and camels in Egypt, in addition to, the morphological and molecular identification of R. sanguineus and H. dromedarii. Materials and Methods: A total of 601 and 104 of ticks’ specimens were collected from dogs and camels, respectively, in Cairo, Giza and Sinai provinces. Hemolymph staining technique and OmpA and gltA genes amplification were performed to estimate the prevalence rate of Rickettsiae in ticks. For morphological identification of tick species, light microscope (LM and scanning electron microscope (SEM were used. In addition to the phylogenetic analyses of 18S rDNA, Second internal transcript spacer, 12S rDNA, cytochrome c oxidase subunit-1, and 16S rDNA were performed for molecular identification of two tick species. Results: The prevalence rate of Rickettsiae in ticks was 11.6% using hemolymph staining technique and 6.17% by OmpA and gltA genes amplification. Morphological identification revealed that 100% of dogs were infested by R. sanguineus while 91.9% of camels had been infested by H. dromedarii. The phylogenetic analyses of five DNA markers confirmed morphological identification by LM and SEM. The two tick species sequences analyses proved 96-100% sequences identities when compared with the reference data in Genbank records. Conclusion: The present studies confirm the suitability of mitochondrial DNA markers for reliable identification of ticks at both intra- and inter-species level over the nuclear ones. In addition to, the detection of Rickettsiae in both ticks’ species and establishment of the phylogenetic status of R. sanguineus and H. dromedarii would be useful in

  6. Morphological and molecular identification of the brown dog tick Rhipicephalus sanguineus and the camel tick Hyalomma dromedarii (Acari: Ixodidae) vectors of Rickettsioses in Egypt.

    Science.gov (United States)

    Abdullah, Hend H A M; El-Molla, Amal; Salib, Fayez A; Allam, Nesreen A T; Ghazy, Alaa A; Abdel-Shafy, Sobhy

    2016-10-01

    Rickettsioses have an epidemiological importance that includes pathogens, vectors, and hosts. The dog tick Rhipicephalus sanguineus and the camel tick Hyalomma dromedarii play important roles as vectors and reservoirs of Rickettsiae. The aim of this study was to determine the prevalence of Rickettsiae in ixodid ticks species infesting dogs and camels in Egypt, in addition to, the morphological and molecular identification of R. sanguineus and H. dromedarii. A total of 601 and 104 of ticks' specimens were collected from dogs and camels, respectively, in Cairo, Giza and Sinai provinces. Hemolymph staining technique and OmpA and gltA genes amplification were performed to estimate the prevalence rate of Rickettsiae in ticks. For morphological identification of tick species, light microscope (LM) and scanning electron microscope (SEM) were used. In addition to the phylogenetic analyses of 18S rDNA, Second internal transcript spacer, 12S rDNA, cytochrome c oxidase subunit-1, and 16S rDNA were performed for molecular identification of two tick species. The prevalence rate of Rickettsiae in ticks was 11.6% using hemolymph staining technique and 6.17% by OmpA and gltA genes amplification. Morphological identification revealed that 100% of dogs were infested by R. sanguineus while 91.9% of camels had been infested by H. dromedarii. The phylogenetic analyses of five DNA markers confirmed morphological identification by LM and SEM. The two tick species sequences analyses proved 96-100% sequences identities when compared with the reference data in Genbank records. The present studies confirm the suitability of mitochondrial DNA markers for reliable identification of ticks at both intra- and inter-species level over the nuclear ones. In addition to, the detection of Rickettsiae in both ticks' species and establishment of the phylogenetic status of R. sanguineus and H. dromedarii would be useful in understanding the epidemiology of ticks and tick borne rickettsioses in Egypt.

  7. In vitro assessment of the acaricidal activity of Piper longum, Piper nigrum, and Zingiber officinale extracts against Hyalomma anatolicum ticks.

    Science.gov (United States)

    Singh, Nirbhay K; Saini, S P S; Singh, Harkirat; Jyoti; Sharma, S K; Rath, S S

    2017-03-01

    Ticks and tick-borne diseases are a major constraint for the sustainable cattle industry in the tropical and subtropical regions including the Indian subcontinent. The development of resistance to most of the commonly used acaricides leads to an attempt to screen plant extracts and their combinations for their possible acaricidal activity to develop an eco-friendly tick control alternative. An alcoholic and various aqueous extracts of Piper longum, Piper nigrum and Zingiber officinale and their combinations were evaluated for acaricidal activity against the three-host ixodid tick, Hyalomma anatolicum by larval immersion test using 14-21 days old unfed larvae. The efficacy was assessed by measuring larval mortality (%) and the lethal concentrations for 50% (LC50) and 95% (LC95) with their 95% confidence limits (CL) values were estimated by applying regression equation analysis to the probit transformed data of mortality. A concentration-dependent mortality response was recorded in all extracts prepared from seeds of P. longum and P. nigrum and their combinations. The highest acaricidal property was exhibited by the alcoholic extract of P. longum seeds with the minimum LC50 and LC95 (95% CL) values of 0.071% (0.07-0.072) and 0.135% (0.13-0.14), respectively, followed by alcoholic combinations. Interestingly, no acaricidal activity was recorded in extracts prepared from the rhizome of Z. officinale. The results indicated that the ethanolic extracts of P. longum and P. nigrum and their combinations can be used effectively for tick control in an integrated format.

  8. Control of Hyalomma lusitanicum (Acari: Ixodidade) Ticks Infesting Oryctolagus cuniculus (Lagomorpha: Leporidae) Using the Entomopathogenic Fungus Beauveria bassiana (Hyocreales: Clavicipitaceae) in Field Conditions.

    Science.gov (United States)

    González, J; Valcárcel, F; Pérez-Sánchez, J L; Tercero-Jaime, J M; Cutuli, M T; Olmeda, A S

    2016-11-01

    Entomopathogenic fungi are widely used to control arthropods not just in agricultural settings but also in Veterinary Medicine and Public Health. These products have been employed to control tick populations and tick-borne diseases. The effectiveness of these control measures not only depends on the fungi, but also on the tick species and environmental conditions. In Mesomediterranean areas, tick species are adapted to extreme climatic conditions and it is therefore especially important to develop suitable tick control strategies. The aim of this study was to evaluate the effectiveness of a new method of tick control which entails the application of a commercial strain of Beauveria bassiana (Balsamo, Vuillemin) on wild rabbit burrows under field conditions. Aqueous solutions of the product were applied using a mist blower sprayer into 1,717 burrows. Two trials were performed, one in spring and the other in summer. The parasitic index (PI) was calculated for 10 rabbits per treatment per time point on day +30, +60, and +90 posttreatment and efficiency was calculated by comparing the PI for ticks in treated and untreated rabbits. A total of 20,234 ixodid ticks were collected. Hyalomma lusitanicum Koch, 1844 was the most abundant tick feeding on rabbits. Treatment significantly reduced the PI in spring (by 78.63% and 63.28% on day +30 and +60, respectively; P < 0.05), but appeared to be less effective in summer, with a marginally significant tick reduction of 35.72% on day +30 (P = 0.05). Results suggest that the efficacy of applications inside burrows could be temperature-dependent and that such applications could be an economic alternative to rabbit tick control during at least two months using a diluted solution of B. bassiana conidia.

  9. Solanum trilobatum extract-mediated synthesis of titanium dioxide nanoparticles to control Pediculus humanus capitis, Hyalomma anatolicum anatolicum and Anopheles subpictus.

    Science.gov (United States)

    Rajakumar, Govindasamy; Rahuman, Abdul Abdul; Jayaseelan, Chidambaram; Santhoshkumar, Thirunavukkarasu; Marimuthu, Sampath; Kamaraj, Chinnaperumal; Bagavan, Asokan; Zahir, Abdul Abduz; Kirthi, Arivarasan Vishnu; Elango, Gandhi; Arora, Pooja; Karthikeyan, Rajan; Manikandan, Sivan; Jose, Sujin

    2014-02-01

    Titanium dioxide nanoparticles (TiO2 NPs) are widely used in paints, printing ink, rubber, paper, cosmetics, sunscreens, car materials, cleaning air products, industrial photocatalytic processes, and decomposing organic matters in wastewater due to their unique physical, chemical, and biological properties. The present study was conducted to assess the antiparasitic efficacies of synthesized TiO2 NPs utilizing leaf aqueous extract of Solanum trilobatum against the adult head louse, Pediculus humanus capitis De Geer (Phthiraptera: Pediculidae); larvae of cattle tick Hyalomma anatolicum (a.) anatolicum Koch (Acari: Ixodidae), and fourth instar larvae of malaria vector Anopheles subpictus Grassi (Diptera: Culicidae). The green synthesized TiO2 NPs were analyzed by X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR), Scanning electron microscopy (SEM), Energy-dispersive X-ray spectroscopy analysis (EDX), and Atomic force microscopy (AFM). XRD analysis of synthesized TiO2 NPs revealed that the particles were in the form of nanocrystals as evidenced by the major peaks at 2θ values of 27.52°, 36.21°, and 54.43° identified as 110, 101, and 211 reflections, respectively. FTIR spectra exhibited a prominent peak at 3,466 cm(-1) and showed OH stretching due to the alcoholic group, and the OH group may act as a capping agent. SEM images displayed NPs that were spherical, oval in shape, individual, and some in aggregates with an average size of 70 nm. Characterization of the synthesized TiO2 NPs using AFM offered a three-dimensional visualization and uneven surface morphology. The pediculocidal and acaricidal activities of synthesized TiO2 NPs showed the percent mortality of 31, 42, 63, 82, 100; 36, 44, 67, 89, and 100 at 2, 4, 6, 8, and 10 mg/L, respectively, against P. h. capitis and H. a. anatolicum. The average larval percent mortality of synthesized TiO2 NPs was 38, 47, 66, 79, and 100 at 1, 2, 3, 4, and 5 mg/L, respectively, against A. subpictus

  10. Tick repellents and acaricides of botanical origin: a green roadmap to control tick-borne diseases?

    Science.gov (United States)

    Benelli, Giovanni; Pavela, Roman; Canale, Angelo; Mehlhorn, Heinz

    2016-07-01

    Arthropods are dangerous vectors of agents of deadly diseases, which may hit as epidemics or pandemics in the increasing world population of humans and animals. Among them, ticks transmit more pathogen species than any other group of blood-feeding arthropods worldwide. Thus, the effective and eco-friendly control of tick vectors in a constantly changing environment is a crucial challenge. A number of novel routes have been attempted to prevent and control tick-borne diseases, including the development of (i) vaccines against viruses vectored by ticks; (ii) pheromone-based control tools, with special reference to the "lure and kill" techniques; (iii) biological control programmes relying on ticks' natural enemies and pathogens; and (iv) the integrated pest management practices aimed at reducing tick interactions with livestock. However, the extensive employment of acaricides and tick repellents still remains the two most effective and ready-to-use strategies. Unfortunately, the first one is limited by the rapid development of resistance in ticks, as well as by serious environmental concerns. On the other hand, the exploitation of plants as sources of effective tick repellents is often promising. Here, we reviewed current knowledge concerning the effectiveness of plant extracts as acaricides or repellents against tick vectors of public health importance, with special reference to Ixodes ricinus, Ixodes persulcatus, Amblyomma cajennense, Haemaphysalis bispinosa, Haemaphysalis longicornis, Hyalomma anatolicum, Hyalomma marginatum rufipes, Rhipicephalus appendiculatus, Rhipicephalus (Boophilus) microplus, Rhipicephalus pulchellus, Rhipicephalus sanguineus and Rhipicephalus turanicus. Eighty-three plant species from 35 botanical families were selected. The most frequent botanical families exploited as sources of acaricides and repellents against ticks were Asteraceae (15 % of the selected studies), Fabaceae (9 %), Lamiaceae (10 %), Meliaceae (5 %), Solanaceae (6

  11. Determination of hard tick species (Acarina:Ixodidae) on sheep and cattle in Hamedan Province, Iran

    Institute of Scientific and Technical Information of China (English)

    Jamal Gharekhani; Abbas Gerami-Sadeghian; Zivar Sadeghi-Dehkordi; Mohammadreza Youssefi

    2015-01-01

    Objective: To determine the fauna and frequency of hard tick species on sheep and cattle in Hamedan Province, Western Iran. Methods: Tick sampling was performed on the whole body of 18000 sheep and 4200 cattle in 3 rural regions (mountain, plateau, and plain-mountainous zone) during the year of 2010 to 2011. The ticks were identified with appropriate identification keys. Results: A total of 1534 hard ticks (62.1% male and 37.9% female) were collected in animals. The infestation rate was found 2.4% in animals (4.2% in cattle and 2.0% in sheep). The ticks were classified into 3 genera and 7 species including: Hyalomma marginatum (34.1%), Hyalomma excavatum (29.7%), Rhipicephalus bursa (13.8%), Rhipicephalus sanguineus (7.5%), Hyalomma detritum (7.1%), Haemaphysalis punctata (5.1%) and Hyalomma dromedarii (2.7%). Conclusions: Current study is the first report of fauna and frequency of hard ticks in this region. The results showed that Hyalomma marginatum is the dominant hard tick species. Further studies are needed to determine the importance of Ixodidae ticks of veterinary and public health in this region of Iran.

  12. Crimean-Congo hemorrhagic fever:a molecular survey on hard ticks (Ixodidae) in Yazd province, Iran

    Institute of Scientific and Technical Information of China (English)

    Salim Abadi Yaser; Chinikar Sadegh; Telmadarraiy Zakkyeh; Vatandoost Hassan; Moradi Maryam; Oshaghi Mohammad Ali; Ghiasi Seyed Mojtaba

    2011-01-01

    Objective: To determine the rate of Crimean-Congo hemorrhagic fever virus (CCHFV) infection in hard ticks (Ixodidae) in Yazd province of Iran. Methods: A molecular survey on hard ticks(Ixodidae) was conducted in Yazd province during 2008 -2009. A total of 140 hard ticks (three genera and 7 species) were collected from randomly selected villages and were exanimate for presence of CCHFV reverse transcription-polymerase chain reaction (RT-PCR) method. Results:CCHFV genome was found in 5.71% of hard ticks. All positive ticks were from Hyalomma genus. Positive ticks including: Hyalomma dromedarii, Hyalomma marginatum, Hyalomma anatolicum,Hyalomma detritum, Hyalomma asiaticum . We were not able to find virus in in Rhipicephalus sanguineus and Dermacentor marginatus. Results exhibited that Hyalomma is the main vector in the study area. Conclusions: Due to the presence of virus in 24 provinces' out of 31, we recommend the use of acaricides and repellent to prevent disease transmission among humans. Greta care should be taken by the people who are working in slaughter houses.

  13. General review of tick species present in Portugal.

    Science.gov (United States)

    Caeiro, V

    1999-09-01

    At present, 24 species are known to occur in Portugal: Argas vespertilionis, Ornithodoros maritimus and Ornithodoros erraticus in Argasidae; Ixodes acuminatus, Ixodes bivari, Ixodes canisuga, Ixodes frontalis, Ixodes hexagonus, Ixodes ricinus, Ixodes simplex simplex, Ixodes ventalloi, Ixodes vespertilionis, Dermacentor marginatus, Dermacentor pictus', Haemaphysalis hispanica, Haemaphysalis inermis, Haemaphysalis punctata, Rhipicephalus bursa, Rhipicephalus pusillus, Rhipicephalus sanguineus, Rhipicephalus turanicus, Hyalomma lusitanicum, Hyalomma marginatum marginatum and Boophilus annulatus in Ixodidae. The more relevant diseases transmitted to cattle by ticks, particulary in Ribatejo and Alentejo regions, are the babesiosis due to Babesia bigemina and Babesia bovis, the theileriosis by Theileria annulata and the anaplasmosis due to Anaplasma marginale; the theileriosis by Theileria mutans2 may not be considered significant. The sheep and goats parasitoses transmitted by ticks are of less importance than the cattle diseases. However the babesiosis due to Babesia motasi and Babesia ovis and also theileriosis by Theileria hirci3 are present in some districts of the country.

  14. Species diversity and geographic distribution of hard ticks (Acari: Ixodoidea: Ixodidae) infesting domestic ruminants, in Qazvin Province, Iran.

    Science.gov (United States)

    Shemshad, Khadijeh; Rafinejad, Javad; Kamali, Karim; Piazak, Norayer; Sedaghat, Mohammad Mahdi; Shemshad, Masoomeh; Biglarian, Akbar; Nourolahi, Fathollah; Valad Beigi, Enshallah; Enayati, Ahmad Ali

    2012-01-01

    This report presents the results of the first faunistic study of hard ticks in Qazvin province of Iran. The primary objective was to determine the species diversity and geographic distribution of hard ticks that parasitize domestic ruminants. Information about the abiotic preferences of these species has been provided. A total of 286 cattle, 1,053 goats, and 2,050 sheep were examined in 13 villages in 28 flocks distributed throughout the studied areas. Total direct body collections of ticks were made from each domestic ruminant. A total of 228 Ixodid specimens belonging to nine species in three different genera were recorded in the areas, including Boophilus annulatus (Say, 1821), Hyalomma anatolicum Koch, 1844, Hyalomma asiaticum (Schulze and Schlettke, 1929), Hyalomma detritum Schulze, 1919, Hyalomma dromedarii Koch, 1844, Hyalomma marginatum Koch 1844, Hyalomma schulzei Olenev, 1931, Rhipicephalus bursa Canestrini and Fanz, 1878 and Rhipicephalus sanguineus (Latreille, 1806). The most abundant species on sheep was R. sanguineus (46.92%), while B. annulatus (6.6%) found only on cattle. A finding of great significance was that R. sanguineus, the main vector of babesiosis, is firmly established throughout the counties. A further objective of the study was to compare the abundance of the major tick species on domestic ruminants. This was carried out at 19 sampling sites. The highest number of ticks was collected in July-August during the hot season.

  15. The influence of interspecific competition and host preference on the phylogeography of two African ixodid tick species.

    Science.gov (United States)

    Cangi, Nídia; Horak, Ivan G; Apanaskevich, Dmitry A; Matthee, Sonja; das Neves, Luís C B G; Estrada-Peña, Agustín; Matthee, Conrad A

    2013-01-01

    A comparative phylogeographic study on two economically important African tick species, Amblyomma hebraeum and Hyalomma rufipes was performed to test the influence of host specificity and host movement on dispersion. Pairwise AMOVA analyses of 277 mtDNA COI sequences supported significant population differentiation among the majority of sampling sites. The geographic mitochondrial structure was not supported by nuclear ITS-2 sequencing, probably attributed to a recent divergence. The three-host generalist, A. hebraeum, showed less mtDNA geographic structure, and a lower level of genetic diversity, while the more host-specific H. rufipes displayed higher levels of population differentiation and two distinct mtDNA assemblages (one predominantly confined to South Africa/Namibia and the other to Mozambique and East Africa). A zone of overlap is present in southern Mozambique. A mechanistic climate model suggests that climate alone cannot be responsible for the disruption in female gene flow. Our findings furthermore suggest that female gene dispersal of ticks is more dependent on the presence of juvenile hosts in the environment than on the ability of adult hosts to disperse across the landscape. Documented interspecific competition between the juvenile stages of H. rufipes and H. truncatum is implicated as a contributing factor towards disrupting gene flow between the two southern African H. rufipes genetic assemblages.

  16. The influence of interspecific competition and host preference on the phylogeography of two African ixodid tick species.

    Directory of Open Access Journals (Sweden)

    Nídia Cangi

    Full Text Available A comparative phylogeographic study on two economically important African tick species, Amblyomma hebraeum and Hyalomma rufipes was performed to test the influence of host specificity and host movement on dispersion. Pairwise AMOVA analyses of 277 mtDNA COI sequences supported significant population differentiation among the majority of sampling sites. The geographic mitochondrial structure was not supported by nuclear ITS-2 sequencing, probably attributed to a recent divergence. The three-host generalist, A. hebraeum, showed less mtDNA geographic structure, and a lower level of genetic diversity, while the more host-specific H. rufipes displayed higher levels of population differentiation and two distinct mtDNA assemblages (one predominantly confined to South Africa/Namibia and the other to Mozambique and East Africa. A zone of overlap is present in southern Mozambique. A mechanistic climate model suggests that climate alone cannot be responsible for the disruption in female gene flow. Our findings furthermore suggest that female gene dispersal of ticks is more dependent on the presence of juvenile hosts in the environment than on the ability of adult hosts to disperse across the landscape. Documented interspecific competition between the juvenile stages of H. rufipes and H. truncatum is implicated as a contributing factor towards disrupting gene flow between the two southern African H. rufipes genetic assemblages.

  17. High infection of Anaplasma and Ehrlichia spp. among tick species collected from different geographical locations of Iran

    Directory of Open Access Journals (Sweden)

    Leila Tajedin

    2016-10-01

    Full Text Available Objective: To ascertain the prevalence of the Anaplasma/Ehrlichia infections in tick population within four provinces of Iran. Methods: A total of 384 tick specimens were collected from domestic animals inhabiting in four provinces (East Azerbaijan, Gilan, South Khorasan and Yazd. Specimens were identified based on morphological analysis. The detection of Anaplasma spp./Ehrlichia spp. within tick samples was carried out by nested PCR amplification of the 16S ribosomal RNA gene accompanied by DNA sequencing and analysis for verification. Results: A total of 10 tick species were identified as follows: Ornithodoros lahorensis (O. lahorensis (44.8%, Hyalomma dromedarii (15.6%, Dermacentor marginatus (13.5%, Hyalomma anatolicum (11.2%, Hyalomma asiaticum (5.7%, Hyalomma marginatum (4.9%, Rhipicephalus sanguineus (2.3%, Hyalomma detritum (1.0%, Dermacentor niveus (0.5% and Argas persicus (0.3%. The percentage distribution of Anaplasma/Ehrlichia was 55.5% (213 across 384 studied ticks. Conclusions: To the best of our knowledge, this is the first report of Anaplasma ovis infection in O. lahorensis in Iran. We also conjecture the prevalence of Ehrlichia spp. in Yazd Province based on sequencing results; also, it is suggested that O. lahorensis is a potential vector in the studied area. This survey highlights the importance of Argasidae family to verify and correlate their threat in causing anaplasmosis and other diseases in animals.

  18. Molecular evidence for bacterial and protozoan pathogens in hard ticks from Romania.

    Science.gov (United States)

    Ionita, Mariana; Mitrea, Ioan Liviu; Pfister, Kurt; Hamel, Dietmar; Silaghi, Cornelia

    2013-09-01

    The aim of the present study was to provide a preliminary insight into the diversity of tick-borne pathogens circulating at the domestic host-tick interface in Romania. For this, feeding and questing ticks were analyzed by real-time polymerase chain reaction (PCR) for the presence of Anaplasma phagocytophilum, Anaplasma platys, Ehrlichia canis, Borrelia burgdorferi sensu latu, and by PCR and subsequent sequencing for Rickettsia spp., Babesia spp. and Theileria spp. A total of 382 ticks, encompassing 5 species from 4 genera, were collected in April-July 2010 from different areas of Romania; of them, 40 were questing ticks and the remainder was collected from naturally infested cattle, sheep, goats, horses or dogs. Tick species analyzed included Ixodes ricinus, Dermacentor marginatus, Hyalomma marginatum, Rhipicephalus bursa, and Rhipicephalus sanguineus. Four rickettsiae of the spotted fever group of zoonotic concern were identified for the first time in Romania: Rickettsia monacensis and Rickettsia helvetica in I. ricinus, and Rickettsia slovaca and Rickettsia raoultii in D. marginatus. Other zoonotic pathogens such as A. phagocytophilum, Borrelia afzelii, and Babesia microti were found in I. ricinus. Pathogens of veterinary importance were also identified, including Theileria equi in H. marginatum, Babesia occultans in D. marginatus and H. marginatum, Theileria orientalis/sergenti/buffeli-group in I. ricinus and in H. marginatum and E. canis in R. sanguineus. These findings show a wide distribution of very diverse bacterial and protozoan pathogens at the domestic host-tick interface in Romania, with the potential of causing both animal and human diseases.

  19. Rickettsia conorii israelensis in Rhipicephalus sanguineus ticks, Sardinia, Italy.

    Science.gov (United States)

    Chisu, Valentina; Masala, Giovanna; Foxi, Cipriano; Socolovschi, Cristina; Raoult, Didier; Parola, Philippe

    2014-06-01

    The presence of tick-borne Rickettsia spp. was examined by PCR using DNA samples extracted from 254 ticks collected from mammals originating from northern and eastern Sardinia, Italy. The spotted fever group rickettsial agent Rickettsia conorii israelensis was detected in 3 Rhipicephalus sanguineus ticks from a dog for the first time in this geographical area. In addition, Ri. massiliae, Ri. slovaca, and Ri. aeschlimannii were detected in Rh. turanicus, Rh. sanguineus, Dermacentor marginatus, and Hyalomma marginatum marginatum ticks from dogs, goats, wild boar, and horse. Moreover, Candidatus Rickettsia barbariae was detected in 2 Rh. turanicus ticks from goats. The detection of Ri. conorii israelensis, an emergent agent which causes Israeli spotted fever, increases our knowledge on tick-borne rickettsioses in Sardinia.

  20. Ticks (Acari: Ixodidae infesting cattle and African buffaloes in the Tsavo conservation area, Kenya

    Directory of Open Access Journals (Sweden)

    Edward K. Kariuki

    2012-02-01

    Full Text Available Several ixodid tick species are shared between domestic cattle and African buffaloes (Syncerus caffer. So too, are a number of tick-borne diseases. The aim of the study was to compare the species composition of ticks that infest cattle and buffaloes utilising the same habitat within the Tsavo Conservation Area, Kenya. To this end, 25 cattle and 62 buffaloes were each opportunistically sampled for ticks on a single occasion in February 2010. Eight species, namely Amblyomma gemma, Amblyomma lepidum, Hyalomma albiparmatum, Hyalomma rufipes, Hyalomma truncatum, Rhipicephalus evertsi evertsi, Rhipicephalus pravus and Rhipicephalus pulchellus infested both cattle and buffaloes. Three species, Rhipicephalus (Boophilus sp., Rhipicephalus kochi, and Rhipicephalus muehlensi were collected only from cattle, and three species, Hyalomma impeltatum, Rhipicephalus humeralis and Rhipicephalus praetextatus were present only on buffaloes. The attachment sites of the various tick species were also recorded. New locality records for H. impeltatum and H. truncatum and the first confirmed locality record for Rhipicephalus praetextatus sensu stricto in Kenya were documented.

  1. Lyme borreliosis spirochetes and spotted fever group rickettsiae in ixodid ticks from Pianosa island, Tuscany Archipelago, Italy.

    Science.gov (United States)

    Tomassone, L; Grego, E; Auricchio, D; Iori, A; Giannini, F; Rambozzi, L

    2013-02-01

    A study on tick fauna and tick-borne pathogens was undertaken in Pianosa, an island in the Tuscany Archipelago that constitutes an important stopping and nesting point for migratory birds. Ticks were removed from feral cats and a few terrestrial birds, and host-seeking ticks were collected by dragging. A total of 89 ticks were found on animals: 57 Ixodes ventalloi Gil Collado, 1936 and 32 Ixodes acuminatus Neumann, 1901. Host-seeking ticks were 354 Hyalomma spp. larvae and 18 Hyalomma spp. adults, identified as Hyalomma marginatum C.L. Koch, 1844 (n=11) and 7 Hyalomma detritum Schulze, 1919 (n=7). A sample of adult ticks was subjected to molecular analyses to look for Rickettsia spp. and Borrelia burgdorferi sensu lato (s.l.). Sequence analysis of the 5S-23S intergenic spacer region and OspA gene of B. burgdorferi s.l.-positive samples showed the presence of Borrelia spielmanii (n=3; 3.7%, 95% confidence interval [CI] 0.08-10.4) and Borrelia valaisiana (n=13; 13.6%, 95% CI 7.0-23.0) in Ixodes ticks from cats and terrestrial birds. Ixodes spp. were also infected by Rickettsia helvetica (n=19; 23.4%, 95% CI 14.7-34.2). Finally, we detected Rickettsia aeschlimannii in 3 out of 12 host-seeking Hyalomma spp. adults tested (25%, 95% CI 5.5-57.2). Our study shows the presence of several tick-borne pathogens in Pianosa. Hyalomma spp. and Ixodes ticks other than I. ricinus seem to be involved in their epidemiological cycle, and birds could contribute to the pathogen dispersal along their migration routes. This is the first finding of B. spielmanii in Italy. We hypothesize the involvement of peridomestic rodents or hedgehogs in its maintenance in Pianosa.

  2. Analysis of the Relative Expression of microRNA-10 in Different Developmental Stages and Various Tissues of Hyalomma asiaticum%亚洲璃眼蜱不同发育阶段及其组织中microRNA-10表达分析

    Institute of Scientific and Technical Information of China (English)

    袁小松; 罗金; 田占成; 谢俊仁; 王芳芳; 田美媛; 张以芳; 刘光远

    2014-01-01

    [Objective] MicroRNAs (miRNAs) are a conserved class of non-coding 20-22 nt small RNAs. miRNAs have been reported in many viruses, animals and plants such as Mareks diseased virus, fruit flies, zebra fish, humans and Arabidopsis so far. MiRNAs regulate gene expression by binding to mRNA at post-transcriptional levels, leading to mRNA inhibition or degradation. MiRNAs regulate a variety of biological processes, including cell proliferation, differentiation, metabolism and apoptosis. The purpose of this experiment is to understand the potential biological function of miR-10 in Hyalomma asiaticum. To obtain the precursor and mature of microRNA-10 (miR-10), its relative expression and the biologic significance in different developmental stages and various tissues from Hyalomma asiaticum were analyzed, which will be helpful for further study the relationship between the function of miR-10 and development of H. asiaticum. [Method] Total RNA of the different developmental stages and various tissues were extracted using Trizol Reagent, then transcripted to cDNA using SYBR ®Prime Script TM miRNA RT-PCR Kit( TaKaRa Code:RR716). To obtain the miR-10 precursor sequence from H. asiaticum, the specific primers were designed according to the miRBase database (Accession number:MI0012262). Then its homology was compared with the sequence from miRBas database by the MEGA4 software. The expression of miR-10 from different developmental stages and various tissues of H. asiaticum was assessed by qPCR. The biological function of miR-10 in H. asiaticum was presumed.[Result]A 73 bp gene was cloned by PCR, which was CUACAUCUACCCUGUAGAUCCGAAUUUGUUUGCCA CUAGACUACAAAUUCGGUUCUAGAGAGGCUUUGUGUGG. There was a relatively high genetic similarity among 16 varieties. The similarity between H. asiaticum and Ixodes scapularis was 95.9%, and 88.9%-91.7% compared with other arthropods. The miR-10 sequence was highly conserved in various species. The mature sequence of miR-10 was UACCCUGUAGAUCCGAAUUUGU

  3. Molecular and serological detection of Theileria equi and Babesia caballi infection in horses and ixodid ticks in Iran.

    Science.gov (United States)

    Abedi, Vali; Razmi, Golamreza; Seifi, Hesam; Naghibi, Abolghasem

    2014-04-01

    Equine piroplasmosis is a hemoprotozoan tick-borne disease with worldwide distribution that is caused by Theileria equi and Babesia caballi. However, the geographical distribution of equine piroplasmosis in Iran is unknown. The aim of the current study was to determine the causative agents and vector ticks of equine piroplasmosis in horses in the North Khorasan Province. In the year 2011, 100 horses were randomly selected from 14 villages. Blood samples and ixodid ticks were collected and examined using microscopical, molecular, and serological methods. Theileria equi infection was microscopically detected in 5 (5%) of the blood smears with low parasitemia, while serum samples were tested by the indirect immunofluorescent antibody test (IFAT). Antibodies against T. equi, B. caballi, and a mixed infection were detected in 48 (48%), 2 (2%), and 3 (3%) of the serum samples, respectively. A multiplex PCR was used to detect T. equi and B. caballi DNA in blood samples. No B. caballi infections could be found, but Theileria equi DNA was detected in 45 (45%) of the blood samples, and a BLAST analysis of the sequenced samples indicated a 99% similarity with T. equi 18S rRNA gene sequences in GenBank. Both molecular and serological results did not identify any significant association between T. equi infection and risk factors. A comparision of the results of 3 diagnostic methods demonstrated a poor agreement between microscopical examination with IFAT and PCR and a moderate agreement between IFAT and PCR. Thirty-seven adult ticks (20 females and 17 males) were collected from 15 horses. The most common tick was Hyalomma marginatum marginatum (n=19), followed by Hyalomma anatolicum excavatum (n=10), Rhipicephalus bursa (n=4), Hyalomma marginatum turanicum (n=3), and Hyalomma anatolicum anatolicum (n=1). The salivary glands and ovaries were also examined using PCR. The genomic DNA samples of the salivary glands of 3 ticks, H. a. excavatum (n=2) and R. bursa (n=1), had a

  4. Parasites of domestic and wild animals in South Africa. XLIX. Ticks (Acari: Ixodidae infesting white and black rhinoceroses in southern Africa

    Directory of Open Access Journals (Sweden)

    Ivan G. Horak

    2017-01-01

    Full Text Available The objectives of the study were to determine the species composition of ticks infesting white and black rhinoceroses in southern Africa as well as the conservation status of those tick species that prefer rhinos as hosts. Ticks were collected opportunistically from rhinos that had been immobilised for management purposes, and 447 white rhinoceroses (Ceratotherium simum and 164 black rhinoceroses (Diceros bicornis were sampled in South Africa, 61 black rhinos in Namibia, 18 white and 12 black rhinos in Zimbabwe, and 24 black rhinos in Zambia. Nineteen tick species were recovered, of which two species, Amblyomma rhinocerotis and Dermacentor rhinocerinus, prefer rhinos as hosts. A. rhinocerotis was collected only in the northeastern KwaZulu-Natal reserves of South Africa and is endangered, while D. rhinocerinus is present in these reserves as well as in the Kruger National Park and surrounding conservancies. Eight of the tick species collected from the rhinos are ornate, and seven species are regularly collected from cattle. The species present on rhinos in the eastern, moister reserves of South Africa were amongst others Amblyomma hebraeum, A. rhinocerotis, D. rhinocerinus, Rhipicephalus maculatus, Rhipicephalus simus and Rhipicephalus zumpti, while those on rhinos in the Karoo and the drier western regions, including Namibia, were the drought-tolerant species, Hyalomma glabrum, Hyalomma rufipes, Hyalomma truncatum and Rhipicephalus gertrudae. The species composition of ticks on rhinoceroses in Zambia differed markedly from those of the other southern African countries in that Amblyomma sparsum, Amblyomma tholloni and Amblyomma variegatum accounted for the majority of infestations.

  5. Molecular detection of Theileria spp. in sheep and vector ticks in the North Khorasan Province, Iran.

    Science.gov (United States)

    Rashidi, Ahmad; Razmi, Gholamreza

    2013-01-01

    A survey was carried in North Khorasan Province, Iran in 2010-2011, designed to identify Theileria spp. infections of both sheep and ticks. The tick species were also examined. Ninety sheep from different flocks were clinically examined, and blood samples and ixodid ticks were collected. Light microscopy of blood smears revealed Theileria spp. infection in 37 (41.1 %), while 74 (82.2 %) of blood samples were positive using semi-nested PCR. Theileria ovis, Theileria lestoquardi, and mixed infection were detected in 63/90 (70 %), 5/90 (5.5 %), and 6/90 (6.6 %) of samples, respectively. Of the 434 ticks that were collected, the most prevalent species was Rhipicephalus turanicus (69.3 %) followed by Hyalomma marginatum turanicum (18.4 %), Dermacentor marginatus (6.4 %), and Rhipicephalus bursa (5.7 %). The ticks were separated into 42 tick pools, and the salivary glands were dissected out in 0.85 % (w/v) saline under a stereomicroscope and examined using semi-nested PCR. Three pools of H. marginatum turanicum salivary glands were infected with T. ovis and T. lestoquardi, and one pool of R. turanicus was infected with T. ovis. Based on these results, it is concluded that the prevalence of T. ovis is higher than T. lestoquardi and that H. marginatum turanicum and R. turanicus are likely vectors of T. lestoquardi and T. ovis in this area.

  6. A molecular survey of Theileria and Babesia parasites in cattle, with a note on the distribution of ticks in Tunisia.

    Science.gov (United States)

    M'ghirbi, Y; Hurtado, A; Barandika, J F; Brandika, J; Khlif, K; Ketata, Z; Bouattour, A

    2008-07-01

    Between October and November 2006, a total of 278 bovine blood samples were examined, and 104 (37.4%) were positive for piroplasms by microscopy. A reverse line blot hybridisation with polymerase chain reaction detected Theileria annulata, T. buffeli, Babesia bovis and B. bigemina in cattle accounting for 48.6% of positive samples. The most frequently found species was T. buffeli, which was present in 39.2% of the samples. T. annulata was found in 48 samples (17.3%). Babesia infections were less frequently detected: B. bovis was found in 6.8% of the samples and B. bigemina in 4.3%. Mixed infections were detected in 45 samples, accounting for seven different combinations of species. Seven Ixodid tick species (Boophilus annulatus, Ixodes ricinus, Hyalomma marginatum, Hyalomma excavatum, Hyalomma detritum, Haemaphysalis punctata and Haemaphysalis sulcata) were collected from examined cattle in the 23 visited farms. I. ricinus was the dominant species (36%), mainly collected in the humid zone, while it seemed to be very rare in the semi-arid zone (where only 15 specimens were collected), whereas B. annulatus was the most commonly collected species in the sub-humid area (68.5% of ticks collected in this zone).

  7. Hard ticks (Ixodidae and Crimean-Congo hemorrhagic fever virus in south west of Iran.

    Directory of Open Access Journals (Sweden)

    Narges Sharifinia

    2015-03-01

    Full Text Available Ticks are vectors of some important arthropod-borne diseases in both fields of veterinary and medicine, such as Lyme, tularemia, Rocky Mountain spotted fever, and some types of encephalitis as well as Crimean Congo hemorrhagic fever (CCHF. Iran is known as one of the main foci of CCHF in west of Asia. This study was conducted in DarrehShahr County because of the development of animal husbandry in this area to detect the fauna and viral infection of the hard ticks of livestock. A cross-sectional survey was conducted during 2011-2012 with random sampling in four villages. A sample of ticks was subjected to RT-PCR method for detection of viral infection. During the study period, 592 Ixodidae ticks were collected and identified as seven species of Hyalomma asiaticum, Hy. marginatum, Hy. anatolicum, Hy. dromedarii, Hy. detritum, Rhipicephalus bursa and Rh. sanguineus. More than 20% of these ticks were examined to detect the genome of CCHF virus while 6.6% were positive. All species of Hyalomma were found to be positive. A high rate of livestock was found to be infected with hard ticks, which can act as the vectors of the CCHF disease. Regarding infection of all five Hyalomma species captured in this area, this genus should be considered as the main vector of CCHF. Planning control program can be performed based on the obtained data on seasonal activity of Ixodidae to prevent animal infestation as well as to reduce the risk of CCHF transmission.

  8. Ticks (Acari: Ixodidae of livestock and their seasonal activities, northwest of Iran

    Directory of Open Access Journals (Sweden)

    Zahra Ramezani

    2014-09-01

    Full Text Available Objective: To identify the ticks (Acari: Ixodidae of livestock and their seasonal activities, in northwest of Iran, including the combination of two of the geographical regions of Iran (Caspian and mountain plateau where the majority of the domestic ruminants in Iran exist. Methods: Fifteen villages of Meshkin-Shahr County were selected randomly from different areas of the county. The animal dwellings were visited and the whole body of sheep, cows, goats and dogs were examined for their probable infestation. Samples were identified at the level of species according to the standard morphological key. Results: In this study 1 208 specimen were collected and totally nine species (Dermacentor marginatus, Dermacentor niveus, Haemaphysalis erinacei, Haemaphysalis punctata, Hyalomma anatolicum, Hyalomma asiaticum, Hyalomma marginatum, Rhipicephalus bursa and Rhipicephalus sanguineus were identified in this study. Also 569 host including 40 cows, 450 sheep, 70 goats and 9 dogs were examined for infestation and among them 255 were infested which showed a 44% of infestation among examined livestock. The infestation rate among sheep (46% was higher than other hosts. The infestation rates among the rest of hosts were as: cows (40%, goat (37% and dogs (33%. Conclusions: The results of this study and other studies of the region showed the probability of the establishment and development of the burden of several tick-borne diseases.

  9. Distribution of ticks (Acari:Ixodidae) infesting domestic ruminants in mountainous areas of Golestan province, Iran

    Institute of Scientific and Technical Information of China (English)

    Moslem Sarani; Zakkyeh Telmadarraiy; Abdolreza Salahi Moghaddam; Kamal Azam; Mohammad Mehdi Sedaghat

    2014-01-01

    Objective: To determine the prevalence of ticks on cattle in the mountainous areas of Golestan province and their geographical distribution.Methods:collection was carried out during four seasons, twice per season over a period of 12 month from March 2009 through February 2010 in two districts, Azadshahr and Ramian. Meteorological data were obtained from Iran Meteorological Organization. The geographical points recorded using a Garmin eTrex®H GPS.Results:In total, 498 animals from 25 herds were selected to search for ticks in 2009-2010. Tick 63 goats, 99 cows and 13 camels in two districts of the mountainous area of Golestan province, including Azadshahr and Ramian. Five species of ixodid ticks were identified: Rhipicephalussanguineus A total of 255 ticks were collected from a total of 219 ruminants including 44 sheep, anatolicum (6%) and Hyalomma asiaticum (4%). The densities of infestations were calculated for sheep, goats, cows and camels 0.9, 0.79, 0.16 and 0.43 respectively. Seasonal activity of each ixodid tick infesting domestic ruminants was determined. The distribution maps showed ixodid ticks on domestic ruminants, and Rhipicephalus sanguineus were dominant species in the area.Conclusions:Such research provides necessary information for human and animal health (66.5%), Rhipicephalus bursa (4.6%), Hyalomma marginatum (19.9%), Hyalomma service mangers to have a better understanding of prevention and control of vector borne diseases especially during the outbreaks.

  10. Screening for cytotoxic activity in a commercially important Indian seaweed, Stocheospermum marginatum

    Digital Repository Service at National Institute of Oceanography (India)

    Rashmi, C.V.; Chatterji, A.

    stream_size 6 stream_content_type text/plain stream_name Diversity_Life_Process_Ocean_Land_2007_36.pdf.txt stream_source_info Diversity_Life_Process_Ocean_Land_2007_36.pdf.txt Content-Encoding ISO-8859-1 Content-Type text...

  11. Occurrence of Soft and Hard Ticks on Ruminants in Zagros Mountainous Areas of Iran

    Directory of Open Access Journals (Sweden)

    S Nabian

    2008-08-01

    Full Text Available Background:The distribution and preferences of ticks of animals in central of Iran were studied four times a year. Methods: One thousand seven tick specimens were collected from different localities including Isfahan, Chaharmahalbak­htiary, EastAzarbaijan, West Azerbaijan, Kordestan, Kermanshah, Lorestan and Fars. Results: Most of sampled animals in this area were infested. We also encountered with a wild goat (Capra hircus aegagrus in Kolah Qazi national park in this part that was infested intensively by Boophilus kohlsi. Fifteen ixodid tick species were identified over the study period from cattle, sheep and domestic and wild goats namely B. kohlsi (3.6% Rhipicephalus sanguineus (4.5%, Rh.bursa (21.9%, Rh.turanicus (2.9%, Dermacentor niveus (12.9%, D.raskemensis (4.1%, D.marginatus (7.3%, Haemaphysalis punctata (3.5%, H. Parva (0.6%, H. Choldokovskyi (2%, Hyalomma anatolicum excavatum (4.8%, H.anatolicum anatolicum (5.2%, H. asiaticum asiaticum (7.3%, H. marginatum marginatum (13%, and H. detritum detritum (5.9%. The only soft tick found was Ornithodoros canestrinii which occurred in all localities of Isfahan Province but with significant differences in abundance. Clear pattern of seasonality was evident for this species and it was generally present from November to March, while ixodid ticks were present throughout the year. The largest numbers of adult ixodid ticks were generally present from April to August. Conclusion: The results showed that Rh.bursa, D.niveus and H.marginatum marginatum are dominant tick species

  12. Lethal and sub-lethal effects of ivermectin on north temperate dung beetles, Aphodius ater and Aphodius rufipes (Coleoptera: Scarabaeidae)

    OpenAIRE

    O'Hea, N. M.; Kirwan, L.; P. S. Giller; J. A. Finn

    2010-01-01

    Ivermectin is an anthelmintic veterinary medicine, and is excreted in the dung of treated livestock in a mainly unmetabolised form. Ivermectin is known to have toxic effects on dung beetles, but most studies to date have been conducted on tropical and sub-tropical species. Relatively few laboratory studies have focused on the specific effects of ivermectin on survival and development of north temperate dung beetles. In this study, we experimentally investigated the effect of ivermectin concen...

  13. Molecular detection and characterization of spotted fever group rickettsiae in ticks from Central Italy.

    Science.gov (United States)

    Scarpulla, M; Barlozzari, G; Marcario, A; Salvato, L; Blanda, V; De Liberato, C; D'Agostini, C; Torina, A; Macrì, G

    2016-07-01

    The aim of this study was to investigate the presence of rickettsial pathogens in ticks from Central Italy. A total of 113 ticks hailed from Latium and Tuscany regions were identified and tested by PCR to detect gltA, ompA, ompB genes of Rickettsia. Positive amplicons were sequenced and identified at species level. Ticks were analyzed individually or in pools. The percentage of positivity for SFG rickettsiae was 12.4%, expressed as minimum infection rate (MIR) assuming that one tick was positive in each positive pool. Rickettsia aeschlimannii was detected in Hyalomma marginatum, Rickettsia monacensis in Ixodes ricinus and Rickettsia massiliae and Rickettsia conorii in Rhipicephalus sanguineus sensu lato. These findings confirm the circulation of pathogenic rickettsiae in Latium and Tuscany regions. To our knowledge this is the first report of R. massiliae in Latium region.

  14. One-Humped Camels (Camelus dromedaries Hard Ticks Infestation in Qeshm Island, Iran

    Directory of Open Access Journals (Sweden)

    Saeed Nazifi

    2011-06-01

    Full Text Available The economic importance of tick infestation on camels are important as they are important meat and milk producer animals in the less vegetation area of Iran and their health and production are greatly affected by the high tick infestation. In this investigation, tick infestations on camels (Camelus dromedarius were determined in Qeshm Island, Iran. A total number of 912 adult ticks (472 males and 440 females were collected and identified. Hyalomma dromedarii was the predominant tick specie and accounted for 61.9% of the adult ticks. Other hard ticks were H. anatolicum excavatum (22 %, H. asiaticum asiaticum (14.2 %, H. marginatum (1.9 %, H. impeltatum (0.4 % and Ripicephalus bursa (0.4 %. In conclusion, The provision of tick control programs in the Qeshm Island would seem a prerequisite for improving camel meat and milk production.

  15. Genetic Analysis of Crimean-Congo Hemorrhagic Fever Virus in Russia

    Science.gov (United States)

    Yashina, Lyudmila; Vyshemirskii, Oleg; Seregin, Sergei; Petrova, Irina; Samokhvalov, Evgeny; Lvov, Dmitry; Gutorov, Valery; Kuzina, Irina; Tyunnikov, Georgy; Tang, Yi-Wei; Netesov, Sergei; Petrov, Vladimir

    2003-01-01

    Genetic analysis of wild-type Crimean-Congo hemorrhagic fever (CCHF) virus strains recovered in the European part of Russia was performed. Reverse transcriptase PCR followed by direct sequencing was used to recover partial sequences of the CCHF virus medium (M) genome segment (M segment) from four pools of Hyalomma marginatum ticks and six human patients. Phylogenetic analysis of the M-segment sequences from Russian strains revealed a close relatedness of the strains (nucleotide sequence diversity, ≤5.0%). The strains differed significantly from CCHF viruses from other regions of the world (nucleotide sequence diversity, 10.3 to 20.4%), suggesting that CCHF virus strains recovered in the European part of Russia form a distinct group. PMID:12574301

  16. Molecular Investigation of Francisella-Like Endosymbiont in Ticks and Francisella tularensis in Ixodid Ticks and Mosquitoes in Turkey.

    Science.gov (United States)

    Duzlu, Onder; Yildirim, Alparslan; Inci, Abdullah; Gumussoy, Kadir Semih; Ciloglu, Arif; Onder, Zuhal

    2016-01-01

    This study was carried out to investigate the molecular prevalence of Francisella-like endosymbionts (FLEs) and Francisella tularensis in ticks (Acari: Ixodidae) and mosquitoes in Turkey. Genomic DNA pools were constructed from a total of 1477 adult hard ticks of Rhipicephalus (Rh.) annulatus, Rh. turanicus, Rh. sanguineus, Rh. bursa, Haemaphysalis (Hae.) parva, Hae. sulcata, Hyalomma marginatum marginatum, H. anatolicum anatolicum, H. anatolicum excavatum, H. detritum detritum, H. dromedarii, Dermacentor marginatus, and Ixodes ricinus species, which were collected from several barns, cattle, and people. Genomic DNA was also extracted from pools consisting of 6203 adult female mosquito species belonging to Aedes vexans, Culex (Cx.) pipiens, Cx. hortensis, Cx. theileri, Culiseta annulata, and Anopheles maculipennis species. Conventional PCR and TaqMan probe-based real- time PCR targeting the 16S rRNA gene for FLEs and the lpnA gene for F. tularensis, respectively, were performed on the DNA isolates obtained. FLEs and F. tularensis were not found in any genomic DNA pools constructed from ixodid ticks and mosquitos. This study represents the first investigation of F. tularensis and FLEs in potential vector ticks and mosquitoes by molecular methods in Turkey. The present study provides useful insights into the molecular epidemiology of F. tularensis and FLEs. One of the major conclusions of the study is that tularemia outbreaks may be essentially due to direct transmission from the environment (especially from water) in Turkey and not to vector-borne transmission.

  17. Sero-epidemiological survey of Crimean-Congo hemorrhagic fever virus in Tunisia

    Directory of Open Access Journals (Sweden)

    Wasfi Fares

    2016-01-01

    Full Text Available Crimean-Congo hemorrhagic fever (CCHF is a tick-borne disease associated with a high case fatality rate and transmitted mainly by Hyalomma marginatum. The geographical distribution of H. marginatum covers most of the Western Mediterranean basin. We aimed to investigate whether CCHF virus (CCHFv is circulating in Tunisia. Samples from unexplained acute febrile patients (n = 181 and a high risk group of humans, mainly slaughter workers (n = 38, were collected in the summer of 2014 and analyzed for exposure to CCHFv using serological tests and real-time RT-PCR. Ticks were collected from Northern and Southern Tunisia during May–June 2014 and examined for the presence of CCHFv by real-time RT-PCR. Of the 181 febrile patients, 5 showed only high titers of IgM suggesting a recent exposure to CCHFv. Among 38 slaughter workers, 2 had IgG anti-CCHFv responses yielding a seroprevalence of 5.2%. No CCHFv was detected in ticks and sera. Our results provide evidence of human exposure to CCHFv in Tunisia.

