WorldWideScience

Sample records for hyalomma marginatum ixodes

  1. First report of adult Hyalomma marginatum rufipes (vector of Crimean-Congo haemorrhagic fever virus on cattle under a continental climate in Hungary

    Directory of Open Access Journals (Sweden)

    Hornok Sándor

    2012-08-01

    Full Text Available Abstract Background South Hungary is being monitored for the northward spreading of thermophilic ixodid species, therefore ticks were collected from cattle and wild ruminants (red, fallow and roe deer in the autumn of 2011. Findings Besides indigenous species (1185 Dermacentor reticulatus and 976 Ixodes ricinus, two Hyalomma marginatum rufipes males were found on two cows, in September eight days apart. Conclusions This is the northernmost autochthonous infestation of the type host (cattle with H. m. rufipes, vector of Crimean-Congo haemorrhagic fever virus. The present findings are suggestive of the moulting success of this Afro-Mediterranean tick species in a continental climate in Central Europe.

  2. Transovarial Transmission of Babesia Ovis by Rhipicephalus Sanguineus and Hyalomma Marginatum

    Directory of Open Access Journals (Sweden)

    E Nouroozi

    2010-09-01

    Full Text Available Background: Rhipicephalus sanguineus and Hyalomma marginatum are the most common spe­cies in sheep herds in Northeast of Iran. There is preliminary evidence that these species may be the vectors of Babesia ovis in Iran. We carried out two experiments in Mashhad area, Khorasan Razavi Province to determine whether B. ovis could be transovarially transmitted by R. san­guineus and H. marginatum.Methods: In experiment 1, adults of laboratory reared H. marginatum and R.sanguineus were infected with B. ovis isolated from naturally infected sheep in Mashhad area by feeding the ticks on the sheep inoculated intravenously by infected blood samples. The inoculated sheep showed clinical signs with parasitaemia while the adult ticks were engorging on them. The engorged fe­males were collected and kept at 28°C and 85% relative humidity in incubator. Then, larval, nym­phal and adult stages derived from engorged females were used to infest the clean sheep. In experiment 2, two splenectomized sheep were infested only with the same adult ticks of two spe­cies.Results: Examination of smears and PCR of blood samples to detect of B. ovis in infested sheep in two experiments were negative.Conclusion: It seems that R. sanguineus and H. marginatum can not transovarially transmit B. ovis in sheep.

  3. Molecular analysis of Crimean-Congo hemorrhagic fever virus and Rickettsia in Hyalomma marginatum ticks removed from patients (Spain) and birds (Spain and Morocco), 2009-2015.

    Science.gov (United States)

    Palomar, Ana M; Portillo, Aránzazu; Mazuelas, David; Roncero, Lidia; Arizaga, Juan; Crespo, Ariñe; Gutiérrez, Óscar; Márquez, Francisco J; Cuadrado, Juan F; Eiros, José M; Oteo, José A

    2016-07-01

    Crimean-Congo hemorrhagic fever virus (CCHFV) was detected in Spain in 2010. The presence of CCHFV in Hyalomma marginatum ticks from migratory birds passing through Morocco during the spring migration strengthened the hypothesis of the arrival of infected ticks transported by birds to the Iberian Peninsula. Furthermore, Hyalomma species are vectors of bacterial infections such as spotted fever rickettsioses. CCHFV and Rickettsia were screened in Hyalomma ticks from Spain attached to patients (n=12) and birds (n=149). In addition, Rickettsia was investigated in 52 Hyalomma ticks from Morocco (previously reported as CCHFV-infected). No sample collected in Spain showed an infection with CCHFV. Two ticks removed from patients (16.7%), as well as 47 (31.5%) and 4 (7.7%) from birds, collected in Spain and Morocco respectively, were infected with Rickettsia aeschlimannii. Rickettsia sibirica subsp. mongolitimonae was also found in 2 ticks from birds collected in Spain (1.3%). The risk of CCHFV-infected ticks attached to migratory birds to reach the North of Spain is low. This study corroborates the presence of R. aeschlimannii in Spain and Morocco, and supports that H. marginatum can be a potential vector of R. sibirica subsp. mongolitimonae in the Iberian Peninsula.

  4. The complete sequence of a West Nile virus lineage 2 strain detected in a Hyalomma marginatum marginatum tick collected from a song thrush (Turdus philomelos) in eastern Romania in 2013 revealed closest genetic relationship to strain Volgograd 2007.

    Science.gov (United States)

    Kolodziejek, Jolanta; Marinov, Mihai; Kiss, Botond J; Alexe, Vasile; Nowotny, Norbert

    2014-01-01

    In this study the first complete sequence of the West Nile virus (WNV) lineage 2 strain currently circulating in Romania was determined. The virus was detected in a Hyalomma marginatum marginatum tick collected from a juvenile song thrush (Turdus philomelos) in the Romanian Danube Delta close to the city of Tulcea, end of August 2013. Our finding emphasizes the role of ticks in introduction and maintenance of WNV infections. Sequence analyses revealed close genetic relationship of the Romanian WNV strain to strain Reb_Volgograd_07_H, which was isolated from human brain tissue during an outbreak of West Nile neuroinvasive disease (WNND) in Russia in 2007. In 2010 the Eastern European lineage 2 WNV caused an outbreak of human WNND in Romania. Partial sequences from subsequent years demonstrated that this WNV strain became endemic in Eastern Europe and has been causing outbreaks of varying sizes in southern Russia since 2007 and in Romania since 2010.

  5. Screening for bacterial DNA in the hard tick Hyalomma marginatum (Ixodidae from Socotra Island (Yemen: detection of Francisella-like endosymbiont

    Directory of Open Access Journals (Sweden)

    M. Montagna

    2012-12-01

    Full Text Available Thirty-four adult ticks collected from livestock on Socotra Island (Yemen were identified as Hyalomma marginatum using traditional morphological characteristics. Morphological identification was confirmed for all the collected specimens using a molecular approach targeting a fragment of the mitochondrial gene 12S rRNA. All the specimens were examined for the presence of tick-borne pathogens and the tick endosymbiont Candidatus Midichloria mitochondrii using polymerase chain reaction. Three specimens out of the 34 analyzed tested positive to the presence of Francisella spp. leading to the first detection of these bacteria in H. marginatum on Socotra Island. The phylogenetic analyses conducted on a 660 bp fragment of the ribosomal gene 16S rRNA of Francisella spp. (including F. philomiragia as outgroup, the four subspecies of F. tularensis and the Francisella-like endosymbiont of ticks confirm that the newly detected Francisella strains cluster into the Francisella-like endosymbionts of ticks. Interestingly, the detected Francisella-like endosymbiont, shows a different genotype to that previously isolated from H. marginatum collected in Bulgaria. No specimen was positive for the presence of Rickettsia spp., Coxiella burnetii, Borrelia burgdorferi or M. mitochondrii.

  6. Effect of various levels of dietary Jatropha curcas seed meal on rabbits infested by the adult ticks of Hyalomma marginatum marginatum I. Animal performance, anti-tick feeding and haemogram.

    Science.gov (United States)

    Abdel-Shafy, Sobhy; Nasr, Soad M; Abdel-Rahman, Hashem H; Habeeb, Salwa M

    2011-02-01

    The goal of this study was to investigate the use of Jatropha curcas seed meal (JCSM) in different levels as acaricide in diet of rabbits experimentally infested by Hyalomma marginatum marginatum then determining animal performance, anti-tick feeding and its effects on haemogram of rabbits. Thirty healthy mixed-breed rabbits were randomly divided into five equal groups. The first group was kept as a control fed soya bean meal (20%) as a source of protein. Groups from the second to the fifth fed diets contained 2.5%, 5%, 7.5% and 10% of JCSM instead of soya bean meal as a source of protein, respectively. Feeding and watering were given freely throughout the study. Animal performance for treatment groups were recorded from the 1st week up to the 6th week. Then each group divided into two subgroups, and the ticks were introduced to all of one subgroup and the other kept as control, following them until dropped at the end of the 8th week for all groups of the experiment. Feeding and reproductive performance of the adult tick females were determined. Blood samples were collected and analysed for haematological examination at the 0, 6th and 8th weeks post-treatment from all animals. Result revealed that rabbits received diets containing 5%, 7.5% and 10% had significantly (P Egg mass and reproductive index per female were marked increase (P drop in the group received 7.5% JCSM. Also, monocytosis was recorded in 7.5% and 10% JCSM groups. In conclusion, JCSM could be use in the treatment of ectoparasites at level less than 10% in diet. Further investigations should be done to detoxification the Jatropha seed meal to decrease the level of its toxicity.

  7. Influence of laboratory animal hosts on the life cycle of Hyalomma marginatum and implications for an in vivo transmission model for Crimean-Congo hemorrhagic fever virus

    Directory of Open Access Journals (Sweden)

    Aysen eGargili

    2013-08-01

    Full Text Available Crimean-Congo hemorrhagic fever virus (CCHFV is one of the most geographically widespread arboviruses and causes a severe hemorrhagic syndrome in humans. The virus circulates in nature in a vertebrate-tick cycle and ticks of the genus Hyalomma are the main vectors and reservoirs. Although the tick vector plays a central role in the maintenance and transmission of CCHFV in nature, comparatively little is known of CCHFV-tick interactions. This is mostly due to the fact that establishing tick colonies is laborious, and working with CCHFV requires a biosafety level 4 laboratory (BSL4 in many countries. Nonetheless, an in vivo transmission model is essential to understand the epidemiology of the transmission cycle of CCHFV. In addition, important parameters such as vectorial capacity of tick species, levels of infection in the host necessary to infect the tick, and aspects of virus transmission by tick bite including the influence of tick saliva, cannot be investigated any other way. Here, we evaluate the influence of different laboratory animal species as hosts supporting the life cycle of Hyalomma marginatum, a two-host tick. Rabbits were considered the host of choice for the maintenance of the uninfected colonies due to high larval attachment rates, shorter larval-nymphal feeding times, higher nymphal molting rates, high egg hatching rates and higher conversion efficiency index. Furthermore, we describe the successful establishment of an in vivo transmission model CCHFV in a BSL4 biocontainment setting using interferon knockout mice. This will give us a new tool to study the transmission and interaction of CCHFV with its tick vector.

  8. Influence of laboratory animal hosts on the life cycle of Hyalomma marginatum and implications for an in vivo transmission model for Crimean-Congo hemorrhagic fever virus.

    Science.gov (United States)

    Gargili, Aysen; Thangamani, Saravanan; Bente, Dennis

    2013-01-01

    Crimean-Congo hemorrhagic fever virus (CCHFV) is one of the most geographically widespread arboviruses and causes a severe hemorrhagic syndrome in humans. The virus circulates in nature in a vertebrate-tick cycle and ticks of the genus Hyalomma are the main vectors and reservoirs. Although the tick vector plays a central role in the maintenance and transmission of CCHFV in nature, comparatively little is known of CCHFV-tick interactions. This is mostly due to the fact that establishing tick colonies is laborious, and working with CCHFV requires a biosafety level 4 laboratory (BSL4) in many countries. Nonetheless, an in vivo transmission model is essential to understand the epidemiology of the transmission cycle of CCHFV. In addition, important parameters such as vectorial capacity of tick species, levels of infection in the host necessary to infect the tick, and aspects of virus transmission by tick bite including the influence of tick saliva, cannot be investigated any other way. Here, we evaluate the influence of different laboratory animal species as hosts supporting the life cycle of Hyalomma marginatum, a two-host tick. Rabbits were considered the host of choice for the maintenance of the uninfected colonies due to high larval attachment rates, shorter larval-nymphal feeding times, higher nymphal molting rates, high egg hatching rates, and higher conversion efficiency index (CEI). Furthermore, we describe the successful establishment of an in vivo transmission model for CCHFV in a BSL4 biocontainment setting using interferon knockout mice. This will give us a new tool to study the transmission and interaction of CCHFV with its tick vector.

  9. In vitro investigation of the toxic effects of extracts of Allium sativum bulbs on adults of Hyalomma marginatum rufipes and Rhipicephalus pulchellus

    Directory of Open Access Journals (Sweden)

    F. Nchu

    2005-06-01

    Full Text Available The toxic effects of the extracts of Allium sativum (Garlic were evaluated against adults of Hyalomma marginatum rufipes and Rhipicephalus pulchellus using three types (Types A, B and C of contact toxicity bioassays. A. sativum bulbs were extracted with acetone, ethanol and dichloromethane (DCM solvents. Among these three solvents, it is the DCM extract of A. sativum that appears to have anti-tick activity. In the Type A contact toxicity bioassay, DCM extracts of A. sativum demonstrated a high acaricidal bioactivity against H. m. rufipes with 100 % of ticks killed in less than an hour, and toxicity persisted to the second day. A weak acaricidal activity of aqueous extracts of A. sativum was observed in the Type B contact toxicity bioassay. In the Type C contact toxicity bioassay, a concentration of 24 % w/v of DCM extracts of garlic in sunflower oil (Helianthus annuus had killed 100% of H. m. rufipes (LC50= 5.9 % w/v and R. pulchellus (LC50 = 10.3 % w/v by 24 hours post-treatment of ticks. The results obtained from this study suggest that DCM extract of A. sativum is a potential source of novel acaricidal agents.

  10. DISTRIBUTION AND ECOLOGICAL CHARACTERISTICS OF HYALOMMA IXODID TICKS IN THE ECOSYSTEMS OF THE STAVROPOL REGION

    Directory of Open Access Journals (Sweden)

    V. I. Trukhachev

    2016-01-01

    Full Text Available Aim. To determine the characteristics of the modern dissemination, distribution and seasonal activity of Hyalomma ixodid ticks in the Stavropol region.Methods. The study of the spread of Ixodes Hyalomma ticks was conducted in all administrative districts of the Stavropol Territory in the period of 2000-2015. Collection of ixodid ticks in natural habitats, home to wild mammals and birds, was carried out according to conventional techniques.Results. Hyalomma marginatum is a two-host tick. In the region, H. marginatum of an adult stage becomes active in early spring (late March - early April; appearance of the larvae is observed in early July; the nymphs in the third decade of July. The peculiarity of biological development of H. scupense is the activation of adult species in the cold season (winter; development is only of one-host cycle. The peak number of ticks of an adult stage in cattle falls on the last days of January and February.Conclusion. Hyalomma ixodid ticks in the Stavropol region are distributed mosaicly, with the dominance of some species depending on climatic and landscape-geographical features of the territories they inhabit. The dominant species are H. marginatum and H. scupense, but H. anatolicum tick species occur sporadically in the east region.

  11. Ticks (Ixodida) from the collection of the Natural History Department, Museum of Upper Silesia in Bytom, Poland - A contribution to knowledge on tick fauna and the first record of Hyalomma marginatum presence in Poland.

    Science.gov (United States)

    Cuber, Piotr Krzysztof

    2016-06-02

    There is no doubt that museum collections provide a wide variety of information on ticks. The tick collection at the Natural History Department of the Museum of Upper Silesia in Bytom consists only of 37 specimens as the department is focused mainly on building collections of insects and birds. However, this does not mean that such collection cannot contribute to our knowledge about these arthropods. The most valuable results of studies on the museum's tick collection concerned Polish fauna. There are specimens of I. ricinus dating back as far as 1930-1948, which are the first known records of the presence of this tick in the Upper Silesia. Two specimens collected in copula in 1941 might be the earliest record of the mating behaviour of this species in Poland. The most important result was the detection of 2 cases of H. marginatum presence in Poland, which by far are the oldest documented cases of its presence in this country.

  12. First detection of Babesia occultans in Hyalomma ticks from Tunisia.

    Science.gov (United States)

    Ros-García, A; M'Ghirbi, Y; Bouattour, A; Hurtado, A

    2011-04-01

    Descriptions of Babesia occultans have previously been restricted to sub-Saharan Africa. Here, we report the finding, for the first time, of this low or non-pathogenic bovine Babesia species in Tunisia, northern Africa. B. occultans DNA was detected by molecular methods in Hyalomma marginatum unfed ticks collected in 3 bioclimatic regions of Tunisia. The near-full-length 18S rRNA gene was sequenced and compared with related sequences retrieved from GenBank. Phylogenetic analysis indicated that other sequences deposited as Babesia sp. could also correspond to B. occultans, suggesting that this species may have a wide distribution in Mediterranean and Asiatic regions, and not only in sub-Saharan Africa as previously described. A B. occultans-specific Reverse Line Blot (RLB) oligonucleotide probe was designed for future epidemiological studies that would help to clarify this possibility.

  13. A case of multiple keratoacanthoma centrifugum marginatum.

    Science.gov (United States)

    Mangas, Cristina; Bielsa, Isabel; Ribera, Miquel; Fernández-Figueras, Ma Teresa; Ferrándiz, Carlos

    2004-05-01

    Keratoacanthoma centrifugum marginatum is a rare variety of keratoacanthoma, usually presented and classified as solitary keratoacanthoma. Reported cases of multiple keratoacanthoma centrifugum marginatum are exceptional in the literature. A 21-year-old man presented for evaluation of erythematous papules and plaques on both legs that had had a peripheral growth over the past year. Clinical and histologic examination showed typical features of keratoacanthoma centrifugum marginatum. Owing to the multiplicity and size of the lesions, treatment with oral isotretinoin was started. It was ineffective. Subsequent treatment with methotrexate combined with oral prednisone led to the regression of all lesions. The exceptional case of a man with multiple keratoacanthoma centrifugum marginatum is reported. Treatment with methotrexate combined with oral prednisone was effective. This case illustrates how some variants of keratoacanthomas do not really fit into the current classification and how complex the treatment of these tumors is.

  14. ИЗУЧЕНИЕ БИОЛОГО-ЭКОЛОГИЧЕСКИХ ОСОБЕННОСТЕЙ КЛЕЩА СЕМЕЙСТВА IXODIDAE, РОДА HYA-LOMMA H. MARGINATUM

    OpenAIRE

    Амирханова, С.

    2008-01-01

    Изучен жизненный цикл и выживаемость отдельных стадий клеща H. marginatum как в природных, так и в лабораторных условиях. В результате исследований нами уточнены температурные границы активации клеща H. marginatum в Дагестане, сроки превращения стадии личинок в нимф, имаго в зависимости от температурных показателей и степени насыщенности крови самками, влияние температуры на процесс овогенеза....

  15. Chemical examination of the brown alga Stoechospermum marginatum (C. Agardh)

    Digital Repository Service at National Institute of Oceanography (India)

    Wahidullah, S.; DeSouza, L.; Kamat, S.Y.

    The crude methalonic extract of marine algae Stoechospermum marginatum from west coast of India was found to have spasmolytic activity. Search for the pharmacologically active compounds led to the isolation of steroids, fatty acids and an ester...

  16. General review of tick species present in Portugal.

    Science.gov (United States)

    Caeiro, V

    1999-09-01

    At present, 24 species are known to occur in Portugal: Argas vespertilionis, Ornithodoros maritimus and Ornithodoros erraticus in Argasidae; Ixodes acuminatus, Ixodes bivari, Ixodes canisuga, Ixodes frontalis, Ixodes hexagonus, Ixodes ricinus, Ixodes simplex simplex, Ixodes ventalloi, Ixodes vespertilionis, Dermacentor marginatus, Dermacentor pictus', Haemaphysalis hispanica, Haemaphysalis inermis, Haemaphysalis punctata, Rhipicephalus bursa, Rhipicephalus pusillus, Rhipicephalus sanguineus, Rhipicephalus turanicus, Hyalomma lusitanicum, Hyalomma marginatum marginatum and Boophilus annulatus in Ixodidae. The more relevant diseases transmitted to cattle by ticks, particulary in Ribatejo and Alentejo regions, are the babesiosis due to Babesia bigemina and Babesia bovis, the theileriosis by Theileria annulata and the anaplasmosis due to Anaplasma marginale; the theileriosis by Theileria mutans2 may not be considered significant. The sheep and goats parasitoses transmitted by ticks are of less importance than the cattle diseases. However the babesiosis due to Babesia motasi and Babesia ovis and also theileriosis by Theileria hirci3 are present in some districts of the country.

  17. Erythema Marginatum as an Unusual Presentation for Kawasaki Disease

    Directory of Open Access Journals (Sweden)

    I. Sedighi

    2008-10-01

    Full Text Available Introduction: Kawasaki disease is an acute, systemic vacuity that predominantly manifests in infants and young children. Severe systemic inflammation and vacuities can cause cardiovascular involvement, particularly coronary artery injury that includes dilatation or aneurysm. The final goal of treatment for acute Kawasaki disease، therefore، is to diminish systemic inflammation and vacuities as soon as possible, thereby, preventing progression to coronary artery injury and thrombosis.Case Report: In this report we present a case of Kawasaki disease in a 7-year-old boy with prolonged fever and cervical adenopathy presented with erythema marginatum as a first skin presentation. We treated the patient with intravenous gamma-globulin (IVIG by six day after admission. He developed cardiac and pulmonary involvement two days later.Conclusion: Any skin rash is described in Kawasaki disease except for bullous and vesicular lesions. The common skin manifestation of Kawasaki disease are erythematous and maculopapular rash, although it may appear urticarial, scarlatiniform, erythema multiforme-like, or as erythroderma. Erythema marginatum had a limited differential diagnosis in pediatric patients. The major cause of erythema marginatum is rheumatic fever but there is no report of erythema marginatum in face and cervical region and Kawasaki disease should be considered in differential diagnosis of erythema marginatum in face and neck.

  18. Colonization and Containment of Hyalomma Marginatum Rufipes for Studies on the Transmission of Crimean-Congo Hemorrhagic Fever

    Science.gov (United States)

    1987-07-31

    Russian) Tabl. anal. Faune URSS 4 125pp Olenev, NO. 1931 Die Zecken (Ixodidea) der fauna Russlands. Zeits chr. Parasitenk. 4(1) 126-139 Olenev, NO. 1931...Parasitenk 4 126 Olenev, NO. 1931 Mag. Paras. Zool. Acad. Scien. URSS . 2 249 q Oliver, JH. 1972 Cytogenetics of ticks (Acari: Ixodoidea). 8. Chr...USA. Pomeranzev, BI. 1946 Tableaux analytiques Faunne URSS . Publ. Ins. Zool. Acad. Science. Popov, GV, Levi, VD, Vasilenko, SM, and Chumakov, MP

  19. Urticaria and Prodromal Symptoms Including Erythema Marginatum in Danish Patients with Hereditary Angioedema

    DEFF Research Database (Denmark)

    Rasmussen, Eva R; Valente de Freitas, Priscila; Bygum, Anette

    2015-01-01

    Erythema marginatum is a characteristic skin rash seen in patients with hereditary angioedema (HAE); however, it can be confused with urticaria, leading to delay in correct diagnosis. The aim of this study was to clarify how often erythema marginatum is misinterpreted as urticaria, potentially...

  20. Urticaria and Prodromal Symptoms Including Erythema Marginatum in Danish Patients with Hereditary Angioedema.

    Science.gov (United States)

    Rasmussen, Eva R; de Freitas, Priscila Valente; Bygum, Anette

    2016-03-01

    Erythema marginatum is a characteristic skin rash seen in patients with hereditary angioedema (HAE); however, it can be confused with urticaria, leading to delay in correct diagnosis. The aim of this study was to clarify how often erythema marginatum is misinterpreted as urticaria, potentially leading physicians to refrain from testing for HAE. Few studies have been published on urticaria and prodromal symptoms in HAE, thus the incidence of these parameters were also investigated. A total of 87 patients affiliated to the national HAE Centre were included. Retrospective and prospective data on skin eruptions and prodromal symptoms were collected. Fifty-six percent of 87 patients had a positive history of erythema marginatum. Half of the patients had experienced erythema marginatum being misinterpreted as urticaria. The most prevalent other prodromal symptoms were other skin symptoms, malaise, psychological changes, fatigue and gastrointestinal symptoms. HAE patients with erythema marginatum have a longer diagnostic delay, presumably caused by misinterpretation of the rash as urticaria.

  1. Urticaria and Prodromal Symptoms Including Erythema Marginatum in Danish Patients with Hereditary Angioedema

    DEFF Research Database (Denmark)

    Rasmussen, Eva R; Valente de Freitas, Priscila; Bygum, Anette

    2016-01-01

    Erythema marginatum is a characteristic skin rash seen in patients with hereditary angioedema (HAE); however, it can be confused with urticaria, leading to delay in correct diagnosis. The aim of this study was to clarify how often erythema marginatum is misinterpreted as urticaria, potentially...... leading physicians to refrain from testing for HAE. Few studies have been published on urticaria and prodromal symptoms in HAE, thus the incidence of these parameters were also investigated. A total of 87 patients affiliated to the national HAE Centre were included. Retrospective and prospective data...... on skin eruptions and prodromal symptoms were collected. Fifty-six percent of 87 patients had a positive history of erythema marginatum. Half of the patients had experienced erythema marginatum being misinterpreted as urticaria. The most prevalent other prodromal symptoms were other skin symptoms, malaise...

  2. Structure and antiviral activity of sulfated fucans from Stoechospermum marginatum.

    Science.gov (United States)

    Adhikari, Utpal; Mateu, Cecilia G; Chattopadhyay, Kausik; Pujol, Carlos A; Damonte, Elsa B; Ray, Bimalendu

    2006-11-01

    A sulfated fucan containing fraction (SmWE) was isolated from water extract of the brown seaweed Stoechospermum marginatum collected from the Arabian Sea. Anion exchange chromatography of the crude fraction results in the production of a sulfated fucan (F3) having a molecular mass of 40 kDa and specific rotation [alpha]D(30) - 124 degrees (c 0.5, H2O). NMR spectroscopic studies and methylation analysis suggested that the polymer consists of a backbone of (1-->4)- and (1-->3)-linked-alpha-L-fucopyranosyl residues that are substituted at C-2 and C-3, and that fucosyl residues are sulfated mostly at C-2 and/or C-4. SmWE and F3 were selective inhibitors of herpes simplex virus type 1 (strain F, thymidine kinase-deficient strains field and B2006 and syncytial variants arising after selection with a natural carrageenan syn 13-8 and 14-1) and type 2 (strain MS) in Vero cells, with antiviral effective concentration 50% (EC50) values in the range 0.63-10.0 microg/ml. The compounds were highly selective due to the lack of cytotoxicity. The antiviral activity was dependent on the presence of the sulfated fucans during the adsorption period. No direct inactivating effect on virions was observed in a virucidal assay. The absence of anticoagulant activity at concentrations near EC50 confirmed that there was no correlation between the antiviral and anticoagulant properties.

  3. Distribution and ecology of ticks (Acari: Ixodidae) infesting livestock in Tunisia: an overview of eighth years field collections.

    Science.gov (United States)

    Bouattour, A; Darghouth, M A; Daoud, A

    1999-09-01

    Ticks (Ixodidae) play a significant role as vectors of pathogens of domestic animals in Tunisia. The major losses caused by ticks are related to transmission of protozoan parasites. These include agents of tropical theileriosis and babesiosis in ruminants. Since 1991, we conducted research studies on tick population of livestock in Tunisia. This overview reports a synthesis on tick distribution, their biology and their role as vectors of pathogens in domestic animals, particularly cattle. During the whole period of the study about 15,000 tick specimens were collected from different zones of the country. A total of 14 species were identified. Hyalomma detritum detritum was the most abundant and important (vector of Theileria annulata) species infesting cattle. Hyalomma dromedarii and Hyalomma impeltatum were collected on domestic ruminants in the arid and desertic zones. Hyalomma marginatum marginatum and Hyalomma anatolicum excavatum were widespread and found on livestock hosts. Ixodes ricinus, vector of Babesia divergens and Borrelia burgdorferi sl, colonises mainly the humid zone. Boophilus annulatus and Rhipicephalus bursa infesting cattle, sheep and goats were found in the sub-humid and semi-arid zones. Haemaphysalis sulcata and Hae. punctata were collected in humid and sub-humid zones on cattle and sheep. Rhipicephalus turanicus were collected in different regions, on different animal species. Rhipicephalus sanguineus, tick of dogs, were often collected on livestock. Only few specimens of Hyalomma marginatum rufipes and Hyalomma franchinii were collected.

  4. Morphometric Study on Male Specimens of Hyalomma anatolicum (Acari: Ixodidae in West of Iran

    Directory of Open Access Journals (Sweden)

    A Hosseini

    2011-12-01

    Conclusion: Morphometric variation in Hyalomma spp is poorly studied. The variation in range and quantity of the mor­phometric parameters of H.anatolicum ‎underlies that the correct recognition and key construction for Hyalomma spe­cies dependes ‎on a complement morphometric study on the other species.

  5. Anti-proliferative and angio-suppressive effect of Stoechospermum marginatum (C. Agardh) Kutzing extract using various experimental models.

    Digital Repository Service at National Institute of Oceanography (India)

    Vinayak, R.C.; Puttananjaiah, S.; Chatterji, A.; Salimath, B.

    , hindering the recognition of competent dietary-based chemo preventive approaches. The aim of this research was to establish the antiproliferative potency and angiosuppressive mode of action of Stoechospermum marginatum seaweed methanolic extract using...

  6. Hyalomma anatolicum anatolicum and Hyalomma dromedarii (Acari: Ixodidae) imbibe bovine blood in vitro by utilizing an artificial feeding system.

    Science.gov (United States)

    Tajeri, S; Razmi, G R

    2011-08-25

    Hard ticks have great importance because of blood feeding and transmitting dangerous human and animal diseases. Each year, they cause a lot of economical damage to the livestock industry. Control of ticks and tick-borne diseases is a major priority in most parts of the world and many studies have been done in this field. We know that studying haemoparasites and assessing the effect of different compounds on ticks requires a lot of money, support and sometimes it is time consuming. Considering all of these problems, today, in some research laboratories throughout the world, artificial in vitro feeding of ticks has become common. Development and application of such methods provide a cheap and accessible background for investigating haemoparasitic diseases under controlled conditions. For the first time we report successful in vitro feeding of two important ixodid ticks of the genus Hyalomma. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Transstadial transmission of Borrelia turcica in Hyalomma aegyptium ticks.

    Science.gov (United States)

    Kalmár, Zsuzsa; Cozma, Vasile; Sprong, Hein; Jahfari, Setareh; D'Amico, Gianluca; Mărcuțan, Daniel I; Ionică, Angela M; Magdaş, Cristian; Modrý, David; Mihalca, Andrei D

    2015-01-01

    Borrelia turcica comprises the third major group of arthropod-transmitted borreliae and is phylogenetically divergent from other Borrelia groups. The novel group of Borrelia was initially isolated from Hyalomma aegyptium ticks in Turkey and it was recently found in blood and multiple organs of tortoises exported from Jordan to Japan. However, the ecology of these spirochetes and their development in ticks or the vertebrate hosts were not investigated in detail; our aims were to isolate the pathogen and to evaluate the possibility of transstadial transmission of Borrelia turcica by H. aegyptium ticks. Ticks were collected from Testudo graeca tortoises during the summer of 2013 from southeastern Romania. Engorged nymphs were successfully molted to the adult stage. Alive B. turcica was isolated from molted ticks by using Barbour-Stoenner-Kelly (BSK) II medium. Four pure cultures of spirochetes were obtained and analyzed by PCR and sequencing. Sequence analysis of glpQ, gyrB and flaB revealed 98%-100% similarities with B. turcica. H. aegyptium ticks collected from T. graeca tortoises were able to pass the infection with B. turcica via transstadial route, suggesting its vectorial capacity.

  8. Sydenham's chorea and erythema marginatum as the first clinical presentation of acute rheumatic fever

    Directory of Open Access Journals (Sweden)

    Farhang Babamahmoodi

    2009-01-01

    Full Text Available (Received 5 February, 2009 ; Accepted 13 Jan, 2010AbstractAcute rheumatic fever is an acute systemic disease due to autoimmune reaction against some of BHSA. Similarity between bacterial antigens and cardiaciovascular tissue, synovial membrane, joints and subcutaneous tissues and cerebral basal ganglions are the causes of autoimmune reactions and manifestation of the disease. Most of the ARF occur in children (5-14 years old followed by streptococcal pharyngitis and the disease is very rare in adults.Sydenham's chorea is a late manifestation of ARF and one of the John's diagnostic criteria that is usually revealed when the other criteria are absent. There is often a long latent period between clinical manifestations of the ARF and the onset of chorea as an uncommon initial presentation of acute rheumatic fever. We report the clinical findings, investigations and the course of clinical development of a seventeen-year-old girl, who presented with acute onset of abnormal involuntary movements in her right hand for two days before her admission. She had sore throat and fever three weeks before development of these new problems. Her complaints disappeared with proper treatment. The considerable findings in this case report was co-incidence of Sydenham's chorea with erythema marginatum, fever, severe mitral valve insufficiency, arthralgia in an adult patient that is a very rare case. She was discharged after a 10-day treatment regime.Key words: Acute rheumatic fever, sydenham's chorea, erythema marginatumJ Mazand Univ Med Sci 2009; 20(74: 91-97 (Persian.

  9. Morphometric Study on Male Specimens of Hyalomma Anatolicum (Acari: Ixodidae in West of Iran

    Directory of Open Access Journals (Sweden)

    M Abdigoudarzi

    2011-12-01

    Full Text Available Background: Hyalomma anatolicum is the well-known hard tick, which is one of the most important livestock and hu­man pathogens vector, wide range in host and distributed in all over the Hyalomma geographic fauna as well as in Iran. Taxonomy of the Hyalomma ssp. is debatable whereas their identification is a problematic work. The reasons for this claim is time consuming Delpy’s researches in Iran also Schulze School, Feldman-Muhsam and the Russian tick workers. We would like to understand morphometric variation in the field collected H. anatolicum in Iran also validat­ing some morphologic quantitative and qualitative characters.Methods: A total 247 field-collected tick specimens from different geographical regions in west of Iran includes Khuzestan and Lorestan Provinces were studied. The morphologic characters of the ticks were measured by the cali­brated stereomicroscope ‎armed scaled lens. The measurements were analyzed using SPSS ‎for windows, version 16 on an IBM PC, ‎so varied shapes of species in different geographic ‎regions were drawn by the ‎aid of a drawing tube con­nected to a light stereomicroscope.‎Results: One way ANOVA test revealed significant differences among the quantitative parameters in five zones (P<‎‎ 0.‎‎00‎‎1‎ also each zone to other zone by Post Hoc Tests e.g. LSD. No significant differences in the lateral grooves length/conscutum length ratio parameter were found.Conclusion: Morphometric variation in Hyalomma spp is poorly studied. The variation in range and quantity of the mor­phometric parameters of H.anatolicum ‎underlies that the correct recognition and key construction for Hyalomma spe­cies dependes ‎on a complement morphometric study on the other species.

  10. Lyme borreliosis spirochetes and spotted fever group rickettsiae in ixodid ticks from Pianosa island, Tuscany Archipelago, Italy.

    Science.gov (United States)

    Tomassone, L; Grego, E; Auricchio, D; Iori, A; Giannini, F; Rambozzi, L

    2013-02-01

    A study on tick fauna and tick-borne pathogens was undertaken in Pianosa, an island in the Tuscany Archipelago that constitutes an important stopping and nesting point for migratory birds. Ticks were removed from feral cats and a few terrestrial birds, and host-seeking ticks were collected by dragging. A total of 89 ticks were found on animals: 57 Ixodes ventalloi Gil Collado, 1936 and 32 Ixodes acuminatus Neumann, 1901. Host-seeking ticks were 354 Hyalomma spp. larvae and 18 Hyalomma spp. adults, identified as Hyalomma marginatum C.L. Koch, 1844 (n=11) and 7 Hyalomma detritum Schulze, 1919 (n=7). A sample of adult ticks was subjected to molecular analyses to look for Rickettsia spp. and Borrelia burgdorferi sensu lato (s.l.). Sequence analysis of the 5S-23S intergenic spacer region and OspA gene of B. burgdorferi s.l.-positive samples showed the presence of Borrelia spielmanii (n=3; 3.7%, 95% confidence interval [CI] 0.08-10.4) and Borrelia valaisiana (n=13; 13.6%, 95% CI 7.0-23.0) in Ixodes ticks from cats and terrestrial birds. Ixodes spp. were also infected by Rickettsia helvetica (n=19; 23.4%, 95% CI 14.7-34.2). Finally, we detected Rickettsia aeschlimannii in 3 out of 12 host-seeking Hyalomma spp. adults tested (25%, 95% CI 5.5-57.2). Our study shows the presence of several tick-borne pathogens in Pianosa. Hyalomma spp. and Ixodes ticks other than I. ricinus seem to be involved in their epidemiological cycle, and birds could contribute to the pathogen dispersal along their migration routes. This is the first finding of B. spielmanii in Italy. We hypothesize the involvement of peridomestic rodents or hedgehogs in its maintenance in Pianosa.

  11. Keratoacanthoma centrifugum marginatum: unresponsive to oral retinoid and successfully treated with wide local excision.

    Directory of Open Access Journals (Sweden)

    Kapildev Das

    2010-01-01

    Full Text Available We describe a case of a 65-year-old male presenting with a large plaque with a rolled-out interrupted margin, atrophic center, and island of normal skin over the left arm. It grew peripherally with central healing, and there was a history of recurrence after inadequate excision. Investigations ruled out other clin­ical mimickers; namely, squamous cell carcinoma, lupus vulgaris, botryomycosis, and blastomycosis-like pyoderma. Histopathological sections showed irregularly shaped craters filled with keratin and epithelial pearl but no evidence of granuloma or cellular atypia. Clinico­pathological correlation proved the lesion to be keratoacanthoma centrifugum marginatum (KCM, a rare variant of keratoacanthoma, which spreads centrifugally, attains a huge size, and never involutes spontaneously. Treatment of KCM has been a problem always and, in our case, systemic retinoid (acitretin for three months proved ineffective. The patient also had a history of recurrence following surgical intervention previously, necessitating wide excision to achieve complete clearance of tumor cells. Hence, after failure of retinoid therapy, the decision of excision with a 1-centimeter margin was taken and the large defect was closed by a split thickness skin graft. The graft uptake was satisfactory, and the patient is being followed-up presently and shows no signs of recurrence after six months, highlighting wide local excision as a useful treatment option.

  12. Variations in free radical scavenging activities and antioxidant responses in salivary glands of Hyalomma anatolicum anatolicum and Hyalomma dromedarii (Acari: Ixodidae ticks

    Directory of Open Access Journals (Sweden)

    Mayukh Ghosh

    2014-10-01

    Full Text Available Aim: Hyalomma anatolicum anatolicum and Hyalomma dromedarii ticks are of major economic importance in the livestock sector as the vector of tropical theileriosis causing huge production loss, mostly in tropical countries. The release of different reactive oxygen and nitrogen species by exogenous and endogenous means can potentially induce oxidative damage to the ticks during their prolonged feeding on their vertebrate hosts. Hence, ticks need an effective free radical scavenging and antioxidant defense system for their successful feeding of a blood meal. Therefore, the present study was undertaken to evaluate the interspecies variations in antioxidant response, free radical scavenging, and anti-inflammatory activities in salivary gland extracts (SGE of the two species as they differ considerably in relation to feeding behavior and host specificity. Materials and Methods: Tick salivary glands were dissected out under ice from semi-fed female ticks of both the species and homogenized at low temperature to prepare SGE. SGE was stored at −40°C for analysis of free radical scavenging activities and antioxidant status. Results: Significant depletion in reduced glutathione concentrations, malondialdehyde level and elevation in free radical scavenging activity, superoxide dismutase, anti-inflammatory activity were found in SGE of engorging female H. dromedarii ticks as compared to H. a. anatolicum. Conclusion: Higher antioxidant status and free radical scavenging activities in H. dromedarii might have enabled these ticks to suck more blood from the host in spite of continuous host’s immune responses. These findings about tick biology will help in improving tick control strategies.

  13. Morphological anomalies in Ixodes ricinus and Ixodes inopinatus collected from tick-borne encephalitis natural foci in Central Europe

    DEFF Research Database (Denmark)

    Chitimia-Dobler, Lidia; Bestehorn, Malena; Bröker, Michael

    2017-01-01

    In 2015, 0.02% nymphs displayed anomalies (ectromely) out of the 6744 collected ticks as part of a tick-borne encephalitis program in Germany. In 2016, questing Ixodes ricinus (n = 14,527) and Ixodes inopinatus (n = 75) ticks were collected by flagging as part of a tick-borne encephalitis program...

  14. A review of Hyalomma scupense (Acari, Ixodidae in the Maghreb region: from biology to control

    Directory of Open Access Journals (Sweden)

    2014-01-01

    Full Text Available Hyalomma scupense (syn. Hyalomma detritum is a two-host domestic endophilic tick of cattle and secondarily other ungulates in the Maghreb region (Africa. This species transmits several pathogens, among which two are major livestock diseases: Theileria annulata and Theileria equi. Various other pathogens are also transmitted by this tick species, such as Anaplasma phagocytophilum and Ehrlichia bovis. Hyalomma scupense is common in sub-humid and semi-arid areas of several regions in the world, mainly in the Maghreb region. In this region, adults attach to animals during the summer season; larvae and nymphs attach to their hosts during autumn, but there is a regional difference in H. scupense phenology. There is an overlap between immature and adult ticks, leading in some contexts to a dramatic modification of the epidemiology of tick-borne diseases. This tick species attaches preferentially to the posterior udder quarters and thighs. Tick burdens can reach 130 ticks per animal, with a mean of 60 ticks. Calves are 70 times less infested than adult cattle. The control can be implemented through six options: (i rehabilitation of the farm buildings by roughcasting and smoothing the outer and inner surfaces of the enclosures and walls. This control option should be recommended to be combined with a thorough cleaning of the farm and its surrounding area. With regard to Theileria annulata infection, this control option is the most beneficial. (ii Acaricide application to animals during the summer season, targeting adults. (iii Acaricide application during the autumn period for the control of the immature stages. (iv Acaricide application to the walls: many field veterinarians have suggested this option but it is only partially efficient since nymphs enter deep into the cracks and crevices. It should be used if there is a very high tick burden or if there is a high risk of tick-borne diseases. (v Manual tick removal: this method is not efficient since the

  15. Facial nerve paralysis due to intra-aural Hyalomma tick infestation.

    Science.gov (United States)

    Doğan, Müzeyyen; Devge, Cem; Tanrıöver, Ozlem; Pata, Yavuz Selim; Sönmezoğlu, Meral

    2012-01-01

    We present the case of a 33 year-old man from a village of the north-eastern part of central Anatolia admitted to the otolaryngology department of Yeditepe University Hospital with right facial asymmetry and pain on the right ear. A tick of the genus Hyalomma was observed in the external auditory canal of the right ear and it was removed with fine cup forceps under otomicroscopy. We are of the opinion that in patients presenting with sudden acute ear pain and facial palsy, the ear canal should be examined to exclude an infestation by ticks.

  16. Entomopathogenic fungi associated with Ixodes ricinus ticks

    DEFF Research Database (Denmark)

    Kalsbeek, Vibeke; Frandsen, F.; Steenberg, Tove

    1995-01-01

    The objective of this study was to demonstrate the occurrence of entomopathogenic fungi on Ixodes ricinus ticks in relation to the tick stage, engorgement and season. Ticks were collected from the vegetation, from small rodents and from deer. All entomopathogenic fungi found belonged...... infected with fungi. Thirty-three out of 149 engorged females were infected, whereas males and engorged larvae were not infected. Throughout the season, a significantly higher proportion of ticks collected in autumn were infected. Entomopathogenic fungi may have a significant impact on the size of the I...

  17. Anti-inflammatory and antinociceptive effects of hydroalcoholic extract from Pseudobombax marginatum inner bark from caatinga potiguar.

    Science.gov (United States)

    Paiva, Dayane Carla Costa; dos Santos, Cliomar Alves; Diniz, Jaécio Carlos; Viana, Francisco Arnaldo; Thomazzi, Sara Maria; Falcão, Dayseanne Araujo

    2013-09-16

    The Pseudobombax marginatum (St Hil) Rob., Malvaceae, is mentioned in ethnobotanical studies. It is used as anti-inflammatory, for ulcers and gastritis, and back pain. To evaluate anti-inflammatory and antinociceptive activities a hydroalcoholic extract (HE) from inner bark was prepared. For the anti-inflammatory activity, carrageenan-induced paw edema and peritonitis models, and also myeloperoxidase assay were used. For the antinociceptiva activity acetic acid-induced writhing, hot plate and formalin tests were employed. The HE extract exhibited an intense inhibition in carrageenan-induced edema model and also in myeloperoxidase activity at the doses of 100 and 300 mg/kg. The leukocyte migration into the peritoneal cavity was also inhibited at the doses of 30, 100 and 300 mg/kg. A similar profile was observed against acid-induced abdominal contortions and in formalin second phase test at the doses of 30 and 100 mg/kg, but this treatment did not affect the behavior of animals in the hot plate test. The experimental data of the HE from Pseudobombax marginatum show anti-inflammatory and antinociceptiva activities, confirming the indication from traditional medicine; however further studies are required to define and isolate the active anti-inflammatory and antinociceptiva components from this active specie. © 2013 Elsevier Ireland Ltd. All rights reserved.

  18. Nutrient Content, Phytonutrient Composition, Alpha Amylase, Alpha Glucosidase Inhibition Activity and Antioxidant Activity of the Stoechospermum Marginatum Collected in Pre Monsoon Season

    Directory of Open Access Journals (Sweden)

    Reka Palanivel

    2017-03-01

    Full Text Available The objective of this study was to investigate the nutrient content, phytonutrient composition, physicochemical properties, alpha amylase and alpha glucosidase inhibition activity and antioxidant activity of the brown algae Stoechospermum marginatum collected from Gulf of Mannar, Tamil Nadu, India in pre monsoon season (June- September, 2015. Six and eight hours of ethanol and aqueous extract of Stoechospermum marginatum were used for phytonutrient screening, alpha amylase, alpha glucosidase inhibition activity and antioxidant activity. From the results of the study it is understood that Stoechospermum marginatum contain a high amount of carbohydrate, protein, crude fiber and phytonutrients like tannin, flavonoid, saponin, alkaloid, terpenoids, steroid and total phenolic content. The physicochemical properties namely Water absorption and Swelling power were very promising. Alpha amylase and alpha glucosidase inhibition activity was recorded to be high in both aqueous and ethanol extracts of eight hour extraction than in extracts taken from six hours extraction. Antioxidant activity was detected using DPPH, FRAP, beta carotene scavenging and H2O2 assay and found to have a high radical scavenging activity. Stoechospermum marginatum possess a valuable amount of total phenolic content and other phytonutrients and physicochemical properties, it may the reason for the potential inhibition of alpha amylase, alpha glucosidase and antioxidant activity. It is concluded from the study that the brown algae may be incorporated into foods to enhance their nutritional and therapeutic value.

  19. Notas de ixodologia: III - conformação de Ixodes aragãoi Fonseca, 1935, de Ixodes amarali Fonseca, 1935, e lista das espécies do gênero Ixodes que ocorrem no Brasil (Acari, Ixodidae

    Directory of Open Access Journals (Sweden)

    Henrique Aragão

    1952-03-01

    Full Text Available After comparison of the types of Ixodes ricinus aragãoi Fonseca, 1935, with a lot of Ixodes affinis Neumann, 1899, kindly loaned by Dr. Kohls, it was observed that both species differ by the aspect of the dorsal scutm, no large punctations being in the posterior border in the Brazilian material. Therefore is FONSECA'S species maintened as Ixodes aragãoi Fonseca, 1935. Ixodes amarali Fonseca, 1935 was reexamined and confirmed as a valid species. A list of Brazilian species of the genus Ixodes studied by the authors is presented.

  20. Repellent efficacy of DEET, Icaridin, and EBAAP against Ixodes ricinus and Ixodes scapularis nymphs (Acari, Ixodidae).

    Science.gov (United States)

    Büchel, Kerstin; Bendin, Juliane; Gharbi, Amina; Rahlenbeck, Sibylle; Dautel, Hans

    2015-06-01

    Repellent efficacy of 10% EBAAP (3-[N-butyl-N-acetyl]-aminopropionic acid, ethyl ester) and 10% Icaridin ((2-(2-hydroxyethyl)-1-piperidinecarboxylic acid 1-methylpropyl ester)) were evaluated against 20% DEET (N,N-diethyl-3-methylbenzamide) in human subject trials against ticks. Responses of host-seeking nymphs of the European castor bean tick (Ixodes ricinus L.; Acari: Ixodidae) and the North American blacklegged tick (I. scapularis Say; Acari: Ixodidae) were compared. Tests were carried out according to the US-EPA standard protocol with ethanolic solutions of the active ingredients of repellents being applied to the forearm of 10 volunteers. The upward movement of ticks was monitored until repellent failure taking up to 12.5 h. Application of 20% DEET resulted in median complete protection times (CPT; Kaplan-Meier median) between 4 and 4.5 h, while 10% EBAAP yielded CPTs of 3.5-4h. No significant differences were found between the efficacies of two repellents nor between the two species tested. The median of the CPT of a 10% Icaridin solution was 5h in nymphs of I. scapularis, but 8h in those of I. ricinus (Prepellent activity against nymphs of the two Ixodes ticks with Icaridin demonstrating particularly promising results against I. ricinus. Future research should investigate whether similar results occur when adult Ixodes ticks or other tick species are tested.

  1. Spatiotemporal dynamics of emerging pathogens in questing Ixodes ricinus

    NARCIS (Netherlands)

    Coipan, E.C.; Jahfari, S.; Fonville, M.; Maassen, C.B.; Giessen, van der J.; Takken, W.; Takumi, K.; Sprong, H.

    2013-01-01

    Ixodes ricinus transmits Borrelia burgdorferi sensu lato, the etiological agent of Lyme disease. Previous studies have also detected Rickettsia helvetica, Anaplasma phagocytophilum, Neoehrlichia mikurensis, and several Babesia species in questing ticks in The Netherlands. In this study, we assessed

  2. Babesia species in questing Ixodes ricinus, Sweden.

    Science.gov (United States)

    Karlsson, Maria E; Andersson, Martin O

    2016-02-01

    Babesiosis is an emerging tick-transmitted zoonosis in large parts of the world. In Sweden, the occurrence and diversity of Babesia species is largely unknown. In order to estimate the exposure to Babesia from infected ticks, we collected questing Ixodes ricinus from several sites across southern Sweden during two consecutive field seasons and investigated the occurrence of Babesia species. We report for the first time the occurrence of the zoonotic species Babesia venatorum in Swedish ticks, with a prevalence of 1%. We also detected B. microti (prevalence 3.2%) and B. divergens (prevalence 0.2%). The incidence of Babesia in questing ticks is substantially lower than that of several other tick-borne diseases in Sweden. Nevertheless, babesiosis should not be neglected as a possible diagnosis following tick bites in humans and animals in Sweden.

  3. Toxicity of essential oils of Piper marginatum Jacq. against Tetranychus urticae Koch and Neoseiulus californicus (McGregor

    Directory of Open Access Journals (Sweden)

    Nicolle Ribeiro

    2016-03-01

    Full Text Available Tetranychus urticae Koch (Acari: Tetranychidae is an economically important pest of agricultural and ornamental crops worldwide. It has been shown that many of natural plant-based pesticides have fewer side effects compared with synthetic chemicals. The essential oils of plants have been broadly studied for pest-control, including toxic and repellent effects, antifeedant, ovicidal, and other properties. Essential oils from stems, flowers, and leaves of Piper marginatum Jacq. were evaluated in the laboratory regarding their acaricidal potential against the two-spotted spider mite (T. urticae and the results were compared with eugenol as a positive control. The oils were also evaluated with regard to the susceptibility of the natural enemy of T. urticae (Neoseiulus californicus McGregor. Based on LC50 estimates, oils from stems and flowers exhibited the same toxicity and differed significantly from the leaf oil with LC50 0.37, 0.56, and 3.77 μL L-1, respectively. None of the oils tested exhibited toxicity greater than or equal to that of the positive control. The oil mortality rate was significantly lower for N. californicus (50% to 70% than for T. urticae (> 95%. The P. marginatum oils also deterred oviposition. Among the chemical constituents tested, sesquiterpenes were more toxic with an LC50 of 2.89 μL L-1 than phenylpropanoids Z-asarone and E-asarone with LC50 6.64 and 8.51 μL L-1, respectively. The acaricidal properties, oviposition deterrence and selectivity make these oils strong candidates for use as the active ingredient in a plant-based acaricidal agent.

  4. Metarhizium anisopliae as a biological control agent against Hyalomma anatolicum (Acari: Ixodidae).

    Science.gov (United States)

    Suleiman, Elham A; Shigidi, M T; Hassan, S M

    2013-12-15

    In the Sudan, ticks and Tick-borne Diseases (TBDs) with subsequent costs of control and treatment are causing substantial economic loss. Control of ticks is mainly by chemical insecticides. The rising environmental hazards and problem of resistance has motivated research on biological agents as alternative methods of control. The present study aims at controlling livestock ticks using fungi for their unique mode of action besides their ability to adhere to the cuticle, to germinate and penetrate enzymatically. The study was conducted to evaluate the fungus Metarhizium anisopliae for tick control as an alternative mean to chemical acaricides. Pathogenicity of the fungus was tested on different developmental stages of the tick Hyalomma anatolicum. The fungus induced high mortality to flat immature stages. It, also, affected reproductive potential of the females. Egg laid, hatching percent, fertility and moulting percent of immature stages were significantly (p anisopliae to control ticks is discussed.

  5. Natural infection rates and transmission of Theileria annulata by Hyalomma anatolicum anatolicum ticks in the Sudan

    Directory of Open Access Journals (Sweden)

    D.A. Salih

    2005-09-01

    Full Text Available Hyalomma anatolicum anatolicum nymphs were collected from two localities in the Sudan: Eddamer in Northern Sudan and Wad-Medani in Central Sudan. They were allowed to moult to adult ticks, which were assessed for Theileria infection in their salivary glands using Feulgen stain. At Eddamer, 49.6 % of 123 ticks examined were infected with Theileria and the mean intensity of infection was 1.3 (i.e. the number of infected acini / number of infected ticks. At Wad-Medani, 8.6 % of 162 ticks were infected and the mean intensity of infection was 7.9. The prevalence of infection was higher in female than in male ticks at both localities. When adult H. a. anatolicum were applied onto two susceptible calves, both animals developed the severe form of theileriosis.

  6. Rickettsia africae in Hyalomma dromedarii ticks from sub-Saharan Algeria.

    Science.gov (United States)

    Kernif, Tahar; Djerbouh, Amel; Mediannikov, Oleg; Ayach, Bouhous; Rolain, Jean-Marc; Raoult, Didier; Parola, Philippe; Bitam, Idir

    2012-12-01

    Spotted fever group (SFG) rickettsioses are caused by obligate, intracellular Gram-negative bacteria of the genus Rickettsia. In recent years, several species and subspecies of rickettsias have been identified as emerging pathogens throughout the world, including sub-Saharan Africa. We report here the detection of Rickettsia africae, the agent responsible for African tick-bite fever, by amplification of fragments of gltA and ompA genes and multi-spacer typing from Hyalomma dromedarii ticks collected from the camel Camelus dromedarius in the Adrar and Béchar region (sub-Saharan Algeria). To date, R. africae has been associated mainly with Amblyomma spp. The role of H. dromedarii in the epidemiology of R. africae requires further investigation.

  7. Pro-toxic 1,2-Dehydropyrrolizidine alkaloid esters, including unprecedented 10-membered macrocyclic diesters, in the medicinally-used Alafia cf. caudata and Amphineurion marginatum (Apocynaceae: Apocynoideae: Nerieae and Apoc

    Science.gov (United States)

    The attraction of pyrrolizidine alkaloid-pharmacophagous insects indicated the presence of pro-toxic dehydropyrrolizidine alkaloids in Alafia cf. caudata Stapf (Nerieae: Alafinae) and Amphineurion marginatum (Roxb.) D.J. Middleton (Apocyneae: Amphineuriinae). Subsequently, monoesters of retronecine ...

  8. 小亚璃眼蜱和亚洲璃眼蜱对环形泰勒虫传播能力的研究%Studies on ability to transmit Theileria annulata with Hyalomma anatolicum anatolicum and Hyalomma asiaticum asiaticum

    Institute of Scientific and Technical Information of China (English)

    罗建勋; 殷宏; 关贵全; 马米玲; 张其才; 吕文顺

    2003-01-01

    将实验室培养的小亚璃眼蜱(Hyalomma anatolicum anatolicum)和亚洲璃眼蜱(Hyalomma asiaticum asiaticum)清洁幼虫和若虫饲喂于感染环形泰勒虫的牛体,收集饱血幼虫和若虫,用所孵化的若虫和成虫感染试验牛.结果显示,小亚璃眼蜱幼虫、若虫阶段感染,所发育之若虫、成虫均可传播环形泰勒虫;而亚洲璃眼蜱各阶段的传播试验结果均为阴性.

  9. The Camel Tick, Hyalomma (Hyalomma dromedarii Koch, 1844 (Ixodoidea: Ixodidae: Description of the Egg and Redescription of the Larva by Scanning Electron Microscopy

    Directory of Open Access Journals (Sweden)

    Ashraf Ahmed Montasser

    2006-01-01

    Full Text Available The present study describes the egg of Hyalomma (H. dromedarii for the first time and adds more features to the larva using Scanning Electron Microscopy (SEM in order to extend our knowledge on these acarine stages to be useful for further taxonomical or control studies. With the purpose of presenting exact description of acarine eggs, it is preferable to examine them both with and without SEM processing. SEM processing caused partial removal of the chorion which makes the egg shell clear and easily observed. The study revealed rough surface of egg shell which was surrounded by the chorion. The egg shell was perforated particularly at poles. The chorion appeared as a finely perforated cloth. Different forms of bumps were noticed between egg shell and chorion. Length, width, l/w ratio and pore diameter of the egg were measured. SEM investigation of the larva revealed smooth scutum with slight irregular ornamentation and horizontally folded extensible cuticle with vertical ridges. At least 2 types of cuticular openings were noticed on the extensible cuticle of the idiosoma. The first type was represented by 1 pair on dorsal side and 2 pairs on ventral one. It was surrounded with thick integumental ring and guarded with 2 internal lips. The second type was numerous, slit-like and without rings or lips. Dorsolateral plate of the hypostome carried numerous oval, tile-like and elevated denticles while ventral one carried 4 rows of posteriorly directed retrograde conical denticles. Mouth enclosed 2 cheliceral digits, each terminated with 3 lobes. Each lobe is supported with 2 or 3 conical denticles which were externally directed to the posterior. Haller`s organ on the tarsus of the first pair of legs consisted of anterior pit and posterior capsule. The pit contained 6 conical sensillae while the capsule opening had extensively branched margin. Measurements of the whole body, idiosoma, scutum, eye, capitulum, hypostome, palp, cuticular pores, legs and

  10. Molecular genetic key for the identification of 17 Ixodes species of the United States (Acari:Ixodidae): a methods model.

    Science.gov (United States)

    Poucher, K L; Hutcheson, H J; Keirans, J E; Durden, L A; Black, W C

    1999-08-01

    A taxonomic key, based on restriction enzyme analysis of the second internal-transcribed spacer (ITS-2) in the nuclear ribosomal DNA gene, was developed for identification of 17 Ixodes tick species in the United States. This key includes: Ixodes affinis Neumann, Ixodes angustus Neumann, Ixodes baergi Cooley and Kohls, Ixodes brunneus Koch, Ixodes cookei Packard, Ixodes dentatus Marx, Ixodes jellisoni Cooley and Kohls, Ixodes kingi Bishopp, Ixodes minor Neumann, Ixodes muris Bishopp and Smith, Ixodes pacificus Cooley and Kohls, Ixodes scapularis Say, Ixodes sculpularis Neumann, I. spinipalpis Hadwen and Nuttall, Ixodes texanus Banks, Ixodes uriae White, and Ixodes woodi Bishopp. A 900-bp fragment of the ITS-2 was amplified using the polymerase chain reaction. This fragment was then digested with the restriction enzymes MspI and CfoI, and the digested fragments were size fractionated on a 2.5% high-resolution agarose gel. A dichotomous key was developed based on digested fragment sizes relative to a standard set of size markers. Little intraspecific variation in restriction fragment banding patterns was detected.

  11. Molecular detection of Rickettsia africae, Rickettsia aeschlimannii, and Rickettsia sibirica mongolitimonae in camels and Hyalomma spp. ticks from Israel.

    Science.gov (United States)

    Kleinerman, Gabriela; Baneth, Gad; Mumcuoglu, Kosta Y; van Straten, Michael; Berlin, Dalia; Apanaskevich, Dmitry A; Abdeen, Ziad; Nasereddin, Abed; Harrus, Shimon

    2013-12-01

    In this study, we aimed to identify and genetically characterize spotted fever group (SFG) rickettsiae in ticks, domestic one-humped camels, and horses from farms and Bedouin communities in southern Israel. A total of 618 ixodid ticks (Hyalomma dromedarii, Hyalomma turanicum, Hyalomma excavatum, and Hyalomma impeltatum) collected from camels and horses, as well as 152 blood samples from 148 camels and four horses were included in the study. Initial screening for rickettsiae was carried out by targeting the gltA gene. Positive samples were further analyzed for rickettsial ompA, 17kDa, ompB, and 16S rRNA genes. Rickettsia aeschlimannii DNA was detected in the blood of three camels and 14 ticks (H. dromedarii, H. turanicum, and H. excavatum). Rickettsia africae was found in six ticks (H. turanicum, H. impeltatum, H. dromedarii, and H. excavatum). In addition, Rickettsia sibirica mongolitimonae was detected in one H. turanicum tick. These findings represent the first autochthonous detection of R. africae in Israel. Previous detections of R. africae in Asia were reported from the Sinai Peninsula (Egypt) and Istanbul, only. Furthermore, we report for the first time the finding of R. aeschlimannii in H. turanicum and H. excavatum ticks, as well as the first identification of R. sibirica mongolitimonae in H. turanicum ticks. The tick species identified to harbor R. africae and other SFG rickettsiae have been reported to occasionally feed on people, and, therefore, physicians should be aware of the possible exposure of local communities and travelers, especially those in contact with camels, to these tick-borne rickettsial pathogens.

  12. The dependence of Hyalomma aegyptium on its tortoise host Testudo graeca in Algeria.

    Science.gov (United States)

    Tiar, G; Tiar-Saadi, M; Benyacoub, S; Rouag, R; Široký, P

    2016-09-01

    Hyalomma aegyptium (Linnaeus, 1758) (Ixodida: Ixodidae) has recently been confirmed as a carrier of numerous pathogenic, including zoonotic, agents. Four environmentally distinct regions of Algeria, located between the humid coastal zone and the arid Saharan Atlas range, were selected in order to compare differences in tick abundance among localities, and the correlations between tick abundance and host population characteristics and other environmental conditions. Sampling was carried out during May and early June in 2010-2012. A total of 1832 H. aegyptium were removed from 201 tortoises. Adult ticks accounted for 52% of the collection. In the pre-adult stages, larvae were dominant. Data on prevalence, intensity (mean ± standard deviation, range) and abundance of tick infestation were calculated for each locality. Locally, prevalences reached 100%. The sex ratio was biased in favour of males (4.2). Intensities of infestation differed significantly among the localities studied for all developmental stages of the tick. The intensity of infestation by adult ticks was positively correlated to the size of the tortoise and with tortoise population density in the habitat. However, findings for immature tick stages were independent of both variables. No significant correlations between infestation intensities and the climatic parameters tested were found. Immature ticks were observed to prefer the front parts of their tortoise hosts, whereas the majority of adults were attached to the rear parts.

  13. Hyalomma aegyptium on Spur-thighed Tortoise (Testudo graeca in Urmia Region West Azerbaijan, Iran

    Directory of Open Access Journals (Sweden)

    M Tavassoli

    2007-05-01

    Full Text Available Background: Ticks are obligate blood feeders that parasitize a wide variety of animals. Hyalomma aegyptium, parasitize tortoises and other small wild life and livestock. This study was carried out to determine spur-thighed tortoise (Testudo graeca infestation to H. ageyptium in Urmia region West Azerbaijan of Iran. Methods: The study was carried out over a 16 month period from the spring of 2004 to the fall of 2005. A total of 32 tor¬toises were sampled. Results: The results indicated that 14 tortoises infected with ticks. A total of 117 ticks were collected from infested animals, the minimum and maximum tick infestation was 1-60. Ticks were attached to the axilla of fore and hind legs of tortoises. All ticks were determined to be H. aegyptium. Conclusion: H. aegyptium was the most common tick species in the study area. Due to tendency of some people to keeping tortoise as pet animal, more attention must be done to tortoise’s tick infestation. Due to existence of H. aegyptium on tor¬toises in this region more study will need to evaluate presence of this tick on other animal species and its role on transmis¬sion of diseases.

  14. [The importance of gamma irradiations with caesium-137 for Hyalomma anatolicum anatolicum (Metastigmata, Ixodidae) control].

    Science.gov (United States)

    Karaer, Zafer; Kar, Sirri; Düzgün, Ali; Güven, Esin; Pekmezci, Zafer; Emre, Zişan

    2006-01-01

    In this study, male ticks belonging to the Hyalomma anatolicum anatolicum species were subjected to gamma radiation doses of 5, 10, 15, 20 and 50 Gy, emitted by a gamma-ray source of Caesium 137. In females that fed with these male ticks, proportional to the increase in radiation dose, the period of feeding was found to shorten. A decrease was demonstrated in the number of engorged female ticks, engorgement weights, number of laying ticks and number of eggs. The hatching period of larvae from eggs was found to increase despite the decrease in the number of hatched larvae. Moreover no larvae were observed to hatch from any of the eggs of female ticks treated with a radiation dose of 50 Gy. Similarly, proportional to the applied dose of radiation, rates of viability and activity were observed to decrease in male ticks. In conclusion, taking into consideration the feeding periods and fertility rates of female ticks as indicators of male activity, this study has demonstrated that in combating with H. anatolicum anatolicum, radiation may be successful and a radiation dose of 10 Gy is most favorable.

  15. Primer registro de Ixodes cookei (Acari: Ixodidae) para México First record of Ixodes cookei (Acari: Ixodidae) in Mexico

    OpenAIRE

    2007-01-01

    En este estudio se aportan los primeros datos de la garrapata Ixodes cookei Packard, 1869 en México. Un macho, 7 larvas y 15 ninfas se recolectaron en los estados de Nuevo León y Veracruz. Además, se registra al cacomixtle Bassariscus astutus como un nuevo huésped.The presence of Ixodes cookei Packard, 1869 is documented for the first time in Mexico, based on one male, 7 larvae and 15 nymphs collected in Veracruz and Nuevo Leon. Additionally, cacomixtle (Bassariscus astutus) is presented as a...

  16. Primer registro de Ixodes cookei (Acari: Ixodidae para México First record of Ixodes cookei (Acari: Ixodidae in Mexico

    Directory of Open Access Journals (Sweden)

    Griselda Montiel-Parra

    2007-06-01

    Full Text Available En este estudio se aportan los primeros datos de la garrapata Ixodes cookei Packard, 1869 en México. Un macho, 7 larvas y 15 ninfas se recolectaron en los estados de Nuevo León y Veracruz. Además, se registra al cacomixtle Bassariscus astutus como un nuevo huésped.The presence of Ixodes cookei Packard, 1869 is documented for the first time in Mexico, based on one male, 7 larvae and 15 nymphs collected in Veracruz and Nuevo Leon. Additionally, cacomixtle (Bassariscus astutus is presented as a new host record.

  17. Molecular detection of Rickettsia aeschlimannii in Hyalomma spp. ticks from camels (Camelus dromedarius) in Nigeria, West Africa.

    Science.gov (United States)

    Kamani, J; Baneth, G; Apanaskevich, D A; Mumcuoglu, K Y; Harrus, S

    2015-06-01

    Several species of the spotted fever group rickettsiae have been identified as emerging pathogens throughout the world, including in Africa. In this study, 197 Hyalomma ticks (Ixodida: Ixodidae) collected from 51 camels (Camelus dromedarius) in Kano, northern Nigeria, were screened by amplification and sequencing of the citrate synthase (gltA), outer membrane protein A (ompA) and 17-kDa antigen gene fragments. Rickettsia sp. gltA fragments were detected in 43.3% (42/97) of the tick pools tested. Rickettsial ompA gene fragments (189 bp and 630 bp) were detected in 64.3% (n = 27) and 23.8% (n = 10) of the gltA-positive tick pools by real-time and conventional polymerase chain reaction (PCR), respectively. The amplicons were 99-100% identical to Rickettsia aeschlimannii TR/Orkun-H and R. aeschlimannii strain EgyRickHimp-El-Arish in GenBank. Furthermore, 17-kDa antigen gene fragments of 214 bp and 265 bp were detected in 59.5% (n = 25) and 38.1% (n = 16), respectively, of tick pools, and sequences were identical to one another and 99-100% identical to those of the R. aeschlimannii strain Ibadan A1 in GenBank. None of the Hyalomma impressum ticks collected were positive for Rickettsia sp. DNA. Rickettsia sp. gltA fragments (133 bp) were detected in 18.8% of camel blood samples, but all samples were negative for the other genes targeted. This is the first report to describe the molecular detection of R. aeschlimannii in Hyalomma spp. ticks from camels in Nigeria.

  18. Molecular evidence for bacterial and protozoan pathogens in hard ticks from Romania.

    Science.gov (United States)

    Ionita, Mariana; Mitrea, Ioan Liviu; Pfister, Kurt; Hamel, Dietmar; Silaghi, Cornelia

    2013-09-01

    The aim of the present study was to provide a preliminary insight into the diversity of tick-borne pathogens circulating at the domestic host-tick interface in Romania. For this, feeding and questing ticks were analyzed by real-time polymerase chain reaction (PCR) for the presence of Anaplasma phagocytophilum, Anaplasma platys, Ehrlichia canis, Borrelia burgdorferi sensu latu, and by PCR and subsequent sequencing for Rickettsia spp., Babesia spp. and Theileria spp. A total of 382 ticks, encompassing 5 species from 4 genera, were collected in April-July 2010 from different areas of Romania; of them, 40 were questing ticks and the remainder was collected from naturally infested cattle, sheep, goats, horses or dogs. Tick species analyzed included Ixodes ricinus, Dermacentor marginatus, Hyalomma marginatum, Rhipicephalus bursa, and Rhipicephalus sanguineus. Four rickettsiae of the spotted fever group of zoonotic concern were identified for the first time in Romania: Rickettsia monacensis and Rickettsia helvetica in I. ricinus, and Rickettsia slovaca and Rickettsia raoultii in D. marginatus. Other zoonotic pathogens such as A. phagocytophilum, Borrelia afzelii, and Babesia microti were found in I. ricinus. Pathogens of veterinary importance were also identified, including Theileria equi in H. marginatum, Babesia occultans in D. marginatus and H. marginatum, Theileria orientalis/sergenti/buffeli-group in I. ricinus and in H. marginatum and E. canis in R. sanguineus. These findings show a wide distribution of very diverse bacterial and protozoan pathogens at the domestic host-tick interface in Romania, with the potential of causing both animal and human diseases.

  19. Repellent activities of dichloromethane extract of Allium sativum (garlic (Liliaceae against Hyalomma rufipes (Acari

    Directory of Open Access Journals (Sweden)

    Felix Nchu

    2016-02-01

    Full Text Available Dichloromethane (DCM extract of garlic (Allium sativum Linn. bulbs was assessed for its repellent effect against the hard tick, Hyalomma rufipes (Acari: Ixodidae using two tick behavioural bioassays; Type A and Type B repellency bioassays, under laboratory conditions. These bioassays exploit the questing behaviour of H. rufipes, a tick that in nature displays ambush strategy, seeking its host by climbing up on vegetation and attaching to a passing host. One hundred microlitres (100 µL of the test solution containing DCM extract of garlic bulbs and DCM at concentrations of 0.35%, 0.7% or 1.4% w/v were evaluated. DCM only was used for control. Tick repellency increased significantly (R2 = 0.98 with increasing concentration (40.03% – 86.96% yielding an EC50 of 0.45% w/v in Type B repellency bioassay. At concentration of 1.4% w/v, the DCM extract of garlic bulbs produced high repellency index of 87% (male ticks and 87.5% (female ticks in the Type A repellency bioassay. Only 4% avoidance of male ticks or female ticks was recorded in the Type B repellency bioassay. In the corresponding controls, the mean numbers of non-repelled male or female ticks were 80% and 41 males or 38 females of 50 ticks in the Type A and Type B repellency bioassays, respectively. The variations in the results could be attributed to the difference in tick repellent behaviours that were assessed by the two repellency bioassays; the Type A repellency bioassay assessed repellent effect of garlic extracts without discriminating between deterrence and avoidance whereas the Type B repellency bioassay only assessed avoidance response. Generally, DCM extract of garlic was repellent against H. rufipes, albeit weak tick repellency was obtained in the Type B repellency bioassay. Furthermore, this study established that the tick repellent activity of garlic extracts is predominantly by deterrence.

  20. Repellent activities of dichloromethane extract of Allium sativum (garlic) (Liliaceae) against Hyalomma rufipes (Acari).

    Science.gov (United States)

    Nchu, Felix; Magano, Solomon R; Eloff, Jacobus N

    2016-12-02

    Dichloromethane (DCM) extract of garlic (Allium sativum Linn.) bulbs was assessed for its repellent effect against the hard tick, Hyalomma rufipes (Acari: Ixodidae) using two tick behavioural bioassays; Type A and Type B repellency bioassays, under laboratory conditions. These bioassays exploit the questing behaviour of H. rufipes, a tick that in nature displays ambush strategy, seeking its host by climbing up on vegetation and attaching to a passing host. One hundred microlitres (100 µL) of the test solution containing DCM extract of garlic bulbs and DCM at concentrations of 0.35%, 0.7% or 1.4% w/v were evaluated. DCM only was used for control. Tick repellency increased significantly (R2 = 0.98) with increasing concentration (40.03% - 86.96%) yielding an EC50 of 0.45% w/v in Type B repellency bioassay. At concentration of 1.4% w/v, the DCM extract of garlic bulbs produced high repellency index of 87% (male ticks) and 87.5% (female ticks) in the Type A repellency bioassay. Only 4% avoidance of male ticks or female ticks was recorded in the Type B repellency bioassay. In the corresponding controls, the mean numbers of non-repelled male or female ticks were 80% and 41 males or 38 females of 50 ticks in the Type A and Type B repellency bioassays, respectively. The variations in the results could be attributed to the difference in tick repellent behaviours that were assessed by the two repellency bioassays; the Type A repellency bioassay assessed repellent effect of garlic extracts without discriminating between deterrence and avoidance whereas the Type B repellency bioassay only assessed avoidance response. Generally, DCM extract of garlic was repellent against H. rufipes, albeit weak tick repellency was obtained in the Type B repellency bioassay. Furthermore, this study established that the tick repellent activity of garlic extracts is predominantly by deterrence.

  1. Gram-negative bacteria from the camel tick Hyalomma dromedarii (Ixodidae) and the chicken tick Argas persicus (Argasidae) and their antibiotic sensitivities.

    Science.gov (United States)

    Montasser, Ashraf A

    2005-04-01

    A total of nine species of gram-negative bacteria were isolated from organs and haemolymph of the hard tick Hyalomma (Hyalomma) dromedarii and the soft tick Argas (Persicargas) persicus. Four species namely Serratia liquefaciens, Stenotrophomonas maltophilia, Klebsiella ornithinolytica and Aeromonas hydrophila were isolated from H. dromedarii and five species namely Rahnella aquatilis, Pseudomonas fluorescens, Enterobacter cloacae, Chryseomonas luteola and Chryseobacterium meningosepticum were isolated from A. persicus. Isolated bacteria were identified using the analytical profile index 20E. Disk diffusion test was carried out on all isolated bacteria to determine antibiotic sensitivity of chloramphenicol, amoxillin/clavulanic acid, neomycin, streptomycin, triplesulphur tetracycline and nitrofurantion. The results were discussed.

  2. Hyalomma (Hyalommina) arabica sp. n. parasitizing goats and sheep in the Yemen Arab Republic and Saudi Arabia.

    Science.gov (United States)

    Pegram, R G; Hoogstraal, H; Wassef, H Y

    1982-02-01

    Hyalomma (Hyalommina) arabica sp. n. is described from 62 adults (29 males, 33 females) taken throughout the year from 23 goats and two sheep, mostly at 200 m altitude in the southern tihama foothills of Ta'izz Province, Yemen Arab Republic. One female from a goat at 2,300 m altitude in this Province may have attached to the host elsewhere and a male from Mecca, Saudi Arabia, was on a goat imported from an unknown source for the traditional religious pilgrimage feast. We postulate that the original host of adults was the Nubian ibex, Capra ibex nubiana F. Cuvier (Artiodactyla: Caprinae). This parasite is most closely related to H. (H.) kumari Sharif, which infests chiefly wild and domestic Caprinae from India to northwestern Iran and Tadzhik, SSR. It also shows relationships to H. (H.) punt Hoogstraal, Kaiser and Pedersen, which parasitizes gazelles and domestic mammals in Somalia and Ethiopia, but differs more widely from the third African-Arabian member of this subgenus, H. (H.) rhipicephaloides Neumann, which feeds on the Nubian ibex and gazelles in the Red Sea and Dead Sea areas. The Hyalomma subgenus Hyalommina now contains seven species, four confined to the Indian subcontinent (including Nepal, Burma, India, Sri Lanka, Pakistan, and Afghanistan) and Southwest Asia, and three in eastern Africa north of the equator and Arabia.

  3. Chronic course of Ixodes tick borreliosis in Krasnoyarsk region

    Directory of Open Access Journals (Sweden)

    N. S. Minoranskaya

    2014-01-01

    Full Text Available The purpose of the study – the optimization of clinical diagnosis of chronic course of Ixodes tick-borne borreliosis based on indicators of immune and cytokine status of patients.Materials and Methods: clinical and immunological study of patients with chronic Ixodes tick-borne borreliosis in the Krasnoyarsk region. The observations were made on 205 patients for 1,5 years. The diagnosis was based on clinical and epidemiological data confirmed the identification of specific antibodies to borrelia by ELISA. The indices of cellular and humoral immune system, phagocytosis, cytokine (interleukin-1β, 4, 8 , tumor necrosis factor-α.Results: Show Part chronicity of infection after an noneritemic form of the disease (37,5% and combined forms of Ixodes tick-borne borreliosis with tick-borne encephalitis (33,2%. Clinical manifestations were characterized by the involvement in the pathological process of the musculoskeletal system (42,9% and combined lesions to the nervous system (38.5%. A rare variant of the chronic course of borreliosis was central nervous system as the onset of the disease (3,5%. Common infectious syndrome relapse accompanied by autonomic dysfunction with prevalence parasimpatotonus (59,0% and simpatotonus (41,0%, and febrile reactions (71,2% were more subfebrile with fever (51,2%.Conclusion: pathogenetic mechanisms of chronic course of Ixodes tick-borne borreliosis closely associated with inflammation and immune-mediated reactions of the organism , and are characterized by the presence of cellular immunodeficiency, insolvency phagocytosis, suppression of the synthesis of interleukin-4 and interleukin-8 intensive products.

  4. Borrelia burgdorferi sensu lato in Ixodes cf. neuquenensis and Ixodes sigelos ticks from the Patagonian region of Argentina.

    Science.gov (United States)

    Sebastian, Patrick S; Bottero, Maria Noelia Saracho; Carvalho, Luis; Mackenstedt, Ute; Lareschi, Marcela; Venzal, José M; Nava, Santiago

    2016-10-01

    This study was conducted to detect Borrelia burgdorferi sensu lato infection in ixodid ticks from the Patagonia region in the south of Argentina. Therefore, ticks were collected on rodents in the provinces of Chubut, Río Negro and Santa Cruz. These ticks were identified as nymphs of Ixodes cf. neuquenensis and Ixodes sigelos. The B. burgdorferi s.l. infection was tested by a battery of PCR methods targeting the gene flagellin (fla) and the rrfA-rrlB intergenic spacer region (IGS). Three pools of I. sigelos nymphs from Chubut and Santa Cruz provinces as well as one pool of I. cf. neuquenensis nymphs from Río Negro province were tested positive in the fla-PCR. The samples of I. sigelos were also positive for the IGS-PCR. Phylogenetically, the haplotypes found in the positive ticks belong to the B. burgdorferi s.l. complex, and they were closely related to Borrelia chilensis, a genospecies isolated from Ixodes stilesi in Chile. The pathogenic relevance of the Borrelia genospecies detected in both I. neuquenensis and I. sigelos is unknown. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Filarial Nematode Infection in Ixodes scapularis Ticks Collected from Southern Connecticut

    Directory of Open Access Journals (Sweden)

    Pabbati Namrata

    2014-05-01

    Full Text Available It was recently demonstrated that the lone star tick Amblyomma americanum could harbor filarial nematodes within the genus Acanthocheilonema. In this study, Ixodes scapularis (deer ticks collected from Southern Connecticut were evaluated for their potential to harbor filarial nematodes. Non-engorged nymphal and adult stage Ixodes scapularis ticks were collected in Southern Connecticut using the standard drag method. In situ hybridization with filarial nematode specific sequences demonstrated the presence of filarial nematodes in Ixodes ticks. Filarial nematode specific DNA sequences were amplified and confirmed by direct sequencing in Ixodes nymphal and adult ticks using either general filarial nematode or Onchocercidae family specific PCR primers. Phylogenetic analysis of the 12S rDNA gene sequence indicated that the filarial nematode infecting Ixodes scapularis ticks is most closely related to the species found in Amblyoma americanum ticks and belongs to the genus of Acanthocheilonema. Our data also demonstrated that infection rate of these filarial nematode in Ixodes ticks is relatively high (about 22% and 30% in nymphal and adult Ixodes ticks, respectively. In summary, the results from our studies demonstrated that filarial nematode infection was found in Ixodes ticks similar to what has been found in Amblyomma americanum ticks.

  6. Seasonal distribution of Borreliae in Ixodes ricinus ticks in the Belgrade region

    Directory of Open Access Journals (Sweden)

    Milutinović Marija

    2006-01-01

    Full Text Available Green areas at four localities in the Belgrade region (Ada Ciganlija, Košutnjak, Miljakovac forest, and Mt. Avala were investigated in 2004. The aim of the research was to clarify the faunistic composition, relative abundance, and population dynamics of ticks, as well as the seasonal distribution of Borrelia burgdorferi sensu lato (sl in Ixodes ricinus. Two species of ticks were detected: Ixodes ricinus and Dermacentor reticulates. Relative abundance analysis revealed that the species Ixodes ricinus was predominant (97.41 %. Out of 942 Ixodes ricinus ticks, 188 (19.96 % were infected with Borrelia burgdorferi sl. The infection rate of adults by localities ranged from 19.16% to 30.99% (Mt. Avala and Ada Ciganlija, respectively.

  7. Pathogenicity of entomopathogenic fungus Metarhizium anisopliae (Deuteromycetes) to Ixodes scapularis (Acari: Ixodidae)

    Science.gov (United States)

    Zhioua, E.; Browning, M.; Johnson, P.W.; Ginsberg, H.S.; LeBrun, R.A.

    1997-01-01

    The entomopathogenic fungus Metarhizium anisopliae is highly pathogenic to the black-legged tick, Ixodes scapularis. Spore concentrations of 108/ml for engorged larvae and 107/ml for engorged females resulted in 100% tick mortality, 2 wk post-infection. The LC50 value for engorged larvae (concentration to kill 50% of ticks) was 107 spores/ml. Metarhizium anisopliae shows considerable potential as a microbial control agent for the management of Ixodes scapularis.

  8. The tick Ixodes granulatus infests Rattus rattus populating a small island offshore of Singapore

    OpenAIRE

    Paperna I.

    2006-01-01

    The ixodid tick Ixodes granulosus Supino 1897 was found infesting Rattus rattus in Semakau island, one of the small offshore islands fringing Singapore to the south. None of the examined R. rattus from the other islands fringing Singapore, or from Singapore island were found infested. Ixodes granulatus occurs, however, on Singapore island on Rattus annandalei, resident of undisturbed forested habitats. We speculate that invading black rats in Semakau replaced autochthonous sylvatic rodent pop...

  9. The extensible alloscutal cuticle of the tick, Ixodes ricinus

    DEFF Research Database (Denmark)

    Andersen, Svend Olav; Roepstorff, Peter

    2005-01-01

    The proteins in the distensible alloscutal cuticle of the blood-feeding tick, Ixodes ricinus, have been characterized by electrophoresis and chromatography, two of the proteins were purified and their total amino acid sequence determined. They show sequence similarity to cuticular proteins from...... of the insoluble fraction are fluorescent when exposed to ultraviolet light, and the fluorescence corresponds in excitation and emission maxima to the fluorescence of the rubber-like arthropodan protein, resilin, and to the amino acid dityrosine. Small amounts of dityrosine were obtained from ticks in the early...... phase of a blood meal when the cuticle weighs less than 4 mg; increasing amounts were obtained from animals in the initial period of feeding, during which the cuticular weight increases from 4 to 11 mg, whereas little increase in dityrosine content was observed during the final period of engorgement...

  10. Efficacy of afoxolaner against Ixodes scapularis ticks in dogs.

    Science.gov (United States)

    Mitchell, Elizabeth B; McCall, John W; Theodore Chester, S; Larsen, Diane

    2014-04-02

    Efficacy of afoxolaner, a novel isoxazoline insecticide/acaricide, against Ixodes scapularis was evaluated in a laboratory study. One day prior to treatment, beagle dogs (n=16) were infested with 50 unfed wild adult ticks. Repeat infestations were performed weekly for four additional weeks. The number of live ticks remaining on each dog was determined 48 h after treatment and after each subsequent infestation. A single oral treatment with a dose approaching the minimum effective dose of afoxolaner (2.5mg/kg) eliminated the pre-existing infestations of I. scapularis ticks and controlled weekly re-infestations, with efficacy between 98% and 100% recorded until Day 23 and 94% at Day 30.