  18. Sero-epidemiological survey of Crimean-Congo hemorrhagic fever virus in Tunisia

    Science.gov (United States)

    Wasfi, Fares; Dowall, Stuart; Ghabbari, Tayssir; Bosworth, Andrew; Chakroun, Mohamed; Varghese, Anitha; Tiouiri, Hanene; Ben Jemaa, Mounir; Znazen, Abir; Hewson, Roger; Zhioua, Elyes; Letaief, Amel

    2016-01-01

    Crimean-Congo hemorrhagic fever (CCHF) is a tick-borne disease associated with a high case fatality rate and transmitted mainly by Hyalomma marginatum. The geographical distribution of H. marginatum covers most of the Western Mediterranean basin. We aimed to investigate whether CCHF virus (CCHFv) is circulating in Tunisia. Samples from unexplained acute febrile patients (n = 181) and a high risk group of humans, mainly slaughter workers (n = 38), were collected in the summer of 2014 and analyzed for exposure to CCHFv using serological tests and real-time RT-PCR. Ticks were collected from Northern and Southern Tunisia during May–June 2014 and examined for the presence of CCHFv by real-time RT-PCR. Of the 181 febrile patients, 5 showed only high titers of IgM suggesting a recent exposure to CCHFv. Among 38 slaughter workers, 2 had IgG anti-CCHFv responses yielding a seroprevalence of 5.2%. No CCHFv was detected in ticks and sera. Our results provide evidence of human exposure to CCHFv in Tunisia. PMID:26956221

  19. Tick Infestation Rate of Sheep and Their Distribution in Abdanan County, Ilam Province, Iran, 2007-2008

    Directory of Open Access Journals (Sweden)

    MA Oshaghi

    2010-12-01

    Full Text Available "nAbstract "nBackground: Ticks are hematophagous arthropod belonging to the Class of Arachnids. Ticks are also one of the major vectors of pathogens to animal and human. This study was conducted to determine tick infestation rate of sheep in Abdanan during 2007–2008. "nMethods: Sampling was performed seasonally in 19 villages during spring 2007 until winter 2008. A total of 1095 sheep were selected and tested for tick infestation.  After collection, all ticks were transported to laboratory of Medi­cal Entomology and were identified with appropriate identification keys. "nResults: Totally, 864 hard ticks were collected. The ticks were classified into two genera and 5 species including: Hyalomma marginatum (44.67%, Hy. anatolicum (43.17%, Hy.asiaticum (6.37%, Hy. dromedarii (5.55%, Hea­maphysalis sulcata (0.24%. The highest seasonal activity was observed in spring (36.46 % and the lowest seasonal was in winter (11.57%. The rate of tick frequency in mountainous region was 48.15% and it was 51.85% in plateau regions. In this study, tick infestation of sheep was 11.41%. "nConclusion: Hy.marginatum has the more frequent density in the study area. "n  "nKeywords: Ticks, sheep, Iran

  20. Laboratory Study on Biological Control of Ticks (Acari: Ixodidae by Entomopathogenic Indigenous Fungi (Beauveria bassiana

    Directory of Open Access Journals (Sweden)

    M Abdigoudarzi

    2009-12-01

    Full Text Available Background: Chemical control method using different acaricides as spray, dipping solution or pour-on is routinely used for controlling ticks. Biological control agents are favorable due to their safety for animals and environment. Entomopathogenic fungi such as Beauveria bassiana are well known for controlling ticks. In this study, two Iranian indigenous strains of B. bassiana (B. bassiana 5197 and B. bassiana Evin were selected and grown on specific me­dia. The pathogenic effects of these strains were evaluated on adult stages of two Iranian Ixodidae members (H. anatolicum anatolicum Koch 1844, and H. marginatum Koch 1844 by dipping method.Methods: Two Iranian strains of Beauveria bassiana (Beauveria bassiana 5197 and Beauveria bassiana Evin were selected and were grown successfully on specific media. The pathogenic effects of these strains were evaluated on adult stages of Iranian Ixodidae members such as, Hyalomma anatolicum anatolicum and H. marginatum by dipping method (these ticks were grown up at laboratory conditions during 2002 up to 2003 and still it is continued .Results: There was no effect of strain 5197 on mortality or fecundity rates for ticks. There was acute phase sign of paralysis in test group after dipping ticks in suspension made from Evin strain of B. bassiana. In addition, the test groups were totally died after four months, but the control groups survived for six months.Conclusion: High concentration of fungal spores is needed for inducing fungal infection. Additional study using different strains and fungi on Iranian ticks is proposed. 

  1. Crimean-Congo hemorrhagic fever virus clades V and VI (Europe 1 and 2) in ticks in Kosovo, 2012.

    Science.gov (United States)

    Sherifi, Kurtesh; Cadar, Daniel; Muji, Skender; Robaj, Avni; Ahmeti, Salih; Jakupi, Xhevat; Emmerich, Petra; Krüger, Andreas

    2014-09-01

    Despite being a small country, Kosovo represents one of the few foci of Crimean-Congo hemorrhagic fever (CCHF) in Europe. The distribution of Kosovar tick vectors and the evolution of CCHF virus in ticks are both as yet unknown. A better description of the extent and the genetic diversity of CCHFV in ticks from endemic settings is essential, in order to be controlled. We investigated the 2012 distribution of Kosovar ticks alongside the prevalence and the phylogeography of tick-derived CCHFV. Hyalomma marginatum dominated in the endemic municipalities with 90.2% versus 24.3% in the non-endemic regions. Of 1,102 tested ticks, 40 (3.6%) were CCHFV-positive, belonging to H. marginatum (29), Rhipicephalus bursa (10), and Ixodes ricinus (1). The virus strains clustered with clade V and VI related sequences. They fell into two lineages: Kosovo I and II. Kosovo I comprised strains recovered exclusively from R. bursa ticks and was closely related to AP92 prototype strain. Kosovo II clustered into Kosovo IIa, including human-derived strains, and IIb including only strains detected in H. marginatum and I. ricinus. Our phylogeographic reconstruction suggests two temporally distinct CCHFV introductions: the most probable location of the most recent common ancestor of Kosovo I lineage was in Greece (63 years ago) and that of lineages IIa-b in Turkey (35 years ago). After each CCHFV introduction into Kosovo, subsequent lineage expansions suggest periods of in situ evolution. The study provides the first insight into the genetic variability and the origin of CCHFV in ticks from Kosovo. Our findings indicate the spreading of CCHFV to non-endemic areas, which underlines the importance of further studies in order to monitor and predict future CCHF outbreaks in Kosovo. The AP92-like strains appear to be more widespread than previously thought and may provide a promising target for experimental studies due to their assumed low pathogenicity.

  2. Crimean-Congo hemorrhagic fever virus clades V and VI (Europe 1 and 2 in ticks in Kosovo, 2012.

    Directory of Open Access Journals (Sweden)

    Kurtesh Sherifi

    2014-09-01

    Full Text Available Despite being a small country, Kosovo represents one of the few foci of Crimean-Congo hemorrhagic fever (CCHF in Europe. The distribution of Kosovar tick vectors and the evolution of CCHF virus in ticks are both as yet unknown. A better description of the extent and the genetic diversity of CCHFV in ticks from endemic settings is essential, in order to be controlled. We investigated the 2012 distribution of Kosovar ticks alongside the prevalence and the phylogeography of tick-derived CCHFV. Hyalomma marginatum dominated in the endemic municipalities with 90.2% versus 24.3% in the non-endemic regions. Of 1,102 tested ticks, 40 (3.6% were CCHFV-positive, belonging to H. marginatum (29, Rhipicephalus bursa (10, and Ixodes ricinus (1. The virus strains clustered with clade V and VI related sequences. They fell into two lineages: Kosovo I and II. Kosovo I comprised strains recovered exclusively from R. bursa ticks and was closely related to AP92 prototype strain. Kosovo II clustered into Kosovo IIa, including human-derived strains, and IIb including only strains detected in H. marginatum and I. ricinus. Our phylogeographic reconstruction suggests two temporally distinct CCHFV introductions: the most probable location of the most recent common ancestor of Kosovo I lineage was in Greece (63 years ago and that of lineages IIa-b in Turkey (35 years ago. After each CCHFV introduction into Kosovo, subsequent lineage expansions suggest periods of in situ evolution. The study provides the first insight into the genetic variability and the origin of CCHFV in ticks from Kosovo. Our findings indicate the spreading of CCHFV to non-endemic areas, which underlines the importance of further studies in order to monitor and predict future CCHF outbreaks in Kosovo. The AP92-like strains appear to be more widespread than previously thought and may provide a promising target for experimental studies due to their assumed low pathogenicity.

  3. Neurosecretory Cell Types and Distribution in Unfed Female Hyalomma Dromedari (Acari: Ixodoidea: Ixodidae) Synganglion

    Science.gov (United States)

    1987-01-01

    of the cell in subtype VIh (Fig. 2). Type IX : In these oval celo, 2 subtypes are distinguished according to cell size and NSG distribution. The NSG...1977) : Neurosecretion in Ornithodoros savignyi (Audouin) (Ixodoidea : Arga- sidae ). The distribution of neurosecretory cells in the brain. J. Vet. Res

  4. Prevalence and genetic diversity of piroplasm species in horses and ticks from Tunisia.

    Science.gov (United States)

    Ros-García, Amaia; M'ghirbi, Youmna; Hurtado, Ana; Bouattour, Ali

    2013-07-01

    The genetic diversity and prevalence of Babesia and Theileria species in the equine population of Tunisia were studied using reverse line blot (RLB) hybridization on blood samples and unfed adult ticks collected from apparently healthy horses from three bioclimatic zones in Tunisia. Piroplasms were identified in 13 of 104 of the horse blood samples analyzed (12.5%) and five genotype groups were identified: Theileria equi group A (nine animals, 8.7%), group C (one animal, 1.0%) and group D (three animals, 2.9%), and Babesia caballi groups A and B (one animal each). All horses from the semi-arid zone were negative and prevalence in the humid and sub-humid zones were 12.9% and 20.0%, respectively. Three Ixodid tick species (Hyalomma marginatum, Hyalomma excavatum and Rhipicephalus bursa) were collected from examined horses and equine piroplasms were detected in 10.8% of them. T. equi groups A and D (9.2%), and B. caballi group B (1.6%) were identified in ticks. This work represents the first epidemiological report of equine piroplasmosis in Tunisia. Results showed a high level of diversity within the 18S rRNA gene of equine piroplasm species, and confirmed the presence in Tunisia of two T. equi genetic groups, C and D, only reported before in South Africa and Sudan.

  5. Ticks (Acari: Ixodida) parasitizing humans in Corum and Yozgat provinces, Turkey.

    Science.gov (United States)

    Keskin, Adem; Keskin, Aysun; Bursali, Ahmet; Tekin, Saban

    2015-12-01

    In order to identify ticks infesting humans in Corum and Yozgat provinces in Turkey, a total of 2110 ticks representing 14 species were collected on humans, between June and September 2009. Of those, 1551 (687♂, 450♀, 407 nymphs, 7 larvae) were collected from Corum and 559 (330♂, 180♀, 49 nymphs) were collected from Yozgat. The majority of ticks (n = 1121, 53.1 %) was Hyalomma marginatum. Other common ticks infesting humans were Dermacentor marginatus (n = 209, 9.9 %) and Rhipicephalus turanicus sensu lato (n = 145, 6.9 %) in the study area. In addition, a total of 386 immature Hyalomma were found on humans in Corum (335 nymphs, 7 larvae) and Yozgat (44 nymphs). Ixodes laguri and Haemaphysalis erinacei taurica were recorded for the first time in Corum. To the best of our knowledge, this study is the first detailed investigation on ticks infesting humans in Corum and Yozgat, except individual or incidental records. The present study provides useful information for those concerned with ticks and tick-borne diseases in Turkey.

  6. Biogeography of Tick-Borne Bhanja Virus (Bunyaviridae in Europe

    Directory of Open Access Journals (Sweden)

    Zdenek Hubálek

    2009-01-01

    Full Text Available Bhanja virus (BHAV is pathogenic for young domestic ruminants and also for humans, causing fever and affections of the central nervous system. This generally neglected arbovirus of the family Bunyaviridae is transmitted by metastriate ticks of the genera Haemaphysalis, Dermacentor, Hyalomma, Rhipicephalus, Boophilus, and Amblyomma. Geographic distribution of BHAV covers southern and Central Asia, Africa, and southern (partially also central Europe. Comparative biogeographic study of eight known natural foci of BHAV infections in Europe (in Italy, Croatia, Bulgaria, Slovakia has revealed their common features. (1 submediterranean climatic pattern with dry growing season and wet mild winter (or microlimatically similar conditions, e.g., limestone karst areas in central Europe, (2 xerothermic woodland-grassland ecosystem, with plant alliances Quercetalia pubescentis, Festucetalia valesiacae, and Brometalia erecti, involving pastoral areas, (3 presence of at least one of the tick species Haemaphysalis punctata, Dermacentor marginatus, Rhipicephalus bursa, and/or Hyalomma marginatum, and (4 presence of ≥60% of the 180 BHAV bioindicator (157 plant, 4 ixodid tick, and 19 vertebrate spp.. On that basis, Greece, France (southern, including Corsica, Albania, Spain, Hungary, European Turkey, Ukraine (southern, Switzerland (southern, Austria (southeastern, Germany (southern, Moldova, and European Russia (southern have been predicted as additional European regions where BHAV might occur.

  7. Vectors of Crimean Congo Hemorrhagic Fever Virus in Iran

    Directory of Open Access Journals (Sweden)

    Zakkyeh Telmadarraiy

    2015-10-01

    Full Text Available Background: Ticks are important vectors and reservoirs of Crimean Congo Hemorrhagic Fever (CCHF virus. Human beings may be infected whenever the normal life cycle of the infected ticks on non- human vertebrate hosts is interrupted by the undesirable presence of humans in the cycle. A total of 26 species of Argasid and Ixodid ticks have been recorded in Iran; including nine Hyalomma, two Rhipicephalus, two Dermacentor, five Haemaphysalis, two Boophilus, one Ixodes and two Argas as well as three Ornithodoros species as blood sucking ectoparasites of livestock and poultries. The present paper reviews tick vectors of CCHF virus in Iran, focusing on the role of ticks in different provinces of Iran using reverse transcription polymerase chain reaction (RT-PCR assay.Methods: During ten years study, 1054 tick specimens; including two species of Argasidae and 17 species of Ixodidae were examined for their infection to CCHF virus genome. The output of all studies as well as related publications were discussed in the current paper.Results: The results show that Rhipicephalus sanguineus, Hyalomma marginatum, H. anatolicum, H. asiaticum and H. dromedarii were known as the most frequent species which were positive for CCHF virus.Conclusion: The status of ticks which were positive for CCHF virus revealed that unlike the most common idea that Hyalomma species are the most important vectors of CCHF virus, other ticks including Rhipicephalus,Haemaphysalis and Dermacentor can be reservoir of this virus; thus, considering geographical distribution, type of host and environmental conditions, different tick control measurements should be carried out in areas with high incidence of CCHF disease.

  8. Laboratory Study on Biological Control of Ticks (Acari: Ixodidae by Entomopathogenic Indigenous Fungi (Beauveria bassiana

    Directory of Open Access Journals (Sweden)

    M Abdigoudarzi

    2009-12-01

    Full Text Available Background: Chemical control method using different acaricides as spray, dipping solution or pour-on is routinely used for controlling ticks. Biological control agents are favorable due to their safety for animals and environment. Entomopathogenic fungi such as Beauveria bassiana are well known for controlling ticks. In this study, two Iranian indigenous strains of B. bassiana (B. bassiana 5197 and B. bassiana Evin were selected and grown on specific me­dia. The pathogenic effects of these strains were evaluated on adult stages of two Iranian Ixodidae members (H. anatolicum anatolicum Koch 1844, and H. marginatum Koch 1844 by dipping method."nMethods: Two Iranian strains of Beauveria bassiana (Beauveria bassiana 5197 and Beauveria bassiana Evin were selected and were grown successfully on specific media. The pathogenic effects of these strains were evaluated on adult stages of Iranian Ixodidae members such as, Hyalomma anatolicum anatolicum and H. marginatum by dipping method (these ticks were grown up at laboratory conditions during 2002 up to 2003 and still it is continued ."nResults: There was no effect of strain 5197 on mortality or fecundity rates for ticks. There was acute phase sign of paralysis in test group after dipping ticks in suspension made from Evin strain of B. bassiana. In addition, the test groups were totally died after four months, but the control groups survived for six months."nConclusion: High concentration of fungal spores is needed for inducing fungal infection. Additional study using different strains and fungi on Iranian ticks is proposed.   Keywords: Biological control, fungi, Beauveria bassiana, ticks, Ixodidae, Iran

  9. Identification of tick-borne pathogens in ticks feeding on humans in Turkey.

    Directory of Open Access Journals (Sweden)

    Ömer Orkun

    2014-08-01

    Full Text Available The importance of tick-borne diseases is increasing all over the world, including Turkey. The tick-borne disease outbreaks reported in recent years and the abundance of tick species and the existence of suitable habitats increase the importance of studies related to the epidemiology of ticks and tick-borne pathogens in Turkey. The aim of this study was to investigate the presence of and to determine the infection rates of some tick-borne pathogens, including Babesia spp., Borrelia burgdorferi sensu lato and spotted fever group rickettsiae in the ticks removed from humans in different parts of Ankara.A total of 169 ticks belonging to the genus Haemaphysalis, Hyalomma, Ixodes and Rhipicephalus were collected by removing from humans in different parts of Ankara. Ticks were molecularly screened for Babesia spp., Borrelia burgdorferi sensu lato and spotted fever group rickettsiae by PCR and sequencing analysis. We detected 4 Babesia spp.; B. crassa, B. major, B. occultans and B. rossi, one Borrelia spp.; B. burgdorferi sensu stricto and 3 spotted fever group rickettsiae; R. aeschlimannii, R. slovaca and R. hoogstraalii in the tick specimens analyzed. This is the report showing the presence of B. rossi in a region that is out of Africa and in the host species Ha. parva. In addition, B. crassa, for which limited information is available on its distribution and vector species, and B. occultans, for which no conclusive information is available on its presence in Turkey, were identified in Ha. parva and H. marginatum, respectively. Two human pathogenic rickettsia species (R. aeschlimannii and R. slovaca were detected with a high prevalence in ticks. Additionally, B. burgdorferi sensu stricto was detected in unusual tick species (H. marginatum, H. excavatum, Hyalomma spp. (nymph and Ha. parva.This study investigates both the distribution of several tick-borne pathogens affecting humans and animals, and the presence of new tick-borne pathogens in Turkey

  10. Identification of tick-borne pathogens in ticks feeding on humans in Turkey.

    Science.gov (United States)

    Orkun, Ömer; Karaer, Zafer; Çakmak, Ayşe; Nalbantoğlu, Serpil

    2014-08-01

    The importance of tick-borne diseases is increasing all over the world, including Turkey. The tick-borne disease outbreaks reported in recent years and the abundance of tick species and the existence of suitable habitats increase the importance of studies related to the epidemiology of ticks and tick-borne pathogens in Turkey. The aim of this study was to investigate the presence of and to determine the infection rates of some tick-borne pathogens, including Babesia spp., Borrelia burgdorferi sensu lato and spotted fever group rickettsiae in the ticks removed from humans in different parts of Ankara. A total of 169 ticks belonging to the genus Haemaphysalis, Hyalomma, Ixodes and Rhipicephalus were collected by removing from humans in different parts of Ankara. Ticks were molecularly screened for Babesia spp., Borrelia burgdorferi sensu lato and spotted fever group rickettsiae by PCR and sequencing analysis. We detected 4 Babesia spp.; B. crassa, B. major, B. occultans and B. rossi, one Borrelia spp.; B. burgdorferi sensu stricto and 3 spotted fever group rickettsiae; R. aeschlimannii, R. slovaca and R. hoogstraalii in the tick specimens analyzed. This is the report showing the presence of B. rossi in a region that is out of Africa and in the host species Ha. parva. In addition, B. crassa, for which limited information is available on its distribution and vector species, and B. occultans, for which no conclusive information is available on its presence in Turkey, were identified in Ha. parva and H. marginatum, respectively. Two human pathogenic rickettsia species (R. aeschlimannii and R. slovaca) were detected with a high prevalence in ticks. Additionally, B. burgdorferi sensu stricto was detected in unusual tick species (H. marginatum, H. excavatum, Hyalomma spp. (nymph) and Ha. parva). This study investigates both the distribution of several tick-borne pathogens affecting humans and animals, and the presence of new tick-borne pathogens in Turkey. More

  11. Hepatozoon kisrae n. sp. infecting the lizard Agama stellio is transmitted by the tick Hyalomma cf. aegyptium

    Directory of Open Access Journals (Sweden)

    Paperna I.

    2002-03-01

    Full Text Available Hepatozoon kisrae n. sp. was found infecting a starred lizard at a site in southeastern Samaria, Palestine. These lizards were also hosts to the ixodid tick Hyolomma cf. aegyptium, which was demonstrated to be the vector of this hemogregarine. Hepatozoon and tick infections occurred in lizards within a very restricted locality; at a second site, nearby, ticks occurred without Hepatozoon infection. Micro- and macromeronts occurred mainly in the lungs, while cyst-like merogonic stages, mainly dizoic, occurred in the liver. Mature intraerythrocytic gametocytes were stout and encapsulated. Development from oocysts to sporocysts took place in the tick hemocoel, and was examined by transmission electron microscopy. Lizards were successfully infected when fed on sporocyst-infected ticks or viscera of infected lizards. Ticks become infected when fed on infected lizards; sporogony was complete when the ticks reached adult stage, over 40 days after initial attachment.

  12. Molecular epidemiology of Crimean-Congo hemorrhagic fever virus detected from ticks of one humped camels (Camelus dromedarius) population in northeastern Iran.

    Science.gov (United States)

    Champour, Mohsen; Chinikar, Sadegh; Mohammadi, Gholamreza; Razmi, Gholamreza; Shah-Hosseini, Nariman; Khakifirouz, Sahar; Mostafavi, Ehsan; Jalali, Tahmineh

    2016-03-01

    A comprehensive study was conducted on camel ticks to assess the epidemiological aspects of the infection in camels. From May 2012 to January 2013, 11 cities and towns from the Khorasan provinces, northeastern Iran, were randomly selected as a "cluster" and at least 14 camels were sampled from each cluster. A total of 200 camels were examined in this study, reverse transcriptase polymerase chain reaction was used for the detection of the Crimean-Congo hemorrhagic fever virus (CCHFV) genome. Tick infestation was observed in 171 of the 200 camels, 480 ixodid ticks were collected, and one genus was identified as Hyalomma. Four species were reported to be the major tick species infesting camels. Among these, Hyalomma dromedarii was the most predominant tick species (90.7 %), followed by H. anatolicum (6 %), H. marginatum (2.9 %), and H. asiaticum (0.4 %). The genome of the CCHFV was detected in 49 (10.2 %) of the 480 ticks. The CCHFV RNA was detected in two of the four tick species, and the viral genome was detected from tick samples in three South Khorasan cities. The positivity rate of ticks was as follows: Boshroyeh, 25 out of 480 (5.2 %); Birjand, 17 out of 480 (3.5 %); and Nehbandan, 7 out of 480 (1.5 %). We recommend the use of acaricides to prevent disease transmission to humans and to reduce the tick population in camels. Care should be taken by abattoir workers and by those who work closely with camels.

  13. Prevalence of Theileria equi and Babesia caballi as well as the identification of associated ticks in sympatric Grevy's zebras (Equus grevyi) and donkeys (Equus africanus asinus) in northern Kenya.

    Science.gov (United States)

    Hawkins, Elaine; Kock, Richard; McKeever, Declan; Gakuya, Francis; Musyoki, Charles; Chege, Stephen M; Mutinda, Mathew; Kariuki, Edward; Davidson, Zeke; Low, Belinda; Skilton, Robert A; Njahira, Moses N; Wamalwa, Mark; Maina, Elsie

    2015-01-01

    The role of equine piroplasmosis as a factor in the population decline of the Grevy's zebra is not known. We determined the prevalence of Babesia caballi and Theileria equi in cograzing Grevy's zebras (Equus grevyi) and donkeys (Equus africanus asinus) in northern Kenya and identified the associated tick vectors. Blood samples were taken from 71 donkeys and 16 Grevy's zebras from March to May 2011. A nested PCR reaction using 18s ribosomal (r)RNA primers on 87 blood spots showed 72% (51/71; 95% confidence interval [CI] 60.4-81.0%) of donkeys and 100% (16/16; 95% CI, 77.3-100%) of Grevy's zebras were T. equi positive. No samples were positive for B. caballi. Sequence comparison using the National Center for Biotechnology Information's basic local alignment search tool identified homologous 18s rRNA sequences with a global geographic spread. The T. equi-derived sequences were evaluated using Bayesian approaches with independent Metropolis-coupled Markov chain Monte Carlo runs. The sequences clustered with those found in Sudan, Croatia, Mongolia, and the US, with statistical support greater than 80% for the two main clades. Hyalomma tick species were found on both donkeys and Grevy's zebras, whereas Rhipicephalus pulchellus was found exclusively on Grevy's zebras and Hyalomma marginatum rupfipes on donkeys. The prevalence of T. equi was 100% in Grevy's zebras and 72% in donkeys with common tick vectors identified. Our results suggest that donkeys and Grevy's zebras can be asymptomatic carriers and that piroplasmosis is endemic in the study area.

  14. Molecular detection of Theileria spp. and Babesia spp. in sheep and ixodid ticks from the northeast of Iran.

    Science.gov (United States)

    Razmi, Gholamreza; Pourhosseini, Moslem; Yaghfouri, Saeed; Rashidi, Ahmad; Seidabadi, Mohsen

    2013-02-01

    Theilerioses and babesioses are important diseases in Iranian sheep. The present study was undertaken to identify and classify/specify Theileria spp. and Babesia spp. in sheep and vector ticks. Investigation was carried out from 2009 to 2011 in the Khorasan Razavi Province, Iran. In total, 302 sheep originating from 60 different flocks were clinically examined and their blood collected. In addition, from the same flocks, ixodid ticks were sampled. Stained blood smears were microscopically examined for the presence of Theileria and Babesia organisms, and a semi-nested PCR was used for subsequent molecular specification. From the ticks, salivary glands and uterus were isolated and subsequently analyzed by semi-nested PCR. Piroplasm organisms were observed in 29% of the blood smears with low parasitemia, whereas 65% of the blood samples yielded positive PCR findings. The presence of Theileria ovis (55.6%), Theileria lestoquardi, and mixed infection with Theileria spp. and Babesia ovis were detected by semi-nested PCR in 0.3%, 5.6%, and 0.99%, respectively. In total, 429 ixodid ticks were collected from different areas of the province. The most prevalent ticks were Rhipicephalus turanicus (n = 376; 87.6% of the total), followed by Hyalomma marginatum turanicum (n = 30; 7.0%), Dermacentor raskemensis (n = 12; 2.8%), Hyalomma anatolicum anatolicum (n = 7; 1.6%), Dermacentor marginatus (n = 2; 0.5%), Rhipicephalus bursa (n = 1; 0.2%), and Haemaphysalis sp. (n = 1; 0.2%). Of the positive R. turanicus samples, 5 (5.7%) were infected with T. ovis and 2 (2.9%) with T. lestoquardi. Neither Babesia ovis nor Babesia motasi infection was detected in salivary glands or uterine samples of the ticks. The results also suggest that R. turanicus could be the vector responsible for transmission of the 2 Theileria species.

  15. Hard Ticks on Domestic Ruminants and their SeasonalPopulation Dynamics in Yazd Province, Iran

    Directory of Open Access Journals (Sweden)

    Y Salim abadi

    2010-06-01

    Full Text Available Background: Ticks are the main vectors for transmission of different pathogens to human and animals. This survey was performed to find out distribution of ticks, which infested the domestic ruminants in Yazd Province, central Iran during year 2008-2009.Methods: A total number of 30 villages from both mountainous (20% and plateau (80% regions of the province were selected randomly. Ticks were colleted from the body of infested animals and transported to the laboratory of Medical Entomology, School of Public Health, Tehran University of Medical Sciences and then were identified to space level using valid identification key.Results: A total of 583 hard ticks were collected. The ticks were classified into three genera and 7 species including:  Hyalomma dromedarii (55.92%, Hy. marginatum (13.20%, Hy. anatolicum (9.78%, Hy. detritum (4.98%,  Hy. asiaticum (3.94%, Rhipicephalus sanguineus (11.84%, and Dermacentor marginatus (0.34%. The highest seasonal activities occurred in summer. The prevalence of the Ixodidae ticks was more evident in plateaus area in Yazd Province. Among the hosts including: cow, goat, sheep and camel, the ticks that collected from camel was more prevalent. The ratio of male was more than female ticks. Hyalomma. dromedarii was the predominant tick species and accounted for 55.92% of the ticks.Conclusion: Some of the collected ticks may play an important role for transmission of vector borne disease to human; therefore, the results of this study will provide a clue for vectors of tick-borne diseases in the region for local authorities for implementation of disease control.

  16. First phylogenetic analysis of a Crimean-Congo hemorrhagic fever virus genome in naturally infected Rhipicephalus appendiculatus ticks (Acari: Ixodidae).

    Science.gov (United States)

    Fakoorziba, Mohammad Reza; Naddaf-Sani, Ali Asghar; Moemenbellah-Fard, Mohammad Djaefar; Azizi, Kourosh; Ahmadnia, Sara; Chinikar, Sadegh

    2015-05-01

    Crimean-Congo haemorrhagic fever (CCHF) is a potentially fatal systemic viral disease in many parts of the world, including Iran. The nationwide incidence of human CCHF in endemic areas was 870 confirmed cases with 126 deaths (case fatality rate, CFR = 17.6 %) in the decade leading to 2012. The detection of the CCHF virus (CCHFV) genome in tick vectors is of fundamental importance for identifying these ticks as potential reservoirs of CCHFV infection. From May to October 2013, following detection of four new clinical cases resulting in two deaths in the city of Mashhad (northeast Iran), hard ticks were recovered from infested livestock in 40 villages in Khorasan-Razavi province and examined by the microscopic method for species identification. About a quarter of the ticks were then subjected to reverse-transcription polymerase chain reaction (RT-PCR) to detect the CCHFV genome. The PCR products were then sequenced, and their phylogenetic lineages were determined. A total of 407 hard ticks were captured, representing seven different species in two distinct genera. Members of the genus Hyalomma were widely distributed in all but two of the villages studied, and this was also the most frequent (83.3 %) tick genus. Of 105 adult ticks subjected to RT-PCR, four (3.8 %) ticks were found positive for the CCHFV genome. One brown ear tick, Rhipicephalus appendiculatus, was found to be naturally infected for the first time anywhere in the world. Ticks of Hyalomma asiaticum, Hyalomma marginatum, and Rhipicephalus turanicus were also found to be naturally infected with CCHFV. CCHFV found in these four different tick species were clustered in the same lineage with the Matin and SR3 strains from Pakistan and some other strains from Iran, indicating that these tick species were naturally infected with genetically closely related CCHFV in the region. The presence of CCHFV infection in four different hard tick species was confirmed using RT-PCR in northeast Iran. Part of this

  17. Current Status of Tick Fauna in North of Iran

    Directory of Open Access Journals (Sweden)

    P Shayan

    2007-04-01

    Full Text Available Background: The distribution and ecological preferences of ticks of domestic animals in North of Iran were studied four times a year from 2002 to 2005. Methods: A total of 1720 tick specimens were collected from cattle, sheep and goats from different localities of Caspian Sea areas consisting of Guilan, Mazandaran, Golestan and Ardebil provinces, Iran. Results: Fourteen tick species were identified as Hyalomma anatolicum anatolicum (5.23%, H.marginatum (20.34%, H.detritum (3.48%, Haemaphysalis punctata (12.79%, Haem. Parva (0.58%, Haem.concinna (0.58%, Haem.choldokovsky (6.97%, Ixodes ricinus (2.32%, Rhipicephalus sanguineus (19.76%, Rh.bursa (4.65%, Boophilus annulatus (9.88%, Dermacentor niveus (6.39%, D. marginatus (1.74% and Ornithodoros lahorensis (5.23%. Both Dermacentor and Ornithodoros were found only in Ardebil with cold climatic conditions and high altitude. The only ticks, which were found in forest area, were Boophilus annulatus and Ixodes ricinus. Conclusion: The veterinary and public health importance of the above species should be emphasized.

  18. [Results of the 20-year study of tick-borne encephalitis in Crimea].

    Science.gov (United States)

    Evstaf'ev, I L

    2001-01-01

    The history of tick-borne encephalitis (TBE) study in the Crimea was retraced and the possibility of introduction of TBE virus to the Crimea in the process of the acclimatization of vertebrates from areas enzootic for TBE is discussed. The foci of TBE were found throughout the whole of the mountain forest zone of the Crimea and coincided with the habitat area of lxodes ricinus, the main vector of TBE. Such ticks as Dermacentor reticulatus, D. marginatus and Hyalomma marginatum were also found to take part in the circulation of the virus. Among the residents of the mountain forest zone, 13.9% were found to have immunity to TBE, testifying to the wide contact of the population with the pathogen. TBE morbidity had pronounced seasonal character and the morbidity rate was low with the prevalence of mild clinical forms. The characteristic feature of the virus population was polymorphism: strains identical to the Far-Eastern strains Sofyin (about 60-70%) and strains differing in their antigenic structure circulated here.

  19. Detection of tick-borne Anaplasma bovis, Anaplasma phagocytophilum and Anaplasma centrale in Spain.

    Science.gov (United States)

    Palomar, A M; Portillo, A; Santibáñez, P; Mazuelas, D; Roncero, L; García-Álvarez, L; Santibáñez, S; Gutiérrez, Ó; Oteo, J A

    2015-09-01

    The genus Anaplasma (Rickettsiales: Anaplasmataceae) includes species of medical and veterinary importance. The presence of Anaplasma spp. in ticks from birds, as well as in Haemaphysalis punctata (Ixodida: Ixodidae) specimens collected from cattle and vegetation in northern Spain was investigated. A total of 336 ticks from birds [174 Ixodes frontalis (Ixodida: Ixodidae), 108 H. punctata, 34 Hyalomma marginatum (Ixodida: Ixodidae), 17 Ixodes ricinus (Ixodida: Ixodidae) and three Ixodes spp.], and 181 H. punctata specimens collected from cattle (n = 71) and vegetation (n = 110) were analysed. Anaplasma bovis was detected in five H. punctata, including two from birds (1.9%) and three from vegetation (2.7%). Four I. frontalis (2.3%) (one co-infected with 'Candidatus Midichloria mitochondrii') and one I. ricinus (5.9%) removed from birds, as well as four H. punctata (5.6%) collected from cattle showed Anaplasma phagocytophilum infection. In addition, Anaplasma centrale was found in two H. punctata, one from a cow (1.4%) and the other from vegetation (0.9%). This study represents the first evidence of the presence of A. bovis in European ticks, and reports the first detection of A. bovis and A. centrale in H. punctata, and the first finding of A. phagocytophilum and 'Ca. Midichloria mitochondrii' in I. frontalis. © 2015 The Royal Entomological Society.

  20. Identifying main drivers and testing control strategies for CCHFV spread.

    Science.gov (United States)

    Hoch, T; Breton, E; Josse, M; Deniz, A; Guven, E; Vatansever, Z

    2016-03-01

    Crimean Congo Haemorrhagic Fever (CCHF) is an emerging zoonotic disease. The causative agent is a virus (CCHFV), mainly transmitted by ticks of the species Hyalomma marginatum in Eastern Europe and Turkey. In order to test potential scenarios for the control of pathogen spread, the basic reproduction number (R0) for CCHF was calculated. This calculation was based on a population dynamics model and parameter values from the literature for pathogen transmission. The tick population dynamics model takes into account the major processes involved and gives estimates for tick survival from one stage to the other and number of feeding ticks. It also considers the influence of abiotic (meteorological variables) and biotic factors (host densities) on model outputs, which were compared with data collected in Central Anatolia (Turkey). R0 computation was thereafter used to test control strategies and especially the effect of acaricide treatment. Simulation results indicate that such treatments could have valuable effects provided that the acaricide is applied regularly throughout the spring and summer, and over several years. Furthermore, a sensitivity analysis to abiotic and biotic factors showed that, even though temperature has a strong impact on model outputs, host (mainly hare) densities also play a role. The kind of model we have developed provides insight into the ability of different strategies to prevent and control disease spread and has proved its relevance when associated with field trials.

  1. Diversity and seasonal patterns of ticks parasitizing wild birds in western Portugal.

    Science.gov (United States)

    Norte, A C; de Carvalho, I Lopes; Ramos, J A; Gonçalves, M; Gern, L; Núncio, M S

    2012-11-01

    The diversity and abundance of questing ticks and ticks parasitizing birds was assessed during 1 year in two recreational forests in western Portugal, a suburban forest and an enclosed game area. The aim of this study was to assess the distribution and seasonality of tick species and to understand the role of bird species as hosts for ticks. Ixodes ricinus was the most abundant questing tick collected in the enclosed game area, whereas in the suburban forest, only three ticks were collected by blanket dragging. Tick species parasitizing birds included I. ricinus, I. frontalis, I. arboricola, I. acuminatus, Haemaphysalis punctata, Hyalomma marginatum and H. lusitanicum. This is the first record of I. arboricola in Portugal. Tick prevalence and intensity of infestation differed between study areas and was higher in birds from the game area where a large population of deer and wild boar may support tick populations. Ground and shrub dwelling bird species such as Turdus merula, Erithacus rubecula and Sylvia melanocephala were the most heavily parasitized by ticks, but the importance of different bird species as hosts of larvae and nymphs of I. ricinus and I. frontalis differed. Therefore, different bird species may contribute differently for tick population maintenance.

  2. Species diversity and abundance of ticks in three habitats in southern Italy.

    Science.gov (United States)

    Dantas-Torres, Filipe; Otranto, Domenico

    2013-04-01

    A 2-year study was conducted from March 2010 to March 2012 in a forested area in southern Italy to evaluate the species diversity and abundance of free-living ticks in 3 different habitats: (i) a meadow habitat within an enclosure inhabited by roe deer (Capreolus capreolus); (ii) a man-made trail located in a high-altitude, forested area; and (iii) a grassland near a house inhabited by 3 people. In total, 10,795 ticks were collected. Ixodes ricinus was the most abundant species (69.0%), followed by Haemaphysalis inermis (19.1%), Rhipicephalus turanicus (6.7%), Dermacentor marginatus (3.2%), and Hyalomma marginatum (1.0%). The least frequently collected species were Rhipicephalus bursa, Haemaphysalis parva, Haemaphysalis sulcata, and Haemaphysalis concinna, representing together less than 1% of the collections. Immature ticks predominated over adult ticks. In particular, immature stages of Ix. ricinus (i.e., 3246 larvae and 3554 nymphs) represented 63% of the total number of ticks collected. High levels of species diversity and abundance of ticks were recorded in all habitats and the daily number of ticks collected was negatively correlated with daily mean temperature, evapotranspiration, and saturation deficit. This study indicates that the southern Italian climate is suitable for different tick species, which may find a preferred 'climate niche' during a specific season, when a combination of factors (e.g., suitable meteorological and environmental conditions) associated with the presence of suitable hosts will facilitate their development and reproduction.

  3. Bio-Prospecting of a Few Brown Seaweeds for Their Cytotoxic and Antioxidant Activities

    Digital Repository Service at National Institute of Oceanography (India)

    Vinayak, R.C.; Sabu, A.S.; Chatterji, A.

    australis > Spatoglossum variabile > Stoechospermum marginatum > Spatoglossum aspermum showed significant cytotoxic activity. A very high DPPH radical scavenging activity was exhibited by the methanolic extracts prepared from St. marginatum, Padina...

  4. Association of environmental traits with the geographic ranges of ticks (Acari: Ixodidae) of medical and veterinary importance in the western Palearctic. A digital data set.

    Science.gov (United States)

    Estrada-Peña, A; Farkas, Robert; Jaenson, Thomas G T; Koenen, Frank; Madder, Maxime; Pascucci, Ilaria; Salman, Mo; Tarrés-Call, Jordi; Jongejan, Frans

    2013-03-01

    We compiled information on the distribution of ticks in the western Palearctic (11°W, 45°E; 29°N, 71°N), published during 1970-2010. The literature search was filtered by the tick's species name and an unambiguous reference to the point of capture. Records from some curated collections were included. We focused on tick species of importance to human and animal health, in particular: Ixodes ricinus, Dermacentor marginatus, D. reticulatus, Haemaphysalis punctata, H. sulcata, Hyalomma marginatum, Hy. lusitanicum, Rhipicephalus annulatus, R. bursa, and the R. sanguineus group. A few records of other species (I. canisuga, I. hexagonus, Hy. impeltatum, Hy. anatolicum, Hy. excavatum, Hy. scupense) were also included. A total of 10,280 records was included in the data set. Almost 42 % of published references are not adequately referenced (and not included in the data set), host is reported for only 61 % of records and a reference to time of collection is missed for 84 % of published records. Ixodes ricinus accounted for 44.3 % of total records, with H. marginatum and D. marginatus accounting for 7.1 and 8.1 % of records, respectively. The lack of homogeneity of the references and potential pitfalls in the compilation were addressed to create a digital data set of the records of the ticks. We attached to every record a coherent set of quantitative descriptors for the site of reporting, namely gridded interpolated monthly climate and remotely sensed data on vegetation (NDVI). We also attached categorical descriptors of the habitat: a standard classification of land biomes and an ad hoc classification of the target territory from remotely sensed temperature and NDVI data. A descriptive analysis of the data revealed that a principal components reduction of the environmental (temperature and NDVI) variables described the distribution of the species in the target territory. However, categorical descriptors of the habitat were less effective. We stressed the importance of

  5. Molecular surveillance of Theileria ovis, Theileria lestoquardi and Theileria annulata infection in sheep and ixodid ticks in Iran

    Directory of Open Access Journals (Sweden)

    Gholamreza Razmi

    2013-03-01

    Full Text Available A molecular study was undertaken to detect Theileria ovis, Theileria lestoquardi and Theileria annulatain sheep and tick vectors. Investigation was conducted from 2010 to 2011 in the south of Khorasan Razavi Province, Iran. A total of 150 blood samples were collected from 30 different sheep flocks. In addition, ixodid ticks were sampled from the same flocks. The stained blood smears were microscopically examined for the presence of piroplasms and a semi-nested polymerase chain reaction-restriction (PCR was used for subsequent molecular speciation. Salivary glands were isolated from the ticks and subsequently analysed by semi-nested PCR. polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP was used to differentiate between T. lestoquardi and T. annulata from PCR-positive samples. Theileria species infection was microscopically detected in 18.6% of blood smears. The presence of T. ovis and T. lestoquardi or T. annulata was detected by semi-nested PCR in 58.6% and 6.6% of blood samples respectively. In total, 169 ixodid ticks were collected from different areas of the province. The most prevalent ticks were Rhipicephalus turanicus (n = 155; 91.7% of the total, followed by Hyalomma anatolicum anatolicum (n = 8; 4.7% and Hyalomma marginatum turanicum (n = 6; 3.5%. From an organ pooling of 33 ticks, three pools of salivary glands from R. turanicus were positive for Theileria species by semi-nested PCR. Of the three R. turanicus samples testing positive for Theileria species, two (6.1% were positive for T. ovis and one (3.0% for T. lestoquardi or T. annulata. Amongst the 11 PCR-positive samples for T. lestoquardi or T. annulata, 10 were positive for T. lestoquardi and one sample was positive for both T. lestoquardi and T. annulata using PCR-RFLP. The results also demonstrated that PCR-RFLP could be used for the detection of T. ovis. Based on the results, it can be concluded that T. ovis has a higher

  6. Molecular surveillance of Theileria ovis, Theileria lestoquardi and Theileria annulata infection in sheep and ixodid ticks in Iran.

    Science.gov (United States)

    Razmi, Gholamreza; Yaghfoori, Saeed

    2013-01-01

    A molecular study was undertaken to detect Theileria ovis, Theileria lestoquardi and Theileria annulata in sheep and tick vectors. Investigation was conducted from 2010 to 2011 in the south of Khorasan Razavi Province, Iran. A total of 150 blood samples were collected from 30 different sheep flocks. In addition, ixodid ticks were sampled from the same flocks. The stained blood smears were microscopically examined for the presence of piroplasms and a semi-nested polymerase chain reaction-restriction (PCR) was used for subsequent molecular speciation. Salivary glands were isolated from the ticks and subsequently analysed by semi-nested PCR. polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was used to differentiate between T. lestoquardi and T. annulata from PCR-positive samples. Theileria species infection was microscopically detected in 18.6% of blood smears. The presence of T. ovis and T. lestoquardi or T. annulata was detected by semi-nested PCR in 58.6% and 6.6% of blood samples respectively. In total, 169 ixodid ticks were collected from different areas of the province. The most prevalent ticks were Rhipicephalus turanicus (n = 155; 91.7% of the total), followed by Hyalomma anatolicum anatolicum (n = 8; 4.7%) and Hyalomma marginatum turanicum (n = 6; 3.5%). From an organ pooling of 33 ticks, three pools of salivary glands from R. turanicus were positive for Theileria species by semi-nested PCR. Of the three R. turanicus samples testing positive for Theileria species, two (6.1%) were positive for T. ovis and one (3.0%) for T. lestoquardi or T.annulata. Amongst the 11 PCR-positive samples for T. lestoquardi or T. annulata, 10 were positive for T. lestoquardi and one sample was positive for both T. lestoquardi and T. annulata using PCR-RFLP. The results also demonstrated that PCR-RFLP could be used for the detection of T. ovis. Based on the results, it can be concluded that T. ovis has a higher prevalence than T. lestoquardi, and that R

  7. Coinfections of Rickettsia slovaca and Rickettsia helvetica with Borrelia lusitaniae in ticks collected in a Safari Park, Portugal.

    Science.gov (United States)

    Milhano, Natacha; de Carvalho, Isabel Lopes; Alves, Ana Sofia; Arroube, Sofia; Soares, Jorge; Rodriguez, Pablo; Carolino, Manuela; Núncio, Maria Sofia; Piesman, Joseph; de Sousa, Rita

    2010-12-01

    Borrelia and Rickettsia bacteria are the most important tick-borne agents causing disease in Portugal. Identification and characterization of these circulating agents, mainly in recreational areas, is crucial for the development of preventive measures in response to the gradually increasing exposure of humans to tick vectors. A total of 677 questing ticks including Dermacentor marginatus, Rhipicephalus sanguineus, Ixodes ricinus, Hyalomma lusitanicum, H. marginatum, and Haemaphysalis punctata were collected in a Safari Park in Alentejo, Portugal, to investigate the prevalences of infection and characterize Borrelia and Rickettsia species. From a total of 371 ticks tested by PCR for Borrelia burgdorferi sensu lato (s.l.), of which 247 were tested for Rickettsia, an infection prevalence of 18.3% was found for B. lusitaniae and 55.1% for Rickettsia spp. Sequence analysis of positive amplicons identified the presence of B. lusitaniae (18.3%), R. monacensis strain IRS3 (51.7%), and R. helvetica (48.3%) in I. ricinus. R. slovaca (41.5%), R. raoultii (58.5%), and also B. lusitaniae (21%) were identified in D. marginatus ticks. One (5.9%) H. lusitanicum was infected with B. lusitaniae, and R. massiliae was found in one Rhipicephalus sanguineus. Coinfection was found in 7 (20%) I. ricinus and 34 (23.3%) D. marginatus ticks. We report, for the first time, simultaneous infection with R. helvetica and B. lusitaniae and also R. slovaca, the agent of TIBOLA/DEBONEL, with B. lusitaniae. Additionally, 6 isolates of B. lusitaniae were established, and isolates of Rickettsia were also obtained for the detected species using tick macerates cultured in mammalian and mosquito cell lines. This report describes the detection and isolation of tick-borne agents from a Portuguese Safari Park, highlighting the increased likelihood of infection with multiple agents to potential visitors or staff. Copyright © 2010 Elsevier GmbH. All rights reserved.

  8. Molecular identification of Theileria and Babesia in ticks collected from sheep and goats in the Black Sea region of Turkey.

    Science.gov (United States)

    Aydin, Mehmet Fatih; Aktas, Munir; Dumanli, Nazir

    2015-01-01

    A molecular survey was undertaken in the Black Sea region of Turkey to determine the presence of Theileria and Babesia species of medical and veterinary importance. The ticks were removed from sheep and goats, pooled according to species and locations, and analyzed by PCR-based reverse line blot (RLB) and sequencing. A total of 2241 ixodid ticks belonging to 5 genus and 12 species were collected and divided into 310 pools. Infection rates were calculated as the maximum likelihood estimation (MLE) with 95% confidence intervals (CI). Of the 310 pools tested, 46 (14.83%) were found to be infected with Theileria or Babesia species, and the overall MLE of the infection rate was calculated as 2.27% (CI 1.67-2.99). The MLE of the infection rates were calculated as 0.691% (CI 0.171-1.78) in Haemaphysalis parva, 1.47% (CI 0.081-6.37) in Rhipicephalus sanguineus, 1.84% (CI 0.101-7.87) in Ixodes ricinus, 2.86% (CI 1.68-4.48) in Rhipicephalus turanicus, 5.57% (CI 0.941-16.3) in Hyalomma marginatum, and 6.2% (CI 4.02-9.02) in Rhipicephalus bursa. Pathogens identified in ticks included Theileria ovis, Babesia ovis, Babesia bigemina, and Babesia microti. Most tick pools were infected with a single pathogen. However, five pools displayed mixed infections with T. ovis and B. ovis. This study provides the first molecular evidence for the presence of B. microti in ticks in Turkey.