  11. Molecular Identification of Borrelia miyamotoi in Ixodes ricinus from Portugal.

    Science.gov (United States)

    Nunes, Mónica; Parreira, Ricardo; Lopes, Nádia; Maia, Carla; Carreira, Teresa; Sousa, Carmelita; Faria, Sofia; Campino, Lenea; Vieira, M Luísa

    2015-08-01

    Borrelia miyamotoi, a relapsing fever spirochete, has been found recently in Ixodes ricinus ticks; however, little is known about its spatial distribution and potential local impact on human health. A total of 640 ticks (447 nymphs and 193 adults) collected throughout Portugal were analyzed using two nested PCR protocols, one targeting the flagellin gene and the other the internal transcribed space region between the 5S and the 23S rRNA. As a result, B. miyamotoi was detected, for the first time, in one guesting I. ricinus nymph collected in the Lisboa district. In addition, a prevalence of 11% (71/640) for B. burgdorferi sensu lato was obtained. Even though no human relapsing fever cases due to infection by B. miyamotoi have been reported yet in Portugal, surveillance must be improved to provide better insight into the prevalence and distribution of this spirochete in ticks.

  12. Exotic Rickettsiae in Ixodes ricinus: fact or artifact?

    Directory of Open Access Journals (Sweden)

    Reimerink Johan HJ

    2010-06-01

    Full Text Available Abstract Several pathogenic Rickettsia species can be transmitted via Ixodes ricinus ticks to humans and animals. Surveys of I. ricinus for the presence of Rickettsiae using part of its 16S rRNA gene yield a plethora of new and different Rickettsia sequences. Interpreting these data is sometimes difficult and presenting these findings as new or potentially pathogenic Rickettsiae should be done with caution: a recent report suggested presence of a known human pathogen, R. australis, in questing I. ricinus ticks in Europe. A refined analysis of these results revealed that R. helvetica was most likely to be misinterpreted as R. australis. Evidence in the literature is accumulating that rickettsial DNA sequences found in tick lysates can also be derived from other sources than viable, pathogenic Rickettsiae. For example, from endosymbionts, environmental contamination or even horizontal gene transfer.

  13. Population dynamics of ticks infesting the one-humped camel (Camelus dromedarius) in central Tunisia.

    Science.gov (United States)

    Gharbi, Mohamed; Moussi, Nawfel; Jedidi, Mohamed; Mhadhbi, Moez; Sassi, Limam; Darghouth, Mohamed Aziz

    2013-12-01

    A tick population was monitored on 30 camels (Camelus dromedarius) over one year in Kairouan region, Central Tunisia. A total of 1630 ticks was collected and identified resulting in an estimate of different parasitological indicators. The ticks belonged to 2 genera and 5 species: Hyalomma impeltatum (53%) and Hyalomma dromedarii (45%) were the dominant species followed by Hyalomma excavatum (1%), Hyalomma marginatum (0.5%), and Rhipicephalus turanicus (0.5%) (pTunisia.

  14. HA03 as an Iranian Candidate Concealed Antigen for Vaccination against Hyalomma anatolicum anatolicum: Comparative Structural and In silico Studies

    Directory of Open Access Journals (Sweden)

    Mohammadi, A.

    2013-12-01

    Full Text Available In the last decades researchers had focused on developing a vaccine against tick based on protective antigen. Recombinant vaccines based on concealed antigen from Boophilus microplus have been developed in Australia and Cuba by the name of TICKGARD and GAVAC (De La Fuente and Kocan, 2006. Further studies on this antigen have shown some extent of protection against other species (De Vos et al., 2001. In Iran most important species is Hyalomma anatolicum and limited information about its control are available. This paper reports structural and polymorphic analysis of HA03 as an Iranian candidate concealed antigen of H. a. anatolicum deposited in Gen-Bank .(Aghaeipour et al. GQ228820. The comparison between this antigen and other mid gut concealed antigen that their characteristics are available in GenBank showed there are high rate of similarity between them. The HA03 amino acid sequence had a homology of around 89%, 64%, 56% with HA98, BM86, BM95 respectively. Potential of MHC class I and II binding region indicated a considerable variation between BM86 antigen and its efficiency against Iranian H. a. anatolicum. In addition, predicted major of hydrophobisity and similarity in N-glycosylation besides large amount of cystein and seven EGF like regions presented in protein structure revealed that value of HA03 as a new protective antigen and the necessity of the development, BM86 homolog of H. a. anatolicum HA03 based recombinant vaccine.

  15. The Midgut Bacterial Flora of Laboratory-Reared Hard Ticks, Haemaphysalis longicornis, Hyalomma asiaticum, and Rhipicephalus haemaphysaloides

    Institute of Scientific and Technical Information of China (English)

    LI Chun-hong; CAO Jie; ZHOU Yong-zhi; ZHANG Hou-shuang; GONG Hai-yan; ZHOU Jin-lin

    2014-01-01

    Ixodid ticks play an important role in the transmission of a variety of zoonoses of viral, bacterial and protozoan origin, and they also harbor a wealth of microorganisms. To gain more detailed insights into the potential interactions between bacterial lfora and tick-borne pathogens, we investigated the midgut bacterial lfora of laboratory-reared Haemaphysalis longicornis, Hyalomma asiaticum and Rhipicephalus haemaphysaloides. Based on morphological, biochemical, and 16S rDNA sequencing results, we identiifed 15 species belonging to 12 genera in the midgut of the three ticks. The bacterial communities were similar to those found in other studies of hematophagous arthropods. Kocuria sp. was the most frequently isolated species and its 16S rDNA gene sequence was very similar to Kocuria koreensis P31T. To our knowledge, this is the ifrst report of the bacterial lfora of tick midguts and the results show that there were many different bacterial species in each tick species. Among the most common genera, there may have been a novel species in the genus Kocuria. The results might be the ifrst step for looking for different aspects of the pathogen and tick interaction.

  16. Effect of Hyalomma Ticks (Acari: Ixodidae on Milk Production of Dairy Buffaloes (Bos Bubalus Bubalis of Punjab (Pakistan

    Directory of Open Access Journals (Sweden)

    M.U. Iqbal

    2010-02-01

    Full Text Available The objective of this study was to estimate economic losses in terms of milk production caused by tick infestation in dairy buffaloes (Bos bubalus bubalis of Punjab (Pakistan. To this end, six hundred Nili-Ravi buffaloes infested with Hyalomma ticks (Acari: Ixodidae were selected and divided into two equal groups viz; A & B. The animals of group A were treated with various doses of 5% cypermethrine pour-on (Cipermetriven, Ivan Labs, Spain while those of group B were treated with propylene glycol (Propandiol - (1, 2, Merck as a sham treatment. Average milk production (L and butter fat (% was recorded before and after treatment in order to calculate post-treatment increase in these parameters (if any. An average daily increase of 1.15L in milk yield per animal with 1.31% more fat was observed in acaricide- treated animals. A dose-dependent effect of acaricide was found on the number of ticks as well as milk production and fat. The results provided a baseline data for further research on economic impact of tick nuisance to the smallholder dairy farming systems of Pakistan.

  17. Laboratory assessment of acaricidal activity of Cymbopogon winterianus, Vitex negundo and Withania somnifera extracts against deltamethrin resistant Hyalomma anatolicum.

    Science.gov (United States)

    Singh, Nirbhay Kumar; Jyoti; Vemu, Bhaskar; Nandi, Abhijit; Singh, Harkirat; Kumar, Rajender; Dumka, V K

    2014-07-01

    Larval packet test was used for detection of resistance levels against cypermethrin and deltamethrin, the most commonly used synthetic pyrethroids, in the multi-host tick Hyalomma anatolicum collected from district Moga, Punjab (India). Results indicated the presence of level I resistance against deltamethrin (RF = 2.81), whereas the tick isolate was susceptible to cypermethrin (RF = 0.2). The aqueous and ethanolic extracts of leaves of Cymbopogon winterianus, Vitex negundo and Withania somnifera along with roots of Vitex negundo were assessed for their acaricidal activity against the larvae of deltamethrin resistant H. anatolicum. The efficacy was assessed by measuring per cent larval mortality and determination of LC50 values. The various ethanolic extracts produced a concentration dependent increase in larval tick mortality, whereas the aqueous extracts exhibited a much lower mortality. The highest mortality (93.7 ± 0.66 %) was observed at the 5.0 % concentration of ethanolic extract of leaves of C. winterianus and the lowest LC50 value (0.011 %) was recorded for ethanolic extracts of leaves of V. negundo. The results indicated that these plant extracts have potential to be developed as herbal acaricides.

  18. Modeling the geographic distribution of Ixodes scapularis and Ixodes pacificus (Acari: Ixodidae) in the contiguous United States

    Science.gov (United States)

    Hahn, Micah; Jarnevich, Catherine S.; Monaghan, Andrew J.; Eisen, Rebecca J.

    2016-01-01

    In addition to serving as vectors of several other human pathogens, the black-legged tick, Ixodes scapularis Say, and western black-legged tick, Ixodes pacificus Cooley and Kohls, are the primary vectors of the spirochete (Borrelia burgdorferi ) that causes Lyme disease, the most common vector-borne disease in the United States. Over the past two decades, the geographic range of I. pacificus has changed modestly while, in contrast, the I. scapularis range has expanded substantially, which likely contributes to the concurrent expansion in the distribution of human Lyme disease cases in the Northeastern, North-Central and Mid-Atlantic states. Identifying counties that contain suitable habitat for these ticks that have not yet reported established vector populations can aid in targeting limited vector surveillance resources to areas where tick invasion and potential human risk are likely to occur. We used county-level vector distribution information and ensemble modeling to map the potential distribution of I. scapularis and I. pacificus in the contiguous United States as a function of climate, elevation, and forest cover. Results show that I. pacificus is currently present within much of the range classified by our model as suitable for establishment. In contrast, environmental conditions are suitable for I. scapularis to continue expanding its range into northwestern Minnesota, central and northern Michigan, within the Ohio River Valley, and inland from the southeastern and Gulf coasts. Overall, our ensemble models show suitable habitat for I. scapularis in 441 eastern counties and for I. pacificus in 11 western counties where surveillance records have not yet supported classification of the counties as established.

  19. A molecular survey of Theileria and Babesia parasites in cattle, with a note on the distribution of ticks in Tunisia.

    Science.gov (United States)

    M'ghirbi, Y; Hurtado, A; Barandika, J F; Brandika, J; Khlif, K; Ketata, Z; Bouattour, A

    2008-07-01

    Between October and November 2006, a total of 278 bovine blood samples were examined, and 104 (37.4%) were positive for piroplasms by microscopy. A reverse line blot hybridisation with polymerase chain reaction detected Theileria annulata, T. buffeli, Babesia bovis and B. bigemina in cattle accounting for 48.6% of positive samples. The most frequently found species was T. buffeli, which was present in 39.2% of the samples. T. annulata was found in 48 samples (17.3%). Babesia infections were less frequently detected: B. bovis was found in 6.8% of the samples and B. bigemina in 4.3%. Mixed infections were detected in 45 samples, accounting for seven different combinations of species. Seven Ixodid tick species (Boophilus annulatus, Ixodes ricinus, Hyalomma marginatum, Hyalomma excavatum, Hyalomma detritum, Haemaphysalis punctata and Haemaphysalis sulcata) were collected from examined cattle in the 23 visited farms. I. ricinus was the dominant species (36%), mainly collected in the humid zone, while it seemed to be very rare in the semi-arid zone (where only 15 specimens were collected), whereas B. annulatus was the most commonly collected species in the sub-humid area (68.5% of ticks collected in this zone).

  20. Comparative Study on the Content of Effective Components of Bupleurum marginatum before and after Processing%竹叶柴胡炮制前后有效成分含量比较

    Institute of Scientific and Technical Information of China (English)

    叶方; 杨光义; 杜士明; 王刚; 杜婷; 孙荣进

    2013-01-01

    Objective:To compare the content of effective components of Bupleurum marginatum from Northwest Hubei Province before and after processing by different methods.Method:The total saponins and volatile oil from B.marginatum processing with honey,wine and vinegar were extracted and the content of effective components was determined by UV-visible spectrophotometry.Result:The content of the total saponins and volatile oil of B.marginatum before and after processing by different methods had many sign changes.The content of the total saponins of B.marginatum increased after processing with honey roasted,but decreased after processing with wine and vinegar.The content varies in different processing methods,the consequent succession was as follows:processing with honey roasted > crude drug > processing with vinegar > processing with wine.The order of the content of total saponins was as follows:2.037 5%,1.519 6%,1.317 4% and 1.127 4%.The content of volatile oil of B.marginatum increased after processing by different methods.The result was as follows:processing with honey roasted > processing with wine > processing with vinegar > crude drug.The order of the content of total saponins was as follows:0.736%,0.689%,0.630% and 0.395%.Conclusion:The content of effective components of B.marginatum changed in varying degrees after processing,and it can be trusted that the B.marginatum was processed by different methods for medical purpose.%目的:分析比较鄂西北地区竹叶柴胡经不同方法炮制前后有效成分的含量变化情况.方法:将竹叶柴胡饮片经蜜制、酒制、醋制后,分别提取生品和几种炮制品中的总皂苷、挥发油,使用紫外-可见分光光度法测量炮制前后总皂苷和挥发油含量.结果:竹叶柴胡炮制前后柴胡皂苷和挥发油含量均发生了明显的变化.蜜制后总皂苷含量升高,酒制和醋制后总皂苷含量降低,含量高低依次为蜜柴胡>生柴胡>醋柴胡

  1. Molecular detection and characterization of spotted fever group rickettsiae in ticks from Central Italy.

    Science.gov (United States)

    Scarpulla, M; Barlozzari, G; Marcario, A; Salvato, L; Blanda, V; De Liberato, C; D'Agostini, C; Torina, A; Macrì, G

    2016-07-01

    The aim of this study was to investigate the presence of rickettsial pathogens in ticks from Central Italy. A total of 113 ticks hailed from Latium and Tuscany regions were identified and tested by PCR to detect gltA, ompA, ompB genes of Rickettsia. Positive amplicons were sequenced and identified at species level. Ticks were analyzed individually or in pools. The percentage of positivity for SFG rickettsiae was 12.4%, expressed as minimum infection rate (MIR) assuming that one tick was positive in each positive pool. Rickettsia aeschlimannii was detected in Hyalomma marginatum, Rickettsia monacensis in Ixodes ricinus and Rickettsia massiliae and Rickettsia conorii in Rhipicephalus sanguineus sensu lato. These findings confirm the circulation of pathogenic rickettsiae in Latium and Tuscany regions. To our knowledge this is the first report of R. massiliae in Latium region.

  2. Length of tick repellency depends on formulation of the repellent compound (icaridin = Saltidin®): tests on Ixodes persulcatus and Ixodes ricinus placed on hands and clothes.

    Science.gov (United States)

    Abdel-Ghaffar, Fathy; Al-Quraishy, Saleh; Mehlhorn, Heinz

    2015-08-01

    The present study had the aim to test the repellent potential of the compound icaridin = Saltidin® against the tick species Ixodes ricinus and Ixodes persulcatus using different formulations of the compound. Tests were done on backs of impregnated human hands, on impregnated linen cloth and versus impregnated dog hair. It was found that 1. Ixodes persulcatus-the common Eastern European, Russian Ixodes species is significantly sensitive to icaridin = Saltidin® as I. ricinus protecting for the test period of 5 h. This is an important finding, since I. persulcatus is the vector of agents of the severe Eastern meningoencephalitis; 2. that this repellent compound acts similarly on both I. ricinus and I. persulcatus, when sprayed either on naked skin or on cloths; 3. that there are only slight differences in duration of the repellency when using different formulations containing icaridin = Saltidin®; 4. that icaridin = Saltidin® sprayed on dog hair has identical repellent effects like those seen on human skin and cloths; thus, this compound can also be used to protect animals such as dogs, cats, horses; and 5. that the icaridin = Saltidin® did not induce a bad sensation on skin, nor bad smells; furthermore, it was not sticky and did not leave residuals neither on clothes nor on dog's hair.

  3. Ocorrência de Ixodes loricatus Neumann, 1899 (Acari: Ixodidae) parasitando Didelphis albiventris (Lund, 1841), (didelphimorphia: didelphidae), em Campo Grande, MS

    OpenAIRE

    2008-01-01

    Este é primeiro relato da ocorrência de Ixodes no Estado do Mato Grosso do Sul e primeiro caso identificado de Ixodes loricatus Neumann, 1899, parasitando Didelphis albiventris no município de Campo Grande, MS, Brasil. This is first report of occurence of Ixodes in the State of Mato Grosso do Sul and first description of Ixodes loricatus Neumann, 1899, parasitizing Didelphis albiventris in Campo Grande, MS, Brazil.

  4. Partial characterization of a novel anti-inflammatory protein from salivary gland extract of Hyalomma anatolicum anatolicum (Acari: Ixodidae ticks

    Directory of Open Access Journals (Sweden)

    Mayukh Ghosh

    2015-06-01

    Full Text Available Aim: Hyalomma anatolicum anatolicum ticks transmit Theileria annulata, causative agent of tropical theileriosis to cattle and buffaloes causing a major economic loss in terms of production and mortality in tropical countries. Ticks have evolved several immune evading strategies to circumvent hosts’ rejection and achieve engorgement. Successful feeding of ticks relies on a pharmacy of chemicals located in their complex salivary glands and secreted saliva. These chemicals in saliva could inhibit host inflammatory responses through modulating cytokine secretion and detoxifying reactive oxygen species. Therefore, the present study was aimed to characterize anti-inflammatory peptides from salivary gland extract (SGE of H. a. anatolicum ticks with a view that this information could be utilized in raising vaccines, designing synthetic peptides or peptidomimetics which can further be developed as novel therapeutics. Materials and Methods: Salivary glands were dissected out from partially fed adult female H. a. anatolicum ticks and homogenized under the ice to prepare SGE. Gel filtration chromatography was performed using Sephadex G-50 column to fractionate the crude extract. Protein was estimated in each fraction and analyzed for identification of anti-inflammatory activity. Sodium dodecyl sulfate - polyacrylamide gel electrophoresis (SDS-PAGE was run for further characterization of protein in desired fractions. Results: A novel 28 kDa protein was identified in H. a. anatolicum SGE with pronounced anti-inflammatory activity. Conclusion: Purification and partial characterization of H. a. anatolicum SGE by size-exclusion chromatography and SDSPAGE depicted a 28 kDa protein with prominent anti-inflammatory activity.

  5. Biological Warfare Agents, Toxins, Vectors and Pests as Biological Terrorism Agents

    Science.gov (United States)

    2003-07-01

    synthesis of >100 amino acid polypeptides, advanced genetic manipulation). Toxins as terrorism agents: 1. Botulinum toxin 2. Ricin 3...marginatum 5. Hyalomma Anatolicum Anatolicum 6. Dermacentor spp. 7. Rhipicephalus spp. 8. Amblyomma spp. 9. Mansonia spp. 10. Culex spp. 11

  6. Functional insights into recombinant TROSPA protein from Ixodes ricinus.

    Science.gov (United States)

    Figlerowicz, Marek; Urbanowicz, Anna; Lewandowski, Dominik; Jodynis-Liebert, Jadwiga; Sadowski, Czeslaw

    2013-01-01

    Lyme disease (also called borreliosis) is a prevalent chronic disease transmitted by ticks and caused by Borrelia burgdorferi s. l. spirochete. At least one tick protein, namely TROSPA from I. scapularis, commonly occurring in the USA, was shown to be required for colonization of the vector by bacteria. Located in the tick gut, TROSPA interacts with the spirochete outer surface protein A (OspA) and initiates the tick colonization. Ixodes ricinus is a primary vector involved in B. burgdorferi s. l. transmission in most European countries. In this study, we characterized the capacities of recombinant TROSPA protein from I. ricinus to interact with OspA from different Borrelia species and to induce an immune response in animals. We also showed that the N-terminal part of TROSPA (a putative transmembrane domain) is not involved in the interaction with OspA and that reduction of the total negative charge on the TROSPA protein impaired TROSPA-OspA binding. In general, the data presented in this paper indicate that recombinant TROSPA protein retains the capacity to form a complex with OspA and induces a significant level of IgG in orally immunized rats. Thus, I. ricinus TROSPA may be considered a good candidate component for an animal vaccine against Borrelia.

  7. Anaplasma phagocytophilum in questing Ixodes ricinus ticks in southwestern Finland.

    Science.gov (United States)

    Sormunen, Jani J; Penttinen, Ritva; Klemola, Tero; Vesterinen, Eero J; Hänninen, Jari

    2016-12-01

    Anaplasma phagocytophilum is the causative agent of an emerging tick-borne disease, human granulocytic anaplasmosis. While the bacterium has been reported from questing ticks in neighboring Sweden, Norway and Russia, the few surveys regarding questing ticks in Finland have thus far been negative. In the current study, the prevalence of A. phagocytophilum in Ixodes ricinus populations was evaluated in several study localities around southwestern Finland during 2013-2014. Some of these populations were previously screened and found negative for A. phagocytophilum in 2000. A total of 3158 I. ricinus collected by blanket dragging were screened for Anaplasma spp. using qPCR. Anaplasma were detected in 9.2% of adult ticks (n = 87) and 3.1% of nymphs (n = 979). All larval samples were negative for infection. All Anaplasma-positive samples were identified as A. phagocytophilum by sequencing. This is, to the best of our knowledge, the first report of the pathogen from questing ticks in Finland. Furthermore, the pathogen was detected from several localities found negative during the previous screening 13 years earlier.

  8. Relative humidity and activity patterns of Ixodes scapularis (Acari: Ixodidae)

    Science.gov (United States)

    Berger, K.A.; Ginsberg, Howard S.; Gonzalez, L.; Mather, T.N.

    2014-01-01

    Laboratory studies have shown clear relationships between relative humidity (RH) and the activity and survival of Ixodes scapularis Say (blacklegged tick). However, field studies have produced conflicting results. We examined this relationship using weekly tick count totals and hourly RH observations at three field sites, stratified by latitude, within the state of Rhode Island. Records of nymphal tick abundance were compared with several RH-related variables (e.g., RH at time of sampling and mean weekly daytime RH). In total, 825 nymphs were sampled in 2009, a year of greater precipitation, with a weighted average leaf litter RH recorded at time of sampling of 85.22%. Alternatively, 649 nymphs were collected in 2010, a year of relatively low precipitation, and a weighted average RH recorded at time of sampling was 75.51%. Negative binomial regression analysis of tick count totals identified cumulative hours <82% RH threshold as a significant factor observed in both years (2009: P = 0.0037; 2010: P < 0.0001). Mean weekly daytime RH did not significantly predict tick activity in either year. However, mean weekly daytime RH recorded with 1-wk lag before sample date was a significant variable (P = 0.0016) in 2010. These results suggest a lag effect between moisture availability and patterns of tick activity and abundance. Differences in the relative importance of each RH variable between years may have been due to abnormally wet summer conditions in 2009.

  9. County-Scale Distribution of Ixodes scapularis and Ixodes pacificus (Acari: Ixodidae) in the Continental United States.

    Science.gov (United States)

    Eisen, Rebecca J; Eisen, Lars; Beard, Charles B

    2016-03-01

    The blacklegged tick, Ixodes scapularis Say, is the primary vector to humans in the eastern United States of the Lyme disease spirochete Borrelia burgdorferi, as well as causative agents of anaplasmosis and babesiosis. Its close relative in the far western United States, the western blacklegged tick Ixodes pacificus Cooley and Kohls, is the primary vector to humans in that region of the Lyme disease and anaplasmosis agents. Since 1991, when standardized surveillance and reporting began, Lyme disease case counts have increased steadily in number and in geographical distribution in the eastern United States. Similar trends have been observed for anaplasmosis and babesiosis. To better understand the changing landscape of risk of human exposure to disease agents transmitted by I. scapularis and I. pacificus, and to document changes in their recorded distribution over the past two decades, we updated the distribution of these species from a map published in 1998. The presence of I. scapularis has now been documented from 1,420 (45.7%) of the 3,110 continental United States counties, as compared with 111 (3.6%) counties for I. pacificus. Combined, these vectors of B. burgdorferi and other disease agents now have been identified in a total of 1,531 (49.2%) counties spread across 43 states. This marks a 44.7% increase in the number of counties that have recorded the presence of these ticks since the previous map was presented in 1998, when 1,058 counties in 41 states reported the ticks to be present. Notably, the number of counties in which I. scapularis is considered established (six or more individuals or one or more life stages identified in a single year) has more than doubled since the previous national distribution map was published nearly two decades ago. The majority of county status changes occurred in the North-Central and Northeastern states, whereas the distribution in the South remained fairly stable. Two previously distinct foci for I. scapularis in the

  10. Comparative Metagenomic Profiling of Symbiotic Bacterial Communities Associated with Ixodes persulcatus, Ixodes pavlovskyi and Dermacentor reticulatus Ticks.

    Directory of Open Access Journals (Sweden)

    Alexander Kurilshikov

    Full Text Available Ixodes persulcatus, Ixodes pavlovskyi, and Dermacentor reticulatus ticks inhabiting Western Siberia are responsible for the transmission of a number of etiological agents that cause human and animal tick-borne diseases. Because these ticks are abundant in the suburbs of large cities, agricultural areas, and popular tourist sites and frequently attack people and livestock, data regarding the microbiomes of these organisms are required. Using metagenomic 16S profiling, we evaluate bacterial communities associated with I. persulcatus, I. pavlovskyi, and D. reticulatus ticks collected from the Novosibirsk region of Russia. A total of 1214 ticks were used for this study. DNA extracted from the ticks was pooled according to tick species and sex. Sequencing of the V3-V5 domains of 16S rRNA genes was performed using the Illumina Miseq platform. The following bacterial genera were prevalent in the examined communities: Acinetobacter (all three tick species, Rickettsia (I. persulcatus and D. reticulatus and Francisella (D. reticulatus. B. burgdorferi sensu lato and B. miyamotoi sequences were detected in I. persulcatus and I. pavlovskyi but not in D. reticulatus ticks. The pooled samples of all tick species studied contained bacteria from the Anaplasmataceae family, although their occurrence was low. DNA from A. phagocytophilum and Candidatus Neoehrlichia mikurensis was first observed in I. pavlovskyi ticks. Significant inter-species differences in the number of bacterial taxa as well as intra-species diversity related to tick sex were observed. The bacterial communities associated with the I. pavlovskyi ticks displayed a higher biodiversity compared with those of the I. persulcatus and D. reticulatus ticks. Bacterial community structure was also diverse across the studied tick species, as shown by permutational analysis of variance using the Bray-Curtis dissimilarity metric (p = 0.002. Between-sex variation was confirmed by PERMANOVA testing in I

  11. Vaccination against Bm86 Homologues in Rabbits Does Not Impair Ixodes ricinus Feeding or Oviposition.

    Directory of Open Access Journals (Sweden)

    Jeroen Coumou

    Full Text Available Human tick-borne diseases that are transmitted by Ixodes ricinus, such as Lyme borreliosis and tick borne encephalitis, are on the rise in Europe. Diminishing I. ricinus populations in nature can reduce tick exposure to humans, and one way to do so is by developing an anti-vector vaccine against tick antigens. Currently, there is only one anti-vector vaccine available against ticks, which is a veterinary vaccine based on the tick antigen Bm86 in the gut of Rhipicephalus microplus. Bm86 vaccine formulations cause a reduction in the number of Rhipicephalus microplus ticks that successfully feed, i.e. lower engorgement weights and a decrease in the number of oviposited eggs. Furthermore, Bm86 vaccines reduce transmission of bovine Babesia spp. Previously two conserved Bm86 homologues in I. ricinus ticks, designated as Ir86-1 and Ir86-2, were described. Here we investigated the effect of a vaccine against recombinant Ir86-1, Ir86-2 or a combination of both on Ixodes ricinus feeding. Recombinant Ixodes ricinus Bm86 homologues were expressed in a Drosophila expression system and rabbits were immunized with rIr86-1, rIr86-2, a combination of both or ovalbumin as a control. Each animal was infested with 50 female adults and 50 male adults Ixodes ricinus and tick mortality, engorgement weights and egg mass were analyzed. Although serum IgG titers against rIr86 proteins were elicited, no effect was found on tick feeding between the rIr86 vaccinated animals and ovalbumin vaccinated animals. We conclude that vaccination against Bm86 homologues in Ixodes ricinus is not an effective approach to control Ixodes ricinus populations, despite the clear effects of Bm86 vaccination against Rhipicephalus microplus.

  12. Vaccination against Bm86 Homologues in Rabbits Does Not Impair Ixodes ricinus Feeding or Oviposition

    Science.gov (United States)

    Coumou, Jeroen; Wagemakers, Alex; Trentelman, Jos J.; Nijhof, Ard M.; Hovius, Joppe W.

    2015-01-01

    Human tick-borne diseases that are transmitted by Ixodes ricinus, such as Lyme borreliosis and tick borne encephalitis, are on the rise in Europe. Diminishing I. ricinus populations in nature can reduce tick exposure to humans, and one way to do so is by developing an anti-vector vaccine against tick antigens. Currently, there is only one anti-vector vaccine available against ticks, which is a veterinary vaccine based on the tick antigen Bm86 in the gut of Rhipicephalus microplus. Bm86 vaccine formulations cause a reduction in the number of Rhipicephalus microplus ticks that successfully feed, i.e. lower engorgement weights and a decrease in the number of oviposited eggs. Furthermore, Bm86 vaccines reduce transmission of bovine Babesia spp. Previously two conserved Bm86 homologues in I. ricinus ticks, designated as Ir86-1 and Ir86-2, were described. Here we investigated the effect of a vaccine against recombinant Ir86-1, Ir86-2 or a combination of both on Ixodes ricinus feeding. Recombinant Ixodes ricinus Bm86 homologues were expressed in a Drosophila expression system and rabbits were immunized with rIr86-1, rIr86-2, a combination of both or ovalbumin as a control. Each animal was infested with 50 female adults and 50 male adults Ixodes ricinus and tick mortality, engorgement weights and egg mass were analyzed. Although serum IgG titers against rIr86 proteins were elicited, no effect was found on tick feeding between the rIr86 vaccinated animals and ovalbumin vaccinated animals. We conclude that vaccination against Bm86 homologues in Ixodes ricinus is not an effective approach to control Ixodes ricinus populations, despite the clear effects of Bm86 vaccination against Rhipicephalus microplus. PMID:25919587

  13. Genetic Diversity of Salp15 in the Ixodes ricinus Complex (Acari: Ixodidae)

    OpenAIRE

    2014-01-01

    Salp15, a 15-kDa tick salivary gland protein, is both essential for ticks to successfully obtain host blood and also facilitates transmission of Lyme borreliosis. To determine whether the Salp15 gene is expressed in Ixodes persulcatus and Ixodes sinensis, principle vectors of Lyme borreliosis in China, we studied transcriptions of this gene in semi-engorged larvae, nymph and adults of these two species. A total of eight Salp15 homologues, five in I. persulcatus and three in I. sinensis, were ...

  14. Zoonotic pathogens associated with Hyalomma aegyptium in endangered tortoises: evidence for host-switching behaviour in ticks?

    Directory of Open Access Journals (Sweden)

    Paștiu Anamaria I

    2012-12-01

    Full Text Available Abstract Background Hyalomma aegyptium is a hard-tick with a typical three-host life cycle. The main hosts are Palearctic tortoises of genus Testudo. However, other hosts can be used by immature ticks for feeding in natural conditions. Given this complex ecology and multiple host use, the circulation of pathogens by H. aegyptium between various hosts can be important from epidemiological point of view. The aim of this study was to evaluate the role of H. aegyptium as natural carrier of four important zoonotic pathogens. Methods From 2008 to 2011, 448 H. aegyptium ticks were collected from 45 Spur-thighed tortoises, Testudo graeca in Romania. DNA was extracted individually from each tick using a commercial kit. DNA was examined for the presence of specific sequences of Borrelia burgdorferi s.l., Anaplasma phagocytophilum, Ehrlichia canis and Coxiella burnetii by PCR, according to previously described protocols. Results PCR analysis of H. aegyptium revealed the presence of A. phagocytophilum (18.8%, E. canis (14.1% and C. burnetii (10%. 32.4% of the ticks were infected with at least one pathogen and 9.8% had co-infections. The stages most frequently infected were nymphs (50% followed by males (33.9% and females (27%. The number of tortoises which harboured infected ticks was 27/45 examined (60%. From all tested T. graeca, 40% harboured ticks infected with A. phagocytophilum, 46.7% had ticks infected with E. canis and 33.3% had ticks with C. burnetii. This study reports for the first time the presence of A. phagocytophilum and E. canis in H. aegyptium. Conclusions The presence and relatively high prevalence of three important zoonotic pathogens in H. aegyptium raises the question of their epidemiologic importance in disease ecology. As tortoises are unlikely to be reservoir hosts for A. phagocytophilum and E. canis and both these pathogens are common in H. aegyptium, this is an important indication for (1 a possible increased host

  15. Identification and characterization of microRNAs by deep-sequencing in Hyalomma anatolicum anatolicum (Acari: Ixodidae) ticks.

    Science.gov (United States)

    Luo, Jin; Liu, Guang-Yuan; Chen, Ze; Ren, Qiao-Yun; Yin, Hong; Luo, Jian-Xun; Wang, Hui

    2015-06-15

    Hyalomma anatolicum anatolicum (H.a. anatolicum) (Acari: Ixodidae) ticks are globally distributed ectoparasites with veterinary and medical importance. These ticks not only weaken animals by sucking their blood but also transmit different species of parasitic protozoans. Multiple factors influence these parasitic infections including miRNAs, which are non-coding, small regulatory RNA molecules essential for the complex life cycle of parasites. To identify and characterize miRNAs in H.a. anatolicum, we developed an integrative approach combining deep sequencing, bioinformatics and real-time PCR analysis. Here we report the use of this approach to identify miRNA expression, family distribution, and nucleotide characteristics, and discovered novel miRNAs in H.a. anatolicum. The result showed that miR-1-3p, miR-275-3p, and miR-92a were expressed abundantly. There was a strong bias on miRNA, family members, and nucleotide compositions at certain positions in H.a. anatolicum miRNA. Uracil was the dominant nucleotide, particularly at positions 1, 6, 16, and 18, which were located approximately at the beginning, middle, and end of conserved miRNAs. Analysis of the conserved miRNAs indicated that miRNAs in H.a. anatolicum were concentrated along three diverse phylogenetic branches of bilaterians, insects and coelomates. Two possible roles for the use of miRNA in H.a. anatolicum could be presumed based on its parasitic life cycle: to maintain a large category of miRNA families of different animals, and/or to preserve stringent conserved seed regions with active changes in other places of miRNAs mainly in the middle and the end regions. These might help the parasite to undergo its complex life style in different hosts and adapt more readily to the host changes. The present study represents the first large scale characterization of H.a. anatolicum miRNAs, which could further the understanding of the complex biology of this zoonotic parasite, as well as initiate miRNA studies

  16. Molecular characterization of novel sulfotransferases from the tick, Ixodes scapularis

    Directory of Open Access Journals (Sweden)

    King Roberta S

    2011-06-01

    Full Text Available Abstract Background Ixodes scapularis, commonly known as the blacklegged or deer tick, is the main vector of Lyme disease in the United States. Recent progress in transcriptome research has uncovered hundreds of different proteins expressed in the salivary glands of hard ticks, the majority of which have no known function, and include many novel protein families. We recently identified transcripts coding for two putative cytosolic sulfotransferases in these ticks which recognized phenolic monoamines as their substrates. In this current study, we characterize the genetic expression of these two cytosolic sulfotransferases throughout the tick life cycle as well as the enzymatic properties of the corresponding recombinant proteins. Interestingly, the resultant recombinant proteins showed sulfotransferase activity against both neurotransmitters dopamine and octopamine. Results The two sulfotransferase genes were coded as Ixosc SULT 1 & 2 and corresponding proteins were referred as Ixosc Sult 1 and 2. Using gene-specific primers, the sulfotransferase transcripts were detected throughout the blacklegged tick life cycle, including eggs, larvae, nymphs, adult salivary glands and adult midgut. Notably, the mRNA and protein levels were altered upon feeding during both the larval and nymphal life stages. Quantitative PCR results confirm that Ixosc SULT1 was statistically increased upon blood feeding while Ixosc SULT 2 was decreased. This altered expression led us to further characterize the function of these proteins in the Ixodid tick. The sulfotransferase genes were cloned and expressed in a bacterial expression system, and purified recombinant proteins Ixosc Sult 1(R and 2(R showed sulfotransferase activity against neurotransmitters dopamine and octopamine as well as the common sulfotransferase substrate p-nitrophenol. Thus, dopamine- or octopamine-sulfonation may be involved in altering the biological signal for salivary secretion in I. scapularis

  17. Identification of 24h Ixodes scapularis immunogenic tick saliva proteins.

    Science.gov (United States)

    Lewis, Lauren A; Radulović, Željko M; Kim, Tae K; Porter, Lindsay M; Mulenga, Albert

    2015-04-01

    Ixodes scapularis is arguably the most medically important tick species in the United States. This tick transmits 5 of the 14 human tick-borne disease (TBD) agents in the USA: Borrelia burgdorferi, Anaplasma phagocytophilum, B. miyamotoi, Babesia microti, and Powassan virus disease. Except for the Powassan virus disease, I. scapularis-vectored TBD agents require more than 24h post attachment to be transmitted. This study describes identification of 24h immunogenic I. scapularis tick saliva proteins, which could provide opportunities to develop strategies to stop tick feeding before transmission of the majority of pathogens. A 24h fed female I. scapularis phage display cDNA expression library was biopanned using rabbit antibodies to 24h fed I. scapularis female tick saliva proteins, subjected to next generation sequencing, de novo assembly, and bioinformatic analyses. A total of 182 contigs were assembled, of which ∼19% (35/182) are novel and did not show identity to any known proteins in GenBank. The remaining ∼81% (147/182) of contigs were provisionally identified based on matches in GenBank including ∼18% (27/147) that matched protein sequences previously annotated as hypothetical and putative tick saliva proteins. Others include proteases and protease inhibitors (∼3%, 5/147), transporters and/or ligand binding proteins (∼6%, 9/147), immunogenic tick saliva housekeeping enzyme-like (17%, 25/147), ribosomal protein-like (∼31%, 46/147), and those classified as miscellaneous (∼24%, 35/147). Notable among the miscellaneous class include antimicrobial peptides (microplusin and ricinusin), myosin-like proteins that have been previously found in tick saliva, and heat shock tick saliva protein. Data in this study provides the foundation for in-depth analysis of I. scapularis feeding during the first 24h, before the majority of TBD agents can be transmitted. Copyright © 2015 Elsevier GmbH. All rights reserved.

  18. Deep Sequencing Analysis of the Ixodes ricinus Haemocytome.

    Directory of Open Access Journals (Sweden)

    Michalis Kotsyfakis

    2015-05-01

    Full Text Available Ixodes ricinus is the main tick vector of the microbes that cause Lyme disease and tick-borne encephalitis in Europe. Pathogens transmitted by ticks have to overcome innate immunity barriers present in tick tissues, including midgut, salivary glands epithelia and the hemocoel. Molecularly, invertebrate immunity is initiated when pathogen recognition molecules trigger serum or cellular signalling cascades leading to the production of antimicrobials, pathogen opsonization and phagocytosis. We presently aimed at identifying hemocyte transcripts from semi-engorged female I. ricinus ticks by mass sequencing a hemocyte cDNA library and annotating immune-related transcripts based on their hemocyte abundance as well as their ubiquitous distribution.De novo assembly of 926,596 pyrosequence reads plus 49,328,982 Illumina reads (148 nt length from a hemocyte library, together with over 189 million Illumina reads from salivary gland and midgut libraries, generated 15,716 extracted coding sequences (CDS; these are displayed in an annotated hyperlinked spreadsheet format. Read mapping allowed the identification and annotation of tissue-enriched transcripts. A total of 327 transcripts were found significantly over expressed in the hemocyte libraries, including those coding for scavenger receptors, antimicrobial peptides, pathogen recognition proteins, proteases and protease inhibitors. Vitellogenin and lipid metabolism transcription enrichment suggests fat body components. We additionally annotated ubiquitously distributed transcripts associated with immune function, including immune-associated signal transduction proteins and transcription factors, including the STAT transcription factor.This is the first systems biology approach to describe the genes expressed in the haemocytes of this neglected disease vector. A total of 2,860 coding sequences were deposited to GenBank, increasing to 27,547 the number so far deposited by our previous transcriptome studies

  19. Microtomography of the Baltic amber tick Ixodes succineus reveals affinities with the modern Asian disease vector lxodes ovatus

    Energy Technology Data Exchange (ETDEWEB)

    Dunlop, Jason; Apanaskevich, Dmitry A.; Lehmann, Jens; Hoffmann, Rene; Fusseis, Florian; Ehlke, Moritz; Zachow, Stefan; Xiao, Xianghui

    2016-10-10

    Background: Fossil ticks are extremely rare, whereby Ixodes succineus Weidner, 1964 from Eocene (ca. 44–49 Ma) Baltic amber is one of the oldest examples of a living hard tick genus (Ixodida: Ixodidae). Previous work suggested it was most closely related to the modern and widespread European sheep tick Ixodes ricinus (Linneaus, 1758). Results: Restudy using phase contrast synchrotron x-ray tomography yielded images of exceptional quality. These confirm the fossil’s referral to Ixodes Latreille, 1795, but the characters resolved here suggest instead affinities with the Asian subgenus Partipalpiger Hoogstraal et al., 1973 and its single living (and medically significant) species Ixodes ovatus Neumann, 1899. We redescribe the amber fossil here as Ixodes (Partipalpiger) succineus. Conclusions: Our data suggest that Ixodes ricinus is unlikely to be directly derived from Weidner’s amber species, but instead reveals that the Partipalpiger lineage was originally more widely distributed across the northern hemisphere. The closeness of Ixodes (P.) succineus to a living vector of a wide range of pathogens offers the potential to correlate its spatial and temporal position (northern Europe, nearly 50 million years ago) with the estimated origination dates of various tick-borne diseases.

  20. Seasonal correlation of sporadic schizophrenia to Ixodes ticks and Lyme borreliosis

    Directory of Open Access Journals (Sweden)

    Fritzsche Markus

    2002-11-01

    Full Text Available Abstract Background Being born in winter and spring is considered one of the most robust epidemiological risk factors for schizophrenia. The aetiology and exact timing of this birth excess, however, has remained elusive so far. Since during phylogeny, Borrelia DNA has led to multiple germ-line mutations within the CB1 candidate gene for schizophrenia, a meta analysis has been performed of all papers on schizophrenic birth excesses with no less than 3000 cases each. All published numerical data were then plotted against the seasonal distributions of Ixodes ticks worldwide. Results In the United States, Europe and Japan the birth excesses of those individuals who later in life develop schizophrenia mirror the seasonal distribution of Ixodes ticks nine months earlier at the time of conception. South of the Wallace Line, which limits the spread of Ixodes ticks and Borrelia burgdorferi into Australia, seasonal trends are less significant, and in Singapore, being non-endemic for Ixodes ticks and Lyme disease, schizophrenic birth excesses are absent. Conclusion At present, it cannot be excluded that prenatal infection by B. burgdorferi is harmful to the implanting human blastocyst. The epidemiological clustering of sporadic schizophrenia by season and locality rather emphasises the risk to the unborn of developing a congenital, yet preventable brain disorder later in life.

  1. Diversity of Ixodes ricinus tick-associated bacterial communities from different forests

    NARCIS (Netherlands)

    Overbeek, van L.S.; Gassner, F.; Lombaers-van der Plas, C.H.; Kastelein, P.; Nunes da Rocha, U.; Takken, W.

    2008-01-01

    Nymphal Ixodes ricinus ticks (n=180) were collected from three different areas in the Netherlands to investigate the effect of forest composition on tick-associated microbial communities. Sampled habitats differed in thickness of leaf litter and humus layers and vegetation associations and were loca

  2. Genomic insights into the Ixodes scapularis tick vector of Lyme disease

    DEFF Research Database (Denmark)

    Gulia-Nuss, Monika; Nuss, Andrew B.; Meyer, Jason M.

    2016-01-01

    Ticks transmit more pathogens to humans and animals than any other arthropod. We describe the 2.1 Gbp nuclear genome of the tick, Ixodes scapularis (Say), which vectors pathogens that cause Lyme disease, human granulocytic anaplasmosis, babesiosis and other diseases. The large genome reflects acc...

  3. Efficacy of granular deltamethrin against Ixodes scapularis and Amblyomma americanum (Acari: Ixodidade) nymphs.

    Science.gov (United States)

    Schulze, T L; Jordan, R A; Hung, R W; Taylor, R C; Markowski, D; Chomsky, M S

    2001-03-01

    A single barrier application of granular deltamethrin to the woodland edges of a forested residential community in late spring significantly reduced the abundance of Ixodes scapularis Say nymphs. The application also suppressed the population of Amblyomma americanum (L.) nymphs, which recently became established in the study area. The efficacy of deltamethrin is compared with other commonly used acaricides.

  4. Diversity of Ixodes ricinus tick-associated bacterial communities from different forests

    NARCIS (Netherlands)

    Overbeek, van L.S.; Gassner, F.; Lombaers-van der Plas, C.H.; Kastelein, P.; Nunes da Rocha, U.; Takken, W.

    2008-01-01

    Nymphal Ixodes ricinus ticks (n=180) were collected from three different areas in the Netherlands to investigate the effect of forest composition on tick-associated microbial communities. Sampled habitats differed in thickness of leaf litter and humus layers and vegetation associations and were

  5. Human Babesia microti Incidence and Ixodes scapularis Distribution, Rhode Island, 1998–2004

    OpenAIRE

    2007-01-01

    Distribution of nymphal Ixodes scapularis in Rhode Island was used as a logistical regressor for predicting presence of human babesiosis. Although the incidence of babesiosis is increasing in southern Rhode Island, large areas of the state are free of babesiosis risk.

  6. Human Babesia microti incidence and Ixodes scapularis distribution, Rhode Island, 1998-2004.

    Science.gov (United States)

    Rodgers, Sarah E; Mather, Thomas N

    2007-04-01

    Distribution of nymphal Ixodes scapularis in Rhode Island was used as a logistical regressor for predicting presence of human babesiosis. Although the incidence of babesiosis is increasing in southern Rhode Island, large areas of the state are free of babesiosis risk.

  7. Driving forces for changes in geographical distribution of Ixodes ricinus ticks in Europe

    DEFF Research Database (Denmark)

    Medlock, Jolyon M.; Hansford, Kayleigh M.; Bormane, Antra;

    2013-01-01

    Many factors are involved in determining the latitudinal and altitudinal spread of the important tick vector Ixodes ricinus (Acari: Ixodidae) in Europe, as well as in changes in the distribution within its prior endemic zones. This paper builds on published literature and unpublished expert opini...

  8. New Records of Ixodes affinis (Acari: Ixodidae) Parasitizing Avian Hosts in Southeastern Virginia.

    Science.gov (United States)

    Heller, Erin L; Wright, Chelsea L; Nadolny, Robyn M; Hynes, Wayne L; Gaff, Holly D; Walters, Eric L

    2016-03-01

    Ixodes affinis Neumann (Acari: Ixodidae) is a hard-bodied tick species distributed throughout much of the southeastern United States. Although I. affinis does not parasitize humans, it is a competent vector of Borrelia burgdorferi sensu stricto, the causative-agent of Lyme disease, and thus contributes to the enzootic maintenance of this pathogen. This study presents evidence of I. affinis parasitizing five new host passerine species. During 2012-2014, 1,888 birds were captured and examined for ticks, and 18 immature I. affinis were collected from 12 birds-six Carolina Wrens (Thyrothorus ludovicianus); two Brown Thrashers (Toxostoma rufum); and one American Robin (Turdus migratorius), Eastern Towhee (Pipilo erythrophthalmus), Northern Cardinal (Cardinalis cardinalis), and White-throated Sparrow (Zonotrichia albicollis). Of 15 larvae and 3 nymphs collected, one nymph tested positive for B. burgdorferi DNA. I. affinis was found co-feeding on birds with immature Amblyomma americanum (L.), Ixodes brunneus Koch, Ixodes dentatus Marx, Ixodes scapularis Say, and Haemaphysalis leporispalustris Packard. The results of this research provide a better understanding of I. affinis hosts and identify avian taxa that may play a role in the maintenance and dispersal of this tick species.

  9. Primer registro de Ixodes cookei (Acari: Ixodidae) para México

    OpenAIRE

    2007-01-01

    En este estudio se aportan los primeros datos de la garrapata Ixodes cookei Packard, 1869 en México. Un macho, 7 larvas y 15 ninfas se recolectaron en los estados de Nuevo León y Veracruz. Además, se registra al cacomixtle Bassariscus astutus como un nuevo huésped.

  10. Detection of Rickettsia helvetica in Ixodes ricinus ticks collected from Pyrenean chamois in France.

    Science.gov (United States)

    Davoust, Bernard; Socolovschi, Cristina; Revelli, Paul; Gibert, Philippe; Marié, Jean-Lou; Raoult, Didier; Parola, Philippe

    2012-12-01

    Seventy-one Ixodes ricinus ticks collected from Pyrenean chamois (Rupicapra pyrenaica) in the French Pyrenees were tested by real-time polymerase chain reaction to detect the presence of Rickettsia and Bartonella. Four ticks (6%) were positive for R. helvetica. The chamois carries infected ticks, and this enables the dissemination throughout the environment with this bacterium, a potential human pathogen.

  11. Blood feeding on large grazers affects the transmission of Borrelia burgdorferi sensu lato by Ixodes ricinus

    NARCIS (Netherlands)

    Pacilly, F.C.A.; Benning, M.E.; Jacobs, F.; Leidekker, J.; Sprong, H.; Wieren, van S.E.; Takken, W.

    2014-01-01

    The presence of Ixodes ricinus and their associated Borrelia infections on large grazers was investigated. Carcases of freshly shot red deer, mouflon and wild boar were examined for the presence of any stage of I. ricinus. Questing ticks were collected from locations where red deer and wild boar are

  12. Detection of tick-borne Anaplasma bovis, Anaplasma phagocytophilum and Anaplasma centrale in Spain.

    Science.gov (United States)

    Palomar, A M; Portillo, A; Santibáñez, P; Mazuelas, D; Roncero, L; García-Álvarez, L; Santibáñez, S; Gutiérrez, Ó; Oteo, J A

    2015-09-01

    The genus Anaplasma (Rickettsiales: Anaplasmataceae) includes species of medical and veterinary importance. The presence of Anaplasma spp. in ticks from birds, as well as in Haemaphysalis punctata (Ixodida: Ixodidae) specimens collected from cattle and vegetation in northern Spain was investigated. A total of 336 ticks from birds [174 Ixodes frontalis (Ixodida: Ixodidae), 108 H. punctata, 34 Hyalomma marginatum (Ixodida: Ixodidae), 17 Ixodes ricinus (Ixodida: Ixodidae) and three Ixodes spp.], and 181 H. punctata specimens collected from cattle (n = 71) and vegetation (n = 110) were analysed. Anaplasma bovis was detected in five H. punctata, including two from birds (1.9%) and three from vegetation (2.7%). Four I. frontalis (2.3%) (one co-infected with 'Candidatus Midichloria mitochondrii') and one I. ricinus (5.9%) removed from birds, as well as four H. punctata (5.6%) collected from cattle showed Anaplasma phagocytophilum infection. In addition, Anaplasma centrale was found in two H. punctata, one from a cow (1.4%) and the other from vegetation (0.9%). This study represents the first evidence of the presence of A. bovis in European ticks, and reports the first detection of A. bovis and A. centrale in H. punctata, and the first finding of A. phagocytophilum and 'Ca. Midichloria mitochondrii' in I. frontalis. © 2015 The Royal Entomological Society.

  13. Molecular Investigation of Francisella-Like Endosymbiont in Ticks and Francisella tularensis in Ixodid Ticks and Mosquitoes in Turkey.

    Science.gov (United States)

    Duzlu, Onder; Yildirim, Alparslan; Inci, Abdullah; Gumussoy, Kadir Semih; Ciloglu, Arif; Onder, Zuhal

    2016-01-01

    This study was carried out to investigate the molecular prevalence of Francisella-like endosymbionts (FLEs) and Francisella tularensis in ticks (Acari: Ixodidae) and mosquitoes in Turkey. Genomic DNA pools were constructed from a total of 1477 adult hard ticks of Rhipicephalus (Rh.) annulatus, Rh. turanicus, Rh. sanguineus, Rh. bursa, Haemaphysalis (Hae.) parva, Hae. sulcata, Hyalomma marginatum marginatum, H. anatolicum anatolicum, H. anatolicum excavatum, H. detritum detritum, H. dromedarii, Dermacentor marginatus, and Ixodes ricinus species, which were collected from several barns, cattle, and people. Genomic DNA was also extracted from pools consisting of 6203 adult female mosquito species belonging to Aedes vexans, Culex (Cx.) pipiens, Cx. hortensis, Cx. theileri, Culiseta annulata, and Anopheles maculipennis species. Conventional PCR and TaqMan probe-based real- time PCR targeting the 16S rRNA gene for FLEs and the lpnA gene for F. tularensis, respectively, were performed on the DNA isolates obtained. FLEs and F. tularensis were not found in any genomic DNA pools constructed from ixodid ticks and mosquitos. This study represents the first investigation of F. tularensis and FLEs in potential vector ticks and mosquitoes by molecular methods in Turkey. The present study provides useful insights into the molecular epidemiology of F. tularensis and FLEs. One of the major conclusions of the study is that tularemia outbreaks may be essentially due to direct transmission from the environment (especially from water) in Turkey and not to vector-borne transmission.

  14. Ixodes ricinus as vector and reservoir of Borrelia burgdorferi in an urban environment

    Directory of Open Access Journals (Sweden)

    Rajković Dragana V.

    2005-01-01

    Full Text Available As specific arthropods, ticks in urban environments transmit the agents of dangerous contagious diseases endangering human and animal health. They are vectors of numerous infective agents that cause serious diseases of animals such as babesiosis and ehrlichiosis. Tick populations maintain and transmit an increas­ing number of different infective agents. In regard to the human population, they transmit the agents of tick encephalitis, Omsk hemorrhagic disease, Crim-Congo hemorrhagic disease, Kyasa-nur forest fever, ixodid fever, Q fever, Rocky Mountain spotted fever, tularemia, Siberian tick typhus and Lyme disease the last of which according to acarological references has become the dominant zoonosis in over 140 of the world's countries. In urban environments ticks represent problem both for their epidemiological significance and as organisms whose presence disturbs people during their work and rest. In Europe, the two most fre­quent species and Ixodes ricinus and Ixodes persulcatus. Both species have a wide spectrum of hosts.

  15. Isolation and characterization of tick-borne encephalitis virus from Ixodes persulcatus in Mongolia in 2012

    OpenAIRE

    Muto, Memi; Bazartseren, Boldbaatar; Tsevel, Bazartseren; Dashzevge, Erdenechimeg; Yoshii, Kentaro; KARIWA, Hiroaki

    2015-01-01

    Tick-borne encephalitis virus (TBEV) is a zoonotic virus belonging to the genus Flavivirus, in the family Flaviviridae. The virus, which is endemic in Europe and northern parts of Asia, causes severe encephalitis. Tick-borne encephalitis (TBE) has been reported in Mongolia since the 1980s, but details about the biological characteristics of the endemic virus are lacking. In this study, 680 ticks (Ixodes persulcatus) were collected in Selenge aimag, northern Mongolia, in 2012. Nine Mongolian T...

  16. Ticks (Acari: Ixodida) parasitizing humans in Corum and Yozgat provinces, Turkey.

    Science.gov (United States)

    Keskin, Adem; Keskin, Aysun; Bursali, Ahmet; Tekin, Saban

    2015-12-01

    In order to identify ticks infesting humans in Corum and Yozgat provinces in Turkey, a total of 2110 ticks representing 14 species were collected on humans, between June and September 2009. Of those, 1551 (687♂, 450♀, 407 nymphs, 7 larvae) were collected from Corum and 559 (330♂, 180♀, 49 nymphs) were collected from Yozgat. The majority of ticks (n = 1121, 53.1 %) was Hyalomma marginatum. Other common ticks infesting humans were Dermacentor marginatus (n = 209, 9.9 %) and Rhipicephalus turanicus sensu lato (n = 145, 6.9 %) in the study area. In addition, a total of 386 immature Hyalomma were found on humans in Corum (335 nymphs, 7 larvae) and Yozgat (44 nymphs). Ixodes laguri and Haemaphysalis erinacei taurica were recorded for the first time in Corum. To the best of our knowledge, this study is the first detailed investigation on ticks infesting humans in Corum and Yozgat, except individual or incidental records. The present study provides useful information for those concerned with ticks and tick-borne diseases in Turkey.

  17. Molecular analysis of Ixodes granulatus, a possible vector tick for Borrelia burgdorferi sensu lato in Taiwan.

    Science.gov (United States)

    Chao, Li-Lian; Wu, Wen-Jer; Shih, Chien-Ming

    2009-08-01

    The genetic identity of Ixodes granulatus ticks was determined for the first time in Taiwan. The phylogenetic relationships were analyzed by comparing the sequences of mitochondrial 16S ribosomal DNA gene obtained from 19 strains of ticks representing seven species of Ixodes and two outgroup species (Rhipicephalus sanguineus and Haemaphysalis inermis). Four major clades could be easily distinguished by neighbour-joining analysis and were congruent by maximum-parsimony method. All these I. granulatus ticks of Taiwan were genetically affiliated to a monophyletic group with highly homogeneous sequences (92.2-99.3% similarity), and can be discriminated from other Ixodes species and other genera of ticks with a sequence divergence ranging from 11.7 to 30.8%. Moreover, intraspecific analysis revealed that two distinct lineages are evident between the same species of I. granulatus ticks collected from Taiwan and Malaysia. Our results demonstrate that all these I. granulatus ticks of Taiwan represent a unique lineage distinct from the common vector ticks (I. ricinus complex) for Borrelia burgdorferi spirochetes.

  18. Genetic diversity of Salp15 in the Ixodes ricinus complex (Acari: Ixodidae.

    Directory of Open Access Journals (Sweden)

    Xin Wang

    Full Text Available Salp15, a 15-kDa tick salivary gland protein, is both essential for ticks to successfully obtain host blood and also facilitates transmission of Lyme borreliosis. To determine whether the Salp15 gene is expressed in Ixodes persulcatus and Ixodes sinensis, principle vectors of Lyme borreliosis in China, we studied transcriptions of this gene in semi-engorged larvae, nymph and adults of these two species. A total of eight Salp15 homologues, five in I. persulcatus and three in I. sinensis, were identified by reverse transcriptase-polymerase chain reaction (RT-PCR. Interestingly, the intra-species similarity of Salp15 is approximately equal to its interspecies similarity and more than one Salp15 protein is expressed in a certain tick developmental stage. Comparison of DNA and proteins with other available tick Salp15 homologues suggests that the Salp15 superfamily is genetically conserved and diverse in the Ixodes ricinus complex. These findings indicate that Salp15 proteins in the I. ricinus complex may play an essential role in interacting with the host immune system and transmission of Borrelia genospecies.

  19. La presencia de Ixodes luciae en el noroeste argentino y nuevos huéspedes para Ixodes pararicinus y algunas especies de Amblyomma (Acari: Ixodidae

    Directory of Open Access Journals (Sweden)

    Analía G. AUTINO

    2006-01-01

    Full Text Available El análisis de una colección de garrapatas de mamíferos del noroeste argentino, depositados en la Colección de Anexos de la Colección Mamíferos Lillo (CML de la Universidad Nacional de Tucumán, permitió ampliar el área de distribución de Ixodes luciae Sénevet, a las provincias de Salta y Tucumán e incrementar su rango de huéspedes al roedor sigmodontino Calomys callosus (Rengger y a los marsupiales de la familia Didelphidae Micoureus constantiae (Thomas, Thylamys cinderella Thomas y Thylamys venustus (Thomas. Se registró a C. callosus y Oligoryzomys destructor (Tschudi como nuevos huéspedes de Ixodes pararicinus Keirans & Clifford, y a los Carnivora Lycalopex gymnocercus (Fischer y Oncifelis geoffroyi (d ́Orbigny & Gervais como nuevos huéspedes de Amblyomma neumanni Ribaga y Amblyomma parvum Aragão, respectivamente. Adicionalmente, se observó la infestación de Lutreolina crassicaudata (Desmarest (Didelphidae por I. luciae y la presencia de Amblyomma tigrinum Koch, sobre L. gymnocercus. Ninfas de Amblyomma sp. se obtuvieron de Akodon Meyen (Sigmodontinae.

  20. Linkages of Weather and Climate With Ixodes scapularis and Ixodes pacificus (Acari: Ixodidae), Enzootic Transmission of Borrelia burgdorferi, and Lyme Disease in North America.

    Science.gov (United States)

    Eisen, Rebecca J; Eisen, Lars; Ogden, Nicholas H; Beard, Charles B

    2016-03-01

    Lyme disease has increased both in incidence and geographic extent in the United States and Canada over the past two decades. One of the underlying causes is changes during the same time period in the distribution and abundance of the primary vectors: Ixodes scapularis Say and Ixodes pacificus Cooley and Kohls in eastern and western North America, respectively. Aside from short periods of time when they are feeding on hosts, these ticks exist in the environment where temperature and relative humidity directly affect their development, survival, and host-seeking behavior. Other important factors that strongly influence tick abundance as well as the proportion of ticks infected with the Lyme disease spirochete, Borrelia burgdorferi, include the abundance of hosts for the ticks and the capacity of tick hosts to serve as B. burgdorferi reservoirs. Here, we explore the linkages between climate variation and: 1) duration of the seasonal period and the timing of peak activity; 2) geographic tick distributions and local abundance; 3) enzootic B. burgdorferi transmission cycles; and 4) Lyme disease cases. We conclude that meteorological variables are most influential in determining host-seeking phenology and development, but, while remaining important cofactors, additional variables become critical when exploring geographic distribution and local abundance of ticks, enzootic transmission of B. burgdorferi, and Lyme disease case occurrence. Finally, we review climate change-driven projections for future impact on vector ticks and Lyme disease and discuss knowledge gaps and research needs.

  1. Crimean-Congo hemorrhagic fever virus clades V and VI (Europe 1 and 2) in ticks in Kosovo, 2012.

    Science.gov (United States)

    Sherifi, Kurtesh; Cadar, Daniel; Muji, Skender; Robaj, Avni; Ahmeti, Salih; Jakupi, Xhevat; Emmerich, Petra; Krüger, Andreas

    2014-09-01

    Despite being a small country, Kosovo represents one of the few foci of Crimean-Congo hemorrhagic fever (CCHF) in Europe. The distribution of Kosovar tick vectors and the evolution of CCHF virus in ticks are both as yet unknown. A better description of the extent and the genetic diversity of CCHFV in ticks from endemic settings is essential, in order to be controlled. We investigated the 2012 distribution of Kosovar ticks alongside the prevalence and the phylogeography of tick-derived CCHFV. Hyalomma marginatum dominated in the endemic municipalities with 90.2% versus 24.3% in the non-endemic regions. Of 1,102 tested ticks, 40 (3.6%) were CCHFV-positive, belonging to H. marginatum (29), Rhipicephalus bursa (10), and Ixodes ricinus (1). The virus strains clustered with clade V and VI related sequences. They fell into two lineages: Kosovo I and II. Kosovo I comprised strains recovered exclusively from R. bursa ticks and was closely related to AP92 prototype strain. Kosovo II clustered into Kosovo IIa, including human-derived strains, and IIb including only strains detected in H. marginatum and I. ricinus. Our phylogeographic reconstruction suggests two temporally distinct CCHFV introductions: the most probable location of the most recent common ancestor of Kosovo I lineage was in Greece (63 years ago) and that of lineages IIa-b in Turkey (35 years ago). After each CCHFV introduction into Kosovo, subsequent lineage expansions suggest periods of in situ evolution. The study provides the first insight into the genetic variability and the origin of CCHFV in ticks from Kosovo. Our findings indicate the spreading of CCHFV to non-endemic areas, which underlines the importance of further studies in order to monitor and predict future CCHF outbreaks in Kosovo. The AP92-like strains appear to be more widespread than previously thought and may provide a promising target for experimental studies due to their assumed low pathogenicity.

  2. Crimean-Congo hemorrhagic fever virus clades V and VI (Europe 1 and 2 in ticks in Kosovo, 2012.

    Directory of Open Access Journals (Sweden)

    Kurtesh Sherifi

    2014-09-01

    Full Text Available Despite being a small country, Kosovo represents one of the few foci of Crimean-Congo hemorrhagic fever (CCHF in Europe. The distribution of Kosovar tick vectors and the evolution of CCHF virus in ticks are both as yet unknown. A better description of the extent and the genetic diversity of CCHFV in ticks from endemic settings is essential, in order to be controlled. We investigated the 2012 distribution of Kosovar ticks alongside the prevalence and the phylogeography of tick-derived CCHFV. Hyalomma marginatum dominated in the endemic municipalities with 90.2% versus 24.3% in the non-endemic regions. Of 1,102 tested ticks, 40 (3.6% were CCHFV-positive, belonging to H. marginatum (29, Rhipicephalus bursa (10, and Ixodes ricinus (1. The virus strains clustered with clade V and VI related sequences. They fell into two lineages: Kosovo I and II. Kosovo I comprised strains recovered exclusively from R. bursa ticks and was closely related to AP92 prototype strain. Kosovo II clustered into Kosovo IIa, including human-derived strains, and IIb including only strains detected in H. marginatum and I. ricinus. Our phylogeographic reconstruction suggests two temporally distinct CCHFV introductions: the most probable location of the most recent common ancestor of Kosovo I lineage was in Greece (63 years ago and that of lineages IIa-b in Turkey (35 years ago. After each CCHFV introduction into Kosovo, subsequent lineage expansions suggest periods of in situ evolution. The study provides the first insight into the genetic variability and the origin of CCHFV in ticks from Kosovo. Our findings indicate the spreading of CCHFV to non-endemic areas, which underlines the importance of further studies in order to monitor and predict future CCHF outbreaks in Kosovo. The AP92-like strains appear to be more widespread than previously thought and may provide a promising target for experimental studies due to their assumed low pathogenicity.

  3. Tissue-Specific Signatures in the Transcriptional Response to Anaplasma phagocytophilum Infection of Ixodes scapularis and Ixodes ricinus Tick Cell Lines.

    Science.gov (United States)

    Alberdi, Pilar; Mansfield, Karen L; Manzano-Román, Raúl; Cook, Charlotte; Ayllón, Nieves; Villar, Margarita; Johnson, Nicholas; Fooks, Anthony R; de la Fuente, José

    2016-01-01

    Anaplasma phagocytophilum are transmitted by Ixodes spp. ticks and have become one of the most common and relevant tick-borne pathogens due to their impact on human and animal health. Recent results have increased our understanding of the molecular interactions between Ixodes scapularis and A. phagocytophilum through the demonstration of tissue-specific molecular pathways that ensure pathogen infection, development and transmission by ticks. However, little is known about the Ixodes ricinus genes and proteins involved in the response to A. phagocytophilum infection. The tick species I. scapularis and I. ricinus are evolutionarily closely related and therefore similar responses are expected in A. phagocytophilum-infected cells. However, differences may exist between I. scapularis ISE6 and I. ricinus IRE/CTVM20 tick cells associated with tissue-specific signatures of these cell lines. To address this hypothesis, the transcriptional response to A. phagocytophilum infection was characterized by RNA sequencing and compared between I. scapularis ISE6 and I. ricinus IRE/CTVM20 tick cell lines. The transcriptional response to infection of I. scapularis ISE6 cells resembled that of tick hemocytes while the response in I. ricinus IRE/CTVM20 cells was more closely related to that reported previously in infected tick midguts. The inhibition of cell apoptosis by A. phagocytophilum appears to be a key adaptation mechanism to facilitate infection of both vertebrate and tick cells and was used to investigate further the tissue-specific response of tick cell lines to pathogen infection. The results supported a role for the intrinsic pathway in the inhibition of cell apoptosis by A. phagocytophilum infection of I. scapularis ISE6 cells. In contrast, the results in I. ricinus IRE/CTVM20 cells were similar to those obtained in tick midguts and suggested a role for the JAK/STAT pathway in the inhibition of apoptosis in tick cells infected with A. phagocytophilum. Nevertheless, tick

  4. Tissue-Specific Signatures in the Transcriptional Response to Anaplasma phagocytophilum Infection of Ixodes scapularis and Ixodes ricinus Tick Cell Lines

    Science.gov (United States)

    Alberdi, Pilar; Mansfield, Karen L.; Manzano-Román, Raúl; Cook, Charlotte; Ayllón, Nieves; Villar, Margarita; Johnson, Nicholas; Fooks, Anthony R.; de la Fuente, José

    2016-01-01

    Anaplasma phagocytophilum are transmitted by Ixodes spp. ticks and have become one of the most common and relevant tick-borne pathogens due to their impact on human and animal health. Recent results have increased our understanding of the molecular interactions between Ixodes scapularis and A. phagocytophilum through the demonstration of tissue-specific molecular pathways that ensure pathogen infection, development and transmission by ticks. However, little is known about the Ixodes ricinus genes and proteins involved in the response to A. phagocytophilum infection. The tick species I. scapularis and I. ricinus are evolutionarily closely related and therefore similar responses are expected in A. phagocytophilum-infected cells. However, differences may exist between I. scapularis ISE6 and I. ricinus IRE/CTVM20 tick cells associated with tissue-specific signatures of these cell lines. To address this hypothesis, the transcriptional response to A. phagocytophilum infection was characterized by RNA sequencing and compared between I. scapularis ISE6 and I. ricinus IRE/CTVM20 tick cell lines. The transcriptional response to infection of I. scapularis ISE6 cells resembled that of tick hemocytes while the response in I. ricinus IRE/CTVM20 cells was more closely related to that reported previously in infected tick midguts. The inhibition of cell apoptosis by A. phagocytophilum appears to be a key adaptation mechanism to facilitate infection of both vertebrate and tick cells and was used to investigate further the tissue-specific response of tick cell lines to pathogen infection. The results supported a role for the intrinsic pathway in the inhibition of cell apoptosis by A. phagocytophilum infection of I. scapularis ISE6 cells. In contrast, the results in I. ricinus IRE/CTVM20 cells were similar to those obtained in tick midguts and suggested a role for the JAK/STAT pathway in the inhibition of apoptosis in tick cells infected with A. phagocytophilum. Nevertheless, tick

  5. [Comparison of the ability to fertilize females by Hyalomma anatolicum anatolicum males irradiated with gamma radiation from caesium 137 with non-irradiated males].

    Science.gov (United States)

    Karaer, Zafer; Kar, Sirri; Düzgün, Ali; Güven, Esin; Cakmak, Ayşe; Emre, Zişan; Nalbantoğlu, Serpil; Saribaş, Taner; Akçay, Aytaç

    2009-01-01

    In this study, Hyalomma anatolicum anatolicum male ticks were subjected to gamma radiation with a dose of 10 Gy emitted by a gamma-ray source of Caesium 137. Female ticks were divided into 3 groups and placed in rabbit ears to feed. In the first group, the females fed with normal and irradiated males, in the second group females fed only with irradiated males and in last group females fed with normal males. Biological parameters such as the feeding period, weights, period of time from dropping until egg-laying began, the number of eggs and the number of larva hatching from eggs were recorded. With the results of statistical analysis it was found that the average egg laying period of females in the second group was clearly less (22.77 days) than other groups and the difference between these groups was statistically important (P < 0.05). After evaluation of numbers of larva, also there was a statistically important difference between the groups and the average number of larva was clearly higher (2519.30) in third group than other groups. In conclusion, in this study it was found that irradiated males could not compete with normal males in mating with females and because of this they couldn't affect the feeding and reproductivity of females.

  6. Genetic variability of Rickettsia spp. in Ixodes persulcatus/Ixodes trianguliceps sympatric areas from Western Siberia, Russia: Identification of a new Candidatus Rickettsia species.

    Science.gov (United States)

    Igolkina, Yana P; Rar, Vera A; Yakimenko, Valeriy V; Malkova, Marina G; Tancev, Aleksey K; Tikunov, Artem Yu; Epikhina, Tamara I; Tikunova, Nina V

    2015-08-01

    Rickettsia spp. are the causative agents of a number of diseases in humans. These bacteria are transmitted by arthropods, including ixodid ticks. DNA of several Rickettsia spp. was identified in Ixodes persulcatus ticks, however, the association of Ixodes trianguliceps ticks with Rickettsia spp. is unknown. In our study, blood samples of small mammals (n=108), unfed adult I. persulcatus ticks (n=136), and I. persulcatus (n=12) and I. trianguliceps (n=34) ticks feeding on voles were collected in two I. persulcatus/I. trianguliceps sympatric areas in Western Siberia. Using nested PCR, ticks and blood samples were studied for the presence of Rickettsia spp. Three distinct Rickettsia species were found in ticks, but no Rickettsia species were found in the blood of examined voles. Candidatus Rickettsia tarasevichiae DNA was detected in 89.7% of unfed I. persulcatus, 91.7% of engorged I. persulcatus and 14.7% of I. trianguliceps ticks. Rickettsia helvetica DNA was detected in 5.9% of I. trianguliceps ticks. In addition, a new Rickettsia genetic variant was found in 32.4% of I. trianguliceps ticks. Sequence analysis of the 16S rRNA, gltA, ompA, оmpB and sca4 genes was performed and, in accordance with genetic criteria, a new Rickettsia genetic variant was classified as a new Candidatus Rickettsia species. We propose to name this species Candidatus Rickettsia uralica, according to the territory where this species was initially identified. Candidatus Rickettsia uralica was found to belong to the spotted fever group. The data obtained in this study leads us to propose that Candidatus Rickettsia uralica is associated with I. trianguliceps ticks.

  7. Current Status of Tick Fauna in North of Iran

    Directory of Open Access Journals (Sweden)

    P Shayan

    2007-04-01

    Full Text Available Background: The distribution and ecological preferences of ticks of domestic animals in North of Iran were studied four times a year from 2002 to 2005. Methods: A total of 1720 tick specimens were collected from cattle, sheep and goats from different localities of Caspian Sea areas consisting of Guilan, Mazandaran, Golestan and Ardebil provinces, Iran. Results: Fourteen tick species were identified as Hyalomma anatolicum anatolicum (5.23%, H.marginatum (20.34%, H.detritum (3.48%, Haemaphysalis punctata (12.79%, Haem. Parva (0.58%, Haem.concinna (0.58%, Haem.choldokovsky (6.97%, Ixodes ricinus (2.32%, Rhipicephalus sanguineus (19.76%, Rh.bursa (4.65%, Boophilus annulatus (9.88%, Dermacentor niveus (6.39%, D. marginatus (1.74% and Ornithodoros lahorensis (5.23%. Both Dermacentor and Ornithodoros were found only in Ardebil with cold climatic conditions and high altitude. The only ticks, which were found in forest area, were Boophilus annulatus and Ixodes ricinus. Conclusion: The veterinary and public health importance of the above species should be emphasized.

  8. Bartonella-like DNA detected in Ixodes tasmani ticks (Acari: Ixodida) infesting Koalas (Phascolarctos cinereus) in Victoria, Australia.

    Science.gov (United States)

    Vilcins, Inger-Marie E; Kosoy, Michael; Old, Julie M; Deane, Elizabeth M

    2009-10-01

    A total of 42 ticks comprising Ixodes tasmani (n = 41) and Ixodes trichosuri (n = 1) were collected from wild koalas (Phascolarctos cinereus) at the Koala Convention Centre, Philip Island, Victoria, Australia and screened for the presence of Bartonella using the target gene gltA. Bartonella-like DNA was detected in 4 of the 19 pooled tick samples (21%). All positive ticks were male. Analysis of partial sequences for the gltA gene indicated the presence of a Bartonella-related species similar to that reported in another Ixodid species. This is the first report of Bartonella-like organisms in a native Australian marsupial.

  9. Insight into the sialome of the castor bean tick, Ixodes ricinus

    Directory of Open Access Journals (Sweden)

    Valenzuela Jesus G

    2008-05-01

    Full Text Available Abstract Background In recent years, there have been several sialome projects revealing transcripts expressed in the salivary glands of ticks, which are important vectors of several human diseases. Here, we focused on the sialome of the European vector of Lyme disease, Ixodes ricinus. Results In the attempt to describe expressed genes and their dynamics throughout the feeding period, we constructed cDNA libraries from four different feeding stages of Ixodes ricinus females: unfed, 24 hours after attachment, four (partially fed and seven days (fully engorged after attachment. Approximately 600 randomly selected clones from each cDNA library were sequenced and analyzed. From a total 2304 sequenced clones, 1881 sequences forming 1274 clusters underwent subsequent functional analysis using customized bioinformatics software. Clusters were sorted according to their predicted function and quantitative comparison among the four libraries was made. We found several groups of over-expressed genes associated with feeding that posses a secretion signal and may be involved in tick attachment, feeding or evading the host immune system. Many transcripts clustered into families of related genes with stage-specific expression. Comparison to Ixodes scapularis and I. pacificus transcripts was made. Conclusion In addition to a large number of homologues of the known transcripts, we obtained several novel predicted protein sequences. Our work contributes to the growing list of proteins associated with tick feeding and sheds more light on the dynamics of the gene expression during tick feeding. Additionally, our results corroborate previous evidence of gene duplication in the evolution of ticks.

  10. First survey of hard ticks (Acari:Ixodidae) on cattle, sheep and goats in Boeen Zahra and Takistan counties, Iran

    Institute of Scientific and Technical Information of China (English)

    Masoomeh Shemshad; Khadijeh Shemshad; Mohammad Mehdi Sedaghat; Majid Shokri; Alireza Barmaki; Mojgan Baniardalani; Javad Rafinejad

    2012-01-01

    Objective: To carry out the distribution survey of hard ticks of livestock in Boeen Zahra and Takistan counties of Qazvin province from April 2010 to September 2010. Methods:Nearly about 2 638 sheep, 461 goats and 318 cattle of 38 herds in different geographical areas were searched for tick infestation. Results:The species compositions collected from the livestock of Boeen Zahra and Takistan were Haemaphysalis concinna (0.63%), Haemaphysalis sulcata (12.66%), Hyalomma anatolicum (3.80%), Hyalomma asiaticum (3.16%), Hyalomma detritum (5.70%), Hyalomma dromedarii (28.48%), Hyalomma marginatum (13.29%), Hyalomma schulzei (1.89%), Rhipicephalus bursa (3.16%) and Rhipicephalus sanguineus (3.16%), and for Takistan’s livestock were Hyalomma dromedarii (9.86%), Hyalomma marginatum (13.29%), Hyalomma schulzei (1.89%) and Rhipicephalus sanguineus (3.16%), respectively. Hard ticks compositions in different topographic areas were different. Hyalomma species had the most prevalence in the areas. Conclusions:The veterinary and public health investigation of the above species should be taken.

  11. La presencia de Ixodes luciae en el noroeste argentino y nuevos huéspedes para Ixodes pararicinus y algunas especies de Amblyomma (Acari: Ixodidae Presence of Ixodes luciae in Argentina northwest and new hosts for Ixodes pararicinus and some species of Amblyomma (Acari: Ixodidae

    Directory of Open Access Journals (Sweden)

    Analía G. Autino

    2006-07-01

    Full Text Available El análisis de una colección de garrapatas de mamíferos del noroeste argentino, depositados en la Colección de Anexos de la Colección Mamíferos Lillo (CML de la Universidad Nacional de Tucumán, permitió ampliar el área de distribución de Ixodes luciae Sénevet, a las provincias de Salta y Tucumán e incrementar su rango de huéspedes al roedor sigmodontino Calomys callosus (Rengger y a los marsupiales de la familia Didelphidae Micoureus constantiae (Thomas, Thylamys cinderella Thomas y Thylamys venustus (Thomas. Se registró a C . callosus y Oligoryzomys destructor (Tschudi como nuevos huéspedes de Ixodes pararicinus Keirans & Clifford, y a los Carnivora Lycalopex gymnocercus (Fischer y Oncifelis geoffroyi (d´Orbigny & Gervais como nuevos huéspedes de Amblyomma neumanni Ribaga y Amblyomma parvum Aragão, respectivamente. Adicionalmente, se observó la infestación de Lutreolina crassicaudata (Desmarest (Didelphidae por I. luciae y la presencia de Amblyomma tigrinum Koch, sobre L. gymnocercus . Ninfas de Amblyomma sp . se obtuvieron de Akodon Meyen (Sigmodontinae.The analysis of a tick collection of mammals from northwestern Argentina deposited in the Annexes (ACML of Colección Mamíferos Lillo (CML National University of Tucumán, amplified the distribution of Ixodes luciae Sénevet, to Salta and Tucumán provinces and increased the host range to the sigmodontinae rodent Calomys callosus (Rengger and the Didelphidae Micoureus constantiae (Thomas, Thylamys cinderella Thomas and Thylamys venustus (Thomas. Calomys callosus and Oligoryzomys destructor (Tschudi were registered as new hosts of Ixodes pararicinus Keirans & Clifford, and the Carnivora Lycalopex gymnocercus (Fischer and Oncifelis geoffroyi (d´Orbigny & Gervais as new hosts of Amblyomma neumanni Ribaga, and Amblyomma parvum Aragão, respectively . Lutreolina crassicaudata (Desmarest (Didelphidae was also found infested with I. luciae while Amblyomma tigrinum Koch was

  12. Two neuropeptides from synganglia of the hard tick,Ixodes sinensis (Acari:Ixodidae)

    Institute of Scientific and Technical Information of China (English)

    LI Jianxu; LIU Tongguang; YANG Hailong; XU Xueqing; LIU Zhigang; LAI Ren

    2006-01-01

    Two neuropeptides were isolated from synganglia (central nervous system) of the hard tick,Ixodes sinensis. Their primary sequences were established as Leu-VaI-VaI-Tyr-Pro-Trp-Thr-Lys and TrpGlu-Lys-Leu-Gly-Ser-Met-Glu-Thr-Leu. By hot plate bioassay, neuropeptide a displayed strong antinociceptive effect in mice by a dose-dependent behavior, while neuropeptide b had some relaxant effects on the isolated rat strip. These neuropeptides might be involved in down-regulating the host's defensive reaction.

  13. The efficacy of repellents against Aedes, Anopheles, Culex and Ixodes spp. - a literature review.

    Science.gov (United States)

    Lupi, Eleonora; Hatz, Christoph; Schlagenhauf, Patricia

    2013-01-01

    Travellers are confronted with a variety of vector-borne threats. Is one type of repellent effective against all biting vectors? The aim of this review is to examine the literature, up to December 31st, 2012, regarding repellent efficacy. We searched PubMed for relevant papers. Repellents of interest were DEET, Icaridin as well as other piperidine-derived products (SS220), Insect Repellent (IR) 3535 (ethyl-butylacetyl-amino-propionat, EBAAP) and plant-derived products, including Citriodora (para-menthane-3,8-diol). As vectors, we considered the mosquito species Anopheles, Aedes and Culex as well as the tick species Ixodes. We selected only studies evaluating the protective efficacy of repellents on human skin. We reviewed a total of 102 publications. Repellents were evaluated regarding complete protection time or as percentage efficacy [%] in a time interval. We found no standardized study for tick bite prevention. Regarding Aedes, DEET at concentration of 20% or more, showed the best efficacy providing up to 10 h protection. Citriodora repellency against this mosquito genus was lower compared to the other products. Also between subspecies a difference could be observed: Ae. aegypti proved more difficult to repel than Ae. Albopictus. Fewer studies have been conducted on mosquito species Anopheles and Culex. The repellency profile against Anopheles species was similar for the four principal repellents of interest, providing on average 4-10 h of protection. Culex mosquitoes are easier to repel and all four repellents provided good protection. Few studies have been conducted on the tick species Ixodes. According to our results, the longest protection against Ixodes scapularis was provided by repellents containing IR3535, while DEET and commercial products containing Icaridin or PMD showed a better response than IR3535 against Ixodes ricinus. Many plant-based repellents provide only short duration protection. Adding vanillin 5% to plant-based repellents and to DEET

  14. Vectors of Crimean Congo Hemorrhagic Fever Virus in Iran

    Directory of Open Access Journals (Sweden)

    Zakkyeh Telmadarraiy

    2015-10-01

    Full Text Available Background: Ticks are important vectors and reservoirs of Crimean Congo Hemorrhagic Fever (CCHF virus. Human beings may be infected whenever the normal life cycle of the infected ticks on non- human vertebrate hosts is interrupted by the undesirable presence of humans in the cycle. A total of 26 species of Argasid and Ixodid ticks have been recorded in Iran; including nine Hyalomma, two Rhipicephalus, two Dermacentor, five Haemaphysalis, two Boophilus, one Ixodes and two Argas as well as three Ornithodoros species as blood sucking ectoparasites of livestock and poultries. The present paper reviews tick vectors of CCHF virus in Iran, focusing on the role of ticks in different provinces of Iran using reverse transcription polymerase chain reaction (RT-PCR assay.Methods: During ten years study, 1054 tick specimens; including two species of Argasidae and 17 species of Ixodidae were examined for their infection to CCHF virus genome. The output of all studies as well as related publications were discussed in the current paper.Results: The results show that Rhipicephalus sanguineus, Hyalomma marginatum, H. anatolicum, H. asiaticum and H. dromedarii were known as the most frequent species which were positive for CCHF virus.Conclusion: The status of ticks which were positive for CCHF virus revealed that unlike the most common idea that Hyalomma species are the most important vectors of CCHF virus, other ticks including Rhipicephalus,Haemaphysalis and Dermacentor can be reservoir of this virus; thus, considering geographical distribution, type of host and environmental conditions, different tick control measurements should be carried out in areas with high incidence of CCHF disease.

  15. Photosensitizers in the fight against ticks: safranin as a novel photodynamic fluorescent acaricide to control the camel tick Hyalomma dromedarii (Ixodidae).

    Science.gov (United States)

    Khater, Hanem; Hendawy, Nabil; Govindarajan, Marimuthu; Murugan, Kadarkarai; Benelli, Giovanni

    2016-10-01

    Ticks transmit more pathogen species than any other group of blood-feeding arthropods worldwide, affecting humans, livestock, and companion animals. Hyalomma dromedarii is the predominant tick species infesting camels, and its effective control is of pivotal importance. In this research, we compared the phytoefficacy of safranin (SF), a fluorescent dye applied as an acaricide for the first time, to that of tetramethrin (TM) against engorged females of H. dromedarii through in vitro immersion bioassays. Furthermore, the effect of SF exposure was evaluated on the reproductive potential of surviving tick females. Different concentrations of SF (0.03, 0.06, 0.3, 1, and 4 % w:v) and TM (0.03, 0.13, 0.5, 2, and 4 %) were prepared in distilled water and administered to engorged females of H. dromedarii. SF-treated ticks were illuminated with a light source for 30 min post-treatment (PT). Photophysical properties of SF were studied, and the relative efficacy of the used light source and sunlight was calculated. Results showed that the minimum least concentration that causes 100 % acaricidal effect was 4 % PT with SF and TM, for 8 and 48 h, respectively. LC50 values 8 and 24 h PT were 0.08, 0.03 and 0.78, 0.20 %, respectively. Comparing LC50 and LC90 2 h PT, SF was 33 and 22 times more potent than TM. LT50 of 4 % SF and TM were 0.80 and 2.17 h, respectively. Treatment with the lowest concentrations of SF and TM induced reduction of the number of ovipositing females, eggs per female, ticks laying viable eggs, and hatched eggs. Overall, our results highlighted that SF is highly effective if compared to TM, allowing use to candidate it for the development of novel and safer acaricides.

  16. Morphological and molecular identification of the brown dog tick Rhipicephalus sanguineus and the camel tick Hyalomma dromedarii (Acari: Ixodidae vectors of Rickettsioses in Egypt

    Directory of Open Access Journals (Sweden)

    Hend H. A. M. Abdullah

    2016-10-01

    Full Text Available Aim: Rickettsioses have an epidemiological importance that includes pathogens, vectors, and hosts. The dog tick Rhipicephalus sanguineus and the camel tick Hyalomma dromedarii play important roles as vectors and reservoirs of Rickettsiae. The aim of this study was to determine the prevalence of Rickettsiae in ixodid ticks species infesting dogs and camels in Egypt, in addition to, the morphological and molecular identification of R. sanguineus and H. dromedarii. Materials and Methods: A total of 601 and 104 of ticks’ specimens were collected from dogs and camels, respectively, in Cairo, Giza and Sinai provinces. Hemolymph staining technique and OmpA and gltA genes amplification were performed to estimate the prevalence rate of Rickettsiae in ticks. For morphological identification of tick species, light microscope (LM and scanning electron microscope (SEM were used. In addition to the phylogenetic analyses of 18S rDNA, Second internal transcript spacer, 12S rDNA, cytochrome c oxidase subunit-1, and 16S rDNA were performed for molecular identification of two tick species. Results: The prevalence rate of Rickettsiae in ticks was 11.6% using hemolymph staining technique and 6.17% by OmpA and gltA genes amplification. Morphological identification revealed that 100% of dogs were infested by R. sanguineus while 91.9% of camels had been infested by H. dromedarii. The phylogenetic analyses of five DNA markers confirmed morphological identification by LM and SEM. The two tick species sequences analyses proved 96-100% sequences identities when compared with the reference data in Genbank records. Conclusion: The present studies confirm the suitability of mitochondrial DNA markers for reliable identification of ticks at both intra- and inter-species level over the nuclear ones. In addition to, the detection of Rickettsiae in both ticks’ species and establishment of the phylogenetic status of R. sanguineus and H. dromedarii would be useful in

  17. Morphological and molecular identification of the brown dog tick Rhipicephalus sanguineus and the camel tick Hyalomma dromedarii (Acari: Ixodidae) vectors of Rickettsioses in Egypt.

    Science.gov (United States)

    Abdullah, Hend H A M; El-Molla, Amal; Salib, Fayez A; Allam, Nesreen A T; Ghazy, Alaa A; Abdel-Shafy, Sobhy

    2016-10-01

    Rickettsioses have an epidemiological importance that includes pathogens, vectors, and hosts. The dog tick Rhipicephalus sanguineus and the camel tick Hyalomma dromedarii play important roles as vectors and reservoirs of Rickettsiae. The aim of this study was to determine the prevalence of Rickettsiae in ixodid ticks species infesting dogs and camels in Egypt, in addition to, the morphological and molecular identification of R. sanguineus and H. dromedarii. A total of 601 and 104 of ticks' specimens were collected from dogs and camels, respectively, in Cairo, Giza and Sinai provinces. Hemolymph staining technique and OmpA and gltA genes amplification were performed to estimate the prevalence rate of Rickettsiae in ticks. For morphological identification of tick species, light microscope (LM) and scanning electron microscope (SEM) were used. In addition to the phylogenetic analyses of 18S rDNA, Second internal transcript spacer, 12S rDNA, cytochrome c oxidase subunit-1, and 16S rDNA were performed for molecular identification of two tick species. The prevalence rate of Rickettsiae in ticks was 11.6% using hemolymph staining technique and 6.17% by OmpA and gltA genes amplification. Morphological identification revealed that 100% of dogs were infested by R. sanguineus while 91.9% of camels had been infested by H. dromedarii. The phylogenetic analyses of five DNA markers confirmed morphological identification by LM and SEM. The two tick species sequences analyses proved 96-100% sequences identities when compared with the reference data in Genbank records. The present studies confirm the suitability of mitochondrial DNA markers for reliable identification of ticks at both intra- and inter-species level over the nuclear ones. In addition to, the detection of Rickettsiae in both ticks' species and establishment of the phylogenetic status of R. sanguineus and H. dromedarii would be useful in understanding the epidemiology of ticks and tick borne rickettsioses in Egypt.

  18. In vitro assessment of the acaricidal activity of Piper longum, Piper nigrum, and Zingiber officinale extracts against Hyalomma anatolicum ticks.

    Science.gov (United States)

    Singh, Nirbhay K; Saini, S P S; Singh, Harkirat; Jyoti; Sharma, S K; Rath, S S

    2017-03-01

    Ticks and tick-borne diseases are a major constraint for the sustainable cattle industry in the tropical and subtropical regions including the Indian subcontinent. The development of resistance to most of the commonly used acaricides leads to an attempt to screen plant extracts and their combinations for their possible acaricidal activity to develop an eco-friendly tick control alternative. An alcoholic and various aqueous extracts of Piper longum, Piper nigrum and Zingiber officinale and their combinations were evaluated for acaricidal activity against the three-host ixodid tick, Hyalomma anatolicum by larval immersion test using 14-21 days old unfed larvae. The efficacy was assessed by measuring larval mortality (%) and the lethal concentrations for 50% (LC50) and 95% (LC95) with their 95% confidence limits (CL) values were estimated by applying regression equation analysis to the probit transformed data of mortality. A concentration-dependent mortality response was recorded in all extracts prepared from seeds of P. longum and P. nigrum and their combinations. The highest acaricidal property was exhibited by the alcoholic extract of P. longum seeds with the minimum LC50 and LC95 (95% CL) values of 0.071% (0.07-0.072) and 0.135% (0.13-0.14), respectively, followed by alcoholic combinations. Interestingly, no acaricidal activity was recorded in extracts prepared from the rhizome of Z. officinale. The results indicated that the ethanolic extracts of P. longum and P. nigrum and their combinations can be used effectively for tick control in an integrated format.

  19. Control of Hyalomma lusitanicum (Acari: Ixodidade) Ticks Infesting Oryctolagus cuniculus (Lagomorpha: Leporidae) Using the Entomopathogenic Fungus Beauveria bassiana (Hyocreales: Clavicipitaceae) in Field Conditions.

    Science.gov (United States)

    González, J; Valcárcel, F; Pérez-Sánchez, J L; Tercero-Jaime, J M; Cutuli, M T; Olmeda, A S

    2016-11-01

    Entomopathogenic fungi are widely used to control arthropods not just in agricultural settings but also in Veterinary Medicine and Public Health. These products have been employed to control tick populations and tick-borne diseases. The effectiveness of these control measures not only depends on the fungi, but also on the tick species and environmental conditions. In Mesomediterranean areas, tick species are adapted to extreme climatic conditions and it is therefore especially important to develop suitable tick control strategies. The aim of this study was to evaluate the effectiveness of a new method of tick control which entails the application of a commercial strain of Beauveria bassiana (Balsamo, Vuillemin) on wild rabbit burrows under field conditions. Aqueous solutions of the product were applied using a mist blower sprayer into 1,717 burrows. Two trials were performed, one in spring and the other in summer. The parasitic index (PI) was calculated for 10 rabbits per treatment per time point on day +30, +60, and +90 posttreatment and efficiency was calculated by comparing the PI for ticks in treated and untreated rabbits. A total of 20,234 ixodid ticks were collected. Hyalomma lusitanicum Koch, 1844 was the most abundant tick feeding on rabbits. Treatment significantly reduced the PI in spring (by 78.63% and 63.28% on day +30 and +60, respectively; P < 0.05), but appeared to be less effective in summer, with a marginally significant tick reduction of 35.72% on day +30 (P = 0.05). Results suggest that the efficacy of applications inside burrows could be temperature-dependent and that such applications could be an economic alternative to rabbit tick control during at least two months using a diluted solution of B. bassiana conidia.

  20. Seasonal feeding activity of the tree-hole tick, Ixodes arboricola.

    Science.gov (United States)

    Heylen, D J A; Van Oosten, A R; Devriendt, N; Elst, J; De Bruyn, L; Matthysen, E

    2014-07-01

    Bird-specific ticks do not infest humans and livestock, but these ticks often share their avian hosts with generalist ticks that do. Therefore, their feeding activity may have an impact on the transmission of pathogens outside bird-tick transmission cycles. Here we examined the seasonal feeding activity of the tree-hole tick (Ixodes arboricola) in relation to the activity of its hole-breeding hosts (Parus major and Cyanistes caeruleus). We analysed data on ticks derived from birds, on the abundance of engorged ticks inside nest boxes, and on bird nests that were experimentally exposed to ticks. We observed a non-random pattern of feeding associated with the tick instar and host age. The majority of adult ticks fed on nestlings, while nymphs and larvae fed on both free-flying birds and nestlings. Due to their fast development, some ticks were able to feed twice within the same breeding season. The highest infestation rates in free-flying birds were found during the pre-breeding period and during autumn and winter when birds roost inside cavities. Except during winter, feeding of I. arboricola overlapped in time with the generalist Ixodes ricinus, implying that tick-borne microorganisms that are maintained by I. arboricola and birds could be bridged by I. ricinus to other hosts.

  1. Detection and characterization of Babesia species in Ixodes ticks in Estonia.

    Science.gov (United States)

    Katargina, Olga; Geller, Julia; Vasilenko, Veera; Kuznetsova, Tatiana; Järvekülg, Lilian; Vene, Sirkka; Lundkvist, Åke; Golovljova, Irina

    2011-07-01

    The presence of Babesia spp. was studied in 2603 Ixodes ricinus and Ixodes persulcatus ticks collected at seven sites in Estonia. By reverse line blot screening, Babesia spp. was detected in 36 (1.4%) ticks, among them 18 (0.7%) were further recognized by a Babesia microti probe, 3 (0.1%) by a Babesia divergens probe, and the other 15 (0.6%) were recognized only by the universal Babesia spp. "catch all" probe. Sequence analyses of 6 of these 15 samples revealed that all of them belonged to Babesia sp. EU1. B. microti was detected in both tick species I. ricinus and I. persulcatus at the seven sites, whereas B. divergens-like and Babesia sp. EU1 were found only in I. persulcatus and I. ricinus, respectively. Genetic characterization based on partial 18S rRNA showed that the Estonian sequences of B. microti, B. divergens-like, and Babesia sp. EU1 share a high rate of similarity and are closely related to sequences from other European countries, Siberia, and United States. The present study demonstrated for the first time the existence and distribution of Babesia spp. in I. persulcatus and I. ricinus ticks in Estonia.

  2. Dermatoses caused by infestations of immature Ixodes spp. on dogs and cats in Sydney, Australia.

    Science.gov (United States)

    Baxter, Cg; Vogelnest, Lj; Doggett, Sl

    2009-05-01

    Infestations of larval and nymphal Ixodes spp. were identified in 16 dogs and 16 cats from several small animal clinics in Sydney. Cases occurred in late summer or autumn, peaking in February, and were seasonally recurrent in some individuals. Clinical signs of infestation included a papular dermatitis and irritation or pruritus that ranged from severe to mild or absent. The distribution of tick attachment tended to be cranial and ventral, with the face, legs, axillae and ventrum the most commonly affected sites. The estimated number of ticks in each infestation varied from less than 10 to more than 100. Basic morphological examination of ticks collected from affected animals was performed by attending veterinarians using light microscopy, and larvae and nymphs belonging to the Ixodes genus were identified. Ticks collected from 17 animals and submitted to the Department of Medical Entomology, Westmead Hospital were putatively identified as I. trichosuri (57%) and I. holocyclus (25%) larvae. Histopathological samples of attachment sites collected from three dogs and one cat were characterised by ticks attached in well-demarcated invaginations of the skin ('tick craters') associated with variable epidermal and/or dermal necrosis, focal eosinophilic intraspinous pustules, mild to marked eosinophilic and neutrophilic, superficial to deep, dermal perivascular to interstitial inflammation, and moderate to marked superficial dermal oedema and red cell extravasation. A range of topical acaricidal preparations, including fipronil and synthetic pyrethroids, were used for treatment.

  3. Detection and identification of Rickettsia species in Ixodes tick populations from Estonia.

    Science.gov (United States)

    Katargina, Olga; Geller, Julia; Ivanova, Anna; Värv, Kairi; Tefanova, Valentina; Vene, Sirkka; Lundkvist, Åke; Golovljova, Irina

    2015-09-01

    A total of 1640 ticks collected in different geographical parts of Estonia were screened for the presence of Rickettsia species DNA by real-time PCR. DNA of Rickettsia was detected in 83 out of 1640 questing ticks with an overall prevalence of 5.1%. The majority of the ticks infected by rickettsiae were Ixodes ricinus (74 of 83), while 9 of the 83 positive ticks were Ixodes persulcatus. For rickettsial species identification, a part of the citrate synthase gltA gene was sequenced. The majority of the positive samples were identified as Rickettsia helvetica (81 out of 83) and two of the samples were identified as Rickettsia monacensis and Candidatus R. tarasevichiae, respectively. Genetic characterization based on the partial gltA gene showed that the Estonian sequences within the R. helvetica, R. monacensis and Candidatus R. tarasevichiae species demonstrated 100% similarity with sequences deposited in GenBank, originating from Rickettsia species distributed over large territories from Europe to Asia.

  4. Identification and Characterization of Ixodes scapularis Antigens That Elicit Tick Immunity Using Yeast Surface Display

    Science.gov (United States)

    Daffre, Sirlei; DePonte, Kathleen; Hovius, Joppe W. R.; Veer, Cornelis van't; van der Poll, Tom; Bakhtiari, Kamran; Meijers, Joost C. M.; Boder, Eric T.; van Dam, Alje P.; Fikrig, Erol

    2011-01-01

    Repeated exposure of rabbits and other animals to ticks results in acquired resistance or immunity to subsequent tick bites and is partially elicited by antibodies directed against tick antigens. In this study we demonstrate the utility of a yeast surface display approach to identify tick salivary antigens that react with tick-immune serum. We constructed an Ixodes scapularis nymphal salivary gland yeast surface display library and screened the library with nymph-immune rabbit sera and identified five salivary antigens. Four of these proteins, designated P8, P19, P23 and P32, had a predicted signal sequence. We generated recombinant (r) P8, P19 and P23 in a Drosophila expression system for functional and immunization studies. rP8 showed anti-complement activity and rP23 demonstrated anti-coagulant activity. Ixodes scapularis feeding was significantly impaired when nymphs were fed on rabbits immunized with a cocktail of rP8, rP19 and rP23, a hall mark of tick-immunity. These studies also suggest that these antigens may serve as potential vaccine candidates to thwart tick feeding. PMID:21246036

  5. Prevalence and diversity of Babesia spp. in questing Ixodes ricinus ticks from Norway

    Directory of Open Access Journals (Sweden)

    Øines Øivind

    2012-08-01

    Full Text Available Abstract Background Ixodes ricinus ticks transmit Babesia species to vertebrate hosts. Using molecular tools we were able to detect the presence of this piroplasmid in its vector. The aims of this study were to investigate the prevalence and identity of Babesia species in questing ticks collected in various areas of Norway. Methods DNA from questing l. ricinus ticks were examined with a realtime PCR for the presence of Babesia. Positive samples of tick DNA were identified to species using PCR, and sequence analysis. Results From a total of 1908 questing l. ricinus ticks, 17 (0.9% indicated the presence of Babesia spp. after realtime-PCR screening. Ixodes ricinus harbouring Babesia spp. was detected in 9 out of 22 localities. Further molecular analyses of DNA from these positive ticks indicate the presence of Babesia venatorum, B. divergens, B. capreoli and a currently undescribed Babesia in Norwegian ticks. The most prevalent was B. venatorum found in 71% of the positive ticks. Conclusions A total of 17 out of 1908 (0.9% ticks were positive for Babesia. Our data confirm that there are several Babesia species in ticks in Norway. Babesia venatorum was the most prevalent. This species has a zoonotic potential and may cause human babesiosis following a tick bite.

  6. Precise identification of different stages of a tick,Ixodes granulatus Supino,1897(Acari:Ixodidae)

    Institute of Scientific and Technical Information of China (English)

    Ernieenor Faraliana Che Lah; Salmah Yaakop; Mariana Ahamad; Ernna George; Shukor Md Nor

    2016-01-01

    Objective: To identify different stages of Ixodes granulatus(I. granulatus) based on morphological characters prior to molecular identification which is significant for confirming and identifying the nymphal stages of I. granulatus.Methods: A total of 14 individuals of adult, engorged and nymphal ticks collected from three different localities were examined morphologically using taxonomic keys, followed by PCR using cytochrome oxidase subunit I(COI). Clustering analysis based on COI sequences was carried out by constructing neighbor-joining and maximum parsimony tree to clarify the genetic variation and diversity of local I. granulatus.Results: Based on external morphological characterizations, nine individuals(64.3%)were successfully identified as I. granulatus, while five individuals were recognized only as Ixodes sp. due to lack of morphological characters visible and development during that stage. Molecular analysis of local I. granulatus using COI gene revealed 93%–94% sequence homology from available sequence in Gen Bank and was in concordance with the morphological identification. Furthermore, a low intraspecific variation was observed among the species of I. granulatus collected from different localities(0%–3.7%).Conclusions: These findings demonstrated for the first time the establishment of COI gene for identifying I. granulatus nymphal tick which is of paramount importance to the control of potential tick-borne infections in Malaysia. Moreover, this study provides evidence that a combination of morphology and molecular data was corroborated as an accurate tool for tick identification.

  7. Precise identification of different stages of a tick, Ixodes granulatus Supino, 1897 (Acari:Ixodidae)

    Institute of Scientific and Technical Information of China (English)

    Ernieenor Faraliana Che Lah; Salmah Yaakop; Mariana Ahamad; Ernna George; Shukor Md Nor

    2016-01-01

    Objective: To identify different stages of Ixodes granulatus (I. granulatus) based on morphological characters prior to molecular identification which is significant for con-firming and identifying the nymphal stages of I. granulatus. Methods: A total of 14 individuals of adult, engorged and nymphal ticks collected from three different localities were examined morphologically using taxonomic keys, followed by PCR using cytochrome oxidase subunit I (COI). Clustering analysis based on COI sequences was carried out by constructing neighbor-joining and maximum parsimony tree to clarify the genetic variation and diversity of local I. granulatus. Results: Based on external morphological characterizations, nine individuals (64.3%) were successfully identified as I. granulatus, while five individuals were recognized only as Ixodes sp. due to lack of morphological characters visible and development during that stage. Molecular analysis of local I. granulatus using COI gene revealed 93%–94%sequence homology from available sequence in GenBank and was in concordance with the morphological identification. Furthermore, a low intraspecific variation was observed among the species of I. granulatus collected from different localities (0%–3.7%). Conclusions: These findings demonstrated for the first time the establishment of COI gene for identifying I. granulatus nymphal tick which is of paramount importance to the control of potential tick-borne infections in Malaysia. Moreover, this study provides evidence that a combination of morphology and molecular data was corroborated as an accurate tool for tick identification.

  8. Arsenophonus nasoniae and Rickettsiae Infection of Ixodes ricinus Due to Parasitic Wasp Ixodiphagus hookeri.

    Directory of Open Access Journals (Sweden)

    Monika Bohacsova

    Full Text Available Arsenophonus nasoniae, a male-killing endosymbiont of chalcid wasps, was recently detected in several hard tick species. Following the hypothesis that its presence in ticks may not be linked to the direct occurrence of bacteria in tick's organs, we identified A. nasoniae in wasps emerging from parasitised nymphs. We confirmed that 28.1% of Ixodiphagus hookeri wasps parasitizing Ixodes ricinus ticks were infected by A. nasoniae. Moreover, in examined I. ricinus nymphs, A. nasoniae was detected only in those, which were parasitized by the wasp. However, in part of the adult wasps as well as in some ticks that contained wasp's DNA, we did not confirm A. nasoniae. We also found, that in spite of reported male-killing, some newly emerged adult wasp males were also infected by A. nasoniae. Additionally, we amplified the DNA of Rickettsia helvetica and Rickettsia monacensis (known to be Ixodes ricinus-associated bacteria in adult parasitoid wasps. This may be related either with the digested bacterial DNA in wasp body lumen or with a role of wasps in circulation of rickettsiae among tick vectors.

  9. Identification and characterization of Ixodes scapularis antigens that elicit tick immunity using yeast surface display.

    Science.gov (United States)

    Schuijt, Tim J; Narasimhan, Sukanya; Daffre, Sirlei; DePonte, Kathleen; Hovius, Joppe W R; Van't Veer, Cornelis; van der Poll, Tom; Bakhtiari, Kamran; Meijers, Joost C M; Boder, Eric T; van Dam, Alje P; Fikrig, Erol

    2011-01-05

    Repeated exposure of rabbits and other animals to ticks results in acquired resistance or immunity to subsequent tick bites and is partially elicited by antibodies directed against tick antigens. In this study we demonstrate the utility of a yeast surface display approach to identify tick salivary antigens that react with tick-immune serum. We constructed an Ixodes scapularis nymphal salivary gland yeast surface display library and screened the library with nymph-immune rabbit sera and identified five salivary antigens. Four of these proteins, designated P8, P19, P23 and P32, had a predicted signal sequence. We generated recombinant (r) P8, P19 and P23 in a Drosophila expression system for functional and immunization studies. rP8 showed anti-complement activity and rP23 demonstrated anti-coagulant activity. Ixodes scapularis feeding was significantly impaired when nymphs were fed on rabbits immunized with a cocktail of rP8, rP19 and rP23, a hall mark of tick-immunity. These studies also suggest that these antigens may serve as potential vaccine candidates to thwart tick feeding.

  10. Identification and characterization of Ixodes scapularis antigens that elicit tick immunity using yeast surface display.

    Directory of Open Access Journals (Sweden)

    Tim J Schuijt

    Full Text Available Repeated exposure of rabbits and other animals to ticks results in acquired resistance or immunity to subsequent tick bites and is partially elicited by antibodies directed against tick antigens. In this study we demonstrate the utility of a yeast surface display approach to identify tick salivary antigens that react with tick-immune serum. We constructed an Ixodes scapularis nymphal salivary gland yeast surface display library and screened the library with nymph-immune rabbit sera and identified five salivary antigens. Four of these proteins, designated P8, P19, P23 and P32, had a predicted signal sequence. We generated recombinant (r P8, P19 and P23 in a Drosophila expression system for functional and immunization studies. rP8 showed anti-complement activity and rP23 demonstrated anti-coagulant activity. Ixodes scapularis feeding was significantly impaired when nymphs were fed on rabbits immunized with a cocktail of rP8, rP19 and rP23, a hall mark of tick-immunity. These studies also suggest that these antigens may serve as potential vaccine candidates to thwart tick feeding.

  11. Are the specialized bird ticks, Ixodes arboricola and I. frontalis, competent vectors for Borrelia burgdorferi sensu lato?

    NARCIS (Netherlands)

    Heylen, D.; Sprong, H.; Van Oers, K.; Fonville, M.; Matthysen, E.

    2014-01-01

    Our study tested whether two European bird-specialized ticks, Ixodes arboricola and I. frontalis, can act as vectors in the transmission cycles of Borrelia burgdorferi s.l. The ticks have contrasting ecologies but share songbird hosts (such as the great tit, Parus major) with the generalist I. ricin

  12. Are the specialized bird ticks, Ixodes arboricola and I. frontalis, competent vectors for Borrelia burgdorferi sensu lato?

    NARCIS (Netherlands)

    Heylen, D.; Sprong, H.; Oers, van K.; Fonville, M.; Leirs, H.; Matthysen, E.

    2014-01-01

    Our study tested whether two European bird-specialized ticks, Ixodes arboricola and I. frontalis, can act as vectors in the transmission cycles of Borrelia burgdorferi s.l. The ticks have contrasting ecologies but share songbird hosts (such as the great tit, Parus major) with the generalist I. ricin

  13. Elemol and Amyris Oil Repel the Ticks Ixodes scapularis and Amblyomma americanum (Acari: Ixodidae) in Laboratory Bioassays

    Science.gov (United States)

    The essential oil from Amyris balsamifera (Rutaceae) and elemol, a principal constituent of the essential oil of Osage orange, Maclura pomifera (Moraceae) were evaluated in in vitro and in vivo laboratory bioassays for repellent activity against host-seeking nymphs of the blacklegged tick, Ixodes sc...

  14. Are the specialized bird ticks, Ixodes arboricola and I. frontalis, competent vectors for Borrelia burgdorferi sensu lato?

    NARCIS (Netherlands)

    Heylen, D.; Sprong, H.; Oers, van K.; Fonville, M.; Leirs, H.; Matthysen, E.

    2014-01-01

    Our study tested whether two European bird-specialized ticks, Ixodes arboricola and I. frontalis, can act as vectors in the transmission cycles of Borrelia burgdorferi s.l. The ticks have contrasting ecologies but share songbird hosts (such as the great tit, Parus major) with the generalist I.

  15. Geographic and Temporal Variations in Population Dynamics of Ixodes ricinus and Associated Borrelia Infections in The Netherlands

    NARCIS (Netherlands)

    Gassner, F.; Vliet, van A.J.H.; Burgers, S.L.G.E.; Jacobs, F.H.H.; Verbaarschot, P.G.H.; Hovius, E.; Mulder, S.; Verhulst, N.O.; Overbeek, van L.S.; Takken, W.

    2011-01-01

    In a countrywide investigation of the ecological factors that contribute to Lyme borreliosis risk, a longitudinal study on population dynamics of the sheep tick Ixodes ricinus and their infections with Borrelia burgdorferi sensu lato (s.l.) was undertaken at 24 sites in The Netherlands from July

  16. Toxicity and repellency of plant essential oils against the arthropod disease vectors Phlebotomus papatasi and Ixodes scapularis

    Science.gov (United States)

    The sand fly Phlebotomus papatasi is an important blood feeder and the main vector of the trypanosomatid protozoa Leishmania major, which causes leishmaniasis in parts of the Afro-Eurasian region. The black- legged tick Ixodes scapularis is the primary tick vector of the bacterium Borrelia burgdorfe...

  17. Infestation of urban populations of the Northern white-breasted hedgehog, Erinaceus roumanicus, by Ixodes spp. ticks in Poland.

    Science.gov (United States)

    Dziemian, S; Michalik, J; Pi Łacińska, B; Bialik, S; Sikora, B; Zwolak, R

    2014-12-01

    Infestation by the nest-dwelling Ixodes hexagonus Leach and the exophilic Ixodes ricinus (Linnaeus) (Ixodida: Ixodidae) on the Northern white-breasted hedgehog, Erinaceus roumanicus (Erinaceomorpha: Erinaceidae), was investigated during a 4-year study in residential areas of the city of Poznań, west-central Poland. Of 341 hedgehogs, 303 (88.9%) hosted 10 061 Ixodes spp. ticks encompassing all parasitic life stages (larvae, nymphs, females). Ixodes hexagonus accounted for 73% and I. ricinus for 27% of the collected ticks. Male hedgehogs carried significantly higher tick burdens than females. Analyses of seasonal prevalence and abundance of I. hexagonus revealed relatively stable levels of infestation of all parasitic stages, with a modest summer peak in tick abundance noted only on male hosts. By contrast, I. ricinus females and nymphs peaked in spring and declined steadily thereafter in summer and autumn, whereas the less abundant larvae peaked in summer. This is the first longterm study to evaluate the seasonal dynamics of both tick species on populations of wild hedgehogs inhabiting urban residential areas.

  18. Rodent species as natural reservoirs of Borrelia burgdorferi sensu lato in different habitats of Ixodes ricinus in The Netherlands

    NARCIS (Netherlands)

    Gassner, F.; Takken, W.; Plas, C.; Kastelein, P.; Hoetmer, A.J.; Holdinga, M.; Overbeek, van L.S.

    2013-01-01

    Rodents are natural reservoirs for human pathogenic spirochaetes of the Borrelia burgdorferi complex [B. burgdorferi sensu lato (s.l.)], and the pathogens are transmitted by Ixodes ricinus ticks to humans in The Netherlands. B. burgdorferi s.l. infection prevalence in questing ticks, rodents, and ti

  19. Ixodes ricinus tick lipocalins: identification, cloning, phylogenetic analysis and biochemical characterization.

    Directory of Open Access Journals (Sweden)

    Jérôme Beaufays

    Full Text Available BACKGROUND: During their blood meal, ticks secrete a wide variety of proteins that interfere with their host's defense mechanisms. Among these proteins, lipocalins play a major role in the modulation of the inflammatory response. METHODOLOGY/PRINCIPAL FINDINGS: Screening a cDNA library in association with RT-PCR and RACE methodologies allowed us to identify 14 new lipocalin genes in the salivary glands of the Ixodes ricinus hard tick. A computational in-depth structural analysis confirmed that LIRs belong to the lipocalin family. These proteins were called LIR for "Lipocalin from I. ricinus" and numbered from 1 to 14 (LIR1 to LIR14. According to their percentage identity/similarity, LIR proteins may be assigned to 6 distinct phylogenetic groups. The mature proteins have calculated pM and pI varying from 21.8 kDa to 37.2 kDa and from 4.45 to 9.57 respectively. In a western blot analysis, all recombinant LIRs appeared as a series of thin bands at 50-70 kDa, suggesting extensive glycosylation, which was experimentally confirmed by treatment with N-glycosidase F. In addition, the in vivo expression analysis of LIRs in I. ricinus, examined by RT-PCR, showed homogeneous expression profiles for certain phylogenetic groups and relatively heterogeneous profiles for other groups. Finally, we demonstrated that LIR6 codes for a protein that specifically binds leukotriene B4. CONCLUSIONS/SIGNIFICANCE: This work confirms that, regarding their biochemical properties, expression profile, and sequence signature, lipocalins in Ixodes hard tick genus, and more specifically in the Ixodes ricinus species, are segregated into distinct phylogenetic groups suggesting potential distinct function. This was particularly demonstrated by the ability of LIR6 to scavenge leukotriene B4. The other LIRs did not bind any of the ligands tested, such as 5-hydroxytryptamine, ADP, norepinephrine, platelet activating factor, prostaglandins D2 and E2, and finally leukotrienes B4 and C

  20. Occurrence of multiple infections with different Borrelia burgdorferi genospecies in Danish Ixodes ricinus nymphs

    DEFF Research Database (Denmark)

    Andersen, Jean Vennestrøm; Egholm, H.; Mikkelsen, Per Jensen

    2008-01-01

    The pathogen Borrelia burgdorferi causes Lyme Borreliosis in human and animals world-wide. In Europe the pathogen is transmitted to the host by the vector Ixodes ricinus. The nymph is the primary instar for transmission to humans. We here study the infection rate of five Borrelia genospecies: B....... burgdorferi sensu stricto B. afzelii, B. garinii, B. valaisiana, B. lusitaniae in nymphs, by IFA and PCR. 600 nymphs were collected in North Zealand of Denmark. Each nymph was first analysed by IFA. If positive for spirochaetal infection, the genospecies was determined by PCR. The infection rate of B....... burgdorferi sensu lato was 15.5%, with the primary genospecies being B. afzelii (64.3%), B. garinii (57.1%), and B. lusitaniae (26.8%). It is the first time B. lusitaniae is documented in Denmark. Even though, the highest infection rate was discovered for B. afzelii and B. garinii, mixed infections are more...

  1. Detection and identification of Anaplasma phagocytophilum, Borrelia burgdorferi, and Rickettsia helvetica in Danish Ixodes ricinus ticks

    DEFF Research Database (Denmark)

    Skarphédinsson, Sigurdur; Lyholm, Birgitte Fjendbo; Ljungberg, Marianne

    2007-01-01

    Jutland and Funen, while 11% were positive for Borrelia burgdorferi. The Borrelia genotype B. afzelii was most prevalent, followed by B. valaisiana, B. burgdorferi s.s. and B. garinii.A. phagocytophilum was found in 14.5% of nymphs and 40.5% of adult ticks, while Borrelia was found in 13% of nymphs and 8......Borreliosis is an endemic infection in Denmark. Recent serosurveys have indicated that human anaplasmosis may be equally common. The aim of this study was to look for Anaplasma phagocytophilum and related pathogens in Ixodes ricinus ticks and estimate their prevalence, compared to Borrelia, using......% of adult ticks. The difference in prevalence between Anaplasma and Borrelia in adult ticks supports the idea that their maintenance cycles in nature may be different. Ticks were also infected with Rickettsia helvetica. Our study indicates that A. phagocytophilum prevalence in ticks in Denmark is as high...

  2. Polymorphism of Beauveria bassiana (Deuteromycota: Hyphomycetes) strains isolated from Ixodes ricinus (Acari: Ixodidae) in Moldova.

    Science.gov (United States)

    Mitina, G V; Tokarev, Y S; Movila, A A; Yli-Mattila, T

    2011-03-01

    Polymorphism of 10 Beauveria bassiana strains, isolated from Ixodes ricinus in Moldova, was evaluated using traditional (morphological and cultural properties) and molecular (RAPD patterns and ITS sequences) methods. The isolates differed greatly in morphological and cultural features, such as color, consistence, and growth rate. Four RAPD-PCR markers were used to evaluate genetic diversity of the strains. Phylogenetic neighbor-joining analysis of RAPD patterns divided strains into 3 major clades. The ITS sequences of 8 strains were identical to those of known B. bassiana strains. Two subsets (1 and 2) different by one nucleotide change were found in the ITS1 region. One strain of subset 1 was different from known B. bassiana strains by possessing 2 point mutations in the ITS region. RAPD-based clustering correlated to ITS sequence and colony morphology-based grouping of the strains.

  3. Pathogenicity of Metarhizium anisopliae (Deuteromycetes) and permethrin to Ixodes scapularis (Acari: Ixodidae) nymphs

    Science.gov (United States)

    Hornbostel, V.L.; Zhioua, Elyes; Benjamin, Michael A.; Ginsberg, Howard S.; Ostfeld, Richard S.

    2005-01-01

    Effectiveness of the entomopathogenic fungus Metarhizium anisopliae, for controlling nymphal Ixodes scapularis, was tested in laboratory and field trials. In the laboratory, M. anisopliae (Metschnikoff) Sorokin strain ESC1 was moderately pathogenic, with an LC50 of 107 spores/ml and induced 70% mortality at 109 spores/ml. In a field study, however, 109 spores/ml M. anisopliae did not effectively control questing I. scapularis nymphs, and significant differences were not detected in pre- and post-treatment densities. For nymphs collected and returned to the laboratory for observation, mortality was low in treatment groups, ranging from 20 to 36%. To assess whether a chemical acaricide would synergistically enhance pathogenicity of the fungus, we challenged unfed nymphal I. scapularis with combinations of M. anisopliae and permethrin, a relatively safe pyrethroid acaricide, in two separate bioassays. Significant interactions between M. anisopliae and permethrin were not observed, supporting neither synergism nor antagonism.

  4. Molecular characterization of COI gene of Ixodes ricinus (Linnaeus, 1758 from Serbia

    Directory of Open Access Journals (Sweden)

    Ćakić Sanja

    2014-01-01

    Full Text Available The Ixodes ricinus tick is common in the central part of the Balkan Peninsula. It is a vector of pathogenic agents causing diseases in humans and animals. Little is known about the genetic structure of I. ricinus in this region. We have investigated intraspecific variability of the COI gene among I. ricinus ticks collected from different regions of Serbia, and the correlation between the various types of habitat and genetic variability of ticks. The obtained COI gene sequences are the first barcoding sequences of I. ricinus ticks collected at localities in Serbia. Intraspecific variability of these COI gene sequences was very low, and there was no correlation between the various types of habitat and genetic variability of ticks. Samples from isolated localities (canyon/gorge showed no genetic differentiations from the majority of samples from open areas. [Projekat Ministarstva nauke Republike Srbije, br. ON 173006

  5. Sequence and secondary structure of the mitochondrial 16S ribosomal RNA gene of Ixodes scapularis.

    Science.gov (United States)

    Krakowetz, Chantel N; Chilton, Neil B

    2015-02-01

    The complete DNA sequences and secondary structure of the mitochondrial (mt) 16S ribosomal (r) RNA gene were determined for six Ixodes scapularis adults. There were 44 variable nucleotide positions in the 1252 bp sequence alignment. Most (95%) nucleotide alterations did not affect the integrity of the secondary structure of the gene because they either occurred at unpaired positions or represented compensatory changes that maintained the base pairing in helices. A large proportion (75%) of the intraspecific variation in DNA sequence occurred within Domains I, II and VI of the 16S gene. Therefore, several regions within this gene may be highly informative for studies of the population genetics and phylogeography of I. scapularis, a major vector of pathogens of humans and domestic animals in North America.

  6. Crystallization and diffraction analysis of the serpin IRS-2 from the hard tick Ixodes ricinus.

    Science.gov (United States)

    Kovářová, Zuzana; Chmelař, Jindřich; Sanda, Miloslav; Brynda, Jiří; Mareš, Michael; Rezáčová, Pavlína

    2010-11-01

    IRS-2 from the hard tick Ixodes ricinus belongs to the serpin family of protease inhibitors. It is produced in the salivary glands of the tick and its anti-inflammatory activity suggests that it plays a role in parasite-host interaction. Recombinant IRS-2 prepared by heterologous expression in a bacterial system was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to the primitive tetragonal space group P4(3) and diffracted to 1.8 Å resolution. Mass-spectrometric and electrophoretic analyses revealed that IRS-2 was cleaved by contaminating proteases during crystallization. This processing of IRS-2 mimicked the specific cleavage of the serpin by its target protease and resulted in a more stable form (the so-called relaxed conformation), which produced well diffracting crystals. Activity profiling with specific substrates and inhibitors demonstrated traces of serine and cysteine proteases in the protein stock solution.

  7. Immunity-related genes in Ixodes scapularis--perspectives from genome information.

    Science.gov (United States)

    Smith, Alexis A; Pal, Utpal

    2014-01-01

    Ixodes scapularis, commonly known as the deer tick, transmits a wide array of human and animal pathogens including Borrelia burgdorferi. Despite substantial advances in our understanding of immunity in model arthropods, including other disease vectors, precisely how I. scapularis immunity functions and influences persistence of invading pathogens remains largely unknown. This review provides a comprehensive analysis of the recently sequenced I. scapularis genome for the occurrence of immune-related genes and related pathways. We will also discuss the potential influence of immunity-related genes on the persistence of tick-borne pathogens with an emphasis on the Lyme disease pathogen B. burgdorferi. Further enhancement of our knowledge of tick immune responses is critical to understanding the molecular basis of the persistence of tick-borne pathogens and development of novel interventions against the relevant infections.

  8. Evidence for Ixodes holocyclus (Acarina: Ixodidae) as a vector for human lyme Borreliosis infection in Australia.

    Science.gov (United States)

    Mayne, P; Song, S; Shao, R; Burke, J; Wang, Y; Roberts, T

    2014-01-01

    Ixodes holocyclus (Acarina: Ixodidae) and Ixodes cornuatus (Acarina: Ixodidae) are two tick species found in the more densely populated areas of Australia and are known to be the cause of the neurotoxic disease tick paralysis in humans and mammals. Borreliosis otherwise known as Lyme disease is an emerging infectious disease in humans in Australia. Borrelia burgdorferi sensu stricto (Spirochaetales: Spirochaetaceae) and sensu lato are closely related spirochetal species that are the causative agents of Lyme disease in humans. Clinical transmission of this tick-borne disease can be identified in several but not all cases by a characteristic rash known as erythema migrans. However, there has been no study of the tick vectors of this infection in Australia. We used morphological and molecular techniques to identify unequivocally the ticks on the patients of this study to be I. holocyclus and then show the presence of B. burgdorferi sensu stricto infection in erythema migrans biopsies. I. holocyclus has not previously been associated with erythema migrans or Lyme disease. Two patients presented to the lead author's medical practice with erythema migrans in mid and late 2012. The morphology and cytochrome oxidase 1 and ITS2 genes of the two ticks were studied. The skin at the attachment site was sampled by central biopsy for both real time and endpoint Borrelia polymerase chain reaction (PCR) analysis and subsequent sequencing. Morphologically, the two ticks were either I. holocyclus or I. cornuatus. Molecular studies and nucleotide sequencing revealed that both ticks were I. holocyclus. Real time and endpoint PCR on the central tissue biopsy samples returned positive results for B. burgdorferi DNA. Our results are evidence for transmission of B. burgdorferi sensu stricto species to humans by the tick I. holocyclus in Australia. I. holocyclus is commonly associated with human tick bites on virtually the entire eastern coastline of Australia. © The Author 2014

  9. New host records of Ixodes luciae (Acari: Ixodidae in the State of Para, Brazil Registros de novos hospedeiros para Ixodes luciae (Acari: Ixodidae no estado do Pará, Brasil

    Directory of Open Access Journals (Sweden)

    Hermes Ribeiro Luz

    2013-03-01

    Full Text Available The aim of this paper is to record new hosts for Ixodes luciae Sénevet in the State of Para, Brazil, and present a case of malformation (teratogeny in a nymph of this species. The new host records are Marmosa murina (parasitized by females and Philander opossum (parasitized by nymphs. One of these nymphs showed malformation in the posterior margin of the opisthosoma resulting in a heart shaped posterior end.O objetivo deste trabalho foi registrar novos hospedeiros para Ixodes luciae Sénevet no estado do Pará, Brasil, e um caso de malformação em uma ninfa dessa espécie de carrapato. Os novos hospedeiros são Marmosa murina (parasitado por fêmeas e Philander opossum (parasitado por ninfas. Uma dessas ninfas apresentou uma malformação na parte posterior do opistossoma em forma de coração.

  10. Detection of two zoonotic Babesia microti lineages, the Hobetsu and U.S. lineages, in two sympatric tick species, ixodes ovatus and Ixodes persulcatus, respectively, in Japan.

    Science.gov (United States)

    Zamoto-Niikura, Aya; Tsuji, Masayoshi; Qiang, Wei; Nakao, Minoru; Hirata, Haruyuki; Ishihara, Chiaki

    2012-05-01

    The species Babesia microti, commonly found in rodents, demonstrates a high degree of genetic diversity. Three lineages, U.S., Kobe, and Hobetsu, are known to have zoonotic potential, but their tick vector(s) in Japan remains to be elucidated. We conducted a field investigation at Nemuro on Hokkaido Island and at Sumoto on Awaji Island, where up to two of the three lineages occur with similar frequencies in reservoirs. By flagging vegetation at these spots and surrounding areas, 4,010 ticks, comprising six species, were collected. A nested PCR that detects the 18S rRNA gene of Babesia species revealed that Ixodes ovatus and I. persulcatus alone were positive. Lineage-specific PCR for rRNA-positive samples demonstrated that I. ovatus and I. persulcatus carried, respectively, the Hobetsu and U.S. parasites. No Kobe-specific DNA was detected. Infected I. ovatus ticks were found at multiple sites, including Nemuro and Sumoto, with minimum infection rates (MIR) of ∼12.3%. However, all I. persulcatus ticks collected within the same regions, a total of 535, were negative for the Hobetsu lineage, indicating that I. ovatus, but not I. persulcatus, was the vector for the lineage. At Nemuro, U.S. lineage was detected in 2 of 139 adult I. persulcatus ticks (MIR, 1.4%), for the first time, while 48 of I. ovatus ticks were negative for that lineage. Laboratory experiments confirmed the transmission of Hobetsu and U.S. parasites to hamsters via I. ovatus and I. persulcatus, respectively. Differences in vector capacity shown by MIRs at Nemuro, where the two species were equally likely to acquire either lineage of parasite, may explain the difference in distribution of Hobetsu throughout Japan and U.S. taxa in Nemuro. These findings are of importance in the assessment of the regional risk for babesiosis in humans.

  11. Prevalence of Borrelia burgdorferi (Spirochaetales: Spirochaetaceae) in Ixodes scapularis (Acari: Ixodidae) adults in New Jersey, 2000-2001.

    Science.gov (United States)

    Schulze, Terry L; Jordan, Robert A; Hung, Robert W; Puelle, Rose S; Markowski, Daniel; Chomsky, Martin S

    2003-07-01

    Using polymerase chain reaction, we analyzed 529 Ixodes scapularis Say adults collected from 16 of New Jersey's 21 counties for the presence of Borrelia burgdorferi, the etiological agent of Lyme disease. Overall, 261 (49.3%) were positive. B. burgdorferi was detected in ticks obtained from each county and from 53 of the 58 (93.1%) municipalities surveyed. The observed statewide prevalence in New Jersey is similar to those reported from other northeastern and mid-Atlantic states.

  12. Efficacy of Plant-Derived and Synthetic Compounds on Clothing as Repellents Against Ixodes scapularis and Amblyomma americanum (Acari: Ixodidae)

    Science.gov (United States)

    2012-01-01

    efÞcacy of the repellent deet against Aedes aegypti . J. Am. Mosq. Control Assoc. 14: 178Ð182. Robbins, P. J., and M. G. Cherniack. 1986. Review of...VECTOR CONTROL , PEST MANAGEMENT, RESISTANCE, REPELLENTS Efficacy of Plant-Derived and Synthetic Compounds on Clothing as Repellents Against Ixodes...4 Division of Vector-BorneDiseases, National Center for Emerging and Zoonotic Infectious Diseases, Centers for Disease Control and Prevention

  13. Recent Discovery of Widespread Ixodes affinis (Acari: Ixodidae) Distribution in North Carolina With Implications for Lyme Disease Studies

    Science.gov (United States)

    2010-06-01

    implications for Lyme disease studies Bruce A. Harrison1, Walker H. Rayburn Jr.2, Marcee Toliver1, Eugene E. Powell1, Barry R. Engber1, Lance A. Durden3...affinis is morphologically very similar to Ixodes scapularis Say, the primary vector of Lyme disease borreliae in the eastern U.S.A. (Keirans et al. 1996...Ixodidae) distribution in North Carolina with implications for Lyme disease studies 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER

  14. Presence of host-seeking Ixodes ricinus and their infection with Borrelia burgdorferi sensu lato in the Northern Apennines, Italy.

    Science.gov (United States)

    Ragagli, Charlotte; Mannelli, Alessandro; Ambrogi, Cecilia; Bisanzio, Donal; Ceballos, Leonardo A; Grego, Elena; Martello, Elisa; Selmi, Marco; Tomassone, Laura

    2016-06-01

    Host-seeking ticks were collected in the Northern Apennines, Italy, by dragging at 35 sites, at altitudes ranging from 680 and 1670 m above sea level (asl), from April to November, in 2010 and 2011. Ixodes ricinus (4431 larvae, 597 nymphs and 12 adults) and Haemaphysalis punctata (11,209 larvae, 313 nymphs, and 25 adults) were the most abundant species, followed by Haemaphysalis sulcata (20 larvae, five nymphs, and 13 adults), Dermacentor marginatus (42 larvae and two adults) and Ixodes hexagonus (one nymph). Greatest numbers of ticks were collected at locations characterised by southern exposure and limestone substratum, at altitudes <1400 m asl; I. ricinus was most abundant in Turkey oak (Quercus cerris) wood, whereas H. punctata was mostly collected in hop hornbeam (Ostrya carpinifolia) wood and on exposed rocks. Ixodes ricinus was also found up to 1670 m asl, in high stand beech (Fagus sylvatica) wood. The overall prevalence of Borrelia burgdorferi sensu lato (sl) in 294 host-seeking I. ricinus nymphs was 8.5 %. Borrelia garinii was the most frequently identified genospecies (64.0 % of positive nymphs), followed by B. valaisiana, B. burgdorferi sensu stricto, B. afzelii, and B. lusitaniae. Based upon the comparison with the results of previous studies at the same location, these research findings suggest the recent invasion of the study area by the tick vector and the agents of Lyme borreliosis.

  15. [The importance of recombinant proteins of West Siberian isolates of Borrelia burgdorferi S.L. for serological diagnostic of ixodic tick borreliosis].

    Science.gov (United States)

    Karavayev, V S; Genina, E S; Ryabchenko, A V; Beklemoschev, A B

    2014-06-01

    The structural proteins OspC, FlaB, FlaA and DbpB of agent of ixodic tick borreliosis are one of main antigens inducing humoral immunity at initial stages of disease. Owing to it, the task was stated to evaluate antigen activity of recombinant proteins OspC (OscP-Bg), fragment of FlaB (f-FlaB) and DbpB of genospecies B. garinii and OspC (OscC-Ba) of genospecies of B. afzelii of West Siberian isolates of Borrelia Burgdorferi S.L. for their possible application as antigens for serological diagnostic of ixodic tick borreliosis The recombinant proteins OscP-Bg, OscC-Ba, f-FlaB, FlaA and DbpB are analyzed using technique of enzymoimmunoassay to detect ability to bound antibodies of serums of patients with ixodic tick borreliosis with localized and disseminated stage of infection. The difference of their sensitivity as antigens during detection of specific antibodies in blood serum of patients with ixodic tick borreliosis was demonstrated In serum of patients with ixodic tick borreliosis with disseminated stage of infection the level of specific IgM and IgG antibodies reacting with OscP-Bg, OscC-Ba, f-FlaB, FlaA and DbpB is within the limits 15.7-52.6% for IgG. The results of enzymoimmunoassay applied to patients with ixodic tick borreliosis for detection of IgM and IgG in serum demonstrated that OscP-Bg and f-FlaB determined the highest antigen activity with antigens. The study results make it possible to consider these proteins as perspective components for development of immune enzyme test system of diagnostic of ixodic tick borreliosis.

  16. Solanum trilobatum extract-mediated synthesis of titanium dioxide nanoparticles to control Pediculus humanus capitis, Hyalomma anatolicum anatolicum and Anopheles subpictus.

    Science.gov (United States)

    Rajakumar, Govindasamy; Rahuman, Abdul Abdul; Jayaseelan, Chidambaram; Santhoshkumar, Thirunavukkarasu; Marimuthu, Sampath; Kamaraj, Chinnaperumal; Bagavan, Asokan; Zahir, Abdul Abduz; Kirthi, Arivarasan Vishnu; Elango, Gandhi; Arora, Pooja; Karthikeyan, Rajan; Manikandan, Sivan; Jose, Sujin

    2014-02-01

    Titanium dioxide nanoparticles (TiO2 NPs) are widely used in paints, printing ink, rubber, paper, cosmetics, sunscreens, car materials, cleaning air products, industrial photocatalytic processes, and decomposing organic matters in wastewater due to their unique physical, chemical, and biological properties. The present study was conducted to assess the antiparasitic efficacies of synthesized TiO2 NPs utilizing leaf aqueous extract of Solanum trilobatum against the adult head louse, Pediculus humanus capitis De Geer (Phthiraptera: Pediculidae); larvae of cattle tick Hyalomma anatolicum (a.) anatolicum Koch (Acari: Ixodidae), and fourth instar larvae of malaria vector Anopheles subpictus Grassi (Diptera: Culicidae). The green synthesized TiO2 NPs were analyzed by X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR), Scanning electron microscopy (SEM), Energy-dispersive X-ray spectroscopy analysis (EDX), and Atomic force microscopy (AFM). XRD analysis of synthesized TiO2 NPs revealed that the particles were in the form of nanocrystals as evidenced by the major peaks at 2θ values of 27.52°, 36.21°, and 54.43° identified as 110, 101, and 211 reflections, respectively. FTIR spectra exhibited a prominent peak at 3,466 cm(-1) and showed OH stretching due to the alcoholic group, and the OH group may act as a capping agent. SEM images displayed NPs that were spherical, oval in shape, individual, and some in aggregates with an average size of 70 nm. Characterization of the synthesized TiO2 NPs using AFM offered a three-dimensional visualization and uneven surface morphology. The pediculocidal and acaricidal activities of synthesized TiO2 NPs showed the percent mortality of 31, 42, 63, 82, 100; 36, 44, 67, 89, and 100 at 2, 4, 6, 8, and 10 mg/L, respectively, against P. h. capitis and H. a. anatolicum. The average larval percent mortality of synthesized TiO2 NPs was 38, 47, 66, 79, and 100 at 1, 2, 3, 4, and 5 mg/L, respectively, against A. subpictus

  17. Outer surface protein B is critical for Borrelia burgdorferi adherence and survival within Ixodes ticks.

    Directory of Open Access Journals (Sweden)

    Girish Neelakanta

    2007-03-01

    Full Text Available Survival of Borrelia burgdorferi in ticks and mammals is facilitated, at least in part, by the selective expression of lipoproteins. Outer surface protein (Osp A participates in spirochete adherence to the tick gut. As ospB is expressed on a bicistronic operon with ospA, we have now investigated the role of OspB by generating an OspB-deficient B. burgdorferi and examining its phenotype throughout the spirochete life cycle. Similar to wild-type isolates, the OspB-deficient B. burgdorferi were able to readily infect and persist in mice. OspB-deficient B. burgdorferi were capable of migrating to the feeding ticks but had an impaired ability to adhere to the tick gut and survive within the vector. Furthermore, the OspB-deficient B. burgdorferi bound poorly to tick gut extracts. The complementation of the OspB-deficient spirochete in trans, with a wild-type copy of ospB gene, restored its ability to bind tick gut. Taken together, these data suggest that OspB has an important role within Ixodes scapularis and that B. burgdorferi relies upon multiple genes to efficiently persist in ticks.

  18. Prevalence and Diversity among Anaplasma phagocytophilum Strains Originating from Ixodes ricinus Ticks from Northwest Norway

    Directory of Open Access Journals (Sweden)

    Ann-Kristin Tveten

    2014-01-01

    Full Text Available The tick-borne pathogen Anaplasma phagocytophilum causes great concern for livestock farmers. Tick-borne fever is a widespread disease in Norway, and antibodies have been produced amongst sheep, roe deer, red deer, and moose. The main vector Ixodes ricinus is found along the Norwegian coastline as far north as the Arctic Circle. A total number of 1804 I. ricinus ticks were collected and the prevalence of the pathogen was determined by species-specific qPCR. The overall infection rate varied from 2.83% to 3.32%, but there were no significant differences (p=0.01 in the overall infection rate in 2010, 2011, or 2012. A multilocus sequencing analysis was performed to further characterise the isolates. The genotyping of 27 strains resulted in classification into 19 different sequences types (ST, none of which was found in the MLST database. The nucleotide diversity was for every locus <0.01, and the number of SNPs was between 1 and 2.8 per 100 bp. The majority of SNPs were synonymous. A goeBURST analysis demonstrated that the strains from northwest Norway cluster together with other Norwegian strains in the MLST database and the strains that are included in this study constitute clonal complexes (CC 9, 10, and 11 in addition to the singleton.

  19. Isolation and characterization of tick-borne encephalitis virus from Ixodes persulcatus in Mongolia in 2012.

    Science.gov (United States)

    Muto, Memi; Bazartseren, Boldbaatar; Tsevel, Bazartseren; Dashzevge, Erdenechimeg; Yoshii, Kentaro; Kariwa, Hiroaki

    2015-07-01

    Tick-borne encephalitis virus (TBEV) is a zoonotic virus belonging to the genus Flavivirus, in the family Flaviviridae. The virus, which is endemic in Europe and northern parts of Asia, causes severe encephalitis. Tick-borne encephalitis (TBE) has been reported in Mongolia since the 1980s, but details about the biological characteristics of the endemic virus are lacking. In this study, 680 ticks (Ixodes persulcatus) were collected in Selenge aimag, northern Mongolia, in 2012. Nine Mongolian TBEV strains were isolated from tick homogenates. A sequence analysis of the envelope protein gene revealed that all isolates belonged to the Siberian subtype of TBEV. Two strains showed similar growth properties in cultured cells, but their virulence in mice differed. Whole genome sequencing revealed only thirteen amino acid differences between these Mongolian TBEV strains. Our results suggest that these naturally occurring amino acid mutations affected the pathogenicity of Mongolian TBEV. Our results may be an important platform for monitoring TBEV to evaluate the epidemiological risk in TBE endemic areas of Mongolia.

  20. Influences of weather on Ixodes scapularis nymphal densities at long-term study sites in Connecticut.

    Science.gov (United States)

    Hayes, Laura E; Scott, Jennifer A; Stafford, Kirby C

    2015-04-01

    Tick species worldwide are implicated in transmission of pathogens that cause mild to severe diseases in humans and livestock. Although tick population densities are often highly correlated with tick-borne disease rates, we currently know little about which factors underlie annual changes in those tick population densities. We used a 25-year dataset of Ixodes scapularis drag-sampling surveys at two locations in CT, USA, to investigate the relationship between average nymphal density from mid-May to mid-August and monthly, lagged regional weather variables. The dataset was randomly split into two data subsets, one for hypothesis development and one for hypothesis testing. Nymphal density showed the strongest association with the Standardized Precipitation Index for January of the same year that density data were collected in the analysis based on the hypothesis development data subset. This association was positive; nymphal tick density increased with regional winter precipitation. Nymphal density was positively associated with this same weather variable in the hypothesis testing data subset. Weather conditions during the coldest months of the year may serve as a bottleneck to tick populations, thereby functioning as an important correlate of not only annual blacklegged tick nymphal densities the following summer, but also entomological risk associated with tick-borne pathogens transmitted by this species. Copyright © 2015 Elsevier GmbH. All rights reserved.

  1. Ixodes scapularis saliva mitigates inflammatory cytokine secretion during Anaplasma phagocytophilum stimulation of immune cells

    Directory of Open Access Journals (Sweden)

    Chen Gang

    2012-10-01

    Full Text Available Abstract Background Ixodes scapularis saliva enables the transmission of infectious agents to the mammalian host due to its immunomodulatory, anesthetic and anti-coagulant properties. However, how I. scapularis saliva influences host cytokine secretion in the presence of the obligate intracellular rickettsial pathogen Anaplasma phagocytophilum remains elusive. Methods Bone marrow derived macrophages (BMDMs were stimulated with pathogen associated molecular patterns (PAMPs and A. phagocytophilum. Cytokine secretion was measured in the presence and absence of I. scapularis saliva. Human peripheral blood mononuclear cells (PBMCs were also stimulated with Tumor Necrosis Factor (TNF-α in the presence and absence of I. scapularis saliva and interleukin (IL-8 was measured. Results I. scapularis saliva inhibits inflammatory cytokine secretion by macrophages during stimulation of Toll-like (TLR and Nod-like receptor (NLR signaling pathways. The effect of I. scapularis saliva on immune cells is not restricted to murine macrophages because decreasing levels of interleukin (IL-8 were observed after TNF-α stimulation of human peripheral blood mononuclear cells. I. scapularis saliva also mitigates pro-inflammatory cytokine response by murine macrophages during challenge with A. phagocytophilum. Conclusions These findings suggest that I. scapularis may inhibit inflammatory cytokine secretion during rickettsial transmission at the vector-host interface.

  2. Coexistence of emerging bacterial pathogens in Ixodes ricinus ticks in Serbia*

    Directory of Open Access Journals (Sweden)

    Tomanović S.

    2010-09-01

    Full Text Available The list of tick-borne pathogens is long, varied and includes viruses, bacteria, protozoa and nematodes. As all of these agents can exist in ticks, their co-infections have been previously reported. We studied co-infections of emerging bacterial pathogens (Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum and Francisella tularensis in Ixodes ricinus ticks in Serbia. Using PCR technique, we detected species-specific sequences, rrf-rrl rDNA intergenic spacer for B. burgdorferi s.l., p44/msp2 paralogs for A. phagocytophilum, and the 17 kDa lipoprotein gene, TUL4, for F. tularensis, respectively, in total DNA extracted from the ticks. Common infections with more than one pathogen were detected in 42 (28.8 % of 146 infected I. ricinus ticks. Co-infections with two pathogens were present in 39 (26.7 % of infected ticks. Simultaneous presence of A. phagocytophilum and different genospecies of B. burgdorferi s.l. complex was recorded in 16 ticks, co-infection with different B. burgdorferi s. l. genospecies was found in 15 ticks and eight ticks harbored mixed infections with F. tularensis and B. burgdorferi s.l. genospecies. Less common were triple pathogen species infections, detected in three ticks, one infected with A. phagocytophilum / B. burgdorferi s.s. / B. lusitaniae and two infected with F. tularensis / B. burgdorferi s.s. / B. lusitaniae. No mixed infections of A. phagocytophilum and F. tularensis were detected.

  3. Detection of Babesia venatorum, Anaplasma phagocytophilum and Candidatus Neoehrlichia mikurensis in Ixodes persulcatus ticks from Mongolia.

    Science.gov (United States)

    Karnath, Carolin; Obiegala, Anna; Speck, Stephanie; Essbauer, Sandra; Derschum, Henri; Scholz, Holger; Kiefer, Daniel; Tserennorov, Damdindorj; Dashdavaa, Otgonbataar; Tsogbadrakh, Nyamdorj; Jigjav, Battsetseg; Pfeffer, Martin

    2016-03-01

    Information about the prevalence and geographical distribution of tick-borne pathogens Anaplasma phagocytophilum, Candidatus Neoehrlichia mikurensis, and Babesia spp. is still rare in Mongolia. We tested 275 Ixodes persulcatus ticks for A. phagocytophilum, Cand. N. mikurensis and Babesia spp. and 125 Dermacentor nuttalli ticks especially for Babesia spp. using different PCR methods. Ticks were collected from three provinces (Selenge, Arkhangai, Khentii) in Mongolia. DNA of A. phagocytophilum, Cand. N. mikurensis and Babesia spp. were found with a prevalence of 6.2%, 1.5% and 3.3% in each case in I. persulcatus ticks. This is the first time Cand. N. mikurensis was found in ticks from Mongolia. Sequence analysis of Babesia spp.-positive amplicons showed exclusively B. venatorum, which had also not been mentioned in Mongolia before. On the contrary, all D. nuttalli ticks tested negatively for Babesia spp. This study demonstrates that all three zoonotic pathogens are present in I. persulcatus ticks in Mongolia, and justify the need for further investigations of a more detailed genetic characterization of these pathogens.

  4. Lyme disease and the detection of Borrelia burgdorferi genospecies in Ixodes ricinus ticks from central Italy

    Directory of Open Access Journals (Sweden)

    Ilaria Pascucci

    2010-06-01

    Full Text Available The Province of Pesaro-Urbino, situated in the Marche Region of central Italy, can be considered to be an area at risk for Lyme disease because of its ecological features. Field data are not yet available although the disease is known to be present in neighbouring areas. During a field study lasting twelve months, ticks were collected from the vegetation, from wild cervids and also from humans who reported a tick bite at the local hospital. All ticks were identified and Ixodes ricinus specimens were tested using three different polymerase chain reaction tests for the detection of Borrelia burgdorferi sensu lato (sl. To identify the genospecies of B. burgdorferi sl, a fragment of the 5S-23S ribosomal rRNA intergenic spacer of the positive samples was amplified and then sequenced. Sequencing of the 5S-23S intergenic spacer led to the identification of two different genospecies, namely: B. burgdorferi sensu stricto and B. lusitaniae, both of which are involved in cases of human infection. Findings on the host-tick relationships and on the genospecies involved in the cycle of borreliosis confirm the suitable conditions for Lyme disease in the study area. The results concur with previous findings reported in the Mediterranean region.

  5. 'Candidatus Midichloria mitochondrii', an endosymbiont of the tick Ixodes ricinus with a unique intramitochondrial lifestyle.

    Science.gov (United States)

    Sassera, Davide; Beninati, Tiziana; Bandi, Claudio; Bouman, Edwin A P; Sacchi, Luciano; Fabbi, Massimo; Lo, Nathan

    2006-11-01

    An intracellular bacterium with the unique ability to enter mitochondria exists in the European vector of Lyme disease, the hard tick Ixodes ricinus. Previous phylogenetic analyses based on 16S rRNA gene sequences suggested that the bacterium formed a divergent lineage within the Rickettsiales (Alphaproteobacteria). Here, we present additional phylogenetic evidence, based on the gyrB gene sequence, that confirms the phylogenetic position of the bacterium. Based on these data, as well as electron microscopy (EM), in situ hybridization and other observations, we propose the name 'Candidatus Midichloria mitochondrii' for this bacterium. The symbiont appears to be ubiquitous in females of I. ricinus across the tick's distribution, while lower prevalence is observed in males (44%). Based on EM and in situ hybridization studies, the presence of 'Candidatus M. mitochondrii' in females appears to be restricted to ovarian cells. The bacterium was found to be localized both in the cytoplasm and in the intermembrane space of the mitochondria of ovarian cells. 'Candidatus M. mitochondrii' is the first bacterium to be identified that resides within animal mitochondria.

  6. Low prevalence of Borrelia bavariensis in Ixodes ricinus ticks in southeastern Austria.

    Science.gov (United States)

    Glatz, Martin; Muellegger, Robert R; Hizo-Teufel, Cecilia; Fingerle, Volker

    2014-10-01

    Borrelia bavariensis was recently described as a distinct genospecies among the B. burgdorferi sensu lato complex. The prevalence of B. bavariensis in Austria, a highly endemic area for tick-transmitted pathogens, is scarcely characterized. To investigate the prevalence of B. bavariensis in Ixodes ricinus ticks we reevaluated the results of a study conducted in 518 ticks from southeastern Austria collected in 2002 and 2003. The presence of B. burgdorferi s.l.-specific DNA in ticks was analyzed by a PCR for the outer surface protein A (ospA) gene. Borrelia species were differentiated by restriction fragment length polymorphism (RFLP) analysis, and samples positive for B. bavariensis were further analyzed by multilocus sequence analysis. Two of 133 (1.5%) B. burgdorferi s.l.-positive I. ricinus ticks were infected with B. bavariensis. Both specimens were coinfected with the OspA serotype 5 of B. garinii. Borrelia bavariensis is present; however, seem to be rare in I. ricinus ticks in southeastern Austria.

  7. Substrate prediction of Ixodes ricinus salivary lipocalins differentially expressed during Borrelia afzelii infection

    Science.gov (United States)

    Valdés, James J.; Cabezas-Cruz, Alejandro; Sima, Radek; Butterill, Philip T.; Růžek, Daniel; Nuttall, Patricia A.

    2016-09-01

    Evolution has provided ticks with an arsenal of bioactive saliva molecules that counteract host defense mechanisms. This salivary pharmacopoeia enables blood-feeding while enabling pathogen transmission. High-throughput sequencing of tick salivary glands has thus become a major focus, revealing large expansion within protein encoding gene families. Among these are lipocalins, ubiquitous barrel-shaped proteins that sequester small, typically hydrophobic molecules. This study was initiated by mining the Ixodes ricinus salivary gland transcriptome for specific, uncharacterized lipocalins: three were identified. Differential expression of these I. ricinus lipocalins during feeding at distinct developmental stages and in response to Borrelia afzelii infection suggests a role in transmission of this Lyme disease spirochete. A phylogenetic analysis using 803 sequences places the three I. ricinus lipocalins with tick lipocalins that sequester monoamines, leukotrienes and fatty acids. Both structural analysis and biophysical simulations generated robust predictions showing these I. ricinus lipocalins have the potential to bind monoamines similar to other tick species previously reported. The multidisciplinary approach employed in this study characterized unique lipocalins that play a role in tick blood-feeding and transmission of the most important tick-borne pathogen in North America and Eurasia.

  8. Habitat Suitability Model for the Distribution of Ixodes scapularis (Acari: Ixodidae) in Minnesota.

    Science.gov (United States)

    Johnson, T L; Bjork, J K H; Neitzel, D F; Dorr, F M; Schiffman, E K; Eisen, R J

    2016-05-01

    Ixodes scapularis Say, the black-legged tick, is the primary vector in the eastern United States of several pathogens causing human diseases including Lyme disease, anaplasmosis, and babesiosis. Over the past two decades, I. scapularis-borne diseases have increased in incidence as well as geographic distribution. Lyme disease exists in two major foci in the United States, one encompassing northeastern states and the other in the Upper Midwest. Minnesota represents a state with an appreciable increase in counties reporting I. scapularis-borne illnesses, suggesting geographic expansion of vector populations in recent years. Recent tick distribution records support this assumption. Here, we used those records to create a fine resolution, subcounty-level distribution model for I. scapularis using variable response curves in addition to tests of variable importance. The model identified 19% of Minnesota as potentially suitable for establishment of the tick and indicated with high accuracy (AUC = 0.863) that the distribution is driven by land cover type, summer precipitation, maximum summer temperatures, and annual temperature variation. We provide updated records of established populations near the northwestern species range limit and present a model that increases our understanding of the potential distribution of I. scapularis in Minnesota.

  9. Identification and characterization of antimicrobial peptide, defensin, in the taiga tick, Ixodes persulcatus.

    Science.gov (United States)

    Saito, Y; Konnai, S; Yamada, S; Imamura, S; Nishikado, H; Ito, T; Onuma, M; Ohashi, K

    2009-08-01

    Ixodes persulcatus is the primary vector for human tick-borne diseases in Japan. A cDNA library was constructed from whole body homogenates of fed nymphs of I. persulcatus. From this library, one cDNA encoding defensin-like antimicrobial peptide was identified. The amino-acid sequence showed high similarity to those of the defensins of other ticks and arthropods. I. persulcatus defensin mRNA transcripts were detected at all life cycle stages of fed ticks and found to be predominantly expressed in the midguts of adult female ticks, but not in the salivary glands, a finding corroborated by Western blotting analysis. To investigate the function of I. persulcatus defensin, we examined its antibacterial activity by evaluation of growth of several bacterial strains in the presence of the synthetic peptide. The defensin from I. persulcatus markedly inhibited the growth of Gram-positive bacteria including Staphylococcus aureus, Bacillus subtilis and Corynebacterium renale, but not Gram-negative bacteria except Escherichia coli O157. In conclusion, these results suggest that I. persulcatus defensin may be playing a significant role in the defence against microbes from bloodmeals.

  10. Ixodes persulcatus Ticks as Vectors for the Babesia microti U.S. Lineage in Japan.

    Science.gov (United States)

    Zamoto-Niikura, Aya; Morikawa, Shigeru; Hanaki, Ken-Ichi; Holman, Patricia J; Ishihara, Chiaki

    2016-11-15

    The U.S. lineage, one of the major clades in the Babesia microti group, is known as a causal agent of human babesiosis mostly in the northeastern and upper midwestern United States. This lineage, however, also is distributed throughout the temperate zone of Eurasia with several reported human cases, although convincing evidence of the identity of the specific vector(s) in this area is lacking. Here, the goal was to demonstrate the presence of infectious parasites directly in salivary glands of Ixodes persulcatus, from which U.S. lineage genetic sequences have been detected in Asia, and to molecularly characterize the isolates. Five PCR-positive specimens were individually inoculated into hamsters, resulting in infections in four; consequently, four strains were newly established. Molecular characterization, including 18S rRNA, β-tubulin, and CCT7 gene sequences, as well as Western blot analysis and indirect fluorescent antibody assay, revealed that all four strains were identical to each other and to the U.S. lineage strains isolated from rodents captured in Japan. The 18S rRNA gene sequence from the isolates was identical to those from I. persulcatus in Russia and China, but the genetic and antigenic profiles of the Japanese parasites differ from those in the United States and Europe. Together with previous epidemiological and transmission studies, we conclude that I. persulcatus is likely the principal vector for the B. microti U.S. lineage in Japan and presumably in northeastern Eurasia.

  11. Bunyaviruses are common in male and female Ixodes scapularis ticks in central Pennsylvania

    Directory of Open Access Journals (Sweden)

    Joyce M. Sakamoto

    2016-08-01

    Full Text Available The blacklegged tick Ixodes scapularis is widely distributed in the United States and transmits multiple pathogens to humans, wildlife and domestic animals. Recently, several novel viruses in the family Bunyaviridae (South Bay virus (SBV and Blacklegged tick phlebovirus (BTPV were identified infecting female I. scapularis ticks collected in New York State. We used metagenomic sequencing to investigate the distribution of viruses infecting male and female I. scapularis ticks collected in Centre County, Pennsylvania. We identified both SBV and BTPV in both male and female ticks from all collection locations. The role of male I. scapularis in pathogen epidemiology has been overlooked because they rarely bite and are not considered important pathogen vectors. However, males may act as reservoirs for pathogens that can then be transmitted to females during mating. Our data highlight the importance of examining all potential avenues of pathogen maintenance and transmission throughout the vector-pathogen life cycle in order to understand the epidemiology of tick-borne pathogens.

  12. Highly variable acquisition rates of Ixodes scapularis (Acari: Ixodidae) by birds on an Atlantic barrier island.

    Science.gov (United States)

    Mitra, S S; Buckley, P A; Buckley, F G; Ginsberg, H S

    2010-11-01

    Acquisition of ticks by bird hosts is a central process in the transmission cycles of many tick-borne zoonoses, but tick recruitment by birds has received little direct study. We documented acquisition of Ixodes scapularis Say on birds at Fire Island, NY, by removing ticks from mist-netted birds, and recording the number of ticks on birds recaptured within 4 d of release. Eight bird species acquired at least 0.8 ticks bird(-1) day(-1) during the seasonal peak for at least one age class of I. scapularis. Gray Catbirds, Eastern Towhees, Common Yellowthroats, and Northern Waterthrushes collectively accounted for 83% of all tick acquisitions; and six individuals apportioned among Black-billed Cuckoo, Gray Catbird, Eastern Towhee, and Common Yellowthroat were simultaneously infested with both larvae and nymphs. Bird species with the highest acquisition rates were generally ground foragers, whereas birds that did not acquire ticks in our samples generally foraged above the ground. Tick acquisition by birds did not differ between deciduous and coniferous forests. Among the 15 bird species with the highest recruitment rates, acquisition of nymphs was not correlated with acquisition of larvae. Tick acquisition rates by individual bird species were not correlated with the reservoir competence of those species for Lyme borreliae. However, birds with high tick acquisition rates can contribute large numbers of infected ticks, and thus help maintain the enzootic cycle, even if their levels of reservoir competence are relatively low.

  13. A novel Rickettsia species detected in Vole Ticks (Ixodes angustus) from Western Canada.

    Science.gov (United States)

    Anstead, Clare A; Chilton, Neil B

    2013-12-01

    The genomic DNA of ixodid ticks from western Canada was tested by PCR for the presence of Rickettsia. No rickettsiae were detected in Ixodes sculptus, whereas 18% of the I. angustus and 42% of the Dermacentor andersoni organisms examined were PCR positive for Rickettsia. The rickettsiae from each tick species were characterized genetically using multiple genes. Rickettsiae within the D. andersoni organisms had sequences at four genes that matched those of R. peacockii. In contrast, the Rickettsia present within the larvae, nymphs, and adults of I. angustus had novel DNA sequences at four of the genes characterized compared to the sequences available from GenBank for all recognized species of Rickettsia and all other putative species within the genus. Phylogenetic analyses of the sequence data revealed that the rickettsiae in I. angustus do not belong to the spotted fever, transitional, or typhus groups of rickettsiae but are most closely related to "Candidatus Rickettsia kingi" and belong to a clade that also includes R. canadensis, "Candidatus Rickettsia tarasevichiae," and "Candidatus Rickettsia monteiroi."

  14. Molecular characterization of 'Candidatus Rickettsia vini' in Ixodes arboricola from the Czech Republic and Slovakia.

    Science.gov (United States)

    Novakova, Marketa; Bulkova, Alexandra; Costa, Francisco B; Kristin, Anton; Krist, Milos; Krause, Frantisek; Liznarova, Eva; Labruna, Marcelo B; Literak, Ivan

    2015-04-01

    The aim of this study was to analyze the prevalence of rickettsiae in the tree-hole tick Ixodes arboricola in the Czech Republic and Slovakia. During May to September of 2009 and 2013, bird boxes belonging to three different areas were screened for ticks. In total, 454 nestlings and 109 nests of 10 hole-breeding bird species were examined. Ticks were found on Ficedula albicollis, Parus major, Cyanistes caeruleus and Sitta europaea and/or in their nests. In total, 166 ticks (17 nymphs, 10 males and 139 females) were found at 3 areas (arithmetic mean±standard error: 55.3±45.9). All ticks were tested for the presence of Rickettsia species by polymerase chain reaction targeting the rickettsial genes gltA, ompA, ompB and htrA and amplicon sequencing. All individuals except 3 nymphs were infected with 'Candidatus Rickettsia vini'. Multilocus sequence typing showed closest proximity to Rickettsia japonica and Rickettsia heilongjiangensis cluster. The presence of 'Ca. R. vini' is reported for the first time in Slovakia.

  15. From Chemistry to Behavior. Molecular Structure and Bioactivity of Repellents against Ixodes ricinus Ticks.

    Directory of Open Access Journals (Sweden)

    Simone Del Fabbro

    Full Text Available Tick-borne zoonoses are considered as emerging diseases. Tick repellents represent an effective tool for reducing the risk of tick bite and pathogens transmission. Previous work demonstrated the repellent activity of the phenylpropanoid eugenol against Ixodes ricinus; here we investigate the relationship between molecular structure and repellency in a group of substances related to that compound. We report the biological activity of 18 compounds varying for the presence/number of several moieties, including hydroxyl and methoxy groups and carbon side-chain. Each compound was tested at different doses with a bioassay designed to measure repellency against individual tick nymphs. Both vapor pressure and chemical features of the tested compounds appeared to be related to repellency. In particular, the hydroxyl and methoxy groups as well as the side-chain on the benzene ring seem to play a role. These results are discussed in light of available data on chemical perception in ticks. In the course of the study new repellent compounds were identified; the biological activity of some of them (at least as effective as the "gold standard" repellent DEET appears to be very promising from a practical point of view.

  16. Impact of Spring Bird Migration on the Range Expansion of Ixodes scapularis Tick Population.

    Science.gov (United States)

    Wu, Xiaotian; Röst, Gergely; Zou, Xingfu

    2016-01-01

    Many observational studies suggest that seasonal migratory birds play an important role in spreading Ixodes scapularis, a vector of Lyme disease, along their migratory flyways, and they are believed to be responsible for geographic range expansion of I. scapularis in Canada. However, the interplay between the dynamics of I. scapularis on land and migratory birds in the air is not well understood. In this study, we develop a periodic delay meta-population model which takes into consideration the local landscape for tick reproduction within patches and the times needed for ticks to be transported by birds between patches. Assuming that the tick population is endemic in the source region, we find that bird migration may boost an already established tick population at the subsequent region and thus increase the risk to humans, or bird migration may help ticks to establish in a region where the local landscape is not appropriate for ticks to survive in the absence of bird migration, imposing risks to public health. This theoretical study reveals that bird migration plays an important role in the geographic range expansion of I. scapularis, and therefore our findings may suggest some strategies for Lyme disease prevention and control.

  17. Functional characterization of two defensin isoforms of the hard tick Ixodes ricinus

    Directory of Open Access Journals (Sweden)

    Růžek Daniel

    2011-04-01

    Full Text Available Abstract Background The immune system of ticks is stimulated to produce many pharmacologically active molecules during feeding and especially during pathogen invasion. The family of cationic peptides - defensins - represents a specific group of antimicrobial compounds with six conserved cysteine residues in a molecule. Results Two isoforms of the defensin gene (def1 and def2 were identified in the European tick Ixodes ricinus. Expression of both genes was induced in different tick organs by a blood feeding or pathogen injection. We have tested the ability of synthetic peptides def1 and def2 to inhibit the growth or directly kill several pathogens. The antimicrobial activities (expressed as minimal inhibition concentration and minimal bactericidal concentration values against Gram positive bacteria were confirmed, while Gram negative bacteria, yeast, Tick Borne Encephalitis and West Nile Viruses were shown to be insensitive. In addition to antimicrobial activities, the hemolysis effect of def1 and def2 on human erythrocytes was also established. Conclusions Although there is nothing known about the realistic concentration of defensins in I. ricinus tick body, these results suggest that defensins play an important role in defence against different pathogens. Moreover this is a first report of a one amino acid substitution in a defensins molecule and its impact on antimicrobial activity.

  18. Chlamydia-Like Organisms (CLOs in Finnish Ixodes ricinus Ticks and Human Skin

    Directory of Open Access Journals (Sweden)

    Kati Hokynar

    2016-08-01

    Full Text Available Ticks carry several human pathogenic microbes including Borreliae and Flavivirus causing tick-born encephalitis. Ticks can also carry DNA of Chlamydia-like organisms (CLOs. The purpose of this study was to investigate the occurrence of CLOs in ticks and skin biopsies taken from individuals with suspected tick bite. DNA from CLOs was detected by pan-Chlamydiales-PCR in 40% of adult ticks from southwestern Finland. The estimated minimal infection rate for nymphs and larvae (studied in pools was 6% and 2%, respectively. For the first time, we show CLO DNA also in human skin as 68% of all skin biopsies studied contained CLO DNA as determined through pan-Chlamydiales-PCR. Sequence analyses based on the 16S rRNA gene fragment indicated that the sequences detected in ticks were heterogeneous, representing various CLO families; whereas the majority of the sequences from human skin remained “unclassified Chlamydiales” and might represent a new family-level lineage. CLO sequences detected in four skin biopsies were most closely related to “uncultured Chlamydial bacterium clones from Ixodes ricinus ticks” and two of them were very similar to CLO sequences from Finnish ticks. These results suggest that CLO DNA is present in human skin; ticks carry CLOs and could potentially transmit CLOs to humans.

  19. Woodland type and spatial distribution of nymphal Ixodes scapularis (Acari: Ixodidae)

    Science.gov (United States)

    Ginsberg, Howard S.; Zhioua, Elyes; Mitra, Shaibal; Fischer, Jason L.; Buckley, P.A.; Verret, Frank; Underwood, H. Brian; Buckley, Francine G.

    2004-01-01

    Spatial distribution patterns of black-legged ticks, Ixodes scapularis, in deciduous and coniferous woodlands were studied by sampling ticks in different woodland types and at sites from which deer had been excluded and by quantifying movement patterns of tick host animals (mammals and birds) at the Lighthouse Tract, Fire Island, NY, from 1994 to 2000. Densities of nymphal ticks were greater in deciduous than coniferous woods in 3 of 7 yr. Only engorged ticks survived the winter, and overwintering survival of engorged larvae in experimental enclosures did not differ between deciduous and coniferous woods. Nymphs were not always most abundant in the same forest type as they had been as larvae, and the habitat shift between life stages differed in direction in different years. Therefore, forest type by itself did not account for tick distribution patterns. Nymphal densities were lower where deer had been excluded compared with areas with deer present for 3 yr after exclusion, suggesting that movement patterns of vertebrate hosts influenced tick distribution, but nymphal densities increased dramatically in one of the enclosures in the fourth year. Therefore, movements of ticks on animal hosts apparently contribute substantially to tick spatial distribution among woodland types, but the factor(s) that determine spatial distribution of nymphal I. scapularis shift from year to year.