  9. A GIS framework for the assessment of tick impact on human health in a changing climate

    Directory of Open Access Journals (Sweden)

    Agustin Estrada-Peña

    2007-05-01

    Full Text Available A framework to evaluate the impact of ticks on human health under various scenarios of climate change is proposed. The purpose is not to provide a comprehensive plan (e.g. the economic impact of ticks on human society is not included, instead we wish to describe a series of indices that would be helpful by obtaining homogeneous comparisons of impact and vulnerability exerted by ticks in different regions, countries or continents, using normalized sets of population, vegetation, climate and physical attributes of the territory. Three tick species, i.e. Dermacentor marginatus, Rhipicephalus turanicus and Hyalomma marginatum, have been traced over the territory of Spain to further explain the computation of these indices. The discussion is based on tick habitat suitability, used as a measure of the abiotic (climate fitness of the habitat for the species in question, and the sensitivity of each tick species to the rate of change of habitat suitability with respect to climate change. The impact is the rate of change in habitat suitability weighted with a fuzzy logic function evaluating the total number of people in an area, percent of rural population and accessibility of the geographical divisions (expressed as hexagons with a 10 km radius used in the study. The different climate scenarios evaluated in relation to ticks show that the north-western part of Spain would suffer the greatest impact in case the mean temperature would increase, while the Mediterranean region would suffer the highest impact if temperatures decreased. Vulnerability, based on the sanitary structure of the territory and on the impact on human activities due to the change in tick distribution and abundance, is proposed as a measure of adaptation of society to these climate scenarios. The cost is evaluated as a function of land use and tick habitat suitability in a buffer zone surrounding each geographic division. All indices proposed have been obtained by search of common and

  10. An Annotated List of Tick (Acari: Ixodida) Common Names Authored by Harry Hoogstraal (1917-1986)

    Science.gov (United States)

    2011-01-01

    America, 63, 590–606. Pegram, R.G., Hoogstraal, H. & Wassef, H.Y. (1982) Hyalomma (Hyalommina) arabica sp. n. parasitizing goats and sheep in the...Hoogstraal et al. (1972a) Arabian goat hyalomminid, Hyalomma arabica Pegram, Hoogstraal and Wassef, 1982 ― Pegram et al. (1982) Arabian goat ...hyalomminine [sic], "Hyalomma sp. in press Pegram, Hoogstraal and Wassef, 1982"—this species was named Hyalomma arabica, "Arabian goat hyalomminid," q.v

  11. Evidence of Competition Between Two Canopy Ant Species: Is Aggressive Behavior Innate or Shaped by a Competitive Environment?

    Directory of Open Access Journals (Sweden)

    Nádia Barbosa do Espírito Santo

    2012-01-01

    Full Text Available Competition occurs in all ecological communities, although it has not always been experimentally tested as a structuring force in the distribution of species. We tested the hypothesis that the aggressiveness exhibited by Camponotus rufipes changes according to the pressures of a competitive environment. This is a dominant species in the montane forest of the Itacolomi State Park, Brazil, where Camponotus sericeiventris does not occur. Using bait traps in a field site where both species occur, (“Juiz de Fora” site we showed that C. sericeiventris was able to remove C. rufipes workers at the same bait. In the laboratory, we used dyadic encounters to test workers from both species taken from colonies found in areas where both occur and where only C. rufipes was found. Camponotus rufipes from Itacolomi fought significantly less and was killed during the first few minutes in 60% of the events. On the other hand, the workers that co-existed with C. sericeiventris in the field were more aggressive, but less efficient fighters than the latter. This investigation demonstrated existence of competition between C. rufipes and C. sericeiventris, and also the lower aggressiveness of C. rufipes' individuals that did not co-exist in the field with C. sericeiventris.

  12. Activity and relative abundance of hymenopterous parasitoids that attack puparia of Musca domestica and Stomoxys calcitrans (Diptera: Muscidae) on confined pig and cattle farms in Denmark

    DEFF Research Database (Denmark)

    Skovgård, H; Jespersen, J B

    1999-01-01

    (Linnaeus). In total, seven pteromalid species were recovered: Spalangia cameroni Perkins, S. nigripes Curtis, S. subpunctata Förster, Muscidifurax raptorGirault & Sanders, Pachycrepoideus vindemiae (Rondani), Urolepis rufipes(Ashmead) and Nasonia vitripennis (Walker), an ichneumonid Phygadeuon fumator......Gravenhorst, a diapriid Trichopria sp., and a staphylinid Aleocharasp. This is the first time that U. rufipes has been recorded in Europe. Spalangia cameroni and M. raptor were the most frequently recorded species in all regions of the country, and accounted for the main parasitism of Musca domesticaand Stomoxys...... from pigs rather than from cattle, whereas Spalangia cameroni mainly seeks fly puparia indoors, irrespective of livestock....

  13. Evaluation of Animal and Plant Pathogens as Terrorism and Warfare Agents, Vectors and Pests

    Science.gov (United States)

    2001-09-01

    Acari Arachnida Hyalomma Anatolicumn Anatolicumn Dermacentor andersoni Acari Arachnida Dermacentor varabilis Amblyimma Cajennese Rhipicephalus sanguineus...Mansonia spp. Diptera Insecta Culex spp. Culiseta spp. Pediculus humanus Anopluraa Insect Ixodides Dermacentor spp. Acari Arachnida Rhipicephalus spp

  14. Study on the Tribe Blondeliini from Japan (Diptera, Tachinidae) : VI. A Revision of the Genus Uromedina TOWNSEND

    OpenAIRE

    Hiroshi, SHIMA; Biological Laboratory, College of General Education, Kyushu University

    1985-01-01

    The Oriental genus Uromedina is revised. Uromedina rufipes sp. nov. is described and illustrated from Japan. Three known species, atrata, caudata and eumorphophaga, are redescribed and illustrated. Females of atrata and caudata are described for the first time. A key to the 4 species of the genus is provided.

  15. Antibacterial activity of selected marine macro algae against vancomycin resistant Enterococcus faecalis

    Directory of Open Access Journals (Sweden)

    Manivachagam Chandrasekaran

    2014-12-01

    Full Text Available Objective: To evaluate the antibacterial activity of different extracts of Caulerpa chemnitzia (Epser J.V. Lamououx, Caulerpa racemosa (Frosk. Weber-van-Bosse (C. racemosa, Caulerpa scalpelliformis (R.Br. Weber-van-Bosse, Ulva lactuca Lin, Ulva fasciata Dellie, Ulva reticulata Forsk, Stoechospermum marginatum (Ag. Kutz (S. marginatum, Sargassum wightii Grev, Gracilaria verrucosa (Huds. Papenfuss and Gracilaria edulis (S.G. Gemelin P.C. Silva against Enterococcus faecalis (MTCC 439 (E. faecalis and one clinical isolate of vancomycin resistant E. faecalis. Methods: The selected marine macro algae were extracted with different solvents viz., hexane, chloroform, ethyl acetate, acetone and methanol. Antibacterial assay was carried out by using disc diffusion method, determination of minimum inhibitory concentration and minimum bactericidal concentration. Results: The maximum antibacterial activity was recorded in the ethyl acetate extracts of S. marginatum and C. racemosa than the other extracts. The mean zone of inhibition produced by the extracts in agar diffusion assays against the tested bacterial strains ranged from 7.1 to 14.5 mm. The minimum inhibitory concentration was between 250 and 500 µg/mL, while the minimum bactericidal concentration was from 500 to 1 000 µg/mL. The ethyl acetate extracts of the seaweeds showed the presence of strong terpenoids, tannins and phenolic compounds compared with the other solvent extracts. Conclusions: These findings suggest that ethyl acetate extracts of S. marginatum and C. racemosa can be used as an antibacterial substance for the treatment of infection caused by E. faecalis.

  16. Antibacterial activity of selected marine macro algae against vancomycin resistant Enterococcus faecalis

    Institute of Scientific and Technical Information of China (English)

    Manivachagam Chandrasekaran; Venugopalan Venkatesalu; Gnanaprakasam Adaikala Raj

    2014-01-01

    Objective: To evaluate the antibacterial activity of different extracts of Caulerpa chemnitzia (Epser) J.V. Lamououx, Caulerpa racemosa (Frosk.) Weber-van-Bosse (C. racemosa), Caulerpascalpelliformis Forsk, Stoechospermum marginatum (Ag.) Kutz (S. marginatum), Sargassum wightii Grev,Gracilaria verrucosa (R.Br.) Weber-van-Bosse, Ulva lactuca Lin, Ulva fasciata Dellie, Ulva reticulata Enterococcus faecalis (MTCC 439) (E. faecalis) and one clinical isolate of vancomycin resistant E.faecalis. Methods: The selected marine macro algae were extracted with different solvents viz., hexane, chloroform, ethyl acetate, acetone and methanol. Antibacterial assay was carried out by using disc diffusion method, determination of minimum inhibitory concentration and minimum bactericidal concentration.Results:(Huds.) Papenfuss and Gracilaria edulis (S.G. Gemelin) P.C. Silva against marginatum and C. racemosa than the other extracts. The mean zone of inhibition produced by the extracts in agar diffusion assays against the tested bacterial strains ranged from 7.1 to 14.5 mm. The minimum inhibitory concentration was between 250 and 500 µg/mL, while the minimum bactericidal concentration was from 500 to 1000 µg/mL. The ethyl acetate extracts of the seaweeds showed the presence of strong terpenoids, tannins and phenolic compounds compared with the other solvent extracts.Conclusions:The maximum antibacterial activity was recorded in the ethyl acetate extracts of S. racemosa can be used as an antibacterial substance for the treatment of infection caused by E. faecalis. These findings suggest that ethyl acetate extracts of S. marginatum and C.

  17. Demam Rematik Dan Penyakit Jantung Rematik Permasalahan Indonesia

    OpenAIRE

    Siregar, Abdullah Afif

    2008-01-01

    Demam rematik dan penyakit jantung rematik telah lama dikenal. Demam rematik (DR) dan atau Penyakit jantung rematik (PJR) eksaserbasi akut adalah suatu sindroma klinik penyakit akibat infeksi kuman Streptokokus ? hemolitik grup A pada tenggorokan yang terjadi secara akut ataupun berulang dengan satu atau lebih gejala mayor yaitu poliartritis migrans akut, karditis, korea, nodul subkutan dan eritema marginatum. 08E00203

  18. MORPHOLOGY OF EMBRYOS AND SEEDLINGS OF WOODY SPECIES NORTHEASTERN ARGENTINA MORFOLOGÍA DE EMBRIONES Y PLÁNTULAS DE ESPECIES LEÑOSAS DEL NORDESTE ARGENTINO

    Directory of Open Access Journals (Sweden)

    María C Franceschini

    2010-11-01

    Full Text Available

    In this paper embryos and seedlings of six native woody species of Northeast of Argentina are studied: Chrysophyllum marginatum (Hook. et Arn. Radlk. subsp. marginatum (Sapotaceae,
    Eugenia uniflora L., Hexachlamys edulis (O. Berg Kausel et D. Legrand (Myrtaceae, Polygala albicans (A.W. Benn. Grondona (Polygalaceae, Sapium haematospermun Müll. Arg. and Sebastiania brasiliensis Spreng. (Euphorbiaceae. Descriptions and illustrations of seeds, embryos, germination and seedlings are given
    En este documento se estudian embriones y plántulas de seis especies leñosas nativas del nordeste de Argentina: Chrysophyllum marginatum (Hook. et Arn. Radlk. subsp. marginatum (Sapotaceae, Eugenia uniflora L., edulis Hexachlamys (O. Berg Kausel et D. Legrand (Myrtaceae, Polygala albicans (AW Benn. Grondona (Polygalaceae, Sapium haematospermun Müll. Arg. y Sebastiania brasiliensis Spreng. (Euphorbiaceae. Comprende las descripciones e ilustraciones de las semillas, embriones, germinación y plántulas

  19. Nomina dubia in the genus Theridion resulting from errors in instalment six of Carl Wilhelm Hahn’s “Monographie der Spinnen” (Araneae: Theridiidae

    Directory of Open Access Journals (Sweden)

    Prpic, Nikola-Michael

    2015-11-01

    Full Text Available An overlooked error in the correlation of new scientific names with the spider images on plate 4 in Carl Wilhelm Hahn’s sixth instalment of his book ”Monographie der Spinnen” led to the notion that at least two of the spiders illustrated on plate 4 cannot be identified and their names are nomina dubia. Here, I draw attention to the fact that, if the names are re-aligned to the images in a meaningful way, then at least three spiders on plate 4 can be identified. Theridion rufipes sensu Hahn is a synonym of Gongylidium rufipes (Linnaeus, 1758 (syn. conf.. In particular, the previous nomen dubium Theridion tibiale Hahn, 1831 is a senior synonym of Lasaeola tristis (Hahn, 1833 (syn. nov.. Evidence is presented that the junior synonym is in prevailing usage and the senior synonym is therefore regarded as nomen oblitum.

  20. The Argentine species of the genus Megacyllene Casey, 1912 (Coleoptera: Cerambycidae), with description of a new species

    OpenAIRE

    Dilorio, Osvaldo R.

    2010-01-01

    Fifteen species of Megacyllene occur in Argentina: M. acuta (Germ.), M. bonplandi (Gounelle), M. castanea (Laporte & Gory), M. insignita (Perroud), M. falsa (Chevrolat), M. mellyi (Chevrolat), M. minuta (Chevrolat), M. multiguttata Burmeister (status nov.), . murina Purmeister), M. neblinosa new species, M. proxima (Laporte and Gory), M. spinifera (Newman), M. rotundicollis Zajciw, M. rufipes (Laporte and Gory) and M. unicolor Fuchs (=M. lateripilosa Zajciw new synonym). A Lectotype and Paral...

  1. Chromosome analysis of chironomids (Diptera: Chironomidae – obligatory miners of freshwater sponges (Porifera

    Directory of Open Access Journals (Sweden)

    N Durnova

    2009-08-01

    Full Text Available Karyotypic characteristics of the chironomids Demeijerea rufipes (Linnaeus, 1761 and Xenochironomus sp., obligatory miners of freshwater sponges, are considered. The karyotype of Xenochironomus sp. is described for the first time. It is assumed that the ordered spatial organization of chromosomes of these species, expressed in terms of the presence of chromocentres of different degrees of stability and an almost complete absence of polymorphism for chromosome rearrangements, represents an adaptation to inhabiting host tissues, i.e. to habitat relative constancy.

  2. Foraging energetics of a nectar-feeding ant: metabolic expenditure as a function of food-source profitability.

    Science.gov (United States)

    Schilman, Pablo E; Roces, Flavio

    2006-10-01

    We examined the quantitative relationship between the energetic costs and benefits of nectar collection by nectar-feeding ants, Camponotus rufipes. In the laboratory, individual workers were trained to visit an artificial feeder that provided a sucrose solution of 1%, 5%, 10%, 30% or 50% at controlled flows, in a similar span range to those observed in natural nectar sources. We measured foraging times, nectar loads collected, and CO(2) production during actual feeding, as an indication of the energy expenditure for a single forager. Results show an increase in individual metabolic rates with increasing flow rate of sugar solution, but no dependence on sucrose concentration. This increase in metabolic expenditure does not depend on the crop load attained while feeding, as intuitively expected, and is therefore a result of an increased activity brought about by the food-source profitability experienced by the forager. The energy gained during collection of sugar solution is always higher than the energy spent by the ant. Even with a food source of lower quality than a natural source, the ants gain ca. tenfold of what they spend. Based on a simplified model, we calculated that foragers of C. rufipes could travel from 0.5 to 9 km with the energy gained in a single foraging trip only. These results suggest that decreasing foraging time is more important than increasing individual energetic efficiency when workers of the nectar-feeding ant C. rufipes decide to stop drinking and return to the nest with partial crop loads.

  3. Morphological and Molecular Characterization of Clinostomum detruncatum (Trematoda: Clinostomidae) Metacercariae Infecting Synbranchus marmoratus.

    Science.gov (United States)

    Acosta, Aline Angelina; Caffara, Monica; Fioravanti, Maria Letizia; Utsunomia, Ricardo; Zago, Aline Cristina; Franceschini, Lidiane; da Silva, Reinaldo José

    2016-02-01

    A complete morphological description, supported by molecular data, of Clinostomum detruncatum metacercariae is reported in this study. The metacercariae were found infecting Synbranchus marmoratus from the Paraná River, municipality of Guaíra, Paraná State, Brazil. The taenioidean uterus is the main morphological characteristic of this species. Both neighbor-joining (NJ) and maximum likelihood (ML) trees showed 2 clear separate clusters grouping together the species from the Palearctic region (Clinostomum complanatum, Clinostomum cutaneum, Clinostomum phalacrocoracis, Clinostomum philippinense) and those from the Nearctic/Neotropical regions (Clinostomum marginatum, Clinostomum tataxumui, C. detruncatum, Clinostomum sp. 7). The latter clade is divided into 2 subclades grouping species from North America and Mexico (C. marginatum and C. tataxumui), and those from Brazil (C. detruncatum and Clinostomum sp. 7).

  4. Paradaemonia thelia (Jordan e seus estágios imaturos (Lepidoptera, Saturniidae, Arsenurinae Paradaemonia thelia (Jordan and its immature stages (Lepidoptera, Saturniidae, Arsenurinae

    Directory of Open Access Journals (Sweden)

    Eurides Furtado

    2005-03-01

    Full Text Available Dados sobre os estágios imaturos, o comportamento e a distribuição de Paradaemonia thelia (Jordan são apresentados. A larva solitária alimenta-se de Chrysophyllum marginatum (Hook. & Arn. Radlk. (Sapotaceae, sua planta hospedeira natural. Os ovos são postos isolados na face dorsal de folhas maduras. O desenvolvimento larval leva 18 dias e o estágio pupal 32-37 dias. Adultos, ovos, larvas e pupa são ilustrados a cores.Data on immature stages, the behavior and the range of Paradaemonia thelia (Jordan, 1922 are presented. The solitary larva feed on Chrysophyllum marginatum (Hook. & Arn. Radlk. (Sapotaceae, its natural hostplant. Isolated ovae are deposited on dorsal surface of mature leaves. Larval development required 18 days; the pupal stage lasted 32-37 days. Adults, ovae, larvae and pupa are illustrated in color.

  5. Persistência de óleos essenciais em milho armazenado, submetido à infestação de gorgulho do milho Persistence of essential oils in stored maize submitted to infestation of maize weevil

    Directory of Open Access Journals (Sweden)

    Rodrigo Leandro Braga de Castro Coitinho

    2010-07-01

    Full Text Available Os óleos essenciais e os compostos constituintes têm sido pesquisados quanto a sua atividade inseticida contra pragas de grãos armazenados. Neste trabalho, avaliou-se a persistência de óleos essenciais em milho armazenado, submetido à infestação do gorgulho do milho, Sitophilus zeamais Mots. (Coleoptera: Curculionidae. A persistência dos óleos e do eugenol foi avaliada no período inicial (logo após a impregnação e aos 30, 60, 90 e 120 dias de armazenamento. As mortalidades de S. zeamais, no período inicial, variaram entre 93,8 (Piper hispidinervum, Melaleuca leucadendron e eugenol e 100% (Eugenia uniflora, frutos verdes de Schinus terebinthifolius e Piper marginatum. A partir dos 30 dias, as mortalidades, de modo geral, decresceram, com exceção de P. marginatum (92,2%, que alcançou 53,1% de mortalidade aos 120 dias de armazenamento. De acordo com as equações de regressão ajustadas para o número de S. zeamais emergidos em todo o período de armazenamento, apenas não houve significância para os óleos de S. terebinthifolius, P. marginatum e testemunha. Em relação à média geral, o óleo de P. marginatum foi o mais persistente, proporcionando emergência de apenas 0,30 insetos, diferindo dos óleos restantes, do eugenol e da testemunha. Os demais tratamentos só diferiram em relação à testemunha.The essential oils and constituent compounds have been studied for their insecticidal activity against stored grain pests. In this research, persistence of the essential oils in stored maize subject to infestation by maize weevil, Sitophilus zeamais Mots. (Coleoptera: Curculionidae were evaluated. Persistence of oils and eugenol were evaluated in the initial period (after impregnation and at 30, 60, 90 and 120 days of storage. Mortalities of S. zeamais in the initial period ranged between 93.8 (Piper hispidinervum, Melaleuca leucadendron and eugenol to 100% (Eugenia uniflora, green fruits of Schinus terebinthifolius and Piper

  6. Insecticidal activity of Piper essential oils from the Amazon against the fire ant Solenopsis saevissima (Smith) (Hymenoptera: Formicidae).

    Science.gov (United States)

    Souto, R N P; Harada, A Y; Andrade, E H A; Maia, J G S

    2012-12-01

    Pepper plants in the genus Piper (Piperales: Piperaceae) are common in the Brazilian Amazon and many produce compounds with biological activity against insect pests. We evaluated the insecticidal effect of essential oils from Piper aduncum, Piper marginatum (chemotypes A and B), Piper divaricatum and Piper callosum against workers of the fire ant Solenopsis saevissima (Smith) (Hymenoptera: Formicidae), as well as their chemical composition by gas chromatography and gas chromatography-mass spectrometry. The lowest median lethal concentration (LC50) in 48 h was obtained with the oil of P. aduncum (58.4 mg/L), followed by the oils of P. marginatum types A (122.4 mg/L) and B (167.0 mg/L), P. divaricatum (301.7 mg/L), and P. callosum (312.6 mg/L). The major chemical constituents were dillapiole (64.4%) in the oil of P. aduncum; p-mentha-1(7),8-diene (39.0%), 3,4-methylenedioxypropiophenone (19.0%), and (E)-β-ocimene (9.8%) in P. marginatum chemotype A and (E)-isoosmorhizole (32.2%), (E)-anethole (26.4%), isoosmorhizole (11.2%), and (Z)-anethole (6.0%) in P. marginatum chemotype B; methyleugenol (69.2%) and eugenol (16.2%) in P. divaricatum; and safrole (69.2%), methyleugenol (8.6%), and β-pinene (6.2%) in P. callosum. These chemical constituents have been previously known to possess insecticidal properties.

  7. Ectoparasites and endoparasites community of Ageneiosus ucayalensis (Siluriformes: Auchenipteridae), catfish from Amazon River system in northern Brazil.

    Science.gov (United States)

    de Oliveira Ferreira, Drielly; Tavares-Dias, Marcos

    2017-09-01

    This study investigated the community of ectoparasites and endoparasites in Ageneiosus ucayalensis (Auchenipteridae) of a tributary from the Amazon River system, in Northern Brazil. Of 34 fish examined, 100% were parasitized by Ichthyophthirius multifiliis, Cosmetocleithrum bulbocirrus, Demidospermus sp., metacercariae of Genarchella genarchella, Clinostomum marginatum and Herpetodiplostomum sp., Procamallanus (Spirocamallanus) belenensis, Cucullanus ageneiosus and larvae of Contracaecum sp. digeneans C. marginatum and Herpetodiplostomum sp. were dominant parasite species, while I. multifiliis was the parasite with higher infection level. Such parasite species showed an aggregated dispersion, except P. (S.) belenensis, which showed a random dispersion. The Brillouin diversity (0.53 ± 0.29) was high, while evenness (0.28 ± 0.16) and species richness of parasites (3.7 ± 1.1) were low. The size of the hosts did not influence diversity, species richness and abundance of parasites. The ectoparasites were characterized by high prevalence and abundance, while endoparasites community presented low prevalence and abundance. The main factors responsible for structuring the parasite community in A. ucayalensis were mainly the behavior of this host and the availability of endoparasites infective stages in the environment. This was the first report of I. multifiliis, C. bulbocirus, Demidospermus sp., Contracaecum sp., C. marginatum, Herpetodiplostomum sp. and G. genarchella for A. ucayalensis. The presence of endohelminth larvae suggests that A. ucayalensis is part of the diet of other fish at the top of the food web in the Amazonian ecosystem studied.

  8. Experimental and molecular study of cercariae of Clinostomum sp. (Trematoda: Clinostomidae) from Biomphalaria spp. (Mollusca: Planorbidae) in Brazil.

    Science.gov (United States)

    Pinto, H A; Caffara, M; Fioravanti, M L; Melo, A L

    2015-02-01

    Despite the large number of reports of species of Clinostomum from vertebrate hosts in South America, studies evaluating the molluscan transmitters of these parasites are scarce. In the present study, clinostomatoid cercariae shed from 0.02% (4/17,485) specimens of Biomphalaria spp., collected at the Pampulha reservoir, Belo Horizonte, Minas Gerais, Brazil, were used for experimental infection of Poecilia reticulata . Samples of cercariae from molluscs and metacercariae experimentally obtained from fish were subjected to morphological and molecular analyses and compared with species of Clinostomum reported in the Americas. The cercariae and metacercariae, here identified as Clinostomum sp., present general morphology similar to that reported for Clinostomum marginatum , however, from molecular point of view, differ significantly from North American C. marginatum and other species of Clinostomum reported in South America. These results suggest that the diversity of Clinostomum found in Brazil may be underestimated. Additional studies aimed at molecular characterization of South American species of Clinostomum, including the finding of specimens with sequences similar to that reported for C. marginatum in North America are required.

  9. On the identity of Chauliognathus flavipes (Coleoptera: Cantharidae: revision of type specimens, new synonyms and new status

    Directory of Open Access Journals (Sweden)

    Gabriel Biffi

    Full Text Available ABSTRACT The identity, taxonomic history, type series and synonyms of Chauliognathus flavipes (Fabricius, 1781, C. fallax (Germar, 1823, C. axillaris (Fischer von Waldheim, 1823 and C. basalis Lacordaire, 1857 are herein discussed. Twenty-five new synonyms are proposed for C. flavipes , with designation of lectotypes: C. fallax var. atrofasciata Pic, 1925 syn. nov., C. fallax var. basireducta Pic, 1925 syn. nov., C. fallax var. concolor Pic, 1927 syn. nov., C. fallax var. medioreducta Pic, 1928 syn. nov., C. fallax var. edmondi Pic, 1948 syn. nov., C. fallax var. petri Pic, 1948 syn. nov., C. fallax var. henrici Pic, 1948 syn. nov., C. fallax var. reductemaculata Pic, 1949 syn. nov., C. plagiatus Blanchard, 1844 syn. nov., C. plagiatus var. latejuncta Pic, 1925 syn. nov., C. plagiatus var. orbygnyi Pic, 1948 syn. nov., C. plagiatus var. alcidei Pic, 1948 syn. nov., C. inbasalis Pic, 1925 syn. nov., C. bimaculatus Pic, 1925 syn. nov., C. mendesensis Pic, 1933 syn. nov., C. opacicollis Pic, 1946 syn. nov., C. opacicollis var. freiburgana Pic, 1946 syn. nov., C. bireductipennis Pic, 1947 syn. nov., C. quadripunctatus var. lebisi Pic, 1947 syn. nov., C. diversesignatus Pic, 1949 syn. nov., C. neopici Wittmer, 1951 syn. nov., C. rufipes Pic, 1924 syn. nov., C. rufipes var. quadrinotata Pic, 1928 syn. nov., C. rufipes var. haasi Pic, 1928 syn. nov., C. ensellatus var. innotatithorax Pic, 1944 syn. nov. The name Chauliognathus neopici var. schneideri Pic, 1934 syn. nov. is also proposed as a junior synonym of Chauliognathus plicatus Pic, 1915. Chauliognathus plagiatus var. latebasalis Pic, 1925 is elevated to species rank (= C . latebasalis Pic, 1925 stat. nov. and the homonymy of C. basalis Lacordaire, 1857 and C. basalis LeConte, 1859 is discussed. Finally, a redescription and a distribution map of C. flavipes are given.

  10. Nucleotide Base Variation of Blast Disease Resistance Gene Pi33 in Rice Selected Broad Genetic Background

    OpenAIRE

    DWINITA WIKAN UTAMI; KALIA BARNITA; SITI YURIAH; IDA HANARIDA

    2011-01-01

    Rice is one of the most important crops for human beings, thus increasing productivity are continually persecuted. Blast disease can reduce the rate of productivity of rice cultivation. Therefore, the program of blast disease-resistant varieties needs to do effectively. One of broad-spectrum blast disease-resistant gene is Pi33. This study was aimed to identify the variation in the sequence of nucleotide bases of Pi33 gene in five interspesific lines which derived from Bio46 (IR64/Oryza rufip...

  11. Evaluation of the possible role of ants (Hymenoptera: Formicidae as mechanical vectors of nematodes and protists

    Directory of Open Access Journals (Sweden)

    Fabio Villani

    2008-10-01

    Full Text Available Nematodes and protists can be transmitted to humans in many ways and little concern has been given to the mechanical transmission by ants. This study aimed at analysing how the eggs of Ascaris lumbricoides and cysts of Entamoeba coli could be mechanically transmitted to the man by Formicidae. Through the experiments using nests of Tapinoma melanocephalum, Linepithema humile and Monomorium pharaonis reared in the laboratory allied to observations of some 17 ant species in an urban park area in Mogi das Cruzes (SP, it was found that L. humile was capable of carrying eggs of A. lumbricoides both in the field and laboratory conditions (1 worker, as well as was Camponotus rufipes (2, Solenopsis saevissima (1 and Acromyrmex niger (1. The cysts of Escherichia coli were found over three workers of C. rufipes. Although the frequency of the workers found transporting pathogens was low, the capacity of common household species in carrying pathogens like nematodes and protists was demonstrated.Os Nematoda e Protista podem ser transmitidos ao homem de diversas maneiras, mas pouca ênfase é dada para a transmissão mecânica por intermédio de formigas. Assim, esse trabalho procurou investigar a transmissão mecânica de ovos de Ascaris lumbricoides e cistos de Entamoeba coli pelos Formicidae. Através de experimentos com espécies mantidas em ninhos no laboratório (Tapinoma melanocephalum, Linepithema humile e Monomorium pharaonis e com 17 espécies de formigas de uma área antropizada na região de Mogi as Cruzes (SP, foi possível constar que os ovos A. lumbricoides foram transportados por L. humile, tanto no campo (1 operária como no laboratório (1 operária, por Camponotus rufipes (2, por Solenopsis saevissima (1 e por Acromyrmrex niger (1. Em três operárias de C. rufipes foram encontrados cistos de E. coli. Apesar da baixa incidência de transporte, as três primeiras espécies pelo fato de viverem muito próximas ao ser humano, podem levar para

  12. Tick paralysis: first zoonosis record in Egypt.

    Science.gov (United States)

    Mosabah, Amira A Abd El-rahman; Morsy, Tosson A

    2012-04-01

    Tick paralysis caused by the secretion of toxin with saliva while taking a blood meal is an important veterinary disease, but is rare in humans. Although it has certain geographical proclivities, it exists worldwide. Tick paralysis was demonstrated for the first time in Egypt among four children living in rural area at Giza Governorate. The clinical pictures were confused with rabies; myasthensia gravis; botulism; diphtheritic polyneuropathy encountered in rural areas. The recovery of tick infesting the four little children and negative clinical and laboratory data of all diseases denoted tick paralysis. The encountered ticks infesting their animals were Rhipicephalus sanguineus on dogs, Hyalomma dromedarii on camels and Hyalomma anatolicum excavatum and Haemaphysalis sp. on goats. The case was recognized as first record of tick paralysis in Egypt.

  13. PCR-Detection of Coxiella burnetii in Ticks Collected from Sheep and Goats in Southeast Iran

    Directory of Open Access Journals (Sweden)

    SR Nourollahi Fard

    2011-06-01

    Results: Three pools, each consisting of five female of Hyalomma anatolicum anatolicum and one pool (6 ticks of Rhipicephalus sanguineus ticks collected from goats and sheep were found to be positive by Trans-PCR. Conclusion: This paper documents the first molecular detection of C. burnetii in ticks, which shows their role as puta­tive vectors and reservoirs for this pathogenic agent.  

  14. IN VITRO EFFECT OF SORGHUM (SORGHUM BICOLOR SEED EXTRACTS AS A BIOLOGICAL ACARICIDAL AGAINST SOME HARD TICK (IXODIDAE IN SULAIMANI GOVERNORATE - KURDISTAN REGION/IRAQ

    Directory of Open Access Journals (Sweden)

    Bahzad H.S. Mustafa

    2016-09-01

    Full Text Available This study was conducted in Sulaimani governorate in order to identify the biological control of some Ixodidae genera among different flocks of cattle, sheep and goats. Four genera of Ixodidae; Boophilus spp., Hyalomma spp., Rhipicephalus spp. and Haemaphysalis spp., were identified in these infested animals. According to chi–square test, the highest distribution of Boophulis spp., was recorded in cattle (56.51%, and the highest distribution of Hyalomma spp., (49.82% and Rhipicephalus spp., (28.16% which were in sheep. The highest number of Haemophasylas spp., was obtained from goats (6.67%, whereas the lowest number of this genus (2.88% and 2.89% was collected from cattle and sheep respectively. The toxicity of Sorghum bicolor seed extract was tested against the more distributed Ixodidae genera (Boophilus spp. and Hyalomma spp. by immersion method on mature ticks, four concentrations (23.2, 17.4, 11.6 and 5.8 mg/dl, in addition to the control treatment (0 mg/dl of the seed were used to evaluate the engorged females in vitro. The results showed that 100% of absolute cumulative mortality of Boophilus spp., was gain after 72 hr by 23.2 mg/dl extract concentration, followed by 17.4 mg/dl which gave 90% mortality, whereas 100% absolute cumulative mortality for Hyalomma spp., was obtained by 23.2 mg/dl extract concentration after 48 hr, followed by 17.4, 11.6 and 5.8 mg/dl concentration that gave 90%, 80% and 40% mortality after 72 hr.

  15. NAMRU-3 Reprint Accession List 1982. Number 12.

    Science.gov (United States)

    1983-01-01

    TuberculousMeningitli. J. Clin. Lab. Inwnunol, 8:37-42, 1982. 1295 SIPPEL, I.E., EL-MASRY, N.A., FARID, Z.: Diagnosis of Human Brucellosis with ELISA. The Lancet...Hyalomma (Hyalonunina) arabica sp. N. Parasitizing Goats andSheep In the Yemen Arab Republic and Saudi Arabia. J. Parasitol., 68(1):150-156, 1982. 1298...Accession Number BACTERIOLOGY Brucellosis 1295 Identification of micro-organisms by gas-chromatography 1282 Meningitis 1294, 1302, 1305, 1311, 1321

  16. Identification of attenuation markers of a Theileria lestoquardi cell line to be used for the development of live vaccine against malignant ovine theileriosis

    OpenAIRE

    Mousa, Awadia Mohamed Ali Mohamed

    2010-01-01

    Theileria lestoquardi is a tick-borne protozoan parasite and highly pathogenic for sheep. The disease caused by the pathogen is known as malignant ovine theileriosis (MOT) and is transmitted by Hyalomma ticks. Control of the disease can be achieved by immunization of sheep with attenuated T. lestoquardi schizont-infected ovine cells that provides the animal with solid immunity. The approach of using the attenuated vaccine against malignant ovine theileriosis has been carried out successfully ...

  17. Reverse transcription PCR-based detection of Crimean-Congo hemorrhagic fever virus isolated from ticks of domestic ruminants in Kurdistan province of Iran.

    Science.gov (United States)

    Fakoorziba, Mohammad Reza; Golmohammadi, Parvaneh; Moradzadeh, Rahmatollah; Moemenbellah-Fard, Mohammad Djaefar; Azizi, Kourosh; Davari, Behrooz; Alipour, Hamzeh; Ahmadnia, Sara; Chinikar, Sadegh

    2012-09-01

    Crimean-Congo hemorrhagic fever (CCHF) is a potentially fatal viral vector-borne zoonosis which has a mortality rate of up to 30% without treatment in humans. CCHF virus is transmitted to humans by ticks, predominantly from the Hyalomma genus. Following the report of two confirmed and one suspected death due to CCHF virus in Kurdistan province of Iran in 2007, this study was undertaken to determine the fauna of hard ticks on domestic ruminants (cattle, sheep, and goats) and their possible infection with CCHF virus using reverse transcription PCR technique. This is the first detection of CCHF virus in ticks from the Kurdistan province of Iran. Overall, 414 ixodid ticks were collected from two districts in this province. They represented four genera from which 10 separate species were identified. The Hyalomma genus was the most abundant tick genus (70%). It was the only genus shown to be infected with the CCHF virus using RT-PCR technique. The number of ticks positive for CCHF virus was 5 out of 90 (5.6%) adult ticks. The three remaining genera (Haemaphysalis, Rhipicephalus, and Dermacentor) were all negative following molecular survey. Four of the five virally-infected ticks were from cattle mainly in the Sanandaj district. We concluded that CCHF virus is present in the Hyalomma ticks on domestic ruminants (cattle) in Kurdistan province of Iran.

  18. Molecular detection of Crimean-Congo haemorrhagic fever (CCHF) virus in ticks from southeastern Iran.

    Science.gov (United States)

    Mehravaran, Ahmad; Moradi, Maryam; Telmadarraiy, Zakyeh; Mostafavi, Ehsan; Moradi, Ali Reza; Khakifirouz, Sahar; Shah-Hosseini, Nariman; Varaie, Fereshteh Sadat Rasi; Jalali, Tahmineh; Hekmat, Soheila; Ghiasi, Seyed Mojtaba; Chinikar, Sadegh

    2013-02-01

    Crimean-Congo haemorrhagic fever (CCHF) virus is a tick-borne member of the genus Nairovirus, family Bunyaviridae. CCHF virus has been isolated from at least 31 different species of ticks. The virus is transmitted through the bite of an infected tick or by direct contact with CCHF virus-infected patients or the products of infected livestock. This study was conducted to determine the rate of CCHF virus infection in ticks in the district of Zahedan, in the province of Sistan and Baluchistan, southeastern Iran. A total of 140 ticks were collected from Sistan and Baluchistan. Reverse transcriptase-polymerase chain reaction (RT-PCR) was used for the detection of the CCHF virus genome in the tick population. This genome was detected in 4.3% of ticks collected from livestock of different regions of Zahedan. The infected tick genera belonged to Hyalomma and Haemaphysalis. Although in the epidemiology of CCHF virus Hyalomma ticks are considered to be the most important vectors and reservoirs, the virus has also been reported to occur in other genera of ticks, which conforms to the current data in our study from Sistan and Baluchistan. Given that animals are common hosts for Hyalomma and Haemaphysalis, regular monitoring programmes for livestock should be applied for CCHF virus control.

  19. Detecção de Aethalion reticulatum (L., 1767 (Hemiptera: Aethalionidae em alfavaca-cravo (Ocimum gratissimum L. e observações sobre sua ocorrência Detection of Aethalion reticulatum (L., 1767 (Hemiptera: Aethalionidae in clove basil (Ocimum gratissimum L. and observations of its occurrence

    Directory of Open Access Journals (Sweden)

    J.S.S Rando

    2010-06-01

    Full Text Available O objetivo deste trabalho foi relatar a ocorrência da cigarrinha Aethalionidae em alfavaca-cravo (Ocimum gratissimum L. no município de Bandeirantes-PR. Plantas com cerca de dois anos, na fase reprodutiva, com inflorescências, flores, frutos e sementes, serviram como fonte para a coleta de ninfas e adultos das cigarrinhas. Registrou-se em alfavaca-cravo a espécie Aethalion reticulatum e a interação com as formigas Camponotus rufipes e C. crassus.The aim of this work was to report the occurrence of the leafhopper Aethalionidae in clove basil (Ocimum gratissimum in Bandeirantes Municipality, Paraná State, Brazil. Plants around two years old, in the reproductive phase, presenting inflorescences, flowers, fruits and seeds, were used as source for collection of leafhopper nymphs and adults. In clove basil, the species Aethalion reticulatum was recorded, in addition to its interaction with the ants Camponotus rufipes and C. crassus.

  20. Flower morphology and anatomy of Bignoniaceae liana species

    OpenAIRE

    Souza,Luiz Antonio de; Santos, Gracielli de Oliveira; Moscheta,Ismar Sebastião

    2010-01-01

    Lianas can be invasive in forests, interfering in the arboreal community’s regeneration. On the other hand, the phenological patterns of the lianas can contribute as alimentary supplement tothe fauna. The ecological importance and the investigation scarcity in fl oral anatomy of lianas motivated the morphological and anatomical study of Adenocalymma marginatum (Cham.) DC., Arrabidaea mutabilis Bureau & K. Schum., Macfadyena unguis-cati (L.) A. Gentry, and Tynanthus micranthus Corr. Méllo ex K...

  1. Observational Study of the Genetic Architecture of Neutrophil-Mediated Inflammatory Skin Diseases

    Science.gov (United States)

    2016-09-26

    Other Specified Inflammatory Disorders of Skin or Subcutaneous Tissue; Pyoderma Gangrenosum; Erosive Pustular Dermatosis of the Scalp; Sweet's Syndrome; Behcet's Disease; Bowel-associated Dermatosis-arthritis Syndrome; Pustular Psoriasis; Acute Generalized Exanthematous Pustulosis; Keratoderma Blenorrhagicum; Sneddon-Wilkinson Disease; IgA Pemphigus; Amicrobial Pustulosis of the Folds; Infantile Acropustulosis; Transient Neonatal Pustulosis; Neutrophilic Eccrine Hidradenitis; Rheumatoid Neutrophilic Dermatitis; Neutrophilic Urticaria; Still's Disease; Erythema Marginatum; Unclassified Periodic Fever Syndromes / Autoinflammatory Syndromes; Dermatitis Herpetiformis; Linear IgA Bullous Dermatosis; Bullous Systemic Lupus Erythematosus; Inflammatory Epidermolysis Bullosa Aquisita; Neutrophilic Dermatosis of the Dorsal Hands (Pustular Vasculitis); Small Vessel Vasculitis Including Urticarial Vasculitis; Erythema Elevatum Diutinum; Medium Vessel Vasculitis

  2. Essential oils of leaves of Piper species display larvicidal activity against the dengue vector, Aedes aegypti (Diptera: Culicidae

    Directory of Open Access Journals (Sweden)

    HT. SANTANA

    2015-03-01

    Full Text Available The mosquito Aedes aegypti is the vector of the dengue virus, an endemic arbovirus from tropical and subtropical regions of the world. The increasing resistance of mosquitoes to commercial insecticides impairs regular control programs; therefore, chemical prospecting originating from the Amazonian flora is promising for potential new insecticides. Several Piper species are, notably, rich in phenylpropanoids and terpenoids, substances with proven insecticidal activity. The composition and the larvicidal activity of three Piper species against A. aegypti were evaluated. Essential oils were extracted by hydrodistillation in a modified Clevenger apparatus and analyzed by GC/MS. The major components found in Piper arboreum were germacrene D (31.83% and bicyclogermacrene (21.40%; in Piper marginatum: (E-methyl isoeugenol (27.08%, (E-anethole (23.98% and (Z-methyl isoeugenol (12.01%; and in Piper aduncum: (E-isocroweacin (29.52% and apiole (28.62% and elemicin (7.82%. Essential oils from the Piperaceae species studied resulted in Lethal Concentrations (LC50 of 34-55 ppm, while LC90 was higher than 100 ppm, except for P. marginatum (85 ppm.

  3. Atividade antimicrobiana de extratos hidroalcólicos de espécies da coleção de plantas medicinais CPQBA/UNICAMP

    Directory of Open Access Journals (Sweden)

    M.C.T. Duarte

    2004-01-01

    Full Text Available Extratos obtidos a partir de 45 espécies da Coleção de Germoplasmas do CPQBA foram estudados quanto à atividade antimicrobiana. As espécies que apresentaram forte inibição (Concentração Mínima Inibitória até 0,5 mg/mL para os respectivos microrganismos foram: Achillea millefolium (0,5, Mikania laevigata (0,04, Solidago chilensis (0,1, Piper marginatum (0,2 para Staphylococcus aureus; Aloysia gratissima (0,1, P. marginatum (0,2, M. laevigata (0,09 para Bacillus subtilis e Mentha pullegium (0,3, Mikania glomerata (0,1, M. laevigata (0,04, Stachytarpeta cayenensis (0,2 e Bacharis dracunculifolia (0,5 para Streptococcus faecium. De acordo com os resultados, ressaltamos a espécie M. laevigata por apresentar inibição contra três das bactérias estudadas, em concentrações similares a do cloranfenicol, padrão de referência utilizado.

  4. Detection, isolation and confirmation of Crimean-Congo hemorrhagic fever virus in human, ticks and animals in Ahmadabad, India, 2010-2011.

    Directory of Open Access Journals (Sweden)

    Devendra T Mourya

    Full Text Available BACKGROUND: In January 2011, human cases with hemorrhagic manifestations in the hospital staff were reported from a tertiary care hospital in Ahmadabad, India. This paper reports a detailed epidemiological investigation of nosocomial outbreak from the affected area of Ahmadabad, Gujarat, India. PRINCIPAL FINDINGS: Samples from 3 suspected cases, 83 contacts, Hyalomma ticks and livestock were screened for Crimean-Congo hemorrhagic fever (CCHF virus by qRT-PCR of which samples of two medical professionals (case C and E and the husband of the index case (case D were positive for CCHFV. The sensitivity and specificity of indigenous developed IgM ELISA to screen CCHFV specific antibodies in human serum was 75.0% and 97.5% respectively as compared to commercial kit. About 17.0% domestic animals from Kolat, Ahmadabad were positive for IgG antibodies while only two cattle and a goat showed positivity by qRT-PCR. Surprisingly, 43.0% domestic animals (Buffalo, cattle, sheep and goat showed IgG antibodies in the adjoining village Jivanpara but only one of the buffalo was positive for CCHFV. The Hyalomma anatolicum anatolicum ticks were positive in PCR and virus isolation. CCHFV was isolated from the blood sample of case C, E in Vero E-6 cells and Swiss albino mice. In partial nucleocapsid gene phylogeny from CCHFV positive human samples of the years 2010 and 2011, livestock and ticks showed this virus was similar to Tajikistan (strain TAJ/H08966, which belongs in the Asian/middle east genetic lineage IV. CONCLUSIONS: The likely source of CCHFV was identified as virus infected Hyalomma ticks and livestock at the rural village residence of the primary case (case A. In addition, retrospective sample analysis revealed the existence of CCHFV in Gujarat and Rajasthan states before this outbreak. An indigenous developed IgM ELISA kit will be of great use for screening this virus in India.

  5. Evaluation of Certain Insecticides and Repellents Against Ticks

    Directory of Open Access Journals (Sweden)

    D. Kapoor

    1972-07-01

    Full Text Available The susceptibility of two commonly occurring species of Ixodid ticks viz., the cattle tick, Hyalomma anatolicum anatolicum Koch and the brown dog tick, Rhipicephalus sanguineus Latr to certain newer insecticdes was investigated under controlled environmental conditions. The repellency of diethyl toluamide (Deet to the two species of ticks was also investigated by a specially devised laboratory technique. It was found that based on LC/sub 50/ values, the two species were most susceptible to pyrethrins followed by carbaryl whereas malathion was found least toxic to the ticks.

  6. Alguns ectoparasitas e protozoários em bovinos da República da Guiné-Bissau

    OpenAIRE

    ROSA, FERNANDA; Crespo, Maria Virgínia; Travassos Dias, J. A.

    1998-01-01

    Os autores assinalam a presença de algumas espécies de ixodídeos (Amblyomma variegatum, Boophilus annulatus, B. geigy e Hyalomma sp.) localizados em diferentes regiões do corpo de bovinos autóctones da República da Guiné-Bissau, colhidos entre Novembro de 1990 e Março de 1991. A pesquisa de protozoários, efectuada principalmente em esfregaços de sangue revelou a presença de Anaplasma marginale, Theileria mutans, Babesia bigemina e Sarcocystis sp. Não foram encontradas lesões relacionada...

  7. [Lymphangitis-associated rickettsiosis caused by Rickettsia sibirica mongolitimonae].

    Science.gov (United States)

    Foissac, M; Socolovschi, C; Raoult, D

    2013-01-01

    Rickettsia sibirica mongolitimonae was first isolated 20 years ago in Asia but has now been identified on three continents. Hyalomma spp. and Rhipicephalus pusillus ticks are vectors but only a small number of cases have been reported to date, mainly on the Mediterranean coast. This bacterium induces the lymphangitis-associated rickettsiosis, a still unfamiliar rickettsiosis that is mainly characterized by fever with a rope-like lymphangitis and/or lymphadenopathy and skin eschar occurring after tick bites. These features are especially evocative if they occur in spring. Sequellae are very rare and treatment with doxycycline is recommended.

  8. Ant foraging on extrafloral nectaries of Qualea grandiflora (Vochysiaceae) in cerrado vegetation: ants as potential antiherbivore agents.

    Science.gov (United States)

    Oliveira, P S; da Silva, A F; Martins, A B

    1987-12-01

    Qualea grandiflora is a typical tree of Brazilian cerrados (savanna-like vegetation) that bears paired extrafloral nectaries (EFNs) along its stems. Results show that possession of EFNs increases ant density on Q. grandiflora shrubs over that of neighbouring non-nectariferous plants. Frequency of ant occupancy and mean number of ants per plant were much higher on Qualea than on plants lacking EFNs. These differences resulted in many more live termitebaits being attacked by foraging ants on Qualea than on neighbours without EFNs. Termites were attacked in equal numbers and with equal speeds on different-aged leaves of Qualea. The greatest potential for herbivore deterrence was presented by Camponotus ants (C. crassus, C. rufipes and C. aff. blandus), which together attacked significantly more termites than nine other ant species grouped. EFNs are regarded as important promoters of ant activity on cerado plants.

  9. Necrophagous beetles associated with carcasses in a semi-arid environment in northeastern Brazil: implications for forensic entomology.

    Science.gov (United States)

    Mayer, Ana C G; Vasconcelos, Simão D

    2013-03-10

    Data on the ecology and bionomics of necrophagous beetles are scarce in tropical countries despite their relevance in forensic investigations. We performed a survey on the diversity and temporal pattern of colonization of beetles on pig carcasses in a fragment of dry forest in northeastern Brazil. We collected 1550 adults of diverse feeding habits from 12 families, of which 96% had necrophagous and/or copro-necrophagous habits and belonged to four families: Dermestidae, Scarabaeidae, Cleridae and Trogidae. Three species, Dermestes maculatus, Necrobia rufipes and Omorgus suberosus are reported for the first time with an expanded geographical distribution that includes the semi-arid region in Brazil. Adult beetles were collected as early as 24h after death. One endemic species, Deltochilum verruciferum, stood out in terms of numerical dominance and temporal occurrence during different stages of decomposition. Its intimate association with carrion emphasizes their potential role in forensic entomology in the region.

  10. Distribution, autecology and biogeography of Dryopidae and Elmidae (Coleoptera, Dryopoidea in the Balearic Islands

    Directory of Open Access Journals (Sweden)

    Rico, E.