  20. Prevalence of pathogenic bacteria in Ixodes ricinus ticks in Central Bohemia.

    Science.gov (United States)

    Klubal, Radek; Kopecky, Jan; Nesvorna, Marta; Sparagano, Olivier A E; Thomayerova, Jana; Hubert, Jan

    2016-01-01

    Bacteria associated with the tick Ixodes ricinus were assessed in specimens unattached or attached to the skin of cats, dogs and humans, collected in the Czech Republic. The bacteria were detected by PCR in 97 of 142 pooled samples including 204 ticks, i.e. 1-7 ticks per sample, collected at the same time from one host. A fragment of the bacterial 16S rRNA gene was amplified, cloned and sequenced from 32 randomly selected samples. The most frequent sequences were those related to Candidatus Midichloria midichlori (71% of cloned sequences), followed by Diplorickettsia (13%), Spiroplasma (3%), Rickettsia (3%), Pasteurella (3%), Morganella (3%), Pseudomonas (2%), Bacillus (1%), Methylobacterium (1%) and Phyllobacterium (1%). The phylogenetic analysis of Spiroplasma 16S rRNA gene sequences showed two groups related to Spiroplasma eriocheiris and Spiroplasma melliferum, respectively. Using group-specific primers, the following potentially pathogenic bacteria were detected: Borellia (in 20% of the 142 samples), Rickettsia (12%), Spiroplasma (5%), Diplorickettsia (5%) and Anaplasma (2%). In total, 68% of I. ricinus samples (97/142) contained detectable bacteria and 13% contained two or more putative pathogenic groups. The prevalence of tick-borne bacteria was similar to the observations in other European countries.

  1. Isolation of entomopathogenic fungi from soils and Ixodes scapularis (Acari: Ixodidae) ticks: prevalence and methods.

    Science.gov (United States)

    Tuininga, Amy R; Miller, Jessica L; Morath, Shannon U; Daniels, Thomas J; Falco, Richard C; Marchese, Michael; Sahabi, Sadia; Rosa, Dieshia; Stafford, Kirby C

    2009-05-01

    Entomopathogenic fungi are commonly found in forested soils that provide tick habitat, and many species are pathogenic to Ixodes scapularis Say, the blacklegged tick. As a first step to developing effective biocontrol strategies, the objective of this study was to determine the best methods to isolate entomopathogenic fungal species from field-collected samples of soils and ticks from an Eastern deciduous forest where I. scapularis is common. Several methods were assessed: (1) soils, leaf litter, and ticks were plated on two types of media; (2) soils were assayed for entomopathogenic fungi using the Galleria bait method; (3) DNA from internal transcribed spacer (ITS) regions of the nuclear ribosomal repeat was extracted from pure cultures obtained from soils, Galleria, and ticks and was amplified and sequenced; and (4) DNA was extracted directly from ticks, amplified, and sequenced. We conclude that (1) ticks encounter potentially entomopathogenic fungi more often in soil than in leaf litter, (2) many species of potentially entomopathogenic fungi found in the soil can readily be cultured, (3) the Galleria bait method is a sufficiently efficient method for isolation of these fungi from soils, and (4) although DNA extraction from ticks was not possible in this study because of small sample size, DNA extraction from fungi isolated from soils and from ticks was successful and provided clean sequences in 100 and 73% of samples, respectively. A combination of the above methods is clearly necessary for optimal characterization of entomopathogenic fungi associated with ticks in the environment.

  2. Antibodies of patients with Lyme disease to components of the Ixodes dammini spirochete.

    Science.gov (United States)

    Barbour, A G; Burgdorfer, W; Grunwaldt, E; Steere, A C

    1983-01-01

    Lyme disease is an inflammatory disorder of skin, joints, nervous system, and heart. The disease is associated with a preceding tick bite and is ameliorated by penicillin treatment. A spirochete (IDS) isolated from Ixodes dammini ticks has been implicated as the etiologic agent of Lyme disease. We examined the antibody responses of Lyme disease patients to IDS lysate components in order to further understand the pathogenesis of this disease. The components were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred to nitrocellulose, reacted with patients' sera, and the bound IgG was detected with 125I-labeled protein A (western blot). We found that (a) Lyme disease patients had antibodies to IDS components (b) most patients studied had antibodies to two components with apparent subunit molecular weights of 41,000 and 60,000, and (c) the patients' antibody responses during illness and remission were specific, for the most part, for the IDS. In contrast to the findings with Lyme disease sera, sera from controls showed little reactivity with IDS components in either the western blots or a derivative solid-phase radioimmunoassay. Images FIGURE 1 FIGURE 2 FIGURE 3 FIGURE 4 FIGURE 5 PMID:6348092

  3. Fourier transform infrared spectroscopy of DNA from Borrelia burgdorferi sensu lato and Ixodes ricinus ticks

    Science.gov (United States)

    Muntean, Cristina M.; Stefan, Razvan; Bindea, Maria; Cozma, Vasile

    2013-06-01

    In this work we present a method for detection of motile and immotile Borrelia burgdorferi genomic DNA, in relation with infectious and noninfectious spirochetes. An FT-IR study of DNA isolated from B. burgdorferi sensu lato strains and from positive and negative Ixodes ricinus ticks, respectively, is reported. Motile bacterial cells from the species B. burgdorferi sensu stricto, Borrelia garinii and Borrelia afzelii were of interest. Also, FT-IR absorbance spectra of DNA from immotile spirochetes of B. burgdorferi sensu stricto, in the absence and presence of different antibiotics (doxycycline, erythromycin, gentamicin, penicillin V or phenoxymethylpenicillin, tetracycline, respectively) were investigated. FT-IR spectra, providing a high molecular structural information, have been analyzed in the wavenumber range 400-1800 cm-1. FT-IR signatures, spectroscopic band assignments and structural interpretations of these DNAs are reported. Spectral differences between FT-IR absorbances of DNAs from motile bacterial cells and immotile spirochetes, respectively, have been found. Particularly, alterations of the sugar-phosphate B-form chain in the case of DNA from Borrelia immotile cells, as compared with DNA from B. burgdorferi sensu lato motile cells have been observed. Based on this work, specific B. burgdorferi sensu lato and I. ricinus DNA-ligand interactions, respectively, might be further investigated using Fourier transform infrared spectroscopy.

  4. Vector competence of the tick Ixodes ricinus for transmission of Bartonella birtlesii.

    Directory of Open Access Journals (Sweden)

    Caroline Reis

    Full Text Available Bartonella spp. are facultative intracellular vector-borne bacteria associated with several emerging diseases in humans and animals all over the world. The potential for involvement of ticks in transmission of Bartonella spp. has been heartily debated for many years. However, most of the data supporting bartonellae transmission by ticks come from molecular and serological epidemiological surveys in humans and animals providing only indirect evidences without a direct proof of tick vector competence for transmission of bartonellae. We used a murine model to assess the vector competence of Ixodes ricinus for Bartonella birtlesii. Larval and nymphal I. ricinus were fed on a B. birtlesii-infected mouse. The nymphs successfully transmitted B. birtlesii to naïve mice as bacteria were recovered from both the mouse blood and liver at seven and 16 days after tick bites. The female adults successfully emitted the bacteria into uninfected blood after three or more days of tick attachment, when fed via membrane feeding system. Histochemical staining showed the presence of bacteria in salivary glands and muscle tissues of partially engorged adult ticks, which had molted from the infected nymphs. These results confirm the vector competence of I. ricinus for B. birtlesii and represent the first in vivo demonstration of a Bartonella sp. transmission by ticks. Consequently, bartonelloses should be now included in the differential diagnosis for patients exposed to tick bites.

  5. Biological control of Ixodes ricinus larvae and nymphs with Metarhizium anisopliae blastospores.

    Science.gov (United States)

    Wassermann, Marion; Selzer, Philipp; Steidle, Johannes L M; Mackenstedt, Ute

    2016-07-01

    The entomopathogenic fungus Metarhizium anisopliae is used as a biological pest control agent against various arthropod species, including ticks. However, the efficacy depends on tick species, tick stage and fungus strain. We studied the effect of M. anisopliae on engorged larvae and nymphs of Ixodes ricinus, the most abundant tick species in Europe, under laboratory and semi-field conditions. A significant reduction of engorged larvae and nymphs could be shown under laboratory as well as under semi-field conditions. Only 3.5% of the larvae treated in the lab and only 18.5% kept under semi-field conditions were able to develop into nymphs compared to the recovered nymphs of the control groups, which were regarded as 100%. Only 7.1% of nymphs were recovered as adult ticks after fungal treatment under semi-field conditions compared to the control (100%). The efficacy of blastospores of M. anisopliae against engorged larvae and nymphs of I. ricinus under semi-field conditions was demonstrated in this study, showing their high potential as a biological control agent of ticks. Further studies will have to investigate the effect of this agent against other stages of I. ricinus as well as other tick species before its value as a biological control agent against ticks can be fully assessed.

  6. The Genus Ixodes (Acari: Ixodidae) in Mexico: Adult Identification Keys, Diagnoses, Hosts, and Distribution (El genero Ixodes (Acari: Ixodidae) en Mexico: claves de identificacion para adultos, diagnosis, huespedes y distribucion)

    Science.gov (United States)

    2010-01-01

    de Historia Natural 23:191-307. Hoffmann, A. 1969. Un caso de parálisis por picadura de garrapata. Revista Latinoamericana de Microbiología y...Hopkins University Press, Baltimore. p. 894-1531. Nuttall, G. H. F. 1916. Notes on ticks. IV. Relating to the genus Ixodes and including a description of...Ixodidae. Cambridge at the University Press, London. p. i-xix, 105-348. Robbins, R. G. and J. E. Keirans. 1992. Systematics and ecology of the

  7. Prevalence and Diversity of Tick-Borne Pathogens in Nymphal Ixodes scapularis (Acari: Ixodidae) in Eastern National Parks.

    Science.gov (United States)

    Johnson, Tammi L; Graham, Christine B; Boegler, Karen A; Cherry, Cara C; Maes, Sarah E; Pilgard, Mark A; Hojgaard, Andrias; Buttke, Danielle E; Eisen, Rebecca J

    2016-12-27

    Tick-borne pathogens transmitted by Ixodes scapularis Say (Acari: Ixodidae), also known as the deer tick or blacklegged tick, are increasing in incidence and geographic distribution in the United States. We examined the risk of tick-borne disease exposure in 9 national parks across six Northeastern and Mid-Atlantic States and the District of Columbia in 2014 and 2015. To assess the recreational risk to park visitors, we sampled for ticks along frequently used trails and calculated the density of I. scapularis nymphs (DON) and the density of infected nymphs (DIN). We determined the nymphal infection prevalence of I. scapularis with a suite of tick-borne pathogens including Borrelia burgdorferi, Borrelia miyamotoi, Anaplasma phagocytophilum, and Babesia microti Ixodes scapularis nymphs were found in all national park units; DON ranged from 0.40 to 13.73 nymphs per 100 m(2) Borrelia burgdorferi, the causative agent of Lyme disease, was found at all sites where I. scapularis was documented; DIN with B. burgdorferi ranged from 0.06 to 5.71 nymphs per 100 m(2) Borrelia miyamotoi and A. phagocytophilum were documented at 60% and 70% of the parks, respectively, while Ba. microti occurred at just 20% of the parks. Ixodes scapularis is well established across much of the Northeastern and Mid-Atlantic States, and our results are generally consistent with previous studies conducted near the areas we sampled. Newly established I. scapularis populations were documented in two locations: Washington, D.C. (Rock Creek Park) and Greene County, Virginia (Shenandoah National Park). This research demonstrates the potential risk of tick-borne pathogen exposure in national parks and can be used to educate park visitors about the importance of preventative actions to minimize tick exposure.

  8. Infection of Ixodes spp. tick cells with different Anaplasma phagocytophilum isolates induces the inhibition of apoptotic cell death.

    Science.gov (United States)

    Alberdi, Pilar; Ayllón, Nieves; Cabezas-Cruz, Alejandro; Bell-Sakyi, Lesley; Zweygarth, Erich; Stuen, Snorre; de la Fuente, José

    2015-09-01

    Anaplasma phagocytophilum is an intracellular rickettsial pathogen transmitted by Ixodes spp. ticks, which causes granulocytic anaplasmosis in humans, horses and dogs and tick-borne fever (TBF) in ruminants. In the United States, human granulocytic anaplasmosis (HGA) is highly prevalent while TBF has not been reported. However, in Europe the situation is the opposite, with high prevalence for TBF in sheep and low prevalence of HGA. The origin of these differences has not been identified and our hypothesis is that different A. phagocytophilum isolates impact differently on tick vector capacity through inhibition of apoptosis to establish infection of the tick vector. In this study we used three different isolates of A. phagocytophilum of human, canine and ovine origin to infect the Ixodes ricinus-derived cell line IRE/CTVM20 and the Ixodes scapularis-derived cell line ISE6 in order to characterize the effect of infection on the level of tick cell apoptosis. Inhibition of apoptosis was observed by flow cytometry as early as 24h post-infection for both tick cell lines and all three isolates of A. phagocytophilum, suggesting that pathogen infection inhibits apoptotic pathways to facilitate infection independently of the origin of the A. phagocytophilum isolate and tick vector species. However, infection with A. phagocytophilum isolates inhibited the intrinsic apoptosis pathway at different levels in I. scapularis and I. ricinus cells. These results suggested an impact of vector-pathogen co-evolution on the adaptation of A. phagocytophilum isolates to grow in tick cells as each isolate grew better in the tick cell line derived from its natural vector species. These results increase our understanding of the mechanisms of A. phagocytophilum infection and multiplication and suggest that multiple mechanisms may affect disease prevalence in different geographical regions.

  9. Tick-borne rickettsiae in Guinea and Liberia.

    Science.gov (United States)

    Mediannikov, Oleg; Diatta, Georges; Zolia, Yah; Balde, Mamadou Cellou; Kohar, Henry; Trape, Jean-François; Raoult, Didier

    2012-02-01

    While the high seroprevalence for the rickettsiae that cause spotted fevers and the multiple pathogenic rickettsiae is known, the data on the distribution of rickettsial diseases in Africa are often incomplete. We collected ticks from domestic or wild animals (generally a source of bushmeat) that were in contact with humans in 2 neighboring countries of tropical West Africa, Guinea and Liberia. In total, 382 ticks representing 6 species were collected in Liberia and 655 ticks representing 7 species were collected in Guinea. We found rickettsiae in 9 different species of ticks from both countries. Rickettsia africae was found in 93-100% of Amblyomma variegatum, in 14-93% of Rhipicephalus (B.) geigyi, Rh. (B.) annulatus, and Rh. (B.) decoloratus, and in several Hyalomma marginatum rufipes and Haemaphysalis paraleachi. A genetic variant of R. africae was found in Amblyomma compressum. R. massiliae was found in 10/61 (16%) of Rh. senegalensis ticks and in 2% of Haemaphysalis paraleachi ticks collected from dogs. We identified a new rickettsia in one of 44 (2%) Ixodes muniensis collected from a dog in Liberia. As this rickettsia is not yet isolated, we propose the provisional name "Candidatus Rickettsia liberiensis" (for the West African country where the host tick was collected).

  10. Diversity and seasonal patterns of ticks parasitizing wild birds in western Portugal.

    Science.gov (United States)

    Norte, A C; de Carvalho, I Lopes; Ramos, J A; Gonçalves, M; Gern, L; Núncio, M S

    2012-11-01

    The diversity and abundance of questing ticks and ticks parasitizing birds was assessed during 1 year in two recreational forests in western Portugal, a suburban forest and an enclosed game area. The aim of this study was to assess the distribution and seasonality of tick species and to understand the role of bird species as hosts for ticks. Ixodes ricinus was the most abundant questing tick collected in the enclosed game area, whereas in the suburban forest, only three ticks were collected by blanket dragging. Tick species parasitizing birds included I. ricinus, I. frontalis, I. arboricola, I. acuminatus, Haemaphysalis punctata, Hyalomma marginatum and H. lusitanicum. This is the first record of I. arboricola in Portugal. Tick prevalence and intensity of infestation differed between study areas and was higher in birds from the game area where a large population of deer and wild boar may support tick populations. Ground and shrub dwelling bird species such as Turdus merula, Erithacus rubecula and Sylvia melanocephala were the most heavily parasitized by ticks, but the importance of different bird species as hosts of larvae and nymphs of I. ricinus and I. frontalis differed. Therefore, different bird species may contribute differently for tick population maintenance.

  11. Species diversity and abundance of ticks in three habitats in southern Italy.

    Science.gov (United States)

    Dantas-Torres, Filipe; Otranto, Domenico

    2013-04-01

    A 2-year study was conducted from March 2010 to March 2012 in a forested area in southern Italy to evaluate the species diversity and abundance of free-living ticks in 3 different habitats: (i) a meadow habitat within an enclosure inhabited by roe deer (Capreolus capreolus); (ii) a man-made trail located in a high-altitude, forested area; and (iii) a grassland near a house inhabited by 3 people. In total, 10,795 ticks were collected. Ixodes ricinus was the most abundant species (69.0%), followed by Haemaphysalis inermis (19.1%), Rhipicephalus turanicus (6.7%), Dermacentor marginatus (3.2%), and Hyalomma marginatum (1.0%). The least frequently collected species were Rhipicephalus bursa, Haemaphysalis parva, Haemaphysalis sulcata, and Haemaphysalis concinna, representing together less than 1% of the collections. Immature ticks predominated over adult ticks. In particular, immature stages of Ix. ricinus (i.e., 3246 larvae and 3554 nymphs) represented 63% of the total number of ticks collected. High levels of species diversity and abundance of ticks were recorded in all habitats and the daily number of ticks collected was negatively correlated with daily mean temperature, evapotranspiration, and saturation deficit. This study indicates that the southern Italian climate is suitable for different tick species, which may find a preferred 'climate niche' during a specific season, when a combination of factors (e.g., suitable meteorological and environmental conditions) associated with the presence of suitable hosts will facilitate their development and reproduction.

  12. Increased mortality of black-browed albatross chicks at a colony heavily-infested with the tick Ixodes uriae.

    Science.gov (United States)

    Bergström, S; Haemig, P D; Olsen, B

    1999-09-01

    At Bird Island, South Georgia, we studied the effects of the tick Ixodes uriae on survival of chicks at two colonies of the black-browed albatross Diomedea melanophrys, one where most chicks were infested with ticks, the other where most chicks were tick-free. When the two colonies were compared, it was found that the colony heavily-infested with ticks had significantly greater chick mortality than the colony lightly-infested with ticks. However, within each of the two colonies, there was no significant difference in survival between chicks with ticks and those without ticks.

  13. Use of imidacloprid-permethrin to prevent transmission of Anaplasma phagocytophilum from naturally infected Ixodes scapularis ticks to dogs.

    Science.gov (United States)

    Blagburn, Byron L; Spencer, Jennifer A; Billeter, Sarah A; Drazenovich, Nicole L; Butler, Jamie M; Land, Tracey M; Dykstra, Christine C; Stafford, Kirby C; Pough, Margaret B; Levy, Steven A; Bledsoe, David L

    2004-01-01

    One group of eight beagles was treated with a combination of imidacloprid and permethrin 7 days before exposure to Ixodes scapularis ticks that were naturally infected with Anaplasma phagocytophilum. A second group of eight beagles was not treated and was also exposed to infected ticks. Seven of eight non-treated dogs--but none of the treated dogs--developed specific antibodies to A. phagocytophilum. Results of this study indicate that a combination of imidacloprid and permethrin can prevent transmission of A. phagocytophilum to dogs if administered before exposure to infected ticks.

  14. Characterization of Ixophilin, a thrombin inhibitor from the gut of Ixodes scapularis.

    Directory of Open Access Journals (Sweden)

    Sukanya Narasimhan

    Full Text Available Ixodes scapularis, the black-legged tick, vectors several human pathogens including Borrelia burgdorferi, the agent of Lyme disease in North America. Pathogen transmission to the vertebrate host occurs when infected ticks feed on the mammalian host to obtain a blood meal. Efforts to understand how the tick confronts host hemostatic mechanisms and imbibes a fluid blood meal have largely focused on the anticoagulation strategies of tick saliva. The blood meal that enters the tick gut remains in a fluid state for several days during the process of feeding, and the role of the tick gut in maintaining the blood-meal fluid is not understood. We now demonstrate that the tick gut produces a potent inhibitor of thrombin, a key enzyme in the mammalian coagulation cascade. Chromatographic fractionation of engorged tick gut proteins identified one predominant thrombin inhibitory activity associated with an approximately 18 kDa protein, henceforth referred to as Ixophilin. The ixophilin gene was preferentially transcribed in the guts of feeding nymphs. Expression began after 24 hours of feeding, coincident with the flow of host blood into the tick gut. Immunity against Ixophilin delayed tick feeding, and decreased feeding efficiency significantly. Surprisingly, immunity against Ixophilin resulted in increased Borrelia burgdorferi transmission to the host, possibly due to delayed feeding and increased transmission opportunity. These observations illuminate the potential drawbacks of targeting individual tick proteins in a functional suite. They also underscore the need to identify the "anticoagulome" of the tick gut, and to prioritize a critical subset of anticoagulants that could be targeted to efficiently thwart tick feeding, and block pathogen transmission to the vertebrate host.

  15. Seasonal activity and tick-borne pathogen infection rates of Ixodes ricinus ticks in Hungary.

    Science.gov (United States)

    Egyed, László; Elő, Péter; Sréter-Lancz, Zsuzsanna; Széll, Zoltán; Balogh, Zsuzsanna; Sréter, Tamás

    2012-04-01

    Ixodes ricinus is the most important tick species in Europe as it is most widely distributed and transmits the majority of tick-borne zoonotic pathogens. As limited data are available for Hungary, the aim of the present study was to investigate the seasonal timing of questing by I. ricinus and the infection rate of this tick species with all major tick-borne zoonotic pathogens. Monthly collections of I. ricinus were carried out over 3 consecutive years by dragging a blanket in 6 biotopes representing different areas of Hungary. Altogether, 1800 nymphs (300 per collection point) were screened as pooled samples (each of 5 specimens) by PCR-based methods for tick-borne pathogens. I. ricinus larvae, nymphs, and adults had bimodal activity patterns with a major peak in the spring. As newly moulted ticks of all stages are thought to emerge in the autumn of each year, it appears that most newly emerged ticks delayed their questing until the following spring. The minimum prevalence of Borrelia burgdorferi sensu lato was 2.5%. Borr. afzelii, Borr. burgdorferi sensu stricto, Borr. garinii, Borr. lusitaniae, and Borr. valaisiana were identified by hybridization. The minimum infection rate with spotted fever group rickettsiae was 1.9%. Rickettsia helvetica was identified in all biotopes. The minimum prevalence of Anaplasma phagocytophilum, Babesia divergens and Bab. microti was low (0.3-0.5%). Bartonella spp.-, Francisella tularensis-, and TBE virus-specific amplification products were not detected. Relative to the results of comparable studies carried out in the Carpathian Basin, the prevalence of tick-borne pathogens was low in Hungary. This might be attributed to the climatic difference between the lowland areas of Hungary and submountain areas of the surrounding countries involved in the studies.

  16. Anaplasma phagocytophilum Infection Subverts Carbohydrate Metabolic Pathways in the Tick Vector, Ixodes scapularis

    Science.gov (United States)

    Cabezas-Cruz, Alejandro; Alberdi, Pilar; Valdés, James J.; Villar, Margarita; de la Fuente, José

    2017-01-01

    The obligate intracellular pathogen, Anaplasma phagocytophilum, is the causative agent of human, equine, and canine granulocytic anaplasmosis and tick-borne fever (TBF) in ruminants. A. phagocytophilum has become an emerging tick-borne pathogen in the United States, Europe, Africa, and Asia, with increasing numbers of infected people and animals every year. It has been recognized that intracellular pathogens manipulate host cell metabolic pathways to increase infection and transmission in both vertebrate and invertebrate hosts. However, our current knowledge on how A. phagocytophilum affect these processes in the tick vector, Ixodes scapularis is limited. In this study, a genome-wide search for components of major carbohydrate metabolic pathways was performed in I. scapularis ticks for which the genome was recently published. The enzymes involved in the seven major carbohydrate metabolic pathways glycolysis, gluconeogenesis, pentose phosphate, tricarboxylic acid cycle (TCA), glyceroneogenesis, and mitochondrial oxidative phosphorylation and β-oxidation were identified. Then, the available transcriptomics and proteomics data was used to characterize the mRNA and protein levels of I. scapularis major carbohydrate metabolic pathway components in response to A. phagocytophilum infection of tick tissues and cultured cells. The results showed that major carbohydrate metabolic pathways are conserved in ticks. A. phagocytophilum infection inhibits gluconeogenesis and mitochondrial metabolism, but increases the expression of glycolytic genes. A model was proposed to explain how A. phagocytophilum could simultaneously control tick cell glucose metabolism and cytoskeleton organization, which may be achieved in part by up-regulating and stabilizing hypoxia inducible factor 1 alpha in a hypoxia-independent manner. The present work provides a more comprehensive view of the major carbohydrate metabolic pathways involved in the response to A. phagocytophilum infection in ticks

  17. Growth of Coxiella burnetii in the Ixodes scapularis-derived IDE8 tick cell line.

    Science.gov (United States)

    Herrin, Brian; Mahapatra, Saugata; Blouin, Edmour F; Shaw, Edward I

    2011-07-01

    Q fever, a zoonotic disease, is caused by a gram-negative intracellular bacterium, Coxiella burnetii. Although normally transmitted during exposure to infectious aerosols, C. burnetii is also found in arthropod vectors. In the environment, ticks are thought to play a crucial role in bacterial maintenance and transmission by infecting various mammalian species. However, the nature of the pathogen-tick relationship is not well defined. To determine C. burnetii's interactions with a cultured tick cell line, we introduced purified C. burnetii NMII into Ixodes scapularis-derived IDE8 cells and assayed for bacterial presence, replication, gene expression, and subsequent infectivity for mammalian cells. Tick cells were harvested at 24 h, 72 h, 7 days, and 11 days postinfection (PI). C. burnetii uptake and subsequent replication was demonstrated by indirect immunofluorescence assay, electron microscopy, and real-time polymerase chain reaction (PCR). When a genome equivalent multiplicity of infection of 30 was used, 30%-40% of exposed cells were seen to have small, rounded, vacuoles at 72 h PI, whereas at 7 and 11 days PI, 60%-70% of cells contained enlarged vacuoles harboring large numbers of bacteria. Quantitative PCR analysis of total genomic DNA confirmed that C. burnetii genome numbers increased significantly from 24 h to 11 days PI. Expression of C. burnetii type four secretion system homologs at 7 days PI was demonstrated by reverse transcriptase PCR. Finally, indirect immunofluorescence assay demonstrated that C. burnetii propagated within IDE8 cells were infectious for mammalian cells. These studies demonstrate the utility of cultured tick cell lines as a model to investigate C. burnetii's molecular interactions with its arthropod vectors.

  18. Acquisition of Borrelia burgdorferi infection by larval Ixodes scapularis (Acari: Ixodidae) associated with engorgement measures

    Science.gov (United States)

    Couret, Janelle; Dyer, M.C.; Mather, T.N.; Han, S.; Tsao, J.I.; LeBrun, R.A.; Ginsberg, Howard

    2017-01-01

    Measuring rates of acquisition of the Lyme disease pathogen, Borrelia burgdorferi sensu lato Johnson, Schmid, Hyde, Steigerwalt & Brenner, by the larval stage of Ixodes scapularis Say is a useful tool for xenodiagnoses of B. burgdorferi in vertebrate hosts. In the nymphal and adult stages of I. scapularis, the duration of attachment to hosts has been shown to predict both body engorgement during blood feeding and the timing of infection with B. burgdorferi. However, these relationships have not been established for the larval stage of I. scapularis. We sought to establish the relationship between body size during engorgement of larval I. scapularis placed on B. burgdorferi-infected, white-footed mice (Peromyscus leucopus Rafinesque) and the presence or absence of infection in larvae sampled from hosts over time. Body size, time, and their interaction were the best predictors of larval infection with B. burgdorferi. We found that infected larvae showed significantly greater engorgement than uninfected larvae as early as 24 h after placement on a host. These findings may suggest that infection with B. burgdorferi affects the larval feeding process. Alternatively, larvae that engorge more rapidly on hosts may acquire infections faster. Knowledge of these relationships can be applied to improve effective xenodiagnosis of B. burgdorferi in white-footed mice. Further, these findings shed light on vector–pathogen–host interactions during an understudied part of the Lyme disease transmission cycle.

  19. Driving forces for changes in geographical distribution of Ixodes ricinus ticks in Europe

    Science.gov (United States)

    2013-01-01

    Many factors are involved in determining the latitudinal and altitudinal spread of the important tick vector Ixodes ricinus (Acari: Ixodidae) in Europe, as well as in changes in the distribution within its prior endemic zones. This paper builds on published literature and unpublished expert opinion from the VBORNET network with the aim of reviewing the evidence for these changes in Europe and discusses the many climatic, ecological, landscape and anthropogenic drivers. These can be divided into those directly related to climatic change, contributing to an expansion in the tick’s geographic range at extremes of altitude in central Europe, and at extremes of latitude in Scandinavia; those related to changes in the distribution of tick hosts, particularly roe deer and other cervids; other ecological changes such as habitat connectivity and changes in land management; and finally, anthropogenically induced changes. These factors are strongly interlinked and often not well quantified. Although a change in climate plays an important role in certain geographic regions, for much of Europe it is non-climatic factors that are becoming increasingly important. How we manage habitats on a landscape scale, and the changes in the distribution and abundance of tick hosts are important considerations during our assessment and management of the public health risks associated with ticks and tick-borne disease issues in 21st century Europe. Better understanding and mapping of the spread of I. ricinus (and changes in its abundance) is, however, essential to assess the risk of the spread of infections transmitted by this vector species. Enhanced tick surveillance with harmonized approaches for comparison of data enabling the follow-up of trends at EU level will improve the messages on risk related to tick-borne diseases to policy makers, other stake holders and to the general public. PMID:23281838

  20. Ecology of the interaction between Ixodes loricatus (Acari: Ixodidae) and Akodon azarae (Rodentia: Criceridae).

    Science.gov (United States)

    Colombo, Valeria C; Nava, Santiago; Antoniazzi, Leandro R; Monje, Lucas D; Racca, Andrea L; Guglielmone, Alberto A; Beldomenico, Pablo M

    2015-10-01

    The present study explores associations of different factors (i.e. host parameters, presence of other ectoparasites and [mainly biotic] environmental factors) with burdens of Ixodes loricatus immature stages in one of its main hosts in Argentina, the rodent Akodon azarae. For 2 years, rodents were trapped and sampled monthly at 16 points located in four different sites in the Parana River Delta region. Data were analysed with generalized linear mixed models with a negative binomial response (counts of larvae or nymphs). The independent variables assessed were (a) environmental: trapping year, presence of cattle, type of vegetation, rodent abundance; (b) host parameters: body length, sex, body condition, blood cell counts, natural antibody titers and (c) co-infestation with other ectoparasites. Two-way interaction terms deemed a priori as relevant were also included in the analysis. Most of the associations investigated were found significant, but in general, the direction and magnitude of the associations were context-dependent. An exception was the presence of cattle, which was consistently negatively associated with both larvae and nymphs independently of all other variables considered and had the strongest effect on tick burdens. Mites, fleas and Amblyomma triste were also significantly associated (mostly positively) with larval and nymph burdens, and in many cases, they influenced associations with environmental or host factors. Our findings strongly support that raising cattle may have a substantial impact on the dynamics of I. loricatus and that interactions within the ectoparasite community may be an important-but generally ignored-driver of tick dynamics.

  1. Metagenomic profile of the bacterial communities associated with Ixodes ricinus ticks.

    Directory of Open Access Journals (Sweden)

    Giovanna Carpi

    Full Text Available Assessment of the microbial diversity residing in arthropod vectors of medical importance is crucial for monitoring endemic infections, for surveillance of newly emerging zoonotic pathogens, and for unraveling the associated bacteria within its host. The tick Ixodes ricinus is recognized as the primary European vector of disease-causing bacteria in humans. Despite I. ricinus being of great public health relevance, its microbial communities remain largely unexplored to date. Here we evaluate the pathogen-load and the microbiome in single adult I. ricinus by using 454- and Illumina-based metagenomic approaches. Genomic DNA-derived sequences were taxonomically profiled using a computational approach based on the BWA algorithm, allowing for the identification of known tick-borne pathogens at the strain level and the putative tick core microbiome. Additionally, we assessed and compared the bacterial taxonomic profile in nymphal and adult I. ricinus pools collected from two distinct geographic regions in Northern Italy by means of V6-16S rRNA amplicon pyrosequencing and community based ecological analysis. A total of 108 genera belonging to representatives of all bacterial phyla were detected and a rapid qualitative assessment for pathogenic bacteria, such as Borrelia, Rickettsia and Candidatus Neoehrlichia, and for other bacteria with mutualistic relationship or undetermined function, such as Wolbachia and Rickettsiella, was possible. Interestingly, the ecological analysis revealed that the bacterial community structure differed between the examined geographic regions and tick life stages. This finding suggests that the environmental context (abiotic and biotic factors and host-selection behaviors affect their microbiome.Our data provide the most complete picture to date of the bacterial communities present within I. ricinus under natural conditions by using high-throughput sequencing technologies. This study further demonstrates a novel detection

  2. Driving forces for changes in geographical distribution of Ixodes ricinus ticks in Europe

    Directory of Open Access Journals (Sweden)

    Medlock Jolyon M

    2013-01-01

    Full Text Available Abstract Many factors are involved in determining the latitudinal and altitudinal spread of the important tick vector Ixodes ricinus (Acari: Ixodidae in Europe, as well as in changes in the distribution within its prior endemic zones. This paper builds on published literature and unpublished expert opinion from the VBORNET network with the aim of reviewing the evidence for these changes in Europe and discusses the many climatic, ecological, landscape and anthropogenic drivers. These can be divided into those directly related to climatic change, contributing to an expansion in the tick’s geographic range at extremes of altitude in central Europe, and at extremes of latitude in Scandinavia; those related to changes in the distribution of tick hosts, particularly roe deer and other cervids; other ecological changes such as habitat connectivity and changes in land management; and finally, anthropogenically induced changes. These factors are strongly interlinked and often not well quantified. Although a change in climate plays an important role in certain geographic regions, for much of Europe it is non-climatic factors that are becoming increasingly important. How we manage habitats on a landscape scale, and the changes in the distribution and abundance of tick hosts are important considerations during our assessment and management of the public health risks associated with ticks and tick-borne disease issues in 21st century Europe. Better understanding and mapping of the spread of I. ricinus (and changes in its abundance is, however, essential to assess the risk of the spread of infections transmitted by this vector species. Enhanced tick surveillance with harmonized approaches for comparison of data enabling the follow-up of trends at EU level will improve the messages on risk related to tick-borne diseases to policy makers, other stake holders and to the general public.

  3. Passive Surveillance of Ixodes scapularis (Say), Their Biting Activity, and Associated Pathogens in Massachusetts

    Science.gov (United States)

    Xu, Guang; Mather, Thomas N.; Hollingsworth, Craig S.

    2016-01-01

    Abstract A passive surveillance of tick-borne pathogens was conducted over a 7-year period (2006–2012), in which a total of 3551 ticks were submitted to the University of Massachusetts for PCR testing. The vast majority of these ticks were Ixodes scapularis from Massachusetts (N = 2088) and hence were the focus of further analysis. Two TaqMan duplex qPCR assays were developed to test I. scapularis ticks for the presence of three human pathogens: Borrelia burgdorferi, Anaplasma phagocytophilum, and Babesia microti. I. scapularis submissions were concentrated from Cape Cod, the eastern half of the state outside of the Boston metropolitan area, parts of Franklin and Hampshire counties along the Quabbin Reservoir watershed, and southwestern Berkshire county. Differences in seasonal activity pattern were observed for different developmental stages of I. scapularis. The largest proportion of tick bite victims were age 9 years and under. Nymphal ticks were found more often on lower extremities of their hosts, while more adult ticks were found on the head. Overall infection rate of B. burgdorferi, A. phagocytophilum, and B. microti in human-biting ticks was 29.6%, 4.6%, and 1.8%, respectively. B. burgdorferi-infected ticks were widely distributed, but A. phagocytophilum- and B. microti-infected I. scapularis were found mainly in the eastern half of the state. We found that 1.8%, 1.0%, and 0.4% of ticks were coinfected by B. burgdorferi and A. phagocytophilum, B. burgdorferi and B. microti, and A. phagocytophilum and B. microti, respectively, and 0.3% of ticks had triple coinfection. PMID:27248292

  4. The Rickettsia Endosymbiont of Ixodes pacificus Contains All the Genes of De Novo Folate Biosynthesis.

    Directory of Open Access Journals (Sweden)

    Daniel J Hunter

    Full Text Available Ticks and other arthropods often are hosts to nutrient providing bacterial endosymbionts, which contribute to their host's fitness by supplying nutrients such as vitamins and amino acids. It has been detected, in our lab, that Ixodes pacificus is host to Rickettsia species phylotype G021. This endosymbiont is predominantly present, and 100% maternally transmitted in I. pacificus. To study roles of phylotype G021 in I. pacificus, bioinformatic and molecular approaches were carried out. MUMmer genome alignments of whole genome sequence of I. scapularis, a close relative to I. pacificus, against completely sequenced genomes of R. bellii OSU85-389, R. conorii, and R. felis, identified 8,190 unique sequences that are homologous to Rickettsia sequences in the NCBI Trace Archive. MetaCyc metabolic reconstructions revealed that all folate gene orthologues (folA, folC, folE, folKP, ptpS required for de novo folate biosynthesis are present in the genome of Rickettsia buchneri in I. scapularis. To examine the metabolic capability of phylotype G021 in I. pacificus, genes of the folate biosynthesis pathway of the bacterium were PCR amplified using degenerate primers. BLAST searches identified that nucleotide sequences of the folA, folC, folE, folKP, and ptpS genes possess 98.6%, 98.8%, 98.9%, 98.5% and 99.0% identity respectively to the corresponding genes of Rickettsia buchneri. Phylogenetic tree constructions show that the folate genes of phylotype G021 and homologous genes from various Rickettsia species are monophyletic. This study has shown that all folate genes exist in the genome of Rickettsia species phylotype G021 and that this bacterium has the genetic capability for de novo folate synthesis.

  5. Evidence for Borrelia bavariensis infections of Ixodes uriae within seabird colonies of the North Atlantic Ocean.

    Science.gov (United States)

    Munro, Hannah J; Ogden, Nicholas H; Lindsay, L Robbin; Robertson, Gregory J; Whitney, Hugh; Lang, Andrew S

    2017-08-11

    The first report of members of the spirochete genus Borrelia in the seabird tick, Ixodes uriae, and seabird colonies occurred during the early 1990s. Since then, Borrelia spp. have been detected in these ticks and seabird colonies around the world. To-date, the primary species detected has been B. garinii, with rare occurrences of B. burgdorferi sensu stricto and B. lusitaniae. During our research on Borrelia and I. uriae in seabird colonies of Newfoundland and Labrador, Canada, we have identified B. bavariensis in I. uriae To our knowledge, B. bavariensis has previously only been found in the Eurasian tick species, I. persulcatus and I. ricinus, and it was believed to be a rodent-specific Borrelia ecotype. We found B. bavariensis within I. uriae from three seabird colonies, over three calendar years. We also reanalyzed B. garinii sequences collected from I. uriae from Eurasian seabird colonies, and determined that sequences from two Russian seabird colonies likely also represent B. bavariensis The Canadian B. bavariensis sequences from I. uriae analysed in this study cluster with previously described sequences from Asia. Overall, this is an important discovery that illustrates and expands the range of hosts and vectors for B. bavariensis and it raises questions regarding the possible mechanisms of pathogen dispersal from Asia to North America.Importance To our knowledge this is the first documentation of B. bavariensis outside Eurasia. Additionally, the bacterium was found in a marine ecosystem involving the seabird tick, I. uriae, and its associated seabird hosts. This indicates the epizootiology of B. bavariensis transmission is much different from what was previously described, with this species previously believed to be a rodent-specific ecotype, and indicates that this pathogen is established, or establishing, much more widely. © Crown copyright 2017.

  6. Expansion of the Lyme Disease Vector Ixodes scapularis in Canada inferred from CMIP5 Climate Projections

    Science.gov (United States)

    McPherson, Michelle Yvonne; García-García, Almudena; José Cuesta-Valero, Francisco; Beltrami, Hugo; Hansen-Ketchum, Patti; MacDougall, Donna; Hume Ogden, Nicholas

    2017-04-01

    A number of studies have assessed possible climate change impacts on the Lyme disease vector, Ixodes scapularis. However, most have used surface air temperature from only one climate model simulation and/or one emission scenario, representing only one possible climate future. We quantified effects of different Representative Concentration Pathway (RCP) and climate model outputs on the projected future changes in the basic reproduction number (R0) of I. scapularis to explore uncertainties in future R0 estimates. We used surface air temperature generated by a complete set of General Circulation Models from the Coupled Model Intercomparison Project Phase 5 (CMIP5) to hindcast historical and forecast future effects of climate change on the R0 of I. scapularis. As in previous studies, R0 of I. scapularis increased with a warming climate under future projected climate. Increases in the multi-model mean R0 values showed significant changes over time under all RCP scenarios, however; only the estimated R0 mean values between RCP6.0 and RCP8.5 showed statistically significant differences. Our results highlight the potential for climate change to have an effect on future Lyme disease risk in Canada even if the Paris Agreement's goal to keep global warming below 2°C is achieved, although mitigation reducing emissions from RCP8.5 levels to those of RCP6.0 or less would be expected to slow tick invasion after the 2030s. On-going planning is needed to inform and guide adaptation in light of the projected range of possible futures.

  7. Dynamics of digestive proteolytic system during blood feeding of the hard tick Ixodes ricinus

    Directory of Open Access Journals (Sweden)

    Sojka Daniel

    2010-12-01

    Full Text Available Abstract Background Ticks are vectors of a wide variety of pathogens causing severe diseases in humans and domestic animals. Intestinal digestion of the host blood is an essential process of tick physiology and also a limiting factor for pathogen transmission since the tick gut represents the primary site for pathogen infection and proliferation. Using the model tick Ixodes ricinus, the European Lyme disease vector, we have previously demonstrated by genetic and biochemical analyses that host blood is degraded in the tick gut by a network of acidic peptidases of the aspartic and cysteine classes. Results This study reveals the digestive machinery of the I. ricinus during the course of blood-feeding on the host. The dynamic profiling of concentrations, activities and mRNA expressions of the major digestive enzymes demonstrates that the de novo synthesis of peptidases triggers the dramatic increase of the hemoglobinolytic activity along the feeding period. Overall hemoglobinolysis, as well as the activity of digestive peptidases are negligible at the early stage of feeding, but increase dramatically towards the end of the slow feeding period, reaching maxima in fully fed ticks. This finding contradicts the established opinion that blood digestion is reduced at the end of engorgement. Furthermore, we show that the digestive proteolysis is localized intracellularly throughout the whole duration of feeding. Conclusions Results suggest that the egressing proteolytic system in the early stage of feeding and digestion is a potential target for efficient impairment, most likely by blocking its components via antibodies present in the host blood. Therefore, digestive enzymes are promising candidates for development of novel 'anti-tick' vaccines capable of tick control and even transmission of tick-borne pathogens.

  8. Functional genomics tool: Gene silencing in Ixodes scapularis eggs and nymphs by electroporated dsRNA

    Directory of Open Access Journals (Sweden)

    Troiano Emily

    2010-01-01

    Full Text Available Abstract Background Ticks are blood-sucking arthropods responsible for transmitting a wide variety of disease-causing agents, and constitute important public health threats globally. Ixodes scapularis is the primary vector of the Lyme disease agent in the eastern and central U.S. RNAi is a mechanism by which gene-specific double-stranded RNA (dsRNA triggers degradation of homologous mRNA transcripts. Here, we describe an optimized protocol for effectively suppressing gene expression in the egg and nymphal stages of I. scapularis by electroporation. Results The genes encoding the putative Phospholipase A2 (PLA2, cytoplasmic Cystatin, Syntaxin-5, β-Actin and Calreticulin were targeted by delivering the dsRNA encoding the specific gene coding regions in the unfed nymphs. Silencing was measured using real time qRT-PCR. Electroporation as a mode of dsRNA delivery appears to be substantially efficient and less traumatic to the tick than dsRNA microinjection in the unfed nymphs. Using Cy3-labeled dsRNA to monitor the movement, electroporated dsRNA entered the nymphs and spread to salivary glands and other tissues. The significant disruption of β-actin and cytoplasmic Cystatin transcripts in tick eggs demonstrate the applicability of this technique. The PLA2, cytoplasmic Cystatin, Syntaxin-5, β-Actin and Calreticulin genes were also significantly silenced, suggesting that this method has the potential to introduce dsRNA in eggs and unfed nymphs. Conclusions Our study demonstrates that electroporation can be used as a simple dsRNA delivery tool in assessing the functional role of tick genes in the vector-host interactions. This technique represents a novel approach for specific gene suppression in immature stages of ticks.

  9. Ixodes ricinus and Its Endosymbiont Midichloria mitochondrii: A Comparative Proteomic Analysis of Salivary Glands and Ovaries.

    Directory of Open Access Journals (Sweden)

    Monica Di Venere

    Full Text Available Hard ticks are hematophagous arthropods that act as vectors of numerous pathogenic microorganisms of high relevance in human and veterinary medicine. Ixodes ricinus is one of the most important tick species in Europe, due to its role of vector of pathogenic bacteria such as Borrelia burgdorferi and Anaplasma phagocytophilum, of viruses such as tick borne encephalitis virus and of protozoans as Babesia spp. In addition to these pathogens, I. ricinus harbors a symbiotic bacterium, Midichloria mitochondrii. This is the dominant bacteria associated to I. ricinus, but its biological role is not yet understood. Most M. mitochondrii symbionts are localized in the tick ovaries, and they are transmitted to the progeny. M. mitochondrii bacteria have however also been detected in the salivary glands and saliva of I. ricinus, as well as in the blood of vertebrate hosts of the tick, prompting the hypothesis of an infectious role of this bacterium. To investigate, from a proteomic point of view, the tick I. ricinus and its symbiont, we generated the protein profile of the ovary tissue (OT and of salivary glands (SG of adult females of this tick species. To compare the OT and SG profiles, 2-DE profiling followed by LC-MS/MS protein identification were performed. We detected 21 spots showing significant differences in the relative abundance between the OT and SG, ten of which showed 4- to 18-fold increase/decrease in density. This work allowed to establish a method to characterize the proteome of I. ricinus, and to detect multiple proteins that exhibit a differential expression profile in OT and SG. Additionally, we were able to use an immunoproteomic approach to detect a protein from the symbiont. Finally, the method here developed will pave the way for future studies on the proteomics of I. ricinus, with the goals of better understanding the biology of this vector and of its symbiont M. mitochondrii.

  10. The toxic effect of permethrin and cypermethrin on engorged Ixodes ricinus females

    Directory of Open Access Journals (Sweden)

    Alicja Buczek

    2014-06-01

    Full Text Available introduction. [i]Ixodes ricinus[/i] tick is of great medical and veterinary importance and has a wide range of geographical distribution. The study presents the effect of permethrin (Per and cypermethrin (CM on engorged[i] I. ricinus[/i] females. materials and method. The effect of perythroids studied on engorged I. ricinus females was assessed on the basis of the pre-oviposition and oviposition period. Remote effects of Per and CM application were assessed by investigation of the length and course of embryonic development and larval hatching from eggs laid by pyrethroid-treated females. Per (Copex WP was used at doses of 0.78125–25.0 µg/1 specimen, and CM (Kordon 10WP was applied at 0.3125–10.0 µg/1 specimen. Immediately after the feeding period, I. ricinus females were sprayed with 20 µl of a pyrethroid solution and kept at 28 °C and 75%RH. results. The experiments demonstrated that CM exerted a stronger toxic effect on [i]I. ricinus[/i] females than Per. The lowest doses of CM doubled the length of the pre-oviposition period while its highest doses prolonged the period nearly three times compared with the control. The pyrethroids applied reduced the number and weight of eggs and changed the parameters of the oviposition process. Application of the tested pyrethroid doses led to disturbances in the embryonic development of[i] I. ricinus[/i], i.e. the development was prolonged, few normal larvae hatched, numerous eggs and embryos at various developmental stages died, and larval hatch was inhibited. conclusions. Knowledge about the sensitivity of engorged females to different doses of the tested pyrethroids and the remote effects of their action can be used in practice for tick control among livestock animals, and the reduction of tick population abundance in the environment.

  11. Identification and functional characterization of a pyrokinin neuropeptide receptor in the Lyme disease vector, Ixodes scapularis.

    Science.gov (United States)

    Gondalia, Kinsi; Qudrat, Anam; Bruno, Brigida; Fleites Medina, Janet; Paluzzi, Jean-Paul V

    2016-12-01

    Pyrokinin-related peptides are pleiotropic factors that are defined by their conserved C-terminal sequence FXPRL-NH2. The pyrokinin nomenclature derives from their originally identified myotropic actions and, as seen in some family members, a blocked amino terminus with pyroglutamate. The black-legged tick, Ixodes scapularis, is well known as a vector of Lyme disease and various other illnesses; however, in comparison to blood-feeding insects, knowledge on its physiology (along with other Ixodid ticks) is rather limited. In this study, we have isolated, examined the expression profile, and functionally deorphanized the pyrokinin peptide receptor in the medically important tick, I. scapularis. Phylogenetic analysis supports that the cloned receptor is indeed a bona fide member of the pyrokinin-related peptide receptor family. The tick pyrokinin receptor transcript expression is most abundant in the central nervous system (i.e. synganglion), but is also detected in trachea, female reproductive tissues, and in a pooled sample comprised of Malpighian (renal) tubules and the hindgut. Finally, functional characterization of the identified receptor confirmed it as a pyrokinin peptide receptor as it was activated equally by four endogenous pyrokinin-related peptides. The receptor was slightly promiscuous as it was also activated by a peptide sharing some structural similarity, namely the CAPA-periviserokinin (CAPA-PVK) peptide. Nonetheless, the I. scapularis pyrokinin receptor required a CAPA-PVK peptide concentration of well over three orders of magnitude to achieve a comparable receptor activation response, which indicates it is quite selective for its native pyrokinin peptide ligands. This study sets the stage for future research to examine the prospective tissue targets identified in order to resolve the physiological roles of this family of peptides in Ixodid ticks.

  12. Diversity of viruses in Ixodes ricinus, and characterization of a neurotropic strain of Eyach virus.

    Science.gov (United States)

    Moutailler, S; Popovici, I; Devillers, E; Vayssier-Taussat, M; Eloit, M

    2016-05-01

    Ticks transmit more pathogens-including bacteria, parasites and viruses-than any other arthropod vector. Although the epidemiological status of many tick-borne bacteria is very well characterized, tick-borne viruses are still relatively under-studied. Recently, several novel tick-borne viruses have been isolated from human febrile illnesses following tick bites, indicating the existence of other potential new and unknown tick-borne viruses. We used high-throughput sequencing to analyse the virome of Ixodes ricinus, the main vector of tick-borne pathogens in Europe. The majority of collected viral sequences were assigned to two potentially novel Nairovirus and Phlebovirus viruses, with prevalence rates ranging from 3.95% to 23.88% in adults and estimated to be between 0.14% and 72.16% in nymphs. These viruses could not be isolated from the brains of inoculated immunocompromised mice, perhaps indicating that they are unable to infect vertebrates. Within the I. ricinus virome, we also identified contigs with >90% identity to the known Eyach virus. Initially isolated in the 1980s, this virus was indirectly associated with human disease, but had never been extensively studied. Eyach virus prevalence varied between 0.07% and 5.26% in ticks from the French Ardennes and Alsace regions. Eyach virus was successfully isolated following intracerebral inoculation of immunocompromised mice with Eyach virus-positive tick extracts. This virus was also able to multiply and persist in the blood of immunocompetent mice inoculated by intraperitoneal injection, and caused brain infections in three of nine juveniles, without any obvious deleterious effects.

  13. The role of rodents in the ecology of Ixodes ricinus and associated pathogens in Central and Eastern Europe.

    Science.gov (United States)

    Mihalca, Andrei D; Sándor, Attila D

    2013-01-01

    Rodents comprise more species than any other mammal order. Most rodents are considered keystone species in their ecological communities, hence the survival of many other species in the ecosystem depend on them. From medical point of view, this is particularly important for rodent-dependent pathogens. In the particular case of tick-borne diseases, rodents are important as hosts for vector ticks and as reservoir hosts (Lyme borreliosis, human granulocytic anaplasmosis, Crimean-Congo hemorrhagic fever, Tick-borne relapsing fevers, tick-borne rickettsioses, babesiosis). Community and population ecology of rodents was shown to be correlated with disease ecology in the case of many tick-borne diseases. In Eastern Europe, several adult hard-tick species use rodents as their principal hosts: Ixodes apronophorus, I. crenulatus, I. laguri, I. redikorzevi, I. trianguliceps. However, the majority of ticks feeding on rodents are immature stages of ticks which as adults are parasitic on larger mammals. Larvae and nymphs of Ixodes ricinus, the most abundant and medically important tick from Europe, are commonly found on rodents. This is particularly important, as many rodents are synanthropic and, together with other micromammals and birds are often the only available natural hosts for ticks in urban environments. This work reviews the correlated ecology of rodents and I. ricinus.

  14. The role of rodents in the ecology of Ixodes ricinus and associated pathogens in Central and Eastern Europe

    Directory of Open Access Journals (Sweden)

    Andrei Daniel Mihalca

    2013-10-01

    Full Text Available Rodents comprise more species than any other mammal order. Most rodents are considered keystone species in their ecological communities, hence the survival of many other species in the ecosystem depend on them. From medical point of view, this is particularly important for rodent-dependent pathogens. In the particular case of tick-borne diseases, rodents are important as hosts for vector ticks and as reservoir hosts (Lyme borreliosis, human granulocytic anaplasmosis, Crimean-Congo hemorrhagic fever, Tick-borne relapsing fevers, tick-borne rickettsioses, babesiosis. Community and population ecology of rodents was shown to be correlated with disease ecology in the case of many tick-borne diseases. In Eastern Europe, several adult hard-tick species use rodents as their principal hosts: Ixodes apronophorus, I. crenulatus, I. laguri, I. redikorzevi, I. trianguliceps. However, the majority of ticks feeding on rodents are immature stages of ticks which as adults are parasitic on larger mammals. Larvae and nymphs of I. ricinus, the most abundant and medically important tick from Europe, are commonly found on rodents. This is particularly important, as many rodents are synanthropic and, together with other micromammals and birds are often the only available natural hosts for ticks in urban environments. This work reviews the correlated ecology of rodents and Ixodes ricinus.

  15. Elemol and amyris oil repel the ticks Ixodes scapularis and Amblyomma americanum (Acari: Ixodidae) in laboratory bioassays.

    Science.gov (United States)

    Carroll, J F; Paluch, G; Coats, J; Kramer, M

    2010-08-01

    The essential oil from Amyris balsamifera (Rutaceae) and elemol, a principal constituent of the essential oil of Osage orange, Maclura pomifera (Moraceae) were evaluated in in vitro and in vivo laboratory bioassays for repellent activity against host-seeking nymphs of the blacklegged tick, Ixodes scapularis, and the lone star tick, Amblyomma americanum. Both bioassays took advantage of the tendency of these host-seeking ticks to climb slender vertical surfaces. In one bioassay, the central portion of a vertical strip of filter paper was treated with test solution and ticks placed or allowed to crawl onto the untreated lower portion. In the other bioassay, a strip of organdy cloth treated with test solution was doubly wrapped (treatment on outer layer) around the middle phalanx of a forefinger and ticks released on the fingertip. Both amyris oil and elemol were repellent to both species of ticks. Elemol did not differ significantly in effectiveness against A. americanum from the widely used repellent deet. At 2 and 4 h after application to filter paper, 827 microg amyris oil/cm(2) paper repelled 80 and 55%, respectively, of A. americanum nymphs. Ixodes scapularis was repelled by lower concentrations of amyris oil and elemol than A. americanum.

  16. Field Applications of Entomopathogenic Fungi Beauveria bassiana (Hypocreales: Clavicipitaceae) and Metarhizium anisopliae F52 (Hypocreales: Nectriaceae) for the Control of Ixodes scapularis (Acari: Ixodidae)

    Science.gov (United States)

    Two commercial formulations of Beauveria bassiana (Balsamo-Crivelli) Vuillemin were applied to residential sites in Old Lyme, Connecticut for the control of nymphs of the blacklegged tick, Ixodes scapularis in 1999 and 2000. The pyrethroid bifenthrin was applied to other homes for comparison with B....

  17. Parasitism of Ixodes (Multidentatus auritulus Neumann (Acari: Ixodidae on birds from the city of Curitiba, state of Paraná, southern Brazil

    Directory of Open Access Journals (Sweden)

    Márcia Arzua

    1999-09-01

    Full Text Available The tick-bird relationship of 56 specimens of birds (Passeriformes and Columbiformes collected in the city of Curitiba, State of Paraná, between 1990 and 1995, among which 102 specimens of Ixodes (Multidentatus auritulus were found and analyzed. New host records were also produced including the first report of I. auritulus on a Columbiformes bird in Brazil.

  18. Persistent detection of Babesia EU1 and Babesia microti in Ixodes ricinus in The Netherlands during a 5-year surveillance: 2003-2007

    NARCIS (Netherlands)

    Wielinga, P.R.; Fonville, M.; Sprong, H.; Gaasenbeek, C.P.H.; Borgsteede, F.H.M.

    2009-01-01

    We report the finding of Babesia EU1 and Babesia microti in Ixodes ricinus ticks in the Netherlands. During 5 years of surveillance between 2003 and 2007, 1488 ticks were collected in a dune forest area near the North Sea and were screened for Babesia infections. In 17 ticks, DNA of the protozoan pa

  19. Identification of tick-borne pathogens in ticks feeding on humans in Turkey.

    Directory of Open Access Journals (Sweden)

    Ömer Orkun

    2014-08-01

    Full Text Available The importance of tick-borne diseases is increasing all over the world, including Turkey. The tick-borne disease outbreaks reported in recent years and the abundance of tick species and the existence of suitable habitats increase the importance of studies related to the epidemiology of ticks and tick-borne pathogens in Turkey. The aim of this study was to investigate the presence of and to determine the infection rates of some tick-borne pathogens, including Babesia spp., Borrelia burgdorferi sensu lato and spotted fever group rickettsiae in the ticks removed from humans in different parts of Ankara.A total of 169 ticks belonging to the genus Haemaphysalis, Hyalomma, Ixodes and Rhipicephalus were collected by removing from humans in different parts of Ankara. Ticks were molecularly screened for Babesia spp., Borrelia burgdorferi sensu lato and spotted fever group rickettsiae by PCR and sequencing analysis. We detected 4 Babesia spp.; B. crassa, B. major, B. occultans and B. rossi, one Borrelia spp.; B. burgdorferi sensu stricto and 3 spotted fever group rickettsiae; R. aeschlimannii, R. slovaca and R. hoogstraalii in the tick specimens analyzed. This is the report showing the presence of B. rossi in a region that is out of Africa and in the host species Ha. parva. In addition, B. crassa, for which limited information is available on its distribution and vector species, and B. occultans, for which no conclusive information is available on its presence in Turkey, were identified in Ha. parva and H. marginatum, respectively. Two human pathogenic rickettsia species (R. aeschlimannii and R. slovaca were detected with a high prevalence in ticks. Additionally, B. burgdorferi sensu stricto was detected in unusual tick species (H. marginatum, H. excavatum, Hyalomma spp. (nymph and Ha. parva.This study investigates both the distribution of several tick-borne pathogens affecting humans and animals, and the presence of new tick-borne pathogens in Turkey

  20. Identification of tick-borne pathogens in ticks feeding on humans in Turkey.

    Science.gov (United States)

    Orkun, Ömer; Karaer, Zafer; Çakmak, Ayşe; Nalbantoğlu, Serpil

    2014-08-01

    The importance of tick-borne diseases is increasing all over the world, including Turkey. The tick-borne disease outbreaks reported in recent years and the abundance of tick species and the existence of suitable habitats increase the importance of studies related to the epidemiology of ticks and tick-borne pathogens in Turkey. The aim of this study was to investigate the presence of and to determine the infection rates of some tick-borne pathogens, including Babesia spp., Borrelia burgdorferi sensu lato and spotted fever group rickettsiae in the ticks removed from humans in different parts of Ankara. A total of 169 ticks belonging to the genus Haemaphysalis, Hyalomma, Ixodes and Rhipicephalus were collected by removing from humans in different parts of Ankara. Ticks were molecularly screened for Babesia spp., Borrelia burgdorferi sensu lato and spotted fever group rickettsiae by PCR and sequencing analysis. We detected 4 Babesia spp.; B. crassa, B. major, B. occultans and B. rossi, one Borrelia spp.; B. burgdorferi sensu stricto and 3 spotted fever group rickettsiae; R. aeschlimannii, R. slovaca and R. hoogstraalii in the tick specimens analyzed. This is the report showing the presence of B. rossi in a region that is out of Africa and in the host species Ha. parva. In addition, B. crassa, for which limited information is available on its distribution and vector species, and B. occultans, for which no conclusive information is available on its presence in Turkey, were identified in Ha. parva and H. marginatum, respectively. Two human pathogenic rickettsia species (R. aeschlimannii and R. slovaca) were detected with a high prevalence in ticks. Additionally, B. burgdorferi sensu stricto was detected in unusual tick species (H. marginatum, H. excavatum, Hyalomma spp. (nymph) and Ha. parva). This study investigates both the distribution of several tick-borne pathogens affecting humans and animals, and the presence of new tick-borne pathogens in Turkey. More

  1. Ixodes scapularis Tick Saliva Proteins Sequentially Secreted Every 24 h during Blood Feeding.

    Directory of Open Access Journals (Sweden)

    Tae Kwon Kim

    2016-01-01

    Full Text Available Ixodes scapularis is the most medically important tick species and transmits five of the 14 reportable human tick borne disease (TBD agents in the USA. This study describes LC-MS/MS identification of 582 tick- and 83 rabbit proteins in saliva of I. scapularis ticks that fed for 24, 48, 72, 96, and 120 h, as well as engorged but not detached (BD, and spontaneously detached (SD. The 582 tick proteins include proteases (5.7%, protease inhibitors (7.4%, unknown function proteins (22%, immunity/antimicrobial (2.6%, lipocalin (3.1%, heme/iron binding (2.6%, extracellular matrix/ cell adhesion (2.2%, oxidant metabolism/ detoxification (6%, transporter/ receptor related (3.2%, cytoskeletal (5.5%, and housekeeping-like (39.7%. Notable observations include: (i tick saliva proteins of unknown function accounting for >33% of total protein content, (ii 79% of proteases are metalloproteases, (iii 13% (76/582 of proteins in this study were found in saliva of other tick species and, (iv ticks apparently selectively inject functionally similar but unique proteins every 24 h, which we speculate is the tick's antigenic variation equivalent strategy to protect important tick feeding functions from host immune system. The host immune responses to proteins present in 24 h I. scapularis saliva will not be effective at later feeding stages. Rabbit proteins identified in our study suggest the tick's strategic use of host proteins to modulate the feeding site. Notably fibrinogen, which is central to blood clotting and wound healing, was detected in high abundance in BD and SD saliva, when the tick is preparing to terminate feeding and detach from the host. A remarkable tick adaptation is that the feeding lesion is completely healed when the tick detaches from the host. Does the tick concentrate fibrinogen at the feeding site to aide in promoting healing of the feeding lesion? Overall, these data provide broad insight into molecular mechanisms regulating different tick

  2. Transcriptional profiling of the murine cutaneous response during initial and subsequent infestations with Ixodes scapularis nymphs

    Directory of Open Access Journals (Sweden)

    Heinze Dar M

    2012-02-01

    Full Text Available Abstract Background Ixodes scapularis ticks are hematophagous arthropods capable of transmitting many infectious agents to humans. The process of blood feeding is an extended and continuous interplay between tick and host responses. While this process has been studied extensively in vitro, no global understanding of the host response to ticks has emerged. Methods To address this issue, we used PCR-arrays to measure skin-specific expression of 233 discrete genes at 8 time points during primary and secondary infestations of mice with pathogen-free I. scapularis nymphs. Selected results were then validated at the mRNA and protein levels by additional real-time PCR and bioplex assay. Results Primary infestation was characterized by the late induction of an innate immune response. Lectin pattern recognition receptors, cytokines, and chemokines were upregulated consistent with increased neutrophil and macrophage migration. Gene ontology and pathway analyses of downregulated genes suggested inhibition of gene transcription and Th17 immunity. During the secondary infestation, additional genes were modulated suggesting a broader involvement of immune cells including CD8 and CD4 positive T lymphocytes. The cytokine response showed a mixed Th1/Th2 profile with a potential for T regulatory cell activity. Key gene ontology clusters observed during the secondary infestation were cell migration and activation. Matrix metalloproteinases were upregulated, apoptosis-related genes were differentially modulated, and immunoreceptor signaling molecules were upregulated. In contrast, transcripts related to mitogenic, WNT, Hedgehog, and stress pathways were downregulated. Conclusions Our results support a model of tick feeding where lectin pattern recognition receptors orchestrate an innate inflammatory response during primary infestation that primes a mixed Th1/Th2 response upon secondary exposure. Tick feeding inhibits gene transcription and Th17 immunity. Salivary

  3. Adverse moisture events predict seasonal abundance of Lyme disease vector ticks (Ixodes scapularis)

    Science.gov (United States)

    Berger, Kathryn A.; Ginsberg, Howard S.; Dugas, Katherine D.; Hamel, Lutz H.; Mather, Thomas N.

    2014-01-01

    Background: Lyme borreliosis (LB) is the most commonly reported vector-borne disease in north temperate regions worldwide, affecting an estimated 300,000 people annually in the United States alone. The incidence of LB is correlated with human exposure to its vector, the blacklegged tick (Ixodes scapularis). To date, attempts to model tick encounter risk based on environmental parameters have been equivocal. Previous studies have not considered (1) the differences between relative humidity (RH) in leaf litter and at weather stations, (2) the RH threshold that affects nymphal blacklegged tick survival, and (3) the time required below the threshold to induce mortality. We clarify the association between environmental moisture and tick survival by presenting a significant relationship between the total number of tick adverse moisture events (TAMEs - calculated as microclimatic periods below a RH threshold) and tick abundance each year.Methods: We used a 14-year continuous statewide tick surveillance database and corresponding weather data from Rhode Island (RI), USA, to assess the effects of TAMEs on nymphal populations of I. scapularis. These TAMEs were defined as extended periods of time (>8 h below 82% RH in leaf litter). We fit a sigmoid curve comparing weather station data to those collected by loggers placed in tick habitats to estimate RH experienced by nymphal ticks, and compiled the number of historical TAMEs during the 14-year record.Results: The total number of TAMEs in June of each year was negatively related to total seasonal nymphal tick densities, suggesting that sub-threshold humidity episodes >8 h in duration naturally lowered nymphal blacklegged tick abundance. Furthermore, TAMEs were positively related to the ratio of tick abundance early in the season when compared to late season, suggesting that lower than average tick abundance for a given year resulted from tick mortality and not from other factors.Conclusions: Our results clarify the mechanism

  4. Ixodes scapularis Tick Saliva Proteins Sequentially Secreted Every 24 h during Blood Feeding

    Science.gov (United States)

    Pinto, Antônio F. M.; Moresco, James; Yates, John R.; da Silva Vaz, Itabajara; Mulenga, Albert

    2016-01-01

    Ixodes scapularis is the most medically important tick species and transmits five of the 14 reportable human tick borne disease (TBD) agents in the USA. This study describes LC-MS/MS identification of 582 tick- and 83 rabbit proteins in saliva of I. scapularis ticks that fed for 24, 48, 72, 96, and 120 h, as well as engorged but not detached (BD), and spontaneously detached (SD). The 582 tick proteins include proteases (5.7%), protease inhibitors (7.4%), unknown function proteins (22%), immunity/antimicrobial (2.6%), lipocalin (3.1%), heme/iron binding (2.6%), extracellular matrix/ cell adhesion (2.2%), oxidant metabolism/ detoxification (6%), transporter/ receptor related (3.2%), cytoskeletal (5.5%), and housekeeping-like (39.7%). Notable observations include: (i) tick saliva proteins of unknown function accounting for >33% of total protein content, (ii) 79% of proteases are metalloproteases, (iii) 13% (76/582) of proteins in this study were found in saliva of other tick species and, (iv) ticks apparently selectively inject functionally similar but unique proteins every 24 h, which we speculate is the tick's antigenic variation equivalent strategy to protect important tick feeding functions from host immune system. The host immune responses to proteins present in 24 h I. scapularis saliva will not be effective at later feeding stages. Rabbit proteins identified in our study suggest the tick's strategic use of host proteins to modulate the feeding site. Notably fibrinogen, which is central to blood clotting and wound healing, was detected in high abundance in BD and SD saliva, when the tick is preparing to terminate feeding and detach from the host. A remarkable tick adaptation is that the feeding lesion is completely healed when the tick detaches from the host. Does the tick concentrate fibrinogen at the feeding site to aide in promoting healing of the feeding lesion? Overall, these data provide broad insight into molecular mechanisms regulating different tick

  5. Ixodes scapularis tick serine proteinase inhibitor (serpin gene family; annotation and transcriptional analysis

    Directory of Open Access Journals (Sweden)

    Chalaire Katelyn C

    2009-05-01

    Full Text Available Abstract Background Serine proteinase inhibitors (Serpins are a large superfamily of structurally related, but functionally diverse proteins that control essential proteolytic pathways in most branches of life. Given their importance in the biology of many organisms, the concept that ticks might utilize serpins to evade host defenses and immunizing against or disrupting their functions as targets for tick control is an appealing option. Results A sequence homology search strategy has allowed us to identify at least 45 tick serpin genes in the Ixodes scapularis genome that are structurally segregated into 32 intronless and 13 intron-containing genes. Nine of the intron-containing serpins occur in a cluster of 11 genes that span 170 kb of DNA sequence. Based on consensus amino acid residues in the reactive center loop (RCL and signal peptide scanning, 93% are putatively inhibitory while 82% are putatively extracellular. Among the 11 different amino acid residues that are predicted at the P1 sites, 16 sequences possess basic amino acid (R/K residues. Temporal and spatial expression analyses revealed that 40 of the 45 serpins are differentially expressed in salivary glands (SG and/or midguts (MG of unfed and partially fed ticks. Ten of the 38 serpin genes were expressed from six to 24 hrs of feeding while six and fives genes each are predominantly or exclusively expressed in either MG and SG respectively. Conclusion Given the diversity among tick species, sizes of tick serpin families are likely to be variable. However this study provides insight on the potential sizes of serpin protein families in ticks. Ticks must overcome inflammation, complement activation and blood coagulation to complete feeding. Since these pathways are regulated by serpins that have basic residues at their P1 sites, we speculate that I. scapularis may utilize some of the serpins reported in this study to manipulate host defense. We have discussed our data in the context of

  6. Bioinformatics and expression analyses of the Ixodes scapularis tick cystatin family.

    Science.gov (United States)

    Ibelli, Adriana Mércia Guaratini; Hermance, Meghan M; Kim, Tae Kwon; Gonzalez, Cassandra Lee; Mulenga, Albert

    2013-05-01

    The cystatins are inhibitors of papain- and legumain-like cysteine proteinases, classified in MEROPS subfamilies I25A-I25C. This study shows that 84 % (42/50) of tick cystatins are putatively extracellular in subfamily I25B and the rest are putatively intracellular in subfamily I25A. On the neighbor joining phylogeny guide tree, subfamily I25A members cluster together, while subfamily I25B cystatins segregate among prostriata or metastriata ticks. Two Ixodes scapularis cystatins, AAY66864 and ISCW011771 that show 50-71 % amino acid identity to metastriata tick cystatins may be linked to pathways that are common to all ticks, while ISCW000447 100 % conserved in I. ricinus is important among prostriata ticks. Likewise metastriata tick cystatins, Dermacentor variabilis-ACF35512, Rhipicephalus microplus-ACX53850, A. americanum-AEO36092, R. sanguineus-ACX53922, D. variabilis-ACF35514, R. sanguineus-ACX54033 and A. maculatum-AEO35155 that show 73-86 % amino acid identity may be essential to metastriata tick physiology. RT-PCR expression analyses revealed that I. scapularis cystatins were constitutively expressed in the salivary glands, midguts and other tissues of unfed ticks and ticks that were fed for 24-120 h, except for ISCW017861 that are restricted to the 24 h feeding time point. On the basis of mRNA expression patterns, I. scapularis cystatins, ISCW017861, ISCW011771, ISCW002215 and ISCW0024528 that are highly expressed at 24 h are likely involved in regulating early stage tick feeding events such as tick attachment onto host skin and creation of the feeding lesion. Similarly, ISCW018602, ISCW018603 and ISCW000447 that show 2-3 fold transcript increase by 120 h of feeding are likely associated with blood meal up take, while those that maintain steady state expression levels (ISCW018600, ISCW018601 and ISCW018604) during feeding may not be associated with tick feeding regulation. We discuss our findings in the context of advancing our knowledge of tick

  7. Effect of landscape features on the relationship between Ixodes ricinus ticks and their small mammal hosts.

    Science.gov (United States)

    Perez, Grégoire; Bastian, Suzanne; Agoulon, Albert; Bouju, Agnès; Durand, Axelle; Faille, Frédéric; Lebert, Isabelle; Rantier, Yann; Plantard, Olivier; Butet, Alain

    2016-01-15

    The consequences of land use changes are among the most cited causes of emerging infectious diseases because they can modify the ecology and transmission of pathogens. This is particularly true for vector-borne diseases which depend on abiotic (e.g. climate) and biotic conditions (i.e. hosts and vectors). In this study, we investigated how landscape features affect the abundances of small mammals and Ixodes ricinus ticks, and how they influence their relationship. From 2012 to 2014, small mammals and questing I. ricinus ticks were sampled in spring and autumn in 24 sites located in agricultural and forest landscapes in Brittany, France. We tested the effects of landscape features (composition and configuration) on the abundances of small mammal species and immature ticks and their relationship. Additionally, we quantified the larval tick burden of small mammals in 2012 to better describe this relationship. The nymph abundance was positively influenced by the larval occurrence and the wood mouse Apodemus sylvaticus abundance the previous spring because they hosted tenfold more larvae than the bank vole Myodes glareolus. The bank vole abundance in spring and autumn had a negative and positive effect, respectively, on the nymph abundance. In agricultural landscapes, wood mice were positively influenced by woodland cover and woodland/hedgerow-grassland ecotone, whereas bank voles showed the opposite or non-significant responses to these landscape variables. The woodland cover had a positive effect on immature ticks. The landscape configuration, likely by affecting the landscape connectivity, influences the small mammal communities in permanent habitats. Our study showed that the wood mouse, due to its dominance and to its tolerance to ticks, feeds a substantial proportion of larvae. The acquired resistance to ticks in the bank vole can reduce its role as a trophic resource over time. The nymph abundance seems indirectly influenced by landscape features via their

  8. Analysis of the Relative Expression of microRNA-10 in Different Developmental Stages and Various Tissues of Hyalomma asiaticum%亚洲璃眼蜱不同发育阶段及其组织中microRNA-10表达分析

    Institute of Scientific and Technical Information of China (English)

    袁小松; 罗金; 田占成; 谢俊仁; 王芳芳; 田美媛; 张以芳; 刘光远

    2014-01-01

    [Objective] MicroRNAs (miRNAs) are a conserved class of non-coding 20-22 nt small RNAs. miRNAs have been reported in many viruses, animals and plants such as Mareks diseased virus, fruit flies, zebra fish, humans and Arabidopsis so far. MiRNAs regulate gene expression by binding to mRNA at post-transcriptional levels, leading to mRNA inhibition or degradation. MiRNAs regulate a variety of biological processes, including cell proliferation, differentiation, metabolism and apoptosis. The purpose of this experiment is to understand the potential biological function of miR-10 in Hyalomma asiaticum. To obtain the precursor and mature of microRNA-10 (miR-10), its relative expression and the biologic significance in different developmental stages and various tissues from Hyalomma asiaticum were analyzed, which will be helpful for further study the relationship between the function of miR-10 and development of H. asiaticum. [Method] Total RNA of the different developmental stages and various tissues were extracted using Trizol Reagent, then transcripted to cDNA using SYBR ®Prime Script TM miRNA RT-PCR Kit( TaKaRa Code:RR716). To obtain the miR-10 precursor sequence from H. asiaticum, the specific primers were designed according to the miRBase database (Accession number:MI0012262). Then its homology was compared with the sequence from miRBas database by the MEGA4 software. The expression of miR-10 from different developmental stages and various tissues of H. asiaticum was assessed by qPCR. The biological function of miR-10 in H. asiaticum was presumed.[Result]A 73 bp gene was cloned by PCR, which was CUACAUCUACCCUGUAGAUCCGAAUUUGUUUGCCA CUAGACUACAAAUUCGGUUCUAGAGAGGCUUUGUGUGG. There was a relatively high genetic similarity among 16 varieties. The similarity between H. asiaticum and Ixodes scapularis was 95.9%, and 88.9%-91.7% compared with other arthropods. The miR-10 sequence was highly conserved in various species. The mature sequence of miR-10 was UACCCUGUAGAUCCGAAUUUGU

  9. Genome scaffolding and annotation for the pathogen vector Ixodes ricinus by ultra-long single molecule sequencing.

    Science.gov (United States)

    Cramaro, Wibke J; Hunewald, Oliver E; Bell-Sakyi, Lesley; Muller, Claude P

    2017-02-08

    Global warming and other ecological changes have facilitated the expansion of Ixodes ricinus tick populations. Ixodes ricinus is the most important carrier of vector-borne pathogens in Europe, transmitting viruses, protozoa and bacteria, in particular Borrelia burgdorferi (sensu lato), the causative agent of Lyme borreliosis, the most prevalent vector-borne disease in humans in the Northern hemisphere. To faster control this disease vector, a better understanding of the I. ricinus tick is necessary. To facilitate such studies, we recently published the first reference genome of this highly prevalent pathogen vector. Here, we further extend these studies by scaffolding and annotating the first reference genome by using ultra-long sequencing reads from third generation single molecule sequencing. In addition, we present the first genome size estimation for I. ricinus ticks and the embryo-derived cell line IRE/CTVM19. 235,953 contigs were integrated into 204,904 scaffolds, extending the currently known genome lengths by more than 30% from 393 to 516 Mb and the N50 contig value by 87% from 1643 bp to a N50 scaffold value of 3067 bp. In addition, 25,263 sequences were annotated by comparison to the tick's North American relative Ixodes scapularis. After (conserved) hypothetical proteins, zinc finger proteins, secreted proteins and P450 coding proteins were the most prevalent protein categories annotated. Interestingly, more than 50% of the amino acid sequences matching the homology threshold had 95-100% identity to the corresponding I. scapularis gene models. The sequence information was complemented by the first genome size estimation for this species. Flow cytometry-based genome size analysis revealed a haploid genome size of 2.65Gb for I. ricinus ticks and 3.80 Gb for the cell line. We present a first draft sequence map of the I. ricinus genome based on a PacBio-Illumina assembly. The I. ricinus genome was shown to be 26% (500 Mb) larger than the genome of its

  10. Dominance of Dermacentor reticulatus over Ixodes ricinus (Ixodidae) on livestock, companion animals and wild ruminants in eastern and central Poland.

    Science.gov (United States)

    Mierzejewska, Ewa J; Welc-Faleciak, Renata; Karbowiak, Grzegorz; Kowalec, Maciej; Behnke, Jerzy M; Bajer, Anna

    2015-05-01

    The most common tick species parasitizing animals in Poland are Ixodes ricinus and Dermacentor reticulatus. These tick species differ in their distribution, habitats, seasonal activity and host specificity. Ixodes ricinus is the most prevalent and widely distributed, whereas the range of D. reticulatus is limited to eastern and central parts of the country with several new foci in the middle-west and the west. However, as in many central European countries, the range of D. reticulatus is expanding, and some authors have correlated this expansion with an increasing number of available hosts. The aim of the present study was to determine the tick fauna on domestic and livestock animals in two areas endemic for I. ricinus and D. reticulatus and to compare the risk of infestation with different tick species in open and forest areas. Over a 14 month period, 732 ticks were collected from five host species including domestic animals (dogs and cats), livestock (cows and horses) and wildlife (European bison) in two areas, central and NE Poland, endemic for D. reticulatus. Three tick species were recorded: D. reticulatus (623 individuals; 85.1% of all collected ticks), I. ricinus (106 individuals; 14.5%) and three females of Ixodes hexagonus (0.4%) from a dog. Dermacentor reticulatus was the dominant tick species found on four host species and constituted 86, 81, 97 and 100% of all ticks from dogs, horses, cows and bison, respectively, and was collected from animals throughout the year, including during the winter. The common tick, I. ricinus, was the dominant tick collected from cats (94%). Fully-engorged, ready-for-reproduction females of D. reticulatus were collected from all host species. In May 2012, questing ticks were collected by dragging in forest or open habitats. The density of adult marsh ticks in open areas was around 2 ticks/100 m(2) in the majority of locations, with a maximum of 9.5 ticks/100 m(2). The density of adult I. ricinus was much lower in its typical

  11. Ixodes ricinus is not an epidemiologically relevant vector of Bartonella species in the wood mouse (Apodemus sylvaticus).

    Science.gov (United States)

    Harrison, Alan; Bown, Kevin J; Montgomery, W Ian; Birtles, Richard J

    2012-05-01

    Bartonella are hemoparasites exploiting a range of mammals as reservoir hosts. Several species are zoonotic pathogens. Fleas, lice, and other arthropods, such as ticks, have been implicated as vectors. While the competence of ticks as vectors of Bartonella species has recently been demonstrated, the epidemiological significance of ticks as vectors of Bartonella species in wildlife populations remains unknown. We used the presence of deer at study sites to control the presence of Ixodes ricinus ticks, and used this system to determine whether I. ricinus contributes to the epidemiology of Bartonella species infections in small mammals. Ticks were present at all sites with deer, but were absent from all sites without deer; however, the abundance of ticks on small mammals did not affect the probability of wood mice being infected with Bartonella species. Data presented here indicate that I. ricinus is not involved in the transmission of Bartonella in woodland rodents.

  12. Molecular detection of Rickettsia, Borrelia, and Babesia species in Ixodes ricinus sampled in northeastern, central, and insular areas of Italy.

    Science.gov (United States)

    Castro, Lyda R; Gabrielli, Simona; Iori, Albertina; Cancrini, Gabriella

    2015-07-01

    The aim of the present study was to provide insight into the diversity of tick-borne pathogens circulating in Italy, carried/transmitted by Ixodes ricinus, one of the most abundant tick species in the country. A total of 447 specimens sampled in five areas of northeastern, central and insular Italy were analysed by polymerase chain reaction and sequencing for the presence of rickettsiae, borreliae and babesiae. Several rickettsial species of the spotted fever group of zoonotic concern and other zoonotic pathogens were found, such as Borrelia burgdorferi s.s., Borrelia afzelii, Borrelia garinii, and Babesia venatorum. These findings confirm a wide distribution of tick-borne bacterial and protozoan species in Italy, and highlight the sanitary importance of I. ricinus, often recorded as feeding on humans.

  13. Detection of Borrelia-specific 16S rRNA sequence in total RNA extracted from Ixodes ricinus ticks

    Directory of Open Access Journals (Sweden)

    Ž. Radulović

    2010-08-01

    Full Text Available A reverse transcriptase - polymerase chain reaction based assay for Borrelia species detection in ticks was developed. The method was based on amplification of 552 nucleotide bases long sequence of 16S rRNA, targeted by Borrelia specific primers. In the present study, total RNA extracted from Ixodes ricinus ticks was used as template. The results showed higher sensitivity for Borrelia detection as compared to standard dark-field microscopy. Method specificity was confirmed by cloning and sequencing of obtained 552 base pairs long amplicons. Phylogenetic analysis of obtained sequences showed that they belong to B. lusitaniae and B. afzelii genospecies. RT-PCR based method presented in this paper could be very useful as a screening test for detecting pathogen presence, especially when in investigations is required extraction of total RNA from ticks.

  14. Relationships between maternal engorgement weight and the number, size, and fat content of larval Ixodes scapularis (Acari: Ixodidae)

    Science.gov (United States)

    Ginsberg, Howard; Lee, Chong; Volson, Barry; Dyer, Megan C.; LeBrun, Roger A.

    2017-01-01

    The relationship between engorgement weight of female Ixodes scapularis Say and characteristics of offspring was studied using field-collected females fed on rabbits in the laboratory. The number of eggs laid was positively related to maternal engorgement weight in one trial, and larval size (estimated by scutal area) was positively related to maternal engorgement weight in the other. These results suggest a trade-off in number of eggs produced versus average size of offspring, possibly determined during late engorgement. The adults for the two trials were collected from different sites in southern Rhode Island and in different seasons (the fall adults were newly emerged, while the spring adults had presumably lived through the winter), so it is not clear whether these results reflect genetic differences or subtle environmental differences between trials. Percent egg hatch and average fat content of larvae were not related to female engorgement weight. We present a modified method to measure lipid content of pooled larval ticks.

  15. Large scale spatial risk and comparative prevalence of Borrelia miyamotoi and Borrelia burgdorferi sensu lato in Ixodes pacificus.

    Directory of Open Access Journals (Sweden)

    Kerry Padgett

    Full Text Available Borrelia miyamotoi is a newly described emerging pathogen transmitted to people by Ixodes species ticks and found in temperate regions of North America, Europe, and Asia. There is limited understanding of large scale entomological risk patterns of B. miyamotoi and of Borreila burgdorferi sensu stricto (ss, the agent of Lyme disease, in western North America. In this study, B. miyamotoi, a relapsing fever spirochete, was detected in adult (n=70 and nymphal (n=36 Ixodes pacificus ticks collected from 24 of 48 California counties that were surveyed over a 13 year period. Statewide prevalence of B. burgdorferi sensu lato (sl, which includes B. burgdorferi ss, and B. miyamotoi were similar in adult I. pacificus (0.6% and 0.8%, respectively. In contrast, the prevalence of B. burgdorferi sl was almost 2.5 times higher than B. miyamotoi in nymphal I. pacificus (3.2% versus 1.4%. These results suggest similar risk of exposure to B. burgdorferi sl and B. miyamotoi from adult I. pacificus tick bites in California, but a higher risk of contracting B. burgdorferi sl than B. miyamotoi from nymphal tick bites. While regional risk of exposure to these two spirochetes varies, the highest risk for both species is found in north and central coastal California and the Sierra Nevada foothill region, and the lowest risk is in southern California; nevertheless, tick-bite avoidance measures should be implemented in all regions of California. This is the first study to comprehensively evaluate entomologic risk for B. miyamotoi and B. burgdorferi for both adult and nymphal I. pacificus, an important human biting tick in western North America.

  16. A multi-level analysis of the relationship between environmental factors and questing Ixodes ricinus dynamics in Belgium

    Directory of Open Access Journals (Sweden)

    Li Sen

    2012-07-01

    Full Text Available Abstract Background Ticks are the most important pathogen vectors in Europe. They are known to be influenced by environmental factors, but these links are usually studied at specific temporal or spatial scales. Focusing on Ixodes ricinus in Belgium, we attempt to bridge the gap between current “single-sided” studies that focus on temporal or spatial variation only. Here, spatial and temporal patterns of ticks are modelled together. Methods A multi-level analysis of the Ixodes ricinus patterns in Belgium was performed. Joint effects of weather, habitat quality and hunting on field sampled tick abundance were examined at two levels, namely, sampling level, which is associated with temporal dynamics, and site level, which is related to spatial dynamics. Independent variables were collected from standard weather station records, game management data and remote sensing-based land cover data. Results At sampling level, only a marginally significant effect of daily relative humidity and temperature on the abundance of questing nymphs was identified. Average wind speed of seven days prior to the sampling day was found important to both questing nymphs and adults. At site level, a group of landscape-level forest fragmentation indices were highlighted for both questing nymph and adult abundance, including the nearest-neighbour distance, the shape and the aggregation level of forest patches. No cross-level effects or spatial autocorrelation were found. Conclusions Nymphal and adult ticks responded differently to environmental variables at different spatial and temporal scales. Our results can advise spatio-temporal extents of environment data collection for continuing empirical investigations and potential parameters for biological tick models.

  17. Association of environmental traits with the geographic ranges of ticks (Acari: Ixodidae) of medical and veterinary importance in the western Palearctic. A digital data set.

    Science.gov (United States)

    Estrada-Peña, A; Farkas, Robert; Jaenson, Thomas G T; Koenen, Frank; Madder, Maxime; Pascucci, Ilaria; Salman, Mo; Tarrés-Call, Jordi; Jongejan, Frans

    2013-03-01

    We compiled information on the distribution of ticks in the western Palearctic (11°W, 45°E; 29°N, 71°N), published during 1970-2010. The literature search was filtered by the tick's species name and an unambiguous reference to the point of capture. Records from some curated collections were included. We focused on tick species of importance to human and animal health, in particular: Ixodes ricinus, Dermacentor marginatus, D. reticulatus, Haemaphysalis punctata, H. sulcata, Hyalomma marginatum, Hy. lusitanicum, Rhipicephalus annulatus, R. bursa, and the R. sanguineus group. A few records of other species (I. canisuga, I. hexagonus, Hy. impeltatum, Hy. anatolicum, Hy. excavatum, Hy. scupense) were also included. A total of 10,280 records was included in the data set. Almost 42 % of published references are not adequately referenced (and not included in the data set), host is reported for only 61 % of records and a reference to time of collection is missed for 84 % of published records. Ixodes ricinus accounted for 44.3 % of total records, with H. marginatum and D. marginatus accounting for 7.1 and 8.1 % of records, respectively. The lack of homogeneity of the references and potential pitfalls in the compilation were addressed to create a digital data set of the records of the ticks. We attached to every record a coherent set of quantitative descriptors for the site of reporting, namely gridded interpolated monthly climate and remotely sensed data on vegetation (NDVI). We also attached categorical descriptors of the habitat: a standard classification of land biomes and an ad hoc classification of the target territory from remotely sensed temperature and NDVI data. A descriptive analysis of the data revealed that a principal components reduction of the environmental (temperature and NDVI) variables described the distribution of the species in the target territory. However, categorical descriptors of the habitat were less effective. We stressed the importance of

  18. Tick repellents and acaricides of botanical origin: a green roadmap to control tick-borne diseases?

    Science.gov (United States)

    Benelli, Giovanni; Pavela, Roman; Canale, Angelo; Mehlhorn, Heinz

    2016-07-01

    Arthropods are dangerous vectors of agents of deadly diseases, which may hit as epidemics or pandemics in the increasing world population of humans and animals. Among them, ticks transmit more pathogen species than any other group of blood-feeding arthropods worldwide. Thus, the effective and eco-friendly control of tick vectors in a constantly changing environment is a crucial challenge. A number of novel routes have been attempted to prevent and control tick-borne diseases, including the development of (i) vaccines against viruses vectored by ticks; (ii) pheromone-based control tools, with special reference to the "lure and kill" techniques; (iii) biological control programmes relying on ticks' natural enemies and pathogens; and (iv) the integrated pest management practices aimed at reducing tick interactions with livestock. However, the extensive employment of acaricides and tick repellents still remains the two most effective and ready-to-use strategies. Unfortunately, the first one is limited by the rapid development of resistance in ticks, as well as by serious environmental concerns. On the other hand, the exploitation of plants as sources of effective tick repellents is often promising. Here, we reviewed current knowledge concerning the effectiveness of plant extracts as acaricides or repellents against tick vectors of public health importance, with special reference to Ixodes ricinus, Ixodes persulcatus, Amblyomma cajennense, Haemaphysalis bispinosa, Haemaphysalis longicornis, Hyalomma anatolicum, Hyalomma marginatum rufipes, Rhipicephalus appendiculatus, Rhipicephalus (Boophilus) microplus, Rhipicephalus pulchellus, Rhipicephalus sanguineus and Rhipicephalus turanicus. Eighty-three plant species from 35 botanical families were selected. The most frequent botanical families exploited as sources of acaricides and repellents against ticks were Asteraceae (15 % of the selected studies), Fabaceae (9 %), Lamiaceae (10 %), Meliaceae (5 %), Solanaceae (6

  19. Immediate efficacy and persistent speed of kill of a novel oral formulation of afoxolaner (NexGardTM) against induced infestations with Ixodes ricinus ticks

    OpenAIRE

    Halos, Lénaïg; Lebon, Wilfried; Chalvet-Monfray, Karine; Larsen, Diane; Beugnet, Frederic

    2014-01-01

    Background Ticks are hematophageous arthropods that transmit a wide spectrum of pathogens to human and animals. The ability of an acaricidal product to kill ticks quickly provides an important added benefit, especially as protecting dogs from tick bites remains the best preventive measure against tick-borne diseases. The speed of kill of afoxolaner in a novel soft chewable formulation (NexGardTM) against induced infestations with Ixodes ricinus adult ticks was evaluated during a full-month ne...

  20. Description of the immature stages and redescription of the female of Ixodes schulzei Aragão & Fonseca, 1951 (Acari: Ixodidae), an endemic tick species of Brazil.

    Science.gov (United States)

    Barros-Battesti, Darci M; Onofrio, Valeria C; Faccini, João L H; Labruna, Marcelo B; Arruda-Santos, Ana D; Giacomin, Flávia G

    2007-11-01

    Ixodes schulzei Aragão & Fonseca, 1951 is a tick endemic to Brazil, where nine species of Ixodes Latreille, 1796 are currently known to occur. Larvae, nymphs and females of I. schulzei were obtained from a laboratory colony originating from an engorged female collected on a free-living water rat Nectomys squamipes from the Santa Branca municipality, São Paulo State. Only female ticks were obtained from engorged nymphs. Unfed immature and female adult specimens were measured and the descriptions were based on optical and scanning electron microscopy, as were drawings of some features of the larva. Both immature stages present the very long palpi and basis capituli, and the female has large, contiguous porose areas. However, the basis capituli is triangular, with a slight central elevation in the larva and nymph, whereas in the female this area is depressed. The I. schulzei types deposited at the FIOCRUZ (Instituto Oswaldo Cruz) were also examined, as was other material from collections, such as the IBSP (Coleção Acarológica do Instituto Butantan), CNC-FMVZ/USP (Coleção Nacional de Carrapatos da Faculdade de Medicina Veterinária e Zootecnia da USP) and USNTC (United States National Tick Collection). In addition, the relationship between I. schulzei and other immature neotropical species of Ixodes is discussed.

  1. Tick Thioester-Containing Proteins and Phagocytosis Do Not Affect Transmission of Borrelia afzelii from the Competent Vector Ixodes ricinus

    Science.gov (United States)

    Urbanová, Veronika; Hajdušek, Ondřej; Hönig Mondeková, Helena; Šíma, Radek; Kopáček, Petr

    2017-01-01

    The present concept of the transmission of Lyme disease from Borrelia-infected Ixodes sp. ticks to the naïve host assumes that a low number of spirochetes that manage to penetrate the midgut epithelium migrate through the hemocoel to the salivary glands and subsequently infect the host with the aid of immunomodulatory compounds present in tick saliva. Therefore, humoral and/or cellular immune reactions within the tick hemocoel may play an important role in tick competence to act as a vector for borreliosis. To test this hypothesis we have examined complement-like reactions in the hemolymph of the hard tick Ixodes ricinus against Borrelia afzelii (the most common vector and causative agent of Lyme disease in Europe). We demonstrate that I. ricinus hemolymph does not exhibit borreliacidal effects comparable to complement-mediated lysis of bovine sera. However, after injection of B. afzelii into the tick hemocoel, the spirochetes were efficiently phagocytosed by tick hemocytes and this cellular defense was completely eliminated by pre-injection of latex beads. As tick thioester-containing proteins (T-TEPs) are components of the tick complement system, we performed RNAi-mediated silencing of all nine genes encoding individual T-TEPs followed by in vitro phagocytosis assays. Silencing of two molecules related to the C3 complement component (IrC3-2 and IrC3-3) significantly suppressed phagocytosis of B. afzelii, while knockdown of IrTep (insect type TEP) led to its stimulation. However, RNAi-mediated silencing of T-TEPs or elimination of phagocytosis by injection of latex beads in B. afzelii-infected I. ricinus nymphs had no obvious impact on the transmission of spirochetes to naïve mice, as determined by B. afzelii infection of murine tissues following tick infestation. This result supports the concept that Borrelia spirochetes are capable of avoiding complement-related reactions within the hemocoel of ticks competent to transmit Lyme disease. PMID:28361038

  2. No Observed Effect of Landscape Fragmentation on Pathogen Infection Prevalence in Blacklegged Ticks (Ixodes scapularis in the Northeastern United States.

    Directory of Open Access Journals (Sweden)

    Christine P Zolnik

    Full Text Available Pathogen prevalence within blacklegged ticks (Ixodes scapularis Say, 1821 tends to vary across sites and geographic regions, but the underlying causes of this variation are not well understood. Efforts to understand the ecology of Lyme disease have led to the proposition that sites with higher host diversity will result in lower disease risk due to an increase in the abundance of inefficient reservoir species relative to the abundance of species that are highly competent reservoirs. Although the Lyme disease transmission cycle is often cited as a model for this "dilution effect hypothesis", little empirical evidence exists to support that claim. Here we tested the dilution effect hypothesis for two pathogens transmitted by the blacklegged tick along an urban-to-rural gradient in the northeastern United States using landscape fragmentation as a proxy for host biodiversity. Percent impervious surface and habitat fragment size around each site were determined to assess the effect of landscape fragmentation on nymphal blacklegged tick infection with Borrelia burgdorferi and Anaplasma phagocytophilum. Our results do not support the dilution effect hypothesis for either pathogen and are in agreement with the few studies to date that have tested this idea using either a landscape proxy or direct measures of host biodiversity.

  3. Evaluation of the efficacy of afoxolaner against two European dog tick species: Dermacentor reticulatus and Ixodes ricinus.

    Science.gov (United States)

    Dumont, Pascal; Blair, Jeffrey; Fourie, Josephus J; Chester, Theodore S; Larsen, Diane L

    2014-04-02

    The acaricidal efficacy of a novel oral formulation of afoxolaner (NEXGARD(®), Merial) against two European tick species was assessed in dogs experimentally infested with Ixodes ricinus and Dermacentor reticulatus. Three studies, each characterized by a negative controlled randomized block design, were conducted with a total of 52 beagle or mongrel dogs of both sexes. Starting 2 days before treatment, each dog was infested weekly with approximately 50 ticks. The number of live ticks was counted at 48 h post-treatment (Day 2) as well as 48 h following each infestation on Days 9, 16, 23, and 30. Afoxolaner, administered at an average dose of 2.7 mg/kg bodyweight (range 2.5-2.9 mg/kg), rapidly eliminated the pre-existing tick infestations with over 99% acaricidal efficacy and controlled the weekly re-infestations for up to 30 days post treatment with over 96% efficacy on both tick species. Afoxolaner provides excellent acaricidal efficacy against these two major European tick species using the oral route of administration.

  4. Geographical distribution and prevalence of Borrelia burgdorferi genospecies in questing Ixodes ricinus from Romania: a countrywide study.

    Science.gov (United States)

    Kalmár, Zsuzsa; Mihalca, Andrei D; Dumitrache, Mirabela O; Gherman, Călin M; Magdaş, Cristian; Mircean, Viorica; Oltean, Miruna; Domşa, Cristian; Matei, Ioana A; Mărcuţan, Daniel I; Sándor, Attila D; D'Amico, Gianluca; Paştiu, Anamaria; Györke, Adriana; Gavrea, Raluca; Marosi, Béla; Ionică, Angela; Burkhardt, Etelka; Toriay, Hortenzia; Cozma, Vasile

    2013-09-01

    The paper reports the prevalence and geographical distribution of Borrelia burgdorferi sensu lato (s.l.) and its genospecies in 12,221 questing Ixodes ricinus ticks collected at 183 locations from all the 41 counties of Romania. The unfed ticks were examined for the presence of B. burgdorferi s.l. by PCR targeting the intergenic spacer 5S-23S. Reverse line blot hybridization (RLB) and restriction fragment length polymorphism (RFLP) analysis were performed for identification of B. burgdorferi genospecies. The overall prevalence of infection was 1.4%, with an average local prevalence between 0.75% and 18.8%. B. burgdorferi s.l. was found in ticks of 55 of the 183 localities. The overall prevalence B. burgdorferi s.l. in ticks in the infected localities was 3.8%. The total infection prevalence was higher in female ticks than in other developmental stages. Three Borrelia genospecies were detected. The most widely distributed genospecies was B. afzelii, followed by B. garinii and B. burgdorferi sensu stricto (s.s.). The study is the first countrywide study and the first report of B. burgdorferi s.s. in Romania. The distribution maps show that higher prevalences were recorded in hilly areas, but Lyme borreliosis spirochetes were also present in forested lowlands, albeit with a lower prevalence.

  5. Detection of Babesia microti and Borrelia burgdorferi in host-seeking Ixodes scapularis (Acari: Ixodidae) in Monmouth County, New Jersey.

    Science.gov (United States)

    Schulze, Terry L; Jordan, Robert A; Healy, Sean P; Roegner, Vivien E

    2013-03-01

    The etiological agents that cause human babesiosis (Babesia microti) and Lyme disease (Borrelia burgdorferi) share a common tick vector (Ixodes scapularis Say) and rodent reservoir (Peromyscus leucopus), but because the geographical distribution of babesiosis is more restricted than Lyme disease, it was not considered a nationally notifiable disease until 2011. Although recent studies have shown dramatic increases in the number of cases of babesiosis and expansion of its range, little is known about infection and coinfection prevalence of these pathogens in the primary tick vector. Of the 478 I. scapularis nymphs collected within six Monmouth County, NJ, municipalities between 2004 and 2006, 4.0 and 10.0% were infected with B. microti and B. burgdorferi, respectively, while 2.9% were coinfected. Analysis of the 610 I. scapularis adults collected during the same period yielded an infection prevalence of 8.2% for B. microti and 45.2% for B. burgdorferi, while 6.2% were coinfected. The potential public health importance of these findings is discussed.

  6. Sympatric occurrence of Ixodes ricinus, Dermacentor reticulatus and Haemaphysalis concinna ticks and Rickettsia and Babesia species in Slovakia.

    Science.gov (United States)

    Svehlová, Andrea; Berthová, Lenka; Sallay, Balázs; Boldiš, Vojtech; Sparagano, Olivier A E; Spitalská, Eva

    2014-09-01

    Vojka nad Dunajom in the south-west of the Slovak Republic is a locality with sympatric occurrence of 3 species of ticks. This study investigated the spatial distribution of Dermacentor reticulatus, Ixodes ricinus, and Haemaphysalis concinna ticks in this area and determined the prevalence of Babesia and Rickettsia species in questing adults of these tick species considered as potential risk for humans and animals. Ticks were collected by blanket dragging over the vegetation from September 2011 to October 2012. All ticks were subjected to DNA extraction and individually assayed with PCR-based methods targeting the gltA, sca4, 23S rRNA genes of Rickettsia spp. and the 18S rRNA gene of Babesia spp. D. reticulatus was the dominant species occurring in this area (67.7%, n=600), followed by I. ricinus (31.8%, n=282) and H. concinna (0.5%, n=4) ticks. Rickettsial infection was determined in 10.8% (n=65) and 11.7% (n=33) of D. reticulatus and I. ricinus ticks, respectively. Babesia spp. infection was confirmed in 1.8% (n=11) of D. reticulatus and 0.4% (n=1) of I. ricinus ticks. DNA of 6 different pathogenic tick-borne species, Rickettsia helvetica, Rickettsia monacensis, Rickettsia slovaca, Rickettsia raoultii, Babesia canis, and Babesia venatorum were identified in this locality with sympatric occurrence of I. ricinus, D. reticulatus, and H. concinna ticks.

  7. Receptors for the neuropeptides, myoinhibitory peptide and SIFamide, in control of the salivary glands of the blacklegged tick Ixodes scapularis.

    Science.gov (United States)

    Simo, Ladislav; Koči, Juraj; Park, Yoonseong

    2013-04-01

    Tick salivary glands are important organs that enable the hematophagous feeding of the tick. We previously described the innervation of the salivary gland acini types II and III by a pair of protocerebral salivary gland neurons that produce both myoinhibitory peptide (MIP) and SIFamide (Šimo et al., 2009b). In this study we identified authentic receptors expressed in the salivary glands for these neuropeptides. Homology-based searches for these receptors in the Ixodes scapularis genome sequence were followed by gene cloning and functional expression of the receptors. Both receptors were activated by low nanomolar concentrations of their respective ligands. The temporal expression patterns of the two ligands and their respective receptors suggest that the SIFamide signaling system pre-exists in unfed salivary glands, while the MIP system is activated upon initiation of feeding. Immunoreactivity for the SIFamide receptor in the salivary gland was detected in acini types II and III, surrounding the acinar valve and extending to the basal region of the acinar lumen. The location of the SIFamide receptor in the salivary glands suggests three potential target cell types and their probable functions: myoepithelial cell that may function in the contraction of the acini and/or the control of the valve; large, basally located dopaminergic granular cells for regulation of paracrine dopamine; and neck cells that may be involved in the control of the acinar duct and its valve.

  8. Molecular Phylogeny of a tick, Ixodes granulatus (Acari: Ixodidae) based on cytochrome oxidase subunit I (COI) marker

    Science.gov (United States)

    Lah, Ernieenor Faraliana Che; Yaakop, Salmah; Ahamad, Mariana; George, Ernna; Nor, Shukor Md

    2014-09-01

    Identification of a local species of tick, Ixodes granulatus from the family Ixodidae is essential because it has potential to be vector for spotted fever group (SFG) rickettsia and tick thypus. The aim of this study is to portray the relationships among several populations of I. granulatus collected from different species of animal hosts and localities in Peninsular Malaysia. Polymerase Chain Reaction was conducted by amplifying mitochondrial DNA marker, namely cytochrome oxidase subunit I (COI) sequences from 15 individual ticks that attached to five different hosts caught from three different localities. Confirmation of the species identity was accomplished using BLAST program. Neighbor-joining (NJ) and Maximum Parsimony (MP) tree based on COI sequences were constructed by using PAUP 4.0b10 to identify the relationship among species. The result of this study showed a high genetic heterogeneity between I. granulatus and other species of the same genus (7.2-23.7%). Furthermore, a low intraspecific variation was observed among the species of I. granulatus collected from different localities (0-3.7%). This study produced the first establishment of molecular marker for clarifying genetic species variation and diversity of local I. granulatus tick which contribute to the control of tick-borne infections.

  9. 'Candidatus Rickettsia mendelii', a novel basal group rickettsia detected in Ixodes ricinus ticks in the Czech Republic.

    Science.gov (United States)

    Hajduskova, Eva; Literak, Ivan; Papousek, Ivo; Costa, Francisco B; Novakova, Marketa; Labruna, Marcelo B; Zdrazilova-Dubska, Lenka

    2016-04-01

    A novel rickettsial sequence in the citrate synthase gltA gene indicating a novel Rickettsia species has been detected in 7 out of 4524 Ixodes ricinus ticks examined within several surveys performed in the Czech Republic from 2005 to 2009. This new Candidatus Rickettsia sp. sequence has been found in 2 nymphs feeding on wild birds (Luscinia megarhynchos and Erithacus rubecula), in a male tick from vegetation, and 4 ticks feeding on a dog (3 males, 1 female tick). Portions of the ompA, ompB, sca4, and htrA genes were not amplifiable in these samples. A maximum likelihood tree of rickettsiae based on comparisons of partial amino acid sequences of citrate synthase and nucleotide sequences of 16S rDNA genes and phylogenetic analysis revealed a basal position of the novel species in the proximity of R. bellii and R. canadensis. The novel species has been named 'Candidatus Rickettsia mendelii' after the founder of genetics, Gregor Mendel. Copyright © 2016 Elsevier GmbH. All rights reserved.

  10. Dermatologic changes induced by repeated Ixodes scapularis bites and implications for prevention of tick-borne infection.

    Science.gov (United States)

    Krause, Peter J; Grant-Kels, Jane M; Tahan, Steven R; Dardick, Kenneth R; Alarcon-Chaidez, Francisco; Bouchard, Keith; Visini, Christine; Deriso, Cindy; Foppa, Ivo M; Wikel, Stephen

    2009-12-01

    Previous studies in rodents and people have demonstrated that repeated tick exposure is associated with reduced Borrelia burgdorferi transmission but the mechanism of prevention remains unclear. We examined the acute histopathologic reactions to initial and repeated Ixodes scapularis bites in BALB/c mice and in people. Skin biopsies of BALB/c mice infested for the first time by I. scapularis nymphs revealed vascular dilatation and an accumulation of inflammatory cells adjacent to the bite site but absent at the site of tick attachment. Such changes would enhance tick-borne pathogen transmission. Mice reexposed to I. scapularis nymphs experienced a decrease in vascular dilatation and a marked increase in inflammatory cells at the site of tick attachment. Skin biopsies of people with attached I. scapularis nymphs revealed similar histologic patterns. These results indicate that cellular changes at the tick-dermal interface following I. scapularis attachment are likely to allow for successful transmission of tick-borne pathogens in non-tick-immune hosts and to inhibit tick-borne pathogen transmission in hosts that have developed tick immunity.

  11. Saturation deficit and deer density affect questing activity and local abundance of Ixodes ricinus (Acari, Ixodidae) in Italy.

    Science.gov (United States)

    Tagliapietra, V; Rosà, R; Arnoldi, D; Cagnacci, F; Capelli, G; Montarsi, F; Hauffe, H C; Rizzoli, A

    2011-12-29

    The wood tick Ixodes ricinus, one of the most common arthropod-borne disease vectors, is of increasing relevance for human and animal health in Europe. The aim of this study was to determine the relative contribution of several abiotic and biotic factors potentially affecting questing activity and local abundance of I. ricinus in Italy, considering the scale at which these factors interact with the host-seeking ticks. Within EDEN, a large-scale EU collaborative project on eco-epidemiology of vector-borne diseases, we collected questing ticks for three consecutive years using a standard protocol at eleven sites in the Italian Alps and Apennines. A total of 25 447 I. ricinus were collected. All sites showed the same annual pattern of tick activity (bimodal for nymphs and unimodal for larvae and adults), although the abundance of nymphs was statistically different between sites and years. A Generalized Linear Mixed Model and a Linear Mixed Model fitted to data for nymphs, showed that while the principal variables affecting the local abundance of questing ticks were saturation deficit (an index combining temperature and relative humidity) and red deer density, the most important variable affecting questing nymph activity was saturation deficit. As for the timing of seasonal emergence, we confirmed that the threshold temperature at this latitude for larvae is 10°C (mean maximum) while that for nymphs is 8°C.

  12. Detection and prevalence of Anaplasma phagocytophilum and Rickettsia helvetica in Ixodes ricinus ticks in seven study areas in Sweden

    Directory of Open Access Journals (Sweden)

    Falk Kerstin

    2010-08-01

    Full Text Available Abstract Background Tick-borne Anaplasma phagocytophilum and Rickettsia spp. are considered to be emerging human pathogens, but only limited data are available on their occurrence in Sweden. Two real-time PCR assays followed by nested PCR and sequence analysis were carried out to investigate the prevalence of A. phagocytophilum and spotted fever rickettsiae in ticks from seven areas in Sweden. Results In 139 pooled samples, representing a total of 1245 Ixodes ricinus ticks (204 larvae, 963 nymphs, 38 males, 40 females, the overall positive mean infection prevalence was 1.3-15.0% for A. phagocytophilum and 1.5-17.3% for R. helvetica. A. phagocytophilum was only detected in nymphs (1.7-19.4%, whereas R. helvetica was detected in all three tick stages. Support for vertical and transstadial transmission was only obtained for R. helvetica. Both agents showed similar infection rates across study areas, although infection rates were greater in coastal areas. Conclusions The results show that both pathogens occurred in all seven locations, indicating that they are prevalent in Sweden and should be considered etiological agents in patients recently bitten by ticks.

  13. Insights into the development of Ixodes scapularis: a resource for research on a medically important tick species.

    Science.gov (United States)

    Kocan, Katherine M; de la Fuente, José; Coburn, Lisa A

    2015-11-14

    Ticks (Acari: Ixodida) are arthropod ectoparasites dependent on a bloodmeal from a vertebrate host at each developmental stage for completion of their life cycle. This tick feeding cycle impacts animal health by causing damage to hides, secondary infections, immune reactions and diseases caused by transmission of pathogens. The genus Ixodes includes several medically important species that vector diseases, including granulocytic anaplasmosis and Lyme disease. I. scapularis, commonly called the black-legged or deer tick, is a medically-important tick species in North America and therefore was the first tick genome to be sequenced, thus serving as an important resource for tick research. This Primer focuses on the normal developmental cycle and laboratory rearing of I. scapularis. Definition of normal morphology, along with a consistent source of laboratory-reared I. scapularis, are fundamental for all aspects of future research, especially the effects of genetic manipulation and the evaluation of tick vaccine efficacy. Recent research important for the advancement of tick research, namely the development of tick cell culture systems for study of ticks and tick-borne pathogens, RNA interference for genetic manipulation of ticks and discovery of candidate antigens for development of tick vaccines, are briefly presented along with areas to target for future research.

  14. Detection of a spotted fever group Rickettsia in the tick Ixodes tasmani collected from koalas in Port Macquarie, Australia.

    Science.gov (United States)

    Vilcins, Inger-Marie E; Old, Julie M; Deane, Elizabeth M

    2008-07-01

    Four species of Rickettsia are recognized as endemic to Australia. This study reports the detection of a new spotted fever group Rickettsia in the common marsupial tick Ixodes tasmani Neumann collected from koalas (Phascolarctos cinereus) in Port Macquarie, NSW, Australia. Based on the results of polymerase chain reaction (PCR) amplification of extracted tick DNA with primers targeting the citrate synthase gene (gltA) and the outer membrane proteins A and B (ompA. ompB), Rickettsiae were detected in 22 of 78 I. tasmani tick samples (28.2%). Sequence data obtained for the three genes displayed the closest degree of similarity to Rickettsia heilongjiangiensiss for gltA (99.4%; 331/333 bp), Rickettsia amblyommii for the ompA gene (94.8%; 417/440 bp), and both Rickettsia massiliae and Rickettsia rhipicephali for the ompB gene (97%; 770/803 bp). BLAST and phylogenetic analysis of partial sequences obtained for the three genes were found to have sufficient nucleotide variation from the current recognized Australian species to be considered a distinct spotted fever group Rickettsia.

  15. Francisella tularensis: No Evidence for Transovarial Transmission in the Tularemia Tick Vectors Dermacentor reticulatus and Ixodes ricinus.

    Directory of Open Access Journals (Sweden)

    Marco Genchi

    Full Text Available Tularemia is a zoonosis caused by the Francisella tularensis, a highly infectious Gram-negative coccobacillus. Due to easy dissemination, multiple routes of infection, high environmental contamination and morbidity and mortality rates, Francisella is considered a potential bioterrorism threat and classified as a category A select agent by the CDC. Tick bites are among the most prevalent modes of transmission, and ticks have been indicated as a possible reservoir, although their reservoir competence has yet to be defined. Tick-borne transmission of F. tularensis was recognized in 1923, and transstadial transmission has been demonstrated in several tick species. Studies on transovarial transmission, however, have reported conflicting results.The aim of this study was to evaluate the role of ticks as reservoirs for Francisella, assessing the transovarial transmission of F. tularensis subsp. holarctica in ticks, using experimentally-infected females of Dermacentor reticulatus and Ixodes ricinus.Transmission electron microscopy and fluorescence in situ hybridization showed F. tularensis within oocytes. However, cultures and bioassays of eggs and larvae were negative; in addition, microscopy techniques revealed bacterial degeneration/death in the oocytes.These results suggest that bacterial death might occur in oocytes, preventing the transovarial transmission of Francisella. We can speculate that Francisella does not have a defined reservoir, but that rather various biological niches (e.g. ticks, rodents, that allow the bacterium to persist in the environment. Our results, suggesting that ticks are not competent for the bacterium vertical transmission, are congruent with this view.

  16. Effectiveness of Garlic for the Control of Ixodes scapularis (Acari: Ixodidae) on Residential Properties in Western Connecticut.

    Science.gov (United States)

    Bharadwaj, Anuja; Hayes, Laura E; Stafford, Kirby C

    2015-07-01

    We conducted field trials to evaluate the ability of a garlic juice-based product to control or suppress nymphal activity of the blacklegged tick, Ixodes scapularis Say, at residential properties in Connecticut in 2009, 2010, and 2011. The product was applied at a rate of 0.2 g AI/m2. Percent control of nymphal densities achieved by the spray treatment at 6, 11, and 18 d postspray for the 3 yr was 37.0, 59.0, and 47.4%, respectively. Differences between nymphal densities were greatest during the first post-spray sampling period. While garlic may require multiple applications for the suppression of tick activity, this product could provide a minimal-risk option for the short-term control of nymphal I. scapularis in the residential landscape. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  17. Borrelia burgdorferi genospecies detection by RLB hybridization in Ixodes cinus ticks from different sites of North-Eastern Poland

    Directory of Open Access Journals (Sweden)

    Justyna Dunaj

    2014-06-01

    Full Text Available Introduction. RLB (Reverse Line Blot Hybridization is a molecular biology technique that might be used for [i]Borrelia burgdorferi [/i]sensu lato (sl DNA detection with genospecies specification. Among[i] B. burgdorferi[/i] sl genospecies at least 7 are regarded as pathogenic in Europe. objective. The aim of the study was to evaluate the frequency of different [i]Borrelia[/i] genospecies DNA detection in Ixodes ricinus ticks in the endemic area of North-Eastern Poland by using RLB. materials and method. Ixodes ricinus ticks were collected in May – June, from 6 different sites in North-Eastern Poland (Jakubin, Kolno, Grajewo, Suwałki, Siemiatycze, Białowieża by flagging. Extracted DNA was amplified by polymerase chain reaction (PCR targeting the intergenic spacer 5S 23S of [i]B. burgdorferi sl.[/i] PCR products were hybridised to 15 different oligonucleotide probes for 9 different [i]Borrelia [/i]genospecies ([i]B. burgdorferi sl, B. burgdorferi ss, B. garinii, B. afzelii, B. valaisiana, B. lusitaniae, B. spielmanii, B. bissettii and B. relapsing[/i] fever-like spirochetes (B. myamotoi by RLB. results. [i]Borrelia [/i]genospecies DNA was detected in 205 Ixodes ricinus ticks. Among 14 infected with [i]Borrelia[/i] ticks, 4 were identified as B. garinii and 10 as B. afzelii. Higher numbers of infected ticks were noticed in the eastern part of the research area, where large forest complexes dominate. Nymphs appeared to be the most frequently infected tick stage, which has an epidemiological meaning in the incidence of Lyme borreliosis. conclusions. The study demonstrated that RLB might be easily used in [i]Borrelia[/i] DNA detection with genospecies-identification, and indicated the domination of [i]B. afzelii and B. garinii [/i]in ticks from North-Eastern Poland.

  18. Detection of Borrelia lusitaniae, Rickettsia sp. IRS3, Rickettsia monacensis, and Anaplasma phagocytophilum in Ixodes ricinus collected in Madeira Island, Portugal.

    Science.gov (United States)

    de Carvalho, Isabel Lopes; Milhano, Natacha; Santos, Ana Sofia; Almeida, Victor; Barros, Silvia C; De Sousa, Rita; Núncio, Maria Sofia

    2008-08-01

    A total of 300 Ixodes ricinus ticks were tested by polymerase chain reaction (PCR) for the presence of Borrelia spp., Rickettsia spp., and Anaplasma phagocytophilum. Sequence analysis demonstrated 8 (2.7%) ticks infected with B. lusitaniae, 60 (20%) with Rickettsia spp., and 1 (0.3%) with A. phagocytophilum. Seven (2.3%) ticks were coinfected with B. lusitaniae and Rickettsia spp., 2 (0.6%) with R. monacensis, and 5 (1.7%) with Rickettsia sp. IRS3. The results of this study suggest simultaneous transmission of multiple tick-borne agents on Madeira Island, Portugal.

  19. Changes in the geographical distribution and abundance of the tick Ixodes ricinus during the past 30 years in Sweden

    Directory of Open Access Journals (Sweden)

    Jaenson Thomas GT

    2012-01-01

    Full Text Available Abstract Background Ixodes ricinus is the main vector in Europe of human-pathogenic Lyme borreliosis (LB spirochaetes, the tick-borne encephalitis virus (TBEV and other pathogens of humans and domesticated mammals. The results of a previous 1994 questionnaire, directed at people living in Central and North Sweden (Svealand and Norrland and aiming to gather information about tick exposure for humans and domestic animals, suggested that Ixodes ricinus ticks had become more widespread in Central Sweden and the southern part of North Sweden from the early 1980s to the early 1990s. To investigate whether the expansion of the tick's northern geographical range and the increasing abundance of ticks in Sweden were still occurring, in 2009 we performed a follow-up survey 16 years after the initial study. Methods A questionnaire similar to the one used in the 1994 study was published in Swedish magazines aimed at dog owners, home owners, and hunters. The questionnaire was published together with a popular science article about the tick's biology and role as a pathogen vector in Sweden. The magazines were selected to get information from people familiar with ticks and who spend time in areas where ticks might be present. Results Analyses of data from both surveys revealed that during the near 30-year period from the early 1980s to 2008, I. ricinus has expanded its distribution range northwards. In the early 1990s ticks were found in new areas along the northern coastline of the Baltic Sea, while in the 2009 study, ticks were reported for the first time from many locations in North Sweden. This included locations as far north as 66°N and places in the interior part of North Sweden. During this 16-year period the tick's range in Sweden was estimated to have increased by 9.9%. Most of the range expansion occurred in North Sweden (north of 60°N where the tick's coverage area doubled from 12.5% in the early 1990s to 26.8% in 2008. Moreover, according to the

  20. Prevalence of tick-borne pathogens in Ixodes ricinus and Dermacentor reticulatus ticks from different geographical locations in Belarus.

    Directory of Open Access Journals (Sweden)

    Anna L Reye

    Full Text Available Worldwide, ticks are important vectors of human and animal pathogens. Besides Lyme Borreliosis, a variety of other bacterial and protozoal tick-borne infections are of medical interest in Europe. In this study, 553 questing and feeding Ixodes ricinus (n = 327 and Dermacentor reticulatus ticks (n = 226 were analysed by PCR for Borrelia, Rickettsia, Anaplasma, Coxiella, Francisella and Babesia species. Overall, the pathogen prevalence in ticks was 30.6% for I. ricinus and 45.6% for D. reticulatus. The majority of infections were caused by members of the spotted-fever group rickettsiae (24.4%, 9.4% of ticks were positive for Borrelia burgdorferi sensu lato, with Borrelia afzelii being the most frequently detected species (40.4%. Pathogens with low prevalence rates in ticks were Anaplasma phagocytophilum (2.2%, Coxiella burnetii (0.9%, Francisella tularensis subspecies (0.7%, Bartonella henselae (0.7%, Babesia microti (0.5% and Babesia venatorum (0.4%. On a regional level, hotspots of pathogens were identified for A. phagocytophilum (12.5-17.2%, F. tularensis ssp. (5.5% and C. burnetii (9.1%, suggesting established zoonotic cycles of these pathogens at least at these sites. Our survey revealed a high burden of tick-borne pathogens in questing and feeding I. ricinus and D. reticulatus ticks collected in different regions in Belarus, indicating a potential risk for humans and animals. Identified hotspots of infected ticks should be included in future surveillance studies, especially when F. tularensis ssp. and C. burnetii are involved.

  1. Toxic and repellent activity of selected monoterpenoids (thymol, carvacrol and linalool) against the castor bean tick, Ixodes ricinus (Acari: Ixodidae).

    Science.gov (United States)

    Tabari, Mohaddeseh Abouhosseini; Youssefi, Mohammad Reza; Maggi, Filippo; Benelli, Giovanni

    2017-10-15

    The castor bean tick, Ixodes ricinus, is a species of medical and veterinary importance. The use of synthetic acaricides for tick control has led to development of resistance, residues in the environment and animal products, and public health concerns. In this regard, plant essential oils and their main constituents represent an appealing alternative strategy to combat ticks. The phenols thymol and carvacrol and the alcohol linalool are monoterpenoids occurring in essential oils of several aromatic and medicinal plants, such as thyme, oregano, savory, lavender and coriander. Recent studies have shown toxicity of these monoterpenoids against selected mosquito vectors and other arthropod pests. However, information on their bioactivity on I. ricinus is not available. On this basis, here we evaluated the ovicidal, larvicidal and repellency effects of these compounds against I. ricinus. Concentrations of 0.25, 0.5, 1, 2 and 5% were sprayed on the egg masses, then hatching rates were noted. Larvicidal assays were conducted on unengorged larvae, following the larval packet technique. The repellency was determined by measuring the vertical migration behavior of ticks in laboratory conditions. Carvacrol and thymol at all concentrations tested led to a significant hatching decrease, showing an efficacy higher than permethrin, whereas linalool did not cause any significant effect. In the larvae treated with carvacrol and thymol (1, 2 and 5%), mortality rates reached 100% after 24h, showing a larvicidal efficacy higher than permethrin, whereas no effect was seen in the larval groups treated with linalool. Carvacrol and thymol at all concentrations tested showed >90% repellency on I. ricinus. Linalool was scarcely effective (50.24% repellency) only at the concentration of 5%. Overall, based on these results, the phenols carvacrol and thymol can be considered as candidate ingredients for the development of novel acaricidal formulations to control the populations of I. ricinus

  2. Sheep experimentally infected with a human isolate of Anaplasma phagocytophilum serve as a host for infection of Ixodes scapularis ticks.

    Science.gov (United States)

    Kocan, Katherine M; Busby, Ann T; Allison, Robin W; Breshears, Melanie A; Coburn, Lisa; Galindo, Ruth C; Ayllón, Nieves; Blouin, Edmour F; de la Fuente, José

    2012-06-01

    Anaplasma phagocytophilum, first identified as a pathogen of ruminants in Europe, has more recently been recognized as an emerging tick-borne pathogen of humans in the U.S. and Europe. A. phagocytophilum is transmitted by Ixodes spp., but the tick developmental cycle and pathogen/vector interactions have not been fully described. In this research, we report on the experimental infection of sheep with the human NY-18 isolate of A. phagocytophilum which then served as a host for infection of I. scapularis nymphs and adults. A. phagocytophilum was propagated in the human promyelocytic cell line, HL-60, and the infected cell cultures were then used to infect sheep by intravenous inoculation. Infections in sheep were confirmed by PCR and an Anaplasma-competitive ELISA. Clinical signs were not apparent in any of the infected sheep, and only limited hematologic and mild serum biochemical abnormalities were identified. While A. phagocytophilum morulae were rarely seen in neutrophils, blood film evaluation revealed prominent large granular lymphocytes, occasional plasma cells, and rare macrophages. Upon necropsy, gross lesions were restricted to the lymphoid system. Mild splenomegaly and lymphadenomegaly with microscopic evidence of lymphoid hyperplasia was observed in all infected sheep. Female I. scapularis that were allowed to feed and acquire infection on each of the 3 experimentally infected sheep became infected with A. phagocytophilum as determined by PCR of guts (80-87%) and salivary glands (67-100%). Female I. scapularis that acquired infection as nymphs on an experimentally infected sheep transmitted A. phagocytophilum to a susceptible sheep, thus confirming transstadial transmission. Sheep proved to be a good host for the production of I. scapularis infected with this human isolate of A. phagocytophilum, which can be used as a model for future studies of the tick/pathogen interface.

  3. Ability of an oral formulation of afoxolaner to protect dogs from Borrelia burgdorferi infection transmitted by wild Ixodes scapularis ticks.

    Science.gov (United States)

    Baker, C F; McCall, J W; McCall, S D; Drag, M D; Mitchell, E B; Chester, S T; Larsen, D

    2016-12-01

    A randomized, blinded, negative controlled study was conducted to determine whether treatment with afoxolaner (NexGard(®), Merial, Inc.) would prevent the transmission of Borrelia burgdorferi to dogs by wild caught Ixodes scapularis ticks. Twenty healthy dogs were randomly assigned to two groups of ten dogs each. Ten dogs were treated orally on Day 0 at a dose near the minimum recommended dose of afoxolaner of 2.5mg/kg (actual doses 2.5-3.1mg/kg) and ten control dogs were not treated. On Day 28, each dog was infested with approximately 50 adult unfed wild caught I. scapularis that had a 67% B. burgdorferi infection rate (determined by polymerase chain reaction). On Day 33, live ticks were counted and removed. No ticks were found on treated dogs while control dogs had an average of 21.4 ticks. To detect infection, the B. burgdorferi-specific C6 antibody SNAP(®) 4Dx(®) test (IDEXX) was performed on serum collected before infestation (all dogs seronegative on Days -6 and 27) and on Days 48, 63, 77 and 92. The ten treated dogs remained seronegative through the end of the study (Day 92), while nine out of the ten control dogs were infected, as demonstrated by their seroconversion to being positive for the presence of the B. burgdorferi-specific C6 antibody starting on Day 48. In this study, all dogs treated with NexGard(®) 28days prior to challenge with wild caught I. scapularis ticks were protected from B. burgdorferi infection, while nine out of the ten untreated control dogs were infected.

  4. To beat or not to beat a tick: comparison of DNA extraction methods for ticks (Ixodes scapularis

    Directory of Open Access Journals (Sweden)

    Alyssa D. Ammazzalorso

    2015-08-01

    Full Text Available Background. Blacklegged ticks (Ixodes scapularis are important disease vectors in the United States, known to transmit a variety of pathogens to humans, including bacteria, protozoa, and viruses. Their importance as a disease vector necessitates reliable and comparable methods for extracting microbial DNA from ticks. Furthermore, to explore the population genetics or genomics of this tick, appropriate DNA extraction techniques are needed for both the vector and its microbes. Although a few studies have investigated different methods of DNA isolation from ticks, they are limited in the number and types of DNA extraction and lack species-specific quantification of DNA yield.Methods. Here we determined the most efficient and consistent method of DNA extraction from two different developmental stages of I. scapularis—nymph and adult—that are the most important for disease transmission. We used various methods of physical disruption of the hard, chitinous exoskeleton, as well as commercial and non-commercial DNA isolation kits. To gauge the effectiveness of these methods, we quantified the DNA yield and confirmed the DNA quality via PCR of both tick and microbial genetic material.Results. DNA extraction using the Thermo GeneJET Genomic DNA Purification Kit resulted in the highest DNA yields and the most consistent PCR amplification when combined with either cutting or bead beating with select matrices across life stages. DNA isolation methods using ammonium hydroxide as well as the MoBio PowerSoil kit also produced strong and successful PCR amplification, but only for females.Discussion. We contrasted a variety of readily available methods of DNA extraction from single individual blacklegged ticks and presented the results through a quantitative and qualitative assessment.

  5. Survey of Ixodes pacificus Ticks in California Reveals a Diversity of Microorganisms and a Novel and Widespread Anaplasmataceae Species.

    Directory of Open Access Journals (Sweden)

    Mark W Eshoo

    Full Text Available Ixodes pacificus ticks can harbor a wide range of human and animal pathogens. To survey the prevalence of tick-borne known and putative pathogens, we tested 982 individual adult and nymphal I. pacificus ticks collected throughout California between 2007 and 2009 using a broad-range PCR and electrospray ionization mass spectrometry (PCR/ESI-MS assay designed to detect a wide range of tick-borne microorganisms. Overall, 1.4% of the ticks were found to be infected with Borrelia burgdorferi, 2.0% were infected with Borrelia miyamotoi and 0.3% were infected with Anaplasma phagocytophilum. In addition, 3.0% were infected with Babesia odocoilei. About 1.2% of the ticks were co-infected with more than one pathogen or putative pathogen. In addition, we identified a novel Anaplasmataceae species that we characterized by sequencing of its 16S rRNA, groEL, gltA, and rpoB genes. Sequence analysis indicated that this organism is phylogenetically distinct from known Anaplasma species with its closest genetic near neighbors coming from Asia. The prevalence of this novel Anaplasmataceae species was as high as 21% at one site, and it was detected in 4.9% of ticks tested statewide. Based upon this genetic characterization we propose that this organism be called 'Candidatus Cryptoplasma californiense'. Knowledge of this novel microbe will provide awareness for the community about the breadth of the I. pacificus microbiome, the concept that this bacterium could be more widely spread; and an opportunity to explore whether this bacterium also contributes to human or animal disease burden.

  6. Ixodes ricinus ticks are reservoir hosts for Rickettsia helvetica and potentially carry flea-borne Rickettsia species

    Directory of Open Access Journals (Sweden)

    Gaasenbeek Cor

    2009-09-01

    Full Text Available Abstract Background Hard ticks have been identified as important vectors of rickettsiae causing the spotted fever syndrome. Tick-borne rickettsiae are considered to be emerging, but only limited data are available about their presence in Western Europe, their natural life cycle and their reservoir hosts. Ixodes ricinus, the most prevalent tick species, were collected and tested from different vegetation types and from potential reservoir hosts. In one biotope area, the annual and seasonal variability of rickettsiae infections of the different tick stages were determined for 9 years. Results The DNA of the human pathogen R. conorii as well as R. helvetica, R. sp. IRS and R. bellii-like were found. Unexpectedly, the DNA of the highly pathogenic R. typhi and R. prowazekii and 4 other uncharacterized Rickettsia spp. related to the typhus group were also detected in I. ricinus. The presence of R. helvetica in fleas isolated from small rodents supported our hypothesis that cross-infection can occur under natural conditions, since R. typhi/prowazekii and R. helvetica as well as their vectors share rodents as reservoir hosts. In one biotope, the infection rate with R. helvetica was ~66% for 9 years, and was comparable between larvae, nymphs, and adults. Larvae caught by flagging generally have not yet taken a blood meal from a vertebrate host. The simplest explanation for the comparable prevalence of R. helvetica between the defined tick stages is, that R. helvetica is vertically transmitted through the next generation with high efficiency. The DNA of R. helvetica was also present in whole blood from mice, deer and wild boar. Conclusion Besides R. helvetica, unexpected rickettsiae are found in I. ricinus ticks. We propose that I. ricinus is a major reservoir host for R. helvetica, and that vertebrate hosts play important roles in the further geographical dispersion of rickettsiae.

  7. To beat or not to beat a tick: comparison of DNA extraction methods for ticks (Ixodes scapularis).

    Science.gov (United States)

    Ammazzalorso, Alyssa D; Zolnik, Christine P; Daniels, Thomas J; Kolokotronis, Sergios-Orestis

    2015-01-01

    Background. Blacklegged ticks (Ixodes scapularis) are important disease vectors in the United States, known to transmit a variety of pathogens to humans, including bacteria, protozoa, and viruses. Their importance as a disease vector necessitates reliable and comparable methods for extracting microbial DNA from ticks. Furthermore, to explore the population genetics or genomics of this tick, appropriate DNA extraction techniques are needed for both the vector and its microbes. Although a few studies have investigated different methods of DNA isolation from ticks, they are limited in the number and types of DNA extraction and lack species-specific quantification of DNA yield. Methods. Here we determined the most efficient and consistent method of DNA extraction from two different developmental stages of I. scapularis-nymph and adult-that are the most important for disease transmission. We used various methods of physical disruption of the hard, chitinous exoskeleton, as well as commercial and non-commercial DNA isolation kits. To gauge the effectiveness of these methods, we quantified the DNA yield and confirmed the DNA quality via PCR of both tick and microbial genetic material. Results. DNA extraction using the Thermo GeneJET Genomic DNA Purification Kit resulted in the highest DNA yields and the most consistent PCR amplification when combined with either cutting or bead beating with select matrices across life stages. DNA isolation methods using ammonium hydroxide as well as the MoBio PowerSoil kit also produced strong and successful PCR amplification, but only for females. Discussion. We contrasted a variety of readily available methods of DNA extraction from single individual blacklegged ticks and presented the results through a quantitative and qualitative assessment.

  8. Prevalence of Tick-Borne Pathogens in Ixodes ricinus and Dermacentor reticulatus Ticks from Different Geographical Locations in Belarus

    Science.gov (United States)

    Reye, Anna L.; Stegniy, Valentina; Mishaeva, Nina P.; Velhin, Sviataslau; Hübschen, Judith M.; Ignatyev, George; Muller, Claude P.

    2013-01-01

    Worldwide, ticks are important vectors of human and animal pathogens. Besides Lyme Borreliosis, a variety of other bacterial and protozoal tick-borne infections are of medical interest in Europe. In this study, 553 questing and feeding Ixodes ricinus (n = 327) and Dermacentor reticulatus ticks (n = 226) were analysed by PCR for Borrelia, Rickettsia, Anaplasma, Coxiella, Francisella and Babesia species. Overall, the pathogen prevalence in ticks was 30.6% for I. ricinus and 45.6% for D. reticulatus. The majority of infections were caused by members of the spotted-fever group rickettsiae (24.4%), 9.4% of ticks were positive for Borrelia burgdorferi sensu lato, with Borrelia afzelii being the most frequently detected species (40.4%). Pathogens with low prevalence rates in ticks were Anaplasma phagocytophilum (2.2%), Coxiella burnetii (0.9%), Francisella tularensis subspecies (0.7%), Bartonella henselae (0.7%), Babesia microti (0.5%) and Babesia venatorum (0.4%). On a regional level, hotspots of pathogens were identified for A. phagocytophilum (12.5–17.2%), F. tularensis ssp. (5.5%) and C. burnetii (9.1%), suggesting established zoonotic cycles of these pathogens at least at these sites. Our survey revealed a high burden of tick-borne pathogens in questing and feeding I. ricinus and D. reticulatus ticks collected in different regions in Belarus, indicating a potential risk for humans and animals. Identified hotspots of infected ticks should be included in future surveillance studies, especially when F. tularensis ssp. and C. burnetii are involved. PMID:23349900

  9. Mechanical tools for the removal of Ixodes ricinus female ticks--differences of instruments and pulling or twisting?

    Science.gov (United States)

    Duscher, G G; Peschke, R; Tichy, A

    2012-10-01

    The fast and safe removal of ticks is of medical and veterinary importance since many tick-borne pathogens require time to be transmitted. In the past, many tools and applications were used to remove ticks from the skin of humans and pets. Choking the ticks by blocking their respiratory system with chemicals cannot be recommended due to the low respiratory rate of ticks. Mechanical devices to remove ticks are usually recommended; however, they vary with regard to their mechanism of seizing and holding the tick and in the way of extraction (pulling or twisting). In this study, five commercial tick removal devices with different mechanisms were tested on pets according to their practicability, injury of the mouthparts, and the idiosoma of female Ixodes ricinus ticks. Therefore, 22 veterinarians and four pet owners removed 596 ticks from various animals by using the different devices and filled in a questionnaire for each case. The tick species and instars were determined, and for the female I. ricinus ticks (n = 527) the condition of the mouthparts as well as the idiosoma was evaluated. Twisting of the female I. ricinus ticks reduced the force required for extraction, the adverse reaction of the animal and the time needed for removal. The device with a "V"-shaped slot which allows a grabbing of the mouthparts delivered the best results according to the condition of the mouthparts and the intactness of the female I. ricinus tick's body. Therefore, grabbing the mouthparts and twisting can be recommended for removal of I. ricinus females from pets.

  10. Detection of Wolbachia in the tick Ixodes ricinus is due to the presence of the hymenoptera endoparasitoid Ixodiphagus hookeri.

    Directory of Open Access Journals (Sweden)

    Olivier Plantard

    Full Text Available The identification of micro-organisms carried by ticks is an important issue for human and animal health. In addition to their role as pathogen vectors, ticks are also the hosts for symbiotic bacteria whose impact on tick biology is poorly known. Among these, the bacterium Wolbachia pipientis has already been reported associated with Ixodes ricinus and other tick species. However, the origins of Wolbachia in ticks and their consequences on tick biology (known to be very diverse in invertebrates, ranging from nutritional symbionts in nematodes to reproductive manipulators in insects are unknown. Here we report that the endoparasitoid wasp Ixodiphagus hookeri (Hymenoptera, Chalcidoidea, Encyrtidae--strictly associated with ticks for their development--infested at almost 100% prevalence by a W. pipientis strain belonging to a Wolbachia supergroup that has already been reported as associated with other hymenopteran parasitoids. In a natural population of I. ricinus that suffers high parasitism rates due to I. hookeri, we used specific PCR primers for both hymenopteran and W. pipientis gene fragments to show that all unfed tick nymphs parasitized by I. hookeri also harbored Wolbachia, while unparasitized ticks were Wolbachia-free. We demonstrated experimentally that unfed nymphs obtained from larvae exposed to I. hookeri while gorging on their vertebrate host also harbor Wolbachia. We hypothesize that previous studies that have reported W. pipientis in ticks are due to the cryptic presence of the endoparasitoid wasp I. hookeri. This association has remained hidden until now because parasitoids within ticks cannot be detected until engorgement of the nymphs brings the wasp eggs out of diapause. Finally, we discuss the consequences of this finding for our understanding of the tick microbiome, and their possible role in horizontal gene transfer among pathogenic and symbiotic bacteria.

  11. Abiotic and biotic factors associated with tick population dynamics on a mammalian host: Ixodes hexagonus infesting otters, Lutra lutra.

    Directory of Open Access Journals (Sweden)

    Ellie Sherrard-Smith

    Full Text Available The Eurasian otter, Lutra lutra, hosts several parasites with zoonotic potential. As this semiaquatic mammal has large ranges across terrestrial, freshwater and marine habitats, it has the capacity for wide dispersion of pathogens. Despite this, parasites of otters have received relatively little attention. Here, we examine their ectoparasite load and assess whether this is influenced by abiotic or biotic variables. Climatic phenomena such as the North Atlantic Oscillation (NAO affect weather conditions in northern Europe. Consequently parasite distributions, particularly species with life stages exposed to the external environment, can be affected. We assessed the extent to which inter-annual variations in large-scale weather patterns (specifically the NAO and Central England (CE temperatures and host characteristics influenced tick prevalence and intensity. Ectoparasites consisted of a single species, the nidiculous tick Ixodes hexagonus (prevalence = 24.3%; mean intensity = 7.2; range = 1-122; on n = 820 otter hosts. The prevalence, but not intensity of infestation, was associated with high CE temperatures, while both prevalence and intensity were associated with positive phases of the NAO. Such associations indicate that I. hexagonus are most abundant when weather conditions are warmer and wetter. Ticks were more prevalent on juvenile than sub-adult or adult otters, which probably reflects the length of time the hosts spend in the holt where these ticks quest. High tick number was associated with poor host condition, so either poor condition hosts are more susceptible to ticks, or tick infestations negatively impact on host condition. Otters are clearly an important and common host for I. hexagonus, which has implications for vector-borne diseases. This work is the first to consider the impacts of long-term weather patterns on I. hexagonus and uses wild-animal cadavers to illustrate the importance of abiotic and biotic pressures impacting

  12. Systems biology of tissue-specific response to Anaplasma phagocytophilum reveals differentiated apoptosis in the tick vector Ixodes scapularis.

    Directory of Open Access Journals (Sweden)

    Nieves Ayllón

    2015-03-01

    Full Text Available Anaplasma phagocytophilum is an emerging pathogen that causes human granulocytic anaplasmosis. Infection with this zoonotic pathogen affects cell function in both vertebrate host and the tick vector, Ixodes scapularis. Global tissue-specific response and apoptosis signaling pathways were characterized in I. scapularis nymphs and adult female midguts and salivary glands infected with A. phagocytophilum using a systems biology approach combining transcriptomics and proteomics. Apoptosis was selected for pathway-focused analysis due to its role in bacterial infection of tick cells. The results showed tissue-specific differences in tick response to infection and revealed differentiated regulation of apoptosis pathways. The impact of bacterial infection was more pronounced in tick nymphs and midguts than in salivary glands, probably reflecting bacterial developmental cycle. All apoptosis pathways described in other organisms were identified in I. scapularis, except for the absence of the Perforin ortholog. Functional characterization using RNA interference showed that Porin knockdown significantly increases tick colonization by A. phagocytophilum. Infection with A. phagocytophilum produced complex tissue-specific alterations in transcript and protein levels. In tick nymphs, the results suggested a possible effect of bacterial infection on the inhibition of tick immune response. In tick midguts, the results suggested that A. phagocytophilum infection inhibited cell apoptosis to facilitate and establish infection through up-regulation of the JAK/STAT pathway. Bacterial infection inhibited the intrinsic apoptosis pathway in tick salivary glands by down-regulating Porin expression that resulted in the inhibition of Cytochrome c release as the anti-apoptotic mechanism to facilitate bacterial infection. However, tick salivary glands may promote apoptosis to limit bacterial infection through induction of the extrinsic apoptosis pathway. These dynamic

  13. Risk maps for range expansion of the Lyme disease vector, Ixodes scapularis, in Canada now and with climate change

    Directory of Open Access Journals (Sweden)

    Michel Pascal

    2008-05-01

    Full Text Available Abstract Background Lyme disease is the commonest vector-borne zoonosis in the temperate world, and an emerging infectious disease in Canada due to expansion of the geographic range of the tick vector Ixodes scapularis. Studies suggest that climate change will accelerate Lyme disease emergence by enhancing climatic suitability for I. scapularis. Risk maps will help to meet the public health challenge of Lyme disease by allowing targeting of surveillance and intervention activities. Results A risk map for possible Lyme endemicity was created using a simple risk algorithm for occurrence of I. scapularis populations. The algorithm was calculated for each census sub-division in central and eastern Canada from interpolated output of a temperature-driven simulation model of I. scapularis populations and an index of tick immigration. The latter was calculated from estimates of tick dispersion distances by migratory birds and recent knowledge of the current geographic range of endemic I. scapularis populations. The index of tick immigration closely predicted passive surveillance data on I. scapularis occurrence, and the risk algorithm was a significant predictor of the occurrence of I. scapularis populations in a prospective field study. Risk maps for I. scapularis occurrence in Canada under future projected climate (in the 2020s, 2050s and 2080s were produced using temperature output from the Canadian Coupled Global Climate Model 2 with greenhouse gas emission scenario enforcing 'A2' of the Intergovernmental Panel on Climate Change. Conclusion We have prepared risk maps for the occurrence of I. scapularis in eastern and central Canada under current and future projected climate. Validation of the risk maps provides some confidence that they provide a useful first step in predicting the occurrence of I. scapularis populations, and directing public health objectives in minimizing risk from Lyme disease. Further field studies are needed, however, to

  14. Prevalence of tick-borne pathogens in Ixodes ricinus and Dermacentor reticulatus ticks from different geographical locations in Belarus.

    Science.gov (United States)

    Reye, Anna L; Stegniy, Valentina; Mishaeva, Nina P; Velhin, Sviataslau; Hübschen, Judith M; Ignatyev, George; Muller, Claude P

    2013-01-01

    Worldwide, ticks are important vectors of human and animal pathogens. Besides Lyme Borreliosis, a variety of other bacterial and protozoal tick-borne infections are of medical interest in Europe. In this study, 553 questing and feeding Ixodes ricinus (n = 327) and Dermacentor reticulatus ticks (n = 226) were analysed by PCR for Borrelia, Rickettsia, Anaplasma, Coxiella, Francisella and Babesia species. Overall, the pathogen prevalence in ticks was 30.6% for I. ricinus and 45.6% for D. reticulatus. The majority of infections were caused by members of the spotted-fever group rickettsiae (24.4%), 9.4% of ticks were positive for Borrelia burgdorferi sensu lato, with Borrelia afzelii being the most frequently detected species (40.4%). Pathogens with low prevalence rates in ticks were Anaplasma phagocytophilum (2.2%), Coxiella burnetii (0.9%), Francisella tularensis subspecies (0.7%), Bartonella henselae (0.7%), Babesia microti (0.5%) and Babesia venatorum (0.4%). On a regional level, hotspots of pathogens were identified for A. phagocytophilum (12.5-17.2%), F. tularensis ssp. (5.5%) and C. burnetii (9.1%), suggesting established zoonotic cycles of these pathogens at least at these sites. Our survey revealed a high burden of tick-borne pathogens in questing and feeding I. ricinus and D. reticulatus ticks collected in different regions in Belarus, indicating a potential risk for humans and animals. Identified hotspots of infected ticks should be included in future surveillance studies, especially when F. tularensis ssp. and C. burnetii are involved.

  15. Determination of hard tick species (Acarina:Ixodidae) on sheep and cattle in Hamedan Province, Iran

    Institute of Scientific and Technical Information of China (English)

    Jamal Gharekhani; Abbas Gerami-Sadeghian; Zivar Sadeghi-Dehkordi; Mohammadreza Youssefi

    2015-01-01

    Objective: To determine the fauna and frequency of hard tick species on sheep and cattle in Hamedan Province, Western Iran. Methods: Tick sampling was performed on the whole body of 18000 sheep and 4200 cattle in 3 rural regions (mountain, plateau, and plain-mountainous zone) during the year of 2010 to 2011. The ticks were identified with appropriate identification keys. Results: A total of 1534 hard ticks (62.1% male and 37.9% female) were collected in animals. The infestation rate was found 2.4% in animals (4.2% in cattle and 2.0% in sheep). The ticks were classified into 3 genera and 7 species including: Hyalomma marginatum (34.1%), Hyalomma excavatum (29.7%), Rhipicephalus bursa (13.8%), Rhipicephalus sanguineus (7.5%), Hyalomma detritum (7.1%), Haemaphysalis punctata (5.1%) and Hyalomma dromedarii (2.7%). Conclusions: Current study is the first report of fauna and frequency of hard ticks in this region. The results showed that Hyalomma marginatum is the dominant hard tick species. Further studies are needed to determine the importance of Ixodidae ticks of veterinary and public health in this region of Iran.

  16. Candidatus Neoehrlichia mikurensis in rodents in an area with sympatric existence of the hard ticks Ixodes ricinus and Dermacentor reticulatus, Germany

    Directory of Open Access Journals (Sweden)

    Silaghi Cornelia

    2012-12-01

    Full Text Available Abstract Background Candidatus Neoehrlichia mikurensis (CNM has been described in the hard tick Ixodes ricinus and rodents as well as in some severe cases of human disease. The aims of this study were to identify DNA of CNM in small mammals, the ticks parasitizing them and questing ticks in areas with sympatric existence of Ixodes ricinus and Dermacentor reticulatus in Germany. Methods Blood, transudate and organ samples (spleen, kidney, liver, skin of 91 small mammals and host-attached ticks from altogether 50 small mammals as well as questing I. ricinus ticks (n=782 were screened with a real-time PCR for DNA of CNM. Results 52.7% of the small mammals were positive for CNM-DNA. The majority of the infected animals were yellow-necked mice (Apodemus flavicollis and bank voles (Myodes glareolus. Small mammals with tick infestation were more often infected with CNM than small mammals without ticks. Compared with the prevalence of ~25% in the questing I. ricinus ticks, twice the prevalence in the rodents provides evidence for their role as reservoir hosts for CNM. Conclusion The high prevalence of this pathogen in the investigated areas in both rodents and ticks points towards the need for more specific investigation on its role as a human pathogen.

  17. Crimean-Congo hemorrhagic fever:a molecular survey on hard ticks (Ixodidae) in Yazd province, Iran

    Institute of Scientific and Technical Information of China (English)

    Salim Abadi Yaser; Chinikar Sadegh; Telmadarraiy Zakkyeh; Vatandoost Hassan; Moradi Maryam; Oshaghi Mohammad Ali; Ghiasi Seyed Mojtaba

    2011-01-01

    Objective: To determine the rate of Crimean-Congo hemorrhagic fever virus (CCHFV) infection in hard ticks (Ixodidae) in Yazd province of Iran. Methods: A molecular survey on hard ticks(Ixodidae) was conducted in Yazd province during 2008 -2009. A total of 140 hard ticks (three genera and 7 species) were collected from randomly selected villages and were exanimate for presence of CCHFV reverse transcription-polymerase chain reaction (RT-PCR) method. Results:CCHFV genome was found in 5.71% of hard ticks. All positive ticks were from Hyalomma genus. Positive ticks including: Hyalomma dromedarii, Hyalomma marginatum, Hyalomma anatolicum,Hyalomma detritum, Hyalomma asiaticum . We were not able to find virus in in Rhipicephalus sanguineus and Dermacentor marginatus. Results exhibited that Hyalomma is the main vector in the study area. Conclusions: Due to the presence of virus in 24 provinces' out of 31, we recommend the use of acaricides and repellent to prevent disease transmission among humans. Greta care should be taken by the people who are working in slaughter houses.

  18. Coinfections of Rickettsia slovaca and Rickettsia helvetica with Borrelia lusitaniae in ticks collected in a Safari Park, Portugal.

    Science.gov (United States)

    Milhano, Natacha; de Carvalho, Isabel Lopes; Alves, Ana Sofia; Arroube, Sofia; Soares, Jorge; Rodriguez, Pablo; Carolino, Manuela; Núncio, Maria Sofia; Piesman, Joseph; de Sousa, Rita

    2010-12-01

    Borrelia and Rickettsia bacteria are the most important tick-borne agents causing disease in Portugal. Identification and characterization of these circulating agents, mainly in recreational areas, is crucial for the development of preventive measures in response to the gradually increasing exposure of humans to tick vectors. A total of 677 questing ticks including Dermacentor marginatus, Rhipicephalus sanguineus, Ixodes ricinus, Hyalomma lusitanicum, H. marginatum, and Haemaphysalis punctata were collected in a Safari Park in Alentejo, Portugal, to investigate the prevalences of infection and characterize Borrelia and Rickettsia species. From a total of 371 ticks tested by PCR for Borrelia burgdorferi sensu lato (s.l.), of which 247 were tested for Rickettsia, an infection prevalence of 18.3% was found for B. lusitaniae and 55.1% for Rickettsia spp. Sequence analysis of positive amplicons identified the presence of B. lusitaniae (18.3%), R. monacensis strain IRS3 (51.7%), and R. helvetica (48.3%) in I. ricinus. R. slovaca (41.5%), R. raoultii (58.5%), and also B. lusitaniae (21%) were identified in D. marginatus ticks. One (5.9%) H. lusitanicum was infected with B. lusitaniae, and R. massiliae was found in one Rhipicephalus sanguineus. Coinfection was found in 7 (20%) I. ricinus and 34 (23.3%) D. marginatus ticks. We report, for the first time, simultaneous infection with R. helvetica and B. lusitaniae and also R. slovaca, the agent of TIBOLA/DEBONEL, with B. lusitaniae. Additionally, 6 isolates of B. lusitaniae were established, and isolates of Rickettsia were also obtained for the detected species using tick macerates cultured in mammalian and mosquito cell lines. This report describes the detection and isolation of tick-borne agents from a Portuguese Safari Park, highlighting the increased likelihood of infection with multiple agents to potential visitors or staff. Copyright © 2010 Elsevier GmbH. All rights reserved.

  19. Molecular identification of Theileria and Babesia in ticks collected from sheep and goats in the Black Sea region of Turkey.

    Science.gov (United States)

    Aydin, Mehmet Fatih; Aktas, Munir; Dumanli, Nazir

    2015-01-01

    A molecular survey was undertaken in the Black Sea region of Turkey to determine the presence of Theileria and Babesia species of medical and veterinary importance. The ticks were removed from sheep and goats, pooled according to species and locations, and analyzed by PCR-based reverse line blot (RLB) and sequencing. A total of 2241 ixodid ticks belonging to 5 genus and 12 species were collected and divided into 310 pools. Infection rates were calculated as the maximum likelihood estimation (MLE) with 95% confidence intervals (CI). Of the 310 pools tested, 46 (14.83%) were found to be infected with Theileria or Babesia species, and the overall MLE of the infection rate was calculated as 2.27% (CI 1.67-2.99). The MLE of the infection rates were calculated as 0.691% (CI 0.171-1.78) in Haemaphysalis parva, 1.47% (CI 0.081-6.37) in Rhipicephalus sanguineus, 1.84% (CI 0.101-7.87) in Ixodes ricinus, 2.86% (CI 1.68-4.48) in Rhipicephalus turanicus, 5.57% (CI 0.941-16.3) in Hyalomma marginatum, and 6.2% (CI 4.02-9.02) in Rhipicephalus bursa. Pathogens identified in ticks included Theileria ovis, Babesia ovis, Babesia bigemina, and Babesia microti. Most tick pools were infected with a single pathogen. However, five pools displayed mixed infections with T. ovis and B. ovis. This study provides the first molecular evidence for the presence of B. microti in ticks in Turkey.

  20. On the potential roles of ticks and migrating birds in the ecology of West Nile virus

    Directory of Open Access Journals (Sweden)

    Karl Hagman

    2014-01-01

    Full Text Available Background: Mosquitoes are the primary vectors of West Nile virus (WNV. Ticks have, however, been suggested to be potential reservoirs of WNV. To investigate their role in the spread of the virus, ticks, which had been collected from birds migrating northward from Africa to Europe, were analyzed for the potential presence of WNV RNA. Methods: On the Mediterranean islands of Capri and Antikythira, a total of 14,824 birds were captured and investigated from which 747 ticks were collected. Results and conclusions: Most of the identified ticks (93% were nymphs and larvae of Hyalomma marginatum sensu lato (s.l., most of which were or appear to be Hyalomma rufipes. Of these ticks, 729 were individually screened for WNV RNA. None of the ticks was found to be WNV positive. Thus, there was no evidence that H. marginatum s.l. ticks play a role in the spread of WNV from Africa to Europe.

  1. Prevalence of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks and assessment of entomological risk index at localities in Belgrade

    Directory of Open Access Journals (Sweden)

    Krstić Milena

    2016-01-01

    Full Text Available Background/Aim. The first case of human Lyme borreliosis (LB in Serbia was recorded in 1987. The number of reported LB cases has increased in the past decade. The aim of this study was to estimate the density of Ixodes ricinus (I. ricinus ticks, the prevalence of Borrelia burgdorferi sensu lato (B. burgdorferi in them, and entomological risk index (ERI at 19 Belgrade localities which were grouped into three categories (forests, parkforests, parks. The values of ERI were compared with the number of tick bites in humans. Methods. Ticks were collected monthly by using the flag hours method and the infection rate was determined by using dark field microscopy. The ERI value was calculated for each locality where the ticks were collected. The related data about tick bites was obtained from the patient protocol of the Institute of Epidemiology, Military Medical Academy, Belgrade. Results. The total number of collected ticks, the number of nymphs and the infection rates of the nymphs were significantly higher in forests (p < 0.05 than park-forests and parks. Statistically, the ERI value was significantly higher in forests than parks of Belgrade (χ2 = 7.78, p < 0.01. In March and July, the ERI value was also significantly higher in forests, than park-forests (p < 0.01 and parks (p < 0.01. May was the month with the highest ERI value in each ecological category (forests p < 0.05; park-forests p < 0.01; parks p < 0.001. However, the number of tick bites in humans did not correlate with ERI values. Conclusion. The obtained results indicate that the risk of tick bite and human exposure to B. burgdorferi sensu lato is present at all selected localities in Belgrade. For a more comprehensive Lyme disease risk assessment the method of entomological risk index assessment should be combined with other methods, taking into consideration all tick stages and the behaviour and habits of people who may get infected B. burgdorferi sensu lato.

  2. Multi-source analysis reveals latitudinal and altitudinal shifts in range of Ixodes ricinus at its northern distribution limit

    Directory of Open Access Journals (Sweden)

    Kristoffersen Anja B

    2011-05-01

    Full Text Available Abstract Background There is increasing evidence for a latitudinal and altitudinal shift in the distribution range of Ixodes ricinus. The reported incidence of tick-borne disease in humans is on the rise in many European countries and has raised political concern and attracted media attention. It is disputed which factors are responsible for these trends, though many ascribe shifts in distribution range to climate changes. Any possible climate effect would be most easily noticeable close to the tick's geographical distribution limits. In Norway- being the northern limit of this species in Europe- no documentation of changes in range has been published. The objectives of this study were to describe the distribution of I. ricinus in Norway and to evaluate if any range shifts have occurred relative to historical descriptions. Methods Multiple data sources - such as tick-sighting reports from veterinarians, hunters, and the general public - and surveillance of human and animal tick-borne diseases were compared to describe the present distribution of I. ricinus in Norway. Correlation between data sources and visual comparison of maps revealed spatial consistency. In order to identify the main spatial pattern of tick abundance, a principal component analysis (PCA was used to obtain a weighted mean of four data sources. The weighted mean explained 67% of the variation of the data sources covering Norway's 430 municipalities and was used to depict the present distribution of I. ricinus. To evaluate if any geographical range shift has occurred in recent decades, the present distribution was compared to historical data from 1943 and 1983. Results Tick-borne disease and/or observations of I. ricinus was reported in municipalities up to an altitude of 583 metres above sea level (MASL and is now present in coastal municipalities north to approximately 69°N. Conclusion I. ricinus is currently found further north and at higher altitudes than described in

  3. Occurrence of Babesia spp., Rickettsia spp. and Bartonella spp. in Ixodes ricinus in Bavarian public parks, Germany

    Directory of Open Access Journals (Sweden)

    Mahling Monia

    2011-07-01

    Full Text Available Abstract Background Only limited information is available about the occurrence of ticks and tick-borne pathogens in public parks, which are areas strongly influenced by human beings. For this reason, Ixodes ricinus were collected in public parks of different Bavarian cities in a 2-year survey (2009 and 2010 and screened for DNA of Babesia spp., Rickettsia spp. and Bartonella spp. by PCR. Species identification was performed by sequence analysis and alignment with existing sequences in GenBank. Additionally, coinfections with Anaplasma phagocytophilum were investigated. Results The following prevalences were detected: Babesia spp.: 0.4% (n = 17, including one pool of two larvae in 2009 and 0.5 to 0.7% (n = 11, including one pool of five larvae in 2010; Rickettsia spp.: 6.4 to 7.7% (n = 285, including 16 pools of 76 larvae in 2009. DNA of Bartonella spp. in I. ricinus in Bavarian public parks could not be identified. Sequence analysis revealed the following species: Babesia sp. EU1 (n = 25, B. divergens (n = 1, B. divergens/capreoli (n = 1, B. gibsoni-like (n = 1, R. helvetica (n = 272, R. monacensis IrR/Munich (n = 12 and unspecified R. monacensis (n = 1. The majority of coinfections were R. helvetica with A. phagocytophilum (n = 27, but coinfections between Babesia spp. and A. phagocytophilum, or Babesia spp. and R. helvetica were also detected. Conclusions I. ricinus ticks in urban areas of Germany harbor several tick-borne pathogens and coinfections were also observed. Public parks are of particularly great interest regarding the epidemiology of tick-borne pathogens, because of differences in both the prevalence of pathogens in ticks as well as a varying species arrangement when compared to woodland areas. The record of DNA of a Babesia gibsoni-like pathogen detected in I. ricinus suggests that I. ricinus may harbor and transmit more Babesia spp. than previously known. Because of their high recreational value for human beings, urban green

  4. Prevalence of Rickettsiales (Anaplasma phagocytophilum and Rickettsia spp.) in hard ticks (Ixodes ricinus) in the city of Hamburg, Germany.

    Science.gov (United States)

    May, Kathrin; Strube, Christina

    2014-06-01

    To narrow the gap of missing knowledge on Rickettsia spp. and Anaplasma phagocytophilum infections in ticks in northwestern Germany and, at the same time, to provide first prevalence data on these pathogens in the city of Hamburg, a total of 1,400 questing Ixodes ricinus ticks were collected at ten different public green areas from April until October 2011. Ticks were examined using probe-based quantitative real-time PCR. A percentage of 3.6% (51/1,400) ticks were tested positive for A. phagocytophilum infections divided into 2.1% (3/141) adults [1.7% (1/60) females and 2.5% (2/81) males] and 3.8% (48/1,259) nymphs. The percentage of infected ticks per sampling site varied statistically significantly from 0.7% (1/140) to 12.1% (17/140), whereas between sampling months, no statistically significant differences were observed (2.0-6.5%, 4-13/140). The overall Rickettsia spp. infection rate was 52.5% (735/1,400). In adult ticks, Rickettsia spp. infection rate was 56% (79/141) divided into 61.7% (37/60) infected females and 51.9% (42/81) infected males. Nymphs showed an infection rate of 52.1% (656/1,259). In contrast to A. phagocytophilum infections, no statistically significant differences in Rickettsia spp. infection rates among sampling sites (44.3-63.6%, 62-89/140) were observed, whereas seasonal variations were obvious: the percentage of Rickettsia-positive ticks was significantly lower in April (36.5%, 73/200) and May (29.5%, 59/200) compared to the summer and fall months (55.0-64.5%, 110-129/200). Rickettsia species differentiation via real-time pyrosequencing revealed Rickettsia helvetica as the only occurring species. Co-infections with both Rickettsia spp. and A. phagocytophilum were detected in 2.0% (28/1,400) of the ticks. The present study revealed that in the city of Hamburg, the tick infection rate with A. phagocytophilum is comparable with other German data, whereas the Rickettsia spp. infection rate of 52.5% is by far the highest prevalence detected in

  5. Babesia microti: prevalence in wild rodents and Ixodes ricinus ticks from the Mazury Lakes District of North-Eastern Poland.

    Science.gov (United States)

    Siński, Edward; Bajer, Anna; Welc, Renata; Pawełczyk, Agnieszka; Ogrzewalska, Maria; Behnke, Jerzy M

    2006-05-01

    Infections of Babesia microti (Apicomplexa, Piroplasmida), a common erythroparasitic protozoon of Holarctic rodents, are not widely acknowledged in Poland. The presence of this parasite in various species of wild rodents has been well documented throughout the northern temperate zone of North America, Europe, and Eurasia. However, human babesiosis attributable to infection with B. microti has been reported only from the north-eastern and upper midwestern United States and Japan. We recently carried out an epizootiological survey investigating the prevalence of B. microti both in the tick Ixodes ricinus and in wild rodents in North-Eastern Poland. Blood samples were collected from a total of 483 animals comprising three species: Apodemus flavicollis, Microtus arvalis, and Microtus oeconomus trapped at Urwitałt near Mikołajki in the Mazury Lakes District. Questing adult I. ricinus ticks were collected in the study sites by blanket dragging of vegetation in heterogeneous, deciduous woodland, and, in addition, rodents were carefully examined for feeding larvae and nymphs. Altogether, B. microti was detected in 9 out of 1513 I. ricinus ticks (0.6%) examined by PCR. This included 163 adults (92 females and 71 males), 50 nymphs, and 1300 larvae 3%, 8%, and 0% of which were PCR-positive, respectively. Of 85 A. flavicollis, 374 M. arvalis and 24 M. oeconomus, 1%, 12.8%, and 42% were parasitaemic, respectively, as determined by microscopic examination of blood smears stained with Giemsa. B. microti DNA, extracted from 53 M. arvalis and 5 M. oeconomus and examined by nested PCR, targeting a piroplasm-specific portion of the 18S ribosomal DNA, revealed 72% and 40%, respectively, to be PCR positive. Sequence analysis showed that all PCR-positive samples had rDNA sequences identical (100% homology) to that of the Munich B. microti strain isolated from Mus musculus. The results of this study indicate that the B. microti commonly encountered among Microtus spp. rodents is

  6. Changes in the Proteome of Langat-Infected Ixodes scapularis ISE6 Cells: Metabolic Pathways Associated with Flavivirus Infection.

    Directory of Open Access Journals (Sweden)

    Jeffrey M Grabowski

    2016-02-01

    Full Text Available Ticks (Family Ixodidae transmit a variety of disease causing agents to humans and animals. The tick-borne flaviviruses (TBFs; family Flaviviridae are a complex of viruses, many of which cause encephalitis and hemorrhagic fever, and represent global threats to human health and biosecurity. Pathogenesis has been well studied in human and animal disease models. Equivalent analyses of tick-flavivirus interactions are limited and represent an area of study that could reveal novel approaches for TBF control.High resolution LC-MS/MS was used to analyze the proteome of Ixodes scapularis (Lyme disease tick embryonic ISE6 cells following infection with Langat virus (LGTV and identify proteins associated with viral infection and replication. Maximal LGTV infection of cells and determination of peak release of infectious virus, was observed at 36 hours post infection (hpi. Proteins were extracted from ISE6 cells treated with LGTV and non-infectious (UV inactivated LGTV at 36 hpi and analyzed by mass spectrometry. The Omics Discovery Pipeline (ODP identified thousands of MS peaks. Protein homology searches against the I. scapularis IscaW1 genome assembly identified a total of 486 proteins that were subsequently assigned to putative functional pathways using searches against the Kyoto Encyclopedia of Genes and Genomes (KEGG database. 266 proteins were differentially expressed following LGTV infection relative to non-infected (mock cells. Of these, 68 proteins exhibited increased expression and 198 proteins had decreased expression. The majority of the former were classified in the KEGG pathways: "translation", "amino acid metabolism", and "protein folding/sorting/degradation". Finally, Trichostatin A and Oligomycin A increased and decreased LGTV replication in vitro in ISE6 cells, respectively.Proteomic analyses revealed ISE6 proteins that were differentially expressed at the peak of LGTV replication. Proteins with increased expression following infection

  7. Multi-trophic interactions driving the transmission cycle of Borrelia afzelii between Ixodes ricinus and rodents: a review.

    Science.gov (United States)

    van Duijvendijk, Gilian; Sprong, Hein; Takken, Willem

    2015-12-18

    The tick Ixodes ricinus is the main vector of the spirochaete Borrelia burgdorferi sensu lato, the causal agent of Lyme borreliosis, in the western Palearctic. Rodents are the reservoir host of B. afzelii, which can be transmitted to I. ricinus larvae during a blood meal. The infected engorged larvae moult into infected nymphs, which can transmit the spirochaetes to rodents and humans. Interestingly, even though only about 1% of the larvae develop into a borreliae-infected nymph, the enzootic borreliae lifecycle can persist. The development from larva to infected nymph is a key aspect in this lifecycle, influencing the density of infected nymphs and thereby Lyme borreliosis risk. The density of infected nymphs varies temporally and geographically and is influenced by multi-trophic (tick-host-borreliae) interactions. For example, blood feeding success of ticks and spirochaete transmission success differ between rodent species and host-finding success appears to be affected by a B. afzelii infection in both the rodent and the tick. In this paper, we review the major interactions between I. ricinus, rodents and B. afzelii that influence this development, with the aim to elucidate the critical factors that determine the epidemiological risk of Lyme borreliosis. The effects of the tick, rodent and B. afzelii on larval host finding, larval blood feeding, spirochaete transmission from rodent to larva and development from larva to nymph are discussed. Nymphal host finding, nymphal blood feeding and spirochaete transmission from nymph to rodent are the final steps to complete the enzootic B. afzelii lifecycle and are included in the review. It is concluded that rodent density, rodent infection prevalence, and tick burden are the major factors affecting the development from larva to infected nymph and that these interact with each other. We suggest that the B. afzelii lifecycle is dependent on the aggregation of ticks among rodents, which is manipulated by the pathogen

  8. Preliminary survey for entomopathogenic fungi associated with Ixodes scapularis>/i> (Acari: Ixodidae) in southern New York and New England, USA

    Science.gov (United States)

    Zhioua, Elyes; Ginsberg, Howard S.; Humber, Richard A.; LeBrun, Roger A.