    1998-12-01

    Full Text Available The distribution of the Dryopidae and Elmidae in the Balearic Islands was studied. Three species of Dryopidae —Dryops algiricus (Lucas, 1949, D. gracilis (Karsch, 1881 and D. sulcipennis (Costa, 1883— and one of Elmidae —Oulimnius echinatus Berthélemy, 1979— were found. Bibliographical data of other three species of Dryopidae exist, but their presence is either refuted —Dryops lutulentus (Erichson, 1847— or requires confirmation —Dryops luridus (Erichson, 1847 and D. rufipes (Krynicki, 1832—. Dryops gracilis and D. sulcipennis are recorded for first time in the archipelago. The first autecological data of the different species in the archipelago and a biogeographical analysis are provided.

    Se realiza un estudio sobre la distribución de los Dryopidae y Elmidae en las islas Baleares. Tres especies de Dryopidae —Dryops algiricus (Lucas, 1949, D. gracilis (Karsch, 1881 y D. sulcipennis (Costa, 1883— y una de Elmidae —Oulimnius echinatus Berthélemy, 1979— han sido halladas. Existen datos bibliográficos de otras tres especies de Dryopidae, pero su presencia es excluida —Dryops lutulentus (Erichson, 1847— o se considera que debe ser confirmada —Dryops luridus (Erichson, 1847 y D. rufipes (Krynicki, 1832—. Dryops gracilis y D. sulcipennis se citan por primera vez en el archipiélago. Se aportan los primeros datos sobre la autoecología de las diferentes especies en las islas y se realiza un análisis biogeográfico.

  11. Prevalence of tick infestation in dromedary camels (Camelus dromedarius) brought for slaughter in Mashhad abattoir, Iran.

    Science.gov (United States)

    Moshaverinia, Ali; Moghaddas, Elham

    2015-09-01

    This study was carried out to investigate the prevalence of tick infestation and identify tick species that parasitize dromedary camels. Since April 2012 through March 2013, a total of 400 camels that brought for slaughter in Mashhad abattoir were examined for tick infestation. Out of the total 400 camels examined, 237 were infested and annual prevalence of tick infestation 59.25 % (95 % CI 54-64) was calculated. The higher prevalence rates were found in the summer and spring, especially the summer that prevalence rate was the highest. A total of 1,122 ticks were collected from the infested camels and identified by stereomicroscopy. Hyalomma dromedarii was the predominant tick species and comprised 70.76 % of the collected ticks. The frequency of other species was as follows: H. excavatum (19.25 %), H. anatolicum (4.81 %), H. asiaticum (4.72 %), Rhipicephalus turanicus (0.17 %), H. detritum (0.09 %), H. impeltatum (0.09 %) and H. schulzei (0.09 %). Based on the results of present study, it is concluded that camels mostly harbor Hyalomma spp. The species of this genus are the most notorious ticks for transmission of human and animal diseases. Therefore, appropriate tick control measures need to be employed and pour-on method for acaricide application is suggested because this method is fast, easy and suitable for use by camel owners in deserts.

  12. Molecular detection of Ehrlichia canis, Anaplasma bovis, Anaplasma platys, Candidatus Midichloria mitochondrii and Babesia canis vogeli in ticks from Israel.

    Science.gov (United States)

    Harrus, S; Perlman-Avrahami, A; Mumcuoglu, K Y; Morick, D; Eyal, O; Baneth, G

    2011-03-01

    : Ticks are vectors of important pathogens of human and animals. Therefore, their microbial carriage capacity is constantly being investigated. The aim of this study was to characterize the diversity of domestic animal pathogens in ticks collected from vegetation and the ground, from different parts of Israel. Non-engorged questing adult ticks were collected from 13 localities. A total of 1196 ticks in 131 pools-83 pools of Rhipicephalus turanicus and 48 of Rhipicephalus sanguineus (with two to ten ticks per pool)-were included in this study. In addition, 13 single free-roaming Hyalomma spp. ticks were collected. Screening by molecular techniques revealed the presence of Ehrlichia canis, Anaplasma platys, Anaplasma bovis and Babesia canis vogeli DNA in R. turanicus ticks. E. canis, A. bovis, B. canis vogeli and Candidatus Midichloria mitochondrii DNA sequences were detected in R. sanguineus ticks. Candidatus Midichloria mitochondrii DNA was also detected in Hyalomma spp. ticks. Neither Hepatozoon spp. nor Bartonella spp. DNA was detected in any of the ticks examined. This study describes the first detection of E. canis in the tick R. turanicus, which may serve as a vector of this canine pathogen; E. canis was the most common pathogen detected in the collected questing ticks. It also describes the first detection of A. bovis and Candidatus Midichloria mitochondrii in Israel. To the best of the author's knowledge, this is the first report describing the detection of DNA of the latter two pathogens in R. sanguineus, and of A. bovis in R. turanicus.

  13. The international trade in reptiles (Reptilia)--the cause of the transfer of exotic ticks (Acari: Ixodida) to Poland.

    Science.gov (United States)

    Nowak, Magdalena

    2010-05-11

    The problem of the unnatural transfer of exotic ticks (Acari: Ixodida) on reptiles (Reptilia) imported to Poland is presented. In the period from 2003 to 2007, 382 specimens of reptiles belonging to the following genera were investigated: Testudo, Iguana, Varanus, Gongylophis, Python, Spalerosophis, Psammophis. The reptiles most infested with ticks are imported to Poland from Ghana in Africa, and are the commonly bred terrarium reptiles: Varanus exanthematicus and Python regius. As a result of the investigations, the transfer of exotic ticks on reptiles to Poland was confirmed. There were 2104 specimens of the genera Amblyomma and Hyalomma. The following species were found: Amblyomma exornatum Koch, 1844, Amblyomma flavomaculatum (Lucas, 1846), Amblyomma latum Koch, 1844, Amblyomma nuttalli Donitz, 1909, Amblyomma quadricavum (Schulze, 1941), Amblyomma transversale (Lucas, 1844), Amblyomma varanense (Supino, 1897), Amblyomma sp. Koch, 1844, Hyalomma aegyptium (Linnaeus, 1758). All the species of ticks of genus Amblyomma revealed have been discovered in Poland for the first time. During the research, 13 cases of anomalies of morphological structure were confirmed in the ticks A. flavomaculatum, A. latum and H. aegyptium. The expanding phenomenon of the import of exotic reptiles in Poland and Central Europe is important for parasitological and epidemiological considerations, and therefore requires monitoring and wide-ranging prophylactic activities to prevent the inflow of exotic parasites to Poland.

  14. Detection of naturally infected vector ticks (acari: ixodidae by different species of babesia and theileria agents from three different enzootic parts of iran.

    Directory of Open Access Journals (Sweden)

    Mohammad Abdigoudarzi

    2013-12-01

    Full Text Available Diagnostic study of vector ticks for different pathogens transmitted specifically have been done by Iranian old scientists working on the basis of biological transmission of pathogens. In this study we decided to confirm natural infection of different collected ticks from three different provinces of Iran.Ticks were collected from livestock (sheep, goats and cattle during favorable seasons (April to September 2007 and 2008. Slide preparations were stained by Giemsa and Feulgen and were studied searching for any trace of infection. Positive DNA from infected blood or tissue samples was provided and was used as positive control. First, PCR optimization for positive DNA was done, and then tick samples were subjected to specific PCR.Eleven pairs of primers were designed for detection of Theileria, Babesia and Anaplasma spp. Totally 21 tick samples were detected to be infected with protozoa. Hyalomma anatolicum anatolicum and Rhipicephalus turanicus from Fars Province were infected with T. lestoquardi at two different places. Hyalomma detritum was infected with T. lestoquardi in Lorestan Province and Rh. turanicus was infected to Ba. ovis from Fars Province.Totally 21 tick samples were detected to be infected with protozoa. Every sample is regarded with host-environment related factors. Since there are complex relations of vectors and their relevant protozoa, different procedures are presented for future studies.

  15. Anaplasma infection of Bactrian camels (Camelus bactrianus) and ticks in Xinjiang, China.

    Science.gov (United States)

    Li, Youquan; Yang, Jifei; Chen, Ze; Qin, Gege; Li, Yaqiong; Li, Qian; Liu, Junlong; Liu, Zhijie; Guan, Guiquan; Yin, Hong; Luo, Jianxun; Zhang, Lin

    2015-06-10

    To date, anaplasmosis has been reported to be a subclinical disease in Indian and Arabian one-humped camels (Camelus dromedarius) and llamas (Lama glama). However, no information on Anaplasma infection in two-humped Bactrian camels (Camelus bactrianus) in China has been published to date. The aim of this study was to investigate the prevalence of Anaplasma spp. in domestic Bactrian camels and ticks in Xinjiang, China. A total of 382 ticks were collected from the Bactrian camels and from environmental sources. Of these, 84 were morphologically identified as belonging to the Rhipicephalus sanguineus group and genetically identified (12S rDNA, 16S rDNA and the cytochrome c oxidase 1 genes) as R. sanguineus group ticks (temporally designated as Rhipicephalus sp. Xinjiang). PCR testing showed that 7.2% (20/279) of the camels harbored Anaplasma platys DNA. However, microscopic examination revealed no A. platys inclusions in blood smears from the camels. The PCR prevalence of A. platys DNA was 9.5% (6/63) in Rhipicephalus sp. Xinjiang from the Bactrian camels and 14.3% (3/21) in Rhipicephalus sp. Xinjiang from the vegetation. A. platys DNA was not detected by PCR in other tick species (Hyalomma asiaticum, Dermacentor niveus and Hyalomma dromedarii), and no other Anaplasma species were detected in these samples. This is the first report of A. platys in Bactrian camels in Xinjiang, China. The moderate positivity observed indicates that these animals might be a natural host for this pathogen in China.

  16. 南疆部分散养户牛场梨形虫及其媒介蜱感染情况的调查

    Institute of Scientific and Technical Information of China (English)

    吴永红; 刘玲; 王真; 巴音查汗

    2011-01-01

    [ Objective ] Piropiasmosis often occurred in the scattered feeding cattie farm in Southern Xinjiang. This disease is a tick - borne endemic biood protozoai disease with high mortaiity rate. This research aimed to investigate the prevaience rate of piropiasmosis and vector tick in some cattie farms better prevent and controi piropiasmosis and reduce the ioss that was caused by this disease to the raisers. [ method ] The author coiiected materiais with iocai veterinarians and owners, took them back to the schooi iaboratory, identified and anaiyzed the vector ticks and pathogen by microscope and the data about piropiasmosis. [ Result ] Bovine tropicai theiieriosis and bovine babesiosis were judged by comprehensive judgment, and the main vector ticks were Hyalomma detritum Hyalomma asiaticum and Boophilus microplus. The infection rate of biood protozoa was 84% : bovine theiieria annuiata 71. 4% ; Babesia bigemina 40. 5% ; babesia bovis 29%. [ Conclusion ] Through this survey we detaiied the occurrence and epidemic status of piropiasmosis in some cattie farms and the predominant distributive species of the iocai vector ticks, and found that there were severai piropiasmosis cross - infection. The resuit provides some scientific basis for the prevention of piropiasmosis.

  17. Long term study of ixodid ticks feeding on red deer (Cervus elaphus) in a meso-Mediterranean climate.

    Science.gov (United States)

    Valcárcel, F; González, J; Tercero Jaime, J M; Olmeda, A S

    2016-05-01

    Red deer (Cervus elaphus L.) are very valuable in trophy-hunting but also contribute to the preservation of natural areas. They are affected by many parasites and pathogens, including hard ticks that are not only important parasites themselves but can also act as vectors and/or reservoirs of pathogens. Tick phenology is complex insofar as population dynamics depend on environmental conditions, vegetation, host availability and their own intrinsic characteristic. Ticks were collected monthly from January 2007 to December 2014 from red deer on a natural reserve located in a meso-Mediterranean environment in Central Spain. A total of 8978 specimens of ixodid ticks were recovered with a mean Parasitization Index of 65.06 ticks/deer. Red deer were infected the whole year round with a summer-spring pattern and two secondary peaks in February and October. The main species was Hyalomma lusitanicum Koch followed by Rhipicephalus bursa Canestrini and Fanzago, Rhipicephalus pusillus Gil Collado, Dermacentor marginatus Sulzer and Ixodes ricinus L. Hyalomma lusitanicum has a complex life cycle in which several generations initiate their cycle at different times throughout the year, most probably lasting more than 1 year. We also describe the ability of nymphs to feed on large ungulates even though their habitual host is wild rabbit.

  18. Permanent Genetic Resources added to Molecular Ecology Resources Database 1 April 2010 - 31 May 2010.

    Science.gov (United States)

    Andree, K; Axtner, Jan; Bagley, M J; Barlow, E J; Beebee, T J C; Bennetzen, Jeffrey L; Bermingham, Eldredge; Boisselier-Dubayle, M C; Bozarth, Christine A; Brooks, Christopher P; Brown, R P; Catanese, Gaetano; Cavers, S; Ceron-Souza, Ivania; Chak, Solomon T C; Chan, M N; Charles-Dominique, P; Chen, C Y; Chen, J D; Chinchilla, Leah; DA Silva, D; Dafreville, S; Daunt, F; Delatte, H; Dorge, T; Duncan, N; Durand, J D; Duvernell, D; Estep, Matt; Fan, Sigang; Fattahi, R; Villela, Oscar Flores; Fong, Yokking; Fréville, H; Funes, Victoria; Gallardo-Escarate, C; Ganeshaiah, K N; Ghaffari, M R; Girod, C; Gomez-Moliner, B J; Gonzalez-Porter, Gracia P; Gosa, A; Govers, F; Guérin, F; Guindo, Diarah; Hailer, Frank; Haye, P A; Hoelmer, Kim A; Hofmann, S; Hong, Yan; Hu, Chaoqun; Huang, S W; Humeau, L; Infante, Carlos; Jackson, S A; Jacobsen, E; Jowkar, A; Kafi, M; Kermani, M J; Kim, Hyojoong; Kim, Kyung Seok; Kim, Min-Young; Knibb, W; Koita, Ousmane A; Korpelainen, H; Lambourdiere, J; Lasso, Eloisa; Leblois, R; Lee, Hang; Lee, Seunghwan; Leung, F C C; Leung, Kenneth M Y; Li, Chunhong; Li, Y; Lieckfeldt, Dietmar; Lizana, M; Loughry, W J; Luo, Peng; Madeira, M J; Mahmoodi, P; Maldonado, Jesús E; Mardi, M; Mendes, O; Miehe, G; Muth, Peter; Nacci, D; Naveen Kumar, L; Ng, Wai-Chuen; Pailler, T; Parzies, Heiko K; Perez, Laura; Pfunder, M; Pietiläinen, M; Pirseyedi, S M; Porta, D; Porta, J; Porta, J M; Quilici, S; Rakotoarivelo, F P; Ramesha, B T; Ravikanth, G; Riéra, B; Risterucci, A M; Roberts, D A; Samadi, S; Sarasola-Puente, V; Sarrazin, E; Sarthou, C; Schmidt, Anke; Segovia, N I; Shen, K N; Simiand, C; Sman, Muhammad Hidayat Bin; Solhoy, T; Sommer, Simone; Sumangala, R C; Taubert, Ramona; Tejangkura, T; Telford, A; Testa, A; Tollon-Cordet, C; Tzeng, W N; Uma Shaanker, R; Van Der Lee, T A J; VAN Mourik, Thomas A; Vasudeva, R; Wai, T C; Wang, R L; Welch, Mark E; Weltzien, Eva; Whitehead, A; Woodard, Anastasia; Xia, Jianjun; Zeinolabedini, M; Zhang, Lvping

    2010-11-01

    This article documents the addition of 396 microsatellite marker loci to the Molecular Ecology Resources Database. Loci were developed for the following species: Anthocidaris crassispina, Aphis glycines, Argyrosomus regius, Astrocaryum sciophilum, Dasypus novemcinctus, Delomys sublineatus, Dermatemys mawii, Fundulus heteroclitus, Homalaspis plana, Jumellea rossii, Khaya senegalensis, Mugil cephalus, Neoceratitis cyanescens, Phalacrocorax aristotelis, Phytophthora infestans, Piper cordulatum, Pterocarpus indicus, Rana dalmatina, Rosa pulverulenta, Saxifraga oppositifolia, Scomber colias, Semecarpus kathalekanensis, Stichopus monotuberculatus, Striga hermonthica, Tarentola boettgeri and Thermophis baileyi. These loci were cross-tested on the following species: Aphis gossypii, Sooretamys angouya, Euryoryzomys russatus, Fundulus notatus, Fundulus olivaceus, Fundulus catenatus, Fundulus majalis, Jumellea fragrans, Jumellea triquetra Jumellea recta, Jumellea stenophylla, Liza richardsonii, Piper marginatum, Piper aequale, Piper darienensis, Piper dilatatum, Rana temporaria, Rana iberica, Rana pyrenaica, Semecarpus anacardium, Semecarpus auriculata, Semecarpus travancorica, Spondias acuminata, Holigarna grahamii, Holigarna beddomii, Mangifera indica, Anacardium occidentale, Tarentola delalandii, Tarentola caboverdianus and Thermophis zhaoermii. © 2010 Blackwell Publishing Ltd.

  19. ORAL MANIFESTATIONS AMONG ROMANIAN HIV PATIENTS

    Directory of Open Access Journals (Sweden)

    Manuela ARBUNE

    2013-03-01

    Full Text Available The objective of the study is to evaluate the oral health problems on HIV youth patients from Galati. Materials and method. A cross-sectional study assessed 102 patients with mean age 22. The most frequent oral manifestations on HIV infected youth under ART are erythema marginatum, periodontitis, candidosis and hypertrophia gingivalis. Results and discussion. Dental decay-missing-filled index on HIV patients is high. Viral HIV replication, long time pediatric exposure on HIV, male sex, smoking, and oral inflamation are related to dental poor condition. Exodontic therapy is comon among HIV youth. However, persistence of some associated oral infections is related to individual or behavioral risk factors, but also to some newly found mechanisms, such as disfunctional immune reconstruction. Seeing to antiretroviral treatment, the severity and frequency of oral manifestations decreased among HIV patients on antiretroviral treatment. Conclusions. Developing medical, social and educational programs is imperative for improving the oral health of HIV youth of Galati.

  20. Toxicidade por fumigação, contato e ingestão de óleos essenciais para Sitophilus zeamais Motschulsky, 1885 (Coleoptera: Curculionidae Toxicity by fumigation, contact and ingestion of essential oils in Sitophilus zeamais Motschulsky, 1885 (Coleoptera: Curculionidae

    Directory of Open Access Journals (Sweden)

    Rodrigo Leandro Braga de Castro Coitinho

    2011-02-01

    Full Text Available A espécie Sitophilus zeamais é uma das principais pragas do milho armazenado no Brasil. O controle é feito, comumente, utilizando-se medidas de higienização e limpeza, bem como inseticidas sintéticos fumigantes e protetores. A busca por produtos menos tóxicos, biodegradáveis e seguros do ponto de vista ecológico, é muito bem aceita pela sociedade. Assim, os objetivos do presente trabalho foram testar a toxicidade de contato e ingestão e fumigante de óleos essenciais e do composto orgânico natural eugenol para adultos de S. zeamais. Os valores de CL50 dos óleos essenciais provenientes de folhas de Piper hispidinervum, Eugenia uniflora, Cinnamomum zeylanicum, P. marginatum, Schinus terebinthifolius, Melaleuca leucadendron, dos frutos verdes de S terebinthifolius e do composto eugenol, nos testes de contato e ingestão, foram estimados em 1,0; 11,6; 14,2; 21,1; 57,7; 75,8; 98,8 e 14,8 µL/40 g de milho, respectivamente. As razões de toxicidade (RT variaram entre 1,3 e 98,8. Na fumigação em adultos, as concentrações letais dos óleos variaram de 0,53 a 94,7 µL/L de ar, obedecendo à seguinte ordem decrescente de toxicidade: P. hispidinervum > P. aduncum > S. terebinthifolius > frutos verdes de S. terebinthifolius > P. marginatum > eugenol e as RT variaram entre 2,0 a 178,7.The Sitophilus zeamais species is a major pest of stored maize in Brazil. The control is made, usually, using measures of hygiene and cleanliness, synthetic insecticides and fumigant protectors. The search for less toxic products, biodegradable and safe from an ecological point of view is very well accepted by society. the objective of this study was to test the toxicity by contact and ingestion and fumigant of essential oils and eugenol natural organic compound for adults of S. zeamais. The values of LC50 in oil from leaves of Piper hispidinervum, Eugenia uniflora, Cinnamomum zeylanicum, P. marginatum, Schinus terebinthifolius, Melaleuca leucadendron, green

  1. Acute rheumatic fever and streptococci: the quintessential pathogenic trigger of autoimmunity.

    Science.gov (United States)

    Chakravarty, Soumya D; Zabriskie, John B; Gibofsky, Allan

    2014-07-01

    Acute rheumatic fever (ARF) is a non-suppurative complication of pharyngeal infection with group A streptococcus. Signs and symptoms of ARF develop 2 to 3 weeks following pharyngitis and include arthritis, carditis, chorea, subcutaneous nodules, and erythema marginatum. In developing areas of the world, ARF and rheumatic heart disease are estimated to affect nearly 20 million people and remain leading causes of cardiovascular death during the first five decades of life. ARF still represents one of the quintessential examples of a pathogenic trigger culminating in autoimmune manifestations. In this review, we will focus on the pathogenesis and etiology of ARF and its complications, along with diagnostic and treatment approaches to both ameliorate and prevent long-term sequelae of this potentially debilitating disease.

  2. Actividad repelente de aceites esenciales contra las picaduras de Lutzomyia migonei (Diptera: Psychodidae

    Directory of Open Access Journals (Sweden)

    Elsa Nieves

    2010-12-01

    Full Text Available Los repelentes naturales de extractos de plantas han mostrado eficacia contra diferentes especies de insectos. El presente estudio evaluó la acción repelente de aceites esenciales extraídos de ocho especies de plantas contra las picaduras de Lutzomyia migonei, vector de Leishmania. Los aceites esenciales se obtuvieron por hidrodestilación, utilizando una trampa de Clevenger, a partir de Hyptis suaveolens, Pimenta racemosa, Piper marginatum, Monticalia imbricatifolia, Pseudognaphalium caeruleocanum, Espeletia shultzii, Plectranthus amboinicus y Cinnamomun zeylanicum. Los ensayos de repelencia se realizaron sobre humanos en condiciones de laboratorio, frente a hembras de L. migonei provenientes de colonia, utilizando el método de la mano en la jaula. Los aceites con efecto repelente también se ensayaron con distintos voluntarios y concentraciones. Se determinó el porcentaje de protección y el tiempo de protección. Los resultados revelaron que el aceite de P. caeruleocanum y C. zeylanicum fueron los más efectivos. El aceite de P. amboinicus presentó efecto de repelencia satisfactorio, sin embargo, ocasionó picazón y toxicidad en la piel. Los aceites de P. marginatum, H. suaveolens y P. racemosa no evidenciaron efecto repelente; el resto de los aceites presentaron repelencia significativa en grado variable. Los aceites de P. caeruleocanum y C. zeylanicum mostraron un 95% de protección de 3h contra las picaduras de L. migonei. El aceite de P. caeruleocanum presentó el mayor tiempo de protección, de más de 4h y de 2h en concentraciones de 50% y 10%, respectivamente. Los resultados sugieren que el aceite P. caeruleocanum podría ser un potencial candidato como repelente natural contra la picadura de dípteros posibles transmisores de Leishmania.Repellent activity of plant essential oils against bites of Lutzomyia migonei (Diptera: Psychodidae. Natural repellents from plant extracts have demonstrated good efficacy against bites of some

  3. Evaluación de medios de cultivo para propagación in vitro de semillas y explantes de especies silvestres de Solanum

    Directory of Open Access Journals (Sweden)

    Danita Andrade Díaz

    2013-01-01

    Full Text Available Se evaluaron los medios de cultivo Hussey-Stacey (A, Hendrix et al. (H, Atkinson et al. (AT y mitad de Murashyge y Skoog (½MS para la propagación in vitro de semillas y explantes de Solanum mammosum, S. marginatum, S. hirtum y S. umbellatum. En la fase de propagación sexual se evaluó el porcentaje de germinación, número de raíces, longitud de planta, días a formación de hojas y raíces, días a morfogénesis completa y materia seca. Se determinó el tipo de morfogénesis a través de callos, vástago y plantas totalmente formadas. Se estudiaron el número y longitud de brotes, número de raíces y hojas, producción de materia seca y días a morfogénesis completa. Para S. mammosum el mejor medio de germinación fue ½MS, para el desarrollo de plantas fue A y para propagación vegetativa, A-Nudos (Medio A con explantes tipo nudos. En el mismo orden, para S. marginatum fueron los medios A, H y ½MS y/o H con nudos, mientras que en S. hirtum fueron H,A y H-nudos. Para S. umbellatum no se encontraron diferencias en germinación entre H, ½MS y A. Para la formación de plantas el mejor medio fue ½ MS y para propagación vegetativa fue H-Nudo.

  4. Actividad repelente de aceites esenciales contra las picaduras de Lutzomyia migonei (Diptera: Psychodidae

    Directory of Open Access Journals (Sweden)

    Elsa Nieves

    2010-12-01

    Full Text Available Los repelentes naturales de extractos de plantas han mostrado eficacia contra diferentes especies de insectos. El presente estudio evaluó la acción repelente de aceites esenciales extraídos de ocho especies de plantas contra las picaduras de Lutzomyia migonei, vector de Leishmania. Los aceites esenciales se obtuvieron por hidrodestilación, utilizando una trampa de Clevenger, a partir de Hyptis suaveolens, Pimenta racemosa, Piper marginatum, Monticalia imbricatifolia, Pseudognaphalium caeruleocanum, Espeletia shultzii, Plectranthus amboinicus y Cinnamomun zeylanicum. Los ensayos de repelencia se realizaron sobre humanos en condiciones de laboratorio, frente a hembras de L. migonei provenientes de colonia, utilizando el método de la mano en la jaula. Los aceites con efecto repelente también se ensayaron con distintos voluntarios y concentraciones. Se determinó el porcentaje de protección y el tiempo de protección. Los resultados revelaron que el aceite de P. caeruleocanum y C. zeylanicum fueron los más efectivos. El aceite de P. amboinicus presentó efecto de repelencia satisfactorio, sin embargo, ocasionó picazón y toxicidad en la piel. Los aceites de P. marginatum, H. suaveolens y P. racemosa no evidenciaron efecto repelente; el resto de los aceites presentaron repelencia significativa en grado variable. Los aceites de P. caeruleocanum y C. zeylanicum mostraron un 95% de protección de 3h contra las picaduras de L. migonei. El aceite de P. caeruleocanum presentó el mayor tiempo de protección, de más de 4h y de 2h en concentraciones de 50% y 10%, respectivamente. Los resultados sugieren que el aceite P. caeruleocanum podría ser un potencial candidato como repelente natural contra la picadura de dípteros posibles transmisores de Leishmania.

  5. Some additions and corrections to the Coleoptera fauna of the Canary Islands

    Directory of Open Access Journals (Sweden)

    Machado, Antonio

    2014-06-01

    Full Text Available Two endomychid species described from El Hierro (Canary Islands are removed from the Canarian fauna: Dapsa hierrensis Franz, 1976 is a synonym of Archipines intricata (Gorham, 1889, nov. syn., and the single specimen (holotype was probably collected in Central America. Dapsa curta Franz, 1976 is also poorly described and based on a single female. Without a male it is not possible to assess with full confidence if it belongs to the African genus Danae or more probably to the Oriental genus Tragoscelis, and to which species. It is for sure not a Dapsa and its Canarian origin relates probably to another labeling error of the author, who also collected in Borneo, where this latter genus is present with 5 species. Consequently, Dapsa curta Franz, 1996 is proposed as nomen dubium. Furthermore, three genera are recorded for the Canaries for the first time: Silpha puncticollis Lucas, 1854 (Silphidae, the coffee bean borer Araecerus fasciculatus (DeGeer, 1775, and Bruchela rufipes (Olivier, 1790 both Anthribidae. Only the latter species can be considered as native; the other two are introduced recently and the Coffee bean weevil could become a pest.Dos especies de endomíquidos descritos de El Hierro (islas Canarias se eliminan de la fauna canaria: Dapsa hierrensis Franz, 1976 es una sinonimia posterior de Archipines intricata (Gorham, 1889, nov. syn., y el único ejemplar conocido (holotipo fue colectado probablemente en América Central. La descripción de Dapsa curta Franz, 1976 es muy pobre y se basa en una única hembra. Sin conocer el macho es imposible determinar con garantías si se trata del género Danae o, lo más probable, del género oriental Tragoscelis, o a cuál de sus especies pertenece, si no es nueva. Es seguro que no se trata de una Dapsa y el presunto origen canario radica seguramente en otro error de etiquetado del autor, que también colectó en Borneo, donde se conocen cinco especies de Tragoscelis. En consecuencia, se propone

  6. Mosquito species succession and physicochemical factors affecting their abundance in rice fields in Mwea, Kenya.

    Science.gov (United States)

    Muturi, Ephantus J; Mwangangi, Joseph; Shililu, Josephat; Muriu, Simon; Jacob, Benjamin; Kabiru, Ephantus; Gu, Weidong; Mbogo, Charles; Githure, John; Novak, Robert

    2007-03-01

    The succession of mosquito species and abiotic factors affecting their distribution and abundance in rice (Oryza spp.) fields was investigated over a 16-wk rice growing cycle covering the period between January and May 2006. Fifteen experimental rice plots were sampled for mosquito larvae and characterized based on rice height, number of tillers, floating vegetation cover, water depth, water temperature, turbidity, salinity, pH, dissolved oxygen, total dissolved solids, and conductivity. Microscopic identification of 3,025 larvae yielded nine mosquito species predominated by Anopheles arabiensis Patton (45.0%), Culex quinquefasciatus Say (35.8%), Anopheles pharoensis Theobald (9.0%) and Ficalbia splendens Theobald (7.1%). Other species, including Anopheles rufipes Gough, Anopheles coustani Laveran, Anonopheles maculipalpis Giles, Culex annulioris Theobald, and Culex poicilipes Theobald made up 3.1% of the total collection. Anopheles gambiae s.l., Cx. quinquefasciatus, and An. pharoensis occurred throughout the cycle, but they were more abundant up to 4 wk posttransplanting with peaks after fertilizer application. As rice plants became established, three groups of mosquitoes were recognized: the first groups included An. rufipes, Fl. splendens, and Cx. annulioris, which occurred throughout much of the second half of the rice cycle, whereas the second group included Cx. poicilipes, which was found in the middle of the rice cycle. An. coustani and An. maculipalpis formed the third group occurring toward the end of the cycle. Dissolved oxygen, number of tillers, and rice height were negatively associated with the abundance ofAn. arabiensis and Cx. quinquefasciatus larvae. In addition, Cx. quinquefasciatus also was associated with water depth (-ve) and turbidity (+ve). Abundance of An. pharoensis larvae was significantly associated with water temperature (+ve), the number of tillers (-ve), and rice height (-ve), whereas Fl. splendens was significantly associated with

  7. Abelhas-sem-ferrão amazônicas defendem meliponários contra saques de outras abelhas Amazonian stingless bees protect meliponaries against robber bees

    Directory of Open Access Journals (Sweden)

    André Rodrigo Rech

    2013-09-01

    Full Text Available Entre as abelhas eussociais, dois gêneros apresentam estratégia de vida cleptobiótica, obtendo recursos alimentares de ninhos de outras abelhas ao invés de coletá-los em flores. Entre as espécies atacadas existe um gradiente de suscetibilidade ao roubo variando desde espécies vulneráveis até altamente resistentes. Neste trabalho nós descrevemos um ataque de Lestrimelitta rufipes a um ninho de Scaptotrigona sp. em um meliponário na Amazônia central (Amazonas, Brazil. O ninho atacado foi transferido para um meliponário com espécies resistentes (Duckeola ghilianii e Melipona fulva e as interações foram descritas. As abelhas resistentes contra-atacaram e afugentaram as ladras protegendo o ninho de Scaptotrigona sp.. A presença de comportamento defensivo em gêneros não proximamente relacionados sugere que ele tenha evoluído mais de uma vez entre os Meliponini. Considerando o comportamento descrito, sugerimos a criação de espécies nativas resistentes em meliponários de regiões onde elas forem nativas, devido ao potencial que elas tem na proteção.Among eusocial bees, two genera evolved a cleptobiotic life strategy, stealing food resources from other bee nest instead of collecting it from flowers. Under natural conditions there is a gradient of strategies against robbing, from more susceptible to highly resistant species. In this work, we describe one attack of the robber bee Lestrimelitta rufipes to a nest of Scaptotrigona sp. in the Amazon Rain Forest (Amazonas, Brazil. The attacked nest was introduced in a beekeeping area with bees already known to be resistant to cleptobiosis. The resident bees (Duckeola ghilianii and Melipona fulva counter-attacked the robber bees and successfully protect the Scaptotrigona sp. nest. The presence of the defensive behaviour in unrelated genera suggests it evolved many times in social bees. Based on the protective behaviour described here, we suggest that in order to reduce the damage caused

  8. Hemolivia mauritanica (Haemogregarinidae: Apicomplexa infection in the tortoise Testudo graeca in the Near East with data on sporogonous development in the tick vector Hyalomna aegyptium

    Directory of Open Access Journals (Sweden)

    Paperna I.

    2006-12-01

    Full Text Available Testudo graeca tortoises were collected in the northern and southern Golan Heights (Israeli occupied territory of south Syria, and various locations in Israel and Palestine. Hyalomma aegyptium ticks were found only on Golan Height tortoises, and only the tortoises and ticks from the northern Golan Heights were infected with Hemolivia mauritanica. Tortoises became infected after ingesting infected ticks. Male ticks carrying sporocysts, which remain attached to tortoises for extended durations, apparently served as the source for dissemination of new infections among tortoises. Sporogenesis followed the pattern observed in the two other known species of Hemolivia, though there was some evident variation in fine-structural detail. The sutural slit detected in the H. mauritanica mature sporocyst wall was reminiscent of the suture characteristic of Coccidia of heterothermic vertebrate hosts; it could be a common ancestral character for both hemogregarines and Coccidia.

  9. Tick cell lines for study of Crimean-Congo hemorrhagic fever virus and other arboviruses.

    Science.gov (United States)

    Bell-Sakyi, Lesley; Kohl, Alain; Bente, Dennis A; Fazakerley, John K

    2012-09-01

    Continuous cell lines derived from many of the vectors of tick-borne arboviruses of medical and veterinary importance are now available. Their role as tools in arbovirus research to date is reviewed and their potential application in studies of tick cell responses to virus infection is explored, by comparison with recent progress in understanding mosquito immunity to arbovirus infection. A preliminary study of propagation of the human pathogen Crimean-Congo hemorrhagic fever virus (CCHFV) in tick cell lines is reported; CCHFV replicated in seven cell lines derived from the ticks Hyalomma anatolicum (a known vector), Amblyomma variegatum, Rhipicephalus (Boophilus) decoloratus, Rhipicephalus (Boophilus) microplus, and Ixodes ricinus, but not in three cell lines derived from Rhipicephalus appendiculatus and Ornithodoros moubata. This indicates that tick cell lines can be used to study growth of CCHFV in arthropod cells and that there may be species-specific restriction in permissive CCHFV infection at the cellular level.

  10. 残缘璃眼蜱人工培育及对环形泰勒虫的实验性传播

    Institute of Scientific and Technical Information of China (English)

    罗建勋; 殷宏; 关贵全; 马米玲; 张其才; 吕文顺; 吕文祥

    2002-01-01

    将采自内蒙古自治区的残缘璃眼蜱(Hyalomma detritum)饲喂于牛体,观察了成虫、幼虫、若虫在实验室饲喂条件下的生活周期及滞育现象;通过蜱传播试验证实,残缘璃眼蜱饥饿幼虫、若虫吸入病原,其蜕化之若虫、成虫能将环形泰勒虫(Theileria annulata)传播给敏感动物,而幼虫阶段吸入病原,如若虫阶段在兔体饱血,所蜕化产生的饥饿成虫不传播该病.

  11. Ixodoidea of the Western Palaearctic: A review of available literature for identification of species.

    Science.gov (United States)

    Estrada-Peña, Agustín; Pfäffle, Miriam; Baneth, Gad; Kleinerman, Gabriela; Petney, Trevor N

    2017-06-01

    We aim to produce a review of the most important literature references necessary for the identification of ticks of the families Ixodidae and Argasidae in Europe and northern Africa (i.e. the Western Palaearctic region). The purpose of this paper is to pinpoint a set of critically selected papers that contain reliable information on morphology, taxonomic keys, and comparative discussions which are critical for the identification of the ticks reported in the target region. When necessary, comments are provided on the systematic position of a species, or on suitable papers already addressing the issue. This review includes a list of 216 references which cover all Ixodoidea species reported as permanent residents of the Western Palaearctic, namely 28 species of the genus Ixodes, two Dermacentor, seven Haemaphysalis, nine Hyalomma, eight Rhipicephalus, five Argas and about seven species of Ornithodoros. Copyright © 2017 Elsevier GmbH. All rights reserved.

  12. Molecular epidemiology of Crimean- Congo hemorrhagic fever virus genome isolated from ticks of Hamadan province of Iran

    DEFF Research Database (Denmark)

    Tahmasebi, F; Ghiasi, Seyed Mojtaba; Mostafavi, E

    2010-01-01

    .2% of the ticks collected from livestock of different regions of the Hamadan province in western Iran. The infected species belonged to Hyalomma detritum, H. anatolicum, Rhipicephalus sanguineus and Argas reflexus. With one exception, genetic analysis of the virus genome isolates showed high sequence identity......BACKGROUND & OBJECTIVES: Crimean-Congo hemorrhagic fever (CCHF) virus is a tick-borne member of the genus Nairovirus, family Bunyaviridae. CCHFV has been isolated from at least 31 different tick species. The virus is transmitted through the bite of an infected tick, or by direct contact with CCHFV......-infected patients or the products of infected livestock. This study was undertaken to study the genetic relationship and distribution of CCHFV in the tick population of Hamadan province of Iran. METHOD: In this study, RT-PCR has been used for detection of the CCHFV genome. RESULTS: This genome was detected in 19...

  13. Rickettsia africae and Candidatus Rickettsia barbariae in ticks in Israel.

    Science.gov (United States)

    Waner, Trevor; Keysary, Avi; Eremeeva, Marina E; Din, Adi Beth; Mumcuoglu, Kosta Y; King, Roni; Atiya-Nasagi, Yafit

    2014-05-01

    DNA of several spotted fever group rickettsiae was found in ticks in Israel. The findings include evidence for the existence of Rickettsia africae and Candidatus Rickettsia barbariae in ticks in Israel. The DNA of R. africae was detected in a Hyalomma detritum tick from a wild boar and DNA of C. Rickettsia barbariae was detected in Rhipicephalus turanicus and Rhipicephalus sanguineus collected from vegetation. The DNA of Rickettsia massiliae was found in Rh. sanguineus and Haemaphysalis erinacei, whereas DNA of Rickettsia sibirica mongolitimonae was detected in a Rhipicephalus (Boophilus) annulatus. Clinicians should be aware that diseases caused by a variety of rickettsiae previously thought to be present only in other countries outside of the Middle East may infect residents of Israel who have not necessarily traveled overseas. Furthermore, this study reveals again that the epidemiology of the spotted fever group rickettsiae may not only involve Rickettsia conorii but may include other rickettsiae.

  14. Growth of Ehrlichia canis, the causative agent of canine monocytic ehrlichiosis, in vector and non-vector ixodid tick cell lines.

    Science.gov (United States)

    Ferrolho, Joana; Simpson, Jennifer; Hawes, Philippa; Zweygarth, Erich; Bell-Sakyi, Lesley

    2016-06-01

    Canine monocytic ehrlichiosis is caused by Ehrlichia canis, a small gram-negative coccoid bacterium that infects circulating monocytes. The disease is transmitted by the brown dog tick Rhipicephalus sanguineus s.l. and is acknowledged as an important infectious disease of dogs and other members of the family Canidae worldwide. E. canis is routinely cultured in vitro in the canine monocyte-macrophage cell line DH82 and in non-vector Ixodes scapularis tick cell lines, but not in cells derived from its natural vector. Here we report infection and limited propagation of E. canis in the tick cell line RSE8 derived from the vector R. sanguineus s.l., and successful propagation through six passages in a cell line derived from the experimental vector Dermacentor variabilis. In addition, using bacteria semi-purified from I. scapularis cells we attempted to infect a panel of cell lines derived from non-vector species of the tick genera Amblyomma, Dermacentor, Hyalomma, Ixodes and Rhipicephalus with E. canis and, for comparison, the closely-related Ehrlichia ruminantium, causative agent of heartwater in ruminants. Amblyomma and non-vector Dermacentor spp. cell lines appeared refractory to infection with E. canis but supported growth of E. ruminantium, while some, but not all, cell lines derived from Hyalomma, Ixodes and Rhipicephalus spp. ticks supported growth of both pathogens. We also illustrated and compared the ultrastructural morphology of E. canis in DH82, RSE8 and I. scapularis IDE8 cells. This study confirms that E. canis, like E. ruminantium, is able to grow not only in cell lines derived from natural and experimental tick vectors but also in a wide range of other cell lines derived from tick species not known to transmit this pathogen.

  15. Isolation of tick and mosquito-borne arboviruses from ticks sampled from livestock and wild animal hosts in Ijara District, Kenya.

    Science.gov (United States)

    Lwande, Olivia Wesula; Lutomiah, Joel; Obanda, Vincent; Gakuya, Francis; Mutisya, James; Mulwa, Francis; Michuki, George; Chepkorir, Edith; Fischer, Anne; Venter, Marietjie; Sang, Rosemary

    2013-09-01

    Tick-borne viruses infect humans through the bite of infected ticks during opportunistic feeding or through crushing of ticks by hand and, in some instances, through contact with infected viremic animals. The Ijara District, an arid to semiarid region in northern Kenya, is home to a pastoralist community for whom livestock keeping is a way of life. Part of the Ijara District lies within the boundaries of a Kenya Wildlife Service-protected conservation area. Arbovirus activity among mosquitoes, animals, and humans is reported in the region, mainly because prevailing conditions necessitate that people continuously move their animals in search of pasture, bringing them in contact with ongoing arbovirus transmission cycles. To identify the tick-borne viruses circulating among these communities, we analyzed ticks sampled from diverse animal hosts. A total of 10,488 ticks were sampled from both wildlife and livestock hosts and processed in 1520 pools of up to eight ticks per pool. The sampled ticks were classified to species, processed for virus screening by cell culture using Vero cells and RT-PCR (in the case of Hyalomma species), followed by amplicon sequencing. The tick species sampled included Rhipicephalus pulchellus (76.12%), Hyalomma truncatum (8.68%), Amblyomma gemma (5.00%), Amblyomma lepidum (4.34%), and others (5.86%). We isolated and identified Bunyamwera (44), Dugbe (5), Ndumu (2), Semliki forest (25), Thogoto (3), and West Nile (3) virus strains. This observation constitutes a previously unreported detection of mosquito-borne Semliki forest and Bunyamwera viruses in ticks, and association of West Nile virus with A. gemma and Rh. pulchellus ticks. These findings provide additional evidence on the potential role of ticks and associated animals in the circulation of diverse arboviruses in northeastern Kenya, including viruses previously known to be essentially mosquito borne.

  16. CRIME CONGO HEMORHAGIC FEVER EPIDEMY: A PRELIMINARY REPORT OF ISFAHAN PROVINCE IN IRAN

    Directory of Open Access Journals (Sweden)

    K MOSTAFAVIZADE

    2002-03-01

    Full Text Available Crimean-Congo hemorrhagic fever (CCHF is a viral disease of Buynaviridae family. Disease is primarily zoonosis but sporadic and epidemic human infection can occur. During year 2001 many outbreaks have been reported from Kosovo, Iran, Albania and Pakistan. A Hyalomma tick can transmit the disease and virus reservoirs are rodents, ostrich, ground frequenting birds and hyalomma tick. Another way of human infection is contact with infected animal blood and products or crushing a tick with bare hands. Contact with infected human blood can also transmit the disease. During outbreak, 18 cases were confirmed by serologic methods. 12 men and 6 women aged 20-40 years old. Ten of men and 5 of women had history of contact with infected animal blood or tissue and a lady had been bitten by a tick. A young assistant of internal medicine who came in contact with the first patient, developed the disease. We were not able to determine route of transmission in one case. The most frequent clinical signs included fever, myalgia, weakness, fatique, bleeding tendency, petechia, purpura and jundice. Lab exam revealed thrombocytopenia, elevated liver enzymes and prolongation of prothrombin time. Althoug the most common route of human infection is tick bite, but in this outbreak the main route was contact with infected animal blood and tissue. This point confirms that unsanitary slaughtering of animal could be dangerous. It seems that reeducating physicians, veterinarians and those who take care of such patients maybe helpful to neighboring countries triggered the outbreak, so that educating people who are involved in husbandry may limiting human infection.

  17. Tick burden and prevalence of Theileria parva infection in Tarime zebu cattle in the lake zone of Tanzania.

    Science.gov (United States)

    Laisser, Emmanuel Levillal Katamboi; Kipanyula, Maulilio John; Msalya, George; Mdegela, Robinson Hammerthon; Karimuribo, Esron Daniel; Mwilawa, Anjello Joseph; Mwega, Elisa Daniel; Kusiluka, Lughano; Chenyambuga, Sebastian Wilson

    2014-12-01

    This study was carried out to assess the distribution, abundance of different tick genera and prevalence of Theileria parva infection in Tarime zebu cattle kept in selected wards of Serengeti and Tarime districts in Mara region. Adult ticks were identified and counted from half body parts of 360 animals which were extensively managed in communal land with natural pastures. Concurrently, blood samples were collected and thereafter DNA extracted and a nested polymerase chain reaction (nPCR) was done using primers specific for p104 gene to detect the presence of T. parva DNA. Ticks were identified into four groups: Amblyomma genus, Boophilus sub-genus of Rhipicephalus genus, other species of Rhipicephalus, and Hyalomma genus. Rhipicephalus genus accounted for 71.8 % of the total ticks, whereas Amblyomma, Boophilus sub-genus of Rhipicephalus genus and Hyalomma constituted 14.1, 14.0 and 0.1 %, respectively. There were more animals (p < 0.05) infested with ticks in Tarime district (96.1 %) than in Serengeti (61.7 %). The average counts of ticks were higher in adult animals (p < 0.05) than in young animals. The overall prevalence of T. parva was 27.7 % and was higher (p < 0.05) in Serengeti (38.3 %) than in Tarime district (16.7 %). However, all animals tested positive for T. parva did not show any clinical signs of East Coast fever (ECF), suggesting the existence of subclinical infection in Tarime zebu. These results suggest that Tarime cattle can tolerate ECF infection and are likely to serve as potential carriers of T. parva to other less-tolerant cattle breeds in mixed herds. Since Tarime cattle are preferred by most farmers with mixed herds, routine screening for T. parva is highly recommended to minimize introduction of infected cattle into an immunologically naive population.

  18. Investigation of hemorrhagic fever viruses inside wild populations of ticks: One of the pioneer studies in Saudi Arabia

    Directory of Open Access Journals (Sweden)

    Rania Ali El Hadi Mohamed

    2017-05-01

    Full Text Available Objective: To screen hemorrhagic fever viruses inside wild populations of ticks collected from Riyadh, Saudi Arabia between January and March 2016. Methods: Ticks were identified depending on their morphological features using classical keys then grouped into pools. Ticks in each pool were processed separately using the sterile pestles and mortars. Viral RNA was extracted using Qiagen RNeasy Mini Kit and Qiagen RNAeasy Columns (Qiagen, Hilden, Germany according to the instructions of manufacturers. A total number of 1 282 hard ticks were collected, and 582 of them were precisely identified then screened for the presence of arboviruses using quantitative real-time PCR. The four species were screened for six viruses: Rift Valley fever virus (RVFV, Chikungunya virus (CHIKV, Crimean-Congo hemorrhagic fever virus (CCHFV, Alkhurma virus (INKV, Sindbis virus (SINV, and Pan Hanta virus (HANTA. CT value for the negative control (RNA free water was zero. Negative and positive controls were tested for each test to confirm the specificity of the selected primer pairs. SYBR Green One step RT-PCR Master Mix (KAPA Biosystems, Boston, MA was tested along with primers. Results: Ticks identification resulted into four species: Hyalomma schulzei, Hyalomma onatoli, Boophilus kdhlsi, and Hyalomm dromedarii. All the ticks’ species (except Boophilus kdhlsi were positive for the following viruses: SINV, RVFV, CHIKV, and CCHFV. While HANTA viruses have been detected in a single species (Hyalomm dromedarii. Conclusions: According to our knowledge this research may be one of the pioneer studies in Kingdom of Saudi Arabia. Incrimination of the above mentioned ticks species as well as their vectorial capacity are highly recommended for investigation in the upcoming researches.

  19. CONTRIBUTIONS TO THE KNOWLEDGE OF THE STRUCTURE, DYNAMICS AND ECOLOGICAL PARAMETERS OF COLLECTED SPECIES OF INVERTEBRATES IN PLUM ORCHARDS

    Directory of Open Access Journals (Sweden)

    Mihai Tălmaciu

    2016-07-01

    Full Text Available The paper presents the results of the observations made in a plum fruit growing plantation in the years 2013 and 2014, belonging Teaching Station Vasile Adamachi within USAMV, Iasi County, at the Stanley variety. The material gathering it was made using soil traps type Barber, from May until August, at intervals between 10 and 20 days. The collection of 2013 was made on the following dates: 30.05, 15.06, 28.06, 12.07, 26.07, 10.08 and 24.08. In total 2013 were collected 151 species belonging to 19 species (taxa. The species (taxa with the largest number of species collected were Heteroptera species (bedbugs with 28 species, Dermestes laniarius L. with 27 species, Coccinella septempunctata L. with 27 species, Polydrosus sericeus Schall. with 15 species and Harpalus calceatus Duft. with 11 species. The collection of biological material in 2014 was made on the following dates: 19.05, 10.06, 29.06, 16.07, 06.08. In total in 2014 it was collected 402 species belonging to 29 species (taxa. The species (taxa with the largest number of species collected were Pseudophonus rufipes De Geer with 86 species, Harpalus distinguendus Duft. 68 species, Pseudephonus griseus Payk. 38 species, Orthoptera (locusts species with 33 species and Hymenoptera (ants species with 20 species.