    1999-01-01

    Free-living larval, nymphal, and adult Ixodes scapularis Say were collected from scattered locales in southern New England and New York to determine infection rates with entomopathogenic fungi. Infection rates of larvae, nymphs, males, and females were 0% (571), 0% (272), 0% (57), and 4.3% (47), respectively. Two entomopathogenic fungi were isolated from field-collected I. scapularis females from Fire Island, NY. Isolates were identified as Verticillium lecanii (Zimmermann) Viegas and Verticillium sp. (a member of the Verticillium lecanii species complex).Ixodes scapularis Say is the principal vector of Borrelia burgdorferi Johnson, Schmid, Hyde, Steigerwalt & Brenner (Burgdorfer et al. 1982, Johnson et al. 1984), the etiologic agent of Lyme disease in the northeastern and upper-midwestern United States. Control of I. scapularis is based on chemical treatment (Mather et al. 1987b; Schulze et al. 1987, 1991), environmental management (Wilson et al. 1988, Schulze et al. 1995), and habitat modification (Wilson 1986). These methods have shown variable success, and some potentially have negative environmental effects (Wilson and Deblinger 1993, Ginsberg 1994).Studies concerning natural predators, parasitoids, and pathogens of I. scapularis are rare. The use of ground-dwelling birds as tick predators has had only limited success (Duffy et al. 1992). Nymphal I. scapularis are often infected with the parasitic wasp Ixodiphagus hookeri (Howard) (Mather et al. 1987a, Hu et al. 1993, Stafford et al. 1996, Hu and Hyland 1997), but this wasp does not effectively control I. scapularis populations (Stafford et al. 1996). The entomopathogenic nematodes Steinernema carpocapsae (Weiser) and S. glaseri (Steiner) are pathogenic only to engorged female I. scapularis, and thus have limited applicability (Zhioua et al. 1995). In contrast, the entomogenous fungus Metarhizium anisopliae (Metschnikoff) Sorokin is highly pathogenic to all stages of I. scapularis, unfed as well as engorged

  9. A study of the presence of B. burgdorferi, Anaplasma (previously Ehrlichia) phagocytophilum, Rickettsia, and Babesia in Ixodes ricinus collected within the territory of Belluno, Italy.

    Science.gov (United States)

    Piccolin, G; Benedetti, G; Doglioni, C; Lorenzato, C; Mancuso, S; Papa, N; Pitton, L; Ramon, M C; Zasio, C; Bertiato, G

    2006-01-01

    In the years 2000 and 2001, we sampled ticks in order to establish the distribution of Ixodes ricinus in the province of Belluno; 5987 tick samples from 244 sites throughout the province were gathered, by dragging for a 5-min period. In 40 sites, seasonal variations and cycle stages of the parasites were studied at monthly intervals from March to September. A polymerase chain reaction (PCR) technique was used to identify the tick-infected sites. Of 1931 individual ticks, 8.23% were positive for Borrelia burgdorferi, 4.4% were positive for Ehrlichia, 1.6% were positive for Rickettsia, and 1.6% were positive for Babesia. The co-presence of Borrelia and Ehrlichia (1.2%) and Babesia (0.5%), Borrelia, Ehrlichia and Rickettsia (0.1%) was also found.

  10. Rickettsia-like microorganisms in the ovarian primordial of molting Ixodes ricinus (acari : ixodidae) larvae and nymphs

    OpenAIRE

    Zhu, Z.; Aeschlimann, André; Gern,Lise

    2017-01-01

    Un grand nombre de micro-organismes de type rickettsien ont été observés dans les cellules des ébauches ovariennes de larves et de nymphes d'Ixodes ricinus, lors de la mue. La morphologie de ces organismes est identique chez toutes les tiques examinées. Ils mesurent 0,3-0,4 µm de diamètre et 0,6-1,3 µm, parfois jusqu’à 2,5 µm, de long. Ils possèdent une paroi externe membraneuse fortement ondulée et une membrane plasmique interne. L’épaisseur de chacune de ces 2 structures est de 6-10 n...

  11. Human behaviors elevating the risk of exposure to Ixodes ricinus larvae and nymphs in two types of lowland coniferous forests in west-central Poland.

    Science.gov (United States)

    Wierzbicka, Anna; Rączka, Grzegorz; Skorupski, Maciej; Michalik, Jerzy; Lane, Robert S

    2016-10-01

    Ixodes ricinus L. is the commonest tick encountered by humans in Central Europe and the most important vector of tick-borne diseases (TBD) in Europe. Foresters represent a group at elevated risk of exposure to I. ricinus throughout Europe. Here, we employed an experimental design similar to one used previously to determine what behavioral factors heighten exposure to questing Ixodes pacificus nymphs in a hardwood forest in the far-western United States. Five activities were evaluated systematically in a coniferous forest and a mixed broadleaved forest in west-central Poland: (i) walking in low-cut running shoes; (ii) sitting atop logs; (iii) sitting on leaf litter; (iv) sitting against tree trunks; and (v) gathering firewood. In total, 540 I. ricinus ticks were collected (198 larvae, 327 nymphs, 15 adults) in spring and late summer. Many more ticks were collected in spring than in late summer, and in the mixed broadleaved forest versus the coniferous forest. The riskiest behavior for acquiring nymphs in both spring and late summer was gathering firewood, though sitting atop logs was nearly as perilous in late summer. In contrast, the riskiest behaviors for encountering larvae in spring and late summer were sitting against trunks and sitting on leaf litter, respectively. Pairwise comparisons revealed only two significant associations among the variables explored for the nymphs: season and human gender, and season and type of forest. For larval ticks, the most significant associations were gender and sitting behaviors and for type of forest and sitting on leaf litter or against tree trunks. The most commonly infested body region was the lower legs. Copyright © 2016 Elsevier GmbH. All rights reserved.

  12. Population-based passive tick surveillance and detection of expanding foci of blacklegged ticks Ixodes scapularis and the Lyme disease agent Borrelia burgdorferi in Ontario, Canada.

    Science.gov (United States)

    Nelder, Mark P; Russell, Curtis; Lindsay, L Robbin; Dhar, Badal; Patel, Samir N; Johnson, Steven; Moore, Stephen; Kristjanson, Erik; Li, Ye; Ralevski, Filip

    2014-01-01

    We identified ticks submitted by the public from 2008 through 2012 in Ontario, Canada, and tested blacklegged ticks Ixodes scapularis for Borrelia burgdorferi and Anaplasma phagocytophilum. Among the 18 species of ticks identified, I. scapularis, Dermacentor variabilis, Ixodes cookei and Amblyomma americanum represented 98.1% of the 14,369 ticks submitted. Rates of blacklegged tick submission per 100,000 population were highest in Ontario's Eastern region; D. variabilis in Central West and Eastern regions; I. cookei in Eastern and South West regions; and A. americanum had a scattered distribution. Rates of blacklegged tick submission per 100,000 population were highest from children (0-9 years old) and older adults (55-74 years old). In two health units in the Eastern region (i.e., Leeds, Grenville & Lanark District and Kingston-Frontenac and Lennox & Addington), the rate of submission for engorged and B. burgdorferi-positive blacklegged ticks was 47× higher than the rest of Ontario. Rate of spread for blacklegged ticks was relatively faster and across a larger geographic area along the northern shore of Lake Ontario/St. Lawrence River, compared with slower spread from isolated populations along the northern shore of Lake Erie. The infection prevalence of B. burgdorferi in blacklegged ticks increased in Ontario over the study period from 8.4% in 2008 to 19.1% in 2012. The prevalence of B. burgdorferi-positive blacklegged ticks increased yearly during the surveillance period and, while increases were not uniform across all regions, increases were greatest in the Central West region, followed by Eastern and South West regions. The overall infection prevalence of A. phagocytophilum in blacklegged ticks was 0.3%. This study provides essential information on ticks of medical importance in Ontario, and identifies demographic and geographic areas for focused public education on the prevention of tick bites and tick-borne diseases.

  13. A list of the 70 species of Australian ticks; diagnostic guides to and species accounts of Ixodes holocyclus (paralysis tick), Ixodes cornuatus (southern paralysis tick) and Rhipicephalus australis (Australian cattle tick); and consideration of the place of Australia in the evolution of ticks with comments on four controversial ideas.

    Science.gov (United States)

    Barker, Stephen C; Walker, Alan R; Campelo, Dayana

    2014-10-15

    Seventy species of ticks are known from Australia: 14 soft ticks (family Argasidae) and 56 hard ticks (family Ixodidae). Sixteen of the 70 ticks in Australia may feed on humans and domestic animals (Barker and Walker 2014). The other 54 species of ticks in Australia feed only on wild mammals, reptiles and birds. At least 12 of the species of ticks in Australian also occur in Papua New Guinea. We use an image-matching system much like the image-matching systems of field guides to birds and flowers to identify Ixodes holocyclus (paralysis tick), Ixodes cornuatus (southern paralysis tick) and Rhipicephalus (Boophilus) australis (Australian cattle tick). Our species accounts have reviews of the literature on I. holocyclus (paralysis tick) from the first paper on the biology of an Australian tick by Bancroft (1884), on paralysis of dogs by I. holocyclus, to papers published recently, and of I. cornuatus (southern paralysis tick) and Rhipicephalus (Boophilus) australis (Australian cattle tick). We comment on four controversial questions in the evolutionary biology of ticks: (i) were labyrinthodont amphibians in Australia in the Devonian the first hosts of soft, hard and nuttalliellid ticks?; (ii) are the nuttalliellid ticks the sister-group to the hard ticks or the soft ticks?; (iii) is Nuttalliella namaqua the missing link between the soft and hard ticks?; and (iv) the evidence for a lineage of large bodied parasitiform mites (ticks plus the holothyrid mites plus the opiliocarid mites).

  14. Species diversity and geographic distribution of hard ticks (Acari: Ixodoidea: Ixodidae) infesting domestic ruminants, in Qazvin Province, Iran.

    Science.gov (United States)

    Shemshad, Khadijeh; Rafinejad, Javad; Kamali, Karim; Piazak, Norayer; Sedaghat, Mohammad Mahdi; Shemshad, Masoomeh; Biglarian, Akbar; Nourolahi, Fathollah; Valad Beigi, Enshallah; Enayati, Ahmad Ali

    2012-01-01

    This report presents the results of the first faunistic study of hard ticks in Qazvin province of Iran. The primary objective was to determine the species diversity and geographic distribution of hard ticks that parasitize domestic ruminants. Information about the abiotic preferences of these species has been provided. A total of 286 cattle, 1,053 goats, and 2,050 sheep were examined in 13 villages in 28 flocks distributed throughout the studied areas. Total direct body collections of ticks were made from each domestic ruminant. A total of 228 Ixodid specimens belonging to nine species in three different genera were recorded in the areas, including Boophilus annulatus (Say, 1821), Hyalomma anatolicum Koch, 1844, Hyalomma asiaticum (Schulze and Schlettke, 1929), Hyalomma detritum Schulze, 1919, Hyalomma dromedarii Koch, 1844, Hyalomma marginatum Koch 1844, Hyalomma schulzei Olenev, 1931, Rhipicephalus bursa Canestrini and Fanz, 1878 and Rhipicephalus sanguineus (Latreille, 1806). The most abundant species on sheep was R. sanguineus (46.92%), while B. annulatus (6.6%) found only on cattle. A finding of great significance was that R. sanguineus, the main vector of babesiosis, is firmly established throughout the counties. A further objective of the study was to compare the abundance of the major tick species on domestic ruminants. This was carried out at 19 sampling sites. The highest number of ticks was collected in July-August during the hot season.

  15. SNP-based real-time pyrosequencing as a sensitive and specific tool for identification and differentiation of Rickettsia species in Ixodes ricinus ticks

    Directory of Open Access Journals (Sweden)

    Janecek Elisabeth

    2012-10-01

    Full Text Available Abstract Background Rickettsioses are caused by pathogenic species of the genus Rickettsia and play an important role as emerging diseases. The bacteria are transmitted to mammal hosts including humans by arthropod vectors. Since detection, especially in tick vectors, is usually based on PCR with genus-specific primers to include different occurring Rickettsia species, subsequent species identification is mainly achieved by Sanger sequencing. In the present study a real-time pyrosequencing approach was established with the objective to differentiate between species occurring in German Ixodes ticks, which are R. helvetica, R. monacensis, R. massiliae, and R. felis. Tick material from a quantitative real-time PCR (qPCR based study on Rickettsia-infections in I. ricinus allowed direct comparison of both sequencing techniques, Sanger and real-time pyrosequencing. Methods A sequence stretch of rickettsial citrate synthase (gltA gene was identified to contain divergent single nucleotide polymorphism (SNP sites suitable for Rickettsia species differentiation. Positive control plasmids inserting the respective target sequence of each Rickettsia species of interest were constructed for initial establishment of the real-time pyrosequencing approach using Qiagen’s PSQ 96MA Pyrosequencing System operating in a 96-well format. The approach included an initial amplification reaction followed by the actual pyrosequencing, which is traceable by pyrograms in real-time. Afterwards, real-time pyrosequencing was applied to 263 Ixodes tick samples already detected Rickettsia-positive in previous qPCR experiments. Results Establishment of real-time pyrosequencing using positive control plasmids resulted in accurate detection of all SNPs in all included Rickettsia species. The method was then applied to 263 Rickettsia-positive Ixodes ricinus samples, of which 153 (58.2% could be identified for their species (151 R. helvetica and 2 R. monacensis by previous custom

  16. Tick-borne borrelioses pathogen identification in Ixodes ticks (Acarina, Ixodidae) collected in St. Petersburg and Kaliningrad Baltic regions of Russia.

    Science.gov (United States)

    Alekseev, A N; Dubinina, H V; Antykova, L P; Dzhivanyan, T I; Rijpkema, S G; Kruif, N V; Cinco, M

    1998-03-01

    Two isolated Baltic seashore populations of Ixodes ticks were studied as vectors of different Borrelia genospecies in Russia by using darkfield microscopy and modified polymerase chain reaction (PCR). In the Kalinigrad region (Kurish Spit, forests near the settlements of Lesnoye and Rybachy), 788 Ixodes ricinus (L.) adults and nymphs were collected by flagging and studied by darkfield microscopy during 1995-1996. There were 88 darkfield microscopy positive specimens (11.2%) of which 69 were also analyzed by PCR. Borrelia afzelii and B. garinii were found individually and together in ticks. In this region, on the Kurish Spit, 7 patients with tick borrelioses were observed: 2 in the Russian part of Spit and 5 in the Lithuanian part. A significant difference was found between Borrelia prevalence during the spring and fall peaks of tick abundance. Specimens that were darkfield microscopy positive prevailed in the fall (25.15%) in comparison with the spring peak (7.3%). The number of specimens with identified genospecies prevailed in the spring: 22 out of 35 versus 4 out of 31 in the fall. Among 29 PCR positive I. ricinus, 21 contained B. afzelii, 3 had B. garinii, and 2 had dual infection. In 1995, only B. afzelii infected specimens were observed. In the vicinity of St. Petersburg (the seashore of the northern Gulf of Finland, in forests near Lisy Nos, Morskaja) during 1992-1996, 31 patients with a tick-borne borrelioses were registered. We collected 487 Ixodes persulcatus Schulze by flagging and studied them by darkfield microscopy in 1995-1996 of which 144 ticks (29.6%) were darkfield microscopy positive. Sixty darkfield-positive specimens were analyzed by PCR, and in 88.3% of cases genospecies were identified. B. afzelii and B. garinii were identified individually and together in ticks. In 1995, I. persulcatus with dual infection prevailed with 11 out of 21 (52.4% positive), whereas in 1996, most I. persulcatus ticks contained B. garinii (81.2%). Dual infection was

  17. Aza-peptidyl Michael acceptor and epoxide inhibitors--potent and selective inhibitors of Schistosoma mansoni and Ixodes ricinus legumains (asparaginyl endopeptidases).

    Science.gov (United States)

    Ovat, Asli; Muindi, Fanuel; Fagan, Crystal; Brouner, Michelle; Hansell, Elizabeth; Dvorák, Jan; Sojka, Daniel; Kopácek, Petr; McKerrow, James H; Caffrey, Conor R; Powers, James C

    2009-11-26

    Aza-peptide Michael acceptors and epoxides with the general structure of YCO-Ala-Ala-AAsn-trans-CH horizontal lineCHCOR and YCO-Ala-Ala-AAsn-EP-COR, respectively, are shown to be potent inhibitors of asparaginyl endopeptidases (legumains) from the bloodfluke, Schistosoma mansoni (SmAE), and the hard tick, Ixodes ricinus (IrAE). Structure-activity relationships (SARs) were determined for a set of 41 aza-peptide Michael acceptors and eight aza-peptide epoxides. Both enzymes prefer disubstituted amides to monosubstituted amides in the P1' position, and potency increased as we increased the hydrophobicity of the inhibitor in this position. Extending the inhibitor to P5 resulted in increased potency, especially against IrAE, and both enzymes prefer small over large hydrophobic residues at P2. Aza-peptide Michael acceptor inhibitors are more potent than aza-peptide epoxide inhibitors, and for some of these compounds, second-order inhibiton rate constants are the fastest yet discovered. Given the central functions of these enzymes in both parasites, the data presented here may facilitate the eventual design of selective antiparasitic drugs.

  18. Infestation and seasonal activity of Ixodes vespertilionis Koch, 1844 (Acari: Ixodidae) on the Maghreb mouse-eared bat, Myotis punicus Felten, 1977, in northeastern Algeria.

    Science.gov (United States)

    Bendjeddou, Mohammed Lamine; Bouslama, Zihad; Amr, Zuhair S; BaniHani, Rihan

    2016-06-01

    Infestation of Ixodes vespertilionis Koch, 1844 on Myotis punicus Felten, 1977 from two sites (Trios Tunnel and Sidi Trad cave) in northeastern Algeria was studied. An overall infestation of 41.4% for all stages was found among bats collected from both sites. By stage, a total of eight females, 70 nymphs, and 107 larvae were recovered from both populations. The number of females recovered per bat at Sidi Trad ranged from 0-1, for nymphs 0-2, and for larvae 0-2. While no female ticks were collected at Trios Tunnel, the number of nymphs ranged from 0-2 and for larvae 0-2. At Trios Tunnel, the number of nymphs was significantly higher during April and June but not for July and September. On the other hand, the number of larvae increased from July to November, while at Sidi Trad cave, female ticks were recovered during April and May and then disappeared until the end of the study period. Significant differences were noted during all the months when compared with all stages. Nymphs infested bats significantly during April and May, declined in June and July, and then became steady until October. Larvae peaked in July, with low frequency in April, and then fluctuated from August to November.

  19. Comparison of synganglion neuropeptides, neuropeptide receptors and neurotransmitter receptors and their gene expression in response to feeding in Ixodes scapularis (Ixodidae) vs. Ornithodoros turicata (Argasidae).

    Science.gov (United States)

    Egekwu, N; Sonenshine, D E; Garman, H; Barshis, D J; Cox, N; Bissinger, B W; Zhu, J; M Roe, R

    2016-02-01

    Illumina GAII high-throughput sequencing was used to compare expressed genes for female synganglion neuropeptides, neuropeptide receptors and neurotransmitter receptors of the soft tick Ornithodoros turicata with the hard tick Ixodes scapularis. Gene ontology molecular level three mapping revealed no significant differences amongst the same categories represented in O. turicata and I. scapularis. Transcripts predicting 22 neuropeptides or their receptors in the O. turicata synganglion were similar to annotations for 23 neuropeptides or receptors previously identified from I scapularis, with minor exceptions. A transcript predicting ecdysis triggering hormone receptor was identified in O. turicata; transcripts encoding for proprotein convertase and glycoprotein B were identified in both species. Transcripts predicting the same neurotransmitter receptors were found in the synganglion of both species. Gene expression of the transcripts showed numerous differences in response to feeding. Major differences were observed in expression of genes believed important in regulating slow vs. rapid feeding, blood water elimination, cuticle synthesis plasticity and in signalling reproductive activity. Although the glutamate receptor was strongly upregulated in both species, the gamma aminobutyric acid receptor, which inhibits glutamate, was upregulated significantly only in I. scapularis. These differences are consistent with the slow vs. rapid action of the pharyngeal pump in the two species.

  20. Molecular evidence of Anaplasma phagocytophilum and Babesia microti co-infections in Ixodes ricinus ticks in central-eastern region of Poland.

    Science.gov (United States)

    Sytykiewicz, Hubert; Karbowiak, Grzegorz; Hapunik, Joanna; Szpechciński, Adam; Supergan-Marwicz, Marta; Goławska, Sylwia; Sprawka, Iwona; Czerniewicz, Paweł

    2012-01-01

    The aim of the study was to elucidate the distribution of Anaplasma phagocytophilum and Babesia microti co-infection in Ixodes ricinus populations within the central-eastern region of Poland. The prevalence of analysed tick-borne human pathogens in single and polymicrobial infections in I. ricinus ticks were analysed using the conventional and nested PCR techniques. A total number of 1,123 questing tick individuals (291 females, 267 males and 565 nymphs) were collected at different ecosystems (municipal parks, suburban forests, and woodlands). In the presented study, 95 samples of ticks (8.5%) were infected with A.phagocytophilum, 3.1% (n=35) with B. microti, whereas the co-existence status of these human pathogens was detected in 1.8% (n=20) of all tested samples. It has been demonstrated that the prevalence of co-infection status was the highest among females of I. ricinus (11 samples, 3.8%), whereas the lowest within tested nymphs (5 samples, 0.9%). Ticks collected at city parks in Warsaw and suburban areas of this town characterized the highest prevalence of co-infections (3.3 and 4.8%, respectively). Furthermore, it was established that co-infection rates of ticks inhabiting woodlands within Kampinos National Park and Nadbużański Landscape Park were similar and reached the levels of 1.4% (n=5) and 1.1% (n=4), respectively.

  1. Prevalence Rates of Borrelia burgdorferi (Spirochaetales: Spirochaetaceae), Anaplasma phagocytophilum (Rickettsiales: Anaplasmataceae), and Babesia microti (Piroplasmida: Babesiidae) in Host-Seeking Ixodes scapularis (Acari: Ixodidae) from Pennsylvania.

    Science.gov (United States)

    Hutchinson, M L; Strohecker, M D; Simmons, T W; Kyle, A D; Helwig, M W

    2015-07-01

    The etiological agents responsible for Lyme disease (Borrelia burgdorferi), human granulocytic anaplasmosis (Anaplasma phagocytophilum), and babesiosis (Babesia microti) are primarily transmitted by the blacklegged tick, Ixodes scapularis Say. Despite Pennsylvania having in recent years reported the highest number of Lyme disease cases in the United States, relatively little is known regarding the geographic distribution of the vector and its pathogens in the state. Previous attempts at climate-based predictive modeling of I. scapularis occurrence have not coincided with the high human incidence rates in parts of the state. To elucidate the distribution and pathogen infection rates of I. scapularis, we collected and tested 1,855 adult ticks statewide from 2012 to 2014. The presence of I. scapularis and B. burgdorferi was confirmed from all 67 Pennsylvania counties. Analyses were performed on 1,363 ticks collected in the fall of 2013 to avoid temporal bias across years. Infection rates were highest for B. burgdorferi (47.4%), followed by Ba. microti (3.5%) and A. phagocytophilum (3.3%). Coinfections included B. burgdorferi+Ba. microti (2.0%), B. burgdorferi+A. phagocytophilum (1.5%) and one tick positive for A. phagocytophilum+Ba. microti. Infection rates for B. burgdorferi were lower in the western region of the state. Our findings substantiate that Lyme disease risk is high throughout Pennsylvania.

  2. Host, habitat and climate preferences of Ixodes angustus (Acari: Ixodidae) and infection with Borrelia burgdorferi and Anaplasma phagocytophilum in California, USA.

    Science.gov (United States)

    Stephenson, Nicole; Wong, Johnny; Foley, Janet

    2016-10-01

    The Holarctic tick Ixodes angustus is a competent vector for Borrelia burgdorferi, the etiologic agent of Lyme disease, and possibly Anaplasma phagocytophilum, the etiologic agent of granulocytic anaplasmosis, as well. From 2005 to 2013, we collected host-feeding I. angustus individuals from live-trapped small mammals and by flagging vegetation from 12 study sites in northern and central California, and tested for B. burgdorferi sensu lato, A. phagocytophilum, and Rickettsia spp. DNA by real-time PCR. Among 261 I. angustus collected (259 from hosts and two by flagging), the most common hosts were tree squirrels (20 % of ticks) and chipmunks (37 %). The PCR-prevalence for A. phagocytophilum and B. burgdorferi in ticks was 2 % and zero, respectively. The minimum infection prevalence on pooled DNA samples was 10 % for Rickettsia spp. DNA sequencing of the ompA gene identified this rickettsia as Candidatus Rickettsia angustus, a putative endosymbiont. A zero-inflated negative binomial mixed effects model was used to evaluate geographical and climatological predictors of I. angustus burden. When host species within study site and season within year were included in the model as nested random effects, all significant variables revealed that I. angustus burden increased as temperature decreased. Together with published data, these findings suggest that I. angustus is a host generalist, has a broad geographic distribution, is more abundant in areas with lower temperature within it's range, and is rarely infected with the pathogens A. phagocytophilum and B. burgdorferi.

  3. Anaplasmataceae and Borrelia burgdorferi sensu lato in the sand lizard Lacerta agilis and co-infection of these bacteria in hosted Ixodes ricinus ticks

    Directory of Open Access Journals (Sweden)

    Ekner Anna

    2011-09-01

    Full Text Available Abstract Background Anaplasmataceae and Borrelia burgdorferi s.l. are important tick-borne bacteria maintained in nature by transmission between ticks and vertebrate hosts. However, the potential role of lizards as hosts has not been sufficiently studied. Results The current study showed that 23 of 171 examined sand lizards Lacerta agilis were PCR positive for Anaplasmataceae. The nucleotide sequences of the several selected PCR products showed 100% homology with Anaplasma spp. found in Ixodes ricinus collected in Tunisia and Morocco (AY672415 - AY672420. 1.2% of lizard collar scale samples were PCR positive for B. lusitaniae. In addition, 12 of 290 examined I. ricinus were PCR positive for B. burgdorferi s.l. and 82 were PCR positive for Anaplasmatacea. The number of ticks per lizard and the number of ticks PCR positive for both microorganisms per lizard were strongly correlated. Moreover, we found a significant correlation between numbers of ticks infected with Anaplasmataceae and with B. burgdorferi s.l. living on the same lizard. However, there was no significant correlation between detection of both bacteria in the same tick. Conclusions To the best of our knowledge, this is the first report of Anaplasmataceae DNA and additionally the second report of B. burgdorferi s.l DNA detection in the sand lizard.

  4. Ixodes ricinus and its transmitted pathogens in urban and peri-urban areas in Europe: new hazards and relevance for public health

    Directory of Open Access Journals (Sweden)

    Annapaola eRizzoli

    2014-12-01

    Full Text Available Tick-borne diseases represent major public and animal health issues worldwide. Ixodes ricinus, primarily associated with deciduous and mixed forests, is the principal vector of causative agents of viral, bacterial and protozoan zoonotic diseases in Europe. Recently, abundant tick populations have been observed in European urban green areas, which are of public health relevance due to exposure of humans and domesticated animals to potentially infected ticks. In urban habitats, small and medium sized mammals, birds, companion animals (dogs, cats and larger mammals (roe deer, wild boar play a role in maintenance of tick populations and as reservoirs of tick-borne pathogens. Presence of ticks infected with tick-borne encephalitis virus and high prevalence of ticks infected with Borrelia burgdorferi s.l., causing Lyme borreliosis, have been reported from urbanized areas in Europe. Emerging pathogens, including bacteria of the order Rickettsiales (Anaplasma phagocytophilum, 'Candidatus Neoehrlichia mikurensis', Rickettsia helvetica, R. monacensis, Borrelia miyamatoi and protozoans (Babesia divergens, B. venatorum and B. microti have also been detected in urban tick populations. Understanding the ecology of ticks and their associations with hosts in a European urbanized environment is crucial to quantify parameters necessary for risk pre-assessment and identification of public health strategies for control and prevention of tick-borne diseases.

  5. First evidence of [i]Babesia venatorum[/i] and [i]Babesia capreoli[/i] in questing Ixodes ricinus ticks in the Czech Republic

    Directory of Open Access Journals (Sweden)

    Kristyna Venclikova

    2015-05-01

    Full Text Available Introduction and objective. [i]Ixodes ricinus[/i] is the most common tick species occurring in Central Europe and it serves as a principal vector of emerging human pathogens. The aim of this study was to determine the prevalence of [i]Babesia spp[/i]. in host-seeking [i]I. ricinus[/i] in urban and natural habitats. Materials and methods. PCR was applied on samples to assess prevalence of [i]Babesia spp.[/i] in questing ixodid ticks. Sequencing was used for [i]Babesia[/i] species determination. Results. 1,473 [i]I. ricinus[/i] ticks (1,294 nymphs, 99 males and 80 females were examined for the presence of [i]Babesia spp[/i]. at the two study sites. Minimum infection rate for [i]Babesia[/i] spp. was found to be 0.5% (infected I. ricinus nymphs were only detected in the natural ecosystem. Two[i] Babesia[/i] species were identified by sequencing: [i]B. venatorum[/i] (formerly called[i] Babesia[/i] sp. EU1 and [i]B. capreoli. [/i] Conclusions. The results obtained represent the first evidence of the occurrence of [i]B. venatorum[/i] and [i]B. capreoli[/i] in host-seeking[i] I. ricinus[/i] ticks in the Czech Republic.

  6. Diversity of Borrelia genospecies in Ixodes ricinus ticks in a Lyme borreliosis endemic area in Switzerland identified by using new probes for reverse line blotting.

    Science.gov (United States)

    Gern, Lise; Douet, Véronique; López, Zully; Rais, Olivier; Cadenas, Francisca Morán

    2010-03-01

    In Europe, 7 Borrelia species belonging to the Borrelia burgdorferi sensu lato complex have been reported in Ixodes ricinus ticks. In addition, another Borrelia, related to the relapsing fever spirochaetes, has also been described. In the present study, we designed probes for reverse line blotting allowing detection and identification of all these Borrelia species after amplification of the variable spacer region between the 23S and 5S ribosomal genes. These new probes allowed us investigate the diversity of Borrelia in 915 I. ricinus collected on the south-facing slope of Chaumont (Switzerland). Among the 159 infected ticks, 7 Borrelia species were identified, and B. spielmanii and relapsing fever-like (RFL) spirochaetes were identified in this area for the first time. B. valaisiana and B. spielmanii were significantly less present in male than in female or nymphal ticks. Mixed infection with RFL spirochaetes and Lyme borreliosis spirochaetes were detected in 4 ticks. In addition, the set of probes could identify the recently described species, B. bavariensis.

  7. Potential of Tenebrio molitor (Coleoptera: Tenebrionidae) as a bioassay probe for Metarhizium brunneum (Hypocreales: Clavicipitaceae) activity against Ixodes scapularis (Acari: Ixodidae).

    Science.gov (United States)

    Bharadwaj, Anuja; Stafford, Kirby C

    2011-12-01

    The yellow mealworm, Tenebrio molitor L., has been used to indicate qualitatively the presence of entomopathogenic fungi in the soil or as a model for evaluating stress and other factors on fungal activity. Although this beetle appears highly susceptible to many of these fungi, little quantitative information is available on the sensitivity of T. molitor to a specific fungus and, therefore, fungal presence or as an indicator for pathogenicity to other species. The purpose of this study was to establish the suitability of T. molitor larvae as a bioassay probe for Metarhizium brunneum for comparison against the blacklegged tick, Ixodes scapularis. Nine concentrations of M. brunneum strain F52 ranging from 1.0 x 10(1) to 8.4 x 10(8) conidial/ml were simultaneously tested against T. molitor larvae and I. scapularis adults. Larvae of yellow mealworm were less sensitive to M. brunneum than I. scapularis adults (LC50's 4.4 x 10(7) and 1.7 x 10(5) conidia/ml, respectively, 4-wk post-treatment). The greater sensitivity of I. scapularis to the fungus suggests that the detection of fungal mycosis in mealworms would indicate sufficient inoculum to be pathogenic to I. scapularis and make this insect a suitable probe for evaluation of the presence and activity of M. brunneum against the blacklegged tick in field applications.

  8. Flåtten Ixodes ricinus som sykdomsvektor i Sør-Norge. Etablering og utvikling av PCR-baserte påvisningsmetoder og påvisning av Babesia, Borrelia og Anaplasma

    OpenAIRE

    2004-01-01

    NORSK SAMMENDRAG: Hensikten med denne undersøkelsen var å undersøke flåtten Ixodes ricinus som smittebærer av Ehrlichia/ Anaplasma, Borrelia burgdorferi sensu lata og Babesia i Sør-Norge, og å etablere DNA-basert metode for påvisning av Babesia og forbedre metode for påvisning av Ehrlichia/ Anaplasma. For å kontrollere variasjon i følsomheten av Ehrlichia/ Anaplasma PCR med 16s rDNA primere Ehr 521/747, ble en internkontroll konstruert. Internkontrollen er et DNA-fragment so...

  9. Environmental factors affecting survival of immature Ixodes scapularis and implications for geographical distribution of lyme disease: The climate/behavior hypothesis

    Science.gov (United States)

    Ginsberg, Howard; Albert, Marisa; Acevedo, Lixis; Dyer, Megan C.; Arsnoe, Isis M.; Tsao, Jean I.; Mather, Thomas N.; LeBrun, Roger A.

    2017-01-01

    Recent reports suggest that host-seeking nymphs in southern populations of Ixodes scapularis remain below the leaf litter surface, while northern nymphs seek hosts on leaves and twigs above the litter surface. This behavioral difference potentially results in decreased tick contact with humans in the south, and fewer cases of Lyme disease. We studied whether north-south differences in tick survival patterns might contribute to this phenomenon. Four month old larvae resulting from a cross between Wisconsin males and South Carolina females died faster under southern than under northern conditions in the lab, as has previously been reported for ticks from both northern and southern populations. However, newly-emerged larvae from Rhode Island parents did not differ consistently in mortality under northern and southern conditions, possibly because of their younger age. Survival is lower, and so the north-south survival difference might be greater in older ticks. Larval survival was positively related to larval size (as measured by scutal area), while survival was positively related to larval fat content in some, but not all, trials. The difference in larval survival under northern vs. southern conditions might simply result from faster metabolism under warmer southern conditions leading to shorter life spans. However, ticks consistently died faster under southern than under northern conditions in the laboratory when relative humidity was low (75%), but not under moderate (85%) or high (95%) RH. Therefore, mortality due to desiccation stress is greater under southern than under northern conditions. We hypothesize that mortality resulting from the greater desiccation stress under southern conditions acts as a selective pressure resulting in the evolution of host-seeking behavior in which immatures remain below the leaf litter surface in southern I. scapularis populations, so as to avoid the desiccating conditions at the surface. If this hypothesis is correct, it has

  10. Prevalence of Borrelia burgdorferi in Ixodes ricinus ticks collected from moose (Alces alces) and roe deer (Capreolus capreolus) in southern Norway.

    Science.gov (United States)

    Kjelland, Vivian; Ytrehus, Bjørnar; Stuen, Snorre; Skarpaas, Tone; Slettan, Audun

    2011-06-01

    As part of a larger survey, ears from 18 roe deer (Capreolus capreolus) and 52 moose (Alces alces) shot in the 2 southernmost counties in Norway were collected and examined for Ixodes ricinus ticks. Seventy-two adult ticks, 595 nymphs, and 267 larvae from the roe deer, and 182 adult ticks, 433 nymphs, and 70 larvae from the moose were investigated for infection with Borrelia burgdorferi sensu lato (s.l.). The results showed the presence of B. burgdorferi s.l. DNA in 2.9% of the nymphs collected from roe deer and in 4.4% of the nymphs and 6.0% of the adults collected from moose. The spirochetes were not detected in adult ticks from roe deer, or in larvae feeding on roe deer or moose. In comparison, the mean infection prevalences in questing I. ricinus collected from the same geographical area were 0.5% infection in larvae, 24.5% in nymphs, and 26.9% in adults. The most prevalent B. burgdorferi genospecies identified in ticks collected from roe deer was B. afzelii (76.5%), followed by B. garinii (17.6%), and B. burgdorferi sensu stricto (5.9%). Only B. afzelii (76.7%) and B. garinii (23.3%) were detected in ticks collected from moose. The present study indicates a lower prevalence of B. burgdorferi infection in I. ricinus ticks feeding on roe deer and moose compared to questing ticks. This is the first study to report B. burgdorferi s.l. prevalence in ticks removed from cervids in Norway.

  11. Detection of Rickettsia helvetica in Ixodes ricinus infesting wild and domestic animals and in a botfly larva (Cephenemyia stimulator) infesting roe deer in Germany.

    Science.gov (United States)

    Scheid, Patrick; Speck, Stephanie; Schwarzenberger, Rafael; Litzinger, Mark; Balczun, Carsten; Dobler, Gerhard

    2016-10-01

    Ixodes ricinus is a well-known vector of different human pathogens including Rickettsia helvetica. The role of wild mammals in the distribution and probable maintenance of Rickettsia in nature is still to be determined. We therefore investigated various parasites from different wild mammals as well as companion animals for the presence of Rickettsia. A total of 606 I. ricinus, 38 Cephenemyia stimulator (botfly larvae), one Dermacentor reticulatus, 24 Haematopinus suis (hog lice) and 30 Lipoptena cervi (deer flies) were collected from free-ranging animals during seasonal hunting, and from companion animals. Sample sites included hunting leases at three main sampling areas and five additional areas in West and Central Germany. All collected parasites were screened for Rickettsia spp. and I. ricinus were investigated for tick-borne encephalitis virus (TBEV) in addition. While no TBEV was detected, the minimum infection rate (MIR) of I. ricinus with Rickettsia was 4.1% referring to all sampling sites and up to 6.9% at the main sampling site in Koblenz area. Sequencing of a fragment of the ompB gene identified R. helvetica. Approximately one third (29.5%) of the animals carried Rickettsia-positive ticks and the MIR in ticks infesting wild mammals ranged from 4.1% (roe deer) to 9.5%. These data affirm the widespread distribution of R. helvetica in Germany. One botfly larva from roe deer also harboured R. helvetica. Botfly larvae are obligate parasites of the nasal cavity, pharynx and throat of cervids and feed on cell fragments and blood. Based on this one might hypothesise that R. helvetica likely induces rickettsemia in cervids thus possibly contributing to maintenance and distribution of this rickettsia in the field. Copyright © 2016 Elsevier GmbH. All rights reserved.

  12. Profiling of proteolytic enzymes in the gut of the tick Ixodes ricinus reveals an evolutionarily conserved network of aspartic and cysteine peptidases

    Directory of Open Access Journals (Sweden)

    Mareš Michael

    2008-03-01

    Full Text Available Abstract Background Ticks are vectors for a variety of viral, bacterial and parasitic diseases in human and domestic animals. To survive and reproduce ticks feed on host blood, yet our understanding of the intestinal proteolytic machinery used to derive absorbable nutrients from the blood meal is poor. Intestinal digestive processes are limiting factors for pathogen transmission since the tick gut presents the primary site of infection. Moreover, digestive enzymes may find practical application as anti-tick vaccine targets. Results Using the hard tick, Ixodes ricinus, we performed a functional activity scan of the peptidase complement in gut tissue extracts that demonstrated the presence of five types of peptidases of the cysteine and aspartic classes. We followed up with genetic screens of gut-derived cDNA to identify and clone genes encoding the cysteine peptidases cathepsins B, L and C, an asparaginyl endopeptidase (legumain, and the aspartic peptidase, cathepsin D. By RT-PCR, expression of asparaginyl endopeptidase and cathepsins B and D was restricted to gut tissue and to those developmental stages feeding on blood. Conclusion Overall, our results demonstrate the presence of a network of cysteine and aspartic peptidases that conceivably operates to digest host blood proteins in a concerted manner. Significantly, the peptidase components of this digestive network are orthologous to those described in other parasites, including nematodes and flatworms. Accordingly, the present data and those available for other tick species support the notion of an evolutionary conservation of a cysteine/aspartic peptidase system for digestion that includes ticks, but differs from that of insects relying on serine peptidases.

  13. Harvested white-tailed deer as sentinel hosts for early establishing Ixodes scapularis populations and risk from vector-borne zoonoses in southeastern Canada.

    Science.gov (United States)

    Bouchard, C; Leighton, P A; Beauchamp, G; Nguon, S; Trudel, L; Milord, F; Lindsay, L R; Bélanger, D; Ogden, N H

    2013-03-01

    Due to recent establishment of the blacklegged tick, Ixodes scapularis Say, in southeastern Canada, tick-borne zoonoses (Lyme disease, human granulocytotropic anaplasmosis, and babesiosis) are of growing concern for public health. Using white-tailed deer (Odocoileus virginianus) culled in southwestern Quebec during 2007-2008, we investigated whether hunter-killed deer could act as sentinels for early establishing tick populations and for tick-borne pathogens. Accounting for environmental characteristics of culling sites, and age and sex of deer, we investigated whether their tick infestation levels could identify locations of known tick populations detected in active surveillance, presumed tick populations detected by passive surveillance, or both. We also used spatial cluster analyses to identify spatial patterns of tick infestation and occurrence of tick-borne zoonoses infection in ticks collected from the deer. Adult ticks were found on 15% of the 583 deer examined. Adult male deer had the greatest number (approximately 90%) of adult ticks. Overall, 3, 15, and 0% of the ticks collected were polymerase chain reaction (PCR)-positive for Borrelia burgdorferi, Anaplasma phagocytophilum, and Babesia microti, respectively. Our statistical analyses suggest that sex and age of deer, temperature, precipitation, and an index of tick dispersion by migratory birds were significantly associated with tick infestation levels. Cluster analysis identified significant clusters of deer carrying ticks PCR-positive for A. phagocytophilum, and for deer carrying two or more I. scapularis. Our study suggests that hunter-killed deer may be effective as sentinels for emerging areas of tick-borne anaplasmosis. They may have limited use as sentinels for early emerging I. scapularis tick populations and emerging Lyme disease risk.

  14. Variable strength of forest stand attributes and weather conditions on the questing activity of Ixodes ricinus ticks over years in managed forests.

    Directory of Open Access Journals (Sweden)

    Ralf Lauterbach

    Full Text Available Given the ever-increasing human impact through land use and climate change on the environment, we crucially need to achieve a better understanding of those factors that influence the questing activity of ixodid ticks, a major disease-transmitting vector in temperate forests. We investigated variation in the relative questing nymph densities of Ixodes ricinus in differently managed forest types for three years (2008-2010 in SW Germany by drag sampling. We used a hierarchical Bayesian modeling approach to examine the relative effects of habitat and weather and to consider possible nested structures of habitat and climate forces. The questing activity of nymphs was considerably larger in young forest successional stages of thicket compared with pole wood and timber stages. Questing nymph density increased markedly with milder winter temperatures. Generally, the relative strength of the various environmental forces on questing nymph density differed across years. In particular, winter temperature had a negative effect on tick activity across sites in 2008 in contrast to the overall effect of temperature across years. Our results suggest that forest management practices have important impacts on questing nymph density. Variable weather conditions, however, might override the effects of forest management practices on the fluctuations and dynamics of tick populations and activity over years, in particular, the preceding winter temperatures. Therefore, robust predictions and the detection of possible interactions and nested structures of habitat and climate forces can only be quantified through the collection of long-term data. Such data are particularly important with regard to future scenarios of forest management and climate warming.

  15. Two Different Virulence-Related Regulatory Pathways in Borrelia burgdorferi Are Directly Affected by Osmotic Fluxes in the Blood Meal of Feeding Ixodes Ticks

    Science.gov (United States)

    Bontemps-Gallo, Sébastien; Lawrence, Kevin; Gherardini, Frank C.

    2016-01-01

    Lyme disease, caused by Borrelia burgdorferi, is a vector-borne illness that requires the bacteria to adapt to distinctly different environments in its tick vector and various mammalian hosts. Effective colonization (acquisition phase) of a tick requires the bacteria to adapt to tick midgut physiology. Successful transmission (transmission phase) to a mammal requires the bacteria to sense and respond to the midgut environmental cues and up-regulate key virulence factors before transmission to a new host. Data presented here suggest that one environmental signal that appears to affect both phases of the infective cycle is osmolarity. While constant in the blood, interstitial fluid and tissue of a mammalian host (300 mOsm), osmolarity fluctuates in the midgut of feeding Ixodes scapularis. Measured osmolarity of the blood meal isolated from the midgut of a feeding tick fluctuates from an initial osmolarity of 600 mOsm to blood-like osmolarity of 300 mOsm. After feeding, the midgut osmolarity rebounded to 600 mOsm. Remarkably, these changes affect the two independent regulatory networks that promote acquisition (Hk1-Rrp1) and transmission (Rrp2-RpoN-RpoS) of B. burgdorferi. Increased osmolarity affected morphology and motility of wild-type strains, and lysed Hk1 and Rrp1 mutant strains. At low osmolarity, Borrelia cells express increased levels of RpoN-RpoS-dependent virulence factors (OspC, DbpA) required for the mammalian infection. Our results strongly suggest that osmolarity is an important part of the recognized signals that allow the bacteria to adjust gene expression during the acquisition and transmission phases of the infective cycle of B. burgdorferi. PMID:27525653

  16. Differential feeding success of two paralysis-inducing ticks, Rhipicephalus warburtoni and Ixodes rubicundus on sympatric small mammal species, Elephantulus myurus and Micaelamys namaquensis.

    Science.gov (United States)

    Harrison, A; Robb, G N; Bennett, N C; Horak, I G

    2012-09-10

    Rodents are recognised as important hosts of ixodid ticks and as reservoirs of tick-borne pathogens across the world. Sympatric insectivores are usually inconspicuous and often overlooked as hosts of ticks and reservoirs of disease. Elephant shrews or sengis of the order Macroscelidea are small insectivores that often occur in sympatry with rodents in southern Africa. Sengis are invariably parasitised by large numbers of immature ticks while sympatric rodents are infested with very few. The reason for the difference in tick parasitism rates between these hosts is unknown. While a number of mechanisms are possible, we hypothesised that certain tick species exhibit "true host specificity" and as such would only attach and feed successfully on their preferred host or a very closely related host species. To investigate this, we conducted feeding experiments using two economically important tick species, the brown paralysis tick, Rhipicephalus warburtoni and the Karoo paralysis tick, Ixodes rubicundus and two sympatric small mammal species as potential hosts, the eastern rock sengi, Elephantulus myurus and the Namaqua rock mouse, Micaelamys namaquensis. Ticks attached and fed readily on E. myurus, but did not attach or feed successfully on M. namaquensis suggesting that these ticks exhibit true host specificity. We suggest that a kairomonal cue originating from the odour of E. myurus may stimulate the attachment and feeding of these ticks and that they further possess immunosuppressive mechanisms specific to E. myurus, allowing them to feed on this host species but not on M. namaquensis. This study highlights the importance of small mammalian insectivores as potential hosts of ixodid tick species and hence their potential as reservoirs of tick-borne pathogens. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. Which forest bird species are the main hosts of the tick, Ixodes ricinus, the vector of Borrelia burgdorferi sensu lato, during the breeding season?

    Science.gov (United States)

    Marsot, M; Henry, P-Y; Vourc'h, G; Gasqui, P; Ferquel, E; Laignel, J; Grysan, M; Chapuis, J-L

    2012-07-01

    Wild birds are important hosts for vector-borne pathogens, especially those borne by ticks. However, few studies have been conducted on the role of different bird species within a community as hosts of vector-borne pathogens. This study addressed individual and species factors that could explain the burden of Ixodes ricinus on forest birds during the reproductive periods of both vectors and hosts. The goal was to identify which bird species contribute the most to the tick population at the community level. Birds were mist-netted on four plots in 2008 and on seven plots in 2009 in two forests (Sénart and Notre Dame, near Paris, France). The dependence of the tick load per bird upon environmental conditions (questing nymph density, year and plot) and on host species traits (species, age, sex, body size, vertical space use, level of innate and acquired immunity) was analysed. Finally, the relative contribution of each bird species to the local dynamics of ticks was estimated, while accounting for their respective abundance. Tick burden differed markedly between bird species and varied according to questing nymph density. Bird species with a high body mass, those that forage low in the vegetation, and those that had a high innate immune response and a high spleen mass were more likely to have a high tick burden. Four species (the Common Blackbird, Turdus merula, the European Robin, Erithacus rubecula, the Song Thrush, Turdus philomelos, and the Winter Wren, Troglodytes troglodytes) hosted more than 90% of the ticks in the local bird community. These species, and particularly T. merula which was host to a high proportion of the nymphs, are likely to contribute significantly to the circulation of pathogens for which they are competent, such as the agent of Lyme borreliosis.

  18. The impact of climate change on the expansion of Ixodes persulcatus habitat and the incidence of tick-borne encephalitis in the north of European Russia

    Directory of Open Access Journals (Sweden)

    Nikolay K. Tokarevich

    2011-10-01

    Full Text Available The increase in tick-borne encephalitis (TBE incidence is observed in recent decades in a number of subarctic countries. The reasons of it are widely discussed in scientific publications. The objective of this study was to understand if the climate change in Arkhangelsk Oblast (AO situated in the north of European subarctic zone of Russia has real impact on the northward expansion of Ixodid ticks and stipulates the increase in TBE incidence. This study analyzes: TBE incidence in AO and throughout Russia, the results of Ixodid ticks collecting in a number of sites in AO, and TBE virus prevalence in those ticks, the data on tick bite incidence in AO, and meteorological data on AO mean annual air temperatures and precipitations.It is established that in recent years TBE incidence in AO tended to increase contrary to its apparent decrease nationwide. In last 10 years, there was nearly 50-fold rise in TBE incidence in AO when compared with 1980–1989. Probably, the increase both in mean annual air temperatures and temperatures during tick active season resulted in the northward expansion of Ixodes Persulcatus, main TBE virus vector. The Ixodid ticks expansion is confirmed both by the results of ticks flagging from the surface vegetation and by the tick bite incidence in the population of AO locations earlier free from ticks. Our mathematical (correlation and regression analysis of available data revealed a distinct correlation between TBE incidence and the growth of mean annual air temperatures in AO in 1990–2009.Not ruling out other factors, we conclude that climate change contributed much to the TBE incidence increase in AO.

  19. Prevalence of infection with Rickettsia helvetica in Ixodes ricinus ticks feeding on non-rickettsiemic rodent hosts in sylvatic habitats of west-central Poland.

    Science.gov (United States)

    Biernat, Beata; Stańczak, Joanna; Michalik, Jerzy; Sikora, Bożena; Wierzbicka, Anna

    2016-02-01

    Ixodes ricinus is the most prevalent and widely distributed tick species in European countries and plays a principal role in transmission of a wide range of microbial pathogens. It is also a main vector and reservoir of Rickettsia spp. of the spotted fever group with the infection level ranging in Poland from 1.3% to 11.4%. Nevertheless, little research has been conducted so far to identify reservoir hosts for these pathogens. A survey was undertaken to investigate the presence of Rickettsia spp. in wild small rodents and detached I. ricinus. Rodents, Apodemus flavicollis mice and Myodes glareolus voles were captured in typically sylvatic habitats of west-central Poland. Blood samples and collected ticks were analyzed by conventional, semi-nested and nested PCRs. Rickettsial species were determined by sequence analysis of obtained fragments of gltA and 16S rRNA genes. A total of 2339 immature I. ricinus (mostly larvae) were collected from 158 animals. Proportion of hosts carrying ticks was 84%, being higher for A. flavicollis than for M. glareolus. Rickettsia helvetica, the only species identified, was detected in 8% of 12 nymphs and in at least 10.7% (MIR) of 804 larvae investigated. Prevalence of infected ticks on both rodent species was comparable (10.8 vs. 9%). None of blood samples tested was positive for Rickettsia spp. The results showed that in sylvatic habitats the level of infestation with larval I. ricinus was higher in A. flavicollis mice in comparison with M. glareolus voles. They show that R. helvetica frequently occurred in ticks feeding on rodents. Positive immature ticks were collected from non-rickettsiemic hosts what might suggest a vertical route of their infection (transovarial and/or transstadial) or a very short-lasting rickettsiemia in rodents. A natural vertebrate reservoir host for R. helvetica remains to be determined.

  20. Susceptibility of four tick species, Amblyomma americanum, Dermacentor variabilis, Ixodes scapularis, and Rhipicephalus sanguineus (Acari: Ixodidae), to nootkatone from essential oil of grapefruit.

    Science.gov (United States)

    Flor-Weiler, Lina B; Behle, Robert W; Stafford, Kirby C

    2011-03-01

    Toxicity of nootkatone was determined in laboratory assays against unfed nymphs of Amblyomma americanum L., Dermacentor variabilis (Say), Ixodes scapularis Say, and Rhipicephalus sanguineus Latreille. We determined the 50% lethal concentration (LC50) and 90% lethal concentration (LC90) of nootkatone by recording tick mortality 24 h after exposure in treated glass vials. Nymphs were susceptible to nootkatone with LC50 values of 0.352, 0.233, 0.169, and 0.197 microg/cm2, and LC90 values of 1.001, 0.644, 0.549, and 0.485 microg/cm2 for A. americanum, D. variabilis, I. scapularis, and R. sanguineus, respectively. The LC50 value for R. sanquineus was not significantly different from D. variabilis or I. scapularis. Other LC50 comparisons were significantly different. The LC90 for A. americanum was higher when compared with the three other tick species, which were not significantly different. Because nootkatone is volatile, we measured the amount of nootkatone recovered from duplicate-treated vials before tick exposure and from vials after tick exposure. Nootkatone recovered from vials before exposure ranged from 82 to 112% of the expected amounts. The nootkatone recovered after the 24-h exposure period ranged from 89% from vials coated with higher concentrations of nootkatone, down to 29% from vials coated with low nootkatone concentrations. Determination of the nootkatone residue after vial coating demonstrated loss of the active compound while verifying the levels of tick exposure. Toxicity of low concentrations of nootkatone to the active questing stage of ticks reported in this study provides a reference point for future formulation research to exploit nootkatone as a safe and environment-friendly tick control.

  1. Anaplasma phagocytophilum increases the levels of histone modifying enzymes to inhibit cell apoptosis and facilitate pathogen infection in the tick vector Ixodes scapularis.

    Science.gov (United States)

    Cabezas-Cruz, Alejandro; Alberdi, Pilar; Ayllón, Nieves; Valdés, James J; Pierce, Raymond; Villar, Margarita; de la Fuente, José

    2016-04-01

    Epigenetic mechanisms have not been characterized in ticks despite their importance as vectors of human and animal diseases worldwide. The objective of this study was to characterize the histones and histone modifying enzymes (HMEs) of the tick vector Ixodes scapularis and their role during Anaplasma phagocytophilum infection. We first identified 5 histones and 34 HMEs in I. scapularis in comparison with similar proteins in model organisms. Then, we used transcriptomic and proteomic data to analyze the mRNA and protein levels of I. scapularis histones and HMEs in response to A. phagocytophilum infection of tick tissues and cultured cells. Finally, selected HMEs were functionally characterized by pharmacological studies in cultured tick cells. The results suggest that A. phagocytophilum manipulates tick cell epigenetics to increase I. scapularis p300/CBP, histone deacetylase, and Sirtuin levels, resulting in an inhibition of cell apoptosis that in turn facilitates pathogen infection and multiplication. These results also suggest that a compensatory mechanism might exist by which A. phagocytophilum manipulates tick HMEs to regulate transcription and apoptosis in a tissue-specific manner to facilitate infection, but preserving tick fitness to guarantee survival of both pathogens and ticks. Our study also indicates that the pathogen manipulates arthropod and vertebrate cell epigenetics in similar ways to inhibit the host response to infection. Epigenetic regulation of tick biological processes is an essential element of the infection by A. phagocytophilum and the study of the mechanisms and principal actors involved is likely to provide clues for the development of anti-tick drugs and vaccines.

  2. Borrelia miyamotoi infections among wild rodents show age and month independence and correlation with Ixodes persulcatus larval attachment in Hokkaido, Japan.

    Science.gov (United States)

    Taylor, Kyle R; Takano, Ai; Konnai, Satoru; Shimozuru, Michito; Kawabata, Hiroki; Tsubota, Toshio

    2013-02-01

    To clarify how Borrelia miyamotoi is maintained in the environment in Hokkaido, we examined Ixodes persulcatus for its prevalence among wild rodents and its tick vector by detecting a portion of the borrelial flaB gene in rodent urinary bladder and blood samples, and from whole ticks. We compared B. miyamotoi infection rates to Borrelia garinii and Borrelia afzelii, which are human Lyme disease pathogens also carried by wild rodents, and which are transmitted by the same vector tick. Whereas B. garinii and B. afzelii showed age dependence of infection rates among wild rodents (18.4% and 9.9% among adults and 6.0% and 3.4% among sub-adults, respectively) when looking at urinary bladder samples, B. miyamotoi infection rates were not age dependent for either blood (4.2% among adults, and 7.9% among sub-adults) or urinary bladder samples (1.0% among adults, and 1.7% among sub-adults). Moreover, while B. garinii and B. afzelii infection rates showed increases across months (June, July [prodents with B. garinii, and July and August had higher rates than in May [prodents with B. afzelii), B. miyamotoi infection rates did not show significant month dependence. These differences in month and age dependence led us to suspect that B. miyamotoi may not develop persistent infections in wild rodents, as B. garinii and B. afzelii are thought to. Furthermore, we examined the extent of rodent exposure to I. persulcatus nymphs and larvae throughout most of the tick's active season (May through September), and determined that B. miyamotoi infection rates in sub-adult rodents were correlated with larval burden (prodents.

  3. High infection of Anaplasma and Ehrlichia spp. among tick species collected from different geographical locations of Iran

    Directory of Open Access Journals (Sweden)

    Leila Tajedin

    2016-10-01

    Full Text Available Objective: To ascertain the prevalence of the Anaplasma/Ehrlichia infections in tick population within four provinces of Iran. Methods: A total of 384 tick specimens were collected from domestic animals inhabiting in four provinces (East Azerbaijan, Gilan, South Khorasan and Yazd. Specimens were identified based on morphological analysis. The detection of Anaplasma spp./Ehrlichia spp. within tick samples was carried out by nested PCR amplification of the 16S ribosomal RNA gene accompanied by DNA sequencing and analysis for verification. Results: A total of 10 tick species were identified as follows: Ornithodoros lahorensis (O. lahorensis (44.8%, Hyalomma dromedarii (15.6%, Dermacentor marginatus (13.5%, Hyalomma anatolicum (11.2%, Hyalomma asiaticum (5.7%, Hyalomma marginatum (4.9%, Rhipicephalus sanguineus (2.3%, Hyalomma detritum (1.0%, Dermacentor niveus (0.5% and Argas persicus (0.3%. The percentage distribution of Anaplasma/Ehrlichia was 55.5% (213 across 384 studied ticks. Conclusions: To the best of our knowledge, this is the first report of Anaplasma ovis infection in O. lahorensis in Iran. We also conjecture the prevalence of Ehrlichia spp. in Yazd Province based on sequencing results; also, it is suggested that O. lahorensis is a potential vector in the studied area. This survey highlights the importance of Argasidae family to verify and correlate their threat in causing anaplasmosis and other diseases in animals.

  4. Preliminary survey of ticks (Acari : Ixodidae on cattle in northern Sudan

    Directory of Open Access Journals (Sweden)

    D.A. Salih

    2004-11-01

    Full Text Available In a cross sectional survey conducted during the period June 2001 to July 2002, the geographical distribution of ticks on cattle in the Sudan was determined. Seventeen locations were surveyed from Northern, Central, Eastern, Western, Blue Nile and White Nile Provinces. Total body collections of ticks were made from 20 cattle at each location. Four tick genera and 11 species were identified. The tick species collected included Amblyomma lepidum, Amblyomma variegatum, Boophilus decoloratus, Hyalomma anatolicum anatolicum, Hyalomma dromedarii, Hyalomma impeltatum, Hyalomma marginatum rufipes, Hyalomma truncatum, Rhipicephalus evertsi evertsi, Rhipicephalus sanguineus group and Rhipicephalus simus simus. Major ecological changes have occurred due to extensive animal movement, deforestation, desertification and establishment of large mechanized agricultural schemes. These factors have certainly affected the distribution of ticks and tick-borne diseases in the Sudan. The absence of A. variegatum and A. lepidum in northern Sudan was not surprising, since these tick species are known to survive in humid areas and not in the desert and semi-desert areas of northern Sudan. The absence of B. annulatus in northern and central Sudan is in accordance with the finding that this tick species is restricted to the southern parts of the central Sudan. The presence of H. anatolicum anatolicum in Um Benin in relatively high abundance is an interesting finding. The present finding may indicate that the southern limit of this species has changed and moved southwards to latitude 13o N. It is concluded that major changes in tick distribution have taken place in the Sudan

  5. [Ticks Ixodes ricinus (Linnaeus, 1758) from selected municipal forests of the city Poznań and their infection with the spirochetes Borrelia burgdorferi senso lato].

    Science.gov (United States)

    Nowosad, A; Jenek, J; Głazaczow, A; Wal, M

    1999-01-01

    The results of research (1997-1998) on the occurrence of the spirochetes Borrelia burgdorferi s.l. in ticks Ixodes ricinus (L.) in selected municipal forests of the city of Poznań (localities--districts of Poznań: 1 Debiec, 2 Marcelin, 3 Golecin and Wola, 4 Krzyzowniki and Smochowice, 5 Kiekrz and Strzeszynek, 6 Morasko, 7 Piatkowo, 8 Umultowo, 9 Naramowice and Rózany Młyn, 10 Malta and Antoninek) are presented. A total of 1432 ticks were collected from 10 localities (748 larvae, 590 nymphs, 47 males, and 47 females). Out of this number, 266 specimens were selected at random for further analysis (20 larvae, 160 nymphs, 44 males, and 42 females) which were then tested for the presence of the spirochetes using the PCR technique (tab. I-III, fig. 1). Spirochetes were found in 60 specimens (22.6%). Percentages of infected nymphs and males were similar: 25.6% and 27.3%, respectively. The level of infection of females was lower (14.3%) and of larvae lowest (5.0%). Infected ticks were found in all ten localities, but their proportions differed from site to site and varied from 9.5% (Piatkowo) to 34.6% (Krzyzowniki and Smochowice). Special attention was devoted to those municipal woods where ticks were abundant (Kiekrz and Strzeszynek, as well as Malta and Antoninek, and relatively numerous Debiec) and where their extensiveness of infestation was high (Krzyzowniki and Smochowice: 34.6%; Debiec: 29.6%; Naramowice and Rózany Młyn: 28.6%; Malta and Antoninek: 28.1%; and Golecin and Wola: 26.9%). After summing up all the data from the literature on Wielkopolska and the city of Poznań, the mean extensiveness of infestation in Wielkopolska turns out to be 21.8% and in Poznań slightly higher, 22.2% (tab. IV). The infection levels of the particular developmental stages are different, though: highly variable in nymphs (8.3-25.6%), and more stable in males (22.0-27.3%) and females (22.0-24.5%).

  6. Activity of the plant-based repellent, TT-4302 against the ticks Amblyomma americanum, Dermacentor variabilis, Ixodes scapularis and Rhipicephalus sanguineus (Acari: Ixodidae).

    Science.gov (United States)

    Bissinger, B W; Schmidt, J P; Owens, J J; Mitchell, S M; Kennedy, M K

    2014-01-01

    The plant-based repellent TT-4302 (5 % geraniol) was compared to deet (15 %) in laboratory two-choice bioassays against the ticks Amblyomma americanum, Dermacentor variabilis, Ixodes scapularis, and Rhipicephalus sanguineus. At 2.5 and 3.5 h after treatment of filter paper with TT-4302, 100 % repellency was observed for all species at both time points with the exception of I. scapularis at the 3.5 h evaluation where repellency was 95.8 %. Deet was 100 % repellent at both time points for D. variabilis and R. sanguineus and was 100 % repellent at the 2.5 h evaluation for I. scapularis. Repellency of deet to A. americanum was 88.9 and 95.8 % at 2.5 and 3.5 h, respectively which was not significantly different than that of TT-4302. No significant difference against I. scapularis was observed between TT-4302 and deet at 3.5 h after treatment where deet was 87.5 % repellent. A variant of TT-4302, TT-4228 was tested in the laboratory against A. americanum and was compared to deet (15 %) in field trials against wild populations of ticks in North Carolina, USA. In the laboratory, TT-4228 was 94.4 and 87.5 % repellent at 2.5 and 3.5 h after treatment, respectively. In the field where the predominant tick species was A. americanum, significantly fewer ticks were collected from socks worn by human volunteers that were treated with TT-4228 compared to those treated with deet 2.5 or 3.5 h after treatment. Significantly fewer ticks were recovered from socks treated with TT-4228 than their paired untreated controls 2.5 or 3.5 h after treatment and repellencies were 90 and 70 %, respectively. Fewer ticks were collected from deet-treated compared to their paired untreated socks 2.5 h after application; however, no significant difference was found in the number of ticks collected from deet-and untreated socks 3.5 h after treatment.

  7. Differences in prevalence of Borrelia burgdorferi and Anaplasma spp. infection among host-seeking Dermacentor occidentalis, Ixodes pacificus, and Ornithodoros coriaceus ticks in northwestern California

    Science.gov (United States)

    Lane, Robert S.; Mun, Jeomhee; Peribáñez, Miguel A.; Fedorova, Natalia

    2010-01-01

    Previous studies revealed that the Pacific Coast tick (Dermacentor occidentalis) is infected occasionally with the agents of Lyme disease (Borrelia burgdorferi) or human granulocytic anaplasmosis (Anaplasma phagocytophilum) and that it is an inefficient experimental vector of B. burgdorferi. The relationship of the pajahuello tick (Ornithodoros coriaceus) to each of these bacterial zoonotic agents has not been reported. The primary bridging vector of both bacterial zoonotic agents to humans is the western black-legged tick (Ixodes pacificus). Because of the spatial and temporal overlap of D. occidentalis and O. coriaceus populations with those of I. pacificus in natural foci of B. burgdorferi and A. phagocytophilum in northwestern California, we conducted field and laboratory studies to determine if the Pacific Coast tick or the pajahuello tick potentially may serve as secondary vectors of either bacterium. Our findings reconfirmed that wild-caught D. occidentalis ticks are infected infrequently with B. burgdorferi or A. phagocytophilum, but some adult ticks from dense woodlands or chaparral were found to contain 2 important veterinary pathogens for the first time (Anaplasma bovis, A. ovis). The high prevalence of A. bovis infection (4.3%, n=185 ticks) within chaparral-derived ticks suggests that D. occidentalis could be an efficient vector of this rickettsia. Experimental attempts to transmit borreliae or Anaplasma spp. that may have been present in >100 wild-caught D. occidentalis adults to naïve rabbits were unsuccessful. Anaplasma spp. were not detected in O. coriaceus, but one (4.3%) of 23 nymphs was infected with B. bissettii. This finding and an antecedent report of a B. burgdorferi-like spirochete from the same tick species demonstrate that O. coriaceus sometimes acquires and transstadially passes Lyme disease group spirochetes. I. pacificus nymphs inhabiting a woodland nidus of B. burgdorferi and A. phagocytophilum had a 5-fold higher prevalence of

  8. Abundance of Ixodes ricinus and prevalence of Borrelia burgdorferi s.l. in the nature reserve Siebengebirge, Germany, in comparison to three former studies from 1978 onwards

    Directory of Open Access Journals (Sweden)

    Schwarz Alexandra

    2012-11-01

    Full Text Available Abstract Background During the last decades, population densities of Ixodes ricinus and prevalences of Borrelia burgdorferi s.l. have increased in different regions in Europe. In the present study, we determined tick abundance and the prevalence of different Borrelia genospecies in ticks from three sites in the Siebengebirge, Germany, which were already examined in the years 1987, 1989, 2001 and 2003. Data from all investigations were compared. Methods In 2007 and 2008, host-seeking I. ricinus were collected by monthly blanket dragging at three distinct vegetation sites in the Siebengebirge, a nature reserve and a well visited local recreation area near Bonn, Germany. In both years, 702 ticks were tested for B. burgdorferi s.l. DNA by nested PCR, and 249 tick samples positive for Borrelia were further genotyped by reverse line blotting. Results A total of 1046 and 1591 I. ricinus were collected in 2007 and 2008, respectively. In comparison to previous studies at these sites, the densities at all sites increased from 1987/89 and/or from 2003 until 2008. Tick densities and Borrelia prevalences in 2007 and 2008, respectively, were not correlated for all sites and both years. Overall, Borrelia prevalence of all ticks decreased significantly from 2007 (19.5% to 2008 (16.5%, thus reaching the same level as in 2001 two times higher than in 1987/89 (7.6%. Since 2001, single infections with a Borrelia genospecies predominated in all collections, but the number of multiple infections increased, and in 2007, for the first time, triple Borrelia infections occurred. Prevalences of Borrelia genospecies differed considerably between the three sites, but B. garinii or B. afzelii were always the most dominant genospecies. B. lusitaniae was detected for the first time in the Siebengebirge, also in co-infections with B. garinii or B. valaisiana. Conclusions Over the last two centuries tick densities have changed in the Siebengebirge at sites that remained

  9. Prevention of infectious tick-borne diseases in humans: Comparative studies of the repellency of different dodecanoic acid-formulations against Ixodes ricinus ticks (Acari: Ixodidae

    Directory of Open Access Journals (Sweden)

    Dautel Hans

    2008-04-01

    Full Text Available Abstract Background Ticks of the species Ixodes ricinus are the main vectors of Lyme Borreliosis and Tick-borne Encephalitis – two rapidly emerging diseases in Europe. Repellents provide a practical means of protection against tick bites and can therefore minimize the transmission of tick-borne diseases. We developed and tested seven different dodecanoic acid (DDA-formulations for their efficacy in repelling host-seeking nymphs of I. ricinus by laboratory screening. The ultimately selected formulation was then used for comparative investigations of commercially available tick repellents in humans. Methods Laboratory screening tests were performed using the Moving-object (MO bioassay. All test formulations contained 10% of the naturally occurring active substance DDA and differed only in terms of the quantitative and qualitative composition of inactive ingredients and fragrances. The test procedure used in the human bioassays is a modification of an assay described by the U.S. Environmental Protection Agency and recommended for regulatory affairs. Repellency was computed using the equation: R = 100 - NR/N × 100, where NR is the number of non-repelled ticks, and N is the respective number of control ticks. All investigations were conducted in a controlled laboratory environment offering standardized test conditions. Results All test formulations strongly repelled nymphs of I. ricinus (100-81% protection as shown by the MO-bioassay. The majority of ticks dropped off the treated surface of the heated rotating drum that served as the attractant (1 mg/cm2 repellent applied. The 10% DDA-based formulation, that produced the best results in laboratory screening, was as effective as the coconut oil-based reference product. The mean protection time of both preparations was generally similar and averaged 8 hours. Repellency investigations in humans showed that the most effective 10% DDA-based formulation (~1.67 mg/cm2 applied strongly avoided the

  10. Rickettsia conorii israelensis in Rhipicephalus sanguineus ticks, Sardinia, Italy.

    Science.gov (United States)

    Chisu, Valentina; Masala, Giovanna; Foxi, Cipriano; Socolovschi, Cristina; Raoult, Didier; Parola, Philippe

    2014-06-01

    The presence of tick-borne Rickettsia spp. was examined by PCR using DNA samples extracted from 254 ticks collected from mammals originating from northern and eastern Sardinia, Italy. The spotted fever group rickettsial agent Rickettsia conorii israelensis was detected in 3 Rhipicephalus sanguineus ticks from a dog for the first time in this geographical area. In addition, Ri. massiliae, Ri. slovaca, and Ri. aeschlimannii were detected in Rh. turanicus, Rh. sanguineus, Dermacentor marginatus, and Hyalomma marginatum marginatum ticks from dogs, goats, wild boar, and horse. Moreover, Candidatus Rickettsia barbariae was detected in 2 Rh. turanicus ticks from goats. The detection of Ri. conorii israelensis, an emergent agent which causes Israeli spotted fever, increases our knowledge on tick-borne rickettsioses in Sardinia.

  11. [Ecology of indigenious arbovirus in Alsace. Tick Central European Encephalitis. I.--Complex Ixodes ricinus--bank voles. II.--Study of bank voles population immunity. III.--Virologic results in bank voles population (author's transl)].

    Science.gov (United States)

    Chatelain, J; Hannoun, C; Rodhain, F; Chatelain, J; Hannoun, C; Salmon, A M; Ardoin, P; Chatelain, J; Hannoun, C; Sureau, P

    1979-01-01

    I.--After showing that bank voles are parasited only by Ixodes ricinus larvae, the authors attempt to found different factors (demographic, biometric, and sexual) who favor individual parasitism. The authors conclude to absent of anti tick immunity for this rodent specie. II.--The search for anti-central european encephalitis antibodies (I.H.A.) are shown that 2 p. cent animals were immuns. Yearly and monthly chronologies of antibodies apparition are shown, factors favoring the growth of specific Central european encephalitis antibodies are discussed. III.--The Central european encephalitis tick viral infection of bank vole is studied according to the number of viral strains isolated from different viscera. The monthly chronology of this infection is shown.

  12. 全沟硬蜱Salp15蛋白家族成员基因的克隆与融合表达%CLONE AND EXPRESSION OF SALP15 SUPER FAMILY PROTEIN GENE FROM IXODES PERSULCATUS (ACARI: IXODIDAE)

    Institute of Scientific and Technical Information of China (English)

    王欣; 孙毅; 牛思博; 蒋宝贵

    2013-01-01

    为明确全沟硬蜱涎腺Salp15蛋白家族的基因表达情况,本文根据已知的Salp15序列设计引物对全沟硬蜱幼蜱的总RNA进行RT-PCR,克隆到可与莱姆病螺旋体外膜蛋白OspC互作的涎腺蛋白Salp15 CDS序列,命名为Ⅰ.p larva5.对该蛋白做生物信息学预测,其肽链在N端含有信号肽,在C端含有与CD4分子的结合位点.与其他蜱种Salp15蛋白的相似性分别为:62.3%(北美的肩突硬蜱Ixodes scapularis)、74.5%(欧洲的篦子硬蜱Ⅰ.ricinus iric3)、59.4%(西伯利亚全沟硬蜱Ⅰ.persulcatus)、67.6%(日本地区的全沟硬蜱iper1).将该cDNA序列分别加上EcoR Ⅰ,SalⅠ酶切位点,插入pMAL-c4X表达载体上,经IPTG诱导,在Transetta (DE3)上融合蛋白成功表达.此工作为研究全沟硬蜱的Salp15与莱姆病螺旋体,以及与宿主动物的相互关系奠定了基础.%As one of main vectors for Lyme borreliosis,Ixodes persulcatus threats both innocent individuals and domestic livestock.Salp15,a 15-kDa salivary protein in Ixodid ticks,has been known to suppress against the activities of host immunity and enhance the transmission of Lyme borrelia.To determine Salp15-1ike gene in Ixodes persulcatus,the primers for RT-PCR against total RNA from nymph according to other Salp15 homologues were designed,and firstly the Salp15 protein entitling Ⅰ.p larva5 (HE820731) potentially interacting with the outer surface protein C (OspC) of Lyme spirochaeta was obtained.The deduced protein Ⅰ.p larva5 shows similarity to Salp15 from other speices,i.e.62.3% (Ⅰ.scapularis in North America),74.5% (Ⅰ.ricinus in Western Europe),59.4% (Ⅰ.persulcatus in Siberia),67.6% (Ⅰ.persulcatus in Japan) respectively.Ⅰ.p larva5 CDS was then subcloned into expression vector pMAL-c4X,expressing in E.coli Rosseta (DE3),induced by IPTG.The recombinant protein was confirmed expressed successfully by SDS-PAGE and western blot,and its relative molecular weights about 60 kDa with MBP Taq

  13. [Molecular-genetic characterization of the Okhotskiy virus (OKHV) and Aniva virus (ANIV) (Orbivirus, Reoviridae) isolated from the ticks Ixodes (Ceratixodes) uriae White, 1852 in high latitudes of the Northern Eurasia].

    Science.gov (United States)

    L'vov, D K; Al'khovskiĭ, S V; Shchelkanov, M Iu; Shchetinin, A M; Deriabin, P G; Gitel'man, A K; Samokhvalov, E I; Botikov, A G

    2014-01-01

    Molecular-genetic characteristics of the Okhotskiy virus (OKHV) and Aniva virus (ANIV) were studied (ID GenBank KF981623-32). These viruses are distributed over the shelf and Island areas in the high latitudes in the Okhotsk, Bering, and Barents seas and linked with nesting colonies of Alcidae seabirds and their obligatory parasites, the Ixodes uriae (Ixodidae) ticks. OKHV and ANIV are observed to be independent species within the limits of the Great Island virus (GIV) group of the Orbivirus genus of the Reoviridae family. The majority of the genes of OKHV and ANIV have high homology (VP1 - 96%, T2 - 99%, VP7 (T13) - 98%, NS1 - 94%, NS2 - 98%, NS3 - 72%, VP6 - 93%). Nevertheless, the envelope proteins containing the main specific antigenic determinants (VP2 and VP5) of OKHV and ANIV are sufficiently different (62% and 68% homology for amino acid sequences, respectively).

  14. Occurrence and identification of risk areas of Ixodes ricinus-borne pathogens: a cost-effectiveness analysis in north-eastern Italy

    Directory of Open Access Journals (Sweden)

    Capelli Gioia

    2012-03-01

    Full Text Available Abstract Background Ixodes ricinus, a competent vector of several pathogens, is the tick species most frequently reported to bite humans in Europe. The majority of human cases of Lyme borreliosis (LB and tick-borne encephalitis (TBE occur in the north-eastern region of Italy. The aims of this study were to detect the occurrence of endemic and emergent pathogens in north-eastern Italy using adult tick screening, and to identify areas at risk of pathogen transmission. Based on our results, different strategies for tick collection and pathogen screening and their relative costs were evaluated and discussed. Methods From 2006 to 2008 adult ticks were collected in 31 sites and molecularly screened for the detection of pathogens previously reported in the same area (i.e., LB agents, TBE virus, Anaplasma phagocytophilum, Rickettsia spp., Babesia spp., "Candidatus Neoehrlichia mikurensis". Based on the results of this survey, three sampling strategies were evaluated a-posteriori, and the impact of each strategy on the final results and the overall cost reductions were analyzed. The strategies were as follows: tick collection throughout the year and testing of female ticks only (strategy A; collection from April to June and testing of all adult ticks (strategy B; collection from April to June and testing of female ticks only (strategy C. Results Eleven pathogens were detected in 77 out of 193 ticks collected in 14 sites. The most common microorganisms detected were Borrelia burgdorferi sensu lato (17.6%, Rickettsia helvetica (13.1%, and "Ca. N. mikurensis" (10.5%. Within the B. burgdorferi complex, four genotypes (i.e., B. valaisiana, B. garinii, B. afzelii, and B. burgdorferi sensu stricto were found. Less prevalent pathogens included R. monacensis (3.7%, TBE virus (2.1%, A. phagocytophilum (1.5%, Bartonella spp. (1%, and Babesia EU1 (0.5%. Co-infections by more than one pathogen were diagnosed in 22% of infected ticks. The prevalences of infection

  15. [Genetic characterization of viruses from the antigenic complex Tyuleniy (Flaviviridae, Flavivirus): Tyuleniy virus (TYUV) (ID GenBank KF815939) isolated from ectoparasites of colonial seabirds--Ixodes (Ceratixodes) uriae White, 1852, ticks collected in the high latitudes of Northern Eurasia--and Kama virus (KAMV) isolated from the Ixodes lividus Roch, 1844, collected in the digging colonies of the middle part of Russian plane].

    Science.gov (United States)

    L'vov, D K; Al'khovskiĭ, S V; Shchelkanov, M Iu; Shchetinin, A M; Deriabin, P G; Samokhvalov, E I; Gitel'man, A K; Botikov, A G

    2014-01-01

    Genetic research into the Tyuleniy virus (TYUV) (ID GenBank KF815939) isolated in high latitudes from the Ixodes uriae White, 1852, ticks collected in the nesting colonies of the Alcidae (Leach, 1820) birds and Kama virus (KAMV) (ID GenBank KF815940) isolated from the I. lividus ticks collected in the nesting bird colonies in the middle part of the Russian Plane was carried out. Full-genome comparative analysis revealed 70% homology between KAMV and TYUV on the nucleotide level and 74% on the amino acid level. Thus, KAMV is a new member of the TYUV complex belonging to the seabird tick-borne virus group (STBVG) of Flavivirus (Flaviviridae). KAMV is a separate virus and forms separate phylogenetic line together with the TYUV, Meaban virus (MEAV), and Saumarez Reef virus (SREV).

  16. Identification of rickettsial pathogens in ixodid ticks in northern Senegal.

    Science.gov (United States)

    Sambou, Masse; Faye, Ngor; Bassène, Hubert; Diatta, Georges; Raoult, Didier; Mediannikov, Oleg

    2014-09-01

    The spotted fevers, caused by the Rickettsia bacteria, are a group of emerging diseases that are responsible for significant human morbidity. In Africa, the distribution of different species of Rickettsia in their tick vectors is poorly studied. We have collected 1169 hard ticks from 5 different species in the northern Senegal, close to the Saharan border. In a far northern collection site, corresponding to the Rickettsia africae distribution area, we collected three Amblyomma variegatum ticks infected by R. africae. Rickettsia africae was also identified in a Hyalomma marginatum rufipes tick, which may represent the secondary host for the pathogen. Rickettsia aeschlimannii was identified in H. m. rufipes, Rhipicephalus evertsi evertsi, and Hyalomma impeltatum ticks.

  17. The crystal structures of two salivary cystatins from the tick Ixodes scapularis and the effect of these inhibitors on the establishment of Borrelia burgdorferi infection in a murine model

    Energy Technology Data Exchange (ETDEWEB)

    Kotsyfakis, Michalis; Horka, Helena; Salat, Jiri; Andersen, John F. (South Bohemia); (ASCR-ICP); (NIAID)

    2010-11-17

    We have previously demonstrated that two salivary cysteine protease inhibitors from the Borrelia burgdorferi (Lyme disease) vector Ixodes scapularis - namely sialostatins L and L2 - play an important role in tick biology, as demonstrated by the fact that silencing of both sialostatins in tandem results in severe feeding defects. Here we show that sialostatin L2 - but not sialostatin L - facilitates the growth of B. burgdorferi in murine skin. To examine the structural basis underlying these differential effects of the two sialostatins, we have determined the crystal structures of both sialostatin L and L2. This is the first structural analysis of cystatins from an invertebrate source. Sialostatin L2 crystallizes as a monomer with an 'unusual' conformation of the N-terminus, while sialostatin L crystallizes as a domain-swapped dimer with an N-terminal conformation similar to other cystatins. Deletion of the 'unusual' N-terminal five residues of sialostatin L2 results in marked changes in its selectivity, suggesting that this region is a particularly important determinant of the biochemical activity of sialostatin L2. Collectively, our results reveal the structure of two tick salivary components that facilitate vector blood feeding and that one of them also supports pathogen transmission to the vertebrate host.

  18. Genetic variability within Borrelia burgdorferi sensu lato genospecies established by PCR-single-strand conformation polymorphism analysis of the rrfA-rrlB intergenic spacer in ixodes ricinus ticks from the Czech Republic.

    Science.gov (United States)

    Derdáková, Markéta; Beati, Lorenza; Pet'ko, Branislav; Stanko, Michal; Fish, Durland

    2003-01-01

    In Europe the Borrelia burgdorferi sensu lato complex is represented by five distinct genospecies: Borrelia burgdorferi sensu stricto, Borrelia afzelii, Borrelia garinii, Borrelia valaisiana, and Borrelia lusitaniae. These taxonomic entities are known to differ in their specific associations with vertebrate hosts and to provoke distinct clinical manifestations in human patients. However, exceptions to these rules have often been observed, indicating that strains belonging to a single genospecies may be more heterogeneous than expected. It is, therefore, important to develop alternative identification tools which are able to distinguish Borrelia strains not only at the specific level but also at the intraspecific level. DNA from a sample of 370 Ixodes ricinus ticks collected in the Czech Republic was analyzed by PCR for the presence of a approximately 230-bp fragment of the rrfA-rrlB intergenic spacer of Borrelia spp. A total of 20.5% of the ticks were found to be positive. The infecting genospecies were identified by analyzing the amplified products by the restriction fragment length polymorphism (RFLP) method with restriction enzyme MseI and by single-strand conformation polymorphism (SSCP) analysis. The two methods were compared, and PCR-SSCP analysis appeared to be a valuable tool for rapid identification of spirochetes at the intraspecific level, particularly when large samples are examined. Furthermore, by using PCR-SSCP analysis we identified a previously unknown Borrelia genotype, genotype I-77, which would have gone unnoticed if RFLP analysis alone had been used.

  19. Prevalence of Borrelia burgdorferi (Spirochaetales: Spirochaetaceae), Anaplasma phagocytophilum (Rickettsiales: Anaplasmataceae), and Babesia microti (Piroplasmida: Babesiidae) in Ixodes scapularis (Acari: Ixodidae) collected from recreational lands in the Hudson Valley Region, New York State.

    Science.gov (United States)

    Prusinski, M A; Kokas, J E; Hukey, K T; Kogut, S J; Lee, J; Backenson, P B

    2014-01-01

    ABSTRACT Blacklegged ticks, Ixodes scapularis Say, were collected from 27 sites in eight New York State counties from 2003 to 2006 to determine the prevalence and distribution of tick-borne pathogens in public-use areas over a 4-yr period. In total, 11,204 I. scapularis (3,300 nymphs and 7,904 adults) were individually analyzed using polymerase chain reaction to detect the presence of Borrelia burgdorferi (causative agent of Lyme disease), Anaplasma phagocytophilum (formerly Ehrlichia phagocytophila, causative agent of human granulocytic anaplasmosis), and Babesia microti (causative agent of human babesiosis). Overall prevalence of B. burgdorferi, A. phagocytophilum, and B. microti was 14.4, 6.5, and 2.7% in nymphs and 45.7, 12.3, and 2.5% in adult ticks, respectively. Rates varied geographically and temporally during the time period examined, and were related to measurements of tick density. Average rate ofpolymicrobial infection for nymphs and adults, respectively, was 1.5 and 8.5% overall, with 0.5 and 6.3% coinfection of B. burgdorferi and A. phagocytophilum, 1.0 and 1.5% B. burgdorferi and B. microti, and 0.05 and 0.6% A. phagocytophilum and B. microti. Thirty-three individual adult ticks from seven study sites in Westchester, Putnam, Dutchess, and Rockland counties tested positive for simultaneous infection with all three agents by multiplex polymerase chain reaction assay.

  20. Geostatistics and remote sensing as predictive tools of tick distribution: a cokriging system to estimate Ixodes scapularis (Acari: Ixodidae) habitat suitability in the United States and Canada from advanced very high resolution radiometer satellite imagery.

    Science.gov (United States)

    Estrada-Peña, A

    1998-11-01

    Geostatistics (cokriging) was used to model the cross-correlated information between satellite-derived vegetation and climate variables and the distribution of the tick Ixodes scapularis (Say) in the Nearctic. Output was used to map the habitat suitability for I. scapularis on a continental scale. A data base of the localities where I. scapularis was collected in the United States and Canada was developed from a total of 346 published and geocoded records. This data base was cross-correlated with satellite pictures from the advanced very high resolution radiometer sensor obtained from 1984 to 1994 on the Nearctic at 10-d intervals, with a resolution of 8 km per pixel. Eight climate and vegetation variables were tabulated from this imagery. A cokriging system was generated to exploit satellite-derived data and to estimate the distribution of I. scapularis. Results obtained using 2 vegetation (standard NDVI) and 4 temperature variables closely agreed with actual records of the tick, with a sensitivity of 0.97 and a specificity of 0.89, with 6 and 4% of false-positive and false-negative sites, respectively. Such statistical analysis can be used to guide field work toward the correct interpretation of the distribution limits of I. scapularis and can also be used to make predictions about the impact of global change on tick range.

  1. Evaluation of Doxycycline-Laden Oral Bait and Topical Fipronil Delivered in a Single Bait Box to Control Ixodes scapularis (Acari: Ixodidae) and Reduce Borrelia burgdorferi and Anaplasma phagocytophilum Infection in Small Mammal Reservoirs and Host-Seeking Ticks.

    Science.gov (United States)

    Dolan, Marc C; Schulze, Terry L; Jordan, Robert A; Schulze, Christopher J; Ullmann, Amy J; Hojgaard, Andrias; Williams, Martin A; Piesman, Joseph

    2017-03-01

    A field trial was conducted on residential properties in a Lyme disease endemic area of New Jersey to determine the efficacy of Maxforce Tick Management System (TMS) bait boxes modified with doxycycline hyclate-laden bait to reduce the acarological risk of Lyme disease and the utility of galvanized steel shrouds to protect the bait boxes from squirrel depredation and ability to routinely service these devices. The strategy began with a 9-wk deployment against larvae followed by a 17-wk deployment against nymphs and larvae the second year. Passive application of fipronil reduced nymphal and larval tick burdens on small mammals by 76 and 77%, respectively, and nymphal tick abundance by 81% on treated properties. In addition, the percentage of infected small mammals recovered from intervention areas following treatment was reduced by 96% for Borrelia burgdorferi and 93% for Anaplasma phagocytophilum. Infection prevalence in host-seeking nymphal ticks for both B. burgdorferi and A. phagocytophilum were reduced by 93 and 61%, respectively. Results indicate that Maxforce TMS bait boxes fitted with doxycycline-impregnated bait is an effective means of reducing ticks and infection prevalence for B. burgdorferi and A. phagocytophilum in both rodent reservoirs and questing Ixodes scapularis Say ticks. The protective shroud allows the device to be routinely serviced and protect against squirrel depredation. Published by Oxford University Press on behalf of Entomological Society of America 2016. This work is written by US Government employees and is in the public domain in the US.

  2. Local-scale spatio-temporal distribution of questing Ixodes ricinus L. (Acari: Ixodidae)-A case study from a riparian urban forest in Wrocław, SW Poland.

    Science.gov (United States)

    Kiewra, Dorota; Stefańska-Krzaczek, Ewa; Szymanowski, Mariusz; Szczepańska, Anna

    2017-03-01

    This paper presents the distribution of questing Ixodes ricinus ticks in suburban forest intensively visited by people. The local-scale observations conducted during a 4-year study at 99 plots (of 100m(2) each) located throughout the entire area of a riparian urban forest, showed a high variation in the density of ticks from year to year. Although I. ricinus is generally permanent in the study area, spatial distribution of sample plots harbouring I. ricinus is variable, i.e. mainly random for adults and larvae, and random or clustered for nymphs. Among the most common plant species in the herb layer, there were not any species which had a statistically significant and constant impact on the occurrence of any of the development stages of I. ricinus. Also relations between the density of tick development stages and vegetation variables, including cover of the herb layer, total species number, species number of the herb layer, and percentage coverage of particular species, as well as ecological indices for light, soil moisture, reaction, and nutrients, did not show any constant and predictable pattern in subsequent years of the study. Only tree and shrub layers were found as variables positively affecting the density of ticks. Although small, suburban forests can be considered as tick-borne risk areas, it is impossible to determine in details areas of tick-borne risk.

  3. Molecular and serological detection of Theileria equi and Babesia caballi infection in horses and ixodid ticks in Iran.

    Science.gov (United States)

    Abedi, Vali; Razmi, Golamreza; Seifi, Hesam; Naghibi, Abolghasem

    2014-04-01

    Equine piroplasmosis is a hemoprotozoan tick-borne disease with worldwide distribution that is caused by Theileria equi and Babesia caballi. However, the geographical distribution of equine piroplasmosis in Iran is unknown. The aim of the current study was to determine the causative agents and vector ticks of equine piroplasmosis in horses in the North Khorasan Province. In the year 2011, 100 horses were randomly selected from 14 villages. Blood samples and ixodid ticks were collected and examined using microscopical, molecular, and serological methods. Theileria equi infection was microscopically detected in 5 (5%) of the blood smears with low parasitemia, while serum samples were tested by the indirect immunofluorescent antibody test (IFAT). Antibodies against T. equi, B. caballi, and a mixed infection were detected in 48 (48%), 2 (2%), and 3 (3%) of the serum samples, respectively. A multiplex PCR was used to detect T. equi and B. caballi DNA in blood samples. No B. caballi infections could be found, but Theileria equi DNA was detected in 45 (45%) of the blood samples, and a BLAST analysis of the sequenced samples indicated a 99% similarity with T. equi 18S rRNA gene sequences in GenBank. Both molecular and serological results did not identify any significant association between T. equi infection and risk factors. A comparision of the results of 3 diagnostic methods demonstrated a poor agreement between microscopical examination with IFAT and PCR and a moderate agreement between IFAT and PCR. Thirty-seven adult ticks (20 females and 17 males) were collected from 15 horses. The most common tick was Hyalomma marginatum marginatum (n=19), followed by Hyalomma anatolicum excavatum (n=10), Rhipicephalus bursa (n=4), Hyalomma marginatum turanicum (n=3), and Hyalomma anatolicum anatolicum (n=1). The salivary glands and ovaries were also examined using PCR. The genomic DNA samples of the salivary glands of 3 ticks, H. a. excavatum (n=2) and R. bursa (n=1), had a

  4. Molecular detection of Theileria spp. in sheep and vector ticks in the North Khorasan Province, Iran.

    Science.gov (United States)

    Rashidi, Ahmad; Razmi, Gholamreza

    2013-01-01

    A survey was carried in North Khorasan Province, Iran in 2010-2011, designed to identify Theileria spp. infections of both sheep and ticks. The tick species were also examined. Ninety sheep from different flocks were clinically examined, and blood samples and ixodid ticks were collected. Light microscopy of blood smears revealed Theileria spp. infection in 37 (41.1 %), while 74 (82.2 %) of blood samples were positive using semi-nested PCR. Theileria ovis, Theileria lestoquardi, and mixed infection were detected in 63/90 (70 %), 5/90 (5.5 %), and 6/90 (6.6 %) of samples, respectively. Of the 434 ticks that were collected, the most prevalent species was Rhipicephalus turanicus (69.3 %) followed by Hyalomma marginatum turanicum (18.4 %), Dermacentor marginatus (6.4 %), and Rhipicephalus bursa (5.7 %). The ticks were separated into 42 tick pools, and the salivary glands were dissected out in 0.85 % (w/v) saline under a stereomicroscope and examined using semi-nested PCR. Three pools of H. marginatum turanicum salivary glands were infected with T. ovis and T. lestoquardi, and one pool of R. turanicus was infected with T. ovis. Based on these results, it is concluded that the prevalence of T. ovis is higher than T. lestoquardi and that H. marginatum turanicum and R. turanicus are likely vectors of T. lestoquardi and T. ovis in this area.

  5. Assessing the abundance, seasonal questing activity, and Borrelia and tick-borne encephalitis virus (TBEV) prevalence of Ixodes ricinus ticks in a Lyme borreliosis endemic area in Southwest Finland.

    Science.gov (United States)

    Sormunen, Jani J; Klemola, Tero; Vesterinen, Eero J; Vuorinen, Ilppo; Hytönen, Jukka; Hänninen, Jari; Ruohomäki, Kai; Sääksjärvi, Ilari E; Tonteri, Elina; Penttinen, Ritva

    2016-02-01

    Studies have revealed that Ixodes ricinus (Acari: Ixodidae) have become more abundant and their geographical distribution extended northwards in some Nordic countries during the past few decades. However, ecological data of tick populations in Finland are sparse. In the current study, I. ricinus abundance, seasonal questing activity, and their Borrelia spp. and tick-borne encephalitis virus (TBEV) prevalence were evaluated in a Lyme borreliosis endemic area in Southwest Finland, Seili Island, where a previous study mapping tick densities was conducted 12 years earlier. A total of 1940 ticks were collected from five different biotopes by cloth dragging during May-September 2012. The overall tick density observed was 5.2 ticks/100m(2) for nymphs and adults. Seasonal questing activity of ticks differed between biotopes and life stages: bimodal occurrences were observed especially for nymphal and adult ticks in forested biotopes, while larvae in pastures exhibited mostly unimodal occurrence. Prevalence of Borrelia and TBEV in ticks was evaluated using conventional and real-time PCR. All samples were negative for TBEV. Borrelia prevalence was 25.0% for adults (n=44) and the minimum infection rate (MIR) 5.6% for pooled nymph samples (191 samples, 1-14 individuals per sample; 30/191 positive). No Borrelia were detected in pooled larval samples (63 samples, 1-139 individuals per sample). Five species of Borrelia were identified from the samples: B. afzelii, B. burgdorferi s.s., B. garinii, B. valaisiana and B. miyamotoi. In Finland, B. valaisiana and B. miyamotoi have previously been reported from the Åland Islands but not from the mainland or inner archipelago. The results of the present study suggest an increase in I. ricinus abundance on the island.

  6. Do the ticks of birds at an important migratory hotspot reflect the seasonal dynamics of Ixodes ricinus at the migration initiation site? A case study in the Danube Delta.

    Directory of Open Access Journals (Sweden)

    Attila D Sándor

    Full Text Available Migratory birds play important roles as distributors of ticks within and between continents. In the Old World, the most important migratory route of birds links Asia, Europe and Africa. During their migration, birds use various stopover sites, where they feed and rest and where ticks may attach or detach, creating new natural foci for vector-borne diseases. Danube Delta is one of the most important migration hotspots and so far no studies were focused on ticks of migratory birds herein. The aim of the present study was to assess the species diversity and seasonal dynamics of ticks parasitizing migratory birds in Danube Delta Biosphere Reserve. Migratory birds were trapped on Grindul Lupilor (44°41'N; 28°56'E using mist nets during 4 migratory seasons (2 spring and 2 autumn in 2011 and 2012. From each bird, all the ticks were collected and identified based on morphological features. Epidemiological parameters (prevalence, mean abundance, mean intensity were calculated and all data were analysed statistically based on the season (spring and autumn, regional status of birds (migrants and breeding and foraging behaviour (ground feeders, reed-bed feeders, foliage feeders. A total of 1434 birds (46 species were captured. Ticks were found on 94 birds (10 species. Significantly more migratory birds hosted ticks, compared to resident birds. The 400 collected ticks belonged to four species: Ixodes ricinus (92.25%, I. arboricola (6.25%, I. redikorzevi (1.00% and Haemaphysalis punctata (0.50%. A higher prevalence was found for I. ricinus in spring, with higher prevalence of nymphs in this season, while larvae occurred with the same prevalence in both seasons. Larval intensity was higher during spring and nymphs were more abundant during autumn. The seasonal differences in our study may be related not to the local seasonal dynamics of ticks, but on the seasonal dynamics at the site of migration initiation.

  7. Hard ticks (Ixodidae and Crimean-Congo hemorrhagic fever virus in south west of Iran.

    Directory of Open Access Journals (Sweden)

    Narges Sharifinia

    2015-03-01

    Full Text Available Ticks are vectors of some important arthropod-borne diseases in both fields of veterinary and medicine, such as Lyme, tularemia, Rocky Mountain spotted fever, and some types of encephalitis as well as Crimean Congo hemorrhagic fever (CCHF. Iran is known as one of the main foci of CCHF in west of Asia. This study was conducted in DarrehShahr County because of the development of animal husbandry in this area to detect the fauna and viral infection of the hard ticks of livestock. A cross-sectional survey was conducted during 2011-2012 with random sampling in four villages. A sample of ticks was subjected to RT-PCR method for detection of viral infection. During the study period, 592 Ixodidae ticks were collected and identified as seven species of Hyalomma asiaticum, Hy. marginatum, Hy. anatolicum, Hy. dromedarii, Hy. detritum, Rhipicephalus bursa and Rh. sanguineus. More than 20% of these ticks were examined to detect the genome of CCHF virus while 6.6% were positive. All species of Hyalomma were found to be positive. A high rate of livestock was found to be infected with hard ticks, which can act as the vectors of the CCHF disease. Regarding infection of all five Hyalomma species captured in this area, this genus should be considered as the main vector of CCHF. Planning control program can be performed based on the obtained data on seasonal activity of Ixodidae to prevent animal infestation as well as to reduce the risk of CCHF transmission.

  8. Ticks (Acari: Ixodidae of livestock and their seasonal activities, northwest of Iran

    Directory of Open Access Journals (Sweden)

    Zahra Ramezani

    2014-09-01

    Full Text Available Objective: To identify the ticks (Acari: Ixodidae of livestock and their seasonal activities, in northwest of Iran, including the combination of two of the geographical regions of Iran (Caspian and mountain plateau where the majority of the domestic ruminants in Iran exist. Methods: Fifteen villages of Meshkin-Shahr County were selected randomly from different areas of the county. The animal dwellings were visited and the whole body of sheep, cows, goats and dogs were examined for their probable infestation. Samples were identified at the level of species according to the standard morphological key. Results: In this study 1 208 specimen were collected and totally nine species (Dermacentor marginatus, Dermacentor niveus, Haemaphysalis erinacei, Haemaphysalis punctata, Hyalomma anatolicum, Hyalomma asiaticum, Hyalomma marginatum, Rhipicephalus bursa and Rhipicephalus sanguineus were identified in this study. Also 569 host including 40 cows, 450 sheep, 70 goats and 9 dogs were examined for infestation and among them 255 were infested which showed a 44% of infestation among examined livestock. The infestation rate among sheep (46% was higher than other hosts. The infestation rates among the rest of hosts were as: cows (40%, goat (37% and dogs (33%. Conclusions: The results of this study and other studies of the region showed the probability of the establishment and development of the burden of several tick-borne diseases.

  9. Distribution of ticks (Acari:Ixodidae) infesting domestic ruminants in mountainous areas of Golestan province, Iran

    Institute of Scientific and Technical Information of China (English)

    Moslem Sarani; Zakkyeh Telmadarraiy; Abdolreza Salahi Moghaddam; Kamal Azam; Mohammad Mehdi Sedaghat

    2014-01-01

    Objective: To determine the prevalence of ticks on cattle in the mountainous areas of Golestan province and their geographical distribution.Methods:collection was carried out during four seasons, twice per season over a period of 12 month from March 2009 through February 2010 in two districts, Azadshahr and Ramian. Meteorological data were obtained from Iran Meteorological Organization. The geographical points recorded using a Garmin eTrex®H GPS.Results:In total, 498 animals from 25 herds were selected to search for ticks in 2009-2010. Tick 63 goats, 99 cows and 13 camels in two districts of the mountainous area of Golestan province, including Azadshahr and Ramian. Five species of ixodid ticks were identified: Rhipicephalussanguineus A total of 255 ticks were collected from a total of 219 ruminants including 44 sheep, anatolicum (6%) and Hyalomma asiaticum (4%). The densities of infestations were calculated for sheep, goats, cows and camels 0.9, 0.79, 0.16 and 0.43 respectively. Seasonal activity of each ixodid tick infesting domestic ruminants was determined. The distribution maps showed ixodid ticks on domestic ruminants, and Rhipicephalus sanguineus were dominant species in the area.Conclusions:Such research provides necessary information for human and animal health (66.5%), Rhipicephalus bursa (4.6%), Hyalomma marginatum (19.9%), Hyalomma service mangers to have a better understanding of prevention and control of vector borne diseases especially during the outbreaks.

  10. Screening for cytotoxic activity in a commercially important Indian seaweed, Stocheospermum marginatum

    Digital Repository Service at National Institute of Oceanography (India)

    Rashmi, C.V.; Chatterji, A.

    stream_size 6 stream_content_type text/plain stream_name Diversity_Life_Process_Ocean_Land_2007_36.pdf.txt stream_source_info Diversity_Life_Process_Ocean_Land_2007_36.pdf.txt Content-Encoding ISO-8859-1 Content-Type text...

  11. Occurrence of Soft and Hard Ticks on Ruminants in Zagros Mountainous Areas of Iran

    Directory of Open Access Journals (Sweden)

    S Nabian

    2008-08-01

    Full Text Available Background:The distribution and preferences of ticks of animals in central of Iran were studied four times a year. Methods: One thousand seven tick specimens were collected from different localities including Isfahan, Chaharmahalbak­htiary, EastAzarbaijan, West Azerbaijan, Kordestan, Kermanshah, Lorestan and Fars. Results: Most of sampled animals in this area were infested. We also encountered with a wild goat (Capra hircus aegagrus in Kolah Qazi national park in this part that was infested intensively by Boophilus kohlsi. Fifteen ixodid tick species were identified over the study period from cattle, sheep and domestic and wild goats namely B. kohlsi (3.6% Rhipicephalus sanguineus (4.5%, Rh.bursa (21.9%, Rh.turanicus (2.9%, Dermacentor niveus (12.9%, D.raskemensis (4.1%, D.marginatus (7.3%, Haemaphysalis punctata (3.5%, H. Parva (0.6%, H. Choldokovskyi (2%, Hyalomma anatolicum excavatum (4.8%, H.anatolicum anatolicum (5.2%, H. asiaticum asiaticum (7.3%, H. marginatum marginatum (13%, and H. detritum detritum (5.9%. The only soft tick found was Ornithodoros canestrinii which occurred in all localities of Isfahan Province but with significant differences in abundance. Clear pattern of seasonality was evident for this species and it was generally present from November to March, while ixodid ticks were present throughout the year. The largest numbers of adult ixodid ticks were generally present from April to August. Conclusion: The results showed that Rh.bursa, D.niveus and H.marginatum marginatum are dominant tick species

  12. Sobre uma população de ixodídeos colhida em troféus de caça na província de “EASTERN CAPE” (República da África do Sul)

    OpenAIRE

    Crespo, Maria Virgínia; Rosa,Fernanda; Oliveira, Bernardo

    2008-01-01

    Apresentação em painel Durante o mês de Maio de 2008 foram observados nove troféus de caça obtidos em reservas de caça privadas na Província de “Eastern Cape” (República da África do Sul), tendo-se recolhido ixodídeos em vertebrados pertencentes à Classe MAMMALIA (ARTIODACTYLA e CARNIVORA). A identificação baseou-se na chave adoptada por Travassos Dias (1989), nas descrições do género Rhipicephalus efectuadas por Walker et al. (2000) e na morfologia das genitálias. Dos 21 exemplares ...

  13. One-Humped Camels (Camelus dromedaries Hard Ticks Infestation in Qeshm Island, Iran

    Directory of Open Access Journals (Sweden)

    Saeed Nazifi

    2011-06-01

    Full Text Available The economic importance of tick infestation on camels are important as they are important meat and milk producer animals in the less vegetation area of Iran and their health and production are greatly affected by the high tick infestation. In this investigation, tick infestations on camels (Camelus dromedarius were determined in Qeshm Island, Iran. A total number of 912 adult ticks (472 males and 440 females were collected and identified. Hyalomma dromedarii was the predominant tick specie and accounted for 61.9% of the adult ticks. Other hard ticks were H. anatolicum excavatum (22 %, H. asiaticum asiaticum (14.2 %, H. marginatum (1.9 %, H. impeltatum (0.4 % and Ripicephalus bursa (0.4 %. In conclusion, The provision of tick control programs in the Qeshm Island would seem a prerequisite for improving camel meat and milk production.

  14. Genetic Analysis of Crimean-Congo Hemorrhagic Fever Virus in Russia

    Science.gov (United States)

    Yashina, Lyudmila; Vyshemirskii, Oleg; Seregin, Sergei; Petrova, Irina; Samokhvalov, Evgeny; Lvov, Dmitry; Gutorov, Valery; Kuzina, Irina; Tyunnikov, Georgy; Tang, Yi-Wei; Netesov, Sergei; Petrov, Vladimir

    2003-01-01

    Genetic analysis of wild-type Crimean-Congo hemorrhagic fever (CCHF) virus strains recovered in the European part of Russia was performed. Reverse transcriptase PCR followed by direct sequencing was used to recover partial sequences of the CCHF virus medium (M) genome segment (M segment) from four pools of Hyalomma marginatum ticks and six human patients. Phylogenetic analysis of the M-segment sequences from Russian strains revealed a close relatedness of the strains (nucleotide sequence diversity, ≤5.0%). The strains differed significantly from CCHF viruses from other regions of the world (nucleotide sequence diversity, 10.3 to 20.4%), suggesting that CCHF virus strains recovered in the European part of Russia form a distinct group. PMID:12574301

  15. Alguns ectoparasitas e protozoários em bovinos da República da Guiné-Bissau

    OpenAIRE

    ROSA, FERNANDA; Crespo, Maria Virgínia; Travassos Dias, J. A.

    1998-01-01

    Os autores assinalam a presença de algumas espécies de ixodídeos (Amblyomma variegatum, Boophilus annulatus, B. geigy e Hyalomma sp.) localizados em diferentes regiões do corpo de bovinos autóctones da República da Guiné-Bissau, colhidos entre Novembro de 1990 e Março de 1991. A pesquisa de protozoários, efectuada principalmente em esfregaços de sangue revelou a presença de Anaplasma marginale, Theileria mutans, Babesia bigemina e Sarcocystis sp. Não foram encontradas lesões relacionada...

  16. Ixodid ticks on cattle belonging to small-scale farmers at 4 communal grazing areas in South Africa

    Directory of Open Access Journals (Sweden)

    N.R. Bryson

    2002-07-01

    Full Text Available Ixodid ticks were collected during the period September 1991 to August 1993 from cattle belonging to small-scale farmers utilising 4 communal grazing areas. Three of these were in North West Province and 1 in Mpumalanga province, South Africa. Ten tick species were collected in North West Province and 7 in Mpumalanga. The adults of Amblyomma hebraeum, Rhipicephalus appendiculatus and Rhipicephalus evertsi evertsi were most numerous in North West Province, while in Mpumalanga Boophilus decoloratus comprised more than 75% of the total population. Amblyomma hebraeum was present on all grazing areas, and heavy infestations of adults occurred during the period October to May on 1 of these. Few B. decoloratus were collected in North West Province, chiefly because the sampling method was inadequate, and most of these were present during early summer (October to December and late summer and autumn (March to May. The initially low population of B. decoloratus in Mpumalanga increased substantially towards the conclusion of the survey, probably because of the cessation of dipping. Boophilus microplus was present in small numbers on 2 grazing areas in the North West Province. Adult Hyalomma marginatum rufipes reached peak numbers from December to February and Hyalomma truncatum from February to April in the North West Province. Only H. marginatum rufipes was collected in Mpumalanga. Rhipicephalus appendiculatus was present on all the grazing areas, with most adults present from December to April. Most adult Rhipicephalus evertsi evertsi were collected from September to April and Rhipicephalus simus was present during the period October-April.

  17. Sero-epidemiological survey of Crimean-Congo hemorrhagic fever virus in Tunisia

    Directory of Open Access Journals (Sweden)

    Wasfi Fares

    2016-01-01

    Full Text Available Crimean-Congo hemorrhagic fever (CCHF is a tick-borne disease associated with a high case fatality rate and transmitted mainly by Hyalomma marginatum. The geographical distribution of H. marginatum covers most of the Western Mediterranean basin. We aimed to investigate whether CCHF virus (CCHFv is circulating in Tunisia. Samples from unexplained acute febrile patients (n = 181 and a high risk group of humans, mainly slaughter workers (n = 38, were collected in the summer of 2014 and analyzed for exposure to CCHFv using serological tests and real-time RT-PCR. Ticks were collected from Northern and Southern Tunisia during May–June 2014 and examined for the presence of CCHFv by real-time RT-PCR. Of the 181 febrile patients, 5 showed only high titers of IgM suggesting a recent exposure to CCHFv. Among 38 slaughter workers, 2 had IgG anti-CCHFv responses yielding a seroprevalence of 5.2%. No CCHFv was detected in ticks and sera. Our results provide evidence of human exposure to CCHFv in Tunisia.

  18. Sero-epidemiological survey of Crimean-Congo hemorrhagic fever virus in Tunisia

    Science.gov (United States)

    Wasfi, Fares; Dowall, Stuart; Ghabbari, Tayssir; Bosworth, Andrew; Chakroun, Mohamed; Varghese, Anitha; Tiouiri, Hanene; Ben Jemaa, Mounir; Znazen, Abir; Hewson, Roger; Zhioua, Elyes; Letaief, Amel

    2016-01-01

    Crimean-Congo hemorrhagic fever (CCHF) is a tick-borne disease associated with a high case fatality rate and transmitted mainly by Hyalomma marginatum. The geographical distribution of H. marginatum covers most of the Western Mediterranean basin. We aimed to investigate whether CCHF virus (CCHFv) is circulating in Tunisia. Samples from unexplained acute febrile patients (n = 181) and a high risk group of humans, mainly slaughter workers (n = 38), were collected in the summer of 2014 and analyzed for exposure to CCHFv using serological tests and real-time RT-PCR. Ticks were collected from Northern and Southern Tunisia during May–June 2014 and examined for the presence of CCHFv by real-time RT-PCR. Of the 181 febrile patients, 5 showed only high titers of IgM suggesting a recent exposure to CCHFv. Among 38 slaughter workers, 2 had IgG anti-CCHFv responses yielding a seroprevalence of 5.2%. No CCHFv was detected in ticks and sera. Our results provide evidence of human exposure to CCHFv in Tunisia. PMID:26956221

  19. Tick Infestation Rate of Sheep and Their Distribution in Abdanan County, Ilam Province, Iran, 2007-2008

    Directory of Open Access Journals (Sweden)

    MA Oshaghi

    2010-12-01

    Full Text Available "nAbstract "nBackground: Ticks are hematophagous arthropod belonging to the Class of Arachnids. Ticks are also one of the major vectors of pathogens to animal and human. This study was conducted to determine tick infestation rate of sheep in Abdanan during 2007–2008. "nMethods: Sampling was performed seasonally in 19 villages during spring 2007 until winter 2008. A total of 1095 sheep were selected and tested for tick infestation.  After collection, all ticks were transported to laboratory of Medi­cal Entomology and were identified with appropriate identification keys. "nResults: Totally, 864 hard ticks were collected. The ticks were classified into two genera and 5 species including: Hyalomma marginatum (44.67%, Hy. anatolicum (43.17%, Hy.asiaticum (6.37%, Hy. dromedarii (5.55%, Hea­maphysalis sulcata (0.24%. The highest seasonal activity was observed in spring (36.46 % and the lowest seasonal was in winter (11.57%. The rate of tick frequency in mountainous region was 48.15% and it was 51.85% in plateau regions. In this study, tick infestation of sheep was 11.41%. "nConclusion: Hy.marginatum has the more frequent density in the study area. "n  "nKeywords: Ticks, sheep, Iran

  20. Laboratory Study on Biological Control of Ticks (Acari: Ixodidae by Entomopathogenic Indigenous Fungi (Beauveria bassiana

    Directory of Open Access Journals (Sweden)

    M Abdigoudarzi

    2009-12-01

    Full Text Available Background: Chemical control method using different acaricides as spray, dipping solution or pour-on is routinely used for controlling ticks. Biological control agents are favorable due to their safety for animals and environment. Entomopathogenic fungi such as Beauveria bassiana are well known for controlling ticks. In this study, two Iranian indigenous strains of B. bassiana (B. bassiana 5197 and B. bassiana Evin were selected and grown on specific me­dia. The pathogenic effects of these strains were evaluated on adult stages of two Iranian Ixodidae members (H. anatolicum anatolicum Koch 1844, and H. marginatum Koch 1844 by dipping method.Methods: Two Iranian strains of Beauveria bassiana (Beauveria bassiana 5197 and Beauveria bassiana Evin were selected and were grown successfully on specific media. The pathogenic effects of these strains were evaluated on adult stages of Iranian Ixodidae members such as, Hyalomma anatolicum anatolicum and H. marginatum by dipping method (these ticks were grown up at laboratory conditions during 2002 up to 2003 and still it is continued .Results: There was no effect of strain 5197 on mortality or fecundity rates for ticks. There was acute phase sign of paralysis in test group after dipping ticks in suspension made from Evin strain of B. bassiana. In addition, the test groups were totally died after four months, but the control groups survived for six months.Conclusion: High concentration of fungal spores is needed for inducing fungal infection. Additional study using different strains and fungi on Iranian ticks is proposed. 

  1. [Genetic characterisation of Powassan virus (POWV) isolated from Haemophysalis longicornis ticks in Primorye and two strains of Tick-borne encephalitis virus (TBEV) (Flaviviridae, Flavivirus): Alma-Arasan virus (AAV) isolated from Ixodes persulcatus ticks in Kazakhstan and Malyshevo virus isolated from Aedes vexans nipponii mosquitoes in Khabarovsk kray].

    Science.gov (United States)

    L'vov, D K; Al'khovskiĭ, S V; Shchelkanov, M Iu; Deriabin, P G; Gitel'man, A K; Botikov, A G; Aristova, V A

    2014-01-01

    The complete genomes of the three tick-borne flaviviruses (genus Flavivirus, fam. Bunyaviridae) were sequenced: Povassan virus (POWV, strain LEIV-3070Prm, isolated from Haemophysalis logicornis in Primorsky Krai, Russia in 1977), Alma-Arasan virus (AAV, strain LEIV-1380Kaz, isolated from Ixodes persulcatus ticks in Kazakhstan in 1977) and Malyshevo virus (isolated from a pool of Aedes vexans nipponii mosquitoes, in the Khabarovsk Krai, Russia in 1978). It is shown that AAV and Malyshevo virus are the strains of Tick-borne encephalitis virus (TBEV) and belong to Sibirian and Far-Eastern genotypes, respectively (GenBank ID: AAV KJ744033; strain Malyshevo KJ744034). Phylogenetically AAV is closest related (94,6% nt and 98,3% aa identity) to TBEV strains, isolated in Sibiria (Vasilchenko, Aino, Chita-653, Irkutsk-12). Malyshevo virus is closest related (96,4% nt and 98,3% nt identity) to strains of TBEV, isolated in Far Eastern part of Russia (1230, Spassk-72, Primorye-89). POWV LEIV-3070Prm has 99.7% identity with the prototype strain POWV LB, isolated in Canada and 99.5% of isolates with Far-Eastern strains of POWV (Spassk-9 and Nadezdinsk-1991).

  2. Neurosecretory Cell Types and Distribution in Unfed Female Hyalomma Dromedari (Acari: Ixodoidea: Ixodidae) Synganglion

    Science.gov (United States)

    1987-01-01

    of the cell in subtype VIh (Fig. 2). Type IX : In these oval celo, 2 subtypes are distinguished according to cell size and NSG distribution. The NSG...1977) : Neurosecretion in Ornithodoros savignyi (Audouin) (Ixodoidea : Arga- sidae ). The distribution of neurosecretory cells in the brain. J. Vet. Res

  3. Prevalence and genetic diversity of piroplasm species in horses and ticks from Tunisia.

    Science.gov (United States)

    Ros-García, Amaia; M'ghirbi, Youmna; Hurtado, Ana; Bouattour, Ali

    2013-07-01

    The genetic diversity and prevalence of Babesia and Theileria species in the equine population of Tunisia were studied using reverse line blot (RLB) hybridization on blood samples and unfed adult ticks collected from apparently healthy horses from three bioclimatic zones in Tunisia. Piroplasms were identified in 13 of 104 of the horse blood samples analyzed (12.5%) and five genotype groups were identified: Theileria equi group A (nine animals, 8.7%), group C (one animal, 1.0%) and group D (three animals, 2.9%), and Babesia caballi groups A and B (one animal each). All horses from the semi-arid zone were negative and prevalence in the humid and sub-humid zones were 12.9% and 20.0%, respectively. Three Ixodid tick species (Hyalomma marginatum, Hyalomma excavatum and Rhipicephalus bursa) were collected from examined horses and equine piroplasms were detected in 10.8% of them. T. equi groups A and D (9.2%), and B. caballi group B (1.6%) were identified in ticks. This work represents the first epidemiological report of equine piroplasmosis in Tunisia. Results showed a high level of diversity within the 18S rRNA gene of equine piroplasm species, and confirmed the presence in Tunisia of two T. equi genetic groups, C and D, only reported before in South Africa and Sudan.

  4. Biogeography of Tick-Borne Bhanja Virus (Bunyaviridae in Europe

    Directory of Open Access Journals (Sweden)

    Zdenek Hubálek

    2009-01-01

    Full Text Available Bhanja virus (BHAV is pathogenic for young domestic ruminants and also for humans, causing fever and affections of the central nervous system. This generally neglected arbovirus of the family Bunyaviridae is transmitted by metastriate ticks of the genera Haemaphysalis, Dermacentor, Hyalomma, Rhipicephalus, Boophilus, and Amblyomma. Geographic distribution of BHAV covers southern and Central Asia, Africa, and southern (partially also central Europe. Comparative biogeographic study of eight known natural foci of BHAV infections in Europe (in Italy, Croatia, Bulgaria, Slovakia has revealed their common features. (1 submediterranean climatic pattern with dry growing season and wet mild winter (or microlimatically similar conditions, e.g., limestone karst areas in central Europe, (2 xerothermic woodland-grassland ecosystem, with plant alliances Quercetalia pubescentis, Festucetalia valesiacae, and Brometalia erecti, involving pastoral areas, (3 presence of at least one of the tick species Haemaphysalis punctata, Dermacentor marginatus, Rhipicephalus bursa, and/or Hyalomma marginatum, and (4 presence of ≥60% of the 180 BHAV bioindicator (157 plant, 4 ixodid tick, and 19 vertebrate spp.. On that basis, Greece, France (southern, including Corsica, Albania, Spain, Hungary, European Turkey, Ukraine (southern, Switzerland (southern, Austria (southeastern, Germany (southern, Moldova, and European Russia (southern have been predicted as additional European regions where BHAV might occur.

  5. [Genetic characterization of the Zaliv Terpeniya virus (ZTV, Bunyaviridae, Phlebovirus, Uukuniemi serogroup) strains isolated from the ticks Ixodes (Ceratixodes) uriae White, 1852, obligate parasites of the Alcidae birds, in high latitudes of Northern Eurasia and the mosquitoes Culex modestus Ficalbi, 1889, in subtropics Transcaucasus].

    Science.gov (United States)

    L'vov, D K; Al'khovskiĭ, S V; Shchelkanov, M Iu; Shchetinin, A M; Deriabin, P G; Gitel'man, A K; Samokhvalov, E I; Botikov, A G

    2014-01-01

    Complete genome sequences were obtained for the LEIV-13841Ka (ID GenBank KF767463-65) and LEIV-279Az (ID GenBank KF767460-62) virus strains, which were classified as different strains of the Zaliv Terpeniya virus (ZTV). LEIV-13841Ka was isolated from the ticks Ixodes (Ceratixodes) uriae White, 1852 collected on Ariy Kamen (Commander Islands) in 1986. LEIV-279Az was isolated from the mosquitoes Culex modestus Ficalbi, 1889, collected in heron colony (Ardea Linnaeus, 1758) in Azerbaijan (1969) and was initially identified as Uukuniemi virus (UUKV). According to the results obtained LEIV-279Az is ZTV strain as well. LEIV-13841Ka and LEIV-279Az RdRp sequences have high level of homology (99%) with previously sequenced ZTV/LEIV-271Ka. The L-segment nucleotide sequences are homological with ZTV/LEIV-271Ka on the level of 94% and 98% for LEIV-13841Ka and LEIV-279Az, respectively; M-segment--89% and 88%, respectively. Such homologies for the amino acid sequences of Gn/Gc polyprotein are 98.3% and 97.7%. NP proteins of ZTV/LEIV-13841Ka and LEIV-279Az have 88.7% and 84.6% homologies with ZTV/LEIV-271Ka both for amino acid and nucleotide sequences, respectively. Thus, for the very first time we demonstrated ZTV strain isolated from mosquitoes in subtropical Transcaucasia zone. Obtained results permit to expand suggested areal of ZTV and to fill up data upon the ecology of the Uukuniemi virus group.

  6. Growth of Ehrlichia canis, the causative agent of canine monocytic ehrlichiosis, in vector and non-vector ixodid tick cell lines.

    Science.gov (United States)

    Ferrolho, Joana; Simpson, Jennifer; Hawes, Philippa; Zweygarth, Erich; Bell-Sakyi, Lesley

    2016-06-01

    Canine monocytic ehrlichiosis is caused by Ehrlichia canis, a small gram-negative coccoid bacterium that infects circulating monocytes. The disease is transmitted by the brown dog tick Rhipicephalus sanguineus s.l. and is acknowledged as an important infectious disease of dogs and other members of the family Canidae worldwide. E. canis is routinely cultured in vitro in the canine monocyte-macrophage cell line DH82 and in non-vector Ixodes scapularis tick cell lines, but not in cells derived from its natural vector. Here we report infection and limited propagation of E. canis in the tick cell line RSE8 derived from the vector R. sanguineus s.l., and successful propagation through six passages in a cell line derived from the experimental vector Dermacentor variabilis. In addition, using bacteria semi-purified from I. scapularis cells we attempted to infect a panel of cell lines derived from non-vector species of the tick genera Amblyomma, Dermacentor, Hyalomma, Ixodes and Rhipicephalus with E. canis and, for comparison, the closely-related Ehrlichia ruminantium, causative agent of heartwater in ruminants. Amblyomma and non-vector Dermacentor spp. cell lines appeared refractory to infection with E. canis but supported growth of E. ruminantium, while some, but not all, cell lines derived from Hyalomma, Ixodes and Rhipicephalus spp. ticks supported growth of both pathogens. We also illustrated and compared the ultrastructural morphology of E. canis in DH82, RSE8 and I. scapularis IDE8 cells. This study confirms that E. canis, like E. ruminantium, is able to grow not only in cell lines derived from natural and experimental tick vectors but also in a wide range of other cell lines derived from tick species not known to transmit this pathogen.

  7. Study on co-infection of tick-borne pathogens in Ixodes persulcatus in Charles Hilary, Xinjiang Uygur autonomous region%新疆维吾尔自治区夏尔西里自然保护区全沟硬蜱复合感染蜱媒病原研究

    Institute of Scientific and Technical Information of China (English)

    刘晓明; 张桂林; 刘然; 孙响; 郑重; 邱尔臣; 马晓玲

    2015-01-01

    目的 了解新疆维吾尔自治区(新疆)夏尔西里自然保护区全沟硬蜱蜱媒病原复合感染情况.方法 2012年6月至2013年6月在新疆夏尔西里自然保护区采用布旗法采集全沟硬蜱,通过巢式PCR方法对蜱体内莱姆病伯氏疏螺旋体[Borrelia(B.) burgdorferi] 5S~ 23S rRNA基因间隔区、无形体(Anaplasma)16S rRNA基因、斑点热立克次体(Rickettsia) ompA基因、Q热贝氏柯克斯体Coxiella(C.)burneti的com1基因、巴贝西原虫(Babesia)的Nss-rRNA基因进行扩增.结果 204只全沟硬蜱中104只蜱病原检测阳性,阳性率为50.98%,其中伯氏疏螺旋体阳性率为34.31%(n=70),斑点热立克次体阳性率为28.92%(n=59),嗜吞噬细胞无形体阳性率为9.31%(n=19),未检出Q热贝氏柯克斯体和巴贝西原虫.x2检验显示,不同病原感染率差异有统计学意义(x2=38.517,P=0.000).204只蜱中有39只存在复合感染,复合感染率为19.12%(39/204),在病原检测阳性蜱中复合感染率为37.50%(39/104).伯氏疏螺旋体与斑点热立克次体复合感染率为16.18%(n=33);伯氏疏螺旋体与嗜吞噬细胞无形体复合感染率为4.90%(n=10),斑点热立克次体与嗜吞噬细胞无形体复合感染率为2.94%(n=6),3种病原体复合感染率为2.45%(n=5).经x2检验,3种病原混合感染率差异有统计学意义(x2=41.328,P=0.000).结论 新疆夏尔西里自然保护区全沟硬蜱存在伯氏疏螺旋体、嗜吞噬细胞无形体、斑点热立克次体的自然感染,并存在2~3种病原的复合感染.%Objective To study the co-infection of tick-borne pathogens in Ixodes persulcatus collected in Charles Hilary,Xinjiang Uygur autonomous region (Xinjiang).Methods Ticks were collected by flagging in grassy areas in Charles Hilary,Xinjiang from June 2012 to June 2013.The 5S-23S rRNA intergenic region from Borrelia (B.) burgdorferi,16S rRNA gene from Anaplasma,ompA gene from spotted fever group Rickettsia,comI gene from Coxiella (C

  8. Efficacy of Tissue Tolerable Plasma (TTP against Ixodes ricinus

    Directory of Open Access Journals (Sweden)

    Bender, Claudia

    2014-03-01

    Full Text Available [english] The efficacy of Tissue Tolerable Plasma (TTP against ticks was tested, as data from the literature has demonstrated its efficacy against other acari.The study was carried out by using the KINPen09 (Argon as carrier gas on (n=24. Treatment times of 1 and 3 minutes led to a reversible inactivation of the ticks. After 5 min of treatment, they died.Thanks to the acaricidal effect of TPP, a new treatment strategy using the KINPen09 for tick-infested pets is now available.

  9. Tick paralysis in Australia caused by Ixodes holocyclus Neumann

    DEFF Research Database (Denmark)

    Hall-Mendelin, S; Craig, S B; Hall, R A

    2011-01-01

    Ticks are obligate haematophagous ectoparasites of various animals, including humans, and are abundant in temperate and tropical zones around the world. They are the most important vectors for the pathogens causing disease in livestock and second only to mosquitoes as vectors of pathogens causing...

  10. Laboratory Study on Biological Control of Ticks (Acari: Ixodidae by Entomopathogenic Indigenous Fungi (Beauveria bassiana

    Directory of Open Access Journals (Sweden)

    M Abdigoudarzi

    2009-12-01

    Full Text Available Background: Chemical control method using different acaricides as spray, dipping solution or pour-on is routinely used for controlling ticks. Biological control agents are favorable due to their safety for animals and environment. Entomopathogenic fungi such as Beauveria bassiana are well known for controlling ticks. In this study, two Iranian indigenous strains of B. bassiana (B. bassiana 5197 and B. bassiana Evin were selected and grown on specific me­dia. The pathogenic effects of these strains were evaluated on adult stages of two Iranian Ixodidae members (H. anatolicum anatolicum Koch 1844, and H. marginatum Koch 1844 by dipping method."nMethods: Two Iranian strains of Beauveria bassiana (Beauveria bassiana 5197 and Beauveria bassiana Evin were selected and were grown successfully on specific media. The pathogenic effects of these strains were evaluated on adult stages of Iranian Ixodidae members such as, Hyalomma anatolicum anatolicum and H. marginatum by dipping method (these ticks were grown up at laboratory conditions during 2002 up to 2003 and still it is continued ."nResults: There was no effect of strain 5197 on mortality or fecundity rates for ticks. There was acute phase sign of paralysis in test group after dipping ticks in suspension made from Evin strain of B. bassiana. In addition, the test groups were totally died after four months, but the control groups survived for six months."nConclusion: High concentration of fungal spores is needed for inducing fungal infection. Additional study using different strains and fungi on Iranian ticks is proposed.   Keywords: Biological control, fungi, Beauveria bassiana, ticks, Ixodidae, Iran

  11. Identification and Mechanistic Analysis of a Novel Tick-Derived Inhibitor of Thrombin.

    Directory of Open Access Journals (Sweden)

    Willy Jablonka

    Full Text Available A group of peptides from the salivary gland of the tick Hyalomma marginatum rufipes, a vector of Crimean Congo hemorrhagic fever show weak similarity to the madanins, a group of thrombin-inhibitory peptides from a second tick species, Haemaphysalis longicornis. We have evaluated the anti-serine protease activity of one of these H. marginatum peptides that has been given the name hyalomin-1. Hyalomin-1 was found to be a selective inhibitor of thrombin, blocking coagulation of plasma and inhibiting S2238 hydrolysis in a competitive manner with an inhibition constant (Ki of 12 nM at an ionic strength of 150 mM. It also blocks the thrombin-mediated activation of coagulation factor XI, thrombin-mediated platelet aggregation, and the activation of coagulation factor V by thrombin. Hyalomin-1 is cleaved at a canonical thrombin cleavage site but the cleaved products do not inhibit coagulation. However, the C-terminal cleavage product showed non-competitive inhibition of S2238 hydrolysis. A peptide combining the N-terminal parts of the molecule with the cleavage region did not interact strongly with thrombin, but a 24-residue fragment containing the cleavage region and the C-terminal fragment inhibited the enzyme in a competitive manner and also inhibited coagulation of plasma. These results suggest that the peptide acts by binding to the active site as well as exosite I or the autolysis loop of thrombin. Injection of 2.5 mg/kg of hyalomin-1 increased arterial occlusion time in a mouse model of thrombosis, suggesting this peptide could be a candidate for clinical use as an antithrombotic.

  12. Hepatozoon kisrae n. sp. infecting the lizard Agama stellio is transmitted by the tick Hyalomma cf. aegyptium

    Directory of Open Access Journals (Sweden)

    Paperna I.

    2002-03-01

    Full Text Available Hepatozoon kisrae n. sp. was found infecting a starred lizard at a site in southeastern Samaria, Palestine. These lizards were also hosts to the ixodid tick Hyolomma cf. aegyptium, which was demonstrated to be the vector of this hemogregarine. Hepatozoon and tick infections occurred in lizards within a very restricted locality; at a second site, nearby, ticks occurred without Hepatozoon infection. Micro- and macromeronts occurred mainly in the lungs, while cyst-like merogonic stages, mainly dizoic, occurred in the liver. Mature intraerythrocytic gametocytes were stout and encapsulated. Development from oocysts to sporocysts took place in the tick hemocoel, and was examined by transmission electron microscopy. Lizards were successfully infected when fed on sporocyst-infected ticks or viscera of infected lizards. Ticks become infected when fed on infected lizards; sporogony was complete when the ticks reached adult stage, over 40 days after initial attachment.

  13. Molecular epidemiology of Crimean-Congo hemorrhagic fever virus detected from ticks of one humped camels (Camelus dromedarius) population in northeastern Iran.

    Science.gov (United States)

    Champour, Mohsen; Chinikar, Sadegh; Mohammadi, Gholamreza; Razmi, Gholamreza; Shah-Hosseini, Nariman; Khakifirouz, Sahar; Mostafavi, Ehsan; Jalali, Tahmineh

    2016-03-01

    A comprehensive study was conducted on camel ticks to assess the epidemiological aspects of the infection in camels. From May 2012 to January 2013, 11 cities and towns from the Khorasan provinces, northeastern Iran, were randomly selected as a "cluster" and at least 14 camels were sampled from each cluster. A total of 200 camels were examined in this study, reverse transcriptase polymerase chain reaction was used for the detection of the Crimean-Congo hemorrhagic fever virus (CCHFV) genome. Tick infestation was observed in 171 of the 200 camels, 480 ixodid ticks were collected, and one genus was identified as Hyalomma. Four species were reported to be the major tick species infesting camels. Among these, Hyalomma dromedarii was the most predominant tick species (90.7 %), followed by H. anatolicum (6 %), H. marginatum (2.9 %), and H. asiaticum (0.4 %). The genome of the CCHFV was detected in 49 (10.2 %) of the 480 ticks. The CCHFV RNA was detected in two of the four tick species, and the viral genome was detected from tick samples in three South Khorasan cities. The positivity rate of ticks was as follows: Boshroyeh, 25 out of 480 (5.2 %); Birjand, 17 out of 480 (3.5 %); and Nehbandan, 7 out of 480 (1.5 %). We recommend the use of acaricides to prevent disease transmission to humans and to reduce the tick population in camels. Care should be taken by abattoir workers and by those who work closely with camels.

  14. Prevalence of Theileria equi and Babesia caballi as well as the identification of associated ticks in sympatric Grevy's zebras (Equus grevyi) and donkeys (Equus africanus asinus) in northern Kenya.

    Science.gov (United States)

    Hawkins, Elaine; Kock, Richard; McKeever, Declan; Gakuya, Francis; Musyoki, Charles; Chege, Stephen M; Mutinda, Mathew; Kariuki, Edward; Davidson, Zeke; Low, Belinda; Skilton, Robert A; Njahira, Moses N; Wamalwa, Mark; Maina, Elsie

    2015-01-01

    The role of equine piroplasmosis as a factor in the population decline of the Grevy's zebra is not known. We determined the prevalence of Babesia caballi and Theileria equi in cograzing Grevy's zebras (Equus grevyi) and donkeys (Equus africanus asinus) in northern Kenya and identified the associated tick vectors. Blood samples were taken from 71 donkeys and 16 Grevy's zebras from March to May 2011. A nested PCR reaction using 18s ribosomal (r)RNA primers on 87 blood spots showed 72% (51/71; 95% confidence interval [CI] 60.4-81.0%) of donkeys and 100% (16/16; 95% CI, 77.3-100%) of Grevy's zebras were T. equi positive. No samples were positive for B. caballi. Sequence comparison using the National Center for Biotechnology Information's basic local alignment search tool identified homologous 18s rRNA sequences with a global geographic spread. The T. equi-derived sequences were evaluated using Bayesian approaches with independent Metropolis-coupled Markov chain Monte Carlo runs. The sequences clustered with those found in Sudan, Croatia, Mongolia, and the US, with statistical support greater than 80% for the two main clades. Hyalomma tick species were found on both donkeys and Grevy's zebras, whereas Rhipicephalus pulchellus was found exclusively on Grevy's zebras and Hyalomma marginatum rupfipes on donkeys. The prevalence of T. equi was 100% in Grevy's zebras and 72% in donkeys with common tick vectors identified. Our results suggest that donkeys and Grevy's zebras can be asymptomatic carriers and that piroplasmosis is endemic in the study area.

  15. Molecular detection of Theileria spp. and Babesia spp. in sheep and ixodid ticks from the northeast of Iran.

    Science.gov (United States)

    Razmi, Gholamreza; Pourhosseini, Moslem; Yaghfouri, Saeed; Rashidi, Ahmad; Seidabadi, Mohsen

    2013-02-01

    Theilerioses and babesioses are important diseases in Iranian sheep. The present study was undertaken to identify and classify/specify Theileria spp. and Babesia spp. in sheep and vector ticks. Investigation was carried out from 2009 to 2011 in the Khorasan Razavi Province, Iran. In total, 302 sheep originating from 60 different flocks were clinically examined and their blood collected. In addition, from the same flocks, ixodid ticks were sampled. Stained blood smears were microscopically examined for the presence of Theileria and Babesia organisms, and a semi-nested PCR was used for subsequent molecular specification. From the ticks, salivary glands and uterus were isolated and subsequently analyzed by semi-nested PCR. Piroplasm organisms were observed in 29% of the blood smears with low parasitemia, whereas 65% of the blood samples yielded positive PCR findings. The presence of Theileria ovis (55.6%), Theileria lestoquardi, and mixed infection with Theileria spp. and Babesia ovis were detected by semi-nested PCR in 0.3%, 5.6%, and 0.99%, respectively. In total, 429 ixodid ticks were collected from different areas of the province. The most prevalent ticks were Rhipicephalus turanicus (n = 376; 87.6% of the total), followed by Hyalomma marginatum turanicum (n = 30; 7.0%), Dermacentor raskemensis (n = 12; 2.8%), Hyalomma anatolicum anatolicum (n = 7; 1.6%), Dermacentor marginatus (n = 2; 0.5%), Rhipicephalus bursa (n = 1; 0.2%), and Haemaphysalis sp. (n = 1; 0.2%). Of the positive R. turanicus samples, 5 (5.7%) were infected with T. ovis and 2 (2.9%) with T. lestoquardi. Neither Babesia ovis nor Babesia motasi infection was detected in salivary glands or uterine samples of the ticks. The results also suggest that R. turanicus could be the vector responsible for transmission of the 2 Theileria species.

  16. Hard Ticks on Domestic Ruminants and their SeasonalPopulation Dynamics in Yazd Province, Iran

    Directory of Open Access Journals (Sweden)

    Y Salim abadi

    2010-06-01

    Full Text Available Background: Ticks are the main vectors for transmission of different pathogens to human and animals. This survey was performed to find out distribution of ticks, which infested the domestic ruminants in Yazd Province, central Iran during year 2008-2009.Methods: A total number of 30 villages from both mountainous (20% and plateau (80% regions of the province were selected randomly. Ticks were colleted from the body of infested animals and transported to the laboratory of Medical Entomology, School of Public Health, Tehran University of Medical Sciences and then were identified to space level using valid identification key.Results: A total of 583 hard ticks were collected. The ticks were classified into three genera and 7 species including:  Hyalomma dromedarii (55.92%, Hy. marginatum (13.20%, Hy. anatolicum (9.78%, Hy. detritum (4.98%,  Hy. asiaticum (3.94%, Rhipicephalus sanguineus (11.84%, and Dermacentor marginatus (0.34%. The highest seasonal activities occurred in summer. The prevalence of the Ixodidae ticks was more evident in plateaus area in Yazd Province. Among the hosts including: cow, goat, sheep and camel, the ticks that collected from camel was more prevalent. The ratio of male was more than female ticks. Hyalomma. dromedarii was the predominant tick species and accounted for 55.92% of the ticks.Conclusion: Some of the collected ticks may play an important role for transmission of vector borne disease to human; therefore, the results of this study will provide a clue for vectors of tick-borne diseases in the region for local authorities for implementation of disease control.

  17. Tick cell lines for study of Crimean-Congo hemorrhagic fever virus and other arboviruses.

    Science.gov (United States)

    Bell-Sakyi, Lesley; Kohl, Alain; Bente, Dennis A; Fazakerley, John K

    2012-09-01

    Continuous cell lines derived from many of the vectors of tick-borne arboviruses of medical and veterinary importance are now available. Their role as tools in arbovirus research to date is reviewed and their potential application in studies of tick cell responses to virus infection is explored, by comparison with recent progress in understanding mosquito immunity to arbovirus infection. A preliminary study of propagation of the human pathogen Crimean-Congo hemorrhagic fever virus (CCHFV) in tick cell lines is reported; CCHFV replicated in seven cell lines derived from the ticks Hyalomma anatolicum (a known vector), Amblyomma variegatum, Rhipicephalus (Boophilus) decoloratus, Rhipicephalus (Boophilus) microplus, and Ixodes ricinus, but not in three cell lines derived from Rhipicephalus appendiculatus and Ornithodoros moubata. This indicates that tick cell lines can be used to study growth of CCHFV in arthropod cells and that there may be species-specific restriction in permissive CCHFV infection at the cellular level.

  18. Ixodoidea of the Western Palaearctic: A review of available literature for identification of species.

    Science.gov (United States)

    Estrada-Peña, Agustín; Pfäffle, Miriam; Baneth, Gad; Kleinerman, Gabriela; Petney, Trevor N

    2017-06-01

    We aim to produce a review of the most important literature references necessary for the identification of ticks of the families Ixodidae and Argasidae in Europe and northern Africa (i.e. the Western Palaearctic region). The purpose of this paper is to pinpoint a set of critically selected papers that contain reliable information on morphology, taxonomic keys, and comparative discussions which are critical for the identification of the ticks reported in the target region. When necessary, comments are provided on the systematic position of a species, or on suitable papers already addressing the issue. This review includes a list of 216 references which cover all Ixodoidea species reported as permanent residents of the Western Palaearctic, namely 28 species of the genus Ixodes, two Dermacentor, seven Haemaphysalis, nine Hyalomma, eight Rhipicephalus, five Argas and about seven species of Ornithodoros. Copyright © 2017 Elsevier GmbH. All rights reserved.

  19. Long term study of ixodid ticks feeding on red deer (Cervus elaphus) in a meso-Mediterranean climate.

    Science.gov (United States)

    Valcárcel, F; González, J; Tercero Jaime, J M; Olmeda, A S

    2016-05-01

    Red deer (Cervus elaphus L.) are very valuable in trophy-hunting but also contribute to the preservation of natural areas. They are affected by many parasites and pathogens, including hard ticks that are not only important parasites themselves but can also act as vectors and/or reservoirs of pathogens. Tick phenology is complex insofar as population dynamics depend on environmental conditions, vegetation, host availability and their own intrinsic characteristic. Ticks were collected monthly from January 2007 to December 2014 from red deer on a natural reserve located in a meso-Mediterranean environment in Central Spain. A total of 8978 specimens of ixodid ticks were recovered with a mean Parasitization Index of 65.06 ticks/deer. Red deer were infected the whole year round with a summer-spring pattern and two secondary peaks in February and October. The main species was Hyalomma lusitanicum Koch followed by Rhipicephalus bursa Canestrini and Fanzago, Rhipicephalus pusillus Gil Collado, Dermacentor marginatus Sulzer and Ixodes ricinus L. Hyalomma lusitanicum has a complex life cycle in which several generations initiate their cycle at different times throughout the year, most probably lasting more than 1 year. We also describe the ability of nymphs to feed on large ungulates even though their habitual host is wild rabbit.

  20. First phylogenetic analysis of a Crimean-Congo hemorrhagic fever virus genome in naturally infected Rhipicephalus appendiculatus ticks (Acari: Ixodidae).

    Science.gov (United States)

    Fakoorziba, Mohammad Reza; Naddaf-Sani, Ali Asghar; Moemenbellah-Fard, Mohammad Djaefar; Azizi, Kourosh; Ahmadnia, Sara; Chinikar, Sadegh

    2015-05-01

    Crimean-Congo haemorrhagic fever (CCHF) is a potentially fatal systemic viral disease in many parts of the world, including Iran. The nationwide incidence of human CCHF in endemic areas was 870 confirmed cases with 126 deaths (case fatality rate, CFR = 17.6 %) in the decade leading to 2012. The detection of the CCHF virus (CCHFV) genome in tick vectors is of fundamental importance for identifying these ticks as potential reservoirs of CCHFV infection. From May to October 2013, following detection of four new clinical cases resulting in two deaths in the city of Mashhad (northeast Iran), hard ticks were recovered from infested livestock in 40 villages in Khorasan-Razavi province and examined by the microscopic method for species identification. About a quarter of the ticks were then subjected to reverse-transcription polymerase chain reaction (RT-PCR) to detect the CCHFV genome. The PCR products were then sequenced, and their phylogenetic lineages were determined. A total of 407 hard ticks were captured, representing seven different species in two distinct genera. Members of the genus Hyalomma were widely distributed in all but two of the villages studied, and this was also the most frequent (83.3 %) tick genus. Of 105 adult ticks subjected to RT-PCR, four (3.8 %) ticks were found positive for the CCHFV genome. One brown ear tick, Rhipicephalus appendiculatus, was found to be naturally infected for the first time anywhere in the world. Ticks of Hyalomma asiaticum, Hyalomma marginatum, and Rhipicephalus turanicus were also found to be naturally infected with CCHFV. CCHFV found in these four different tick species were clustered in the same lineage with the Matin and SR3 strains from Pakistan and some other strains from Iran, indicating that these tick species were naturally infected with genetically closely related CCHFV in the region. The presence of CCHFV infection in four different hard tick species was confirmed using RT-PCR in northeast Iran. Part of this

  1. Acaricide efficiency of amitraz / cypermethrin and abamectin pour-on preparations in game

    Directory of Open Access Journals (Sweden)

    J.S. Van der Merwe

    2005-09-01

    Full Text Available The efficacy of an amitraz / cypermethrin pour-on preparation (1 % w/v each was tested against natural tick infestations of buffaloes, eland and blesbok in three separate trials. The eland were also treated with a 0.02 % abamectin (w/v acaricidal pour-on preparation. The amitraz / cypermethrin pour-on was effective against Amblyomma hebraeum, Rhipicephalus evertsi evertsi, Rhipicephalus appendiculatus and Hyalomma marginatum rufipes on the buffaloes. Both acaricides were effective against R. appendiculatus and Rhipicephalus (Boophilus decoloratus in the eland. The amitraz / cypermethrin acaricide was effective against R. (Boophilus decoloratus in the blesbok. Ticks can cause damage to the skins, secondary infections, abscesses, anaemia, loss of condition, tick toxicosis and act as vectors of infectious diseases. Introduction of hosts and / or ticks from endemic to non-endemic areas because of translocation of game, may lead to severe losses. The pouron acaricides tested were effective against natural tick infestations and should always be used according to the manufacturer's instructions and efficacy claims.

  2. Acaricide efficiency of amitraz/cypermethrin and abamectin pour-on preparations in game.

    Science.gov (United States)

    Van Der Merwe, J S; Smit, F J; Durand, A M; Krüger, L P; Michael, L M

    2005-12-01

    The efficacy of an amitraz/cypermethrin pour-on preparation (1% w/v each) was tested against natural tick infestations of buffaloes, eland and blesbok in three separate trials. The eland were also treated with a 0.02% abamectin (w/v) acaricidal pour-on preparation. The amitraz/cypermethrin pour-on was effective against Amblyomma hebraeum, Rhipicephalus evertsi evertsi, Rhipicephalus appendiculatus and Hyalomma marginatum rufipes on the buffaloes. Both acaricides were effective against R. appendiculatus and Rhipicephalus (Boophilus) decoloratus in the eland. The amitraz/cypermethrin acaricide was effective against R. (Boophilus) decoloratus in the blesbok. Ticks can cause damage to the skins, secondary infections, abscesses, anaemia, loss of condition, tick toxicosis and act as vectors of infectious diseases. Introduction of hosts and/or ticks from endemic to non-endemic areas because of translocation of game, may lead to severe losses. The pouron acaricides tested were effective against natural tick infestations and should always be used according to the manufacturer's instructions and efficacy claims.

  3. [Results of the 20-year study of tick-borne encephalitis in Crimea].

    Science.gov (United States)

    Evstaf'ev, I L

    2001-01-01

    The history of tick-borne encephalitis (TBE) study in the Crimea was retraced and the possibility of introduction of TBE virus to the Crimea in the process of the acclimatization of vertebrates from areas enzootic for TBE is discussed. The foci of TBE were found throughout the whole of the mountain forest zone of the Crimea and coincided with the habitat area of lxodes ricinus, the main vector of TBE. Such ticks as Dermacentor reticulatus, D. marginatus and Hyalomma marginatum were also found to take part in the circulation of the virus. Among the residents of the mountain forest zone, 13.9% were found to have immunity to TBE, testifying to the wide contact of the population with the pathogen. TBE morbidity had pronounced seasonal character and the morbidity rate was low with the prevalence of mild clinical forms. The characteristic feature of the virus population was polymorphism: strains identical to the Far-Eastern strains Sofyin (about 60-70%) and strains differing in their antigenic structure circulated here.

  4. Identifying main drivers and testing control strategies for CCHFV spread.

    Science.gov (United States)

    Hoch, T; Breton, E; Josse, M; Deniz, A; Guven, E; Vatansever, Z

    2016-03-01

    Crimean Congo Haemorrhagic Fever (CCHF) is an emerging zoonotic disease. The causative agent is a virus (CCHFV), mainly transmitted by ticks of the species Hyalomma marginatum in Eastern Europe and Turkey. In order to test potential scenarios for the control of pathogen spread, the basic reproduction number (R0) for CCHF was calculated. This calculation was based on a population dynamics model and parameter values from the literature for pathogen transmission. The tick population dynamics model takes into account the major processes involved and gives estimates for tick survival from one stage to the other and number of feeding ticks. It also considers the influence of abiotic (meteorological variables) and biotic factors (host densities) on model outputs, which were compared with data collected in Central Anatolia (Turkey). R0 computation was thereafter used to test control strategies and especially the effect of acaricide treatment. Simulation results indicate that such treatments could have valuable effects provided that the acaricide is applied regularly throughout the spring and summer, and over several years. Furthermore, a sensitivity analysis to abiotic and biotic factors showed that, even though temperature has a strong impact on model outputs, host (mainly hare) densities also play a role. The kind of model we have developed provides insight into the ability of different strategies to prevent and control disease spread and has proved its relevance when associated with field trials.

  5. Ticks (Acari: Ixodidae) associated with wildlife and vegetation of Haller park along the Kenyan coastline.

    Science.gov (United States)

    Wanzala, W; Okanga, S

    2006-09-01

    This artcile describes the results obtained from a tick survey conducted in Haller park along the Kenyan coastline. The survey aimed at evaluating tick-host associations, assessing tick population density, and providing baseline information for planning future tick control and management in the park. Ticks (2,968) were collected by handpicking from eight species of wildlife and by dragging in 14 selected sites within the park. A considerable proportion of ticks were also collected from leaves, stems, and bark of most dominant trees, namely, Casuarina equisetifolia L. (Forst. and Forst.), Cocos nucifera L., Adansonia digitata L., Musa paradisiaca L., and Azadiracta indica Adr. Juss. Dragging was conducted in sites predominantly occupied by Cynodon dactylon L. (Pers.), Cenchrus ciliaris L., Stenotaphrum dimidiatum L. (Kuntze.) Brongn., and Brachiaria xantholeuca Hack. Ex Schinz Stapf. and Loudetia kagerensis K. Schum. Hutch. Eight tick species were identified, and the collection included Rhipicephalus pravus Dönitz 1910, Rhipicephalus pulchellus Gerstäcker 1873, Hyalomma marginatum rufipes Koch 1844, Amblyomma gemma Dönitz 1910, Amblyomma hebraeum Koch 1844, Amblyomma sparsum Neumann 1899, Amblyomma nuttalli Dönitz 1909, and Boophilus decoloratus Koch 1844. Given that the identified tick species are known to parasitize humans as well as livestock, there exist risks of emergence of zoonotic infections mediated by tick vectors. In the recreational environment of Haller park, where tick vectors share habitats with hosts, there is a need to develop sustainable and effective tick control and management strategies to minimize economic losses that tick infestation may cause.

  6. Arthropod parasites of Nubian ibexes (Capra ibex nubiana) and gazelles (Gazella gazella) in Israel.

    Science.gov (United States)

    Yeruham, I; Rosen, S; Hadani, A; Braverman, Y

    1999-06-15

    In a 20-year survey the following ectoparasites were collected from Nubian ibexes: larvae of an unidentified Oestrus sp. collected from the nasal cavities, sinuses and horns, hippoboscid flies (Lipoptena chalcomelaena) specific to the Nubian ibex, blood sucking lice (Linognathus africanus) and unidentified biting lice (Damalinia sp.). Ibexes were severely infested with the cattle tick, Boophilus annulatus; a few Hyalomma anatolicum excavatum ticks were also collected. In five ibexes kept in two zoos, showing otitis, Psoroptes cuniculi, was identified, and from skin scrpaings of nine animals with severe dermatitis in three other zoos, Sarcoptes scabiei was isolated. Infestation of Nubian ibexes with sucking and biting lice as well as H. anatolicum excavatum is reported for the first time. The ectoparasites collected from gazelles were: hippoboscid flies (Lipoptena capreoli), calliphorid flies (Lucilia sericata and Calliphora sp.), sucking lice (Linognathus africanus and Solenopotes capillatus) and unidentified biting lice (Damalinia sp.), fleas (Ctenocephalides felis felis), and ticks, B. annulatus, Rhipicepahlus bursa, Rhipicephalus turanicus, H. anatolicum excavatum and H. marginatum rufipes. In skin scrapings of four gazelles with local dermatitis in the fetlocks Chorioptes bovis was identified. Neoschoengastia sp. was found in craters between the claws in three gazelles.

  7. A Preliminary Investigation on Ticks (Acari: Ixodidae) Infesting Birds in Kızılırmak Delta, Turkey.

    Science.gov (United States)

    Keskin, Adem; Erciyas-Yavuz, Kiraz

    2016-01-01

    Ticks are mandatory blood-feeding ectoparasites of mammals, birds, reptiles, and even amphibians. Turkey has a rich bird fauna and is located on the main migration route for many birds. However, information on ticks infesting birds is very limited. In the present study, we aimed to determine ticks infesting birds in Kızılırmak Delta, Turkey. In 2014 autumn bird migration season, a total of 7,452 birds belonging to 79 species, 52 genera, 35 families, and 14 orders were examined for tick infestation. In total, 287 (234 larvae, 47 nymphs, 6♀) ticks were collected from 54 passerine birds (prevalence = 0.72%) belonging to 12 species. Ticks were identified as Amblyomma sp., Dermacentor marginatus (Sulzer), Haemaphysalis concinna Koch, Haemaphysalis punctata Canestrini and Fanzago, Hyalomma sp., Ixodes frontalis (Panzer), and Ixodes ricinus (L). The most common tick species were I. frontalis (223 larvae, 23 nymphs, 6♀) followed by I. ricinus (3 larvae, 12 nymphs) and H. concinna (4 larvae, 6 nymphs). Based on our results, it can be said that Erithacus rubecula (L.) is the main host of immature I. frontalis, whereas Turdus merula L. is the most important carrier of immature stages of some ticks in Kızılırmak Delta, Turkey. To the best of our knowledge, most of the tick-host associations found in this study have never been documented in the literature.

  8. Bio-Prospecting of a Few Brown Seaweeds for Their Cytotoxic and Antioxidant Activities

    Digital Repository Service at National Institute of Oceanography (India)

    Vinayak, R.C.; Sabu, A.S.; Chatterji, A.

    australis > Spatoglossum variabile > Stoechospermum marginatum > Spatoglossum aspermum showed significant cytotoxic activity. A very high DPPH radical scavenging activity was exhibited by the methanolic extracts prepared from St. marginatum, Padina...

  9. Molecular surveillance of Theileria ovis, Theileria lestoquardi and Theileria annulata infection in sheep and ixodid ticks in Iran

    Directory of Open Access Journals (Sweden)

    Gholamreza Razmi

    2013-03-01

    Full Text Available A molecular study was undertaken to detect Theileria ovis, Theileria lestoquardi and Theileria annulatain sheep and tick vectors. Investigation was conducted from 2010 to 2011 in the south of Khorasan Razavi Province, Iran. A total of 150 blood samples were collected from 30 different sheep flocks. In addition, ixodid ticks were sampled from the same flocks. The stained blood smears were microscopically examined for the presence of piroplasms and a semi-nested polymerase chain reaction-restriction (PCR was used for subsequent molecular speciation. Salivary glands were isolated from the ticks and subsequently analysed by semi-nested PCR. polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP was used to differentiate between T. lestoquardi and T. annulata from PCR-positive samples. Theileria species infection was microscopically detected in 18.6% of blood smears. The presence of T. ovis and T. lestoquardi or T. annulata was detected by semi-nested PCR in 58.6% and 6.6% of blood samples respectively. In total, 169 ixodid ticks were collected from different areas of the province. The most prevalent ticks were Rhipicephalus turanicus (n = 155; 91.7% of the total, followed by Hyalomma anatolicum anatolicum (n = 8; 4.7% and Hyalomma marginatum turanicum (n = 6; 3.5%. From an organ pooling of 33 ticks, three pools of salivary glands from R. turanicus were positive for Theileria species by semi-nested PCR. Of the three R. turanicus samples testing positive for Theileria species, two (6.1% were positive for T. ovis and one (3.0% for T. lestoquardi or T. annulata. Amongst the 11 PCR-positive samples for T. lestoquardi or T. annulata, 10 were positive for T. lestoquardi and one sample was positive for both T. lestoquardi and T. annulata using PCR-RFLP. The results also demonstrated that PCR-RFLP could be used for the detection of T. ovis. Based on the results, it can be concluded that T. ovis has a higher

  10. Molecular surveillance of Theileria ovis, Theileria lestoquardi and Theileria annulata infection in sheep and ixodid ticks in Iran.

    Science.gov (United States)

    Razmi, Gholamreza; Yaghfoori, Saeed

    2013-01-01

    A molecular study was undertaken to detect Theileria ovis, Theileria lestoquardi and Theileria annulata in sheep and tick vectors. Investigation was conducted from 2010 to 2011 in the south of Khorasan Razavi Province, Iran. A total of 150 blood samples were collected from 30 different sheep flocks. In addition, ixodid ticks were sampled from the same flocks. The stained blood smears were microscopically examined for the presence of piroplasms and a semi-nested polymerase chain reaction-restriction (PCR) was used for subsequent molecular speciation. Salivary glands were isolated from the ticks and subsequently analysed by semi-nested PCR. polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was used to differentiate between T. lestoquardi and T. annulata from PCR-positive samples. Theileria species infection was microscopically detected in 18.6% of blood smears. The presence of T. ovis and T. lestoquardi or T. annulata was detected by semi-nested PCR in 58.6% and 6.6% of blood samples respectively. In total, 169 ixodid ticks were collected from different areas of the province. The most prevalent ticks were Rhipicephalus turanicus (n = 155; 91.7% of the total), followed by Hyalomma anatolicum anatolicum (n = 8; 4.7%) and Hyalomma marginatum turanicum (n = 6; 3.5%). From an organ pooling of 33 ticks, three pools of salivary glands from R. turanicus were positive for Theileria species by semi-nested PCR. Of the three R. turanicus samples testing positive for Theileria species, two (6.1%) were positive for T. ovis and one (3.0%) for T. lestoquardi or T.annulata. Amongst the 11 PCR-positive samples for T. lestoquardi or T. annulata, 10 were positive for T. lestoquardi and one sample was positive for both T. lestoquardi and T. annulata using PCR-RFLP. The results also demonstrated that PCR-RFLP could be used for the detection of T. ovis. Based on the results, it can be concluded that T. ovis has a higher prevalence than T. lestoquardi, and that R

  11. A GIS framework for the assessment of tick impact on human health in a changing climate

    Directory of Open Access Journals (Sweden)

    Agustin Estrada-Peña

    2007-05-01

    Full Text Available A framework to evaluate the impact of ticks on human health under various scenarios of climate change is proposed. The purpose is not to provide a comprehensive plan (e.g. the economic impact of ticks on human society is not included, instead we wish to describe a series of indices that would be helpful by obtaining homogeneous comparisons of impact and vulnerability exerted by ticks in different regions, countries or continents, using normalized sets of population, vegetation, climate and physical attributes of the territory. Three tick species, i.e. Dermacentor marginatus, Rhipicephalus turanicus and Hyalomma marginatum, have been traced over the territory of Spain to further explain the computation of these indices. The discussion is based on tick habitat suitability, used as a measure of the abiotic (climate fitness of the habitat for the species in question, and the sensitivity of each tick species to the rate of change of habitat suitability with respect to climate change. The impact is the rate of change in habitat suitability weighted with a fuzzy logic function evaluating the total number of people in an area, percent of rural population and accessibility of the geographical divisions (expressed as hexagons with a 10 km radius used in the study. The different climate scenarios evaluated in relation to ticks show that the north-western part of Spain would suffer the greatest impact in case the mean temperature would increase, while the Mediterranean region would suffer the highest impact if temperatures decreased. Vulnerability, based on the sanitary structure of the territory and on the impact on human activities due to the change in tick distribution and abundance, is proposed as a measure of adaptation of society to these climate scenarios. The cost is evaluated as a function of land use and tick habitat suitability in a buffer zone surrounding each geographic division. All indices proposed have been obtained by search of common and

  12. Larvae of Ixodes ricinus transmit Borrelia afzelii and B. miyamotoi to vertebrate hosts

    NARCIS (Netherlands)

    Duijvendijk, van Gilian; Coipan, Claudia; Wagemakers, Alex; Fonville, Manoj; Ersöz, Jasmin; Oei, Anneke; Földvári, Gábor; Hovius, Joppe; Takken, Willem; Sprong, Hein

    2016-01-01

    Background: Lyme borreliosis is the most common tick-borne human disease and is caused by Borrelia burgdorferi sensu lato (s.l.). Borrelia miyamotoi, a relapsing fever spirochaete, is transmitted transovarially, whereas this has not been shown for B. burgdorferi (s.l). Therefore, B. burgdorferi (

  13. The Genus Ixodes (Acari: Ixodidae) in Mexico: Adult Identification Keys, Diagnoses, Hosts, and Distribution

    Science.gov (United States)

    2010-01-01

    1962. Monografía de los Ixodoidea de México. I Parte. Revista de la Sociedad Mexicana de Historia Natural 23:191-307. Hoffmann, A. 1969. Un caso de...geographic reference, 3rd ed., D. E. Wilson and D. M. Reeder (eds.). The Johns Hopkins University Press, Baltimore. p. 894-1531. Nuttall, G. H. F...337. Nuttall, G. H. F. and C. Warburton. 1911. A monograph of the Ixodoidea. Part II. Ixodidae. Cambridge at the University Press, London. p. i-xix

  14. Molecular detection of tick-borne pathogens in Ixodes ricinus from Moldova collected in 1960.

    Science.gov (United States)

    Movila, Alexandru; Toderas, Ion; Uspenskaia, Inga; Conovalov, Jurii

    2013-06-01

    This study is the first report about the prevalence of tick-borne pathogens, as well as their (co-)infection rates, in the museum-archived I. ricinus female ticks collected in Moldova in 1960. A total of 16.7% (21/126) ticks was mono-infected. Borrelia burgdorferi sensu stricto was revealed as the most abundant species (4.8%) followed by B. garinii (1.6%), B. afzelii (0.8%), B. valaisiana (0.8%), and B. lusitaniae (0.8%). DNA of Rickettsia helvetica (2.4%), R. monacensis (2.4%), Anaplasma phagocytophilum (2.4%), 'Candidatus Neoehrlichia mikurensis' (0.8%), and Babesia microti (0.8%) were also detected, indicating the occurrence of these emerging tick-borne microorganisms in Moldova since 1960 at least. In this study, we detected a co-infection (0.8%; 1/126 tested ticks) between B. microti and R. helvetica. Additional investigations are warranted to further characterize a historical snapshot of the distribution of tick-borne pathogens in Europe.

  15. The Ixodes (Acari: Ixodidae) of Mexico: Parasite-Host and Host-Parasite Checklists

    Science.gov (United States)

    2007-08-20

    en Peligro de Extinción. Comisión Nacional para el Cono- cimiento y Uso de la Biodiversidad , Fondo de Cultura Económica, Instituto de Ecología, UNAM... Biodiversidad y Fondo de Cultura Económica, México, D. F. 981 pp. Chavarría, C.M. (1941) Garrapatas determinadas en México. Caracteres genéricos de las más...Campos, G. (2000) Biodiversidad de los ácaros en México. Fideicomiso Fondo para la Biodiver- sidad, México D. F., 230 pp. Hooker, W.A., Bishopp, F.C

  16. Infectiousness of Ixodes Persulcatus Ticks with Pathogens of Various Diseases in Endemic Regions of European Russia

    Directory of Open Access Journals (Sweden)

    O.N. Lyubeznova

    2014-04-01

    Conclusion. Kirov region is an active natural focus of transmissible infections. Quite often tick contains two or three pathogens. It is necessary to continue the monitoring of the natural foci to develop more adequate preventive measures against tick-borne infections.

  17. Autocrine/paracrine dopamine in the salivary glands of the blacklegged tick Ixodes scapularis.

    Science.gov (United States)

    Koči, Juraj; Simo, Ladislav; Park, Yoonseong

    2014-03-01

    Dopamine (DA) is known to be the most potent activator of tick salivary secretion, which is an essential component of successful tick feeding. We examined the quantitative changes of catecholamines using a method coupling high-pressure liquid chromatography with electrochemical detection (HPLC-ECD). We also investigated the levels of catecholamines conjugated to other molecules utilising appropriate methods to hydrolyse the conjugates. Three different biological samples, salivary glands, synganglia, ovaries and haemolymph were compared, and the largest quantity of DA was detected in salivary gland extracts (up to ∼100pg/tick), supporting the hypothesis that autocrine/paracrine dopamine activates salivary secretion. Quantitative changes of catecholamines in the salivary glands over the entire blood feeding duration were examined. The amount of dopamine in the salivary glands increased until the day 5 of feeding, at which the rapid engorgement phase began. We also detected a small but significant amount of norepinephrine in the salivary glands. Interestingly, saliva collected after induction of salivary secretion by the cholinergic agonist pilocarpine contained a large amount of DA sulphate with a trace amount of DA, suggesting a potential biological role of DA sulphate in tick saliva.

  18. Autocrine/paracrine dopamine in the salivary glands of the blacklegged tick Ixodes scapularis

    OpenAIRE

    Koči, Juraj; Šimo, Ladislav; Park, Yoonseong

    2014-01-01

    Dopamine (DA) is known to be the most potent activator of tick salivary secretion, which is an essential component of successful tick feeding. We examined the quantitative changes of catecholamines using a method coupling high-pressure liquid chromatography with electrochemical detection (HPLC-ECD). We also investigated the levels of catecholamines conjugated to other molecules utilising appropriate methods to hydrolyse the conjugates. Three different biological samples, salivary glands, syng...

  19. Precise identification of different stages of a tick, Ixodes granulatus Supino, 1897 (Acari: Ixodidae

    Directory of Open Access Journals (Sweden)

    Ernieenor Faraliana Che Lah

    2016-07-01

    Conclusions: These findings demonstrated for the first time the establishment of COI gene for identifying I. granulatus nymphal tick which is of paramount importance to the control of potential tick-borne infections in Malaysia. Moreover, this study provides evidence that a combination of morphology and molecular data was corroborated as an accurate tool for tick identification.

  20. Driving forces for changes in geographical distribution of Ixodes ricinus ticks in Europe

    DEFF Research Database (Denmark)

    Medlock, Jolyon M.; Hansford, Kayleigh M.; Bormane, Antra;

    2013-01-01

    , and the changes in the distribution and abundance of tick hosts are important considerations during our assessment and management of the public health risks associated with ticks and tick-borne disease issues in 21st century Europe. Better understanding and mapping of the spread of I. ricinus (and changes in its...... abundance) is, however, essential to assess the risk of the spread of infections transmitted by this vector species. Enhanced tick surveillance with harmonized approaches for comparison of data enabling the follow-up of trends at EU level will improve the messages on risk related to tick-borne diseases...

  1. [Mapping of parasitological environmental data: the tick Ixodes ricinus--a case of study].

    Science.gov (United States)

    Kiewra, Dorota; Lonc, Elzbieta; Rydzanicz, Katarzyna

    2009-01-01

    While the mapping of health data is not new for epidemiologists the incorporation of differentiated environmental factors, e.g., temperature, rainfall, humidity, elevation, vegetation type, host abundance and distribution, zoonotic reservoirs of infection can create a new opportunities for parasitologists. Suitable tools for spatial modeling of health problems and pathogen occurrence in space and time are provided by geographic information system (GIS). It is computer-based system which integrates, storages, edits, analyses, shares and displays information. This software system is based on connection between information--data and their location. GIS applications allow users to create interactive queries, analyze spatial information, edit data and maps. GIS is very useful to define the habitats of parasites, especially for the ticks which are strong depended on environmental conditions. Mapping not only enables to create maps based on field monitoring but also to create forecasting maps for prevention and control strategies on small and large scale. Up to now ticks and tick-borne diseases (TBD) having strong relationship with the ecosystem are highly amenable to predictive mapping. The aim of study is the characterization of procedural steps with regard to entering field environmental data to GIS database and their visualization on digital maps. The field date of tick monitoring conducted in April 2008 in the Wrocław area (the Osobowicki Forest) made possible to create digital database. ArcView as one of three separate software products of ArcGIS (a scalable framework for implementing GIS) was used to create an interactive maps. Visualization of the data which are stored in tables of attributes made possible to show legibly the distribution of I. ricinus on the analysed area. Mapping of I. ricinus occurrence on digital maps enable to indicate areas of the highest risk of biting and potential tick-borne diseases.