  20. An initial study of insect succession on decomposing rabbit carrions in Harare, Zimbabwe

    Institute of Scientific and Technical Information of China (English)

    Nyasha Mabika; Ron Masendu; Gilbert Mawera

    2014-01-01

    Objective: To investigate insects visiting sun exposed and shaded decomposing rabbit carcasses and to establish the relationship between insects and carcasses which may be of forensic importance in Harare. Methods: Two rabbits weighing 2.3 kg and 2.5 kg were killed by sharp blows on the head. One was exposed to the sun while the other was placed under shade. The carcasses were allowed to decompose and insects were collected twice a day for the first week and thereafter once a day up to the end of the 7 weeks. Maggots were also collected from the decomposing carcasses and reared.Results:Five dipteran families (Calliphoridae, Muscidae, Sarcophagidae, Phoridae and Drosophilidae) were identified from the sun-exposed carcass. Species collected included Luciliacuprina (L. cuprina), Chrysomya albiceps (C. albiceps), Musca domestica, Sarcophaga sp. and Drosophila sp. Four families (Calliphoridae, Muscidae, Phoridae, Anthomyiidae) were identified from the shaded carcass. Representatives of these families included L. cuprina, C. albiceps, Musca domestica, and Hydrotaea sp. Three Coleopteran families (Histeridae, Cleridae and Dermestidae) were identified from both carcasses. The observed species were Saprinus sp., Necrobia rufipes and Dermestes sp. Formicidae (Hymenoptera) was represented by only one species (Pheidole sp.). Flies which emerged from the rearing units were L. cuprina, Lucilia sp., C. albiceps, Sarcophaga sp. and Sepsis sp.). Conclusions: Of the dipteran species collected during the study, L. cuprina and C. albiceps could be important for further forensic studies since they were collected from the carcasses and also observed from the rearing units.

  1. Arthropods associated with pig carrion in two vegetation profiles of Cerrado in the State of Minas Gerais, Brazil

    Directory of Open Access Journals (Sweden)

    Thiago Augusto Rosa

    2011-09-01

    Full Text Available Forensic Entomology research has been concentrated in only a few localities of the "Cerrado" vegetation, the Brazilian Savannah. The present study had, as its objective, an examination of the diversity of arthropod fauna associated with the carcasses of Sus scrofa (Linnaeus in this biome. The study was conducted during the dry and humid periods in two Cerrado vegetation profiles of the State of Minas Gerais. The decaying process was slower and greater quantities of arthropods were collected during the dry period. Insects represented 99% of 161,116 arthropods collected. The majority of these were Diptera (80.2% and Coleoptera (8.8%. The entomofauna belong to 85 families and at least 212 species. Diptera were represented by 31 families and at least 132 species. Sarcophagidae (Diptera and Scarabaeidae (Coleoptera were the richest groups. Oxysarcodexia (Sarcophagidae presented the largest number of attracted species, however none of these species bred in the carcasses. The Coleoptera collected belong to at least 50 species of 21 families. Among these species, Dermestes maculatus and Necrobia rufipes were observed breeding in the carcasses. This study showed species with potential importance for estimating the postmortem interval (PMI, indicative of seasonal and environmental type located.

  2. A checklist of arthropods associated with pig carrion and human corpses in Southeastern Brazil

    Directory of Open Access Journals (Sweden)

    LML Carvalho

    2000-01-01

    Full Text Available Necrophagous insects, mainly Diptera and Coleoptera, are attracted to specific stages of carcass decomposition, in a process of faunistic succession. They are very important in estimating the postmortem interval, the time interval between the death and the discovery of the body. In studies done with pig carcasses exposed to natural conditions in an urban forest (Santa Genebra Reservation, located in Campinas, State of São Paulo, southeastern Brazil, 4 out of 36 families of insects collected - Calliphoridae, Sarcophagidae, Muscidae (Diptera and Dermestidae (Coleoptera - were considered of forensic importance, because several species were collected in large numbers both visiting and breeding in pig carcasses. Several species were also observed and collected on human corpses at the Institute of Legal Medicine. The species belonged to 17 different families, 6 being of forensic importance because they were reared from human corpses or pig carcasses: Calliphoridae, Sarcophagidae, Muscidae, Piophilidae (Diptera, Dermestidae, Silphidae and Cleridae (Coleoptera. The most important species were: Diptera - Chrysomya albiceps, Chrysomya putoria, Hemilucilia segmentaria, Hemilucilia semidiaphana (Calliphoridae, Pattonella intermutans (Sarcophagidae, Ophyra chalcogaster (Muscidae, Piophila casei (Piophilidae; Coleoptera - Dermestes maculatus (Dermestidae, Oxyletrum disciolle (Silphidae and Necrobia rufipes (Cleridae.

  3. Foraging ants trade off further for faster: use of natural bridges and trunk trail permanency in carpenter ants

    Science.gov (United States)

    Loreto, Raquel G.; Hart, Adam G.; Pereira, Thairine M.; Freitas, Mayara L. R.; Hughes, David P.; Elliot, Simon L.

    2013-10-01

    Trail-making ants lay pheromones on the substrate to define paths between foraging areas and the nest. Combined with the chemistry of these pheromone trails and the physics of evaporation, trail-laying and trail-following behaviours provide ant colonies with the quickest routes to food. In relatively uniform environments, such as that provided in many laboratory studies of trail-making ants, the quickest route is also often the shortest route. Here, we show that carpenter ants ( Camponotus rufipes), in natural conditions, are able to make use of apparent obstacles in their environment to assist in finding the fastest routes to food. These ants make extensive use of fallen branches, twigs and lianas as bridges to build their trails. These bridges make trails significantly longer than their straight line equivalents across the forest floor, but we estimate that ants spend less than half the time to reach the same point, due to increased carriage speed across the bridges. We also found that these trails, mainly composed of bridges, are maintained for months, so they can be characterized as trunk trails. We suggest that pheromone-based foraging trail networks in field conditions are likely to be structured by a range of potentially complex factors but that even then, speed remains the most important consideration.

  4. A review of scuttle fly genera of Israel (Diptera: Phoridae), with new records and an identification key.

    Science.gov (United States)

    Mostovski, Mike B

    2016-07-08

    A brief review of Israeli scuttle flies is given. The following genera are new records for the country: Arabiphora, Billotia, Chonocephalus, Menozziola, Phalacrotophora, Pseudacteon, Psyllomyia, and Puliciphora. Eighteen species-Arabiphora tenuifemorata, Chonocephalus depressus, Conicera floricola, Conicera similis, Gymnophora integralis, Gymnophora perpropinqua, Megaselia scalaris, Megaselia stigmatica, Menozziola schmitzi, Metopina formicomendicula, Phalacrotophora beuki, Phalacrotophora fasciata, Phora limpida, Phora tincta, Psyllomyia braunsi, Puliciphora rufipes, Spiniphora bergenstammi, and Tubicera lichtwardi-are added to the list of 56 phorid species previously known from Israel. Two species, Conicera similis and Megaselia scalaris, are recorded in association with the summer truffle Tuber aestivum commercially grown in northern Israel. The status of the Afrotropical Phora congolensis Beyer, 1965 is designated as nomen dubium. A lapsius calami, which led to an erroneous generic attribution of Metopina braueri in the paper on Israeli Metopina (Mostovski, 2016), is noted here. An identification key to the Israeli genera of scuttle flies, as well as notes on recognition and/or biology of individual species, are provided.

  5. New evidences supporting trophobiosis between populations of Edessa rufomarginata (Heteroptera: Pentatomidae and Camponotus (Hymenoptera: Formicidae ants

    Directory of Open Access Journals (Sweden)

    Daniel Paiva Silva

    2016-06-01

    Full Text Available ABSTRACT Despite its important effect on the maintenance of tritrophic interactions among plants, insect herbivores, and ants, there is still a paucity of natural history and basic biology information involving trophobiosis among Heteroptera stink bugs. Here, based on previous observations of a new trophobiotic interaction between Edessa rufomarginata (De Geer, 1773 and Camponotus rufipes (Fabricius, 1775 ants, we describe the chemical profile of the honeydew obtained by Gas Chromatography–Mass Spectrometry. There were mainly three different sugars (trehalose, glucose, and sorbose within our samples. The extrafloral nectaries of Caryocar brasiliense Camb., the host plant of E. rufomarginata, attracts a wide assemblage of Cerrado ants with varying aggressiveness toward herbivores. Therefore, this facultative trophobiotic interaction may allow the survival of the stink bug while feeding on the risky, highly ant-visited plant. Given the rarity of trophobiotic interactions between Pentatomidae species and ants and considering a zoological perspective within this family, here we discuss the ecological and evolutionary routes that may allow the rise of these interactions.

  6. The bioindication importance of the Carabidae communities of Veporské vrchy and Juhoslovanská kotlina

    Directory of Open Access Journals (Sweden)

    Langraf Vladimír

    2016-06-01

    Full Text Available The Carabidae family (Coleoptera is used frequently for its bioindication potential to detect the environmental burden. In 2013 and 2014, we studied the correlation of Carabidae on the biotopes of six areas in the Veporské vrchy Mts and the Juhoslovenská kotlina basin by using pitfall traps, Möricke plates and Bambara beetle traps. Out of 432 recorded specimens of beetles (53 species, 15 families, the Carabidae family were the highest number of species and specimens represented, with which we confirmed higher anthropogenic interference and disturbance of ecosystems in the Juhoslovenská kotlina basin. This statistic confirms the presence of the following species typically found on arable land: Anchomenus dorsalis, Calathus fuscipes fuscipes, Harpalus affinis and Pseudoophonus rufipes. The ecosystems in the Veporské vrchy Mts region show less disturbance, and the anthropological impact is smaller, indicated by the presence of the Carabus problematicus species, an important indicator of the conservation of natural forest ecosystems.

  7. Direct effects of tillage on the activity density of ground beetle (Coleoptera: Carabidae) weed seed predators.

    Science.gov (United States)

    Shearin, A F; Reberg-Horton, S C; Gallandt, E R

    2007-10-01

    Ground beetles are well known as beneficial organisms in agroecosystems, contributing to the predation of a wide range of animal pests and weed seeds. Tillage has generally been shown to have a negative effect on ground beetles, but it is not known whether this is because of direct mortality or the result of indirect losses resulting from dispersal caused by habitat deterioration. In 2005, field experiments measured direct, tillage-induced mortality, of four carabid weed seed predators, Harpalus rufipes DeGeer, Agonum muelleri Herbst, Anisodactylus merula Germar, and Amara cupreolata Putzeys, and one arthropod predator, Pterostichus melanarius Illiger, common to agroecosystems in the northeastern United States. Three tillage treatments (moldboard plow, chisel plow, and rotary tillage) were compared with undisturbed controls at two sites (Stillwater and Presque Isle) and at two dates (July and August) in Maine. Carabid activity density after disturbance was measured using fenced pitfall traps installed immediately after tillage to remove any effects of dispersal. Rotary tillage and moldboard plowing reduced weed seed predator activity density 52 and 54%, respectively. Carabid activity density after chisel plowing was similar to the undisturbed control. This trend was true for each of the weed seed predator species studied. However, activity density of the arthropod predator P. melanarius was reduced by all tillage types, indicating a greater sensitivity to tillage than the four weed seed predator species. These results confirm the need to consider both direct and indirect effects of management in studies of invertebrate seed predators.

  8. Detection of seed DNA in regurgitates of granivorous carabid beetles.

    Science.gov (United States)

    Wallinger, C; Sint, D; Baier, F; Schmid, C; Mayer, R; Traugott, M

    2015-12-01

    Granivory can play a pivotal role in influencing regeneration, colonization as well as abundance and distribution of plants. Due to their high abundance, nutrient content and longevity, seeds are an important food source for many animals. Among insects, carabid beetles consume substantial numbers of seeds and are thought to be responsible for a significant amount of seed loss. However, the processes that govern which seeds are eaten and are therefore prevented from entering the seedbank are poorly understood. Here, we assess if DNA-based diet analysis allows tracking the consumption of seeds by carabids. Adult individuals of Harpalus rufipes were fed with seeds of Taraxacum officinale and Lolium perenne allowing them to digest for up to 3 days. Regurgitates were tested for the DNA of ingested seeds at eight different time points post-feeding using general and species-specific plant primers. The detection of seed DNA decreased with digestion time for both seed species, albeit in a species-specific manner. Significant differences in overall DNA detection rates were found with the general plant primers but not with the species-specific primers. This can have implications for the interpretation of trophic data derived from next-generation sequencing, which is based on the application of general primers. Our findings demonstrate that seed predation by carabids can be tracked, molecularly, on a species-specific level, providing a new way to unravel the mechanisms underlying in-field diet choice in granivores.

  9. Dinâmica Populacional de Pulgão Preto dos Citros (Sternorrhyncha em Cultivo Orgânico de Tangerina (Citrus reticulata Blanco em Seropédica-RJ

    Directory of Open Access Journals (Sweden)

    William Rodrigues

    2010-07-01

    Abstract. The aphid Toxoptera citricida (Kyrkaldy (Sternorrhyncha is a potential vector of citrus virus tristeza, consider an important pest of the orchard. Was realized bimonthly monitoring between October 2002 and October 2003, with aim of study the populational dynamic this aphid, included predators ant ant-tending, in organic cropping of tangerine cv Ponkan, Fazendinha Agroecológica, Seropédica, RJ. The faunistic analysis of the ant-tending and predators, were realized across Shanon-Wiener (H' and Simpson (D diversity index's, Berger-Parker dominance (d and equitability J (e. The predators considered efficient in the populational reduction of brown citrus aphid (BCA, was Cycloneda sanguinea (L., Azya luteipes Mulsant and Pseudodorus clavatus (Fabr., although has been registered eight predators attacking BCA colonies. Verified that C. sangiunea obtained the biggest populational peak, following P. clavatus and A. luteipes. The predators diversity and equitability was considered high (H'= 0.7979; D =0.9638; e= 0.8836. Tending BCA, was registered Brachymyrmex sp., Camponotus rufipes (Fabricius Camponotus atriceps (Fabricius, Camponotus crassus (Mayr, Camponotus clypeatus (Mayr; Crematogaster sp., Solenospis sp., Ectatomma brunneum (Fabricius and Pseudomyrmex termitarius (Fr. Smith. Ant-tending was considered medium to H' value (0.6585 and high to D value (0.9012. The equitability was considered medium too (e =0.69. T. citricida populational dynamic is influenced to foliar shoot following predation and ant-tending. These two end factors are antagonist due to protection offer to ants at BCA.

  10. Systematic relationships and cospeciation of bacterial endosymbionts and their carpenter ant host species: proposal of the new taxon Candidatus Blochmannia gen. nov.

    Science.gov (United States)

    Sauer, C; Stackebrandt, E; Gadau, J; Hölldobler, B; Gross, R

    2000-09-01

    The systematic relationships of intracellular bacteria of 13 Camponotus species (carpenter ants) from America and Europe were compared to those of their hosts. Phylogenetic trees of the bacteria and the ants were based on 16S rDNA (rrs) gene sequences and mitochondrial cytochrome oxidase subunit I (COI) gene sequences, respectively. The bacterial endosymbionts of Camponotus spp. form a distinct lineage in the y-subclass of the Proteobacteria. The taxa most closely related to these bacteria are endosymbionts of aphids and the tsetse fly. The bacterial and host phylogenies deduced from the sequence data show a high degree of congruence, providing significant evidence for cospeciation of the bacteria and the ants and a maternal transmission route of the symbionts. The cloned rrs genes of the endosymbionts contain putative intervening sequences (IVSs) with a much lower G+C content than the mean of the respective rrs genes. By in situ hybridization specific 16S rDNA oligonucleotide probes verified the presence of the bacteria within tissues of three of the eukaryotic hosts. It is proposed that the endosymbionts of these three carpenter ants be assigned to a new taxon 'Candidatus Blochmannia gen. nov.' with the symbionts of the individual ants being species named according to their host, 'Candidatus Blochmannia floridanus sp. nov.', 'Candidatus Blochmannia herculeanus sp. nov.' and 'Candidatus Blochmannia rufipes sp. nov.'.

  11. Repellent efficacy of formic acid and the abdominal secretion of carpenter ants (Hymenoptera: Formicidae) against Amblyomma ticks (Acari: Ixodidae).

    Science.gov (United States)

    Falótico, Tiago; Labruna, Marcelo B; Verderane, Michele P; De Resende, Briseida D; Izar, Patrícia; Ottoni, Eduardo B

    2007-07-01

    Formic acid is a substance produced by some ants for defense, trail marking, and recruitment. Some animals are known to rub ants or other arthropods on parts of their plumage or fur to anoint themselves with released substances. A recent study with a semifree-ranging group of capuchin monkeys, Cebus apella L., in the Tietê Ecological Park, Sao Paulo, Brazil, an area of occurrence of the tick species Amblyomma cajennense (F.), revealed that "anting" with carpenter ants, Camponotus rufipes F. (Hymenoptera: Formicidae), occurs frequently, especially during the A. cajennense subadult season. Based on these observations, we tested the repellent effect of the formic acid and the ants themselves against A. cajennense and Amblyomma incisum Neumann nymphs, and Amblyomma parcum Aragdo adult ticks in the laboratory. The results revealed a significant repellent effect of formic acid and ant secretion, and a significant duration of the repellent effect. The results suggest that the anting behavior of capuchin monkeys, and other vertebrates, may be related with repellence of ticks and other ectoparasites.

  12. Malaria Transmission Pattern in an Area Selected for Clinical Trials in the Sudanian Area of Senegal (West Africa

    Directory of Open Access Journals (Sweden)

    El Hadji Amadou Niang

    2013-01-01

    Full Text Available Malaria transmission pattern was studied in 3 villages (Toubanding, Daga Ndoup, and Keur Samba Guèye situated within an area selected for clinical trials. The study was conducted in the rainy season from July to December 2011. The main objective of this work was to gather baseline data on malaria transmission intensity and other entomological parameters before the advent of clinical trials. Mosquitoes were collected by Human-Landing Collections (HLCs and by pyrethrum spray catches (PSCs. Five anopheline species were collected, namely, An. arabiensis, An. gambiae, An. funestus, An. pharoensis, and An. rufipes, giving a heterogeneous distribution within the study area. The populations dynamics of the vectors varied temporarily in each village depending on the pattern of the rainy season. Transmission intensity estimated by the entomological inoculation rate (EIR was measured in each of the three villages with the variations linked to the microecological differences between the villages. Measurements were calculated for August, September, and October and were found to vary between 4 and 30 infected bites per person over the study period with a peak intensity observed in September. These results indicate that epidemiological field trials on malaria could be conducted in this area on the basis of the differences observed with transmission intensity, micro-ecological variations, and the objectives of the trials.

  13. A review of insect parasitoids associated with Lobesia botrana (Denis & Schiffermüller, 1775) in Italy. 1. DipteraTachinidae and HymenopteraBraconidae (Lepidoptera, Tortricidae).

    Science.gov (United States)

    Scaramozzino, Pier Luigi; Loni, Augusto; Lucchi, Andrea

    2017-01-01

    This paper is aimed to summarize the information available on the parasitoid complex of the European Grapevine Moth (EGVM), Lobesia botrana (Denis & Schiffermüller, 1775) (Lepidoptera Tortricidae) in Italy. The list is the result of the consultation of a vast bibliography published in Italy for almost two hundred years, from 1828 to date. This allowed the clarification and correction of misunderstandings and mistakes on the taxonomic position of each species listed. In Italy the complex of parasitoids detected on EGVM includes approximately 90 species belonging to ten families of Hymenoptera (Braconidae, Ichneumonidae, Chalcididae, Eulophidae, Eupelmidae, Eurytomidae, Pteromalidae, Torymidae, Trichogrammatidae, and Bethylidae) and one family of Diptera (Tachinidae). This paper deals with EGVM parasitoids of the families Tachinidae (Diptera) and Braconidae (Hymenoptera). Only two species of Tachinidae are associated to EGVM larvae in Italy, Actia pilipennis (Fallen) and Phytomyptera nigrina (Meigen), whereas the record of Eurysthaea scutellaris (Robineau-Desvoidy) is doubtful. Moreover, 21 species of Braconidae are reported to live on EGVM, but, unfortunately, eight of them were identified only at generic level. Bracon mellitor Say has been incorrectly listed among the parasitoids of Lobesia botrana. Records concerning Ascogaster rufidens Wesmael, Meteorus sp., Microgaster rufipes Nees, and Microplitis tuberculifer (Wesmael) are uncertain.

  14. A review of insect parasitoids associated with Lobesia botrana (Denis & Schiffermüller, 1775 in Italy. 1. Diptera Tachinidae and Hymenoptera Braconidae (Lepidoptera, Tortricidae

    Directory of Open Access Journals (Sweden)

    Pier Luigi Scaramozzino

    2017-01-01

    Full Text Available This paper is aimed to summarize the information available on the parasitoid complex of the European Grapevine Moth (EGVM, Lobesia botrana (Denis & Schiffermüller, 1775 (Lepidoptera Tortricidae in Italy. The list is the result of the consultation of a vast bibliography published in Italy for almost two hundred years, from 1828 to date. This allowed the clarification and correction of misunderstandings and mistakes on the taxonomic position of each species listed. In Italy the complex of parasitoids detected on EGVM includes approximately 90 species belonging to ten families of Hymenoptera (Braconidae, Ichneumonidae, Chalcididae, Eulophidae, Eupelmidae, Eurytomidae, Pteromalidae, Torymidae, Trichogrammatidae, and Bethylidae and one family of Diptera (Tachinidae. This paper deals with EGVM parasitoids of the families Tachinidae (Diptera and Braconidae (Hymenoptera. Only two species of Tachinidae are associated to EGVM larvae in Italy, Actia pilipennis (Fallen and Phytomyptera nigrina (Meigen, whereas the record of Eurysthaea scutellaris (Robineau-Desvoidy is doubtful. Moreover, 21 species of Braconidae are reported to live on EGVM, but, unfortunately, eight of them were identified only at generic level. Bracon mellitor Say has been incorrectly listed among the parasitoids of L. botrana. Records concerning Ascogaster rufidens Wesmael, Meteorus sp., Microgaster rufipes Nees, and Microplitis tuberculifer (Wesmael are uncertain.

  15. Biodiversity of carabidae beetles (Coleoptera: Carabidae in agroecosystems of Azadshahr region, Golestan province, Northern Iran

    Directory of Open Access Journals (Sweden)

    M. Rezaye-Nodeh

    2016-05-01

    Full Text Available Ground beetles (Family Carabidae with more than 40,000 described species worldwide are one of the most important generalist predators in agroecosystems. Because of their habit of feeding on agricultural pests and weed seeds, in this study we tried to assess their biodiversity in agroecosystems of Azadshahr region, eastern Golestan province. Samples were collected for some main crops, using pitfall traps during 2009 and 2010 and two indices, including SIMPSON'S RECIPROCAL INDEX and Shannon-Weaver index were used to measure diversity and structure of the community. Results showed that there were a high species richness of ground beetles in this region and 24, 22, 18, 18 and 12 species were identified in rape seed, wheat, tomato, broad bean and soybean fields, respectively. Dominant species in these crops were Harpalus distinguendus Duftchmid, Agonum dorsale (Pontoppidan, Poecilus cupreus (L., Agonum dorsale (Pontoppidan, and Harpalus rufipes (De Geer, respectively. The values of Shannon and Simpson indices in these ecosystems were 2.16, 2.57, 1.81, 2.22 and 2.00, and 4.93, 10.09, 4.21, 6.16 and 6.12, respectively. The highest (7.1±0.85 and the lowest (0.45±0.12 numbers of beetles were captured in margins of rape seed and soybean fields, respectively.

  16. A new species of Heilipus Germar (Coleoptera: Curculionidae: Molytinae) associated with commercial species of Annonaceae in Brazil, and comments on other species of the genus causing damage to avocado trees in Brazil.

    Science.gov (United States)

    Vanin, Sergio Antonio; Bená, Daniela De Cassia

    2015-01-14

    Heilipus gibbus sp. nov. (type locality: Brazil, state of São Paulo, Angatuba) is described from 73 specimens. The holotype and three paratypes from the same locality were reared from larvae collected in the basis region, near the ground, of an atemoya tree (a hybrid of the sugar-apple, "pinha" or fruta-do-conde"-Annona squamosa L., and the cherymoya, A. cherimoya (Mill.), Annonaceae). Heilipus gibbus sp. nov. can cause severe injury to commercial Annonaceae, and has been misidentified in the collections and the literature as Heilipus catagraphus Germar, 1834. The new species and H. catagraphus have a very similar color pattern, but can be easily distinguished by the rostrum shape in lateral view, being humped in H. gibbus sp. nov. but evenly arcuate in H. catagraphus. Illustrations of habitus and of male and female genitalia are provided to the new species and for avocado stem boring species of Heilipus which occur in Brazil (H. catagraphus and H. rufipes). Comments are made for H. elegans Guérin, 1844, which record to Brazil is probably based on a misidentification. 

  17. Structure and function of the cibarial armature in Simuliidae.

    Science.gov (United States)

    Reid, G D

    1994-07-01

    Cibarial armature morphology in adult female blackflies (Diptera: Simuliidae) is described using scanning electron microscopy. Three distinct types of armature are recognized, comprising those with teeth, e.g. Simulium ochraceum, S. ornatum, S. veracruzanum and S. vorax, those with spicules, e.g. Austrosimulium bancrofti, S. damnosum, S. exiguum, S. metallicum and S. neavei; and those lacking these projections, e.g. Prosimulium rufipes and S. lineatum. Whereas the armature is poorly developed in vectors of human onchocerciasis such as S. damnosum, S. exiguum, S. metallicum and S. neavei, the well-developed armature in S. ochraceum, S. veracruzanum and S. vorax does not prevent these species becoming infected with Onchocerca spp. (Nematoda: Onchocercidae). Hence the armature is not primarily a mechanism to counteract microfilaria superinfection. Since cibarial armatures are more developed in the haematophagous females than in the males of certain Families of flies, e.g. Ceratopogonidae, Culicidae, Phlebotominae and Simuliidae in the sub-order Nematocera, evidently the armature has evolved in response to the blood-feeding habit. As the suction of imbibed blood by the cibarial pump may require a valve mechanism to prevent back-flow, it is suggested that the armature is primarily for this purpose. Secondarily, the cibarial armature presents a damaging barrier against ingested microfilariae.

  18. Foraging ants trade off further for faster: use of natural bridges and trunk trail permanency in carpenter ants.

    Science.gov (United States)

    Loreto, Raquel G; Hart, Adam G; Pereira, Thairine M; Freitas, Mayara L R; Hughes, David P; Elliot, Simon L

    2013-10-01

    Trail-making ants lay pheromones on the substrate to define paths between foraging areas and the nest. Combined with the chemistry of these pheromone trails and the physics of evaporation, trail-laying and trail-following behaviours provide ant colonies with the quickest routes to food. In relatively uniform environments, such as that provided in many laboratory studies of trail-making ants, the quickest route is also often the shortest route. Here, we show that carpenter ants (Camponotus rufipes), in natural conditions, are able to make use of apparent obstacles in their environment to assist in finding the fastest routes to food. These ants make extensive use of fallen branches, twigs and lianas as bridges to build their trails. These bridges make trails significantly longer than their straight line equivalents across the forest floor, but we estimate that ants spend less than half the time to reach the same point, due to increased carriage speed across the bridges. We also found that these trails, mainly composed of bridges, are maintained for months, so they can be characterized as trunk trails. We suggest that pheromone-based foraging trail networks in field conditions are likely to be structured by a range of potentially complex factors but that even then, speed remains the most important consideration.

  19. Preliminary results on the ability of pentatomidae to transfer fire blight Erwinia amylovora under controlled conditions.

    Science.gov (United States)

    Peusens, G; Schoofs, H; Deckers, T; Belien, T

    2013-01-01

    With their piercing-sucking mouthparts stink bugs (Heteroptera: Pentatomidae), a major pest in especially organic orchards, create wounds in fruit of pear trees. As Erwinia amylovora (Burrill, Winslow et al.), a wide spread bacterial disease affecting many rosaceous plants including pome fruit trees and hawthorn, enters through openings in flowers, leaves, shoots and fruit, feeding punctures caused by these bugs might be inoculated with Erwinia bacteria. In order to investigate the ability of the bugs Pentotoma rufipes L. and Polomena prasina L. to transmit fire blight, insects were caught in an organically managed orchard without fire blight, brought into contact with artificially inoculated immature pear fruit/slices and transferred to healthy, mechanically wounded pear fruit/slices. After an incubation period potential transmission of bacteria was examined by evaluation of symptom expression (necrosis, ooze production). To assess the presence of bacteria on the exoskeleton of the tested bugs, all bugs were forced to walk on a semiselective nutrient agar medium. In another experiment the viability of Ea on the exoskeleton was tested -after previous contact with ooze- through washing and plating of the wash water. All experiments were conducted under optimal climatological conditions and according to quarantine standards. Results demonstrated the ability of stink bugs to transfer E. amylovora to fruit and the viability of bacteria on stink bugs externally - both under lab conditions.

  20. Artropofauna de importancia forense en un cadáver de cerdo en el Callao, Perú Arthropofauna of forensic importance in pig carcass in Callao, Peru

    Directory of Open Access Journals (Sweden)

    José Iannacone

    2003-03-01

    Full Text Available This is the first report of an ongoing study on arthropofauna of forensic importance in Callao, Peru using a baby pig (Sus scrofa Linneaus, 1758 on land as a model to determine the arthropofauna over 84 days of weekly survey between 17 July and 02 October 2 000. A total of 4,405 specimens were collected belonging to five orders and eight families: Cochliomyia macellaria (Fabricius, 1775 (Diptera, Calliphoridae (81.62%; Dermestes maculatus (De Geer, 1774 (Coleoptera, Dermestidae (16.35%; Fannia canicularis (Linnaeus, 1761 (Diptera, Muscidae (0.04%; Saprinus aeneus (Fabricius, 1775 (Coleoptera, Histeridae (1.48%; Necrobia rufipes (De Geer, 1775 (Coleoptera, Cleridae (0.45%; Linepithema humile (Mayr, 1868 (Hymenoptera, Formicidae (0.02%; Porcellio laevis Latreille, 1804 (Isopoda, Porcellionidae (0.02% and Hadruroides lunatus (L. Koch, 1867 (Scorpionida, Iuridae (0.02%. Larvae accounted for 76%, pupae 14% and adults 10% of the total collected. The arthropods were into three: necrophages (98.01%, predators (1.95% and omnivorous (0.04%. C. macellaria were significantly higher during the decayed stage; by contrast D. maculatus was much higher in dry remains stage. The highest diversity with the Shannon-Weaver (H' and Pielou (J index were found during the advanced decayed stage. The absence of species of genus Chrysomyia Robineau-Desvoidy, 1830 is discussed.

  1. Inhibition of Cytochrome P450 (CYP3A4) Activity by Extracts from 57 Plants Used in Traditional Chinese Medicine (TCM)

    Science.gov (United States)

    Ashour, Mohamed L; Youssef, Fadia S; Gad, Haidy A; Wink, Michael

    2017-01-01

    Background: Herbal medicine is widely used all over the world for treating various health disorders. It is employed either alone or in combination with synthetic drugs or plants to be more effective. Objective: The assessment of the effect of both water and methanol extracts of 57 widely used plants from Traditional Chinese Medicine (TCM) against the main phase I metabolizing enzyme CYP3A4 in vitro for the first time. Materials and Methods: The inhibition of cytochrome P450 activity was evaluated using a luminescence assay. The principal component analysis (PCA) was used to correlate the inhibitory activity with the main secondary metabolites present in the plant extracts. Molecular modeling studies on CYP3A4 (PDB ID 4NY4) were carried out with 38 major compounds present in the most active plant extracts to validate the observed inhibitory effect. Results: Aqueous extracts of Acacia catechu, Andrographis paniculata, Arctium lappa, Areca catechu, Bupleurum marginatum, Chrysanthemum indicum, Dysosma versipellis, and Spatholobus suberectus inhibited CYP3A4 is more than 85% (at a dose of 100 μg/mL). The corresponding methanol extracts of A. catechu, A. paniculata, A. catechu, Mahonia bealei, and Sanguisorba officinalis inhibited the enzyme by more than 50%. Molecular modeling studies revealed that two polyphenols, namely hesperidin and rutin, revealed the highest fitting scores in the active sites of the CYP3A4 with binding energies equal to -74.09 and -71.34 kcal/mol, respectively. Conclusion: These results provide evidence that many TCM plants can inhibit CYP3A4, which might cause a potential interference with the metabolism of other concomitantly administered herbs or drugs. SUMMARY In this study, the inhibitory activity of the aqueous and methanol extracts of 57 widely used plants from Traditional Chinese Medicine (TCM) against the main phase I metabolizing enzyme CYP3A4 was tested in vitro for the first time.Aqueous extracts of Acacia catechu, Andrographis

  2. Digenean parasites of six species of birds from Formosa Province, Argentina Digéneos parásitos de seis especies de aves de la provincia de Formosa, Argentina

    Directory of Open Access Journals (Sweden)

    Lía Inés Lunaschi

    2009-04-01

    Full Text Available The aim of this paper is to increase the knowledge of the diversity of digenean parasites from birds collected in Formosa Province, Argentina. The helminthological survey of 15 specimens of 6 bird species revealed the presence of 5 digenean species: Clinostomatopsis sorbens (Braun, 1899 and Clinostomum marginatum (Rudolphi, 1819 (Clinostomidae from the esophagus of Tigrisoma lineatum (Boddaert; Glaphyrostomum propinquum Braun, 1901 (Brachylaimidae from the cloaca of Guira guira (Gmelin; Stomylotrema vicarium Braun, 1901 (Stomylotrematidae from the cloaca of Busarellus nigricollis (Latham and Buteogallus meridionalis (Latham; and Athesmia heterolecithodes (Braun, 1899 (Dicrocoeliidae from the bile canaliculi of G. guira, Milvago chimachima (Vieillot and Rostrhamus sociabilis (Vieillot. The present study adds new morphometric data on 2 species of digeneans (C. sorbens and G. propinquum and new host records for C. sorbens, G. propinquum, A. heterolecithodes and S. vicarium. The genera Clinostomatopsis Dollfus, 1932 and Glaphyrostomum Braun, 1901 are reported for the first time in Argentina.El propósito de este trabajo es incrementar el conocimiento sobre la diversidad de digéneos parásitos de aves recolectadas en la provincia de Formosa, Argentina. El estudio helmintológico de 15 ejemplares de 6 especies de aves reveló la presencia de 5 especies de digéneos: Clinostomatopsis sorbens (Braun, 1899 y Clinostomum marginatum (Rudolphi, 1819 (Clinostomidae halladas en el esófago de Tigrisoma lineatum (Boddaert; Glaphyrostomum propinquum Braun, 1901 (Brachylaimidae recolectada de la cloaca de Guira guira (Gmelin; Stomylotrema vicarium Braun, 1901 (Stomylotrematidae encontrada en la cloaca de Busarellus nigricollis (Latham y Buteogallus meridionalis (Latham; Athesmia heterolecithodes (Braun, 1899 (Dicrocoeliidae hallada en los canalículos biliares de G. guira, Milvago chimachima (Vieillot y Rostrhamus sociabilis (Vieillot. El presente estudio

  3. Evolução do uso e valorização das espécies madeiráveis da Floresta Estacional Decidual do Alto-Uruguai, SC

    Directory of Open Access Journals (Sweden)

    Ademir Roberto Ruschel

    2003-01-01

    Full Text Available Species identification and their market value and price evolution since the colonization time of the remnants of the Brazilian Semi-Evergreen Forest (Floresta Estacional Decidual do Rio Uruguai for potential timber production was assessed through 41 questionnaires, applied to timbermen and settlers from the surrounding region. The diversity of species for timber production commonly known by the people reached 63. From the 15 predominant species is relevant to mention Apuleia leiocarpa, Parapiptadenia rigida, Balfourodendron riedelianum, Nectandra megapotamica, Patagonula americana, Luehea divaricata, Cedrela fissilis, Ocotea diospyrifolia, Holocalyx balansae, Myrocarpus frondosus, Cabralea canjerana and Peltophorum dubium. The species with the highest commercial value were: Cordia trichotoma, Cedrela fissilis, Myrocarpus frondosus and Balfourodendron riedelianum. Data from the interviews suggest that several species from the Lauraceae family and Schefflera morototoni, Aralia warmingiana, Machaerium stipitatum, Chrysophyllum marginatum had an increment in use and commercial value during the last 15 years. Changing in the commercial value of a species was pointed out as due not only to the timber quality but also to the amount of the timber availability. Overall, it was detected that the species values changed across time and that the timber industry found several ways to adapt to the demands of forest products.

  4. In vitro Mosquito Larvicidal Activity of Marine Algae Against the Human Vectors, Culex quinquefasciatus (Say and Aedes aegypti (Linnaeus (Diptera: Culicidae

    Directory of Open Access Journals (Sweden)

    Akbar Idhayadhulla

    2011-01-01

    Full Text Available A total of twenty marine algae were collected from the rocky intertidal and subtidal regions of the southwest coast of India and extracted in methanol. The extracts were evaluated for larvicidal activity against the second and third instar larvae of the human vector mosquito Culex quinquefasciatus and Aedes aegypti (Diptera: Culicidae. Analysis on the activity profile of the above marine algae indicated that the early stage larvae were very sensitive to seven seaweed extracts that had been tested. Among the seven marine algae, Lobophora variegata was highly potential, showing LD50 value of 70.38 and 79.43 g mL-1 on the 2nd instar larvae of A. aegypti and C. quinquefasciatus respectively. The rank of larvicidal potency in highly active algae in the descending order is as follows: Lobophora variegata (Dictyotaceae>Spatoglossum asperum (Dictyotaceae>Stoechospermum marginatum (Dictyotaceae>Sargassum wightii (Sargassaceae >Acrosiphonia orientalis (Acrosiphoniaceae>Centroceras clavulatum (Ceramiacea>Padina tetrastromatica (Dictyotaceae. This is the first report that envisaged the mosquito larvicidal efficacy of L. variegata from the Indian coast. Therefore, this marine alga could be recognized as a potential resource of natural insecticide and can be developed to replace synthetic insecticides in future.

  5. Light regulation to chlorophyll synthesis and plastid development of the chlorophyll-less golden-leaf privet.

    Science.gov (United States)

    Yuan, Ming; Xu, Mo-Yun; Yuan, Shu; Chen, Yang-Er; Du, Jun-Bo; Xu, Fei; Zhang, Zhong-Wei; Guo, Zi-Chan; Zhao, Zhong-Yi; Lin, Hong-Hui

    2010-09-01

    Ligustrum vicaryi L. is a hybrid of Ligustrum ovalifolium Hassk. var. aureo-marginatum and Ligustrum vulgale L., and displays a chlorophyll-less phenotype. Therefore it is widely used as a horticultural shrub because of its golden-color leaves. Its putative mechanism, light responses, chlorophyll synthesis and plastid development were studied. L. vicaryi has a higher level of 5-aminolevulinic acid (ALA), but lower levels of chlorophylls compared with L. quihoui. The yellowish phenotype of L. vicaryi upper leaves could be attributed to their hampered conversion from chlorophyllide into chlorophyll a. Despite the enhanced ALA level and the decreased thylakoid stacking in plastids, L. vicaryi golden leaves contain normal levels of Lhcb transcripts and photosystem apoproteins. Furthermore, reactive oxygen species (ROS) accumulation is almost the same in L. vicaryi and L. quihoui. The golden leaves often turn green and the contents of chlorophylls increase with decreasing light intensity. Dynamic changes of chlorophyll-synthesis-system under the light transition were also analyzed.

  6. Toxicity of essential oils from leaves of Piperaceae species in rice stalk stink bug eggs, Tibraca limbativentris (Hemiptera: Pentatomidae

    Directory of Open Access Journals (Sweden)

    Diones Krinski

    Full Text Available ABSTRACT Tibraca limbativentris to is an important rice pest and occurs in all rice-growing regions of Latin America. The control this insect is accomplished with synthetic chemical insecticides, however, new approaches are needed to reduce risks to the environment, to the natural enemies and also to avoid the onset of insecticides resistance. This study was designed to assess the toxicity of essential oils (EOs from leaves of Piper aduncum, P. gaudichaudianum, P. malacophyllum, P. marginatum and P. tuberculatum (Piperaceae on rice stalk stink bug eggs, T. limbativentris. Essential oils were extracted with steam distillation and dilutions were made for bioassays at concentrations of 0.25; 0.5; 1.0; 2.0 and 4.0%. Essential oils from all species of Piperaceae displayed ovicidal activity. The LC50 values indicated that both younger and older eggs were susceptible to these oils. Ovicidal activity is related to the potential toxicity of several compounds, especially dilapiolle, myristicin, cubebene, α-guaiene, longifolene, prezizane, spathulenol, sabinene and δ-2-carene. Thus, EOs tested showed promising results for use as biorational botanical insecticides.

  7. Management of Lyme Disease in European Children: a Review for Practical Purpose.

    Science.gov (United States)

    D'Alessandro, Matteo; Loy, Anna; Castagnola, Elio

    2017-08-01

    Lyme disease is a tick-borne zoonosis transmitted through a bite of a tick carrying a spirochete belonging to Borrelia species. In the last 20 years, the reported incidence of Lyme disease is increased by three times in Europe. Clinically, the illness develops through a primary stage with a typical skin rash (erythema marginatum), then a secondary stage with possible neurologic or cardiac involvement. The last stage (chronic Lyme disease) is mainly represented by arthritis or late neurological complications but nowadays is rarely seen due to precocious antibiotic use. The diagnosis of Lyme disease is essentially based on history in agreement with tick exposure (living/recent traveling in endemic area or tick bite) and clinical findings compatible with the disease. At present, no laboratory diagnostic tool available can neither establish nor exclude the diagnosis of Lyme disease. The management of Lyme disease should comprise a prophylactic administration of antibiotic in selected population (patients exposed to a tick bite in endemic regions) in which the typical signs of Lyme disease are not yet appeared; conversely, patients with current signs of Lyme disease should undergo a standard therapeutic course. First-line therapy should be oral tetracycline or oral penicillin/cephalosporin (in pediatric populations, beta-lactamic drugs are preferred). In severe courses, intravenous route should be preferred. The aim of this review is to provide an updated guide to the management of pediatric Lyme patients, from prophylaxis to first- and second-line therapy in European setting.

  8. Structure of parasites community in Chaetobranchopsis orbicularis (Cichlidae), a host from the Amazon River system in northern Brazil.

    Science.gov (United States)

    Tavares-Dias, Marcos; Oliveira, Marcos Sidney Brito

    2017-08-01

    The aim of this paper was to investigate the component communities of parasites in Chaetobranchopsis orbicularis from a tributary of the Amazon River system, in Northern Brazil. In 32 fish examined, 902,551 parasites were collected, including Ichthyophthirius multifiliis, Piscinoodinium pillulare, Sciadicleithrum geophagi, Posthodiplostomum sp., Clinostomum marginatum, Echinorhynchus paranensis, Neoechinorhynchus pterodoridis, and Dolops longicauda. I. multifiliis was the dominant and abundant parasite species. The ectoparasites presented aggregate dispersion, but the endoparasites showed random dispersion pattern. Mean species richness was 4.0 ± 1.5 parasites, mean Brillouin diversity (HB) was 0.33 ± 0.28, mean evenness was 0.15 ± 0.13, and Berger-Parker dominance (d) was 0.85 ± 0.17. The species richness of parasites and HB were positively correlated with the length of hosts. There was positive correlation between the abundance of P. pillulare and length and weight, between the abundance of I. multifiliis and weight, as well as between the abundance of E. paranensis and N. pterodoridis and the length of hosts. Body condition of the hosts was not affected by moderate parasitism. The low diversity of endoparasites indicates that C. orbicularis is a host with low position in the food web. This is the first record of all these parasites for C. orbicularis.

  9. Rheumatic fever: a multicenter study in the State of São Paulo

    Directory of Open Access Journals (Sweden)

    Silva Carlos Henrique Martins da

    1999-01-01

    Full Text Available Rheumatic fever is still the most commonly seen rheumatic disease in Brazilian pediatric rheumatology clinics. It remains a significant health problem since subsequent cardiac sequelae represent one of the most important causes of chronic heart disease in children. We reviewed the clinical manifestations of rheumatic fever in 786 patients, followed at seven pediatric rheumatology clinics in the state of São Paulo, Brazil. All patients were diagnosed according to revised Jones' criteria. Regarding major criteria, 396 (50.4% children exhibited carditis, 453 (57.6% polyarthritis, 274 (34.8% chorea, 13 (1.6% erythema marginatum, and 12 (1.5% subcutaneous nodules. Valvular lesions documented by echocardiography in the absence of accompanying auscultatory findings were found in 144 (18.3% patients. Migratory polyarthritis was observed in 290 (64.0% patients with articular involvement. Documented previous streptococcal infection assessed by serum antistreptolysin (ASO titers occurred in 531 (67.5% patients. Even though prophylaxis with benzathine penicillin was recommended to all patients, recurrent attacks were observed in 147 (18.7%. We emphasize the high frequency of chorea, silent carditis and recurrences in our series as well as the variable clinical presentation of arthritis in rheumatic fever. Multicenter studies should be encouraged to improve our understanding of the clinical features of rheumatic diseases in children and adolescents.

  10. ANÁLISE DE AGRUPAMENTOS EM REMANESCENTE DE FLORESTA ESTACIONAL DECIDUAL

    Directory of Open Access Journals (Sweden)

    Clarice Maboni de Almeida

    2015-01-01

    Full Text Available This study intended to analyze the presence of clusters in the vegetation of Seasonal Deciduous Forest remnants, characterized as a concave enclave, on steep sandy soil, among the region’s characteristic fields. Shrub and tree specimens with CBH (circumference at breast height ≥ 15 cm were sampled in two size classes. In class I (CBH ≥ 30 cm specimen sampling, we used fourteen 20 x 100 m plots, divided into sub-plots (10 x 10 m. Class II (15 ≤ CBH < 30 cm specimens were observed in 70 sub-portions. We used the TWINSPAN program to analyze the clusters, which indicated two well-defined clusters in class I (G1 and G2 and one relatively homogenous cluster in class II (understorey. There were Trichilia claussenii , Cupania vernalis and Crysophyllum marginatum indicator species in the G1 cluster; and Luehea divaricata and Sebastiania commersoniana in the G2 cluster. Regarding to horizontal structure , these species were among the three most important ones in both clusters. In the understorey , the most important species were Actinostemon concolor, Trichilia claussenii , Trichilia elegans , Eugenia rostrifolia and Sorocea bonplandii . Since these species prevail in the tree vegetation, they are fundamental to stabilize hillsides, considering that they are adapted to steep and shallow soil areas, pointing out the Cupania vernalis and Trichilia claussenii in less modified environments and the Luehea divaricata and Sebastiania commersoniana in environments more susceptible to interference.

  11. Influence of sheep breed and application site on the efficacy of a flumethrin pour-on formulation against ticks

    Directory of Open Access Journals (Sweden)

    L.J. Fourie

    2001-07-01

    Full Text Available The objectives of this study were to determine the influence of application site and sheep breed on the efficacy of a flumethrin (1 % m/v solution for the control of 'bont'-legged (Hyalomma spp. and red-legged ticks (Rhipicephalus evertsi evertsi. This study was conducted from November 1996 to February 1997 on 3 farms in the southwestern Free State Province. Two trials were conducted on Dorper sheep and 2 on Merino sheep. For each specific application 30 sheep were selected and allocated to 3 groups of 10 animals each using randomisation through minimisation, with pre-treatment total tick count as only criterion. Groups consisted of an untreated control group, a group treated with 3 m of a flumethrin (1 % m/v solution applied only to the anogenital region, and a group treated at a dose rate of 1 m flumethrin (1% m/v/5 kg host body mass. The total dose volume for animals in the last group was divided into 3 equal parts and applied to the brisket/axillae, groin and anogenital regions respectively. Animals grazed under extensive farming conditions and were infested by ticks that occurred naturally in the environment. Ticks were counted and removed weekly over a 6-week period. In all 4 trials, Rhipicephalus e. evertsi was the dominant tick species, followed, in 3 of the trials, by Hyalomma spp. Efficacy (% of control against ticks for Dorper sheep, treated only on the anogenital region, was variable, ranging between 29.5 and 97 %. In Merino sheep the efficacy values ranged between 23.1 and 90 %. The site-spcific (anogenital region efficacy of control against ticks infesting Merino sheep was in general 100 % or almost 100 %. In Dorper sheep the efficacy values were >80 % for 3-5 weeks. The efficacy (% of control against ticks for sheep treated on the brisket/axillae, groin and anogenital regions was always higher compared to sheep treated only on the anogenital region. In Dorper sheep, efficacy of control was >80 % for up to 4 weeks and in Merino

  12. Efficacy of larvicidal activity of green synthesized titanium dioxide nanoparticles using Mangifera indica extract against blood-feeding parasites.