  2. Ixodes pacificus ticks maintain embryogenesis and egg hatching after antibiotic treatment of Rickettsia endosymbiont.

    Science.gov (United States)

    Kurlovs, Andre H; Li, Jinze; Cheng, Du; Zhong, Jianmin

    2014-01-01

    Rickettsia is a genus of intracellular bacteria that causes a variety of diseases in humans and other mammals and associates with a diverse group of arthropods. Although Rickettsia appears to be common in ticks, most Rickettsia-tick relationships remain generally uncharacterized. The most intimate of these associations is Rickettsia species phylotype G021, a maternally and transstadially transmitted endosymbiont that resides in 100% of I. pacificus in California. We investigated the effects of this Rickettsia phylotype on I. pacificus reproductive fitness using selective antibiotic treatment. Ciprofloxacin was 10-fold more effective than tetracycline in eliminating Rickettsia from I. pacificus, and quantitative PCR results showed that eggs from the ciprofloxacin-treated ticks contained an average of 0.02 Rickettsia per egg cell as opposed to the average of 0.2 in the tetracycline-treated ticks. Ampicillin did not significantly affect the number of Rickettsia per tick cell in adults or eggs compared to the water-injected control ticks. We found no relationship between tick embryogenesis and rickettsial density in engorged I. pacificus females. Tetracycline treatment significantly delayed oviposition of I. pacificus ticks, but the antibiotic's effect was unlikely related to Rickettsia. We also demonstrated that Rickettsia-free eggs could successfully develop into larvae without any significant decrease in hatching compared to eggs containing Rickettsia. No significant differences in the incubation period, egg hatching rate, and the number of larvae were found between any of the antibiotic-treated groups and the water-injected tick control. We concluded that Rickettsia species phylotype G021 does not have an apparent effect on embryogenesis, oviposition, and egg hatching of I. pacificus.

  3. Prevalence of Beauveria pseudobassiana among entomopathogenic fungi isolated from the hard tick, Ixodes ricinus.

    Science.gov (United States)

    Munteanu, Natalia V; Mitkovets, Polina V; Mitina, Galina V; Movila, Alexandru; Tokarev, Yuri S; Leclerque, Andreas

    2014-10-01

    Human and animal disease-transmitting hard ticks (Acari: Ixodidae) are of great concern for public health and animal farming. Alternatives to tick control by chemical acaricides are urgently needed, and one intensively evaluated biocontrol strategy is based on the use of tick-pathogenic filamentous fungi. An indispensable prerequisite for the development of tick-derived fungal isolates into registered myco-acaricides is their sound taxonomic characterisation. A set of fungal strains isolated from ixodid ticks in the Republic of Moldova was genetically characterised at the genus and species level together with further tick-derived fungal isolates from different geographic locations in Europe and North America. In a previous study, the same isolates had been assigned to the species Beauveria bassiana. Using a recent molecular taxonomic approach based on phylogenetic reconstruction from both internal transcribed spacer (ITS) and protein-encoding gene sequences, all fungi investigated were conclusively assigned to one of the two "hyphomycete" genera, Beauveria or Isaria (Ascomycota; Hypocreales; Cordycipitaceae). Within the genus Isaria, two species, Isaria farinosa and Isaria fumosorosea, were equally represented. Within the genus Beauveria, the comparatively rare species Beauveria pseudobassiana was found to strongly prevail among the isolates from Moldova, and one of the two tick-derived Beauveria strains from North America could be assigned to this species as well. In particular, the previous classification as B. bassiana could not be confirmed for any of the characterised tick pathogens from Europe and North America. The data presented here lend support to the hypothesis that within the genus Beauveria specific adaptation to ticks might have occurred within the species B. pseudobassiana. To test this hypothesis, a more extensive molecular taxonomic survey carefully reconsidering previous taxonomic assignments of tick-derived fungal isolates is needed.

  4. Identification and Characterization of Ixodes scapularis Antigens That Elicit Tick Immunity Using Yeast Surface Display

    NARCIS (Netherlands)

    T.J. Schuijt; S. Narasimhan; S. Daffre; K. Deponte; J.W.R. Hovius; C. van 't Veer; T. van der Poll; K. Bakhtiari; J.C.M. Meijers; E.T. Boder; A.P. van Dam; E. Fikrig

    2011-01-01

    Repeated exposure of rabbits and other animals to ticks results in acquired resistance or immunity to subsequent tick bites and is partially elicited by antibodies directed against tick antigens. In this study we demonstrate the utility of a yeast surface display approach to identify tick salivary a

  5. Gene silencing in tick cell lines using small interfering or long double-stranded RNA.

    Science.gov (United States)

    Barry, Gerald; Alberdi, Pilar; Schnettler, Esther; Weisheit, Sabine; Kohl, Alain; Fazakerley, John K; Bell-Sakyi, Lesley

    2013-03-01

    Gene silencing by RNA interference (RNAi) is an important research tool in many areas of biology. To effectively harness the power of this technique in order to explore tick functional genomics and tick-microorganism interactions, optimised parameters for RNAi-mediated gene silencing in tick cells need to be established. Ten cell lines from four economically important ixodid tick genera (Amblyomma, Hyalomma, Ixodes and Rhipicephalus including the sub-species Boophilus) were used to examine key parameters including small interfering RNA (siRNA), double stranded RNA (dsRNA), transfection reagent and incubation time for silencing virus reporter and endogenous tick genes. Transfection reagents were essential for the uptake of siRNA whereas long dsRNA alone was taken up by most tick cell lines. Significant virus reporter protein knockdown was achieved using either siRNA or dsRNA in all the cell lines tested. Optimum conditions varied according to the cell line. Consistency between replicates and duration of incubation with dsRNA were addressed for two Ixodes scapularis cell lines; IDE8 supported more consistent and effective silencing of the endogenous gene subolesin than ISE6, and highly significant knockdown of the endogenous gene 2I1F6 in IDE8 cells was achieved within 48 h incubation with dsRNA. In summary, this study shows that gene silencing by RNAi in tick cell lines is generally more efficient with dsRNA than with siRNA but results vary between cell lines and optimal parameters need to be determined for each experimental system.

  6. An Annotated List of Tick (Acari: Ixodida) Common Names Authored by Harry Hoogstraal (1917-1986)

    Science.gov (United States)

    2011-01-01

    America, 63, 590–606. Pegram, R.G., Hoogstraal, H. & Wassef, H.Y. (1982) Hyalomma (Hyalommina) arabica sp. n. parasitizing goats and sheep in the...Hoogstraal et al. (1972a) Arabian goat hyalomminid, Hyalomma arabica Pegram, Hoogstraal and Wassef, 1982 ― Pegram et al. (1982) Arabian goat ...hyalomminine [sic], "Hyalomma sp. in press Pegram, Hoogstraal and Wassef, 1982"—this species was named Hyalomma arabica, "Arabian goat hyalomminid," q.v

  7. Ixodid ticks on domestic dogs in the Northern Cape Province of South Africa and in Namibia : short communication

    Directory of Open Access Journals (Sweden)

    S. Matthee

    2010-05-01

    Full Text Available The objective of this study was to determine the species composition of ixodid ticks infesting domestic dogs in the northwestern region of the Northern Cape Province of South Africa and in Namibia. Ticks were collected from February 2008 to January 2009 from dogs presented for a variety of reasons at a veterinary clinic in the Northern Cape Province and at 3 clinics in Namibia. The ticks collected at each place were pooled separately for each month at each locality. Eleven ixodid tick species were collected from dogs in the Northern Cape Province and new locality records for Haemaphysalis colesbergensis and Ixodes rubicundus, new locality and host records for Hyalomma glabrum, and a new host record for Rhipicephalus neumanni are reported. Six tick species were collected from dogs at the 3 clinics in Namibia. The most numerous species on dogs in both countries was R. sanguineus. The present results increase the total number of ixodid tick species collected from dogs in South Africa from 25 to 28.

  8. ГЕНЕТИЧЕСКАЯ ХАРАКТЕРИСТИКА ВИРУСОВ ИЗ АНТИГЕННОГО КОМПЛЕКСА ТЮЛЕНИЙ (FLAVIVIRIDAE, FLAVIVIRUS): ТЮЛЕНИЙ (TYUV TYULENIY VIRUS), ИЗОЛИРОВАННОГО ИЗ ОБЛИГАТНЫХ ЭКТОПАРАЗИТОВ КОЛОНИАЛЬНЫХ ПТИЦ КЛЕЩЕЙ IXODES (CERATIXODES) URIAE WHITE, 1852, СОБРАННЫХ В ВЫСОКИХ ШИРОТАХ СЕВЕРНОЙ ЕВРАЗИИ, И КАМА (KAMV KAMA VIRUS), ИЗОЛИРОВАННОГО ИЗ КЛЕЩЕЙ IXODES LIVIDUS ROCH, 1844, СОБРАННЫХ В НОРОВЫХ КОЛОНИЯХ ПТИЦ В СРЕДНЕЙ ЧАСТИ РУССКОЙ РАВНИНЫ

    OpenAIRE

    Львов, Дмитрий; Альховский, Сергей; Щелканов, Михаил; Щетинин, Алексей; Дерябин, Петр; Самохвалов, Евгений; Гительман, Ася; Ботиков, Андрей

    2014-01-01

    Проведено генетическое изучение вирусов Тюлений (TYUV Tyuleniy virus) (iD GenBank KF815939), изолированных в высоких широтах от клещей Ixodes uriae White, 1852, собранных в гнездовьях чистиковых птиц (Alcidae Leach, 1820), и Кама (KAMAV Kama virus) (iD GenBank KF815940), изолированного от клещей I. lividus, собранных в гнездовых колониях птиц в средней части Русской равнины. Результаты сравнительного анализа полноразмерных последовательностей геномов выявили 70% гомологии KAMV и TYUV на нукле...

  9. Transmission differentials for multible pathogens as inferred from their prevalence in larva, nymph and sult of Ixodes ricinus (Acari: Ixodidae)

    DEFF Research Database (Denmark)

    Jensen, Per M.; Christoffersen, Christian S.; Moutailler, Sara

    2017-01-01

    in prevalence rate of infection in larvae, nymphs and adults for multiple pathogens. Prevalence of infection for larvae, nymphs and adults, respectively, was: 0, 1.5 and 4.5% for Borrelia burgdorferi; 0, 4.2 and 3.9% for Borrelia garinii; 0, 6.6 and 6.1% for Borrelia afzelii; 0, 0 and 0.6% for Borrelia...... valaisiana; 0, 3.7 and 0.6% for Borrelia spielmanii; 0, 0.7 and 1.2% for Babesia divergens; 0, 0, 0.6% for Babesia venatorum; 0, 1.5 and 6.1% for A. phagocytophilum. The results were in general compatible with the hypothesis i.e., that differences in blood host for larvae and nymphs define differences...

  10. The presence of Borrelia miyamotoi, a relapsing fever spirochaete, in questing Ixodes ricinus in Belgium and in The Netherlands

    NARCIS (Netherlands)

    Cochez, C.; Heyman, P.; Heylen, D.; Fonville, M.; Hengeveld, P.; Takken, W.; Simons, L.; Sprong, H.

    2015-01-01

    Borrelia miyamotoi is a tick-borne bacterium that may cause relapsing fever in humans. As this pathogen has been discovered in Europe only recently, only little is known about its local impact on human health and its spatial distribution. In this study, we show the results of PCR screenings for B. m

  11. Anaplasma phagocytophilum and Rickettsia spp. infections in hard ticks (Ixodes ricinus) in the city of Hanover (Germany): revisited.

    Science.gov (United States)

    Tappe, Julia; Strube, Christina

    2013-09-01

    The present study aimed to determine the prevalence of Rickettsiales (A. phagocytophilum and Rickettsia spp.) in 2100 I. ricinus ticks collected at 10 different sampling sites every month during the tick season 2010 in the city of Hanover, northern Germany. At the same time, the results served as a fifth-year-follow-up study to monitor whether changes or stagnation of tick infection rates - possibly due to climate change--were obvious or not. To detect infections with A. phagocytophilum and/or Rickettsia spp., tick samples were analysed by quantitative real-time PCR. Differentiation of Rickettsia species was accomplished using real-time pyrosequencing technology. Overall, 4.5% (94/2100) of the collected ticks were tested positive for A. phagocytophilum and 26.2% (551/2100) were positive for Rickettsia spp. infections. Species differentiation of Rickettsia-positive ticks via real-time pyrosequencing was possible in 48.6% (268/551) of samples, which were all identified as R. helvetica. Coinfections with both pathogens were found in 1.0% (20/2100) of ticks. Statistically significant seasonal fluctuations between sampling months as well as local differences between sampling sites were detected for Rickettsia spp. infection rates. For A. phagocytophilum infections, only significant seasonal variations were found. When comparing infection rates of Hanoverian ticks in 2010 to those in 2005, infection rates of A. phagocytophilum-infected nymphs increased statistically significant (P=0.008, power: 0.762) from 2.3% in 2005 (Schicht et al., 2011) to 4.5% in 2010. Rickettsia spp. infections in female ticks decreased significantly (P=0.049, power: 0.491) from 41.8% in 2005 (Schicht et al., 2012) to 32.4% in 2010. Comparison of the remaining tick stages showed no statistically significant differences.

  12. The presence of Borrelia miyamotoi, a relapsing fever spirochaete, in questing Ixodes ricinus in Belgium and in The Netherlands

    NARCIS (Netherlands)

    Cochez, C.; Heyman, P.; Heylen, D.; Fonville, M.; Hengeveld, P.; Takken, W.; Simons, L.; Sprong, H.

    2015-01-01

    Borrelia miyamotoi is a tick-borne bacterium that may cause relapsing fever in humans. As this pathogen has been discovered in Europe only recently, only little is known about its local impact on human health and its spatial distribution. In this study, we show the results of PCR screenings for B.

  13. Comparison of the toxic effect of pyrethroids on [i]Ixodes ricinus[/i] and Dermacentor reticulatus females

    Directory of Open Access Journals (Sweden)

    Alicja Buczek

    2014-06-01

    Full Text Available introduction. Despite the increased rates of infestations with[i] I. ricinus (Ir[/i] and [i]D. reticulatus (Dr[/i] ticks observed over the last decade, no effective control methods have been developed so far. The resent study was focused on assessment of the action of pyrethroids on these both tick species. materials and method. The different doses of four pyrethroids, i.e. deltamethrin – D (K-Othrine, permethrin – P (Copex WP, cypermethrin – C (Kordon 10WP, and alphacypermethrin – AC (Alfasekt 5SC were tested. The LD50 for each tested compound was also determined for both tick species. Unengorged and engorged (maintained on rabbit skin tick females were sprayed with 20ml of 0.01563–0.50% solutions of the tested preparations. results. The investigations showed that sensitivity of Ir and Dr to the tested pyrethroids, but the effects exerted by the different doses varied between both tick species and between engorged and unengorged females in these species. The strongest toxic effect on unengorged and engorged Ir and Dr females was exerted by D, whereas the effect of AC was weaker. The LD 50 (in µg/1 g b.w. of D, AC, C, and P for unengorged Ir and Dr females was, respectively, 55.4 and 25.5, 105.2 and 48.5, 225.9 and 197.7, and 553.8 and 380.8. In the case of engorged Ir and Dr females, the LD50 of AC, D, C, and P reached a value of 0.9453 and 0.2310, 1.0428 and 1.3533, 3.489 and 6.5662, and 8.3955 and 7.3940, respectively. conclusions. The differences between the effects of the tested pyrethroids and their different doses on Ir and Dr highlight the necessity for development of a strategy for control of the tick species in different regions, based on investigations of their sensitivity to chemical compounds.

  14. Circumstantial evidence for an increase in the total number and activity of borrelia-infected ixodes ricinus in the Netherlands

    Directory of Open Access Journals (Sweden)

    Sprong Hein

    2012-12-01

    Full Text Available Abstract Background Between 1994 and 2009, a threefold increase has been observed in consultations of general practitioners for tick bites and Lyme disease in The Netherlands. The objective of this study was to determine whether an increase in the number of questing ticks infected with B. burgdorferi sensu lato is a potential cause of the rise in Lyme disease incidence. Methods Historic data on land usage, temperature and wildlife populations were collected and analyzed together with data from two longitudinal field studies on density of questing ticks. Effective population sizes of Borrelia burgdorferi s.l. were calculated. Results Long-term trend analyses indicated that the length of the annual tick questing season increased as well as the surface area of tick-suitable habitats in The Netherlands. The overall abundances of feeding and reproductive hosts also increased. Mathematical analysis of the data from the field studies demonstrated an increase in mean densities/activities of questing ticks, particularly of larvae between 2006 and 2009. No increase in infection rate of ticks with Borrelia burgdorferi sensu lato was found. Population genetic analysis of the collected Borrelia species points to an increase in B. afzelii and B. garinii populations. Conclusions Together, these findings indicate an increase in the total number of Borrelia-infected ticks, providing circumstantial evidence for an increase in the risk of acquiring a bite of a tick infected with B. burgdorferi s.l. Due to the high spatiotemporal variation of tick densities/activities, long-term longitudinal studies on population dynamics of I. ricinus are necessary to observe significant trends.

  15. Abundance of questing ticks and molecular evidence for pathogens in ticks in three parks of Emilia-Romagna region of Northern Italy

    Directory of Open Access Journals (Sweden)

    Sara Aureli

    2015-09-01

    Full Text Available Introduction and objective. Infectious and parasitic diseases transmitted by ticks, such as Lyme diseases, granulocytic anaplasmosis and piroplasmosis, have been frequently reported in Europe, with increasing attention to them as an emerging zoonotic problem. The presented study was performed to assess the distribution and the density of questing ticks in three regional parks of Emilia-Romagna region of Northern Italy, and to seek molecular evidence of potential human pathogens in tick populations. Materials and Methods. In the period April-October 2010, 8,139 questing ticks were collected: 6,734 larvae, 1,344 nymphs and only a few adults – 28 females and 33 males. The abundance of[i] Ixodes ricinus[/i] questing ticks was compared among different sampling sites and related to microclimate parameters. 1,544 out of 8,139 ticks were examined for the presence of pathogens: PCR was used to detect piroplasms DNA and Real time Taqman PCR for [i]Anaplasma phagocytophilum[/i] and [i]Borrelia burgdorferi[/i] s.l. Results. The predominant species was [i]I. ricinus[/i] (overall abundance 1,075.9/100 m[sup]2[/sup] ; more rarely, [i]Dermacentor marginatus[/i] (n = 37 – 0.45%, [i]Scaphixodes frontalis[/i] (n = 13 – 0.16%, [i]Hyalomma[/i] spp. (n = 6 – 0.07% and [i]Ixodes acuminatus[/i] (n = 3 – 0.04% were also found. 28 out of 324 (8.6% samples of ticks were PCR-positive for piroplasm DNA. 11 amplicons of 18S rRNA gene were identical to each other and had 100% identity with[i] Babesia[/i] EU1 ([i]Babesia venatorum[/i] using BLAST analysis. Real time Taqman PCR gave positive results for [i]A. phagocytophilum[/i] in 23 out of 292 samples (7.9%, and for [i]B. burgdorferi[/i] s.l. in 78 out of 292 samples (26.7%. [i]I. ricinu[/i]s was the only species found positive for pathogens by molecular analysis; 16 tick samples were co-infected with at least 2 pathogens. Discussion. The peak of nymph presence was in May, and the higher prevalence of pathogens

  16. Detection and identification of putative bacterial endosymbionts and endogenous viruses in tick cell lines.

    Science.gov (United States)

    Alberdi, M Pilar; Dalby, Matthew J; Rodriguez-Andres, Julio; Fazakerley, John K; Kohl, Alain; Bell-Sakyi, Lesley

    2012-06-01

    As well as being vectors of many viral, bacterial, and protozoan pathogens of medical and veterinary importance, ticks harbour a variety of microorganisms which are not known to be pathogenic for vertebrate hosts. Continuous cell lines established from ixodid and argasid ticks could be infected with such endosymbiotic bacteria and endogenous viruses, but to date very few cell lines have been examined for their presence. DNA and RNA extracted from over 50 tick cell lines deposited in the Roslin Wellcome Trust Tick Cell Biobank (http://tickcells.roslin.ac.uk) were screened for presence of bacteria and RNA viruses, respectively. Sequencing of PCR products amplified using pan-16S rRNA primers revealed the presence of DNA sequences from bacterial endosymbionts in several cell lines derived from Amblyomma and Dermacentor spp. ticks. Identification to species level was attempted using Rickettsia- and Francisella-specific primers. Pan-Nairovirus primers amplified PCR products of uncertain specificity in cell lines derived from Rhipicephalus, Hyalomma, Ixodes, Carios, and Ornithodoros spp. ticks. Further characterisation attempted with primers specific for Crimean-Congo haemorrhagic fever virus segments confirmed the absence of this arbovirus in the cells. A set of pan-Flavivirus primers did not detect endogenous viruses in any of the cell lines. Transmission electron microscopy revealed the presence of endogenous reovirus-like viruses in many of the cell lines; only 4 of these lines gave positive results with primers specific for the tick Orbivirus St Croix River virus, indicating that there may be additional, as yet undescribed 'tick-only' viruses inhabiting tick cell lines.

  17. PCR screening of tick-borne agents in sensitive conservation areas, Southeast Portugal.

    Science.gov (United States)

    Santos-Silva, Maria Margarida; Melo, Pedro; Santos, Nuno; Antunes, Sandra; Duarte, Luís Raposo; Ferrolho, Joana; Milhano, Natacha; Santos, Patrícia Tavares; Domingos, Ana; Santos, Ana Sofia

    2017-02-01

    The Southeast region of Portugal, particularly the Guadiana valley, is currently the reintroduction territory of Lynx pardinus (Iberian lynx), one of the most endangered felids in the world that is only found in the Iberian Peninsula. Over the last century, populations have declined, placing L. pardinus at extremely high risk of extinction in the wild and relying on reintroduction projects. Among the aspects taken into account in the establishment of new populations is the sanitary status of the selected habitats, especially concerning infectious diseases, including tick-borne pathogens (TBPs). This study presents the results of TBPs survey on ticks collected at sensitive conservation areas of Southeast Portugal. From 2012 to 2014, 231 ticks obtained from vegetation, sympatric domestic and wild animals were submitted for analysis. The presence of Babesia spp., Cytauxzoon spp., Theileria spp., Hepatozoon spp., Anaplasma spp., Ehrlichia spp., Candidatus Neoehrlichia mikurensis, among other Anaplasmataceae, and Coxiella burnetii were investigated by PCR. Six tick species were recorded, Dermacentor marginatus (n = 13/5.6%), Hyalomma lusitanicum (n = 175/75.8%), Ixodes ricinus (n = 4/1.7%), Rhipicephalus bursa (n = 7/3.0%), R. pusillus (n = 21/9.1%) and R. sanguineus sensu lato (n = 11/4.8%). The molecular screening confirmed the presence of two tick-borne pathogens, C. burnetii (N = 34) and Anaplasma platys (N = 1), and one tick-endosymbiont, Candidatus Midichloria mitochondrii (N = 45). The results obtained provide new information on the circulation of ticks and TBPs with potential veterinary importance in Iberian lynx habitat. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Detection and identification of putative bacterial endosymbionts and endogenous viruses in tick cell lines☆

    Science.gov (United States)

    Alberdi, M. Pilar; Dalby, Matthew J.; Rodriguez-Andres, Julio; Fazakerley, John K.; Kohl, Alain; Bell-Sakyi, Lesley

    2012-01-01

    As well as being vectors of many viral, bacterial, and protozoan pathogens of medical and veterinary importance, ticks harbour a variety of microorganisms which are not known to be pathogenic for vertebrate hosts. Continuous cell lines established from ixodid and argasid ticks could be infected with such endosymbiotic bacteria and endogenous viruses, but to date very few cell lines have been examined for their presence. DNA and RNA extracted from over 50 tick cell lines deposited in the Roslin Wellcome Trust Tick Cell Biobank (http://tickcells.roslin.ac.uk) were screened for presence of bacteria and RNA viruses, respectively. Sequencing of PCR products amplified using pan-16S rRNA primers revealed the presence of DNA sequences from bacterial endosymbionts in several cell lines derived from Amblyomma and Dermacentor spp. ticks. Identification to species level was attempted using Rickettsia- and Francisella-specific primers. Pan-Nairovirus primers amplified PCR products of uncertain specificity in cell lines derived from Rhipicephalus, Hyalomma, Ixodes, Carios, and Ornithodoros spp. ticks. Further characterisation attempted with primers specific for Crimean-Congo haemorrhagic fever virus segments confirmed the absence of this arbovirus in the cells. A set of pan-Flavivirus primers did not detect endogenous viruses in any of the cell lines. Transmission electron microscopy revealed the presence of endogenous reovirus-like viruses in many of the cell lines; only 4 of these lines gave positive results with primers specific for the tick Orbivirus St Croix River virus, indicating that there may be additional, as yet undescribed ‘tick-only’ viruses inhabiting tick cell lines. PMID:22743047

  19. Detection of Bartonella tamiae, Coxiella burnetii and rickettsiae in arthropods and tissues from wild and domestic animals in northeastern Algeria.

    Science.gov (United States)

    Leulmi, Hamza; Aouadi, Atef; Bitam, Idir; Bessas, Amina; Benakhla, Ahmed; Raoult, Didier; Parola, Philippe

    2016-01-20

    In recent years, the scope and importance of emergent vector-borne diseases has increased dramatically. In Algeria, only limited information is currently available concerning the presence and prevalence of these zoonotic diseases. For this reason, we conducted a survey of hematophagous ectoparasites of domestic mammals and/or spleens of wild animals in El Tarf and Souk Ahras, Algeria. Using real-time PCR, standard PCR and sequencing, the presence of Bartonella spp., Rickettsia spp., Borrelia spp. and Coxiella burnetii was evaluated in 268/1626 ticks, 136 fleas, 11 Nycteribiidae flies and 16 spleens of domestic and/or wild animals from the El Tarf and Souk Ahras areas. For the first time in Algeria, Bartonella tamiae was detected in 12/19 (63.2%) Ixodes vespertilionis ticks, 8/11 (72.7%) Nycteribiidae spp. flies and in 6/10 (60%) bat spleens (Chiroptera spp.). DNA from Coxiella burnetii, the agent of Q fever, was also identified in 3/19 (15.8%) I. vespertilionis from bats. Rickettsia slovaca, the agent of tick-borne lymphadenopathy, was detected in 1/1 (100%) Haemaphysalis punctata and 2/3 (66.7%) Dermacentor marginatus ticks collected from two boars (Sus scrofa algira) respectively. Ri. massiliae, an agent of spotted fever, was detected in 38/94 (40.4%) Rhipicephalus sanguineus sensu lato collected from cattle, sheep, dogs, boars and jackals. DNA of Ri. aeschlimannii was detected in 6/20 (30%) Hyalomma anatolicum excavatum and 6/20 (30%) Hy. scupense from cattle. Finally, Ri. felis, an emerging rickettsial pathogen, was detected in 80/110 (72.7%) Archaeopsylla erinacei and 2/2 (100%) Ctenocephalides felis of hedgehogs (Atelerix algirus). In this study, we expanded knowledge about the repertoire of ticks and flea-borne bacteria present in ectoparasites and/or tissues of domestic and wild animals in Algeria.

  20. Seasonal dynamics of ixodid ticks on wild rabbits Oryctolagus cuniculus (Leporidae) from Central Spain.

    Science.gov (United States)

    González, J; Valcárcel, F; Pérez-Sánchez, J L; Tercero-Jaime, J M; Olmeda, A S

    2016-11-01

    Rabbit Hemorrhagic Disease and Myxomatosis caused a decline in the rabbit population in the second half of the last century. Despite some recovery, the risk of vector-borne disease is present and thus the importance of controlling vector populations. In the current study, we describe the ixodid tick fauna in wild rabbit in a natural reserve in Ciudad Real (Central Spain) during the course of two 3-year periods (2007-2009 and 2012-2014). Of all the ticks collected on average 72.5 % were larvae, 24.4 % nymphs and 3.1 % adults, although the percentage varied monthly. Seven tick species were identified: Hyalomma lusitanicum Koch (Parasitic indicator [PI] = number of ticks per examined rabbit = 96.47), Rhipicephalus pusillus Gil Collado (PI = 47.37), Haemaphysalis hispanica Gil Collado (PI = 12.15), Ixodes ventalloi Gil Collado (PI = 0.65), R. bursa Canestrini and Fanzago (PI = 0.18), R. sanguineus Latreille (PI = 0.11), Dermacentor marginatus Sulzer (PI = 0.01). In spring and summer, most abundant were larvae of H. lusitanicum, followed by immature stages of R. pusillus and Ha. hispanica. In autumn, the main tick species were nymphs of I. ventalloi whereas in winter adults of Ha. hispanica were more numerous. Rhipicephalus pusillus was present all year long, although not always in high percentage. PI of other species (R. bursa, R. sanguineus and D. marginatus) were too low to be representative. The seasonal dynamics of ticks on wild rabbit defined in this study could be useful to design species-specific control strategies.

  1. МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКАЯ ХАРАКТЕРИСТИКА ВИРУСОВ ОХОТСКИЙ (OKHV-OKHOTSKIY VIRUS) И АНИВА (ANIV-ANIVA VIRUS) (REOVIRIDAE, ORBIVIRUS), ИЗОЛИРОВАННЫХ В ВЫСОКИХ ШИРОТАХ СЕВЕРНОЙ ЕВРАЗИИ ИЗ ОБЛИГАТНЫХ ЭКТОПАРАЗИТОВ ЧИСТИКОВЫХ ПТИЦ (ALCIDAE LEACH, 1820) КЛЕЩЕЙ IXODES (CERATIXODES) URIAE WHITE, 1852

    OpenAIRE

    Львов, Дмитрий; Альховский, Сергей; Щелканов, Михаил; Щетинин, Алексей; Дерябин, Петр; Гительман, Ася; Самохвалов, Евгений; Ботиков, Андрей

    2014-01-01

    Изучены молекулярно-генетические характеристики вирусов Охотский (OKHV Okhotskiy virus) (iD Gen Bank KF981623-32) и Анива (ANiV Aniva virus), ареал распространения которых охватывает в высоких широтах шельфовые и островные территории бассейнов Охотского, Берингова и Баренцева морей. Вирусы экологически связаны с гнездовьями чистиковых (Alcidae) птиц и их облигатными паразитами клещами Ixodes uriae (Ixodidae). OKHV и ANiV являются самостоятельными видами в составе группы Грейт-Айленд (GiV Grea...

  2. Longitudinal analysis of tick densities and Borrelia, Anaplasma, and Ehrlichia infections of Ixodes ricinus ticks in different habitat areas in The Netherlands.

    NARCIS (Netherlands)

    Wielinga, Peter R; Gaasenbeek, Cor; Fonville, Manoj; Boer, Albert de; Vries, Ankje de; Dimmers, Wim; Akkerhuis Op Jagers, Gerard; Schouls, Leo M; Borgsteede, Fred; Giessen, Joke W B van der

    2006-01-01

    From 2000 to 2004, ticks were collected by dragging a blanket in four habitat areas in The Netherlands: dunes, heather, forest, and a city park. Tick densities were calculated, and infection with Borrelia burgdorferi and Anaplasma and Ehrlichia species was investigated by reverse line blot analysis.

  3. Longitudinal analysis of tick densities and Borrelia, Anaplasma, and Ehrlichia infections of Ixodes ricinus ticks in different habitat areas in the Netherlands

    NARCIS (Netherlands)

    Wielinga, P.R.; Gaasenbeek, C.P.H.; Fonville, M.; Boer, de A.G.; Vries, de A.; Dimmers, W.J.; Jagers op Akkerhuis, G.A.J.M.; Schouls, L.M.; Borgsteede, F.H.M.; Giessen, van der J.W.B.

    2006-01-01

    From 2000 to 2004, ticks were collected by dragging a blanket in four habitat areas in The Netherlands: dunes, heather, forest, and a city park. Tick densities were calculated, and infection with Borrelia burgdorferi and Anaplasma and Ehrlichia species was investigated by reverse line blot analysis.

  4. Relatório REVIVE 2011 - Culicídeos e Ixodídeos (excerto): Rede de Vigilância de Vectores

    OpenAIRE

    2011-01-01

    Rede de Vigilância de Vectores: DGS – Divisão de Saúde Ambiental; ARS – Administração Regional de Saúde do Alentejo, Algarve, Centro, Lisboa e Vale do Tejo e Norte; IASAS Madeira; INSA/DDI – Centro de Estudos de Vectores e Doenças Infecciosas Doutor Francisco Cambournac

  5. Topical Treatment of White-Tailed Deer with an Acaricide for the Control of Ixodes Scapularis (Acari: Ixodidae) in a Connecticut Lyme Borreliosis Hyperendemic Community

    Science.gov (United States)

    The 4-Poster device for the topical treatment of white-tailed deer, Odocoileus virginianus (Zimmermann), against ticks using the acaricide amitraz, was evaluated in a Lyme borreliosis endemic community in Connecticut. As part of a 5-year project from 1997 to 2002, 21–24 of the 4-Posters were distrib...

  6. Longitudinal analysis of tick densities and Borrelia, Anaplasma, and Ehrlichia infections of Ixodes ricinus ticks in different habitat areas in the Netherlands

    NARCIS (Netherlands)

    Wielinga, P.R.; Gaasenbeek, C.P.H.; Fonville, M.; Boer, de A.G.; Vries, de A.; Dimmers, W.J.; Jagers op Akkerhuis, G.A.J.M.; Schouls, L.M.; Borgsteede, F.H.M.; Giessen, van der J.W.B.

    2006-01-01

    From 2000 to 2004, ticks were collected by dragging a blanket in four habitat areas in The Netherlands: dunes, heather, forest, and a city park. Tick densities were calculated, and infection with Borrelia burgdorferi and Anaplasma and Ehrlichia species was investigated by reverse line blot analysis.

  7. Longitudinal analysis of tick densities and Borrelia, Anaplasma, and Ehrlichia infections of Ixodes ricinus ticks in different habitat areas in The Netherlands.

    NARCIS (Netherlands)

    Wielinga, Peter R; Gaasenbeek, Cor; Fonville, Manoj; Boer, Albert de; Vries, Ankje de; Dimmers, Wim; Akkerhuis Op Jagers, Gerard; Schouls, Leo M; Borgsteede, Fred; Giessen, Joke W B van der

    2006-01-01

    From 2000 to 2004, ticks were collected by dragging a blanket in four habitat areas in The Netherlands: dunes, heather, forest, and a city park. Tick densities were calculated, and infection with Borrelia burgdorferi and Anaplasma and Ehrlichia species was investigated by reverse line blot analysis.

  8. Ability of Two Natural Products, Nootkatone and Carvacrol, to Suppress Ixodes Scapularis and Amblyomma americanum (Acari: Ixodidae) in a Lyme Disease Endemic Area of New Jersey

    Science.gov (United States)

    2009-12-01

    steam - distilled ex- tracts from Alaska...ap- plication, at 24 and 48 h postapplication, and at weekly intervals thereafter in all years. Plots were sampled using a combination of dragging ...Ginsberg and Ewing 1989, Schulze et al. 1997). The entire surface of each plot was sampled each time. Drags and coveralls were examined at

  9. Tick-borne bacteria in Ixodes ricinus collected in southern Norway evaluated by a commercial kit and established real-time PCR protocols.

    Science.gov (United States)

    Quarsten, H; Skarpaas, T; Fajs, L; Noraas, S; Kjelland, V

    2015-06-01

    Ticks are important vectors of human pathogens. The knowledge of disease causing agents harboured by ticks in Norway is limited. The focus of this study was (a) to detect the bacteria of medical importance in ticks collected from the vegetation at locations in the southern part of the country and (b) to evaluate a novel commercially available multiplex PCR based method by comparing results with conventional established real-time PCR protocols. Borrelia burgdorferi sensu lato was confirmed to be the most prevalent pathogen detected (31%) among one hundred individually analysed adult ticks. Borrelia miyamotoi, a spirochete associated with relapsing fever, was detected in one sample. Anaplasma phagocytophilum was found in 4% of the ticks, followed by Rickettsia helvetica which was detected in one sample. Similar pathogen prevalence was also detected in 500 ticks analysed in pools. This is the first report of the spotted fever group Rickettsia in Norway. Francisella tularensis, Bartonella species or Coxiella burnetti was not detected. However, due to the low number of ticks analysed, the possible presence of these pathogens in the region cannot be ruled out. All isolates were screened by at least two different molecular methods for each bacterial target; one commercially available multiplex PCR based tick-borne bacteria flow chip system (Master Diagnostica) and corresponding real-time PCR protocols. The comparison of methods verified that most findings were detected by both methods (71 Borrelia, 15 Anaplasma and 2 Rickettsia), whereas two additional Borrelia and Anaplasma infected samples were detected by the real-time protocols.

  10. Implications of climate change on the distribution of the tick vector Ixodes scapularis and risk for Lyme disease in the Texas-Mexico transboundary region

    Science.gov (United States)

    Disease risk maps are important tools that help ascertain the likelihood of exposure to specific infectious agents. Understanding how climate change may affect the suitability of habitats for ticks will improve the accuracy of risk maps of tick-borne pathogen transmission in humans and domestic anim...

  11. The effectiveness of permethrin-treated deer stations for control of the Lyme disease vector Ixodes scapularis on Cape Cod and the Islands

    Science.gov (United States)

    The use of animal host-targeted pesticide application to control blacklegged ticks, which transmit the Lyme disease bacterium between wildlife hosts and humans, is receiving increased attention as an approach to Lyme disease risk management. Included among the attractive feature...

  12. Acaricidal Treatment of White-Tailed Deer to Control Ixodes Scapularis (Acari: Ixodidae) in a New York Lyme Disease-Endemic Community

    Science.gov (United States)

    The 4-Poster device for the topical treatment of white-tailed deer, Odocoileus virginianus (Zimmermann) against ticks using the acaricide amitraz was evaluated in a Lyme borreliosis endemic community in Connecticut. As part of a 5-year project from 1997 to 2002, 21–24 of the 4-Posters were distribut...

  13. The effectiveness of permethrin-treated deer stations for control of the Lyme disease vector Ixodes scapularis on Cape Cod and the islands: a five year experiment

    Science.gov (United States)

    The use of animal host-targeted pesticide application to control blacklegged ticks, which transmit the Lyme disease bacterium between wildlife hosts and humans, is receiving increased attention as an approach to Lyme disease risk management. Included among the attractive features...

  14. An Assessment for the Presence of Powassan Virus in Ixodes scapularis Nymphs from Locations in Virginia, Maryland, New Jersey, Pennsylvania, New York, and Connecticut

    Science.gov (United States)

    2013-03-21

    of Powassan virus. Vector The only known vector of DTV is I. scapularis, commonly known as the deer or black-legged tick. Originally found in...problems, and wasting (2; 28). The DTV genotype was originally thought to be mild or asymptomatic (76); however, three Powassan encephalitis cases have...different habitats. Deciduous and coniferous forest stands, forest edge ecotones, and tall grass fields are examples of habitats sampled during the

  15. Dicty_cDB: Contig-U02852-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ( AY395265 |pid:none) Ixodes muris calreticulin gene, co... 341 4e-92 AY395272_1( AY395272 |pid:none) Ixodes ricinus...395270 |pid:none) Ixodes pararicinus calreticulin ge... 340 6e-92 AB000718_1( AB0

  16. Dicty_cDB: Contig-U15509-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available none) Ixodes woodi calreticulin gene, pa... 88 6e-16 AY395270_1( AY395270 |pid:none) Ixodes pararicinus calr...2_1( AY395272 |pid:none) Ixodes ricinus calreticulin gene, ... 88 8e-16 AY395271_

  17. Evaluation of Animal and Plant Pathogens as Terrorism and Warfare Agents, Vectors and Pests

    Science.gov (United States)

    2001-09-01

    Acari Arachnida Hyalomma Anatolicumn Anatolicumn Dermacentor andersoni Acari Arachnida Dermacentor varabilis Amblyimma Cajennese Rhipicephalus sanguineus...Mansonia spp. Diptera Insecta Culex spp. Culiseta spp. Pediculus humanus Anopluraa Insect Ixodides Dermacentor spp. Acari Arachnida Rhipicephalus spp

  18. 从桂黔交界地区中华硬蜱中分离到莱姆病螺旋体%Borrelia burgdorferi isolated from Ixodes sinensis in the border areas between Guangxi and Guizhou in China

    Institute of Scientific and Technical Information of China (English)

    李永学; 王昭孝; 曾霞; 王树声; 余春; 周敬祝

    2010-01-01

    目的 从桂黔交界地区捕获的蜱中分离莱姆病螺旋体,以探查广西壮族自治区(广西区)和贵州省莱姆病的传播媒介.方法 用BSK-Ⅱ培养基从蜱中分离莱姆病螺旋体.用PCR扩增分离菌株的5S~23S rRNA基因间隔区,将PCR扩增产物克隆后测序,通过将测序结果与基因库中莱姆病螺旋体菌株的5S~23S rRNA基因间隔区进行同源性比较和分析,从而鉴定分离株的基因型.结果 从捕获的中华硬蜱中分离出1株莱姆病螺旋体(命名为QLT1).分离株经鉴定为Borrelia valaisiana基因型莱姆病螺旋体.结论 中华硬蜱很有可能是广西区和贵州省莱姆病的传播媒介.

  19. Estudio de la enfermedad de Lyme en el área sanitaria del Hospital Universitario Lucus Augusti y su relación con las poblaciones de corzos parasitados por Ixodes

    OpenAIRE

    Vázquez López, María Esther

    2016-01-01

    Entre los años 2006 y 2013 se analizaron los resultados serológicos de 2845 personas, residentes en el área de influencia del Hospital Universitario Lucus Augusti y consideradas de riesgo para la enfermedad de Lyme (EL). Se revisaron las historias clínicas de 108 pacientes con diagnóstico confirmado EL, analizándose diversas variables epidemiológicas y clínicas. En el área de estudio, se recogieron garrapatas de la naturaleza y de corzos, en las que se identificaron diversas genoespecies de B...

  20. Dicty_cDB: VHB349 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available lete sequence. 40 0.80 3 AB231666 |AB231666.1 Ixodes philipi mitochondrial genes for NADH dehydrogenase subu...nd sequence, strain:O. 42 1.0 1 AB231665 |AB231665.1 Ixodes philipi mitochondrial genes for NADH dehydrogena...M2. 42 1.0 1 AB231664 |AB231664.1 Ixodes philipi mitochondrial genes for NADH dehydrogenase subunit 2, tRNA-... strain:M1. 42 1.0 1 AB231663 |AB231663.1 Ixodes philipi mitochondrial genes for NADH dehydrogenase subunit

  1. Antibacterial activity of selected marine macro algae against vancomycin resistant Enterococcus faecalis

    Directory of Open Access Journals (Sweden)

    Manivachagam Chandrasekaran

    2014-12-01

    Full Text Available Objective: To evaluate the antibacterial activity of different extracts of Caulerpa chemnitzia (Epser J.V. Lamououx, Caulerpa racemosa (Frosk. Weber-van-Bosse (C. racemosa, Caulerpa scalpelliformis (R.Br. Weber-van-Bosse, Ulva lactuca Lin, Ulva fasciata Dellie, Ulva reticulata Forsk, Stoechospermum marginatum (Ag. Kutz (S. marginatum, Sargassum wightii Grev, Gracilaria verrucosa (Huds. Papenfuss and Gracilaria edulis (S.G. Gemelin P.C. Silva against Enterococcus faecalis (MTCC 439 (E. faecalis and one clinical isolate of vancomycin resistant E. faecalis. Methods: The selected marine macro algae were extracted with different solvents viz., hexane, chloroform, ethyl acetate, acetone and methanol. Antibacterial assay was carried out by using disc diffusion method, determination of minimum inhibitory concentration and minimum bactericidal concentration. Results: The maximum antibacterial activity was recorded in the ethyl acetate extracts of S. marginatum and C. racemosa than the other extracts. The mean zone of inhibition produced by the extracts in agar diffusion assays against the tested bacterial strains ranged from 7.1 to 14.5 mm. The minimum inhibitory concentration was between 250 and 500 µg/mL, while the minimum bactericidal concentration was from 500 to 1 000 µg/mL. The ethyl acetate extracts of the seaweeds showed the presence of strong terpenoids, tannins and phenolic compounds compared with the other solvent extracts. Conclusions: These findings suggest that ethyl acetate extracts of S. marginatum and C. racemosa can be used as an antibacterial substance for the treatment of infection caused by E. faecalis.

  2. Antibacterial activity of selected marine macro algae against vancomycin resistant Enterococcus faecalis

    Institute of Scientific and Technical Information of China (English)

    Manivachagam Chandrasekaran; Venugopalan Venkatesalu; Gnanaprakasam Adaikala Raj

    2014-01-01

    Objective: To evaluate the antibacterial activity of different extracts of Caulerpa chemnitzia (Epser) J.V. Lamououx, Caulerpa racemosa (Frosk.) Weber-van-Bosse (C. racemosa), Caulerpascalpelliformis Forsk, Stoechospermum marginatum (Ag.) Kutz (S. marginatum), Sargassum wightii Grev,Gracilaria verrucosa (R.Br.) Weber-van-Bosse, Ulva lactuca Lin, Ulva fasciata Dellie, Ulva reticulata Enterococcus faecalis (MTCC 439) (E. faecalis) and one clinical isolate of vancomycin resistant E.faecalis. Methods: The selected marine macro algae were extracted with different solvents viz., hexane, chloroform, ethyl acetate, acetone and methanol. Antibacterial assay was carried out by using disc diffusion method, determination of minimum inhibitory concentration and minimum bactericidal concentration.Results:(Huds.) Papenfuss and Gracilaria edulis (S.G. Gemelin) P.C. Silva against marginatum and C. racemosa than the other extracts. The mean zone of inhibition produced by the extracts in agar diffusion assays against the tested bacterial strains ranged from 7.1 to 14.5 mm. The minimum inhibitory concentration was between 250 and 500 µg/mL, while the minimum bactericidal concentration was from 500 to 1000 µg/mL. The ethyl acetate extracts of the seaweeds showed the presence of strong terpenoids, tannins and phenolic compounds compared with the other solvent extracts.Conclusions:The maximum antibacterial activity was recorded in the ethyl acetate extracts of S. racemosa can be used as an antibacterial substance for the treatment of infection caused by E. faecalis. These findings suggest that ethyl acetate extracts of S. marginatum and C.

  3. Demam Rematik Dan Penyakit Jantung Rematik Permasalahan Indonesia

    OpenAIRE

    Siregar, Abdullah Afif

    2008-01-01

    Demam rematik dan penyakit jantung rematik telah lama dikenal. Demam rematik (DR) dan atau Penyakit jantung rematik (PJR) eksaserbasi akut adalah suatu sindroma klinik penyakit akibat infeksi kuman Streptokokus ? hemolitik grup A pada tenggorokan yang terjadi secara akut ataupun berulang dengan satu atau lebih gejala mayor yaitu poliartritis migrans akut, karditis, korea, nodul subkutan dan eritema marginatum. 08E00203

  4. MORPHOLOGY OF EMBRYOS AND SEEDLINGS OF WOODY SPECIES NORTHEASTERN ARGENTINA MORFOLOGÍA DE EMBRIONES Y PLÁNTULAS DE ESPECIES LEÑOSAS DEL NORDESTE ARGENTINO

    Directory of Open Access Journals (Sweden)

    María C Franceschini

    2010-11-01

    Full Text Available

    In this paper embryos and seedlings of six native woody species of Northeast of Argentina are studied: Chrysophyllum marginatum (Hook. et Arn. Radlk. subsp. marginatum (Sapotaceae,
    Eugenia uniflora L., Hexachlamys edulis (O. Berg Kausel et D. Legrand (Myrtaceae, Polygala albicans (A.W. Benn. Grondona (Polygalaceae, Sapium haematospermun Müll. Arg. and Sebastiania brasiliensis Spreng. (Euphorbiaceae. Descriptions and illustrations of seeds, embryos, germination and seedlings are given
    En este documento se estudian embriones y plántulas de seis especies leñosas nativas del nordeste de Argentina: Chrysophyllum marginatum (Hook. et Arn. Radlk. subsp. marginatum (Sapotaceae, Eugenia uniflora L., edulis Hexachlamys (O. Berg Kausel et D. Legrand (Myrtaceae, Polygala albicans (AW Benn. Grondona (Polygalaceae, Sapium haematospermun Müll. Arg. y Sebastiania brasiliensis Spreng. (Euphorbiaceae. Comprende las descripciones e ilustraciones de las semillas, embriones, germinación y plántulas

  5. Dicty_cDB: Contig-U13202-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 6_1( EF428206 |pid:none) Ixodes ricinus cathepsin B-like cy... 153 1e-35 AJ251536...ne) Tuberaphis coreana catB gene for c... 70 2e-10 EU128750_1( EU128750 |pid:none) Ixodes ricinus cathepsin

  6. Dicty_cDB: Contig-U16382-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ) RecName: Full=Actin-3; &S49480(S49480) &Z38130_1(Z3813... 236 6e-71 AJ889837_1( AJ889837 |pid:none) Ixodes ricinus..._1( AY898751 |pid:none) Ixodes ricinus actin mRNA, partial... 236 1e-70 AF393832_1( AF393832 |pid:none) Moru

  7. Dicty_cDB: Contig-U13537-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 4 5e-20 EU128750_1( EU128750 |pid:none) Ixodes ricinus cathepsin C precurs... 75 8e-20 AB117976_1( AB117976 ...stegopteryx spinocephala catB mRN... 70 3e-19 EF428206_1( EF428206 |pid:none) Ixodes ricinus cathepsin B-lik

  8. NCBI nr-aa BLAST: CBRC-PHAM-01-0651 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PHAM-01-0651 ref|XP_002411151.1| transmembrane and coiled-coil domains protein..., putative [Ixodes scapularis] gb|EEC13275.1| transmembrane and coiled-coil domains protein, putative [Ixodes scapularis] XP_002411151.1 3.1 32% ...

  9. EST Table: CN377181 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available CN377181 rzhswab0_002909 10/09/28 68 %/161 aa ref|XP_002405324.1| cargo transport p...rotein EMP24, putative [Ixodes scapularis] gb|EEC01376.1| cargo transport protein EMP24, putative [Ixodes sc

  10. The Ticks (Acari: Ixodida: Argasidae, Ixodidae) of Taiwan: A Synonymic Checklist

    Science.gov (United States)

    2005-01-01

    Hoogstraal & Wassef, H. taiwana Sugimoto, H. yeni Toumanoff, Ixodes acutitarsus ( Karsch ), I. granulatus Supino, I. kuntzi Hoogstraal & Kohls, I...in the same five checklists. The senior synonym I. ovatus is listed only by Tseng Ixodes acutitarsus ( Karsch , 1880).8 (1978) and Hoogstraal (letter no

  11. NCBI nr-aa BLAST: CBRC-MDOM-02-0026 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MDOM-02-0026 ref|XP_002416287.1| glycine rich secreted cement protein, putativ...e [Ixodes scapularis] gb|EEC19954.1| glycine rich secreted cement protein, putative [Ixodes scapularis] XP_002416287.1 5e-51 48% ...

  12. NCBI nr-aa BLAST: CBRC-PVAM-01-1566 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PVAM-01-1566 ref|XP_002416287.1| glycine rich secreted cement protein, putativ...e [Ixodes scapularis] gb|EEC19954.1| glycine rich secreted cement protein, putative [Ixodes scapularis] XP_002416287.1 4e-13 42% ...

  13. NCBI nr-aa BLAST: CBRC-GGOR-01-1493 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGOR-01-1493 ref|XP_002416287.1| glycine rich secreted cement protein, putativ...e [Ixodes scapularis] gb|EEC19954.1| glycine rich secreted cement protein, putative [Ixodes scapularis] XP_002416287.1 7e-28 46% ...

  14. NCBI nr-aa BLAST: CBRC-OPRI-01-1292 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OPRI-01-1292 ref|XP_002433763.1| cyclic-nucleotide-gated cation channel, putat...ive [Ixodes scapularis] gb|EEC05163.1| cyclic-nucleotide-gated cation channel, putative [Ixodes scapularis] XP_002433763.1 0.56 37% ...

  15. Ticks (Acari: Ixodidae infesting cattle and African buffaloes in the Tsavo conservation area, Kenya

    Directory of Open Access Journals (Sweden)

    Edward K. Kariuki

    2012-02-01

    Full Text Available Several ixodid tick species are shared between domestic cattle and African buffaloes (Syncerus caffer. So too, are a number of tick-borne diseases. The aim of the study was to compare the species composition of ticks that infest cattle and buffaloes utilising the same habitat within the Tsavo Conservation Area, Kenya. To this end, 25 cattle and 62 buffaloes were each opportunistically sampled for ticks on a single occasion in February 2010. Eight species, namely Amblyomma gemma, Amblyomma lepidum, Hyalomma albiparmatum, Hyalomma rufipes, Hyalomma truncatum, Rhipicephalus evertsi evertsi, Rhipicephalus pravus and Rhipicephalus pulchellus infested both cattle and buffaloes. Three species, Rhipicephalus (Boophilus sp., Rhipicephalus kochi, and Rhipicephalus muehlensi were collected only from cattle, and three species, Hyalomma impeltatum, Rhipicephalus humeralis and Rhipicephalus praetextatus were present only on buffaloes. The attachment sites of the various tick species were also recorded. New locality records for H. impeltatum and H. truncatum and the first confirmed locality record for Rhipicephalus praetextatus sensu stricto in Kenya were documented.

  16. Bacteria of the genus Rickettsia in ticks (Acari: Ixodidae) collected from birds in Costa Rica.

    Science.gov (United States)

    Ogrzewalska, Maria; Literák, Ivan; Capek, Miroslav; Sychra, Oldřich; Calderón, Víctor Álvarez; Rodríguez, Bernardo Calvo; Prudencio, Carlos; Martins, Thiago F; Labruna, Marcelo B

    2015-06-01

    The aim of this study was to document the presence of Rickettsia spp. in ticks parasitizing wild birds in Costa Rica. Birds were trapped at seven locations in Costa Rica during 2004, 2009, and 2010; then visually examined for the presence of ticks. Ticks were identified, and part of them was tested individually for the presence of Rickettsia spp. by polymerase chain reaction (PCR) using primers targeting fragments of the rickettsial genes gltA and ompA. PCR products were DNA-sequenced and analyzed in BLAST to determine similarities with previously reported rickettsial agents. A total of 1878 birds were examined, from which 163 birds (9%) were infested with 388 ticks of the genera Amblyomma and Ixodes. The following Amblyomma (in decreasing order of abundance) were found in immature stages (larvae and nymphs): Amblyomma longirostre, Amblyomma calcaratum, Amblyomma coelebs, Amblyomma sabanerae, Amblyomma varium, Amblyomma maculatum, and Amblyomma ovale. Ixodes ticks were represented by Ixodes minor and two unclassified species, designated here as Ixodes sp. genotype I, and Ixodes sp. genotype II. Twelve of 24 tested A. longirostre ticks were found to be infected with 'Candidatus Rickettsia amblyommii', and 2 of 4 A. sabanerae were found to be infected with Rickettsia bellii. Eight of 10 larval Ixodes minor were infected with an endosymbiont (a novel Rickettsia sp. agent) genetically related to the Ixodes scapularis endosymbiont. No rickettsial DNA was found in A. calcaratum, A. coelebs, A. maculatum, A. ovale, A. varium, Ixodes sp. I, and Ixodes sp. II. We report the occurrence of I. minor in Costa Rica for the first time and a number of new bird host-tick associations. Moreover, 'Candidatus R. amblyommii' and R. bellii were found in A. longirostre and A. sabanerae, respectively, in Costa Rica for the first time.

  17. Morphological and Molecular Characterization of Clinostomum detruncatum (Trematoda: Clinostomidae) Metacercariae Infecting Synbranchus marmoratus.

    Science.gov (United States)

    Acosta, Aline Angelina; Caffara, Monica; Fioravanti, Maria Letizia; Utsunomia, Ricardo; Zago, Aline Cristina; Franceschini, Lidiane; da Silva, Reinaldo José

    2016-02-01

    A complete morphological description, supported by molecular data, of Clinostomum detruncatum metacercariae is reported in this study. The metacercariae were found infecting Synbranchus marmoratus from the Paraná River, municipality of Guaíra, Paraná State, Brazil. The taenioidean uterus is the main morphological characteristic of this species. Both neighbor-joining (NJ) and maximum likelihood (ML) trees showed 2 clear separate clusters grouping together the species from the Palearctic region (Clinostomum complanatum, Clinostomum cutaneum, Clinostomum phalacrocoracis, Clinostomum philippinense) and those from the Nearctic/Neotropical regions (Clinostomum marginatum, Clinostomum tataxumui, C. detruncatum, Clinostomum sp. 7). The latter clade is divided into 2 subclades grouping species from North America and Mexico (C. marginatum and C. tataxumui), and those from Brazil (C. detruncatum and Clinostomum sp. 7).

  18. Paradaemonia thelia (Jordan e seus estágios imaturos (Lepidoptera, Saturniidae, Arsenurinae Paradaemonia thelia (Jordan and its immature stages (Lepidoptera, Saturniidae, Arsenurinae

    Directory of Open Access Journals (Sweden)

    Eurides Furtado

    2005-03-01

    Full Text Available Dados sobre os estágios imaturos, o comportamento e a distribuição de Paradaemonia thelia (Jordan são apresentados. A larva solitária alimenta-se de Chrysophyllum marginatum (Hook. & Arn. Radlk. (Sapotaceae, sua planta hospedeira natural. Os ovos são postos isolados na face dorsal de folhas maduras. O desenvolvimento larval leva 18 dias e o estágio pupal 32-37 dias. Adultos, ovos, larvas e pupa são ilustrados a cores.Data on immature stages, the behavior and the range of Paradaemonia thelia (Jordan, 1922 are presented. The solitary larva feed on Chrysophyllum marginatum (Hook. & Arn. Radlk. (Sapotaceae, its natural hostplant. Isolated ovae are deposited on dorsal surface of mature leaves. Larval development required 18 days; the pupal stage lasted 32-37 days. Adults, ovae, larvae and pupa are illustrated in color.

  19. Persistência de óleos essenciais em milho armazenado, submetido à infestação de gorgulho do milho Persistence of essential oils in stored maize submitted to infestation of maize weevil

    Directory of Open Access Journals (Sweden)

    Rodrigo Leandro Braga de Castro Coitinho

    2010-07-01

    Full Text Available Os óleos essenciais e os compostos constituintes têm sido pesquisados quanto a sua atividade inseticida contra pragas de grãos armazenados. Neste trabalho, avaliou-se a persistência de óleos essenciais em milho armazenado, submetido à infestação do gorgulho do milho, Sitophilus zeamais Mots. (Coleoptera: Curculionidae. A persistência dos óleos e do eugenol foi avaliada no período inicial (logo após a impregnação e aos 30, 60, 90 e 120 dias de armazenamento. As mortalidades de S. zeamais, no período inicial, variaram entre 93,8 (Piper hispidinervum, Melaleuca leucadendron e eugenol e 100% (Eugenia uniflora, frutos verdes de Schinus terebinthifolius e Piper marginatum. A partir dos 30 dias, as mortalidades, de modo geral, decresceram, com exceção de P. marginatum (92,2%, que alcançou 53,1% de mortalidade aos 120 dias de armazenamento. De acordo com as equações de regressão ajustadas para o número de S. zeamais emergidos em todo o período de armazenamento, apenas não houve significância para os óleos de S. terebinthifolius, P. marginatum e testemunha. Em relação à média geral, o óleo de P. marginatum foi o mais persistente, proporcionando emergência de apenas 0,30 insetos, diferindo dos óleos restantes, do eugenol e da testemunha. Os demais tratamentos só diferiram em relação à testemunha.The essential oils and constituent compounds have been studied for their insecticidal activity against stored grain pests. In this research, persistence of the essential oils in stored maize subject to infestation by maize weevil, Sitophilus zeamais Mots. (Coleoptera: Curculionidae were evaluated. Persistence of oils and eugenol were evaluated in the initial period (after impregnation and at 30, 60, 90 and 120 days of storage. Mortalities of S. zeamais in the initial period ranged between 93.8 (Piper hispidinervum, Melaleuca leucadendron and eugenol to 100% (Eugenia uniflora, green fruits of Schinus terebinthifolius and Piper

  20. Insecticidal activity of Piper essential oils from the Amazon against the fire ant Solenopsis saevissima (Smith) (Hymenoptera: Formicidae).

    Science.gov (United States)

    Souto, R N P; Harada, A Y; Andrade, E H A; Maia, J G S

    2012-12-01

    Pepper plants in the genus Piper (Piperales: Piperaceae) are common in the Brazilian Amazon and many produce compounds with biological activity against insect pests. We evaluated the insecticidal effect of essential oils from Piper aduncum, Piper marginatum (chemotypes A and B), Piper divaricatum and Piper callosum against workers of the fire ant Solenopsis saevissima (Smith) (Hymenoptera: Formicidae), as well as their chemical composition by gas chromatography and gas chromatography-mass spectrometry. The lowest median lethal concentration (LC50) in 48 h was obtained with the oil of P. aduncum (58.4 mg/L), followed by the oils of P. marginatum types A (122.4 mg/L) and B (167.0 mg/L), P. divaricatum (301.7 mg/L), and P. callosum (312.6 mg/L). The major chemical constituents were dillapiole (64.4%) in the oil of P. aduncum; p-mentha-1(7),8-diene (39.0%), 3,4-methylenedioxypropiophenone (19.0%), and (E)-β-ocimene (9.8%) in P. marginatum chemotype A and (E)-isoosmorhizole (32.2%), (E)-anethole (26.4%), isoosmorhizole (11.2%), and (Z)-anethole (6.0%) in P. marginatum chemotype B; methyleugenol (69.2%) and eugenol (16.2%) in P. divaricatum; and safrole (69.2%), methyleugenol (8.6%), and β-pinene (6.2%) in P. callosum. These chemical constituents have been previously known to possess insecticidal properties.

  1. Ectoparasites and endoparasites community of Ageneiosus ucayalensis (Siluriformes: Auchenipteridae), catfish from Amazon River system in northern Brazil.

    Science.gov (United States)

    de Oliveira Ferreira, Drielly; Tavares-Dias, Marcos

    2017-09-01

    This study investigated the community of ectoparasites and endoparasites in Ageneiosus ucayalensis (Auchenipteridae) of a tributary from the Amazon River system, in Northern Brazil. Of 34 fish examined, 100% were parasitized by Ichthyophthirius multifiliis, Cosmetocleithrum bulbocirrus, Demidospermus sp., metacercariae of Genarchella genarchella, Clinostomum marginatum and Herpetodiplostomum sp., Procamallanus (Spirocamallanus) belenensis, Cucullanus ageneiosus and larvae of Contracaecum sp. digeneans C. marginatum and Herpetodiplostomum sp. were dominant parasite species, while I. multifiliis was the parasite with higher infection level. Such parasite species showed an aggregated dispersion, except P. (S.) belenensis, which showed a random dispersion. The Brillouin diversity (0.53 ± 0.29) was high, while evenness (0.28 ± 0.16) and species richness of parasites (3.7 ± 1.1) were low. The size of the hosts did not influence diversity, species richness and abundance of parasites. The ectoparasites were characterized by high prevalence and abundance, while endoparasites community presented low prevalence and abundance. The main factors responsible for structuring the parasite community in A. ucayalensis were mainly the behavior of this host and the availability of endoparasites infective stages in the environment. This was the first report of I. multifiliis, C. bulbocirus, Demidospermus sp., Contracaecum sp., C. marginatum, Herpetodiplostomum sp. and G. genarchella for A. ucayalensis. The presence of endohelminth larvae suggests that A. ucayalensis is part of the diet of other fish at the top of the food web in the Amazonian ecosystem studied.

  2. Experimental and molecular study of cercariae of Clinostomum sp. (Trematoda: Clinostomidae) from Biomphalaria spp. (Mollusca: Planorbidae) in Brazil.

    Science.gov (United States)

    Pinto, H A; Caffara, M; Fioravanti, M L; Melo, A L

    2015-02-01

    Despite the large number of reports of species of Clinostomum from vertebrate hosts in South America, studies evaluating the molluscan transmitters of these parasites are scarce. In the present study, clinostomatoid cercariae shed from 0.02% (4/17,485) specimens of Biomphalaria spp., collected at the Pampulha reservoir, Belo Horizonte, Minas Gerais, Brazil, were used for experimental infection of Poecilia reticulata . Samples of cercariae from molluscs and metacercariae experimentally obtained from fish were subjected to morphological and molecular analyses and compared with species of Clinostomum reported in the Americas. The cercariae and metacercariae, here identified as Clinostomum sp., present general morphology similar to that reported for Clinostomum marginatum , however, from molecular point of view, differ significantly from North American C. marginatum and other species of Clinostomum reported in South America. These results suggest that the diversity of Clinostomum found in Brazil may be underestimated. Additional studies aimed at molecular characterization of South American species of Clinostomum, including the finding of specimens with sequences similar to that reported for C. marginatum in North America are required.

  3. Ehrlichiosis

    Science.gov (United States)

    ... Ehrlichia bacteria can be carried by the: American dog tick Deer tick ( Ixodes scapularis ), which can also ... rare) Kidney damage Lung damage Other organ damage Seizure In rare cases, a tick bite can lead ...

  4. Flåtbårne infektioner i Danmark

    DEFF Research Database (Denmark)

    Jensen, Bo Bødker; Ocias, Lukas Frans; Andersen, Nanna Skaarup

    2017-01-01

    The castor bean tick, Ixodes ricinus, is common in woodlands in most of Denmark. Besides Borrelia burgdorferi, it can harbour a number of pathogenic microorganisms such as tick-borne encephalitis virus, Anaplasma phagocytophilum, Rickettsia helvetica, Francisella tularensis, Candidatus Neoehrlichia...

  5. Genetic identification of rickettsiae isolated from ticks in Japan.

    Science.gov (United States)

    Fournier, Pierre-Edouard; Fujita, Hiromi; Takada, Nobuhiro; Raoult, Didier

    2002-06-01

    Following the description in Japan of Japanese spotted fever, caused by Rickettsia japonica, a search for the vector of this disease led to the isolation of several rickettsiae from various tick species. Sixty-three rickettsial isolates were obtained from six different tick species, and six type strains were described by PCR and monoclonal antibody testing. We identified these six strains by amplification and sequencing of the genes encoding 16S rRNA and citrate synthase. We confirmed that the isolates from Dermacentor taiwanensis and Haemaphysalis flava ticks were R. japonica isolates. In Ixodes ovatus, Ixodes persulcatus, and Ixodes monospinosus, we identified a Rickettsia identical or closely related to Rickettsia helvetica, a species that is pathogenic for humans and that to date has only been found in Europe. Finally, we identified a new genotype of unknown pathogenicity, genotype AT, that was isolated from Amblyomma testudinarium ticks and that is closely related to a Slovakian genotype obtained from Ixodes ricinus ticks.

  6. Dicty_cDB: Contig-U05425-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ostelium discoideum UDP glucose pyrophosphoryl... 44 1.5 1 ( FJ710598 ) Bactrocera dorsalis... clone gt.bactrocera_dorsalis.... 44 1.5 1 ( EU443429 ) Ixodes pacificus isolate IpacCA2 16S ribos

  7. Investigation ofBorrelia spp. in ticks (Acari:Ixodidae) at the border crossings between China and Russia in Heilongjiang Province, China

    Institute of Scientific and Technical Information of China (English)

    Shi Liu; Chao Yuan; Yun-Fu Cui; Bai-Xiang Li; Li-Jie Wu; Ying Liu

    2012-01-01

    Objective:To investigate the precise species of tick vector and theBorrelia spirochete pathogen at the Heilongjiang Province international border with Russia.Methods:In this study, ticks were collected from12 Heilongjiang border crossings (including grasslands, shrublands, forests, and plantantions) to determine the rate and species type of spirochete-infected ticks and the most prevalent spirochete genotypes.Results:The ticks represented three genera and four species of the Ixodidae family [Ixodes persulcatus,Dermacentor silvarum,Haemaphysalis concinna and Haemaphysalis japonica].Ixodes persulcatus had the highest amount ofBorrelia burgdorferi sensu lato infection of25.6% and the most common species ofBorreliaisolated from Ixodes persulcatus wasBorrelia garinii, strainPD91.Conclusions: Our results suggest thatBorrelia gariniiPD91-infectedIxodes persulcatus may be the principal cause of Lyme disease in the border crossing areas of Heilongjiang Province.

  8. EST Table: FS904290 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available leus) 10/09/28 62 %/221 aa ref|XP_002407962.1| methyl-CpG binding transcription regulator, putative [Ixodes ...scapularis] gb|EEC12376.1| methyl-CpG binding transcription regulator, putative [Ixodes scapularis] 10/09/12...7 aa gi|91079510|ref|XP_969537.1| PREDICTED: similar to methyl-cpg binding protein [Tribolium castaneum] FS904290 fufe ...

  9. Natural Infection of Borrelia afzelii in Ixodes sinensis and Its Parasitism Hosts in Forest Areas of Huangshan, Anhui Province%安徽黄山地区中华硬蜱及其宿主感染莱姆病Borrelia afzelii的检测

    Institute of Scientific and Technical Information of China (English)

    孙毅; 许荣满; 葛学峰; 曹务春

    2009-01-01

    A survey was conducted on lxodes sinensis and its parasitism hosts for the infection of Borrelia burgdorferi with PCR and cultivation method. Only one spirochete strain was isolated from 40 I. sinensis collected in Huangshan Mountains. While all blood sample and other I. sinensis ticks fail to get Lyme spirochetes isolation. When detected by 16s rRNA amplification, 6.78% female and 5% male adult I. sinensis ticks yield positive result, two of 92 Chinese hares and one of 16 Chinese muntjaes also appear to be positive with the same DNA band, while all nymph ticks appeared uninfected. However, these DNA amplicon have the same 16S rRNA sequences without any difference. The isolated spirochetes strain obtained from I. sinensis in Huangshan show high similarity to other strains of B. afzelii by phylogeny analysis with 16S rRNA sequences and might belong to Borrelia afzelii species.The finding together with the proved transmission ability, imply that I. sinensis might be the vector tick species in southern China.%利用PCR和病原体分离技术对安徽黄山地区中华硬蜱及其宿主感染莱姆病螺旋体的状况进行了检测,结果从40只黄山林区的中华硬蜱中获得了一株莱姆病螺旋体分离株,寄主动物及其他中华硬蜱均未获得阳性分离结果.以16s rRNA为靶标进行PCR检测,6.78%雌性和5%雄性中华硬蜱发现有阳性感染,2只草兔(92只)和1只麂子(16只)也发现有阳性感染;若蜱和其余宿主动物未发现阳性感染.阳性分离株和扩增获得的168 rRNA序列结果一致,同GenBank中的B.afzelii的系统发育关系最近,提示该分离株螺旋体属于B.afzelii.该结果与前期的实验传播结果提示中华硬蜱是我国南方莱姆病的传播媒介.

  10. The use of Sporothrix insectorum and Paecilomyces fumosoroseus against Boophilus microplus (Canestrini, 1887: in vitro assay and electronic microscopy/ Atividade anti-ixodídica dos fungos Sporothrix insectorum e Paecilomyces fumosoroseus sobre Boophilus microplus (Canestrini, 1887: bioensaios emicroscopia eletrônica de varredura

    Directory of Open Access Journals (Sweden)

    Alvimar José da Costa

    2001-08-01

    Full Text Available In function of the development resistance to the several existent quimiotherapics, biological control has being a promising alternative to the control of Boophilus microplus. In this work, the pathogenic action of Sporothrix insectorum and Paecilomyces fumosoroseus in the different stages of life cycle of Boophilus microplus was evaluated. The fungis in study were cultivated in appropriate culture medium and suspensions in the concentrations of 105, 106, 107, 108, 109 conidia/mL for both fungis were prepared, starling from stock suspension. The eggs and the larvaes were treated by spray, and the engorged tick were immersed in the different conidia suspensions. The pathogenicity of the fungis were appraised for the reproductive performance of the ticks. The experimental was accomplished with five repetitions for each treatment group, in the different fungal concentrations. The fungis S. insectorum and P. fumosoroseus reduced in 50,19% and 49,34%, respectively, the posture of the infected engorged female ticks, in the concentration 108 conidia/mL. In relation to effectiveness, the fungis S. insectorum and P. fumosoroseus, they reached the values 82,99%, in the concentration 108 conidia/mL, and 82,93% in the concentration 109 conidia/mL, for the respective fungis. In the eggs treatment with the S. insectorum and P. fumosoroseus, the fungi P. fumosoroseus presented a superiority with reduction of eclodibility in 79,04%, in the concentration 106 conidia/mL, while the S. insectorum, reduced in only 37,92%, in the concentration 107 conidia/mL. In the larvas treatment there were not significant differences in the larva mortality in both fungi. The electronic microscopy, in different stage of life of the B. microplus, showed the power predatory of the fungi S. insectorum and P. fumosoroseus. With these results, it can be inferred that S. insectorum and P. fumosoroseus presented deleterious action on engorged female of B. microplus in vitro, what reinforces your possibility eventual control of this important tick.Em função do desenvolvimento de resistência aos diversos quimioterápicos existentes, o controle biológico vem sendo uma alternativa promissora no controle do Boophilus microplus. Neste trabalho foi avaliada a ação patogênica de Sporothrix insectorum e de Paecilomyces fumosoroseus nas diferentes fases do ciclo de vida do Boophilus microplus. Para isso, os fungos em estudo foram cultivados em meio de cultura apropriado, obtendo-se a suspensão estoque, a partir da qual foram preparadas suspensões nas concentrações de 105, 106, 107, 108, 109 conídios/mL para ambos os fungos. Os ovos e as larvas foram tratados por aspersão, e as partenóginas foram imersas nas diferentes suspensões de conídios. A patogenicidade dos fungos foi avaliada pela “performance reprodutiva” das carrapatas. O delineamento experimental foi realizado com cinco repetições para cada grupo de tratamento, nas diferentes concentrações fúngicas. Os fungos S. insectorum e P. fumosoroseus reduziram em 50,19% e 49,34%, respectivamente, a postura das partenóginas, quando utilizados na concentração de 108 conídios/mL. Em relação à eficácia, tais fungos alcançaram os valores de 82,99% e 82,93% na concentração de 108 conídios/mL e na de 109 conídios/mL, respectivamente. Sobre ovos de B. microplus, a atividade de P. fumosoroseus foi superior a de S. insectorum, reduzindo a eclodibilidade em 79,04% na concentração de 106 conídios/mL. S. insectorum reduziu tal parâmetro em apenas 37,92%, na concentração de 107 conídios/mL. No tratamento das larvas, os fungos avaliados não diferiram significativamente (P < 0,05 quanto à mortalidade das mesmas. As elétron-micrografias de varreduras, dos diferentes ínstares do B. microplus, evidenciam o poder predador dos fungos S. insectorum e P. fumosoroseus. Em face dos resultados obtidos, pode-se inferir que S. insectorum e P. fumosoroseus apresentaram ação deletéria sobre partenóginas de B. microplus in vitro, o que reforça a possibilidade do eventual emprego, desses fungos, no biocontrole desse importante ácaro.

  11. Tick paralysis: first zoonosis record in Egypt.

    Science.gov (United States)

    Mosabah, Amira A Abd El-rahman; Morsy, Tosson A

    2012-04-01

    Tick paralysis caused by the secretion of toxin with saliva while taking a blood meal is an important veterinary disease, but is rare in humans. Although it has certain geographical proclivities, it exists worldwide. Tick paralysis was demonstrated for the first time in Egypt among four children living in rural area at Giza Governorate. The clinical pictures were confused with rabies; myasthensia gravis; botulism; diphtheritic polyneuropathy encountered in rural areas. The recovery of tick infesting the four little children and negative clinical and laboratory data of all diseases denoted tick paralysis. The encountered ticks infesting their animals were Rhipicephalus sanguineus on dogs, Hyalomma dromedarii on camels and Hyalomma anatolicum excavatum and Haemaphysalis sp. on goats. The case was recognized as first record of tick paralysis in Egypt.

  12. PCR-Detection of Coxiella burnetii in Ticks Collected from Sheep and Goats in Southeast Iran

    Directory of Open Access Journals (Sweden)

    SR Nourollahi Fard

    2011-06-01

    Results: Three pools, each consisting of five female of Hyalomma anatolicum anatolicum and one pool (6 ticks of Rhipicephalus sanguineus ticks collected from goats and sheep were found to be positive by Trans-PCR. Conclusion: This paper documents the first molecular detection of C. burnetii in ticks, which shows their role as puta­tive vectors and reservoirs for this pathogenic agent.  

  13. IN VITRO EFFECT OF SORGHUM (SORGHUM BICOLOR SEED EXTRACTS AS A BIOLOGICAL ACARICIDAL AGAINST SOME HARD TICK (IXODIDAE IN SULAIMANI GOVERNORATE - KURDISTAN REGION/IRAQ

    Directory of Open Access Journals (Sweden)

    Bahzad H.S. Mustafa

    2016-09-01

    Full Text Available This study was conducted in Sulaimani governorate in order to identify the biological control of some Ixodidae genera among different flocks of cattle, sheep and goats. Four genera of Ixodidae; Boophilus spp., Hyalomma spp., Rhipicephalus spp. and Haemaphysalis spp., were identified in these infested animals. According to chi–square test, the highest distribution of Boophulis spp., was recorded in cattle (56.51%, and the highest distribution of Hyalomma spp., (49.82% and Rhipicephalus spp., (28.16% which were in sheep. The highest number of Haemophasylas spp., was obtained from goats (6.67%, whereas the lowest number of this genus (2.88% and 2.89% was collected from cattle and sheep respectively. The toxicity of Sorghum bicolor seed extract was tested against the more distributed Ixodidae genera (Boophilus spp. and Hyalomma spp. by immersion method on mature ticks, four concentrations (23.2, 17.4, 11.6 and 5.8 mg/dl, in addition to the control treatment (0 mg/dl of the seed were used to evaluate the engorged females in vitro. The results showed that 100% of absolute cumulative mortality of Boophilus spp., was gain after 72 hr by 23.2 mg/dl extract concentration, followed by 17.4 mg/dl which gave 90% mortality, whereas 100% absolute cumulative mortality for Hyalomma spp., was obtained by 23.2 mg/dl extract concentration after 48 hr, followed by 17.4, 11.6 and 5.8 mg/dl concentration that gave 90%, 80% and 40% mortality after 72 hr.

  14. NAMRU-3 Reprint Accession List 1982. Number 12.

    Science.gov (United States)

    1983-01-01

    TuberculousMeningitli. J. Clin. Lab. Inwnunol, 8:37-42, 1982. 1295 SIPPEL, I.E., EL-MASRY, N.A., FARID, Z.: Diagnosis of Human Brucellosis with ELISA. The Lancet...Hyalomma (Hyalonunina) arabica sp. N. Parasitizing Goats andSheep In the Yemen Arab Republic and Saudi Arabia. J. Parasitol., 68(1):150-156, 1982. 1298...Accession Number BACTERIOLOGY Brucellosis 1295 Identification of micro-organisms by gas-chromatography 1282 Meningitis 1294, 1302, 1305, 1311, 1321

  15. Identification of attenuation markers of a Theileria lestoquardi cell line to be used for the development of live vaccine against malignant ovine theileriosis

    OpenAIRE

    Mousa, Awadia Mohamed Ali Mohamed

    2010-01-01

    Theileria lestoquardi is a tick-borne protozoan parasite and highly pathogenic for sheep. The disease caused by the pathogen is known as malignant ovine theileriosis (MOT) and is transmitted by Hyalomma ticks. Control of the disease can be achieved by immunization of sheep with attenuated T. lestoquardi schizont-infected ovine cells that provides the animal with solid immunity. The approach of using the attenuated vaccine against malignant ovine theileriosis has been carried out successfully ...

  16. Reverse transcription PCR-based detection of Crimean-Congo hemorrhagic fever virus isolated from ticks of domestic ruminants in Kurdistan province of Iran.

    Science.gov (United States)

    Fakoorziba, Mohammad Reza; Golmohammadi, Parvaneh; Moradzadeh, Rahmatollah; Moemenbellah-Fard, Mohammad Djaefar; Azizi, Kourosh; Davari, Behrooz; Alipour, Hamzeh; Ahmadnia, Sara; Chinikar, Sadegh

    2012-09-01

    Crimean-Congo hemorrhagic fever (CCHF) is a potentially fatal viral vector-borne zoonosis which has a mortality rate of up to 30% without treatment in humans. CCHF virus is transmitted to humans by ticks, predominantly from the Hyalomma genus. Following the report of two confirmed and one suspected death due to CCHF virus in Kurdistan province of Iran in 2007, this study was undertaken to determine the fauna of hard ticks on domestic ruminants (cattle, sheep, and goats) and their possible infection with CCHF virus using reverse transcription PCR technique. This is the first detection of CCHF virus in ticks from the Kurdistan province of Iran. Overall, 414 ixodid ticks were collected from two districts in this province. They represented four genera from which 10 separate species were identified. The Hyalomma genus was the most abundant tick genus (70%). It was the only genus shown to be infected with the CCHF virus using RT-PCR technique. The number of ticks positive for CCHF virus was 5 out of 90 (5.6%) adult ticks. The three remaining genera (Haemaphysalis, Rhipicephalus, and Dermacentor) were all negative following molecular survey. Four of the five virally-infected ticks were from cattle mainly in the Sanandaj district. We concluded that CCHF virus is present in the Hyalomma ticks on domestic ruminants (cattle) in Kurdistan province of Iran.

  17. Parasites of domestic and wild animals in South Africa. XLIX. Ticks (Acari: Ixodidae infesting white and black rhinoceroses in southern Africa

    Directory of Open Access Journals (Sweden)

    Ivan G. Horak

    2017-01-01

    Full Text Available The objectives of the study were to determine the species composition of ticks infesting white and black rhinoceroses in southern Africa as well as the conservation status of those tick species that prefer rhinos as hosts. Ticks were collected opportunistically from rhinos that had been immobilised for management purposes, and 447 white rhinoceroses (Ceratotherium simum and 164 black rhinoceroses (Diceros bicornis were sampled in South Africa, 61 black rhinos in Namibia, 18 white and 12 black rhinos in Zimbabwe, and 24 black rhinos in Zambia. Nineteen tick species were recovered, of which two species, Amblyomma rhinocerotis and Dermacentor rhinocerinus, prefer rhinos as hosts. A. rhinocerotis was collected only in the northeastern KwaZulu-Natal reserves of South Africa and is endangered, while D. rhinocerinus is present in these reserves as well as in the Kruger National Park and surrounding conservancies. Eight of the tick species collected from the rhinos are ornate, and seven species are regularly collected from cattle. The species present on rhinos in the eastern, moister reserves of South Africa were amongst others Amblyomma hebraeum, A. rhinocerotis, D. rhinocerinus, Rhipicephalus maculatus, Rhipicephalus simus and Rhipicephalus zumpti, while those on rhinos in the Karoo and the drier western regions, including Namibia, were the drought-tolerant species, Hyalomma glabrum, Hyalomma rufipes, Hyalomma truncatum and Rhipicephalus gertrudae. The species composition of ticks on rhinoceroses in Zambia differed markedly from those of the other southern African countries in that Amblyomma sparsum, Amblyomma tholloni and Amblyomma variegatum accounted for the majority of infestations.

  18. Molecular detection of Crimean-Congo haemorrhagic fever (CCHF) virus in ticks from southeastern Iran.

    Science.gov (United States)

    Mehravaran, Ahmad; Moradi, Maryam; Telmadarraiy, Zakyeh; Mostafavi, Ehsan; Moradi, Ali Reza; Khakifirouz, Sahar; Shah-Hosseini, Nariman; Varaie, Fereshteh Sadat Rasi; Jalali, Tahmineh; Hekmat, Soheila; Ghiasi, Seyed Mojtaba; Chinikar, Sadegh

    2013-02-01

    Crimean-Congo haemorrhagic fever (CCHF) virus is a tick-borne member of the genus Nairovirus, family Bunyaviridae. CCHF virus has been isolated from at least 31 different species of ticks. The virus is transmitted through the bite of an infected tick or by direct contact with CCHF virus-infected patients or the products of infected livestock. This study was conducted to determine the rate of CCHF virus infection in ticks in the district of Zahedan, in the province of Sistan and Baluchistan, southeastern Iran. A total of 140 ticks were collected from Sistan and Baluchistan. Reverse transcriptase-polymerase chain reaction (RT-PCR) was used for the detection of the CCHF virus genome in the tick population. This genome was detected in 4.3% of ticks collected from livestock of different regions of Zahedan. The infected tick genera belonged to Hyalomma and Haemaphysalis. Although in the epidemiology of CCHF virus