    Science.gov (United States)

    Rajakumar, Govindasamy; Rahuman, Abdul Abdul; Roopan, Selvaraj Mohana; Chung, Ill-Min; Anbarasan, Karunanithi; Karthikeyan, Viswanathan

    2015-02-01

    Titanium dioxide nanoparticles (TiO2 NPs) are considered to be among the best photocatalytic materials due to their long-term thermodynamic stability, strong oxidizing power, and relative non-toxicity. Nano-preparations with TiO2 NPs are currently under investigation as novel treatments for acne vulgaris, recurrent condyloma acuminata, atopic dermatitis, hyperpigmented skin lesions, and other non-dermatologic diseases. The present study was to investigate the acaricidal and larvicidal activity of synthesized TiO2 NPs utilizing leaf aqueous extract of Mangifera indica L. (Anacardiaceae) against hematophagous parasites. The anti-parasitic activity of TiO2 NPs against the larvae of Rhipicephalus (Boophilus) microplus, Hyalomma anatolicum anatolicum and Haemaphysalis bispinosa (Acari: Ixodidae), fourth instar larvae of Anopheles subpictus, and Culex quinquefasciatus (Diptera: Culicidae) were assessed. The green synthesized TiO2 NPs were analyzed by UV-Vis, FTIR, X-ray diffraction (XRD), AFM, SEM, and TEM. The XRD analysis of synthesized TiO2 NPs revealed the dominant peak at 2θ value of 27.81 which matched the 110 crystallographic plane of the rutile structure indicating the crystal structure. The FTIR spectra exhibited a prominent peak at 3,448 cm(-1) and showed OH stretching due to the alcoholic group, and the OH group may act as a capping agent. The SEM images of TiO2 NPs displayed spherical, oval in shape, individual, and some in aggregates. Characterization of the synthesized TiO2 NPs using AFM offered three-dimensional visualization and uneven surface morphology. The TEM micrograph showed agglomerates, round and slight elongation with an average size of 30 ± 5 nm. The maximum efficacy was observed in synthesized TiO2 NPs against the larvae of R. microplus, Hyalomma anatolicum anatolicum, Haemaphysalis bispinosa, A. subpictus, and Culex quinquefasciatus with LC50 value of 28.56, 33.17, 23.81, 5.84, and 4.34 mg/L, respectively. In the present study, a novel

  13. Espécies de formigas que interagem com as sementes de Mabea fistulifera Mart. (Euphorbiaceae Interaction between ant species and seeds of Mabea fistulifera Mart. (Euphorbiaceae

    Directory of Open Access Journals (Sweden)

    Ethel Fernandes de Oliveira Peternelli

    2004-10-01

    Full Text Available As formigas, quando atraídas por um apêndice nutritivo, produzido na semente de certas plantas, podem exercer o papel de agente predador ou dispersor das sementes. No processo de dispersão, grande número desses insetos pode interagir com sementes de determinada planta. O objetivo deste trabalho foi identificar as espécies de formigas em contato com sementes de Mabea fistulifera Mart. - uma espécie arbórea e colonizadora em áreas antrópicas no Brasil - e o tipo de interação desses insetos com as sementes, bem como determinar as espécies dispersoras. Foram realizadas coletas manuais de formigas em fragmentos de vegetação com alta densidade de M. fistulifera, no município de Viçosa, MG, no momento de sua visitação às sementes. As formigas capturadas foram triadas e identificadas por espécie. Além disso, durante as coletas foram feitas observações quanto ao tipo de comportamento das formigas que se associaram às sementes e ao cálculo da taxa de remoção destas, verificando-se que 16 espécies tiveram contato com estas. Acromyrmex subterraneus subterraneus, Atta sexdens rubropilosa, Ectatomma edentatum, Pachycondyla sp.1 e Pheidole sp. 2 foram, de fato, dispersoras, já que transportaram efetivamente as sementes. Ac. subterraneus subterraneus, Camponotus rufipes, Ectatomma permagnum, Megalomyrmex sp.1, Pachycondyla sp. 1, Pachycondyla sp. 2, Pheidole sp. 4, Pheidole sp. 5 e Pogonomyrmex sp. são, pela primeira vez, relatadas interagindo com sementes. A taxa de remoção das sementes de M. fistulifera pelas formigas foi de 85 a 97%.Ants, when attracted by nutritious corpuscles produced by seeds of certain plant species, can act as predators or dispersing agents. During seed dispersal, a great number of ant species can interact with seeds of a particular plant species. The purpose of this study was to identify the ant species that interact with seeds of Mabea fistulifera Mart., a pioneer tree species in anthropic disturbed

  14. On the identity of some weevil species described by Johann Christian Fabricius (1745–1808 in the Museum of Zoology of Copenhagen (Coleoptera, Cucujoidea, Curculionoidea, Tenebrionoidea

    Directory of Open Access Journals (Sweden)

    Miguel Alonso-Zarazaga

    2014-11-01

    Full Text Available The types of thirty-two nominal weevil species described by Johann Christian Fabricius are reviewed and lecto- and paralectotypes are designated for twenty-two of them. A neotype is designated for Curculio sticticus Fabricius, 1777. Protapion varipes (Germar, 1817 is declared a nomen protectum over Curculio flavipes Fabricius, 1775. Based on a study of syntypes, Rhinomacer curculioides Fabricius, 1781 is confirmed as a member of Mycterus (Mycteridae, Bruchus undatus Fabricius, 1787 is tentatively transferred to Erotylidae, Curculio fulvirostris Fabricius, 1787 and Anthribus roboris Fabricius, 1798 are confirmed as members of Salpingus (Salpingidae, and Brachycerus cristatus Fabricius, 1798 is transferred to Tenebrionidae. Based on lectotype designation, Curculio caninus Fabricius, 1792 is confirmed as a synonym of Sitona lineatus (Linnaeus, 1758 and Curculio innocuus Fabricius, 1802 as a synonym of Cneorhinus barcelonicus (Herbst, 1797. Bruchus rufipes Fabricius, 1792 is not considered an available species name, but a later use of Bruchus rufipes Olivier, 1790. Cossonus incisus Pascoe, 1885 is reinstated as valid from synonymy under Cossonus illigeri Champion, 1909 and Cossonus vulneratus Illiger, 1805 from synonymy under Cossonus canaliculatus (Fabricius, 1792 (a primary homonym of Curculio canaliculatus Olivier, 1791. Cossonus canaliculatus Fabricius, 1802 is a secondary homonym of the former and is replaced with Cossonus incisus. Salpingus fulvirostris (Fabricius, 1787 is reinstated as valid from synonymy under Salpingus planirostris (Fabricius, 1787, a primary homonym of Curculio planirostris Piller & Mitterpacher, 1783. The following new combinations are proposed: Brachysomus erinaceus (Fabricius, 1802 (from Curculio, Bronchus ferus (Gyllenhal, 1840 (from Hipporhinus, Bronchus glandifer (Fabricius, 1792 (from Curculio, Bronchus nivosus (Sparrman, 1785 (from Curculio, Bronchus sparrmani (Gyllenhal, 1833 (from Hipporhinus, Coelocephalapion

  15. Taxonomic Reevaluation of Phrynops (Testudines: Chelidae with the description of two new genera and a new species of Batrachemys

    Directory of Open Access Journals (Sweden)

    William P. McCord

    2001-06-01

    Full Text Available Relationships among turtle species loosely categorized within the South American genus Phrynops are explored. Three once recognized genera (Batrachemys, Mesoclemmys and Phrynops that were demoted to subgenera, and then synonymized with Phrynops, are demonstrated to warrant full recognition based on morphometric analysis, skull osteology, and mitochondrial and nuclear gene sequencing. Mesoclemmys is resurrected from the synonymy of Phrynops as a monotypic genus including M. gibba. The genus Rhinemys, previously a synonym of Phrynops, is resurrected for the species R. rufipes. Ranacephala gen. nov. is described to inciude the species R hogei. The genus Batrachemys is resurrected from the synonymy of Phrynops and inciudes B. dahli, B. nasuta B. raniceps, B. tuberculata, and B. zuliae. The taxon vanderhaegei is placed in Bufocephala gen. nov. The genus Phrynops is redefined to include the taxa P. geoffroanus, P. hilarii, P. tuberosus and P.williamsi. Ciadistic analysis of morphological data supports this taxonomy. A new species of Batrachemys is described from the western Amazon region, and is distinguished by having facial markings in juveniles, a relatively wide head, and a flattened shell. The new species, B. heliostemma sp. nov., is sympatric with and most similar to the recently resurrected form Batrachemys raniceps in the upper Amazonian region of Peru and adjacent Brazil, Ecuador, Venezuela, and Colombia. Lastly, morphometric data from living and museum specimens of all species of Batrachemys are presented.Se investigaron las afinidades entre las especies de tortugas agrupadas casualmente dentro del género suramericano Phrynops. Tres géneros anteriormente reconocidos (Batrachemys, Mesoclemmys, y Phrynops, que fueron subsecuentemente colocados como sub-géneros, y luego puestos bajo sinonimia de Phrynops, se reconocen ahora como géneros válidos basándose en análisis morfométrico, osteología craneal y de secuencias génicas, nucleares y

  16. An initial study of insect succession on decomposing rabbit carrions in Harare,Zimbabwe

    Institute of Scientific and Technical Information of China (English)

    Nyasha; Mabika; Ron; Masendu; Gilbert; Mawera

    2014-01-01

    Objective:To investigate insects visiting sun exposed and shaded decomposing rabbit carcasses and to establish the relationship between insects and carcasses which may be of forensic importance in Harare.Methods:Two rabbits weighing 2.3 kg and 2.5 kg were killed by sharp blows on the head.One was exposed to the sun while the other was placed under shade.The carcasses were allowed to decompose and insects were collected twice a day for the first week and thereafter once a day up to the end of the 7 weeks.Maggots were also collected from the decomposing carcasses and reared.Results:Five dipteran families(Galliphoridae,Muscidae,Sarcophagidae,Phoridae and Drosophilidae)were identified from the sun-exposed carcass.Species collected included Lucilia cuprina(L.cuprina),Chrysomya albiceps(C.albiceps),Musca domestica,Sarcophaga sp.and Drosophila sp.Four families(Calliphoridae,Muscidae,Phoridae,Anthomyiidae)were identified from the shaded carcass.Representatives of these families included L cuprina,C.albiceps,Musca domestica,and Hydrotaea sp.Three Coleopteran families(Histeridae,Cleridae and Dermestidae)were identified from hodt carcasses.The observed species were Saprinus sp,Necrobia rufipes and Dermestes sp.Fomicidae(Hymenoptera)was represented by only one species(Pheidoie sp.)Flies which emerged from the rearing units were L cuprina,Lucilia sp.,C.albiceps,Sarcophaga sp.and Sepsis sp.).Conclusions:Of the dipteran species collected during the study,L cuprina and C.albiceps could be important for further forensic studies since they were collected from the carcasses and also observed from the rearing units.

  17. Weed seed predation by granivorous carabids as influenced by carnivorous carabids

    Directory of Open Access Journals (Sweden)

    de Mol, Friederike

    2014-02-01

    Full Text Available Weed seed predation is influenced for both biological and abiotic factors. Knowledge about these factors is necessary to optimize seed predation as a biological weed control measure. Here, we asked whether carnivorous carabid beetles can affect the seed predation. Additionally, the effect of weather on seed predation rate was investigated. For this purpose, 12, 1m² enclosures were installed in a field (block design with four treatments and three replications in northeastern Germany over a period of 23 days. Treatments in the enclosures were 1 without carabids, 2 with a natural density and species composition of carabids, 3 with granivorous carabid beetles (Pseudoophonus rufipes, Harpulus affinis, and 4 as 3 but additionally with carnivorous carabids (Pterostichus melanarius, Poecilus cupreus Seed predation rate was determined daily using seed cards with Poa annua and Stellaria media seeds. Temperature, relative air humidity and daily precipitation were measured as covariables. In the treatment with granivorous carabids seed predation rate was 54.3 (P. annua resp. 14.3 (S. media seeds per enclosure and day. In the treatment with granivorous and carnivorous carabids, seed predation rate was significantly lower for P. annua (46.6 seeds per enclosure and day, paired Wilcoxon-Test, p = 0.04 and equally high for S. media (14.4 seeds per enclosure and day. In enclosures containing non-manipulated carabid densities 9.1 seeds of P. annua and 7.2 seeds of S. media were lost per enclosure and per day, which is significantly higher than from enclosures that were void of carabids. The minimum night temperature was the only weather variable that significantly influenced seed predation rate. This work contributes to a better understanding of the factors influencing seed predation rates in the field.

  18. Intracellular endosymbiotic bacteria of Camponotus species (carpenter ants): systematics, evolution and ultrastructural characterization.

    Science.gov (United States)

    Schröder, D; Deppisch, H; Obermayer, M; Krohne, G; Stackebrandt, E; Hôlldobler, B; Goebel, W; Gross, R

    1996-08-01

    Intracellular endosymbiotic bacteria inherent to ants of the genus Camponotus were characterized. The bacteria were localized in bacteriocytes, which are specialized cells of both workers and queen ants; these cells are intercalated between epithelial cells of the midgut. The bacteriocytes show a different morphology from the normal epithelial cells and carry a large number of the rod-shaped Gram-negative bacteria free in the cytoplasm. The bacteria were never observed in the neighbouring epithelial cells, but they were found intracellularly in oocytes, strongly indicating a maternal transmission of the bacteria. The 16S DNA encoding rrs loci of the endosymbionts of four species of the genus Camponotus derived either from Germany (C. herculeanus and C. ligniperdus), North America (C. floridanus) or South America (C. rufipes) were cloned after polymerase chain reaction (PCR) amplification using oligonucleotides complementary to all so far known eubacterial rrs sequences. The DNA sequences of the rrs loci of the four endosymbionts were determined, and, using various genus- and species-specific oligonucleotides derived from variable regions in the rrs sequences, the identity of the bacteria present in the bacteriocytes and the ovarian cells was confirmed by PCR and in situ hybridization techniques. Comparison of the 16S DNA sequences with the available database showed the endosymbiotic bacteria to be members of the gamma-subclass of Proteobacteria. They formed a distinct taxonomic group, a sister taxon of the taxons defined by the tsetse fly and aphid endosymbionts. Within the gamma-subclass, the cluster of the ant, tsetse fly and aphid endosymbionts are placed adjacent to the family of Enterobacteriaceae. The evolutionary tree of the ant endosymbionts reflects the systematic classification and geographical distribution of their host insects, indicating an early co-evolution of the symbiotic partners and a vertical transmission of the bacteria.

  19. Hidden diversity behind the zombie-ant fungus Ophiocordyceps unilateralis: four new species described from carpenter ants in Minas Gerais, Brazil.

    Directory of Open Access Journals (Sweden)

    Harry C Evans

    Full Text Available BACKGROUND: Ophiocordyceps unilateralis (Clavicipitaceae: Hypocreales is a fungal pathogen specific to ants of the tribe Camponotini (Formicinae: Formicidae with a pantropical distribution. This so-called zombie or brain-manipulating fungus alters the behaviour of the ant host, causing it to die in an exposed position, typically clinging onto and biting into the adaxial surface of shrub leaves. We (HCE and DPH are currently undertaking a worldwide survey to assess the taxonomy and ecology of this highly variable species. METHODS: We formally describe and name four new species belonging to the O. unilateralis species complex collected from remnant Atlantic rainforest in the south-eastern region (Zona da Mata of the State of Minas Gerais, Brazil. Fully illustrated descriptions of both the asexual (anamorph and sexual (teleomorph stages are provided for each species. The new names are registered in Index Fungorum (registration.indexfungorum.org and have received IF numbers. This paper is also a test case for the electronic publication of new names in mycology. CONCLUSIONS: We are only just beginning to understand the taxonomy and ecology of the Ophiocordyceps unilateralis species complex associated with carpenter ants; macroscopically characterised by a single stalk arising from the dorsal neck region of the ant host on which the anamorph occupies the terminal region and the teleomorph occurs as lateral cushions or plates. Each of the four ant species collected--Camponotus rufipes, C. balzani, C. melanoticus and C. novogranadensis--is attacked by a distinct species of Ophiocordyceps readily separated using traditional micromorphology. The new taxa are named according to their ant host.

  20. ECOLOGICAL SUCCESSION PATTERN OF THE INSECT SPECIES ASSOCIATED WITH THE CARCASS OF THE FREE-RANGING URBAN DOG, Canis domesticus (L.: A TOOL FOR FORENSIC ENTOMOLOGY

    Directory of Open Access Journals (Sweden)

    FARZANA PERVEEN

    2013-01-01

    Full Text Available The free-ranging urban dog, Canis domesticus (L. carcass decomposition in tropical region, i.e., Takht-i-Bahi, Mardan, Khyber Pakhtunkhwa, Pakistan during 15-25 May 2011 was characterized by 5 stages, i.e., fresh (12 h, bloated (13-48 h, active (49-96 h, advanced (97-144 h and dry (145-265 h and the ecological succession pattern of insect species collected were identified into 11 species of 3 orders. The insect species associated with the carcass of C. domesticus found that the blow flies, Chrysomya rufifacies (Macquart and house fly, Musca domestica (Linnaeus, 1758 were found in the fresh, bloat and active decay stages. However, the blow fly, C. megacephala (Fabricius; flesh fly, Parasarcophaga ruficornis (Meigen and the hornet wasp, Vespa orientalis (Linnaeus were existed in the fresh and bloat stages. Moreover, cheese fly, Piophila casei (Linnaeus was found bloat and active decay stages. Further, the hide beetle, Dermestes maculates (Geer, clown beetle, Hister sp. (Gullenhal; ham beetle, Necrobia rufipes (Fabricus and skin beetle, Trox sp. (Harold completed their life cycle in active decay, advance decay and dry stages. Furthermore, the jummper ant, Myrmecia pilosula (Smith was collected from only fresh stage. The specimens of insect species were collected minimum 0.8% of V. orientalis and maximum 21.3% of 2 species, i.e., C. rufifacies and M. domestica. The temperature, humidity and rainfalls were found affected insect larvae, pupae and adults, and rate of decomposition of C. domesticus. The average temperature, humidity and rainfalls were 35.34±1.54, 38.8% and 3.8 mm, respectively, of 11 experimental days. This research will be helpful for forensic entomologist for a case study of death to investigate of crimes in tropical region of Pakistan.

  1. Distribution of tree species in a geomorphological and pedological gradient of submontane semidecidual seasonal forest in the vicinity of Rio Doce state park, Minas Gerais

    Directory of Open Access Journals (Sweden)

    Priscila Bezerra de Souza

    2012-08-01

    Full Text Available The objective of this study was to test the hypothesis that the distribution of tree species in a fragment of submontane seasonal semideciduous forest, a buffer zone in the Parque Estadual do Rio Doce, Minas Gerais, is influenced by geomorphological and weather and soil variables, therefore it can represent a source of information for the restoration of degraded areas where environmental conditions are similar to those of the study area. A detailed soil survey was conducted in the area by sampling three soil profiles per slope segment, totaling 12 profiles. To sample the topsoil, four composite samples were collected from the 10-20 cm layers in each topographic range totaling 16 composite samples. In the low ramp and the lower and upper concave slopes, the texture ranged from clay to sandy-clay. The soil and topographic gradient was characterized by changes in the soil physical-chemical properties. The soil in the 10-20 cm sampled layer was sandier, slightly more fertile and less acid in the low ramp than the clayer soil, nutrient-poor and highly acid soil at the top. The soil conditions in the lower and upper slope of the sampled layers, in turn, were intermediate. The P levels were limiting in all soils. The species distribution along the topographic gradient was associated with variations in chemical fertility, acidity and soil texture. The distribution of Pera leandri, Astronium fraxinifolium, Pouteria torta, Machaerium brasiliense and Myrcia rufipes was correlated with high aluminum levels and to low soil fertility and these species may be indicated for restoration of degraded areas on hillsides and hilltops in regions where environmental conditions are similar. The distribution of Pouteria venosa, Apuleia leiocarpa and Acacia polyphylla was correlated with the less acid and more fertile soil in the environment of the low ramps, indicating the potential for the restoration of similar areas.

  2. OCCURRENCE OF SPECIES FAMILY CARABIDAE (COLEOPTERA INDEPENCE ON THE INPUT OF ORGANIC MATTER INTO SOIL

    Directory of Open Access Journals (Sweden)

    Jana Porhajašová

    2009-03-01

    Full Text Available The aim of this work was to investigate the effects of different rates of organic fertilizers (farmyard manure and bio sludge on occurrence of soil organisms with focus to species of family Carabidae. During 2001-2003, samples of biological material were collected using the earth trap method. Samples were taken from five treatments (i unfertilized, (ii 25 t ha-1 farmyard manure, (iii 50 t ha-1 bio sludge, (iv 50 t ha-1 farmyard manure, (v 100 t ha-1 bio sludge which cover area of 9 000 m2 at experimental farm of Slovak Agricultural University Kolíňany. Totally 59 054 individuals of soil edaphon belong to 23 epigeic groups was collected from which 25 species totally 21 189 individuals belong to the target group Carabidae. The attributes of specific identity according Jaccard (IA ranged from 45.45 to 71.43 % and those of dominant identity (ID from 94.20 to 97.72 %. The attributes of diversity (d achieved a level from 0.5406 to 0.8986. Harpalus rufipes (De Geer, 1774 occurring on arid to damp soil, mostly in light places, was determined as the dominant species. The attributes of individual treatments are influenced by the quantity of organic mater inputs into soil that affects the formation of well-defined communities with the characteristic species composition. A comparison of individual treatments in terms of the occurrence of zooedaphon showed that application of 100 t ha-1 bio sludge create the most suitable soil condition for zooedaphon development.

  3. Mermithid nematodes found in adult Anopheles from southeastern Senegal

    Directory of Open Access Journals (Sweden)

    Kobylinski Kevin C

    2012-06-01

    Full Text Available Abstract Background Over two dozen mermithid nematodes have been described parasitizing mosquitoes worldwide, however, only two species were found in Africa. Mermithid nematodes kill their mosquito host upon emergence, which suggests that they could be developed as biological control agents of mosquitoes. Both Romanomermis culicivorax and Romanomermis iyengari have been reared for mass release to control numerous Anopheles species vector populations, and in one instance this may have led to reduced malaria prevalence in a human population. Methods Anopheles mosquitoes were collected during a malaria study in southeastern Senegal. Two different adult blood fed mosquitoes had a single mermithid nematode emerge from their anus while they were being held post-capture. Primers from the 18 S rDNA were developed to sequence nematode DNA and screen mosquitoes for mermithid DNA. 18 S rDNA from the Senegalese mermithid and other mermithid entries in GenBank were used to create a Maximum Parsimony tree of the Mermithidae family. Results The mermithid was present in 1.8% (10/551 of the sampled adult Anopheles species in our study area. The mermithid was found in An. gambiae s.s., An. funestus, and An. rufipes from the villages of Ndebou, Boundoucondi, and Damboucoye. Maximum parsimony analysis confirmed that the nematode parasites found in Anopheles were indeed mermithid parasites, and of the mermithid sequences available in GenBank, they are most closely related to Strelkovimermis spiculatus. Conclusions To our knowledge, this is the first report of mermithids from adult Anopheles mosquitoes in Senegal. The mermithid appears to infect Anopheles mosquitoes that develop in diverse larval habitats. Although maximum parsimony analysis determined the mermithid was closely related to Strelkovimermis spiculatus, several characteristics of the mermithid were more similar to the Empidomermis genus. Future mermithid isolations will hopefully allow: formal

  4. Determination of Rodent Ectoparasite Fauna in Sarpole-Zahab District, Kermanshah Province, Iran, 2004-2005

    Directory of Open Access Journals (Sweden)

    Z Telmadarraiy

    2007-05-01

    Full Text Available Ectoparasites of various species of rodents were examined from Sarepole Zehab, Kermanshah Province Iran during 2005. This city is bordered with Iraq. A total of 139 rodents included 6 species of hosts were captured during all different seasons and examined for ectoparasites using live trap. The area of study was mainly plateu (70% and mountanous. The hosts including: Microtus socialis, Mus musculus, Rattus rattus, Nesokia indica, Meriones persicus and Tatera indica. The 9 species of ectoparasites recovered included 3 fleas (Pulex irritans, Xenopsylla buxtoni, Nosopsyllus medus, one sucking lice (Polyplax spinolosa, two ticks (Rhipicephalus sp., Hyalomma sp., and 3 mites (Lealaps nuttalli, Dermanysus sanguineus, Ornithonussus bacoti. Among all arthropod collected, the lice and flea had the most and least frequency, i.e. 77.7% and 4.4%, respectivelly. The data showed that the ectoparasites on some rodent hosts tend to prefer particular host body sites, and that some ectoparasite species sites may overlap owing to their inaccessibility to the host.

  5. Determination of Rodent Ectoparasite Fauna in Sarpole-Zahab District, Kermanshah Province, Iran, 2004-2005

    Directory of Open Access Journals (Sweden)

    Z Telmadarraiy

    2007-06-01

    Full Text Available Ectoparasites of various species of rodents were examined from Sarepole Zehab, Kermanshah Province Iran during 2005. This city is bordered with Iraq. A total of 139 rodents included 6 species of hosts were captured during all different seasons and examined for ectoparasites using live trap. The area of study was mainly plateu (70% and mountanous. The hosts including: Microtus socialis, Mus musculus, Rattus rattus, Nesokia indica, Meriones persicus and Tatera indica. The 9 species of ectoparasites recovered included 3 fleas (Pulex irritans, Xenopsylla buxtoni, Nosopsyllus medus, one sucking lice (Polyplax spinolosa, two ticks (Rhipicephalus sp., Hyalomma sp., and 3 mites (Lealaps nuttalli, Dermanysus sanguineus, Ornithonussus bacoti. Among all arthropod collected, the lice and flea had the most and least frequency, i.e. 77.7% and 4.4%, respectivelly. The data showed that the ectoparasites on some rodent hosts tend to prefer particular host body sites, and that some ectoparasite species sites may overlap owing to their inaccessibility to the host.

  6. Fatal cases of Theileria annulata infection in calves in Portugal associated with neoplastic-like lymphoid cell proliferation

    Science.gov (United States)

    Orvalho, João; Leitão, Alexandre; Pereira, Isadora; Malta, Manuel; Mariano, Isabel; Carvalho, Tânia; Baptista, Rui; Shiels, Brian R.; Peleteiro, Maria C.

    2010-01-01

    This study was carried out to investigate fifteen cases of acute lethal infection of calves (≤ 4 months of age) by the protozoan parasite Theileria (T.) annulata in the south of Portugal. Calves developed multifocal to coalescent nodular skin lesions, similar to multicentric malignant lymphoma. Infestation with ticks (genus Hyalomma) was intense. Theileria was seen in blood and lymph node smears, and T. annulata infection was confirmed by isolation of schizont-transformed cells and sequencing of hypervariable region 4 of the 18S rRNA gene. At necropsy, hemorrhagic nodules or nodules with a hemorrhagic halo were seen, particularly in the skin, subcutaneous tissue, skeletal and cardiac muscles, pharynx, trachea and intestinal serosa. Histologically, nodules were formed by large, round, lymphoblastoid neoplastic-like cells. Immunohistochemistry (IHC) identified these cells as mostly CD3 positive T lymphocytes and MAC387 positive macrophages. A marker for B lymphocytes (CD79αcy) labeled very few cells. T. annulata infected cells in these nodules were also identified by IHC through the use of two monoclonal antibodies (1C7 and 1C12) which are diagnostic for the parasite. It was concluded that the pathological changes observed in the different organs and tissues were caused by proliferation of schizont-infected macrophages, which subsequently stimulate a severe uncontrolled proliferation of uninfected T lymphocytes. PMID:20195062

  7. Theileria ovis discovered in China.

    Science.gov (United States)

    Li, Youquan; Guan, Guiquan; Ma, Miling; Liu, Junlong; Ren, Qiaoyun; Luo, Jianxun; Yin, Hong

    2011-01-01

    A polymerase chain reaction (PCR) using 989/990 primers was conducted to identify a newly isolated Theileria sp. in Xinjiang Province of China. The target DNA fragments of the complete 18S rRNA gene were cloned and sequenced. The phylogenetic relationship of newly isolated Theileria spp. was inferred based on the 18S rRNA gene. The results showed that the new Theileria sp. belonged to the cluster of Theileria ovis. Moreover, the findings were confirmed by T. ovis species-specific PCR. An expected 520 bp fragment of T. ovis DNA was obtained from 25 out of 320 (8%) field blood samples, and blood of an experimental sheep infested by Hyalomma anatolicum anatolicum collected in Xinjiang. The infection rate of T. ovis was 78% (25/32) in Xinjiang province. The investigation did not find T. ovis positive samples from the field samples collected from the other twelve provinces. This study indicates that T. ovis is prevalent in Xinjiang province of China and its transmission vector is H. anatolicum anatolicum.

  8. Review of cattle ticks (Acari, Ixodida) in Ivory Coast and geographic distribution of Rhipicephalus (Boophilus) microplus, an emerging tick in West Africa.

    Science.gov (United States)

    Boka, O M; Achi, L; Adakal, H; Azokou, A; Yao, P; Yapi, Y G; Kone, M; Dagnogo, K; Kaboret, Y Y

    2017-04-01

    The exotic tick Rhipicephalus (Boophilus) microplus was discovered in Ivory Coast in 2007 and then gradually in other countries in West Africa. It is known to induce significant losses in farming and to replace other species of the same genus. In order to contribute to improve health and productivity of cattle in Ivory Coast regarding the emergence of this dreaded tick, a study was conducted to determine the current geographic distribution of the tick R. (B.) microplus and review cattle ticks in general. To this end, 23,460 ticks were collected from 180 farms located throughout the country. Ten species of ticks belonging to the genus Rhipicephalus (including those of the subgenus Boophilus), Hyalomma and Ambyomma were identified. It was found that the exotic tick R. (B.) microplus has invaded the entire Ivorian territory and is now the main cattle tick (63.6% of ticks collected), followed by Amblyomma variegatum that remains still dominant in the North. The population of indigenous species of Rhipicephalus (Boophilus) is in drastic decline.

  9. Development and evaluation of a real-time RT-qPCR for detection of Crimean-Congo hemorrhagic fever virus representing different genotypes.

    Science.gov (United States)

    Jääskeläinen, Anne J; Kallio-Kokko, Hannimari; Ozkul, Aykut; Bodur, Hurrem; Korukruoglu, Gulay; Mousavi, Mehrdad; Pranav, Patel; Vaheri, Antti; Mirazimi, Ali; Vapalahti, Olli

    2014-12-01

    Crimean-Congo hemorrhagic fever (CCHF) is a zoonotic disease caused by a nairovirus belonging to family Bunyaviridae. The CCHF virus (CCHFV) can be transmitted to humans by Hyalomma ticks as well as by direct contact with infected body fluids or tissues from viremic livestock or humans. Our aim was to set up a fast RT-qPCR for detection of the different CCHFV genotypes in clinical samples, including an inactivation step to make the sample handling possible in lower biosafety levels (BSL) than BSL-4. This method was evaluated against commercial reference assays and international External Quality Assessment (EQA) samples. The analytical limit of detection for the developed CCHFV-S RT-qPCR was 11 CCHFV genomes per reaction. After exclusion of four dubious samples, we studied 38 CCHFV-positive samples (using reference tests) of which 38 were found positive by CCHFV-S RT-qPCR, suggesting a sensitivity of 100%. CCHFV-S RT q-PCR detected all eight different CCHFV strains representing five different CCHFV genotypes. In conclusion, the CCHFV-S RT-qPCR described in this study was evaluated using various sources of CCHFV samples and shown to be an accurate tool to detect human CCHFV infection caused by different genotypes of the virus.

  10. Detection of novel strains genetically related to Anaplasma platys in Tunisian one-humped camels (Camelus dromedarius).

    Science.gov (United States)

    Belkahia, Hanène; Ben Said, Mourad; Sayahi, Lotfi; Alberti, Alberto; Messadi, Lilia

    2015-10-29

    Little information is currently available regarding the presence of Anaplasma species in North African dromedaries. To fill this gap in knowledge, the prevalence, risk factors, and genetic diversity of Anaplasma species were investigated in Tunisian dromedary camels. A total of 226 camels from three different bioclimatic areas were sampled and tested for the presence of Anaplasma species by quantitative polymerase chain reaction (qPCR) and nested polymerase chain reaction (nPCR) assays. Detected Anaplasma strains were characterized by 16S rRNA sequence analysis. Overall infection rate of Anaplasma spp. was 17.7%, and was significantly higher in females. Notably, A. marginale, A. centrale, A. bovis, and A. phagocytophilum were not detected. Animals were severely infested by three tick species belonging to the genus Hyalomma (H. dromedarii, H. impeltatum, and H. excavatum). Alignment, similarity comparison, and phylogenetic analysis of the 16S rRNA sequence variants obtained in this study suggest that Tunisian dromedaries are infected by more than one novel Anaplasma strain genetically related to A. platys. This study reports the presence of novel Anaplasma sp. strains genetically related to A. platys in dromedaries from various bioclimatic areas of Tunisia. Findings raise new concerns about the specificity of the direct and indirect diagnostic tests routinely used to detect different Anaplasma species in ruminants and provide useful molecular information to elucidate the evolutionary history of bacterial species related to A. platys.

  11. Investigation of the Cases Presenting To Manisa Moris Şinasi Children’s Hospital with a Tick Bite Between 2007 and 2010

    Directory of Open Access Journals (Sweden)

    Tonay İnceboz

    2011-12-01

    Full Text Available Introduction: The purpose of this study was to investigate the cases with a tick bite in Moris Sinasi Children’s Hospital between January 2007 and December 2010. We aimed to retrospectively determine the types of the tick, distribution of the cases according to months and years and personal characteristics of the cases. Materials and Methods: Total number of cases with tick bite in this period was 433. All withdrawn samples were put into alcohol and glycerine and examined under the light microscope. Demographic characteristics including residential areas of the patients, symptoms related to tick borne diseases of the patients and species and other characteristics of ticks removed from the subjects were investigated. Results: Of all 433 children, 182 (42% were female and 251 (58%, male. In 285 (65.8% of 433 tick bite suspected samples, various ectoparasites were detected microscopically. Removed ticks were classified in five genera. The overwhelmingly dominant genera were Hyalomma nymph and it comprised 54% of the collected samples. In terms of ages of children with tick bite suspected samples, 68 (15.7% were 0-1 year old and accordingly 207 (47.8% were 2-5 years old, 124 (28.6% were 6-10 years old and 34 (7.9% were 11-16 years old. Conclusion: Children are at risk for tick bites and tick-borne diseases, and therefore attention should be given, especially during the summer months. (Journal of Current Pediatrics 2011; 9: 116-21

  12. The feasibility of developing a risk assessment for the impact of climate change on the emergence of Crimean-Congo haemorrhagic fever in livestock in Europe: a review.

    Science.gov (United States)

    Gale, P; Estrada-Peña, A; Martinez, M; Ulrich, R G; Wilson, A; Capelli, G; Phipps, P; de la Torre, A; Muñoz, M J; Dottori, M; Mioulet, V; Fooks, A R

    2010-06-01

    Crimean-Congo haemorrhagic fever virus (CCHFV) is one of the most widespread of all medically important arboviruses with ticks of the Hyalomma spp. serving as the main vectors. Infection of livestock by CCHFV serves as a route of exposure to humans, as a reservoir of disease and as a route of importation. This study discusses the pathways and data requirements for a qualitative risk assessment for the emergence of CCHFV in livestock in Europe. A risk map approach is proposed based on layers that include the potential routes of release (e.g. by migrating birds carrying infected ticks) together with the main components for exposure, namely the distributions of the tick vectors, the small vertebrate host reservoirs and the livestock. A layer on landscape fragmentation serves as a surrogate for proximity of livestock to the tick cycle. Although the impact of climate change on the emergence of CCHF is not clear, comparing the distribution of risk factors in each layer currently with those predicted in the 2080s with climate change can be used to speculate how potential high-risk areas may shift. According to the risk pathway, transstadial and/or transovarial transmission in the tick vector are crucial for CCHFV spread. Vector competence and tick vector switching, however, remain critical factors for CCHFV colonization of new regions in Europe. The species of migratory bird is also an important consideration in the release assessment with greater abundance and biodiversity of ground-dwelling birds in southern Europe than in northern Europe.

  13. First molecular evidence of [i]Borrelia burgdorferi[/i] sensu lato in goats, sheep, cattle and camels in Tunisia.

    Science.gov (United States)

    Ben Said, Mourad; Belkahia, Hanène; Alberti, Alberto; Abdi, Khaoula; Zhioua, Manel; Daaloul-Jedidi, Monia; Messadi, Lilia

    2016-09-01

    Borrelia burgdorferi sensu lato (s.l.) are tick-transmitted spirochaetes of veterinary and human importance. Molecular epidemiology data on ruminants are still lacking in most countries of the world. Therefore, the aim of this study was to estimate the rate of B. burgdorferi s.l. infection in ruminants from Tunisia. A total of 1,021 ruminants (303 goats, 260 sheep, 232 cattle and 226 camels) from different bioclimatic areas in Tunisia were investigated for the presence of B. burgdorferi s.l. DNA in blood by real time PCR. Prevalence rates were 30.4% (92/303) in goats, 6.2% (16/260) in sheep, 1.3% (3/232) in cattle, and 1.8% (4/226) in camels. Only tick species belonging to Rhipicephalus and Hyalomma genera were found on the investigated animals. In small ruminants, the prevalence of B. burgdorferi s.l. varied significantly according to localities and farms. Goats located in humid areas were statistically more infected than those located in sub-humid areas. Prevalence rates varied significantly according to age and breed in sheep, and age and tick infestation in goats. This study provides the first insight into the presence of B. burgdorferi s.l. DNA in ruminants in Tunisia, and demonstrates that host species such as goats and sheep may play an important role in natural Lyme disease cycles in this country.

  14. Epidemiology of ixodid ticks in cattle population of various agro-climatic zones of Punjab, India

    Institute of Scientific and Technical Information of China (English)

    Nirbhay Kumar Singh; Shitanshu Shekhar Rath

    2013-01-01

    Objective:To determine the epidemiology of ixodid ticks in bovines of different agro-climatic zones ofPunjab state,India.Methods:A total of4459 cattle of all age groups and sex were examined from eighteen districts of five major agro-climatic zones ofPunjab state, India.Results:The overall prevalence of ixodid ticks,Rhipicephalus microplus(R. microplus), Hyalomma anatolicum anatolicum(H. a. anatolicum) and mixed infestation were58.06%,50.16%, 11.34% and3.45%, respectively.Amongthe various agro-climatic zones highest prevalence rate ofR. microplus andH. a. anatolicumwere recorded in submountain undulating region(79.36%) and western region(20.40%), respectively indicating thatR. microplus prefers a hot and humid environment whereas, arid and semi arid conditions suit better forH. a. anatolicum.The overall prevalence of ixodid ticks was highest in monsoon season(83.74%), followed by summer(69.01%) and least in winters(31.64%) and a significant variation(P1year age group(55.02%) and the difference was statistically significant(P<0.01). Also a significantly higher(P<0.01) infestation rates of ixodid ticks was observed in males. Conclusions:The findings of the current study would provide a basis for evolving effective control strategy for the management of ticks in bovines of the region.

  15. Consensus report: Preventive measures for Crimean-Congo Hemorrhagic Fever during Eid-al-Adha festival

    Directory of Open Access Journals (Sweden)

    Hakan Leblebicioglu

    2015-09-01

    Full Text Available Crimean-Congo hemorrhagic fever (CCHF is endemic in Eurasian countries such as, Turkey, Pakistan, Afghanistan and Iran. CCHF virus is spread by the Hyalomma tick, which is found mainly on cattle and sheep. Muslim countries, in which these animals are sacrificed during Eid-Al-Adha, are among the countries where CCHF is endemic, and it has been observed that CCHF is associated with practices surrounding the Eid-ad-Adha festival. The dates for Eid-Al-Adha drift 10 days earlier in each year according to Georgian calendar. In previous years Eid-al-Adha occurred in autumn-winter months however in the next 10-15 years it will be take place in the summer months when CCHF is more prevalent. This may lead to a rise in the number of cases due to increased dissemination of CCHF virus with uncontrolled animal movements in and between countries. This consensus report focuses on the variable practices regarding animal handling in different regions and possible preventative measures to reduce the incidence of CCHF. Environmental hygiene and personal protection are essential parts of prevention. There is a need for international collaborative preparedness and response plans for prevention and management of CCHF during Eid-Al-Adha in countries where the disease is prevalent.

  16. Ixodid ticks on domestic dogs in the Northern Cape Province of South Africa and in Namibia : short communication

    Directory of Open Access Journals (Sweden)

    S. Matthee

    2010-05-01

    Full Text Available The objective of this study was to determine the species composition of ixodid ticks infesting domestic dogs in the northwestern region of the Northern Cape Province of South Africa and in Namibia. Ticks were collected from February 2008 to January 2009 from dogs presented for a variety of reasons at a veterinary clinic in the Northern Cape Province and at 3 clinics in Namibia. The ticks collected at each place were pooled separately for each month at each locality. Eleven ixodid tick species were collected from dogs in the Northern Cape Province and new locality records for Haemaphysalis colesbergensis and Ixodes rubicundus, new locality and host records for Hyalomma glabrum, and a new host record for Rhipicephalus neumanni are reported. Six tick species were collected from dogs at the 3 clinics in Namibia. The most numerous species on dogs in both countries was R. sanguineus. The present results increase the total number of ixodid tick species collected from dogs in South Africa from 25 to 28.

  17. A Study on Babesia Infection in Sheep of Pars Abad Moghan Region, Ardabil Province (2014

    Directory of Open Access Journals (Sweden)

    SHahram Dastouri Dastgir

    2016-07-01

    Full Text Available Background & objectives: Pars Abad Moghan city, due to the mild weather and numerous Pastures for animals feeding, is a suitable place for breeding sheep and goat. Babesiosis is one of the most important parasitic infection in animals, especially ruminants. Babesia is a protozoa living inside the red blood cells and transmitted to the host by hard Tick especially Rhipicephalus, Hyalomma, Dermacentor and Haemaphysalis. The aim of this study was to consider Babesia infection in sheep of Pars Abad Moghan city. Methods: In order to investigate the prevalence of babesia, 105 sheep in two different seasons of spring and summer were prepared and blood sample was taken and thin and thick smears were done. Thin blood smear was fixed with methanol and in order to determine the presence of the protozoan parasite, Giemsa with ratio of 1 to 14 in distilled water was used for staining. Results: The results showed that the number of 33 samples (31.42% were infected with Babesia. Among these, 18 samples (17.14% were infected with Babesia ovis, 9 (8.57% with babesia motasi and 6 samples (5.71% were infected simultaneously with both species of Babesia ovis and Babesia motasi. Conclusion: The rate of infection to Babesia among the sheep in Pars Abad Moghan city is remarkable. Early diagnosis and early treatment can prevent spread of the disease in this area.

  18. Seasonal fluctuation of parasitic infestation in donkeys (Equus asinus in Oodi village, Kgatleng District, Botswana : short communication

    Directory of Open Access Journals (Sweden)

    E.Z. Mushi

    2003-06-01

    Full Text Available During the period March to September 2000, a study was conducted in Oodi village, Kgatleng District, Botswana, to investigate the seasonal fluctuation of internal, external and blood parasites of donkeys. Twelve adult donkeys were randomly selected from a farmer with a herd of 15 donkeys. Monthly visits were made to the farmer when the donkeys were examined for parasites. The only ectoparasites recovered from the donkeys were instars of various tick species. The most prevalent tick was Rhipicephalus evertsi evertsi (98.4 %, followed by Amblyomma hebraeum and Hyalomma species. The only haemoparasite seen on microscopy was Babesia equi at low parasitaemia in 26.8% of the donkeys. However, no clinical babesiosis was evident. Coprological examination showed the presence of strongyle eggs in moderate numbers. Very low numbers of coccidia oocysts were found in the faecal samples. High tick numbers and worm egg counts coincided with the warm, wet months in contrast to the low numbers recovered during the cold, dry months. An interview conducted by the authors indicated that donkeys were nutritionally marginalised by owners. Supplementary feeding was therefore recommended, especially during the winter months when grazing is poor.

  19. Diversity and distribution of tick species (Acari: Ixodidae) associated with human otoacariasis and socio-ecological risk factors of tick infestations in Sri Lanka.

    Science.gov (United States)

    Ariyarathne, S; Apanaskevich, D A; Amarasinghe, P H; Rajakaruna, R S

    2016-09-01

    Tick infestation in humans is a major public health concern. The diversity and distribution of tick species associated with human otoacariasis was studied in five districts: Anuradhapura, Kandy, Kurunegala, Nuwara Eliya and Ratnapura in the main agro-climatic zones of Sri Lanka. Ticks from patients attending the ear, nose and throat clinics of the General Hospitals were collected during a 3 year period. In total 426 ticks were collected. Most human otoacariasis cases were reported from Kandy (33.8 %) and the fewest from Nuwara Eliya (8.2 %). Of the five tick species identified, nymphs of Dermacentor auratus constituted 90.6 % of the collection. Rhipicephalus sanguineus, Hyalomma isaaci, Haemaphysalis bispinosa and Otobius megnini were found rarely infesting humans possibly as an accidental host; H. bispinosa and O. megnini in the human ear canal were first time records in Sri Lanka. Females and children under 10 years were identified as risk groups of human otoacariasis. Subsequently, a field study was carried out to determine socio-ecological risk factors of human tick infestations in the five districts. Based on hospital data, eight villages with high prevalence of otoacariasis were selected from each district. A total 40 villages were visited and 1674 household members were interviewed. Involvement in outdoor activities, presence of wild animals around the house, location of the house in close proximity to a forest and occupation were identified as major risk factors.

  20. Microscopic Visualisation of Zoonotic Arbovirus Replication in Tick Cell and Organ Cultures Using Semliki Forest Virus Reporter Systems

    Directory of Open Access Journals (Sweden)

    Lesley Bell-Sakyi

    2016-09-01

    Full Text Available Ticks are vectors and reservoirs of many arboviruses pathogenic for humans or domestic animals; in addition, during bloodfeeding they can acquire and harbour pathogenic arboviruses normally transmitted by other arthropods such as mosquitoes. Tick cell and organ cultures provide convenient tools for propagation and study of arboviruses, both tick-borne and insect-borne, enabling elucidation of virus-tick cell interaction and yielding insight into the mechanisms behind vector competence and reservoir potential for different arbovirus species. The mosquito-borne zoonotic alphavirus Semliki Forest virus (SFV, which replicates well in tick cells, has been isolated from Rhipicephalus, Hyalomma, and Amblyomma spp. ticks removed from mammalian hosts in East Africa; however nothing is known about any possible role of ticks in SFV epidemiology. Here we present a light and electron microscopic study of SFV infecting cell lines and organ cultures derived from African Rhipicephalus spp. ticks. As well as demonstrating the applicability of these culture systems for studying virus-vector interactions, we provide preliminary evidence to support the hypothesis that SFV is not normally transmitted by ticks because the virus does not infect midgut cells.

  1. A Preliminary Investigation on Ticks (Acari: Ixodidae) Infesting Birds in Kızılırmak Delta, Turkey.

    Science.gov (United States)

    Keskin, Adem; Erciyas-Yavuz, Kiraz

    2016-01-01

    Ticks are mandatory blood-feeding ectoparasites of mammals, birds, reptiles, and even amphibians. Turkey has a rich bird fauna and is located on the main migration route for many birds. However, information on ticks infesting birds is very limited. In the present study, we aimed to determine ticks infesting birds in Kızılırmak Delta, Turkey. In 2014 autumn bird migration season, a total of 7,452 birds belonging to 79 species, 52 genera, 35 families, and 14 orders were examined for tick infestation. In total, 287 (234 larvae, 47 nymphs, 6♀) ticks were collected from 54 passerine birds (prevalence = 0.72%) belonging to 12 species. Ticks were identified as Amblyomma sp., Dermacentor marginatus (Sulzer), Haemaphysalis concinna Koch, Haemaphysalis punctata Canestrini and Fanzago, Hyalomma sp., Ixodes frontalis (Panzer), and Ixodes ricinus (L). The most common tick species were I. frontalis (223 larvae, 23 nymphs, 6♀) followed by I. ricinus (3 larvae, 12 nymphs) and H. concinna (4 larvae, 6 nymphs). Based on our results, it can be said that Erithacus rubecula (L.) is the main host of immature I. frontalis, whereas Turdus merula L. is the most important carrier of immature stages of some ticks in Kızılırmak Delta, Turkey. To the best of our knowledge, most of the tick-host associations found in this study have never been documented in the literature.

  2. Susceptibilidad de genotipos de Solanum spp. al nematodo causante del nudo radical Meloidogyne spp. (chitwood) Susceptibility of genotypes of Solanum spp. to the nematode causative of the root knot Meloidogyne spp. (chitwood)

    Directory of Open Access Journals (Sweden)

    Cristian Gelpud Chaves

    2011-01-01

    Full Text Available El cultivo del lulo (Solanum quitoense L.) presenta una disminución en su productividad, debido al ataque de patógenos como el nematodo del nudo radical Meloidogyne spp., en el Departamento de Nariño (Colombia), se han reportado incidencias cercanas al 79%, y pérdidas del 50%. En la presente investigación, se colectaron 45 genotipos de (Solanum quitoense L.) en los Departamentos de Nariño y Putumayo y 4 genotipos silvestres (S. mammosum, S. hirtum, S. marginatum y S. umbellatum) buscando fuentes de resistencia al nematodo. Se inocularon 9 plantas de cada genotipo de dos meses de edad con 10000 huevos de Meloidogyne spp., dejando tres testigos por cada material. Las variables evaluadas fueron: altura de planta, severidad, incidencia, peso fresco (tallo y raíz) y especies prevalentes de Meloidogyne spp. Se hizo una clasificación de genotipos mediante escala de resistencia y regresión entre la severidad y las demás variables para establecer el efecto de Meloidogyne spp. sobre los genotipos de planta. Los resultados mostraron 100% de incidencia del nematodo en todos los genotipos, 2.04% genotipos resistentes, 34.7% moderadamente resistentes, 42.8% moderadamente susceptibles, 18.3% susceptibles, y 2.04% altamente susceptibles. El genotipo SQbr05 resistente, no se vio afectado por la severidad, al contrario SQbc04 genotipo susceptible, mostró reducciones significativas en peso fresco de tallo y raíz, (R² = 0.71 y 0.98), el genotipo silvestre (S. mammosum) es altamente susceptible, Meloidogyne incognita presentó 55.31% de presencia. El genotipo SQbr05 es promisorio para ser evaluado en campo.The green orange (Solanum quitoense L.) crop has decreased in its productivity due to the pathogens attack such as the root knot nematode Meloidogyne spp. In the Nariño Department of Colombia, pest incidences near to 79% and losses of 50% have been reported. In this study, 45 genotypes of Solanum quitoense were collected in Nariño and Putumayo

  3. Clinical assessment and echocardiography follow-up results of the children with acute rheumatic fever

    Directory of Open Access Journals (Sweden)

    Ahmet Basturk

    2016-04-01

    Full Text Available Acute rheumatic fever (ARF is an inflammatory collagenous tissue disease which shows its cardinal signs in joints, heart, skin and nervous system while affecting whole connective tissue system more or less. This study was conducted in order to investigate the clinical pattern and severity of ARF, echocardiographic findings and the course of the patients with heart valve involvement by studying the clinical and laboratory aspects of the patients diagnosed with ARF according to updated Jones criteria. The study included 214 patients diagnosed with ARF for the first time between January 2005 and May 2008. All patients were scanned with doppler echocardiography (ECHO between certain intervals. Severity of carditis was grouped into 3 groups of mild, moderate and severe. The frequency of carditis was 57.9%, arthritis was 73.4%, chorea was 11.7% and erythema marginatum was 0.9% but no subcutaneous nodules. Recovery was observed in 22% of the cases of isolated aortic insufficiency (AI, 50% of the cases with isolated mitral insufficiency (MI and 80% of the cases with mitral and aortic insufficiencies together (MI+AI. Recovery in isolated MI was significantly much more than recovery in isolated AI. However, recovery in AI was significantly much more than in MI in cases of mitral and aortic insufficiencies together. In conclusion, ARF is a cause of acquired and preventable heart disease and it can be reversed through right diagnosis and appropriate treatment. Isolated mitral insufficiency, isolated aortic insufficiency and both mitral and aortic insufficiency are observed during a valvular disease. Remission among valvular diseases are most commonly in those with mitral insufficiency and remissions in both mitral and aortic insufficiency occur most commonly in aortic ones. Regular prophylaxis is the key element for long term prevention of patients with ARF.

  4. Sesquiterpene lactones from the Yugoslavian wild growing plant families Asteraceae and Apiaceae (REVIEW

    Directory of Open Access Journals (Sweden)

    MILUTIN STEFANOVIC

    1999-08-01

    Full Text Available 1. Introduction 2. Results 3. Asteraceae 3.1. Genus Artemisia L. 3.1.1. Artemisia annua L. 3.1.2. Artemisia vulgaris L. 3.1.3. Artemisia absinthium L. (warmwood 3.1.4. Artemisia scoparia W. et K. 3.1.5. Artemisia camprestris L. 3.2. Genus Ambrosia L. 3.2.1. Ambrosia artemisiifolia L. (the common rag weed 3.3. Genus Tanacetum L. (syn. Chrysanthemum L. 3.3.1. Tanacetum parthenium L. (feverfew 3.3.2. Tanacetum serotinum L. 3.3.3. Tanacetum vulgare L. (tansy 3.3.4. Tanacetum macrophyllum Willd. 3.3.5. Tanacetum corymbosum L. 3.4. Genus Telekia Baumg. 3.4.1. Telekia speciosa (Schreb. Baumg. 3.5. Genus Inula L. 3.5.1. Inula helenium L. 3.5.2. Inula spiraeifolia L. 3.6. Genus Eupatorium L. 3.6.1. Eupatorium cannabinum L. 3.7. Genus Achillea L. 3.7.1. Achillea abrotanoides Vis. 3.7.2. Achillea millefolium subsp. pannonica 3.7.3. Achillea crithmifolia W. et K. 3.7.4. Achillea clypeolata Sibth. et Sm. 3.7.5. Achillea serbica Nyman 3.7.6. Achillea depressa Janka 3.8. Genus Anthemis L. 3.8.1. Anthemis carpatica Willd. 3.8.2. Anthemis cretica L. subsp. cretica 3.9. Genus Centaurea L. 3.9.1. Centaurea derventana Vis. et Panc. 3.9.2. Centaurea kosaninii Hayek 3.9.3. Centaurea solstitialis L. 4. Apiaceae 4.1. Genus Laserpitium L. 4.1.1. Laserpitium siler L. 4.1.2. Laserpitium marginatum L. 4.1.3. Laserpitium latifolium L. 4.1.4. Laserpitium alpinum W. K. 4.2. Genus Angelica L. 4.2.1. Angelica silvestris L. 4.3. Genus Peucedanum L. 4.3.1. Peucedanum austriacum (Jacq. Koch

  5. Molecular detection of Theileria spp in sheep and vector ticks in Fasa and Kazeroun areas, Fars Province, Iran

    Directory of Open Access Journals (Sweden)

    Yaghfoori, S.

    2013-12-01

    Full Text Available A molecular survey was performed for identification Theileria spp in sheep and ticks during from 2010-2011 in Fasa and Kazeroun areas, Fars province, Iran. A total of 100 sheep from different flocks were clinically examined and blood samples with ixodid ticks collected. The prepared blood smears from capillary vein of ear were stained with giemsa methods and examined by using light microscope. The collected ticks were separated into tick pools with five ticks according to their species and sex. Then, the salivary glands were dissected out in 0.85% saline solution under stereomicroscope. The boold and tick salivary glands samples were examined by using semi-nested PCR. The Theileria spp infection was observed in 46% of blood smears, while 76 % of blood samples were positive by using semi-nested PCR. T. ovis, T. lestoquardi and mixed infection were detected in 43 (43%, 3 (3% and 30 (30% of positive samples, respectively. Any significant difference was not observed between the frequency of Theileria spp infection in sheep of Kazeroun and Fasa areas. In the present study, the most prevalent ticks were R. turanicus 48.8% and followed by H. a. anatolicum 42.2% and H. marginatum 8.8%. The results were shown that one pool belong to salivary glands of H. turanicus were infected with T. ovis. Based on the obtained results, it is concluded that T. ovis have high prevalence with compared to T. lestoquardi and also, R. turanicus could be the vectors T. ovis in this area

  6. Habitat use by mountain nyala Tragelaphus buxtoni determined using stem bite diameters at point of browse, bite rates, and time budgets in the Bale Mountains National Park, Ethiopia

    Directory of Open Access Journals (Sweden)

    Solomon A. TADESSE, Burt P. KOTLER

    2013-12-01

    Full Text Available We studied the habitat use of mountain nyala Tragelaphus buxtoni in the northern edge of the Bale Mountains National Park, Ethiopia. The aims of this study were to: (1 measure and quantify habitat-specific stem bite diameters of mountain nyala foraging on common natural plant species in two major habitat types (i.e. grasslands versus woodlands, and (2 quantify the bite rates (number of bites per minute and the activity time budgets of mountain nyala as functions of habitat type and sex-age category. We randomly laid out three transects in each habitat type. Following each transect, through focal animal observations, we assessed and quantified stem diameters at point of browse (dpb, bite rates, and time budgets of mountain nyala in grasslands versus woodlands. Stem dpb provide a measure of natural giving-up densities (GUDs and can be used to assess foraging costs and efficiencies, with greater stem dpb corresponding to lower costs and greater efficiencies. The results showed that stem dpb, bite rates, induced vigilance, and proportion of time spent in feeding differed between habitats. In particular, mountain nyala had greater stem dpb, higher bite rates, and spent a greater proportion of their time in feeding and less in induced vigilance in the grasslands. In addition, adult females had the highest bite rates, and the browse species Solanum marginatum had the greatest stem dpb. Generally, grasslands provide the mountain nyala with several advantages over the woodlands, including offering lower foraging costs, greater safety, and more time for foraging. The study advocates how behavioural indicators and natural GUDs are used to examine the habitat use of the endangered mountain nyala through applying non-invasive techniques. We conclude that the resulting measures are helpful for guiding conservation and management efforts and could be applicable to a number of endangered wildlife species including the mountain nyala [Current Zoology 59 (6 : 707

  7. Susceptibilidad de genotipos de Solanum spp. al nematodo causante del nudo radical Meloidogyne spp. (chitwood

    Directory of Open Access Journals (Sweden)

    Cristian Gelpud Chaves

    2011-01-01

    Full Text Available El cultivo del lulo (Solanum quitoense L. presenta una disminución en su productividad, debido al ataque de patógenos como el nematodo del nudo radical Meloidogyne spp., en el Departamento de Nariño (Colombia, se han reportado incidencias cercanas al 79%, y pérdidas del 50%. En la presente investigación, se colectaron 45 genotipos de (Solanum quitoense L. en los Departamentos de Nariño y Putumayo y 4 genotipos silvestres (S. mammosum, S. hirtum, S. marginatum y S. umbellatum buscando fuentes de resistencia al nematodo. Se inocularon 9 plantas de cada genotipo de dos meses de edad con 10000 huevos de Meloidogyne spp., dejando tres testigos por cada material. Las variables evaluadas fueron: altura de planta, severidad, incidencia, peso fresco (tallo y raíz y especies prevalentes de Meloidogyne spp. Se hizo una clasificación de genotipos mediante escala de resistencia y regresión entre la severidad y las demás variables para establecer el efecto de Meloidogyne spp. sobre los genotipos de planta. Los resultados mostraron 100% de incidencia del nematodo en todos los genotipos, 2.04% genotipos resistentes, 34.7% moderadamente resistentes, 42.8% moderadamente susceptibles, 18.3% susceptibles, y 2.04% altamente susceptibles. El genotipo SQbr05 resistente, no se vio afectado por la severidad, al contrario SQbc04 genotipo susceptible, mostró reducciones significativas en peso fresco de tallo y raíz, (R² = 0.71 y 0.98, el genotipo silvestre (S. mammosum es altamente susceptible, Meloidogyne incognita presentó 55.31% de presencia. El genotipo SQbr05 es promisorio para ser evaluado en campo.

  8. CLINICAL PROFILE OF RHEUMATIC FEVER AND RHEUMATIC HEART DISEASE IN CHILDREN UNDER 15 YEARS AGE GROUP AND ITS CORRELATION WITH ECHOCARDIOGRAPHY

    Directory of Open Access Journals (Sweden)

    Ramu

    2015-02-01

    Full Text Available Context ( Back ground Acute Rheumatic fever and Rheumatic heart disease are the most common acquired childhood heart disease in India. It is well established that 2 D Echo cardiography is more sensitive in picking up minor degrees of valvular regurgitation than clinical examination . AIMS & OBJECTIVES: To study the clinical profile of “Rheumatic Fever and Rheumatic heart disease“ & correlate it with Echocardiographic fin dings in Children under 15 years age group presenting to a tertiary care hospital. MATERIALS AND METHODS OF STUDY: Thirty six cases of Acute Rheumatic fever, which includes eight cases of first attack and twenty eight cases of reactivation of Rheumatic fev er were studied over a period of two years in paediatric medical wards, King George Hospital, Visakhapatnam. The revised (1992 modified Jones criteria with the 1988 WHO modification was taken as a criterion to diagnose Acute Rheumatic fever . RESULTS : Peak age of Acute Rheumatic fever and Chronic Rheumatic heart disease is between 5 - 10 years (55.8%. No sex variation has been observed. Fever and joint involvement are the most common clinical manifestations (87.5%each in first attack cases. Active cardi tis (75% the second most common manifestation , followed by arthralgia (25% and sore throat (25% , chorea , chest pain , abdominal pain were infrequent manifestations found to be 12.5% each. None of the cases had Erythema marginatum. CONCLUSION : In the pres ent study the clinical findings were correlated with that of previous studies and Echocardiographic findings were correlated well as far as moderate to severe lesions. Further Echocardiography was proved to be more sensitive in detecting even trivial or mi ld aortic regurgitation and mitral or aortic stenosis.

  9. Circumsporozoite protein rates, blood-feeding pattern and frequency of knockdown resistance mutations in Anopheles spp. in two ecological zones of Mauritania.

    Science.gov (United States)

    Lekweiry, Khadijetou Mint; Salem, Mohamed Salem Ould Ahmedou; Cotteaux-Lautard, Christelle; Jarjaval, Fanny; Marin-Jauffre, Adeline; Bogreau, Hervé; Basco, Leonardo; Briolant, Sébastien; Boukhary, Ali Ould Mohamed Salem; Brahim, Khyarhoum Ould; Pagès, Frédéric

    2016-05-05

    Mosquitoes belonging to Anopheles gambiae species complex are the main malaria vector in Mauritania but data on their vector capacities, feeding habits and insecticide susceptibility are still scanty. The objectives of this study were to fill this gap. Adult Anopheles spp. mosquitoes were collected using pyrethrum spray catch method from two ecological zones of Mauritania: Nouakchott (Saharan zone) and Hodh Elgharbi region (Sahelian zone). Circumsporozoite proteins (CSP) for P. falciparum, P. vivax VK210 and P. vivax VK247 were detected by enzyme-linked immunosorbent assay (ELISA) from the female anopheline mosquitoes. To confirm CSP-ELISA results, polymerase chain reaction (PCR) was also performed. Blood meal identification was performed in all engorged females by partial sequencing of the mitochondrial cytochrome b gene. Molecular assessments of pyrethroid knockdown resistance (kdr) and insensitive acetylcholinesterase resistance (ace-1) were conducted. In Nouakchott, the only species of Anopheles identified during the survey was Anopheles arabiensis (356 specimens). In Hodh Elgharbi, 1016 specimens of Anopheles were collected, including 578 (56.9%) Anopheles rufipes, 410 (40.35%) An. arabiensis, 20 (1.96%) An. gambiae, 5 (0.5%) An. pharoensis and 3 (0.3 %) An. funestus. Three of 186 female An. arabiensis collected in Nouakchott and tested by ELISA were found positive for Plasmodium vivax VK210, corresponding to a sporozoite rate of 1.6%; however PCR confirmed infection by P. vivax sporozoite in only one of these. In Hodh Elgharbi, no mosquito was found positive for Plasmodium spp. infection. There was a statistically significant difference in the percentage of human blood-fed Anopheles spp. between Nouakchott (58.7%, 47 of 80 blood-engorged An. arabiensis females) and Hodh Elgharbi (11.1%, 2 of 18 blood-engorged mosquitoes). Analysis of the kdr polymorphisms showed 48.2% (70/145) of East African kdr mutation (L1014S) in Nouakchott compared to 10% (4/40) in Hodh

  10. Abundance and dynamics of anopheline larvae in a highland malarious area of south-central Ethiopia.

    Science.gov (United States)

    Animut, Abebe; Gebre-Michael, Teshome; Balkew, Meshesha; Lindtjørn, Bernt

    2012-06-13

    Malaria is a public health problem in Ethiopia, and increasingly so in highland areas, possibly because of global warming. This study describes the distribution, breeding habitat and monthly dynamics of anopheline larvae in Butajira, a highland area in south-central Ethiopia. A study of the abundance and dynamics of Anopheles larvae was undertaken at different sites and altitudes in Butajira from July 2008 to June 2010. The sites included Hobe (1817 m.a.s.l), Dirama (1995m.a.s.l.) and Wurib (2196m.a.s.l.). Potential anopheline larval habitats were surveyed once per month in each village. The recorded characteristics of the habitats included habitat type, pH, surface debris, emergent plants, algae, substrate, turbidity, temperature, length, width, depth, distance to the nearest house and anophelines. The Spearman correlation coefficient and Mann-Whitney U test were used to calculate the degree of association between the density of anopheline species and key environmental factors. Among the different types of habitat surveyed, the Odamo, Akamuja and Assas streams and Beko swamp were positive for anopheline larvae. A total of 3,957 third and fourth instar larvae were collected from the three localities, and they represented ten species of anophelines. These were: Anopheles cinereus (32.5%), An. arabiensis (31.4%), An. chrysti (23%), An. demeilloni (12.2%), An. pretoriensis (0.6%), An. azaniae (0.1%), An. rufipes(0.1%), An. sergentii (0.06%), An. garnhami (0.06%) and An. pharoensis (0.03%). The density of anopheline larvae was highest during the dry months. An. arabiensis was widely distributed, and its density decreased from the lowest elevation in Hobe to the highest in Wurib. The density of An. arabiensis larvae was correlated positively with larval habitat temperature (r = 0.33, p < 0.05) and negatively with depth of larval habitat (r = -0.56, p < 0.05). Ten species of anophelines were identified, including two known vectors of malaria (An

  11. Effect of rice cultivation on malaria transmission in central Kenya.

    Science.gov (United States)

    Muturi, Ephantus J; Muriu, Simon; Shililu, Josephat; Mwangangi, Joseph; Jacob, Benjamin G; Mbogo, Charles; Githure, John; Novak, Robert J

    2008-02-01

    A 12-month field study was conducted between April 2004 and March 2005 to determine the association between irrigated rice cultivation and malaria transmission in Mwea, Kenya. Adult mosquitoes were collected indoors twice per month in three villages representing non-irrigated, planned, and unplanned rice agro-ecosystems and screened for blood meal sources and Plasmodium falciparum circumsporozoite proteins. Anopheles arabiensis Patton and An. funestus Giles comprised 98.0% and 1.9%, respectively, of the 39,609 female anophelines collected. Other species including An. pharoensis Theobald, An. maculipalpis Giles, An. pretoriensis Theobald, An. coustani Laveran, and An. rufipes Gough comprised the remaining 0.1%. The density of An. arabiensis was highest in the planned rice village and lowest in the non-irrigated village and that of An. funestus was significantly higher in the non-irrigated village than in irrigated ones. The human blood index (HBI) for An. arabiensis was significantly higher in the non-irrigated village compared with irrigated villages. For An. funestus, the HBI for each village differed significantly from the others, being highest in the non-irrigated village and lowest in the planned rice village. The sporozoite rate and annual entomologic inoculation rate (EIR) for An. arabiensis was 1.1% and 3.0 infective bites per person, respectively with no significant difference among villages. Sporozoite positive An. funestus were detected only in planned rice and non-irrigated villages. Overall, 3.0% of An. funestus samples tested positive for Plasmodium falciparum sporozoites. The annual EIR of 2.21 for this species in the non-irrigated village was significantly higher than 0.08 for the planned rice village. We conclude that at least in Mwea Kenya, irrigated rice cultivation may reduce the risk of malaria transmission by An. funestus but has no effect on malaria transmission by An. arabiensis. The zoophilic tendency of malaria vectors in irrigated areas

  12. Detection of Lyme disease pathogens in isolated ticks at Aibi Lake, Alataw Pass, Xinjiang Autonomous Region%新疆阿拉山口艾比湖湿地蜱种莱姆病病原体检测

    Institute of Scientific and Technical Information of China (English)

    王安东; 徐军; 王远志; 徐新龙; 戴莉; 杜景云; 王丽娜; 牟路萌; 肖云霞

    2015-01-01

    Objective In order to understand the major tick species,Borrelia burgdorferi infection and genotype status at Aibi Lake,Alataw Pass,Xinjiang Autonomous Region.Methods Free-living ticks were collected by drag-flag method from April to August,2014,and the morphological identification was carried out.Borrelia spp.was detected by 5S-23S rRNA gene primers.The PCR products were sequenced and analyzed with BLAST.Results One hundred fifty-two isolated ticks were collected,including Rhipicephalus sanguineus (12),Hyalomma asiaticum (59) and Dermacentor Marginatus (81).The positive rate of Borrelia spp.was 34.87% (53/152).The positive rate of Hyalomma asiaticum (57.63%,34/59) was higher than that of Dermacentor Marginatus (22.22%,18/81,x2 =18.328,P < 0.05) and Rhipicephalus sanguineus (8.33%,1/12,x2 =9.694,P < 0.05).The analysis of 5S-23S rRNA sequencing indicated the pathogen was Borrelia burgdorferi sensu stricto.Conclusions Borrelia burgdorferi sensu stricto in ticks is firstly detected in Alataw region.The results conveyed us Aibi Lake was natural epidemic focus of Lyme disease.%目的 了解新疆阿拉山口艾比湖湿地主要蜱种莱姆病螺旋体感染与基因型状况.方法 2014年4-8月,在新疆艾比湖湿地选取3个采集点,采用布旗法采集游离蜱,经形态学鉴定蜱种后,采用巢式PCR法扩增莱姆病病原5S-23S rRNA基因,将PCR产物测序并进行BLAST比对分析.结果 共检测游离蜱152只,其中血红扇头蜱12只、亚洲璃眼蜱59只、边缘革蜱81只.各蜱种莱姆病病原总体阳性率为34.87%(53/152),其中亚洲璃眼蜱阳性率为(57.63%,34/59),边缘革蜱阳性率为(22.22%,18/81),血红扇头蜱阳性率为(8.33%,1/12),亚洲璃眼蜱的阳性率高于边缘革蜱和血红扇头蜱(x2=18.328、9.694,P均<0.05);5S-23SrRNA基因测序比对显示艾比湖湿地莱姆病基因型为伯氏疏螺旋体.结论 首次在新疆阿拉山口艾比湖湿地硬蜱检测到伯氏疏螺旋体,提示新

  13. First international external quality assessment of molecular detection of Crimean-Congo hemorrhagic fever virus.

    Directory of Open Access Journals (Sweden)

    Camille Escadafal

    Full Text Available Crimean-Congo hemorrhagic fever (CCHF is a zoonosis caused by a Nairovirus of the family Bunyaviridae. Infection is transmitted to humans mostly by Hyalomma ticks and also by direct contact with the blood or tissues of infected humans or viremic livestock. Clinical features usually include a rapid progression characterized by hemorrhage, myalgia and fever, with a lethality rate up to 30%. CCHF is one of the most widely distributed viral hemorrhagic fevers and has been reported in Africa, the Middle East and Asia, as well as parts of Europe. There is no approved vaccine or specific treatment against CCHF virus (CCHFV infections. In this context, an accurate diagnosis as well as a reliable surveillance of CCHFV infections is essential. Diagnostic techniques include virus culture, serology and molecular methods, which are now increasingly used. The European Network for the Diagnostics of "Imported" Viral Diseases organized the first international external quality assessment of CCHVF molecular diagnostics in 2011 to assess the efficiency and accurateness of CCHFV molecular methods applied by expert laboratories. A proficiency test panel of 15 samples was distributed to the participants including 10 different CCHFV preparations generated from infected cell cultures, a preparation of plasmid cloned with the nucleoprotein of CCHFV, two CCHFV RNA preparations and two negative controls. Forty-four laboratories worldwide participated in the EQA study and 53 data sets were received. Twenty data sets (38% met all criteria with optimal performance, 10 (19% with acceptable performance, while 23 (43% reported results showing a need for improvement. Differences in performance depended on the method used, the type of strain tested, the concentration of the sample tested and the laboratory performing the test. These results indicate that there is still a need for improving testing conditions and standardizing protocols for the molecular detection of Crimean

  14. Epidemic Situation and Prevention of Bovine Tropical Theileriosis in Xinjiang%新疆牛环形泰勒虫病的流行现状和防治

    Institute of Scientific and Technical Information of China (English)

    曹雯丽; 陈亮; 刘启生; 巴音查汗

    2011-01-01

    环形泰勒虫病是由泰勒科属的环形泰勒原虫寄生于牛、羊和其它野生动物巨噬细胞、淋巴细胞和红细胞内引起的一种危害严重的疾病。该病的传播媒介为璃眼蜱属的多种蜱,是一种季节性很强的地方性流行病,多呈急性型经过,发病率和死亡率均很高,尤其是对外来牛和改良牛,严重影响我区牛业的健康发展。本文从环形泰勒虫的病原形态、生活史、流行病学、我区流行现状及其防治等方面进行综述。%Tropical theileriosis is a serious disease that is caused by Theileria annulata of Theileria which parasitic in macrophages,lymphocytes and red blood cell of cattle,sheep and other wildlifes.The spread of the disease is various ticks of Hyalomma,it is a Strong seasonal local endemic diseases,it is shown more acute type,the morbidity and mortality of the disease are high,especially for foreign cows and improved cattle,it seriously affects the development of cattle.In this essay I will write about the Pathogen morphology,life cycle,epidemiology,epidemic status and prevention of Theileria annulata in Xinjiang.

  15. Ticks imported to Europe with exotic reptiles.

    Science.gov (United States)

    Mihalca, Andrei Daniel

    2015-09-30

    It is known that traded exotic animals carry with them an immense number of associated symbionts, including parasites. Reptiles are no exception. Most of the imported reptiles originate from tropical countries and their possibility to carry potentially dangerous pathogens is high. According to CITES, Europe is currently the main reptile importer in the world. Despite this, there is no review or analysis available for the risk related to the importation of tick-borne diseases with traded reptile to the EU. The main aim of the manuscript is to provide a review on the available literature on ticks introduced to and exchanged between European countries via the live reptile trade. So far, the published reports of ticks imported on reptiles are limited to few European countries: Italy, Poland, Spain, Netherlands, Belgium, Slovenia and UK. The following species have been reported: Hyalomma aegyptium, Amblyomma dissimile, Amblyomma exornatum, Amblyomma flavomaculatum, Amblyomma fuscolineatum, Amblyomma latum, Amblyomma quadricavum, Amblyomma marmoreum, Amblyomma nuttalli, Amblyomma sparsum, Amblyomma sphenodonti, Amblyomma transversale and Amblyomma varanense. The majority of species are of African origin, followed by American and Asian species. All groups of reptiles (chelonians, snakes, lizards, crocodiles, tuataras) were involved. However, it seems that certain groups (i.e. tortoises of genus Testudo, monitor lizards of genus Varanus, snakes of genus Python) are more important as host for imported ticks, but this may be related to higher levels of international trade. Even fewer are the reports of tick-borne pathogens associated with imported reptile ticks. Despite the diversity of tick species reported on imported reptiles, the situations of truly invasive species are atypical and are limited in natural environments to maximum two cases where H. aegyptium was involved. Otherwise, the risk associated with reptile trade for introduction of invasive tick to Europe is low

  16. Control of Tick Infestations in Oryctolagus cuniculus (Lagomorpha: Leporidae) With Spinosad Under Laboratory and Field Conditions.

    Science.gov (United States)

    ValcÁrcel, Félix; SÁnchez, J L Pérez; Jaime, J M Tercero; Basco-Basco, P I; Guajardo, S C Cota; Cutuli, M T; GonzÁlez, J; Olmeda, A S

    2015-03-01

    Because of great economic loss in the world's livestock industry, and the serious risks to human health, the control of ticks and tick-borne diseases is one of the most important health management issues today. Current methodology involves integrated tick control for preventing the development of resistance. Rabbits are hosts for immature stages of the three-host tick Hyalomma lusitanicum Koch; so, we focus on this host as a strategy to interrupt the tick life cycle. Spinosad is an insecticide-acaricide, produced by the fermentation of metabolites of the actinomycete bacterium Saccharopolyspora spinosa. We administered spinosad orally by force-feeding naturally and artificially infested rabbits, and under field conditions by administering treated food via a hopper during the period of peak infestation and reinfestation risk for rabbits. No living larvae were recovered from treated laboratory rabbits. In naturally infested rabbits, the number of live ticks collected from treated rabbits (mean = 0.62 ticks per ear) was significantly lower than those recovered from untreated rabbits (mean = 7.27; P < 0.001), whereas the number of dead ticks collected from untreated rabbits (mean = 6.53) was significantly lower than those recovered from treated rabbits (mean = 18.62; P < 0.001). In addition, free and continually reinfested rabbits freely ingested low doses of spinosad, reducing the tick burden from 48.00 (Day 0) to 26.09 ticks per ear in treated rabbits (Day 16), whereas controls maintained the infection (46.64). This strategy could be useful as an alternative or supplement to traditional acaricides in tick control programs.

  17. Isolation of aerobic bacteria from ticks infested sheep in Iraq

    Institute of Scientific and Technical Information of China (English)

    Waleed Ibrahem Jalil; Mohammad Mushgil Zenad

    2016-01-01

    Objective:To highlight the presence of aerobic bacteria in live ticks infested sheep,in Diyala Governorate,Iraq.Methods:One hundred and thirty adult alive ticks were picked up from sheep which were reared in different farms in Diyala Governorate,Iraq,during the period from November 2012 to May 2013.Ticks were classified in the Natural History Museum in Baghdad.They were dissected aseptically for extraction of the salivary gland and midgut.The removed tissue from each organ was inoculated in buffer peptone water(1%)and incubated for 2 h at 37 °C,to maintain weak and/or injured bacterial cells,then transmitted to nutrient broth incubated at 37 °C for 18 h.Culturing was done on three solid bacteriological media(nutrient,blood and McConkey agars),and then incubated at37 ℃ for 24 h.Bacterial identification was performed by using multiple biochemical tests and API-20 strips.Data were analyzed by using Statistical Analysis System version 9.1,2010.Chi-square test was used for comparison at significant level of P ≤ 0.05.Results:Two species of ticks were identified[Rhipicephalus(Boophilus) annulatus and Hyalomma turanicum].High bacterial isolation rate was observed(483 isolates).A significant high isolation rate was recorded from Rhipicephalus annulatus(63.14%).Six bacterial species were identified[Escherichia coli(28.36%),Pseudomonas aeruginosa(18.01%),Bacillus cereus(14.69%),Staphylococcus aureus(13.66%),Citrobacter freundii(13.04%),and Enterobacter species(12.21%)].Also the high bacterial isolation rates were recorded in the temperate months(November,March and April);these coincided with high reproductive performance of ticks.Conclusions:The high isolation rate of aerobic pathogens from ticks might reflect the active contribution of this arthropod in environmental contamination and increase the probability of transmitting bacterial pathogens to their hosts.

  18. Isolation of aerobic bacteria from ticks infested sheep in Iraq

    Institute of Scientific and Technical Information of China (English)

    Waleed Ibrahem Jalil; Mohammad Mushgil Zenad

    2016-01-01

    Objective: To highlight the presence of aerobic bacteria in live ticks infested sheep, in Diyala Governorate, Iraq. Methods: One hundred and thirty adult alive ticks were picked up from sheep which were reared in different farms in Diyala Governorate, Iraq, during the period from November 2012 to May 2013. Ticks were classified in the Natural History Museum in Baghdad. They were dissected aseptically for extraction of the salivary gland and mid-gut. The removed tissue from each organ was inoculated in buffer peptone water (1%) and incubated for 2 h at 37℃, to maintain weak and/or injured bacterial cells, then transmitted to nutrient broth incubated at 37℃ for 18 h. Culturing was done on three solid bacteriological media (nutrient, blood and McConkey agars), and then incubated at 37℃ for 24 h. Bacterial identification was performed by using multiple biochemical tests and API-20 strips. Data were analyzed by using Statistical Analysis System version 9.1, 2010. Chi-square test was used for comparison at significant level of P ≤0.05. Results: Two species of ticks were identified [Rhipicephalus (Boophilus) annulatus and Hyalomma turanicum]. High bacterial isolation rate was observed (483 isolates). A significant high isolation rate was recorded from Rhipicephalus annulatus (63.14%). Six bacterial species were identified [Escherichia coli (28.36%), Pseudomonas aeruginosa (18.01%), Bacillus cereus (14.69%), Staphylococcus aureus (13.66%), Citrobacter freundii (13.04%), and Enterobacter species (12.21%)]. Also the high bacterial isolation rates were recorded in the temperate months (November, March and April); these coin-cided with high reproductive performance of ticks. Conclusions: The high isolation rate of aerobic pathogens from ticks might reflect the active contribution of this arthropod in environmental contamination and increase the probability of transmitting bacterial pathogens to their hosts.

  19. Isolation and characterization of Babesia pecorum sp. nov. from farmed red deer (Cervus elaphus).

    Science.gov (United States)

    Jouglin, Maggy; Fernández-de-Mera, Isabel G; de la Cotte, Nathalie; Ruiz-Fons, Francisco; Gortázar, Christian; Moreau, Emmanuelle; Bastian, Suzanne; de la Fuente, José; Malandrin, Laurence

    2014-08-26

    The diversity of Babesia species infecting cervids in parts of central and southern Spain was analyzed by collecting blood from farmed red deer (Cervus elaphus). Babesia sp. was isolated in vitro from two red deer herds in Cádiz and Ciudad Real. The number of Babesia sp. carriers differed between the two herds: 36/77 in Cádiz and 1/35 in Ciudad Real. Hyalomma lusitanicum was the most prevalent tick species identified on the Cádiz farm vegetation and on sampled animals, and is therefore a candidate vector. The molecular characteristics of 21 isolates were determined by complete (8 isolates) or partial (13 isolates) 18S rRNA gene sequencing. The sequences were highly similar (over 99.4% identity) and 6 sequence types were identified at the level of one herd only, demonstrating a rather high genetic diversity. They formed a monophyletic clade, and members of the three main sequence types shared a similar morphology and the same erythrocyte susceptibility pattern. This clade also included Babesia sp. Xinjiang isolated from sheep in China and Babesia sp. identified in giraffe in South Africa, with identities higher than 98.3% and statistically relevant phylogenetic support. None of the biological properties analyzed for both Babesia from red deer and Babesia sp. Xinjiang allowed their differentiation (ability to develop in vitro in erythrocytes from cattle and sheep, as well as in erythrocytes from different cervids, unsuccessful infection of calves). We propose the Babesia isolated from red deer as a new species named B. pecorum. Whether Babesia sp. Xinjiang and the Babesia characterized in South Africa belong to the same species is debated.

  20. Transcriptome and microRNome of Theileria annulata Host Cells

    KAUST Repository

    Rchiad, Zineb

    2016-06-01

    Tropical Theileriosis is a parasitic disease of calves with a profound economic impact caused by Theileria annulata, an apicomplexan parasite of the genus Theileria. Transmitted by Hyalomma ticks, T. annulata infects and transforms bovine lymphocytes and macrophages into a cancer-like phenotype characterized by all six hallmarks of cancer. In the current study we investigate the transcriptional landscape of T. annulata-infected lymphocytes to define genes and miRNAs regulated by host cell transformation using next generation sequencing. We also define genes and miRNAs differentially expressed as a result of the attenuation of a T.annulata-infected macrophage cell line used as a vaccine. By comparing the transcriptional landscape of one attenuated and two transformed cell lines we identify four genes that we propose as key factors in transformation and virulence of the T. annulata host cells. We also identify miR- 126-5p as a key regulator of infected cells proliferation, adhesion, survival and invasiveness. In addition to the host cell trascriptome we studied T. annulata transcriptome and identified the role of ROS and TGF-β2 in controlling parasite gene expression. Moreover, we have used the deep parasite ssRNA-seq data to refine the available T. annulata annotation. Taken together, this study provides the full list of host cell’s genes and miRNAs transcriptionally perturbed after infection with T. annulata and after attenuation and describes genes and miRNAs never identified before as players in this type of host cell transformation. Moreover, this study provides the first database for the transcriptome of T. annulata and its host cells using next generation sequencing.

  1. [Prevalence of Anaplasma spp. infection in a desert landscape region of Heshuo, Xinjiang].

    Science.gov (United States)

    Zhang, Gui-lin; Sun, Xiang; Zhao, Yan; Liu, Xiao-min; Zheng, Zhong; Sun, Yi; Liu, Ran

    2013-02-01

    To study the prevalence of Anaplasmosis among human, domestic sheep and tick population in Heshuo area, southern Xinjiang and to investigate the diversity of Anaplasma species. Ticks were captured from wild field and blood samples were collected from healthy residents and their domestic sheep. Indirect fluorescent assay was carried out to determine the presence of Anaplasma specific IgG antibodies in blood sample of human and goats, respectively. Nested PCR and sequence alignment of Anaplasma partial 16S rDNA were used to investigate the diversity of Anaplasma species. 43.31% (55/127) of human beings and 27.50% (55/200) of the goats were found positive for Anaplasma specific IgG. In total, 367 ticks were captured, including 3 genus and 4 species, which mainly consisting of dominate Hyalomma (H.) asiaticum (47.41%) and Rhipicephalus (R.) pumilio (37.60%). 5.00% (18/360) of the questing ticks and 4.49% (7/156) of the goat blood samples were found to have had 16S rDNA, representing Anaplasma sp. by nested PCR, but none was found from human beings. Results from sequential alignment revealed that the positive amplicons were identified to be Anaplasma phagocytophilum (99.2% GU046565, 99.5% GU064897 and 99.5% AB196721) and Anaplasma central (99.2% GU064903). Human and zoonotic anaplasmosis, which were probably transmitted by H. asiaticum and R. pumilio, were co-circulating in the desert landscape of Heshuo area, Xinjiang.

  2. Anaplasma phagocytophilum in sheep and goats in central and southeastern China.

    Science.gov (United States)

    Yang, Jifei; Liu, Zhijie; Niu, Qingli; Liu, Junlong; Han, Rong; Guan, Guiquan; Li, Youquan; Liu, Guangyuan; Luo, Jianxun; Yin, Hong

    2016-11-21

    Anaplasma phagocytophilum is wide spread throughout the world and impacts both human and animal health. Several distinct ecological clusters and ecotypes of the agent have been established on the basis of various genetic loci. However, information on the genetic variability of A. phagocytophilum isolates in China represents a gap in knowledge. The objective of this study was to determine the prevalence and genetic characterization of A. phagocytophilum in small ruminants in central and southeastern China. The presence of A. phagocytophilum was determined in 421 blood samples collected from small ruminants by PCR. Positive samples were genetically characterized based on 16S rRNA and groEL genes. Statistical analyses were conducted to identify ecotypes of A. phagocytophilum strains, to assess their host range and zoonotic potential. Out of 421 sampled small ruminants, 106 (25.2%) were positive for A. phagocytophilum. The positive rate was higher in sheep (35.1%, 40/114) than in goats (26.4%, 66/307) (P Anaplasma sp. was identified and closely related to an isolate previously reported in Hyalomma asiaticum, which clustered independently from all recognized Anaplasma species. A molecular survey of A. phagocytophilum was conducted in sheep and goats from ten provinces in central and southeastern China. Two 16S rRNA variants and a new ecotype of A. phagocytophilum were identified in small ruminants in China. Moreover, a potential novel Anaplasma species was reported in goats. Our findings provide additional information on the complexity of A. phagocytophilum in terms of genetic diversity in China.

  3. Detection and identification of putative bacterial endosymbionts and endogenous viruses in tick cell lines.

    Science.gov (United States)

    Alberdi, M Pilar; Dalby, Matthew J; Rodriguez-Andres, Julio; Fazakerley, John K; Kohl, Alain; Bell-Sakyi, Lesley

    2012-06-01

    As well as being vectors of many viral, bacterial, and protozoan pathogens of medical and veterinary importance, ticks harbour a variety of microorganisms which are not known to be pathogenic for vertebrate hosts. Continuous cell lines established from ixodid and argasid ticks could be infected with such endosymbiotic bacteria and endogenous viruses, but to date very few cell lines have been examined for their presence. DNA and RNA extracted from over 50 tick cell lines deposited in the Roslin Wellcome Trust Tick Cell Biobank (http://tickcells.roslin.ac.uk) were screened for presence of bacteria and RNA viruses, respectively. Sequencing of PCR products amplified using pan-16S rRNA primers revealed the presence of DNA sequences from bacterial endosymbionts in several cell lines derived from Amblyomma and Dermacentor spp. ticks. Identification to species level was attempted using Rickettsia- and Francisella-specific primers. Pan-Nairovirus primers amplified PCR products of uncertain specificity in cell lines derived from Rhipicephalus, Hyalomma, Ixodes, Carios, and Ornithodoros spp. ticks. Further characterisation attempted with primers specific for Crimean-Congo haemorrhagic fever virus segments confirmed the absence of this arbovirus in the cells. A set of pan-Flavivirus primers did not detect endogenous viruses in any of the cell lines. Transmission electron microscopy revealed the presence of endogenous reovirus-like viruses in many of the cell lines; only 4 of these lines gave positive results with primers specific for the tick Orbivirus St Croix River virus, indicating that there may be additional, as yet undescribed 'tick-only' viruses inhabiting tick cell lines.

  4. Tick (Acari: Ixodidae) infestations in cattle along Geba River basin in Guinea-Bissau.

    Science.gov (United States)

    Zúquete, Sara Tudela; Coelho, João; Rosa, Fernanda; Vaz, Yolanda; Cassamá, Bernardo; Padre, Ludovina; Santos, Dulce; Basto, Afonso P; Leitão, Alexandre

    2017-01-01

    Tick infestations are a major problem for animal production in tropical areas where prevention and control remain deficient. The present study sought to assess the awareness of traditional cattle producers towards the importance of ticks and aimed at the identification of tick species infesting bovines within the Geba River basin, Guinea-Bissau. Interviews with producers revealed that the majority directly correlates the presence of ticks with the occurrence of diseases in cattle. However, insufficient or inadequate control approaches prevail. A total of 337 ticks were collected on bovines at 18 different villages (10 during dry season, and 8 during rainy season). The tick species collected during the dry season were Rhipicephalus (Boophilus) geigyi (56.5%), followed by Amblyomma variegatum (23.3%), Rhipicephalus (Boophilus) annulatus (17.6%) and Hyalomma truncatum (1%). In the rainy season A. variegatum was the most collected (88.9%), followed by R. (Boophilus) geigyi (4.2%), R. (Boophilus) annulatus (3.4%), Rhipicephalus sanguineus group (2.8%) and H. truncatum (0.7%). To support species identification, segments of both cytochrome c oxidase I (COI) and 12S ribosomal RNA (12S) genes were sequenced and the data gathered were analysed by maximum likelihood and parsimony. Morphological and genetic data of individual specimens gathered in this study provide relevant information for future studies on tick population dynamics in the region. In addition, it led to a deeper characterization of R. sulcatus and a R. sanguineus-like specimen, exploring their genetic relationship with other R. sanguineus, which supports their classification as distinct species within R. sanguineus group.

  5. New data regarding distribution of cattle ticks in the south-western Indian Ocean islands.

    Science.gov (United States)

    Stachurski, Frédéric; Tortosa, Pablo; Rahajarison, Patrick; Jacquet, Stéphanie; Yssouf, Amina; Huber, Karine

    2013-09-09

    Recent studies have produced new insight into the origin and distribution of some cattle ticks in the south-western Indian Ocean islands. Rhipicephalus appendiculatus, introduced from Tanzania in 2002, is now well established on Grande Comore but has not yet reached the other islands of the archipelago (Mohéli, Anjouan and Mayotte). Only one of the two clades identified in Africa has settled so far. Amblyomma variegatum, which was not supposed to be able to persist in the Antananarivo region (1300 m) nor in other Malagasy regions of high altitude without regular introductions of ticks by infested cattle, is now endemic as a general rule up to 1600 m although other regions of lower altitude (1400 m) are still free of the tick. This species remains confined in a small area of the west coast on La Reunion Island. On the contrary, Hyalomma dromedarii could not settle on Madagascar where it was introduced in 2008 and Rhipicephalus evertsi evertsi is not yet present in Grande Comore despite regular introductions by infested cattle from Tanzania. A phylogeographic approach has been carried out at an intra-specific level for A. variegatum. This study has led to the identification of two main lineages, one covering all species distribution and one restricted to East Africa and the Indian Ocean area. These two lineages are in sympatry in Madagascar where a high genetic diversity has been described, whereas a lower genetic diversity is observed on other islands. These results seem to agree with the historical data concerning the introduction of the tick in the Indian Ocean area.

  6. Molecular cloning and expression of a larval immunogenic protein from the cattle tick Boophilus annulatus.

    Science.gov (United States)

    Shahein, Yasser Ezzat

    2008-02-15

    A full-length cDNA of an immunogenic protein was cloned from a cDNA library of the local Egyptian cattle tick Boophilus annulatus. Antibodies raised against B. annulatus larval proteins were used to screen a cDNA expression library. A 936bp cloned fragment was sequenced and showed an open reading frame of 516bp encoding a protein of 171 amino acids. Comparison of the deduced amino acid sequence with protein data bank revealed that the sequence is related to a sequence isolated from the hard tick Haemaphysalis qinghaiensis (Hq05). Southern blot analysis of B. annulatus genomic DNA showed that the cloned cDNA hybridized to double bands per restriction digest, suggesting that the cloned cDNA is a double copy gene. Amino acid analysis of the cloned gene revealed the presence of two casein kinase II phosphorylation sites in the N-terminal domain suggesting that this molecule may be involved in the signal transduction or gene expression pathways. RT-PCR and northern blotting revealed the presence of two isoforms of the Ba05 gene in salivary glands and in the 3-day-old eggs. The cloned gene without the signal peptide, was expressed in Escherichia coli under T7 promotor of pET-30b vector, and purified under denaturation conditions. The purified protein appeared as a single band on 12% SDS-PAGE with a molecular weight around 22.8kDa including the histidine tag of the vector. Antibodies raised against the purified molecule were used to detect the B. annulatus homologue to the Hq05 gene in whole tick, larvae and gut protein extracts. Immunoblotting revealed the presence of this molecule Ba05 only in whole tick and larval protein extracts and not in the gut protein extract. Using the same antibodies, homologues to the Ba05 gene were detected in other tick species as Hyalomma dromedarii and Rhipicephalus sp. but not in Ornithodoros moubata.

  7. Molecular cloning, expression and characterization of a functional GSTmu class from the cattle tick Boophilus annulatus.

    Science.gov (United States)

    Shahein, Yasser Ezzat; El Sayed El-Hakim, Amr; Abouelella, Amira Mohamed Kamal; Hamed, Ragaa Reda; Allam, Shaimaa Abdul-Moez; Farid, Nevin Mahmoud

    2008-03-25

    A full-length cDNA of a glutathione S-transferase (GST) was cloned from a cDNA library of the local Egyptian cattle tick Boophilus annulatus. The 672 bp cloned fragment was sequenced and showed an open reading frame encoding a protein of 223 amino acids. Comparison of the deduced amino acid sequence with GSTs from other species revealed that the sequence is closely related to the mammalian mu-class GST. The cloned gene was expressed in E. coli under T7 promotor of pET-30b vector, and purified under native conditions. The purified enzyme appeared as a single band on 12% SDS-PAGE and has a molecular weight of 30.8 kDa including the histidine tag of the vector. The purified enzyme was assayed upon the chromogenic substrate 1-chloro-2,4-dinitrobenzene (CDNB) and the recombinant enzyme showed high level of activity even in the presence of the beta-galactosidase region on its 5' end and showed maximum activity at pH 7.5. The Km values for CDNB and GSH were 0.57 and 0.79 mM, respectively. The over expressed rBaGST showed high activity toward CDNB (121 units/mg protein) and less toward DCNB (29.3 units/mg protein). rBaGST exhibited peroxidatic activity on cumene hydroperoxide sharing this property with GSTs belonging to the GST alpha class. I50 values for cibacron blue and bromosulfophthalein were 0.22 and 8.45 microM, respectively, sharing this property with the mammalian GSTmu class. Immunoblotting revealed the presence of the GST molecule in B. annulatus protein extracts; whole tick, larvae, gut, salivary gland and ovary. Homologues to the GSTmu were also detected in other tick species as Hyalomma dromedarii and Rhipicephalus sp. while in Ornithodoros moubata, GSTmu homologue could not be detected.

  8. PCR screening of tick-borne agents in sensitive conservation areas, Southeast Portugal.

    Science.gov (United States)

    Santos-Silva, Maria Margarida; Melo, Pedro; Santos, Nuno; Antunes, Sandra; Duarte, Luís Raposo; Ferrolho, Joana; Milhano, Natacha; Santos, Patrícia Tavares; Domingos, Ana; Santos, Ana Sofia

    2017-02-01

    The Southeast region of Portugal, particularly the Guadiana valley, is currently the reintroduction territory of Lynx pardinus (Iberian lynx), one of the most endangered felids in the world that is only found in the Iberian Peninsula. Over the last century, populations have declined, placing L. pardinus at extremely high risk of extinction in the wild and relying on reintroduction projects. Among the aspects taken into account in the establishment of new populations is the sanitary status of the selected habitats, especially concerning infectious diseases, including tick-borne pathogens (TBPs). This study presents the results of TBPs survey on ticks collected at sensitive conservation areas of Southeast Portugal. From 2012 to 2014, 231 ticks obtained from vegetation, sympatric domestic and wild animals were submitted for analysis. The presence of Babesia spp., Cytauxzoon spp., Theileria spp., Hepatozoon spp., Anaplasma spp., Ehrlichia spp., Candidatus Neoehrlichia mikurensis, among other Anaplasmataceae, and Coxiella burnetii were investigated by PCR. Six tick species were recorded, Dermacentor marginatus (n = 13/5.6%), Hyalomma lusitanicum (n = 175/75.8%), Ixodes ricinus (n = 4/1.7%), Rhipicephalus bursa (n = 7/3.0%), R. pusillus (n = 21/9.1%) and R. sanguineus sensu lato (n = 11/4.8%). The molecular screening confirmed the presence of two tick-borne pathogens, C. burnetii (N = 34) and Anaplasma platys (N = 1), and one tick-endosymbiont, Candidatus Midichloria mitochondrii (N = 45). The results obtained provide new information on the circulation of ticks and TBPs with potential veterinary importance in Iberian lynx habitat. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Studies on prevalence, risk indicators and control options for tick infestation in ruminants

    Directory of Open Access Journals (Sweden)

    Nady M. Asmaa

    2014-03-01

    Full Text Available An epidemiological study was conducted at Benisuef district to determine the current situation and associated determinants of tick infestations in ruminants and to assess the efficacy of three different types of insecticides against tick infestation under field conditions. Total of (1082 animals of different species (540 cattle, 230 buffaloes, 108 of each sheep & goats and 96 camels were selected randomly and examined carefully for tick infestation. About (30.1% of total observed animals were found tick infested with highest rate in cattle (60.5% followed by goats (25.9%, buffaloes (17.8%, sheep (14.8% while no tick infestation recorded in camels. The most prevalent tick's species affecting ruminants was Boophilus annulatus (26.5% followed by Hyalomma anatolicum (6.1% then Rhipicephalus turanicus (3.4%. Regarding the associated risk factors, tick infestation was found statistically significant (P 3 years (78.8% followed by at age, ≤2 months (57.8% and during summer months were found highly significant (P < 0.01 in cattle ( 76.5% followed by goats and sheep (33.3% & 22.9% resp., comparing with results in winter. The preferred sites of ticks' attachment to infested animals were udders and external genitalia (70.7% of each then Neck & chest (63.0% of each, inner thighs (61.1%, perineum (41.7%, ears (14.6%, around eyes (11.7%. The obtained results revealed that poor husbandry practices of small holder farmers be a determinant making the animals more prone to tick infestation in this district. Improving the hygienic conditions associated with treatment of infested cattle with Ivermectin (0.2 mg/kg b.wt, S/C and spraying of Deltamethrin (1% for surrounding environment twice every 14 days are recommended for control of tick infestation under field condition.

  10. Development of three quantitative real-time PCR assays for the detection of Rickettsia raoultii, Rickettsia slovaca, and Rickettsia aeschlimannii and their validation with ticks from the country of Georgia and the Republic of Azerbaijan.

    Science.gov (United States)

    Jiang, Ju; You, Brian J; Liu, Evan; Apte, Anisha; Yarina, Tamasin R; Myers, Todd E; Lee, John S; Francesconi, Stephen C; O'Guinn, Monica L; Tsertsvadze, Nikoloz; Vephkhvadze, Nino; Babuadze, Giorgi; Sidamonidze, Ketevan; Kokhreidze, Maka; Donduashvili, Marina; Onashvili, Tinatin; Ismayilov, Afrail; Agayev, Nigar; Aliyev, Mubariz; Muttalibov, Nizam; Richards, Allen L

    2012-12-01

    A previous surveillance study of human pathogens within ticks collected in the country of Georgia showed a relatively high infection rate for Rickettsia raoultii, R. slovaca, and R. aeschlimannii. These 3 spotted fever group rickettsiae are human pathogens: R. raoultii and R. slovaca cause tick-borne lymphadenopathy (TIBOLA), and R. aeschlimannii causes an infection characterized by fever and maculopapular rash. Three quantitative real-time polymerase chain reaction (qPCR) assays, Rraoul, Rslov, and Raesch were developed and optimized to detect R. raoultii, R. slovaca, and R. aeschlimannii, respectively, by targeting fragments of the outer membrane protein B gene (ompB) using species-specific molecular beacon or TaqMan probes. The 3 qPCR assays showed 100% specificity when tested against a rickettsiae DNA panel (n=20) and a bacteria DNA panel (n=12). The limit of detection was found to be at least 3 copies per reaction for all assays. Validation of the assays using previously investigated tick nucleic acid preparations, which included Rickettsia-free tick samples, tick samples that contain R. raoultii, R. slovaca, R. aeschlimannii, and other Rickettsia spp., gave 100% sensitivity for all 3 qPCR assays. In addition, a total of 65 tick nucleic acid preparations (representing 259 individual ticks) collected from the country of Georgia and the Republic of Azerbaijan in 2009 was tested using the 3 qPCR assays. R. raoultii, R. slovaca, and R. aeschlimannii were not detected in any ticks (n=31) from the Republic of Azerbaijan, but in the ticks from the country of Georgia (n=228) the minimal infection rate for R. raoultii and R. slovaca in Dermacentor marginatus was 10% and 4%, respectively, and for R. aeschlimannii in Haemaphysalis sulcata and Hyalomma spp. it was 1.9% and 20%, respectively.

  11. Hedgehogs (Erinaceus europaeus as a Source of Ectoparasites in Urban-suburban Areas of Northwest of Iran

    Directory of Open Access Journals (Sweden)

    Nasser Hajipour

    2015-10-01

    Full Text Available Background: Hedgehogs are small, nocturnal mammals which become popular in the world and have important role in transmission of zoonotic agents. Thus, the present study aimed to survey ectoparasite infestation from April 2010 to December 2011 in urban and suburban parts of Urmia and Tabriz Cities, Northwest of Iran.Methods: A total number of 84 hedgehogs (40 females and 44 males were examined. They have been carefully inspected for ectoparasites and collected arthropods were stored in 70% ethanol solution. The identification of arthropods was carried out using morphological diagnostic keys.Results: The occurrence of ticks on hedgehogs was 23 (67.7% with Rhipicephalus turanicus in Urmia and 11 (22% as well as 1(2% with Rh. turanicus and Hyalomma anatolicum anatolicum in Tabriz, respectively. One flea species, Archaeopsylla erinacei, was found with prevalence of 19 (55.9% and 27 (54% in Urmia and Tabriz Cities, respectively. Prevalence of infestation with Rh. turanicus and A. erinacei were not different (P> 0.05 between sexes of hedgehogs in two study areas. Highest prevalence of tick and flea infestation was in June in Urmia, whereas it was observed in August in Tabriz. Both tick and flea parasitizing hedgehogs showed seasonal difference in prevalence (P< 0.05 in Urmia, but it was not detected in Tabriz (P> 0.05.Conclusion: The result showed the high occurrence of ectoparasites in hedgehog population and according to the zoonotic potential of these animals as vector of some agents further studies are needed to investigate in different parts of Iran.

  12. The comparative host status of red veld rats (Aethomys chrysophilus) and bushveld gerbils (Tatera leucogaster) for epifaunal arthropods in the southern Kruger National Park, South Africa.

    Science.gov (United States)

    Braack, L E; Horak, I G; Jordaan, L C; Segerman, J; Louw, J P

    1996-06-01

    Red veld rats (Aethomys chrysophilus) and bushveld gerbils (Tatera leucogaster) were trapped at monthly intervals, when possible, over a 2-year period, in the southern Kruger National Park, Mpumalanga Province. Forty-six specimens of each species were caught, euthenased and microscopically examined for fleas, lice, ticks and mites. Clear differences existed between the two rodent hosts in infestation intensity and also parasite species. The flea, Xenopsylla brasiliensis, commonly and exclusively utilized red veld rats, whereas Xenopsylla frayi was common and specific to bushveld gerbils. T. leucogaster were commonly infested with the lice Hoplopleura biseriata and Polyplax biseriata, while only a single A. chrysophilus hosted the louse, Hoplopleura patersoni. Red veld rats harboured small numbers of the immature stages of Haemaphysalis leachi/spinulosa and relatively large numbers of Rhipicephalus simus. The larvae of R. simus were irregularly collected from February to September and the nymphs from March to November. Bushveld gerbils hosted fewer ticks than did the rats, with a single specimen of H. leachi/spinulosa and low numbers of immature Hyalomma truncatum, the latter erratically present from June to October. Miles were abundant on both rodent hosts, A. chrysophilus hosting 13 species in six families, and T. leucogaster hosting 12 species representing seven families, with clear differences in mite assemblages between the two rodents. As the rats and gerbils were collected from the same trap lines at the same times, the differences in species composition and infestation intensity of their parasites, suggest that immunological behavioural or other segregating mechanisms are in operation to maintain discrete parasite assemblages.

  13. Scientific Opinion on the Role of Tick Vectors in the Epidemiology of Crimean-Congo Hemorrhagic Fever and African Swine Fever in Eurasia

    Directory of Open Access Journals (Sweden)

    EFSA Panel on Animal Health and Welfare (AHAW

    2010-08-01

    Full Text Available The report provides an update on the role of the tick vectors in the epidemiology of African swine fever (ASF and Crimean and Congo haemorrhagic fever (CCHF in Eurasia, specifically to review of the geographical distribution of the relevant ticks with presentation of maps of their occurrence in Europe and Mediterranean basin; a description of the factors that define the relevant tick population dynamics and identify possible high risk areas in the EU; an update on the role of tick vectors associated with CCHF and ASF in Eurasia; and reviews available methods for the control of the relevant tick vectors. Data were collected through systematic literature review in a database from which maps of geographic distribution of ticks, CCHF virus and ASF virus were issued. The main vectors for CCHF are Hyalomma spp, Increase in the number of fragmented areas and the degradation of agricultural lands to bush lands are the two main factors in the creation of new foci of CCHF in endemic areas. Movement of livestock and wildlife species, which may carry infected ticks, contributes to the spread of the infection. The Middle East and Balkan countries are the most likely sources of introduction of CCHFV into other European countries. All the Ornithodoros species investigated so far can become infective with ASF virus and are perhaps biological vectors. These ticks are important in maintaining the local foci of the ASFV, but do not play an active role in the geographical spread of the virus. Wild boars have never been found infested by Ornithodoros spp. because wild boars normally do not rest inside protected burrows, but above the ground. There is no single ideal solution to the control of ticks relevant for CCHF or ASF. The integrated control approach is probably the most effective.

  14. Detection and identification of putative bacterial endosymbionts and endogenous viruses in tick cell lines☆

    Science.gov (United States)

    Alberdi, M. Pilar; Dalby, Matthew J.; Rodriguez-Andres, Julio; Fazakerley, John K.; Kohl, Alain; Bell-Sakyi, Lesley

    2012-01-01

    As well as being vectors of many viral, bacterial, and protozoan pathogens of medical and veterinary importance, ticks harbour a variety of microorganisms which are not known to be pathogenic for vertebrate hosts. Continuous cell lines established from ixodid and argasid ticks could be infected with such endosymbiotic bacteria and endogenous viruses, but to date very few cell lines have been examined for their presence. DNA and RNA extracted from over 50 tick cell lines deposited in the Roslin Wellcome Trust Tick Cell Biobank (http://tickcells.roslin.ac.uk) were screened for presence of bacteria and RNA viruses, respectively. Sequencing of PCR products amplified using pan-16S rRNA primers revealed the presence of DNA sequences from bacterial endosymbionts in several cell lines derived from Amblyomma and Dermacentor spp. ticks. Identification to species level was attempted using Rickettsia- and Francisella-specific primers. Pan-Nairovirus primers amplified PCR products of uncertain specificity in cell lines derived from Rhipicephalus, Hyalomma, Ixodes, Carios, and Ornithodoros spp. ticks. Further characterisation attempted with primers specific for Crimean-Congo haemorrhagic fever virus segments confirmed the absence of this arbovirus in the cells. A set of pan-Flavivirus primers did not detect endogenous viruses in any of the cell lines. Transmission electron microscopy revealed the presence of endogenous reovirus-like viruses in many of the cell lines; only 4 of these lines gave positive results with primers specific for the tick Orbivirus St Croix River virus, indicating that there may be additional, as yet undescribed ‘tick-only’ viruses inhabiting tick cell lines. PMID:22743047

  15. Gene silencing in tick cell lines using small interfering or long double-stranded RNA.

    Science.gov (United States)

    Barry, Gerald; Alberdi, Pilar; Schnettler, Esther; Weisheit, Sabine; Kohl, Alain; Fazakerley, John K; Bell-Sakyi, Lesley

    2013-03-01

    Gene silencing by RNA interference (RNAi) is an important research tool in many areas of biology. To effectively harness the power of this technique in order to explore tick functional genomics and tick-microorganism interactions, optimised parameters for RNAi-mediated gene silencing in tick cells need to be established. Ten cell lines from four economically important ixodid tick genera (Amblyomma, Hyalomma, Ixodes and Rhipicephalus including the sub-species Boophilus) were used to examine key parameters including small interfering RNA (siRNA), double stranded RNA (dsRNA), transfection reagent and incubation time for silencing virus reporter and endogenous tick genes. Transfection reagents were essential for the uptake of siRNA whereas long dsRNA alone was taken up by most tick cell lines. Significant virus reporter protein knockdown was achieved using either siRNA or dsRNA in all the cell lines tested. Optimum conditions varied according to the cell line. Consistency between replicates and duration of incubation with dsRNA were addressed for two Ixodes scapularis cell lines; IDE8 supported more consistent and effective silencing of the endogenous gene subolesin than ISE6, and highly significant knockdown of the endogenous gene 2I1F6 in IDE8 cells was achieved within 48 h incubation with dsRNA. In summary, this study shows that gene silencing by RNAi in tick cell lines is generally more efficient with dsRNA than with siRNA but results vary between cell lines and optimal parameters need to be determined for each experimental system.

  16. Detection of Bartonella tamiae, Coxiella burnetii and rickettsiae in arthropods and tissues from wild and domestic animals in northeastern Algeria.

    Science.gov (United States)

    Leulmi, Hamza; Aouadi, Atef; Bitam, Idir; Bessas, Amina; Benakhla, Ahmed; Raoult, Didier; Parola, Philippe

    2016-01-20

    In recent years, the scope and importance of emergent vector-borne diseases has increased dramatically. In Algeria, only limited information is currently available concerning the presence and prevalence of these zoonotic diseases. For this reason, we conducted a survey of hematophagous ectoparasites of domestic mammals and/or spleens of wild animals in El Tarf and Souk Ahras, Algeria. Using real-time PCR, standard PCR and sequencing, the presence of Bartonella spp., Rickettsia spp., Borrelia spp. and Coxiella burnetii was evaluated in 268/1626 ticks, 136 fleas, 11 Nycteribiidae flies and 16 spleens of domestic and/or wild animals from the El Tarf and Souk Ahras areas. For the first time in Algeria, Bartonella tamiae was detected in 12/19 (63.2%) Ixodes vespertilionis ticks, 8/11 (72.7%) Nycteribiidae spp. flies and in 6/10 (60%) bat spleens (Chiroptera spp.). DNA from Coxiella burnetii, the agent of Q fever, was also identified in 3/19 (15.8%) I. vespertilionis from bats. Rickettsia slovaca, the agent of tick-borne lymphadenopathy, was detected in 1/1 (100%) Haemaphysalis punctata and 2/3 (66.7%) Dermacentor marginatus ticks collected from two boars (Sus scrofa algira) respectively. Ri. massiliae, an agent of spotted fever, was detected in 38/94 (40.4%) Rhipicephalus sanguineus sensu lato collected from cattle, sheep, dogs, boars and jackals. DNA of Ri. aeschlimannii was detected in 6/20 (30%) Hyalomma anatolicum excavatum and 6/20 (30%) Hy. scupense from cattle. Finally, Ri. felis, an emerging rickettsial pathogen, was detected in 80/110 (72.7%) Archaeopsylla erinacei and 2/2 (100%) Ctenocephalides felis of hedgehogs (Atelerix algirus). In this study, we expanded knowledge about the repertoire of ticks and flea-borne bacteria present in ectoparasites and/or tissues of domestic and wild animals in Algeria.

  17. Climate suitability for European ticks: assessing species distribution models against null models and projection under AR5 climate.

    Science.gov (United States)

    Williams, Hefin Wyn; Cross, Dónall Eoin; Crump, Heather Louise; Drost, Cornelis Jan; Thomas, Christopher James

    2015-08-28

    There is increasing evidence that the geographic distribution of tick species is changing. Whilst correlative Species Distribution Models (SDMs) have been used to predict areas that are potentially suitable for ticks, models have often been assessed without due consideration for spatial patterns in the data that may inflate the influence of predictor variables on species distributions. This study used null models to rigorously evaluate the role of climate and the potential for climate change to affect future climate suitability for eight European tick species, including several important disease vectors. We undertook a comparative assessment of the performance of Maxent and Mahalanobis Distance SDMs based on observed data against those of null models based on null species distributions or null climate data. This enabled the identification of species whose distributions demonstrate a significant association with climate variables. Latest generation (AR5) climate projections were subsequently used to project future climate suitability under four Representative Concentration Pathways (RCPs). Seven out of eight tick species exhibited strong climatic signals within their observed distributions. Future projections intimate varying degrees of northward shift in climate suitability for these tick species, with the greatest shifts forecasted under the most extreme RCPs. Despite the high performance measure obtained for the observed model of Hyalomma lusitanicum, it did not perform significantly better than null models; this may result from the effects of non-climatic factors on its distribution. By comparing observed SDMs with null models, our results allow confidence that we have identified climate signals in tick distributions that are not simply a consequence of spatial patterns in the data. Observed climate-driven SDMs for seven out of eight species performed significantly better than null models, demonstrating the vulnerability of these tick species to the effects of

  18. Effect of Peganum harmala (wild rue extract on experimental ovine malignant theileriosis : pathological and parasitological findings

    Directory of Open Access Journals (Sweden)

    A. Derakhshanfar

    2008-09-01

    Full Text Available Malignant theileriosis of sheep is a highly fatal, acute or subacute disease is caused by the tick-borne protozoan parasite, Theileria hirci. In this investigation ten healthy male lambs aged 5-6 months were randomly divided into two groups, A and B and were kept in isolated tick-proof pens. They were treated for internal and external parasite before commencement of the experiment. The lambs were experimentally infected with T. hirci by placing ticks Hyalomma anatolicum anatolicum infected with T. hirci on them. The ticks used in this survey had originally been isolated from sheep and colonies of them were established in an insectarium. Before and after infection rectal temperatures and clinical signs of the lambs were recorded, blood and prescapular lymph node smears were prepared and examined to determine the extent of the parasitaemia, and blood samples were analyzed to evaluate their haemoglobin (Hb and packed cell volume (PCV rates. Three days after the commencement of a febrile reaction and appearance of the schizonts in the lymph node smears, treatment of the lambs in Group A with an extract containing the alkaloids of Peganum harmala (wild rue was commenced. Group B lambs were kept untreated controls. Before treatment there were no significant differences in the rectal temperature, parasitaemia rate, and the Hb and PCV values between animals in the two groups but after treatment significant differences in these values was detected (P < 0.05. After treatment, the clinical signs and parasites in the lymph node smears of the animals in Group A disappeared and they all animals recovered. These parameters in the animals of Group B progressed until their death. Pathological studies showed the characteristic lesions of theileriosis in lambs in Group B, but not in Group A. The results indicate a therapeutic effect of the alkaloids of P. harmala for treatment of ovine malignant theileriosis.

  19. Seasonal dynamics of ixodid ticks on wild rabbits Oryctolagus cuniculus (Leporidae) from Central Spain.

    Science.gov (United States)

    González, J; Valcárcel, F; Pérez-Sánchez, J L; Tercero-Jaime, J M; Olmeda, A S

    2016-11-01

    Rabbit Hemorrhagic Disease and Myxomatosis caused a decline in the rabbit population in the second half of the last century. Despite some recovery, the risk of vector-borne disease is present and thus the importance of controlling vector populations. In the current study, we describe the ixodid tick fauna in wild rabbit in a natural reserve in Ciudad Real (Central Spain) during the course of two 3-year periods (2007-2009 and 2012-2014). Of all the ticks collected on average 72.5 % were larvae, 24.4 % nymphs and 3.1 % adults, although the percentage varied monthly. Seven tick species were identified: Hyalomma lusitanicum Koch (Parasitic indicator [PI] = number of ticks per examined rabbit = 96.47), Rhipicephalus pusillus Gil Collado (PI = 47.37), Haemaphysalis hispanica Gil Collado (PI = 12.15), Ixodes ventalloi Gil Collado (PI = 0.65), R. bursa Canestrini and Fanzago (PI = 0.18), R. sanguineus Latreille (PI = 0.11), Dermacentor marginatus Sulzer (PI = 0.01). In spring and summer, most abundant were larvae of H. lusitanicum, followed by immature stages of R. pusillus and Ha. hispanica. In autumn, the main tick species were nymphs of I. ventalloi whereas in winter adults of Ha. hispanica were more numerous. Rhipicephalus pusillus was present all year long, although not always in high percentage. PI of other species (R. bursa, R. sanguineus and D. marginatus) were too low to be representative. The seasonal dynamics of ticks on wild rabbit defined in this study could be useful to design species-specific control strategies.

  20. [Transfer of exotic ticks (Acari: ixodida) on reptiles (Reptilia) imported to Poland].

    Science.gov (United States)

    2009-01-01

    In the of period 2003-2007, a total of 382 specimens of reptiles belonging to the following genera were investigated: Testudo, Iguana, Varanus, Gongylophis, Python, Spalerosophis, Psammophis. The material for the present study was a collection of reptiles owned by the "Animals" Ltd from Swietochłowice (Upper Silesia, Poland), specialising in import of exotic animals to Poland, as well as the reptile collections of private breeders. The reptiles that turned out to be the most heavily infected with ticks were the commonly bred terrarium reptiles: Varanus exanthematicus and Python regius and they were imported to Poland from Ghana, Africa. Exotic reptiles are also imported from Southern Europe, Asia and Central America. The presently reported study helped to confirm the fact of transfer of exotic ticks on reptiles to Poland. A total of 2104 tick specimens, representing all stages of development (males, females, nymphs, larvae), were collected. They represented species of the genera Amblyomma and Hyalomma. The following species were found: Amblyomma exornatum Koch, 1844, Amblyomma flavomaculatum (Lucas, 1846), Amblyomma latum Koch, 1844, Amblyomma nuttalli Dönitz, 1909, Amblyomma quadricavum Schulze, 1941, Amblyomma transversale (Lucas, 1844), Amblyomma varanense (Supino, 1897), Amblyomma spp. Koch, 1844, Hyalomma aegyptium (Linnaeus, 1758). All the species of ticks of genus Ambylomma revealed have been discovered in Poland for the first time. The overall prevalence of infection was 77.6%. The highest prevalence value (81.2%) was observed on pythons (Python regius) and (78.7%) on monitor lizards (Varanus exanthematicus). The highest number of ticks was collected from Python regius and Varanus exanthematicus. The mean infection intensity for V. exanthematicus was 7.6 ticks per host, while for P. regius the intensity reached 4.7 ticks. The most abundant tick transferred to Poland on a host was an African tick, Amblyomma latum. Fifty eight specimens of monitor lizards

  1. Susceptibilidad de genotipos de Solanum spp. al nematodo causante del nudo radical Meloidogyne spp. (chitwood

    Directory of Open Access Journals (Sweden)

    Gelpud Chaves Cristian

    2011-03-01

    Full Text Available

    El cultivo del lulo (Solanum quitoense L. presenta una disminución en su productividad, debido al ataque de patógenos como el nematodo del nudo radical Meloidogyne  spp., en el Departamento  de Nariño (Colombia, se han reportado incidencias cercanas al 79%, y pérdidas del 50%.   En la presente investigación, se colectaron 45 genotipos de (Solanum quitoense  L. en los Departamentos  de Nariño  y Putumayo  y 4 genotipos  silvestres  (S. mammosum, S. hirtum,       S. marginatum  y S. umbellatum buscando fuentes de resistencia al nematodo. Se inocularon 9 plantas de cada genotipo de dos meses de edad con 10000 huevos de Meloidogyne spp., dejando tres testigos por cada material. Las variables evaluadas fueron: altura de planta, severidad, incidencia, peso fresco (tallo y raíz y especies prevalentes de Meloidogyne spp. Se hizo una clasificación de genotipos mediante escala de resistencia y regresión entre la severidad y las demás variables para establecer el efecto de Meloidogyne spp. sobre los genotipos de planta. Los resultados mostraron 100% de incidencia del nematodo en  todos  los  genotipos,  2.04%  genotipos  resistentes,  34.7%  moderadamente  resistentes, 42.8% moderadamente susceptibles, 18.3% susceptibles, y 2.04% altamente susceptibles. El genotipo SQbr05 resistente, no se vio afectado por la severidad, al contrario SQbc04 genotipo susceptible, mostró reducciones significativas en peso fresco de tallo y raIz, (R2 = 0.71 y 0.98,el genotipo silvestre (S. mammosum es altamente susceptible, Meloidogyne incognita presentó 55.31% de presencia. El genotipo SQbr05 es promisorio para ser evaluado en campo.

  2. Investigation and Evaluation of the Rare and Endangered Tibetan Medicinal Plants in the Linzhi Region%林芝地区珍稀濒危藏药植物资源调查与评价

    Institute of Scientific and Technical Information of China (English)

    卢杰; 兰小中; 罗建

    2011-01-01

    Tibetan medicinal industry is one of six major pillar industries in Tibet autonomous region. The rare and endangered plants are increasingly and widely used in Tibetan medicinal industry; however, there has been lack of a clear understanding of these resources and their reasonable applications. In this study, the rare and endangered Tibetan medicinal plants distributed in the Linzhi region of Tibet were analyzed by the plot-quadrat method, walking and inquiry ways. In the investigation, 153 sample plots (30m×30m) and 1,377 quadrats (2m×2m) were set up in 51 typical sites, covering a total plot area of 137,700 m^2. Results show that there were 35 species of rare and endangered plants, pertaining to 23 families and 33 genera in the Linzhi region. The ratio of species was high, and it was an epitome of plants distribution in Tibet. The moisture content of aerial part was higher than that of underground part in many plants except for Codonopsis convolvulacea, Mirabilis himalaica, Polygonatum cirrhifolium, Asparagus filicinus, Pterocephalus hooked, Phlomis younghusbandii and Bupleurum marginatum var. stenophyllum. The mean biomass of Berberis Agricola was highest (1,800 g) and the lowest one was only 0.699 g for Polygonatum cirrhifolium. The biomass of aerial part was 14 times that of underground part for Herpetospermum pedunculosum, the ratio was the maximum, and the minimum ratio of them was 0.189 for Asparagus filicinus. Variations in biomass of aerial part, underground part, and the whole plant were similar for Polygonatum cirrhifolium, Halenia elliptica, Bupleurum marginatum var. stenophyllum and Veronica L. in the same latitude, but changes in the biomass showed different features, determined by plant height and density. The resources reserves of the rare and endangered plants were estimated to be 3,199.29 t in the Linzhi region. The biomass in unit area was closely related to altitude. Rare and endangered plants showed characteristics of abundant

  3. Sydenham's chorea in western Pennsylvania.

    Science.gov (United States)

    Zomorrodi, Arezoo; Wald, Ellen R

    2006-04-01

    mean age of presentation was 9.8 years (range: 5-14.5 years). Chorea was unilateral in 23 (30%) patients. Family history of ARF existed in 30% of patients. Neurologic symptoms of SC included behavior change (46%), dysarthria (67%), gait change (51%), deterioration of handwriting (29%), and headache (11%). Nonneurologic manifestations of ARF were carditis (44%), arthritis (11%), erythema marginatum (3%), and subcutaneous nodules (0%). Antecedent group A streptococcal infection was documented in 99% of patients who were tested by an elevated antistreptolysin O titer (n = 53), an elevated anti-deoxyribonuclease B titer (n = 7), a positive streptozyme (n = 53), or acute throat infection with Streptococcus pyogenes (n = 19). A total of 52 neuroimaging tests were obtained from 46 patients with SC. In patients with SC, brain MRI was abnormal in 8 of 32 patients, and brain computed tomography was abnormal in 1 of 20 patients. Abnormalities did not aid in diagnosis and included nonspecific increased signal (n = 2), nonspecific punctate lesions (n = 2), asymmetry of the hippocampal fissures, unrelated petrous bone anomaly, Arnold Chiari malformation, and medulloblastoma in a macrocephalic patient. Three patients with chorea that was not attributed to ARF had atypical presentations: 1 developed chorea after a perioperative hypoxic/ischemic central nervous system insult; 1 had an episode of disorientation, aphasia, and transient facial droop (angiography showed basal ganglia infarct); and 1 with hemichorea had basal ganglion infarct seen on MRI. Ninety-six percent of children who had acute chorea and presented to a large children's hospital in an area that is endemic for ARF had SC. These patients had characteristic demographic and clinical features of SC. The most common concurrent major Jones criterion was carditis. Arthritis, erythema marginatum, and subcutaneous nodules were uncommon in this population. Neuroimaging was obtained in 58% of patients with SC and did not aid in

  4. Prevalence and seasonal abundance of ticks on dogs and the role of Rhipicephalus sanguineus in transmitting Babesia species in Maidugiri, North-Eastern Nigeria

    Directory of Open Access Journals (Sweden)

    M. Konto

    2014-03-01

    Full Text Available Aim: An investigation on ticks and haemoparasites of dogs that belonged to Maiduguri metropolis (Borno State was conducted. Materials and Methods: Survey of ticks and haemo-parasites on 400 stray dogs was conducted in Maiduguri from December 2009 to November 2011, using a stratified random sampling technique from different locations of the town. The town was divided into 10 districts out of which a total of 40 dogs were sampled at random from each district. Results: Four genera of ticks were identified on the infested dogs 384 (96.0, all of which belonged to the family Ixodidae (hard ticks. The genus Boophilus was predominant with a prevalence of 88.0%, Rhipicephalus 10.8%, Hyalomma 0.9% and Amblyomma 0.3% at (p ˂ 0.05. Dogs within the age-group of 6-12 months were the most infested, while those within the age-group of 24 –120 months were the least infested. Sex appeared to have a less significant influence (p > 0.05 on the prevalence of ticks among the dog population as females were more infested than the males. The perineum and the ear were the most commonly infested areas, with 328 (85.4% and 252 (65.4% respectively, while the scrotal and abdominal regions were the least infested areas 12 (3.1% each. The month of August showed the highest mean tick burden of 462.5±3.2 ranging from 450-475, while the month of February showed the least number of ticks with a mean of 244.5±3.8 ranging from 239-250. Dogs found to be infected with Babesia canis are all harboring ticks of the genus Rhipicephalus. Female dogs were more infected (66.7% with Babesia canis than their male counterparts (33.3% (p ˂ 0.05 and dogs within the age group of 1-6 months were more infected. Conclusion: Prevalence of ticks on dogs in this study area is relatively high and the occurrence of Babesia species is vector dependent, with ticks of the genus Rhipicephalus sanguineous being the most common vector in transmission of the parasite. Seasons also play a vital role in the

  5. Abundance of questing ticks and molecular evidence for pathogens in ticks in three parks of Emilia-Romagna region of Northern Italy

    Directory of Open Access Journals (Sweden)

    Sara Aureli

    2015-09-01

    Full Text Available Introduction and objective. Infectious and parasitic diseases transmitted by ticks, such as Lyme diseases, granulocytic anaplasmosis and piroplasmosis, have been frequently reported in Europe, with increasing attention to them as an emerging zoonotic problem. The presented study was performed to assess the distribution and the density of questing ticks in three regional parks of Emilia-Romagna region of Northern Italy, and to seek molecular evidence of potential human pathogens in tick populations. Materials and Methods. In the period April-October 2010, 8,139 questing ticks were collected: 6,734 larvae, 1,344 nymphs and only a few adults – 28 females and 33 males. The abundance of[i] Ixodes ricinus[/i] questing ticks was compared among different sampling sites and related to microclimate parameters. 1,544 out of 8,139 ticks were examined for the presence of pathogens: PCR was used to detect piroplasms DNA and Real time Taqman PCR for [i]Anaplasma phagocytophilum[/i] and [i]Borrelia burgdorferi[/i] s.l. Results. The predominant species was [i]I. ricinus[/i] (overall abundance 1,075.9/100 m[sup]2[/sup] ; more rarely, [i]Dermacentor marginatus[/i] (n = 37 – 0.45%, [i]Scaphixodes frontalis[/i] (n = 13 – 0.16%, [i]Hyalomma[/i] spp. (n = 6 – 0.07% and [i]Ixodes acuminatus[/i] (n = 3 – 0.04% were also found. 28 out of 324 (8.6% samples of ticks were PCR-positive for piroplasm DNA. 11 amplicons of 18S rRNA gene were identical to each other and had 100% identity with[i] Babesia[/i] EU1 ([i]Babesia venatorum[/i] using BLAST analysis. Real time Taqman PCR gave positive results for [i]A. phagocytophilum[/i] in 23 out of 292 samples (7.9%, and for [i]B. burgdorferi[/i] s.l. in 78 out of 292 samples (26.7%. [i]I. ricinu[/i]s was the only species found positive for pathogens by molecular analysis; 16 tick samples were co-infected with at least 2 pathogens. Discussion. The peak of nymph presence was in May, and the higher prevalence of pathogens

  6. Zoonotic surveillance for rickettsiae in domestic animals in Kenya.

    Science.gov (United States)

    Mutai, Beth K; Wainaina, James M; Magiri, Charles G; Nganga, Joseph K; Ithondeka, Peter M; Njagi, Obadiah N; Jiang, Ju; Richards, Allen L; Waitumbi, John N

    2013-06-01

    Abstract Rickettsiae are obligate intracellular bacteria that cause zoonotic and human diseases. Arthropod vectors, such as fleas, mites, ticks, and lice, transmit rickettsiae to vertebrates during blood meals. In humans, the disease can be life threatening. This study was conducted amidst rising reports of rickettsioses among travelers to Kenya. Ticks and whole blood were collected from domestic animals presented for slaughter at major slaughterhouses in Nairobi and Mombasa that receive animals from nearly all counties in the country. Blood samples and ticks were collected from 1019 cattle, 379 goats, and 299 sheep and were screened for rickettsiae by a quantitative PCR (qPCR) assay (Rick17b) using primers and probe that target the genus-specific 17-kD gene (htrA). The ticks were identified using standard taxonomic keys. All Rick17b-positive tick DNA samples were amplified and sequenced with primers sets that target rickettsial outer membrane protein genes (ompA and ompB) and the citrate-synthase encoding gene (gltA). Using the Rick17b qPCR, rickettsial infections in domestic animals were found in 25/32 counties sampled (78.1% prevalence). Infection rates were comparable in cattle (16.3%) and sheep (15.1%) but were lower in goats (7.1%). Of the 596 ticks collected, 139 had rickettsiae (23.3%), and the detection rates were highest in Amblyomma (62.3%; n=104), then Rhipicephalus (45.5%; n=120), Hyalomma (35.9%; n=28), and Boophilus (34.9%; n=30). Following sequencing, 104 out of the 139 Rick17b-positive tick DNA had good reverse and forward sequences for the 3 target genes. On querying GenBank with the generated consensus sequences, homologies of 92-100% for the following spotted fever group (SFG) rickettsiae were identified: Rickettsia africae (93.%, n=97), Rickettsia aeschlimannii (1.9%, n=2), Rickettsia mongolotimonae (0.96%, n=1), Rickettsia conorii subsp. israelensis (0.96%, n=1), Candidatus Rickettsia kulagini (0.96% n=1), and Rickettsia spp. (1.9% n=2). In

  7. Ectoparasites of sheep in three agro-ecological zones in central Oromia, Ethiopia

    Directory of Open Access Journals (Sweden)

    Bersissa Kumsa

    2012-02-01

    Full Text Available A cross-sectional study was conducted to determine the prevalence and risk factors for ectoparasites infestation in sheep in three agro-ecological zones in central Oromia, Ethiopia, from October 2009 to April 2010. The study revealed that 637 (48.1% of the 1325 sheep examined were infested with one or more ectoparasites. The ectoparasites identified were Bovicola ovis (27.2%, Melophagus ovinus (16.4%, Ctenocephalides sp. (2.3%, Linognathus africanus (1.2%, Linognathus ovillus (0.3%, Sarcoptes sp. (1.2%, Amblyomma variegatum (4.4%, Rhipicephalus evertsi evertsi (1.9%, Rhipicephalus pravus (1.9%, Rhipicephalus (Boophilus decoloratus (1.1%, Rhipicephalus sanguineus (0.9%, Rhipicephalus praetextatus (1.1% and Hyalomma truncatum (1.6%. Statistically significant difference was observed in prevalence of B. ovis amongst study agroecological zones: highland 36.6%, midland 20.9% and lowland 14.0%. Significantly higher prevalence was recorded in highland agroecological zone. A significantly (OR = 0.041, p < 0.001 higher prevalence of M. ovinus in the highland (31.7% than in both the lowland (0% and midland (1.9% was observed. The risk of tick infestation in the lowland and midland was 9.883 times and 13.988 times higher than the risk in the highland, respectively. A significantly higher prevalence of Ctenocephalides species was encountered in both the lowland (OR = 4.738, p = 0.011 and midland (OR = 8.078, p = 0.000 than in the highland agro-ecological zone. However, a significant difference (p = 0.191 amongst agro-ecological zones was not found for the prevalence of Linognathus and Sarcoptes species. Statistically significant variation (p > 0.05 was never recorded in the prevalence of all the identified species of ectoparasites between male and female sheep hosts. However, a significantly (p = 0.006 higher prevalence of B. ovis was recorded between young and adult sheep. The risk of B. ovis infestation was 1.45 times higher in young than the adult sheep

  8. Prevalence, associated determinants, and in vivo chemotherapeutic control of hard ticks (Acari: Ixodidae) infesting domestic goats (Capra hircus) of lower Punjab, Pakistan.

    Science.gov (United States)

    Sajid, Muhammad Sohail; Iqbal, Zafar; Khan, Muhammad Nisar; Muhammad, Ghulam; Needham, Glen; Khan, Muhammad Kasib

    2011-03-01

    A total of 800 goats of various breeds, age, and sex were randomly selected from Muzaffargarh (M. garh) and Layyah districts of lower Punjab, Pakistan. The selected goats were visited twice a month to collect information about determinants influencing goat tick infestation prevalence. For acaricidal efficacy, 360 tick-infested adult goats were subjected to an acaricidal treatment and post-treatment quantitative assessment of tick burden. Quantification of adult tick detachment 24 h post-treatment and the duration of treatment efficacy were calculated. Overall prevalence of goat tick infestation in both study districts was 60.1% (481/800). The prevalence was higher in district M. garh than in district Layyah. Tehsil-wise prevalence in district Layyah was highest in tehsil Layyah followed in order by Chaubara and Karor. In district M. garh, highest prevalence was found in tehsil M. garh followed by Kot Addu, Alipur, and Jatoi. Hyalomma a. anatolicum (75.9%; 365/481) and Rhipicephalus sanguineus (24.1%; 116/481) were the predominant species in both the districts. The highest month-wise prevalence was 56.9% and 62.7% in Layyah and M. garh districts, respectively, during July 2008, and the minimum (0%) prevalence was reported in November and December, respectively. Regarding host determinants, female goats were more heavily infested (72.8%) than males (47.5%), and younger animals were (63.5%) more burdened than older ones (56.7%). Teddy goats were the most susceptible breeds followed in order by Beetal, cross-bred, Nachi, and Dera Din Pannah. The preferred sites of attachment were inside and outside of the ear. Both the ivermectin (IVM)- and cypermethrin (CYM)-treated groups resulted in significantly lower (P < 0.05) tick counts relative to controls on all post-treatment counting days. The lowest tick burden in the IVM-treated group was significantly higher (P < 0.05) as compared to the CYM-treated group, the latter being close to zero. Hence, the in vivo efficacy

  9. Detection of Rickettsia and Ehrlichia spp. in Ticks Associated with Exotic Reptiles and Amphibians Imported into Japan.

    Directory of Open Access Journals (Sweden)

    Masako Andoh

    Full Text Available One of the major routes of transmission of rickettsial and ehrlichial diseases is via ticks that infest numerous host species, including humans. Besides mammals, reptiles and amphibians also carry ticks that may harbor Rickettsia and Ehrlichia strains that are pathogenic to humans. Furthermore, reptiles and amphibians are exempt from quarantine in Japan, thus facilitating the entry of parasites and pathogens to the country through import. Accordingly, in the current study, we examined the presence of Rickettsia and Ehrlichia spp. genes in ticks associated with reptiles and amphibians originating from outside Japan. Ninety-three ticks representing nine tick species (genera Amblyomma and Hyalomma were isolated from at least 28 animals spanning 10 species and originating from 12 countries (Ghana, Jordan, Madagascar, Panama, Russia, Sri Lanka, Sudan, Suriname, Tanzania, Togo, Uzbekistan, and Zambia. None of the nine tick species are indigenous in Japan. The genes encoding the common rickettsial 17-kDa antigen, citrate synthase (gltA, and outer membrane protein A (ompA were positively detected in 45.2% (42/93, 40.9% (38/93, and 23.7% (22/93 of the ticks, respectively, by polymerase chain reaction (PCR. The genes encoding ehrlichial heat shock protein (groEL and major outer membrane protein (omp-1 were PCR-positive in 7.5% (7/93 and 2.2% (2/93 of the ticks, respectively. The p44 gene, which encodes the Anaplasma outer membrane protein, was not detected. Phylogenetic analysis showed that several of the rickettsial and ehrlichial sequences isolated in this study were highly similar to human pathogen genes, including agents not previously detected in Japan. These data demonstrate the global transportation of pathogenic Rickettsia and Ehrlichia through reptile- and amphibian-associated ticks. These imported animals have potential to transfer pathogens into human life. These results highlight the need to control the international transportation of known

  10. Detection of Rickettsia and Ehrlichia spp. in Ticks Associated with Exotic Reptiles and Amphibians Imported into Japan.

    Science.gov (United States)

    Andoh, Masako; Sakata, Akiko; Takano, Ai; Kawabata, Hiroki; Fujita, Hiromi; Une, Yumi; Goka, Koichi; Kishimoto, Toshio; Ando, Shuji

    2015-01-01

    One of the major routes of transmission of rickettsial and ehrlichial diseases is via ticks that infest numerous host species, including humans. Besides mammals, reptiles and amphibians also carry ticks that may harbor Rickettsia and Ehrlichia strains that are pathogenic to humans. Furthermore, reptiles and amphibians are exempt from quarantine in Japan, thus facilitating the entry of parasites and pathogens to the country through import. Accordingly, in the current study, we examined the presence of Rickettsia and Ehrlichia spp. genes in ticks associated with reptiles and amphibians originating from outside Japan. Ninety-three ticks representing nine tick species (genera Amblyomma and Hyalomma) were isolated from at least 28 animals spanning 10 species and originating from 12 countries (Ghana, Jordan, Madagascar, Panama, Russia, Sri Lanka, Sudan, Suriname, Tanzania, Togo, Uzbekistan, and Zambia). None of the nine tick species are indigenous in Japan. The genes encoding the common rickettsial 17-kDa antigen, citrate synthase (gltA), and outer membrane protein A (ompA) were positively detected in 45.2% (42/93), 40.9% (38/93), and 23.7% (22/93) of the ticks, respectively, by polymerase chain reaction (PCR). The genes encoding ehrlichial heat shock protein (groEL) and major outer membrane protein (omp-1) were PCR-positive in 7.5% (7/93) and 2.2% (2/93) of the ticks, respectively. The p44 gene, which encodes the Anaplasma outer membrane protein, was not detected. Phylogenetic analysis showed that several of the rickettsial and ehrlichial sequences isolated in this study were highly similar to human pathogen genes, including agents not previously detected in Japan. These data demonstrate the global transportation of pathogenic Rickettsia and Ehrlichia through reptile- and amphibian-associated ticks. These imported animals have potential to transfer pathogens into human life. These results highlight the need to control the international transportation of known and

  11. Genetic characterization and molecular clock analyses of the Crimean-Congo hemorrhagic fever virus from human and ticks in India, 2010-2011.

    Science.gov (United States)

    Yadav, Pragya D; Cherian, Sarah S; Zawar, Divya; Kokate, Prasad; Gunjikar, Rashmi; Jadhav, Santosh; Mishra, Akhilesh C; Mourya, Devendra T

    2013-03-01

    A nosocomial outbreak of Crimean Congo hemorrhagic fever (CCHF) was reported among humans in Ahmadabad district, Gujarat, India during January, 2011. In the present study we provide the complete genomic sequences of four CCHFV isolates derived from two human patients and two pools of Hyalomma anatolicum ticks during the period of this outbreak and the complete S segment sequence of two retrospective human serum samples, positive for CCHFV in 2010. Sequence-based molecular characterization of the Indian CCHFV showed that they possessed the functional motifs known to occur in the S, M and L gene segment products as in other CCHF viruses. The S segment of the six Indian CCHF viruses showed 99.8% nucleotide identity. Notably both tick isolates shared 100% nucleotide identity with one of the Indian human isolates of 2011. Phylogenetic analysis based on the S segment demonstrated that the Indian CCHFV isolates formed a distinct cluster in the Asian-Middle East group IV of CCHF viruses. The S segment was closest to a Tajikistan strain TADJ/HU8966 of 1990 (98.5% nucleotide identity) and was of South-Asia 2 type while the M segment was of type M2. Both M and L segments were closest to an Afghanistan strain Afg09-2990 of 2009 (93% and 98% nucleotide identity, respectively). The Indian isolates were thus identified as a South-Asia 2/M2 far-east virus combination and the differing parental origin in the S and L/M segments is suggestive that it may be an intra-genotypic reassortant. Molecular clock studies further revealed that the ancestry of the viruses was not very recent and dated back to about 33years on the basis of the S segment while it was about 15years based on the M segment. Thus though the 2011 outbreak may not have resulted from a very recent introduction, considering that so far there is no evidence of multiple circulating strains in the country, the possibility of a recent re-introduction of the virus from any of the neighboring countries cannot be ruled out. The

  12. New Curculionoidea (Coleoptera records for Canadа

    Directory of Open Access Journals (Sweden)

    Hume Douglas

    2013-06-01

    schevyrewi Semenov Tjan-Shansky, 1902; Tyloderma foveolatum (Say, 1832; (all Curculionidae; Ontario – Trichapion nigrum (Herbst, 1797; Nanophyes marmoratus marmoratus (Goeze, 1777 (both Brentidae; Asperosoma echinatum (Fall, 1917; Micracis suturalis LeConte, 1868; Orchestes alni (Linnaeus, 1758; Phloeosinus pini Swaine, 1915; Scolytus schevyrewi Semenov Tjan-Shansky, 1902; Xyleborinus attenuatus (Blandford, 1894 (all Curculionidae; Quebec – Trigonorhinus alternatus (Say, 1826; Trigonorhinus tomentosus tomentosus (Say, 1826 (both Anthribidae; Trichapion nigrum (Herbst, 1797; Trichapion porcatum (Boheman, 1839; Nanophyes marmoratus marmoratus (Goeze, 1777 (all Brentidae; Lissorhoptrus oryzophilus Kuschel, 1952 (Brachyceridae; Acalles carinatus LeConte, 1876; Ampeloglypter ampelopsis (Riley, 1869; Anthonomus rufipes LeConte, 1876; Anthonomus suturalis LeConte, 1824; Ceutorhynchus hamiltoni Dietz, 1896; Curculio pardalis (Chittenden, 1908; Cyrtepistomus castaneus (Roelofs, 1873; Larinus planus (Fabricius, 1792; Mecinus janthinus (Germar, 1821; Microhyus setiger LeConte, 1876; Microplontus campestris (Gyllenhal, 1837; Orchestes alni (Linnaeus, 1758; Otiorhynchus ligustici (Linnaeus, 1758; Rhinusa neta (Germar, 1821; Trichobaris trinotata (Say, 1832; Tychius liljebladi Blatchley, 1916; Xyleborinus attenuatus (Blandford, 1894; Xyleborus affinis Eichhoff, 1868 (all Curculionidae; Sphenophorus incongruus Chittenden, 1905 (Dryophthoridae; New Brunswick – Euparius paganus Gyllenhal, 1833; Allandrus populi Pierce, 1930; Gonotropis dorsalis (Thunberg, 1796; Euxenus punctatus LeConte, 1876 (all Anthribidae; Loborhynchapion cyanitinctum (Fall, 1927 (Brentidae; Pseudanthonomus seriesetosus Dietz, 1891; Curculio sulcatulus (Casey, 1897; Lignyodes bischoffi (Blatchley, 1916; Lignyodes horridulus (Casey, 1892; Dietzella zimmermanni (Gyllenhal, 1837; Parenthis vestitus Dietz, 1896; Pelenomus squamosus LeConte, 1876; Psomus armatus Dietz, 1891; Rhyncolus macrops Buchanan, 1946; Magdalis

  13. Divisão do gênero Distenia Lepeletier & Audinet-Serville, notas sobre a venação alar em Disteniini, Homonímias, Sinonímia e Redescrições (Coleoptera, Cerambycidae, Disteniinae

    Directory of Open Access Journals (Sweden)

    Antonio Santos-Silva

    2007-01-01

    .; E. (G. simplex (Bates, 1885 comb. nov.; E. (G. trifasciata (Bates, 1892 comb. nov.; E. (G. vittata (Bates, 1880 comb. nov.] e D. (Distenia [D. (D. angustata Bates, 1870; D. (D. annulicornis Villiers, 1959; D. (D. atrocyanea Villiers, 1959; D. (D. bahiaensis Villiers, 1959; D. (D. caerulescens Gounelle, 1911; D. (D. cinctipennis Gounelle, 1911; D. (D. columbina Audinet-Serville, 1828; D. (D. esmeralda Villiers, 1959; D. (D. fastuosa Pascoe, 1871; D. (D. forcipata Villiers, 1959; D. (D. fryi Villiers, 1959; D. (D. langurioides Bates, 1885; D. (D. lateralis Fisher, 1946; D. (D. limbata Bates, 1885; D. (D. macella Villiers, 1959; D. (D. pilosa Villiers, 1959; D. (D. splendens Bates, 1870; D. (D. suturalis Bates, 1870; D. (D. viridicyanea (Thomson, 1864] e D. (Basisvallis subgen. nov. [D. (B. agroides Bates, 1870; D. (B. carinata Villiers, 1959; D. (B. chaparensis Tippmann, 1953; D. (B. cyaneipennis Villiers, 1959; D. (B. fossulata Villiers, 1959; D. (B. granulipes Villiers, 1959; D. (B. phaeocera Bates, 1880; D. (B. pullula Gounelle, 1911; D. (B. rufipes Bates, 1870; D. (B. rugiscapis Bates, 1885; D. (B. sallaei Bates, 1885; D. (B. spinipennis Fisher, 1946; D. (B. striaticollis Villiers, 1959]. Dois novos nomes são propostos para eliminar homonímia: Novantinoe nom. nov. para substituir Antinoe Thomson, 1864 (ocupado e Thomsonistenia nom. nov. para Thelxiope Thomson, 1864 (ocupado. Novantinoe é revalidado e Thomsonistenia é mantido na sinonímia de Distenia Lepeletier & Audinet-Serville, 1828. Discute-se e descreve-se a venação alar em Disteniini. Disteniinae é considerado nomen protectum e "Cométites" Blanchard, 1845 é considerado nomen oblitum. O status de Disteniinae é discutido em função das constantes modificações: família ou subfamília. Hovorestenia humeralis (Waterhouse, 1880 comb. nov. é redescrita e figurada. Novo sinônimo: Distenia mirabilis Villiers, 1959 = Oculipetilus pulcher (Melzer, 1926 comb. nov. Chaves incluídas: gêneros americanos

  14. 水稻过氧化物酶基因Os POX 1遗传变异分析%Genetic Variation Analysis of Peroxidase Gene Os POX 1 in Rice

    Institute of Scientific and Technical Information of China (English)

    李程鹏; 孙一丁; 刘辉; 曾千春; 王炎炎; 马继琼; 许明辉

    2015-01-01

    variation of OsPOX1 did not associate with temperature. Four O. nivara accessions from 3 countries belonged to H3 of indic a rice, and 3 O. rufip ogon accessions from 2 countries belonged to H4, H5 and H6, respectively, suggested that O. niv ara was closer relatives with cultivated rice than O. rufipogon. The phylogenetic analysis showed that haplotype H2 was significant different with others, implied the ancestor of Oryza sativa may be polygenous. The encoding protein had no difference between 6 haplotypes, a-these results indicated high conservation of OsPOX1 during evolution.

  15. Pamphagidae (Orthoptera: Acridoidea) from the Palaearctic Region: taxonomy, classification, keys to genera and a review of the tribe Nocarodeini I.Bolívar.

    Science.gov (United States)

    Ünal, Mustafa

    2016-12-13

    (Werner, 1939)], Eremocharis granulosa roseipes Uvarov, 1943 [with Eremocharis granulosa granulosa (Walker, 1871)], Eremocharis subsulcata minor Cejchan, 1969 (with Eremocharis maior Ramme, 1952), Asiotmethis limbatus motasi Ramme, 1951 [with Asiotmethis limbatus (Charpentier, 1845)], Tropidauchen marginatum Bolívar, 1912 (with Tropidauchen escalerai Bolívar, 1912), Paranocarodes straubei serratus Uvarov, 1949, Paranocarodes straubei insularis Ramme, 1951 and Paranocarodes fieberi mytilenensis Ramme, 1951 [with Paranocarodes fieberi (Brunner von Wattenwyl, 1882)], Paranocarodes atympanicus Ramme, 1951 (with Paranocarodes tolunayi tolunayi Ramme, 1949), Paranocarodes cilicicus Ramme, 1951 (with Paranocarodes lubricus Mistshenko, 1951), Paranothrotes opacus hakkariana Demirsoy, 1973 [with Paranothrotes opacus opacus (Brunner von Wattenwyl, 1882)], Paranothrotes tenuicornis sordidus Mistshenko, 1951 and Paranothrotes iranicus (Ramme, 1951) (with Paranothrotes tenuicornis Mistshenko, 1951), Paranothrotes elbursianus (Ramme, 1951) [with Paranothrotes demawendi (Ramme, 1951)], Paranocarodes aserbeidshanicus Ramme, 1951 [with Paranothrotes margaritae (Miram, 1938)], Nocaracris burri obscurata Ramme, 1951 [with Nocaracris furvus furvus (Mistshenko, 1951)], Paranocaracris rimansonae ventosus Mistshenko, 1951 [with Nocaracris rimansonae (Uvarov, 1918)], Paranocaracris rigidus Mistshenko, 1951 (with Nocaracris tauricolus Ramme, 1951), Nocaracris cyanipes tristis Ramme, 1951 [with Nocaracris cyanipes (Motschulsky, 1846)], Nocarodes armenus Ramme, 1951 (with Nocarodes serricollis Fischer von Waldheim, 1846), Nocarodes specialis Mistshenko, 1951 [with Nocarodes iranicus (Werner, 1939)], Nocarodes gibbosus Mistshenko, 1951 (with Nocarodes humerosus Mistshenko, 1951), Nocarodes urmianus carinatus Mistshenko, 1951 (with Nocarodes urmianus Ramme, 1939). One new genus in the tribe Nocarodeini, Turkanocaracris Ünal gen. nov., and the following 29 new species and subspecies in four tribes